WorldWideScience

Sample records for detecting neutrinoless double

  1. Simulation of complex detection systems in neutrinoless double beta decay experiments

    International Nuclear Information System (INIS)

    Larrea, A.; Morales, A.; Morales, J.; Nunez-Lagos, R.; Puimedon, J.; Villar, J.A.

    1988-01-01

    The estimated efficiency of several detection systems dedicated to the search of the neutrinoless double beta decay of 76 Ge is reported. In order to perform this work, we have developed the GEOM macro library system which can handle highly complex geometries in simulation problems, allowing to include an accurate description of the experimental setup in a very simple way. Also an internal mechanism for checking the correct location of every boundary defining the geometrical regions is included. The present version of GEOM is implemented in the EGS4 code of Monte Carlo simulation of photons and electron/positron showers, but it can be easily extended to other simulation codes. (orig.)

  2. Constraining neutrinoless double beta decay

    International Nuclear Information System (INIS)

    Dorame, L.; Meloni, D.; Morisi, S.; Peinado, E.; Valle, J.W.F.

    2012-01-01

    A class of discrete flavor-symmetry-based models predicts constrained neutrino mass matrix schemes that lead to specific neutrino mass sum-rules (MSR). We show how these theories may constrain the absolute scale of neutrino mass, leading in most of the cases to a lower bound on the neutrinoless double beta decay effective amplitude.

  3. Neutrinoless double beta decay

    Indian Academy of Sciences (India)

    2012-10-06

    Oct 6, 2012 ... Anyhow, the 'multi-isotope' ansatz is needed to compensate for matrix element ... The neccessary half-life requirement to touch this ... site energy depositions (like double beta decay) and multiple site interactions (most of.

  4. Neutrinoless Double Beta Decay Experiments

    International Nuclear Information System (INIS)

    Garfagnini, A.

    2014-08-01

    Neutrinoless double beta decay is the only process known so far able to test the neutrino intrinsic nature: its experimental observation would imply that the lepton number is violated by two units and prove that neutrinos have a Majorana mass components, being their own anti-particle. While several experiments searching for such a rare decay have been per- formed in the past, a new generation of experiments using different isotopes and techniques have recently released their results or are taking data and will provide new limits, should no signal be observed, in the next few years to come. The present contribution reviews the latest public results on double beta decay searches and gives an overview on the expected sensitivities of the experiments in construction which will be able to set stronger limits in the near future. EXO and KamLAND-Zen experiments are based on the decay of Xe 136 , GERDA and MAJORANA experiments are based on the decay of Ge 76 , and the CUORE experiment is based on the decay of Te 130

  5. Resonance enhancement of neutrinoless double electron capture

    International Nuclear Information System (INIS)

    Krivoruchenko, M.I.; Simkovic, Fedor; Frekers, Dieter; Faessler, Amand

    2011-01-01

    The process of neutrinoless double electron (0νECEC) capture is revisited for those cases where the two participating atoms are nearly degenerate in mass. The theoretical framework is the formalism of an oscillation of two atoms with different total lepton number (and parity), one of which can be in an excited state so that mass degeneracy is realized. In such a case and assuming light Majorana neutrinos, the two atoms will be in a mixed configuration with respect to the weak interaction. A resonant enhancement of transitions between such pairs of atoms will occur, which could be detected by the subsequent electromagnetic de-excitation of the excited state of the daughter atom and nucleus. Available data of atomic masses, as well as nuclear and atomic excitations are used to select the most likely candidates for the resonant transitions. Assuming an effective mass for the Majorana neutrino of 1 eV, some half-lives are predicted to be as low as 10 22 years in the unitary limit. It is argued that, in order to obtain more accurate predictions for the 0νECEC half-lives, precision mass measurements of the atoms involved are necessary, which can readily be accomplished by today's high precision Penning traps. Further advancements also require a better understanding of high-lying excited states of the final nuclei (i.e. excitation energy, angular momentum and parity) and the calculation of the nuclear matrix elements.

  6. Search for Neutrinoless Double-Beta Decay

    OpenAIRE

    Tornow, Werner

    2014-01-01

    After the pioneering work of the Heidelberg-Moscow (HDM) and International Germanium Experiment (IGEX) groups, the second round of neutrinoless double-$\\beta$ decay searches currently underway has or will improve the life-time limits of double-$\\beta$ decay candidates by a factor of two to three, reaching in the near future the $T_{1/2} = 3 \\times 10^{25}$ yr level. This talk will focus on the large-scale experiments GERDA, EXO-200, and KamLAND-Zen, which have reported already lower half-life...

  7. Novel measurement method of heat and light detection for neutrinoless double beta decay

    Science.gov (United States)

    Kim, G. B.; Choi, J. H.; Jo, H. S.; Kang, C. S.; Kim, H. L.; Kim, I.; Kim, S. R.; Kim, Y. H.; Lee, C.; Lee, H. J.; Lee, M. K.; Li, J.; Oh, S. Y.; So, J. H.

    2017-05-01

    We developed a cryogenic phonon-scintillation detector to search for 0νββ decay of 100Mo. The detector module, a proto-type setup of the AMoRE experiment, has a scintillating 40Ca100MoO4 absorber composed of 100Mo-enriched and 48Ca-depleted elements. This new detection method employs metallic magnetic calorimeters (MMCs) as the sensor technology for simultaneous detection of heat and light signals. It is designed to have high energy and timing resolutions to increase sensitivity to probe the rare event. The detector, which is composed of a 200 g 40Ca100MoO4 crystal and phonon/photon sensors, showed an energy resolution of 8.7 keV FWHM at 2.6 MeV, with a weak temperature dependence in the range of 10-40 mK. Using rise-time and mean-time parameters and light/heat ratios, the proposed method showed a strong capability of rejecting alpha-induced events from electron events with as good as 20σ separation. Moreover, we discussed how the signal rise-time improves the rejection efficiency for random coincidence signals.

  8. NEUTRINOLESS DOUBLE BETA DECAY: AN EXTREME CHALLENGE

    Directory of Open Access Journals (Sweden)

    Fernando Ferroni

    2013-12-01

    Full Text Available Neutrino-less Double Beta Decay is the only known way to possibly resolve the nature of neutrino mass. The chances to cover the mass region predicted by the inverted hierarchy require a step forward in detector capability. A possibility is to make use of scintillating bolometers. These devices shall have a great power in distinguishing signals from alfa particles from those induced by electrons. This feature might lead to an almost background-free experiment. Here the Lucifer concept will be introduced and the prospects related to this project will be discussed.

  9. Limit on the radiative neutrinoless double electron capture of {sup 36}Ar from GERDA Phase I

    Energy Technology Data Exchange (ETDEWEB)

    Agostini, M.; Balata, M.; D' Andrea, V.; Di Vacri, A.; Junker, M.; Laubenstein, M. [INFN Laboratori Nazionali del Gran Sasso and Gran Sasso Science Institute, Assergi (Italy); Allardt, M.; Domula, A.; Lehnert, B.; Schneider, B.; Wester, T.; Wilsenach, H.; Zuber, K. [Technische Universitaet Dresden, Institut fuer Kern- und Teilchenphysik, Dresden (Germany); Bakalyarov, A.M.; Belyaev, S.T.; Lebedev, V.I.; Zhukov, S.V. [National Research Centre ' ' Kurchatov Institute' ' , Moscow (Russian Federation); Barabanov, I.; Bezrukov, L.; Doroshkevich, E.; Fedorova, O.; Gurentsov, V.; Kazalov, V.; Kuzminov, V.V.; Lubsandorzhiev, B.; Moseev, P.; Selivanenko, O.; Veresnikova, A.; Yanovich, E. [Institute for Nuclear Research of the Russian Academy of Sciences, Moscow (Russian Federation); Barros, N. [Technische Universitaet Dresden, Institut fuer Kern- und Teilchenphysik, Dresden (Germany); University of Pennsylvania, Philadelphia, PA (United States); Baudis, L.; Benato, G.; Kish, A.; Miloradovic, M.; Mingazheva, R.; Walter, M. [Physik Institut der Universitaet Zuerich, Zurich (Switzerland); Bauer, C.; Hakenmueller, J.; Heisel, M.; Heusser, G.; Hofmann, W.; Kihm, T.; Kirsch, A.; Knoepfle, K.T.; Lindner, M.; Maneschg, W.; Salathe, M.; Schreiner, J.; Schwingenheuer, B.; Simgen, H.; Smolnikov, A.; Stepaniuk, M.; Wagner, V.; Wegmann, A. [Max-Planck-Institut fuer Kernphysik, Heidelberg (Germany); Bellotti, E. [Universita Milano Bicocca, Dipartimento di Fisica, Milan (Italy); INFN Milano Bicocca, Milan (Italy); Belogurov, S.; Kornoukhov, V.N. [Institute for Nuclear Research of the Russian Academy of Sciences, Moscow (Russian Federation); Institute for Theoretical and Experimental Physics NRC ' ' Kurchatov Institute' ' , Moscow (Russian Federation); Bettini, A.; Brugnera, R.; Garfagnini, A.; Medinaceli, E.; Sada, C.; Sturm, K. von [Dipartimento di Fisica e Astronomia dell' Universita di Padova, Padua (Italy); INFN Padova, Padua (Italy); Bode, T.; Csathy, J.J.; Lazzaro, A.; Schoenert, S.; Wiesinger, C. [Technische Universitaet Muenchen, Physik Department and Excellence Cluster Universe, Munich (Germany); Borowicz, D. [Jagiellonian University, Institute of Physics, Krakow (Poland); Joint Institute for Nuclear Research, Dubna (Russian Federation); Brudanin, V.; Egorov, V.; Kochetov, O.; Nemchenok, I.; Rumyantseva, N.; Zhitnikov, I.; Zinatulina, D. [Joint Institute for Nuclear Research, Dubna (Russian Federation); Caldwell, A.; Gooch, C.; Kneissl, R.; Liao, H.Y.; Majorovits, B.; Palioselitis, D.; Schulz, O.; Vanhoefer, L. [Max-Planck-Institut fuer Physik, Munich (Germany); Cattadori, C.; Salamida, F. [INFN Milano Bicocca, Milan (Italy); Chernogorov, A.; Demidova, E.V.; Kirpichnikov, I.V.; Vasenko, A.A. [Institute for Theoretical and Experimental Physics NRC ' ' Kurchatov Institute' ' , Moscow (Russian Federation); Falkenstein, R.; Freund, K.; Grabmayr, P.; Hegai, A.; Jochum, J.; Schmitt, C.; Schuetz, A.K. [Eberhard Karls Universitaet Tuebingen, Physikalisches Institut, Tuebingen (Germany); Frodyma, N.; Misiaszek, M.; Panas, K.; Pelczar, K.; Wojcik, M.; Zuzel, G. [Jagiellonian University, Institute of Physics, Krakow (Poland); Gangapshev, A. [Max-Planck-Institut fuer Kernphysik, Heidelberg (Germany); Institute for Nuclear Research of the Russian Academy of Sciences, Moscow (Russian Federation); Gusev, K. [Joint Institute for Nuclear Research, Dubna (Russian Federation); National Research Centre ' ' Kurchatov Institute' ' , Moscow (Russian Federation); Technische Universitaet Muenchen, Physik Department and Excellence Cluster Universe, Munich (Germany); Hemmer, S.; Lippi, I.; Stanco, L. [INFN Padova, Padua (Italy); Hult, M.; Lutter, G. [European Commission, JRC-Geel, Geel (Belgium); Inzhechik, L.V. [Institute for Nuclear Research of the Russian Academy of Sciences, Moscow (Russian Federation); Moscow Institute of Physics and Technology, Moscow (Russian Federation); Klimenko, A. [Joint Institute for Nuclear Research, Dubna (Russian Federation); Max-Planck-Institut fuer Kernphysik, Heidelberg (Germany); International University for Nature, Society and Man ' ' Dubna' ' , Dubna (Russian Federation); Lubashevskiy, A. [Joint Institute for Nuclear Research, Dubna (Russian Federation); Max-Planck-Institut fuer Kernphysik, Heidelberg (Germany); Macolino, C. [INFN Laboratori Nazionali del Gran Sasso and Gran Sasso Science Institute, Assergi (Italy); LAL, CNRS/IN2P3, Universite Paris-Saclay, Orsay (France); Pandola, L. [INFN Laboratori Nazionali del Sud, Catania (Italy); Pullia, A.; Riboldi, S. [Universita degli Studi di Milano, Dipartimento di Fisica, Milan (Italy); INFN Milano (Italy); Shirchenko, M. [Joint Institute for Nuclear Research, Dubna (Russian Federation); National Research Centre ' ' Kurchatov Institute' ' , Moscow (Russian Federation); Collaboration: GERDA collaboration

    2016-12-15

    Neutrinoless double electron capture is a process that, if detected, would give evidence of lepton number violation and the Majorana nature of neutrinos. A search for neutrinoless double electron capture of {sup 36}Ar has been performed with germanium detectors installed in liquid argon using data from Phase I of the GERmanium Detector Array (Gerda) experiment at the Gran Sasso Laboratory of INFN, Italy. No signal was observed and an experimental lower limit on the half-life of the radiative neutrinoless double electron capture of {sup 36}Ar was established: T{sub 1/2} > 3.6 x 10{sup 21} years at 90% CI. (orig.)

  10. Limit on the radiative neutrinoless double electron capture of ^{36}Ar from GERDA Phase I

    Science.gov (United States)

    Agostini, M.; Allardt, M.; Bakalyarov, A. M.; Balata, M.; Barabanov, I.; Barros, N.; Baudis, L.; Bauer, C.; Bellotti, E.; Belogurov, S.; Belyaev, S. T.; Benato, G.; Bettini, A.; Bezrukov, L.; Bode, T.; Borowicz, D.; Brudanin, V.; Brugnera, R.; Caldwell, A.; Cattadori, C.; Chernogorov, A.; D'Andrea, V.; Demidova, E. V.; di Vacri, A.; Domula, A.; Doroshkevich, E.; Egorov, V.; Falkenstein, R.; Fedorova, O.; Freund, K.; Frodyma, N.; Gangapshev, A.; Garfagnini, A.; Gooch, C.; Grabmayr, P.; Gurentsov, V.; Gusev, K.; Hakenmüller, J.; Hegai, A.; Heisel, M.; Hemmer, S.; Heusser, G.; Hofmann, W.; Hult, M.; Inzhechik, L. V.; Csáthy, J. Janicskó; Jochum, J.; Junker, M.; Kazalov, V.; Kihm, T.; Kirpichnikov, I. V.; Kirsch, A.; Kish, A.; Klimenko, A.; Kneißl, R.; Knöpfle, K. T.; Kochetov, O.; Kornoukhov, V. N.; Kuzminov, V. V.; Laubenstein, M.; Lazzaro, A.; Lebedev, V. I.; Lehnert, B.; Liao, H. Y.; Lindner, M.; Lippi, I.; Lubashevskiy, A.; Lubsandorzhiev, B.; Lutter, G.; Macolino, C.; Majorovits, B.; Maneschg, W.; Medinaceli, E.; Miloradovic, M.; Mingazheva, R.; Misiaszek, M.; Moseev, P.; Nemchenok, I.; Palioselitis, D.; Panas, K.; Pandola, L.; Pelczar, K.; Pullia, A.; Riboldi, S.; Rumyantseva, N.; Sada, C.; Salamida, F.; Salathe, M.; Schmitt, C.; Schneider, B.; Schönert, S.; Schreiner, J.; Schütz, A.-K.; Schulz, O.; Schwingenheuer, B.; Selivanenko, O.; Shirchenko, M.; Simgen, H.; Smolnikov, A.; Stanco, L.; Stepaniuk, M.; Vanhoefer, L.; Vasenko, A. A.; Veresnikova, A.; von Sturm, K.; Wagner, V.; Walter, M.; Wegmann, A.; Wester, T.; Wiesinger, C.; Wilsenach, H.; Wojcik, M.; Yanovich, E.; Zhitnikov, I.; Zhukov, S. V.; Zinatulina, D.; Zuber, K.; Zuzel, G.

    2016-12-01

    Neutrinoless double electron capture is a process that, if detected, would give evidence of lepton number violation and the Majorana nature of neutrinos. A search for neutrinoless double electron capture of ^{36}Ar has been performed with germanium detectors installed in liquid argon using data from Phase I of the GERmanium Detector Array ( Gerda) experiment at the Gran Sasso Laboratory of INFN, Italy. No signal was observed and an experimental lower limit on the half-life of the radiative neutrinoless double electron capture of ^{36}Ar was established: T_{1/2} > 3.6 × 10^{21} years at 90% CI.

  11. Pionic Contribution to Neutrinoless Double Beta Decay

    CERN Document Server

    Vergados, J D; Toki, H

    2010-01-01

    It is well known that neutrinoless double decay is going to play a crucial role in settling the neutrino properties, which cannot be extracted from the neutrino oscillation data. It is, in particular, expected to settle the absolute scale of neutrino mass and determine whether the neutrinos are Majorana particles, i.e. they coincide with their own antiparticles. In order to extract the average neutrino mass from the data one must be able to estimate the contribution all possible high mass intermediate particles. The latter, which occur in practically all extensions of the standard model, can, in principle, be differentiated from the usual mass term, if data from various targets are available. One, however, must first be able reliably calculate the corresponding nuclear matrix elements. Such calculations are extremely difficult since the effective transition operators are very short ranged. For such operators processes like pionic contributions, which are usually negligible, turn out to be dominant. We study s...

  12. Is neutrinoless double beta decay suppressed

    International Nuclear Information System (INIS)

    Tomoda, T.

    1989-01-01

    Much effort has been devoted to the study of nuclear double beta decay, since the observation of a neutrinoless double beta (OνΒΒ) decay would be clear evidence that the electron neutrino is a Majorana particle. The OνΒΒ decay is caused by a finite Majorana neutrino mass and/or an admixture of right-handed leptonic currents. In order to relate these quantities to OνΒΒ decay rates, we need nuclear matrix elements, which are model dependent. One of the possibilities of testing nuclear models employed in such analysis is to calculate the experimentally known rates of ΒΒ decay with emission of two neutrinos (2νΒΒ decay) which occurs independently of the nature of the neutrino. There was a long-standing difficulty in such attempts that the calculated 2νΒΒ decay rates turned out to be always too large by one to two orders of magnitude. Trying to overcome such difficulty, Klapdor and Grotz as well as Vogel and Zirnbauer showed in their calculation using schematic effective interactions such that 2νΒΒ decay rates can get reduced considerably due to the nuclear ground state correlations. This paper reports that the suppression is ascribed to that of the virtual Gamow-Teller transitions from the excited 1 + states of the intermediate odd-odd -even nucleus

  13. Neutrinoless double beta decay search with SNO+

    Directory of Open Access Journals (Sweden)

    Lozza V.

    2014-01-01

    Full Text Available The SNO+ experiment is the follow up of SNO. The detector is located 2 km underground in the Vale Canada Ltd.’s Creighton Mine near Sudbury, Ontario, Canada. The active volume of the detector consists of 780 tonnes of Linear Alkyl Benzene (LAB in an acrylic vessel of 12 m diameter, surrounded by about 9500 PMTs. The main goal of the SNO+ experiment is the search for neutrinoless double beta decay of 130Te. With an initial loading of 0.3% of natural tellurium (nearly 800 kg of 130Te, it is expected to reach a sensitivity on the effective Majorana neutrino mass of about 100 meV after several years of data taking. Designed as a general purpose neutrino experiment, other exciting physical goals can be explored, like the measurement of reactor neutrino oscillations and geo-neutrinos in a geologically-interesting location, watch of supernova neutrinos and studies of solar neutrinos. A first commissioning phase with water filled detector will start at the end of 2013, while the double beta decay phase will start in 2015.

  14. Neutrinoless double beta decay in Gerda

    Science.gov (United States)

    Grabmayr, Peter; Gerda Collaboration

    2015-10-01

    The Germanium Detector Array (Gerda) experiment searches for the neutrinoless double beta decay in 76Ge. This lepton number violating process is predicted by extensions of the standard model. Gerda follows a staged approach by increasing mass and lowering the background level from phase to phase. Gerda is setup at the Gran Sasso underground laboratory of INFN, Italy. An array of high-purity germanium detectors is lowered directly in liquid argon for shielding and cooling. Further background reduction is achieved by an instrumented water buffer. In Phase I an exposure of 21.6 kg yr was collected at a background level of 10-2 cts/(keV kg yr). The lower limit on the half-life of 76Ge > 2 . 1 .1025 yr (90% C.L.) has been published. Further analyses search for decay into excited states or the accompanied Majoron decay. Presently, Phase II is in preparation which intends to reach a background level of 10-3 cts/(keV kg yr) and to increase the exposure to 100 kg yr. About 20 kg of novel thick-window BEGe (Broad Energy Germanium) detectors will be added and the liquid argon will be instrumented. The status of Phase II preparation and results from the commissioning runs will be presented as well as some further results from Phase I.

  15. Theory of neutrinoless double beta decay

    CERN Document Server

    Vergados, J.D.; Simkovic, F.

    2012-01-01

    Neutrinoless double beta decay, which is a very old and yet elusive process, is reviewed. Its observation will signal that lepton number is not conserved and the neutrinos are Majorana particles. More importantly it is our best hope for determining the absolute neutrino mass scale at the level of a few tens of meV. To achieve the last goal certain hurdles have to be overcome involving particle, nuclear and experimental physics. Nuclear physics is important for extracting the useful information from the data. One must accurately evaluate the relevant nuclear matrix elements, a formidable task. To this end, we review the sophisticated nuclear structure approaches recently been developed, which give confidence that the needed nuclear matrix elements can be reliably calculated. From an experimental point of view it is challenging, since the life times are long and one has to fight against formidable backgrounds. If a signal is found, it will be a tremendous accomplishment. Then, of course, the real task is going ...

  16. PandaX-III neutrinoless double beta decay experiment

    Science.gov (United States)

    Wang, Shaobo; PandaX-III Collaboration

    2017-09-01

    The PandaX-III experiment uses high pressure Time Projection Chambers (TPCs) to search for neutrinoless double-beta decay of Xe-136 with high energy resolution and sensitivity at the China Jin-Ping underground Laboratory II (CJPL-II). Fine-pitch Microbulk Micromegas will be used for charge amplification and readout in order to reconstruct both the energy and track of the neutrinoless double-beta decay event. In the first phase of the experiment, the detector, which contains 200 kg of 90% Xe-136 enriched gas operated at 10 bar, will be immersed in a large water tank to ensure 5 m of water shielding. For the second phase, a ton-scale experiment with multiple TPCs will be constructed to improve the detection probability and sensitivity. A 20-kg scale prototype TPC with 7 Micromegas modules has been built to optimize the design of Micromegas readout module, study the energy calibration of TPC and develop algorithm of 3D track reconstruction.

  17. Search for neutrinoless double-electron capture of 156Dy

    Science.gov (United States)

    Finch, S. W.; Tornow, W.

    2015-12-01

    Background: Multiple large collaborations are currently searching for neutrinoless double-β decay, with the ultimate goal of differentiating the Majorana-Dirac nature of the neutrino. Purpose: Investigate the feasibility of resonant neutrinoless double-electron capture, an experimental alternative to neutrinoless double-β decay. Method: Two clover germanium detectors were operated underground in coincidence to search for the de-excitation γ rays of 156Gd following the neutrinoless double-electron capture of 156Dy. 231.95 d of data were collected at the Kimballton underground research facility with a 231.57 mg enriched 156Dy sample. Results: No counts were seen above background and half-life limits are set at O (1016-1018) yr for the various decay modes of 156Dy. Conclusion: Low background spectra were efficiently collected in the search for neutrinoless double-electron capture of 156Dy, although the low natural abundance and associated lack of large quantities of enriched samples hinders the experimental reach.

  18. Sensitivity of NEXT-100 to neutrinoless double beta decay

    CERN Document Server

    Martín-Albo, J.; Ferrario, P.; Nebot-Guinot, M.; Gómez-Cadenas, J.J.; Álvarez, V.; Azevedo, C.D.R.; Borges, F.I.G.; Cárcel, S.; Cebrián, S.; Cervera, A.; Conde, C.A.N.; Díaz, J.; Diesburg, M.; Esteve, R.; Fernandes, L.M.P.; Ferreira, A.L.; Freitas, E.D.C.; Gehman, V.M.; Goldschmidt, A.; González-Díaz, D.; Gutiérrez, R.M.; Henriques, C.A.O.; Hernando Morata, J.A.; Labarga, L.; Laing, A.; Lebrun, P.; Liubarsky, I.; López-March, N.; Lorca, D.; Losada, M.; Martínez-Lema, G.; Martínez, A.; Miller, T.; Monrabal, F.; Monserrate, M.; Monteiro, C.M.B.; Mora, F.J.; Moutinho, L.M.; Novella, P.; Nygren, D.; Para, A.; Perez, J.; Perez Aparicio, J.L.; Querol, M.; Renner, J.; Ripoll, L.; Rodríguez, J.; Santos, F.P.; dos Santos, J.M.F.; Serra, L.; Shuman, D.; Simón, A.; Sofka, C.; Sorel, M.; Stiegler, T.; Toledo, J.F.; Torrent, J.; Tsamalaidze, Z.; Veloso, J.F.C.A.; Villar, J.A.; Webb, R.; White, J.T.; Yahlali, N.; Yepes-Ramírez, H.; Hauptman, J.

    2016-01-01

    NEXT-100 is an electroluminescent high-pressure xenon gas time projection chamber that will search for the neutrinoless double beta decay of Xe-136. The detector possesses two features of great value in neutrinoless double beta decay searches: very good energy resolution (better than 1% FWHM at the Q value of Xe-136) and track reconstruction for the discrimination of signal and background events. This combination results in excellent sensitivity, as discussed in this paper. Detailed Monte Carlo detector simulations and material-screening measurements predict a background rate for NEXT-100 of at most 0.0004 counts/(keV kg yr). Accordingly, the detector will reach a sensitivity to the neutrinoless double beta decay half-life of 6.E25 years after running for 3 effective years.

  19. Limit on the radiative neutrinoless double electron capture of "3"6Ar from GERDA Phase I

    International Nuclear Information System (INIS)

    Agostini, M.; Balata, M.; D'Andrea, V.; Di Vacri, A.; Junker, M.; Laubenstein, M.; Allardt, M.; Domula, A.; Lehnert, B.; Schneider, B.; Wester, T.; Wilsenach, H.; Zuber, K.; Bakalyarov, A.M.; Belyaev, S.T.; Lebedev, V.I.; Zhukov, S.V.; Barabanov, I.; Bezrukov, L.; Doroshkevich, E.; Fedorova, O.; Gurentsov, V.; Kazalov, V.; Kuzminov, V.V.; Lubsandorzhiev, B.; Moseev, P.; Selivanenko, O.; Veresnikova, A.; Yanovich, E.; Barros, N.; Baudis, L.; Benato, G.; Kish, A.; Miloradovic, M.; Mingazheva, R.; Walter, M.; Bauer, C.; Hakenmueller, J.; Heisel, M.; Heusser, G.; Hofmann, W.; Kihm, T.; Kirsch, A.; Knoepfle, K.T.; Lindner, M.; Maneschg, W.; Salathe, M.; Schreiner, J.; Schwingenheuer, B.; Simgen, H.; Smolnikov, A.; Stepaniuk, M.; Wagner, V.; Wegmann, A.; Bellotti, E.; Belogurov, S.; Kornoukhov, V.N.; Bettini, A.; Brugnera, R.; Garfagnini, A.; Medinaceli, E.; Sada, C.; Sturm, K. von; Bode, T.; Csathy, J.J.; Lazzaro, A.; Schoenert, S.; Wiesinger, C.; Borowicz, D.; Brudanin, V.; Egorov, V.; Kochetov, O.; Nemchenok, I.; Rumyantseva, N.; Zhitnikov, I.; Zinatulina, D.; Caldwell, A.; Gooch, C.; Kneissl, R.; Liao, H.Y.; Majorovits, B.; Palioselitis, D.; Schulz, O.; Vanhoefer, L.; Cattadori, C.; Salamida, F.; Chernogorov, A.; Demidova, E.V.; Kirpichnikov, I.V.; Vasenko, A.A.; Falkenstein, R.; Freund, K.; Grabmayr, P.; Hegai, A.; Jochum, J.; Schmitt, C.; Schuetz, A.K.; Frodyma, N.; Misiaszek, M.; Panas, K.; Pelczar, K.; Wojcik, M.; Zuzel, G.; Gangapshev, A.; Gusev, K.; Hemmer, S.; Lippi, I.; Stanco, L.; Hult, M.; Lutter, G.; Inzhechik, L.V.; Klimenko, A.; Lubashevskiy, A.; Macolino, C.; Pandola, L.; Pullia, A.; Riboldi, S.; Shirchenko, M.

    2016-01-01

    Neutrinoless double electron capture is a process that, if detected, would give evidence of lepton number violation and the Majorana nature of neutrinos. A search for neutrinoless double electron capture of "3"6Ar has been performed with germanium detectors installed in liquid argon using data from Phase I of the GERmanium Detector Array (Gerda) experiment at the Gran Sasso Laboratory of INFN, Italy. No signal was observed and an experimental lower limit on the half-life of the radiative neutrinoless double electron capture of "3"6Ar was established: T_1_/_2 > 3.6 x 10"2"1 years at 90% CI. (orig.)

  20. Majorana neutrino masses and the neutrinoless double-beta decay

    International Nuclear Information System (INIS)

    Faessler, A.

    2006-01-01

    Neutrinoless double-beta decay is forbidden in the Standard Model of electroweak and strong interaction but allowed in most Grand Unified Theories (GUTs). Only if the neutrino is a Majorana particle (identical with its antiparticle) and if it has a mass is neutrinoless double-beta decay allowed. Apart from one claim that the neutrinoless double-beta decay in 76 Ge is measured, one has only upper limits for this transition probability. But even the upper limits allow one to give upper limits for the electron Majorana neutrino mass and upper limits for parameters of GUTs and the minimal R-parity-violating supersymmetric model. One further can give lower limits for the vector boson mediating mainly the right-handed weak interaction and the heavy mainly right-handed Majorana neutrino in left-right symmetric GUTs. For that, one has to assume that the specific mechanism is the leading one for neutrinoless double-beta decay and one has to be able to calculate reliably the corresponding nuclear matrix elements. In the present work, one discusses the accuracy of the present status of calculating of the nuclear matrix elements and the corresponding limits of GUTs and supersymmetric parameters

  1. Extra dimensions and neutrinoless double beta decay experiments

    International Nuclear Information System (INIS)

    Gozdz, Marek; Kaminski, Wieslaw A.; Faessler, Amand

    2005-01-01

    The neutrinoless double beta decay is one of the few phenomena, belonging to the nonstandard physics, which is extensively being sought for in experiments. In the present paper the link between the half-life of the neutrinoless double beta decay and theories with large extra dimensions is explored. The use of the sensitivities of currently planned 0ν2β experiments: DAMA, CANDLES, COBRA, DCBA, CAMEO, GENIUS, GEM, MAJORANA, MOON, CUORE, EXO, and XMASS, gives the possibility for a nondirect 'experimental' verification of various extra dimensional scenarios. We discuss also the results of the Heidelberg-Moscow Collaboration. The calculations are based on the Majorana neutrino mass generation mechanism in the Arkani-Hamed-Dimopoulos-Dvali model

  2. Search for neutrinoless double beta decay beyond GERDA

    Energy Technology Data Exchange (ETDEWEB)

    Schwingenheuer, Bernhard [MPI Kernphysik, Heidelberg (Germany)

    2016-07-01

    The search for neutrinoless double beta decay might be the only window to observe lepton number violation and to determine the nature of neutrinos. Is is therefore considered to be of highest relevance. The isotope Ge-76 has historically been most important for this search and the ongoing experiment GERDA has the lowest background of all experiments in the field. The proposed experimental program beyond GERDA (and Majorana) is presented.

  3. Neutrinoless double beta decay searches with 76Ge

    CERN Multimedia

    CERN. Geneva

    2017-01-01

    The search for neutrinoless double beta decay might be the only window to observe lepton number violation. Its observation would favour the leptogenesis mechanism for the explanation of the baryon asymmetry of the universe and is therefore considered to be of highest relevance. The isotope 76Ge has historically been most important for this search and the ongoing experiment GERDA has the lowest background of all experiments in the field. The talk reviews the motivation, the current status of experiments and future programs.

  4. New approach to the search for neutrinoless double beta decay

    International Nuclear Information System (INIS)

    Raghavan, R.S.

    1994-01-01

    Sub-eV Majorana neutrino masses left-angle m ν right-angle, can be explored by a new approach to neutrinoless double β decay using 136 Xe in a Xe gas-loaded, multiton liquid scintillator installed in a very low background detector such as the Kamiokande facility. With enriched 136 Xe, a readily implementable, 10 ton detector experiment can establish an left-angle m ν right-angle=0.45 eV at 3σ in 1 yr (or exclude an left-angle m ν right-angle ν right-angle ν right-angle <1.3 eV

  5. The GERDA Neutrinoless Double Beta-Decay Experiment

    International Nuclear Information System (INIS)

    Majorovits, Bela A.

    2007-01-01

    Neutrinoless double beta (0νββ)-decay is the key process to gain understanding of the nature of neutrinos. The GErmanium Detector Array (GERDA) is designed to search for 0νββ-decay of the isotope 76 Ge. Germanium crystals enriched in 76 Ge, acting as source and detector simultaneously, will be submerged directly into an ultra pure cooling medium that also serves as a radiation shield. This concept will allow for a reduction of the background by up to two orders of magnitudes with respect to earlier experiments

  6. Neutrinoless double beta decay and lepton flavor violation

    International Nuclear Information System (INIS)

    Cirigliano, V.; Kurylov, A.; Vogel, P.; Ramsey-Musolf, M.J.

    2004-01-01

    We point out that extensions of the standard model with low scale (∼TeV) lepton number violation (LNV) generally lead to a pattern of lepton flavor violation (LFV) experimentally distinguishable from the one implied by models with grand unified theory scale LNV. As a consequence, muon LFV processes provide a powerful diagnostic tool to determine whether or not the effective neutrino mass can be deduced from the rate of neutrinoless double beta decay. We discuss the role of μ→eγ and μ→e conversion in nuclei, which will be studied with high sensitivity in forthcoming experiments

  7. The Search for Neutrino-less Double-Beta Decay: A Decade of Discovery or Despair?

    CERN Multimedia

    CERN. Geneva

    2011-01-01

    The search for "neutrino-less double-bete decay" decay in candidate nuclear isotopes remains a central focus in contemporary particle physics, with the main goal of establishing whether the neutrino is its own anti-particle. A positive detection would also establish the presence of lepton number violation in this decay, and suggest the existence of processes beyond the Standard Model and reach of terrestrial accelerators. With the discovery and quantitative assessment of neutrino flavor oscillation, guaranteeing the presence of a non-zero neutrino mass – a requirement for "neutrino-less double-bete decay" decay to occur – motivation has surged. In a review of the present diverse and vigorous current experimental situation, I must focus on just a few approaches and candidate isotopes, in particular on 136Xe and a new experimental effort, NEXT, exploiting the unfamiliar phenomenon of electroluminescence. But, even if the neutrino is its own anti-particle, experiments may see no decays! Stil...

  8. Search for new physics with neutrinoless double beta decay

    International Nuclear Information System (INIS)

    Klapdor-Kleingrothaus, H.V.; Baudis, L.; Hellmig, J.; Hirsch, M.; Kolb, S.; Paes, H.; Ramachers, Y.

    1999-01-01

    Neutrinoless double beta decay (0νββ) is one of the most sensitive approaches to test particle physics beyond the standard model. During the last years, besides the most restrictive limit on the effective Majorana neutrino mass, the analysis of new contributions by the Heidelberg group led to bounds on left-right-symmetric models, leptoquarks and R-parity violating models competitive to recent accelerator limits, which are of special interest in view of the HERA anomaly at large Q 2 and x. These new results deduced from the Heidelberg-Moscow double beta decay experiment are reviewed. Also an outlook on the future of double beta decay, the GENIUS proposal, is given

  9. Background-free search for neutrinoless double-β decay of 76Ge with GERDA

    Science.gov (United States)

    Agostini, M.; Allardt, M.; Bakalyarov, A. M.; Balata, M.; Barabanov, I.; Baudis, L.; Bauer, C.; Bellotti, E.; Belogurov, S.; Belyaev, S. T.; Benato, G.; Bettini, A.; Bezrukov, L.; Bode, T.; Borowicz, D.; Brudanin, V.; Brugnera, R.; Caldwell, A.; Cattadori, C.; Chernogorov, A.; D'Andrea, V.; Demidova, E. V.; di Marco, N.; di Vacri, A.; Domula, A.; Doroshkevich, E.; Egorov, V.; Falkenstein, R.; Fedorova, O.; Freund, K.; Frodyma, N.; Gangapshev, A.; Garfagnini, A.; Gooch, C.; Grabmayr, P.; Gurentsov, V.; Gusev, K.; Hakenmüller, J.; Hegai, A.; Heisel, M.; Hemmer, S.; Hofmann, W.; Hult, M.; Inzhechik, L. V.; Janicskó Csáthy, J.; Jochum, J.; Junker, M.; Kazalov, V.; Kihm, T.; Kirpichnikov, I. V.; Kirsch, A.; Kish, A.; Klimenko, A.; Kneißl, R.; Knöpfle, K. T.; Kochetov, O.; Kornoukhov, V. N.; Kuzminov, V. V.; Laubenstein, M.; Lazzaro, A.; Lebedev, V. I.; Lehnert, B.; Liao, H. Y.; Lindner, M.; Lippi, I.; Lubashevskiy, A.; Lubsandorzhiev, B.; Lutter, G.; Macolino, C.; Majorovits, B.; Maneschg, W.; Medinaceli, E.; Miloradovic, M.; Mingazheva, R.; Misiaszek, M.; Moseev, P.; Nemchenok, I.; Palioselitis, D.; Panas, K.; Pandola, L.; Pelczar, K.; Pullia, A.; Riboldi, S.; Rumyantseva, N.; Sada, C.; Salamida, F.; Salathe, M.; Schmitt, C.; Schneider, B.; Schönert, S.; Schreiner, J.; Schulz, O.; Schütz, A.-K.; Schwingenheuer, B.; Selivanenko, O.; Shevchik, E.; Shirchenko, M.; Simgen, H.; Smolnikov, A.; Stanco, L.; Vanhoefer, L.; Vasenko, A. A.; Veresnikova, A.; von Sturm, K.; Wagner, V.; Walter, M.; Wegmann, A.; Wester, T.; Wiesinger, C.; Wojcik, M.; Yanovich, E.; Zhitnikov, I.; Zhukov, S. V.; Zinatulina, D.; Zuber, K.; Zuzel, G.; GERDA Collaboration

    2017-04-01

    Many extensions of the Standard Model of particle physics explain the dominance of matter over antimatter in our Universe by neutrinos being their own antiparticles. This would imply the existence of neutrinoless double-β decay, which is an extremely rare lepton-number-violating radioactive decay process whose detection requires the utmost background suppression. Among the programmes that aim to detect this decay, the GERDA Collaboration is searching for neutrinoless double-β decay of 76Ge by operating bare detectors, made of germanium with an enriched 76Ge fraction, in liquid argon. After having completed Phase I of data taking, we have recently launched Phase II. Here we report that in GERDA Phase II we have achieved a background level of approximately 10-3 counts keV-1 kg-1 yr-1. This implies that the experiment is background-free, even when increasing the exposure up to design level. This is achieved by use of an active veto system, superior germanium detector energy resolution and improved background recognition of our new detectors. No signal of neutrinoless double-β decay was found when Phase I and Phase II data were combined, and we deduce a lower-limit half-life of 5.3 × 1025 years at the 90 per cent confidence level. Our half-life sensitivity of 4.0 × 1025 years is competitive with the best experiments that use a substantially larger isotope mass. The potential of an essentially background-free search for neutrinoless double-β decay will facilitate a larger germanium experiment with sensitivity levels that will bring us closer to clarifying whether neutrinos are their own antiparticles.

  10. Neutrinoless double β decay and low scale leptogenesis

    Directory of Open Access Journals (Sweden)

    Marco Drewes

    2016-12-01

    Full Text Available The extension of the Standard Model by right handed neutrinos with masses in the GeV range can simultaneously explain the observed neutrino masses via the seesaw mechanism and the baryon asymmetry of the universe via leptogenesis. It has previously been claimed that the requirement for successful baryogenesis implies that the rate of neutrinoless double β decay in this scenario is always smaller than the standard prediction from light neutrino exchange alone. In contrast, we find that the rate for this process can also be enhanced due to a dominant contribution from heavy neutrino exchange. In a small part of the parameter space it even exceeds the current experimental limit, while the properties of the heavy neutrinos are consistent with all other experimental constraints and the observed baryon asymmetry is reproduced. This implies that neutrinoless double β decay experiments have already started to rule out part of the leptogenesis parameter space that is not constrained by any other experiment, and the lepton number violation that is responsible for the origin of baryonic matter in the universe may be observed in the near future.

  11. Neutrinoless double β decay and low scale leptogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Drewes, Marco, E-mail: marco.drewes@tum.de [Physik Department T70, Technische Universität München, James Franck Straße 1, D-85748 Garching (Germany); Eijima, Shintaro [Institute of Physics, École Polytechnique Fédérale de Lausanne, CH-1015 Lausanne (Switzerland)

    2016-12-10

    The extension of the Standard Model by right handed neutrinos with masses in the GeV range can simultaneously explain the observed neutrino masses via the seesaw mechanism and the baryon asymmetry of the universe via leptogenesis. It has previously been claimed that the requirement for successful baryogenesis implies that the rate of neutrinoless double β decay in this scenario is always smaller than the standard prediction from light neutrino exchange alone. In contrast, we find that the rate for this process can also be enhanced due to a dominant contribution from heavy neutrino exchange. In a small part of the parameter space it even exceeds the current experimental limit, while the properties of the heavy neutrinos are consistent with all other experimental constraints and the observed baryon asymmetry is reproduced. This implies that neutrinoless double β decay experiments have already started to rule out part of the leptogenesis parameter space that is not constrained by any other experiment, and the lepton number violation that is responsible for the origin of baryonic matter in the universe may be observed in the near future.

  12. GERDA - a new neutrinoless double beta experiment using 76Ge

    International Nuclear Information System (INIS)

    Meierhofer, G

    2011-01-01

    The search for neutrinoless double beta decay (0νssss) has been a very active field for the last decades. While double beta decay has been observed, 0νssss decay still waits for its experimental proof. The GErmanium Detector Array (GERDA) uses 76 Ge, an ideal candidate as it is acting as source and detector simultaneously. Germanium detectors, isotopically enriched in 76 Ge are submerged directly into an ultra pure cryo liquid, which serves as coolant and radiation shield. This concept will allow to reduce the background by up to two orders of magnitude with respect to earlier experiments. GERDA has been constructed in hall A of the underground laboratory LNGS of the INFN in Italy. The experiment started recently with a test run.

  13. Neutrinoless double-beta decay - Status of evidence and future

    International Nuclear Information System (INIS)

    Klapdor-Kleingrothaus, H.V.

    2002-01-01

    Double-beta decay is indispensable to solve the question of the neutrino mass matrix together with ν oscillation experiments. Recent analysis of the most sensitive experiment in the last eight years - the Heidelberg-Moscow experiment in Gran Sasso - yields evidence for the neutrinoless decay mode at a 97% C.L. This result is the first indication for lepton number violation and for the neutrino to be a Majorana particle. We give the present status of the analysis in these proceedings. It excludes several of the neutrino mass scenarios allowed from present neutrino oscillation experiments - essentially only degenerate and partially degenerate mass scenarios survive. To improve the present result, considerably enlarged experiments are required, such as GENIUS. A GENIUS Test Facility has just been funded and will come into operation by the end of 2002

  14. Neutrinoless Double Beta Decay Matrix Elements in Light Nuclei

    Energy Technology Data Exchange (ETDEWEB)

    Pastore, S.; Carlson, J.; Cirigliano, V.; Dekens, W.; Mereghetti, E.; Wiringa, R. B.

    2018-01-17

    We present the first ab initio calculations of neutrinoless double-β decay matrix elements in A=6-12 nuclei using variational Monte Carlo wave functions obtained from the Argonne v18 two-nucleon potential and Illinois-7 three-nucleon interaction. We study both light Majorana neutrino exchange and potentials arising from a large class of multi-TeV mechanisms of lepton-number violation. Our results provide benchmarks to be used in testing many-body methods that can be extended to the heavy nuclei of experimental interest. In light nuclei we also study the impact of two-body short-range correlations and the use of different forms for the transition operators, such as those corresponding to different orders in chiral effective theory.

  15. The MAJORANA DEMONSTRATOR Neutrinoless Double-Beta Decay Experiment

    Directory of Open Access Journals (Sweden)

    N. Abgrall

    2014-01-01

    Full Text Available The Majorana Demonstrator will search for the neutrinoless double-beta (ββ0ν decay of the isotope Ge with a mixed array of enriched and natural germanium detectors. The observation of this rare decay would indicate that the neutrino is its own antiparticle, demonstrate that lepton number is not conserved, and provide information on the absolute mass scale of the neutrino. The Demonstrator is being assembled at the 4850-foot level of the Sanford Underground Research Facility in Lead, South Dakota. The array will be situated in a low-background environment and surrounded by passive and active shielding. Here we describe the science goals of the Demonstrator and the details of its design.

  16. The SNO+ experiment for neutrinoless double-beta decay

    Energy Technology Data Exchange (ETDEWEB)

    Lozza, Valentina; Krosigk, Belina von; Soerensen, Arnd; Zuber, Kai [Institut fuer Kern- und Teilchenphysik, Dresden (Germany)

    2015-07-01

    SNO+ is a large liquid scintillator based experiment that re-uses the Sudbury Neutrino Observatory detector. The detector, located 2 km underground in a mine near Sudbury, Canada, consists of a 12 m diameter acrylic vessel which will be filled with 780 tonnes of liquid scintillator. The main physics goal of SNO+ is to search for the neutrinoless double-beta (0n2b) decay of {sup 130}Te. During the double-beta phase, the liquid scintillator will be initially loaded with 0.3% natural tellurium (nearly 800 kg of {sup 130}Te). During this demonstration phase we anticipate that we will achieve a sensitivity in the region just above the inverted neutrino mass hierarchy. Recently the possibility to deploy up to 10 times more natural tellurium is being developed, by which SNO+ could explore, in the near future, deep into the parameter space for the inverted hierarchy. Designed as a general purpose neutrino experiment, SNO+ can additionally measure the reactor neutrino oscillations, geo-neutrinos in a geologically-interesting location, watch supernova neutrinos and measure low energy solar neutrinos. A first commissioning phase with the detector filled with water has started in autumn 2014, while full running with water will take place in 2015. Transition to the scintillator phase will start towards the end of 2015. The 0n2b decay phase is foreseen for the 2016.

  17. Probing new physics models of neutrinoless double beta decay with SuperNEMO

    Energy Technology Data Exchange (ETDEWEB)

    Arnold, R. [CNRS/IN2P3, IPHC, Universite de Strasbourg, Strasbourg (France); Augier, C.; Bongrand, M.; Garrido, X.; Jullian, S.; Sarazin, X.; Simard, L. [CNRS/IN2P3, LAL, Universite Paris-Sud 11, Orsay (France); Baker, J.; Caffrey, A.J.; Horkley, J.J.; Riddle, C.L. [INL, Idaho Falls, ID (United States); Barabash, A.S.; Konovalov, S.I.; Umatov, V.I.; Vanyushin, I.A. [Institute of Theoretical and Experimental Physics, Moscow (Russian Federation); Basharina-Freshville, A.; Evans, J.J.; Flack, R.; Holin, A.; Kauer, M.; Richards, B.; Saakyan, R.; Thomas, J.; Vasiliev, V.; Waters, D. [University College London, London (United Kingdom); Brudanin, V.; Egorov, V.; Kochetov, O.; Nemchenok, I.; Timkin, V.; Tretyak, V.; Vasiliev, R. [Joint Institute for Nuclear Research, Dubna (Russian Federation); Cebrian, S.; Dafni, T.; Irastorza, I.G.; Gomez, H.; Iguaz, F.J.; Luzon, G.; Rodriguez, A. [University of Zaragoza, Zaragoza (Spain); Chapon, A.; Durand, D.; Guillon, B.; Mauger, F. [Universite de Caen, LPC Caen, ENSICAEN, Caen (France); Chauveau, E.; Hubert, P.; Hugon, C.; Lutter, G.; Marquet, C.; Nachab, A.; Nguyen, C.H.; Perrot, F.; Piquemal, F.; Ricol, J.S. [UMR 5797, Universite de Bordeaux, Centre d' Etudes Nucleaires de Bordeaux Gradignan, Gradignan (France); UMR 5797, CNRS/IN2P3, Centre d' Etudes Nucleaires de Bordeaux Gradignan, Gradignan (France); Deppisch, F.F.; Jackson, C.M.; Nasteva, I.; Soeldner-Rembold, S. [Univ. of Manchester (United Kingdom); Diaz, J.; Monrabal, F.; Serra, L.; Yahlali, N. [CSIC - Univ. de Valencia, IFIC (Spain); Fushima, K.I. [Tokushima Univ., Tokushima (Japan); Holy, K.; Povinec, P.P.; Simkovic, F. [Comenius Univ., FMFI, Bratislava (Slovakia); Ishihara, N. [KEK, Tsukuba, Ibaraki (Japan); Kovalenko, V. [CNRS/IN2P3, IPHC, Univ. de Strasbourg (France); Joint Inst. for Nuclear Research, Dubna (Russian Federation); Lamhamdi, T. [USMBA, Fes (Morocco); Lang, K.; Pahlka, R.B. [Univ. of Texas, Austin, TX (United States)] (and others)

    2010-12-15

    The possibility to probe new physics scenarios of light Majorana neutrino exchange and right-handed currents at the planned next generation neutrinoless double {beta} decay experiment SuperNEMO is discussed. Its ability to study different isotopes and track the outgoing electrons provides the means to discriminate different underlying mechanisms for the neutrinoless double {beta} decay by measuring the decay half-life and the electron angular and energy distributions. (orig.)

  18. An electroweak basis for neutrinoless double β decay

    Science.gov (United States)

    Graesser, Michael L.

    2017-08-01

    A discovery of neutrinoless double- β decay would be profound, providing the first direct experimental evidence of Δ L = 2 lepton number violating processes. While a natural explanation is provided by an effective Majorana neutrino mass, other new physics interpretations should be carefully evaluated. At low-energies such new physics could man-ifest itself in the form of color and SU(2) L × U(1) Y invariant higher dimension operators. Here we determine a complete set of electroweak invariant dimension-9 operators, and our analysis supersedes those that only impose U(1) em invariance. Imposing electroweak invariance implies: 1) a significantly reduced set of leading order operators compared to only imposing U(1) em invariance; and 2) other collider signatures. Prior to imposing electroweak invariance we find a minimal basis of 24 dimension-9 operators, which is reduced to 11 electroweak invariant operators at leading order in the expansion in the Higgs vacuum expectation value. We set up a systematic analysis of the hadronic realization of the 4-quark operators using chiral perturbation theory, and apply it to determine which of these operators have long-distance pion enhancements at leading order in the chiral expansion. We also find at dimension-11 and dimension-13 the electroweak invariant operators that after electroweak symmetry breaking produce the remaining Δ L = 2 operators that would appear at dimension-9 if only U(1) em is imposed.

  19. The Gerda search for neutrinoless double beta decay

    Science.gov (United States)

    O'Shaughnessy, Christopher; Gerda Collaboration

    2013-10-01

    The Germanium Detector Array (Gerda) is a search for the neutrinoless double beta decay of 76Ge. High Purity Germanium (HPGe) detectors enriched in the isotope-76 are operated bare in liquid argon (LAr). LAr is used for both cooling of the HPGe diodes to their operating temperatures and for shielding from external radiation sources. From the measurements of the first phase that began data taking on 1 Nov. 2011 it is expected to have a sensitivity on the level of T1/2>2E25 yr at a 90% CL after 15 kġyr. The goal of this phase will be to probe the claim of an observation by part of the Heidelberg-Moscow collaboration. Efforts will then focus on increasing the sensitivity of the experiment by deploying additional enriched detectors that are in an advanced stage of production and by reducing the background index further by making use of pulse shape discrimination techniques as well as an active LAr veto. While the 0νββ region of interest continues to remain blinded, here the status of Phase-I data taking is presented along with the work towards improving the experimental sensitivity.

  20. Constraining neutrino mass from neutrinoless double beta decay

    Science.gov (United States)

    Dev, P. S. Bhupal; Goswami, Srubabati; Mitra, Manimala; Rodejohann, Werner

    2013-11-01

    We study the implications of the recent results on neutrinoless double beta decay (0νββ) from GERDA-I (Ge76) and KamLAND-Zen+EXO-200 (Xe136) and the upper limit on the sum of light neutrino masses from Planck. We show that the upper limits on the effective neutrino mass from Xe136 are stronger than those from Ge76 for most of the recent calculations of the nuclear matrix elements (NMEs). We also analyze the compatibility of these limits with the claimed observation in Ge76 and show that while the updated claim value is still compatible with the recent GERDA limit as well as the individual Xe136 limits for a few NME calculations, it is inconsistent with the combined Xe136 limit for all but one NME. Imposing the most stringent limit from Planck, we find that the canonical light neutrino contribution cannot saturate the current limit, irrespective of the NME uncertainties. Saturation can be reached by inclusion of the right-handed (RH) neutrino contributions in TeV-scale left-right symmetric models with type-II seesaw. This imposes a lower limit on the lightest neutrino mass. Using the 0νββ bounds, we also derive correlated constraints in the RH sector, complimentary to those from direct searches at the LHC.

  1. Neutrinoless double beta decay in GERDA Phase II

    International Nuclear Information System (INIS)

    Macolino, C.

    2014-01-01

    The GERmanium Detector Array, GERDA, is designed to search for neutrinoless double beta (0νββ) decay of 76 Ge and it is installed in the Laboratori Nazionali del Gran Sasso (LNGS) of INFN, Italy. The GERDA experiment has completed the Phase I with a total collected exposure of 21.6 kg yr and a background index (BI) of the order of BI ≃ 10 −2 cts/(keVkg yr). No excess of events from 0νββ decay has been observed and a lower limit on the half-life on the 0νββ decay for 76 Ge has been estimated: T 0ν 1 /2 > 2.1·10 25 yr at 90% CL. The goal of GERDA Phase II is to reach the target sensitivity of T 0ν 1 /2 ≃ 1.4 · 10 26 yr, with an increased total mass of the enriched material and a reduced background level. In this paper the results from GERDA Phase I and the major improvements planned for Phase II are discussed.

  2. Search of Neutrinoless Double Beta Decay with the GERDA Experiment

    Science.gov (United States)

    Agostini, M.; Allardt, M.; Bakalyarov, A. M.; Balata, M.; Barabanov, I.; Baudis, L.; Bauer, C.; Becerici-Schmidt, N.; Bellotti, E.; Belogurov, S.; Belyaev, S. T.; Benato, G.; Bettini, A.; Bezrukov, L.; Bode, T.; Borowicz, D.; Brudanin, V.; Brugnera, R.; Budjáš, D.; Caldwell, A.; Cattadori, C.; Chernogorov, A.; D'Andrea, V.; Demidova, E. V.; Domula, A.; Doroshkevich, E.; Egorov, V.; Falkenstein, R.; Fedorova, O.; Freund, K.; Frodyma, N.; Gangapshev, A.; Garfagnini, A.; Gooch, C.; Gotti, C.; Grabmayr, P.; Gurentsov, V.; Gusev, K.; Hampel, W.; Hegai, A.; Heisel, M.; Hemmer, S.; Heusser, G.; Hoffmann, W.; Hult, M.; Inzhechik, L. V.; Ioannucci, L.; Janicksó Csáthy, J.; Jochum, J.; Junker, M.; Kazalov, V.; Kihm, T.; Kirpichnikov, I. V.; Kirsch, A.; Klimenko, A.; Knöpfle, K. T.; Kochetov, O.; Kornoukhov, V. N.; Kuzminov, V. V.; Laubenstein, M.; Lazzaro, A.; Lebedev, V. I.; Lehnert, B.; Liao, H. Y.; Lindner, M.; Lippi, I.; Lubashevskiy, A.; Lubsandorzhiev, B.; Lutter, G.; Macolino, C.; Majorovits, B.; Maneschg, W.; Marissens, G.; Medinaceli, E.; Misiaszek, M.; Moseev, P.; Nemchenok, I.; Nisi, S.; Palioselitis, D.; Panas, K.; Pandola, L.; Pelczar, K.; Pessina, G.; Pullia, A.; Reissfelder, M.; Riboldi, S.; Rumyantseva, N.; Sada, C.; Salathe, M.; Schmitt, C.; Schneider, B.; Schreiner, J.; Schulz, O.; Schwingenheuer, B.; Schönert, S.; Seitz, H.; Selivalenko, O.; Shevchik, E.; Shirchenko, M.; Simgen, H.; Smolnikov, A.; Stanco, L.; Stepaniuk, M.; Strecker, H.; Ur, C. A.; Vanhoefer, L.; Vasenko, A. A.; Veresnikova, A.; von Sturm, K.; Wagner, V.; Walter, M.; Wegmann, A.; Wester, T.; Wiesinger, C.; Wilsenach, H.; Wojcik, M.; Yanovich, E.; Zavarise, P.; Zhitnikov, I.; Zhukov, S. V.; Zinatulina, D.; Zuber, K.; Zuzel, G.

    2016-04-01

    The GERDA (GERmanium Detector Array) is an experiment for the search of neutrinoless double beta decay (0 νββ) in 76Ge, located at Laboratori Nazionali del Gran Sasso of INFN (Italy). In the first phase of the experiment, a 90% confidence level (C.L.) sensitivity of 2.4 ṡ1025 yr on the 0 νββ decay half-life was achieved with a 21.6 kgṡyr exposure and an unprecedented background index in the region of interest of 10-2 counts/(keVṡkgṡyr). No excess of signal events was found, and an experimental lower limit on the half-life of 2.1 ṡ 1025 yr (90% C.L.) was established. Correspondingly, the limit on the effective Majorana neutrino mass is mee < 0.2- 0.4 eV, depending on the considered nuclear matrix element. The previous claim for evidence of a 0 νββ decay signal is strongly disfavored, and the field of research is open again.

  3. Semiconductor-based experiments for neutrinoless double beta decay search

    International Nuclear Information System (INIS)

    Barnabé Heider, Marik

    2012-01-01

    Three experiments are employing semiconductor detectors in the search for neutrinoless double beta (0νββ) decay: COBRA, Majorana and GERDA. COBRA is studying the prospects of using CdZnTe detectors in terms of achievable energy resolution and background suppression. These detectors contain several ββ emitters and the most promising for 0νββ-decay search is 116 Cd. Majorana and GERDA will use isotopically enriched high purity Ge detectors to search for 0νββ-decay of 76 Ge. Their aim is to achieve a background ⩽10 −3 counts/(kg⋅y⋅keV) at the Q improvement compared to the present state-of-art. Majorana will operate Ge detectors in electroformed-Cu vacuum cryostats. A first cryostat housing a natural-Ge detector array is currently under preparation. In contrast, GERDA is operating bare Ge detectors submerged in liquid argon. The construction of the GERDA experiment is completed and a commissioning run started in June 2010. A string of natural-Ge detectors is operated to test the complete experimental setup and to determine the background before submerging the detectors enriched in 76 Ge. An overview and a comparison of these three experiments will be presented together with the latest results and developments.

  4. Search for neutrinoless double beta decay with GERDA phase II

    Science.gov (United States)

    Agostini, M.; Bakalyarov, A. M.; Balata, M.; Barabanov, I.; Baudis, L.; Bauer, C.; Bellotti, E.; Belogurov, S.; Bettini, A.; Bezrukov, L.; Bode, T.; Borowicz, D.; Brudanin, V.; Brugnera, R.; Caldwell, A.; Cattadori, C.; Chernogorov, A.; D'Andrea, V.; Demidova, E. V.; Di Marco, N.; Domula, A.; Doroshkevich, E.; Egorov, V.; Falkenstein, R.; Gangapshev, A.; Garfagnini, A.; Gooch, C.; Grabmayr, P.; Gurentsov, V.; Gusev, K.; Hakenmüller, J.; Hegai, A.; Heisel, M.; Hemmer, S.; Hofmann, W.; Hult, M.; Inzhechik, L. V.; Csáthy, J. Janicskó; Jochum, J.; Junker, M.; Kazalov, V.; Kihm, T.; Kirpichnikov, I. V.; Kirsch, A.; Kish, A.; Klimenko, A.; Kneißl, R.; Knies, J.; Knöpfle, K. T.; Kochetov, O.; Kornoukhov, V. N.; Kuzminov, V. V.; Laubenstein, M.; Lazzaro, A.; Lebedev, V. I.; Liao, H. Y.; Lindner, M.; Lippi, I.; Lubashevskiy, A.; Lubsandorzhiev, B.; Lutter, G.; Majorovits, B.; Maneschg, W.; Marissens, G.; Miloradovic, M.; Mingazheva, R.; Misiaszek, M.; Moseev, P.; Nemchenok, I.; Panas, K.; Pandola, L.; Pelczar, K.; Pullia, A.; Ransom, C.; Reissfelder, M.; Riboldi, S.; Rumyantseva, N.; Sada, C.; Salamida, F.; Schmitt, C.; Schneider, B.; Schönert, S.; Schreiner, J.; Schulz, O.; Schütz, A.-K.; Schwingenheuer, B.; Seitz, H.; Selivanenko, O.; Shevchik, E.; Shirchenko, M.; Simgen, H.; Smolnikov, A.; Stanco, L.; Vanhoefer, L.; Vasenko, A. A.; Veresnikova, A.; von Sturm, K.; Wagner, V.; Wegmann, A.; Wester, T.; Wiesinger, C.; Wojcik, M.; Yanovich, E.; Zhitnikov, I.; Zhukov, S. V.; Zinatulina, D.; Zuber, K.; Zuzel, G.

    2017-10-01

    The GERmanium Detector Array (gerda) experiment, located at the Gran Sasso underground laboratory in Italy, is one of the leading experiments for the search of 0νββ decay. In Phase II of the experiment 35.6 kg of enriched germanium detectors are operated. The application of active background rejection methods, such as a liquid argon scintillation light read-out and pulse shape discrimination of germanium detector signals, allowed to reduce the background index to the intended level of 10-3 cts/(keV.kg.yr). In the first five month of data taking 10.8 kg yr of exposure were accumulated. No signal has been found and together with data from Phase I a new limit for the neutrinoless double beta decay half-life of 76Ge of 5.3 . 1025 yr at 90% C.L. was established in June 2016. Phase II data taking is ongoing and will allow the exploration of half-lifes in the 1026 yr regime. The current status of data taking and an update on the background index are presented.

  5. Searching Neutrinoless Double Beta Decay with GERDA Phase II

    Science.gov (United States)

    Agostini, M.; Bakalyarov, A. M.; Balata, M.; Barabanov, I.; Baudis, L.; Bauer, C.; Bellotti, E.; Belogurov, S.; Bettini, A.; Bezrukov, L.; Bode, T.; Brudanin, V.; Brugnera, R.; Caldwell, A.; Cattadori, C.; Chernogorov, A.; Comellato, T.; D’Andrea, V.; Demidova, E. V.; di Marco, N.; Domula, A.; Doroshkevich, E.; Egorov, V.; Falkenstein, R.; Gangapshev, A.; Garfagnini, A.; Giordano, M.; Gooch, C.; Grabmayr, P.; Gurentsov, V.; Gusev, K.; Hahne, C.; Hakenmüller, J.; Hegai, A.; Heisel, M.; Hemmer, S.; Hiller, R.; Hofmann, W.; Holl, P.; Hult, M.; Inzhechik, L. V.; Ioannucci, L.; Csáthy, J. Janicskó; Jochum, J.; Junker, M.; Kazalov, V.; Kermaidic, Y.; Kihm, T.; Kirpichnikov, I. V.; Kirsch, A.; Kish, A.; Klimenko, A.; Kneißl, R.; Knöpfle, K. T.; Kochetov, O.; Kornoukhov, V. N.; Kuzminov, V. V.; Laubenstein, M.; Lazzaro, A.; Lindner, M.; Lippi, I.; Lubashevskiy, A.; Lubsandorzhiev, B.; Lutter, G.; Macolino, C.; Majorovits, B.; Maneschg, W.; Marissens, G.; Miloradovic, M.; Mingazheva, R.; Misiaszek, M.; Moseev, P.; Nemchenok, I.; Nisi, S.; Panas, K.; Pandola, L.; Pelczar, K.; Pullia, A.; Ransom, C.; Reissfelder, M.; Riboldi, S.; Rumyantseva, N.; Sada, C.; Sala, E.; Salamida, F.; Schmitt, C.; Schneider, B.; Schreiner, J.; Schulz, O.; Schweisshelm, B.; Schwingenheuer, B.; Schönert, S.; Schütz, A.-K.; Seitz, H.; Selivanenko, O.; Shevchik, E.; Shirchenko, M.; Simgen, H.; Smolnikov, A.; Stanco, L.; Vanhoefer, L.; Vasenko, A. A.; Veresnikova, A.; von Sturm, K.; Wagner, V.; Wegmann, A.; Wester, T.; Wiesinger, C.; Wojcik, M.; Yanovich, E.; Zhitnikov, I.; Zhukov, S. V.; Zinatulina, D.; Zschocke, A.; Zsigmond, A. J.; Zuber, K.; Zuzel, G.

    An observation of neutrinoless double beta (0νββ) decay would allow to shed light onto the nature of neutrinos. GERDA (GERmanium Detector Array) aims to discover this process in a background-free search using 76Ge. The experiment is located at the Laboratori Nazionali del Gran Sasso (LNGS) of the Istituto Nazionale di Fisica Nucleare (INFN) in Italy. Bare, isotopically enriched, high purity germanium detectors are operated in liquid argon. GERDA follows a staged approach. In Phase II 35.6 kg of enriched germanium detectors are operated since December 2015. The application of active background rejection methods, such as a liquid argon scintillation light read-out and pulse shape discrimination of germanium detector signals, allows to reduce the background index to the intended level of 10‑3 cts/(keVṡkgṡyr). No evidence for the 0νββ decay has been found in 23.2 kgṡyr of Phase II data, and together with data from Phase I the up-to-date most stringent half-life limit for this process in 76Ge has been established, at a median sensitivity of 5.8ṡ1025yr the 90% C.L. lower limit is 8.0ṡ1025yr.

  6. The CUORE neutrinoless double-beta decay experiment

    International Nuclear Information System (INIS)

    Banks, T.I.

    2014-01-01

    CUORE is an upcoming experiment designed to search for neutrinoless double-beta decay (0νββ) decay in 130 Te. Observation of the process would be a major finding because it would unambiguously establish that neutrinos are Majorana particles (i.e., their own antiparticles) as well as provide information about the absolute neutrino mass scale. The CUORE detector will consist of 988 identical TeO 2 crystal bolometers (containing 206 kg of 130 Te in total) arranged into 19 towers and cooled to about 10 mK at the underground Gran Sasso National Laboratory (LNGS), Italy, which provides the low-background environment necessary for rare event searches of this kind. A predecessor experiment, Cuoricino, ran from 2003-2008 at LNGS and served as a learning ground for CUORE, which will be 20 times larger and exhibit much lower backgrounds. The CUORE detector assembly line has produced its first tower, designated CUORE-0, which is expected to come online in the former Cuoricino cryostat in October 2012 and take data for about 2 years while 19 CUORE towers are assembled. CUORE data taking is expected for 2015-2019. (author)

  7. Neutrinoless double β decay and effective field theory

    International Nuclear Information System (INIS)

    Prezeau, G.; Ramsey-Musolf, M.; Vogel, Petr

    2003-01-01

    We analyze neutrinoless double β decay (0νββ decay) mediated by heavy particles from the standpoint of effective field theory. We show how symmetries of the 0νββ-decay quark operators arising in a given particle physics model determine the form of the corresponding effective, hadronic operators. We classify the latter according to their symmetry transformation properties as well as the order at which they appear in a derivative expansion. We apply this framework to several particle physics models, including R-parity violating supersymmetry (RPV SUSY) and the left-right symmetric model (LRSM) with mixing and a right-handed Majorana neutrino. We show that, in general, the pion exchange contributions to 0νββ decay dominate over the short-range four-nucleon operators. This confirms previously published RPV SUSY results and allows us to derive new constraints on the masses in the LRSM. In particular, we show how a nonzero mixing angle ζ in the left-right symmetry model produces a new potentially dominant contribution to 0νββ decay that substantially modifies previous limits on the masses of the right-handed neutrino and boson stemming from constraints from 0νββ decay and vacuum stability requirements

  8. Localizability of tachyonic particles and neutrinoless double beta decay

    Energy Technology Data Exchange (ETDEWEB)

    Jentschura, U.D. [Missouri University of Science and Technology, Department of Physics, Rolla, MO (United States); Institut fuer Theoretische Physik, Heidelberg (Germany); Wundt, B.J. [Missouri University of Science and Technology, Department of Physics, Rolla, MO (United States)

    2012-02-15

    The quantum field theory of superluminal (tachyonic) particles is plagued by a number of problems, which include the Lorentz non-invariance of the vacuum state, the ambiguous separation of the field operator into creation and annihilation operators under Lorentz transformations, and the necessity of a complex reinterpretation principle for quantum processes. Another unsolved question concerns the treatment of subluminal components of a tachyonic wave packet in the field-theoretical formalism, and the calculation of the time-ordered propagator. After a brief discussion on related problems, we conclude that rather painful choices have to be made in order to incorporate tachyonic spin- (1)/(2) particles into field theory. We argue that the field theory needs to be formulated such as to allow for localizable tachyonic particles, even if that means that a slight unitarity violation is introduced into the S matrix, and we write down field operators with unrestricted momenta. We find that once these choices have been made, the propagator for the neutrino field can be given in a compact form, and the left-handedness of the neutrino as well as the right-handedness of the antineutrino follow naturally. Consequences for neutrinoless double beta decay and superluminal propagation of neutrinos are briefly discussed. (orig.)

  9. Localizability of tachyonic particles and neutrinoless double beta decay

    International Nuclear Information System (INIS)

    Jentschura, U.D.; Wundt, B.J.

    2012-01-01

    The quantum field theory of superluminal (tachyonic) particles is plagued by a number of problems, which include the Lorentz non-invariance of the vacuum state, the ambiguous separation of the field operator into creation and annihilation operators under Lorentz transformations, and the necessity of a complex reinterpretation principle for quantum processes. Another unsolved question concerns the treatment of subluminal components of a tachyonic wave packet in the field-theoretical formalism, and the calculation of the time-ordered propagator. After a brief discussion on related problems, we conclude that rather painful choices have to be made in order to incorporate tachyonic spin- (1)/(2) particles into field theory. We argue that the field theory needs to be formulated such as to allow for localizable tachyonic particles, even if that means that a slight unitarity violation is introduced into the S matrix, and we write down field operators with unrestricted momenta. We find that once these choices have been made, the propagator for the neutrino field can be given in a compact form, and the left-handedness of the neutrino as well as the right-handedness of the antineutrino follow naturally. Consequences for neutrinoless double beta decay and superluminal propagation of neutrinos are briefly discussed. (orig.)

  10. Neutrinoless double beta decay with 82SeF6 and direct ion imaging

    Science.gov (United States)

    Nygren, D. R.; Jones, B. J. P.; López-March, N.; Mei, Y.; Psihas, F.; Renner, J.

    2018-03-01

    We present a new neutrinoless double beta decay concept: the high pressure selenium hexafluoride gas time projection chamber. A promising new detection technique is outlined which combines techniques pioneered in high pressure xenon gas, such as topological discrimination, with the high Q-value afforded by the double beta decay isotope 82Se. The lack of free electrons in SeF6 mandates the use of an ion TPC. The microphysics of ion production and drift, which have many nuances, are explored. Background estimates are presented, suggesting that such a detector may achieve background indices of better than 1 count per ton per year in the region of interest at the 100 kg scale, and still better at the ton-scale.

  11. First results of neutrinoless double beta decay search with the GERmanium Detector Array "GERDA"

    Science.gov (United States)

    Janicskó Csáthy, József

    2014-06-01

    The study of neutrinoless double beta decay is the most powerful approach to the fundamental question if the neutrino is a Majorana particle, i.e. its own anti-particle. The observation of the lepton number violating neutrinoless double beta decay would establish the Majorana nature of the neutrino. Until now neutrinoless double beta decay was not observed. The GERmanium Detector Array, GERDA is a double beta decay experiment located at the INFN Gran Sasso National Laboratory, Italy. GERDA operates bare Ge diodes enriched in 76Ge in liquid argon supplemented by a water shield. The exposure accumulated adds up to 21.6 kg· yr with a background level of 1.8 · 10-2 cts/(keV·kg·yr). The results of the Phase I of the experiment are presented and the preparation of the Phase II is briefly discussed.

  12. The MAJORANA DEMONSTRATOR: A Search for Neutrinoless Double-beta Decay of Germanium-76

    Energy Technology Data Exchange (ETDEWEB)

    Schubert, Alexis G.; Aguayo, Estanislao; Avignone, F. T.; Zhang, C.; Back, Henning O.; Barabash, Alexander S.; Bergevin, M.; Bertrand, F.; Boswell, M.; Brudanin, V.; Busch, Matthew; Chan, Yuen-Dat; Christofferson, Cabot-Ann; Collar, J. I.; Combs, Dustin C.; Cooper, R. J.; Detwiler, Jason A.; Leon, Jonathan D.; Doe, Peter J.; Efremenko, Yuri; Egorov, Viatcheslav; Ejiri, H.; Elliott, S. R.; Esterline, James H.; Fast, James E.; Fields, N.; Finnerty, P.; Fraenkle, Florian; Gehman, Victor M.; Giovanetti, G. K.; Green, M.; Guiseppe, Vincente; Gusey, K.; Hallin, A. L.; Hazama, R.; Henning, Reyco; Hime, Andrew; Hoppe, Eric W.; Horton, Mark; Howard, Stanley; Howe, Mark; Johnson, R. A.; Keeter, K.; Keillor, Martin E.; Keller, C.; Kephart, Jeremy D.; Kidd, M. F.; Knecht, A.; Kochetov, Oleg; Konovalov, S.; Kouzes, Richard T.; LaFerriere, Brian D.; LaRoque, B. H.; Leviner, L.; Loach, J. C.; MacMullin, S.; Marino, Michael G.; Martin, R. D.; Mei, Dong-Ming; Merriman, Jason H.; Miller, M. L.; Mizouni, Leila; Nomachi, Masaharu; Orrell, John L.; Overman, Nicole R.; Phillips, D.; Poon, Alan; Perumpilly, Gopakumar; Prior, Gersende; Radford, D. C.; Rielage, Keith; Robertson, R. G. H.; Ronquest, M. C.; Shima, T.; Shirchenko, M.; Snavely, Kyle J.; Sobolev, V.; Steele, David; Strain, J.; Thomas, K.; Timkin, V.; Tornow, Werner; Vanyushin, I.; Varner, R. L.; Vetter, Kai; Vorren, Kris R.; Wilkerson, J. F.; Wolfe, B. A.; Yakushev, E.; Young, A.; Yu, Chang-Hong; Yumatov, Vladimir

    2012-09-28

    The observation of neutrinoless double-beta decay would determine whether the neutrino is a Majorana particle and provide information on the absolute scale of neutrino mass. The MAJORANA Collaboration is constructing the DEMONSTRATOR, an array of germanium detectors, to search for neutrinoless double-beta decay of 76Ge. The DEMONSTRATOR will contain 40 kg of germanium; up to 30 kg will be enriched to 86% in 76Ge. The DEMONSTRATOR will be deployed deep underground in an ultra-low-background shielded environment. Operation of the DEMONSTRATOR aims to determine whether a future tonne-scale germanium experiment can achieve a background goal of one count per tonne-year in a 4-keV region of interest around the 76Ge neutrinoless double-beta decay Q-value of 2039 keV.

  13. Neutron Interactions in the CUORE Neutrinoless Double Beta Decay Experiment

    Energy Technology Data Exchange (ETDEWEB)

    Dolinski, Michelle Jean [Univ. of California, Berkeley, CA (United States)

    2008-10-01

    Neutrinoless double beta decay (0vDBD) is a lepton-number violating process that can occur only for a massive Majorana neutrino. The search for 0vDBD is currently the only practical experimental way to determine whether neutrinos are identical to their own antiparticles (Majorana neutrinos) or have distinct particle and anti-particle states (Dirac neutrinos). In addition, the observation of 0vDBD can provide information about the absolute mass scale of the neutrino. The Cuoricino experiment was a sensitive search for 0vDBD, as well as a proof of principle for the next generation experiment, CUORE. CUORE will search for 0vDBD of 130Te with a ton-scale array of unenriched TeO2 bolometers. By increasing mass and decreasing the background for 0vDBD, the half-life sensitivity of CUORE will be a factor of twenty better than that of Cuoricino. The site for both of these experiments is the Laboratori Nazionali del Gran Sasso, an underground laboratory with 3300 meters water equivalent rock overburden and a cosmic ray muon attenuation factor of 10-6. Because of the extreme low background requirements for CUORE, it is important that all potential sources of background in the 0vDBD peak region at 2530 keV are well understood. One potential source of background for CUORE comes from neutrons, which can be produced underground both by (α,n) reactions and by fast cosmic ray muon interactions. Preliminary simulations by the CUORE collaboration indicate that these backgrounds will be negligible for CUORE. However, in order to accurately simulate the expected neutron background, it is important to understand the cross sections for neutron interactions with detector materials. In order to help refine these simulations, I have measured the gamma-ray production cross sections for interactions of neutrons on the abundant stable isotopes of Te using the GEANIE detector array at the Los Alamos Neutron Science Center. In addition, I have used the GEANIE

  14. The MAJORANA experiment: an ultra-low background search for neutrinoless double-beta decay

    Energy Technology Data Exchange (ETDEWEB)

    Phillips, D.; Aguayo Navarrete, Estanislao; Avignone, Frank T.; Back, Henning O.; Barabash, Alexander S.; Bergevin, M.; Bertrand, F.; Boswell, M.; Brudanin, V.; Busch, Matthew; Chan, Yuen-Dat; Christofferson, Cabot-Ann; Collar, J. I.; Combs, Dustin C.; Cooper, R. J.; Detwiler, Jason A.; Doe, Peter J.; Efremenko, Yuri; Egorov, Viatcheslav; Ejiri, H.; Elliott, Steven R.; Esterline, James H.; Fast, James E.; Fields, N.; Finnerty, P.; Fraenkle, Florian; Gehman, Victor; Giovanetti, G. K.; Green, Matthew P.; Guiseppe, Vincente; Gusey, K.; Hallin, A. L.; Hazama, R.; Henning, Reyco; Hime, Andrew; Hoppe, Eric W.; Horton, Mark; Howard, Stanley; Howe, M. A.; Johnson, R. A.; Keeter, K.; Keller, C.; Kidd, Mary; Knecht, A.; Kochetov, Oleg; Konovalov, S.; Kouzes, Richard T.; LaFerriere, Brian D.; LaRoque, B. H.; Leon, Jonathan D.; Leviner, L.; Loach, J. C.; MacMullin, S.; Marino, Michael G.; Martin, R. D.; Mei, Dong-Ming; Merriman, Jason H.; Miller, M. L.; Mizouni, Leila; Nomachi, Masaharu; Orrell, John L.; Overman, Nicole R.; Poon, Alan; Perumpilly, Gopakumar; Prior, Gersende; Radford, D. C.; Rielage, Keith; Robertson, R. G. H.; Ronquest, M. C.; Schubert, Alexis G.; Shima, T.; Shirchenko, M.; Snavely, Kyle J.; Steele, David; Strain, J.; Thomas, K.; Timkin, V.; Tornow, W.; Vanyushin, I.; Varner, R. L.; Vetter, Kai; Vorren, Kris R.; Wilkerson, J. F.; Wolfe, B. A.; Yakushev, E.; Young, A.; Yu, Chang-Hong; Yumatov, Vladimir; Zhang, C.

    2012-12-01

    The observation of neutrinoless double-beta decay would resolve the Majorana nature of the neutrino and could provide information on the absolute scale of the neutrino mass. The initial phase of the Majorana Experiment, known as the Demonstrator, will house 40 kg of Ge in an ultra-low background shielded environment at the 4850' level of the Sanford Underground Laboratory in Lead, SD. The objective of the Demonstrator is to validate whether a future 1-tonne experiment can achieve a background goal of one count per tonne-year in a narrow region of interest around the 76Ge neutrinoless double-beta decay peak.

  15. Search for neutrinoless double beta decay in {sup 136}Xe with EXO-200

    Energy Technology Data Exchange (ETDEWEB)

    Feldmeier, Wolfhart

    2015-02-19

    Several properties of neutrinos, such as their absolute mass, their possible Majorana nature or the mechanisms that lead to small neutrino masses, are still unknown. The EXO-200 experiment is trying to answer some of these questions by searching for the hypothetical neutrinoless double beta decay of the isotope {sup 136}Xe. This thesis describes an analysis of two years of detector data, which yields a lower limit on the half-life of neutrinoless double beta decay of {sup 136}Xe of 1.1 x 10{sup 25} years.

  16. Phase II Upgrade of the GERDA Experiment for the Search of Neutrinoless Double Beta Decay

    Science.gov (United States)

    Majorovits, B.

    Observation of neutrinoless double beta decay could answer the question regarding the Majorana or Dirac nature of neutrinos. The GERDA experiment utilizes HPGe detectors enriched with the isotope 76Ge to search for this process. Recently the GERDA collaboration has unblinded data of Phase I of the experiment. In order to further improve the sensitivity of the experiment, additionally to the coaxial detectors used, 30 BEGe detectors made from germanium enriched in 76Ge will be deployed in GERDA Phase II. BEGe detectors have superior PSD capability, thus the background can be further reduced. The liquid argon surrounding the detector array will be instrumented in order to reject background by detecting scintillation light induced in the liquid argon by radiation. After a short introduction the hardware preparations for GERDA Phase II as well as the processing and characterization of the 30 BEGe detectors are discussed.

  17. Demonstration of Single-Barium-Ion Sensitivity for Neutrinoless Double-Beta Decay Using Single-Molecule Fluorescence Imaging

    Science.gov (United States)

    McDonald, A. D.; Jones, B. J. P.; Nygren, D. R.; Adams, C.; Álvarez, V.; Azevedo, C. D. R.; Benlloch-Rodríguez, J. M.; Borges, F. I. G. M.; Botas, A.; Cárcel, S.; Carrión, J. V.; Cebrián, S.; Conde, C. A. N.; Díaz, J.; Diesburg, M.; Escada, J.; Esteve, R.; Felkai, R.; Fernandes, L. M. P.; Ferrario, P.; Ferreira, A. L.; Freitas, E. D. C.; Goldschmidt, A.; Gómez-Cadenas, J. J.; González-Díaz, D.; Gutiérrez, R. M.; Guenette, R.; Hafidi, K.; Hauptman, J.; Henriques, C. A. O.; Hernandez, A. I.; Hernando Morata, J. A.; Herrero, V.; Johnston, S.; Labarga, L.; Laing, A.; Lebrun, P.; Liubarsky, I.; López-March, N.; Losada, M.; Martín-Albo, J.; Martínez-Lema, G.; Martínez, A.; Monrabal, F.; Monteiro, C. M. B.; Mora, F. J.; Moutinho, L. M.; Muñoz Vidal, J.; Musti, M.; Nebot-Guinot, M.; Novella, P.; Palmeiro, B.; Para, A.; Pérez, J.; Querol, M.; Repond, J.; Renner, J.; Riordan, S.; Ripoll, L.; Rodríguez, J.; Rogers, L.; Santos, F. P.; dos Santos, J. M. F.; Simón, A.; Sofka, C.; Sorel, M.; Stiegler, T.; Toledo, J. F.; Torrent, J.; Tsamalaidze, Z.; Veloso, J. F. C. A.; Webb, R.; White, J. T.; Yahlali, N.; NEXT Collaboration

    2018-03-01

    A new method to tag the barium daughter in the double-beta decay of Xe 136 is reported. Using the technique of single molecule fluorescent imaging (SMFI), individual barium dication (Ba++ ) resolution at a transparent scanning surface is demonstrated. A single-step photobleach confirms the single ion interpretation. Individual ions are localized with superresolution (˜2 nm ), and detected with a statistical significance of 12.9 σ over backgrounds. This lays the foundation for a new and potentially background-free neutrinoless double-beta decay technology, based on SMFI coupled to high pressure xenon gas time projection chambers.

  18. Demonstration of Single-Barium-Ion Sensitivity for Neutrinoless Double-Beta Decay Using Single-Molecule Fluorescence Imaging

    Energy Technology Data Exchange (ETDEWEB)

    McDonald, A. D.; Jones, B. J. P.; Nygren, D. R.; Adams, C.; Álvarez, V.; Azevedo, C. D. R.; Benlloch-Rodríguez, J. M.; Borges, F. I. G. M.; Botas, A.; Cárcel, S.; Carrión, J. V.; Cebrián, S.; Conde, C. A. N.; Díaz, J.; Diesburg, M.; Escada, J.; Esteve, R.; Felkai, R.; Fernandes, L. M. P.; Ferrario, P.; Ferreira, A. L.; Freitas, E. D. C.; Goldschmidt, A.; Gómez-Cadenas, J. J.; González-Díaz, D.; Gutiérrez, R. M.; Guenette, R.; Hafidi, K.; Hauptman, J.; Henriques, C. A. O.; Hernandez, A. I.; Hernando Morata, J. A.; Herrero, V.; Johnston, S.; Labarga, L.; Laing, A.; Lebrun, P.; Liubarsky, I.; López-March, N.; Losada, M.; Martín-Albo, J.; Martínez-Lema, G.; Martínez, A.; Monrabal, F.; Monteiro, C. M. B.; Mora, F. J.; Moutinho, L. M.; Muñoz Vidal, J.; Musti, M.; Nebot-Guinot, M.; Novella, P.; Palmeiro, B.; Para, A.; Pérez, J.; Querol, M.; Repond, J.; Renner, J.; Riordan, S.; Ripoll, L.; Rodríguez, J.; Rogers, L.; Santos, F. P.; dos Santos, J. M. F.; Simón, A.; Sofka, C.; Sorel, M.; Stiegler, T.; Toledo, J. F.; Torrent, J.; Tsamalaidze, Z.; Veloso, J. F. C. A.; Webb, R.; White, J. T.; Yahlali, N.

    2018-03-01

    A new method to tag the barium daughter in the double beta decay of $^{136}$Xe is reported. Using the technique of single molecule fluorescent imaging (SMFI), individual barium dication (Ba$^{++}$) resolution at a transparent scanning surface has been demonstrated. A single-step photo-bleach confirms the single ion interpretation. Individual ions are localized with super-resolution ($\\sim$2~nm), and detected with a statistical significance of 12.9~$\\sigma$ over backgrounds. This lays the foundation for a new and potentially background-free neutrinoless double beta decay technology, based on SMFI coupled to high pressure xenon gas time projection chambers.

  19. Neutrinoless double-beta decay and dark matter search with GENIUS

    International Nuclear Information System (INIS)

    Klapdor-Kleingrothaus, H.V.; Kolb, S.

    2000-01-01

    The potential of the GENIUS (GErmanium in liquid NItrogen Underground Setup) experiment, proposed the successor of the Heidelberg-Moscow experiment, for the search for neutrinoless double-beta decay, the direct search for neutralino Cold Dark Matter and for other physics beyond the Standard Model are presented. The current status of the Heidelberg-Moscow experiment will be reviewed [ru

  20. Neutrinoless double-beta decay and dark matter search with GENIUS

    International Nuclear Information System (INIS)

    Klapdor-Kleingrothaus, H.V.; Kolb, St.

    2000-01-01

    The potential of the GENIUS (GErmanium in liquid NItrogen Underground Setup) experiment, proposed as the successor of the Heidelberg-Moscow experiment, for the search for neutrinoless double-beta decay, the direct search for neutralino Cold Dark Matter, and for other physics beyond the Standard Model will be presented. The current status of the Heidelberg-Moscow experiment will be reviewed

  1. The 76Ge Program to Search for Neutrinoless Double-Beta Decay

    Science.gov (United States)

    Guiseppe, Vincente

    2017-09-01

    Neutrinoless double-beta decay searches play a major role in determining the nature of neutrinos, the existence of a lepton violating process, and the effective Majorana neutrino mass. The Majorana and Gerda Collaborations are operating arrays of high purity Ge detectors to search for neutrinoless double-beta decay in 76Ge. The Majorana Demonstrator is operating at the Sanford Underground Research Facility in South Dakota while the Gerda experiment is operating at LNGS in Italy. The Gerda and Majorana Demonstrator experiments have achieved the lowest backgrounds in the neutrinoless double-beta decay region of interest. These results, coupled with the superior energy resolution (0.1%) of Ge detectors demonstrate that 76Ge is an ideal isotope for a large next generation experiment. The LEGEND collaboration, with 220 members from 47 institutions around the world, has been formed to pursue a ton scale 76Ge experiment. Building on the successes of Gerda and Majorana, the LEGEND collaboration aims to develop a phased neutrinoless double-beta decay experimental program with discovery potential at a half-life significantly longer than 1027 years. This talk will present the initial results from the Majorana Demonstrator and Gerda experiments and the plan for the LEGEND program.

  2. Neutrinoless double beta decay in type I+II seesaw models

    Energy Technology Data Exchange (ETDEWEB)

    Borah, Debasish [Department of Physics, Tezpur University,Tezpur-784028 (India); Dasgupta, Arnab [Institute of Physics, Sachivalaya Marg,Bhubaneshwar-751005 (India)

    2015-11-30

    We study neutrinoless double beta decay in left-right symmetric extension of the standard model with type I and type II seesaw origin of neutrino masses. Due to the enhanced gauge symmetry as well as extended scalar sector, there are several new physics sources of neutrinoless double beta decay in this model. Ignoring the left-right gauge boson mixing and heavy-light neutrino mixing, we first compute the contributions to neutrinoless double beta decay for type I and type II dominant seesaw separately and compare with the standard light neutrino contributions. We then repeat the exercise by considering the presence of both type I and type II seesaw, having non-negligible contributions to light neutrino masses and show the difference in results from individual seesaw cases. Assuming the new gauge bosons and scalars to be around a TeV, we constrain different parameters of the model including both heavy and light neutrino masses from the requirement of keeping the new physics contribution to neutrinoless double beta decay amplitude below the upper limit set by the GERDA experiment and also satisfying bounds from lepton flavor violation, cosmology and colliders.

  3. Status of the Frejus experiment on the neutrinoless double beta decay of the 76Ge

    International Nuclear Information System (INIS)

    Morales, A.; Nunez-Lagos, R.; Morales, J.; Puimedon, J.; Villar, J.A.; Dassie, D.; Hubbert, Ph.; Leccia, F.; Mennrath, P.; Villard, M.

    1987-01-01

    A brief account of the design, experimental set up and status of the Frejus experiments on the neutrinoless double beta decay of 76 Ge is presented. The theoretical implications and expectatives of this experimental research are analized. A comparison with other dedicated experiments is also reported. (author)

  4. Internal Energy Loss of the Electrons Ejected in Neutrinoless Double Beta Decay

    International Nuclear Information System (INIS)

    Drukarev, E. G.; Amusia, M. Ya.; Chernysheva, L. V.

    2017-01-01

    The excitations of the electron shell in neutrinoless double beta decay shifts the limiting energy available for ejected electrons. We present the general equations for this shift and make computations for the decays of two nuclei—germanium and xenon. (author)

  5. The next enriched xenon observatory. A search for neutrinoless double beta decay

    Energy Technology Data Exchange (ETDEWEB)

    Bayerlein, Reimund; Hufschmidt, Patrick; Jamil, Ako; Schneider, Judith; Wagenpfeil, Michael; Wrede, Gerrit; Ziegler, Tobias; Hoessl, Juergen; Anton, Gisela; Michel, Thilo [ECAP, Friedrich-Alexander-Universitaet Erlangen-Nuernberg (Germany)

    2016-07-01

    The question whether the neutrino could be its own antiparticle is still not answered. The most practical way to test this is the search for the neutrinoless double beta decay. The half-life of this decay is related to the value of a linear combination of the masses of the neutrino mass eigenstates and therefore provides information about the absolute mass scale of neutrinos. The nEXO experiment - the successor of EXO200 - is currently under research and development. The baseline concept comprises a single-phase liquid xenon (LXe) time projection chamber (TPC) filled with about 5 tons of liquid xenon enriched to about 80% Xe-136 as the double beta decay nuclide. In order to fully cover the range of the effective Majorana neutrino mass in the inverted hierarchy scheme, excellent energy resolution is required. Therefore, a position-resolving, low-noise charge readout and very efficient light collection and detection are mandatory. For the purpose of very low background levels radiopure Silicon Photomultipliers (SiPMs) have to be used to detect the scintillation light of LXe. Due to the large half-life a huge detector mass and long term measurement are needed. In this talk the baseline-concept of the experimental setup is presented.

  6. Search for 136Xe neutrinoless double beta decay with the Enriched Xenon Observatory (EXO)

    International Nuclear Information System (INIS)

    Giroux, G.

    2014-01-01

    The EXO collaboration is searching for the neutrinoless double beta decay of 136 Xe. Such observation would determine an absolute mass scale for the neutrinos, establish their Majorana nature, and uncover physics beyond the Standard Model. The EXO-200 detector is a single phase liquid xenon ultra low background TPC (Time Projection Chamber), with an active mass of 110 kg of 80.6% enriched xenon in the isotope 136. The detector is currently operating at the WIPP site and has been collecting data with enriched xenon since May 2011. The data collected give a lower limit for the neutrinoless double beta decay half-life of 136 Xe: T > 1.6*10 25 years at 90% C.L. The same data give a lower limit for the 2 neutrinos double beta decay of 136 Xe: T > 2.23*10 21 years that agrees with experimental values found in the literature

  7. Background constrains of the SuperNEMO experiment for neutrinoless double beta-decay searches

    Energy Technology Data Exchange (ETDEWEB)

    Povinec, Pavel P.

    2017-02-11

    The SuperNEMO experiment is a new generation of experiments dedicated to the search for neutrinoless double beta-decay, which if observed, would confirm the existence of physics beyond the Standard Model. It is based on the tracking and calorimetry techniques, which allow the reconstruction of the final state topology, including timing and kinematics of the double beta-decay transition events, offering a powerful tool for background rejection. While the basic detection strategy of the SuperNEMO detector remains the same as of the NEMO-3 detector, a number of improvements were accomplished for each of detector main components. Upgrades of the detector technologies and development of low-level counting techniques ensure radiopurity control of construction parts of the SuperNEMO detector. A reference material made of glass pellets has been developed to assure quality management and quality control of radiopurity measurements. The first module of the SuperNEMO detector (Demonstrator) is currently under construction in the Modane underground laboratory. No background event is expected in the neutrinoless double beta-decay region in 2.5 years of its operation using 7 kg of {sup 82}Se. The half-life sensitivity of the Demonstrator is expected to be >6.5·10{sup 24} y, corresponding to an effective Majorana neutrino mass sensitivity of |0.2−0.4| eV (90% C.L.). The full SuperNEMO experiment comprising of 20 modules with 100 kg of {sup 82}Se source should reach an effective Majorana neutrino mass sensitivity of |0.04−0.1| eV, and a half-life limit 1·10{sup 26} y. - Highlights: • SuperNEMO detector for 2β0ν-decay of {sup 82}Se should reach half-life limit of 10{sup 26} y. • Radiopurity of the SuperNEMO internal detector parts was checked down to 0.1 mBq/kg. • Reference material of glass pellets was developed for underground γ-spectrometry.

  8. Neutrinoless Double Beta Decay with CUORE-0: Physics Results and Detector Performance

    Science.gov (United States)

    Canonica, L.

    2016-08-01

    The CUORE-0 experiment searches for neutrinoless double beta decay in ^{130}Te. It consists of an array of 52 tellurium dioxide crystals, operated as bolometers at a temperature of 10 mK, with a total mass of about 39 kg of TeO_2. CUORE-0 has been built to test the performance of the upcoming CUORE experiment and represents the largest ^{130}Te bolometric setup currently in operation. This experiment has been running in the Gran Sasso National Laboratory, Italy, since March 2013. We report the results of a search for neutrinoless double beta decay in 9.8 kg years ^{130}Te exposure, which allowed us to set the most stringent limit to date on this half-life. The performance of the detector in terms of background rate and energy resolution are also reported.

  9. Hamiltonian Markov Chain Monte Carlo Methods for the CUORE Neutrinoless Double Beta Decay Sensitivity

    Science.gov (United States)

    Graham, Eleanor; Cuore Collaboration

    2017-09-01

    The CUORE experiment is a large-scale bolometric detector seeking to observe the never-before-seen process of neutrinoless double beta decay. Predictions for CUORE's sensitivity to neutrinoless double beta decay allow for an understanding of the half-life ranges that the detector can probe, and also to evaluate the relative importance of different detector parameters. Currently, CUORE uses a Bayesian analysis based in BAT, which uses Metropolis-Hastings Markov Chain Monte Carlo, for its sensitivity studies. My work evaluates the viability and potential improvements of switching the Bayesian analysis to Hamiltonian Monte Carlo, realized through the program Stan and its Morpho interface. I demonstrate that the BAT study can be successfully recreated in Stan, and perform a detailed comparison between the results and computation times of the two methods.

  10. Signal and background studies for the search of neutrinoless double beta decay in GERDA

    International Nuclear Information System (INIS)

    Agostini, Matteo

    2013-01-01

    The GERDA experiment searches for the neutrinoless double beta decay in Ge-76, by operating bare HPGe detectors in ultra-pure liquid Ar. This dissertation presents a first decomposition of the background measured in the current data-taking phase. The background at the energy of interest was found to be dominated by 214 Bi, 208 Tl and 42 K gamma-rays, with secondary contributions from 42 K and 214 Bi beta-rays, and 210 Po alpha-rays. For the forthcoming upgrade of the apparatus, a new HPGe detector design (BEGe) has been studied, with focus on its capability of suppressing the identified backgrounds through pulse shape analysis. This included the development of a comprehensive modeling of the detectors and the experimental characterization of their response to surface interactions. The achieved results show that GERDA can improve the present limit on the neutrinoless double beta decay half-life by an order of magnitude.

  11. Neutrinoless double beta decay in an SU(3)L x U(1)N model

    International Nuclear Information System (INIS)

    Pleitez, V.; Tonasse, M.D.

    1993-01-01

    A model for the electroweak interactions with SU (3) L x U(1) N gauge symmetry is considered. It is shown that, it is the conservation of F = L + B which forbids massive neutrinos and the neutrinoless double beta decay, (β β) On u. Explicit and spontaneous breaking of F imply that the neutrinos have an arbitrary mass and (β β) On u proceeds also with some contributions that do not depend explicitly on the neutrino mass. (author)

  12. Combining and comparing neutrinoless double beta decay experiments using different nuclei

    Science.gov (United States)

    Bergström, Johannes

    2013-02-01

    We perform a global fit of the most relevant neutrinoless double beta decay experiments within the standard model with massive Majorana neutrinos. Using Bayesian inference makes it possible to take into account the theoretical uncertainties on the nuclear matrix elements in a fully consistent way. First, we analyze the data used to claim the observation of neutrinoless double beta decay in 76Ge, and find strong evidence (according to Jeffrey's scale) for a peak in the spectrum and moderate evidence for that the peak is actually close to the energy expected for the neutrinoless decay. We also find a significantly larger statistical error than the original analysis, which we include in the comparison with other data. Then, we statistically test the consistency between this claim with that of recent measurements using 136Xe. We find that the two data sets are about 40 to 80 times more probable under the assumption that they are inconsistent, depending on the nuclear matrix element uncertainties and the prior on the smallest neutrino mass. Hence, there is moderate to strong evidence of incompatibility, and for equal prior probabilities the posterior probability of compatibility is between 1.3% and 2.5%. If one, despite such evidence for incompatibility, combines the two data sets, we find that the total evidence of neutrinoless double beta decay is negligible. If one ignores the claim, there is weak evidence against the existence of the decay. We also perform approximate frequentist tests of compatibility for fixed ratios of the nuclear matrix elements, as well as of the no signal hypothesis. Generalization to other sets of experiments as well as other mechanisms mediating the decay is possible.

  13. MAJORANA Neutrinoless Double-Beta Decay DUSEL R and D. Final report

    International Nuclear Information System (INIS)

    Wilkerson, John F.

    2009-01-01

    The Majorana research and development is addressing key issues and risks related to the collaboration's goal of undertaking a search for neutrinoless double-beta decay (0νββ) in 76 Ge using an array of hyper-pure Ge-diodes (HPGe). The observation of this decay would provide critical insight into our understanding of neutrinos, yielding definitive evidence that neutrinos are Majorana particles and providing information on the absolute mass of neutrinos. Achieving sensitivities to 0νββ decay half-lives on the order of 10 26 years requires ultra-low backgrounds in the 2039 keV region where a 0νββ decay peak would be observed. The goal of our R and D program has been to demonstrate the feasibility of all components of Majorana and to provide an integrated evaluation framework, allowing for optimization of these components in terms of background, background suppression, and signal detection efficiency and acceptance. This report covers work carried out by Majorana collaboration members at the University of Washington as part of the overall Majorana collaboration activities. Specifically the Majorana group at the University of Washington was involved in moving forward on demonstrating technology for clean large-scale cryostats and mounting the HPGe crystals in low-mass holders. The UW activities included assistance in the procurement and assembly of an electroforming system for large size cryostats, and design and fabrication of prototype crystal mounting hardware.

  14. Results on Neutrinoless Double-Beta Decay from Gerda Phase I

    Science.gov (United States)

    Macolino, Carla

    2014-12-01

    The GERmanium Detector Array, GERDA, is designed to search for neutrinoless double-beta (0νββ) decay of 76Ge and it is installed in the Laboratori Nazionali del Gran Sasso (LNGS) of INFN, Italy. In this review, the detection principle and detector setup of GERDA are described. Also, the main physics results by GERDA Phase I, are discussed. They include the measurement of the half-life of 2νββ decay, the background decomposition of the energy spectrum and the techniques for the discrimination of the background, based on the pulse shape of the signal. In the last part of this review, the estimation of a limit on the half-life of 0νββ (T0ν 1/2>2.1ḑot 1025 yr at 90% C.L.) and the comparison with previous results are discussed. GERDA data from Phase I strongly disfavor the recent claim of 0νββ discovery, based on data from the Heidelberg-Moscow experiment.

  15. The contribution of light Majorana neutrinos to neutrinoless double beta decay and cosmology

    Energy Technology Data Exchange (ETDEWEB)

    Dell’Oro, S.; Marcocci, S. [INFN, Gran Sasso Science Institute,Viale F. Crispi 7, 67100 L’Aquila (Italy); Viel, M. [INAF, Osservatorio Astronomico di Trieste,Via G.B. Tiepolo 11, 34131 Trieste (Italy); INFN, Sezione di Trieste,Via Valerio 2, 34127 Trieste (Italy); Vissani, F. [INFN, Laboratori Nazionali del Gran Sasso,Via G. Acitelli 22, 67100 Assergi (AQ) (Italy); INFN, Gran Sasso Science Institute,Viale F. Crispi 7, 67100 L’Aquila (Italy)

    2015-12-11

    Cosmology is making impressive progress and it is producing stringent bounds on the sum of the neutrino masses Σ, a parameter of great importance for the current laboratory experiments. In this letter, we exploit the potential relevance of the analysis of Palanque-Delabrouille et al. to the neutrinoless double beta decay (0νββ) search. This analysis indicates small values for the lightest neutrino mass, since the authors find Σ<84 meV at 1σ C.L., and provides a 1σ preference for the normal hierarchy. The allowed values for the Majorana effective mass, probed by 0νββ, turn out to be <75 meV at 3σ C.L. and lower down to less than 20 meV at 1σ C.L. . If this indication is confirmed, the impact on the 0νββ experiments will be tremendous since the possibility of detecting a signal will be out of the reach of the next generation of experiments.

  16. LUCIFER: a scintillating bolometer array for the search of neutrinoless double beta decay

    International Nuclear Information System (INIS)

    Cardani, Laura

    2011-01-01

    In spite of the high precision achieved in the field of neutrino oscillations, there are some fundamental questions that can not be addressed by a study of ths phenomenon. We do not know in fact the absolute mass of neutrino and weather it is a Dirac or a Majorana particle. The LUCIFER experiment, financed by the ERC-AdG, will play an important role in this field. This project aims to push beyond the actual technological limits the possibility of observation of the Neutrinoless Double Beta Decay (0νDBD). The detection of this extremely rare decay would indeed demonstrate that neutrino is a Majorana particle and, at the same time, would allow to set its absolute mass scale. LUCIFER will study the 0νDBD do 82 Se through ZnSe scintillating bolometers. Thanks to the simultaneous red-out of the heat and light produced by an interaction in the crystal, the background rate in the region of interest will be lower than 10 -3 counts/kg/keV/years. In the following, the expected performance of LUCIFER are discussed.

  17. The NUMEN project: NUclear Matrix Elements for Neutrinoless double beta decay

    Science.gov (United States)

    Cappuzzello, F.; Agodi, C.; Cavallaro, M.; Carbone, D.; Tudisco, S.; Lo Presti, D.; Oliveira, J. R. B.; Finocchiaro, P.; Colonna, M.; Rifuggiato, D.; Calabretta, L.; Calvo, D.; Pandola, L.; Acosta, L.; Auerbach, N.; Bellone, J.; Bijker, R.; Bonanno, D.; Bongiovanni, D.; Borello-Lewin, T.; Boztosun, I.; Brunasso, O.; Burrello, S.; Calabrese, S.; Calanna, A.; Chávez Lomelí, E. R.; D'Agostino, G.; De Faria, P. N.; De Geronimo, G.; Delaunay, F.; Deshmukh, N.; Ferreira, J. L.; Fisichella, M.; Foti, A.; Gallo, G.; Garcia-Tecocoatzi, H.; Greco, V.; Hacisalihoglu, A.; Iazzi, F.; Introzzi, R.; Lanzalone, G.; Lay, J. A.; La Via, F.; Lenske, H.; Linares, R.; Litrico, G.; Longhitano, F.; Lubian, J.; Medina, N. H.; Mendes, D. R.; Moralles, M.; Muoio, A.; Pakou, A.; Petrascu, H.; Pinna, F.; Reito, S.; Russo, A. D.; Russo, G.; Santagati, G.; Santopinto, E.; Santos, R. B. B.; Sgouros, O.; da Silveira, M. A. G.; Solakci, S. O.; Souliotis, G.; Soukeras, V.; Spatafora, A.; Torresi, D.; Magana Vsevolodovna, R.; Yildirim, A.; Zagatto, V. A. B.

    2018-05-01

    The article describes the main achievements of the NUMEN project together with an updated and detailed overview of the related R&D activities and theoretical developments. NUMEN proposes an innovative technique to access the nuclear matrix elements entering the expression of the lifetime of the double beta decay by cross section measurements of heavy-ion induced Double Charge Exchange (DCE) reactions. Despite the fact that the two processes, namely neutrinoless double beta decay and DCE reactions, are triggered by the weak and strong interaction respectively, important analogies are suggested. The basic point is the coincidence of the initial and final state many-body wave functions in the two types of processes and the formal similarity of the transition operators. First experimental results obtained at the INFN-LNS laboratory for the 40Ca(18O,18Ne)40Ar reaction at 270MeV give an encouraging indication on the capability of the proposed technique to access relevant quantitative information. The main experimental tools for this project are the K800 Superconducting Cyclotron and MAGNEX spectrometer. The former is used for the acceleration of the required high resolution and low emittance heavy-ion beams and the latter is the large acceptance magnetic spectrometer for the detection of the ejectiles. The use of the high-order trajectory reconstruction technique, implemented in MAGNEX, allows to reach the experimental resolution and sensitivity required for the accurate measurement of the DCE cross sections at forward angles. However, the tiny values of such cross sections and the resolution requirements demand beam intensities much larger than those manageable with the present facility. The on-going upgrade of the INFN-LNS facilities in this perspective is part of the NUMEN project and will be discussed in the article.

  18. Present and future strategies for neutrinoless double beta decay ...

    Indian Academy of Sciences (India)

    doubled exposure, with signal shape analysis to discard Compton events, a heavy ... sonable amount to put stringent (and competitive) limits on 0νDBD. ..... with an impressive reduced electronic noise and an almost eliminated risk of de-.

  19. Results on neutrinoless double beta decay from GERDA phase I

    CERN Multimedia

    CERN. Geneva

    2013-01-01

    After motivating searches of double beta decay and lepton number violation details about the construction, operation and analysis of GERDA will be given. Results of the recently completed phase I of data taking will then be presented and interpreted. Finally an outlook on future plans will be given.

  20. Rearrangement of valence neutrons in the neutrinoless double-β decay of 136Xe

    Science.gov (United States)

    Szwec, S. V.; Kay, B. P.; Cocolios, T. E.; Entwisle, J. P.; Freeman, S. J.; Gaffney, L. P.; Guimarães, V.; Hammache, F.; McKee, P. P.; Parr, E.; Portail, C.; Schiffer, J. P.; de Séréville, N.; Sharp, D. K.; Smith, J. F.; Stefan, I.

    2016-11-01

    A quantitative description of the change in ground-state neutron occupancies between 136Xe and 136Ba, the initial and final state in the neutrinoless double-β decay of 136Xe, has been extracted from precision measurements of the cross sections of single-neutron-adding and -removing reactions. Comparisons are made to recent theoretical calculations of the same properties using various nuclear-structure models. These are the same calculations used to determine the magnitude of the nuclear matrix elements for the process, which at present disagree with each other by factors of 2 or 3. The experimental neutron occupancies show some disagreement with the theoretical calculations.

  1. Results on neutrinoless double beta decay of 76Ge from GERDA Phase I

    International Nuclear Information System (INIS)

    Palioselitis, Dimitrios

    2015-01-01

    The Germanium Detector Array (GERDA) experiment is searching for the neutrinoless double beta (0νββ) decay of 76 Ge by operating bare germanium diodes in liquid argon. GERDA is located at the Gran Sasso National Laboratory (LNGS) in Italy. During Phase I, a total exposure of 21.6 kg yrand a background index of 0.01 cts/(keVkg yr) were reached. No signal was observed and a lower limit of T 0ν 1/2 > 2.1 · 10 25 yr(90% C.L.) is derived for the half life of the 0νββ decay of 76 Ge. (paper)

  2. Results on neutrinoless double beta decay of 76Ge from GERDA Phase I

    Science.gov (United States)

    Palioselitis, Dimitrios; GERDA Collaboration

    2015-05-01

    The Germanium Detector Array (GERDA) experiment is searching for the neutrinoless double beta (0νββ) decay of 76Ge by operating bare germanium diodes in liquid argon. GERDA is located at the Gran Sasso National Laboratory (LNGS) in Italy. During Phase I, a total exposure of 21.6 kg yrand a background index of 0.01 cts/(keVkg yr) were reached. No signal was observed and a lower limit of T0ν1/2 > 2.1 · 1025 yr(90% C.L.) is derived for the half life of the 0νββ decay of 76Ge.

  3. Limit on Neutrinoless Double Beta Decay of 76Ge by GERDA

    Science.gov (United States)

    Agostini, M.; Allardt, M.; Andreotti, E.; Bakalyarov, A. M.; Balata, M.; Barabanov, I.; Heider, M. Barabè; Barros, N.; Baudis, L.; Bauer, C.; Becerici-Schmidt, N.; Bellotti, E.; Belogurov, S.; Belyaev, S. T.; Benato, G.; Bettini, A.; Bezrukov, L.; Bode, T.; Brudanin, V.; Brugnera, R.; Budjáš, D.; Caldwell, A.; Cattadori, C.; Chernogorov, A.; Cossavella, F.; Demidova, E. V.; Domula, A.; Egorov, V.; Falkenstein, R.; Ferella, A.; Freund, K.; Frodyma, N.; Gangapshev, A.; Garfagnini, A.; Gotti, C.; Grabmayr, P.; Gurentsov, V.; Gusev, K.; Guthikonda, K. K.; Hampel, W.; Hegai, A.; Heisel, M.; Hemmer, S.; Heusser, G.; Hofmann, W.; Hult, M.; Inzhechik, L. V.; Csáthy, J. Janicskó; Jochum, J.; Junker, M.; Kihm, T.; Kirpichnikov, I. V.; Kirsch, A.; Klimenko, A.; Knöpfle, K. T.; Kochetov, O.; Kornoukhov, V. N.; Kuzminov, V. V.; Laubenstein, M.; Lazzaro, A.; Lebedev, V. I.; Lehnert, B.; Liao, H. Y.; Lindner, M.; Lippi, I.; Lubashevskiy, A.; Lubsandorzhiev, B.; Lutter, G.; Machado, A. A.; Macolino, C.; Majorovits, B.; Maneschg, W.; Misiaszek, M.; Nemchenok, I.; Nisi, S.; Shaughnessy, C. O.'.; Pandola, L.; Pelczar, K.; Pessina, G.; Pullia, A.; Riboldi, S.; Rumyantseva, N.; Sada, C.; Salathe, M.; Schmitt, C.; Schreiner, J.; Schulz, O.; Schwingenheuer, B.; Schönert, S.; Shevchik, E.; Shirchenko, M.; Simgen, H.; Smolnikov, A.; Stanco, L.; Strecker, H.; Tarka, M.; Ur, C. A.; Vasenko, A. A.; Volynets, O.; von Sturm, K.; Wagner, V.; Walter, M.; Wegmann, A.; Wester, T.; Wojcik, M.; Yanovich, E.; Zavarise, P.; Zhitnikov, I.; Zhukov, S. V.; Zinatulina, D.; Zuber, K.; Zuzel, G.

    The Gerda experiment at the Laboratori Nazionali del Gran Sasso in Italy uses germanium detectors made from material with an enriched 76Ge isotope fraction to search for neutrinoless double beta decay of this nucleus. Applying a blind analysis we find no signal after an exposure of 21.6 kg·yr and a background of about 0.01 cts/(keV·kg·yr). A half-life limit of Tov1/2> 2.1 · 1025 yr (90% C.L.) is extracted. The previous claim of a signal for 76Ge is excluded with 99% probability in a model independent way.

  4. Neutrinoless double-beta decay search with CUORE and CUORE-0 experiments

    Directory of Open Access Journals (Sweden)

    Moggi N.

    2015-01-01

    Full Text Available The Cryogenic Underground Observatory for Rare Events (CUORE is an upcoming experiment designed to search for the neutrinoless double-beta decays. Observation of the process would unambiguously establish that neutrinos are Majorana particles and provide information on their absolute mass scale hierarchy. CUORE is now under construction and will consist of an array of 988 TeO2 crystal bolometers operated at 10 mK, but the first tower (CUORE-0 is already taking data. The experimental techniques used will be presented as well as the preliminary CUORE-0 results. The current status of the full-mass experiment and its expected sensitivity will then be discussed.

  5. Monte Carlo Simulation for the Majorana Neutrinoless Double-beta Decay Experiment

    International Nuclear Information System (INIS)

    Henning, Reyco; Majorana Collaboration

    2005-01-01

    The Majorana experiment is a proposed HPGe detector array that will primarily search for neutrinoless double-beta decay and dark matter. It will rely on pulse-shape discrimination and crystal segmentation to suppress backgrounds following careful materials selection. A critical aspect of the design phase of Majorana is a reliable simulation of the detector response, pulse formation, and its radioactive backgrounds. We are developing an adaptable and complete simulation based on GEANT 4 to address these requirements and the requirements of a modern, large collaboration experiment. The salient aspects of the simulation are presented. The Majorana experiment is presented in a parallel poster by Kareem Kazkaz

  6. Neutrinoless double beta decay search for 130Te: cuoricino status and cuore prospects

    International Nuclear Information System (INIS)

    Sangiorgio, S.; Artusa, D.R.; And others

    2006-01-01

    CUORE is a ∼ I-ton experiment to search for Neutrinoless Double Beta Decay of 130 Te using 988 TeO 2 bolometers. It aims at reaching a sensitivity of the order of few tens of MeV on the effective neutrino mass. CUORICINO, a single CUORE tower running since 2003 in the Gran Sasso Underground Laboratory (LNGS), plays an important role as a standing alone experiment and for developing the future CUORE setup. Present results already achieved and studies that are underway are presented and discussed

  7. Neutrinoless double electron capture decay of 54-Fe

    International Nuclear Information System (INIS)

    Bikit, I; Krmar, M.; Slivka, J.; Anicin, I.; Veskovic, M.; Convie, L.

    1994-01-01

    Double electron capture is the only decay mode of 54-Fe to 54-Cr. The most probable KK capture in the 0 nu case would lead to an otherwise not populated excited state of 54-Cr with the energy of 668 + - KeV. This process has not been yet investigated, probably because the lacking theoretical arguments on the nature of the excited state which could favour the decay. On the other hand if we suppose that gamma transition from this state to the ground state is allowed the 668 KeV gamma ray would be a definite signature of the process. Having in mind the relatively large abundance of 54-Fe in natural iron, a large quantity of iron in some shields in low level gamma spectroscopy systems and the low and flat background in the 668 keV spectral region, we easily estimate that the sensitivity for measuring the half life of this process is quit high. With our equipment consisting of a 25% efficiency commercial HP Ge spectrometer, placed in a cubic shaped iron shield with wall thickness of 25 cm from the background spectrum measured for only 100 days we calculated the lower limit for the half life of the 0 nu EC.EC decay of 54-Fe on the 68% confidence level to be T > 3.1 *10 sup 2 sup 2 years. 2 figs., 5 refs. (author)

  8. Sensitivity and Discovery Potential of CUORE to Neutrinoless Double-Beta Decay

    Energy Technology Data Exchange (ETDEWEB)

    Alessandria, F; Ardito, R; Artusa, DR; III, FTA; Azzolini, O; Balata, M; Banks, TI; Bari, G; Beeman, J; Bellini, F; Bersani, A; Biassoni, M; Bloxham, T; Brofferio, C; Bucci, C; Cai, XZ; Canonica, L; Cao, X; Capelli, S; Carbone, L; Cardani, L; Carrettoni, M; Casali, N; Chiesa, D; Chott, N; Clemenza, M; Cosmelli, C; Cremonesi, O; Creswick, RJ; Dafinei, I; Dally, A; Datskov, V; Biasi, AD; Deninno, MM; Domizio, SD; Vacri, MLD; Ejzak, L; Faccini, R; Fang, DQ; Farach, HA; Faverzani, M; Fernandes, G; Ferri, E; Ferroni, F; Fiorini, E; Franceschi, MA; Freedman, SJ; Fujikawa, BK; Giachero, A; Gironi, L; Giuliani, A; Goett, J; Gorla, P; Gotti, C; Guardincerri, E; Gutierrez, TD; Haller, EE; Han, K; Heeger, KM; Huang, HZ; Kadel, R; Kazkaz, K; Keppel, G; Kogler, L; Kolomensky, YG; Lenz, D; Li, YL; Ligi, C; Liu, X; Ma, YG; Maiano, C; Maino, M; Martinez, M; Maruyama, RH; Mei, Y; Moggi, N; Morganti, S; Napolitano, T; Newman, S; Nisi, S; Nones, C; Norman, EB; Nucciotti, A; O' Donnell, T; Orio, F; Orlandi, D; Ouellet, JL; Pallavicini, M; Palmieri, V; Pattavina, L; Pavan, M; Pedretti, M; Pessina, G; Piperno, G; Pirro, S; Previtali, E; Rampazzo, V; Rimondi, F; Rosenfeld, C; Rusconi, C; Sala, E; Sangiorgio, S; Scielzo, ND; Sisti, M; Smith, AR; Stivanello, F; Taffarello, L; Tenconi, M; Tian, WD; Tomei, C; Trentalange, S; Ventura, G; Vignati, M; Wang, BS; Wang, HW; Wise, T; Woodcraft, A; Zanotti, L; Zarra, C; Zhu, BX; Zucchelli, S

    2017-07-06

    We present a study of the sensitivity and discovery potential of CUORE, a bolometric double-beta decay experiment under construction at the Laboratori Nazionali del Gran Sasso in Italy. Two approaches to the computation of experimental sensitivity for various background scenarios are presented, and an extension of the sensitivity formulation to the discovery potential case is also discussed. Assuming a background rate of 10-2 cts/(keV kg y), we find that, after 5 years of live time, CUORE has a 1 sigma sensitivity to the neutrinoless double-beta decay half-life of T$0v\\atop{1/2}$(1θ) = 1.6 \\times 1026 y and thus a potential to probe the effective Majorana neutrino mass down to 40-100 meV; the sensitivity at 1.64 sigma, which corresponds to 90% C.L., will be T$0v\\atop{1/2}$(1.64θ) = 9.5 \\times 1025 y. This range is compared with the claim of observation of neutrinoless double-beta decay in 76Ge and the preferred range of the neutrino mass parameter space from oscillation results.

  9. The LUCIFER/CUPID-0 demonstrator: searching for the neutrinoless double-beta decay with Zn82Se scintillating bolometers

    Science.gov (United States)

    Artusa, D. R.; Balzoni, A.; Beeman, J. W.; Bellini, F.; Biassoni, M.; Brofferio, C.; Camacho, A.; Capelli, S.; Cardani, L.; Carniti, P.; Casali, N.; Cassina, L.; Clemenza, M.; Cremonesi, O.; Cruciani, A.; D'Addabbo, A.; Dafinei, I.; Di Domizio, S.; di Vacri, M. L.; Ferroni, F.; Gironi, L.; Giuliani, A.; Gotti, C.; Keppel, G.; Maino, M.; Mancuso, M.; Martinez, M.; Morganti, S.; Nagorny, S. S.; Nastasi, M.; Nisi, S.; Nones, C.; Orlandi, D.; Pagnanini, L.; Pallavicini, M.; Palmieri, V.; Pattavina, L.; Pavan, M.; Pessina, G.; Pettinacci, V.; Pirro, S.; Pozzi, S.; Previtali, E.; Puiu, A.; Rusconi, C.; Schäffner, K.; Tomei, C.; Vignati, M.; Zolotarova, A.

    2017-09-01

    Future experiments on neutrinoless double beta-decay with the aim of exploring the inverted hierarchy region have to employ detectors with excellent energy resolution and zero background in the energy region of interest. Cryogenic scintillating bolometers turn out to be a suitable candidate since they offer particle discrimination: the dual channel detection of the heat and the scintillation light signal allows for particle identification. In particular such detectors permit for a suppression of α-induced backgrounds, a key-issue for next-generation tonne-scale bolometric experiments. We report on the progress and current status of the LUCIFER/CUPID-0 demonstrator, the first array of scintillating bolometers based on enriched Zn82Se crystals which is expected to start data taking in 2016 and the potential of this detection technique for a future tonne-scale bolometric experiment after CUORE.

  10. Neutrino-Less Double Beta Decay - Experimentum Crucis of Neutrino Physics

    International Nuclear Information System (INIS)

    Sujkowski, Z.

    2003-01-01

    The presently most wanted information on neutrino properties concerns their mass values and their transformation properties under charge conjugation. The recent oscillation experiments prove that at least one of the three neutrino species has a non-vanishing rest mass and that the lepton flavour is not conserved. These findings have to be supplemented by data from phenomena of different kind in order to deduce the information needed. The most promising method proposed thus far to determine Majorana neutrino mass and thus to answer the two leading questions is to observe the neutrino-less double beta decay and to measure its rate. The physics of this process is discussed and the on-going and planned experimental search is reviewed. This search concentrates on the 0 + →0 + ground-to-ground state decay of β - β - emitters using calorimetric or β - -β - coincidence tracking techniques. The β + β + or β + EC decays are usually considered as less favourable because of longer half-lives, even though they offer some advantages in combating the background. The recent proposition of measuring the monoenergetic photon spectra accompanying the radiative neutrino-less double electron capture decay is discussed. The experimental advantages of this technique may off-set the generally longer life-times expected. (author)

  11. Signal and background studies for the search of neutrinoless double beta decay in GERDA

    Energy Technology Data Exchange (ETDEWEB)

    Agostini, Matteo

    2013-04-24

    The GERDA experiment searches for the neutrinoless double beta decay in Ge-76, by operating bare HPGe detectors in ultra-pure liquid Ar. This dissertation presents a first decomposition of the background measured in the current data-taking phase. The background at the energy of interest was found to be dominated by {sup 214}Bi, {sup 208}Tl and {sup 42}K gamma-rays, with secondary contributions from {sup 42}K and {sup 214}Bi beta-rays, and {sup 210}Po alpha-rays. For the forthcoming upgrade of the apparatus, a new HPGe detector design (BEGe) has been studied, with focus on its capability of suppressing the identified backgrounds through pulse shape analysis. This included the development of a comprehensive modeling of the detectors and the experimental characterization of their response to surface interactions. The achieved results show that GERDA can improve the present limit on the neutrinoless double beta decay half-life by an order of magnitude.

  12. Search for neutrinoless double beta decay of Ge-76 with the GERmanium Detector Array '' GERDA ''

    International Nuclear Information System (INIS)

    Brugnera, R.

    2009-01-01

    The study of neutrinoless double beta decay (DBD) is the most powerful approach to the fundamental question if the neutrino is a Majorana particle, i.e. its own anti-particle. The observation of neutrinoless DBD would not only establish the Majorana nature of the neutrino but also represent a determination of its effective mass if the nuclear matrix element is given. So far, the most sensitive results have been obtained with Ge-76, and the group of Klapdor-Kleingrothaus has made a claim of discovery. Future experiments have to reduce radioactive backgrounds to increase the sensitivity. '' GERDA '' is a new double beta-decay experiment which is currently under construction in the INFN Gran Sasso National Laboratory, Italy. It is implementing a new shielding concept by operating bare Ge diodes - enriched in Ge-76 - in high purity liquid argon supplemented by a water shield. The aim of '' GERDA '' is to verify or refute the recent claim of discovery, and, in a second phase, to achieve a two orders of magnitude lower background index than recent experiments, increasing the sensitive mass and reaching exposure of 100 kg yr. It be will discuss design, physics reach, and status of construction of '' GERDA '', and present results from various R efforts including long term stability of bare Ge diodes in cryogenic liquids, material screening, cryostat performance, detector segmentation, cryogenic precision electronics, safety aspects, and Monte Carlo simulations. (author)

  13. GERDA and the search for neutrinoless double beta decay: first results and perspectives

    Energy Technology Data Exchange (ETDEWEB)

    Agostini, Matteo [Physik Department and Excellence Cluster Universe, Technische Universitaet Muenchen (Germany); Collaboration: GERDA-Collaboration

    2014-07-01

    Neutrinoless double beta decay is a lepton-number-violating nuclear transition predicted by several extensions of the Standard Model. The Gerda experiment searches for this transition in {sup 76}Ge by operating bare Ge detectors in liquid Ar. The talk focuses on the results of data acquired during Phase I of the experiment, in which 21.6 kg.yr of exposure were accumulated with a background index of about 0.01 cts/(keV.kg.yr). No signal was observed and a lower limit was derived for the half-life of neutrinoless double beta decay of {sup 76}Ge, T{sub 1/2} > 2.1 . 10{sup 25} yr (90% C.L.). The experiment is currently undergoing a major upgrade in preparation for the next phase of data taking. Thanks to an increased target mass, an improved energy resolution and the introduction of novel background reduction techniques, the sensitivity of Gerda will increase of about one order of magnitude in a few years of operation.

  14. The Majorana Demonstrator: A search for neutrinoless double-beta decay of germanium-76

    Science.gov (United States)

    Elliott, S. R.; Abgrall, N.; Aguayo, E.; Avignone, F. T., III; Barabash, A. S.; Bertrand, F. E.; Boswell, M.; Brudanin, V.; Busch, M.; Caldwell, A. S.; Chan, Y.-D.; Christofferson, C. D.; Combs, D. C.; Detwiler, J. A.; Doe, P. J.; Efremenko, Yu.; Egorov, V.; Ejiri, H.; Esterline, J.; Fast, J. E.; Finnerty, P.; Fraenkle, F. M.; Galindo-Uribarri, A.; Giovanetti, G. K.; Goett, J.; Green, M. P.; Gruszko, J.; Guiseppe, V. E.; Gusev, K.; Hallin, A. L.; Hazama, R.; Hegai, A.; Henning, R.; Hoppe, E. W.; Howard, S.; Howe, M. A.; Keeter, K. J.; Kidd, M. F.; Kochetov, O.; Konovalov, S. I.; Kouzes, R. T.; LaFerriere, B. D.; Leon, J.; Leviner, L. E.; Loach, J. C.; MacMullin, S.; Martin, R. D.; Mertens, S.; Mizouni, L.; Nomachi, M.; Orrell, J. L.; O'Shaughnessy, C.; Overman, N. R.; Phillips, D. G., II; Poon, A. W. P.; Pushkin, K.; Radford, D. C.; Rielage, K.; Robertson, R. G. H.; Ronquest, M. C.; Schubert, A. G.; Shanks, B.; Shima, T.; Shirchenko, M.; Snavely, K. J.; Snyder, N.; Soin, A.; Strain, J.; Suriano, A. M.; Timkin, V.; Tornow, W.; Varner, R. L.; Vasilyev, S.; Vetter, K.; Vorren, K.; White, B. R.; Wilkerson, J. F.; Xu, W.; Yakushev, E.; Young, A. R.; Yu, C.-H.; Yumatov, V.

    2013-12-01

    The Majorana collaboration is searching for neutrinoless double beta decay using 76Ge, which has been shown to have a number of advantages in terms of sensitivities and backgrounds. The observation of neutrinoless double-beta decay would show that lepton number is violated and that neutrinos are Majorana particles and would simultaneously provide information on neutrino mass. Attaining sensitivities for neutrino masses in the inverted hierarchy region, 15 - 50 meV, will require large, tonne-scale detectors with extremely low backgrounds, at the level of ˜1 count/t-y or lower in the region of the signal. The Majorana collaboration, with funding support from DOE Office of Nuclear Physics and NSF Particle Astrophysics, is constructing the Demonstrator, an array consisting of 40 kg of p-type point-contact high-purity germanium (HPGe) detectors, of which ˜30 kg will be enriched to 87% in 76Ge. The Demonstrator is being constructed in a clean room laboratory facility at the 4850' level (4300 m.w.e.) of the Sanford Underground Research Facility (SURF) in Lead, SD. It utilizes a compact graded shield approach with the inner portion consisting of ultra-clean Cu that is being electroformed and machined underground. The primary aim of the Demonstrator is to show the feasibility of a future tonne-scale measurement in terms of backgrounds and scalability.

  15. Status of the CUORE and results from the CUORE-0 neutrinoless double beta decay experiments

    Science.gov (United States)

    Sisti, M.; Artusa, D. R.; Avignone, F. T.; Azzolini, O.; Balata, M.; Banks, T. I.; Bari, G.; Beeman, J.; Bellini, F.; Bersani, A.; Biassoni, M.; Brofferio, C.; Bucci, C.; Cai, X. Z.; Camacho, A.; Caminata, A.; Canonica, L.; Cao, X. G.; Capelli, S.; Cappelli, L.; Carbone, L.; Cardani, L.; Casali, N.; Cassina, L.; Chiesa, D.; Chott, N.; Clemenza, M.; Copello, S.; Cosmelli, C.; Cremonesi, O.; Creswick, R. J.; Cushman, J. S.; Dafinei, I.; Dally, A.; Datskov, V.; Dell'Oro, S.; Deninno, M. M.; Di Domizio, S.; di Vacri, M. L.; Drobizhev, A.; Ejzak, L.; Fang, D. Q.; Farach, H. A.; Faverzani, M.; Fernandes, G.; Ferri, E.; Ferroni, F.; Fiorini, E.; Franceschi, M. A.; Freedman, S. J.; Fujikawa, B. K.; Giachero, A.; Gironi, L.; Giuliani, A.; Gorla, P.; Gotti, C.; Gutierrez, T. D.; Haller, E. E.; Han, K.; Heeger, K. M.; Hennings-Yeomans, R.; Hickerson, K. P.; Huang, H. Z.; Kadel, R.; Keppel, G.; Kolomensky, Yu. G.; Li, Y. L.; Ligi, C.; Lim, K. E.; Liu, X.; Ma, Y. G.; Maiano, C.; Maino, M.; Martinez, M.; Maruyama, R. H.; Mei, Y.; Moggi, N.; Morganti, S.; Napolitano, T.; Nastasi, M.; Nisi, S.; Nones, C.; Norman, E. B.; Nucciotti, A.; O'Donnell, T.; Orio, F.; Orlandi, D.; Ouellet, J. L.; Pagliarone, C. E.; Pallavicini, M.; Palmieri, V.; Pattavina, L.; Pavan, M.; Pedretti, M.; Pessina, G.; Pettinacci, V.; Piperno, G.; Pira, C.; Pirro, S.; Pozzi, S.; Previtali, E.; Rosenfeld, C.; Rusconi, C.; Sala, E.; Sangiorgio, S.; Scielzo, N. D.; Smith, A. R.; Taffarello, L.; Tenconi, M.; Terranova, F.; Tian, W. D.; Tomei, C.; Trentalange, S.; Ventura, G.; Vignati, M.; Wang, B. S.; Wang, H. W.; Wielgus, L.; Wilson, J.; Winslow, L. A.; Wise, T.; Woodcraft, A.; Zanotti, L.; Zarra, C.; Zhang, G. Q.; Zhu, B. X.; Zucchelli, S.

    2016-04-01

    CUORE is a 741 kg array of TeO2 bolometers for the search of neutrinoless double beta decay of 130Te. The detector is being constructed at the Laboratori Nazionali del Gran Sasso, Italy, where it will start taking data in 2015. If the target background of 0.01 counts / (keV ṡkg ṡy) will be reached, in five years of data taking CUORE will have a 1σ half life sensitivity of 1026 y. CUORE-0 is a smaller experiment constructed to test and demonstrate the performances expected for CUORE. The detector is a single tower of 52 CUORE-like bolometers that started taking data in spring 2013. The status and perspectives of CUORE will be discussed, and the first CUORE-0 data will be presented.

  16. Results on neutrinoless double beta decay of 76Ge from the GERDA experiment

    Science.gov (United States)

    Palioselitis, Dimitrios

    2015-05-01

    The Germanium Detector Array (GERDA) experiment is searching for neutrinoless double beta (0νββ) decay of 76Ge, a lepton number violating nuclear process predicted by extensions of the Standard Model. GERDA is an array of bare germanium diodes immersed in liquid argon located at the Gran Sasso National Laboratory (LNGS) in Italy. The results of the GERDA Phase I data taking with a total exposure of 21.6 kg yr and a background index of 0.01 cts/(keV kg yr) are presented in this paper. No signal was observed and a lower limit of T1/20ν > 2.1×1025 yr (90% C.L.) was derived for the half-life of the 0νββ decay of 76Ge. Phase II of the experiment aims to reduce the background around the region of interest by a factor of ten.

  17. The search for Majorana neutrinos with neutrinoless double beta decays: From CUORICINO to LUCIFER experiment

    Energy Technology Data Exchange (ETDEWEB)

    Bellini, F. [Dipartimento di Fisica, Sapienza Universita di Roma, Roma I-00185 (Italy) and INFN - Sezione di Roma, Roma I-00185 (Italy)

    2012-11-20

    The study of neutrino properties is one of the fundamental challenges in particle physics nowadays. Fifty years of investigations established that neutrinos are massive but the absolute mass scale has not yet been measured. Moreover its true nature is still unknown. Is the neutrino its own antiparticle (thus violating the lepton number) as proposed by Majorana in 1937? The only way to probe the neutrino nature is through the observation of Neutrinoless Double Beta Decay (0{nu}{beta}{beta}), a very rare spontaneous nuclear transition which emits two electrons and no neutrinos. In this paper, after a brief introduction to the theoretical framework of Majorana's neutrino, a presentation of experimental challenges posed by 0{nu}{beta}{beta} search will be given as well as an overview of present status and future perpectives of experiments.

  18. LUCIFER, a potentially background-free approach to the search for neutrinoless double beta decay

    Energy Technology Data Exchange (ETDEWEB)

    Nones, C. [Centre de Spectrometrie Nucleaire et de Spectrometrie de Masse, Bat. 108 Orsay Campus - Orsay (France)

    2011-08-15

    LUCIFER (Low-background Underground Cryogenic Installation For Elusive Rates) is a new project for the study of neutrinoless Double Beta Decay, based on the technology of scintillating bolometers. These devices promise a very efficient rejection of the alpha background, opening the way to a virtual background-free experiment if candidates with a transition energy higher than 2615 keV are investigated. The baseline candidate for LUCIFER is {sup 82}Se. This isotope will be embedded in ZnSe crystals grown with enriched selenium and operated as scintillating bolometers in a low-radioactivity underground dilution refrigerator. In this paper, the LUCIFER concept will be introduced. The sensitivity and the very promising prospects related to this project will be discussed.

  19. Neutrinoless double-beta decay in left-right symmetric models

    International Nuclear Information System (INIS)

    Picciotto, C.E.; Zahir, M.S.

    1982-06-01

    Neutrinoless double-beta decay is calculated via doubly charged Higgs, which occur naturally in left-right symmetric models. We find that the comparison with known half-lives yields values of phenomenological parameters which are compatible with earlier analyses of neutral current data. In particular, we obtain a right-handed gauge-boson mass lower bound of the order of 240 GeV. Using this result and expressions for neutrino masses derived in a parity non-conserving left-right symmetric model, we obtain msub(νsub(e)) < 1.5 eV, msub(νsub(μ)) < 0.05 MeV and msub(νsub(tau)) < 18 MeV

  20. A segmented, enriched N-type germanium detector for neutrinoless double beta-decay experiments

    Science.gov (United States)

    Leviner, L. E.; Aalseth, C. E.; Ahmed, M. W.; Avignone, F. T.; Back, H. O.; Barabash, A. S.; Boswell, M.; De Braeckeleer, L.; Brudanin, V. B.; Chan, Y.-D.; Egorov, V. G.; Elliott, S. R.; Gehman, V. M.; Hossbach, T. W.; Kephart, J. D.; Kidd, M. F.; Konovalov, S. I.; Lesko, K. T.; Li, Jingyi; Mei, D.-M.; Mikhailov, S.; Miley, H.; Radford, D. C.; Reeves, J.; Sandukovsky, V. G.; Umatov, V. I.; Underwood, T. A.; Tornow, W.; Wu, Y. K.; Young, A. R.

    2014-01-01

    We present data characterizing the performance of the first segmented, N-type Ge detector, isotopically enriched to 85% 76Ge. This detector, based on the Ortec PT6×2 design and referred to as SEGA (Segmented, Enriched Germanium Assembly), was developed as a possible prototype for neutrinoless double beta-decay measurements by the MAJORANA collaboration. We present some of the general characteristics (including bias potential, efficiency, leakage current, and integral cross-talk) for this detector in its temporary cryostat. We also present an analysis of the resolution of the detector, and demonstrate that for all but two segments there is at least one channel that reaches the MAJORANA resolution goal below 4 keV FWHM at 2039 keV, and all channels are below 4.5 keV FWHM.

  1. Analysis of the Intermediate-State Contributions to Neutrinoless Double β− Decays

    Directory of Open Access Journals (Sweden)

    Juhani Hyvärinen

    2016-01-01

    Full Text Available A comprehensive analysis of the structure of the nuclear matrix elements (NMEs of neutrinoless double beta-minus (0νβ-β- decays to the 0+ ground and first excited states is performed in terms of the contributing multipole states in the intermediate nuclei of 0νβ-β- transitions. We concentrate on the transitions mediated by the light (l-NMEs Majorana neutrinos. As nuclear model we use the proton-neutron quasiparticle random-phase approximation (pnQRPA with a realistic two-nucleon interaction based on the Bonn one-boson-exchange G matrix. In the computations we include the appropriate short-range correlations, nucleon form factors, and higher-order nucleonic weak currents and restore the isospin symmetry by the isoscalar-isovector decomposition of the particle-particle proton-neutron interaction parameter gpp.

  2. Neutrinoless double-β decay of Se82 in the shell model: Beyond the closure approximation

    Science.gov (United States)

    Sen'kov, R. A.; Horoi, M.; Brown, B. A.

    2014-05-01

    We recently proposed a method [R. A. Senkov and M. Horoi, Phys. Rev. C 88, 064312 (2013), 10.1103/PhysRevC.88.064312] to calculate the standard nuclear matrix elements for neutrinoless double-β decay (0νββ) of Ca48 going beyond the closure approximation. Here we extend this analysis to the important case of Se82, which was chosen as the base isotope for the upcoming SuperNEMO experiment. We demonstrate that by using a mixed method that considers information from closure and nonclosure approaches, one can get excellent convergence properties for the nuclear matrix elements, which allows one to avoid unmanageable computational costs. We show that in contrast with the closure approximation the mixed approach has a very weak dependence on the average closure energy. The matrix elements for the heavy neutrino-exchange mechanism that could contribute to the 0νββ decay of Se82 are also presented.

  3. Pions in nuclei and manifestations of supersymmetry in neutrinoless double beta decay

    International Nuclear Information System (INIS)

    Faessler, A.; Kovalenko, S.; Simkovic, F.

    1998-01-01

    We examine the pion realization of the short ranged supersymmetric (SUSY) mechanism of neutrinoless double beta decay (0νββ-decay). It originates from the R-parity violating quark-lepton interactions of the SUSY extensions of the standard model of the electroweak interactions. We argue that pions are dominant SUSY mediators in 0νββ-decay. The corresponding nuclear matrix elements for potentially 0νββ-decaying isotopes are calculated within the proton-neutron renormalized quasiparticle random phase approximation (pn-RQRPA). We define those isotopes which are most sensitive to the SUSY signal and outlook the present experimental situation with the 0νββ-decay searches for the SUSY. Upper limits on the R-parity violating 1st generation Yukawa coupling λ' 111 are derived from various 0νββ - experiments

  4. Status of evidence for neutrinoless double beta decay, and the future. Genius and genius-TF

    International Nuclear Information System (INIS)

    Klapdor-Kleingrothaus, H.V.

    2004-01-01

    The first evidence for neutrinoless double beta decay has been observed in the HEIDELBERG-MOSCOW experiment, which is the most sensitive double beta decay experiment since ten years. This is the first evidence for lepton number violation and proves that the neutrino is a Majorana particle. It further shows that neutrino masses are degenerate. In addition it puts several stringent constraints on other physics beyond the Standard Model. The result from the HEIDEL-BERG-MOSCOW experiment is consistent with recent results from CMB investigations, with high energy cosmic rays, with the result from the g-2 experiment and with recent theoretical work. It is indirectly supported by the analysis of other Ge double beta experiments. The new project GENIUS will cover a wide range of the parameter space of predictions of SUSY for neutralinos as cold dark matter. Further it has the potential to be a real-time detector for low-energy (pp and 7 Be) solar neutrinos. A GENIUS Test Facility has come into operation on May 5, 2003. This is the first time that this novel technique for extreme background reduction in search for rare decays is applied under the background conditions of an underground laboratory. (author)

  5. Measuring nuclear reaction cross sections to extract information on neutrinoless double beta decay

    Science.gov (United States)

    Cavallaro, M.; Cappuzzello, F.; Agodi, C.; Acosta, L.; Auerbach, N.; Bellone, J.; Bijker, R.; Bonanno, D.; Bongiovanni, D.; Borello-Lewin, T.; Boztosun, I.; Branchina, V.; Bussa, M. P.; Calabrese, S.; Calabretta, L.; Calanna, A.; Calvo, D.; Carbone, D.; Chávez Lomelí, E. R.; Coban, A.; Colonna, M.; D'Agostino, G.; De Geronimo, G.; Delaunay, F.; Deshmukh, N.; de Faria, P. N.; Ferraresi, C.; Ferreira, J. L.; Finocchiaro, P.; Fisichella, M.; Foti, A.; Gallo, G.; Garcia, U.; Giraudo, G.; Greco, V.; Hacisalihoglu, A.; Kotila, J.; Iazzi, F.; Introzzi, R.; Lanzalone, G.; Lavagno, A.; La Via, F.; Lay, J. A.; Lenske, H.; Linares, R.; Litrico, G.; Longhitano, F.; Lo Presti, D.; Lubian, J.; Medina, N.; Mendes, D. R.; Muoio, A.; Oliveira, J. R. B.; Pakou, A.; Pandola, L.; Petrascu, H.; Pinna, F.; Reito, S.; Rifuggiato, D.; Rodrigues, M. R. D.; Russo, A. D.; Russo, G.; Santagati, G.; Santopinto, E.; Sgouros, O.; Solakci, S. O.; Souliotis, G.; Soukeras, V.; Spatafora, A.; Torresi, D.; Tudisco, S.; Vsevolodovna, R. I. M.; Wheadon, R. J.; Yildirin, A.; Zagatto, V. A. B.

    2018-02-01

    Neutrinoless double beta decay (0vββ) is considered the best potential resource to access the absolute neutrino mass scale. Moreover, if observed, it will signal that neutrinos are their own anti-particles (Majorana particles). Presently, this physics case is one of the most important research “beyond Standard Model” and might guide the way towards a Grand Unified Theory of fundamental interactions. Since the 0vββ decay process involves nuclei, its analysis necessarily implies nuclear structure issues. In the NURE project, supported by a Starting Grant of the European Research Council (ERC), nuclear reactions of double charge-exchange (DCE) are used as a tool to extract information on the 0vββ Nuclear Matrix Elements. In DCE reactions and ββ decay indeed the initial and final nuclear states are the same and the transition operators have similar structure. Thus the measurement of the DCE absolute cross-sections can give crucial information on ββ matrix elements. In a wider view, the NUMEN international collaboration plans a major upgrade of the INFN-LNS facilities in the next years in order to increase the experimental production of nuclei of at least two orders of magnitude, thus making feasible a systematic study of all the cases of interest as candidates for 0vββ.

  6. Corrections to the neutrinoless double-β-decay operator in the shell model

    Science.gov (United States)

    Engel, Jonathan; Hagen, Gaute

    2009-06-01

    We use diagrammatic perturbation theory to construct an effective shell-model operator for the neutrinoless double-β decay of Se82. The starting point is the same Bonn-C nucleon-nucleon interaction that is used to generate the Hamiltonian for recent shell-model calculations of double-β decay. After first summing high-energy ladder diagrams that account for short-range correlations and then adding diagrams of low order in the G matrix to account for longer-range correlations, we fold the two-body matrix elements of the resulting effective operator with transition densities from the recent shell-model calculation to obtain the overall nuclear matrix element that governs the decay. Although the high-energy ladder diagrams suppress this matrix element at very short distances as expected, they enhance it at distances between one and two fermis, so that their overall effect is small. The corrections due to longer-range physics are large, but cancel one another so that the fully corrected matrix element is comparable to that produced by the bare operator. This cancellation between large and physically distinct low-order terms indicates the importance of a reliable nonperturbative calculation.

  7. Development of segmented germanium detectors for neutrinoless double beta decay experiments

    International Nuclear Information System (INIS)

    Liu, Jing

    2009-01-01

    The results from neutrino oscillation experiments indicate that at least two neutrinos have mass. However, the value of the masses and whether neutrinos and anti-neutrinos are identical, i.e., Majorana particles, remain unknown. Neutrinoless double beta decay experiments can help to improve our understanding in both cases and are the only method currently possible to tackle the second question. The GERmanium Detector Array (GERDA) experiment, which will search for the neutrinoless double beta decay of 76 Ge, is currently under construction in Hall A of the INFN Gran Sasso National Laboratory (LNGS), Italy. In order to achieve an extremely low background level, segmented germanium detectors are considered to be operated directly in liquid argon which serves simultaneously as cooling and shielding medium. Several test cryostats were built at the Max-Planck-Institut fuer Physik in Muenchen to operate segmented germanium detectors both in vacuum and submerged in cryogenic liquid. The performance and the background discrimination power of segmented germanium detectors were studied in detail. It was proven for the first time that segmented germanium detectors can be operated stably over long periods submerged in a cryogenic liquid. It was confirmed that the segmentation scheme employed does well in the identification of photon induced background and demonstrated for the first time that also neutron interactions can be identified. The C++ Monte Carlo framework, MaGe (Majorana-GERDA), is a joint development of the Majorana and GERDA collaborations. It is based on GEANT4, but tailored especially to simulate the response of ultra-low background detectors to ionizing radiation. The predictions of the simulation were veri ed to be accurate for a wide range of conditions. Some shortcomings were found and corrected. Pulse shape analysis is complementary to segmentation in identifying background events. Its efficiency can only be correctly determined using reliable pulse shape

  8. Development of segmented germanium detectors for neutrinoless double beta decay experiments

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Jing

    2009-06-09

    The results from neutrino oscillation experiments indicate that at least two neutrinos have mass. However, the value of the masses and whether neutrinos and anti-neutrinos are identical, i.e., Majorana particles, remain unknown. Neutrinoless double beta decay experiments can help to improve our understanding in both cases and are the only method currently possible to tackle the second question. The GERmanium Detector Array (GERDA) experiment, which will search for the neutrinoless double beta decay of {sup 76}Ge, is currently under construction in Hall A of the INFN Gran Sasso National Laboratory (LNGS), Italy. In order to achieve an extremely low background level, segmented germanium detectors are considered to be operated directly in liquid argon which serves simultaneously as cooling and shielding medium. Several test cryostats were built at the Max-Planck-Institut fuer Physik in Muenchen to operate segmented germanium detectors both in vacuum and submerged in cryogenic liquid. The performance and the background discrimination power of segmented germanium detectors were studied in detail. It was proven for the first time that segmented germanium detectors can be operated stably over long periods submerged in a cryogenic liquid. It was confirmed that the segmentation scheme employed does well in the identification of photon induced background and demonstrated for the first time that also neutron interactions can be identified. The C++ Monte Carlo framework, MaGe (Majorana-GERDA), is a joint development of the Majorana and GERDA collaborations. It is based on GEANT4, but tailored especially to simulate the response of ultra-low background detectors to ionizing radiation. The predictions of the simulation were veri ed to be accurate for a wide range of conditions. Some shortcomings were found and corrected. Pulse shape analysis is complementary to segmentation in identifying background events. Its efficiency can only be correctly determined using reliable pulse

  9. Purifications of calcium carbonate and molybdenum oxide powders for neutrinoless double beta decay experiment, AMoRE

    International Nuclear Information System (INIS)

    Park, HyangKyu

    2015-01-01

    The AMoRE (Advanced Mo based Rare process Experiment) collaboration is going to use calcium molybdate crystals to search for neutrinoless double beta decay of 100 Mo isotope. In order to make the crystal, we use calcium carbonate and molybdenum oxide powders as raw materials. Therefore it is highly necessary to reduce potential sources for radioactive backgrounds such as U and Th in the powders. In this talk, we will present our studies for purification of calcium carbonate and molybdenum oxide powders

  10. Some new contributions to neutrinoless double β-decay in an SU(2)xU(1) model

    International Nuclear Information System (INIS)

    Escobar, C.O.

    1982-11-01

    An SU(2) x U(1) model having both Dirac and Majorana mass terms for the neutrinos, with an extended Higgs sector without natural flavor conservation is considered. Under these conditions, it is shown that for a certain range of the mass parameters of the model, some new contributions become important for the neutrinoless double β-decay (ββ)oν. (Author) [pt

  11. Results on neutrinoless double-β decay of 76Ge from phase I of the GERDA experiment.

    Science.gov (United States)

    Agostini, M; Allardt, M; Andreotti, E; Bakalyarov, A M; Balata, M; Barabanov, I; Barnabé Heider, M; Barros, N; Baudis, L; Bauer, C; Becerici-Schmidt, N; Bellotti, E; Belogurov, S; Belyaev, S T; Benato, G; Bettini, A; Bezrukov, L; Bode, T; Brudanin, V; Brugnera, R; Budjáš, D; Caldwell, A; Cattadori, C; Chernogorov, A; Cossavella, F; Demidova, E V; Domula, A; Egorov, V; Falkenstein, R; Ferella, A; Freund, K; Frodyma, N; Gangapshev, A; Garfagnini, A; Gotti, C; Grabmayr, P; Gurentsov, V; Gusev, K; Guthikonda, K K; Hampel, W; Hegai, A; Heisel, M; Hemmer, S; Heusser, G; Hofmann, W; Hult, M; Inzhechik, L V; Ioannucci, L; Janicskó Csáthy, J; Jochum, J; Junker, M; Kihm, T; Kirpichnikov, I V; Kirsch, A; Klimenko, A; Knöpfle, K T; Kochetov, O; Kornoukhov, V N; Kuzminov, V V; Laubenstein, M; Lazzaro, A; Lebedev, V I; Lehnert, B; Liao, H Y; Lindner, M; Lippi, I; Liu, X; Lubashevskiy, A; Lubsandorzhiev, B; Lutter, G; Macolino, C; Machado, A A; Majorovits, B; Maneschg, W; Misiaszek, M; Nemchenok, I; Nisi, S; O'Shaughnessy, C; Pandola, L; Pelczar, K; Pessina, G; Pullia, A; Riboldi, S; Rumyantseva, N; Sada, C; Salathe, M; Schmitt, C; Schreiner, J; Schulz, O; Schwingenheuer, B; Schönert, S; Shevchik, E; Shirchenko, M; Simgen, H; Smolnikov, A; Stanco, L; Strecker, H; Tarka, M; Ur, C A; Vasenko, A A; Volynets, O; von Sturm, K; Wagner, V; Walter, M; Wegmann, A; Wester, T; Wojcik, M; Yanovich, E; Zavarise, P; Zhitnikov, I; Zhukov, S V; Zinatulina, D; Zuber, K; Zuzel, G

    2013-09-20

    Neutrinoless double beta decay is a process that violates lepton number conservation. It is predicted to occur in extensions of the standard model of particle physics. This Letter reports the results from phase I of the Germanium Detector Array (GERDA) experiment at the Gran Sasso Laboratory (Italy) searching for neutrinoless double beta decay of the isotope (76)Ge. Data considered in the present analysis have been collected between November 2011 and May 2013 with a total exposure of 21.6 kg yr. A blind analysis is performed. The background index is about 1 × 10(-2) counts/(keV kg yr) after pulse shape discrimination. No signal is observed and a lower limit is derived for the half-life of neutrinoless double beta decay of (76)Ge, T(1/2)(0ν) >2.1 × 10(25) yr (90% C.L.). The combination with the results from the previous experiments with (76)Ge yields T(1/2)(0ν)>3.0 × 10(25) yr (90% C.L.).

  12. Results on Neutrinoless Double-β Decay of Ge76 from Phase I of the GERDA Experiment

    Science.gov (United States)

    Agostini, M.; Allardt, M.; Andreotti, E.; Bakalyarov, A. M.; Balata, M.; Barabanov, I.; Barnabé Heider, M.; Barros, N.; Baudis, L.; Bauer, C.; Becerici-Schmidt, N.; Bellotti, E.; Belogurov, S.; Belyaev, S. T.; Benato, G.; Bettini, A.; Bezrukov, L.; Bode, T.; Brudanin, V.; Brugnera, R.; Budjáš, D.; Caldwell, A.; Cattadori, C.; Chernogorov, A.; Cossavella, F.; Demidova, E. V.; Domula, A.; Egorov, V.; Falkenstein, R.; Ferella, A.; Freund, K.; Frodyma, N.; Gangapshev, A.; Garfagnini, A.; Gotti, C.; Grabmayr, P.; Gurentsov, V.; Gusev, K.; Guthikonda, K. K.; Hampel, W.; Hegai, A.; Heisel, M.; Hemmer, S.; Heusser, G.; Hofmann, W.; Hult, M.; Inzhechik, L. V.; Ioannucci, L.; Janicskó Csáthy, J.; Jochum, J.; Junker, M.; Kihm, T.; Kirpichnikov, I. V.; Kirsch, A.; Klimenko, A.; Knöpfle, K. T.; Kochetov, O.; Kornoukhov, V. N.; Kuzminov, V. V.; Laubenstein, M.; Lazzaro, A.; Lebedev, V. I.; Lehnert, B.; Liao, H. Y.; Lindner, M.; Lippi, I.; Liu, X.; Lubashevskiy, A.; Lubsandorzhiev, B.; Lutter, G.; Macolino, C.; Machado, A. A.; Majorovits, B.; Maneschg, W.; Misiaszek, M.; Nemchenok, I.; Nisi, S.; O'Shaughnessy, C.; Pandola, L.; Pelczar, K.; Pessina, G.; Pullia, A.; Riboldi, S.; Rumyantseva, N.; Sada, C.; Salathe, M.; Schmitt, C.; Schreiner, J.; Schulz, O.; Schwingenheuer, B.; Schönert, S.; Shevchik, E.; Shirchenko, M.; Simgen, H.; Smolnikov, A.; Stanco, L.; Strecker, H.; Tarka, M.; Ur, C. A.; Vasenko, A. A.; Volynets, O.; von Sturm, K.; Wagner, V.; Walter, M.; Wegmann, A.; Wester, T.; Wojcik, M.; Yanovich, E.; Zavarise, P.; Zhitnikov, I.; Zhukov, S. V.; Zinatulina, D.; Zuber, K.; Zuzel, G.

    2013-09-01

    Neutrinoless double beta decay is a process that violates lepton number conservation. It is predicted to occur in extensions of the standard model of particle physics. This Letter reports the results from phase I of the Germanium Detector Array (GERDA) experiment at the Gran Sasso Laboratory (Italy) searching for neutrinoless double beta decay of the isotope Ge76. Data considered in the present analysis have been collected between November 2011 and May 2013 with a total exposure of 21.6 kg yr. A blind analysis is performed. The background index is about 1×10-2counts/(keVkgyr) after pulse shape discrimination. No signal is observed and a lower limit is derived for the half-life of neutrinoless double beta decay of Ge76, T1/20ν>2.1×1025yr (90% C.L.). The combination with the results from the previous experiments with Ge76 yields T1/20ν>3.0×1025yr (90% C.L.).

  13. The large enriched germanium experiment for neutrinoless double beta decay (LEGEND)

    Science.gov (United States)

    Abgrall, N.; Abramov, A.; Abrosimov, N.; Abt, I.; Agostini, M.; Agartioglu, M.; Ajjaq, A.; Alvis, S. I.; Avignone, F. T.; Bai, X.; Balata, M.; Barabanov, I.; Barabash, A. S.; Barton, P. J.; Baudis, L.; Bezrukov, L.; Bode, T.; Bolozdynya, A.; Borowicz, D.; Boston, A.; Boston, H.; Boyd, S. T. P.; Breier, R.; Brudanin, V.; Brugnera, R.; Busch, M.; Buuck, M.; Caldwell, A.; Caldwell, T. S.; Camellato, T.; Carpenter, M.; Cattadori, C.; Cederkäll, J.; Chan, Y.-D.; Chen, S.; Chernogorov, A.; Christofferson, C. D.; Chu, P.-H.; Cooper, R. J.; Cuesta, C.; Demidova, E. V.; Deng, Z.; Deniz, M.; Detwiler, J. A.; Di Marco, N.; Domula, A.; Du, Q.; Efremenko, Yu.; Egorov, V.; Elliott, S. R.; Fields, D.; Fischer, F.; Galindo-Uribarri, A.; Gangapshev, A.; Garfagnini, A.; Gilliss, T.; Giordano, M.; Giovanetti, G. K.; Gold, M.; Golubev, P.; Gooch, C.; Grabmayr, P.; Green, M. P.; Gruszko, J.; Guinn, I. S.; Guiseppe, V. E.; Gurentsov, V.; Gurov, Y.; Gusev, K.; Hakenmüeller, J.; Harkness-Brennan, L.; Harvey, Z. R.; Haufe, C. R.; Hauertmann, L.; Heglund, D.; Hehn, L.; Heinz, A.; Hiller, R.; Hinton, J.; Hodak, R.; Hofmann, W.; Howard, S.; Howe, M. A.; Hult, M.; Inzhechik, L. V.; Csáthy, J. Janicskó; Janssens, R.; Ješkovský, M.; Jochum, J.; Johansson, H. T.; Judson, D.; Junker, M.; Kaizer, J.; Kang, K.; Kazalov, V.; Kermadic, Y.; Kiessling, F.; Kirsch, A.; Kish, A.; Klimenko, A.; Knöpfle, K. T.; Kochetov, O.; Konovalov, S. I.; Kontul, I.; Kornoukhov, V. N.; Kraetzschmar, T.; Kröninger, K.; Kumar, A.; Kuzminov, V. V.; Lang, K.; Laubenstein, M.; Lazzaro, A.; Li, Y. L.; Li, Y.-Y.; Li, H. B.; Lin, S. T.; Lindner, M.; Lippi, I.; Liu, S. K.; Liu, X.; Liu, J.; Loomba, D.; Lubashevskiy, A.; Lubsandorzhiev, B.; Lutter, G.; Ma, H.; Majorovits, B.; Mamedov, F.; Martin, R. D.; Massarczyk, R.; Matthews, J. A. J.; McFadden, N.; Mei, D.-M.; Mei, H.; Meijer, S. J.; Mengoni, D.; Mertens, S.; Miller, W.; Miloradovic, M.; Mingazheva, R.; Misiaszek, M.; Moseev, P.; Myslik, J.; Nemchenok, I.; Nilsson, T.; Nolan, P.; O'Shaughnessy, C.; Othman, G.; Panas, K.; Pandola, L.; Papp, L.; Pelczar, K.; Peterson, D.; Pettus, W.; Poon, A. W. P.; Povinec, P. P.; Pullia, A.; Quintana, X. C.; Radford, D. C.; Rager, J.; Ransom, C.; Recchia, F.; Reine, A. L.; Riboldi, S.; Rielage, K.; Rozov, S.; Rouf, N. W.; Rukhadze, E.; Rumyantseva, N.; Saakyan, R.; Sala, E.; Salamida, F.; Sandukovsky, V.; Savard, G.; Schönert, S.; Schütz, A.-K.; Schulz, O.; Schuster, M.; Schwingenheuer, B.; Selivanenko, O.; Sevda, B.; Shanks, B.; Shevchik, E.; Shirchenko, M.; Simkovic, F.; Singh, L.; Singh, V.; Skorokhvatov, M.; Smolek, K.; Smolnikov, A.; Sonay, A.; Spavorova, M.; Stekl, I.; Stukov, D.; Tedeschi, D.; Thompson, J.; Van Wechel, T.; Varner, R. L.; Vasenko, A. A.; Vasilyev, S.; Veresnikova, A.; Vetter, K.; von Sturm, K.; Vorren, K.; Wagner, M.; Wang, G.-J.; Waters, D.; Wei, W.-Z.; Wester, T.; White, B. R.; Wiesinger, C.; Wilkerson, J. F.; Willers, M.; Wiseman, C.; Wojcik, M.; Wong, H. T.; Wyenberg, J.; Xu, W.; Yakushev, E.; Yang, G.; Yu, C.-H.; Yue, Q.; Yumatov, V.; Zeman, J.; Zeng, Z.; Zhitnikov, I.; Zhu, B.; Zinatulina, D.; Zschocke, A.; Zsigmond, A. J.; Zuber, K.; Zuzel, G.

    2017-10-01

    The observation of neutrinoless double-beta decay (0νββ) would show that lepton number is violated, reveal that neu-trinos are Majorana particles, and provide information on neutrino mass. A discovery-capable experiment covering the inverted ordering region, with effective Majorana neutrino masses of 15 - 50 meV, will require a tonne-scale experiment with excellent energy resolution and extremely low backgrounds, at the level of ˜0.1 count /(FWHM.t.yr) in the region of the signal. The current generation 76Ge experiments GERDA and the Majorana Demonstrator, utilizing high purity Germanium detectors with an intrinsic energy resolution of 0.12%, have achieved the lowest backgrounds by over an order of magnitude in the 0νββ signal region of all 0νββ experiments. Building on this success, the LEGEND collaboration has been formed to pursue a tonne-scale 76Ge experiment. The collaboration aims to develop a phased 0νββ experimental program with discovery potential at a half-life approaching or at 1028 years, using existing resources as appropriate to expedite physics results.

  14. Improved Limit on Neutrinoless Double-β Decay of ^{76}Ge from GERDA Phase II.

    Science.gov (United States)

    Agostini, M; Bakalyarov, A M; Balata, M; Barabanov, I; Baudis, L; Bauer, C; Bellotti, E; Belogurov, S; Bettini, A; Bezrukov, L; Biernat, J; Bode, T; Borowicz, D; Brudanin, V; Brugnera, R; Caldwell, A; Cattadori, C; Chernogorov, A; Comellato, T; D'Andrea, V; Demidova, E V; Di Marco, N; Domula, A; Doroshkevich, E; Egorov, V; Falkenstein, R; Gangapshev, A; Garfagnini, A; Grabmayr, P; Gurentsov, V; Gusev, K; Hakenmüller, J; Hegai, A; Heisel, M; Hemmer, S; Hiller, R; Hofmann, W; Hult, M; Inzhechik, L V; Janicskó Csáthy, J; Jochum, J; Junker, M; Kazalov, V; Kermaidic, Y; Kihm, T; Kirpichnikov, I V; Kirsch, A; Kish, A; Klimenko, A; Kneißl, R; Knöpfle, K T; Kochetov, O; Kornoukhov, V N; Kuzminov, V V; Laubenstein, M; Lazzaro, A; Lindner, M; Lippi, I; Lubashevskiy, A; Lubsandorzhiev, B; Lutter, G; Macolino, C; Majorovits, B; Maneschg, W; Miloradovic, M; Mingazheva, R; Misiaszek, M; Moseev, P; Nemchenok, I; Panas, K; Pandola, L; Pelczar, K; Pertoldi, L; Pullia, A; Ransom, C; Riboldi, S; Rumyantseva, N; Sada, C; Salamida, F; Schmitt, C; Schneider, B; Schönert, S; Schütz, A-K; Schulz, O; Schwingenheuer, B; Selivanenko, O; Shevchik, E; Shirchenko, M; Simgen, H; Smolnikov, A; Stanco, L; Vanhoefer, L; Vasenko, A A; Veresnikova, A; von Sturm, K; Wagner, V; Wegmann, A; Wester, T; Wiesinger, C; Wojcik, M; Yanovich, E; Zhitnikov, I; Zhukov, S V; Zinatulina, D; Zschocke, A; Zsigmond, A J; Zuber, K; Zuzel, G

    2018-03-30

    The GERDA experiment searches for the lepton-number-violating neutrinoless double-β decay of ^{76}Ge (^{76}Ge→^{76}Se+2e^{-}) operating bare Ge diodes with an enriched ^{76}Ge fraction in liquid argon. The exposure for broad-energy germanium type (BEGe) detectors is increased threefold with respect to our previous data release. The BEGe detectors feature an excellent background suppression from the analysis of the time profile of the detector signals. In the analysis window a background level of 1.0_{-0.4}^{+0.6}×10^{-3}  counts/(keV kg yr) has been achieved; if normalized to the energy resolution this is the lowest ever achieved in any 0νββ experiment. No signal is observed and a new 90% C.L. lower limit for the half-life of 8.0×10^{25}  yr is placed when combining with our previous data. The expected median sensitivity assuming no signal is 5.8×10^{25}  yr.

  15. Improved Limit on Neutrinoless Double-β Decay of Ge 76 from GERDA Phase II

    Science.gov (United States)

    Agostini, M.; Bakalyarov, A. M.; Balata, M.; Barabanov, I.; Baudis, L.; Bauer, C.; Bellotti, E.; Belogurov, S.; Bettini, A.; Bezrukov, L.; Biernat, J.; Bode, T.; Borowicz, D.; Brudanin, V.; Brugnera, R.; Caldwell, A.; Cattadori, C.; Chernogorov, A.; Comellato, T.; D'Andrea, V.; Demidova, E. V.; di Marco, N.; Domula, A.; Doroshkevich, E.; Egorov, V.; Falkenstein, R.; Gangapshev, A.; Garfagnini, A.; Grabmayr, P.; Gurentsov, V.; Gusev, K.; Hakenmüller, J.; Hegai, A.; Heisel, M.; Hemmer, S.; Hiller, R.; Hofmann, W.; Hult, M.; Inzhechik, L. V.; Janicskó Csáthy, J.; Jochum, J.; Junker, M.; Kazalov, V.; Kermaidic, Y.; Kihm, T.; Kirpichnikov, I. V.; Kirsch, A.; Kish, A.; Klimenko, A.; Kneißl, R.; Knöpfle, K. T.; Kochetov, O.; Kornoukhov, V. N.; Kuzminov, V. V.; Laubenstein, M.; Lazzaro, A.; Lindner, M.; Lippi, I.; Lubashevskiy, A.; Lubsandorzhiev, B.; Lutter, G.; Macolino, C.; Majorovits, B.; Maneschg, W.; Miloradovic, M.; Mingazheva, R.; Misiaszek, M.; Moseev, P.; Nemchenok, I.; Panas, K.; Pandola, L.; Pelczar, K.; Pertoldi, L.; Pullia, A.; Ransom, C.; Riboldi, S.; Rumyantseva, N.; Sada, C.; Salamida, F.; Schmitt, C.; Schneider, B.; Schönert, S.; Schütz, A.-K.; Schulz, O.; Schwingenheuer, B.; Selivanenko, O.; Shevchik, E.; Shirchenko, M.; Simgen, H.; Smolnikov, A.; Stanco, L.; Vanhoefer, L.; Vasenko, A. A.; Veresnikova, A.; von Sturm, K.; Wagner, V.; Wegmann, A.; Wester, T.; Wiesinger, C.; Wojcik, M.; Yanovich, E.; Zhitnikov, I.; Zhukov, S. V.; Zinatulina, D.; Zschocke, A.; Zsigmond, A. J.; Zuber, K.; Zuzel, G.; Gerda Collaboration

    2018-03-01

    The GERDA experiment searches for the lepton-number-violating neutrinoless double-β decay of Ge 76 (Ge 76 →Se 76 +2 e- ) operating bare Ge diodes with an enriched Ge 76 fraction in liquid argon. The exposure for broad-energy germanium type (BEGe) detectors is increased threefold with respect to our previous data release. The BEGe detectors feature an excellent background suppression from the analysis of the time profile of the detector signals. In the analysis window a background level of 1. 0-0.4+0.6×10-3 counts /(keV kg yr ) has been achieved; if normalized to the energy resolution this is the lowest ever achieved in any 0 νβ β experiment. No signal is observed and a new 90% C.L. lower limit for the half-life of 8.0 ×1025 yr is placed when combining with our previous data. The expected median sensitivity assuming no signal is 5.8 ×1025 yr .

  16. Limits on neutrino-less double beta decay of 100Mo

    International Nuclear Information System (INIS)

    Ejiri, H.; Fushimi, K.; Hayashi, K.; Kishimoto, T.; Kudomi, N.; Ohsumi, H.; Okada, K.; Shima, T.; Tanaka, J.

    1996-01-01

    Exclusive measurements of neutrino-less double beta decays (0νββ) of 100 Mo were made by means of ELEGANT V. Most stringent lower limits on the half-lives for the ground-state transition were obtained for the 0νββ processes as T 1/2 0ν (m ν ) > 5.2 x 10 22 y, T 1/2 0ν (λ) > 3.9 x 10 22 y and T 1/2 0ν (η) > 5.1 x 10 22 y, for the mass term left angle m ν right angle, for the right-handed current terms of left angle λ right angle and left angle η right angle, respectively, and as T 1/2 0νB > 5.4 x 10 21 y for the process (0νββB) followed by a Majoron (B). These limits lead to the upper limits of left angle m ν right angle -6 , left angle η right angle -8 and left angle g B right angle -5 with g B being the coupling of B with the neutrino field. Limits on other possible processes beyond the standard theory are discussed. (orig.)

  17. LUCIFER: Scintillating bolometers for the search of Neutrinoless Double Beta Decay

    Energy Technology Data Exchange (ETDEWEB)

    Vignati, M. [Sapienza Universita di Roma and INFN Sezione di Roma, Roma, I-00185 (Italy)

    2012-08-15

    The nature of neutrino mass is one of the frontier problems of particle physics. Neutrinoless Double Beta Decay (0{nu}DBD) is a powerful tool to measure the neutrino mass and to test possible extensions of the Standard Model. Bolometers are excellent detectors to search for this rare decay, thanks to their good energy resolution and to the low background conditions in which they can operate. The current challenge consists in the reduction of the background, represented by environmental {gamma}'s and {alpha}'s, in view of a zero background experiment. We present the LUCIFER R and D, funded by an European grant, in which the background can be reduced by an order of magnitude with respect to the present generation experiments. The technique is based on the simultaneous bolometric measurement of the heat and of the scintillation light produced by a particle, that allows to discriminate between {beta} and {alpha} particles. The {gamma} background is reduced by choosing 0{nu}DBD candidate isotopes with transition energy above the environmental {gamma}'s spectrum. The prospect of this R and D are discussed.

  18. Characterization of a ZnSe scintillating bolometer prototype for neutrinoless double beta decay search

    Directory of Open Access Journals (Sweden)

    Tenconi M.

    2014-01-01

    Full Text Available As proposed in the LUCIFER project, ZnSe crystals are attractive materials to realize scintillating bolometers aiming at the search for neutrinoless double beta decay of the promising isotope 82Se. However, the optimization of the ZnSe-based detectors is rather complex and requires a wide-range investigation of the crystal features: optical properties, crystalline quality, scintillation yields and bolometric behaviour. Samples tested up to now show problems in the reproducibility of crucial aspects of the detector performance. In this work, we present the results obtained with a scintillating bolometer operated aboveground at about 25 mK. The detector energy absorber was a single 1 cm3 ZnSe crystal. The good energy resolution of the heat channel (about 14 keV at 1460 keV and the excellent alpha/beta discrimination capability are very encouraging for a successful realization of the LUCIFER program. The bolometric measurements were completed by optical tests on the crystal (optical transmission and luminescence measurements down to 10 K and investigation of the crystalline structure. The work here described provides a set of parameters and procedures useful for a complete pre-characterization of ZnSe crystals in view of the realization of highly performing scintillating bolometers.

  19. Results of a search for neutrinoless double-beta decay using the COBRA demonstrator

    Energy Technology Data Exchange (ETDEWEB)

    Quante, Thomas; Goessling, Claus; Kroeninger, Kevin [TU Dortmund, Exp. Physik IV, Dortmund (Germany)

    2016-07-01

    COBRA is an experiment aiming to search for neutrinoless double-beta-decay (0νββ-decay) using CdZnTe semiconductor detectors. The main focus is on {sup 116}Cd, with a Q-value of 2813.5 keV well above the highest dominant naturally occurring gamma lines. By measuring the half-life of the 0νββ-decay, it is possible to clarify the nature of the neutrino as either Dirac or Majorana particle and furthermore to determine its effective Majorana mass. The COBRA collaboration operates a demonstrator to search for these decays at the Laboratori Nazionali del Gran Sasso in Italy. The exposure of 234.7 kg d considered in this analysis was collected between September 2011 and February 2015. The analysis focuses on the decay of the nuclides {sup 114}Cd, {sup 128}Te, {sup 70}Zn, {sup 130}Te and {sup 116}Cd. A Bayesian analysis is performed to estimate the signal strength of 0νββ-decay.

  20. Search for Neutrinoless Double-β Decay in Ge 76 with the Majorana Demonstrator

    Science.gov (United States)

    Aalseth, C. E.; Abgrall, N.; Aguayo, E.; Alvis, S. I.; Amman, M.; Arnquist, I. J.; Avignone, F. T.; Back, H. O.; Barabash, A. S.; Barbeau, P. S.; Barton, C. J.; Barton, P. J.; Bertrand, F. E.; Bode, T.; Bos, B.; Boswell, M.; Bradley, A. W.; Brodzinski, R. L.; Brudanin, V.; Busch, M.; Buuck, M.; Caldwell, A. S.; Caldwell, T. S.; Chan, Y.-D.; Christofferson, C. D.; Chu, P.-H.; Collar, J. I.; Combs, D. C.; Cooper, R. J.; Cuesta, C.; Detwiler, J. A.; Doe, P. J.; Dunmore, J. A.; Efremenko, Yu.; Ejiri, H.; Elliott, S. R.; Fast, J. E.; Finnerty, P.; Fraenkle, F. M.; Fu, Z.; Fujikawa, B. K.; Fuller, E.; Galindo-Uribarri, A.; Gehman, V. M.; Gilliss, T.; Giovanetti, G. K.; Goett, J.; Green, M. P.; Gruszko, J.; Guinn, I. S.; Guiseppe, V. E.; Hallin, A. L.; Haufe, C. R.; Hehn, L.; Henning, R.; Hoppe, E. W.; Hossbach, T. W.; Howe, M. A.; Jasinski, B. R.; Johnson, R. A.; Keeter, K. J.; Kephart, J. D.; Kidd, M. F.; Knecht, A.; Konovalov, S. I.; Kouzes, R. T.; LaFerriere, B. D.; Leon, J.; Lesko, K. T.; Leviner, L. E.; Loach, J. C.; Lopez, A. M.; Luke, P. N.; MacMullin, J.; MacMullin, S.; Marino, M. G.; Martin, R. D.; Massarczyk, R.; McDonald, A. B.; Mei, D.-M.; Meijer, S. J.; Merriman, J. H.; Mertens, S.; Miley, H. S.; Miller, M. L.; Myslik, J.; Orrell, J. L.; O'Shaughnessy, C.; Othman, G.; Overman, N. R.; Perumpilly, G.; Pettus, W.; Phillips, D. G.; Poon, A. W. P.; Pushkin, K.; Radford, D. C.; Rager, J.; Reeves, J. H.; Reine, A. L.; Rielage, K.; Robertson, R. G. H.; Ronquest, M. C.; Ruof, N. W.; Schubert, A. G.; Shanks, B.; Shirchenko, M.; Snavely, K. J.; Snyder, N.; Steele, D.; Suriano, A. M.; Tedeschi, D.; Tornow, W.; Trimble, J. E.; Varner, R. L.; Vasilyev, S.; Vetter, K.; Vorren, K.; White, B. R.; Wilkerson, J. F.; Wiseman, C.; Xu, W.; Yakushev, E.; Yaver, H.; Young, A. R.; Yu, C.-H.; Yumatov, V.; Zhitnikov, I.; Zhu, B. X.; Zimmermann, S.; Majorana Collaboration

    2018-03-01

    The Majorana Collaboration is operating an array of high purity Ge detectors to search for neutrinoless double-β decay in Ge 76 . The Majorana Demonstrator comprises 44.1 kg of Ge detectors (29.7 kg enriched in Ge 76 ) split between two modules contained in a low background shield at the Sanford Underground Research Facility in Lead, South Dakota. Here we present results from data taken during construction, commissioning, and the start of full operations. We achieve unprecedented energy resolution of 2.5 keV FWHM at Qβ β and a very low background with no observed candidate events in 9.95 kg yr of enriched Ge exposure, resulting in a lower limit on the half-life of 1.9 ×1025 yr (90% C.L.). This result constrains the effective Majorana neutrino mass to below 240-520 meV, depending on the matrix elements used. In our experimental configuration with the lowest background, the background is 4.0-2.5+3.1 counts /(FWHM t yr ) .

  1. Searching for Neutrinoless Double-Beta Decay of 130Te with CUORE

    Directory of Open Access Journals (Sweden)

    D. R. Artusa

    2015-01-01

    Full Text Available Neutrinoless double-beta (0νββ decay is a hypothesized lepton-number-violating process that offers the only known means of asserting the possible Majorana nature of neutrino mass. The Cryogenic Underground Observatory for Rare Events (CUORE is an upcoming experiment designed to search for 0νββ decay of 130Te using an array of 988 TeO2 crystal bolometers operated at 10 mK. The detector will contain 206 kg of 130Te and have an average energy resolution of 5 keV; the projected 0νββ decay half-life sensitivity after five years of livetime is 1.6 × 1026 y at 1σ (9.5 × 1025 y at the 90% confidence level, which corresponds to an upper limit on the effective Majorana mass in the range 40–100 meV (50–130 meV. In this paper, we review the experimental techniques used in CUORE as well as its current status and anticipated physics reach.

  2. A neutrino mass-mixing sum rule from SO(10) and neutrinoless double beta decay

    Energy Technology Data Exchange (ETDEWEB)

    Buccella, F. [INFN, Sezione di Napoli,Complesso University Monte S. Angelo, I-80126 Napoli (Italy); Chianese, M. [INFN, Sezione di Napoli,Complesso University Monte S. Angelo, I-80126 Napoli (Italy); Dipartimento di Fisica Ettore Pancini, Università di Napoli Federico II,Complesso University Monte S. Angelo, I-80126 Napoli (Italy); Mangano, G. [INFN, Sezione di Napoli,Complesso University Monte S. Angelo, I-80126 Napoli (Italy); Miele, G.; Morisi, S.; Santorelli, P. [INFN, Sezione di Napoli,Complesso University Monte S. Angelo, I-80126 Napoli (Italy); Dipartimento di Fisica Ettore Pancini, Università di Napoli Federico II,Complesso University Monte S. Angelo, I-80126 Napoli (Italy)

    2017-04-03

    Minimal SO(10) grand unified models provide phenomenological predictions for neutrino mass patterns and mixing. These are the outcome of the interplay of several features, namely: i) the seesaw mechanism; ii) the presence of an intermediate scale where B-L gauge symmetry is broken and the right-handed neutrinos acquire a Majorana mass; iii) a symmetric Dirac neutrino mass matrix whose pattern is close to the up-type quark one. In this framework two natural characteristics emerge. Normal neutrino mass hierarchy is the only allowed, and there is an approximate relation involving both light-neutrino masses and mixing parameters. This differs from what occurring when horizontal flavour symmetries are invoked. In this case, in fact, neutrino mixing or mass relations have been separately obtained in literature. In this paper we discuss an example of such comprehensive mixing-mass relation in a specific realization of SO(10) and, in particular, analyse its impact on the expected neutrinoless double beta decay effective mass parameter 〈m{sub ee}〉, and on the neutrino mass scale. Remarkably a lower limit for the lightest neutrino mass is obtained (m{sub lightest}≳7.5×10{sup −4} eV, at 3 σ level).

  3. Exploring the neutrinoless double beta decay in the inverted neutrino hierarchy with bolometric detectors

    Energy Technology Data Exchange (ETDEWEB)

    Artusa, D.R. [University of South Carolina, Department of Physics and Astronomy, Columbia, SC (United States); INFN-Laboratori Nazionali del Gran Sasso, Assergi, L' Aquila (Italy); Avignone, F.T.; Chott, N.; Creswick, R.J.; Farach, H.A.; Rosenfeld, C.; Wilson, J. [University of South Carolina, Department of Physics and Astronomy, Columbia, SC (United States); Azzolini, O.; Camacho, A.; De Biasi, A.; Keppel, G.; Palmieri, V.; Pira, C.; Rampazzo, V. [INFN-Laboratori Nazionali di Legnaro, Legnaro, Padua (Italy); Balata, M.; Bucci, C.; Canonica, L.; Casali, N.; Di Vacri, M.L.; Goett, J.; Gorla, P.; Nisi, S.; Orlandi, D.; Pattavina, L.; Pirro, S.; Zarra, C. [INFN-Laboratori Nazionali del Gran Sasso, Assergi, L' Aquila (Italy); Banks, T.I. [INFN-Laboratori Nazionali del Gran Sasso, Assergi, L' Aquila (Italy); University of California, Department of Physics, Berkeley, CA (United States); Lawrence Berkeley National Laboratory, Nuclear Science Division, Berkeley, CA (United States); Bari, G.; Deninno, M.M.; Moggi, N. [INFN-Sezione di Bologna, Bologna (Italy); Beeman, J. [Lawrence Berkeley National Laboratory, Materials Science Division, Berkeley, CA (United States); Bellini, F.; Cardani, L.; Cosmelli, C.; Ferroni, F.; Piperno, G. [Sapienza Universita di Roma, Dipartimento di Fisica, Rome (Italy); INFN-Sezione di Roma, Rome (Italy); Bersani, A. [INFN-Sezione di Genova, Genoa (Italy); Biassoni, M.; Brofferio, C.; Capelli, S.; Carrettoni, M.; Chiesa, D.; Clemenza, M.; Faverzani, M.; Ferri, E.; Fiorini, E.; Giachero, A.; Gironi, L.; Gotti, C.; Maiano, C.; Maino, M.; Nucciotti, A.; Pavan, M.; Sala, E.; Sisti, M.; Terranova, F.; Zanotti, L. [Universita di Milano-Bicocca, Dipartimento di Fisica, Milan (Italy); INFN-Sezione di Milano Bicocca, Milan (Italy); Cai, X.Z.; Cao, X.G.; Fang, D.Q.; Li, Y.L.; Ma, Y.G.; Tian, W.D.; Wang, H.W. [Chinese Academy of Sciences, Shanghai Institute of Applied Physics, Shanghai (China); Carbone, L.; Cremonesi, O.; Datskov, V.; Pessina, G.; Previtali, E.; Rusconi, C. [INFN-Sezione di Milano Bicocca, Milan (Italy); Dafinei, I.; Morganti, S.; Orio, F.; Pettinacci, V.; Tomei, C.; Vignati, M. [INFN-Sezione di Roma, Rome (Italy); Dally, A.; Ejzak, L.; Wielgus, L. [University of Wisconsin, Department of Physics, Madison, WI (United States); Di Domizio, S.; Fernandes, G.; Pallavicini, M. [INFN-Sezione di Genova, Genoa (Italy); Universita di Genova, Dipartimento di Fisica, Genoa (Italy); Franceschi, M.A.; Ligi, C.; Napolitano, T. [INFN-Laboratori Nazionali di Frascati, Frascati, Rome (Italy); Freedman, S.J. [University of California, Department of Physics, Berkeley, CA (United States); Lawrence Berkeley National Laboratory, Nuclear Science Division, Berkeley, CA (United States); Fujikawa, B.K.; Han, K.; Mei, Y.; Smith, A.R. [Lawrence Berkeley National Laboratory, Nuclear Science Division, Berkeley, CA (United States); Giuliani, A.; Tenconi, M. [Centre de Spectrometrie Nucleaire et de Spectrometrie de Masse, Orsay (France); Gutierrez, T.D. [California Polytechnic State University, Physics Department, San Luis Obispo, CA (United States); Haller, E.E. [Lawrence Berkeley National Laboratory, Materials Science Division, Berkeley, CA (United States); University of California, Department of Materials Science and Engineering, Berkeley, CA (United States); Heeger, K.M.; Maruyama, R.H. [Yale University, Department of Physics, New Haven, CT (United States); Hennings-Yeomans, R.; O' Donnell, T. [University of California, Department of Physics, Berkeley, CA (United States); Huang, H.Z.; Liu, X.; Trentalange, S.; Winslow, L.A.; Zhu, B.X. [University of California, Department of Physics and Astronomy, Los Angeles, CA (United States); Kadel, R. [Lawrence Berkeley National Laboratory, Physics Division, Berkeley, CA (United States); Kazkaz, K.; Pedretti, M.; Sangiorgio, S.; Scielzo, N.D. [Lawrence Livermore National Laboratory, Livermore, CA (United States); Kolomensky, Yu.G. [University of California, Department of Physics, Berkeley, CA (United States); Lawrence Berkeley National Laboratory, Physics Division, Berkeley, CA (United States); Martinez, M. [Universidad de Zaragoza, Laboratorio de Fisica Nuclear y Astroparticulas, Saragossa (Spain); Nones, C. [CEA/Saclay, Service de Physique des Particules, Gif-sur-Yvette (France); Norman, E.B.; Wang, B.S. [Lawrence Livermore National Laboratory, Livermore, CA (United States); University of California, Department of Nuclear Engineering, Berkeley, CA (United States); Ouellet, J.L. [University of California, Department of Physics, Berkeley, CA (United States); Lawrence Berkeley National Laboratory, Nuclear Science Division, Berkeley, CA (United States); Taffarello, L. [INFN-Sezione di Padova, Padua (Italy); Ventura, G. [Universita di Firenze, Dipartimento di Fisica, Florence (Italy); INFN-Sezione di Firenze, Florence (Italy); Wise, T. [University of Wisconsin, Department of Physics, Madison, WI (United States); Yale University, Department of Physics, New Haven, CT (United States); Woodcraft, A. [University of Edinburgh, SUPA, Institute for Astronomy, Edinburgh (United Kingdom); Zucchelli, S. [INFN-Sezione di Bologna, Bologna (Italy); Universita di Bologna, Dipartimento di Fisica, Bologna (Italy)

    2014-10-15

    Neutrinoless double beta decay (0νββ) is one of the most sensitive probes for physics beyond the Standard Model, providing unique information on the nature of neutrinos. In this paper we review the status and outlook for bolometric 0νββ decay searches. We summarize recent advances in background suppression demonstrated using bolometers with simultaneous readout of heat and light signals. We simulate several configurations of a future CUORE-like bolometer array which would utilize these improvements and present the sensitivity reach of a hypothetical next-generation bolometric 0νββ experiment. We demonstrate that a bolometric experiment with the isotope mass of about 1 ton is capable of reaching the sensitivity to the effective Majorana neutrino mass (vertical stroke m{sub ee} vertical stroke) of order 10-20 meV, thus completely exploring the so-called inverted neutrino mass hierarchy region. We highlight the main challenges and identify priorities for an R and D program addressing them. (orig.)

  4. Radon-induced surface contaminations in neutrinoless double beta decay and dark matter experiments

    International Nuclear Information System (INIS)

    Pattavina, L.

    2011-01-01

    In experiments looking for rare events, like neutrinoless double beta decay (DBD0ν) and dark matter search (DM), one of the main issues is to increase the experimental sensitivity through the material selection and production. The background contribution coming from the materials used for the detector realization has to be minimized. Moreover the net reduction of the background produced by the bulk part of the apparatus has raised concerns about the background contribution coming from the surfaces. Many procedures and techniques were developed during the last years in order to remove and to minimize the presence of possible contaminants on detector surfaces. To succeed in this strategy a big effort was put in defining all possible mechanisms that lead to surface contaminations, as well as specific cleaning procedures, which are able to reduce and control the surface radioactivity. The presence in air and gases of possible radioactive elements that can stick on the detector surfaces can lead to a recontamination process that will vanish all the applied cleaning procedures. Here is presented and analyzed the contribution to the background of rare events experiments like CUORE experiment (DBD0ν) and EDELWEISS experiment (DM) produced by an exposure of their detector components to a big activity of 222 Rn, radioactive daughter isotope from the 238 U chain. (author)

  5. Minimally allowed neutrinoless double beta decay rates within an anarchical framework

    International Nuclear Information System (INIS)

    Jenkins, James

    2009-01-01

    Neutrinoless double beta decay (ββ0ν) is the only realistic probe of the Majorana nature of the neutrino. In the standard picture, its rate is proportional to m ee , the e-e element of the Majorana neutrino mass matrix in the flavor basis. I explore minimally allowed m ee values within the framework of mass matrix anarchy where neutrino parameters are defined statistically at low energies. Distributions of mixing angles are well defined by the Haar integration measure, but masses are dependent on arbitrary weighting functions and boundary conditions. I survey the integration measure parameter space and find that for sufficiently convergent weightings, m ee is constrained between (0.01-0.4) eV at 90% confidence. Constraints from neutrino mixing data lower these bounds. Singular integration measures allow for arbitrarily small m ee values with the remaining elements ill-defined, but this condition constrains the flavor structure of the model's ultraviolet completion. ββ0ν bounds below m ee ∼5x10 -3 eV should indicate symmetry in the lepton sector, new light degrees of freedom, or the Dirac nature of the neutrino.

  6. Double Gamow-Teller Transitions and its Relation to Neutrinoless β β Decay

    Science.gov (United States)

    Shimizu, Noritaka; Menéndez, Javier; Yako, Kentaro

    2018-04-01

    We study the double Gamow-Teller (DGT) strength distribution of 48Ca with state-of-the-art large-scale nuclear shell model calculations. Our analysis shows that the centroid energy of the DGT giant resonance depends mostly on the isovector pairing interaction, while the resonance width is more sensitive to isoscalar pairing. Pairing correlations are also key in neutrinoless β β (0 ν β β ) decay. We find a simple relation between the centroid energy of the 48Ca DGT giant resonance and the 0 ν β β decay nuclear matrix element. More generally, we observe a very good linear correlation between the DGT transition to the ground state of the final nucleus and the 0 ν β β decay matrix element. The correlation, which originates on the dominant short-range character of both transitions, extends to heavier systems including several β β emitters and also holds in energy-density functional results. Our findings suggest that DGT experiments can be a very valuable tool to obtain information on the value of 0 ν β β decay nuclear matrix elements.

  7. Few active mechanisms of the neutrinoless double beta-decay and effective mass of Majorana neutrinos

    CERN Document Server

    Simkovic, Fedor; Faessler, Amand

    2010-01-01

    It is well known that there exist many mechanisms that may contribute to neutrinoless double beta decay (0nbb-decay). By exploiting the fact that the associated nuclear matrix elements are target dependent we show that, given definite experimental results on a sufficient number of targets, one can determine or sufficiently constrain all lepton violating parameters including the mass term. As a specific example we show that, assuming the observation of the 0nbb-decay in three different nuclei, e.g., 76Ge, 100Mo and 130Te, and just three lepton number violating mechanisms (light and heavy neutrino mass mechanisms as well as R-parity breaking SUSY mechanism) being active, there are only four different solutions for the lepton violating parameters, provided that they are relatively real. In particular, assuming evidence of the 0nbb-decay of 76Ge, the effective neutrino Majorana mass |m_bb| can be almost uniquely extracted by utilizing other existing constraints (cosmological observations and tritium beta-decay ex...

  8. The NEXT-100 experiment for neutrinoless double beta decay searches (Conceptual Design Report)

    CERN Document Server

    Álvarez, V; Batallé, M; Bayarri, J; Borges, F I G; Cárcel, S; Carmona, J M; Castel, J; Catalá, J M; Cebrián, S; Cervera-Villanueva, A; Chan, D; Conde, C A N; Dafni, T; Dias, T H V T; Díaz, J; Esteve, R; Evtoukhovitch, P; Fernandes, L M P; Ferrario, P; Ferrer-Ribas, E; Ferreira, A L; Freitas, E D C; Gil, A; Giomataris, I; Goldschmidt, A; Gómez, E; Gómez, H; Gómez-Cadenas, J J; Gónzález, K; Gutiérrez, R M; Hernando-Morata, J A; Herrera, D C; Herrero, V; Iguaz, F; Irastorza, I G; Kalinnikov, V; Kustov, A; Liubarsky, I; Lopes, J A M; Lorca, D; Losada, M; Luzón, G; Martín-Albo, J; Méndez, A; Miller, T; Moisenko, A; Mols, J P; Monrabal, F; Monteiro, C M B; Monzó, J M; Mora, F J; Muñoz-Vidal, J; da Luz, H Natal; Navarro, G; Nebot, M; Nygren, D; Oliveira, C A B; Palma, R; Pérez-Aparicio, J L; Renner, J; Ripoll, L; Rodríguez, A; Rodríguez, J; Santos, F P; Santos, J M F dos; Seguí, L; Serra, L; Sofka, C; Sorel, M; Spieler, H; Toledo, J F; Tomás, A; Tsamalaidze, Z; Vázquez, D; Velicheva, E; Veloso, J F C A; Villar, J A; Webb, R; Weber, T; White, J; Yahlali, N

    2011-01-01

    We propose an EASY (Electroluminescent ApparatuS of high Yield) and SOFT (Separated Optimized FuncTion) time-projection chamber for the NEXT experiment, that will search for neutrinoless double beta decay (bb0nu) in Xe-136. Our experiment must be competitive with the new generation of bb0nu searches already in operation or in construction. This requires a detector with very good energy resolution (<1%), very low background con- tamination (1E-4 counts/(keV \\bullet kg \\bullet y)) and large target mass. In addition, it needs to be operational as soon as possible. The design described here optimizes energy resolution thanks to the use of proportional electroluminescent amplification (EL); it is compact, as the Xe gas is under high pressure; and it allows the measurement of the topological signature of the event to further reduce the background contamination. The SOFT design uses different sensors for tracking and calorimetry. We propose the use of SiPMs (MPPCs) coated with a suitable wavelength shifter for th...

  9. An investigation of proton pair correlations relevant to the neutrinoless double beta decay of 76Ge

    Science.gov (United States)

    Ticehurst, David R.

    The observation of neutrinoless double beta decay (0nubetabeta ) would demonstrate that the neutrino is a Majorana particle and allow determination of its mass by comparing the measured decay rate to the calculated rate. The main uncertainty in the calculation of the 0 nubetabeta rate is due to uncertainties in the nuclear structure models used in the computation of the nuclear matrix elements for the decay process. This project tested the validity of using wavefunctions for the nuclear states involved in the 0nubetabeta process that are based on a first-order application of the Bardeen-Cooper-Schrieffer (BCS) theory of superconductivity. In the BCS approximation, most of the strength for two-nucleon transfer reactions should be for transitions to the 0 + ground state of the final nucleus (i.e., little strength should go to the 0+ excited states). This experiment measured the strength to the first 0+ excited state for the 74Ge( 3He,n)76Se and 76Ge( 3He,n)78Se reactions relative to the strength for transition to the 0+ ground state in selenium. For both nuclei, and at 3He beam energies of 15 and 21 MeV, the observed relative strength for transfer to the first 0+ excited state was less than 13%. This result supports the validity of using the BCS approximation to describe the ground state of both 76Se and 78Se and is consistent with the results of recent ( 3He,n) cross section measurements on 74Ge and 76Ge. In addition, the magnitude and shape of the measured angular distributions suggest that contribution of the sequential two-nucleon transfer process, which is an indicator of long-range nucleon-nucleon correlations, is over-predicted by the DWBA code FRESCO.

  10. Probing new physics in the neutrinoless double beta decay using electron angular correlation

    Energy Technology Data Exchange (ETDEWEB)

    Ali, A. [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Borisov, A.V.; Zhuridov, D.V. [Moscow State Univ. (Russian Federation). Faculty of Physics

    2007-06-15

    The angular correlation of the electrons emitted in the neutrinoless double beta decay (0{nu}2{beta}) is presented using a general Lorentz invariant effective Lagrangian for the leptonic and hadronic charged weak currents. We show that the coefficient K in the angular correlation d{gamma}/dcos {theta} {proportional_to}(1-K cos {theta}) is essentially independent of the nuclear matrix element models and present its numerical values for the five nuclei of interest ({sup 76}Ge, {sup 82}Se, {sup 100}Mo, {sup 130}Te, and {sup 136}Xe), assuming that the 0{nu}2{beta}-decays in these nuclei are induced solely by a light Majorana neutrino, {nu}{sub M}. This coefficient varies between K=0.82 (for the {sup 76}Ge nucleus) and K=0.88 (for the {sup 82}Se and {sup 100}Mo nuclei), calculated taking into account the effects from the nucleon recoil, the S and P-waves for the outgoing electrons and the electron mass. Deviation of K from its values derived here would indicate the presence of New Physics (NP) in addition to a light Majorana neutrino, and we work out the angular coefficients in several {nu}{sub M}+NP scenarios for the {sup 76}Ge nucleus. As an illustration of the correlations among the 0{nu}2{beta} observables (half-life T{sub 1/2}, the coefficient K, and the effective Majorana neutrino mass vertical stroke left angle m right angle vertical stroke) and the parameters of the underlying NP model, we analyze the left-right symmetric models, taking into account current phenomenological bounds on the right-handed W{sub R}-boson mass and the left-right mixing parameter {zeta}. (orig.)

  11. Neutrinoless double beta decay in chiral effective field theory: lepton number violation at dimension seven

    Science.gov (United States)

    Cirigliano, V.; Dekens, W.; de Vries, J.; Graesser, M. L.; Mereghetti, E.

    2017-12-01

    We analyze neutrinoless double beta decay (0 νββ) within the framework of the Standard Model Effective Field Theory. Apart from the dimension-five Weinberg operator, the first contributions appear at dimension seven. We classify the operators and evolve them to the electroweak scale, where we match them to effective dimension-six, -seven, and -nine operators. In the next step, after renormalization group evolution to the QCD scale, we construct the chiral Lagrangian arising from these operators. We develop a power-counting scheme and derive the two-nucleon 0 νββ currents up to leading order in the power counting for each lepton-number-violating operator. We argue that the leading-order contribution to the decay rate depends on a relatively small number of nuclear matrix elements. We test our power counting by comparing nuclear matrix elements obtained by various methods and by different groups. We find that the power counting works well for nuclear matrix elements calculated from a specific method, while, as in the case of light Majorana neutrino exchange, the overall magnitude of the matrix elements can differ by factors of two to three between methods. We calculate the constraints that can be set on dimension-seven lepton-number-violating operators from 0 νββ experiments and study the interplay between dimension-five and -seven operators, discussing how dimension-seven contributions affect the interpretation of 0 νββ in terms of the effective Majorana mass m ββ .

  12. Search for the neutrinoless double beta decay (0νββ) of {sup 76}Ge: GERDA Phase II commissioning

    Energy Technology Data Exchange (ETDEWEB)

    Bode, Tobias [Physik-Department E15, Technische Universitaet Muenchen (Germany); Collaboration: GERDA-Collaboration

    2015-07-01

    After successful completion of Phase I the Gerda (Germanium Detector Array) experiment underwent a major upgrade of the experimental apparatus. These upgrades include additional 20 kg of custom-made detectors with improved background rejection capabilities, accompanied by improved front-end electronics and an active liquid argon scintillation light veto. A sensitivity on the neutrinoless double beta decay half-life (T{sub 1/2}{sup 0ν}) of 10{sup 26} yr should be reached after a few years of data taking (Phase II). First results of Phase II commissioning and latest results from Phase I analyses are presented in this talk.

  13. GERDA results and the future perspectives for the neutrinoless double beta decay search using 76Ge

    Science.gov (United States)

    Agostini, M.; Bakalyarov, A. M.; Balata, M.; Barabanov, I.; Baudis, L.; Bauer, C.; Bellotti, E.; Belogurov, S.; Bettini, A.; Bezrukov, L.; Biernat, J.; Bode, T.; Borowicz, D.; Brudanin, V.; Brugnera, R.; Caldwell, A.; Cattadori, C.; Chernogorov, A.; Comellato, T.; D’Andrea, V.; Demidova, E. V.; di Marco, N.; Domula, A.; Doroshkevich, E.; Egorov, V.; Gangapshev, A.; Garfagnini, A.; Giordano, M.; Grabmayr, P.; Gurentsov, V.; Gusev, K.; Hakenmüller, J.; Heisel, M.; Hemmer, S.; Hiller, R.; Hofmann, W.; Hult, M.; Inzhechik, L. V.; Janicskó Csáthy, J.; Jochum, J.; Junker, M.; Kazalov, V.; Kermaidic, Y.; Kihm, T.; Kirpichnikov, I. V.; Kirsch, A.; Klimenko, A.; Kneißl, R.; Knöpfle, K. T.; Kochetov, O.; Kornoukhov, V. N.; Kuzminov, V. V.; Laubenstein, M.; Lazzaro, A.; Lindner, M.; Lippi, I.; Lubashevskiy, A.; Lubsandorzhiev, B.; Lutter, G.; Macolino, C.; Majorovits, B.; Maneschg, W.; Miloradovic, M.; Mingazheva, R.; Misiaszek, M.; Moseev, P.; Nemchenok, I.; Panas, K.; Pandola, L.; Pelczar, K.; Pertoldi, L.; Pullia, A.; Ransom, C.; Riboldi, S.; Rumyantseva, N.; Sada, C.; Salamida, F.; Schneider, B.; Schönert, S.; Schreiner, J.; Schütz, A.-K.; Schulz, O.; Schwingenheuer, B.; Selivanenko, O.; Shevchik, E.; Shirchenko, M.; Simgen, H.; Smolnikov, A.; Stanco, L.; Vanhoefer, L.; Vasenko, A. A.; Veresnikova, A.; von Sturm, K.; Wagner, V.; Wegmann, A.; Wester, T.; Wiesinger, C.; Wojcik, M.; Yanovich, E.; Zhitnikov, I.; Zhukov, S. V.; Zinatulina, D.; Zschocke, A.; Zsigmond, A. J.; Zuber, K.; Zuzel, G.

    2018-03-01

    The GERmanium Detector Array (GERDA) is a low background experiment at the Laboratori Nazionali del Gran Sasso (LNGS) of INFN designed to search for the rare neutrinoless double beta decay (0νββ) of 76Ge. In the first phase (Phase I) of the experiment, high purity germanium diodes were operated in a “bare” mode and immersed in liquid argon. The overall background level of 10‑2cts/(keV ṡkg ṡyr) was a factor of ten better than those of its predecessors. No signal was found and a lower limit was set on the half-life for the 0νββ decay of 76Ge T1/20ν > 2.1 × 1025 yr (90% CL), while the corresponding median sensitivity was 2.4 × 1025 yr (90% CL). A second phase (Phase II) started at the end of 2015 after a major upgrade. Thanks to the increased detector mass and performance of the enriched germanium diodes and due to the introduction of liquid argon instrumentation techniques, it was possible to reduce the background down to 10‑3cts/(keV ṡkg ṡyr). After analyzing 23.2 kgṡyr of these new data no signal was seen. Combining these with the data from Phase I a stronger half-life limit of the 76Ge 0νββ decay was obtained: T1/20ν > 8.0 × 1025 yr (90% CL), reaching a sensitivity of 5.8 × 1025 yr (90% CL). Phase II will continue for the collection of an exposure of 100 kg ṡyr. If no signal is found by then the GERDA sensitivity will have reached 1.4 × 1026 yr for setting a 90% CL. limit. After the end of GERDA Phase II, the flagship experiment for the search of 0νββ decay of 76Ge will be LEGEND. LEGEND experiment is foreseen to deploy up to 1-ton of 76Ge. After ten years of data taking, it will reach a sensitivity beyond 1028 yr, and hence fully cover the inverted hierarchy region.

  14. The Search for Neutrinoless Double Beta Decay with 130Te with CUORE-0

    International Nuclear Information System (INIS)

    Ouellet, Jonathan Loren

    2015-01-01

    This thesis describes the design, operation and results of an experimental search for neutrinoless double beta decay (0νββ) of 130 Te using the CUORE-0 detector. The discovery of 0νββ would have profound implications for particle physics and our understanding of the Universe. Its discovery would demonstrate the violation of lepton number and imply that neutrinos are Majorana fermions and therefore their own anti-particles. Combined with other experimental results, the discovery of 0νββ could also have implications for understanding the absolute neutrino mass scale as well as the presently unknown neutrino mass hierarchy. The CUORE experiment is a ton-scale search for 0νββ in 130 Te expected to begin operation in late 2015. The first stage of this experiment is a smaller 39-kg active-mass detector called CUORE-0. This detector contains 11 kg of 130 Te and operates in the Laboratori Nazionali del Gran Sasso lab in Italy from 2013-2015. The results presented here are based on a nat TeO 2 exposure of 35.2 kg·yr, or 9.8 kg·yr exposure of 130 Te collected between 2013-2015. We see no evidence of 0νββ and place an upper limit on the 0νββ decay rate of Γ 0νββ <0.25x10 24 yr 1 (90 % C.L.), corresponding to a lower limit on the half-life of T 1/2 0ν >2.8x10 24 yr (90 % C.L.). We combine the present result with the results of previous searches in 130 Te. Combining it with the 1.2 kg·Te exposure from the Three Towers Test run we place a half-life limit of T 1/2 03 ν>3.3x10 24 yr (90 % C.L.). And combining these results with the 19.75 kg·yr 130 Te exposure from Cuoricino, we place the strongest limit on the 0νββ half-life of 130 Te to date, at T 1/2 0ν >4.5x10 24 yr (90 % C.L.). Using the present nuclear matrix element calculations for 130 Te, this result corresponds to a 90 % upper limit range on the effective Majorana mass of m ββ <250-710 meV.

  15. Change of nuclear configurations in the neutrinoless double-β decay of 130Te →130Be and 136Xe136Ba

    Science.gov (United States)

    Entwisle, J. P.; Kay, B. P.; Tamii, A.; Adachi, S.; Aoi, N.; Clark, J. A.; Freeman, S. J.; Fujita, H.; Fujita, Y.; Furuno, T.; Hashimoto, T.; Hoffman, C. R.; Ideguchi, E.; Ito, T.; Iwamoto, C.; Kawabata, T.; Liu, B.; Miura, M.; Ong, H. J.; Schiffer, J. P.; Sharp, D. K.; Süsoy, G.; Suzuki, T.; Szwec, S. V.; Takaki, M.; Tsumura, M.; Yamamoto, T.

    2016-06-01

    The change in the configuration of valence protons between the initial and final states in the neutrinoless double-β decay of 130Te → 130Be and of 136Xe136Ba has been determined by measuring the cross sections of the (d ,3He) reaction with 101-MeV deuterons. Together with our recent determination of the relevant neutron configurations involved in the process, a quantitative comparison with the latest shell-model and interacting-boson-model calculations reveals significant discrepancies. These are the same calculations used to determine the nuclear matrix elements governing the rate of neutrinoless double-β decay in these systems.

  16. Results on neutrinoless double beta decay search in GERDA. Background modeling and limit setting

    Energy Technology Data Exchange (ETDEWEB)

    Becerici Schmidt, Neslihan

    2014-07-22

    The search for the neutrinoless double beta decay (0νββ) process is primarily motivated by its potential of revealing the possible Majorana nature of the neutrino, in which the neutrino is identical to its antiparticle. It has also the potential to yield information on the intrinsic properties of neutrinos, if the underlying mechanism is the exchange of a light Majorana neutrino. The Gerda experiment is searching for 0νββ decay of {sup 76}Ge by operating high purity germanium (HPGe) detectors enriched in the isotope {sup 76}Ge (∝ 87%), directly in ultra-pure liquid argon (LAr). The first phase of physics data taking (Phase I) was completed in 2013 and has yielded 21.6 kg.yr of data. A background index of B∼10{sup -2} cts/(keV.kg.yr) at Q{sub ββ}=2039 keV has been achieved. A comprehensive background model of the Phase I energy spectrum is presented as the major topic of this dissertation. Decomposition of the background energy spectrum into the individual contributions from different processes provides many interesting physics results. The specific activity of {sup 39}Ar has been determined. The obtained result, A=(1.15±0.11) Bq/kg, is in good agreement with the values reported in literature. The contribution from {sup 42}K decays in LAr to the background spectrum has yielded a {sup 42}K({sup 42}Ar) specific activity of A=(106.2{sub -19.2}{sup +12.7}) μBq/kg, for which only upper limits exist in literature. The analysis of high energy events induced by α decays in the {sup 226}Ra chain indicated a total {sup 226}Ra activity of (3.0±0.9) μBq and a total initial {sup 210}Po activity of (0.18±0.01) mBq on the p{sup +} surfaces of the enriched semi-coaxial HPGe detectors. The half life of the two-neutrino double beta (2νββ) decay of {sup 76}Ge has been determined as T{sub 1/2}{sup 2ν}=(1.926±0.094).10{sup 21} yr, which is in good agreement with the result that was obtained with lower exposure and has been published by the Gerda collaboration

  17. Results on neutrinoless double beta decay search in GERDA. Background modeling and limit setting

    International Nuclear Information System (INIS)

    Becerici Schmidt, Neslihan

    2014-01-01

    The search for the neutrinoless double beta decay (0νββ) process is primarily motivated by its potential of revealing the possible Majorana nature of the neutrino, in which the neutrino is identical to its antiparticle. It has also the potential to yield information on the intrinsic properties of neutrinos, if the underlying mechanism is the exchange of a light Majorana neutrino. The Gerda experiment is searching for 0νββ decay of 76 Ge by operating high purity germanium (HPGe) detectors enriched in the isotope 76 Ge (∝ 87%), directly in ultra-pure liquid argon (LAr). The first phase of physics data taking (Phase I) was completed in 2013 and has yielded 21.6 kg.yr of data. A background index of B∼10 -2 cts/(keV.kg.yr) at Q ββ =2039 keV has been achieved. A comprehensive background model of the Phase I energy spectrum is presented as the major topic of this dissertation. Decomposition of the background energy spectrum into the individual contributions from different processes provides many interesting physics results. The specific activity of 39 Ar has been determined. The obtained result, A=(1.15±0.11) Bq/kg, is in good agreement with the values reported in literature. The contribution from 42 K decays in LAr to the background spectrum has yielded a 42 K( 42 Ar) specific activity of A=(106.2 -19.2 +12.7 ) μBq/kg, for which only upper limits exist in literature. The analysis of high energy events induced by α decays in the 226 Ra chain indicated a total 226 Ra activity of (3.0±0.9) μBq and a total initial 210 Po activity of (0.18±0.01) mBq on the p + surfaces of the enriched semi-coaxial HPGe detectors. The half life of the two-neutrino double beta (2νββ) decay of 76 Ge has been determined as T 1/2 2ν =(1.926±0.094).10 21 yr, which is in good agreement with the result that was obtained with lower exposure and has been published by the Gerda collaboration. According to the model, the background in Q ββ ±5 keV window is resulting from close

  18. Nd loaded liquid scintillator to search for 150Nd neutrinoless double beta decay

    International Nuclear Information System (INIS)

    Barabanov, I; Bezrukov, L; Yanovich, E; Cattadori, C; Danilov, N; Di Vacri, A; Ianni, A; Nisi, S; Ortica, F; Romani, A; Salvo, C; Smirnov, O

    2008-01-01

    The 150 Nd is considered one of the most attractive candidate for searching neutrinoless double beta (0νββ-) decay, thanks to its high Q-value (3.367 MeV), that makes the external background issue less significative respect to other isotopes, and favorable computed matrix elements. The isotopic abundance of this isotope in natural neodimium is only 5.6% and up to now, it has been investigated only in low mass experiments. The next step is to increase the sensitivity of the experiments using larger mass of neodymium (10 ton-1 kton). This could be possible with a Nd loaded liquid scintillator (LS). At the Gran Sasso National Laboratory (LNGS), a joint INFN (Istituto Nazionale di Fisica Nucleare) and INR (Institute for Nuclear Research of Moscow) working group has been carrying out since 2001 an R and D activity aiming to develop organic liquid scintillators (LS) doped with metals. The achieved know-how and the satisfactory results obtained both with In and Gd allowed to face the development and production of Nd doped LS. The development of metal doped LS is challenging because the metal has to be embedded in a proper organic system that makes it soluble in an organic solvent minimizing the impact of the metal-organic compound on the optical and scintillation properties of the LS. A further challenge in the case of Nd is the presence of absorption bands of this element in the optical region with a transparent region around 400 nm, which is about at the maximum of the scintillator emission spectrum. A 2.5 1 Nd loaded LS has been produced diluting an originally developed Nd-Carboxylic (Nd-CBX) salt in pseudocumene (PC), the solvent of the Borexino liquid scintillator. The measured light yield, at [Nd] = 6.5 g/1 and [PPO] = 1.5 g/1, is ∼ 75% of pure PC at the same fluor concentration (∼ 10000 ph/MeV). The Nd doped LS has been tested in a 2 1 quartz cell (wrapped by VM2000 reflector film) having dimensions 5x5x100 cm 3 . The light propagates in the cell by total

  19. Radiative corrections to light neutrino masses in low scale type I seesaw scenarios and neutrinoless double beta decay

    Energy Technology Data Exchange (ETDEWEB)

    Lopez-Pavon, J. [SISSA and INFN - sezione di Trieste, via Bonomea 265, 34136 Trieste (Italy); Molinaro, E. [CP-Origins and Danish Institute for Advanced Study, University of Southern Denmark,Campusvej 55, DK-5230 Odense M (Denmark); Petcov, S.T. [SISSA and INFN - sezione di Trieste, via Bonomea 265, 34136 Trieste (Italy); Kavli IPMU (WPI), University of Tokyo, 5-1-5 Kashiwanoha, 277-8583 Kashiwa (Japan)

    2015-11-05

    We perform a detailed analysis of the one-loop corrections to the light neutrino mass matrix within low scale type I seesaw extensions of the Standard Model and their implications in experimental searches for neutrinoless double beta decay. We show that a sizable contribution to the effective Majorana neutrino mass from the exchange of heavy Majorana neutrinos is always possible, provided one requires a fine-tuned cancellation between the tree-level and one-loop contribution to the light neutrino masses. We quantify the level of fine-tuning as a function of the seesaw parameters and introduce a generalisation of the Casas-Ibarra parametrization of the neutrino Yukawa matrix, which easily allows to include the one-loop corrections to the light neutrino masses.

  20. Fast-neutron-induced potential background near the Q value of neutrinoless double-β decay of 76Ge

    Science.gov (United States)

    Tornow, W.; Bhike, Megha; Fallin, B.; Krishichayan

    2016-01-01

    The 76Ge (n,p)76Ga reaction and the subsequent β decay of 76Ga to 76Ge has been used to excite the 3951.89-keV state of 76Ge , which decays by the emission of a 2040.70-keV γ ray. Using high-purity germanium detectors, the associated pulse-height signal may be undistinguishable from the potential signal produced in neutrinoless double-β decay of 76Ge with its Q value of 2039.0 keV. At 20-MeV neutron energy the production cross section of the 2040.70-keV γ ray is approximately 0.1 mb.

  1. Extending two Higgs doublet models for two-loop neutrino mass generation and one-loop neutrinoless double beta decay

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Zhen, E-mail: liu-zhen@sjtu.edu.cn; Gu, Pei-Hong, E-mail: peihong.gu@sjtu.edu.cn

    2017-02-15

    We extend some two Higgs doublet models, where the Yukawa couplings for the charged fermion mass generation only involve one Higgs doublet, by two singlet scalars respectively carrying a singly electric charge and a doubly electric charge. The doublet and singlet scalars together can mediate a two-loop diagram to generate a tiny Majorana mass matrix of the standard model neutrinos. Remarkably, the structure of the neutrino mass matrix is fully determined by the symmetric Yukawa couplings of the doubly charged scalar to the right-handed leptons. Meanwhile, a one-loop induced neutrinoless double beta decay can arrive at a testable level even if the electron neutrino has an extremely small Majorana mass. We also study other experimental constraints and implications including some rare processes and Higgs phenomenology.

  2. Extending two Higgs doublet models for two-loop neutrino mass generation and one-loop neutrinoless double beta decay

    Directory of Open Access Journals (Sweden)

    Zhen Liu

    2017-02-01

    Full Text Available We extend some two Higgs doublet models, where the Yukawa couplings for the charged fermion mass generation only involve one Higgs doublet, by two singlet scalars respectively carrying a singly electric charge and a doubly electric charge. The doublet and singlet scalars together can mediate a two-loop diagram to generate a tiny Majorana mass matrix of the standard model neutrinos. Remarkably, the structure of the neutrino mass matrix is fully determined by the symmetric Yukawa couplings of the doubly charged scalar to the right-handed leptons. Meanwhile, a one-loop induced neutrinoless double beta decay can arrive at a testable level even if the electron neutrino has an extremely small Majorana mass. We also study other experimental constraints and implications including some rare processes and Higgs phenomenology.

  3. Neutrinoless double-β decay matrix elements in large shell-model spaces with the generator-coordinate method

    Science.gov (United States)

    Jiao, C. F.; Engel, J.; Holt, J. D.

    2017-11-01

    We use the generator-coordinate method (GCM) with realistic shell-model interactions to closely approximate full shell-model calculations of the matrix elements for the neutrinoless double-β decay of 48Ca, 76Ge, and 82Se. We work in one major shell for the first isotope, in the f5 /2p g9 /2 space for the second and third, and finally in two major shells for all three. Our coordinates include not only the usual axial deformation parameter β , but also the triaxiality angle γ and neutron-proton pairing amplitudes. In the smaller model spaces our matrix elements agree well with those of full shell-model diagonalization, suggesting that our Hamiltonian-based GCM captures most of the important valence-space correlations. In two major shells, where exact diagonalization is not currently possible, our matrix elements are only slightly different from those in a single shell.

  4. Search for the neutrinoless double β-decay in GERDA phase I using a pulse shape discrimination technique

    International Nuclear Information System (INIS)

    Kirsch, Andrea

    2014-01-01

    The Germanium Detector Array (Gerda) experiment, located underground at the INFN Laboratori Nazionali del Gran Sasso (LNGS) in Italy, deploys high-purity germanium detectors to search for the neutrinoless double β-decay (0νββ) of 76 Ge. An observation of this lepton number violating process, which is expected by many extensions of the Standard Model, would not only generate a fundamental shift in our understanding of particle physics, but also unambiguously prove the neutrino to have a non-vanishing Majorana mass component. A first phase of data recording lasted from November 2011 to May 2013 - resulting in a total exposure (defined as the product of detector mass and measurement time) of 21.6 kg.yr. Within this thesis a thorough study of this data with special emphasis on the development and scrutiny of an active background suppression technique by means of a signal shape analysis has been performed. Among several investigated multivariate approaches, particularly a selection algorithm based on an artificial neural network is found to yield the best performance; i.a. the background index close to the Q-value of the 0νββ-decay could be suppressed by 45% to 1.10 -2 cts/(keV.kg.yr), while still retaining a considerably high signal survival fraction of (83±3)% leading to a significant improvement of the experimental sensitivity. The efficiency is derived by a simulation and further validated by substantiated consistency checks availing themselves of measurements taken with different calibration sources and physics data. No signal is observed and a new lower limit of T 0ν 1/2 (90%C.L.)> 2.2. 10 25 yr for the half-life of neutrinoless double β-decay of 76 Ge is established.

  5. Search for the neutrinoless double β-decay in GERDA phase I using a pulse shape discrimination technique

    Energy Technology Data Exchange (ETDEWEB)

    Kirsch, Andrea

    2014-07-09

    The Germanium Detector Array (Gerda) experiment, located underground at the INFN Laboratori Nazionali del Gran Sasso (LNGS) in Italy, deploys high-purity germanium detectors to search for the neutrinoless double β-decay (0νββ) of {sup 76}Ge. An observation of this lepton number violating process, which is expected by many extensions of the Standard Model, would not only generate a fundamental shift in our understanding of particle physics, but also unambiguously prove the neutrino to have a non-vanishing Majorana mass component. A first phase of data recording lasted from November 2011 to May 2013 - resulting in a total exposure (defined as the product of detector mass and measurement time) of 21.6 kg.yr. Within this thesis a thorough study of this data with special emphasis on the development and scrutiny of an active background suppression technique by means of a signal shape analysis has been performed. Among several investigated multivariate approaches, particularly a selection algorithm based on an artificial neural network is found to yield the best performance; i.a. the background index close to the Q-value of the 0νββ-decay could be suppressed by 45% to 1.10{sup -2} cts/(keV.kg.yr), while still retaining a considerably high signal survival fraction of (83±3)% leading to a significant improvement of the experimental sensitivity. The efficiency is derived by a simulation and further validated by substantiated consistency checks availing themselves of measurements taken with different calibration sources and physics data. No signal is observed and a new lower limit of T{sup 0ν}{sub 1/2} (90%C.L.)> 2.2. 10{sup 25} yr for the half-life of neutrinoless double β-decay of {sup 76}Ge is established.

  6. Development of {sup 100}Mo-containing scintillating bolometers for a high-sensitivity neutrinoless double-beta decay search

    Energy Technology Data Exchange (ETDEWEB)

    Armengaud, E.; Gros, M.; Herve, S.; Magnier, P.; Navick, X.F.; Nones, C.; Paul, B.; Penichot, Y.; Zolotarova, A.S. [Universite Paris-Saclay, IRFU, CEA, Gif-sur-Yvette (France); Augier, C.; Billard, J.; Cazes, A.; Charlieux, F.; Jesus, M. de; Gascon, J.; Juillard, A.; Queguiner, E.; Sanglard, V.; Vagneron, L. [Univ Lyon, Universite Lyon 1, CNRS/IN2P3, IPN-Lyon, Villeurbanne (France); Barabash, A.S.; Konovalov, S.I.; Umatov, V.I. [National Research Centre Kurchatov Institute, Institute of Theoretical and Experimental Physics, Moscow (Russian Federation); Beeman, J.W. [Lawrence Berkeley National Laboratory, Berkeley, CA (United States); Bekker, T.B. [V.S. Sobolev Institute of Geology and Mineralogy of the Siberian Branch of the RAS, Novosibirsk (Russian Federation); Bellini, F.; Ferroni, F. [Sapienza Universita di Roma, Dipartimento di Fisica, Rome (Italy); INFN, Sezione di Roma, Rome (Italy); Benoit, A.; Camus, P. [CNRS-Neel, Grenoble (France); Berge, L.; Chapellier, M.; Dumoulin, L.; Humbert, V.; Le Sueur, H.; Marcillac, P. de; Marnieros, S.; Marrache-Kikuchi, C.; Novati, V.; Olivieri, E.; Plantevin, O. [CSNSM, Univ. Paris-Sud, CNRS/IN2P3, Universite Paris-Saclay, Orsay (France); Bergmann, T.; Kleifges, M.; Tcherniakhovski, D.; Weber, M. [Karlsruhe Institute of Technology, Institut fuer Prozessdatenverarbeitung und Elektronik, Karlsruhe (Germany); Boiko, R.S.; Danevich, F.A.; Kobychev, V.V.; Nikolaichuk, M.O.; Tretyak, V.I. [Institute for Nuclear Research, Kyiv (Ukraine); Broniatowski, A. [CSNSM, Univ. Paris-Sud, CNRS/IN2P3, Universite Paris-Saclay, Orsay (France); Karlsruhe Institute of Technology, Institut fuer Experimentelle Teilchenphysik, Karlsruhe (Germany); Brudanin, V.; Rozov, S.; Yakushev, E. [JINR, Laboratory of Nuclear Problems, Dubna, Moscow Region (Russian Federation); Capelli, S.; Gironi, L.; Pavan, M.; Pessina, G. [Universita di Milano Bicocca, Dipartimento di Fisica, Milan (Italy); INFN, Sezione di Milano Bicocca, Milan (Italy); Cardani, L.; Casali, N.; Dafinei, I.; Tomei, C.; Vignati, M. [INFN, Sezione di Roma, Rome (Italy); Chernyak, D.M. [Institute for Nuclear Research, Kyiv (Ukraine); The University of Tokyo, Kavli Institute for the Physics and Mathematics of the Universe (WPI), The University of Tokyo Institutes for Advanced Study, Kashiwa, Chiba (Japan); Combarieu, M. de; Pari, P. [Universite Paris-Saclay, IRAMIS, CEA, Gif-sur-Yvette (France); Coron, N.; Redon, T. [Universite Paris-Sud, IAS, CNRS, Orsay (France); Devoyon, L.; Koskas, F.; Strazzer, O. [Universite Paris-Saclay, Orphee, CEA, Gif-sur-Yvette (France); Di Domizio, S. [Universita di Genova, Dipartimento di Fisica, Genoa (Italy); INFN Sezione di Genova, Genoa (Italy); Eitel, K.; Siebenborn, B. [Karlsruhe Institute of Technology, Institut fuer Kernphysik, Karlsruhe (Germany); Enss, C.; Fleischmann, A.; Gastaldo, L. [Heidelberg University, Kirchhoff Institute for Physics, Heidelberg (Germany); Foerster, N.; Kozlov, V. [Karlsruhe Institute of Technology, Institut fuer Experimentelle Teilchenphysik, Karlsruhe (Germany); Giuliani, A. [CSNSM, Univ. Paris-Sud, CNRS/IN2P3, Universite Paris-Saclay, Orsay (France); Universita dell' Insubria, DISAT, Como (Italy); Grigorieva, V.D.; Ivannikova, N.V.; Ivanov, I.M.; Makarov, E.P.; Shlegel, V.N.; Vasiliev, Ya.V. [Nikolaev Institute of Inorganic Chemistry, Novosibirsk (Russian Federation); Hehn, L. [Lawrence Berkeley National Laboratory, Berkeley, CA (United States); Karlsruhe Institute of Technology, Institut fuer Kernphysik, Karlsruhe (Germany); Jin, Y. [Laboratoire de Photonique et de Nanostructures, CNRS, Marcoussis (France); Kraus, H. [University of Oxford, Department of Physics, Oxford (United Kingdom); Kudryavtsev, V.A. [University of Sheffield, Department of Physics and Astronomy, Sheffield (United Kingdom); Laubenstein, M.; Nagorny, S.; Pattavina, L.; Pirro, S. [INFN, Laboratori Nazionali del Gran Sasso, Assergi, AQ (Italy); Loidl, M.; Rodrigues, M. [CEA-Saclay, CEA, LIST, Laboratoire National Henri Becquerel (LNE-LNHB), Gif-sur-Yvette Cedex (France); Mancuso, M. [CSNSM, Univ. Paris-Sud, CNRS/IN2P3, Universite Paris-Saclay, Orsay (France); Universita dell' Insubria, DISAT, Como (Italy); Max-Planck-Institut fuer Physik, Munich (Germany); Pagnanini, L.; Schaeffner, K. [INFN, Laboratori Nazionali del Gran Sasso, Assergi, AQ (Italy); INFN, Gran Sasso Science Institute, L' Aquila (Italy); Piperno, G. [INFN, Laboratori Nazionali di Frascati, Rome (Italy); Poda, D.V. [CSNSM, Univ. Paris-Sud, CNRS/IN2P3, Universite Paris-Saclay, Orsay (France); Institute for Nuclear Research, Kyiv (Ukraine); Rusconi, C. [INFN, Laboratori Nazionali del Gran Sasso, Assergi, AQ (Italy); University of South Carolina, Department of Physics and Astronomy, Columbia, SC (United States); Scorza, S. [Karlsruhe Institute of Technology, Institut fuer Experimentelle Teilchenphysik, Karlsruhe (Germany); SNOLAB, Lively, ON (Canada); Velazquez, M. [Universite de Bordeaux, ICMCB, CNRS, Pessac (France)

    2017-11-15

    This paper reports on the development of a technology involving {sup 100}Mo-enriched scintillating bolometers, compatible with the goals of CUPID, a proposed next-generation bolometric experiment to search for neutrinoless double-beta decay. Large mass (∝ 1 kg), high optical quality, radiopure {sup 100}Mo-containing zinc and lithium molybdate crystals have been produced and used to develop high performance single detector modules based on 0.2-0.4 kg scintillating bolometers. In particular, the energy resolution of the lithium molybdate detectors near the Q-value of the double-beta transition of {sup 100}Mo (3034 keV) is 4-6 keV FWHM. The rejection of the α-induced dominant background above 2.6 MeV is better than 8σ. Less than 10 μBq/kg activity of {sup 232}Th({sup 228}Th) and {sup 226}Ra in the crystals is ensured by boule recrystallization. The potential of {sup 100}Mo-enriched scintillating bolometers to perform high sensitivity double-beta decay searches has been demonstrated with only 10 kg x d exposure: the two neutrino double-beta decay half-life of {sup 100}Mo has been measured with the up-to-date highest accuracy as T{sub 1/2} = [6.90 ± 0.15(stat.) ± 0.37(syst.)] x 10{sup 18} years. Both crystallization and detector technologies favor lithium molybdate, which has been selected for the ongoing construction of the CUPID-0/Mo demonstrator, containing several kg of {sup 100}Mo. (orig.)

  7. PandaX-III: Searching for neutrinoless double beta decay with high pressure 136Xe gas time projection chambers

    Science.gov (United States)

    Chen, Xun; Fu, ChangBo; Galan, Javier; Giboni, Karl; Giuliani, Franco; Gu, LingHui; Han, Ke; Ji, XiangDong; Lin, Heng; Liu, JiangLai; Ni, KaiXiang; Kusano, Hiroki; Ren, XiangXiang; Wang, ShaoBo; Yang, Yong; Zhang, Dan; Zhang, Tao; Zhao, Li; Sun, XiangMing; Hu, ShouYang; Jian, SiYu; Li, XingLong; Li, XiaoMei; Liang, Hao; Zhang, HuanQiao; Zhao, MingRui; Zhou, Jing; Mao, YaJun; Qiao, Hao; Wang, SiGuang; Yuan, Ying; Wang, Meng; Khan, Amir N.; Raper, Neill; Tang, Jian; Wang, Wei; Dong, JiaNing; Feng, ChangQing; Li, Cheng; Liu, JianBei; Liu, ShuBin; Wang, XiaoLian; Zhu, DanYang; Castel, Juan F.; Cebrián, Susana; Dafni, Theopisti; Garza, Javier G.; Irastorza, Igor G.; Iguaz, Francisco J.; Luzón, Gloria; Mirallas, Hector; Aune, Stephan; Berthoumieux, Eric; Bedfer, Yann; Calvet, Denis; d'Hose, Nicole; Delbart, Alain; Diakaki, Maria; Ferrer-Ribas, Esther; Ferrero, Andrea; Kunne, Fabienne; Neyret, Damien; Papaevangelou, Thomas; Sabatié, Franck; Vanderbroucke, Maxence; Tan, AnDi; Haxton, Wick; Mei, Yuan; Kobdaj, Chinorat; Yan, Yu-Peng

    2017-06-01

    Searching for the neutrinoless double beta decay (NLDBD) is now regarded as the topmost promising technique to explore the nature of neutrinos after the discovery of neutrino masses in oscillation experiments. PandaX-III (particle and astrophysical xenon experiment III) will search for the NLDBD of 136Xe at the China Jin Ping Underground Laboratory (CJPL). In the first phase of the experiment, a high pressure gas Time Projection Chamber (TPC) will contain 200 kg, 90% 136Xe enriched gas operated at 10 bar. Fine pitch micro-pattern gas detector (Microbulk Micromegas) will be used at both ends of the TPC for the charge readout with a cathode in the middle. Charge signals can be used to reconstruct the electron tracks of the NLDBD events and provide good energy and spatial resolution. The detector will be immersed in a large water tank to ensure 5 m of water shielding in all directions. The second phase, a ton-scale experiment, will consist of five TPCs in the same water tank, with improved energy resolution and better control over backgrounds.

  8. Neutron-induced Backgrounds in 134Xe for Large-Scale Neutrinoless Double-Beta Decay Experiments

    Science.gov (United States)

    Moriguchi, Nina; Kidd, Mary; Tornow, Werner

    2016-09-01

    136Xe is used in large neutrinoless double-beta (0 νββ) decay experiments, such as KamLAND- Zen and EXO 200. Though highly purified, 136Xe still contains a significant amount of 134Xe. Recently, a new nuclear energy level was found in 134Xe. If 134Xe decays from this proposed excited state, it will emit a 2485.7 keV gamma ray. Because this energy lies near the region of interest of 136Xe νββ decay experiments (Q value 2457.8 keV), it could make a significant contribution to the background. A purified gaseous sample of 134Xe will be irradiated with neutrons of an incident energy of 4.0 MeV at Triangle Universities Nuclear Laboratory and monitored with high-purity germanium detectors. The spectra obtained from these detectors will be analyzed for the presence of the 2581 keV gamma ray. We will report on the status of this experiment. Future plans include expanding this measurement to higher initial neutron energies. Tennesse Tech University CISE Grant program.

  9. Discovery potential of xenon-based neutrinoless double beta decay experiments in light of small angular scale CMB observations

    International Nuclear Information System (INIS)

    Gómez-Cadenas, J.J.; Martín-Albo, J.; Vidal, J. Muñoz; Peña-Garay, C.

    2013-01-01

    The South Pole Telescope (SPT) has probed an expanded angular range of the CMB temperature power spectrum. Their recent analysis of the latest cosmological data prefers nonzero neutrino masses, with Σm ν = (0.32±0.11) eV. This result, if confirmed by the upcoming Planck data, has deep implications on the discovery of the nature of neutrinos. In particular, the values of the effective neutrino mass m ββ involved in neutrinoless double beta decay (ββ0ν) are severely constrained for both the direct and inverse hierarchy, making a discovery much more likely. In this paper, we focus in xenon-based ββ0ν experiments, on the double grounds of their good performance and the suitability of the technology to large-mass scaling. We show that the current generation, with effective masses in the range of 100 kg and conceivable exposures in the range of 500 kg·year, could already have a sizeable opportunity to observe ββ0ν events, and their combined discovery potential is quite large. The next generation, with an exposure in the range of 10 ton·year, would have a much more enhanced sensitivity, in particular due to the very low specific background that all the xenon technologies (liquid xenon, high-pressure xenon and xenon dissolved in liquid scintillator) can achieve. In addition, a high-pressure xenon gas TPC also features superb energy resolution. We show that such detector can fully explore the range of allowed effective Majorana masses, thus making a discovery very likely

  10. Predictions for the Majorana CP violation phases in the neutrino mixing matrix and neutrinoless double beta decay

    Science.gov (United States)

    Girardi, I.; Petcov, S. T.; Titov, A. V.

    2016-10-01

    We obtain predictions for the Majorana phases α21 / 2 and α31 / 2 of the 3 × 3 unitary neutrino mixing matrix U = Ue† Uν, Ue and Uν being the 3 × 3 unitary matrices resulting from the diagonalisation of the charged lepton and neutrino Majorana mass matrices, respectively. We focus on forms of Ue and Uν permitting to express α21 / 2 and α31 / 2 in terms of the Dirac phase δ and the three neutrino mixing angles of the standard parametrisation of U, and the angles and the two Majorana-like phases ξ21 / 2 and ξ31 / 2 present, in general, in Uν. The concrete forms of Uν considered are fixed by, or associated with, symmetries (tri-bimaximal, bimaximal, etc.), so that the angles in Uν are fixed. For each of these forms and forms of Ue that allow to reproduce the measured values of the three neutrino mixing angles θ12, θ23 and θ13, we derive predictions for phase differences (α21 / 2 -ξ21 / 2), (α31 / 2 -ξ31 / 2), etc., which are completely determined by the values of the mixing angles. We show that the requirement of generalised CP invariance of the neutrino Majorana mass term implies ξ21 = 0 or π and ξ31 = 0 or π. For these values of ξ21 and ξ31 and the best fit values of θ12, θ23 and θ13, we present predictions for the effective Majorana mass in neutrinoless double beta decay for both neutrino mass spectra with normal and inverted ordering.

  11. The effective neutrino mass of neutrinoless double-beta decays: how possible to fall into a well

    Energy Technology Data Exchange (ETDEWEB)

    Xing, Zhi-zhong [University of Chinese Academy of Sciences, Institute of High Energy Physics and School of Physical Sciences, Beijing (China); Peking University, Center of High Energy Physics, Beijing (China); Zhao, Zhen-hua [Liaoning Normal University, Department of Physics, Dalian (China)

    2017-03-15

    The neutrinoless double-beta (0ν2β) decay is currently the only feasible process in particle and nuclear physics to probe whether massive neutrinos are the Majorana fermions. If they are of a Majorana nature and have a normal mass ordering, the effective neutrino mass term left angle m right angle {sub ee} of a 0ν2β decay may suffer significant cancellations among its three components and thus sink into a decline, resulting in a ''well'' in the three-dimensional graph of vertical stroke left angle m right angle {sub ee} vertical stroke against the smallest neutrino mass m{sub 1} and the relevant Majorana phase ρ. We present a new and complete analytical understanding of the fine issues inside such a well, and identify a novel threshold of vertical stroke left angle m right angle {sub ee} vertical stroke in terms of the neutrino masses and flavor mixing angles: vertical stroke left angle m right angle {sub ee} vertical stroke {sub *} = m{sub 3}sin{sup 2}θ{sub 13} in connection with tanθ{sub 12} = √(m{sub 1}/m{sub 2}) and ρ = π. This threshold point, which links the local minimum and maximum of vertical stroke left angle m right angle {sub ee} vertical stroke, can be used to signify observability or sensitivity of the future 0ν2β-decay experiments. Given current neutrino oscillation data, the possibility of vertical stroke left angle m right angle {sub ee} vertical stroke < vertical stroke left angle m right angle {sub ee} vertical stroke {sub *} is found to be very small. (orig.)

  12. LUCIFER: A Scintillating Bolometer Array for the Search of Neutrinoless Double Beta Decay

    International Nuclear Information System (INIS)

    Cardani, L

    2012-01-01

    One of the main limitations in the study of 0vDBD is the presence of a radioactive background in the energy region of interest. This limit can be overcome by the technological approach of the LUCIFER project, which is based the double read-out of the heat and scintillation light produced by ZnSe scintillating bolometers. This experiment aims at a background lower than 10 −3 counts/keV/kg/y in the energy region of the 0νDBD of 82 Se. Such a low background level will provide a sensitivity on the effective neutrino mass of the order of 100 meV. In the following, the results of the recent R and D activity are discussed, the single module for the LUCIFER detector is described, and the process for the production of 82 Se-enriched ZnSe crystals is presented.

  13. Probing flavor models with {sup 76}Ge-based experiments on neutrinoless double-β decay

    Energy Technology Data Exchange (ETDEWEB)

    Agostini, Matteo [Technische Universitaet Muenchen, Physik Department and Excellence Cluster Universe, Munich (Germany); Gran Sasso Science Institute (INFN), L' Aquila (Italy); Merle, Alexander [Max-Planck-Institut fuer Physik (Werner-Heisenberg-Institut), Munich (Germany); Zuber, Kai [Technische Universitaet Dresden, Institute for Nuclear and Particle Physics, Dresden (Germany)

    2016-04-15

    The physics impact of a staged approach for double-β decay experiments based on {sup 76}Ge is studied. The scenario considered relies on realistic time schedules envisioned by the Gerda and the Majorana collaborations, which are jointly working towards the realization of a future larger scale {sup 76}Ge experiment. Intermediate stages of the experiments are conceived to perform quasi background-free measurements, and different data sets can be reliably combined to maximize the physics outcome. The sensitivity for such a global analysis is presented, with focus on how neutrino flavor models can be probed already with preliminary phases of the experiments. The synergy between theory and experiment yields strong benefits for both sides: the model predictions can be used to sensibly plan the experimental stages, and results from intermediate stages can be used to constrain whole groups of theoretical scenarios. This strategy clearly generates added value to the experimental efforts, while at the same time it allows to achieve valuable physics results as early as possible. (orig.)

  14. The 76Ge(n,p)76Ga reaction and its relevance to searches for the neutrino-less double-beta decay of 76Ge

    Science.gov (United States)

    Tornow, W.; Bhike, Megha; Fallin, B.; Krishichayan, Fnu

    2015-10-01

    The 76Ge(n,p)76Ga reaction and the subsequent β decay of 76Ga to 76Ge has been used to excite the 3951.9 keV state of 76Ge, which decays by emission of a 2040.7 keV γ ray. Using HPGe detectors, the associated pulse-height signal may be undistinguishable from the potential signal produced in neutrino-less double-beta decay of 76Ge with its Q-value of 2039.0 keV. In the neutron energy range between 10 and 20 MeV the production cross section of the 2040.7 keV γ ray is approximately 0.1 mb. In the same experiment γ rays of energy 2037.9 keV resulting from the 76Ge(n, γ)77Ge reaction were clearly observed. Adding the 76Ge(n,n' γ)76Ge reaction, which also produces the 2040.7 keV γ ray with a cross section value of the order of 0.1 mb clearly shows that great care has to be taken to eliminate neutron-induced backgrounds in searches for neutrino-less double-beta decay of 76Ge. This work was supported by the U.S. DOE under Grant NO. DE-FG02-97ER41033.

  15. First test of an enriched {sup 116}CdWO{sub 4} scintillating bolometer for neutrinoless double-beta-decay searches

    Energy Technology Data Exchange (ETDEWEB)

    Barabash, A.S.; Konovalov, S.I.; Umatov, V.I. [ITEP, National Research Centre ' ' Kurchatov Institute' ' , Moscow (Russian Federation); Danevich, F.A. [MSP, Institute for Nuclear Research, Kyiv (Ukraine); Gimbal-Zofka, Y. [Univ. Paris-Sud, CNRS/IN2P3, Universite Paris-Saclay, CSNSM, Orsay (France); Linnaeus University, Department of Physics and Electrical Engineering, Kalmar (Sweden); Giuliani, A.; Mancuso, M. [Univ. Paris-Sud, CNRS/IN2P3, Universite Paris-Saclay, CSNSM, Orsay (France); DISAT, Universita dell' Insubria, Como (Italy); Marcillac, P. de; Marnieros, S.; Novati, V.; Olivieri, E. [Univ. Paris-Sud, CNRS/IN2P3, Universite Paris-Saclay, CSNSM, Orsay (France); Nones, C.; Zolotarova, A.S. [DSM/IRFU, CEA Saclay, Gif-sur-Yvette Cedex (France); Poda, D.V. [MSP, Institute for Nuclear Research, Kyiv (Ukraine); Univ. Paris-Sud, CNRS/IN2P3, Universite Paris-Saclay, CSNSM, Orsay (France); Shlegel, V.N. [Nikolaev Institute of Inorganic Chemistry, Novosibirsk (Russian Federation); Tretyak, V.I. [MSP, Institute for Nuclear Research, Kyiv (Ukraine); INFN, Sezione di Roma, Rome (Italy)

    2016-09-15

    For the first time, a cadmium tungstate crystal scintillator enriched in {sup 116}Cd has been succesfully tested as a scintillating bolometer. The measurement was performed above ground at a temperature of 18 mK. The crystal mass was 34.5 g and the enrichment level ∝ 82 %. Despite a substantial pile-up effect due to above-ground operation, the detector demonstrated high energy resolution (2-7 keV FWHM in 0.2-2.6 MeV γ energy range and 7.5 keV FWHM at the {sup 116}Cd double-beta decay transition energy of 2813 keV), a powerful particle identification capability and a high level of internal radio-purity. These results prove that cadmium tungstate is a promising detector material for a next-generation neutrinoless double-beta decay bolometric experiment, like that proposed in the CUPID project (CUORE Upgrade with Particle IDentification). (orig.)

  16. Analysis method for the search for neutrinoless double beta decay in the NEMO3 experiment: study of the background and first results

    International Nuclear Information System (INIS)

    Etienvre, A.I.

    2003-04-01

    The NEMO3 detector, installed in the Frejus Underground Laboratory, is dedicated to the study of neutrinoless double beta decay: the observation of this process would sign the massive and Majorana nature of neutrino. The experiment consists in very thin central source foils (the total mass is equal to 10 kg), a tracking detector made of drift cells operating in Geiger mode, a calorimeter made of plastic scintillators associated to photomultipliers, a coil producing a 30 gauss magnetic field and two shields, dedicated to the reduction of the γ-ray and neutron fluxes. In the first part, I describe the implications of several mechanisms, related to trilinear R-parity violation, on double beta decay. The second part is dedicated to a detailed study of the tracking detector of the experiment: after a description of the different working tests, I present the determination of the characteristics of the tracking reconstruction (transverse and longitudinal resolution, by Geiger cell and precision on vertex determination, charge recognition). The last part corresponds to the analysis of the data taken by the experiment. On the one hand, an upper limit on the Tl 208 activity of the sources has been determined: it is lower than 68 mBq/kg, at 90% of confidence level. On the other hand, I have developed and tested on these data a method in order to analyse the neutrinoless double beta decay signal; this method is based on a maximum of likelihood using all the available information. Using this method, I could determine a first and very preliminary upper limit on the effective mass of the neutrino. (author)

  17. Results of a search for the neutrinoless double beta decay of 76Ge to the first excited state of 76Se

    International Nuclear Information System (INIS)

    Morales, A.; Morales, J.; Nunez-Lagos, R.; Puimedon, J.; Villar, J.A.; Larrea, A.

    1988-01-01

    A search for the neutrinoless double beta decay of 76 Ge to the first excited state E=559.1 KeV of 76 Se has been carried out in the Frejus tunnel using a coincidence technique between Ge and NaI detectors. No peak has been observed in the electron energy spectrum at the value of 1482 KeV. That implies a half-life lower limit of 6 x 10 22 years. However the experimental data display a coincidence, at the level of 2.5 σ, between an energy deposition of 1483.7 ± 0.5 KeV in the Ge detector and 558 ± 15 KeV in the NaI detector. The main features of such a coincidence effect are analysed and, in spite of its small statistical significance, its possible interpretation is discussed

  18. Study of the background of the neutrinoless double {beta} decay with the detector NEMO 2: contribution arising from the radon diffusion and internal pollution of the source {sup 214}Bi have been estimated; Etude du bruit de fond de la double-desintegration {beta} sans emission de neutrino dans le detecteur NEMO 2: contribution du radon ambiant et mesure de la pollution interne de la source en {sup 214}Bi

    Energy Technology Data Exchange (ETDEWEB)

    Mauger, F.

    1995-02-01

    The NEMO experiment is designed to understand the nature of the neutrino by studying the double beta decay of Mo-100 which is related to the Majorana neutrino effective mass. In this kind of experiment a good understanding of the different sources of background is crucial as only few events are expected per year at the required level of sensitivity. In this thesis we present the main theoretical and experimental aspects of the measurement of the neutrinoless double beta decay of Mo-100 with the prototype detector NEMO2. The goal of this study is to obtain a realistic interpretation of the few events detected at high energy in the two-electron channel as a background to neutrinoless double beta decay. In particular, the contribution arising from Bi-214 has been investigated. These events have been selected and analysed by means of the beta-alpha decays of Bi-214 into Pb-210. The events are characterized by a delayed track in the wire chamber and the corresponding signal is rather clean. The study has demonstrated the diffusion of Rn-222 into the detector and its contribution to Bi-214 pollution has been estimated. A measurement of the Bi-214 internal contamination of the source has been made as well as an estimation of the Bi-214 deposit due to Rn-222. As a result of this study it appears that, under the conditions of the NEMO2 experiment, the Bi and Rn contributions are of the same order of magnitude as the background induced at high energy by two-neutrino double beta decay. In conclusion, the backgrounds of the neutrinoless double beta decay of Mo-100 are well understood in the NEMO2 experiment leading to an extrapolation for the NEMO3 experiment. (authors).

  19. The Majorana Demonstrator: Progress towards showing the feasibility of a tonne-scale 76Ge neutrinoless double-beta decay experiment

    Science.gov (United States)

    Finnerty, P.; Aguayo, E.; Amman, M.; Avignone, F. T., Iii; Barabash, A. S.; Barton, P. J.; Beene, J. R.; Bertrand, F. E.; Boswell, M.; Brudanin, V.; Busch, M.; Chan, Y.-D.; Christofferson, C. D.; Collar, J. I.; Combs, D. C.; Cooper, R. J.; Detwiler, J. A.; Doe, P. J.; Efremenko, Yu; Egorov, V.; Ejiri, H.; Elliott, S. R.; Esterline, J.; Fast, J. E.; Fields, N.; Fraenkle, F. M.; Galindo-Uribarri, A.; Gehman, V. M.; Giovanetti, G. K.; Green, M. P.; Guiseppe, V. E.; Gusey, K.; Hallin, A. L.; Hazama, R.; Henning, R.; Hoppe, E. W.; Horton, M.; Howard, S.; Howe, M. A.; Johnson, R. A.; Keeter, K. J.; Kidd, M. F.; Knecht, A.; Kochetov, O.; Konovalov, S. I.; Kouzes, R. T.; LaFerriere, B. D.; Leon, J.; Leviner, L. E.; Loach, J. C.; Luke, P. N.; MacMullin, S.; Marino, M. G.; Martin, R. D.; Merriman, J. H.; Miller, M. L.; Mizouni, L.; Nomachi, M.; Orrell, J. L.; Overman, N. R.; Perumpilly, G.; Phillips, D. G., Ii; Poon, A. W. P.; Radford, D. C.; Rielage, K.; Robertson, R. G. H.; Ronquest, M. C.; Schubert, A. G.; Shima, T.; Shirchenko, M.; Snavely, K. J.; Steele, D.; Strain, J.; Timkin, V.; Tornow, W.; Varner, R. L.; Vetter, K.; Vorren, K.; Wilkerson, J. F.; Yakushev, E.; Yaver, H.; Young, A. R.; Yu, C.-H.; Yumatov, V.; Majorana Collaboration

    2014-03-01

    The Majorana Demonstrator will search for the neutrinoless double-beta decay (0vββ) of the 76Ge isotope with a mixed array of enriched and natural germanium detectors. The observation of this rare decay would indicate the neutrino is its own anti-particle, demonstrate that lepton number is not conserved, and provide information on the absolute mass-scale of the neutrino. The Demonstrator is being assembled at the 4850 foot level of the Sanford Underground Research Facility in Lead, South Dakota. The array will be contained in a low-background environment and surrounded by passive and active shielding. The goals for the Demonstrator are: demonstrating a background rate less than 3 t-1 y-1 in the 4 keV region of interest (ROI) surrounding the 2039 keV 76Ge endpoint energy; establishing the technology required to build a tonne-scale germanium based double-beta decay experiment; testing the recent claim of observation of 0vββ [1]; and performing a direct search for light WIMPs (3-10 GeV/c2).

  20. Surface Alpha Interactions in P-Type Point-Contact HPGe Detectors: Maximizing Sensitivity of 76Ge Neutrinoless Double-Beta Decay Searches

    Science.gov (United States)

    Gruszko, Julieta

    Though the existence of neutrino oscillations proves that neutrinos must have non-zero mass, Beyond-the-Standard-Model physics is needed to explain the origins of that mass. One intriguing possibility is that neutrinos are Majorana particles, i.e., they are their own anti-particles. Such a mechanism could naturally explain the observed smallness of the neutrino masses, and would have consequences that go far beyond neutrino physics, with implications for Grand Unification and leptogenesis. If neutrinos are Majorana particles, they could undergo neutrinoless double-beta decay (0nBB), a hypothesized rare decay in which two antineutrinos annihilate one another. This process, if it exists, would be exceedingly rare, with a half-life over 1E25 years. Therefore, searching for it requires experiments with extremely low background rates. One promising technique in the search for 0nBB is the use of P-type point-contact (P-PC) high-purity Germanium (HPGe) detectors enriched in 76Ge, operated in large low-background arrays. This approach is used, with some key differences, by the MAJORANA and GERDA Collaborations. A problematic background in such large granular detector arrays is posed by alpha particles incident on the surfaces of the detectors, often caused by 222Rn contamination of parts or of the detectors themselves. In the MAJORANA DEMONSTRATOR, events have been observed that are consistent with energy-degraded alphas originating near the passivated surface of the detectors, leading to a potential background contribution in the region-of-interest for neutrinoless double-beta decay. However, it is also observed that when energy deposition occurs very close to the passivated surface, high charge trapping occurs along with subsequent slow charge re-release. This leads to both a reduced prompt signal and a measurable change in slope of the tail of a recorded pulse. Here we discuss the characteristics of these events and the development of a filter that can identify the

  1. Addendum to: ''The SNO solar neutrino data, neutrinoless double beta-decay and neutrino mass spectrum'' [Phys. Lett. B 544 (2002) 239

    International Nuclear Information System (INIS)

    Pascoli, S.; Petcov, S.T.

    2004-01-01

    We update our earlier study [Phys. Lett. B 544 (2002) 239], which was inspired by the 2002 SNO data, on the implications of the results of the solar neutrino experiments for the predictions of the effective Majorana mass in neutrinoless double beta-decay, vertical bar vertical bar. We obtain predictions for vertical bar vertical bar using the values of the neutrino oscillation parameters, obtained in the analyzes of the presently available solar neutrino data, including the just published data from the salt phase of the SNO experiment, the atmospheric neutrino and CHOOZ data and the first data from the KamLAND experiment. The main conclusion reached in the previous study [Phys. Lett. B 544 (2002) 239] of the existence of significant lower bounds on vertical bar vertical bar in the cases of neutrino mass spectrum of inverted hierarchical (IH) and quasi-degenerate (QD) type is strongly reinforced by fact that combined solar neutrino data (i) exclude the possibility of cos2θ o =0 at more than 5 s.d., (ii) determine as a best fit value cos2θ o =0.40, and (iii) imply at 95% C.L. that cos2θ o ∼>0.22, θ o being the solar neutrino mixing angle. For the IH and QD spectra we get using, e.g., the 90% C.L. allowed ranges of values of the oscillation parameters, vertical bar vertical bar ∼>0.010 eV and vertical bar vertical bar ∼>0.043 eV, respectively. We also comment on the possibility to get information on the neutrino mass spectrum and on the CP-violation in the lepton sector due to Majorana CP-violating phases

  2. Analysis of the data from the NEMO3 experiment and search for neutrinoless double beta decay - Study of systematic bias of the calorimeter and development of analysis tools

    International Nuclear Information System (INIS)

    Hugon, C.

    2012-11-01

    The NEMO3 experiment was researching the neutrinoless double-β (0ndb) decay by using various sources of double beta decay isotopes (mainly 100 Mo, 82 Se, 116 Cd and 130 Te for about 10 kg in total). The detector was located in the underground laboratory of Modane (Italy) in the halfway point of the Frejus tunnel. This experiment demonstrated that the 'tracko-calo' technology is really competitive and, in addition, it gives new results for the 2-neutrinos double-β (2ndb) decay and the (0ndb) decays research. Moreover it opened an new way for its successor SuperNEMO, which aim is to reach a mass of 100 kg of 82 Se (for a sensitivity of 10 26 years). The main goal of the thesis is to measure the 2ndb and 0ndb decay of the 100 Mo to the excited state 0 1 + of the 100 Ru thanks to the whole NEMO3 data, with new original methods of analysis and through the development of the collaboration analysis software. The results obtained for the ground states (gs) and excited states 2ndb of the 100 Mo are for the half-lives: T(2nbd, gs)=[7.05±0.01(stat)±0.54(syst)]*10 18 years and T(2ndb, 0 1 + )=[6.15±1.1(sta)±0.78]*10 20 years. Those results are compatibles with the last ones published by the collaboration. For the 0ndb(0 1 + ), this work gave a half-life of T(0ndb, 0 1 + ) > 2.6*10 23 years, improving significantly the last published results. Furthermore those methods also allowed to present a new and more exhaustive background noise model for this experiment. The second point of this work was to measure the systematics errors of the NEMO3 calorimeter, among others due to the wavelength of the NEMO3 calibration systems. This work was done using a new test bench based on LED. This bench also allowed to contribute to the development of the SuperNEMO calorimeter, especially in the time characteristic and the energy linearity measurement of the photomultiplier intended to the demonstrator of the experiments. (author)

  3. Search for evidence of lepton number violation by neutrinoless double beta decay process from 82Se and 150Nd in NEMO-3 experiment: Bi-Po decay study from thoron chain

    International Nuclear Information System (INIS)

    Lemiere, Y.

    2008-09-01

    The NEMO-3 experiment searches for a neutrinoless double beta decay signal (ββ0ν) with an expected sensitivity in terms of the half-life limit of the order of 10 24 years. The discovery of this signal, forbidden in the Standard Model, would imply the violation of leptonic number conservation and would allow to determine the nature of this particle (Dirac or Majorana) and measure the neutrino mass scale. The goal of this work is to study high energy events from 82 Se and 150 Nd ββ decay used in NEMO-3 detector. The first part of this work consists in the elaboration of a background model using NEMO-3 data. In the second part, the ββ2ν half-life and a lower limit of the ββ0ν half-life are computed using massive Majorana neutrino exchange hypothesis, we have got: T(0ν) > 1.44*10 22 years for 150 Nd and T(0ν) > 1.82*10 23 years for 82 Se. The upper limits for the effective mass of the Majorana neutrinos are also computed, we obtain: m ββ 150 Nd and m ββ 82 Se. In the last part, the measurement of some specific thallium contamination is performed thanks to the NEMO-3 capability to detect the 212 Bi-Po decay. The measured value of the surface contamination of the calorimeter is about (150 ± 30) μBq/m 3 . So the surface contamination is too low to intervene in the data analysis of NEMO-3 but appears important for next generation scintillators

  4. Structure of nuclear transition matrix elements for neutrinoless ...

    Indian Academy of Sciences (India)

    Abstract. The structure of nuclear transition matrix elements (NTMEs) required for the study of neutrinoless double- decay within light Majorana neutrino mass mechanism is disassembled in the PHFB model. The NTMEs are calculated using a set of HFB intrinsic wave functions, the reliability of which has been previously ...

  5. Structure of nuclear transition matrix elements for neutrinoless ...

    Indian Academy of Sciences (India)

    Abstract. The structure of nuclear transition matrix elements (NTMEs) required for the study of neutrinoless double-β decay within light Majorana neutrino mass mechanism is disassembled in the PHFB model. The NTMEs are calculated using a set of HFB intrinsic wave functions, the reliability of which has been previously ...

  6. Neutron-capture cross-section measurements of 74Ge and 76Ge in the energy region 0.4-14.8 MeV for neutrinoless double β decay applications

    Science.gov (United States)

    Bhike, Megha; Tornow, Werner

    2013-10-01

    Fast neutron capture cross sections for the reactions 74Ge(n, γ)75Ge and 76Ge(n, γ)77Ge have been measured in the neutron energy region 0.4-14.8 MeV with the activation method. The results are important to identify backgrounds in the neutrinoless double- β decay experiments GERDA and MAJORANA, which use germanium as both source and detector. Isotopically enriched targets which consisted of 86% of 76Ge and 14% of 74Ge were irradiated with mono-energetic neutrons produced via 3H(p,n)3He, 2H(d,n)3He and 3H(d,n)4He reactions. The cross sections were determined relative to 197Au(n, γ)198Au, 115In(n,n')115mIn and 197Au(n,2n)196Au standard cross sections. The activities of the products were measured using high-resolution γ-ray spctroscopy. The present results are compared with the evaluated data from ENDF/B-VII.1 and TALYS.

  7. Analysis techniques for the evaluation of the neutrinoless double- β decay lifetime in Te130 with the CUORE-0 detector

    Energy Technology Data Exchange (ETDEWEB)

    Alduino, C.; Alfonso, K.; Artusa, D. R.; Avignone, F. T.; Azzolini, O.; Banks, T. I.; Bari, G.; Beeman, J. W.; Bellini, F.; Bersani, A.; Biassoni, M.; Brofferio, C.; Bucci, C.; Caminata, A.; Canonica, L.; Cao, X. G.; Capelli, S.; Cappelli, L.; Carbone, L.; Cardani, L.; Carniti, P.; Casali, N.; Cassina, L.; Chiesa, D.; Chott, N.; Clemenza, M.; Copello, S.; Cosmelli, C.; Cremonesi, O.; Creswick, R. J.; Cushman, J. S.; Dafinei, I.; Dally, A.; Davis, C. J.; Dell' Oro, S.; Deninno, M. M.; Di Domizio, S.; Di Vacri, M. L.; Drobizhev, A.; Fang, D. Q.; Faverzani, M.; Fernandes, G.; Ferri, E.; Ferroni, F.; Fiorini, E.; Freedman, S. J.; Fujikawa, B. K.; Giachero, A.; Gironi, L.; Giuliani, A.; Gladstone, L.; Gorla, P.; Gotti, C.; Gutierrez, T. D.; Haller, E. E.; Han, K.; Hansen, E.; Heeger, K. M.; Hennings-Yeomans, R.; Hickerson, K. P.; Huang, H. Z.; Kadel, R.; Keppel, G.; Kolomensky, Yu. G.; Lim, K. E.; Liu, X.; Ma, Y. G.; Maino, M.; Marini, L.; Martinez, M.; Maruyama, R. H.; Mei, Y.; Moggi, N.; Morganti, S.; Mosteiro, P. J.; Nones, C.; Norman, E. B.; Nucciotti, A.; O' Donnell, T.; Orio, F.; Ouellet, J. L.; Pagliarone, C. E.; Pallavicini, M.; Palmieri, V.; Pattavina, L.; Pavan, M.; Pessina, G.; Pettinacci, V.; Piperno, G.; Pirro, S.; Pozzi, S.; Previtali, E.; Rosenfeld, C.; Rusconi, C.; Sala, E.; Sangiorgio, S.; Santone, D.; Scielzo, N. D.; Singh, V.; Sisti, M.; Smith, A. R.; Taffarello, L.; Tenconi, M.; Terranova, F.; Tomei, C.; Trentalange, S.; Ventura, G.; Vignati, M.; Wagaarachchi, S. L.; Wang, B. S.; Wang, H. W.; Wilson, J.; Winslow, L. A.; Wise, T.; Woodcraft, A.; Zanotti, L.; Zhang, G. Q.; Zhu, B. X.; Zimmermann, S.; Zucchelli, S.

    2016-04-25

    We describe in detail the methods used to obtain the lower bound on the lifetime of neutrinoless double-beta ( 0 ν β β ) decay in 130 Te and the associated limit on the effective Majorana mass of the neutrino using the CUORE-0 detector. CUORE-0 is a bolometric detector array located at the Laboratori Nazionali del Gran Sasso that was designed to validate the background reduction techniques developed for CUORE, a next-generation experiment scheduled to come online in 2016. CUORE-0 is also a competitive 0 ν β β decay search in its own right and functions as a platform to further develop the analysis tools and procedures to be used in CUORE. These include data collection, event selection and processing, as well as an evaluation of signal efficiency. In particular, we describe the amplitude evaluation, thermal gain stabilization, energy calibration methods, and the analysis event selection used to create our final 0 ν β β search spectrum. We define our high level analysis procedures, with emphasis on the new insights gained and challenges encountered. We outline in detail our fitting methods near the hypothesized 0 ν β β decay peak and catalog the main sources of systematic uncertainty. Finally, we derive the 0 ν β β decay half-life limits previously reported for CUORE-0, T 0 ν 1 / 2 > 2.7 × 10 24 yr , and in combination with the Cuoricino limit, T 0 ν 1 / 2 > 4.0 × 10 24 yr .

  8. Probabilistic double guarantee kidnapping detection in SLAM.

    Science.gov (United States)

    Tian, Yang; Ma, Shugen

    2016-01-01

    For determining whether kidnapping has happened and which type of kidnapping it is while a robot performs autonomous tasks in an unknown environment, a double guarantee kidnapping detection (DGKD) method has been proposed. The good performance of DGKD in a relative small environment is shown. However, a limitation of DGKD is found in a large-scale environment by our recent work. In order to increase the adaptability of DGKD in a large-scale environment, an improved method called probabilistic double guarantee kidnapping detection is proposed in this paper to combine probability of features' positions and the robot's posture. Simulation results demonstrate the validity and accuracy of the proposed method.

  9. Analysis method for the search for neutrinoless double beta decay in the NEMO3 experiment: study of the background and first results; Methode d'analyse pour la recherche de la double desintegration {beta} sans emission de neutrinos dans l'experience NEMO3. Etude du bruit de fond et premiers resultats

    Energy Technology Data Exchange (ETDEWEB)

    Etienvre, A I

    2003-04-15

    The NEMO3 detector, installed in the Frejus Underground Laboratory, is dedicated to the study of neutrinoless double beta decay: the observation of this process would sign the massive and Majorana nature of neutrino. The experiment consists in very thin central source foils (the total mass is equal to 10 kg), a tracking detector made of drift cells operating in Geiger mode, a calorimeter made of plastic scintillators associated to photomultipliers, a coil producing a 30 gauss magnetic field and two shields, dedicated to the reduction of the {gamma}-ray and neutron fluxes. In the first part, I describe the implications of several mechanisms, related to trilinear R-parity violation, on double beta decay. The second part is dedicated to a detailed study of the tracking detector of the experiment: after a description of the different working tests, I present the determination of the characteristics of the tracking reconstruction (transverse and longitudinal resolution, by Geiger cell and precision on vertex determination, charge recognition). The last part corresponds to the analysis of the data taken by the experiment. On the one hand, an upper limit on the Tl{sup 208} activity of the sources has been determined: it is lower than 68 mBq/kg, at 90% of confidence level. On the other hand, I have developed and tested on these data a method in order to analyse the neutrinoless double beta decay signal; this method is based on a maximum of likelihood using all the available information. Using this method, I could determine a first and very preliminary upper limit on the effective mass of the neutrino. (author)

  10. Analysis method for the search for neutrinoless double beta decay in the NEMO3 experiment: study of the background and first results; Methode d'analyse pour la recherche de la double desintegration {beta} sans emission de neutrinos dans l'experience NEMO3. Etude du bruit de fond et premiers resultats

    Energy Technology Data Exchange (ETDEWEB)

    Etienvre, A.I

    2003-04-15

    The NEMO3 detector, installed in the Frejus Underground Laboratory, is dedicated to the study of neutrinoless double beta decay: the observation of this process would sign the massive and Majorana nature of neutrino. The experiment consists in very thin central source foils (the total mass is equal to 10 kg), a tracking detector made of drift cells operating in Geiger mode, a calorimeter made of plastic scintillators associated to photomultipliers, a coil producing a 30 gauss magnetic field and two shields, dedicated to the reduction of the {gamma}-ray and neutron fluxes. In the first part, I describe the implications of several mechanisms, related to trilinear R-parity violation, on double beta decay. The second part is dedicated to a detailed study of the tracking detector of the experiment: after a description of the different working tests, I present the determination of the characteristics of the tracking reconstruction (transverse and longitudinal resolution, by Geiger cell and precision on vertex determination, charge recognition). The last part corresponds to the analysis of the data taken by the experiment. On the one hand, an upper limit on the Tl{sup 208} activity of the sources has been determined: it is lower than 68 mBq/kg, at 90% of confidence level. On the other hand, I have developed and tested on these data a method in order to analyse the neutrinoless double beta decay signal; this method is based on a maximum of likelihood using all the available information. Using this method, I could determine a first and very preliminary upper limit on the effective mass of the neutrino. (author)

  11. Detecting double compression of audio signal

    Science.gov (United States)

    Yang, Rui; Shi, Yun Q.; Huang, Jiwu

    2010-01-01

    MP3 is the most popular audio format nowadays in our daily life, for example music downloaded from the Internet and file saved in the digital recorder are often in MP3 format. However, low bitrate MP3s are often transcoded to high bitrate since high bitrate ones are of high commercial value. Also audio recording in digital recorder can be doctored easily by pervasive audio editing software. This paper presents two methods for the detection of double MP3 compression. The methods are essential for finding out fake-quality MP3 and audio forensics. The proposed methods use support vector machine classifiers with feature vectors formed by the distributions of the first digits of the quantized MDCT (modified discrete cosine transform) coefficients. Extensive experiments demonstrate the effectiveness of the proposed methods. To the best of our knowledge, this piece of work is the first one to detect double compression of audio signal.

  12. Exploration of the neutrinoless double beta decay of 136Xe nucleus by the 'KamLAND-Zen' experiment. Results of the first phase and future prospect

    International Nuclear Information System (INIS)

    Yamada, Satoru; Shirai, Junpei

    2013-01-01

    Exploration of the double beta decay without neutrino production (0 ν ββ decay) has come to be considered as one of the clues to the new physics beyond the standard model in the recent years. Searching for this phenomenon is the only possible method to verify if the neutrino itself be the equal particle of the antineutrino (Majorana particle) or not. If this decay process is found, it is the discovery of the nonconservative process of the total lepton number which goes beyond the standard theory. At the same time, it confirms that the neutrinos are the Majorana particles. In addition, from the decay half-lives, the absolute value of neutrino mass and hierarchy as well as the new knowledge of the CP violation in the lepton sector are expected to be obtained. Further progress is expected toward the development of the research of the particle creation mechanism at the beginning of the universe. Strong competitions are now being developed throughout the world to become the first to discover the phenomenon to go beyond the standard theory. In this text, the underground facility of KamLAND-Zen experiment with remodeled KamLAND detector with large amount of 136 Xe isotope is introduced and the results of the data obtained and analyzed by June 2012 are reported. Future prospect is described finally. (S. Funahashi)

  13. Search for neutrinoless τ decays

    International Nuclear Information System (INIS)

    Albrecht, H.; Ehrlichmann, H.; Hamacher, T.; Krueger, A.; Nau, A.; Nippe, A.; Nowak, S.; Reidenbach, M.; Schaefer, M.; Schroeder, H.; Schulz, H.D.; Walter, M.; Wurth, R.; Appuhn, R.D.; Hast, C.; Herrera, G.; Kolanoski, H.; Lange, A.; Lindner, A.; Mankel, R.; Schieber, M.; Siegmund, T.; Spaan, B.; Thurn, H.; Toepfer, D.; Walther, A.; Wegener, D.; Britton, D.I.; Charlesworth, C.E.K.; Edwards, K.W.; Hyatt, E.R.F.; Kapitza, H.; Krieger, P.; MacFarlane, D.B.; Patel, P.M.; Prentice, J.D.; Saull, P.R.B.; Seidel, S.C.; Tzamariudaki, K.; Van de Water, R.G.; Yoon, T.S.; Ressing, D.; Schmidtler, M.; Schneider, M.; Schubert, K.R.; Strahl, K.; Waldi, R.; Weseler, S.

    1992-01-01

    Upper limits on branching ratios for six neutrinoless leptonic, 16 semileptonic, two radiative-leptonic, two radiative-hadronic and three purely hadronic τ decays have been determined. The results improve over previously published ones by about a factor of two. For the first time the lepton and baryon number violating decays τ - →anti pγ, τ - →anti pπ 0 and τ - →anti pη have been investigated. The 90% confidence level (CL) limits for the corresponding branching ratios amount to 2.9x10 -4 , 6.6x10 -4 and 1.3x10 -3 respectively. (orig.)

  14. Search for neutrinoless τ decays

    International Nuclear Information System (INIS)

    Albrecht, H.; Ehrlichmann, H.; Hamacher, T.; Krueger, A.; Nau, A.; Nippe, A.; Nowak, S.; Reidenbach, M.; Schaefer, M.; Schroeder, H.; Schulz, H.D.; Walter, M.; Wurth, R.; Appuhn, R.D.; Hast, C.; Herrera, G.; Kolanoski, H.; Lange, A.; Lindner, A.; Mankel, R.; Schieber, M.; Siegmund, T.; Spaan, B.; Thurn, H.; Toepfer, D.; Walther, A.; Wegener, D.; Britton, D.I.; Charlesworth, C.E.K.; Edwards, K.W.; Hyatt, E.R.F.; Kapitza, H.; Krieger, P.; MacFarlane, D.B.; Patel, P.M.; Prentice, J.D.; Saull, P.R.B.; Seidel, S.C.; Tzamariudaki, K.; Van de Water, R.G.; Yoon, T.S.; Ressling, D.; Schmidtler, M.; Schneider, M.; Schubert, K.R.; Strahl, K.; Waldi, R.; Weseler, S.

    1992-01-01

    Upper limits on branching ratios for six neutrinoless leptonic, 16 semileptonic, two radiative-leptonic, two radiative-hadronic and three purely hardronic τ decays have been determined. The results improve over previously published ones by about a factor of two. For the first time the lepton and baryon previously published ones by about a factor of two. For the first time the lepton and baryon number violating decays τ - →anti pγ, τ - →anti pπ 0 and τ - →anti pη have been investigated. The 90% confidence level (CL) limits for the corresponding branching ratios amount to 2.9x10 -4 , 6.6x10 -4 and 1.3x10 -3 respectively. (orig.)

  15. Double beta decay: experiments

    International Nuclear Information System (INIS)

    Fiorini, Ettore

    2006-01-01

    The results obtained so far and those of the running experiments on neutrinoless double beta decay are reviewed. The plans for second generation experiments, the techniques to be adopted and the expected sensitivities are compared and discussed

  16. GERDA, a GERmanium Detector Array for the search for neutrinoless ββ decay in 76Ge

    International Nuclear Information System (INIS)

    Pandola, L.; Tomei, C.

    2006-01-01

    The GERDA project, searching for neutrinoless double beta-decay of 76Ge with enriched germanium detectors submerged in a cryogenic bath, has been approved for installation at the Gran Sasso National Laboratory (LNGS), Italy. The GERDA technique is aiming at a dramatic reduction of the background due to radioactive contaminations of the materials surrounding the detectors. This will lead to a sensitivity of about 1026 years on the half-life of neutrinoless double beta decay. Already in the first phase of the experiment, GERDA will be able to investigate with high statistical significance the claimed evidence for neutrinoless double beta decay of 76Ge based on the data of the Heidelberg-Moscow experiment

  17. Limit on neutrinoless ββ decay of 136Xe from the first phase of KamLAND-Zen and comparison with the positive claim in 76Ge.

    Science.gov (United States)

    Gando, A; Gando, Y; Hanakago, H; Ikeda, H; Inoue, K; Ishidoshiro, K; Kato, R; Koga, M; Matsuda, S; Mitsui, T; Motoki, D; Nakada, T; Nakamura, K; Obata, A; Oki, A; Ono, Y; Otani, M; Shimizu, I; Shirai, J; Suzuki, A; Takemoto, Y; Tamae, K; Ueshima, K; Watanabe, H; Xu, B D; Yamada, S; Yoshida, H; Kozlov, A; Yoshida, S; Banks, T I; Freedman, S J; Fujikawa, B K; Han, K; O'Donnell, T; Berger, B E; Efremenko, Y; Karwowski, H J; Markoff, D M; Tornow, W; Detwiler, J A; Enomoto, S; Decowski, M P

    2013-02-08

    We present results from the first phase of the KamLAND-Zen double-beta decay experiment, corresponding to an exposure of 89.5 kg yr of (136)Xe. We obtain a lower limit for the neutrinoless double-beta decay half-life of T(1/2)(0ν)>1.9×10(25) yr at 90% C.L. The combined results from KamLAND-Zen and EXO-200 give T(1/2)(0ν)>3.4×10(25) yr at 90% C.L., which corresponds to a Majorana neutrino mass limit of <(120-250) meV based on a representative range of available matrix element calculations. Using those calculations, this result excludes the Majorana neutrino mass range expected from the neutrinoless double-beta decay detection claim in (76)Ge, reported by a part of the Heidelberg-Moscow Collaboration, at more than 97.5% C.L.

  18. Project for detecting the double beta decay of 136Xe

    International Nuclear Information System (INIS)

    Miyajima, M.; Sasaki, S.; Tawara, H.

    1992-01-01

    For detecting the nuclear double beta decay of 136 Xe, a liquid-xenon positive-ion collector and a time-of-flight mass spectrometer are under development for detecting the decay product 136 Ba. Two sets of lasers are used with the mass spectrometer. An Nd-YAG laser is used for sampling 136 Ba from the surface of the positive-ion collector electrode, and a dye laser pumped by an Nd-YAG laser is used for the selective ionization of 136 Ba. The principle of measurements as well as the experimental apparatus and procedures are described in detail, together with our future plans. (orig.)

  19. Study of tracking detector of NEMO3 experiment - simulation of the measurement of the ultra low {sup 208}Tl radioactivity in the source foils used as neutrinoless double beta decay emitters in NEMO3 experiment; Etude du detecteur de traces de l'experience NEMO3. Simulation de la mesure de l'ultra-faible radioactivite en {sup 208}Tl des sources de l'experience NEMO3 candidates a la double desintegration {beta} sans emission de neutrino

    Energy Technology Data Exchange (ETDEWEB)

    Errahmane, K

    2001-04-01

    The purpose of NEMO3 experiment is the research of the neutrinoless double beta decay. This low energy process can sign the massive and Majorana nature of neutrino. This experiment, with a very low radioactive background and containing 10 kg of enriched isotopes, studies mainly {sup 100}Mo. Installed at the Frejus underground laboratory, NEMO3 is a cylindrical detector, which consists in very thin central source foils, in a tracking detector made up of vertical drift cells operating in Geiger mode, in a calorimeter and in a suitable shielding. This thesis is divided in two different parts. The first part is a full study of the features of the tracking detector. With a prototype composed of 9 drift cells, we characterised the longitudinal and transverse reconstruction of position of the ionisation created by a LASER. With the first 3 modules under operation, we used radioactive external neutron sources to measure the transverse resolution of ionisation position in a drift cell for high energy electrons. To study the vertex reconstruction on the source foil, sources of {sup 207}Bi, which produced conversion electrons, were used inside the 3 modules. The second part of this thesis, we show, with simulations, that we can measure, with NEMO3 detector itself, the ultra low level of contamination in {sup 208}Tl of the source foil, which comes from the natural radioactive chain of thorium. Using electron-photons channels, we can obtain the {sup 208}Tl activity in the sources. With an analysis on the energy and on the time of flight of particles, NEMO3 is able to reach a sensitivity of 20{mu}Bq/kg after only 2 months of measurement. This sensitivity is the maximum {sup 208}Tl activity, which we accepted for the sources in the NEMO3 proposal. (author)

  20. DOUBLE COMPACT OBJECTS. III. GRAVITATIONAL-WAVE DETECTION RATES

    Energy Technology Data Exchange (ETDEWEB)

    Dominik, Michal; Belczynski, Krzysztof; Bulik, Tomasz [Astronomical Observatory, University of Warsaw, Al. Ujazdowskie 4, 00-478 Warsaw (Poland); Berti, Emanuele [Department of Physics and Astronomy, The University of Mississippi, University, MS 38677 (United States); O’Shaughnessy, Richard [Center for Gravitation, Cosmology, and Astrophysics, University of Wisconsin-Milwaukee, Milwaukee, WI (United States); Mandel, Ilya [School of Physics and Astronomy, University of Birmingham, Edgbaston, Birmingham B15 2TT (United Kingdom); Fryer, Christopher [CCS-2, MSD409, Los Alamos National Laboratory, Los Alamos, NM 87545 (United States); Holz, Daniel E. [Enrico Fermi Institute, Department of Physics, and Kavli Institute for Cosmological Physics University of Chicago, Chicago, IL 60637 (United States); Pannarale, Francesco [School of Physics and Astronomy, Cardiff University, The Parade, Cardiff CF24 3AA (United Kingdom)

    2015-06-20

    The unprecedented range of second-generation gravitational-wave (GW) observatories calls for refining the predictions of potential sources and detection rates. The coalescence of double compact objects (DCOs)—i.e., neutron star–neutron star (NS–NS), black hole–neutron star (BH–NS), and black hole–black hole (BH–BH) binary systems—is the most promising source of GWs for these detectors. We compute detection rates of coalescing DCOs in second-generation GW detectors using the latest models for their cosmological evolution, and implementing inspiral-merger-ringdown gravitational waveform models in our signal-to-noise ratio calculations. We find that (1) the inclusion of the merger/ringdown portion of the signal does not significantly affect rates for NS–NS and BH–NS systems, but it boosts rates by a factor of ∼1.5 for BH–BH systems; (2) in almost all of our models BH–BH systems yield by far the largest rates, followed by NS–NS and BH–NS systems, respectively; and (3) a majority of the detectable BH–BH systems were formed in the early universe in low-metallicity environments. We make predictions for the distributions of detected binaries and discuss what the first GW detections will teach us about the astrophysics underlying binary formation and evolution.

  1. Detection of gastritis by single- and double-contrast radiography

    International Nuclear Information System (INIS)

    Thoeni, R.F.; Goldberg, H.I.; Ominsky, S.; Cello, J.P.

    1983-01-01

    Sixty-eight patients with various types of gastritis, 23 patients with normal stomachs, and four patients with other gastric diseases were examined in a prospective study to assess the sensitivity and specificity of single-contrast (SC) and double-contrast (DC) upper gastrointestinal examinations in the evaluation of gastritis. All patients underwent endoscopy with biopsy followed first by DC and then by SC radiography. The respective sensitivities of SC and DC radiography were 58% and 72% for all examinations and 59% and 77% for adequate examinations only. The respective specificities were 59% and 55% based on all examinations. Useful radiographic features included polypoid defects and erosions detected by both methods, abnormal folds and flattened margins detected by the SC technique, and narrowed lumen and crenulated margins detected by the DC technique. In 93% of all cases, the correct diagnosis was based on two or more of these radiographic features. According to this study, the radiographic sensitivity in the detection of gastritis is reliable only in cases of moderate-to-severe disease and only when based on findings of the DC examination. Neither SC nor DC radiography should be used as the primary screening method for patients with suspected gastritis, and the radiographic diagnosis should be restricted to the terms ''erosive'' or ''nonerosive gastritis.''

  2. Neutrino mass bounds from neutrinoless double beta-decays and ...

    Indian Academy of Sciences (India)

    2016-01-21

    Jan 21, 2016 ... CMD model. In addition, we explore the interacting neutrino dark-energy model, where the ... This decay has a small energy release (E0 ≃ 18.6 keV) and a convenient lifetime (T1/2 = 12.3 yr). As the ...... Research Programme funded by the Korean Ministry of Science, ICT and Future Planning. (Grant No.

  3. Present and future strategies for neutrinoless double beta decay ...

    Indian Academy of Sciences (India)

    The scope of this paper is not only to review the present results reached in the field by the different groups and technologies worldwide, but also to illustrate and comment on the (near and long-term) future strategies that experimentalists are trying to pursue to reach the needed sensitivity required to explore the inverted ...

  4. Neutrinoless double beta decay and the solar neutrino problem

    International Nuclear Information System (INIS)

    Petcov, S.T.; Smirnov, A.Yu.

    1993-10-01

    The MSW or vacuum oscillation solution of the solar neutrino problem can be reconciled with possible existence of the (ββ) oν decay with a half-line corresponding to an effective Majorana mass of the electron neutrino modul m ee approx. (0.1 - 1.0) eV. The phenomenological consequences of such a possibility are analyzed and the implications for the mechanisms of neutrino mass generation are considered. (author). 31 refs, 2 figs

  5. Limit on neutrinoless ββ decay of 136Xe from the first phase of KamLAND-Zen and comparison with the positive claim in 76Ge

    NARCIS (Netherlands)

    Gando, A.; Gando, Y.; Hanakago, H.; Ikeda, H.; Inoue, K.; Ishidoshiro, K.; Kato, R.; Koga, M.; Matsuda, S.; Mitsui, T.; Motoki, D.; Nakada, T.; Nakamura, K.; Obata, A.; Oki, A.; Ono, Y.; Otani, M.; Shimizu, I.; Shirai, J.; Suzuki, A.; Takemoto, Y.; Tamae, K.; Ueshima, K.; Watanabe, H.; Xu, B.D.; Yamada, S.; Yoshida, H.; Kozlov, A.; Yoshida, S.; Banks, T.I.; Freedman, S.J.; Fujikawa, B.K.; Han, K.; O’Donnell, T.; Berger, B.E.; Efremenko, Y.; Karwowski, H.J.; Markoff, D.M.; Tornow, W.; Detwiler, J.A.; Enomoto, S.; Decowski, M.P.

    2013-01-01

    We present results from the first phase of the KamLAND-Zen double-beta decay experiment, corresponding to an exposure of 89.5 kg yr of Xe136. We obtain a lower limit for the neutrinoless double-beta decay half-life of T0ν1/2>1.9×1025  yr at 90% C.L. The combined results from KamLAND-Zen and EXO-200

  6. Detection of internal fields in double-metal terahertz resonators

    DEFF Research Database (Denmark)

    Mitrofanov, Oleg; Han, Zhanghua; Ding, Fei

    2017-01-01

    Terahertz (THz) double-metal plasmonic resonators enable enhanced light-matter coupling by exploiting strong field confinement. The double-metal design however restricts access to the internal fields. We propose and demonstrate a method for spatial mapping and spectroscopic analysis of the internal...... electromagnetic fields in double-metal plasmonic resonators. We use the concept of image charges and aperture-type scanning near-field THz time-domain microscopy to probe the fields confined within the closed resonator. The experimental method opens doors to studies of light-matter coupling in deeply sub...

  7. WARP: a double phase argon programme for dark matter detection

    International Nuclear Information System (INIS)

    Ferrari, N

    2006-01-01

    WARP (Wimp ARgon Programme) is a double phase Argon detector for Dark Matter search under construction at Laboratori Nazionali del Gran Sasso. We present recent results obtained operating a prototype with a sensitive mass of 2.3 litres deep underground

  8. Denaturation strategies for detection of double stranded PCR products on GMR magnetic biosensor array

    DEFF Research Database (Denmark)

    Rizzi, Giovanni; Lee, Jung-Rok; Guldberg, Per

    2017-01-01

    Microarrays and other surface-based nucleic acid detection schemes rely on the hybridization of the target to surface-bound detection probes. We present the first comparison of two strategies to detect DNA using a giant magnetoresistive (GMR) biosensor platform starting from an initially double...

  9. New Technique for Barium Daughter Ion Identification in a Liquid Xe-136 Double Beta Decay Experiment

    International Nuclear Information System (INIS)

    Fairbank, William

    2016-01-01

    This work addresses long-standing issues of fundamental interest in elementary particle physics. The most important outcome of this work is a new limit on neutrinoless double beta decay. This is an extremely rare and long-sought-after type of radioactive decay. If discovered, it would require changes in the standard model of the elementary constituents of matter, and would prove that neutrinos and antineutrinos are the same, a revolutionary concept in particle physics. Neutrinos are major components of the matter in the universe that are so small and so weakly interacting with other matter that their masses have not yet been discovered. A discovery of neutrinoless double beta decay could help determine the neutrino masses. An important outcome of the work on this project was the Colorado State University role in operating the EXO-200 neutrinoless double beta decay experiment and in analysis of the data from this experiment. One type of double beta decay of the isotope "1"3"6Xe, the two-neutrino variety, was discovered in this work. Although the other type of double beta decay, the neutrinoless variety, was not yet discovered in this work, a world's best sensitivity of 1.9x10"2"5 year half-life was obtained. This result rules out a previous claim of a positive result in a different isotope. This work also establishes that the masses of the neutrinos are less than one millionth of that of electrons. A unique EXO-200 analysis, in which the CSU group had a leading role, has established for the first time ever in a liquid noble gas the fraction of daughter atoms from alpha and beta decay that are ionized. This result has important impact on other pending studies, including nucleon decay and barium tagging. Novel additional discoveries include multiphoton ionization of liquid xenon with UV pulsed lasers, which may find application in calibration of future noble liquid detectors, and studies of association and dissociation reactions of Ba"+ ions in gaseous xenon. Through

  10. Search for the neutrinoless ββ decay in 76Ge with the GERDA experiment

    International Nuclear Information System (INIS)

    Cattadori, C.; Knapp, M.; Kröninger, K.; Liu, X.; Pandola, L.; Pullia, A.; Tomei, C.; Ur, C.; Zocca, F.

    2011-01-01

    The GERmanium Detector Array, GERDA, [Gerda Collaboration, Abt I et al., Proposal, a (http://www.mpi-hd.mpg.de/ge76/home.html)] is designed to search for neutrinoless double beta (0νββ)-decay of 76 Ge. The importance of such a search is emphasized by the evidence of a non-zero neutrino mass from flavour oscillation experiments and by the recent claim [Klapdor-Kleingrothaus H V et al., Phys. Lett. B 586, 198 (2004)] based on data of the Heidelberg-Moscow experiment. GERDA will be installed in the Hall A of the Gran Sasso underground Laboratory (LNGS), Italy. The construction of GERDA will start in 2006.

  11. A search of the neutrinoless decay of 76Ge to the first excited state of 76Se in the Canfranc tunnel

    International Nuclear Information System (INIS)

    Morales, A.; Morales, J.; Nunez-Lagos, R.; Puimedon, J.; Villar, J.A.; Larrea, A.; Garcia, E.

    1991-01-01

    To further investigate a small, unexplained coincidence effect, close to the region where a neutrinoless, 0 + →2 + 76 Ge double beta decay should be expected, which we found in a previous experiment in the Frejus tunnel, a new experiment, with improved background conditions is being performed in the Canfranc railroad tunnel. The details of the experimental set-up are given and the first results, corresponding to t=4375 hours, are presented. (author)

  12. Why search for double beta decay?

    International Nuclear Information System (INIS)

    Kayser, B.

    1988-01-01

    Searching for neutrinoless double beta decay is the only known practical method for trying to determine whether neutrinos are their own antiparticles. The theoretical motivation for supposing that they may indeed be their own antiparticles is described. The reason that it is so difficult to ascertain experimentally whether they are or are not is explained, as is the special sensitivity of neutrinoless double beta decay. The potential implications of the observation of this reaction for neutrino mass and for the physics of neutrinos is discussed

  13. Double-pulse standoff laser-induced breakdown spectroscopy for versatile hazardous materials detection

    Energy Technology Data Exchange (ETDEWEB)

    Gottfried, Jennifer L. [U.S. Army Research Laboratory, AMSRD-ARL-WM-BD, Aberdeen Proving Ground, MD, 21005-5069 (United States)], E-mail: jennifer.gottfried@arl.army.mil; De Lucia, Frank C.; Munson, Chase A.; Miziolek, Andrzej W. [U.S. Army Research Laboratory, AMSRD-ARL-WM-BD, Aberdeen Proving Ground, MD, 21005-5069 (United States)

    2007-12-15

    We have developed a double-pulse standoff laser-induced breakdown spectroscopy (ST-LIBS) system capable of detecting a variety of hazardous materials at tens of meters. The use of a double-pulse laser improves the sensitivity and selectivity of ST-LIBS, especially for the detection of energetic materials. In addition to various metallic and plastic materials, the system has been used to detect bulk explosives RDX and Composition-B, explosive residues, biological species such as the anthrax surrogate Bacillus subtilis, and chemical warfare simulants at 20 m. We have also demonstrated the discrimination of explosive residues from various interferents on an aluminum substrate.

  14. Visual performance on detection tasks with double-targets of the same and different difficulty.

    Science.gov (United States)

    Chan, Alan H S; Courtney, Alan J; Ma, C W

    2002-10-20

    This paper reports a study of measurement of horizontal visual sensitivity limits for 16 subjects in single-target and double-targets detection tasks. Two phases of tests were conducted in the double-targets task; targets of the same difficulty were tested in phase one while targets of different difficulty were tested in phase two. The range of sensitivity for the double-targets test was found to be smaller than that for single-target in both the same and different target difficulty cases. The presence of another target was found to affect performance to a marked degree. Interference effect of the difficult target on detection of the easy one was greater than that of the easy one on the detection of the difficult one. Performance decrement was noted when correct percentage detection was plotted against eccentricity of target in both the single-target and double-targets tests. Nevertheless, the non-significant correlation found between the performance for the two tasks demonstrated that it was impossible to predict quantitatively ability for detection of double targets from the data for single targets. This indicated probable problems in generalizing data for single target visual lobes to those for multiple targets. Also lobe area values obtained from measurements using a single-target task cannot be applied in a mathematical model for situations with multiple occurrences of targets.

  15. Double Displacement: an Improved Bioorthogonal Reaction Strategy for Templated Nucleic Acid Detection

    OpenAIRE

    Kleinbaum, Daniel J.; Miller, Gregory P.; Kool, Eric T.

    2010-01-01

    Quenched autoligation probes have been employed previously in a target-templated nonenzymatic ligation strategy for detecting nucleic acids in cells by fluorescence. A common source of background signal in such probes is undesired reaction with water and other cellular nucleophiles. Here we describe a new class of self-ligating probes, double displacement (DD) probes, that rely on two displacement reactions to fully unquench a nearby fluorophore. Three potential double displacement architectu...

  16. Search for two-neutrino double-β decay of 96Zr to excited states of 96Mo

    Science.gov (United States)

    Finch, S. W.; Tornow, W.

    2015-10-01

    Background: Double-β decay is a rare second-order nuclear decay. The importance of this decay stems from the possibility of neutrinoless double-β decay and its applications to neutrino physics. Purpose: A search was conducted for the 2 ν β β decay of 96Zr to excited final states of the daughter nucleus, 96Mo. Measurements of this decay are important to test nuclear matrix element calculations, which are necessary to extract the neutrino mass from a measurement of the neutrinoless double-β decay half-life. Method: Two coaxial high-purity germanium detectors were used in coincidence to detect γ rays produced by the daughter nucleus as it de-excited to the ground state. The experiment was carried out at the Kimballton Underground Research Facility and produced 685.7 d of data with a 17.91 g enriched sample. Results: No counts were seen above background. For the decay to the first excited 0+ state, a limit of T1 /2>3.1 ×1020 yr was produced. Limits to higher excited states are also reported. Conclusion: The new limits on double-β decay are an improvement over previous experiments by a factor of 2 to 5 for the various excited states. The nuclear matrix element for the double-β decay to the first excited 0+ state is found to be <0.13 .

  17. Double Compton effect: a new method of detection

    International Nuclear Information System (INIS)

    Cafagne, A.

    1978-01-01

    In this paper, a new method of observation of the double Compton effect is described. The proposed method is based on the use of a sum-coincidence circuit, whose resulting pulse is in a fast coincidence (ζ=1,7x10 -8 sec) with pulses (∼=10- 9 sec) from both scintillation detectors used to measure the energy of the coincident scattered gamma-rays. By means of this procedure, the contribution of the pulses from the sum-coincidence circuit due to random gamma-rays is eliminated. The spectra were registered in an Ortec model 6240 Multi-channel analyser using a further coincidence circuit, eliminate non-coincident pulses. The gate is open by a rectangulasr pulse which lasts for 10n sec and an adjustable delayed pulse generator adjusts its time-position in order to be coincident with the top of the sum-coincidence pulses. The adjustable delayed pulse generator compensates also for the finite time of propagation of the pulses in the circuits. Through this experimental technique it was possible to measure simultaneously the energy of each coincident photon which allowed an excellent comparison due the agreement found between the obtained results and the theory of Mandl and Skyrme. (Author) [pt

  18. Double Fault Detection of Cone-Shaped Redundant IMUs Using Wavelet Transformation and EPSA

    Directory of Open Access Journals (Sweden)

    Wonhee Lee

    2014-02-01

    Full Text Available A model-free hybrid fault diagnosis technique is proposed to improve the performance of single and double fault detection and isolation. This is a model-free hybrid method which combines the extended parity space approach (EPSA with a multi-resolution signal decomposition by using a discrete wavelet transform (DWT. Conventional EPSA can detect and isolate single and double faults. The performance of fault detection and isolation is influenced by the relative size of noise and fault. In this paper; the DWT helps to cancel the high frequency sensor noise. The proposed technique can improve low fault detection and isolation probability by utilizing the EPSA with DWT. To verify the effectiveness of the proposed fault detection method Monte Carlo numerical simulations are performed for a redundant inertial measurement unit (RIMU.

  19. Double Fault Detection of Cone-Shaped Redundant IMUs Using Wavelet Transformation and EPSA

    Science.gov (United States)

    Lee, Wonhee; Park, Chan Gook

    2014-01-01

    A model-free hybrid fault diagnosis technique is proposed to improve the performance of single and double fault detection and isolation. This is a model-free hybrid method which combines the extended parity space approach (EPSA) with a multi-resolution signal decomposition by using a discrete wavelet transform (DWT). Conventional EPSA can detect and isolate single and double faults. The performance of fault detection and isolation is influenced by the relative size of noise and fault. In this paper; the DWT helps to cancel the high frequency sensor noise. The proposed technique can improve low fault detection and isolation probability by utilizing the EPSA with DWT. To verify the effectiveness of the proposed fault detection method Monte Carlo numerical simulations are performed for a redundant inertial measurement unit (RIMU). PMID:24556675

  20. Beta-gamma spectroscopy for double beta decays and Lepton number conservation

    International Nuclear Information System (INIS)

    Ejiri, H.; Takahashi, N.; Shibata, T.; Nagai, Y.; Okada, K.; Kamikubota, N.; Watanabe, T.

    1984-01-01

    In this paper neutrino-less double β decays (Oν ββ) of /sup 76/Ge were studied by means of the newly developed ELEGANTS (Electron gamma-ray neutrino spectrometer). It consists of a 171 cc pure Ge detector surrounded bu a big 4π-NaI detector, and active and inactive filters. Measurement of both the electron signal from the Ge detector and γ-ray signals from the 4π-NaI detector made it possible to select the true double decay events from background events due to the other radio-active isotopes and cosmic rays. The ELEGANTS showed the highest sensitivity for detecting the neutrino-less double β decay. The preliminary data obtained so far give a lower limit of the half life T/sub 1/2/≥2.2 10/sup 22/y for the O/sup +/→O/sup +/ Oν ββ decay and T/sub 1/2/ ≥1.5.10/sup 22/y for the O/sup +/→2/sup +/ Oν ββ decay of /sup 76/Ge

  1. A background free double beta decay experiment

    International Nuclear Information System (INIS)

    Giomataris, I

    2011-01-01

    We present a new detection scheme for rejecting backgrounds in neutrino-less double beta decay experiments. It relies on the detection of Cherenkov light emitted by electrons in the MeV region. The momentum threshold is tuned to reach a good discrimination between background and good events. We consider many detector concepts and a range of target materials. The most promising is the high-pressure 136 Xe emitter where the required energy threshold is easily adjusted. Combination of this concept and a high pressure Time Projection Chamber could provide an optimal solution. A simple and low cost effective solution is the use of the Spherical Proportional Counter that provides, using a single read-out channel, two delayed signals from ionization and Cherenkov light. In solid-state double beta decay emitters, because of its higher density, the considered process is out of energy range. An escape will be the fabrication of double decay emitters having lower density by using for instance the aerogel technique. It is surprising that a technology used for particle identification in high-energy physics becomes a powerful tool for rejecting backgrounds in such low-energy experiments.

  2. Building Double-decker Traps for Early Detection of Emerald Ash Borer.

    Science.gov (United States)

    McCullough, Deborah G; Poland, Therese M

    2017-10-04

    Emerald ash borer (EAB) (Agrilus planipennis Fairmaire), the most destructive forest insect to have invaded North America, has killed hundreds of millions of forest and landscape ash (Fraxinus spp.) trees. Several artificial trap designs to attract and capture EAB beetles have been developed to detect, delineate, and monitor infestations. Double-decker (DD) traps consist of two corrugated plastic prisms, one green and one purple, attached to a 3 m tall polyvinyl chloride (PVC) pipe supported by a t-post. The green prism at the top of the PVC pipe is baited with cis-3-hexenol, a compound produced by ash foliage. Surfaces of both prisms are coated with sticky insect glue to capture adult EAB beetles. Double-decker traps should be placed near ash trees but in open areas, exposed to sun. Double-decker trap construction and placement are presented here, along with a summary of field experiments demonstrating the efficacy of DD traps in capturing EAB beetles. In a recent study in sites with relatively low EAB densities, double-decker traps captured significantly more EAB than green or purple prism traps or green funnel traps, all of which are designed to be suspended from a branch in the canopy of ash trees. A greater percentage of double decker traps were positive, i.e., captured at least one EAB, than the prism traps or funnel traps that were hung in ash tree canopies.

  3. Preliminary Evaluation of a Nest Usage Sensor to Detect Double Nest Occupations of Laying Hens

    Directory of Open Access Journals (Sweden)

    Mauro Zaninelli

    2015-01-01

    Full Text Available Conventional cage systems will be replaced by housing systems that allow hens to move freely. These systems may improve hens’ welfare, but they lead to some disadvantages: disease, bone fractures, cannibalism, piling and lower egg production. New selection criteria for existing commercial strains should be identified considering individual data about laying performance and the behavior of hens. Many recording systems have been developed to collect these data. However, the management of double nest occupations remains critical for the correct egg-to-hen assignment. To limit such events, most systems adopt specific trap devices and additional mechanical components. Others, instead, only prevent these occurrences by narrowing the nest, without any detection and management. The aim of this study was to develop and test a nest usage “sensor”, based on imaging analysis, that is able to automatically detect a double nest occupation. Results showed that the developed sensor correctly identified the double nest occupation occurrences. Therefore, the imaging analysis resulted in being a useful solution that could simplify the nest construction for this type of recording system, allowing the collection of more precise and accurate data, since double nest occupations would be managed and the normal laying behavior of hens would not be discouraged by the presence of the trap devices.

  4. Preliminary evaluation of a nest usage sensor to detect double nest occupations of laying hens.

    Science.gov (United States)

    Zaninelli, Mauro; Costa, Annamaria; Tangorra, Francesco Maria; Rossi, Luciana; Agazzi, Alessandro; Savoini, Giovanni

    2015-01-26

    Conventional cage systems will be replaced by housing systems that allow hens to move freely. These systems may improve hens' welfare, but they lead to some disadvantages: disease, bone fractures, cannibalism, piling and lower egg production. New selection criteria for existing commercial strains should be identified considering individual data about laying performance and the behavior of hens. Many recording systems have been developed to collect these data. However, the management of double nest occupations remains critical for the correct egg-to-hen assignment. To limit such events, most systems adopt specific trap devices and additional mechanical components. Others, instead, only prevent these occurrences by narrowing the nest, without any detection and management. The aim of this study was to develop and test a nest usage "sensor", based on imaging analysis, that is able to automatically detect a double nest occupation. Results showed that the developed sensor correctly identified the double nest occupation occurrences. Therefore, the imaging analysis resulted in being a useful solution that could simplify the nest construction for this type of recording system, allowing the collection of more precise and accurate data, since double nest occupations would be managed and the normal laying behavior of hens would not be discouraged by the presence of the trap devices.

  5. Sensitivity of single and double contrast barium enema in the detection of colorectal carcinoma

    International Nuclear Information System (INIS)

    Myllylae, V.; Paeivansalo, M.; Laitinen, S.; Oulu Univ.

    1984-01-01

    The preoperative barium enema of the 188 colorectal carcinoma patients operated at the Oulu University Central Hospital (Finland) during 1977-1982 were examined retrospectively. Altogether 112 single contrast studies and 87 double contrast studies had been made on these patients. The single contrast barium enemas had resulted in a correct diagnosis of colorectal carcinoma in 93 cases (sensitivity 83%). The correct diagnosis in the double contrast studies numbered 71 (sensitivity 82%). Most of the overlooked carcinomas were located in the caecum, in the sigmoid or the rectum. Most of the errors made in the single contrast studies were due to detection errors and poor evacuation. The most common failures in double contrast enemas were detection errors and nonvisualisation of the sigmoid. The authors recommend use of the double contrast technique and suggest that the two methods of barium enema be used to complement each other. A false negative diagnosis delayed the operation of the colorectal carcinoma patients by 2.2 months (median). (orig.) [de

  6. Development of the double-wall-tube steam generator. Evaluation of inner tube leak detection system

    International Nuclear Information System (INIS)

    Teraoku, Takuji; Kisohara, Naoyuki

    1995-01-01

    A double-wall-tube steam generator (DWT-SG) is considered to have possibility of eliminating a secondary heat transport system to realize a reliable and simplified FBR plant. Thus, basic tests for inner/outer tube leak detection and prototypical leak tests by use of the 1MWt DWT-SG model have been performed to evaluate the feasibility of DWT-SG. Their results demonstrated that the inner leak detection system can definitely detect a steam leak from an inner tube flaw. Analyses of the inner tube leak and detection behavior obtained in the 1MWt DWT-SG test enabled to estimate the performance of the inner tube detection system of the commercial DWT-SG system. (author)

  7. Label-Free, Single Molecule Resonant Cavity Detection: A Double-Blind Experimental Study

    Directory of Open Access Journals (Sweden)

    Maria V. Chistiakova

    2015-03-01

    Full Text Available Optical resonant cavity sensors are gaining increasing interest as a potential diagnostic method for a range of applications, including medical prognostics and environmental monitoring. However, the majority of detection demonstrations to date have involved identifying a “known” analyte, and the more rigorous double-blind experiment, in which the experimenter must identify unknown solutions, has yet to be performed. This scenario is more representative of a real-world situation. Therefore, before these devices can truly transition, it is necessary to demonstrate this level of robustness. By combining a recently developed surface chemistry with integrated silica optical sensors, we have performed a double-blind experiment to identify four unknown solutions. The four unknown solutions represented a subset or complete set of four known solutions; as such, there were 256 possible combinations. Based on the single molecule detection signal, we correctly identified all solutions. In addition, as part of this work, we developed noise reduction algorithms.

  8. Double symbol error rates for differential detection of narrow-band FM

    Science.gov (United States)

    Simon, M. K.

    1985-01-01

    This paper evaluates the double symbol error rate (average probability of two consecutive symbol errors) in differentially detected narrow-band FM. Numerical results are presented for the special case of MSK with a Gaussian IF receive filter. It is shown that, not unlike similar results previously obtained for the single error probability of such systems, large inaccuracies in predicted performance can occur when intersymbol interference is ignored.

  9. Review of modern double beta decay experiments

    Energy Technology Data Exchange (ETDEWEB)

    Barabash, A. S., E-mail: barabash@itep.ru [Institute of Theoretical and Experimental Physics (NRC ”Kurchatov Institute”), B. Cheremushkinskaya 25, Moscow (Russian Federation)

    2015-10-28

    The review of modern experiments on search and studying of double beta decay processes is done. Results of the most sensitive current experiments are discussed. The main attention is paid to EXO-200, KamLAND-Zen, GERDA-I and CUORE-0 experiments. Modern values of T{sub 1/2}(2ν) and best present limits on neutrinoless double beta decay and double beta decay with Majoron emission are presented. Conservative limits on effective mass of a Majorana neutrino (〈m{sub ν}〉 < 0.46 eV) and a coupling constant of Majoron to neutrino (〈g{sub ee}〉 < 1.3 · 10{sup −5}) are obtained. Prospects of search for neutrinoless double beta decay in new experiments with sensitivity to 〈m{sub ν}〉 at the level of ∼ 0.01-0.1 eV are discussed.

  10. Action detection by double hierarchical multi-structure space-time statistical matching model

    Science.gov (United States)

    Han, Jing; Zhu, Junwei; Cui, Yiyin; Bai, Lianfa; Yue, Jiang

    2018-03-01

    Aimed at the complex information in videos and low detection efficiency, an actions detection model based on neighboring Gaussian structure and 3D LARK features is put forward. We exploit a double hierarchical multi-structure space-time statistical matching model (DMSM) in temporal action localization. First, a neighboring Gaussian structure is presented to describe the multi-scale structural relationship. Then, a space-time statistical matching method is proposed to achieve two similarity matrices on both large and small scales, which combines double hierarchical structural constraints in model by both the neighboring Gaussian structure and the 3D LARK local structure. Finally, the double hierarchical similarity is fused and analyzed to detect actions. Besides, the multi-scale composite template extends the model application into multi-view. Experimental results of DMSM on the complex visual tracker benchmark data sets and THUMOS 2014 data sets show the promising performance. Compared with other state-of-the-art algorithm, DMSM achieves superior performances.

  11. Isothermal amplification detection of nucleic acids by a double-nicked beacon.

    Science.gov (United States)

    Shi, Chao; Zhou, Meiling; Pan, Mei; Zhong, Guilin; Ma, Cuiping

    2016-03-01

    Isothermal and rapid amplification detection of nucleic acids is an important technology in environmental monitoring, foodborne pathogen detection, and point-of-care clinical diagnostics. Here we have developed a novel method of isothermal signal amplification for single-stranded DNA (ssDNA) detection. The ssDNA target could be used as an initiator, coupled with a double-nicked molecular beacon, to originate amplification cycles, achieving cascade signal amplification. In addition, the method showed good specificity and strong anti-jamming capability. Overall, it is a one-pot and isothermal strand displacement amplification method without the requirement of a stepwise procedure, which greatly simplifies the experimental procedure and decreases the probability of contamination of samples. With its advantages, the method would be very useful to detect nucleic acids in point-of-care or field use. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. Detection of Double White Dwarf Binaries with Gaia, LSST and eLISA

    Science.gov (United States)

    Korol, V.; Rossi, E. M.; Groot, P. J.

    2017-03-01

    According to simulations around 108 double degenerate white dwarf binaries are expected to be present in the Milky Way. Due to their intrinsic faintness, the detection of these systems is a challenge, and the total number of detected sources so far amounts only to a few tens. This will change in the next two decades with the advent of Gaia, the LSST and eLISA. We present an estimation of how many compact DWDs with orbital periods less than a few hours we will be able to detect 1) through electromagnetic radiation with Gaia and LSST and 2) through gravitational wave radiation with eLISA. We find that the sample of simultaneous electromagnetic and gravitational waves detections is expected to be substantial, and will provide us a powerful tool for probing the white dwarf astrophysics and the structure of the Milky Way, letting us into the era of multi-messenger astronomy for these sources.

  13. Characterization of ionization chambers in double face for X-ray detection systems

    International Nuclear Information System (INIS)

    Costa, Alessandro M. da; Caldas, Linda V.O.

    2000-01-01

    Two identical parallel-plate ionization chambers with collecting electrodes of different materials (in order to obtain different energy dependences), developed at Instituto de Pesquisas Energeticas e Nucleares, were tested in low energy X-radiation beams, simulating a special ionization chamber, of double face, in a Tandem system. The purpose of this work is to justify a project of a double face detection system utilizing ionization chambers in Tandem. In relation to conventional methods, this kind of system will provide more efficient and precise absorbed dose in air measurements and radiation effective energy determinations. The results obtained in relation to characteristics of short- and long-term stabilities and angular and energy dependence show that the project is feasible and very appropriate. (author)

  14. Generation and detection of spin polarization in parallel coupled double quantum dots connected to four terminals

    International Nuclear Information System (INIS)

    An, Xing-Tao; Mu, Hui-Ying; Li, Yu-Xian; Liu, Jian-Jun

    2011-01-01

    A four-terminal parallel double quantum dots (QDs) device is proposed to generate and detect the spin polarization in QDs. It is found that the spin accumulation in QDs and the spin-polarized currents in the upper and down leads can be generated when a bias voltage is applied between the left and right leads. It is more interesting that the spin polarization in the QDs can be detected using the upper and down leads. Moreover, the direction and magnitude of the spin polarization in the QDs, and in the upper and down leads can be tuned by the energy levels of QDs and the bias. -- Highlights: → The spin polarization in the quantum dots can be generated and controlled. → The spin polarization in quantum dots can be detected by the nonferromagnetic leads. → The system our studied is a discrete level spin Hall system.

  15. Detecting gradual visual changes in colour and brightness agnosia: a double dissociation.

    Science.gov (United States)

    Nijboer, Tanja C W; te Pas, Susan F; van der Smagt, Maarten J

    2011-03-09

    Two patients, one with colour agnosia and one with brightness agnosia, performed a task that required the detection of gradual temporal changes in colour and brightness. The results for these patients, who showed anaverage or an above-average performance on several tasks designed to test low-level colour and luminance (contrast) perception in the spatial domain, yielded a double dissociation; the brightness agnosic patient was within the normal range for the coloured stimuli, but much slower to detect brightness differences, whereas the colour agnosic patient was within the normal range for the achromatic stimuli, but much slower for the coloured stimuli. These results suggest that a modality-specific impairment in the detection of gradual temporal changes might be related to, if not underlie, the phenomenon of visual agnosia.

  16. Double beta decays studied by β-γ spectroscopy with a drift chamber

    International Nuclear Information System (INIS)

    Okada, K.; Ejiri, H.; Shibata, T.

    1986-01-01

    A large scale ultra low background β-γ spectrometer ELEGANTS-V for studying double beta decays(ββ) of /sup 100/Mo and/or /sup 150/Nd is designed and is now under construction. It consists of drift chambers for identification of tracks and vertex of two β-rays, thin NaI(T1) or plastic scintillators for β-rays energy and NaI(T1) counters for γ- and cosmic-rays. Specifications of the spectrometer; energy resolution, detection efficiency, possible background counting rate and available ββ sources, have been evaluated. The spectrometer has extremely high sensitivities of the neutrinoless ββ decays (0νββ), two neutrino ββ decays (2νββ) and neutrinoless ββ decays followed one boson (Majoron). It may detect 0νββ decays with half lives up to T/sub 1/2/ = 1.2- 1.7 . 10/sup 23/ year. This limit corresponds to one part of million for the Majoran neutrino mass in units of the electron mass and for the right-handed weak current in units of the left handed one

  17. Electric-field-induced superconductivity detected by magnetization measurements of an electric-double-layer capacitor

    International Nuclear Information System (INIS)

    Kasahara, Yuichi; Takeuchi, Yuki; Ye, Jianting; Yuan, Hongtao; Shimotani, Hidekazu; Iwasa, Yoshihiro; Nishimura, Takahiro; Sato, Tatsuya

    2010-01-01

    We report evidence for superconductivity induced by the application of strong electric fields onto the surface of a band insulator, ZrNCl, provided by the observation of a shielding diamagnetic signal. We introduced an electric-double-layer capacitor configuration and in situ magnetization measurements at low temperatures as a method to detect the novel electric-field-induced superconducting state. The results showed excellent agreement with a previous report using a transistor configuration, demonstrating that the present technique is a novel method for investigating the nonequilibrium phase induced by electric fields. (author)

  18. NMR parallel Q-meter with double-balanced-mixer detection for polarized target experiments

    International Nuclear Information System (INIS)

    Boissevain, J.; Tippens, W.B.

    1983-01-01

    A constant-voltage, parallel-tuned nuclear magnetic resonance (NMR) circuit, patterned after a Liverpool design, has been developed for polarized target experiments. Measuring the admittance of the resonance circuit allows advantageous use of double-balanced mixer detection. The resonant circuit is tolerant of stray capacitance between the NMR coil and the target cavity, thus easing target-cell-design constraints. The reference leg of the circuit includes a voltage-controlled attenuator and phase shifter for ease of tuning. The NMR output features a flat background and has good linearity and stability

  19. Double displacement: An improved bioorthogonal reaction strategy for templated nucleic acid detection.

    Science.gov (United States)

    Kleinbaum, Daniel J; Miller, Gregory P; Kool, Eric T

    2010-06-16

    Quenched autoligation probes have been employed previously in a target-templated nonenzymatic ligation strategy for detecting nucleic acids in cells by fluorescence. A common source of background signal in such probes is the undesired reaction with water and other cellular nucleophiles. Here, we describe a new class of self-ligating probes, double displacement (DD) probes, that rely on two displacement reactions to fully unquench a nearby fluorophore. Three potential double displacement architectures, all possessing two fluorescence quencher/leaving groups (dabsylate groups), were synthesized and evaluated for templated reaction with nucleophile (phosphorothioate) probes both in vitro and in intact bacterial cells. All three DD probe designs provided substantially better initial quenching than a single-Dabsyl control. In isothermal templated reactions in vitro, double displacement probes yielded considerably lower background signal than previous single displacement probes; investigation into the mechanism revealed that one dabsylate acts as a sacrificial leaving group, reacting nonspecifically with water, but yielding little signal because another quencher group remains. Templated reaction with the specific nucleophile probe is required to activate a signal. The double displacement probes provided a ca. 80-fold turn-on signal and yielded a 2-4-fold improvement in signal/background over single Dabsyl probes. The best-performing probe architecture was demonstrated in a two-color, FRET-based two-allele discrimination system in vitro and was shown to be capable of discriminating between two closely related species of bacteria differing by a single nucleotide at an rRNA target site.

  20. BER Analysis Using Beat Probability Method of 3D Optical CDMA Networks with Double Balanced Detection

    Directory of Open Access Journals (Sweden)

    Chih-Ta Yen

    2015-01-01

    Full Text Available This study proposes novel three-dimensional (3D matrices of wavelength/time/spatial code for code-division multiple-access (OCDMA networks, with a double balanced detection mechanism. We construct 3D carrier-hopping prime/modified prime (CHP/MP codes by extending a two-dimensional (2D CHP code integrated with a one-dimensional (1D MP code. The corresponding coder/decoder pairs were based on fiber Bragg gratings (FBGs and tunable optical delay lines integrated with splitters/combiners. System performance was enhanced by the low cross correlation properties of the 3D code designed to avoid the beat noise phenomenon. The CHP/MP code cardinality increased significantly compared to the CHP code under the same bit error rate (BER. The results indicate that the 3D code method can enhance system performance because both the beating terms and multiple-access interference (MAI were reduced by the double balanced detection mechanism. Additionally, the optical component can also be relaxed for high transmission scenery.

  1. The Majorana Double Beta Decay Experiment: Present Status

    Energy Technology Data Exchange (ETDEWEB)

    Aguayo, Estanislao; Avignone, Frank T.; Back, Henning O.; Barabash, Alexander S.; Beene, Jim; Bergevin, M.; Bertrand, F.; Boswell, M.; Brudanin, V.; Busch, Matthew; Chan, Yuen-Dat; Christofferson, C. D.; Collar, J. I.; Combs, Dustin C.; Cooper, R. J.; Detwiler, Jason A.; Doe, Peter J.; Efremenko, Yuri; Egorov, Viatcheslav; Ejiri, H.; Elliott, S. R.; Esterline, James H.; Fast, James E.; Fields, N.; Finnerty, P.; Fraenkle, Florian; Gehman, Victor M.; Giovanetti, G. K.; Green, M. P.; Guiseppe, V. E.; Gusey, K.; Hallin, A. L.; Hazama, R.; Henning, Reyco; Hime, Andrew; Hoppe, Eric W.; Horton, Mark; Howard, Stanley; Howe, M. A.; Johnson, R. A.; Keeter, K.; Keller, C.; Kidd, M. F.; Knecht, A.; Kochetov, Oleg; Konovalov, S.; Kouzes, Richard T.; Laferriere, Brian D.; LaRoque, B. H.; Leon, Jonathan D.; Leviner, L.; Loach, J. C.; MacMullin, S.; Marino, Michael G.; Martin, R. D.; Mei, Dong-Ming; Merriman, Jason H.; Miller, M. L.; Mizouni, Leila; Nomachi, Masaharu; Orrell, John L.; Overman, Nicole R.; Phillips II, D. G.; Poon, Alan; Perumpilly, Gopakumar; Prior, Gersende; Radford, D. C.; Rielage, Keith; Robertson, R. G. H.; Ronquest, M. C.; Schubert, Alexis G.; Shima, T.; Shirchenko, M.; Snavely, Kyle J.; Steele, David; Strain, J.; Thomas, K.; Timkin, V.; Tornow, W.; Vanyushin, I.; Varner, R. L.; Vetter, Kai; Vorren, Kris R.; Wilkerson, J. F.; Yakushev, E.; Young, A.; Yu, Chang-Hong; Yumatov, Vladimir; Zhang, C.

    2013-06-01

    The Majorana collaboration is actively pursuing research and development aimed at a tonne-scale 76Ge neutrinoless double-beta decay experiment, an R&D effort that will field approximately 40 kg of germanium detectors with mixed enrichment levels. This article provides a status update on the construction of the Demonstrator

  2. Grand unification and the double beta-decay

    International Nuclear Information System (INIS)

    Faessler, A.

    1992-01-01

    Models of the unification of the electroweak and the strong interaction predict that the neutrino is a Majorana particle and therefore essentially identical with its own antiparticle. In such grand unified models the neutrino has also a finite mass and a slight right-handed weak interaction, since the model is left-right symmetric. These models have also left handed and right-handed vector bosons to mediate the weak interactions. If these models are correct the neutrinoless double beta-decay is feasable. Thus if one finds the neutrinoless double beta-decay one knows that the standard model can not be correct in which the neutrino is a Dirac particle and therefore different from its antiparticle. Although the neutrinoless double beta-decay has not been seen it is possible to extract from the lower limits of the lifetime against the double neutrinoless beta-decay upper limits for the effective electron-neutrino mass and for the effective mixing angle of the right-handed and the left-handed vector bosons mediating the weak interaction. One also can obtain an effective upper limit for the mass ratio of the light and the heavy vector bosons. The extraction of this physical quantities from the data is made difficult due to the fact that the weak interaction must not be diagonal in the representation of the mass matrix of the six neutrinos requested by such left-right symmetric models. (author)

  3. A Novel Multiple-Bits Collision Attack Based on Double Detection with Error-Tolerant Mechanism

    Directory of Open Access Journals (Sweden)

    Ye Yuan

    2018-01-01

    Full Text Available Side-channel collision attacks are more powerful than traditional side-channel attack without knowing the leakage model or establishing the model. Most attack strategies proposed previously need quantities of power traces with high computational complexity and are sensitive to mistakes, which restricts the attack efficiency seriously. In this paper, we propose a multiple-bits side-channel collision attack based on double distance voting detection (DDVD and also an improved version, involving the error-tolerant mechanism, which can find all 120 relations among 16 key bytes when applied to AES (Advanced Encryption Standard algorithm. In addition, we compare our collision detection method called DDVD with the Euclidean distance and the correlation-enhanced collision method under different intensity of noise, which indicates that our detection technique performs better in the circumstances of noise. Furthermore, 4-bit model of our collision detection method is proven to be optimal in theory and in practice. Meanwhile the corresponding practical attack experiments are also performed on a hardware implementation of AES-128 on FPGA board successfully. Results show that our strategy needs less computation time but more traces than LDPC method and the online time for our strategy is about 90% less than CECA and 96% less than BCA with 90% success rate.

  4. Microscopic polyangiitis complicated with ileal involvement detected by double-balloon endoscopy: a case report.

    Science.gov (United States)

    Fukushima, Masashi; Inoue, Satoko; Ono, Yuichiro; Tamaki, Yoshitaka; Yoshimura, Hajime; Imai, Yukihiro; Inokuma, Tetsuro

    2013-03-02

    Microscopic polyangiitis is characterized by pauci-immune, necrotizing small-vessel vasculitis and an anti-neutrophil cytoplasmic antibody-associated vasculitis. Although gastrointestinal involvement in microscopic polyangiitis is not rare, endoscopic observation of it is extremely rare. To the best of our knowledge, this is the first case report of small intestinal involvement in microscopic polyangiitis detected and followed up by double-balloon endoscopy. A 70-year-old Japanese woman was transferred to our hospital for close examination of suspected small intestinal lymphoma. Retrograde double-balloon endoscopy revealed various forms of ulcers with redness and edema in the ileum. Histological findings suggested ischemic changes. Because mononeuritis multiplex and a fever spike appeared later, vasculitis was suspected. The perinuclear anti-neutrophil cytoplasmic antibody titer was elevated. Nerve biopsy results suggested vasculitis. From these findings, microscopic polyangiitis was diagnosed. It was suggested that microscopic polyangiitis caused the intestinal involvement. Intravenous pulse cyclophosphamide and oral predonisolone were started. After treatment, perinuclear anti-neutrophil cytoplasmic antibodies decreased to the normal range. Retrograde double-balloon endoscopy after treatment showed ulcer scars and no ulcer. The cause of gastrointestinal involvement in microscopic polyangiitis is ischemia due to vasculitis. It is difficult to diagnose small-vessel vasculitis by endoscopic biopsy. Although histological evidence of microscopic polyangiitis is important, the treatment should not be delayed by repeating the biopsy, because such delay can result in adverse sequela.This case report shows that microscopic polyangiitis should be considered as a differential diagnosis when small intestinal changes like those in the present case are observed by endoscopy.

  5. Double-blind test program for astrometric planet detection with Gaia

    Science.gov (United States)

    Casertano, S.; Lattanzi, M. G.; Sozzetti, A.; Spagna, A.; Jancart, S.; Morbidelli, R.; Pannunzio, R.; Pourbaix, D.; Queloz, D.

    2008-05-01

    Aims: The scope of this paper is twofold. First, it describes the simulation scenarios and the results of a large-scale, double-blind test campaign carried out to estimate the potential of Gaia for detecting and measuring planetary systems. The identified capabilities are then put in context by highlighting the unique contribution that the Gaia exoplanet discoveries will be able to bring to the science of extrasolar planets in the next decade. Methods: We use detailed simulations of the Gaia observations of synthetic planetary systems and develop and utilize independent software codes in double-blind mode to analyze the data, including statistical tools for planet detection and different algorithms for single and multiple Keplerian orbit fitting that use no a priori knowledge of the true orbital parameters of the systems. Results: 1) Planets with astrometric signatures α≃ 3 times the assumed single-measurement error σ_ψ and period P≤ 5 yr can be detected reliably and consistently, with a very small number of false positives. 2) At twice the detection limit, uncertainties in orbital parameters and masses are typically 15-20%. 3) Over 70% of two-planet systems with well-separated periods in the range 0.2≤ P≤ 9 yr, astrometric signal-to-noise ratio 2≤α/σ_ψ≤ 50, and eccentricity e≤ 0.6 are correctly identified. 4) Favorable orbital configurations (both planets with P≤ 4 yr and α/σ_ψ≥ 10, redundancy over a factor of 2 in the number of observations) have orbital elements measured to better than 10% accuracy > 90% of the time, and the value of the mutual inclination angle i_rel determined with uncertainties ≤ 10°. 5) Finally, nominal uncertainties obtained from the fitting procedures are a good estimate of the actual errors in the orbit reconstruction. Extrapolating from the present-day statistical properties of the exoplanet sample, the results imply that a Gaia with σ_ψ = 8 μas, in its unbiased and complete magnitude-limited census of

  6. Nuclear aspects of double-beta decay

    International Nuclear Information System (INIS)

    Stoica, S.; Paun, V.

    2002-01-01

    Calculations of the neutrinoless double-beta decay (0νββ) matrix elements are performed with the second quasi random phase approximation (SQRPA) method for several nuclei. The results display a weak dependence on the single particle basis used and the Ikeda sum rule is fulfilled with good accuracy. Comparing our calculations with similar ones performed with other QRPA-based methods we estimate the accuracy of these methods in the prediction of the (0νββ) decay matrix elements and neutrino mass parameter, which is settled to about 50% from their calculated values. Taking the most recent experimental limits for the neutrinoless double beta decay half-lives, we also deduced new limits for the neutrino mass parameter. (authors)

  7. Analysis of gate underlap channel double gate MOS transistor for electrical detection of bio-molecules

    Science.gov (United States)

    Ajay; Narang, Rakhi; Saxena, Manoj; Gupta, Mridula

    2015-12-01

    In this paper, an analytical model for gate drain underlap channel Double-Gate Metal-Oxide-Semiconductor Field-Effect Transistor (DG-MOSFET) for label free electrical detection of biomolecules has been proposed. The conformal mapping technique has been used to derive the expressions for surface potential, lateral electric field, energy bands (i.e. conduction and valence band) and threshold voltage (Vth). Subsequently a full drain current model to analyze the sensitivity of the biosensor has been developed. The shift in the threshold voltage and drain current (after the biomolecules interaction with the gate underlap channel region of the MOS transistor) has been used as a sensing metric. All the characteristic trends have been verified through ATLAS (SILVACO) device simulation results.

  8. Detection of single electron spin resonance in a double quantum dota)

    Science.gov (United States)

    Koppens, F. H. L.; Buizert, C.; Vink, I. T.; Nowack, K. C.; Meunier, T.; Kouwenhoven, L. P.; Vandersypen, L. M. K.

    2007-04-01

    Spin-dependent transport measurements through a double quantum dot are a valuable tool for detecting both the coherent evolution of the spin state of a single electron, as well as the hybridization of two-electron spin states. In this article, we discuss a model that describes the transport cycle in this regime, including the effects of an oscillating magnetic field (causing electron spin resonance) and the effective nuclear fields on the spin states in the two dots. We numerically calculate the current flow due to the induced spin flips via electron spin resonance, and we study the detector efficiency for a range of parameters. The experimental data are compared with the model and we find a reasonable agreement.

  9. Double beta decays and neutrino masses

    International Nuclear Information System (INIS)

    Ejiri, Hiro

    2006-01-01

    Neutrino-less double beta decays(0νββ) are of great interest for studying the Majorana nature of ν's and the absolute ν-mass scale. The present report is a brief review of the 0νββ studies with emphasis on future experiments with the mass sensitivity of an order of 25∼100 meV and on experimental probes for investigating 0νββ nuclear matrix elements

  10. How nanoparticles encapsulating fluorophores allow a double detection of biomolecules by localized surface plasmon resonance and luminescence

    International Nuclear Information System (INIS)

    Barbillon, G; Faure, A C; Kork, N El; Moretti, P; Roux, S; Tillement, O; Ou, M G; Descamps, A; Perriat, P; Vial, A; Bijeon, J-L; Marquette, C A; Jacquier, B

    2008-01-01

    The paper shows how polysiloxane particles encapsulating fluorophores can be successfully used to detect biotin-streptavidin binding by two types of technique. After functionalization of the particles by streptavidin, the fixation of the biomolecule can indeed be detected by a shift of the localized surface plasmon resonance of the biotinylated gold dots used as substrate and by the luminescence of the fluorophores evidenced by scanning near-field optical microscopy. The development of particles allowing such a double detection opens a route for increasing the reliability of biological detection and for multi-labelling strategies crossing both detection principles

  11. How nanoparticles encapsulating fluorophores allow a double detection of biomolecules by localized surface plasmon resonance and luminescence

    Energy Technology Data Exchange (ETDEWEB)

    Barbillon, G; Faure, A C; Kork, N El; Moretti, P [Universite de Lyon, Universite Lyon 1, CNRS UMR 5620, Laboratoire de Physico-Chimie des Materiaux Luminescents (LPCML), Domaine Scientifique de La Doua, Bat Kastler, 10 rue Andre Marie Ampere 69622 Villeurbanne Cedex (France); Roux, S; Tillement, O [Universite de Lyon, Universite Lyon 1, CNRS UMR 5620, Laboratoire de Physico-Chimie des Materiaux Luminescents (LPCML), Domaine Scientifique de La Doua, Bat Kastler, 10 rue Andre Marie Ampere 69622 Villeurbanne Cedex (France); Ou, M G; Descamps, A; Perriat, P [Materiaux, Ingenierie et Sciences (MATEIS), CNRS UMR 5510, Universite de Lyon, INSA-Lyon, Domaine Scientifique de La Doua, 7 avenue Jean Capelle 69621 Villeurbanne Cedex (France); Vial, A; Bijeon, J-L [Institut Charles Delaunay, CNRS FRE 2848, Laboratoire de Nanotechnologie et d' Instrumentation Optique (LNIO), Universite de Technologie de Troyes, 12 rue Marie Curie BP 2060 10010 Troyes Cedex (France); Marquette, C A [Laboratoire de Genie Enzymatique et Biomoleculaire, UMR 5246 CNRS-ICBMS, Universite de Lyon, Universite Lyon 1, 69622 Villeurbanne Cedex (France); Jacquier, B [Universite de Lyon, Universite Lyon 1, CNRS UMR 5620, Laboratoire de Physico-Chimie des Materiaux Luminescents (LPCML), Domaine Scientifique de La Doua, Bat Kastler, 10 rue Andre Marie Ampere 69622 Villeurbanne Cedex (France)

    2008-01-23

    The paper shows how polysiloxane particles encapsulating fluorophores can be successfully used to detect biotin-streptavidin binding by two types of technique. After functionalization of the particles by streptavidin, the fixation of the biomolecule can indeed be detected by a shift of the localized surface plasmon resonance of the biotinylated gold dots used as substrate and by the luminescence of the fluorophores evidenced by scanning near-field optical microscopy. The development of particles allowing such a double detection opens a route for increasing the reliability of biological detection and for multi-labelling strategies crossing both detection principles.

  12. Combining Frequency Doubling Technology Perimetry and Scanning Laser Polarimetry for Glaucoma Detection.

    Science.gov (United States)

    Mwanza, Jean-Claude; Warren, Joshua L; Hochberg, Jessica T; Budenz, Donald L; Chang, Robert T; Ramulu, Pradeep Y

    2015-01-01

    To determine the ability of frequency doubling technology (FDT) and scanning laser polarimetry with variable corneal compensation (GDx-VCC) to detect glaucoma when used individually and in combination. One hundred ten normal and 114 glaucomatous subjects were tested with FDT C-20-5 screening protocol and the GDx-VCC. The discriminating ability was tested for each device individually and for both devices combined using GDx-NFI, GDx-TSNIT, number of missed points of FDT, and normal or abnormal FDT. Measures of discrimination included sensitivity, specificity, area under the curve (AUC), Akaike's information criterion (AIC), and prediction confidence interval lengths. For detecting glaucoma regardless of severity, the multivariable model resulting from the combination of GDx-TSNIT, number of abnormal points on FDT (NAP-FDT), and the interaction GDx-TSNIT×NAP-FDT (AIC: 88.28, AUC: 0.959, sensitivity: 94.6%, specificity: 89.5%) outperformed the best single-variable model provided by GDx-NFI (AIC: 120.88, AUC: 0.914, sensitivity: 87.8%, specificity: 84.2%). The multivariable model combining GDx-TSNIT, NAP-FDT, and interaction GDx-TSNIT×NAP-FDT consistently provided better discriminating abilities for detecting early, moderate, and severe glaucoma than the best single-variable models. The multivariable model including GDx-TSNIT, NAP-FDT, and the interaction GDx-TSNIT×NAP-FDT provides the best glaucoma prediction compared with all other multivariable and univariable models. Combining the FDT C-20-5 screening protocol and GDx-VCC improves glaucoma detection compared with using GDx or FDT alone.

  13. Automated microaneurysm detection method based on double ring filter in retinal fundus images

    Science.gov (United States)

    Mizutani, Atsushi; Muramatsu, Chisako; Hatanaka, Yuji; Suemori, Shinsuke; Hara, Takeshi; Fujita, Hiroshi

    2009-02-01

    The presence of microaneurysms in the eye is one of the early signs of diabetic retinopathy, which is one of the leading causes of vision loss. We have been investigating a computerized method for the detection of microaneurysms on retinal fundus images, which were obtained from the Retinopathy Online Challenge (ROC) database. The ROC provides 50 training cases, in which "gold standard" locations of microaneurysms are provided, and 50 test cases without the gold standard locations. In this study, the computerized scheme was developed by using the training cases. Although the results for the test cases are also included, this paper mainly discusses the results for the training cases because the "gold standard" for the test cases is not known. After image preprocessing, candidate regions for microaneurysms were detected using a double-ring filter. Any potential false positives located in the regions corresponding to blood vessels were removed by automatic extraction of blood vessels from the images. Twelve image features were determined, and the candidate lesions were classified into microaneurysms or false positives using the rule-based method and an artificial neural network. The true positive fraction of the proposed method was 0.45 at 27 false positives per image. Forty-two percent of microaneurysms in the 50 training cases were considered invisible by the consensus of two co-investigators. When the method was evaluated for visible microaneurysms, the sensitivity for detecting microaneurysms was 65% at 27 false positives per image. Our computerized detection scheme could be improved for helping ophthalmologists in the early diagnosis of diabetic retinopathy.

  14. New Technique for Barium Daughter Ion Identification in a Liquid Xe-136 Double Beta Decay Experiment

    Energy Technology Data Exchange (ETDEWEB)

    Fairbank, William [Colorado State Univ., Fort Collins, CO (United States)

    2016-06-08

    This work addresses long-standing issues of fundamental interest in elementary particle physics. The most important outcome of this work is a new limit on neutrinoless double beta decay. This is an extremely rare and long-sought-after type of radioactive decay. If discovered, it would require changes in the standard model of the elementary constituents of matter, and would prove that neutrinos and antineutrinos are the same, a revolutionary concept in particle physics. Neutrinos are major components of the matter in the universe that are so small and so weakly interacting with other matter that their masses have not yet been discovered. A discovery of neutrinoless double beta decay could help determine the neutrino masses. An important outcome of the work on this project was the Colorado State University role in operating the EXO-200 neutrinoless double beta decay experiment and in analysis of the data from this experiment. One type of double beta decay of the isotope 136Xe, the two-neutrino variety, was discovered in this work. Although the other type of double beta decay, the neutrinoless variety, was not yet discovered in this work, a world’s best sensitivity of 1.9x1025 year half-life was obtained. This result rules out a previous claim of a positive result in a different isotope. This work also establishes that the masses of the neutrinos are less than one millionth of that of electrons. A unique EXO-200 analysis, in which the CSU group had a leading role, has established for the first time ever in a liquid noble gas the fraction of daughter atoms from alpha and beta decay that are ionized. This result has important impact on other pending studies, including nucleon decay and barium tagging. Novel additional discoveries include multiphoton ionization of liquid xenon with UV pulsed lasers, which may find application in calibration of future noble liquid detectors, and studies of association and dissociation reactions of Ba

  15. Review of modern double beta decay experiments

    Science.gov (United States)

    Barabash, A. S.

    2015-10-01

    The review of modern experiments on search and studying of double beta decay processes is done. Results of the most sensitive current experiments are discussed. The main attention is paid to EXO-200, KamLAND-Zen, GERDA-I and CUORE-0 experiments. Modern values of T1/2(2ν) and best present limits on neutrinoless double beta decay and double beta decay with Majoron emission are presented. Conservative limits on effective mass of a Majorana neutrino ( at the level of ˜ 0.01-0.1 eV are discussed.

  16. Majorana neutrinos and double beta-decay

    International Nuclear Information System (INIS)

    Shchepkin, M.G.

    1986-01-01

    Problem, related to neutrino mass and lepton charge L conservation is briefly discussed. A possibility to experimentally test L conservation in different processes and to produce limitations for neutrino mass in double beta-decay processes is considered. Planned experiments on studying the double neutrinoless (2β) beta-decays and searching 2β(2ν)-decays, permitted by the conservation laws, are discussed. It is stressed, that comparison of the existing theoretical predictions of 2β(2ν)-decay probability with experimental results will make it possible to choose the most adequate approach to the calculation of double β-transition nuclear amplitudes

  17. Double line sign: a helpful sonographic sign to detect occult fractures of the proximal humerus

    International Nuclear Information System (INIS)

    Rutten, Matthieu J.C.M.; Jager, Gerrit J.; Waal malefijt, Maarten C. de; Blickman, Johan G.

    2007-01-01

    The aim of this study was to describe a new sonographic sign of bone fracture and to determine if it can be helpful in decreasing the number of missed fractures of the proximal humerus. Ultrasound (US) of the shoulder was performed in 57 consecutive patients with shoulder pain and/or disability following trauma. All cases were prospectively reviewed for the presence of a humeral fracture. Sonographic signs of fractures, with special emphasis on what was termed the 'double line sign' (DLS), were assessed. Plain radiography was considered the standard of reference and in equivocal cases magnetic resonance imaging (MRI). Twenty-eight patients had a tuberosity complex fracture, which were all detected at US examination. Sonographic features of a fracture were periosteal elevation, corticol bone discontinuity, step-off deformity or a combination of these findings. This study showed that in 26 (93%) patients an additional sonographic feature, a DLS, could be demonstrated. The DLS is a helpful and probably reliable sonographic sign to indicate a humeral fracture. High-spatial-resolution US substantially increases the detection of fractures of the proximal humerus and should be considered as an alternative diagnostic tool prior to computed tomography (CT), MRI and arthroscopy in patients with persisting shoulder pain and/or disability following trauma. (orig.)

  18. Double line sign: a helpful sonographic sign to detect occult fractures of the proximal humerus

    Energy Technology Data Exchange (ETDEWEB)

    Rutten, Matthieu J.C.M.; Jager, Gerrit J. [Jeroen Bosch Hospital, Department of Radiology, Hertogenbosch (Netherlands); Waal malefijt, Maarten C. de [University Medical Center Nijmegen, Department of Orthopedic Surgery, Nijmegen (Netherlands); Blickman, Johan G. [University Medical Center Nijmegen, Department of Radiology, Nijmegen (Netherlands)

    2007-03-15

    The aim of this study was to describe a new sonographic sign of bone fracture and to determine if it can be helpful in decreasing the number of missed fractures of the proximal humerus. Ultrasound (US) of the shoulder was performed in 57 consecutive patients with shoulder pain and/or disability following trauma. All cases were prospectively reviewed for the presence of a humeral fracture. Sonographic signs of fractures, with special emphasis on what was termed the 'double line sign' (DLS), were assessed. Plain radiography was considered the standard of reference and in equivocal cases magnetic resonance imaging (MRI). Twenty-eight patients had a tuberosity complex fracture, which were all detected at US examination. Sonographic features of a fracture were periosteal elevation, corticol bone discontinuity, step-off deformity or a combination of these findings. This study showed that in 26 (93%) patients an additional sonographic feature, a DLS, could be demonstrated. The DLS is a helpful and probably reliable sonographic sign to indicate a humeral fracture. High-spatial-resolution US substantially increases the detection of fractures of the proximal humerus and should be considered as an alternative diagnostic tool prior to computed tomography (CT), MRI and arthroscopy in patients with persisting shoulder pain and/or disability following trauma. (orig.)

  19. Fermi LAT Pulsed Detection of PSR J0737-3039A in the Double Pulsar System

    Science.gov (United States)

    Guillemot, L.; Kramer, M.; Johnson, T. J.; Craig, H. A.; Romani, R. W.; Venter, C.; Harding, A. K.; Ferdman, R. D.; Stairs, I. H.; Kerr, M.

    2013-01-01

    We report the Fermi Large Area Telescope discovery of gamma-ray pulsations from the 22.7 ms pulsar A in the double pulsar system J0737-3039A/B. This is the first mildly recycled millisecond pulsar (MSP) detected in the GeV domain. The 2.7 s companion object PSR J0737-3039B is not detected in gamma rays. PSR J0737-3039A is a faint gamma-ray emitter, so that its spectral properties are only weakly constrained; however, its measured efficiency is typical of other MSPs. The two peaks of the gamma-ray light curve are separated by roughly half a rotation and are well offset from the radio and X-ray emission, suggesting that the GeV radiation originates in a distinct part of the magnetosphere from the other types of emission. From the modeling of the radio and the gamma-ray emission profiles and the analysis of radio polarization data, we constrain the magnetic inclination alpha and the viewing angle zeta to be close to 90 deg., which is consistent with independent studies of the radio emission from PSR J0737-3039A. A small misalignment angle between the pulsar's spin axis and the system's orbital axis is therefore favored, supporting the hypothesis that pulsar B was formed in a nearly symmetric supernova explosion as has been discussed in the literature already.

  20. FERMI LAT PULSED DETECTION OF PSR J0737-3039A IN THE DOUBLE PULSAR SYSTEM

    Energy Technology Data Exchange (ETDEWEB)

    Guillemot, L.; Kramer, M. [Max-Planck-Institut fuer Radioastronomie, Auf dem Huegel 69, D-53121 Bonn (Germany); Johnson, T. J. [National Research Council Research Associate, National Academy of Sciences, Washington, DC 20001 (United States); Craig, H. A.; Romani, R. W.; Kerr, M. [W. W. Hansen Experimental Physics Laboratory, Kavli Institute for Particle Astrophysics and Cosmology, Department of Physics and SLAC National Accelerator Laboratory, Stanford University, Stanford, CA 94305 (United States); Venter, C. [Centre for Space Research, North-West University, Potchefstroom Campus, Private Bag X6001, 2520 Potchefstroom (South Africa); Harding, A. K. [NASA Goddard Space Flight Center, Greenbelt, MD 20771 (United States); Ferdman, R. D. [Jodrell Bank Centre for Astrophysics, School of Physics and Astronomy, The University of Manchester, M13 9PL (United Kingdom); Stairs, I. H., E-mail: guillemo@mpifr-bonn.mpg.de [Department of Physics and Astronomy, University of British Columbia, Vancouver, BC V6T 1Z1 (Canada)

    2013-05-10

    We report the Fermi Large Area Telescope discovery of {gamma}-ray pulsations from the 22.7 ms pulsar A in the double pulsar system J0737-3039A/B. This is the first mildly recycled millisecond pulsar (MSP) detected in the GeV domain. The 2.7 s companion object PSR J0737-3039B is not detected in {gamma} rays. PSR J0737-3039A is a faint {gamma}-ray emitter, so that its spectral properties are only weakly constrained; however, its measured efficiency is typical of other MSPs. The two peaks of the {gamma}-ray light curve are separated by roughly half a rotation and are well offset from the radio and X-ray emission, suggesting that the GeV radiation originates in a distinct part of the magnetosphere from the other types of emission. From the modeling of the radio and the {gamma}-ray emission profiles and the analysis of radio polarization data, we constrain the magnetic inclination {alpha} and the viewing angle {zeta} to be close to 90 Degree-Sign , which is consistent with independent studies of the radio emission from PSR J0737-3039A. A small misalignment angle between the pulsar's spin axis and the system's orbital axis is therefore favored, supporting the hypothesis that pulsar B was formed in a nearly symmetric supernova explosion as has been discussed in the literature already.

  1. Sensitivity and Specificity of Double-Track Sign in the Detection of Transverse Sinus Stenosis: A Multicenter Retrospective Study.

    Science.gov (United States)

    Zhu, De-Sheng; Fu, Jue; Zhang, Yi; Xie, Chong; Wang, Xiao-Qing; Zhang, Yue; Yang, Jie; Li, Shi-Xu; Liu, Xiao-Bei; Wan, Zhi-Wen; Dong, Qiang; Guan, Yang-Tai

    2015-01-01

    Transverse sinus stenosis (TSS) is common among patients with cerebral venous sinus thrombosis. No previous studies have reported on double-track sign detected on axial Gd-enhanced T1WI in TSS. This study aimed to determine the sensitivity and specificity of the double-track sign in the detection of TSS. We retrospectively reviewed medical records of 383 patients with transverse sinus thrombosis (TST) and 30 patients with normal transverse sinus from 5 participating hospitals in china from January 2008 to June 2014. 167 feasible transverse sinuses included in this study were categorized into TSS (n = 76), transverse sinus occlusion (TSO) (n = 52) and transverse sinus normal (TSN) groups (n = 39) according to imaging diagnosis on digital subtraction angiography (DSA) or magnetic resonance venography (MRV). Double-track sign on axial Gd-enhanced T1WI was compared among the three groups. Sensitivity and specificity of double-track sign in detection of TSS were calculated, with final imaging diagnosis of TSS on DSA or MRV as the reference standard. Of 383 patients with TST recruited over a 6.5-year period, 128 patients were enrolled in the study, 255 patients were excluded because of insufficient clinical data, imaging finding and delay time, and 30 matched patients with normal transverse sinus were enrolled in the control group. Therefore, double-track sign assessment was conducted in 167 available transverse sinuses of 158 patients. Of the 76 sinuses in TSS group, 51 had double-track sign. Of the other 91 sinuses in TSO and TSN groups, 3 had a false-positive double-track sign. Thus, double-track sign on axial Gd-enhanced T1WI was 67.1% (95% CI 55.3-77.2) sensitive and 96.7% (95% CI 89.9-99.1) specific for detection of TSS. The double-track sign on axial Gd-enhanced T1WI is highly specific and moderate sensitive for detection of TSS. Nevertheless, it could be a direct sign and might provide an early clue for TSS.

  2. Double Beta Decay

    International Nuclear Information System (INIS)

    Fiorini, Ettore

    2008-01-01

    The importance of neutrinoless Double Beta Decay (DBD) is stressed in view of the recent results of experiments on neutrino oscillations which indicate that the difference between the squared masses of two neutrinos of different flavours is finite [For a recent review including neutrino properties and recent results see: Review of Particle Physics, J. of Phys. G: Nuclear and Particle Physics 33, 1]. As a consequence the mass of at least one neutrino has to be different from zero and it becomes imperative to determine its absolute value. The various experimental techniques to search for DBD are discussed together with the difficult problems of the evaluation of the corresponding nuclear matrix elements. The upper limits on neutrino mass coming from the results of the various experiments are reported together with the indication for a non zero value by one of them not confirmed so far. The two presently running experiments on neutrinoless DBD are briefly described together with the already approved or designed second generation searches aiming to reach the values on the absolute neutrino mass indicated by the results on neutrino oscillations

  3. Detection of a Double Relic in the Torpedo Cluster: SPT-CL J0245-5302

    Science.gov (United States)

    Zheng, Q.; Johnston-Hollitt, M.; Duchesne, S. W.; Li, W. T.

    2018-06-01

    The Torpedo cluster, SPT-CL J0245-5302 (S0295) is a massive, merging cluster at a redshift of z = 0.300, which exhibits a strikingly similar morphology to the Bullet cluster 1E 0657-55.8 (z = 0.296), including a classic bow shock in the cluster's intra-cluster medium revealed by Chandra X-ray observations. We present Australia Telescope Compact Array data centred at 2.1 GHz and Murchison Widefield Array data at frequencies between 72 MHz and 231 MHz which we use to study the properties of the cluster. We characterise a number of discrete and diffuse radio sources in the cluster, including the detection of two previously unknown radio relics on the cluster periphery. The average spectral index of the diffuse emission between 70 MHz and 3.1 GHz is α =-1.63_{-0.10}^{+0.10} and a radio-derived Mach number for the shock in the west of the cluster is calculated as M = 2.04. The Torpedo cluster is thus a double relic system at moderate redshift.

  4. Effective laser-induced breakdown spectroscopy (LIBS) detection using double pulse at optimum configuration.

    Science.gov (United States)

    Choi, Soo Jin; Yoh, Jack J

    2011-08-01

    A short laser pulse is irradiated on a sample to create a highly energetic plasma that emits light of a specific peak wavelength according to the material. By identifying different peaks for the analyzed samples, their chemical composition can be rapidly determined. The characteristics of the laser-induced breakdown spectroscopy (LIBS) plasma are strongly dependent on the ambient conditions. Research aimed at enhancing LIBS intensity is of great benefit in advancing LIBS for the exploration of harsh environments. By using double-pulse LIBS, the signal intensity of Al and Ca lines was enhanced by five times compared to the single-pulse signal. Also, the angles of the target and detector are adjusted to simulate samples of arbitrary shape. We verified that there exists an optimal angle at which specific elements of a test sample may be detected with stronger signal intensity. We provide several optimum configurations for the LIBS system for maximizing the signal intensity for the analysis of a nonstandard aluminum sample.

  5. Multiple and double scattering contributions to depth resolution and low energy background in hydrogen elastic recoil detection

    Energy Technology Data Exchange (ETDEWEB)

    Wielunski, L S [Commonwealth Scientific and Industrial Research Organisation (CSIRO), Lindfield, NSW (Australia). Div. of Applied Physics

    1997-12-31

    The sensitivity of hydrogen elastic recoil detection ( ERD ) is usually limited by the low energy background in the ERD spectrum. A number of 4.5 MeV He{sup ++} hydrogen ERD spectra from different hydrogen implanted samples are compared. The samples are chosen with different atomic numbers from low Z (carbon) to high Z (tungsten carbide) to observe the effects of multiple scattering and double scattering within the sample material. The experimental depth resolution and levels of the low energy background in ERD spectra are compared with theoretical predictions from multiple and double scattering. 10 refs., 2 tabs., 5 figs.

  6. Multiple and double scattering contributions to depth resolution and low energy background in hydrogen elastic recoil detection

    Energy Technology Data Exchange (ETDEWEB)

    Wielunski, L.S. [Commonwealth Scientific and Industrial Research Organisation (CSIRO), Lindfield, NSW (Australia). Div. of Applied Physics

    1996-12-31

    The sensitivity of hydrogen elastic recoil detection ( ERD ) is usually limited by the low energy background in the ERD spectrum. A number of 4.5 MeV He{sup ++} hydrogen ERD spectra from different hydrogen implanted samples are compared. The samples are chosen with different atomic numbers from low Z (carbon) to high Z (tungsten carbide) to observe the effects of multiple scattering and double scattering within the sample material. The experimental depth resolution and levels of the low energy background in ERD spectra are compared with theoretical predictions from multiple and double scattering. 10 refs., 2 tabs., 5 figs.

  7. Early detection of osteoarthritis in rabbits using MRI with a double-contrast agent.

    Science.gov (United States)

    Onishi, Okihiro; Ikoma, Kazuya; Kido, Masamitsu; Kabuto, Yukichi; Ueshima, Keiichiro; Matsuda, Ken-Ichi; Tanaka, Masaki; Kubo, Toshikazu

    2018-03-13

    of the knees in a rabbit OA model and a control model using a new double-contrast agent. MRI with this agent enabled OA detection earlier than using conventional MRI.

  8. Multiparameter double hole contrast detail phantom: Ability to detect image displacement due to off position anode stem

    International Nuclear Information System (INIS)

    Pauzi, Nur Farahana; Majid, Zafri Azran Abdul; Sapuan, Abdul Halim; Junet, Laila Kalidah; Azemin, Mohd Zulfaezal Che

    2015-01-01

    Contrast Detail phantom is a quality control tool to analyze the performance of imaging devices. Currently, its function is solely to evaluate the contrast detail characteristic of imaging system. It consists of drilled hole which gives effect to the penetration of x-ray beam divergence to pass through the base of each hole. This effect will lead to false appearance of image from its original location but it does not being visualized in the radiograph. In this study, a new design of Contrast Detail phantom’s hole which consists of double hole construction has been developed. It can detect the image displacement which is due to off position of anode stem from its original location. The double hole differs from previous milled hole, whereby it consists of combination of different hole diameters. Small hole diameter (3 mm) is positioned on top of larger hole diameter (10 mm). The thickness of double hole acrylic blocks is 13 mm. Result revealed that Multiparameter Double Hole Contrast Detail phantom can visualize the shifted flaw image quality produced by x-ray machine due to improper position of the anode stem which is attached to rotor and stator. The effective focal spot of x-ray beam also has been shifted from the center of collimator as a result of off-position anode stem. As a conclusion, the new design of double hole Contrast Detail phantom able to measure those parameters in a well manner

  9. Multiparameter double hole contrast detail phantom: Ability to detect image displacement due to off position anode stem

    Energy Technology Data Exchange (ETDEWEB)

    Pauzi, Nur Farahana; Majid, Zafri Azran Abdul; Sapuan, Abdul Halim; Junet, Laila Kalidah [Department of Diagnostic Imaging and Radiotherapy, Kulliyyah of Allied Health Sciences, International Islamic University Malaysia, Jalan Istana, 25200, Kuantan, Pahang (Malaysia); Azemin, Mohd Zulfaezal Che [Department of Optometry and Visual Science, Kulliyyah of Allied Health Sciences, International Islamic University Malaysia, Jalan Istana, 25200, Kuantan, Pahang (Malaysia)

    2015-04-24

    Contrast Detail phantom is a quality control tool to analyze the performance of imaging devices. Currently, its function is solely to evaluate the contrast detail characteristic of imaging system. It consists of drilled hole which gives effect to the penetration of x-ray beam divergence to pass through the base of each hole. This effect will lead to false appearance of image from its original location but it does not being visualized in the radiograph. In this study, a new design of Contrast Detail phantom’s hole which consists of double hole construction has been developed. It can detect the image displacement which is due to off position of anode stem from its original location. The double hole differs from previous milled hole, whereby it consists of combination of different hole diameters. Small hole diameter (3 mm) is positioned on top of larger hole diameter (10 mm). The thickness of double hole acrylic blocks is 13 mm. Result revealed that Multiparameter Double Hole Contrast Detail phantom can visualize the shifted flaw image quality produced by x-ray machine due to improper position of the anode stem which is attached to rotor and stator. The effective focal spot of x-ray beam also has been shifted from the center of collimator as a result of off-position anode stem. As a conclusion, the new design of double hole Contrast Detail phantom able to measure those parameters in a well manner.

  10. Status of double beta decay experiments using isotopes other than 136Xe

    Science.gov (United States)

    Pandola, L.

    2014-09-01

    Neutrinoless double beta decay is a lepton-number violating process predicted by many extensions of the standard model. It is actively searched for in several candidate isotopes within many experimental projects. The status of the experimental initiatives which are looking for the neutrinoless double beta decay in isotopes other than 136Xe is reviewed, with special emphasis given to the projects that passed the R&D phase. The results recently released by the experiment GERDA are also summarized and discussed. The GERDA data give no positive indication of neutrinoless double beta decay of 76Ge and disfavor in a model-independent way the long-standing observation claim on the same isotope. The lower limit reported by GERDA for the half-life of neutrinoless double beta decay of 76Ge is T1/20ν > 2.1 ṡ1025 yr (90% C.L.), or T1/20ν > 3.0 ṡ1025 yr, when combined with the results of other 76Ge predecessor experiments.

  11. Double Beta Decay and Neutrino Masses Accuracy of the Nuclear Matrix Elements

    International Nuclear Information System (INIS)

    Faessler, Amand

    2005-01-01

    The neutrinoless double beta decay is forbidden in the standard model of the electroweak and strong interaction but allowed in most Grand Unified Theories (GUT's). Only if the neutrino is a Majorana particle (identical with its antiparticle) and if it has a mass, the neutrinoless double beta decay is allowed. Apart of one claim that the neutrinoless double beta decay in 76 Ge is measured, one has only upper limits for this transition probability. But even the upper limits allow to give upper limits for the electron Majorana neutrino mass and upper limits for parameters of GUT's and the minimal R-parity violating supersymmetric model. One further can give lower limits for the vector boson mediating mainly the right-handed weak interaction and the heavy mainly right-handed Majorana neutrino in left-right symmetric GUT's. For that one has to assume that the specific mechanism is the leading one for the neutrinoless double beta decay and one has to be able to calculate reliably the corresponding nuclear matrix elements. In the present contribution, one discusses the accuracy of the present status of calculating the nuclear matrix elements and the corresponding limits of GUT's and supersymmetric parameters

  12. The Milano-Gran Sasso double beta decay experiment: toward a 20-crystal array

    International Nuclear Information System (INIS)

    Alessandrello, A.; Brofferio, C.; Bucci, C.; Cremonesi, O.; Fiorini, E.; Giuliani, A.; Nucciotti, A.; Pavan, M.; Pessina, G.; Previtali, E.; Zanotti, L.

    1996-01-01

    TeO 2 thermal detectors are being used by the Milano group to search for neutrinoless double beta decay of 130 Te. An upper limit for neutrinoless decay half life of 2.1 x 10 22 yr at 90% CL obtained with a 334 g TeO 2 detector has been previously reported. To improve the sensitivity of the experiment an array of twenty 340 g TeO 2 crystals will be realised in the next future. As a first step toward the realisation of that experiment a 4 crystal detector has been tested in the Gran Sasso refrigerator. Detector performances, data acquisition and analysis are discussed. (orig.)

  13. Challenges in Double Beta Decay

    Directory of Open Access Journals (Sweden)

    Oliviero Cremonesi

    2014-01-01

    Full Text Available In the past ten years, neutrino oscillation experiments have provided the incontrovertible evidence that neutrinos mix and have finite masses. These results represent the strongest demonstration that the electroweak Standard Model is incomplete and that new Physics beyond it must exist. In this scenario, a unique role is played by the Neutrinoless Double Beta Decay searches which can probe lepton number conservation and investigate the Dirac/Majorana nature of the neutrinos and their absolute mass scale (hierarchy problem with unprecedented sensitivity. Today Neutrinoless Double Beta Decay faces a new era where large-scale experiments with a sensitivity approaching the so-called degenerate-hierarchy region are nearly ready to start and where the challenge for the next future is the construction of detectors characterized by a tonne-scale size and an incredibly low background. A number of new proposed projects took up this challenge. These are based either on large expansions of the present experiments or on new ideas to improve the technical performance and/or reduce the background contributions. In this paper, a review of the most relevant ongoing experiments is given. The most relevant parameters contributing to the experimental sensitivity are discussed and a critical comparison of the future projects is proposed.

  14. Double Trouble

    NARCIS (Netherlands)

    Elsaesser, Thomas; Kievit, Robert; Simons, Jan

    1994-01-01

    Double Trouble highlights the career of Dutch scriptwriter and television producer Chiem van Houweninge, well-known for his long-running TV comedy series and as author of episodes for TV detective series. Double Trouble gives Van Houweninge's own views on writing and filming in television prime

  15. Double-label immunofluorescence method for simultaneous detection of adenovirus and herpes simplex virus from the eye.

    Science.gov (United States)

    Walpita, P; Darougar, S

    1989-07-01

    The development and application of a double-label immunofluorescence method which has the potential to screen for single or dual infections from any site, in single shell vial cultures, is described. In this study, a total of 1,141 ocular specimens were inoculated in shell vials, centrifuged at 15,000 X g for 1 h, incubated at 37 degrees C for 48 h, and fixed in methanol at room temperature for 15 min. The virus inclusions were detected by staining with a double-label indirect immunofluorescence procedure using mixtures of appropriate first antibodies, followed by fluorescein- and rhodamine-conjugated second antibodies. Each specimen was also inoculated in parallel by the conventional virus isolation method. The sensitivity and specificity of the double-label shell vial procedure were comparable to those with the conventional method, and the former test took only 48 h to complete. The test offers a rapid and simple single-vial procedure which allows for individual or simultaneous detection of multiple pathogens. It results in savings in time and cost over the conventional virus isolation method and other shell vial procedures.

  16. Efficacy of double arterial phase dynamic magnetic resonance imaging with the sensitivity encoding technique versus dynamic multidetector-row helical computed tomography for detecting hypervascular hepatocellular carcinoma

    International Nuclear Information System (INIS)

    Kumano, Seishi; Okada, Masahiro; Murakami, Takamichi; Uemura, Masahiko; Haraikawa, Toyoaki; Hirata, Masaaki; Kikuchi, Keiichi; Mochizuki, Teruhito; Kim, Tonsok

    2009-01-01

    The aim of this study was to evaluate the efficacy of double arterial phase dynamic magnetic resonance imaging (MRI) with the sensitivity encoding technique (SENSE dynamic MRI) for detection of hypervascular hepatocellular carcinoma (HCC) in comparison with double arterial phase dynamic multidetector-row helical computed tomography (dynamic MDCT). A total of 28 patients with 66 hypervascular HCCs underwent both double arterial SENSE dynamic MRI and dynamic MDCT. The diagnosis of HCC was based on surgical resection (n=7), biopsy (n=10), or a combination of CT during arterial portography (CTAP), CT during hepatic arteriography (CTA), and/or the 6-month follow-up CT (n=49). Based on alternative-free response receiving operating characteristic (ROC) analysis, the diagnostic performance for detecting HCC was compared between double arterial phase SENSE dynamic MRI and double arterial phase dynamic MDCT. The mean sensitivity, positive predictive value, and mean A Z values for hypervascular HCCs were 72%, 80%, and 0.79, respectively, for SENSE dynamic MRI and 66%, 92%, and 0.78, respectively, for dynamic MDCT. The mean sensitivity for double arterial phase SENSE dynamic MRI was higher than that for double arterial phase dynamic MDCT, but the difference was not statistically significant. Double arterial phase SENSE dynamic MRI is as valuable as double arterial phase dynamic MDCT for detecting hypervascular HCCs. (author)

  17. A baseband circuit for wake-up receivers with double-mode detection and enhanced sensitivity robustness

    International Nuclear Information System (INIS)

    Zhu Wenrui; Yang Haigang; Gao Tongqiang; Liu Fei; Cheng Xiaoyan; Zhang Dandan

    2013-01-01

    This paper proposes a baseband circuit for wake-up receivers with double-mode detection and enhanced sensitivity robustness for use in the electronic toll collection system. A double-mode detection method, including amplitude detection and frequency detection, is proposed to reject interference and reduce false wake-ups. An improved closed-loop band-pass filter and a DC offset cancellation technique are also newly introduced to enhance the sensitivity robustness. The circuit is fabricated in TSMC 0.18 μm 3.3 V CMOS technology with an area of 0.12 mm 2 . Measurement results show that the sensitivity is −54.5 dBm with only a ±0.95 dBm variation from the 1.8 to 3.3 V power supply, and that the temperature variation of the sensitivity is ±1.4 dBm from −50 to 100°C. The current consumption is 1.4 to 1.7 μA under a 1.8 to 3.3 V power supply. (semiconductor integrated circuits)

  18. Analysis of uncertainties and detection limits for the double measurement method of {sup 90}Sr and {sup 89}Sr

    Energy Technology Data Exchange (ETDEWEB)

    Herranz, M., E-mail: m.herranz@ehu.es [Department of Nuclear Engineering and Fluid Mechanics, University of the Basque Country (UPV/EHU), Alameda de Urquijo s/n 48013 Bilbao (Spain); Idoeta, R.; Legarda, F. [Department of Nuclear Engineering and Fluid Mechanics, University of the Basque Country (UPV/EHU), Alameda de Urquijo s/n 48013 Bilbao (Spain)

    2011-08-15

    The determination process of the {sup 90}Sr and {sup 89}Sr contents in a sample, although it involves their radiochemical isolation, results always in a complex measurement process due to the interferences among their respective beta emissions and also among those of the daughter of {sup 90}Sr, {sup 90}Y, a beta emitter as well. In this paper, the process consisting in a double measurement method after the Sr radiochemical isolation is analyzed, developing the formulae to obtain activity concentrations, uncertainties and detection limits. A study of the trend of uncertainties and detection limits as function of the time in which the first measurement since the isolation is done, the delay between the two measurements and the activity concentration of each strontium isotope in the sample is carried out as well. Results show that with a very precise determination of the times involved in the whole process (isolation, measurement and duration of measurements) this method permits a reliable assessment of both strontium radioisotopes. The quicker the first measurement since the isolation is done and the longer the delay between measurements is chosen, the lower are the detection limits and the uncertainties of the activities obtained. - Highlights: > The double measurement method for {sup 90}Sr and {sup 89}Sr determination is analysed. > Uncertainties and detection limits are determined and their dependences studied. > Proposals for the optimization of the method are given.

  19. Electric-Field-Induced Superconductivity Detected by Magnetization Measurements of an Electric-Double-Layer Capacitor

    NARCIS (Netherlands)

    Kasahara, Yuichi; Nishijima, Takahiro; Sato, Tatsuya; Takeuchi, Yuki; Ye, Jianting; Yuan, Hongtao; Shimotani, Hidekazu; Iwasa, Yoshihiro

    We report evidence for superconductivity induced by the application of strong electric fields onto the surface of a band insulator, ZrNCl, provided by the observation of a shielding diamagnetic signal. We introduced an electric-double-layer capacitor configuration and in situ magnetization

  20. The Majorana Double Beta Decay Experiment:. Present Status

    Science.gov (United States)

    Aguayo, E.; Avignone, F. T.; Back, H. O.; Barabash, A. S.; Beene, J. R.; Bergevin, M.; Bertrand, F. E.; Boswell, M.; Brudanin, V.; Busch, M.; Chan, Y.-D.; Christofferson, C. D.; Collar, J. I.; Combs, D. C.; Cooper, R. J.; Detwiler, J. A.; Doe, P. J.; Efremenko, Yu.; Egorov, V.; Ejiri, H.; Elliott, S. R.; Esterline, J.; Fast, J. E.; Fields, N.; Finnerty, P.; Fraenkle, F. M.; Gehman, V. M.; Giovanetti, G. K.; Green, M. P.; Guiseppe, V. E.; Gusey, K.; Hallin, A. L.; Hazama, R.; Henning, R.; Hime, A.; Hoppe, E. W.; Horton, M.; Howard, S.; Howe, M. A.; Johnson, R. A.; Keeter, K. J.; Keller, C.; Kidd, M. F.; Knecht, A.; Kochetov, O.; Konovalov, S. I.; Kouzes, R. T.; Laferriere, B. D.; Laroque, B. H.; Leon, J.; Leviner, L. E.; Loach, J. C.; Macmullin, S.; Marino, M. G.; Martin, R. D.; Mei, D.-M.; Merriman, J. H.; Miller, M. L.; Mizouni, L.; Nomachi, M.; Orrell, J. L.; Overman, N. R.; Phillips, D. G.; Poon, A. W. P.; Perumpilly, G.; Prior, G.; Radford, D. C.; Rielage, K.; Robertson, R. G. H.; Ronquest, M. C.; Schubert, A. G.; Shima, T.; Shirchenko, M.; Snavely, K. J.; Steele, D.; Strain, J.; Thomas, K.; Timkin, V.; Tornow, W.; Vanyushin, I.; Varner, R. L.; Vetter, K.; Vorren, K.; Wilkerson, J. F.; Yakushev, E.; Young, A. R.; Yu, C.-H.; Yumatov, V. I.; Zhang, C.

    2013-11-01

    The Majorana collaboration is actively pursuing research and development aimed at a tonne-scale 76Ge neutrinoless double-beta decay (0νββ) experiment. The current, primary focus is the construction of the Majorana Demonstrator experiment, an R&D effort that will field approximately 40 kg of germanium detectors with mixed enrichment levels. This article provides a status update on the construction of the Demonstrator.

  1. Double Charge Exchange Reactions and Double Beta Decay

    Science.gov (United States)

    Auerbach, N.

    2018-05-01

    The subject of this presentation is at the forefront of nuclear physics, namely double beta decay. In particular one is most interested in the neutrinoless process of double beta decay, when the decay proceeds without the emission of two neutrinos. The observation of such decay would mean that the lepton conservation symmetry is violated and that the neutrinos are of Majorana type, meaning that they are their own anti-particles. The life time of this process has two unknowns, the mass of the neutrino and the nuclear matrix element. Determining the nuclear matrix element and knowing the cross-section well will set limits on the neutrino mass. There is a concentrated effort among the nuclear physics community to calculate this matrix element. Usually these matrix elements are a very small part of the total strength of the transition operators involved in the process. There is no simple way to “calibrate” the nuclear double beta decay matrix element. The double beta decay is a double charge exchange process, therefore it is proposed that double charge exchange reactions using ion projectiles on nuclei that are candidates for double beta decay, will provide additional necessary information about the nuclear matrix elements.

  2. Detection of extremely high bit density signals with a narrow track width GMR head in double layered perpendicular recording media

    International Nuclear Information System (INIS)

    Kiya, T.; Honda, N.; Ariake, J.; Ouchi, K.; Iwasaki, S.

    2001-01-01

    Recording resolution, medium noise and thermal stability have been investigated for double layered perpendicular magnetic recording media. The recording performance was improved by introducing a stacked intermediate layer between a soft magnetic backlayer and a storage layer due to increased crystal orientation with a small magnetic domain size and suppressed initial growing layer of the storage layer. The reproduced output at an extremely high linear density of 950 kFRPI was detected by using a contact-type CF-SPT head for write and a GMR head with a narrow read track width of 0.4 μm

  3. Glaucoma progression detection with frequency doubling technology (FDT) compared to standard automated perimetry (SAP) in the Groningen Longitudinal Glaucoma Study.

    Science.gov (United States)

    Wesselink, Christiaan; Jansonius, Nomdo M

    2017-09-01

    To determine the usefulness of frequency doubling perimetry (FDT) for progression detection in glaucoma, compared to standard automated perimetry (SAP). Data were used from 150 eyes of 150 glaucoma patients from the Groningen Longitudinal Glaucoma Study. After baseline, SAP was performed approximately yearly; FDT every other year. First and last visit had to contain both tests. Using linear regression, progression velocities were calculated for SAP (Humphrey Field Analyzer) mean deviation (MD) and FDT MD and the number of test locations with a total deviation probability below p glaucoma progression in patients who cannot perform SAP reliably. © 2017 The Authors Ophthalmic & Physiological Optics © 2017 The College of Optometrists.

  4. Nuclear transparency and double beta decay of molybdenum 100. Annual report, February 1, 1995 - January 31, 1996

    International Nuclear Information System (INIS)

    Nicholson, H.W.

    1995-07-01

    This report describes progress in data analysis for a search for neutrinoless double-beta decay of molybdenum 100 and related work, Brookhaven National Laboratory's Experiment 850 on color transparency, and work on Brookhaven's EVA detector and the Stanford Linear Accelerator Center's B factory experiment. 6 refs

  5. Accuracy of the double contrast technique in the detection of small lesions of the colon

    Energy Technology Data Exchange (ETDEWEB)

    Muzzio, P C; Pomerri, F; Feltrin, G P; Biondetti, P R; Di Maggio, C [Padua Univ. (Italy). Istituto di Radiologia e Fisioterapia

    1979-02-01

    Double contrast enema has become an indispensible aid in early lesions of the colon, in particular for small lesions. According to the authors' opinion, the method provides so much additional information that it ought to be applied at all rates in such cases. It is neither expensive nor time-consuming and can easily be carried out in any X-ray department, especially where a fibroscope is not available. The results are reliable if the technique is applied correctly, if the patient is well-prepared, and if the radiologist has enough technical and semiological experience.

  6. Double layer films based on TiO{sub 2} and NiO{sub x} for gas detection

    Energy Technology Data Exchange (ETDEWEB)

    Kosc, I., E-mail: ivan.kosc@stuba.sk [Institute of Electronics and Photonics, Slovak University of Technology, Bratislava (Slovakia); Hotovy, I. [Institute of Electronics and Photonics, Slovak University of Technology, Bratislava (Slovakia); Roch, T.; Plecenik, T.; Gregor, M. [Faculty of Mathematics, Physics and Informatics, Comenius University, Bratislava (Slovakia); Predanocy, M. [Institute of Electronics and Photonics, Slovak University of Technology, Bratislava (Slovakia); Cehlarova, M.; Kus, P.; Plecenik, A. [Faculty of Mathematics, Physics and Informatics, Comenius University, Bratislava (Slovakia)

    2014-09-01

    Highlights: • Double layer films based on TiO{sub 2} and NiO{sub x} for gas detection were studied. • Structural, compositional and morphological properties were investigated. • XPS spectra of TiO{sub 2} and NiO{sub x} were identified. • P- and n-type of response to hydrogen were presented. • Inversion of conductivity response type was confirmed. - Abstract: Double layer films based on TiO{sub 2} and NiO{sub x} for gas detection were studied. Two layouts with opposite position of functional films were deposited via DC magnetron sputtering method and annealed at 600 °C. The compositional, structural, morphological, electrical and gas sensing parameters were investigated. The depth profiles and the chemical state of the thin films elements were explored by X-ray photoelectron spectroscopy (XPS). Differences between the surface and subsurface NiO{sub x} were confirmed. In this way the formation of surface oxides and subsurface metallic Ni were observed. The structural changes and polycrystalline character were noticed by X-ray diffraction (XRD). The atomic force microscopy (AFM) revealed nanocrystalline character of the examined surfaces (both layouts). Different position of TiO{sub 2} and NiO{sub x} functional films brought difference in the type of response to reducing gas. Moreover, inversion of response type due to different H{sub 2} concentrations was confirmed.

  7. Front-end electronics for accurate energy measurement of double beta decays

    International Nuclear Information System (INIS)

    Gil, A.; Díaz, J.; Gómez-Cadenas, J.J.; Herrero, V.; Rodriguez, J.; Serra, L.; Toledo, J.; Esteve, R.; Monzó, J.M.; Monrabal, F.; Yahlali, N.

    2012-01-01

    NEXT, a double beta decay experiment that will operate in Canfranc Underground Laboratory (Spain), aims at measuring the neutrinoless double-β decay of the 136Xe isotope using a TPC filled with enriched Xenon gas at high pressure operated in electroluminescence mode. One technological challenge of the experiment is to achieve resolution better than 1% in the energy measurement using a plane of UV sensitive photomultipliers readout with appropriate custom-made front-end electronics. The front-end is designed to be sensitive to the single photo-electron to detect the weak primary scintillation light produced in the chamber, and also to be able to cope with the electroluminescence signal (several hundred times higher and with a duration of microseconds). For efficient primary scintillation detection and precise energy measurement of the electroluminescent signals the front-end electronics features low noise and adequate amplification. The signal shaping provided allows the digitization of the signals at a frequency as low as 40 MHz.

  8. Electrochemical aptasensor for detecting Der p2 allergen using polycarbonate-based double-generation gold nanoparticle chip

    Directory of Open Access Journals (Sweden)

    Ming-Che Shen

    2017-04-01

    Full Text Available In this study, a novel aptamer-based impedimetric biosensor for detecting the group 2 allergen of Dermatophagoides pteronyssinus (Der p2 was developed. First, an anodic aluminum oxide (AAO membrane was prepared. A modified AAO barrier-layer surface with an array of nanohemispheres of 400 nm in diameter was used as a template for the nanoelectroforming of a nickel mold. After electroforming, the AAO template was etched and a nickel nanomold with a concave nanostructure array was produced. The formed nanostructured nickel nanomold was then used in the replica molding of a nanostructured polycarbonate (PC substrate via hot embossing. Finally, a gold thin film was sputtered onto the PC substrate to form a double-generation gold nanoparticle electrode (array of nanohemispheres with smaller nanoparticles orderly distributed on each nanohemisphere. After immobilizing specifically designed aptamers on the fabricated electrode, electrochemical impedance spectroscopy was used to determine the concentration of Der p2. The sensitivity of the proposed scheme for the detection of the dust mite antigen Der p2 was 2.088 Ω / (ng/mL × cm2 with a dynamic detection range of 27.5–400 ng/mL and detection limit of 16.47 ng/mL.The aptamer-based impedimetric biosensor proposed in this study possesses many advantages such as high sensitivity, low cost, and high consistency over currently used sensors. The proposed sensor was found to be useful for the rapid detection of rare molecules present in an analyte. Keywords: Aptamers, Der p2 dust mite allergen detection, Nanostructured biosensors, Electrochemical impedance spectroscopy

  9. Detection of Ammonia-Oxidizing Bacteria (AOB) Using a Porous Silicon Optical Biosensor Based on a Multilayered Double Bragg Mirror Structure.

    Science.gov (United States)

    Zhang, Hongyan; Lv, Jie; Jia, Zhenhong

    2018-01-01

    We successfully demonstrate a porous silicon (PS) double Bragg mirror by electrochemical etching at room temperature as a deoxyribonucleic acid (DNA) label-free biosensor for detecting ammonia-oxidizing bacteria (AOB). Compared to various other one-dimension photonic crystal configurations of PS, the double Bragg mirror structure is quite easy to prepare and exhibits interesting optical properties. The width of high reflectivity stop band of the PS double Bragg mirror is about 761 nm with a sharp and deep resonance peak at 1328 nm in the reflectance spectrum, which gives a high sensitivity and distinguishability for sensing performance. The detection sensitivity of such a double Bragg mirror structure is illustrated through the investigation of AOB DNA hybridization in the PS pores. The redshifts of the reflectance spectra show a good linear relationship with both complete complementary and partial complementary DNA. The lowest detection limit for complete complementary DNA is 27.1 nM and the detection limit of the biosensor for partial complementary DNA is 35.0 nM, which provides the feasibility and effectiveness for the detection of AOB in a real environment. The PS double Bragg mirror structure is attractive for widespread biosensing applications and provides great potential for the development of optical applications.

  10. DETECTION OF EQUATORWARD MERIDIONAL FLOW AND EVIDENCE OF DOUBLE-CELL MERIDIONAL CIRCULATION INSIDE THE SUN

    International Nuclear Information System (INIS)

    Zhao Junwei; Bogart, R. S.; Kosovichev, A. G.; Hartlep, Thomas; Duvall, T. L. Jr.

    2013-01-01

    Meridional flow in the solar interior plays an important role in redistributing angular momentum and transporting magnetic flux inside the Sun. Although it has long been recognized that the meridional flow is predominantly poleward at the Sun's surface and in its shallow interior, the location of the equatorward return flow and the meridional flow profile in the deeper interior remain unclear. Using the first 2 yr of continuous helioseismology observations from the Solar Dynamics Observatory/Helioseismic Magnetic Imager, we analyze travel times of acoustic waves that propagate through different depths of the solar interior carrying information about the solar interior dynamics. After removing a systematic center-to-limb effect in the helioseismic measurements and performing inversions for flow speed, we find that the poleward meridional flow of a speed of 15 m s –1 extends in depth from the photosphere to about 0.91 R ☉ . An equatorward flow of a speed of 10 m s –1 is found between 0.82 and 0.91 R ☉ in the middle of the convection zone. Our analysis also shows evidence of that the meridional flow turns poleward again below 0.82 R ☉ , indicating an existence of a second meridional circulation cell below the shallower one. This double-cell meridional circulation profile with an equatorward flow shallower than previously thought suggests a rethinking of how magnetic field is generated and redistributed inside the Sun

  11. DETECTION OF EQUATORWARD MERIDIONAL FLOW AND EVIDENCE OF DOUBLE-CELL MERIDIONAL CIRCULATION INSIDE THE SUN

    Energy Technology Data Exchange (ETDEWEB)

    Zhao Junwei; Bogart, R. S.; Kosovichev, A. G.; Hartlep, Thomas [W. W. Hansen Experimental Physics Laboratory, Stanford University, Stanford, CA 94305-4085 (United States); Duvall, T. L. Jr. [Solar Physics Laboratory, NASA Goddard Space Flight Center, Greenbelt, MD 20771 (United States)

    2013-09-10

    Meridional flow in the solar interior plays an important role in redistributing angular momentum and transporting magnetic flux inside the Sun. Although it has long been recognized that the meridional flow is predominantly poleward at the Sun's surface and in its shallow interior, the location of the equatorward return flow and the meridional flow profile in the deeper interior remain unclear. Using the first 2 yr of continuous helioseismology observations from the Solar Dynamics Observatory/Helioseismic Magnetic Imager, we analyze travel times of acoustic waves that propagate through different depths of the solar interior carrying information about the solar interior dynamics. After removing a systematic center-to-limb effect in the helioseismic measurements and performing inversions for flow speed, we find that the poleward meridional flow of a speed of 15 m s{sup -1} extends in depth from the photosphere to about 0.91 R{sub Sun }. An equatorward flow of a speed of 10 m s{sup -1} is found between 0.82 and 0.91 R{sub Sun} in the middle of the convection zone. Our analysis also shows evidence of that the meridional flow turns poleward again below 0.82 R{sub Sun }, indicating an existence of a second meridional circulation cell below the shallower one. This double-cell meridional circulation profile with an equatorward flow shallower than previously thought suggests a rethinking of how magnetic field is generated and redistributed inside the Sun.

  12. MDA5 Detects the Double-Stranded RNA Replicative Form in Picornavirus-Infected Cells

    Directory of Open Access Journals (Sweden)

    Qian Feng

    2012-11-01

    Full Text Available RIG-I and MDA5 are cytosolic RNA sensors that play a critical role in innate antiviral responses. Major advances have been made in identifying RIG-I ligands, but our knowledge of the ligands for MDA5 remains restricted to data from transfection experiments mostly using poly(I:C, a synthetic dsRNA mimic. Here, we dissected the IFN-α/β-stimulatory activity of different viral RNA species produced during picornavirus infection, both by RNA transfection and in infected cells in which specific steps of viral RNA replication were inhibited. Our results show that the incoming genomic plus-strand RNA does not activate MDA5, but minus-strand RNA synthesis and production of the 7.5 kbp replicative form trigger a strong IFN-α/β response. IFN-α/β production does not rely on plus-strand RNA synthesis and thus generation of the partially double-stranded replicative intermediate. This study reports MDA5 activation by a natural RNA ligand under physiological conditions.

  13. Local Preparation and Evaluation of Double - antibody Liquid Phase Radioimmunoassay System for Detection of Human Testosterone

    International Nuclear Information System (INIS)

    Shafik, H.M.; Sallam, Kh.M.; Ebeid, N.H.; Elshaer, M.R.; Elshae, M.R.

    2016-01-01

    Preparation, evaluation and optimization of testosterone radioimmunoassay (RIA) system using liquid phase double antibody is considered to be the main objective. Three primary components were prepared and characterized to obtain valid and accurate system. These components were polyclonal testosterone antibody, the "1"2"5I-testosterone tracer and set of testosterone standards. The production of polyclonal testosterone antibody was undertaken by immunizing two groups of females white New-Zealand rabbits with testosterone-3-(O-carboxy methyloxime): BSA as immunogen through primary immunization and five boosters. Both R 1 and R 4 gave anti-serum has a high immuno reactivity. The preparation of "1"2"5I-testosterone tracer was carried out using three different conjugates (testosterone-3-TME, testosterone-3-histamine and testosterone-3-BSA) by electrophilic substitution mechanism using chloramine-T as oxidizing agent. Tracers were characterized in terms of radiochemical yield %, radiochemical purity %, specific activity and immuno reactivity. A set of testosterone standards were prepared using highly purified testosterone antigen. Optimization and validation tests of the local liquid phase RIA system were carried out. In conclusion, the results showed that, the local testosterone RIA system is sensitive, specific and accurate with significant cost reduction in comparison with commertial kit and extended use of the method for routine investigation of variety of diseases especially hypogonadism and associated male infertility

  14. Detection of heavy ion induced DNA double-strand breaks using static-field gel electrophoresis

    International Nuclear Information System (INIS)

    Taucher-Scholz, G.; Heilmann, J.; Schneider, G.; Kraft, G.

    1994-11-01

    Radiation induced DNA double-strand breaks (DSBs) were measured in Chinese hamster ovary cells (CHO-K1) using an experimental protocol involving static-field gel electrophoresis following exposure to various accelerated ions. Dose-effect curves were set up and relative biological efficiencies (RBEs) for DSB induction were determined for different radiation qualities. RBEs around 1 were obtained for low energy deuterons (6-7 keV/μm), while for high energy oxygen ions (20 keV/μm) an RBE value slightly greater than 1 was determined. Low energetic oxygen ions (LET ∼ 250 keV/μm) were found to show RBEs substantially below unity, and for higher LET particles (≥ 250 keV/μm) RBEs for DSB induction were generally found to be smaller than 1. The data presented here are in line with the generally accepted view that not induced DSBs, but misrepaired or unrepaired DNA-lesions are related to cellular inactivation. (orig.)

  15. Relativistic pn-QRPA to the double beta decay

    International Nuclear Information System (INIS)

    Conti, Claudio de; Krmpotic, F.; Carlson, Brett Vern

    2010-01-01

    Full text: In nature there are about 50 nuclear systems where the single beta-decay is energetically forbidden, and double- beta decay turns out to be only possible mode of disintegration. It is the nuclear pairing force which causes such an 'anomaly', by making the mass of the odd-odd isobar, (N - 1;Z + 1), to be greater than the masses of its even-even neighbors, (N;Z) and (N - 2;Z +2). The modes by which the double-beta decay can take place are connected with the neutrino and antineutrino distinction. In case the lepton number is strictly conserved the neutrino is a Dirac fermion and the two-neutrino mode is the only possible mode of disintegration. On the other hand, if this conservation is violated, the neutrino is a Majorana particle and neutrinoless double-beta decay also can occur. Both two-neutrino and neutrinoless double-beta decay processes have attracted much attention, because a comparison between experiment and theory for the first, provides a measure of confidence one may have in the nuclear wave function employed for extracting the unknown parameters from neutrinoless lifetime measurements. The proton-neutron (pn) quasiparticle random phase approximation (QRPA) has turned out be the most simple model for calculating the nuclear wave function involved in the double-beta decay transitions. In this work the transition matrix elements for 0 + -> 0 + double-beta decay are calculated for 48 Ca, 76 Ge, 82 Se, 100 Mo, 128 Te and 130 Te nuclei, using a relativistic pn-QRPA based on Hartree-Bogoliubov approximation to the single-particle motion. (author)

  16. Relativistic pn-QRPA to the double beta decay

    International Nuclear Information System (INIS)

    Conti, Claudio de; Krmpotic, Francisco; Carlson, Brett Vern

    2011-01-01

    Full text: In nature there are about 50 nuclear systems where the single beta-decay is energetically forbidden, and double-beta decay turns out to be only possible mode of disintegration. It is the nuclear pairing force which causes such an 'anomaly', by making the mass of the odd-odd isobar, (N - 1;Z + 1), to be greater than the masses of its even-even neighbors, (N;Z) and (N - 2;Z +2). The modes by which the double-beta decay can take place are connected with the neutrino and antineutrino distinction. In case the lepton number is strictly conserved the neutrino is a Dirac fermion and the two-neutrino mode is the only possible mode of disintegration. On the other hand, if this conservation is violated, the neutrino is a Majorana particle and neutrinoless double-beta decay also can occur. Both two-neutrino and neutrinoless double-beta decay processes have attracted much attention, because a comparison between experiment and theory for the first, provides a measure of confidence one may have in the nuclear wave function employed for extracting the unknown parameters from neutrinoless lifetime measurements. The proton-neutron (pn) quasiparticle random phase approximation (QRPA) has turned out be the most simple model for calculating the nuclear wave function involved in the double-beta decay transitions. In this work the transition matrix elements for 0 + → 0 + double-beta decay are calculated for 48 Ca, 76 Ge, 82 Se, 100 Mo, 128 Te and 130 Te nuclei, using a relativistic pn-QRPA based on Hartree-Bogoliubov approximation to the single-particle motion. (author)

  17. Gold Nanoparticle-Aptamer-Based LSPR Sensing of Ochratoxin A at a Widened Detection Range by Double Calibration Curve Method.

    Science.gov (United States)

    Liu, Boshi; Huang, Renliang; Yu, Yanjun; Su, Rongxin; Qi, Wei; He, Zhimin

    2018-01-01

    Ochratoxin A (OTA) is a type of mycotoxin generated from the metabolism of Aspergillus and Penicillium , and is extremely toxic to humans, livestock, and poultry. However, traditional assays for the detection of OTA are expensive and complicated. Other than OTA aptamer, OTA itself at high concentration can also adsorb on the surface of gold nanoparticles (AuNPs), and further inhibit AuNPs salt aggregation. We herein report a new OTA assay by applying the localized surface plasmon resonance effect of AuNPs and their aggregates. The result obtained from only one single linear calibration curve is not reliable, and so we developed a "double calibration curve" method to address this issue and widen the OTA detection range. A number of other analytes were also examined, and the structural properties of analytes that bind with the AuNPs were further discussed. We found that various considerations must be taken into account in the detection of these analytes when applying AuNP aggregation-based methods due to their different binding strengths.

  18. Development of a double-antibody radioimmunoassay for detecting ovarian tumor-associated antigen fraction OCA in plasma

    International Nuclear Information System (INIS)

    Knauf, S.; Urbach, G.I.

    1978-01-01

    Ovarian tumor-associated antigen isolated from human tumor tissue was shown to have a different mobility from that of carcinoembryonic antigen (CEA) in both acrylamide gel electrophoresis and immunoelectrophoresis in agarose. The ovarian tumor antigen is composed of six species with different electrophoretic mobility in acrylamide gel electrophoresis. Three of these species were detected in Sephadex G-100 ovarian fraction OCA (from the void volume peak) and the other three species of lower apparent molecular weight were detected in fraction OCD (from the second peak). Fractions OCA and OCD did not share common antigenic determinants as determined by immunodiffusion. CEA was shown to share antigenic determinants with both OCA and OCD. A double-antibody radioimmunoassay capable of detecting nanogram quantities of plasma OCA was developed. In a preliminary study of ovarian cancer patients, OCA appeared to be a more sensitive marker for ovarian cancer than CEA. There was virtually no correlation (r 2 = 0.1) between OCA and CEA levels in these patients, as determined by radioimmunoassay

  19. Decoding of DBEC-TBED Reed-Solomon codes. [Double-Byte-Error-Correcting, Triple-Byte-Error-Detecting

    Science.gov (United States)

    Deng, Robert H.; Costello, Daniel J., Jr.

    1987-01-01

    A problem in designing semiconductor memories is to provide some measure of error control without requiring excessive coding overhead or decoding time. In LSI and VLSI technology, memories are often organized on a multiple bit (or byte) per chip basis. For example, some 256 K bit DRAM's are organized in 32 K x 8 bit-bytes. Byte-oriented codes such as Reed-Solomon (RS) codes can provide efficient low overhead error control for such memories. However, the standard iterative algorithm for decoding RS codes is too slow for these applications. The paper presents a special decoding technique for double-byte-error-correcting, triple-byte-error-detecting RS codes which is capable of high-speed operation. This technique is designed to find the error locations and the error values directly from the syndrome without having to use the iterative algorithm to find the error locator polynomial.

  20. A mathematical model for the detection mechanism of DNA double-strand breaks depending on autophosphorylation of ATM.

    Science.gov (United States)

    Mouri, Kazunari; Nacher, Jose C; Akutsu, Tatsuya

    2009-01-01

    After IR stress, DNA double-strand breaks (DSBs) occur and repair proteins (RPs) bind to them, generating DSB-RP complexes (DSBCs), which results in repaired DSBs (RDSBs). In recent experimental studies, it is suggested that the ATM proteins detect these DNA lesions depending on the autophosphorylation of ATM which exists as a dimer before phosphorylation. Interestingly, the ATM proteins can work as a sensor for a small number of DSBs (approximately 18 DSBs in a cell after exposure to IR). Thus the ATM proteins amplify the small input signals based on the phosphorylation of the ATM dimer proteins. The true DSB-detection mechanism depending on ATM autophosphorylation has yet to be clarified. We propose a mathematical model for the detection mechanism of DSBs by ATM. Our model includes both a DSB-repair mechanism and an ATM-phosphorylation mechanism. We model the former mechanism as a stochastic process, and obtain theoretical mean values of DSBs and DSBCs. In the latter mechanism, it is known that ATM autophosphorylates itself, and we find that the autophosphorylation induces bifurcation of the phosphorylated ATM (ATM*). The bifurcation diagram depends on the total concentration of ATM, which makes three types of steady state diagrams of ATM*: monostable, reversible bistable, and irreversible bistable. Bistability exists depending on the Hill coefficient in the equation of ATM autophosphorylation, and it emerges as the total concentration of ATM increases. Combining these two mechanisms, we find that ATM* exhibits switch-like behaviour in the presence of bistability, and the detection time after DNA damage decreases when the total concentration of ATM increases. This work provides a mathematical model that explains the DSB-detection mechanism depending on ATM autophosphorylation. These results indicate that positive auto-regulation works both as a sensor and amplifier of small input signals.

  1. Optical detection of symmetric and antisymmetric states in double quantum wells at room temperature

    Science.gov (United States)

    Marchewka, M.; Sheregii, E. M.; Tralle, I.; Marcelli, A.; Piccinini, M.; Cebulski, J.

    2009-09-01

    We studied the optical reflectivity of a specially grown double quantum well (DQW) structure characterized by a rectangular shape and a high electron density at room temperature. Assuming that the QWs depth is known, reflectivity spectra in the mid-IR range allow to carry out the precise measurements of the SAS-gap values (the energy gap between the symmetric and anti-symmetric states) and the absolute energies of both symmetric and antisymmetric electron states. The results of our experiments are in favor of the existence of the SAS splitting in the DQWs at room temperature. Here we have shown that the SAS gap increases proportionally to the subband quantum number and the optical electron transitions between symmetric and antisymmetric states belonging to different subbands are allowed. These results were used for interpretation of the beating effect in the Shubnikov-de Haas (SdH) oscillations at low temperatures (0.6 and 4.2 K). The approach to the calculation of the Landau-levels energies for DQW structures developed earlier [D. Ploch , Phys. Rev. B 79, 195434 (2009)] is used for the analysis and interpretation of the experimental data related to the beating effect. We also argue that in order to explain the beating effect in the SdH oscillations, one should introduce two different quasi-Fermi levels characterizing the two electron subsystems regarding symmetry properties of their wave functions, symmetric and antisymmetric ones. These states are not mixed neither by electron-electron interaction nor probably by electron-phonon interaction.

  2. Combining evolutionary algorithms with oblique decision trees to detect bent-double galaxies

    Science.gov (United States)

    Cantu-Paz, Erick; Kamath, Chandrika

    2000-10-01

    Decision tress have long been popular in classification as they use simple and easy-to-understand tests at each node. Most variants of decision trees test a single attribute at a node, leading to axis- parallel trees, where the test results in a hyperplane which is parallel to one of the dimensions in the attribute space. These trees can be rather large and inaccurate in cases where the concept to be learned is best approximated by oblique hyperplanes. In such cases, it may be more appropriate to use an oblique decision tree, where the decision at each node is a linear combination of the attributes. Oblique decision trees have not gained wide popularity in part due to the complexity of constructing good oblique splits and the tendency of existing splitting algorithms to get stuck in local minima. Several alternatives have been proposed to handle these problems including randomization in conjunction wiht deterministic hill-climbing and the use of simulated annealing. In this paper, we use evolutionary algorithms (EAs) to determine the split. EAs are well suited for this problem because of their global search properties, their tolerance to noisy fitness evaluations, and their scalability to large dimensional search spaces. We demonstrate our technique on a synthetic data set, and then we apply it to a practical problem from astronomy, namely, the classification of galaxies with a bent-double morphology. In addition, we describe our experiences with several split evaluation criteria. Our results suggest that, in some cases, the evolutionary approach is faster and more accurate than existing oblique decision tree algorithms. However, for our astronomical data, the accuracy is not significantly different than the axis-parallel trees.

  3. Search for the neutrinoless muon decay μ+ → e+γ

    International Nuclear Information System (INIS)

    Wilson, S.L.

    1985-07-01

    Separate muon, electron, and tau numbers are conserved in the minimal standard model of electroweak interactions with massless neutrinos. However, in many extensions to the standard model, separate lepton numbers are not expected to be conserved quantities. A new search for muon number non-conserving processes has been undertaken at the Los Alamos Meson Physics Facility (LAMPF), specifically to look for three neutrinoless decay modes of the muon. The search for the decay of a muon to an electron and a photon is discussed here. A new detector facility, located in the LAMPF stopped muon channel, was developed for this experiment. This Crystal Box detector consists of a cylindrical drift chamber surrounded by a plastic scintillator hodoscope and a large solid angle, modularized, NaI(Tl) calorimeter. The apparatus measures the trajectories, relative timing, and energies of charged particles and photons from the decays of positive muons stopped in a central target. The assembly and calibration of the detector are described, and the procedure for taking data is discussed. The sample of 1.3 million candidate events, from the first data run of the Crystal Box, was analyzed using a maximum-likelihood method. The upper limit on the branching ratio, relative to normal muon decay, for a muon decaying to an electron and a photon is found to be consistent with previous measurements. With 90% confidence, the branching ratio for this neutrinoless decay is observed to be less than 2.8 x 10 10

  4. Double-β decay Q value of 150Nd

    International Nuclear Information System (INIS)

    Kolhinen, V. S.; Eronen, T.; Gorelov, D.; Hakala, J.; Jokinen, A.; Kankainen, A.; Moore, I. D.; Rissanen, J.; Saastamoinen, A.; Suhonen, J.; Aeystoe, J.

    2010-01-01

    The double-β decay Q value of 150 Nd was determined by using the JYFLTRAP Penning trap mass spectrometer. The measured mass difference between 150 Nd and 150 Sm is 3371.38(20) keV. This new value deviates by 3.7 keV from the previously adopted value of 3367.7(22) keV and is a factor of 10 more precise. Accurate knowledge of this Q value is important because 150 Nd is a primary candidate to be used in the search for neutrinoless double-β decay modes in several experiments.

  5. Tissue resonance interaction accurately detects colon lesions: A double-blind pilot study.

    Science.gov (United States)

    Dore, Maria P; Tufano, Marcello O; Pes, Giovanni M; Cuccu, Marianna; Farina, Valentina; Manca, Alessandra; Graham, David Y

    2015-07-07

    To investigated the performance of the tissue resonance interaction method (TRIM) for the non-invasive detection of colon lesions. We performed a prospective single-center blinded pilot study of consecutive adults undergoing colonoscopy at the University Hospital in Sassari, Italy. Before patients underwent colonoscopy, they were examined by the TRIMprobe which detects differences in electromagnetic properties between pathological and normal tissues. All patients had completed the polyethylene glycol-containing bowel prep for the colonoscopy procedure before being screened. During the procedure the subjects remained fully dressed. A hand-held probe was moved over the abdomen and variations in electromagnetic signals were recorded for 3 spectral lines (462-465 MHz, 930 MHz, and 1395 MHz). A single investigator, blind to any clinical information, performed the test using the TRIMprob system. Abnormal signals were identified and recorded as malignant or benign (adenoma or hyperplastic polyps). Findings were compared with those from colonoscopy with histologic confirmation. Statistical analysis was performed by χ(2) test. A total of 305 consecutive patients fulfilling the inclusion criteria were enrolled over a period of 12 months. The most frequent indication for colonoscopy was abdominal pain (33%). The TRIMprob was well accepted by all patients; none spontaneously complained about the procedure, and no adverse effects were observed. TRIM proved inaccurate for polyp detection in patients with inflammatory bowel disease (IBD) and they were excluded leaving 281 subjects (mean age 59 ± 13 years; 107 males). The TRIM detected and accurately characterized all 12 adenocarcinomas and 135/137 polyps (98.5%) including 64 adenomatous (100%) found. The method identified cancers and polyps with 98.7% sensitivity, 96.2% specificity, and 97.5% diagnostic accuracy, compared to colonoscopy and histology analyses. The positive predictive value was 96.7% and the negative predictive

  6. Solar neutrino detection in a large volume double-phase liquid argon experiment

    Energy Technology Data Exchange (ETDEWEB)

    Franco, D.; Agnes, P. [APC, Université Paris Diderot, CNRS/IN2P3, CEA/Irfu, Observatoire de Paris, Sorbonne Paris Cité, Paris 75205 (France); Giganti, C.; Agostino, L.; De Cecco, S., E-mail: dfranco@in2p3.fr, E-mail: cgiganti@lpnhe.in2p3.fr, E-mail: pagnes@in2p3.fr, E-mail: lagostin@lpnhe.in2p3.fr, E-mail: sandro.dececco@lpnhe.in2p3.fr [LPNHE Paris, Université Pierre et Marie Curie, Université Paris Diderot, CNRS/IN2P3, Paris 75252 (France); and others

    2016-08-01

    Precision measurements of solar neutrinos emitted by specific nuclear reaction chains in the Sun are of great interest for developing an improved understanding of star formation and evolution. Given the expected neutrino fluxes and known detection reactions, such measurements require detectors capable of collecting neutrino-electron scattering data in exposures on the order of 1 ktonne-yr, with good energy resolution and extremely low background. Two-phase liquid argon time projection chambers (LAr TPCs) are under development for direct Dark Matter WIMP searches, which possess very large sensitive mass, high scintillation light yield, good energy resolution, and good spatial resolution in all three cartesian directions. While enabling Dark Matter searches with sensitivity extending to the ''neutrino floor'' (given by the rate of nuclear recoil events from solar neutrino coherent scattering), such detectors could also enable precision measurements of solar neutrino fluxes using the neutrino-electron elastic scattering events. Modeling results are presented for the cosmogenic and radiogenic backgrounds affecting solar neutrino detection in a 300 tonne (100 tonne fiducial) LAr TPC operating at LNGS depth (3,800 meters of water equivalent). The results show that such a detector could measure the CNO neutrino rate with ∼15% precision, and significantly improve the precision of the {sup 7}Be and pep neutrino rates compared to the currently available results from the Borexino organic liquid scintillator detector.

  7. A double isotope technique for the detection of diffuse liver disease

    International Nuclear Information System (INIS)

    McCready, V.R.; Seelentag, W.W.; Lillicrap, S.C.; Royal Mardsen Hospital, Sutton, Surrey

    1978-01-01

    Radioisotope, ultrasound and CT X-ray scanning are all moderately successful in diagnosing focal abnormalities of the liver. However, the diagnosis of diffuse disease remains difficult or impossible in spite of recent advances in imaging and biochemical techniques. This paper investigates the possibility of using two radioactive compounds which detect different aspects of liver function to determine the presence of diffuse disease. Normal patients and patients with obvious metastases were studied after an injection of a mixture of Tc 99m sulphur colloid and Gallium 67 citrate. Measurements of the absolute and relative uptake in the liver were made within one hour and at 48 hours using a quantitative dual probe system and a collimated dual detector system. The Tc 99m:Ga-67 ratio was calculated. The ratio for abnormals ranged from 1.5-3.9 mean=2.5 and the normals ranged from 3.67-6.25 (mean=4.5). The technique shows promise in the detection of diffuse disease. (author)

  8. The cumulative burden of double-stranded DNA virus detection after allogeneic HCT is associated with increased mortality.

    Science.gov (United States)

    Hill, Joshua A; Mayer, Bryan T; Xie, Hu; Leisenring, Wendy M; Huang, Meei-Li; Stevens-Ayers, Terry; Milano, Filippo; Delaney, Colleen; Sorror, Mohamed L; Sandmaier, Brenda M; Nichols, Garrett; Zerr, Danielle M; Jerome, Keith R; Schiffer, Joshua T; Boeckh, Michael

    2017-04-20

    Strategies to prevent active infection with certain double-stranded DNA (dsDNA) viruses after allogeneic hematopoietic cell transplantation (HCT) are limited by incomplete understanding of their epidemiology and clinical impact. We retrospectively tested weekly plasma samples from allogeneic HCT recipients at our center from 2007 to 2014. We used quantitative PCR to test for cytomegalovirus, BK polyomavirus, human herpesvirus 6B, HHV-6A, adenovirus, and Epstein-Barr virus between days 0 and 100 post-HCT. We evaluated risk factors for detection of multiple viruses and association of viruses with mortality through day 365 post-HCT with Cox models. Among 404 allogeneic HCT recipients, including 125 cord blood, 125 HLA-mismatched, and 154 HLA-matched HCTs, detection of multiple viruses was common through day 100: 90% had ≥1, 62% had ≥2, 28% had ≥3, and 5% had 4 or 5 viruses. Risk factors for detection of multiple viruses included cord blood or HLA-mismatched HCT, myeloablative conditioning, and acute graft-versus-host disease ( P values < .01). Absolute lymphocyte count of <200 cells/mm 3 was associated with greater virus exposure on the basis of the maximum cumulative viral load area under the curve (AUC) ( P = .054). The maximum cumulative viral load AUC was the best predictor of early (days 0-100) and late (days 101-365) overall mortality (adjusted hazard ratio [aHR] = 1.36, 95% confidence interval [CI] [1.25, 1.49], and aHR = 1.04, 95% CI [1.0, 1.08], respectively) after accounting for immune reconstitution and graft-versus-host disease. In conclusion, detection of multiple dsDNA viruses was frequent after allogeneic HCT and had a dose-dependent association with increased mortality. These data suggest opportunities to improve outcomes with better antiviral strategies. © 2017 by The American Society of Hematology.

  9. HUBBLE SPACE TELESCOPE DETECTION OF THE DOUBLE PULSAR SYSTEM J0737–3039 IN THE FAR-ULTRAVIOLET

    Energy Technology Data Exchange (ETDEWEB)

    Durant, Martin [Department of Medical Biophysics, Sunnybrook Hospital M6 623, 2075 Bayview Avenue, Toronto M4N 3M5 (Canada); Kargaltsev, Oleg [Department of Physics, The George Washington University, 725 21st Street NW, Washington, DC 20052 (United States); Pavlov, George G., E-mail: mdurant@sri.utoronto.ca, E-mail: kargaltsev@email.gwu.edu, E-mail: pavlov@astro.psu.edu [Department of Astronomy and Astrophysics, Pennsylvania State University, University Park, PA 16802 (United States)

    2014-03-01

    We report on detection of the double pulsar system J0737–3039 in the far-UV with the Advanced Camera for Surveys/Solar-blind Channel detector aboard Hubble Space Telescope. We measured the energy flux F = (4.6 ± 1.0) × 10{sup –17} erg cm{sup –2} s{sup –1} in the 1250-1550 Å band, which corresponds to the extinction-corrected luminosity L ≈ 1.5 × 10{sup 28} erg s{sup –1} for the distance d = 1.1 kpc and a plausible reddening E(B – V) = 0.1. If the detected emission comes from the entire surface of one of the neutron stars with a 13 km radius, the surface blackbody temperature is in the range T ≅ (2-5) × 10{sup 5} K for a reasonable range of interstellar extinction. Such a temperature requires an internal heating mechanism to operate in old neutron stars, or, less likely, it might be explained by heating of the surface of the less energetic Pulsar B by the relativistic wind of Pulsar A. If the far-ultraviolet emission is non-thermal (e.g., produced in the magnetosphere of Pulsar A), its spectrum exhibits a break between the UV and X-rays.

  10. HUBBLE SPACE TELESCOPE DETECTION OF THE DOUBLE PULSAR SYSTEM J0737–3039 IN THE FAR-ULTRAVIOLET

    International Nuclear Information System (INIS)

    Durant, Martin; Kargaltsev, Oleg; Pavlov, George G.

    2014-01-01

    We report on detection of the double pulsar system J0737–3039 in the far-UV with the Advanced Camera for Surveys/Solar-blind Channel detector aboard Hubble Space Telescope. We measured the energy flux F = (4.6 ± 1.0) × 10 –17  erg cm –2 s –1 in the 1250-1550 Å band, which corresponds to the extinction-corrected luminosity L ≈ 1.5 × 10 28  erg s –1 for the distance d = 1.1 kpc and a plausible reddening E(B – V) = 0.1. If the detected emission comes from the entire surface of one of the neutron stars with a 13 km radius, the surface blackbody temperature is in the range T ≅ (2-5) × 10 5  K for a reasonable range of interstellar extinction. Such a temperature requires an internal heating mechanism to operate in old neutron stars, or, less likely, it might be explained by heating of the surface of the less energetic Pulsar B by the relativistic wind of Pulsar A. If the far-ultraviolet emission is non-thermal (e.g., produced in the magnetosphere of Pulsar A), its spectrum exhibits a break between the UV and X-rays

  11. Preliminary evaluation of helical CT colonography in detection of colonic diseases compared with double contrast barium enema

    International Nuclear Information System (INIS)

    Zhai Xiaoli; Zhang Lei; Zhai Renyou; Li Jie; Wang Yajie; Ding Yi

    2000-01-01

    Objective: To evaluate helical CT colonography in regard to technology principles, limitations, and clinical applications. Methods: Fifty-six patients underwent volume scanning using helical CT. The diseases included adenocarcinoma 39, adenomatous polyp 3, multiple diverticular 7, mucocele of appendix 1, and normal colon 6. All cases had been compared with double contrast barium enema (DCBE), proved by histology except the 6 normal colon and the 7 multiple diverticular. All CTC images were reconstructed using shaded surface display (SSD) on workstation. Then, perspective images such as the ones from DCBE were generated via ray sum. The images could clearly demonstrate the extent and detail of the disorder by using 'CUT' software, 'revolve' function, and zoom. Results: CTC correctly demonstrated 3-5 mm diverticulum, 3 mm ulcer, and 6 mm polyps. Not only show colon straitness clearly, CTC is also very sensitive to demonstrate the stenotic end of masses. In these cases, discovery rate of CTC is 100.0%, the rate of DCBE is 88.6%; CTC is more sensitive than DCBE in cases of tumor nodules. Ray sum can show the boundary of colonic mass extending to both proximal and distal ends, its discovery rate is 62.6%. Accuracy of localization for CTC is 100.0%. Conclusion: CTC is a novel technique for detecting colonic diseases. It is a safe, accurate, and non-invasive means for detection of lesions and is an efficient complement for DCBE. Further development in CTC technique is expected in the future

  12. Double contrast-enhanced ultrasonography in the detection of periampullary cancer: Comparison with B-mode ultrasonography and MR imaging

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Ting [Department of Medical Image Center, Zhujiang Hospital, Southern Medical University, Guangzhou (China); Department of Medical Ultrasonics, The Third Affiliated Hospital, Sun Yat-sen University, Guangzhou (China); Su, Zhong-zhen; Wang, Ping; Wu, Tao [Department of Medical Ultrasonics, The Third Affiliated Hospital, Sun Yat-sen University, Guangzhou (China); Tang, Wen [Department of Radiology, The Third Affiliated Hospital, Sun Yat-sen University, Guangzhou (China); Xu, Er-jiao; Ju, Jin-xiu [Department of Medical Ultrasonics, The Third Affiliated Hospital, Sun Yat-sen University, Guangzhou (China); Quan, Xian-yue, E-mail: quanxianyue2014@163.com [Department of Medical Image Center, Zhujiang Hospital, Southern Medical University, Guangzhou (China); Zheng, Rong-qin, E-mail: zhengrq@mail.sysu.edu.cn [Department of Medical Ultrasonics, The Third Affiliated Hospital, Sun Yat-sen University, Guangzhou (China)

    2016-11-15

    Purpose: To investigate the value of double contrast-enhanced ultrasonography (DCEUS) in the detection of periampullary cancer. Materials and methods: Ninety-nine patients with surgery or biopsy-proven periampullary cancer who underwent both DCEUS and magnetic resonance imaging (MRI) examinations before operation were enrolled in our study. DCEUS in which intravenous microbubbles were used in combination with oral contrast agent and MRI were performed preoperatively to make a detection diagnosis of periampullary cancer. The sensitivity, specificity, positive predictive value (PPV), negative predictive value (NPV) and accuracy of DCEUS, B-mode ultrasonography (BUS) and MRI were calculated and compared. Receiver operating characteristic (ROC) curves were used to evaluate the accuracy of BUS, DCEUS and MRI in the detection. Stratified analyses were performed for different pathological types and different sizes of periampullary lesions. The inter- and intra-observer reliability of DCEUS for cancer detection was also investigated. Result: There were no significant differences in sensitivity, specificity, PPV, NPV or accuracy between DCEUS and MRI (all P > 0.05). ROC analysis showed that the accuracy of DCEUS or MRI was higher than that of BUS (P < 0.001), while no significant differences were noted in the accuracy between DCEUS and MR. In the 76 cases of periampullary cancer, DCEUS appeared to be superior to BUS for ampullary carcinoma, duodenum carcinoma and for lesions with an average diameter of less than 3 cm. DCEUS appeared equal to BUS in other groups. No significant differences were noted between DCEUS and MRI in the stratified analysis. A considerably well agreement between DCEUS and MRI was obtained using Kappa analysis (k = 0.649, P < 0.001). The intra- and inter-observer reproducibility were both good for detection of periampullary cancer by DCEUS, with a Kappa values of 0.783 (P < 0.01) and 0.732 (P < 0.01), respectively. Conclusion: DCEUS provides an

  13. First Limit on the Direct Detection of Lightly Ionizing Particles for Electric Charge as Low as e /1000 with the Majorana Demonstrator

    Science.gov (United States)

    Alvis, S. I.; Arnquist, I. J.; Avignone, F. T.; Barabash, A. S.; Barton, C. J.; Bertrand, F. E.; Brudanin, V.; Busch, M.; Buuck, M.; Caldwell, T. S.; Chan, Y.-D.; Christofferson, C. D.; Chu, P.-H.; Cuesta, C.; Detwiler, J. A.; Dunagan, C.; Efremenko, Yu.; Ejiri, H.; Elliott, S. R.; Gilliss, T.; Giovanetti, G. K.; Green, M. P.; Gruszko, J.; Guinn, I. S.; Guiseppe, V. E.; Haufe, C. R.; Hehn, L.; Henning, R.; Hoppe, E. W.; Howe, M. A.; Konovalov, S. I.; Kouzes, R. T.; Lopez, A. M.; Martin, R. D.; Massarczyk, R.; Meijer, S. J.; Mertens, S.; Myslik, J.; O'Shaughnessy, C.; Othman, G.; Pettus, W.; Poon, A. W. P.; Radford, D. C.; Rager, J.; Reine, A. L.; Rielage, K.; Robertson, R. G. H.; Ruof, N. W.; Shanks, B.; Shirchenko, M.; Suriano, A. M.; Tedeschi, D.; Varner, R. L.; Vasilyev, S.; Vorren, K.; White, B. R.; Wilkerson, J. F.; Wiseman, C.; Xu, W.; Yakushev, E.; Yu, C.-H.; Yumatov, V.; Zhitnikov, I.; Zhu, B. X.; Majorana Collaboration

    2018-05-01

    The Majorana Demonstrator is an ultralow-background experiment searching for neutrinoless double-beta decay in 76Ge. The heavily shielded array of germanium detectors, placed nearly a mile underground at the Sanford Underground Research Facility in Lead, South Dakota, also allows searches for new exotic physics. Free, relativistic, lightly ionizing particles with an electrical charge less than e are forbidden by the standard model but predicted by some of its extensions. If such particles exist, they might be detected in the Majorana Demonstrator by searching for multiple-detector events with individual-detector energy depositions down to 1 keV. This search is background-free, and no candidate events have been found in 285 days of data taking. New direct-detection limits are set for the flux of lightly ionizing particles for charges as low as e /1000 .

  14. Gaseous time projection chambers for rare event detection: results from the T-REX project. I. Double beta decay

    Energy Technology Data Exchange (ETDEWEB)

    Irastorza, I.G.; Aznar, F.; Castel, J., E-mail: igor.irastorza@cern.ch, E-mail: faznar@unizar.es, E-mail: jfcastel@unizar.es [Grupo de Física Nuclear y Astropartículas, Departamento de Física Teórica, Universidad de Zaragoza, C/ P. Cerbuna 12, Zaragoza, 50009 (Spain); and others

    2016-01-01

    As part of the T-REX project, a number of R and D and prototyping activities have been carried out during the last years to explore the applicability of gaseous Time Projection Chambers (TPCs) with Micromesh Gas Structures (Micromegas) in rare event searches like double beta decay, axion research and low-mass WIMP searches. In both this and its companion paper, we compile the main results of the project and give an outlook of application prospects for this detection technique. While in the companion paper we focus on axions and WIMPs, in this paper we focus on the results regarding the measurement of the double beta decay (DBD) of {sup 136}Xe in a high pressure Xe (HPXe) TPC. Micromegas of the microbulk type have been extensively studied in high pressure Xe and Xe mixtures. Particularly relevant are the results obtained in Xe + trimethylamine (TMA) mixtures, showing very promising results in terms of gain, stability of operation, and energy resolution at high pressures up to 10 bar. The addition of TMA at levels of ∼ 1% reduces electron diffusion by up to a factor of 10 with respect to pure Xe, improving the quality of the topological pattern, with a positive impact on the discrimination capability. Operation with a medium size prototype of 30 cm diameter and 38 cm of drift (holding about 1 kg of Xe at 10 bar in the fiducial volume, enough to contain high energy electron tracks in the detector volume) has allowed to test the detection concept in realistic experimental conditions. Microbulk Micromegas are able to image the DBD ionization signature with high quality while, at the same time, measuring its energy deposition with a resolution of at least a ∼ 3% FWHM @ Q{sub ββ}. This value was experimentally demonstrated for high-energy extended tracks at 10 bar, and is probably improvable down to the ∼ 1% FWHM levels as extrapolated from low energy events. In addition, first results on the topological signature information (one straggling track ending in two

  15. Nuclear transparency, B physics, and double beta decay. Annual report, February 1, 1996 - January 31, 1997

    International Nuclear Information System (INIS)

    Nicholson, H.W.

    1996-07-01

    This report describes the publication of results of a search for neutrinoless double-beta decay of molybdenum 100 and preparation of a paper on statistical analysis techniques used, developments related to purification techniques for the molybdenum, and other related work; progress in redesign, rebuilding, and installation of the Brookhaven EVA detector's superconducting magnet and cryogenic system; and the testing of detector components for SLAC's BaBar experiment. 3 refs

  16. MaGe: a Monte Carlo framework for the Gerda and Majorana double beta decay experiments

    International Nuclear Information System (INIS)

    Bauer, M; Belogurov, S; Chan, Yd; Descovich, M; Detwiler, J; Di Marco, M; Fujikawa, B; Franco, D; Gehman, V; Henning, R; Hudek, K; Johnson, R; Jordan, D; Kazkaz, K; Klimenko, A; Knapp, M; Kroeninger, K; Lesko, K; Liu, X; Marino, M; Mokhtarani, A; Pandola, L; Perry, M; Poon, A; Radford, D; Tomei, C; Tull, C

    2006-01-01

    The Gerda and Majorana projects, both searching for the neutrinoless double beta-decay of 76 Ge, are developing a joint Monte-Carlo simulation framework called MaGe. Such an approach has many benefits: the workload for the development of general tools is shared between more experts, the code is tested in more detail, and more experimental data is made available for validation

  17. The use of antibiotics to improve phage detection and enumeration by the double-layer agar technique

    Directory of Open Access Journals (Sweden)

    Ferreira Eugénio C

    2009-07-01

    Full Text Available Abstract Background The Double-Layer Agar (DLA technique is extensively used in phage research to enumerate and identify phages and to isolate mutants and new phages. Many phages form large and well-defined plaques that are easily observed so that they can be enumerated when plated by the DLA technique. However, some give rise to small and turbid plaques that are very difficult to detect and count. To overcome these problems, some authors have suggested the use of dyes to improve the contrast between the plaques and the turbid host lawns. It has been reported that some antibiotics stimulate bacteria to produce phages, resulting in an increase in final titer. Thus, antibiotics might contribute to increasing plaque size in solid media. Results Antibiotics with different mechanisms of action were tested for their ability to enhance plaque morphology without suppressing phage development. Some antibiotics increased the phage plaque surface by up to 50-fold. Conclusion This work presents a modification of the DLA technique that can be used routinely in the laboratory, leading to a more accurate enumeration of phages that would be difficult or even impossible otherwise.

  18. Conformational cycle of the vitamin B12 ABC importer in liposomes detected by double electron-electron resonance (DEER).

    Science.gov (United States)

    Joseph, Benesh; Korkhov, Vladimir M; Yulikov, Maxim; Jeschke, Gunnar; Bordignon, Enrica

    2014-02-07

    Double electron-electron resonance is used here to investigate intermediates of the transport cycle of the Escherichia coli vitamin B12 ATP-binding cassette importer BtuCD-F. Previously, we showed the ATP-induced opening of the cytoplasmic gate I in TM5 helices, later confirmed by the AMP-PNP-bound BtuCD-F crystal structure. Here, other key residues are analyzed in TM10 helices (positions 307 and 322) and in the cytoplasmic gate II, i.e. the loop between TM2 and TM3 (positions 82 and 85). Without BtuF, binding of ATP induces detectable changes at positions 307 and 85 in BtuCD in liposomes. Together with BtuF, ATP triggers the closure of the cytoplasmic gate II in liposomes (reported by both positions 82 and 85). This forms a sealed cavity in the translocation channel in agreement with the AMP-PNP·BtuCD-F x-ray structure. When vitamin B12 and AMP-PNP are simultaneously present, the extent of complex formation is reduced, but the short 82-82 interspin distance detected indicates that the substrate does not affect the closed conformation of this gate. The existence of the BtuCD-F complex under these conditions is verified with spectroscopically orthogonal nitroxide and Gd(III)-based labels. The cytoplasmic gate II remains closed also in the vanadate-trapped state, but it reopens in the ADP-bound state of the complex. Therefore, we suggest that the substrate likely trapped in ATP·BtuCD-F can be released after ATP hydrolysis but before the occluded ADP-bound conformation is reached.

  19. Implications of Binary Black Hole Detections on the Merger Rates of Double Neutron Stars and Neutron Star–Black Holes

    Energy Technology Data Exchange (ETDEWEB)

    Gupta, Anuradha; Arun, K. G.; Sathyaprakash, B. S., E-mail: axg645@psu.edu, E-mail: kgarun@cmi.ac.in, E-mail: bss25@psu.edu [Institute for Gravitation and Cosmos, Physics Department, Pennsylvania State University, University Park, PA 16802 (United States)

    2017-11-01

    We show that the inferred merger rate and chirp masses of binary black holes (BBHs) detected by advanced LIGO (aLIGO) can be used to constrain the rate of double neutron star (DNS) and neutron star–black hole (NSBH) mergers in the universe. We explicitly demonstrate this by considering a set of publicly available population synthesis models of Dominik et al. and show that if all the BBH mergers, GW150914, LVT151012, GW151226, and GW170104, observed by aLIGO arise from isolated binary evolution, the predicted DNS merger rate may be constrained to be 2.3–471.0 Gpc{sup −3} yr{sup −1} and that of NSBH mergers will be constrained to 0.2–48.5 Gpc{sup −3} yr{sup −1}. The DNS merger rates are not constrained much, but the NSBH rates are tightened by a factor of ∼4 as compared to their previous rates. Note that these constrained DNS and NSBH rates are extremely model-dependent and are compared to the unconstrained values 2.3–472.5 Gpc{sup −3} yr{sup −1} and 0.2–218 Gpc{sup −3} yr{sup −1}, respectively, using the same models of Dominik et al. (2012a). These rate estimates may have implications for short Gamma Ray Burst progenitor models assuming they are powered (solely) by DNS or NSBH mergers. While these results are based on a set of open access population synthesis models, which may not necessarily be the representative ones, the proposed method is very general and can be applied to any number of models, thereby yielding more realistic constraints on the DNS and NSBH merger rates from the inferred BBH merger rate and chirp mass.

  20. Implications of Binary Black Hole Detections on the Merger Rates of Double Neutron Stars and Neutron Star–Black Holes

    International Nuclear Information System (INIS)

    Gupta, Anuradha; Arun, K. G.; Sathyaprakash, B. S.

    2017-01-01

    We show that the inferred merger rate and chirp masses of binary black holes (BBHs) detected by advanced LIGO (aLIGO) can be used to constrain the rate of double neutron star (DNS) and neutron star–black hole (NSBH) mergers in the universe. We explicitly demonstrate this by considering a set of publicly available population synthesis models of Dominik et al. and show that if all the BBH mergers, GW150914, LVT151012, GW151226, and GW170104, observed by aLIGO arise from isolated binary evolution, the predicted DNS merger rate may be constrained to be 2.3–471.0 Gpc −3 yr −1 and that of NSBH mergers will be constrained to 0.2–48.5 Gpc −3 yr −1 . The DNS merger rates are not constrained much, but the NSBH rates are tightened by a factor of ∼4 as compared to their previous rates. Note that these constrained DNS and NSBH rates are extremely model-dependent and are compared to the unconstrained values 2.3–472.5 Gpc −3 yr −1 and 0.2–218 Gpc −3 yr −1 , respectively, using the same models of Dominik et al. (2012a). These rate estimates may have implications for short Gamma Ray Burst progenitor models assuming they are powered (solely) by DNS or NSBH mergers. While these results are based on a set of open access population synthesis models, which may not necessarily be the representative ones, the proposed method is very general and can be applied to any number of models, thereby yielding more realistic constraints on the DNS and NSBH merger rates from the inferred BBH merger rate and chirp mass.

  1. Automated brightfield dual-color in situ hybridization for detection of mouse double minute 2 gene amplification in sarcomas.

    Science.gov (United States)

    Zhang, Wenjun; McElhinny, Abigail; Nielsen, Alma; Wang, Maria; Miller, Melanie; Singh, Shalini; Rueger, Ruediger; Rubin, Brian P; Wang, Zhen; Tubbs, Raymond R; Nagle, Raymond B; Roche, Pat; Wu, Ping; Pestic-Dragovich, Lidija

    2011-01-01

    The human homolog of the mouse double minute 2 (MDM2) oncogene is amplified in about 20% of sarcomas. The measurement of the MDM2 amplification can aid in classification and may provide a predictive value for recently formulated therapies targeting MDM2. We have developed and validated an automated bright field dual-color in situ hybridization application to detect MDM2 gene amplification. A repeat-depleted MDM2 probe was constructed to target the MDM2 gene region at 12q15. A chromosome 12-specific probe (CHR12) was generated from a pα12H8 plasmid. The in situ hybridization assay was developed by using a dinitrophenyl-labeled MDM2 probe and a digoxigenin-labeled CHR12 probe on the Ventana Medical Systems' automated slide-staining platforms. The specificity of the MDM2 and CHR12 probes was shown on metaphase spreads and further validated against controls, including normal human tonsil and known MDM2-amplified samples. The assay performance was evaluated on a cohort of 100 formalin-fixed, paraffin-embedded specimens by using a conventional bright field microscope. Simultaneous hybridization and signal detection for MDM2 and CHR12 showed that both DNA targets were present in the same cells. One hundred soft tissue specimens were stained for MDM2 and CHR12. Although 26 of 29 lipomas were nonamplified and eusomic, MDM2 amplification was noted in 78% of atypical lipomatous tumors or well-differentiated liposarcomas. Five of 6 dedifferentiated liposarcoma cases were amplified for MDM2. MDM2 amplification was observed in 1 of 8 osteosarcomas; 3 showed CHR12 aneusomy. MDM2 amplification was present in 1 of 4 chondrosarcomas. Nine of 10 synovial sarcomas displayed no evidence of MDM2 amplification in most tumor cells. In pleomorphic sarcoma, not otherwise specified (pleomorphic malignant fibrous histiocytoma), MDM2 was amplified in 38% of cases, whereas 92% were aneusomic for CHR12. One alveolar rhabdomyosarcoma and 2 embryonal rhabdomyosarcomas displayed low-level aneusomy

  2. Double-labeled donor probe can enhance the signal of fluorescence resonance energy transfer (FRET) in detection of nucleic acid hybridization

    Science.gov (United States)

    Okamura, Yukio; Kondo, Satoshi; Sase, Ichiro; Suga, Takayuki; Mise, Kazuyuki; Furusawa, Iwao; Kawakami, Shigeki; Watanabe, Yuichiro

    2000-01-01

    A set of fluorescently-labeled DNA probes that hybridize with the target RNA and produce fluorescence resonance energy transfer (FRET) signals can be utilized for the detection of specific RNA. We have developed probe sets to detect and discriminate single-strand RNA molecules of plant viral genome, and sought a method to improve the FRET signals to handle in vivo applications. Consequently, we found that a double-labeled donor probe labeled with Bodipy dye yielded a remarkable increase in fluorescence intensity compared to a single-labeled donor probe used in an ordinary FRET. This double-labeled donor system can be easily applied to improve various FRET probes since the dependence upon sequence and label position in enhancement is not as strict. Furthermore this method could be applied to other nucleic acid substances, such as oligo RNA and phosphorothioate oligonucleotides (S-oligos) to enhance FRET signal. Although the double-labeled donor probes labeled with a variety of fluorophores had unexpected properties (strange UV-visible absorption spectra, decrease of intensity and decay of donor fluorescence) compared with single-labeled ones, they had no relation to FRET enhancement. This signal amplification mechanism cannot be explained simply based on our current results and knowledge of FRET. Yet it is possible to utilize this double-labeled donor system in various applications of FRET as a simple signal-enhancement method. PMID:11121494

  3. Detection of Double-Compressed H.264/AVC Video Incorporating the Features of the String of Data Bits and Skip Macroblocks

    Directory of Open Access Journals (Sweden)

    Heng Yao

    2017-12-01

    Full Text Available Today’s H.264/AVC coded videos have a high quality, high data-compression ratio. They also have a strong fault tolerance, better network adaptability, and have been widely applied on the Internet. With the popularity of powerful and easy-to-use video editing software, digital videos can be tampered with in various ways. Therefore, the double compression in the H.264/AVC video can be used as a first step in the study of video-tampering forensics. This paper proposes a simple, but effective, double-compression detection method that analyzes the periodic features of the string of data bits (SODBs and the skip macroblocks (S-MBs for all I-frames and P-frames in a double-compressed H.264/AVC video. For a given suspicious video, the SODBs and S-MBs are extracted for each frame. Both features are then incorporated to generate one enhanced feature to represent the periodic artifact of the double-compressed video. Finally, a time-domain analysis is conducted to detect the periodicity of the features. The primary Group of Pictures (GOP size is estimated based on an exhaustive strategy. The experimental results demonstrate the efficacy of the proposed method.

  4. Double peak-induced distance error in short-time-Fourier-transform-Brillouin optical time domain reflectometers event detection and the recovery method.

    Science.gov (United States)

    Yu, Yifei; Luo, Linqing; Li, Bo; Guo, Linfeng; Yan, Jize; Soga, Kenichi

    2015-10-01

    The measured distance error caused by double peaks in the BOTDRs (Brillouin optical time domain reflectometers) system is a kind of Brillouin scattering spectrum (BSS) deformation, discussed and simulated for the first time in the paper, to the best of the authors' knowledge. Double peak, as a kind of Brillouin spectrum deformation, is important in the enhancement of spatial resolution, measurement accuracy, and crack detection. Due to the variances of the peak powers of the BSS along the fiber, the measured starting point of a step-shape frequency transition region is shifted and results in distance errors. Zero-padded short-time-Fourier-transform (STFT) can restore the transition-induced double peaks in the asymmetric and deformed BSS, thus offering more accurate and quicker measurements than the conventional Lorentz-fitting method. The recovering method based on the double-peak detection and corresponding BSS deformation can be applied to calculate the real starting point, which can improve the distance accuracy of the STFT-based BOTDR system.

  5. Performance of computer-aided detection of pulmonary nodules in low-dose CT: comparison with double reading by nodule volume

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Yingru; Vliegenthart, Rozemarijn; Wang, Ying; Ooijen, Peter M.A. van; Oudkerk, Matthijs [University of Groningen/University Medical Center Groningen, Center for Medical Imaging - North East Netherlands, Department of Radiology, P.O. Box 30.001, Groningen (Netherlands); Bock, Geertruida H. de [University of Groningen/University Medical Center Groningen, Department of Epidemiology, P.O. Box 30.001, Groningen (Netherlands); Klaveren, Rob J. van [Lievensberg Hospital, Department of Pulmonology, P.O. Box 135, Bergen op Zoom (Netherlands); Bogoni, Luca [CAD Group, Siemens Medical Solutions USA, Inc., Malvern, PA (United States); Jong, Pim A. de; Mali, Willem P. [University of Utrecht, Department of Radiology, University Medical Center Utrecht, P.O. Box 85500, Utrecht (Netherlands)

    2012-10-15

    To evaluate performance of computer-aided detection (CAD) beyond double reading for pulmonary nodules on low-dose computed tomography (CT) by nodule volume. A total of 400 low-dose chest CT examinations were randomly selected from the NELSON lung cancer screening trial. CTs were evaluated by two independent readers and processed by CAD. A total of 1,667 findings marked by readers and/or CAD were evaluated by a consensus panel of expert chest radiologists. Performance was evaluated by calculating sensitivity of pulmonary nodule detection and number of false positives, by nodule characteristics and volume. According to the screening protocol, 90.9 % of the findings could be excluded from further evaluation, 49.2 % being small nodules (less than 50 mm{sup 3}). Excluding small nodules reduced false-positive detections by CAD from 3.7 to 1.9 per examination. Of 151 findings that needed further evaluation, 33 (21.9 %) were detected by CAD only, one of them being diagnosed as lung cancer the following year. The sensitivity of nodule detection was 78.1 % for double reading and 96.7 % for CAD. A total of 69.7 % of nodules undetected by readers were attached nodules of which 78.3 % were vessel-attached. CAD is valuable in lung cancer screening to improve sensitivity of pulmonary nodule detection beyond double reading, at a low false-positive rate when excluding small nodules. circle Computer-aided detection (CAD) has known advantages for computed tomography (CT). (orig.)

  6. Performance of computer-aided detection of pulmonary nodules in low-dose CT: comparison with double reading by nodule volume

    International Nuclear Information System (INIS)

    Zhao, Yingru; Vliegenthart, Rozemarijn; Wang, Ying; Ooijen, Peter M.A. van; Oudkerk, Matthijs; Bock, Geertruida H. de; Klaveren, Rob J. van; Bogoni, Luca; Jong, Pim A. de; Mali, Willem P.

    2012-01-01

    To evaluate performance of computer-aided detection (CAD) beyond double reading for pulmonary nodules on low-dose computed tomography (CT) by nodule volume. A total of 400 low-dose chest CT examinations were randomly selected from the NELSON lung cancer screening trial. CTs were evaluated by two independent readers and processed by CAD. A total of 1,667 findings marked by readers and/or CAD were evaluated by a consensus panel of expert chest radiologists. Performance was evaluated by calculating sensitivity of pulmonary nodule detection and number of false positives, by nodule characteristics and volume. According to the screening protocol, 90.9 % of the findings could be excluded from further evaluation, 49.2 % being small nodules (less than 50 mm 3 ). Excluding small nodules reduced false-positive detections by CAD from 3.7 to 1.9 per examination. Of 151 findings that needed further evaluation, 33 (21.9 %) were detected by CAD only, one of them being diagnosed as lung cancer the following year. The sensitivity of nodule detection was 78.1 % for double reading and 96.7 % for CAD. A total of 69.7 % of nodules undetected by readers were attached nodules of which 78.3 % were vessel-attached. CAD is valuable in lung cancer screening to improve sensitivity of pulmonary nodule detection beyond double reading, at a low false-positive rate when excluding small nodules. circle Computer-aided detection (CAD) has known advantages for computed tomography (CT). (orig.)

  7. Double Beta Decay in Xenon-136. Measuring the Neutrino-Emitting Mode and Searching for Majoron-Emitting Modes

    Energy Technology Data Exchange (ETDEWEB)

    Herrin, Steven [Stanford Univ., CA (United States)

    2013-06-01

    Observations of neutrino flavor oscillations have demonstrated that neutrinos have mass. Since the discovery of these oscillations, much progress has been made at mea- suring the neutrino mass-squared differences and lepton mixing angles that character- ize them. However, the origin and absolute scale of neutrino masses remain unknown. Unique among fermions, neutrinos can be Majorana particles, which could provide an explanation for neutrino masses. Discovery of a hypothetical process known as neutrinoless double beta decay would show that neutrinos are Majorana particles and determine the mass scale for neutrinos. The Enriched Xenon Observatory (EXO) is a series of experiments searching for the neutrinoless double beta decay of 136Xe. The first experiment, EXO-200, began operation in 2011 and makes use of 200 kg of xenon enriched to 80.6% in 136Xe. The analysis presented here makes use of data from EXO-200 to obtain a more precise measurement of the half-life for the two-neutrino-emitting mode of double beta decay than previously reported. The analysis also sets limits on the half-lives for exotic, Majoron-emitting modes of neutrinoless double beta decay. Data from EXO-200 is also used to produce a measurement of the cosmic muon flux at the WIPP under- ground site where EXO-200 is located.

  8. Double beta decay in the generalized seniority scheme

    International Nuclear Information System (INIS)

    Pittel, S.; Engel, J.; Vogel, P.; Ji Xiangdong

    1990-01-01

    A generalized-seniority truncation scheme is used in shell-model calculations of double beta decay matrix elements. Calculations are carried out for 78 Ge, 82 Se and 128,130 Te. Matrix elements calculated for the two-neutrino decay mode are small compared to weak-coupling shell-model calculations and support the suppression mechanism first observed in the quasi-particle random phase approximation. Matrix elements for the neutrinoless mode are similar to those of the weak-coupling shell model, suggesting that these matrix elements can be pinned down fairly accurately. (orig.)

  9. Experimental search for double beta decay of 100Mo

    International Nuclear Information System (INIS)

    Alston-Garnjost, M.; Dougherty, B.L.; Kenney, R.W.; Krivicich, J.M.; Tripp, R.D.; Nicholson, H.W.; Dieterle, B.D.; Leavitt, C.P.

    1986-01-01

    An experiment is proposed to search for double beta decay in 100 Mo using thin silicon solid state detectors. We expect to be sensitive to a half life limit of over 2 x 10 23 years for the neutrinoless mode and 2 x 10 20 years for the two-neutrino mode in one year's running. This is a substantial improvement in the measurement of the limits on electron neutrino mass and/or right-handed current admixtures over present 76 Ge experiments. 16 refs., 12 figs., 9 tabs

  10. GENIUS and the Genius TF: A New Observatory for WIMP Dark Matter and Neutrinoless Double Beta Decay

    OpenAIRE

    Klapdor-Kleingrothaus, H. V.; Majorovits, B.

    2001-01-01

    The GENIUS proposal is described and some of it's physics potential is outlined. Also in the light of the contradictive results from the DAMA and CDMS experiments the Genius TF, a new experimental setup is proposed. The Genius TF could probe the DAMA evidence region using the WIMP nucleus recoil signal and WIMP annual modulation signature simultaneously. Besides that it can prove the long term feasibility of the detector technique to be implemented into the GENIUS setup and will in this sense...

  11. Improving the physics impact of next-generation 76Ge neutrinoless double-beta decay experiments

    Energy Technology Data Exchange (ETDEWEB)

    Hossbach, Todd W. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States)

    2009-01-01

    It was shown that segmentation and pulse-shape discrimination can improve the discovery sensitivity of a next-gen 0vBB-decay experiment by 90%. - However, when practical aspects are considered (such as instrumenting each segment with front-end electronics), the discovery sensitivity is decreased by 19%. - This has extremely important consequences to proposed next-gen experiments since the two active collaborations have strongly advocated the use of segmented detectors for all or part of the experiment. - New germanium detector technology, currently under development, has demonstrated excellent multi-site background rejection capabilities without the complexity of segmentation or complicated PSD algorithms. - The physically-segmented p-type germanium detector technology has proven to be a useful and practical tool in modern nuclear physics. The PSEG technology deserves further development as it has the potential for use in a variety of applications.

  12. Double-beta decay with majoron emission in GERDA Phase I

    Science.gov (United States)

    Hemmer, Sabine

    2015-07-01

    Neutrinoless double-beta decay with emission of one or two majorons (0 νββχ( χ)) is predicted by several beyond-Standard-Model theories. This article reviews the results of a search for 0 νββχ( χ) of 76Ge using data from the Germanium Detector Array (GERDA) experiment, located underground at the INFN Laboratori Nazionali del Gran Sasso (LNGS) in Italy. The analysis comprised data with an exposure of 20.3 kg·yr from the first phase of the experiment. No indication of contributions to the observed energy spectra was detected for any of the majoron models. The lower limit on the half-life for the ordinary majoron model (spectral index n = 1 was determined to be T {1/2/0 νβ } > 4.2 · 1023 yr (90% quantile). This limit and the limits derived for the other majoron modes constitute the most stringent limits on 0 νββχ( χ) decay of 76Ge measured to date.

  13. Isotensor Axial Polarizability and Lattice QCD Input for Nuclear Double- β Decay Phenomenology

    Energy Technology Data Exchange (ETDEWEB)

    Shanahan, Phiala E.; Tiburzi, Brian C.; Wagman, Michael L.; Winter, Frank; Chang, Emmanuel; Davoudi, Zohreh; Detmold, William; Orginos, Kostas; Savage, Martin J.

    2017-08-01

    The potential importance of short-distance nuclear effects in double-$\\beta$ decay is assessed using a lattice QCD calculation of the $nn\\rightarrow pp$ transition and effective field theory methods. At the unphysical quark masses used in the numerical computation, these effects, encoded in the isotensor axial polarisability, are found to be of similar magnitude to the nuclear modification of the single axial current, which phenomenologically is the quenching of the axial charge used in nuclear many-body calculations. This finding suggests that nuclear models for neutrinoful and neutrinoless double-$\\beta$ decays should incorporate this previously neglected contribution if they are to provide reliable guidance for next-generation neutrinoless double-$\\beta$ decay searches. The prospects of constraining the isotensor axial polarisabilities of nuclei using lattice QCD input into nuclear many-body calculations are discussed.

  14. Possible test of grand unification in the double beta-decay

    International Nuclear Information System (INIS)

    Faessler, A.

    1988-01-01

    The more successful grand unified theories predict that the neutrino is identical with its antiparticle and therefore is a Majorana neutrino which violates lepton number conservation. Such a neutrino should have a finite mass and also a small right handed weak interaction. If the double neutrinoless beta decay is observed with the full decay energy in the two electrons, it would establish that the electron neutrino is a Majorana particle. It is shown that the relativistic corrections of the nucleonic wave functions are essential for determining an upper limit of the right handedness from the measured lower limit of the life-time against the neutrinoless double beta decay. The upper limit for the right handedness of the weak interaction derived from the lower limit of the life-times against the neutrinoless beta decay is vertical stroke vertical stroke -8 and the upper limit for the neutrino mass is vertical stroke ν m>vertical stroke + -decay in proton rich nuclei, one can explain the long standing puzzle of the quenching of the Gamow-Teller strength in agreement with the data. (orig.)

  15. “Turn-off” fluorescent data array sensor based on double quantum dots coupled with chemometrics for highly sensitive and selective detection of multicomponent pesticides

    Energy Technology Data Exchange (ETDEWEB)

    Fan, Yao; Liu, Li; Sun, Donglei; Lan, Hanyue [The Modernization Engineering Technology Research Center of Ethnic Minority Medicine of Hubei Province, College of Pharmacy, South-Central University for Nationalities, Wuhan 430074 (China); Fu, Haiyan, E-mail: fuhaiyan@mail.scuec.edu.cn [The Modernization Engineering Technology Research Center of Ethnic Minority Medicine of Hubei Province, College of Pharmacy, South-Central University for Nationalities, Wuhan 430074 (China); Yang, Tianming, E-mail: tmyang@mail.scuec.edu.cn [The Modernization Engineering Technology Research Center of Ethnic Minority Medicine of Hubei Province, College of Pharmacy, South-Central University for Nationalities, Wuhan 430074 (China); She, Yuanbin, E-mail: sheyb@zjut.edu.cn [State Key Laboratory Breeding Base of Green Chemistry-Synthesis Technology, College of Chemical Engineering, Zhejiang University of Technology, Hangzhou 310032 (China); Ni, Chuang [The Modernization Engineering Technology Research Center of Ethnic Minority Medicine of Hubei Province, College of Pharmacy, South-Central University for Nationalities, Wuhan 430074 (China)

    2016-04-15

    As a popular detection model, the fluorescence “turn-off” sensor based on quantum dots (QDs) has already been successfully employed in the detections of many materials, especially in the researches on the interactions between pesticides. However, the previous studies are mainly focused on simple single track or the comparison based on similar concentration of drugs. In this work, a new detection method based on the fluorescence “turn-off” model with water-soluble ZnCdSe and CdSe QDs simultaneously as the fluorescent probes is established to detect various pesticides. The fluorescence of the two QDs can be quenched by different pesticides with varying degrees, which leads to the differences in positions and intensities of two peaks. By combining with chemometrics methods, all the pesticides can be qualitative and quantitative respectively even in real samples with the limit of detection was 2 × 10{sup −8} mol L{sup −1} and a recognition rate of 100%. This work is, to the best of our knowledge, the first report on the detection of pesticides based on the fluorescence quenching phenomenon of double quantum dots combined with chemometrics methods. What's more, the excellent selectivity of the system has been verified in different mediums such as mixed ion disruption, waste water, tea and water extraction liquid drugs. - Highlights: • A new model based on double QDs is established for pesticide residues detection. • The fluorescent data array sensor is coupled with chmometrics methods. • The sensor can be highly sensitive and selective detection in actual samples.

  16. “Turn-off” fluorescent data array sensor based on double quantum dots coupled with chemometrics for highly sensitive and selective detection of multicomponent pesticides

    International Nuclear Information System (INIS)

    Fan, Yao; Liu, Li; Sun, Donglei; Lan, Hanyue; Fu, Haiyan; Yang, Tianming; She, Yuanbin; Ni, Chuang

    2016-01-01

    As a popular detection model, the fluorescence “turn-off” sensor based on quantum dots (QDs) has already been successfully employed in the detections of many materials, especially in the researches on the interactions between pesticides. However, the previous studies are mainly focused on simple single track or the comparison based on similar concentration of drugs. In this work, a new detection method based on the fluorescence “turn-off” model with water-soluble ZnCdSe and CdSe QDs simultaneously as the fluorescent probes is established to detect various pesticides. The fluorescence of the two QDs can be quenched by different pesticides with varying degrees, which leads to the differences in positions and intensities of two peaks. By combining with chemometrics methods, all the pesticides can be qualitative and quantitative respectively even in real samples with the limit of detection was 2 × 10"−"8 mol L"−"1 and a recognition rate of 100%. This work is, to the best of our knowledge, the first report on the detection of pesticides based on the fluorescence quenching phenomenon of double quantum dots combined with chemometrics methods. What's more, the excellent selectivity of the system has been verified in different mediums such as mixed ion disruption, waste water, tea and water extraction liquid drugs. - Highlights: • A new model based on double QDs is established for pesticide residues detection. • The fluorescent data array sensor is coupled with chmometrics methods. • The sensor can be highly sensitive and selective detection in actual samples.

  17. Neutrino mass, the right-handed interaction and the double beta decay, 1

    International Nuclear Information System (INIS)

    Doi, Masaru; Kotani, Tsuneyuki; Nishiura, Hiroyuki; Okuda, Kazuko; Takasugi, Eiichi.

    1981-01-01

    In order to shed light on the important question whether neutrinos are Dirac or Majorana particles, the double β decay is investigated within a general form of weak interaction Hamiltonian. The systematic study is made on the 0 + → J + nuclear transitions for the two-neutrino and neutrinoless modes both in the two-nucleon- and N*-mechanism. It is shown that for the neutrinoless mode, only the 0 + → 0 + transition in the two-nucleon mechanism is allowed if there is no right-handed interaction. When the right-handed interaction gives a sizable contribution, the role of the 0 + → 2 + transition becomes as important as the 0 + → 0 + transition. The comparison of our results with the previous ones is also presented. (author)

  18. Does the accuracy of single reading with CAD (computer-aided detection) compare with that of double reading?: A review of the literature

    International Nuclear Information System (INIS)

    Bennett, R.L.; Blanks, R.G.; Moss, S.M.

    2006-01-01

    Aim: To examine current evidence to determine whether the accuracy of single reading with computed-aided detection (CAD) compares with that of double reading. Methods: We performed a literature review to identify studies where both protocols had been investigated and compared. We identified eight studies that compared single reading with CAD against double reading, of which six reported on comparisons of both sensitivity and specificity. Results: Of the six studies identified, three showed no differences in either sensitivity or specificity. One showed single reading with CAD had a higher sensitivity at the same specificity, another that single reading with CAD had a higher specificity at the same sensitivity. However, one study, in a real-life setting, showed that single reading with CAD had a higher sensitivity but a lower specificity. Conclusion: As the majority of the studies were not in a real-life setting, used test sets, lacked sufficient training in the use of CAD and simulated double reading (using a protocol of recall if one suggests), current evidence is therefore limited as to the accuracy, in terms of sensitivity and specificity, of single reading with CAD in comparison with the most common practice in the UK of double reading using a protocol of consensus or arbitration

  19. Double Chooz

    Energy Technology Data Exchange (ETDEWEB)

    Buck, Christian [Max-Planck-Institut fuer Kernphysik, Saupfercheckweg 1, D-69117 Heidelberg (Germany)

    2006-05-15

    The goal of the Double Chooz reactor neutrino experiment is to search for the neutrino mixing parameter {theta}{sub 13}. Double Chooz will use two identical detectors at 150 m and 1.05 km distance from the reactor cores. The near detector is used to monitor the reactor {nu}-bar {sub e} flux while the second is dedicated to the search for a deviation from the expected (1/distance){sup 2} behavior. This two detector concept will allow a relative normalization systematic error of ca. 0.6 %. The expected sensitivity for sin{sup 2}2{theta}{sub 13} is then in the range 0.02 - 0.03 after three years of data taking. The antineutrinos will be detected in a liquid scintillator through the capture on protons followed by a gamma cascade, produced by the neutron capture on Gd.

  20. Noninvasive detection of coronary vasospastic angina using a double-acquisition coronary CT angiography protocol in the presence and absence of an intravenous nitrate: a pilot study

    Energy Technology Data Exchange (ETDEWEB)

    Kang, Eun-Ju; Kim, Dong Won; Yoon, Seong Kuk; Lee, Ki-Nam [Dong-A University, Department of Radiology, College of Medicine, Busan (Korea, Republic of); Kim, Moo Hyun; Jin, Cai De [Dong-A University, Department of Cardiology, College of Medicine, Busan (Korea, Republic of); Dong-A University Hospital, Global Clinical Trial Center, Busan (Korea, Republic of); Seo, Jeongmin; Park, Tae-Ho [Dong-A University, Department of Cardiology, College of Medicine, Busan (Korea, Republic of); Choi, Sang Il [Seoul National University Bundang Hospital, Department of Radiology, Seongnam-si (Korea, Republic of); Yoon, Yeonyee Elizabeth [Seoul National University Bundang Hospital, Department of Cardiology, Seongnam-si (Korea, Republic of)

    2017-03-15

    To evaluate the feasibility of a double-acquisition coronary CT angiography (CCTA) protocol in the presence and absence of an intravenous (IV) vasodilator infusion for detecting vasospastic angina. Twenty patients with a high clinical probability of vasospastic angina were enrolled. All subjects underwent baseline CCTA without a vasodilator in the early morning followed by a catheterized coronary angiography with ergonovine provocation test. Within 3 days, all subjects underwent repeat CCTA during a continuous IV infusion of nitrate. Vasospastic angina as detected by CCTA was defined as significant stenosis (≥50 %) with negative remodelling without definite plaques or diffuse small diameter (<2 mm) of a major coronary artery with a beaded appearance on baseline CT that completely dilated on IV nitrate CT. The CCTA results were compared to the catheterized ergonovine provocation test as the reference standard. Among 20 patients, the catheterized ergonovine provocation test detected vasospasm in 15 patients. The sensitivity, specificity, positive predictive value and negative predictive value of CCTA in a per-patient-based analysis were 73, 100, 100 and 56 %, respectively. Double-acquisition CCTA in the presence and absence of IV infusion of nitrate allows noninvasive detection of vasospastic angina with moderate sensitivity and high specificity. (orig.)

  1. Does Kepler unveil the mystery of the Blazhko effect? First detection of period doubling in Kepler Blazhko RR Lyrae stars

    DEFF Research Database (Denmark)

    Szabó, R.; Kollath, Z.; Molnár, L.

    2010-01-01

    -doubling bifurcation in our non-linear RR Lyrae models computed by the Florida-Budapest hydrocode. This enabled us to trace the origin of this instability in RR Lyrae stars to a resonance, namely a 9:2 resonance between the fundamental mode and a high-order (ninth) radial overtone showing strange-mode characteristics...

  2. Study of inter-strip gap effects and efficiency for full energy detection of double sided silicon strip detectors

    International Nuclear Information System (INIS)

    Fisichella, M.; Forneris, J.; Grassi, L.

    2015-01-01

    We performed a characterization of Double Sided Silicon Strip Detectors (DSSSD) with the aim to carry out a systematic study of the inter-strip effects on the energy measurement of charged particles. The dependence of the DSSSD response on ion, energy and applied bias has been investigated. (author)

  3. Validation of an automatic system (DoubleCage) for detecting the location of animals during preference tests.

    Science.gov (United States)

    Tsai, P P; Nagelschmidt, N; Kirchner, J; Stelzer, H D; Hackbarth, H

    2012-01-01

    Preference tests have often been performed for collecting information about animals' acceptance of environmental refinement objects. In numerous published studies animals were individually tested during preference experiments, as it is difficult to observe group-housed animals with an automatic system. Thus, videotaping is still the most favoured method for observing preferences of socially-housed animals. To reduce the observation workload and to be able to carry out preference testing of socially-housed animals, an automatic recording system (DoubleCage) was developed for determining the location of group-housed animals in a preference test set-up. This system is able to distinguish the transition of individual animals between two cages and to record up to 16 animals at the same time (four animals per cage). The present study evaluated the reliability of the DoubleCage system. The data recorded by the DoubleCage program and the data obtained by human observation were compared. The measurements of the DoubleCage system and manual observation of the videotapes are comparable and significantly correlated (P animals and a considerable reduction of animal observation time.

  4. Two-neutrino double-β decay of 150Nd to excited final states in 150Sm

    Science.gov (United States)

    Kidd, M. F.; Esterline, J. H.; Finch, S. W.; Tornow, W.

    2014-11-01

    Background: Double-β decay is a rare nuclear process in which two neutrons in the nucleus are converted to two protons with the emission of two electrons and two electron antineutrinos. Purpose: We measured the half-life of the two-neutrino double-β decay of 150Nd to excited final states of 150Sm by detecting the deexcitation γ rays of the daughter nucleus. Method: This study yields the first detection of the coincidence γ rays from the 0 1+ excited state of 150Sm. These γ rays have energies of 333.97 and 406.52 keV and are emitted in coincidence through a 01+→21+→0gs+ transition. Results: The enriched Nd2O3 sample consisted of 40.13 g 150Nd and was observed for 642.8 days at the Kimballton Underground Research Facility, producing 21.6 net events in the region of interest. This count rate gives a half-life of T1 /2=[1 .07-0.25+0.45(stat ) ±0.07 (syst ) ] ×1020 yr. The effective nuclear matrix element was found to be 0.0465 -0.0054+0.0098. Finally, lower limits were obtained for decays to higher excited final states. Conclusions: Our half-life measurement agrees within uncertainties with another recent measurement in which no coincidence was employed. Our nuclear matrix element calculation may have an impact on a recent neutrinoless double-β decay nuclear matrix element calculation which implies that the decay to the first excited state in 150Sm is favored over that to the ground state.

  5. Observation of Two-Neutrino Double-Beta Decay in Xe-136 with EXO-200

    Energy Technology Data Exchange (ETDEWEB)

    Ackerman, N.; /SLAC; Aharmim, B.; /Laurentian U.; Auger, M.; /Bern U.; Auty, D.J.; /Alabama U.; Barbeau, P.S.; Barry, K.; Bartoszek, L.; /Stanford U., Phys. Dept.; Beauchamp, E.; /Laurentian U.; Belov, V.; /Moscow, ITEP; Benitez-Medina, C.; /Colorado State U.; Breidenbach, M.; /SLAC; Burenkov, A.; /Moscow, ITEP; Cleveland, B.; /Laurentian U.; Conley, R.; Conti, E.; /SLAC; Cook, J.; /Massachusetts U., Amherst; Cook, S.; /Colorado State U.; Coppens, A.; /Carleton U.; Counts, I.; /Stanford U., Phys. Dept.; Craddock, W.; /SLAC; Daniels, T.; /Massachusetts U., Amherst /Moscow, ITEP /Maryland U. /Stanford U., Phys. Dept. /Alabama U. /Maryland U. /Moscow, ITEP /Stanford U., Phys. Dept. /Laurentian U. /Carleton U. /Colorado State U. /Laurentian U. /Munich, Tech. U. /Bern U. /SLAC /Bern U. /Carleton U. /Stanford U., Phys. Dept. /Carleton U. /Maryland U. /Colorado State U. /SLAC /Carleton U. /SLAC /Alabama U. /SLAC /Moscow, ITEP /Indiana U. /Stanford U., Phys. Dept. /Moscow, ITEP /Stanford U., Phys. Dept. /Massachusetts U., Amherst /Seoul U. /Carleton U. /Stanford U., Phys. Dept.; /more authors..

    2012-09-14

    We report the observation of two-neutrino double-beta decay in {sup 136}Xe with T{sub 1/2} = 2.11 {+-} 0.04(stat) {+-} 0.21(syst) x 10{sup 21} yr. This second-order process, predicted by the standard model, has been observed for several nuclei but not for {sup 136}Xe. The observed decay rate provides new input to matrix element calculations and to the search for the more interesting neutrinoless double-beta decay, the most sensitive probe for the existence of Majorana particles and the measurement of the neutrino mass scale.

  6. Double beta decay and neutrino mass models

    Energy Technology Data Exchange (ETDEWEB)

    Helo, J.C. [Universidad Técnica Federico Santa María, Centro-Científico-Tecnológico de Valparaíso, Casilla 110-V, Valparaíso (Chile); Hirsch, M. [AHEP Group, Instituto de Física Corpuscular - C.S.I.C./Universitat de València, Edificio de Institutos de Paterna, Apartado 22085, E-46071 València (Spain); Ota, T. [Department of Physics, Saitama University, Shimo-Okubo 255, 338-8570 Saitama-Sakura (Japan); Santos, F.A. Pereira dos [Departamento de Física, Pontifícia Universidade Católica do Rio de Janeiro,Rua Marquês de São Vicente 225, 22451-900 Gávea, Rio de Janeiro (Brazil)

    2015-05-19

    Neutrinoless double beta decay allows to constrain lepton number violating extensions of the standard model. If neutrinos are Majorana particles, the mass mechanism will always contribute to the decay rate, however, it is not a priori guaranteed to be the dominant contribution in all models. Here, we discuss whether the mass mechanism dominates or not from the theory point of view. We classify all possible (scalar-mediated) short-range contributions to the decay rate according to the loop level, at which the corresponding models will generate Majorana neutrino masses, and discuss the expected relative size of the different contributions to the decay rate in each class. Our discussion is general for models based on the SM group but does not cover models with an extended gauge. We also work out the phenomenology of one concrete 2-loop model in which both, mass mechanism and short-range diagram, might lead to competitive contributions, in some detail.

  7. A sensitive biosensor using double-layer capillary based immunomagnetic separation and invertase-nanocluster based signal amplification for rapid detection of foodborne pathogen.

    Science.gov (United States)

    Huang, Fengchun; Zhang, Huilin; Wang, Lei; Lai, Weihua; Lin, Jianhan

    2018-02-15

    Combining double-layer capillary based high gradient immunomagnetic separation, invertase-nanocluster based signal amplification and glucose meter based signal detection, a novel biosensor was developed for sensitive and rapid detection of E. coli O157:H7 in this study. The streptavidin modified magnetic nanobeads (MNBs) were conjugated with the biotinylated polyclonal antibodies against E. coli O157:H7 to form the immune MNBs, which were captured by the high gradient magnetic field in the double-layer capillary to specifically separate and efficiently concentrate the target bacteria. Calcium chloride was used with the monoclonal antibodies against E. coli O157:H7 and the invertase to form the immune invertase-nanoclusters (INCs), which were used to react with the target bacteria to form the MNB-bacteria-INC complexes in the capillary. The sucrose was then injected into the capillary and catalyzed by the invertase on the complexes into the glucose, which was detected using the glucose meter to obtain the concentration of the glucose for final determination of the E. coli O157:H7 cells in the sample. A linear relationship between the readout of the glucose meter and the concentration of the E. coli O157:H7 cells (from 10 2 to 10 7 CFU/mL) was found and the lower detection limit of this biosensor was 79 CFU/mL. This biosensor might be extended for the detection of other foodborne pathogens by changing the antibodies and has shown the potential for the detection of foodborne pathogens in a large volume of sample to further increase the sensitivity. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. The G-BHQ synergistic effect: Improved double quenching molecular beacons based on guanine and Black Hole Quencher for sensitive simultaneous detection of two DNAs.

    Science.gov (United States)

    Xiang, Dongshan; Li, Fengquan; Wu, Chenyi; Shi, Boan; Zhai, Kun

    2017-11-01

    We designed two double quenching molecular beacons (MBs) with simple structure based on guanine (G base) and Black Hole Quencher (BHQ), and developed a new analytical method for sensitive simultaneous detection of two DNAs by synchronous fluorescence analysis. In this analytical method, carboxyl fluorescein (FAM) and tetramethyl-6-carboxyrhodamine (TAMRA) were respectively selected as fluorophore of two MBs, Black Hole Quencher 1 (BHQ-1) and Black Hole Quencher 2 (BHQ-2) were respectively selected as organic quencher, and three continuous nucleotides with G base were connected to organic quencher (BHQ-1 and BHQ-2). In the presence of target DNAs, the two MBs hybridize with the corresponding target DNAs, the fluorophores are separated from organic quenchers and G bases, leading to recovery of fluorescence of FAM and TAMRA. Under a certain conditions, the fluorescence intensities of FAM and TAMRA all exhibited good linear dependence on their concentration of target DNAs (T1 and T2) in the range from 4 × 10 -10 to 4 × 10 -8 molL -1 (M). The detection limit (3σ, n = 13) of T1 was 3 × 10 -10 M and that of T2 was 2×10 -10 M, respectively. Compared with the existing analysis methods for multiplex DNA with MBs, this proposed method based on double quenching MBs is not only low fluorescence background, short analytical time and low detection cost, but also easy synthesis and good stability of MB probes. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Anti-double strand (ds) DNA antibody formation by NZB/W (F1) spleen cells in a microculture system detected by solid phase radioimmunoassay.

    Science.gov (United States)

    Okudaira, H; Terada, E; Ogita, T; Aotsuka, S; Yokohari, R

    1981-01-01

    A solid-phase radioimmunoassay method was devised to detect mouse anti-double strand (ds) DNA antibody. This method could easily detect the anti-dsDNA antibody in 1 : 10,000 dilutions (1 unit) of pooled 9-10-month-old female NZB/W F1 sera. The sensitivity was about 10(3)- and 10(2)-fold higher than that of the modified Farr method and of the double antibody technique respectively. NZB/W mice developed high titer anti-dsDNA antibody as they grew older. Spleen cells brought to a microculture system using flat-bottomed polystyrene plates produced anti-dsDNA antibody clearly detectable by solid-phase radioimmunoassay. Anti-dsDNA antibody produced in vitro (y units) was in close correlation with the anti-dsDNA antibody titer of the spleen donor (x units) (y = 4.8 X 10(-2) x -65, gamma = 0.94, P less than 0.001). A combination of the microculture system and solid-phase radioimmunoassay was recommended for the characterization of anti-dsDNA antibody-forming cells.

  10. Anti-double strand (ds) DNA antibody formation by NZB/W (F1) spleen cells in a microculture system detected by solid-phase radioimmunoassay

    International Nuclear Information System (INIS)

    Okudaira, H.; Terada, E.; Ogita, T.; Aotsuka, S.; Yokohari, R.

    1981-01-01

    A solid-phase radioimmunoassay method was devised to detect mouse anti-double strand (ds) DNA antibody. This method could easily detect the anti-ds DNA antibody in 1 : 10,000 dilutions (1 unit) of pooled 9-10 month-old female NZB/W F1 sera. The sensitivity was about 10 3 and 10 2 -fold higher than that of the modified Farr method and of the double antibody technique respectively. NZB/W mice developed high titer anti-dsDNA antibody as they grew older. Spleen cells brought to a microculture system using flat-bottomed polystyrene plates produced anti-dsDNA antibody clearly detectable by solid-phase radioimmunoassay. Anti-dsDNA antibody produced in vitro (y units) was in close correlation with the anti-dsDNA antibody titer of the spleen donor (x units) (y = 4.8 X 10 -2 x-65, γ = 0.94, P < 0.001). A combination of the microculture system and solid-phase radioimmunoassay was recommended for the characterization of anti-dsDNA antibody-forming cells. (Auth.)

  11. Evaluation of the neutral comet assay for detection of alpha-particle induced DNA-double-strand-breaks

    International Nuclear Information System (INIS)

    Hofbauer, Daniela

    2010-01-01

    Aim of this study was to differentiate DNA-double-strand-breaks from DNA-single-strand-breaks on a single cell level, using the comet assay after α- and γ-irradiation. Americium-241 was used as a alpha-irradiation-source, Caesium-137 was used for γ-irradiation. Because of technical problems with both the neutral and alkaline comet assay after irradiation of gastric cancer cells and human lymphocytes, no definite differentiation of DNA-damage was possible.

  12. "Turn-off" fluorescent data array sensor based on double quantum dots coupled with chemometrics for highly sensitive and selective detection of multicomponent pesticides.

    Science.gov (United States)

    Fan, Yao; Liu, Li; Sun, Donglei; Lan, Hanyue; Fu, Haiyan; Yang, Tianming; She, Yuanbin; Ni, Chuang

    2016-04-15

    As a popular detection model, the fluorescence "turn-off" sensor based on quantum dots (QDs) has already been successfully employed in the detections of many materials, especially in the researches on the interactions between pesticides. However, the previous studies are mainly focused on simple single track or the comparison based on similar concentration of drugs. In this work, a new detection method based on the fluorescence "turn-off" model with water-soluble ZnCdSe and CdSe QDs simultaneously as the fluorescent probes is established to detect various pesticides. The fluorescence of the two QDs can be quenched by different pesticides with varying degrees, which leads to the differences in positions and intensities of two peaks. By combining with chemometrics methods, all the pesticides can be qualitative and quantitative respectively even in real samples with the limit of detection was 2 × 10(-8) mol L(-1) and a recognition rate of 100%. This work is, to the best of our knowledge, the first report on the detection of pesticides based on the fluorescence quenching phenomenon of double quantum dots combined with chemometrics methods. What's more, the excellent selectivity of the system has been verified in different mediums such as mixed ion disruption, waste water, tea and water extraction liquid drugs. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Detection and Repair of Ionizing Radiation-Induced DNA Double Strand Breaks: New Developments in Nonhomologous End Joining

    International Nuclear Information System (INIS)

    Wang, Chen; Lees-Miller, Susan P.

    2013-01-01

    DNA damage can occur as a result of endogenous metabolic reactions and replication stress or from exogenous sources such as radiation therapy and chemotherapy. DNA double strand breaks are the most cytotoxic form of DNA damage, and defects in their repair can result in genome instability, a hallmark of cancer. The major pathway for the repair of ionizing radiation-induced DSBs in human cells is nonhomologous end joining. Here we review recent advances on the mechanism of nonhomologous end joining, as well as new findings on its component proteins and regulation

  14. Detection and Repair of Ionizing Radiation-Induced DNA Double Strand Breaks: New Developments in Nonhomologous End Joining

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Chen [Departments of Biochemistry and Molecular Biology and Oncology, and Southern Alberta Cancer Research Institute, University of Calgary, Calgary (Canada); Lees-Miller, Susan P., E-mail: leesmill@ucalgary.ca [Departments of Biochemistry and Molecular Biology and Oncology, and Southern Alberta Cancer Research Institute, University of Calgary, Calgary (Canada)

    2013-07-01

    DNA damage can occur as a result of endogenous metabolic reactions and replication stress or from exogenous sources such as radiation therapy and chemotherapy. DNA double strand breaks are the most cytotoxic form of DNA damage, and defects in their repair can result in genome instability, a hallmark of cancer. The major pathway for the repair of ionizing radiation-induced DSBs in human cells is nonhomologous end joining. Here we review recent advances on the mechanism of nonhomologous end joining, as well as new findings on its component proteins and regulation.

  15. Modulation of the Singlet Oxygen Generation from the Double Strand DNA-SYBR Green I Complex Mediated by T-Melamine-T Mismatch for Visual Detection of Melamine.

    Science.gov (United States)

    Hu, Hao; Zhang, Jinyi; Ding, Yu; Zhang, Xinfeng; Xu, Kailai; Hou, Xiandeng; Wu, Peng

    2017-05-02

    Singlet oxygen ( 1 O 2 ), generated via photosensitization, has been proved to oxidize chromogenic substrates with neither H 2 O 2 oxidation nor enzyme (horseradish peroxidase, HRP) catalysis. Of the various methods for modulation of the 1 O 2 generation, DNA-controlled photosensitization received great attention. Therefore, integration of the formation/deformation DNA structures with DNA-controlled photosensitization will be extremely appealing in visual biosensor developments. Here, the stable melamine-thymine complex was explored in combination with DNA-controlled photosensitization for visual detection of melamine. A T-rich single stand DNA was utilized as the recognition unit. Upon the formation of the T-M-T complex, double stand DNA was formed, which was ready for the binding of SYBR Green I and activated the photosensitization. Subsequent oxidation of TMB allowed visual detection of melamine in dairy products, with spike-recoveries ranging from 94% to 106%.

  16. 32-Channel banana-avg montage is better than 16-channel double banana montage to detect epileptiform discharges in routine EEGs.

    Science.gov (United States)

    Ochoa, Juan; Gonzalez, Walter; Bautista, Ramon; DeCerce, John

    2008-10-01

    We designed a study, comparing the yield of standard 16-channel longitudinal bipolar montage (double banana) versus a combined 32-channel longitudinal bipolar plus average referential montage (banana-plus), to detect epileptic abnormalities. We selected 25 consecutive routine EEG samples with a diagnosis of spike or sharp waves in the temporal regions and 25 consecutive focal slowing and 50 normal EEGs. A total of 100 samples were printed in both montages and randomized for reading. Thirty independent EEG readers blinded from the EEG diagnosis were invited to participate. Twenty-two readers successfully completed the test for a total of 4400 answers collected for analysis. The average sensitivity to detect epileptiform discharges for 16 and 32-channel montages was 36.5% and 61%, respectively (Pdouble banana montage. Residents and EEG fellows could improve EEG-reading accuracy if taught on a combined 32-channel montage.

  17. Construction, expression, purification and biotin labeling of a single recombinant multi-epitope antigen for double-antigen sandwich ELISA to detect hepatitis C virus antibody.

    Science.gov (United States)

    He, Jing; Xiu, Bingshui; Wang, Guohua; Chen, Kun; Feng, Xiaoyan; Song, Xiaoguo; Zhu, Cuixia; Yang, Xiqin; Bai, Guanzhong; Ling, Shigan; Zhang, Heqiu

    2011-08-01

    Based on B cell epitope predictions, a recombinant antigen with multiple epitopes from four Hepatitis C Virus fragments (C, NS3, NS4 and NS5) were engineered. The recombinant gene was then highly expressed in E. coli. The non-modified and C-terminal-modified recombinant proteins were used for coating and biotin labeling, respectively, to establish the double-antigen sandwich ELISA. Ten positive reference samples confirmed by the CHIRON RIBA HCV 3.0 SIA kit were detected positive, Forty one plasma samples were positive among samples from 441 volunteers, which indicated that the recombinant antigen could readily react well with plasma HCV antibody. As critical reagents of double-antigen sandwich ELISA, the recombinant multi-epitope antigen and the C-terminal-modified and biotin-conjugated antigen show good antigenicity. In this study, we provide a simple approach to produce multiple epitopes within one recombinant protein in order to avoid the costly expression of less-effective pools of multiple proteins, which is the conventional strategy of diagnostic antigen production for HCV antibody detection.

  18. Neutrinoless ββ decay mediated by the exchange of light and heavy neutrinos: the role of nuclear structure correlations

    Science.gov (United States)

    Menéndez, J.

    2018-01-01

    Neutrinoless β β decay nuclear matrix elements calculated with the shell model and energy-density functional theory typically disagree by more than a factor of two in the standard scenario of light-neutrino exchange. In contrast, for a decay mediated by sterile heavy neutrinos the deviations are reduced to about 50%, an uncertainty similar to the one due to short-range effects. We compare matrix elements in the light- and heavy-neutrino-exchange channels, exploring the radial, momentum transfer and angular momentum-parity matrix element distributions, and considering transitions that involve correlated and uncorrelated nuclear states. We argue that the shorter-range heavy-neutrino exchange is less sensitive to collective nuclear correlations, and that discrepancies in matrix elements are mostly due to the treatment of long-range correlations in many-body calculations. Our analysis supports previous studies suggesting that isoscalar pairing correlations, which affect mostly the longer-range part of the neutrinoless β β decay operator, are partially responsible for the differences between nuclear matrix elements in the standard light-neutrino-exchange mechanism.

  19. A novel double staining strategy for improved detection of testicular carcinoma in situ cells in human semen samples

    DEFF Research Database (Denmark)

    Nielsen, J E; Kristensen, D M; Almstrup, K

    2012-01-01

    by immunohistochemistry or in situ hybridisation in urogenital epithelia, which may interfere with detection of CIS cells in semen. In addition to OCT3/4, the expression of AP-2¿ and NANOG or their variants was detected in urogenital epithelia, while other CIS markers, including PLAP/alkaline phosphatase were absent...... of CIS cells in semen. In conclusion, transcription factors related to pluripotency and undifferentiated state of cells, which most likely have several variants or modifications, are unexpectedly detected using currently available antibodies in urogenital epithelial cells which may be shed into semen...

  20. Direct detection of ligand binding to Sepharose-immobilised protein using saturation transfer double difference (STDD) NMR spectroscopy

    International Nuclear Information System (INIS)

    Haselhorst, Thomas; Muenster-Kuehnel, Anja K.; Oschlies, Melanie; Tiralongo, Joe; Gerardy-Schahn, Rita; Itzstein, Mark von

    2007-01-01

    We report an easy and direct application of 'Saturation Transfer Double Difference' (STDD) NMR spectroscopy to identify ligands that bind to a Sepharose-immobilised target protein. The model protein, cytidine 5'-monophosphate sialic acid (CMP-Sia) synthetase, was expressed as a Strep-Tag II fusion protein and immobilised on Strep-Tactin Sepharose. STD NMR experiments of the protein-enriched Sepharose matrix in the presence of a binding ligand (cytidine 5'-triphosphate, CTP) and a non-binding ligand (α/β-glucose) clearly show that CTP binds to the immobilised enzyme, whereas glucose has no affinity. This approach has three major advantages: (a) only low quantities of protein are required, (b) no specialised NMR technology or the application of additional data analysis by non-routine methods is required, and (c) easy multiple use of the immobilised protein is available

  1. A high-gain, low ion-backflow double micro-mesh gaseous structure for single electron detection

    Science.gov (United States)

    Zhang, Zhiyong; Qi, Binbin; Liu, Chengming; Feng, Jianxin; Liu, Jianbei; Shao, Ming; Zhou, Yi; Hong, Daojin; Lv, You; Song, Guofeng; Wang, Xu; You, Wenhao

    2018-05-01

    Application of micro-pattern gaseous detectors to gaseous photomultiplier tubes has been widely investigated over the past two decades. In this paper, we present a double micro-mesh gaseous structure that has been designed and fabricated for this application. Tests with X-rays and UV laser light indicate that this structure exhibits an excellent gas gain of > 7 × 104 and good energy resolution of 19% (full width at half maximum) for 5.9 keV X-rays. The gas gain can reach up to 106 for single electrons while maintaining a very low ion-backflow ratio down to 0.0005. This structure has good potential for other applications requiring a very low level of ion backflow.

  2. Anti-double stranded DNA antibodies in systemic lupus erythematosus : Detection and clinical relevance of IgM-class antibodies

    NARCIS (Netherlands)

    Bootsma, H; Spronk, PE; Hummel, EJ; deBoer, G; terBorg, EJ; Limburg, PC; Kallenberg, CGM

    1996-01-01

    We determined the discriminative value of the Farr assay in comparison to ELISA and Crithidia luciliae immunofluorescence assay (IFT) for detecting anti-dsDNA antibodies as a diagnostic tool for systemic lupus erythematosus (SLE). Special attention was paid to the diagnostic significance of

  3. Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines.

    Science.gov (United States)

    Gao, Zitong; Liu, Yang; Wang, Xiaoyue; Song, Jingyuan; Chen, Shilin; Ragupathy, Subramanyam; Han, Jianping; Newmaster, Steven G

    2017-07-19

    Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.

  4. Volume doubling time of lung cancer detected in idiopathic interstitial pneumonia. Comparison with that in chronic obstructive pulmonary disease

    International Nuclear Information System (INIS)

    Kim, Cherry; Lee, Sang Min; Choe, Jooae; Chae, Eun Jin; Do, Kyung-Hyun; Seo, Joon Beom

    2018-01-01

    To assess the volume doubling time (VDT) of lung cancers in IIP compared with COPD. A total of 61 patients (32 with IIP and 29 with COPD) were identified. A radiologist performed three-dimensional manual segmentation for lung cancers. VDTs were calculated and compared between two groups. Logistic regression was performed to identify factors associated with rapid tumour growth (VDT < 90 days). The median VDT of lung cancers in IIP (78.2 days) was significantly shorter than that in COPD (126.1 days; p=0.004). Squamous cell carcinoma (SqCC) was the most frequent subtype, followed by small cell lung cancer (SCLC) in IIP. In COPD, SqCC was the most frequent subtype, followed by adenocarcinoma. Rapid tumour growth was observed in 20 cancers from IIP, and in nine cancers from COPD (p=0.021). SCLC was significantly correlated with rapid tumour growth (p=0.038). Multivariate analysis revealed that the presence of IIP was the single independent predictor of rapid tumour growth (p = 0.016; odds ratio, 3.7). Lung cancers in IIP showed more rapid growth, with median VDT < 90 days. Therefore, a shorter follow-up interval (<90 days) may be necessary when CT surveillance is considered in IIP patients with suspected lung cancer. (orig.)

  5. Detecting DNA double-stranded breaks in mammalian genomes by linear amplification-mediated high-throughput genome-wide translocation sequencing.

    Science.gov (United States)

    Hu, Jiazhi; Meyers, Robin M; Dong, Junchao; Panchakshari, Rohit A; Alt, Frederick W; Frock, Richard L

    2016-05-01

    Unbiased, high-throughput assays for detecting and quantifying DNA double-stranded breaks (DSBs) across the genome in mammalian cells will facilitate basic studies of the mechanisms that generate and repair endogenous DSBs. They will also enable more applied studies, such as those to evaluate the on- and off-target activities of engineered nucleases. Here we describe a linear amplification-mediated high-throughput genome-wide sequencing (LAM-HTGTS) method for the detection of genome-wide 'prey' DSBs via their translocation in cultured mammalian cells to a fixed 'bait' DSB. Bait-prey junctions are cloned directly from isolated genomic DNA using LAM-PCR and unidirectionally ligated to bridge adapters; subsequent PCR steps amplify the single-stranded DNA junction library in preparation for Illumina Miseq paired-end sequencing. A custom bioinformatics pipeline identifies prey sequences that contribute to junctions and maps them across the genome. LAM-HTGTS differs from related approaches because it detects a wide range of broken end structures with nucleotide-level resolution. Familiarity with nucleic acid methods and next-generation sequencing analysis is necessary for library generation and data interpretation. LAM-HTGTS assays are sensitive, reproducible, relatively inexpensive, scalable and straightforward to implement with a turnaround time of <1 week.

  6. An Approach to Detect and Study DNA Double-Strand Break Repair by Transcript RNA Using a Spliced-Antisense RNA Template.

    Science.gov (United States)

    Keskin, Havva; Storici, Francesca

    2018-01-01

    A double-strand break (DSB) is one of the most dangerous DNA lesion, and its repair is crucial for genome stability. Homologous recombination is considered the safest way to repair a DNA DSB and requires an identical or nearly identical DNA template, such as a sister chromatid or a homologous chromosome for accurate repair. Can transcript RNA serve as donor template for DSB repair? Here, we describe an approach that we developed to detect and study DNA repair by transcript RNA. Key features of the method are: (i) use of antisense (noncoding) RNA as template for DSB repair by RNA, (ii) use of intron splicing to distinguish the sequence of the RNA template from that of the DNA that generates the RNA template, and (iii) use of a trans and cis system to study how RNA repairs a DSB in homologous but distant DNA or in its own DNA, respectively. This chapter provides details on how to use a spliced-antisense RNA template to detect and study DSB repair by RNA in trans or cis in yeast cells. Our approach for detection of DSB repair by RNA in cells can be applied to cell types other than yeast, such as bacteria, mammalian cells, or other eukaryotic cells. © 2018 Elsevier Inc. All rights reserved.

  7. Detection of brain metastasis. Comparison of Turbo-FLAIR imaging, T2-weighted imaging and double-dose gadolinium-enhanced MR imaging

    International Nuclear Information System (INIS)

    Okubo, Toshiyuki; Hayashi, Naoto; Shirouzu, Ichiro; Abe, Osamu; Ohtomo, Kuni; Sasaki, Yasuhito; Aoki, Shigeki; Wada, Akihiko

    1998-01-01

    The purpose of this study was to compare Turbo-FLAIR imaging, T 2 -weighted imaging, and double-dose gadolinium-enhanced MR imaging in the detection of brain metastasis. Using the three sequences, 20 consecutive patients with brain metastases were prospectively studied with a 1.5-Tesla system. Three independent, blinded readers assessed the images for the presence, size, number, and location of metastatic lesions. In the detection of large lesions (>0.5 cm), Turbo-FLAIR imaging (38/48, 79%) was not significantly different from gadolinium-enhanced imaging (42/48, 88%) (p=0.273). T 2 -weighted imaging (31/48, 65%), however, was inferior to gadolinium-enhanced imaging (p<0.05). There was no difference between Turbo-FLAIR imaging and gadolinium-enhanced imaging in the accuracy of detecting solitary brain metastasis (4/4, 100%). In conclusion, Turbo-FLAIR imaging is a useful, noninvasive screening modality for brain metastasis. Its use may lead to cost savings in the diagnosis of brain metastases and may impact positively the cost-effectiveness of treatment. (author)

  8. Detecting cm-scale hot spot over 24-km-long single-mode fiber by using differential pulse pair BOTDA based on double-peak spectrum.

    Science.gov (United States)

    Diakaridia, Sanogo; Pan, Yue; Xu, Pengbai; Zhou, Dengwang; Wang, Benzhang; Teng, Lei; Lu, Zhiwei; Ba, Dexin; Dong, Yongkang

    2017-07-24

    In distributed Brillouin optical fiber sensor when the length of the perturbation to be detected is much smaller than the spatial resolution that is defined by the pulse width, the measured Brillouin gain spectrum (BGS) experiences two or multiple peaks. In this work, we propose and demonstrate a technique using differential pulse pair Brillouin optical time-domain analysis (DPP-BOTDA) based on double-peak BGS to enhance small-scale events detection capability, where two types of single mode fiber (main fiber and secondary fiber) with 116 MHz Brillouin frequency shift (BFS) difference have been used. We have realized detection of a 5-cm hot spot at the far end of 24-km single mode fiber by employing a 50-cm spatial resolution DPP-BOTDA with only 1GS/s sampling rate (corresponding to 10 cm/point). The BFS at the far end of 24-km sensing fiber has been measured with 0.54 MHz standard deviation which corresponds to a 0.5°C temperature accuracy. This technique is simple and cost effective because it is implemented using the similar experimental setup of the standard BOTDA, however, it should be noted that the consecutive small-scale events have to be separated by a minimum length corresponding to the spatial resolution defined by the pulse width difference.

  9. One-step enrichment and chemiluminescence detection of sodium dodecyl benzene sulfonate in river water using Mg-Al-carbonate layered double hydroxides.

    Science.gov (United States)

    Guan, Weijiang; Zhou, Wenjuan; Han, Dongmei; Zhang, Mengchun; Lu, Chao; Lin, Jin-Ming

    2014-03-01

    In this work, Mg-Al CO3-layered double hydroxides (LDHs) were used as adsorbent materials for sodium dodecyl benzene sulfonate (SDBS) in aqueous solutions, the enriched SDBS can be directly detected by IO4(-)-H2O2 chemiluminescence (CL) system. The commonly existing cations cannot be enriched by Mg-Al CO3-LDHs due to the structurally positively charged layers of LDHs, while other adsorbed anionic interferents had no effect on the IO4(-)-H2O2 CL reaction. The corresponding linear regression equation was established in the range of 0.1-10 μM for SDBS. The detection limit at a signal-to-noise (S/N) ratio of 3 for SDBS was 0.08 μM. The relative standard deviation (RSD) for nine repeated measurements of 0.5 μM SDBS was 2.6%. This proposed method has been successfully applied to the determination of SDBS in river water samples. To the best of our knowledge, we have first time coupled the high enrichment capacity of LDHs towards anions with CL detection for analytes. Copyright © 2013 Elsevier B.V. All rights reserved.

  10. Electrochemical sensor based on EDTA intercalated into layered double hydroxides of magnesium and aluminum for ultra trace level detection of lead (II)

    International Nuclear Information System (INIS)

    Dong, Junping; Fang, Qinghua; He, Haibo; Xu, Jiaqiang; Zhang, Yuan; Sun, Youbao

    2015-01-01

    The chelator ethylene diaminetetraacetate (EDTA) has been intercalated into layered double hydroxides by the anion exchange method. The resulting composites were characterized by powder X-ray diffraction, FTIR spectroscopy, thermogravimetry and X-ray photoelectron spectrometry. They were applied to modify a carbon paste electrode for the stripping voltammetric determination of lead (II) ions at ng L −1 levels. Stripping currents are linearly related to the logarithm of Pb (II) concentrations from 2 ng L −1 to 33 μg L −1 . The detection limit (3σ) is as low as 0.95 ng L −1 . The method was successfully applied to the determination of Pb (II) in spiked tap water without any pretreatment.(author)

  11. Development of Voltammetric Double-Polymer-Modified Electrodes for Nanomolar Ion Detection for Environmental and Biological Applications

    Science.gov (United States)

    Kim, Yushin

    Qualitative and quantitative electrochemical methods for trace ion analysis of organic and inorganic species with environmental and biological attention have been developed and reported during past decades. The development of fast and accurate electrochemical methods is critical for field applications with various blocking contaminants. Voltammetric method is attractive not only to analyze selective ion species due to its characteristic based on ion lipophilicity, but also to lower the limit of detection by combining with stripping analysis. In my PhD work, I have developed and studied a highly selective and sensitive electrochemical method that can be used to characterize fundamental transport dynamics and to develop electrochemical sensors at liquid/liquid interfaces based on electrochemically-controlled ion transfer and recognition. The understanding of the kinetic and thermodynamic properties of the voltammetric ion transfer through polymer-modified ion-selective electrodes leads to realize the highly selective and sensitive analytical method. The ultrathin polymer membrane is used to maximize a current response by complete exhaustion of preconcentrated ions. Therefore, nanomolar detection is achieved and confirmed by a thermodynamic mechanism that controls the detection limit. It was also demonstrated experimentally and theoretically that more lipophilic ionic species gives a significantly lower detection limit. The voltammetric method was expanded into inexpensive and disposable applications based on pencil lead modified with the thin polymer membrane. In the other hand, micropipet/nanopipet voltammetry as an artificial cell membrane was used to study the interface between two immiscible solutions for environmental and biomedical applications. It is very useful to get quantitative kinetic and thermodynamic information by studying numerical simulations of ion transfer and diffusion. Molecular recognition and transport of heparin and low

  12. Streptavidin-biotin-based directional double Nanobody sandwich ELISA for clinical rapid and sensitive detection of influenza H5N1.

    Science.gov (United States)

    Zhu, Min; Gong, Xue; Hu, Yonghong; Ou, Weijun; Wan, Yakun

    2014-12-20

    Influenza H5N1 is one subtype of the influenza A virus which can infect human bodies and lead to death. Timely diagnosis before its breakout is vital to the human health. The current clinical biochemical diagnosis for influenza virus are still flawed, and the diagnostic kits of H5N1 are mainly based on traditional monoclonal antibodies that hardly meet the requirements for clinical applications. Nanobody is a promising tool for diagnostics and treatment due to its smallest size, high specificity and stability. In this study, a novel Nanobody-based bioassay was developed for rapid, low-cost and sensitive detection of the influenza H5N1 virus. Nanobodies specific to H5N1 virus were selected from a VHH library by phage display technology. In this system, the biotinylated Nanobody was directionally captured by streptavidin coated on ELISA plate, which can specifically capture the H5N1 virus. Another Nanobody conjugated with HRP was used as a detector. A novel directional enzyme-linked immunosorbent assay for H5N1 using specific Nanobodies was established and compared to the conventional undirected ELISA assay. We have successfully constructed a high quality phage display Nanobody library and isolated two Nanobodies against H5N1 with high affinity and specificity. These two Nanobodies were further used to prepare the biosensor detection system. This streptavidin-biotin-based directional double Nanobodies sandwich ELISA for H5N1 detection showed superiority over the commonly undirectional ELISA protocol. The linear range of detection for standards in this immunoassay was approximately 50-1000 ng/mL and the detection limit was 14.1 ng/mL. The average recoveries of H5N1 virus from human serum samples were in the range from 94.58% to 114.51%, with a coefficient of variation less than 6.5%. Collectively, these results demonstrated that the proposed detection system is an alternative diagnostic tool that enables a rapid, inexpensive, sensitive and specific detection of the

  13. Double resonance long period fiber grating for detection of E. coli in trace concentration by choosing a proper bacteriophage

    Science.gov (United States)

    Chiniforooshan, Y.; Celebanska, A.; Janik, M.; Mikulic, P.; Haddad, F.; Perreault, J.; Bock, W. J.

    2017-04-01

    There is a critical need of a fast, specific and reliable assay for biological species. To address this need, long period fiber gratings (LPFG) among other fiber optic sensors can be used because of their high sensitivity to changes in surrounding medium. In this work we fabricated and used two over-etched LPFGs. One of them was covered with T4 Phage and the other was covered with MS2 phage that both specifically bind with Escherichia coli (E. coli) bacteria. This bacterium is a major cause of the food contaminations and outbreaks. We showed achieving a highest sensitivity region of the LPFG and the way to fine tune to that region by over-etching the grating. Finally, using the highly sensitive LPFG platform we could detect E. coli at concentrations as low as 100 colony forming units (CFU), by covering the LPFG with an optimized bio-functionalization of the fiber surface with MS2 bacteriophage.

  14. Double positive effect of adding hexaethyelene glycol when optimizing the hybridization efficiency of a microring DNA detection assay

    Energy Technology Data Exchange (ETDEWEB)

    Van Eeghem, Anabelle, E-mail: anabelle.vaneeghem@gmail.com [Polymer Chemistry and Biomaterials Research Group, Department of Organic and Macromolecular Chemistry, Ghent University (Belgium); Center for Nano- and Biophotonics, Ghent University (Belgium); Werquin, Sam [Center for Nano- and Biophotonics, Ghent University (Belgium); Photonics Research Group, Department of Information Technology, Ghent University – IMEC (Belgium); Hoste, Jan-Willem, E-mail: janwillem.hoste@ugent.be [Center for Nano- and Biophotonics, Ghent University (Belgium); Photonics Research Group, Department of Information Technology, Ghent University – IMEC (Belgium); Goes, Arne [Polymer Chemistry and Biomaterials Research Group, Department of Organic and Macromolecular Chemistry, Ghent University (Belgium); Agrosavfe NV, Technologiepark 4 (Bio-incubator), Zwijnaarde (Belgium); Vanderleyden, Els [Polymer Chemistry and Biomaterials Research Group, Department of Organic and Macromolecular Chemistry, Ghent University (Belgium); Center for Nano- and Biophotonics, Ghent University (Belgium); Bienstman, Peter [Center for Nano- and Biophotonics, Ghent University (Belgium); Photonics Research Group, Department of Information Technology, Ghent University – IMEC (Belgium); Dubruel, Peter [Polymer Chemistry and Biomaterials Research Group, Department of Organic and Macromolecular Chemistry, Ghent University (Belgium); Center for Nano- and Biophotonics, Ghent University (Belgium)

    2017-05-31

    Highlights: • The hybridization efficiency of a DNA assay was investigated based on SOI microring resonators. • A 4-fold increase in efficiency was obtained by using HEG as backfilling agent, as well as improving robustness. • The dual polarization microring technique shows that HEG reorients the DNA in an upright position. • Hybridizing at 35 °C and with a buffer containing 50 v/v% of formamide greatly improves the robustness. - Abstract: In this paper, a method for detection of DNA molecules using silicon-on-insulator (SOI) microring resonators is described. The influence of temperature and the use of formamide on the hybridization efficiency were studied. It was shown that 50 v/v% of formamide in the hybridization buffer can ensure hybridization when working close to physiological temperature. Furthermore, the use of hexaethylene glycol (HEG) as backfilling agent was studied in order to resolve issues of non-specific adsorption to the surface. The results indicated that not only non-specific binding was reduced significantly but also that HEG improves the orientation of the DNA probes on the surface. This led to a 4-fold increase in hybridization efficiency and thus in an equal decrease in the detection limit, compared to hybridization without the use of HEG. An improvement in robustness of the assay was also observed. This DNA reorientation hypothesis was confirmed by studying the thickness and density of the layers by using dual polarization microring sensing. Finally, the different steps in the sensing experiment were characterized in more detail by static contact angle (SCA) and X-ray photoelectron spectroscopy (XPS) analysis. The results showed quantitatively that the surface modifications were successful.

  15. Searches for double beta decay of Xe134 with EXO-200

    Energy Technology Data Exchange (ETDEWEB)

    Albert, J. B.; Anton, G.; Badhrees, I.; Barbeau, P. S.; Bayerlein, R.; Beck, D.; Belov, V.; Breidenbach, M.; Brunner, T.; Cao, G. F.; Cen, W. R.; Chambers, C.; Cleveland, B.; Coon, M.; Craycraft, A.; Cree, W.; Daniels, T.; Danilov, M.; Daugherty, S. J.; Daughhetee, J.; Davis, J.; Delaquis, S.; Der Mesrobian-Kabakian, A.; DeVoe, R.; Didberidze, T.; Dilling, J.; Dolgolenko, A.; Dolinski, M. J.; Fairbank, W.; Farine, J.; Feyzbakhsh, S.; Fierlinger, P.; Fudenberg, D.; Gornea, R.; Graham, K.; Gratta, G.; Hall, C.; Hoessl, J.; Hufschmidt, P.; Hughes, M.; Jamil, A.; Jewell, M. J.; Johnson, A.; Johnston, S.; Karelin, A.; Kaufman, L. J.; Koffas, T.; Kravitz, S.; Krücken, R.; Kuchenkov, A.; Kumar, K. S.; Lan, Y.; Leonard, D. S.; Li, S.; Licciardi, C.; Lin, Y. H.; MacLellan, R.; Marino, M. G.; Michel, T.; Mong, B.; Moore, D.; Murray, K.; Nelson, R.; Njoya, O.; Odian, A.; Ostrovskiy, I.; Piepke, A.; Pocar, A.; Retière, F.; Rowson, P. C.; Russell, J. J.; Schubert, A.; Sinclair, D.; Smith, E.; Stekhanov, V.; Tarka, M.; Tolba, T.; Tsang, R.; Vogel, P.; Vuilleumier, J. -L.; Wagenpfeil, M.; Waite, A.; Walton, J.; Walton, T.; Weber, M.; Wen, L. J.; Wichoski, U.; Yang, L.; Yen, Y. -R.; Zeldovich, O. Ya.; Zettlemoyer, J.; Ziegler, T.

    2017-11-01

    Searches for double beta decay of 134Xe were performed with EXO-200, a single-phase liquid xenon detector designed to search for neutrinoless double beta decay of 136Xe. Using an exposure of 29.6 kg · yr, the lower limits of T2νββ 1=2 > 8.7 × 1020 yr and T0νββ 1=2 > 1.1 × 1023 yr at 90% confidence level were derived, with corresponding half-life sensitivities of 1.2 × 1021 yr and 1.9 × 1023 yr. These limits exceed those in the literature for 134Xe, improving by factors of nearly 105 and 2 for the two antineutrino and neutrinoless modes, respectively.

  16. Temperature and electrolyte optimization of the α-hemolysin latch sensing zone for detection of base modification in double-stranded DNA.

    Science.gov (United States)

    Johnson, Robert P; Fleming, Aaron M; Jin, Qian; Burrows, Cynthia J; White, Henry S

    2014-08-19

    The latch region of the wild-type protein pore α-hemolysin (α-HL) constitutes a sensing zone for individual abasic sites (and furan analogs) in double-stranded DNA (dsDNA). The presence of an abasic site or furan within a DNA duplex, electrophoretically captured in the α-HL vestibule and positioned at the latch region, can be detected based on the current blockage prior to duplex unzipping. We investigated variations in blockage current as a function of temperature (12-35°C) and KCl concentration (0.15-1.0 M) to understand the origin of the current signature and to optimize conditions for identifying the base modification. In 1 M KCl solution, substitution of a furan for a cytosine base in the latch region results in an ∼ 8 kJ mol(-1) decrease in the activation energy for ion transport through the protein pore. This corresponds to a readily measured ∼ 2 pA increase in current at room temperature. Optimal resolution for detecting the presence of a furan in the latch region is achieved at lower KCl concentrations, where the noise in the measured blockage current is significantly lower. The noise associated with the blockage current also depends on the stability of the duplex (as measured from the melting temperature), where a greater noise in the measured blockage current is observed for less stable duplexes. Copyright © 2014 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  17. Selective extraction by dissolvable (nitriloacetic acid-nickel)-layered double hydroxide coupled with reaction with potassium thiocyanate for sensitive detection of iron(III).

    Science.gov (United States)

    Tang, Sheng; Chang, Yuepeng; Shen, Wei; Lee, Hian Kee

    2016-07-01

    A highly selective method has been proposed for the determination of iron cation (Fe(3+)). (Nitriloacetic acid-nickel)-layered double hydroxide ((NTA-Ni)-LDH) was successfully synthesized and used as dissolvable sorbent in dispersive solid-phase extraction to pre-concentrate and separate Fe(3+) from aqueous phase. Since Fe(3+) has a larger formation constant with NTA compared to Ni(2+), subsequently ion exchange occurred when (NTA-Ni)-LDH was added to the sample solution. The resultant (NTA-Fe)-LDH sol was isolated and transferred in an acidic medium containing potassium thiocyanate (KSCN). Since (NTA-Fe)-LDH could be dissolved in acidic conditions, Fe(3+)was released and reacted with SCN(-) to form an Fe-SCN complex. The resulting product was measured by ultraviolet-visible spectrometry for quantitative detection of Fe(3+). Extraction factors, including sample pH, reaction pH, extraction temperature, extraction time, reaction time and concentration of KSCN were optimized. This method achieved a low limit of detection of 15.2nM and a good linear range from 0.05 to 50μM (r(2)=0.9937). A nearly 18-fold enhancement of signal intensity was achieved after selective extraction. The optimized conditions were validated by applying the method to determine Fe(3+) in seawater samples. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Prospective study aiming to compare 2D mammography and tomosynthesis + synthesized mammography in terms of cancer detection and recall. From double reading of 2D mammography to single reading of tomosynthesis.

    Science.gov (United States)

    Romero Martín, Sara; Raya Povedano, Jose Luis; Cara García, María; Santos Romero, Ana Luz; Pedrosa Garriguet, Margarita; Álvarez Benito, Marina

    2018-06-01

    To evaluate tomosynthesis compared with 2D-mammography in cancer detection and recalls in a screening-programme, and assess performing synthesized instead of 2D, and compare double reading of 2D with single reading of tomosynthesis. Women (age 50-69 years) participating in the screening-programme were included. 2D-mammography and tomosynthesis were performed. There were four reading models: 2D-mammography (first); 2D-mammography (second); tomosynthesis + synthesized (third); tomosynthesis + synthesized + 2D (fourth reading). Paired double reading of 2D (first+second) and tomosynthesis (third+fourth) were analysed. In 16,067 participants, there were 98 cancers and 1,196 recalls. Comparing double reading of 2D with single reading of tomosynthesis, there was an increase of 12.6 % in cancer detection with the third reading (p= 0.043) and 6.9 % with the fourth reading (p=0.210), and a decrease in recalls of 40.5 % (ptomosynthesis. Single reading of tomosynthesis plus synthesized increased cancer detection and decreased recalls compared with double reading 2D. 2D did not improve results when added to tomosynthesis. • Tomosynthesis increases cancer detection and decreases recall rates versus 2D mammography. • Synthesized-mammography avoids performing 2D, showing higher cancer detection. • Single reading of tomosynthesis + synthesized is feasible as a new practice.

  19. Observation of strongly forbidden solid effect dynamic nuclear polarization transitions via electron-electron double resonance detected NMR

    Energy Technology Data Exchange (ETDEWEB)

    Smith, Albert A.; Corzilius, Björn; Haze, Olesya; Swager, Timothy M.; Griffin, Robert G., E-mail: rgg@mit.edu [Department of Chemistry and Francis Bitter Magnet Laboratory, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139 (United States)

    2013-12-07

    We present electron paramagnetic resonance experiments for which solid effect dynamic nuclear polarization transitions were observed indirectly via polarization loss on the electron. This use of indirect observation allows characterization of the dynamic nuclear polarization (DNP) process close to the electron. Frequency profiles of the electron-detected solid effect obtained using trityl radical showed intense saturation of the electron at the usual solid effect condition, which involves a single electron and nucleus. However, higher order solid effect transitions involving two, three, or four nuclei were also observed with surprising intensity, although these transitions did not lead to bulk nuclear polarization—suggesting that higher order transitions are important primarily in the transfer of polarization to nuclei nearby the electron. Similar results were obtained for the SA-BDPA radical where strong electron-nuclear couplings produced splittings in the spectrum of the indirectly observed solid effect conditions. Observation of high order solid effect transitions supports recent studies of the solid effect, and suggests that a multi-spin solid effect mechanism may play a major role in polarization transfer via DNP.

  20. Does computer-aided detection have a role in the arbitration of discordant double-reading opinions in a breast-screening programme?

    International Nuclear Information System (INIS)

    James, J.J.; Cornford, E.J.

    2009-01-01

    Aims: To investigate whether a computer-aided detection (CAD) system could act as an arbitrator of discordant double-reading opinions, replacing the need for an independent third film reader. Methods: The mammograms of the 240 women that underwent arbitration by an independent third reader were identified from the 16,629 women attending our screening centre between July 2003 and April 2004. Mammograms of the arbitration cases were digitized and analysed by a CAD system. To assess the ability of CAD to act as the arbitrator, the site of the CAD prompts was retrospectively compared to the site of any abnormality noted by the original film readers. If a CAD prompt was placed on a region marked by one of the film readers then the decision of CAD as the arbitrator was that the women should be recalled for further assessment. If no mark was placed then the region was considered low risk and the decision was not to recall. The decision of CAD as the arbitrator was retrospectively compared with the original recall decision of the independent third reader. Results: There were 21 cancer cases in the group of women undergoing arbitration, diagnosed both at the original screening episode and subsequently. The independent third reader recalled 15/18 (83%) of the cancers that corresponded with the arbitrated lesion. CAD as the arbitrator would have recalled 16/18 (89%) of the cancers that corresponded to the arbitrated lesion. CAD acting as the arbitrator would have resulted in a significant increase in normal women being recalled to assessment in the arbitration group (P < 0.001). The extra 50 recalls would have potentially increased the overall recall rate to assessment from 3.1 to 3.4%; a relative increase of 10%. Conclusions: The main effect of CAD acting as an arbitrator of discordant double-reading opinions is to increase the recall rate, significantly above what is found when arbitration is performed by an independent third reader. Using CAD as an arbitrator may be an

  1. Attention Measures of Accuracy, Variability, and Fatigue Detect Early Response to Donepezil in Alzheimer's Disease: A Randomized, Double-blind, Placebo-Controlled Pilot Trial.

    Science.gov (United States)

    Vila-Castelar, Clara; Ly, Jenny J; Kaplan, Lillian; Van Dyk, Kathleen; Berger, Jeffrey T; Macina, Lucy O; Stewart, Jennifer L; Foldi, Nancy S

    2018-04-09

    Donepezil is widely used to treat Alzheimer's disease (AD), but detecting early response remains challenging for clinicians. Acetylcholine is known to directly modulate attention, particularly under high cognitive conditions, but no studies to date test whether measures of attention under high load can detect early effects of donepezil. We hypothesized that load-dependent attention tasks are sensitive to short-term treatment effects of donepezil, while global and other domain-specific cognitive measures are not. This longitudinal, randomized, double-blind, placebo-controlled pilot trial (ClinicalTrials.gov Identifier: NCT03073876) evaluated 23 participants newly diagnosed with AD initiating de novo donepezil treatment (5 mg). After baseline assessment, participants were randomized into Drug (n = 12) or Placebo (n = 11) groups, and retested after approximately 6 weeks. Cognitive assessment included: (a) attention tasks (Foreperiod Effect, Attentional Blink, and Covert Orienting tasks) measuring processing speed, top-down accuracy, orienting, intra-individual variability, and fatigue; (b) global measures (Alzheimer's Disease Assessment Scale-Cognitive Subscale, Mini-Mental Status Examination, Dementia Rating Scale); and (c) domain-specific measures (memory, language, visuospatial, and executive function). The Drug but not the Placebo group showed benefits of treatment at high-load measures by preserving top-down accuracy, improving intra-individual variability, and averting fatigue. In contrast, other global or cognitive domain-specific measures could not detect treatment effects over the same treatment interval. The pilot-study suggests that attention measures targeting accuracy, variability, and fatigue under high-load conditions could be sensitive to short-term cholinergic treatment. Given the central role of acetylcholine in attentional function, load-dependent attentional measures may be valuable cognitive markers of early treatment response.

  2. Double beta decay in gauge theories

    International Nuclear Information System (INIS)

    Vergados, J.D.

    2002-01-01

    Neutrinoless double beta decay is a very important process both from the particle and nuclear physics point of view. From the elementary particle point of view it pops up in almost every model, giving rise among others to the following mechanisms: a) The traditional contributions like the light neutrino mass mechanism as well as the j L - j R leptonic interference (λ and η terms). b) The exotic R-parity violating supersymmetric (SUSY) contributions. From the nuclear physics point of view it is challenging, because: 1) The nuclei, which can undergo double beta decay, have complicated nuclear structure. 2) The energetically allowed transitions are suppressed (exhaust a small part of all the strength). 3) Since in some mechanisms the intermediate particles are very heavy one must cope with the short distance behavior of the transition operators. 4) The intermediate momenta involved are quite high and one has to consider momentum dependent terms of the nucleon current. Taking the above effects into account from the experimental limits on the interesting nuclei A=76, 82, 96, 100, 116, 128, 130, 136 and 150, we have extracted new limits on the various lepton violating parameters. In particular we get a stringent limit on the R-parity violating parameter λ' 111 -4 . (author)

  3. Phenotypic detection of the cfiA metallo-β-lactamase in Bacteroides fragilis with the meropenem-EDTA double-ended Etest and the ROSCO KPC/MBL Confirm Kit

    DEFF Research Database (Denmark)

    Ferløv-Schwensen, Simon Andreas; Acar, Ziyap; Sydenham, Thomas V

    2017-01-01

    OBJECTIVES: To investigate the performance of the meropenem and imipenem double-ended Etest ± EDTA and the tablet-based (meropenem and meropenem + dipicolinic acid) KPC/MBL Confirm Kit to detect cfiA metallo-β-lactamase (MBL) in Bacteroides fragilis. METHODS: Well-characterized B. fragilis isolates...

  4. New limit for the half-life of double beta decay of {sup 94}Zr to the first excited state of {sup 94}Mo

    Energy Technology Data Exchange (ETDEWEB)

    Dokania, N.; Nanal, V.; Gupta, G.; Pillay, R.G.; Ghosh, C. [Tata Institute of Fundamental Research, Department of Nuclear and Atomic Physics, Mumbai (India); Pal, S. [Tata Institute of Fundamental Research, Pelletron Linac Facility, Mumbai (India); Rath, P.K. [University of Lucknow, Department of Physics, Lucknow (India); Tretyak, V.I. [Institute for Nuclear Research, Kyiv (Ukraine); Garai, A.; Krishnamoorthy, H. [Tata Institute of Fundamental Research, India-based Neutrino Observatory, Mumbai (India); Homi Bhabha National Institute, Mumbai (India); Raina, P.K. [Indian Institute of Technology, Department of Physics, Rupnagar (India); Bhushan, K.G. [Bhabha Atomic Research Centre, Technical Physics Division, Mumbai (India)

    2017-04-15

    Neutrinoless double beta decay is a phenomenon of fundamental interest in particle physics. The decay rates of double beta decay transitions to the excited states can provide input for Nuclear Transition Matrix Element calculations for the relevant two neutrino double beta decay process. It can be useful as supplementary information for the calculation of Nuclear Transition Matrix Element for the neutrinoless double beta decay process. In the present work, double beta decay of {sup 94}Zr to the 2{sup +}{sub 1} excited state of {sup 94}Mo at 871.1 keV is studied using a low background ∝ 230 cm{sup 3} HPGe detector. No evidence of this decay was found with a 232 g.y exposure of natural zirconium. The lower half-life limit obtained for the double beta decay of {sup 94}Zr to the 2{sup +}{sub 1} excited state of {sup 94}Mo is T{sub 1/2}(0ν + 2ν) > 3.4 x 10{sup 19} y at 90% C.L., an improvement by a factor of ∝ 4 over the existing experimental limit at 90% C.L. The sensitivity is estimated to be T{sub 1/2} (0ν + 2ν) > 2.0 x 10{sup 19} y at 90% C.L. using the Feldman-Cousins method. (orig.)

  5. Double Beta Decay Experiments: Present Status and Prospects for the Future

    Science.gov (United States)

    Barabash, A. S.

    The review of modern experiments on search and studying of double beta decay processes is done. Results of the most sensitive current experiments are discussed. The main attention is paid to EXO-200, KamLAND-Zen, GERDA-I and CUORE-0 experiments. Modern values of T1/2(2ν) and best present limits on neutrinoless double beta decay and double beta decay with Majoron emission are presented. Conservative limits on effective mass of a Majorana neutrino ( at the level of ˜ (0.01-0.1) eV are discussed. The main attention is paid to experiments of CUORE, GERDA, MAJORANA, EXO, KamLAND-Zen-2, SuperNEMO and SNO+. Possibilities of low-temperature scintillating bolometers on the basis of inorganic crystals (ZnSe, ZnMoO4, Li2MoO4, CaMoO4 and CdWO4) are considered too.

  6. Q values of the 76Ge and 100Mo double-beta decays

    International Nuclear Information System (INIS)

    Rahaman, S.; Elomaa, V.-V.; Eronen, T.; Hakala, J.; Jokinen, A.; Julin, J.; Kankainen, A.; Saastamoinen, A.; Suhonen, J.; Weber, C.; Aystoe, J.

    2008-01-01

    Penning trap measurements using mixed beams of 76 Ge- 76 Se and 100 Mo- 100 Ru have been utilized to determine the double-beta decay Q-values of 76 Ge and 100 Mo with uncertainties less than 200 eV. The value for 76 Ge, 2039.04(16) keV is in agreement with the published SMILETRAP value, 2039.006(50) keV. The new value for 100 Mo, 3034.40(17) keV is 30 times more precise than the previous literature value, sufficient for the ongoing neutrinoless double-beta decay searches in 100 Mo. Moreover, the precise Q-value is used to calculate the phase-space integrals and the experimental nuclear matrix element of double-beta decay

  7. An experimental investigation of double beta decay of 100Mo

    International Nuclear Information System (INIS)

    Dougherty, B.L.

    1988-01-01

    New limits on half-lives for several double beta decay modes of 100 Mo were obtained with a novel experimental system which included thin source films interleaved with a coaxial array of windowless silicon detectors. Segmentation and timing information allowed backgrounds originating in the films to be studied in some detail. Dummy films containing 96 Mo were used to assess remaining backgrounds. With 0.1 mole years of 100 Mo data collected, the lower half-life limits at 90% confidence were 2.7 /times/ 10 18 years for decay via the two-neutrino mode, 5.2 /times/10 19 years for decay with the emission of a Majoron, and 1.6 /times/ 10 20 years and 2.2 /times/ 10 21 years for neutrinoless 0 + → 2 + and 0 + → 0 + transitions, respectively. 50 refs., 38 figs., 11 tabs

  8. Scalar-mediated double beta decay and LHC

    Energy Technology Data Exchange (ETDEWEB)

    Gonzalez, L. [Universidad Técnica Federico Santa María, Centro-Científico-Tecnológico de Valparaíso,Casilla 110-V, Valparaíso (Chile); Helo, J.C. [Universidad Técnica Federico Santa María, Centro-Científico-Tecnológico de Valparaíso,Casilla 110-V, Valparaíso (Chile); Departamento de Física, Facultad de Ciencias, Universidad de La Serena,Avenida Cisternas 1200, La Serena (Chile); Hirsch, M. [AHEP Group, Instituto de Física Corpuscular - C.S.I.C./Universitat de València,Edificio de Institutos de Paterna, Apartado 22085, E-46071 València (Spain); Kovalenko, S.G. [Universidad Técnica Federico Santa María, Centro-Científico-Tecnológico de Valparaíso,Casilla 110-V, Valparaíso (Chile)

    2016-12-23

    The decay rate of neutrinoless double beta (0νββ) decay could be dominated by Lepton Number Violating (LNV) short-range diagrams involving only heavy scalar intermediate particles, known as “topology-II” diagrams. Examples are diagrams with diquarks, leptoquarks or charged scalars. Here, we compare the LNV discovery potentials of the LHC and 0νββ-decay experiments, resorting to three example models, which cover the range of the optimistic-pessimistic cases for 0νββ decay. We use the LHC constraints from dijet as well as leptoquark searches and find that already with 20/fb the LHC will test interesting parts of the parameter space of these models, not excluded by the current limits on 0νββ-decay.

  9. Scalar-mediated double beta decay and LHC

    International Nuclear Information System (INIS)

    Gonzalez, L.; Helo, J.C.; Hirsch, M.; Kovalenko, S.G.

    2016-01-01

    The decay rate of neutrinoless double beta (0νββ) decay could be dominated by Lepton Number Violating (LNV) short-range diagrams involving only heavy scalar intermediate particles, known as “topology-II” diagrams. Examples are diagrams with diquarks, leptoquarks or charged scalars. Here, we compare the LNV discovery potentials of the LHC and 0νββ-decay experiments, resorting to three example models, which cover the range of the optimistic-pessimistic cases for 0νββ decay. We use the LHC constraints from dijet as well as leptoquark searches and find that already with 20/fb the LHC will test interesting parts of the parameter space of these models, not excluded by the current limits on 0νββ-decay.

  10. Magnetoencephalography for the Detection of Intervention Effects of a Specific Nutrient Combination in Patients with Mild Alzheimer's Disease: Results from an Exploratory Double-Blind, Randomized, Controlled Study.

    Science.gov (United States)

    van Straaten, Elisabeth C W; de Waal, Hanneke; Lansbergen, Marieke M; Scheltens, Philip; Maestu, Fernando; Nowak, Rafal; Hillebrand, Arjan; Stam, Cornelis J

    2016-01-01

    Synaptic loss is an early pathological finding in Alzheimer's disease (AD) and correlates with memory impairment. Changes in macroscopic brain activity measured with electro- and magnetoencephalography (EEG and MEG) in AD indicate synaptic changes and may therefore serve as markers of intervention effects in clinical trials. EEG peak frequency and functional networks have shown, in addition to improved memory performance, to be sensitive to detect an intervention effect in mild AD patients of the medical food Souvenaid containing the specific nutrient combination Fortasyn ® Connect, which is designed to enhance synapse formation and function. Here, we explore the value of MEG, with higher spatial resolution than EEG, in identifying intervention effects of the nutrient combination by comparing MEG spectral measures, functional connectivity, and networks between an intervention and a control group. Quantitative markers describing spectral properties, functional connectivity, and graph theoretical aspects of MEG from the exploratory 24-week, double-blind, randomized, controlled Souvenir II MEG sub-study (NTR1975, http://www.trialregister.nl) in drug naïve patients with mild AD were compared between a test group ( n  = 27), receiving Souvenaid, and a control group ( n  = 28), receiving an isocaloric control product. The groups were unbalanced at screening with respect to Mini-Mental State Examination. Peak frequencies of MEG were compared with EEG peak frequencies, recorded in the same patients at similar time points, were compared with respect to sensitivity to intervention effects. No consistent statistically significant intervention effects were detected. In addition, we found no difference in sensitivity between MEG and EEG peak frequency. This exploratory study could not unequivocally establish the value of MEG in detecting interventional effects on brain activity, possibly due to small sample size and unbalanced study groups. We found no indication that

  11. Reliability of cortical lesion detection on double inversion recovery MRI applying the MAGNIMS-Criteria in multiple sclerosis patients within a 16-months period.

    Directory of Open Access Journals (Sweden)

    Tobias Djamsched Faizy

    Full Text Available In patients with multiple sclerosis (MS, Double Inversion Recovery (DIR magnetic resonance imaging (MRI can be used to identify cortical lesions (CL. We sought to evaluate the reliability of CL detection on DIR longitudinally at multiple subsequent time-points applying the MAGNIMs scoring criteria for CLs.26 MS patients received a 3T-MRI (Siemens, Skyra with DIR at 12 time-points (TP within a 16 months period. Scans were assessed in random order by two different raters. Both raters separately marked all CLs on each scan and total lesion numbers were obtained for each scan-TP and patient. After a retrospective re-evaluation, the number of consensus CLs (conL was defined as the total number of CLs, which both raters finally agreed on. CLs volumes, relative signal intensities and CLs localizations were determined. Both ratings (conL vs. non-consensus scoring were compared for further analysis.A total number of n = 334 CLs were identified by both raters in 26 MS patients with a first agreement of both raters on 160 out of 334 of the CLs found (κ = 0.48. After the retrospective re-evaluation, consensus agreement increased to 233 out of 334 CL (κ = 0.69. 93.8% of conL were visible in at least 2 consecutive TP. 74.7% of the conL were visible in all 12 consecutive TP. ConL had greater mean lesion volumes and higher mean signal intensities compared to lesions that were only detected by one of the raters (p<0.05. A higher number of CLs in the frontal, parietal, temporal and occipital lobe were identified by both raters than the number of those only identified by one of the raters (p<0.05.After a first assessment, slightly less than a half of the CL were considered as reliably detectable on longitudinal DIR images. A retrospective re-evaluation notably increased the consensus agreement. However, this finding is narrowed, considering the fact that retrospective evaluation steps might not be practicable in clinical routine. Lesions that were not reliably

  12. Silicon photomultipliers for the detection of VUV scintillation light in LXe for the nEXO experiment

    Energy Technology Data Exchange (ETDEWEB)

    Ziegler, Tobias; Jamil, Ako; Bayerlein, Reimund; Hoessl, Juergen; Hufschmidt, Patrick; Schneider, Judith; Wagenpfeil, Michael; Wrede, Gerrit; Anton, Gisela; Michel, Thilo [Erlangen Centre for Astroparticle Physics, Erlangen 91058 (Germany)

    2016-07-01

    The future nEXO (next Enriched Xenon Observatory) experiment with a single phase TPC design will use about 4 m{sup 2} of SiPMs for the detection of the VUV (vacuum ultraviolet) scintillation light (λ=175 nm) from LXe to search for the neutrinoless double beta (0νββ) decay of {sup 136}Xe. Commercially available SiPMs are not sensitive to ultraviolet light, because of an antireflective coating on top of the sensitive area. In addition, they suffer from relatively high dark count rate at room temperature and correlated avalanches, such as crosstalk and afterpulsing. The core criteria, for having an energy resolution of about 1% (σ) at the Q-value of the 0νββ decay of {sup 136}Xe (2457.8 keV), are a photon detection efficiency (PDE) of at least 15% at 175 nm and a correlated avalanche probability (CAP) of less than 20% at -100 C. We considered different approaches for optimizing both PDE and CAP. These improved SiPMs from several vendors were tested in different test setups at temperatures of about -100 C with respect to the criteria required in the nEXO experiment.

  13. Study of the sensitivity of CMS to the lepton flavour violating neutrinoless $\\tau$ decay $\\tau \\to \\mu\\mu\\mu$

    CERN Document Server

    AUTHOR|(CDS)2069565

    2009-01-01

    The world largest proton-proton collider, the Large Hadron Collider (LHC), which was built up at CERN in the near of Geneva, will start its operation in summer 2009. The total τ lepton production cross-section for the CMS experiment, at a center-of-mass energy of 14 TeV, is about 140 μb. Assuming an integrated luminosity of 10 fb−1 per year, which is expected to be reached in the low luminosity phase of L = 2 × 1033 cm−2 s−1 , about 1012 τ leptons are produced in total. This copious τ production at the LHC provides an excellent potential for the search of neutrinoless and therefore lepton flavour violating τ decays. It is already known since the experimental discovery of neutrino oscillations, that the conservation law of the lepton family number is not strict. The neutrino oscillations have dramatic consequences for the picture of leptons in the Standard Model. The neutrinos become massive particles, the mass eigenstates differ from the flavour eigenstates and a mixing matrix similar to the CKM m...

  14. Detecting surface events at the COBRA experiment

    Energy Technology Data Exchange (ETDEWEB)

    Tebruegge, Jan [Exp. Physik IV, TU Dortmund (Germany); Collaboration: COBRA-Collaboration

    2015-07-01

    The aim of the COBRA experiment is to prove the existence of neutrinoless double-beta-decay and to measure its half-life. For this purpose the COBRA demonstrator, a prototype for a large-scale experiment, is operated at the Gran Sasso Underground Laboratory (LNGS) in Italy. The demonstrator is a detector array made of 64 Cadmium-Zinc-Telluride (CdZnTe) semiconductor detectors in the coplanar grid anode configuration. Each detector is 1**1 ccm in size. This setup is used to investigate the experimental issues of operating CdZnTe detectors in low background mode and identify potential background components. As the ''detector=source'' principle is used, the neutrinoless double beta decay COBRA searches for happens within the whole detector volume. Consequently, events on the surface of the detectors are considered as background. These surface events are a main background component, stemming mainly from the natural radioactivity, especially radon. This talk explains to what extent surface events occur and shows how these are recognized and vetoed in the analysis using pulse shape discrimination algorithms.

  15. Consensus review of discordant findings maximizes cancer detection rate in double-reader screening mammography: Irish National Breast Screening Program experience.

    Science.gov (United States)

    Shaw, Colette M; Flanagan, Fidema L; Fenlon, Helen M; McNicholas, Michelle M

    2009-02-01

    To assesses consensus review of discordant screening mammography findings in terms of its sensitivity, safety, and effect on overall performance in the first 6 years of operation of the Irish National Breast Screening Program (NBSP). Women who participated in the Irish NBSP gave written informed consent for use of their data for auditing purposes. Local ethics committee approval was obtained. The study population consisted of women who participated in the Irish NBSP and underwent initial screening mammography at one of the two screening centers serving the eastern part of Ireland between 2000 and 2005. Independent double reading of mammograms was performed. When the readers disagreed regarding referral, the case was reviewed by a consensus panel. Of the 128 569 screenings performed, 1335 (1%) were discussed by consensus. Of the 1335 cases discussed by consensus, 606 (45.39%) were recalled for further assessment. This resulted in an overall recall rate of 4.41%. In those recalled to assessment, 71 cases of malignant disease were diagnosed (ductal carcinoma in situ, n = 24; invasive cancer, n = 47). The remaining 729 patients were returned to biennial screening. Of these 729 patients, seven had false-negative findings that were identified in the subsequent screening round. Use of the highest reader recall method, in which a patient is recalled if her findings are deemed abnormal by either reader, could potentially increase the cancer detection rate by 0.6 per 1000 women screened but would increase the recall rate by 12.69% and the number of false-positive findings by 15.37%. The consensus panel identified 71 (7.33%) of 968 cancers diagnosed. Consensus review substantially reduced the number of cases recalled and was associated with a low false-negative rate.

  16. Use of mucolytic agents and guaran HEPART (HP-7000) for the detection of mucosal villi in double contrast barium studies of the small intestine

    International Nuclear Information System (INIS)

    Desaga, J.F.

    1987-01-01

    It was the aim of this study to enhance the visualisation of mucosal villi by double contrast barium studies of the small bowel. Prior to the radiological examination a 2-day pretreatment with the mucolytic agents acetylcysteine or carbocisteine was effected. Double contrast studies were performed with a high-molecular fraction of guaran HEPART (HP-7000), a hydrocolloidal isolated from the seed endosperm of C. tetragonolobus added into contrast-medium and distention medium. Compared to double contrast studies without mucolytic therapy, this procedure results in a better transparency and demonstration of the mucosal villi shown by a granular pattern in the radiographs. High quality visualisation of intestinal villi was achieved in all patients studied. A 2-day pretreatment with carbocisteine or acetylcysteine and the use of guaran in the double contrast barium study of the small bowel results in a greatly enhanced visualisation of mucosal villi. (orig.) [de

  17. Gerda: A new 76Ge Double Beta Decay Experiment at Gran Sasso

    International Nuclear Information System (INIS)

    Simgen, Hardy

    2005-01-01

    In the new 76 Ge double beta decay experiment Gerda [I. Abt et al., arXiv hep-ex/0404039; Gerda proposal, to be submitted to the Gran Sasso scientific committee] bare diodes of enriched 76 Ge will be operated in highly pure liquid nitrogen or argon. The goal is to reduce the background around Q ββ =2039 keV below 10 -3 counts/(kg-bar keV-bar y). With presently available diodes from the Igex and HdMs experiments the current evidence for neutrinoless double beta decay [H.-V. Klapdor-Kleingrothaus, et al., Mod. Phys. Lett. A16 (2001) 2409ff] can unambigously be checked within one year of measurement

  18. Search for two-neutrino double electron capture on 124Xe with the XMASS-I detector

    Directory of Open Access Journals (Sweden)

    K. Abe

    2016-08-01

    Full Text Available Double electron capture is a rare nuclear decay process in which two orbital electrons are captured simultaneously in the same nucleus. Measurement of its two-neutrino mode would provide a new reference for the calculation of nuclear matrix elements whereas observation of its neutrinoless mode would demonstrate lepton number violation. A search for two-neutrino double electron capture on 124Xe is performed using 165.9 days of data collected with the XMASS-I liquid xenon detector. No significant excess above background was observed and we set a lower limit on the half-life as 4.7×1021 years at 90% confidence level. The obtained limit has ruled out parts of some theoretical expectations. We obtain a lower limit on the 126Xe two-neutrino double electron capture half-life of 4.3×1021 years at 90% confidence level as well.

  19. Double-beta decay processes from lattice quantum chromodynamics

    Science.gov (United States)

    Davoudi, Zohreh; Tiburzi, Brian; Wagman, Michael; Winter, Frank; Chang, Emmanuel; Detmold, William; Orginos, Kostas; Savage, Martin; Shanahan, Phiala; Nplqcd Collaboration

    2017-09-01

    While an observation of neutrinoless double-beta decay in upcoming experiments will establish that the neutrinos are Majorana particles, the underlying new physics responsible for this decay can only be constrained if the theoretical predictions of the rate are substantially refined. This talk demonstrates the roadmap in connecting the underlying high-scale theory to the corresponding nuclear matrix elements, focusing mainly on the nucleonic matrix elements in the simplest extension of Standard Model in which a light Majorana neutrino is mediating the process. The role of lattice QCD and effective field theory in this program, in particular, the prospect of a direct matching of the nn to pp amplitude to lattice QCD will be discussed. As a first step towards this goal, the results of the first lattice QCD calculation of the relevant matrix element for neutrinofull double-beta decay will be presented, albeit with unphysical quark masses, along with important lessons that could impact the calculations of nuclear matrix elements involved in double-beta decays of realistic nuclei.

  20. Status of LUMINEU program to search for neutrinoless double beta decay of {sup 100}Mo with cryogenic ZnMoO{sub 4} scintillating bolometers

    Energy Technology Data Exchange (ETDEWEB)

    Danevich, F. A., E-mail: danevich@kinr.kiev.ua; Boiko, R. S.; Chernyak, D. M.; Kobychev, V. V. [Institute for Nuclear Research, MSP 03680 Kyiv (Ukraine); Bergé, L.; Chapellier, M.; Drillien, A.-A.; Dumoulin, L.; Humbert, V.; Marcillac, P. de; Marnieros, S.; Marrache-Kikuchi, C.; Olivieri, E.; Plantevin, O.; Tenconi, M. [Centre de Sciences Nucléaires et de Sciences de la Matière, CNRS/IN2P3, Université Paris-Sud, 91405 Orsay (France); Coron, N.; Redon, T.; Torres, L. [IAS, CNRS, Université Paris-Sud, 91405 Orsay (France); Devoyon, L.; Koskas, F. [CEA, Centre d’Etudes Saclay, Orphée, 91191 Gif-Sur-Yvette Cedex (France); and others

    2015-10-28

    The LUMTNEU program aims at performing a pilot experiment on 0ν2β decay of {sup 100}Mo using radiopure ZnMoO{sub 4} crystals enriched in {sup 100}Mo operated as cryogenic scintillating bolometers. Large volume ZnMoO{sub 4} crystal scintillators (∼ 0.3 kg) were developed and tested showing high performance in terms of radiopurity, energy resolution and α/β particle discrimination capability. Zinc molybdate crystal scintillators enriched in {sup 100}Mo were grown for the first time by the low-thermal-gradient Czochralski technique with a high crystal yield and an acceptable level of enriched molybdenum irrecoverable losses. A background level of ∼ 0.5 counts/(yr keV ton) in the region of interest can be reached in a large detector array thanks to the excellent detectors radiopurity and particle discrimination capability, suppression of randomly coinciding events by pulse-shape analysis, and anticoincidence cut. These results pave the way to future sensitive searches based on the LUMTNEU technology, capable of approachingand exploring the inverted hierarchy region of the neutrino mass pattern.

  1. Double supergeometry

    Energy Technology Data Exchange (ETDEWEB)

    Cederwall, Martin [Division for Theoretical Physics, Department of Physics, Chalmers University of Technology,SE 412 96 Gothenburg (Sweden)

    2016-06-27

    A geometry of superspace corresponding to double field theory is developed, with type I I supergravity in D=10 as the main example. The formalism is based on an orthosymplectic extension OSp(d,d|2s) of the continuous T-duality group. Covariance under generalised super-diffeomorphisms is manifest. Ordinary superspace is obtained as a solution of the orthosymplectic section condition. A systematic study of curved superspace Bianchi identities is performed, and a relation to a double pure spinor superfield cohomology is established. A Ramond-Ramond superfield is constructed as an infinite-dimensional orthosymplectic spinor. Such objects in minimal orbits under the OSp supergroup (“pure spinors”) define super-sections.

  2. Double ambidexterity

    DEFF Research Database (Denmark)

    Kaulio, Matti; Thorén, Kent; Rohrbeck, René

    2017-01-01

    We leverage the business model innovation and ambidexterity literature to investigate a contradictory case, the Swedish-Finnish Telecom operator TeliaSonera. Despite being challenged by three major disruptions, the company not only still exists but also enjoys remarkably good financial performance....... Building on extant archival data and interviews, we carefully identify and map 26 organizational responses during 1992–2016. We find that the firm has overcome three critical phases by experimenting and pioneering with portfolios of business models and/or technological innovations. We describe...... this behaviour as double ambidexterity. We use an in-depth case study to conceptualize double ambidexterity and discuss its impact on the business's survival and enduring success....

  3. Analyzing Double Image Illusion through Double Indiscernibility and Lattice Theory

    Directory of Open Access Journals (Sweden)

    Kohei Sonoda

    2011-10-01

    Full Text Available The figure-ground division plays a fundamental role in all image perceptions. Although there are a lot of studies about extraction of a figure such as detection of edges or grouping of texture, there are few discussions about a relationship between obtained figure and ground. We focused on double image illusions having two complementary relationships be- tween figure and ground and analyzed them. We divided the double image illusions according to two different interpretations and using these divisions we extracted and analyzed their logical structures by lattices derived from rough sets that we had developed. As a result we discovered unusual logical structures in double image illusions.

  4. The majorana {sup 76}Ge double-beta decay project

    Energy Technology Data Exchange (ETDEWEB)

    Aalseth, C.E.; Adles, E.; Anderson, D.; Avignone, F.T.; Barabash, A.; Bowyer, T.W.; Brodzinski, R.L.; Brudanin, V.; Champangne, A.; Collar, J.I.; Doe, P.J.; Egorov, S.; Elliott, S.R.; Farach, H.A.; Gaitskell, R.; Jordan, D.; Jain, R.K.; Kazkaz, K.; King, G.; Kochetov, O.; Konovalov, S.; Kouzes, R.; Miley, H.S.; Palms, J.M.; Pitts, W.K.; Reeves, J.H.; Robertson, R.G.H.; Rohm, R.; Sandukovsky, S.; Smith, L.E.; Stekhanov, V.; Thompson, R.C.; Tornow, W.; Umatov' , V.; Warner, R.; Webb, J.; Wilkerson, J.F.; Young, A

    2003-07-01

    The interest and relevance of next-generation 0{sub v} {beta}{beta}-decay experiments is increasing. Even with nonzero neutrino mass strongly suggested by solar and atmospheric neutrino experiments sensitive to {delta}m{sup 2}, 0{sub v} {beta}{beta}-decay experiments are still the only way to establish the Dirac or Majorana nature of neutrinos by measuring the effective electron neutrino mass, . In addition, the atmospheric neutrino oscillation experiments imply that at least one neutrino has a mass greater than about 50 meV. The Majorana Experiment expects to probe an effective neutrino mass near this critical value. Majorana is a next-generation {sup 76}Ge double-beta decay search. It will employ 500 kg of Ge, isotopically enriched to 86% in {sup 76}Ge, in the form of {approx} 200 detectors in a close-packed array. Each crystal will be electronically segmented and each segment fitted with pulse-shape analysis electronics. This combination of segmentation and pulse-shape analysis significantly improves our ability to discriminate neutrinoless double beta-decay from internal cosmogenic {sup 68}Ge and {sup 60}Co. The half-life sensitivity is estimated to be 4.2 x 10{sup 27} y corresponding to a range of {<=} 20 - 70 meV, depending on the nuclear matrix elements used to interpret the data.

  5. Testing Left-Right extensions of the standard model of electroweak interactions with double-beta decay and LHC measurements

    Science.gov (United States)

    Civitarese, O.; Suhonen, J.; Zuber, K.

    2015-07-01

    The minimal extension of the standard model of electroweak interactions allows for massive neutrinos, a massive right-handed boson WR, and a left-right mixing angle ζ. While an estimate of the light (electron) neutrino can be extracted from the non-observation of the neutrinoless double beta decay, the limits on the mixing angle and the mass of the righthanded (RH) boson may be extracted from a combined analysis of the double beta decay measurements (GERDA, EXO-200 and KamLAND-Zen collaborations) and ATLAS data on the two-jets two-leptons signals following the excitation of a virtual RH boson mediated by a heavy-mass neutrino. In this work we shall compare results of both types of experiments, and show that the estimates are not in tension.

  6. rApi m 3 and rApi m 10 improve detection of honey bee sensitization in Hymenoptera venom-allergic patients with double sensitization to honey bee and yellow jacket venom.

    Science.gov (United States)

    Frick, M; Müller, S; Bantleon, F; Huss-Marp, J; Lidholm, J; Spillner, E; Jakob, T

    2015-12-01

    Recombinant allergens improve the diagnostic precision in Hymenoptera venom allergy (HVA), in particular in patients with double sensitization to both honey bee (HBV) and yellow jacket venom (YJV). While currently available vespid allergens allow the detection of >95% of YJV-allergic patients, the sensitization frequency to the only available HBV marker allergen rApi m 1 in HBV-allergic patients is lower. Here, we demonstrate that sIgE to additional HBV marker allergens rApi m 3 and rApi m 10 allows the detection of genuine HBV sensitization in 46-65% of Api m 1 negative sera. This is of particular relevance in patients with double sensitization to HBV and YJV that did not identify the culprit insect. Addition of sIgE to rApi m 3 and rApi m 10 provides evidence of HBV sensitization in a large proportion of rApi m 1-negative patients and thus provides a diagnostic marker and rationale for VIT treatment with HBV, which otherwise would have been missing. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  7. Exploration of Pixelated detectors for double beta decay searches within the COBRA experiment

    Energy Technology Data Exchange (ETDEWEB)

    Schwenke, M., E-mail: schwenke@asp.tu-dresden.de [Institut fuer Kern- und Teilchenphysik, Technische Universitaet Dresden, Zellescher Weg 19, 01069 Dresden (Germany); Zuber, K.; Janutta, B. [Institut fuer Kern- und Teilchenphysik, Technische Universitaet Dresden, Zellescher Weg 19, 01069 Dresden (Germany); He, Z.; Zeng, F. [Department of Nuclear Engineering and Radiological Sciences, University of Michigan, Ann Arbor, Michigan 48109-2104 (United States); Anton, G.; Michel, T.; Durst, J.; Lueck, F.; Gleixner, T. [Erlangen Centre for Astroparticle Physics, Friedrich-Alexander-Universitaet Erlangen-Nuernberg, Erwin-Rommel-Str. 1, 91058 Erlangen (Germany); Goessling, C.; Schulz, O.; Koettig, T. [Technische Universitaet Dortmund, Physik E IV, 44221 Dortmund (Germany); Krawczynski, H.; Martin, J. [Department of Physics, Washington University in St. Louis, Campus Box 1105, One Brookings Drive, St. Louis, MO 63130-4899 (United States); Stekl, I.; Cermak, P. [Institute of Experimental and Applied Physics, Czech Technical University in Prague, Horska 3a/22, 128 00 Prague (Czech Republic)

    2011-09-11

    The aim of the COBRA experiment is the search for neutrinoless double beta decay events in Cadmium Zinc Telluride (CdZnTe) room temperature semiconductor detectors. The development of pixelated detectors provides the potential for clear event identification and thus major background reduction. The tracking option of a semiconductor is a unique approach in this field. For initial studies, several possible detector systems are considered with a special regard for low background applications: the large volume system Polaris with a pixelated CdZnTe sensor, Timepix detectors with Si and enriched CdTe sensor material and a CdZnTe pixel system developed at the Washington University in St. Louis, USA. For all detector systems first experimental background measurements taken at underground laboratories (Gran Sasso Underground Laboratory in Italy, LNGS and the Niederniveau Messlabor Felsenkeller in Dresden, Germany) and additionally for the Timepix detectors simulation results are presented.

  8. Research and Development Supporting a Next Generation Germanium Double Beta Decay Experiment

    Science.gov (United States)

    Rielage, Keith; Elliott, Steve; Chu, Pinghan; Goett, Johnny; Massarczyk, Ralph; Xu, Wenqin

    2015-10-01

    To improve the search for neutrinoless double beta decay, the next-generation experiments will increase in source mass and continue to reduce backgrounds in the region of interest. A promising technology for the next generation experiment is large arrays of Germanium p-type point contact detectors enriched in 76-Ge. The experience, expertise and lessons learned from the MAJORANA DEMONSTRATOR and GERDA experiments naturally lead to a number of research and development activities that will be useful in guiding a future experiment utilizing Germanium. We will discuss some R&D activities including a hybrid cryostat design, background reduction in cabling, connectors and electronics, and modifications to reduce assembly time. We acknowledge the support of the U.S. Department of Energy through the LANL/LDRD Program.

  9. Radiopurity control in the NEXT-100 double beta decay experiment: procedures and initial measurements

    International Nuclear Information System (INIS)

    Álvarez, V; Cárcel, S; Cervera, A; Díaz, J; Ferrario, P; Bandac, I; Bettini, A; Castel, J; Cebrián, S; Dafni, T; Borges, F I G M; Conde, C A N; Dias, T H V T; Fernandes, L M P; Freitas, E D C; Egorov, M; Gehman, V M; Esteve, R; Evtoukhovitch, P; Ferreira, A L

    2013-01-01

    The ''Neutrino Experiment with a Xenon Time-Projection Chamber'' (NEXT) is intended to investigate the neutrinoless double beta decay of 136 Xe, which requires a severe suppression of potential backgrounds. An extensive screening and material selection process is underway for NEXT since the control of the radiopurity levels of the materials to be used in the experimental set-up is a must for rare event searches. First measurements based on Glow Discharge Mass Spectrometry and gamma-ray spectroscopy using ultra-low background germanium detectors at the Laboratorio Subterr and apos;aneo de Canfranc (Spain) are described here. Activity results for natural radioactive chains and other common radionuclides are summarized, being the values obtained for some materials like copper and stainless steel very competitive. The implications of these results for the NEXT experiment are also discussed.

  10. Cutting edge: double-stranded DNA breaks in the IgV region gene were detected at lower frequency in affinity-maturation impeded GANP-/- mice.

    Science.gov (United States)

    Kawatani, Yousuke; Igarashi, Hideya; Matsui, Takeshi; Kuwahara, Kazuhiko; Fujimura, Satoru; Okamoto, Nobukazu; Takagi, Katsumasa; Sakaguchi, Nobuo

    2005-11-01

    Double-stranded DNA breaks (DSBs) at the IgV region (IgV) genes might be involved in somatic hypermutation and affinity-maturation of the B cell receptor in response to T cell-dependent Ag. By ligation-mediated PCR, we studied IgV DSBs that occurred in mature germinal center B cells in response to nitrophenyl-chicken gamma-globulin in a RAG1-independent, Ag-dependent, and IgV-selective manner. We quantified their levels in GANP-deficient B cells that have impaired generation of high-affinity Ab. GANP-/- B cells showed a decreased level of DSBs with blunt ends than control B cells and, on the contrary, the ganp gene transgenic (GANPTg) B cells showed an increased level. These results suggested that the level of IgV DSBs in germinal center B cells is associated with GANP expression, which is presumably required for B cell receptor affinity maturation.

  11. Double Solvent Sensing Method for Improving Sensitivity and Accuracy of Hg(II) Detection Based on Different Signal Transduction of a Tetrazine-Functionalized Pillared Metal-Organic Framework.

    Science.gov (United States)

    Razavi, Sayed Ali Akbar; Masoomi, Mohammad Yaser; Morsali, Ali

    2017-08-21

    To design a robust, π-conjugated, low-cost, and easy to synthesize metal-organic framework (MOF) for cation sensing by the photoluminescence (PL) method, 4,4'-oxybis(benzoic acid) (H 2 OBA) has been used in combination with 3,6-di(pyridin-4-yl)-1,2,4,5-tetrazine (DPT) as a tetrazine-functionalized spacer to construct [Zn(OBA)(DPT) 0.5 ]·DMF (TMU-34(-2H)). The tetrazine motif is a π-conjugated, water-soluble/stable fluorophore with relatively weak σ-donating Lewis basic sites. These characteristics of tetrazine make TMU-34(-2H) a good candidate for cation sensing. Because of hydrogen bonding between tetrazine moieties and water molecules, TMU-34(-2H) shows different PL emissions in water and acetonitrile. Cation sensing in these two solvents revealed that TMU-34(-2H) can selectively detect Hg 2+ in water (by 243% enhancement) and in acetonitrile (by 90% quenching). The contribution of electron-donating/accepting characteristics along with solvation effects on secondary interactions of the tetrazine motifs inside the TMU-34(-2H) framework results in different signal transductions. Improved sensitivity and accuracy of detection were obtained using the double solvent sensing method (DSSM), in which different signal transductions of TMU-34(-2H) in water and acetonitrile were combined simultaneously to construct a double solvent sensing curve and formulate a sensitivity factor. Calculation of sensitivity factors for all of the tested cations demonstrated that it is possible to detect Hg 2+ by DSSM with ultrahigh sensitivity. Such a tremendous distinction in the Hg 2+ sensitivity factor is visualizable in the double solvent sensing curve. Thus, by application of DSSM instead of one-dimensional sensing, the interfering effects of other cations are completely eliminated and the sensitivity toward Hg(II) is highly improved. Strong interactions between Hg 2+ and the nitrogen atoms of the tetrazine groups along with easy accessibility of Hg 2+ to the tetrazine groups lead

  12. Impact of total PSA, PSA doubling time and PSA velocity on detection rates of 11C-Choline positron emission tomography in recurrent prostate cancer

    NARCIS (Netherlands)

    Rybalov, Maxim; Breeuwsma, Anthonius J.; Leliveld, Anna M.; Pruim, Jan; Dierckx, Rudi A.; de Jong, Igle J.

    PURPOSE: To evaluate the effect of total PSA (tPSA) and PSA kinetics on the detection rates of (11)C-Choline PET in patients with biochemical recurrence (BCR) after radical prostatectomy (RP) or external beam radiotherapy (EBRT). METHODS: We included 185 patients with BCR after RP (PSA >0.2 ng/ml)

  13. Double inflation

    International Nuclear Information System (INIS)

    Silk, J.; Turner, M.S.

    1986-04-01

    The Zel'dovich spectrum of adiabatic density perturbations is a generic prediction of inflation. There is increasing evidence that when the spectrum is normalized by observational data on small scales, there is not enough power on large scales to account for the observed large-scale structure in the Universe. Decoupling the spectrum on large and small scales could solve this problem. As a means of decoupling the large and small scales we propose double inflation (i.e., two episodes of inflation). In this scenario the spectrum on large scales is determined by the first episode of inflation and those on small scales by a second episode of inflation. We present three models for such a scenario. By nearly saturating the large angular-scale cosmic microwave anisotropy bound, we can easily account for the observed large-scale structure. We take the perturbations on small scales to be very large, deltarho/rho approx. = 0.1 to 0.01, which results in the production of primordial black holes (PBHs), early formation of structure, reionization of the Universe, and a rich array of astrophysical events. The Ω-problem is also addressed by our scenario. Allowing the density perturbations produced by the second episode of inflation to be large also lessens the fine-tuning required in the scalar potential and makes reheating much easier. We briefly speculate on the possibility that the second episode of inflation proceeds through the nucleation of bubbles, which today manifest themselves as empty bubbles whose surfaces are covered with galaxies. 37 refs., 1 fig

  14. Double Outlet Right Ventricle

    Science.gov (United States)

    ... Right Ventricle Menu Topics Topics FAQs Double Outlet Right Ventricle Double outlet right ventricle (DORV) is a rare form of congenital heart disease. En español Double outlet right ventricle (DORV) is a rare form of congenital ...

  15. Fine and hyperfine structure spectra of the ultra-violet 23S → 53P transition in 4He and 3He with a frequency doubled CW ring laser, detected via associative ionization

    International Nuclear Information System (INIS)

    Runge, S.; Pesnelle, A.; Perdrix, M.; Sevin, D.; Wolffer, N.; Watel, G.

    1982-01-01

    High resolution laser spectroscopy coupled to a sensitive method of detection via mass analysis of He + 2 ions produced in He(5 3 P) + He(1 1 S) collisions, is used to obtain the fine and hyperfine spectra of the ultra-violet He 2 3 S → 5 3 P transition. A cw tunable UV radiation around 294.5 nm is generated by intracavity frequency doubling a Rhodamine 6G single mode ring dye laser using an ADA crystal. Both spectra enable fine and hyperfine structures to be determined within a few MHz. The magnetic dipole coupling constant A of the 5 3 P term of 3 He is found to be -4326 +- 9 MHz (-0.1443 +- 0.0003 cm -1 ). (orig.)

  16. Employing a hydrazine linked asymmetric double naphthalene hybrid for efficient naked eye detection of F-: Crystal structure with real application for F-

    Science.gov (United States)

    Bhattacharyya, Arghyadeep; Makhal, Subhash Chandra; Ghosh, Soumen; Guchhait, Nikhil

    2018-06-01

    An asymmetric hydrazide, (12E, 13E)-2-((naphthalen-1-yl) methylene)-1-(1-(2-hydroxynaphthalen-6-yl) ethylidene) hydrazine (abbreviated as AH) is synthesized and characterized by standard techniques and crystal structure of AH has been obtained. The naked eye detection of F- in aqueous acetonitrile (acetonitrile: water = 7:3/v:v) by AH has been investigated by UV-Visible titration and in presence of other anions, the limit of detection being 1.31 × 10-6(M). The mechanism of F- sensing has been explored by 1H NMR titration. AH undergoes hydrogen bonding with F- followed by deprotonation. The practical utility of AH has been explored by successful test kit response and color change in toothpaste solution.

  17. Detection of DNA Double Strand Breaks by γH2AX Does Not Result in 53bp1 Recruitment in Mouse Retinal Tissues

    Directory of Open Access Journals (Sweden)

    Brigitte Müller

    2018-05-01

    Full Text Available Gene editing is an attractive potential treatment of inherited retinopathies. However, it often relies on endogenous DNA repair. Retinal DNA repair is incompletely characterized in humans and animal models. We investigated recruitment of the double stranded break (DSB repair complex of γH2AX and 53bp1 in both developing and mature mouse neuroretinas. We evaluated the immunofluorescent retinal expression of these proteins during development (P07-P30 in normal and retinal degeneration models, as well as in potassium bromate induced DSB repair in normal adult (3 months retinal explants. The two murine retinopathy models used had different mutations in Pde6b: the severe rd1 and the milder rd10 models. Compared to normal adult retina, we found increased numbers of γH2AX positive foci in all retinal neurons of the developing retina in both model and control retinas, as well as in wild type untreated retinal explant cultures. In contrast, the 53bp1 staining of the retina differed both in amount and character between cell types at all ages and in all model systems. There was strong pan nuclear staining in ganglion, amacrine, and horizontal cells, and cone photoreceptors, which was attenuated. Rod photoreceptors did not stain unequivocally. In all samples, 53bp1 stained foci only rarely occurred. Co-localization of 53bp1 and γH2AX staining was a very rare event (< 1% of γH2AX foci in the ONL and < 3% in the INL, suggesting the potential for alternate DSB sensing and repair proteins in the murine retina. At a minimum, murine retinal DSB repair does not appear to follow canonical pathways, and our findings suggests further investigation is warranted.

  18. Double hard scattering without double counting

    Energy Technology Data Exchange (ETDEWEB)

    Diehl, Markus [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Gaunt, Jonathan R. [VU Univ. Amsterdam (Netherlands). NIKHEF Theory Group; Schoenwald, Kay [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany)

    2017-02-15

    Double parton scattering in proton-proton collisions includes kinematic regions in which two partons inside a proton originate from the perturbative splitting of a single parton. This leads to a double counting problem between single and double hard scattering. We present a solution to this problem, which allows for the definition of double parton distributions as operator matrix elements in a proton, and which can be used at higher orders in perturbation theory. We show how the evaluation of double hard scattering in this framework can provide a rough estimate for the size of the higher-order contributions to single hard scattering that are affected by double counting. In a numeric study, we identify situations in which these higher-order contributions must be explicitly calculated and included if one wants to attain an accuracy at which double hard scattering becomes relevant, and other situations where such contributions may be neglected.

  19. Double hard scattering without double counting

    International Nuclear Information System (INIS)

    Diehl, Markus; Gaunt, Jonathan R.

    2017-02-01

    Double parton scattering in proton-proton collisions includes kinematic regions in which two partons inside a proton originate from the perturbative splitting of a single parton. This leads to a double counting problem between single and double hard scattering. We present a solution to this problem, which allows for the definition of double parton distributions as operator matrix elements in a proton, and which can be used at higher orders in perturbation theory. We show how the evaluation of double hard scattering in this framework can provide a rough estimate for the size of the higher-order contributions to single hard scattering that are affected by double counting. In a numeric study, we identify situations in which these higher-order contributions must be explicitly calculated and included if one wants to attain an accuracy at which double hard scattering becomes relevant, and other situations where such contributions may be neglected.

  20. Comparison of single-dose and double-dose thallium-201 myocardial perfusion scintigraphy for the detection of coronary artery disease and prior myocardial infarction

    International Nuclear Information System (INIS)

    Blood, D.K.; McCarthy, D.M.; Sciacca, R.R.; Cannon, P.J.

    1978-01-01

    Thallium-201 myocardial perfusion scintigraphy was performed after exercise, 4 hours after exercise (redistribution) and after a separate rest injection in 87 patients undergoing coronary arteriography. Significant coronary lesions were present in 62 of the patients. Interpretation of the rest and redistribution scintiscans was the same in 69 patients, 45 of whom had coronary artery disease (CAD). In 16 of the 17 patients with CAD and differing interpretations, defects were present on redistribution scintiscans but not on rest scintiscans; 11 of these patients had evidence of prior transmural myocardial infarction and the other five had an occluded coronary artery supplying the region of the defect. Redistribution scintiscans were more sensitive than rest scintiscans for the detection of prior myocardial infarction (93% vs 54%; P < 0.01). The increased sensitivity was confined to the detection of prior inferior myocardial infarctions. In 36 of 38 patients with persistent perfusion defects on 4-hour redistribution scintiscans, either a prior infarction or an occluded coronary vessel was present. These data demonstrate that redistribution thallium-201 scintiscans may be substituted for conventional rest scintiscans, resulting in reduced cost and radiation exposure to the patients

  1. A dual spectroscopic fluorescence probe based on carbon dots for detection of 2,4,6-trinitrophenol/Fe (III) ion by fluorescence and frequency doubling scattering spectra and its analytical applications.

    Science.gov (United States)

    Xu, Jinxia; Bai, Zhangjun; Zu, Fanlin; Yan, Fanyong; Wei, Junfu; Zhang, Saihui; Luo, Yunmei

    2018-07-05

    A convenient, highly sensitive and reliable assay for 2,4,6‑trinitrophenol (TNP) and Fe (III) ion (Fe 3+ ) in the dual spectroscopic manner is developed based on novel carbon dots (CDs). The CDs with highly blue emitting fluorescent were easily prepared via the one-step potassium hydroxide-assisted reflux method from dextrin. The as-synthesized CDs exhibited the high crystalline quality, the excellent fluorescence characteristics with a high quantum yield of ~13.1%, and the narrow size distribution with an average diameter of 6.3±0.5nm. Fluorescence and frequency doubling scattering (FDS) spectra of CDs show the unique changes in the presence of TNP/Fe 3+ by different mechanism. The fluorescence of CDs decreased apparently in the presence of TNP via electron-transfer. Thus, after the experimental conditions were optimized, the linear range for detection TNP is 0-50μM, the detection limit was 19.1nM. With the addition of Fe 3+ , the FDS of CDs appeared to be highly sensitive with a quick response to Fe 3+ as a result of the change concentration of the scattering particle. The emission peak for FDS at 450nm was enhanced under the excitation wavelength at 900nm. The fluorescence response changes linearly with Fe 3+ concentration in the range of 8-40μM, the detection limits were determined to be 44.1nM. The applications of CDs were extended for the detection of TNP, Fe 3+ in real water samples with a high recovery. The results reported here may become the potential tools for the fast response of TNP and Fe 3+ in the analysis of environmental pollutants. Copyright © 2018 Elsevier B.V. All rights reserved.

  2. Measurement of the two-neutrino double-beta decay half-life of {sup 130}Te with the CUORE-0 experiment

    Energy Technology Data Exchange (ETDEWEB)

    Alduino, C.; Avignone, F.T.; Chott, N.; Creswick, R.J.; Rosenfeld, C.; Wilson, J. [University of South Carolina, Department of Physics and Astronomy, Columbia, SC (United States); Alfonso, K.; Hickerson, K.P.; Huang, H.Z.; Liu, X.; Trentalange, S.; Zhu, B.X. [University of California, Department of Physics and Astronomy, Los Angeles, CA (United States); Artusa, D.R. [University of South Carolina, Department of Physics and Astronomy, Columbia, SC (United States); INFN-Laboratori Nazionali del Gran Sasso, Assergi, L' Aquila (Italy); Azzolini, O.; Camacho, A.; Keppel, G.; Palmieri, V.; Pira, C. [INFN-Laboratori Nazionali di Legnaro, Legnaro, Padova (Italy); Banks, T.I.; Drobizhev, A.; Freedman, S.J.; Hennings-Yeomans, R.; O' Donnell, T.; Wagaarachchi, S.L. [University of California, Department of Physics, Berkeley, CA (United States); Lawrence Berkeley National Laboratory, Nuclear Science Division, Berkeley, CA (United States); Bari, G.; Deninno, M.M. [INFN-Sezione di Bologna, Bologna (Italy); Beeman, J.W. [Lawrence Berkeley National Laboratory, Materials Science Division, Berkeley, CA (United States); Bellini, F.; Cardani, L.; Casali, N.; Cosmelli, C.; Ferroni, F. [Sapienza Universita di Roma, Dipartimento di Fisica, Rome (Italy); INFN-Sezione di Roma, Rome (Italy); Bersani, A.; Caminata, A. [INFN-Sezione di Genova, Genova (Italy); Biassoni, M.; Carbone, L.; Cremonesi, O.; Ferri, E.; Giachero, A.; Pessina, G.; Previtali, E.; Rusconi, C. [INFN-Sezione di Milano Bicocca, Milan (Italy); Brofferio, C.; Capelli, S.; Carniti, P.; Cassina, L.; Chiesa, D.; Clemenza, M.; Faverzani, M.; Fiorini, E.; Gironi, L.; Gotti, C.; Maino, M.; Nucciotti, A.; Pavan, M.; Pozzi, S.; Sisti, M.; Terranova, F.; Zanotti, L. [Universita di Milano-Bicocca, Dipartimento di Fisica, Milan (Italy); INFN-Sezione di Milano Bicocca, Milan (Italy); Bucci, C.; Cappelli, L.; D' Addabbo, A.; Di Vacri, M.L.; Gorla, P.; Pattavina, L.; Pirro, S. [INFN-Laboratori Nazionali del Gran Sasso, Assergi, L' Aquila (Italy); Canonica, L. [INFN-Laboratori Nazionali del Gran Sasso, Assergi, L' Aquila (Italy); Massachusetts Institute of Technology, Cambridge, MA (United States); Cao, X.G.; Fang, D.Q.; Ma, Y.G.; Wang, H.W.; Zhang, G.Q. [Chinese Academy of Sciences, Shanghai Institute of Applied Physics, Shanghai (China); Copello, S.; Di Domizio, S.; Fernandes, G.; Marini, L.; Pallavicini, M. [INFN-Sezione di Genova, Genova (Italy); Universita di Genova, Dipartimento di Fisica, Genova (Italy); Cushman, J.S.; Davis, C.J.; Heeger, K.M.; Lim, K.E.; Maruyama, R.H. [Yale University, Department of Physics, New Haven, CT (United States); Dafinei, I.; Morganti, S.; Mosteiro, P.J.; Orio, F.; Pettinacci, V.; Tomei, C.; Vignati, M. [INFN-Sezione di Roma, Rome (Italy); Dell' Oro, S. [INFN-Laboratori Nazionali del Gran Sasso, Assergi, L' Aquila (Italy); INFN-Gran Sasso Science Institute, L' Aquila (Italy); Feintzeig, J.; Fujikawa, B.K.; Mei, Y.; Smith, A.R. [Lawrence Berkeley National Laboratory, Nuclear Science Division, Berkeley, CA (United States); Franceschi, M.A.; Ligi, C.; Napolitano, T.; Piperno, G. [INFN-Laboratori Nazionali di Frascati, Frascati, Rome (Italy); Giuliani, A.; Tenconi, M. [Universite Paris-Saclay, CSNSM, Univ. Paris-Sud, CNRS/IN2P3, Orsay (France); Gladstone, L.; Leder, A.; Winslow, L.A. [Massachusetts Institute of Technology, Cambridge, MA (United States); Gutierrez, T.D. [California Polytechnic State University, Physics Department, San Luis Obispo, CA (United States); Haller, E.E. [Lawrence Berkeley National Laboratory, Materials Science Division, Berkeley, CA (United States); University of California, Department of Materials Science and Engineering, Berkeley, CA (United States); Han, K. [Yale University, Department of Physics, New Haven, CT (United States); Shanghai Jiao Tong University, Department of Physics and Astronomy, Shanghai (China); Hansen, E. [University of California, Department of Physics and Astronomy, Los Angeles, CA (United States); Massachusetts Institute of Technology, Cambridge, MA (United States); Kadel, R. [Lawrence Berkeley National Laboratory, Physics Division, Berkeley, CA (United States); Kolomensky, Yu.G. [University of California, Department of Physics, Berkeley, CA (United States); Lawrence Berkeley National Laboratory, Nuclear Science Division, Berkeley, CA (United States); Lawrence Berkeley National Laboratory, Physics Division, Berkeley, CA (United States); Martinez, M. [Sapienza Universita di Roma, Dipartimento di Fisica, Rome (Italy); INFN-Sezione di Roma, Rome (Italy); Universidad de Zaragoza, Laboratorio de Fisica Nuclear y Astroparticulas, Zaragoza (Spain); Moggi, N. [INFN-Sezione di Bologna, Bologna (Italy); Alma Mater Studiorum-Universita di Bologna, Dipartimento di Scienze per la Qualita della Vita, Bologna (Italy); Nones, C. [Service de Physique des Particules, CEA/Saclay, Gif-sur-Yvette (France); Norman, E.B.; Wang, B.S. [Lawrence Livermore National Laboratory, Livermore, CA (United States); University of California, Department of Nuclear Engineering, Berkeley, CA (United States); Ouellet, J.L. [University of California, Department of Physics, Berkeley, CA (United States); Lawrence Berkeley National Laboratory, Nuclear Science Division, Berkeley, CA (United States); Massachusetts Institute of Technology, Cambridge, MA (United States); Pagliarone, C.E. [INFN-Laboratori Nazionali del Gran Sasso, Assergi, L' Aquila (Italy); Universita degli Studi di Cassino e del Lazio Meridionale, Dipartimento di Ingegneria Civile e Meccanica, Cassino (Italy); Sangiorgio, S.; Scielzo, N.D. [Lawrence Livermore National Laboratory, Livermore, CA (United States); Santone, D. [INFN-Laboratori Nazionali del Gran Sasso, Assergi, L' Aquila (Italy); Universita dell' Aquila, Dipartimento di Scienze Fisiche e Chimiche, L' Aquila (Italy); Singh, V. [University of California, Department of Physics, Berkeley, CA (US); Taffarello, L. [INFN-Sezione di Padova, Padova (IT); Wise, T. [Yale University, Department of Physics, New Haven, CT (US); University of Wisconsin, Department of Physics, Madison, WI (US); Woodcraft, A. [University of Edinburgh, SUPA, Institute for Astronomy, Edinburgh (GB); Zimmermann, S. [Lawrence Berkeley National Laboratory, Engineering Division, Berkeley, CA (US); Zucchelli, S. [INFN-Sezione di Bologna, Bologna (IT); Alma Mater Studiorum-Universita di Bologna, Dipartimento di Fisica e Astronomia, Bologna (IT)

    2017-01-15

    We report on the measurement of the two-neutrino double-beta decay half-life of {sup 130}Te with the CUORE-0 detector. From an exposure of 33.4 kg year of TeO{sub 2}, the half-life is determined to be T{sub 1/2}{sup 2ν} = [8.2 ± 0.2 (stat.) ± 0.6 (syst.)] x 10{sup 20} year. This result is obtained after a detailed reconstruction of the sources responsible for the CUORE-0 counting rate, with a specific study of those contributing to the {sup 130}Te neutrinoless double-beta decay region of interest. (orig.)

  3. Double photoionisation spectra of molecules

    CERN Document Server

    Eland, John

    2017-01-01

    This book contains spectra of the doubly charged positive ions (dications) of some 75 molecules, including the major constituents of terrestrial and planetary atmospheres and prototypes of major chemical groups. It is intended to be a new resource for research in all areas of molecular spectroscopy involving high energy environments, both terrestrial and extra-terrestrial. All the spectra have been produced by photoionisation using laboratory lamps or synchrotron radiation and have been measured using the magnetic bottle time-of-flight technique by coincidence detection of correlated electron pairs. Full references to published work on the same species are given, though for several molecules these are the first published spectra. Double ionisation energies are listed and discussed in relation to the molecular electronic structure of the molecules. A full introduction to the field of molecular double ionisation is included and the mechanisms by which double photoionisation can occur are examined in detail. A p...

  4. Firewalls from double purity

    Science.gov (United States)

    Bousso, Raphael

    2013-10-01

    The firewall paradox is often presented as arising from double entanglement, but I argue that more generally the paradox is double purity. Near-horizon modes are purified by the interior, in the infalling vacuum. Hence, they cannot also be pure alone, or in combination with any third system, as demanded by unitarity. This conflict arises independently of the Page time, for entangled and for pure states. It implies that identifications of Hilbert spaces cannot resolve the paradox. Traditional complementarity requires the unitary identification of infalling matter with a scrambled subsystem of the Hawking radiation. Extending this map to the infalling vacuum overdetermines the out-state. More general complementarity maps (“A=RB,” “ER=EPR”) necessarily fail when the near-horizon zone is pure. I argue that pure-zone states span the microcanonical ensemble, and that this suffices to make the horizon a special place. I advocate that the ability to detect the horizon locally, rather than the degree or probability of violence, is what makes firewalls problematic. Conversely, if the production of matter at the horizon can be dynamically understood and shown to be consistent, then firewalls do not constitute a violation of the equivalence principle.

  5. Double photoionization of strontium

    Energy Technology Data Exchange (ETDEWEB)

    Sokell, Emma; Grimm, Michael; Sheridan, Paul, E-mail: emma.sokell@ucd.i [School of Physics, University College Dublin, Belfield, Dublin 4 (Ireland)

    2010-02-01

    Resonant triple-differential cross-section (TDCS) measurements have been used to study the double photoionization process in strontium. Two sets of measurements were made at the photon energy of the 4p {yields} 4d resonance. The coplanar geometry was used and the fixed analyser, positioned at -90{sup 0} to the main axis of polarization of the photons, detected electrons with {approx}65% of the available excess energy. The mutual angle between the two electrons had a range just short of 90 {yields} 270{sup 0}. The TDCS exhibit unexpected lobes at a mutual angle of 180{sup 0}. Comparison with other measurements made with the same geometry but with different sharings of the available energy indicate that these TDCS all show the unexpected lobe. Some possible explanations for the lobe are considered.

  6. Real-time detection of gastric insufflation related to facemask pressure-controlled ventilation using ultrasonography of the antrum and epigastric auscultation in nonparalyzed patients: a prospective, randomized, double-blind study.

    Science.gov (United States)

    Bouvet, Lionel; Albert, Marie-Laure; Augris, Caroline; Boselli, Emmanuel; Ecochard, René; Rabilloud, Muriel; Chassard, Dominique; Allaouchiche, Bernard

    2014-02-01

    The authors sought to determine the level of inspiratory pressure minimizing the risk of gastric insufflation while providing adequate pulmonary ventilation. The primary endpoint was the increase in incidence of gastric insufflation detected by ultrasonography of the antrum while inspiratory pressure for facemask pressure-controlled ventilation increased from 10 to 25 cm H2O. In this prospective, randomized, double-blind study, patients were allocated to one of the four groups (P10, P15, P20, and P25) defined by the inspiratory pressure applied during controlled-pressure ventilation: 10, 15, 20, and 25 cm H2O. Anesthesia was induced using propofol and remifentanil; no neuromuscular-blocking agent was administered. Once loss of eyelash reflex occurred, facemask ventilation was started for a 2-min period while gastric insufflation was detected by auscultation and by real-time ultrasonography of the antrum. The cross-sectional antral area was measured using ultrasonography before and after facemask ventilation. Respiratory parameters were recorded. Sixty-seven patients were analyzed. The authors registered statistically significant increases in incidences of gastric insufflation with inspiratory pressure, from 0% (group P10) to 41% (group P25) according to auscultation, and from 19 to 59% according to ultrasonography. In groups P20 and P25, detection of gastric insufflation by ultrasonography was associated with a statistically significant increase in the antral area. Lung ventilation was insufficient for group P10. Inspiratory pressure of 15 cm H2O allowed for reduced occurrence of gastric insufflation with proper lung ventilation during induction of anesthesia with remifentanil and propofol in nonparalyzed and nonobese patients. (Anesthesiology 2014; 120:326-34).

  7. Double-beta decay investigation with highly pure enriched {sup 82}Se for the LUCIFER experiment

    Energy Technology Data Exchange (ETDEWEB)

    Beeman, J. W. [Lawrence Berkeley National Laboratory, 94720, Berkeley, CA (United States); Bellini, F. [Dipartimento di Fisica, Sapienza Università di Roma, 00185, Rome (Italy); INFN, Sezione di Roma, 00185, Rome (Italy); Benetti, P. [Dipartimento di Chimica, Università di Pavia, 27100, Pavia (Italy); INFN, Sezione di Pavia, 27100, Pavia (Italy); Cardani, L. [Dipartimento di Fisica, Sapienza Università di Roma, 00185, Rome (Italy); Physics Department, Princeton University, 08544, Princeton, NJ (United States); Casali, N. [Dipartimento di Fisica, Sapienza Università di Roma, 00185, Rome (Italy); INFN, Sezione di Roma, 00185, Rome (Italy)

    2015-12-13

    The LUCIFER project aims at deploying the first array of enriched scintillating bolometers for the investigation of neutrinoless double-beta decay of {sup 82}Se. The matrix which embeds the source is an array of ZnSe crystals, where enriched {sup 82}Se is used as decay isotope. The radiopurity of the initial components employed for manufacturing crystals, that can be operated as bolometers, is crucial for achieving a null background level in the region of interest for double-beta decay investigations. In this work, we evaluated the radioactive content in 2.5 kg of 96.3 % enriched {sup 82}Se metal, measured with a high-purity germanium detector at the Gran Sasso deep underground laboratory. The limits on internal contaminations of primordial decay chain elements of {sup 232}Th, {sup 238}U and {sup 235}U are respectively: <61, <110 and <74 μBq/kg at 90 % C.L. The extremely low-background conditions in which the measurement was carried out and the high radiopurity of the {sup 82}Se allowed us to establish the most stringent lower limits on the half-lives of the double-beta decay of {sup 82}Se to 0{sub 1}{sup +}, 2{sub 2}{sup +} and 2{sub 1}{sup +} excited states of {sup 82}Kr of 3.4·10{sup 22}, 1.3·10{sup 22} and 1.0·10{sup 22} y, respectively, with a 90 % C.L.

  8. Double-beta decay investigation with highly pure enriched {sup 82}Se for the LUCIFER experiment

    Energy Technology Data Exchange (ETDEWEB)

    Beeman, J.W. [Lawrence Berkeley National Laboratory, Berkeley, CA (United States); Bellini, F.; Casali, N.; Ferroni, F.; Piperno, G. [Sapienza Universita di Roma, Dipartimento di Fisica, Rome (Italy); INFN, Sezione di Roma, Rome (Italy); Benetti, P. [Universita di Pavia, Dipartimento di Chimica, Pavia (Italy); INFN, Sezione di Pavia, Pavia (Italy); Cardani, L. [Sapienza Universita di Roma, Dipartimento di Fisica, Rome (Italy); Princeton University, Physics Department, Princeton, NJ (United States); Chiesa, D.; Clemenza, M.; Gironi, L.; Maino, M. [Universita di Milano-Bicocca, Dipartimento di Fisica, Milan (Italy); INFN, Sezione di Milano Bicocca, Milan (Italy); Dafinei, I.; Orio, F.; Tomei, C.; Vignati, M. [INFN, Sezione di Roma, Rome (Italy); Di Domizio, S. [INFN, Sezione di Genova, Genoa (Italy); Universita di Genova, Dipartimento di Fisica, Genoa (Italy); Giuliani, A. [Centre de Spectrometrie de Masse, Orsay (France); Gotti, C.; Pessina, G.; Previtali, E.; Rusconi, C. [INFN, Sezione di Milano Bicocca, Milan (Italy); Laubenstein, M.; Nisi, S.; Pattavina, L.; Pirro, S.; Schaeffner, K. [INFN, Laboratori Nazionali del Gran Sasso, Assergi (L' Aquila) (Italy); Nagorny, S.; Pagnanini, L. [Gran Sasso Science Institute, L' Aquila (Italy); Nones, C. [SPP Centre de Saclay, CEA, Irfu, Gif-sur-Yvette (France)

    2015-12-15

    The LUCIFER project aims at deploying the first array of enriched scintillating bolometers for the investigation of neutrinoless double-beta decay of {sup 82}Se. The matrix which embeds the source is an array of ZnSe crystals, where enriched {sup 82}Se is used as decay isotope. The radiopurity of the initial components employed for manufacturing crystals, that can be operated as bolometers, is crucial for achieving a null background level in the region of interest for double-beta decay investigations. In this work, we evaluated the radioactive content in 2.5 kg of 96.3 % enriched {sup 82}Se metal, measured with a high-purity germanium detector at the Gran Sasso deep underground laboratory. The limits on internal contaminations of primordial decay chain elements of {sup 232}Th, {sup 238}U and {sup 235}U are respectively: <61, <110 and <74 μBq/kg at 90 % C.L. The extremely low-background conditions in which the measurement was carried out and the high radiopurity of the {sup 82}Se allowed us to establish the most stringent lower limits on the half-lives of the double-beta decay of {sup 82}Se to 0{sub 1}{sup +}, 2{sub 2}{sup +} and 2{sub 1}{sup +} excited states of {sup 82}Kr of 3.4.10{sup 22}, 1.3.10{sup 22} and 1.0.10{sup 22} y, respectively, with a 90 % C.L. (orig.)

  9. Diagnostic value of whole-body MRI and bone scintigraphy in the detection of osseous metastases in patients with breast cancer - a prospective double-blinded study at two hospital centers

    International Nuclear Information System (INIS)

    Ohlmann-Knafo, Susanne; Pickuth, D.; Kirschbaum, M.; Fenzl, G.

    2009-01-01

    The purpose of this study was to compare the diagnostic accuracy of whole-body MRI (WB-MRI) and bone scintigraphy (BS) for the screening of bone metastases for the first time in a large and homogeneous patient collective with breast cancer in a systematic and controlled study. 213 breast cancer patients were evaluated for bone metastases under randomized, double-blinded and prospective conditions at two hospitals. All participants were examined by WB-MRI and BS over an average period of four days. The examinations were performed separately at two different locations. The WB-MRI protocol included T 1-TSE and STIR sequences. WB-MRI and BS were reviewed independently by experienced radiologists and nuclear medicine specialists in a consensus reading. In 66 % of cases bone metastases were excluded by both procedures, and bone metastases were detected concordantly in 2 % of cases. In 7 % of cases there were discrepant results: in 7 cases BS was false-positive when WB-MRI was negative. In 5 / 7 cases BS was negative when WB-MRI identified bone metastases. In 89 % of cases BS was uncertain when WB-MRI was true-negative. In 17 % of cases WB-MRI showed important (non-) tumor-associated findings. The sensitivity, specificity, positive and negative predictive value and diagnostic accuracy for WB-MRI were 90 %, 94 %, 82 %, 98 % and 99 % and for BS those were 40 %, 81 %, 36 %, 91 % and 93 %. (orig.)

  10. A novel single fluorophore-labeled double-stranded oligonucleotide probe for fluorescence-enhanced nucleic acid detection based on the inherent quenching ability of deoxyguanosine bases and competitive strand-displacement reaction.

    Science.gov (United States)

    Zhang, Yingwei; Tian, Jingqi; Li, Hailong; Wang, Lei; Sun, Xuping

    2012-01-01

    We develop a novel single fluorophore-labeled double-stranded oligonucleotide (OND) probe for rapid, nanostructure-free, fluorescence-enhanced nucleic acid detection for the first time. We further demonstrate such probe is able to well discriminate single-base mutation in nucleic acid. The design takes advantage of an inherent quenching ability of guanine bases. The short strand of the probe is designed with an end-labeled fluorophore that is placed adjacent to two guanines as the quencher located on the long opposite strand, resulting in great quenching of dye fluorescence. In the presence of a target complementary to the long strand of the probe, a competitive strand-displacement reaction occurs and the long strand forms a more stable duplex with the target, resulting in the two strands of the probe being separated from each other. As a consequence of this displacement, the fluorophore and the quencher are no longer in close proximity and dye fluorescence increases, signaling the presence of target.

  11. Quantitative Detection of the Foot-And-Mouth Disease Virus Serotype O 146S Antigen for Vaccine Production Using a Double-Antibody Sandwich ELISA and Nonlinear Standard Curves.

    Directory of Open Access Journals (Sweden)

    Xia Feng

    Full Text Available The efficacy of an inactivated foot-and-mouth disease (FMD vaccine is mainly dependent on the integrity of the foot-and-mouth disease virus (FMDV particles. At present, the standard method to quantify the active component, the 146S antigen, of FMD vaccines is sucrose density gradient (SDG analysis. However, this method is highly operator dependent and difficult to automate. In contrast, the enzyme-linked immunosorbent assay (ELISA is a time-saving technique that provides greater simplicity and sensitivity. To establish a valid method to detect and quantify the 146S antigen of a serotype O FMD vaccine, a double-antibody sandwich (DAS ELISA was compared with an SDG analysis. The DAS ELISA was highly correlated with the SDG method (R2 = 0.9215, P<0.01. In contrast to the SDG method, the DAS ELISA was rapid, robust, repeatable and highly sensitive, with a minimum quantification limit of 0.06 μg/mL. This method can be used to determine the effective antigen yields in inactivated vaccines and thus represents an alternative for assessing the potency of FMD vaccines in vitro. But it still needs to be prospectively validated by analyzing a new vaccine preparation and determining the proper protective dose followed by an in vivo vaccination-challenge study to confirm the ELISA findings.

  12. Quantitative Detection of the Foot-And-Mouth Disease Virus Serotype O 146S Antigen for Vaccine Production Using a Double-Antibody Sandwich ELISA and Nonlinear Standard Curves

    Science.gov (United States)

    Feng, Xia; Ma, Jun-Wu; Sun, Shi-Qi; Guo, Hui-Chen; Yang, Ya-Min; Jin, Ye; Zhou, Guang-Qing; He, Ji-Jun; Guo, Jian-Hong; Qi, Shu-yun; Lin, Mi; Cai, Hu; Liu, Xiang-Tao

    2016-01-01

    The efficacy of an inactivated foot-and-mouth disease (FMD) vaccine is mainly dependent on the integrity of the foot-and-mouth disease virus (FMDV) particles. At present, the standard method to quantify the active component, the 146S antigen, of FMD vaccines is sucrose density gradient (SDG) analysis. However, this method is highly operator dependent and difficult to automate. In contrast, the enzyme-linked immunosorbent assay (ELISA) is a time-saving technique that provides greater simplicity and sensitivity. To establish a valid method to detect and quantify the 146S antigen of a serotype O FMD vaccine, a double-antibody sandwich (DAS) ELISA was compared with an SDG analysis. The DAS ELISA was highly correlated with the SDG method (R2 = 0.9215, P<0.01). In contrast to the SDG method, the DAS ELISA was rapid, robust, repeatable and highly sensitive, with a minimum quantification limit of 0.06 μg/mL. This method can be used to determine the effective antigen yields in inactivated vaccines and thus represents an alternative for assessing the potency of FMD vaccines in vitro. But it still needs to be prospectively validated by analyzing a new vaccine preparation and determining the proper protective dose followed by an in vivo vaccination-challenge study to confirm the ELISA findings. PMID:26930597

  13. International double taxation

    OpenAIRE

    Körbl, Hugo

    2012-01-01

    1 Summary This thesis deals with the issue of international double taxation of income and capital and methods for its solution. International double taxation is an issue which states began to deal with in the late 19th century. This interest intensified after the First World War when also the League of Nations (predecessor of the United Nations) began to deal with international double taxation. Most attention the phenomenon of double taxation of income and capital with an international elemen...

  14. The Muon-Induced Neutron Indirect-Detection EXperiment. MINIDEX

    Energy Technology Data Exchange (ETDEWEB)

    Palermo, Matteo

    2016-06-06

    A new experiment to measure muon-induced neutrons is introduced. The design of the Muon-Induced Neutron Indirect Detection EXperiment, MINIDEX, is presented and its installation and commissioning in the Tuebingen Shallow Underground Laboratory are described. Results from its first data taking period, run I, are presented. Muon-induced neutrons are not only an interesting physics topic by itself, but they are also an important source of background in searches for possible new rare phenomena like neutrinoless double beta decay or directly observable interactions of dark matter. These subjects are of great importance to understand the development of the early universe. Therefore, a new generation of ton-scale experiments which require extremely low background levels is under consideration. Reliable Monte Carlo simulations are needed to design such future experiments and estimate their background levels and sensitivities. The background due to muon-induced neutrons is hard to estimate, because of inconsistencies between different experimental results and discrepancies between measurements and Monte Carlo predictions. Especially for neutron production in high-Z materials, more experimental data and related simulation studies are clearly needed. MINIDEX addresses exactly this subject. Already the first five months of data taking provided valuable data on neutron production, propagation and interaction in lead. A first round of comparisons between MINIDEX data and Monte Carlo predictions are presented. In particular, the predictions of two Monte Carlo packages, based on GEANT4, are compared to the data. The data show an overall 70-100% higher rate of muon-induced events than predicted by the Monte Carlo packages. These packages also predict a faster time evolution of the muon-induced signal than observed in the data. Nevertheless, the time until the signal from the muon-induced events is completely collected was correctly predicted by the Monte Carlos. MINIDEX is foreseen

  15. Double layers in space

    International Nuclear Information System (INIS)

    Carlqvist, P.

    1982-07-01

    For more than a decade it has been realised that electrostatic double layers are likely to occur in space. We briefly discuss the theoretical background of such double layers. Most of the paper is devoted to an account of the observational evidence for double layers in the ionosphere and magnetosphere of the Earth. Several different experiments are reviewed including rocket and satellite measurements and ground based observations. It is concluded that the observational evidence for double layers in space is very strong. The experimental results indicate that double layers with widely different properties may exist in space. (Author)

  16. Double layers in space

    International Nuclear Information System (INIS)

    Carlqvist, P.

    1982-01-01

    For more than a decade it has been realised that electrostatic double layers are likely to occur in space. The author briefly discusses the theoretical background of such double layers. Most of the paper is devoted to an account of the observational evidence for double layers in the ionosphere and magnetosphere of the Earth. Several different experiments are reviewed including rocket and satellite measurements and ground based observations. It is concluded that the observational evidence for double layers in space is very strong. The experimental results indicate that double layers with widely different properties may exist in space. (Auth.)

  17. Double-double effect and coordination number

    International Nuclear Information System (INIS)

    Mioduski, T.

    1992-01-01

    The original method of interpretation together with its theoretical foundations is developed, making it possible to use location and direction of the double-double (tetrad) effect within the Ln and An series to determine the coordination number (CN) complexes of the f-block elements. The method is applied for potentiometric and radiometric equilibrium studies. It has been pointed and that the decisive factor for the direction of the double-double effect in the case of the Gibbs energy variations is a difference in the CN of the f-element ion between the reaction product complex and that for the reaction substrate the ''regular'' effect for a given tetrad is accompanied by decrease in the CN while the ''reverse'' effect by increase in the CN. (author). 122 refs, 5 tabs, 8 figs

  18. Magnetoencephalography for the detection of intervention effects of a specific nutrient combination in patients with mild Alzheimer’s disease: Results from an exploratory double blind randomised controlled study

    Directory of Open Access Journals (Sweden)

    Elisabeth Catharina Van Straaten

    2016-10-01

    Full Text Available Synaptic loss is an early pathological finding in Alzheimer’s disease (AD and correlates with memory impairment. Changes in macroscopic brain activity measured with electro- and magnetoencephalography (EEG and MEG in AD indicate synaptic changes and may therefore serve as markers of intervention effects in clinical trials. EEG peak frequency and functional networks have shown, in addition to improved memory performance, to be sensitive to detect an intervention effect in mild AD patients of the medical food Souvenaid containing the specific nutrient combination Fortasyn® Connect, which is designed to enhance synapse formation and function. Here, we explore the value of MEG, with higher spatial resolution than EEG, in identifying intervention effects of the nutrient combination by comparing MEG spectral measures, functional connectivity and – networks between an intervention and a control group. Quantitative markers describing spectral properties, functional connectivity and graph theoretical aspects of MEG from the exploratory 24-week, double blind, randomized controlled Souvenir II MEG sub-study (NTR1975, http://www.trialregister.nl in drug-naïve patients with mild AD were compared between a test group (n=27, receiving Souvenaid, and a control group (n=28, receiving an isocaloric control product. The groups were unbalanced at screening with respect to Mini-Mental State Examination (MMSE. Peak frequencies of MEG were compared to EEG peak frequencies, recorded in the same patients at similar time points, were compared with respect to sensitivity to intervention effects. No consistent statistically significant intervention effects were detected. In addition, we found no difference in sensitivity between MEG and EEG peak frequency. This exploratory study could not unequivocally establish the value of MEG in detecting interventional effects on brain activity, possibly due to small sample size and unbalanced study groups. We found no indication

  19. Magnetoencephalography for the Detection of Intervention Effects of a Specific Nutrient Combination in Patients with Mild Alzheimer’s Disease: Results from an Exploratory Double-Blind, Randomized, Controlled Study

    Science.gov (United States)

    van Straaten, Elisabeth C. W.; de Waal, Hanneke; Lansbergen, Marieke M.; Scheltens, Philip; Maestu, Fernando; Nowak, Rafal; Hillebrand, Arjan; Stam, Cornelis J.

    2016-01-01

    Synaptic loss is an early pathological finding in Alzheimer’s disease (AD) and correlates with memory impairment. Changes in macroscopic brain activity measured with electro- and magnetoencephalography (EEG and MEG) in AD indicate synaptic changes and may therefore serve as markers of intervention effects in clinical trials. EEG peak frequency and functional networks have shown, in addition to improved memory performance, to be sensitive to detect an intervention effect in mild AD patients of the medical food Souvenaid containing the specific nutrient combination Fortasyn® Connect, which is designed to enhance synapse formation and function. Here, we explore the value of MEG, with higher spatial resolution than EEG, in identifying intervention effects of the nutrient combination by comparing MEG spectral measures, functional connectivity, and networks between an intervention and a control group. Quantitative markers describing spectral properties, functional connectivity, and graph theoretical aspects of MEG from the exploratory 24-week, double-blind, randomized, controlled Souvenir II MEG sub-study (NTR1975, http://www.trialregister.nl) in drug naïve patients with mild AD were compared between a test group (n = 27), receiving Souvenaid, and a control group (n = 28), receiving an isocaloric control product. The groups were unbalanced at screening with respect to Mini-Mental State Examination. Peak frequencies of MEG were compared with EEG peak frequencies, recorded in the same patients at similar time points, were compared with respect to sensitivity to intervention effects. No consistent statistically significant intervention effects were detected. In addition, we found no difference in sensitivity between MEG and EEG peak frequency. This exploratory study could not unequivocally establish the value of MEG in detecting interventional effects on brain activity, possibly due to small sample size and unbalanced study groups. We found no indication that

  20. Influence of PSA, PSA velocity and PSA doubling time on contrast-enhanced 18F-choline PET/CT detection rate in patients with rising PSA after radical prostatectomy

    International Nuclear Information System (INIS)

    Schillaci, Orazio; Calabria, Ferdinando; Tavolozza, Mario; Caracciolo, Cristiana Ragano; Orlacchio, Antonio; Danieli, Roberta; Simonetti, Giovanni; Agro, Enrico Finazzi; Miano, Roberto

    2012-01-01

    To evaluate the accuracy of contrast-enhanced 18 F-choline PET/CT in restaging patients with prostate cancer after radical prostatectomy in relation to PSA, PSA velocity (PSAve) and PSA doubling time (PSAdt). PET/CT was performed in 49 patients (age range 58-87 years) with rising PSA (mean 4.13 ng/ml) who were divided in four groups according to PSA level: ≤1 ng/ml, 1 to ≤2 ng/ml, 2 to ≤4 ng/ml, and >4 ng/ml. PSAve and PSAdt were measured. PET and CT scans were interpreted separately and then together. PET/CT diagnosed relapse in 33 of the 49 patients (67%). The detection rates were 20%, 55%, 80% and 87% in the PSA groups ≤1, 1 to ≤2, 2 to ≤4 and >4 ng/ml, respectively. PET/CT was positive in 7 of 18 patients (38.9%) with a PSA ≤2 ng/ml, and in 26 of 31 (83.9%) with a PSA >2 ng/ml. PET/CT was positive in 7 of 25 patients (84%) with PSAdt ≤6 months, and in 12 of 24 patients (50%) with PSAdt >6 months, and was positive in 26 of 30 patients (86%) with a PSAve >2 ng/ml per year, and in 7 of 19 patients (36.8%) with PSAve ≤2 ng/ml per year. PET alone was positive in 31 of 49 patients (63.3%), and of these 31 patients, CT was negative in 14 but diagnosed bone lesions in 2 patients in whom PET alone was negative. CT with the administration of intravenous contrast medium did not provide any further information. Detection rate of 18 F-choline imaging is closely related to PSA and PSA kinetics. In particular, 18 F-choline PET/CT is recommended in patients with PSA >2 ng/ml, PSAdt ≤6 months and PSAve >2 ng/ml per year. CT is useful for detecting bone metastases that are not 18 F-choline-avid. The use of intravenous contrast agent seems unnecessary. (orig.)

  1. Influence of PSA, PSA velocity and PSA doubling time on contrast-enhanced {sup 18}F-choline PET/CT detection rate in patients with rising PSA after radical prostatectomy

    Energy Technology Data Exchange (ETDEWEB)

    Schillaci, Orazio [University ' ' Tor Vergata' ' , Department of Biopathology and Diagnostic Imaging, Interventional, Rome (Italy); IRCCS Neuromed, Department of Nuclear Medicine and Molecular Imaging, Pozzilli (Italy); Calabria, Ferdinando [IRCCS Neuromed, Department of Nuclear Medicine and Molecular Imaging, Pozzilli (Italy); Tavolozza, Mario; Caracciolo, Cristiana Ragano; Orlacchio, Antonio; Danieli, Roberta; Simonetti, Giovanni [University ' ' Tor Vergata' ' , Department of Biopathology and Diagnostic Imaging, Interventional, Rome (Italy); Agro, Enrico Finazzi; Miano, Roberto [University Hospital ' ' Tor Vergata' ' , Department of Urology, Rome (Italy)

    2012-04-15

    To evaluate the accuracy of contrast-enhanced {sup 18}F-choline PET/CT in restaging patients with prostate cancer after radical prostatectomy in relation to PSA, PSA velocity (PSAve) and PSA doubling time (PSAdt). PET/CT was performed in 49 patients (age range 58-87 years) with rising PSA (mean 4.13 ng/ml) who were divided in four groups according to PSA level: {<=}1 ng/ml, 1 to {<=}2 ng/ml, 2 to {<=}4 ng/ml, and >4 ng/ml. PSAve and PSAdt were measured. PET and CT scans were interpreted separately and then together. PET/CT diagnosed relapse in 33 of the 49 patients (67%). The detection rates were 20%, 55%, 80% and 87% in the PSA groups {<=}1, 1 to {<=}2, 2 to {<=}4 and >4 ng/ml, respectively. PET/CT was positive in 7 of 18 patients (38.9%) with a PSA {<=}2 ng/ml, and in 26 of 31 (83.9%) with a PSA >2 ng/ml. PET/CT was positive in 7 of 25 patients (84%) with PSAdt {<=}6 months, and in 12 of 24 patients (50%) with PSAdt >6 months, and was positive in 26 of 30 patients (86%) with a PSAve >2 ng/ml per year, and in 7 of 19 patients (36.8%) with PSAve {<=}2 ng/ml per year. PET alone was positive in 31 of 49 patients (63.3%), and of these 31 patients, CT was negative in 14 but diagnosed bone lesions in 2 patients in whom PET alone was negative. CT with the administration of intravenous contrast medium did not provide any further information. Detection rate of {sup 18}F-choline imaging is closely related to PSA and PSA kinetics. In particular, {sup 18}F-choline PET/CT is recommended in patients with PSA >2 ng/ml, PSAdt {<=}6 months and PSAve >2 ng/ml per year. CT is useful for detecting bone metastases that are not {sup 18}F-choline-avid. The use of intravenous contrast agent seems unnecessary. (orig.)

  2. Double layers and circuits in astrophysics

    International Nuclear Information System (INIS)

    Alfven, H.

    1986-05-01

    As the rate of energy release in a double layer with voltage DeltaV is P corresponding to IDeltaV, a double layer must be treated part of a circuit which delivers the current I. As neither double layer nor circuit can be derived from magnetofluid models of a plasma, such models are useless for treating energy transfer by menas of double layers. They must be replaced by particle models and circuit theory. A simple circuit is suggested which is applied to the energizing of auroroal particles, to solar flares, and to intergalactic double radio sources. Application to the heliospheric current systems leads to the prediction of two double layers on the sun's axis which may give radiations detectable from earth. Double layers in space should be classified as a new type of celestial object (one example is the double radio sources). It is tentatively suggested in X-ray and gamma-ray bursts may be due to exploding double layers (although annihilation is an alternative energy source). A study of how a number of the most used textbooks in astrophysics treat important concepts like double layers, critical velocity, pinch effects and circuits is made. It is found that students using these textbooks remain essentially ignorant of even the existence of these, in spite of the fact that some of them have been well known for half a centry (e.g., double layers, Langmuir, 1929: pinch effect, Bennet, 1934). The conclusion is that astrophysics is too important to be left in the hands of the astrophysicist. Earth bound and space telescope data must be treated by scientists who are familiar with laboratory and magnetospheric physics and circuit theory, and of course with modern plasma theory. At least by volume the universe consists to more than 99 percent of plasma, and electromagnetic forces are 10/sup39/ time stronger than gravitation

  3. Measurement of Radon-Induced Backgrounds in the NEXT Double Beta Decay Experiment

    Energy Technology Data Exchange (ETDEWEB)

    Novella, P.; et al.

    2018-04-02

    The measurement of the internal 222Rn activity in the NEXT-White detector during the so-called Run-II period with 136Xe-depleted xenon is discussed in detail, together with its implications for double beta decay searches in NEXT. The activity is measured through the alpha production rate induced in the fiducial volume by 222Rn and its alpha-emitting progeny. The specific activity is measured to be $(37.5\\pm 2.3~\\mathrm{(stat.)}\\pm 5.9~\\mathrm{(syst.)})$~mBq/m$^3$. Radon-induced electrons have also been characterized from the decay of the 214Bi daughter ions plating out on the cathode of the time projection chamber. From our studies, we conclude that radon-induced backgrounds are sufficiently low to enable a successful NEXT-100 physics program, as the projected rate contribution should not exceed 0.2~counts/yr in the neutrinoless double beta decay sample.

  4. Colloquium : The future of double β decay research

    International Nuclear Information System (INIS)

    Zdesenko, Yuri

    2002-01-01

    The current results and future perspectives of 2β decay research are reviewed. The present status of neutrino physics makes it necessary to enhance the sensitivity of 2β decay experiments (in terms of the half-life limit for the neutrinoless mode) to the level of 10 26 -10 28 yr. Requirements for future supersensitivity projects are formulated and it is concluded that such a goal will certainly be reached in the most realistic next generation experiments (e.g., CAMEO, CUORE, GEM, GENIUS, and MAJORANA), where restrictions on the neutrino mass may be pushed down to m ν ≤0.01-0.05 eV. In addition, the GEM and GENIUS projects may advance the best current limits on the existence of neutralinos--as dark matter candidates--by three orders of magnitude, and at the same time may be able to identify unambiguously the dark matter signal by detection of its seasonal modulation. All of these results will provide crucial tests of the key theoretical models of modern astroparticle physics and cosmology

  5. Observing Double Stars

    Science.gov (United States)

    Genet, Russell M.; Fulton, B. J.; Bianco, Federica B.; Martinez, John; Baxter, John; Brewer, Mark; Carro, Joseph; Collins, Sarah; Estrada, Chris; Johnson, Jolyon; Salam, Akash; Wallen, Vera; Warren, Naomi; Smith, Thomas C.; Armstrong, James D.; McGaughey, Steve; Pye, John; Mohanan, Kakkala; Church, Rebecca

    2012-05-01

    Double stars have been systematically observed since William Herschel initiated his program in 1779. In 1803 he reported that, to his surprise, many of the systems he had been observing for a quarter century were gravitationally bound binary stars. In 1830 the first binary orbital solution was obtained, leading eventually to the determination of stellar masses. Double star observations have been a prolific field, with observations and discoveries - often made by students and amateurs - routinely published in a number of specialized journals such as the Journal of Double Star Observations. All published double star observations from Herschel's to the present have been incorporated in the Washington Double Star Catalog. In addition to reviewing the history of visual double stars, we discuss four observational technologies and illustrate these with our own observational results from both California and Hawaii on telescopes ranging from small SCTs to the 2-meter Faulkes Telescope North on Haleakala. Two of these technologies are visual observations aimed primarily at published "hands-on" student science education, and CCD observations of both bright and very faint doubles. The other two are recent technologies that have launched a double star renaissance. These are lucky imaging and speckle interferometry, both of which can use electron-multiplying CCD cameras to allow short (30 ms or less) exposures that are read out at high speed with very low noise. Analysis of thousands of high speed exposures allows normal seeing limitations to be overcome so very close doubles can be accurately measured.

  6. Formation of double layers

    International Nuclear Information System (INIS)

    Leung, P.; Wong, A.Y.; Quon, B.H.

    1981-01-01

    Experiments on both stationary and propagating double layers and a related analytical model are described. Stationary double layers were produced in a multiple plasma device, in which an electron drift current was present. An investigation of the plasma parameters for the stable double layer condition is described. The particle distribution in the stable double layer establishes a potential profile, which creates electron and ion beams that excite plasma instabilities. The measured characteristics of the instabilities are consistent with the existence of the double layer. Propagating double layers are formed when the initial electron drift current is large. Ths slopes of the transition region increase as they propagate. A physical model for the formation of a double layer in the experimental device is described. This model explains the formation of the low potential region on the basis of the space charge. This space charge is created by the electron drift current. The model also accounts for the role of ions in double layer formation and explains the formation of moving double layers. (Auth.)

  7. Search for the Neutrino Less Double Beta Decay

    Energy Technology Data Exchange (ETDEWEB)

    Efremenko, Yuri [Univ. of Tennessee, Knoxville, TN (United States). Dept. of Physics and Astronomy

    2016-07-11

    During the past few years our understanding of neutrino properties has reached a new level, with experiments such as Super-K, SNO, KamLAND, and others obtaining exciting results. Major questions such as “Do neutrinos have mass?” and “Do neutrinos oscillate?” now have positive answers. However, an extensive program of neutrino research remains. Undoubtedly, the most important of these is the question pointed out by the National Research Council in its February 2002 report “Connecting Quarks with the Cosmos”, specifically: What are the masses of neutrinos and how have they shaped the evolution of the Universe? The MAJORANA collaboration has proposed to build the world’s most sensitive one-ton scale experiment to search for neutrino less double beta decay to answer this question. In its initial stage, the collaboration is building a prototype MAJORANA DEMONSTRATOR (MJD) experiment consisting of detectors made out of enriched Ge76 with a total sensitive mass of ~30 kg. This will accomplish two goals. First, it will test not yet confirmed claim for observation of neutrino-less double beta decay. Second, it will establish that the selected technology is capable of extension to a one-ton experiment with sufficient sensitivity to measure neutrino mass mββ down to 10 meV. To achieve the last goal, collaboration must demonstrate that a background level of 1 count per year per 4 keV per ton of detector is achievable. The University of Tennessee (UT) neutrino group has made a major commitment to the MJD. P.I. accepted the responsibility for one of the major tasks of the experiment, “Materials and Assay Task” which is crucial to the achievement of low background levels required for the experiment. In addition, the UT group is committed to construct, commission, and operate the MJD active veto system. Those activities were supported by NP-DOE via program funding for “Search for the Neutrino Less Double Beta Decay” at the University

  8. Double deflation and aggregation

    NARCIS (Netherlands)

    Dietzenbacher, Erik; Hoen, A.R.

    Published input-output tables in constant prices are relatively scarce. Therefore, input-output tables often have to be deflated by the practitioners themselves. The method of double deflation is used predominantly for this purpose. The present paper shows that the double-deflation method is subject

  9. Single particle detecting telescope system

    International Nuclear Information System (INIS)

    Yamamoto, I.; Tomiyama, T.; Iga, Y.; Komatsubara, T.; Kanada, M.; Yamashita, Y.; Wada, T.; Furukawa, S.

    1981-01-01

    We constructed the single particle detecting telescope system for detecting a fractionally charged particle. The telescope consists of position detecting counters, wall-less multi-cell chambers, single detecting circuits and microcomputer system as data I/0 processor. Especially, a frequency of double particle is compared the case of the single particle detecting with the case of an ordinary measurement

  10. Congenital maxillary double lip

    Directory of Open Access Journals (Sweden)

    Dinesh Singh Chauhan

    2012-01-01

    Full Text Available Double lip, also referred to as "macrocheilia," is a rare anomaly which affects the upper lip more commonly than the lower lip. It consists of a fold of excess or redundant hypertrophic tissue on the mucosal side of the lip. The congenital double lip is believed to be present at birth and becomes more prominent after eruption of teeth. It affects esthetics and also interferes with speech and mastication. Simple surgical excision produces good functional and cosmetic results. We report a case of a non-syndromic congenital maxillary double lip in a 21-year-old male patient.

  11. Pion double charge exchange

    International Nuclear Information System (INIS)

    Cooper, M.D.

    1978-01-01

    The pion double charge exchange data on the oxygen isotopes is reviewed and new data on 9 Be, 12 C, 24 Mg, and 28 Si are presented. Where theoretical calculations exist, they are compared to the data. 9 references

  12. Project Half Double

    DEFF Research Database (Denmark)

    Svejvig, Per; Ehlers, Michael; Adland, Karoline Thorp

    activities carried out within the framework of the projects. The formal part of Project Half Double was initiated in June 2015. We started out by developing, refining and testing the Half Double methodology on seven pilot projects in the first phase of the project, which will end June 2016. The current......Project Half Double has a clear mission to succeed in finding a project methodology that can increase the success rate of our projects while increasing the speed at which we generate new ideas and develop new products and services. Chaos and complexity should be seen as a basic condition...... and as an opportunity rather than a threat and a risk. We are convinced that by doing so, we can strengthen Denmark’s competitiveness and play an important role in the battle for jobs and future welfare. The overall goal is to deliver “projects in half the time with double the impact”, where projects in half the time...

  13. Project Half Double

    DEFF Research Database (Denmark)

    Svejvig, Per; Gerstrøm, Anna; Frederiksen, Signe Hedeboe

    The Half Double mission: Project Half Double has a clear mission. We want to succeed in finding a project methodology that can increase the success rate of our projects while increasing the development speed of new products and services. We are convinced that by doing so we can strengthen...... the competitiveness of Denmark and play an important role in the battle for jobs and future welfare. The overall goal is to deliver “Projects in half the time with double the impact” where projects in half the time should be understood as half the time to impact (benefit realization, effect is achieved......) and not as half the time for project execution. The Half Double project journey: It all began in May 2013 when we asked ourselves: How do we create a new and radical project paradigm that can create successful projects? Today we are a movement of hundreds of passionate project people, and it grows larger...

  14. A double layer review

    International Nuclear Information System (INIS)

    Block, L.P.

    1977-06-01

    A review of the main results on electrostatic double layers (sometimes called space charge layers or sheaths) obtained from theory, and laboratory and space experiments up to the spring of 1977 is given. By means of barium jets and satellite probes, double layers have now been found at the altitudes, earlier predicted theoretically. The general potential distribution above the auroral zone, suggested by inverted V-events and electric field reversals, is corroborated. (author)

  15. Pulse-shape discrimination techniques for the COBRA double beta-decay experiment at LNGS

    Science.gov (United States)

    Zatschler, S.; COBRA Collaboration

    2017-09-01

    In modern elementary particle physics several questions arise from the fact that neutrino oscillation experiments have found neutrinos to be massive. Among them is the so far unknown nature of neutrinos: either they act as so-called Majorana particles, where one cannot distinguish between particle and antiparticle, or they are Dirac particles like all the other fermions in the Standard Model. The study of neutrinoless double beta-decay (0νββ-decay), where the lepton number conservation is violated by two units, could answer the question regarding the underlying nature of neutrinos and might also shed light on the mechanism responsible for the mass generation. So far there is no experimental evidence for the existence of 0νββ-decay, hence, existing experiments have to be improved and novel techniques should be explored. One of the next-generation experiments dedicated to the search for this ultra-rare decay is the COBRA experiment. This article gives an overview of techniques to identify and reject background based on pulse-shape discrimination.

  16. Consistency check of pulse shape discrimination for broad energy germanium detectors using double beta decay data

    Energy Technology Data Exchange (ETDEWEB)

    Liao, Heng-Ye [Max-Planck-Institut fuer Physik, Muenchen (Germany); Collaboration: GERDA-Collaboration

    2013-07-01

    The Gerda (GERmanium Detector Array) experiment was built to study fundamental neutrino properties via neutrinoless double beta decay (0νββ). 0νββ events are single-site events (SSE) confined to a scale about millimeter. However, most of backgrounds are multi-site events (MSE). Broad Energy Germanium detectors (BEGes) offer the potential merits of improved pulse shape recognition efficiencies of SSE/MSE. They allow us to reach the goal of Phase II with a background index of 10{sup -3} cts/(keV.kg.yr) in the ROI. BEGe detectors with a total target mass of 3.63 kg have been installed to the Gerda setup in the Laboratori Nazionali del Gran Sasso (LNGS) in July 2012 and are collecting data since. A consistency check of the pulse shape discrimination (PSD) efficiencies by comparison of calibration data and 2νββ data will be presented. The PSD power of these detectors is demonstrated.

  17. LBL/UCSB 76Ge double beta decay experiment: first results

    International Nuclear Information System (INIS)

    Goulding, F.S.; Cork, C.P.; Landis, D.A.

    1984-10-01

    A paper given at the IEEE Nuclear Science Symposium last year presented the scientific justification for this experiment and discussed the design of the detector system. At the present time two of the dual detector systems (i.e., four out of a final total of eight detectors) are operating in the complete active/passive shield in the low background laboratory at LBL. Early results (1620 h) of an experiment using two detectors yield a limit of 4 x 10 22 years (68% confidence) for the half life of the neutrinoless double beta decay (ββ/sub o nu/) of 76 Ge. Although this experiment was carried out above ground, the result approaches those achieved by other groups in deep underground laboratories. Based on studies of the origins of background in our system, we hope to reach a limit of 3 x 10 23 years (or more) in a two month/four detector experiment to be carried out soon in an underground facility

  18. A scintillating bolometer array for double beta decay studies: The LUCIFER experiment

    Energy Technology Data Exchange (ETDEWEB)

    Gironi, L., E-mail: luca.gironi@mib.infn.it [Università degli Studi di Milano-Bicocca, Milano (Italy); INFN – Sezione di Milano-Bicocca, Milano (Italy)

    2016-07-11

    The main goal of the LUCIFER experiment is to study the neutrinoless double beta decay, a rare process allowed if neutrinos are Majorana particles. Although aiming at a discovery, in the case of insufficient sensitivity the LUCIFER technique will be the demonstrator for a higher mass experiment able to probe the entire inverted hierarchy region of the neutrino mass. In order to achieve this challenging result, high resolution detectors with active background discrimination capability are required. This very interesting possibility can be largely fulfilled by scintillating bolometers thanks to the simultaneous read-out of heat and light emitted by the interactions in the detector or by pulse shape analysis. - Highlights: • The LUCIFER technique will be the demonstrator for a higher mass experiment. • Scintillating bolometers allow high energy resolution and background discrimination. • The first choice for the LUCIFER tower are ZnSe crystals. • The LUCIFER setup will consist of an array of 30 individual single module detectors. • An array of ZnMoO4 crystals allowed the bolometric observation of the 2vDBD of {sup 100}Mo.

  19. Neutrino mass, the right-handed interaction and the double beta decay, 2

    International Nuclear Information System (INIS)

    Doi, Masaru; Kotani, Tsuneyuki; Nishiura, Hiroyuki; Okuda, Kazuko; Takasugi, Eiichi.

    1981-01-01

    Based on the formulae for the double β decay obtained in the previous paper, the general properties of 0 + → J + transitions are discussed and the analysis of the experimental data is presented. It is found that, for the two neutrino mode, the 0 + → 0 + transition in the two nucleon (2n)-mechanism dominates over the 0 + → 2 + transition as well as the contribution from the N*-mechanism. For the neutrinoless mode, only the 0 + → 0 + transition in the 2n-mechanism is allowed if there is no right-handed interaction. When the right-handed interaction gives a sizable contribution, the role of the 0 + → 2 + transition becomes as important as the 0 + → 0 + transition in this mode. It is concluded that the experimental data on the ratio of the 128 Te to 130 Te half-lives by Hennecke et al. suggest that neutrinos are Majorana particles, if we take the Vergados estimation of the nuclear matrix elements. Moreover, we find that the weighted average of neutrino masses is around 34 eV if there is no right-handed interaction. (author)

  20. Radiopurity assessment of the energy readout for the NEXT double beta decay experiment

    Science.gov (United States)

    Cebrián, S.; Pérez, J.; Bandac, I.; Labarga, L.; Álvarez, V.; Azevedo, C. D. R.; Benlloch-Rodríguez, J. M.; Borges, F. I. G. M.; Botas, A.; Cárcel, S.; Carrión, J. V.; Conde, C. A. N.; Díaz, J.; Diesburg, M.; Escada, J.; Esteve, R.; Felkai, R.; Fernandes, L. M. P.; Ferrario, P.; Ferreira, A. L.; Freitas, E. D. C.; Goldschmidt, A.; Gómez-Cadenas, J. J.; González-Díaz, D.; Gutiérrez, R. M.; Hauptman, J.; Henriques, C. A. O.; Hernandez, A. I.; Hernando Morata, J. A.; Herrero, V.; Jones, B. J. P.; Laing, A.; Lebrun, P.; Liubarsky, I.; López-March, N.; Losada, M.; Martín-Albo, J.; Martínez-Lema, G.; Martínez, A.; McDonald, A. D.; Monrabal, F.; Monteiro, C. M. B.; Mora, F. J.; Moutinho, L. M.; Muñoz Vidal, J.; Musti, M.; Nebot-Guinot, M.; Novella, P.; Nygren, D. R.; Palmeiro, B.; Para, A.; Querol, M.; Renner, J.; Ripoll, L.; Rodríguez, J.; Rogers, L.; Santos, F. P.; dos Santos, J. M. F.; Simón, A.; Sofka, C.; Sorel, M.; Stiegler, T.; Toledo, J. F.; Torrent, J.; Tsamalaidze, Z.; Veloso, J. F. C. A.; Villar, J. A.; Webb, R.; White, J. T.; Yahlali, N.

    2017-08-01

    The "Neutrino Experiment with a Xenon Time-Projection Chamber" (NEXT) experiment intends to investigate the neutrinoless double beta decay of 136Xe, and therefore requires a severe suppression of potential backgrounds. An extensive material screening and selection process was undertaken to quantify the radioactivity of the materials used in the experiment. Separate energy and tracking readout planes using different sensors allow us to combine the measurement of the topological signature of the event for background discrimination with the energy resolution optimization. The design of radiopure readout planes, in direct contact with the gas detector medium, was especially challenging since the required components typically have activities too large for experiments demanding ultra-low background conditions. After studying the tracking plane, here the radiopurity control of the energy plane is presented, mainly based on gamma-ray spectroscopy using ultra-low background germanium detectors at the Laboratorio Subterr&aposaneo de Canfranc (Spain). All the available units of the selected model of photomultiplier have been screened together with most of the components for the bases, enclosures and windows. According to these results for the activity of the relevant radioisotopes, the selected components of the energy plane would give a contribution to the overall background level in the region of interest of at most 2.4×10-4 counts keV-1 kg-1 y-1, satisfying the sensitivity requirements of the NEXT experiment.

  1. Radon and material radiopurity assessment for the NEXT double beta decay experiment

    Energy Technology Data Exchange (ETDEWEB)

    Cebrián, S.; Dafni, T.; González-Díaz, D.; Herrera, D. C.; Irastorza, I. G.; Luzón, G.; Ortiz de Solórzano, A.; Villar, J. A. [Laboratorio de Física Nuclear y Astropartículas, Universidad de Zaragoza, C/ Pedro Cerbuna 12, 50009 Zaragoza (Spain); Laboratorio Subterráneo de Canfranc, Paseo de los Ayerbe s/n, 22880 Canfranc Estación, Huesca (Spain); Pérez, J. [Instituto de Física Teórica, UAM/CSIC, Campus de Cantoblanco, 28049 Madrid (Spain); Bandac, I. [Laboratorio Subterráneo de Canfranc, Paseo de los Ayerbe s/n, 22880 Canfranc Estación, Huesca (Spain); Labarga, L. [Dpto. de Física Teórica, Universidad Autónoma de Madrid, Campus de Cantoblanco, 28049 Madrid (Spain); Álvarez, V.; Cárcel, S.; Cervera, A.; Díaz, J.; Ferrario, P.; Gómez-Cadenas, J. J.; Laing, A.; Liubarsky, I.; López-March, N. [Instituto de Física Corpuscular, CSIC & Universitat de València, C/ Catedrático José Beltrán, 2, 46980 Paterna, Valencia (Spain); and others

    2015-08-17

    The ”Neutrino Experiment with a Xenon TPC” (NEXT), intended to investigate the neutrinoless double beta decay using a high-pressure xenon gas TPC filled with Xe enriched in {sup 136}Xe at the Canfranc Underground Laboratory in Spain, requires ultra-low background conditions demanding an exhaustive control of material radiopurity and environmental radon levels. An extensive material screening process is underway for several years based mainly on gamma-ray spectroscopy using ultra-low background germanium detectors in Canfranc but also on mass spectrometry techniques like GDMS and ICPMS. Components from shielding, pressure vessel, electroluminescence and high voltage elements and energy and tracking readout planes have been analyzed, helping in the final design of the experiment and in the construction of the background model. The latest measurements carried out will be presented and the implication on NEXT of their results will be discussed. The commissioning of the NEW detector, as a first step towards NEXT, has started in Canfranc; in-situ measurements of airborne radon levels were taken there to optimize the system for radon mitigation and will be shown too.

  2. Nuclear transparency and double beta decay of molybdenum 100. Annual progress report, February 1, 1994--January 31, 1995

    International Nuclear Information System (INIS)

    Nicholson, H.W.

    1994-07-01

    During the past year, work has been nearly completed on a Physical Review paper with final results of a search for neutrinoless double-β decay of molybdenum 100 with collaborators from LBL, the University of New Mexico, and the Idaho Engineering Laboratory. Major part of this work was to carry out an extensive statistical analysis of the data. During the spring of 1994, Sean Sutton spent the majority of this time at Orsay, France working on NEMO 3, a next generation double-β decay experiment involving molybdenum 100 and other isotopes. Nicholson and Sutton have designed and built a scintillating fiber hadoscope used in the May--July AGS high energy physics run at BNL in AGS experiment 850 to measure color transparency. Professor Nicholson has had primary responsibility for the design, construction, and installation of this hodoscope and for overseeing the construction and installation of two scintillating counter upstream hodoscopes. To date, the fiber hodoscope had handled total beam rates exceeding 20 MHz with beam rates as high as 10 MHz on a single fiber. Light intensification and readout electronics to be used in the CsI(Tl) calorimeter in the SLAC B factory has just begun this summer

  3. Aristotle and Double Effect

    DEFF Research Database (Denmark)

    Di Nucci, Ezio

    2014-01-01

    There are some interesting similarities between Aristotle’s ‘mixed actions’ in Book III of the Nicomachean Ethics and the actions often thought to be justifiable with the Doctrine of Double Effect. Here I analyse these similarities by comparing Aristotle’s examples of mixed actions with standard...... cases from the literature on double effect such as, amongst others, strategic bombing, the trolley problem, and craniotomy. I find that, despite some common features such as the dilemmatic structure and the inevitability of a bad effect, Aristotle’s mixed actions do not count as cases justifiable...... through application of the Doctrine of Double Effect because they fail to meet the crucial necessary condition of the Doctrine according to which the bad effect can only be a merely foreseen side- effect and not an intended means....

  4. Coulomb double helical structure

    Science.gov (United States)

    Kamimura, Tetsuo; Ishihara, Osamu

    2012-01-01

    Structures of Coulomb clusters formed by dust particles in a plasma are studied by numerical simulation. Our study reveals the presence of various types of self-organized structures of a cluster confined in a prolate spheroidal electrostatic potential. The stable configurations depend on a prolateness parameter for the confining potential as well as on the number of dust particles in a cluster. One-dimensional string, two-dimensional zigzag structure and three-dimensional double helical structure are found as a result of the transition controlled by the prolateness parameter. The formation of stable double helical structures resulted from the transition associated with the instability of angular perturbations on double strings. Analytical perturbation study supports the findings of numerical simulations.

  5. John Deakin: Double Exposures

    Directory of Open Access Journals (Sweden)

    Paul Rousseau

    2015-11-01

    Full Text Available In this series of short films made by Jonathan Law, the art historian James Boaden, and the curator of The John Deakin Archive, Paul Rousseau, discuss the double-exposure images made by the photographer John Deakin (1912-1972 in the 1950s and 1960s. The films ask you, firstly, to look closely at the images being discussed. Each one begins with a sustained and intense shot of a single image before opening up to a wide-ranging discussion about Deakin, double exposures, and photography.

  6. Double Photoionization Near Threshold

    Science.gov (United States)

    Wehlitz, Ralf

    2007-01-01

    The threshold region of the double-photoionization cross section is of particular interest because both ejected electrons move slowly in the Coulomb field of the residual ion. Near threshold both electrons have time to interact with each other and with the residual ion. Also, different theoretical models compete to describe the double-photoionization cross section in the threshold region. We have investigated that cross section for lithium and beryllium and have analyzed our data with respect to the latest results in the Coulomb-dipole theory. We find that our data support the idea of a Coulomb-dipole interaction.

  7. Double Chooz experiment

    International Nuclear Information System (INIS)

    Palomares, C.

    2009-01-01

    Double Chooz will use two identical detectors at different distances from the Chooz nuclear power station to search for a non-vanishing value of θ 13 , and, hopefully, to open the way to experiments aspiring to discover CP violation in the leptonic sector. The far detector is expected to be operative by the end of 2009. Installation of the near detector will occur in 2010. Double Chooz has the capacity to exclude sin 2 (2θ 13 ) 31 2 = 2.5 x 10 -3 eV 2 with three years of data running both near and far detectors. (author)

  8. Double-helix stellarator

    International Nuclear Information System (INIS)

    Moroz, P.E.

    1997-09-01

    A new stellarator configuration, the Double-Helix Stellarator (DHS), is introduced. This novel configuration features a double-helix center post as the only helical element of the stellarator coil system. The DHS configuration has many unique characteristics. One of them is the extreme low plasma aspect ratio, A ∼ 1--1.2. Other advantages include a high enclosed volume, appreciable rotational transform, and a possibility of extreme-high-β MHD equilibria. Moreover, the DHS features improved transport characteristics caused by the absence of the magnetic field ripple on the outboard of the torus. Compactness, simplicity and modularity of the coil system add to the DHS advantages for fusion applications

  9. Is neutrino produced in standard weak interactions a Dirac or Majorana particle?

    International Nuclear Information System (INIS)

    Beshtoev, Kh.M.

    2010-01-01

    This work considers the following problem: what type (Dirac or Majorana) of neutrinos is produced in standard weak interactions? It is concluded that only Dirac neutrinos but not Majorana neutrinos can be produced in these interactions. Then neutrino interacts with W ± and Z bosons but neutrinoless double beta decay is absent. It means that this neutrino will be produced in another type of interaction. Namely, Majorana neutrino will be produced in the interaction which differentiates spin projections but cannot differentiate neutrino (particle) from antineutrino (antiparticle). Then neutrino will interact with W ± bosons and neutrinoless double beta decay will arise. But interaction with Z boson will be absent. Such an interaction has not been discovered yet. Therefore, experiments with very high precision are important to detect the neutrinoless double decays if they are realized in the Nature

  10. Double-beta decay measurement of 100Mo to the excited 01+ state of 100Ru in the NEMO3 experiment - R/D program for SuperNEMO: development of a BiPo detector to measure ultra low contaminations in the source foils

    International Nuclear Information System (INIS)

    Chapon, A.

    2011-10-01

    The NEMO3 detector was designed for the study of double beta decay and in particular the search for neutrinoless double beta decay (ββ0ν). The quantity of 100 Mo in the detector (7 kg) allows also a competitive measurement of the two-neutrino double beta decay (ββ2ν) of 100 Mo to the excited 0 1 + state of 100 Ru (eeNγ channel). Monte-Carlo simulations of the effect and of all the possible sources of background have been studied in order to determine their contributions to the full NEMO3 experimental data (2003-2011). These one have then been analysed: the ββ2ν decay half-life has been measured, and a limit on the ββ0ν decay has been obtained. Moreover, the SuperNEMO experiment aims to reach a sensitivity up to 10 26 years on the half-life of neutrinoless double beta decay. The SuperNEMO detector radioactivity has to be as low as possible. Especially radio-purity levels of 2 μBq*kg -1 in 208 Tl and 10 μBq*kg -1 in 214 Bi are required for the source foils. The gamma-spectrometry can not measure such low contamination levels. Hence, a BiPo dedicated detector has been developed to measure 208 Tl and 214 Bi contaminations, identifying the Bi→Po→Pb β-α chains. A proof of principle has been performed and the detector background has been measured. Assuming these values, a full BiPo detector of 3.6 m 2 can achieve the required sensitivities for the SuperNEMO source foils within six months of measurement. (author)

  11. Double aortic arch

    Science.gov (United States)

    Surgery can be done to fix double aortic arch. The surgeon ties off the smaller branch and separates it from the larger branch. Then the surgeon closes the ends of the aorta with stitches. This relieves pressure on the esophagus and windpipe.

  12. Singapore's double festival

    Energy Technology Data Exchange (ETDEWEB)

    Fraser, Gordon

    1990-09-15

    Coinciding with celebrations for the nation's 25th anniversary, the 25th International Conference on High Energy Physics, held in Singapore from 2-8 August, was itself a double festival, with the Standard Model of contemporary physics and CERN's new LEP electron-positron collider providing the twin themes.

  13. Layered double hydroxides

    DEFF Research Database (Denmark)

    López Rayo, Sandra; Imran, Ahmad; Hansen, Hans Chr. Bruun

    2017-01-01

    A novel zinc (Zn) fertilizer concept based on Zn doped layered double hydroxides (Zn-doped Mg-Fe-LDHs) has been investigated. Zn-doped Mg-Fe-LDHs were synthetized, their chemical composition was analyzed and their nutrient release was studied in buffered solutions with different pH values. Uptake...

  14. Double Beta Decay Experiments

    International Nuclear Information System (INIS)

    Piepke, A.

    2005-01-01

    The experimental observation of neutrino oscillations and thus neutrino mass and mixing gives a first hint at new particle physics. The absolute values of the neutrino mass and the properties of neutrinos under CP-conjugation remain unknown. The experimental investigation of the nuclear double beta decay is one of the key techniques for solving these open problems

  15. Double quick, double click reversible peptide "stapling".

    Science.gov (United States)

    Grison, Claire M; Burslem, George M; Miles, Jennifer A; Pilsl, Ludwig K A; Yeo, David J; Imani, Zeynab; Warriner, Stuart L; Webb, Michael E; Wilson, Andrew J

    2017-07-01

    The development of constrained peptides for inhibition of protein-protein interactions is an emerging strategy in chemical biology and drug discovery. This manuscript introduces a versatile, rapid and reversible approach to constrain peptides in a bioactive helical conformation using BID and RNase S peptides as models. Dibromomaleimide is used to constrain BID and RNase S peptide sequence variants bearing cysteine (Cys) or homocysteine ( h Cys) amino acids spaced at i and i + 4 positions by double substitution. The constraint can be readily removed by displacement of the maleimide using excess thiol. This new constraining methodology results in enhanced α-helical conformation (BID and RNase S peptide) as demonstrated by circular dichroism and molecular dynamics simulations, resistance to proteolysis (BID) as demonstrated by trypsin proteolysis experiments and retained or enhanced potency of inhibition for Bcl-2 family protein-protein interactions (BID), or greater capability to restore the hydrolytic activity of the RNAse S protein (RNase S peptide). Finally, use of a dibromomaleimide functionalized with an alkyne permits further divergent functionalization through alkyne-azide cycloaddition chemistry on the constrained peptide with fluorescein, oligoethylene glycol or biotin groups to facilitate biophysical and cellular analyses. Hence this methodology may extend the scope and accessibility of peptide stapling.

  16. Double contrast arthrography of the shoulder

    International Nuclear Information System (INIS)

    Gasparini, D.

    1991-01-01

    From 1980 to 1989 the author performed 481 double-contrast arthrographic examinations of the shoulder (DCSA). A hundred and forty-two complete and 46 partial rotator cuff tears were demonstrated; 68 of them underwent surgical exploration. Results confirmed DCSA capabilities in detecting both their location (100%) and size (95%). Moreover, thickness (89%) and erosions (94%) in tendon edges and surfaces were demonstrated - that is, all the qualitative information needed to depict degenerative processes. Such evidence may also affect treatment planning

  17. Subatmospheric double containment system

    International Nuclear Information System (INIS)

    Gans, D. Jr.; Noble, J.H.

    1978-01-01

    A reinforced concrete double wall nuclear containment structure with each wall including an essentially impervious membrane or liner and porous concrete filling the annulus between the two walls is described. The interior of the structure is maintained at subatmospheric pressure, and the annulus between the two walls is maintained at a subatmospheric pressure intermediate between that of the interior and the surrounding atmospheric pressure, during normal operation. In the event of an accident within the containment structure the interior pressure may exceed atmospheric pressure, but leakage from the interior to the annulus between the double walls will not result in the pressure of the annulus exceeding atmospheric pressure so that there is no net outleakage from the containment structure

  18. Double rupture disc experience

    International Nuclear Information System (INIS)

    1979-01-01

    Result of these observations, comparisons and evaluations can be summarized in the following list of concerns regarding the use of double rupture discs coupled to the liquid space of a steam generator that is subjected to a large leak sodium water reaction event. Single rupture disc show delayed collapse characteristics in LLTR Series I and double disc assemblies are presumed to be more complex with additional delay before opening to give pressure relief. Delayed failure increases pressures in the IHTS and must be adequately covered by design requirements. With CRBR design, the first disc may fail only partially reducing the loading on the second disc with the result that relief performance may not meet requirements

  19. Gravitational double layers

    International Nuclear Information System (INIS)

    Senovilla, José M M

    2014-01-01

    I analyze the properties of thin shells through which the scalar curvature R is discontinuous in gravity theories with Lagrangian F(R) = R − 2Λ + αR 2 on the bulk. These shells/domain walls are of a new kind because they possess, in addition to the standard energy–momentum tensor, an external energy flux vector, an external scalar pressure/tension and, most exotic of all, another energy–momentum contribution resembling classical dipole distributions on a shell: a double layer. I prove that all these contributions are necessary to make the entire energy–momentum tensor divergence-free. This is the first known occurrence of such a type of double layer in a gravity theory. I present explicit examples in constant-curvature five-dimensional bulks, with a brief study of their properties: new physical behaviors arise. (fast track communications)

  20. The double Laplacian growth

    International Nuclear Information System (INIS)

    Loutsenko, I.; Yermolayeva, O.

    2008-06-01

    The dynamics of the idealized Laplacian growth (or the Hele-Shaw problem) can be approximated by the Poiselle flow which in appropriate units takes the form of the Darcy law. In this paper we account for the liquid inertia in the Hele-Shaw problem at zero surface tension limit. The Laplace dynamics for the pressure is extended here with one more for the velocity potential for which we call this growth process the Double Laplacian. The application of the conformal mappings technique leads to doubled dynamics for both the conformal map and the complex potential, which is presented in the paper for the radial and the planar growth. We apply the stability analysis and discuss the integrability for the stated problem. (author)

  1. Algebra of Majorana doubling.

    Science.gov (United States)

    Lee, Jaehoon; Wilczek, Frank

    2013-11-27

    Motivated by the problem of identifying Majorana mode operators at junctions, we analyze a basic algebraic structure leading to a doubled spectrum. For general (nonlinear) interactions the emergent mode creation operator is highly nonlinear in the original effective mode operators, and therefore also in the underlying electron creation and destruction operators. This phenomenon could open up new possibilities for controlled dynamical manipulation of the modes. We briefly compare and contrast related issues in the Pfaffian quantum Hall state.

  2. Twisted quantum doubles

    Directory of Open Access Journals (Sweden)

    Daijiro Fukuda

    2004-01-01

    Full Text Available Using diagrammatic pictures of tensor contractions, we consider a Hopf algebra (Aop⊗ℛλA** twisted by an element ℛλ∈A*⊗Aop corresponding to a Hopf algebra morphism λ:A→A. We show that this Hopf algebra is quasitriangular with the universal R-matrix coming from ℛλ when λ2=idA, generalizing the quantum double construction which corresponds to the case λ=idA.

  3. Ac-induced disruption of the doubleDs structure in tomato

    NARCIS (Netherlands)

    Rommens, Caius M.T.; Biezen, Erik A. van der; Ouwerkerk, Pieter B.F.; Nijkamp, H. John J.; Hille, Jacques

    1991-01-01

    The maize doubleDs element is stably maintained in the tomato genome. Upon the subsequent introduction of Ac into a plant containing doubleDs, disruption of the doubleDs structure and DNA rearrangements at the site of the doubleDs element were observed. No indications were obtained for excision of

  4. Conical Double Frequency Emission by Femtosecond Laser Pulses from DKDP

    International Nuclear Information System (INIS)

    Xi-Peng, Zhang; Hong-Bing, Jiang; Shan-Chun, Tang; Qi-Huang, Gong

    2009-01-01

    Conical double frequency emission is investigated by femtosecond laser pulses at a wavelength of 800 nm in a DKDP crystal. It is demonstrated that the sum frequency of incident wave and its scattering wave accounts for the conical double frequency emission. The gaps on the conical rings are observed and they are very sensitive to the propagation direction, and thus could be used to detect the small angle deviation of surface direction. (fundamental areas of phenomenology (including applications))

  5. A double-pass interferometer for measurement of dimensional changes

    International Nuclear Information System (INIS)

    Ren, Dongmei; Lawton, K M; Miller, J A

    2008-01-01

    A double-pass interferometer was developed for measuring dimensional changes of materials in a nanoscale absolute interferometric dilatometer. This interferometer realized the double-ended measurement of a sample using a single-detection double-pass interference system. The nearly balanced design, in which the measurement beam and the reference beam have equal optical path lengths except for the path difference caused by the sample itself, makes this interferometer have high stability, which is verified by the measurement of a quasi-zero-length sample. The preliminary experiments and uncertainty analysis show that this interferometer should be able to measure dimensional changes with characteristic uncertainty at the nanometer level

  6. A Unimodal Model for Double Observer Distance Sampling Surveys.

    Directory of Open Access Journals (Sweden)

    Earl F Becker

    Full Text Available Distance sampling is a widely used method to estimate animal population size. Most distance sampling models utilize a monotonically decreasing detection function such as a half-normal. Recent advances in distance sampling modeling allow for the incorporation of covariates into the distance model, and the elimination of the assumption of perfect detection at some fixed distance (usually the transect line with the use of double-observer models. The assumption of full observer independence in the double-observer model is problematic, but can be addressed by using the point independence assumption which assumes there is one distance, the apex of the detection function, where the 2 observers are assumed independent. Aerially collected distance sampling data can have a unimodal shape and have been successfully modeled with a gamma detection function. Covariates in gamma detection models cause the apex of detection to shift depending upon covariate levels, making this model incompatible with the point independence assumption when using double-observer data. This paper reports a unimodal detection model based on a two-piece normal distribution that allows covariates, has only one apex, and is consistent with the point independence assumption when double-observer data are utilized. An aerial line-transect survey of black bears in Alaska illustrate how this method can be applied.

  7. The Double Star mission

    Directory of Open Access Journals (Sweden)

    Liu

    2005-11-01

    Full Text Available The Double Star Programme (DSP was first proposed by China in March, 1997 at the Fragrant Hill Workshop on Space Science, Beijing, organized by the Chinese Academy of Science. It is the first mission in collaboration between China and ESA. The mission is made of two spacecraft to investigate the magnetospheric global processes and their response to the interplanetary disturbances in conjunction with the Cluster mission. The first spacecraft, TC-1 (Tan Ce means "Explorer", was launched on 29 December 2003, and the second one, TC-2, on 25 July 2004 on board two Chinese Long March 2C rockets. TC-1 was injected in an equatorial orbit of 570x79000 km altitude with a 28° inclination and TC-2 in a polar orbit of 560x38000 km altitude. The orbits have been designed to complement the Cluster mission by maximizing the time when both Cluster and Double Star are in the same scientific regions. The two missions allow simultaneous observations of the Earth magnetosphere from six points in space. To facilitate the comparison of data, half of the Double Star payload is made of spare or duplicates of the Cluster instruments; the other half is made of Chinese instruments. The science operations are coordinated by the Chinese DSP Scientific Operations Centre (DSOC in Beijing and the European Payload Operations Service (EPOS at RAL, UK. The spacecraft and ground segment operations are performed by the DSP Operations and Management Centre (DOMC and DSOC in China, using three ground station, in Beijing, Shanghai and Villafranca.

  8. Double your money

    International Nuclear Information System (INIS)

    Moxon, Suzanne

    1998-01-01

    The government-owned Hydro-Quebec was instructed to take certain actions, one of which was to increase profits. The company has published a report describing its plans for 1998-2002. The company expects to increase sales and double its income over the five years. Hydro-Quebec (which produces or purchases 97% of the electricity consumed in the province) will freeze prices until April 2002. Environmental considerations and liaison with local communities are included in the 5-year plan. The company expects to invest c$1.2B in international markets over the five years and C$20M per year are earmarked for research. (UK)

  9. Layered double hydroxides

    DEFF Research Database (Denmark)

    López Rayo, Sandra; Imran, Ahmad; Hansen, Hans Chr. Bruun

    2017-01-01

    A novel zinc (Zn) fertilizer concept based on Zn doped layered double hydroxides (Zn-doped Mg-Fe-LDHs) has been investigated. Zn-doped Mg-Fe-LDHs were synthetized, their chemical composition was analyzed and their nutrient release was studied in buffered solutions with different pH values. Uptake...... equation showing maximum release at pH 5.2, reaching approximately 45% of the total Zn content. The Zn concentrations in the plants receiving the LDHs were between 2- and 9.5-fold higher than those in plants without Zn addition. A positive effect of the LDHs was also found in soil. This work documents...

  10. Double sodium rubidium molybdates

    International Nuclear Information System (INIS)

    Mokhoseev, M.V.; Khal'baeva, K.M.; Khajkina, E.G.; Ogurtsov, A.M.

    1990-01-01

    According to ceramic technique double sodium-rubidium molybdates of the compositions Rb 2-x Na x MoO 4 (0.5≤x≤0.67) and Na 3 Rb(MoO 4 ) 2 have been prepared. It is ascertained that Rb 2-x Na x MoO 4 is crystallized in glaserite structural type (trigonal crystal system, sp.gr. P3m1, Z=2) and melts incongruently at 640 deg C. Na 3 Rb(MoO 4 ) 2 at room temperature is unstable and gradually decomposes into Na 2 MoO 4 and Rb 2-x Na x MoO 4

  11. Double profunda brachii artery

    OpenAIRE

    Gavishiddappa A Hadimani; Jyoti V Hadimani; Ishwar B Bagoji; Shardha Bai Rathod; Balappa M Bannur

    2016-01-01

    Brachial artery (BA) is a continuation of the axillary artery at the lower border of teres major. In the cubital fossa, BA divides into radial artery and ulnar artery as terminal branches. Large branch given from the BA in the upper part is profunda brachii artery. In the present case, we noticed double profunda brachii that arises from the BA. They are profunda brachii artery 1 and profunda brachii artery 2. Profunda brachii artery 1 arises in the proximal part of the BA and profunda brachii...

  12. Double-Difference Tomography for Sequestration MVA

    Energy Technology Data Exchange (ETDEWEB)

    Westman, Erik

    2008-12-31

    Analysis of synthetic data was performed to determine the most cost-effective tomographic monitoring system for a geologic carbon sequestration injection site. Double-difference tomographic inversion was performed on 125 synthetic data sets: five stages of CO2 plume growth, five seismic event regions, and five geophone arrays. Each resulting velocity model was compared quantitatively to its respective synthetic velocity model to determine an accuracy value. The results were examined to determine a relationship between cost and accuracy in monitoring, verification, and accounting applications using double-difference tomography. The geophone arrays with widely-varying geophone locations, both laterally and vertically, performed best. Additionally, double difference seismic tomography was performed using travel time data from a carbon sequestration site at the Aneth oil field in southeast Utah as part of a Department of Energy initiative on monitoring, verification, and accounting (MVA) of sequestered CO2. A total of 1,211 seismic events were recorded from a borehole array consisting of 22 geophones. Artificial velocity models were created to determine the ease with which different CO2 plume locations and sizes can be detected. Most likely because of the poor geophone arrangement, a low velocity zone in the Desert Creek reservoir can only be detected when regions of test site containing the highest ray path coverage are considered. MVA accuracy and precision may be improved through the use of a receiver array that provides more comprehensive ray path coverage.

  13. Simulation studies of muon-produced background events deep underground and consequences for double beta decay experiments

    Science.gov (United States)

    Massarczyk, Ralph; Majorana Collaboration

    2015-10-01

    Cosmic radiation creates a significant background for low count rate experiments. The Majorana demonstrator experiment is located at the Sanford Underground Research Facility at a depth of 4850ft below the surface but it can still be penetrated by cosmic muons with initial energies above the TeV range. The interaction of muons with the rock, the shielding material in the lab and the detector itself can produce showers of secondary particles, like fast neutrons, which are able to travel through shielding material and can produce high-energy γ-rays via capture or inelastic scattering. The energy deposition of these γ rays in the detector can overlap with energy region of interest for the neutrino-less double beta decay. Recent studies for cosmic muons penetrating the Majorana demonstrator are made with the Geant4 code. The results of these simulations will be presented in this talk and an overview of the interaction of the shower particles with the detector, shielding and veto system will be given. This material is based upon work supported by the U.S. Department of Energy, Office of Science, Office of Nuclear Physics, the Particle Astrophysics Program of the National Science Foundation, and the Sanford Underground Research Facility. Supported by U.S. Department of Energy through the LANL/LDRD Program.

  14. The processing of enriched germanium for the MAJORANA DEMONSTRATOR and R&D for a next generation double-beta decay experiment

    Science.gov (United States)

    Abgrall, N.; Arnquist, I. J.; Avignone, F. T., III; Barabash, A. S.; Bertrand, F. E.; Bradley, A. W.; Brudanin, V.; Busch, M.; Buuck, M.; Caja, J.; Caja, M.; Caldwell, T. S.; Christofferson, C. D.; Chu, P.-H.; Cuesta, C.; Detwiler, J. A.; Dunagan, C.; Dunstan, D. T.; Efremenko, Yu.; Ejiri, H.; Elliott, S. R.; Gilliss, T.; Giovanetti, G. K.; Goett, J.; Green, M. P.; Gruszko, J.; Guinn, I. S.; Guiseppe, V. E.; Haufe, C. R. S.; Henning, R.; Hoppe, E. W.; Jasinski, B. R.; Kidd, M. F.; Konovalov, S. I.; Kouzes, R. T.; Lopez, A. M.; MacMullin, J.; Martin, R. D.; Massarczyk, R.; Meijer, S. J.; Mertens, S.; Meyer, J. H.; Myslik, J.; O'Shaughnessy, C.; Poon, A. W. P.; Radford, D. C.; Rager, J.; Reine, A. L.; Reising, J. A.; Rielage, K.; Robertson, R. G. H.; Shanks, B.; Shirchenko, M.; Suriano, A. M.; Tedeschi, D.; Toth, L. M.; Trimble, J. E.; Varner, R. L.; Vasilyev, S.; Vetter, K.; Vorren, K.; White, B. R.; Wilkerson, J. F.; Wiseman, C.; Xu, W.; Yakushev, E.; Yu, C.-H.; Yumatov, V.; Zhitnikov, I.; Zhu, B. X.

    2018-01-01

    The MAJORANA DEMONSTRATOR is an array of point-contact Ge detectors fabricated from Ge isotopically enriched to 88% in 76 Ge to search for neutrinoless double beta decay. The processing of Ge for germanium detectors is a well-known technology. However, because of the high cost of Ge enriched in 76 Ge special procedures were required to maximize the yield of detector mass and to minimize exposure to cosmic rays. These procedures include careful accounting for the material; shielding it to reduce cosmogenic generation of radioactive isotopes; and development of special reprocessing techniques for contaminated solid germanium, shavings, grindings, acid etchant and cutting fluids from detector fabrication. Processing procedures were developed that resulted in a total yield in detector mass of 70%. However, none of the acid-etch solution and only 50% of the cutting fluids from detector fabrication were reprocessed. Had they been processed, the projections for the recovery yield would be between 80% and 85%. Maximizing yield is critical to justify a possible future ton-scale experiment. A process for recovery of germanium from the acid-etch solution was developed with yield of about 90%. All material was shielded or stored underground whenever possible to minimize the formation of 68Ge by cosmic rays, which contributes background in the double-beta decay region of interest and cannot be removed by zone refinement and crystal growth. Formation of 68Ge was reduced by a significant factor over that in natural abundance detectors not protected from cosmic rays.

  15. Xanthogranulomatous Pyelonephritis with Incomplete Double Ureter

    Directory of Open Access Journals (Sweden)

    Yutaro Hayashi

    2017-01-01

    Full Text Available Introduction. Xanthogranulomatous pyelonephritis (XGP is a type of chronic renal inflammation that usually occurs in immunocompromised middle-aged women with chronic urinary tract infection or ureteral obstruction induced by the formation of ureteral stones. XGP with an incomplete double ureter is extremely rare. Case Presentation. A 76-year-old woman was referred to our department to undergo further examination for a left renal tumor that was detected by ultrasonography. Dynamic contrast computed tomography (CT revealed an enhanced tumor in the upper renal parenchyma. Laparoscopic radical nephrectomy was performed based on a preoperative diagnosis of renal cell carcinoma. Histological sections showed the aggregation of foam cells; thus, XGP was diagnosed. Conclusion. We herein report a rare case of XGP in the upper pole of the kidney, which might have been associated with an incomplete double ureter.

  16. Doubling time of liver metastase images

    International Nuclear Information System (INIS)

    Bittighoffer, Bernard.

    1975-01-01

    For our study, where clinical and scintigraphic observation seldom lasts more than two years and where measurable metastases always exceed 1 cm 3 , the exponential model was adopted and our results were all calculated with GERSTENBERG's formula which gives an apparent doubling time. The liver metastases were measured on the scintigraphic image obtained, a more or less sharply limited blank which makes for a first difficulty of judgement. Two magnascanner V type PICKER 5-inch crystal scintigraphs were used, giving three images simultaneously by a transcriber made up of a stylus and a light spot built into the detection system. The isotope used is colloidal gold ( 198 Au) phagocytized by the Kuepfferian reticulo-endothelial system. The doubling time for liver metastase scintigraphic images calculated for fifteen patients having undergone one or more isotopic checks after a first metastase image was discovered range from 10 to 103 days [fr

  17. Studies of the electron-impact double-ionisation process in magnesium using coincidence techniques

    International Nuclear Information System (INIS)

    Ford, M.J.

    1998-01-01

    This article will review recent measurements of the electron-impact double-ionisation of atomic magnesium. Results for the resonant Auger double-ionisation process with coincident detection of all three outgoing electrons, the (e, 3e) experiment, and for the direct double-ionisation process where only two outgoing electrons are detected, the (e, (3 -1)e) experiment, will be discussed. The results are analysed with reference to ionisation mechanisms and comparisons are made with calculated double-ionisation cross sections. Copyright (1998) CSIRO Australia

  18. Double Degenerate Stars

    International Nuclear Information System (INIS)

    Xin-Lian, Luo; Hua, Bai; Lei, Zhao

    2008-01-01

    Regardless of the formation mechanism, an exotic object, the double degenerate star (DDS), is introduced and investigated, which is composed of baryonic matter and some unknown fermion dark matter. Different from the simple white dwarfs (WDs), there is additional gravitational force provided by the unknown fermion component inside DDSs, which may strongly affect the structure and the stability of such kind of objects. Many possible and strange observational phenomena connecting with them are concisely discussed. Similar to the normal WD, this object can also experience thermonuclear explosion as type Ia supernova explosion when DDS's mass exceeds the maximum mass that can be supported by electron degeneracy pressure. However, since the total mass of baryonic matter can be much lower than that of WD at Chandrasekhar mass limit, the peak luminosity should be much dimmer than what we expect before, which may throw a slight shadow on the standard candle of SN Ia in the research of cosmology. (general)

  19. Double-Skin Facade

    DEFF Research Database (Denmark)

    Kalyanova, Olena

    favored by companies and their employees. To bring the reduction of energy use in these buildings application of suitable tools and methods is necessary to achieve successful design solutions. Earlier work on the topic of DSF modelling was examined from various publications. As a result, the main...... IEA Annex 34/43, subtask E "Double-Skin Facade". The results of empirical validation are discussed in this work. Discussion and analysis of experimental results is carried out. It has lead to hypothesis of recirculation flow phenomenon in the DSF cavity. Finally, a suggestion of a new numerical model...... is developed to account for recirculation flow appearance in the DSF cavity. The model is based on a simple mass balance between the boundary layer flow and the main flow in the cavity....

  20. Deconvoluting double Doppler spectra

    International Nuclear Information System (INIS)

    Ho, K.F.; Beling, C.D.; Fung, S.; Chan, K.L.; Tang, H.W.

    2001-01-01

    The successful deconvolution of data from double Doppler broadening of annihilation radiation (D-DBAR) spectroscopy is a promising area of endeavour aimed at producing momentum distributions of a quality comparable to those of the angular correlation technique. The deconvolution procedure we test in the present study is the constrained generalized least square method. Trials with computer simulated DDBAR spectra are generated and deconvoluted in order to find the best form of regularizer and the regularization parameter. For these trials the Neumann (reflective) boundary condition is used to give a single matrix operation in Fourier space. Experimental D-DBAR spectra are also subject to the same type of deconvolution after having carried out a background subtraction and using a symmetrize resolution function obtained from an 85 Sr source with wide coincidence windows. (orig.)

  1. Beyond the double banana

    DEFF Research Database (Denmark)

    Rosenzweig, Ivana; Fogarasi, András; Johnsen, Birger

    2014-01-01

    PURPOSE: To investigate whether extending the 10-20 array with 6 electrodes in the inferior temporal chain and constructing computed montages increases the diagnostic value of ictal EEG activity originating in the temporal lobe. In addition, the accuracy of computer-assisted spectral source......). Spectral source analysis used source montage to calculate density spectral array, defining the earliest oscillatory onset. From this, phase maps were calculated for localization. The reference standard was the decision of the multidisciplinary epilepsy surgery team on the seizure onset zone. Clinical...... performance was compared with the double banana (longitudinal bipolar montage, 10-20 array). RESULTS: Adding the inferior temporal electrode chain, computed montages (reference free, common average, and source derivation), and voltage maps significantly increased the sensitivity. Phase maps had the highest...

  2. Double-mode pulsation

    International Nuclear Information System (INIS)

    Cox, A.N.

    1982-01-01

    Double mode pulsation is a very pervasive phenomenon in stars all over the Hertzsprung-Russell diagram. In order of increasing radius, examples are: ZZ Ceti stars, the sun, the delta Scuti stars, RR Lyrae variables, the β Cephei variables and those related to them, Cepheids, and maybe even the Mira stars. These many modes have been interpreted as both radial and nonradial modes, but in many cases the actual mode has not been clearly identified. Yellow giants seem to be the most simple pulsators with a large majority of the RR Lyrae variables and Cepheids showing only one pulsation period. We limit this review to those very few cases for classical Cepheids and RR Lyrae variables which display two modes. For these we know many facts about these stars, but the actual cause of the pulsation in two modes simultaneously remains unknown

  3. Dual double field theory

    Energy Technology Data Exchange (ETDEWEB)

    Bergshoeff, Eric A. [Centre for Theoretical Physics, University of Groningen,Nijenborgh 4, 9747 AG Groningen (Netherlands); Hohm, Olaf [Simons Center for Geometry and Physics, Stony Brook University,Stony Brook, NY 11794-3636 (United States); Penas, Victor A. [Centre for Theoretical Physics, University of Groningen,Nijenborgh 4, 9747 AG Groningen (Netherlands); Riccioni, Fabio [INFN - Sezione di Roma, Dipartimento di Fisica, Università di Roma “La Sapienza”,Piazzale Aldo Moro 2, 00185 Roma (Italy)

    2016-06-06

    We present the dual formulation of double field theory at the linearized level. This is a classically equivalent theory describing the duals of the dilaton, the Kalb-Ramond field and the graviton in a T-duality or O(D,D) covariant way. In agreement with previous proposals, the resulting theory encodes fields in mixed Young-tableau representations, combining them into an antisymmetric 4-tensor under O(D,D). In contrast to previous proposals, the theory also requires an antisymmetric 2-tensor and a singlet, which are not all pure gauge. The need for these additional fields is analogous to a similar phenomenon for “exotic' dualizations, and we clarify this by comparing with the dualizations of the component fields. We close with some speculative remarks on the significance of these observations for the full non-linear theory yet to be constructed.

  4. Double profunda brachii artery

    Directory of Open Access Journals (Sweden)

    Gavishiddappa A Hadimani

    2016-01-01

    Full Text Available Brachial artery (BA is a continuation of the axillary artery at the lower border of teres major. In the cubital fossa, BA divides into radial artery and ulnar artery as terminal branches. Large branch given from the BA in the upper part is profunda brachii artery. In the present case, we noticed double profunda brachii that arises from the BA. They are profunda brachii artery 1 and profunda brachii artery 2. Profunda brachii artery 1 arises in the proximal part of the BA and profunda brachii artery 2 arises distal to the profunda brachii artery 1. Both the arteries run inferolaterally in the spiral groove along with radial nerve. Variations of profunda brachii artery are important during harvesting of the lateral arm flaps and may lead to inadvertent injury during percutaneous arterial catheterization or injection of drugs.

  5. GENERALIZED DOUBLE PARETO SHRINKAGE.

    Science.gov (United States)

    Armagan, Artin; Dunson, David B; Lee, Jaeyong

    2013-01-01

    We propose a generalized double Pareto prior for Bayesian shrinkage estimation and inferences in linear models. The prior can be obtained via a scale mixture of Laplace or normal distributions, forming a bridge between the Laplace and Normal-Jeffreys' priors. While it has a spike at zero like the Laplace density, it also has a Student's t -like tail behavior. Bayesian computation is straightforward via a simple Gibbs sampling algorithm. We investigate the properties of the maximum a posteriori estimator, as sparse estimation plays an important role in many problems, reveal connections with some well-established regularization procedures, and show some asymptotic results. The performance of the prior is tested through simulations and an application.

  6. Double optical gating

    Science.gov (United States)

    Gilbertson, Steve

    The observation and control of dynamics in atomic and molecular targets requires the use of laser pulses with duration less than the characteristic timescale of the process which is to be manipulated. For electron dynamics, this time scale is on the order of attoseconds where 1 attosecond = 10 -18 seconds. In order to generate pulses on this time scale, different gating methods have been proposed. The idea is to extract or "gate" a single pulse from an attosecond pulse train and switch off all the other pulses. While previous methods have had some success, they are very difficult to implement and so far very few labs have access to these unique light sources. The purpose of this work is to introduce a new method, called double optical gating (DOG), and to demonstrate its effectiveness at generating high contrast single isolated attosecond pulses from multi-cycle lasers. First, the method is described in detail and is investigated in the spectral domain. The resulting attosecond pulses produced are then temporally characterized through attosecond streaking. A second method of gating, called generalized double optical gating (GDOG), is also introduced. This method allows attosecond pulse generation directly from a carrier-envelope phase un-stabilized laser system for the first time. Next the methods of DOG and GDOG are implemented in attosecond applications like high flux pulses and extreme broadband spectrum generation. Finally, the attosecond pulses themselves are used in experiments. First, an attosecond/femtosecond cross correlation is used for characterization of spatial and temporal properties of femtosecond pulses. Then, an attosecond pump, femtosecond probe experiment is conducted to observe and control electron dynamics in helium for the first time.

  7. Spin-filtering junctions with double ferroelectric barriers

    International Nuclear Information System (INIS)

    Yan, Ju; Ding-Yu, Xing

    2009-01-01

    An FS/FE/NS/FE/FS double tunnel junction is suggested to have the ability to inject, modulate and detect the spin-polarized current electrically in a single device, where FS is the ferromagnetic semiconductor electrode, NS is the nonmagnetic semiconductor, and FE the ferroelectric barrier. The spin polarization of the current injected into the NS region can be switched between a highly spin-polarized state and a spin unpolarized state. The high spin polarization may be detected by measuring the tunneling magnetoresistance ratio of the double tunnel junction

  8. Detection of closed influenza virus hemagglutinin fusion peptide structures in membranes by backbone {sup 13}CO-{sup 15}N rotational-echo double-resonance solid-state NMR

    Energy Technology Data Exchange (ETDEWEB)

    Ghosh, Ujjayini; Xie Li; Weliky, David P., E-mail: weliky@chemistry.msu.edu [Michigan State University, Department of Chemistry (United States)

    2013-02-15

    The influenza virus fusion peptide is the N-terminal {approx}20 residues of the HA2 subunit of the hemagglutinin protein and this peptide plays a key role in the fusion of the viral and endosomal membranes during initial infection of a cell. The fusion peptide adopts N-helix/turn/C-helix structure in both detergent and membranes with reports of both open and closed interhelical topologies. In the present study, backbone {sup 13}CO-{sup 15}N REDOR solid-state NMR was applied to the membrane-associated fusion peptide to detect the distribution of interhelical distances. The data clearly showed a large fraction of closed and semi-closed topologies and were best-fitted to a mixture of two structures that do not exchange. One of the earlier open structural models may have incorrect G13 dihedral angles derived from TALOS analysis of experimentally correct {sup 13}C shifts.

  9. Etiological aspects of double monsters.

    Science.gov (United States)

    Jaschevatzky, O E; Goldman, B; Kampf, D; Wexler, H; Grünstein, S

    1980-06-01

    Four cases of double monsters are reported, including a rare case of craniofacial duplication (diprosopus). Based on the findings observed, etiological factors of these malformations are discussed. We suggest that exogenous (environmental) factors such as habits, way of life or religious practices of certain populations can influence the development of double monsters.

  10. A measurement of the 2 neutrino double beta decay rate of Te-130 in the CUORICINO experiment

    Energy Technology Data Exchange (ETDEWEB)

    Kogler, Laura K. [Univ. of California, Berkeley, CA (United States)

    2011-11-30

    CUORICINO was a cryogenic bolometer experiment designed to search for neutrinoless double beta decay and other rare processes, including double beta decay with two neutrinos (2vββ). The experiment was located at Laboratori Nazionali del Gran Sasso and ran for a period of about 5 years, from 2003 to 2008. The detector consisted of an array of 62 TeO2 crystals arranged in a tower and operated at a temperature of 10 mK. Events depositing energy in the detectors, such as radioactive decays or impinging particles, produced thermal pulses in the crystals which were read out using sensitive thermistors. The experiment included 4 enriched crystals, 2 enriched with 130Te and 2 with 128Te, in order to aid in the measurement of the 2vββ rate. The enriched crystals contained a total of 350 g 130Te. The 128-enriched (130-depleted) crystals were used as background monitors, so that the shared backgrounds could be subtracted from the energy spectrum of the 130- enriched crystals. Residual backgrounds in the subtracted spectrum were fit using spectra generated by Monte-Carlo simulations of natural radioactive contaminants located in and on the crystals. The 2vββ half-life was measured to be T2v1/2 = [9.81± 0.96(stat)± 0.49(syst)] x1020 y.

  11. Double chambered right ventricle

    International Nuclear Information System (INIS)

    Cho, Chul Koo; Yu, Yun Jeong; Yeon, Kyung Mo; Han, Man Chung

    1983-01-01

    Fourteen cases of double chambered right ventricle were diagnosed angiographically and of these nine cases were confirmed after operation and autopsy at Seoul National University Hospital in recent four years since 1979. The clinical and radiological findings with the emphasis on the cinecardiographic findings were analysed. The summaries of the analysis are as follows: 1. Among 14 cases, 6 cases were male and 8 cases were female. Age distribution was from 4 years to 36 years. 2. In chest x-ray findings, pulmonary vascularity was increased in 8 cases, decreased in 4 cases, and normal in 2 cases. Cardiomegaly was observed in 8 cases and other showed normal heart size. 3. In cinecardiography, 11 cases had interventricular septal defect. Among these 11 cases, VSD located in proximal high pressure chamber was in 2 cases and located in distal low pressure chamber was in 9 cases. 4. The location of aberrant muscle bundle in sinus portion of right ventricle was in 8 cases. In the rest 6 cases, the aberrant muscle bundle was located below the infundibulum of right ventricle. 5. For accurate diagnosis and differential diagnosis with other congenital cardiac anomalies such as Tetralogy of Fallot or isolated pulmonic stenosis, biplane cineangiography and catheterization is an essential procedure

  12. Double chambered right ventricle

    Energy Technology Data Exchange (ETDEWEB)

    Cho, Chul Koo; Yu, Yun Jeong; Yeon, Kyung Mo; Han, Man Chung [Seoul National University College of Medicine, Seoul (Korea, Republic of)

    1983-12-15

    Fourteen cases of double chambered right ventricle were diagnosed angiographically and of these nine cases were confirmed after operation and autopsy at Seoul National University Hospital in recent four years since 1979. The clinical and radiological findings with the emphasis on the cinecardiographic findings were analysed. The summaries of the analysis are as follows: 1. Among 14 cases, 6 cases were male and 8 cases were female. Age distribution was from 4 years to 36 years. 2. In chest x-ray findings, pulmonary vascularity was increased in 8 cases, decreased in 4 cases, and normal in 2 cases. Cardiomegaly was observed in 8 cases and other showed normal heart size. 3. In cinecardiography, 11 cases had interventricular septal defect. Among these 11 cases, VSD located in proximal high pressure chamber was in 2 cases and located in distal low pressure chamber was in 9 cases. 4. The location of aberrant muscle bundle in sinus portion of right ventricle was in 8 cases. In the rest 6 cases, the aberrant muscle bundle was located below the infundibulum of right ventricle. 5. For accurate diagnosis and differential diagnosis with other congenital cardiac anomalies such as Tetralogy of Fallot or isolated pulmonic stenosis, biplane cineangiography and catheterization is an essential procedure.

  13. Double Tracks closure report

    International Nuclear Information System (INIS)

    1997-06-01

    This report describes the remediation activities performed and the results of postremediation radiation surveys conducted at the Double Tracks site, located on Range 71 North, of the Nellis Air Force Range (NAFR) in southern Nevada. This remediation was conducted from June to August 1996 in accordance with the Interim Corrective Action Plan (ICAP) to remediate the site to an acceptable risk to human health and the environment. Soil with a total transuranic activity greater than 200 picoCuries per gram (pCi/g) was excavated, shipped to the Nevada Test Site (NTS), and disposed at the Area 3 Radioactive Waste Management Site (RWMS). A total of 52.3 grams of plutonium (Pu) with an activity of 5.12 Curies was disposed. The concrete pad at ground zero (GZ) was broken up, placed in a Sealand reg-sign container, and shipped to the NTS Area 6 decontamination pad. Additionally, approximately 10 m 3 (350 ft 3 ) of soil containing small chips of concrete was shipped to the NTS Area 6 decontamination pad. The concrete and soil/concrete mixture will be further characterized prior to disposal. At the time this report was written, characterization samples were being collected, with analytical results expected in January 1997. It is anticipated that the material will be disposed in mid-1997. This remediation is an interim action because final cleanup levels have not been established

  14. Remote just-in-time telementored trauma ultrasound: a double-factorial randomized controlled trial examining fluid detection and remote knobology control through an ultrasound graphic user interface display.

    Science.gov (United States)

    Kirkpatrick, Andrew W; McKee, Ian; McKee, Jessica L; Ma, Irene; McBeth, Paul B; Roberts, Derek J; Wurster, Charles L; Parfitt, Robbie; Ball, Chad G; Oberg, Scott; Sevcik, William; Hamilton, Douglas R

    2016-05-01

    Remote-telementored ultrasound involves novice examiners being remotely guided by experts using informatic-technologies. However, requiring a novice to perform ultrasound is a cognitively demanding task exacerbated by unfamiliarity with ultrasound-machine controls. We incorporated a randomized evaluation of using remote control of the ultrasound functionality (knobology) within a study in which the images generated by distant naive examiners were viewed on an ultrasound graphic user interface (GUI) display viewed on laptop computers by mentors in different cities. Fire-fighters in Edmonton (101) were remotely mentored from Calgary (n = 65), Nanaimo (n = 19), and Memphis (n = 17) to examine an ultrasound phantom randomized to contain free fluid or not. Remote mentors (2 surgeons, 1 internist, and 1 ED physician) were randomly assigned to use GUI knobology control during mentoring (GUIK+/GUIK-). Remote-telementored ultrasound was feasible in all cases. Overall accuracy for fluid detection was 97% (confidence interval = 91 to 99%) with 3 false negatives (FNs). Positive/negative likelihood ratios were infinity/0.0625. One FN occurred with the GUIK+ and 2 without (GUIK-). There were no statistical test performance differences in either group (GUIK+ and GUIK-). Ultrasound-naive 1st responders can be remotely mentored with high accuracy, although providing basic remote control of the knobology did not affect outcomes. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. A generally applicable sequential alkaline phosphatase immunohistochemical double staining

    NARCIS (Netherlands)

    van der Loos, Chris M.; Teeling, Peter

    2008-01-01

    A universal type of sequential double alkaline phosphatase immunohistochemical staining is described that can be used for formalin-fixed, paraffin-embedded and cryostat tissue sections from human and mouse origin. It consists of two alkaline phosphatase detection systems including enzymatic

  16. Multicoincidence measurements of double photoionization in helium

    International Nuclear Information System (INIS)

    Huetz, A.; Andric, L.; Selles, P.; Mazeau, J.; Lablanquie, P.

    1994-01-01

    A new toroidal analyser has been used to study the double photoionization of helium, for energies down to 4 eV above threshold. The two electrons are detected with equal energies, and coincidences between them for various angles of emission can be obtained simultaneously. The plane of detection contains the photon beam, in contrast with recent experiments performed in the plane perpendicular to the photon beam. The angular correlation function is extracted directly from the present measurements, which are shown to be insensitive to the Stokes parameters of the photon beam. The width of that function is not observed to vary significantly from 4 eV to 17.6 eV above threshold. (author)

  17. Z₂-double cyclic codes