WorldWideScience

Sample records for depot shaw afb

  1. Shaw on Hamlet

    Science.gov (United States)

    Dukore, Bernard F.

    1971-01-01

    Shaw's preoccupation with Hamlet resonates in his creative writing. Article documents this statement not only by examining his novels and plays but by searching through prefaces, postscripts, reviews, letters, speeches, etc. that span Shaw's lifetime. (Author/RB)

  2. Shaw's Comedy, Language Arts: 5113.90.

    Science.gov (United States)

    Dade County Public Schools, Miami, FL.

    This guide provides the teacher with strategies to aid students in examining five representative plays by Bernard Shaw and in comparing his comedy with the comic art of Oscar Wilde, Richard Sheridan, Ben Jonson, and William Shakespeare. Performance objectives include isolating elements which pertain to the life and times of Shaw, delineating…

  3. Makahiki+WattDepot

    DEFF Research Database (Denmark)

    Johnson, Philip M.; Xu, Yongwen; Brewer, Robert S.

    2013-01-01

    to consumers. Since 2009, we have been designing, implementing, and evaluating an open source software "stack" to facilitate this research. This software stack consists of two custom systems called WattDepot and Makahiki, along with the open source components they rely upon (Java, Restlet, Postgres, Python...

  4. Structure health assessment and warning system (SHAWS)

    Science.gov (United States)

    Bock, Daniel M.; Kim, Keehoon; Mapar, Jalal

    2008-03-01

    We are developing a Structure Health Assessment and Warning System (SHAWS) based on building displacement measurements and wireless communication. SHAWS will measure and predict the stability/instability of a building, determine whether it is safe for emergency responders to enter during an emergency, and provide individual warnings on the condition of the structure. SHAWS incorporates remote sensing nodes (RSNs) installed on the exterior frame of a building. Each RSN includes a temperature sensor, a three-axis accelerometer making static-acceleration measurements, and a ZigBee wireless system (IEEE 802.15.4). The RSNs will be deployed remotely using an air cannon delivery system, with each RSN having an innovative adhesive structure for fast (<10 min) and strong installation under emergency conditions. Once the building has moved past a threshold (~0.25 in./building story), a warning will be issued to emergency responders. In addition to the RSNs, SHAWS will include a base station located on an emergency responder's primary vehicle, a PDA for mobile data display to guide responders, and individual warning modules that can be worn by each responder. The individual warning modules will include visual and audio indicators with a ZigBee receiver to provide the proper degree of warning to each responder.

  5. Shaw Air Force Base Capital Improvement Program Environmental Assessment

    Science.gov (United States)

    2010-05-01

    A FB Capital Im provem ent Program Environm ental A ssessm ent 3-21 Figure 3.6-1. W ater R esources at Shaw A FB under the Proposed A ction...Figure 3.6-2. W ater R esources at Shaw A FB under A lternative 1 0 Key c::::J Shaw!IFB C’l1 Proposed Project ~ Number -- Creek/Stream c:::::J w

  6. Depot Maintenance: Executed Workload and Maintenance Operations at DOD Depots

    Science.gov (United States)

    2017-02-03

    in turn enable testing of helicopter rotor blades. The Army has also made investments in logistics software at all of its depots. According to the...maintenance and repair of structural helicopter airframes and blades; advanced composite technologies; flight controls and control surfaces; and...level maintenance on a wide range of vehicles and other military assets, including helicopters , combat vehicles, ships, aircraft, engines, and software

  7. Electrokinetic Fingering In Hele-Shaw Cells

    Science.gov (United States)

    Mirzadeh, Mohammad; Bazant, Martin

    2016-11-01

    Large scale flow problems in porous media, such as those encountered in underground oil reservoirs, are typically described by the Darcy's law. However, it is well known that many underground rock formations contain surface groups and minerals that dissociate in the presence of water. Convection of these charges by the pressure driven flow can then set up streaming current and streaming potential that affects the flow. Furthermore, electric fields that are often used to enhance oil recovery, e.g. by reducing the oil's viscosity through electro-thermal heating, drive electro-osmotic flows that could set up very large pressure in small pores. The full description of fluid flow thus requires a solution to the fully coupled electrokinetic problem. In their seminal work, Saffman and Taylor showed that the moving interface between two immiscible fluids in a porous medium becomes unstable if pushed by the low-viscosity fluid. Here we report on the role of electrokinetic phenomena on stability of these viscous fronts in Hele-Shaw cells by using analytic as well as numerical approaches. Interestingly, we find that the instability could be suppressed if the right physical conditions are met or otherwise enhanced, leading to greater mixing of two fluids.

  8. Network technology for depot modernization

    Energy Technology Data Exchange (ETDEWEB)

    Hostick, C.J.

    1990-12-01

    This report was prepared by the Pacific Northwest Laboratory to summarize existing and emerging information system technology and standards applicable to Depot System Command (DESCOM) modernization efforts. The intent of this summarization is to provide the Revitalization of Army Depots for the Year 2000 (READY 2000) team a clear understanding of the enabling information system technologies required to support effective modernization activities. Much of the information contained in this report was acquired during the last year in support of the US Army Armament, Munitions, and Chemical Command (AMCCOM) Facility Integrated Manufacturing Management System (FIMMS) project at PNL, which is targeting the modernization of plant-wide information systems at Army Ammunition Plants. The objective of information system modernization is to improve the effectiveness of an organization in performing its mission. Information system modernization strives to meet this objective by creating an environment where data is electronically captured near the source and readily available to all areas of the organization. Advanced networks, together with related information system technology, are the enabling mechanisms that make modern information system infrastructures possible. The intent of this paper is to present an overview of advanced information system network technology to support depot modernization planners in making technology management decisions. Existing and emerging Open System Interconnection (OSI) and Government Open System Interconnection Profile (GOSIP) standards are explained, as well as a brief assessment of existing products compliant with these standards. Finally, recommendations for achieving plant-wide integration using existing products are presented, and migration strategies for full OSI compliance are introduced. 5 refs., 16 figs. (JF)

  9. Space Transportation Infrastructure Supported By Propellant Depots

    Science.gov (United States)

    Smitherman, David; Woodcock, Gordon

    2012-01-01

    A space transportation infrastructure is described that utilizes propellant depot servicing platforms to support all foreseeable missions in the Earth-Moon vicinity and deep space out to Mars. The infrastructure utilizes current expendable launch vehicle (ELV) systems such as the Delta IV Heavy, Atlas V, and Falcon 9, for all crew, cargo, and propellant launches to orbit. Propellant launches are made to Low-Earth-Orbit (LEO) Depot and an Earth-Moon Lagrange Point 1 (L1) Depot to support a new reusable in-space transportation vehicles. The LEO Depot supports missions to Geosynchronous Earth Orbit (GEO) for satellite servicing and to L1 for L1 Depot missions. The L1 Depot supports Lunar, Earth-Sun L2 (ESL2), Asteroid and Mars Missions. New vehicle design concepts are presented that can be launched on current 5 meter diameter ELV systems. These new reusable vehicle concepts include a Crew Transfer Vehicle (CTV) for crew transportation between the LEO Depot, L1 Depot and missions beyond L1; a new reusable lunar lander for crew transportation between the L1 Depot and the lunar surface; and Mars orbital Depot are based on International Space Station (ISS) heritage hardware. Data provided includes the number of launches required for each mission utilizing current ELV systems (Delta IV Heavy or equivalent) and the approximate vehicle masses and propellant requirements. Also included is a discussion on affordability with ideas on technologies that could reduce the number of launches required and thoughts on how this infrastructure include competitive bidding for ELV flights and propellant services, developments of new reusable in-space vehicles and development of a multiuse infrastructure that can support many government and commercial missions simultaneously.

  10. Storage depot for radioactive material

    International Nuclear Information System (INIS)

    Szulinski, M.J.

    1983-01-01

    Vertical drilling of cylindrical holes in the soil, and the lining of such holes, provides storage vaults called caissons. A guarded depot is provided with a plurality of such caissons covered by shielded closures preventing radiation from penetrating through any linear gap to the atmosphere. The heat generated by the radioactive material is dissipated through the vertical liner of the well into the adjacent soil and thus to the ground surface so that most of the heat from the radioactive material is dissipated into the atmosphere in a manner involving no significant amount of biologically harmful radiation. The passive cooling of the radioactive material without reliance upon pumps, personnel, or other factor which might fail, constitutes one of the most advantageous features of this system. Moreover this system is resistant to damage from tornadoes or earthquakes. Hermetically sealed containers of radioactive material may be positioned in the caissons. Loading vehicles can travel throughout the depot to permit great flexibility of loading and unloading radioactive materials. Radioactive material can be shifted to a more closely spaced caisson after ageing sufficiently to generate much less heat. The quantity of material stored in a caisson is restricted by the average capacity for heat dissipation of the soil adjacent such caisson

  11. DEPOT database: Reference manual and user's guide

    International Nuclear Information System (INIS)

    Clancey, P.; Logg, C.

    1991-03-01

    DEPOT has been developed to provide tracking for the Stanford Linear Collider (SLC) control system equipment. For each piece of equipment entered into the database, complete location, service, maintenance, modification, certification, and radiation exposure histories can be maintained. To facilitate data entry accuracy, efficiency, and consistency, barcoding technology has been used extensively. DEPOT has been an important tool in improving the reliability of the microsystems controlling SLC. This document describes the components of the DEPOT database, the elements in the database records, and the use of the supporting programs for entering data, searching the database, and producing reports from the information

  12. MHD Hele-Shaw flow of Rivlin-Ericksen fluid

    International Nuclear Information System (INIS)

    Ghosh, B.C.; Sengupta, P.R.

    1995-01-01

    In this paper, an attempt has been made to study the MHD Hele-Shaw flow of Rivlin-Ericksen visco-elastic fluid assuming the pressure gradient to be proportional to exp (-nt). The velocity components are obtained and the effect of visco-elasticity is discussed on velocity components. (author). 8 refs

  13. George Bernard Shaw's "Androcles and the Lion": A Postmodernist Study

    Science.gov (United States)

    Hooti, Noorbakhsh; Jeihouni, Mojtaba

    2012-01-01

    This study makes an attempt to analyze the manifold aspects of Shaw's "Androcles and the Lion" on a postmodernist standpoint, meanwhile, demonstrates the dominion of modernism, which is portrayed through the vehicle of comedy with a bitter ironic language through the play. Regardless of the historical period in which the play occurs, the…

  14. Multiple bubbles in a Hele-Shaw cell

    International Nuclear Information System (INIS)

    Vasconcelos, G.L.

    1994-01-01

    A new class of exact solutions is reported for an infinite stream of identical groups of bubbles moving with a constant velocity U in a Hele-Shaw cell when surface tension is neglected. It is suggested that the existence of these solutions might explain some of the complex behavior observed in recent experiments on rising bubbles in a Hele-Shaw cell. Solutions for a finite number of bubbles in a channel are also obtained. In this case, it is shown that solutions with an arbitrary bubble velocity U>V, where V is the fluid velocity at infinity, can in general be obtained from a simple transformation of the solutions for U=2V

  15. Hyperbolic prisms and foams in Hele-Shaw cells

    Energy Technology Data Exchange (ETDEWEB)

    Tufaile, A., E-mail: tufaile@usp.br [Soft Matter Laboratory, Escola de Artes, Ciencias e Humanidades, Universidade de Sao Paulo, 03828-000, Sao Paulo (Brazil); Tufaile, A.P.B. [Soft Matter Laboratory, Escola de Artes, Ciencias e Humanidades, Universidade de Sao Paulo, 03828-000, Sao Paulo (Brazil)

    2011-10-03

    The propagation of light in foams creates patterns which are generated due to the reflection and refraction of light. One of these patterns is observed by the formation of multiple mirror images inside liquid bridges in a layer of bubbles in a Hele-Shaw cell. We are presenting the existence of these patterns in foams and their relation with hyperbolic geometry and Sierpinski gaskets using the Poincare disk model. The images obtained from the experiment in foams are compared to the case of hyperbolic optical elements. -- Highlights: → The chaotic scattering of light in foams generating deltoid patterns is based on hyperbolic geometry. → The deltoid patterns are obtained through the Plateau borders in a Hele-Shaw cell. → The Plateau borders act like hyperbolic prism. → Some effects of the refraction and reflection of the light rays were studied using a hyperbolic prism.

  16. Environmental Assessment, Minuteman III and Peacekeeper Silo Elimination, Malmstrom AFB, Montana; F. E. Warren AFB, Wyoming; and Vandenberg AFB, California

    Science.gov (United States)

    2013-05-01

    Baccharis pilularis), California sagebrush (Artemisia californica), and poison hemlock ( Conium maculatum ) are common species in the area (Vandenberg AFB...spotted bat (Euderma maculatum ) and Preble’s shrew (Sorex preblei). Habitat for the spotted bat is most often in rough, rocky, semiarid, and arid

  17. Sloshing in a Hele-Shaw cell: experiments and theory

    OpenAIRE

    Viola , Francesco; Gallaire , Francois; Dollet , Benjamin

    2017-01-01

    International audience; The response of the free liquid surface in a Hele-Shaw cell subjected to a horizontal oscillation is investigated. We study the low-oscillation-amplitude regime and we show, by varying the fluid viscosity, ν, and the forcing frequency, ω, that the ratio between the Stokes viscous length, 2ν/ω, and the cell thickness greatly affects the amplitude and phase lag of the gravity waves. In particular, the sloshing system undergoes an under-damped/overdamped transition for su...

  18. Mixing foams and grains in Hele-Shaw cells

    Energy Technology Data Exchange (ETDEWEB)

    Tufaile, A P B; Tufaile, A; Haddad, T A S, E-mail: tufaile@usp.b [Escola de Artes, Ciencias e Humanidades da Universidade de Sao Paulo, R. Arlindo Bettio, 1000, 03828-000, Sao Paulo (Brazil)

    2010-09-01

    We have observed some features of the coexistence of foams and granular materials in Hele-Shaw cells. The most part of the liquid and granular material stays at the bottom of the cell, with only a small quantity of the mixture resting on the froth. The fractal dimensions of the final states of the foams are close to the values obtained from the Random Apollonian Packing model. The disperse structure of the granular material affects the probability distribution of number of sides of the foam bubbles. The nearest neighbor distances between the peaks of the sand piles at the bottom of the cell are close to a lognormal distribution.

  19. Life support and euthanasia, a perspective on Shaw's new perspective.

    Science.gov (United States)

    Busch, Jacob; Rodogno, Raffaele

    2011-02-01

    It has recently been suggested by Shaw (2007) that the distinction between voluntary active euthanasia, such as giving a patient a lethal overdose with the intention of ending that patient's life, and voluntary passive euthanasia, such as removing a patient from a ventilator, is much less obvious than is commonly acknowledged in the literature. This is argued by suggesting a new perspective that more accurately reflects the moral features of end-of-life situations. The argument is simply that if we consider the body of a mentally competent patient who wants to die, a kind of 'unwarranted' life support, then the distinction collapses. We argue that all Shaw has provided is a perspective that makes the conclusion that there is little distinction between voluntary active euthanasia and voluntary passive euthanasia only seemingly more palatable. In doing so he has yet to convince us that this perspective is superior to other perspectives and thus more accurately reflects the moral features of the situations pertaining to this issue.

  20. Survey of Wastewater Discharge, Eielson AFB, Alaska, EHL(K) 73-24

    National Research Council Canada - National Science Library

    Thomas, Jerry F; Pauls, Chester F

    1973-01-01

    This report contains the results of a wastewater survey at Eielson AFB, Alaska, conducted by the USAF Environmental Health Laboratories, Kelly AFB, Texas and McClellan AFB, CA, between 22 and 27 June 1973...

  1. Universality Results for Multi-phase Hele-Shaw Flows

    Science.gov (United States)

    Daripa, Prabir

    2013-03-01

    Saffman-Taylor instability is a well known viscosity driven instability of an interface separating two immiscible fluids. We study linear stability of displacement processes in a Hele-Shaw cell involving an arbitrary number of immiscible fluid phases. This is a problem involving many interfaces. Universal stability results have been obtained for this multi-phase immiscible flow in the sense that the results hold for arbitrary number of interfaces. These stability results have been applied to design displacement processes that are considerably less unstable than the pure Saffman-Taylor case. In particular, we derive universal formula which gives specific values of the viscosities of the fluid layers corresponding to smallest unstable band. Other similar universal results will also be presented. The talk is based on the following paper. This work was supported by the Qatar National Research Fund (a member of The Qatar Foundation).

  2. Three dimensional vortices and interfaces in Hele-Shaw cells

    International Nuclear Information System (INIS)

    Pumir, A.

    1987-06-01

    A model of nonviscous flow, based on the Biot-Savart equations is used to examine the existence of singularities in three dimensional, incompressible, hydrodynamic equations. The results suggest a fairly simple physical mechanism, which could lead to the formation of singularities in the nonviscous case: two vortex tubes with opposite circulations pair up and stretch each other, until the radii of the vortex cores become extremely small, causing a divergence of the vorticity. The cases of a perfect and a slightly viscous fluid are considered. The results are unclear as to whether the vorticity of a slightly viscous fluid can become infinite or not, and whether singularities exist. The dynamics of hydrodynamic interfaces are also investigated. The propagation of bubbles in a slightly viscous fluid, in a Hele-Shaw cell are described [fr

  3. Faraday waves in a Hele-Shaw cell

    Science.gov (United States)

    Li, Jing; Li, Xiaochen; Chen, Kaijie; Xie, Bin; Liao, Shijun

    2018-04-01

    We investigate Faraday waves in a Hele-Shaw cell via experimental, numerical, and theoretical studies. Inspired by the Kelvin-Helmholtz-Darcy theory, we develop the gap-averaged Navier-Stokes equations and end up with the stable standing waves with half frequency of the external forced vibration. To overcome the dependency of a numerical model on the experimental parameter of wave length, we take two-phase flow into consideration and a novel dispersion relation is derived. The numerical results compare well with our experimental data, which effectively validates our proposed mathematical model. Therefore, this model can produce robust solutions of Faraday wave patterns and resolve related physical phenomena, which demonstrates the practical importance of the present study.

  4. Level II Ergonomic Analyses, Dover AFB, DE

    Science.gov (United States)

    1999-02-01

    IERA-RS-BR-TR-1999-0002 UNITED STATES AIR FORCE IERA Level II Ergonomie Analyses, Dover AFB, DE Andrew Marcotte Marilyn Joyce The Joyce...Project (070401881, Washington, DC 20503. 1. AGENCY USE ONLY (Leave blank) 2. REPORT DATE 4. TITLE AND SUBTITLE Level II Ergonomie Analyses, Dover...1.0 INTRODUCTION 1-1 1.1 Purpose Of The Level II Ergonomie Analyses : 1-1 1.2 Approach 1-1 1.2.1 Initial Shop Selection and Administration of the

  5. Depot Medroxyprogesterone Acetate (Depo-Provlera) as a Contrac ...

    African Journals Online (AJOL)

    Depot Medroxyprogesterone Acetate (Depo-Provlera) as a Contrac·eptive Preparation. Basil Bloch. Abstract. Experience with depot medroxyprogesterone acetate as a contraceptive preparation in 7 335 patients for a total of 38 714 months over a 3-year period is described. The discontinuation rate was 18.3% and the ...

  6. Ligand Depot: a data warehouse for ligands bound to macromolecules.

    Science.gov (United States)

    Feng, Zukang; Chen, Li; Maddula, Himabindu; Akcan, Ozgur; Oughtred, Rose; Berman, Helen M; Westbrook, John

    2004-09-01

    Ligand Depot is an integrated data resource for finding information about small molecules bound to proteins and nucleic acids. The initial release (version 1.0, November, 2003) focuses on providing chemical and structural information for small molecules found as part of the structures deposited in the Protein Data Bank. Ligand Depot accepts keyword-based queries and also provides a graphical interface for performing chemical substructure searches. A wide variety of web resources that contain information on small molecules may also be accessed through Ligand Depot. Ligand Depot is available at http://ligand-depot.rutgers.edu/. Version 1.0 supports multiple operating systems including Windows, Unix, Linux and the Macintosh operating system. The current drawing tool works in Internet Explorer, Netscape and Mozilla on Windows, Unix and Linux.

  7. Elastic fingering in rotating Hele-Shaw flows

    KAUST Repository

    Carvalho, Gabriel D.

    2014-05-21

    The centrifugally driven viscous fingering problem arises when two immiscible fluids of different densities flow in a rotating Hele-Shaw cell. In this conventional setting an interplay between capillary and centrifugal forces makes the fluid-fluid interface unstable, leading to the formation of fingered structures that compete dynamically and reach different lengths. In this context, it is known that finger competition is very sensitive to changes in the viscosity contrast between the fluids. We study a variant of such a rotating flow problem where the fluids react and produce a gellike phase at their separating boundary. This interface is assumed to be elastic, presenting a curvature-dependent bending rigidity. A perturbative weakly nonlinear approach is used to investigate how the elastic nature of the interface affects finger competition events. Our results unveil a very different dynamic scenario, in which finger length variability is not regulated by the viscosity contrast, but rather determined by two controlling quantities: a characteristic radius and a rigidity fraction parameter. By properly tuning these quantities one can describe a whole range of finger competition behaviors even if the viscosity contrast is kept unchanged. © 2014 American Physical Society.

  8. Droplet formation in Hele-Shaw T-junction.

    Science.gov (United States)

    Ricouvier, Joshua; Yazhgur, Pavel; Leshansky, Alexander; Tabeling, Patrick; Microflusa Team

    The development of digital microfluidics has attracted considerable interest towards generation of highly monodisperse microdroplets. T-junction has become an essential element of most of microfluidic chips. Despite its importance, theoretical analysis of droplet formation at T-junction is still incomplete due to complexity of physics involved. We focused on droplet generation at the Hele-Shaw T-junction. The effect of various experimental parameters, such as channel geometry, flow rates, surface tension and fluid viscosities, was thoroughly investigated. Our results show that the experimental system exhibits three distinct regimes (squeezing, dripping and jetting regimes) and point out the effect of confinement on the transitions. We demonstrate that the size of the ''plug'' droplet depends not only on the flow rate ratio (as described in the literature), but also on the capillary number and the channel cross-section aspect ratio. Quasi-2D flow equations allow us to perform numerical simulations and to compare them with experimental results. The Microflusa project receives funding from the European Union's Horizon 2020 research and innovation programme under Grant Agreement No. 664823.

  9. Elastic fingering in rotating Hele-Shaw flows

    KAUST Repository

    Carvalho, Gabriel D.; Gadê lha, Hermes; Miranda, José A.

    2014-01-01

    The centrifugally driven viscous fingering problem arises when two immiscible fluids of different densities flow in a rotating Hele-Shaw cell. In this conventional setting an interplay between capillary and centrifugal forces makes the fluid-fluid interface unstable, leading to the formation of fingered structures that compete dynamically and reach different lengths. In this context, it is known that finger competition is very sensitive to changes in the viscosity contrast between the fluids. We study a variant of such a rotating flow problem where the fluids react and produce a gellike phase at their separating boundary. This interface is assumed to be elastic, presenting a curvature-dependent bending rigidity. A perturbative weakly nonlinear approach is used to investigate how the elastic nature of the interface affects finger competition events. Our results unveil a very different dynamic scenario, in which finger length variability is not regulated by the viscosity contrast, but rather determined by two controlling quantities: a characteristic radius and a rigidity fraction parameter. By properly tuning these quantities one can describe a whole range of finger competition behaviors even if the viscosity contrast is kept unchanged. © 2014 American Physical Society.

  10. Examination of adipose depot-specific PPAR moieties

    Energy Technology Data Exchange (ETDEWEB)

    Dodson, M.V., E-mail: dodson@wsu.edu [Department of Animal Sciences, Washington State University, Pullman, WA 99164 (United States); Vierck, J.L. [Department of Animal Sciences, Washington State University, Pullman, WA 99164 (United States); Hausman, G.J. [USDA-ARS, Richard B. Russell Agricultural Research Station, Athens, GA 30604 (United States); Guan, L.L. [Department of Agricultural, Food and Nutritional Science, University of Alberta, Edmonton, Alberta, T6G 2P5 Canada (Canada); Fernyhough, M.E. [The Hartz Mountain Corporation, Secaucus, NJ 07094 (United States); Poulos, S.P. [The Coca-Cola Company, Research and Technology, Atlanta, GA 30313 (United States); Mir, P.S. [Agriculture and Agri-Food Canada Research Centre, Lethbridge, CA T1J 4B1 (United States); Jiang, Z. [Department of Animal Sciences, Washington State University, Pullman, WA 99164 (United States)

    2010-04-02

    Molecular mechanisms of peroxisome proliferator activated receptors (PPARs) are being defined rapidly, as illustrated by the volume of papers published. Much of the research is directed towards a clinical end-point/application; however, the non-homogeneous nature of adipose depots in laboratory animals is spurring similar research in domestic meat animals (such as beef cattle). Moreover, the size of adipose depots in meat animals remains an attractive feature for using them to obtain cells for PPAR research. Examination of meat-animal depot-specific PPAR moieties may provide novel information about adipocyte regulation that might be extrapolated to all animals.

  11. Examination of adipose depot-specific PPAR moieties

    International Nuclear Information System (INIS)

    Dodson, M.V.; Vierck, J.L.; Hausman, G.J.; Guan, L.L.; Fernyhough, M.E.; Poulos, S.P.; Mir, P.S.; Jiang, Z.

    2010-01-01

    Molecular mechanisms of peroxisome proliferator activated receptors (PPARs) are being defined rapidly, as illustrated by the volume of papers published. Much of the research is directed towards a clinical end-point/application; however, the non-homogeneous nature of adipose depots in laboratory animals is spurring similar research in domestic meat animals (such as beef cattle). Moreover, the size of adipose depots in meat animals remains an attractive feature for using them to obtain cells for PPAR research. Examination of meat-animal depot-specific PPAR moieties may provide novel information about adipocyte regulation that might be extrapolated to all animals.

  12. Locating Depots for Capacitated Vehicle Routing

    DEFF Research Database (Denmark)

    Gørtz, Inge Li; Nagarajan, Viswanath

    2016-01-01

    We study a location-routing problem in the context of capacitated vehicle routing. The input to the k-location capacitated vehicle routing problem (k-LocVRP) consists of a set of demand locations in a metric space and a fleet of k identical vehicles, each of capacity Q. The objective is to locate k...... depots, one for each vehicle, and compute routes for the vehicles so that all demands are satisfied and the total cost is minimized. Our main result is a constant-factor approximation algorithm for k-LocVRP. In obtaining this result, we introduce a common generalization of the k-median and minimum...... spanning tree problems (called k median forest), which might be of independent interest. We give a local-search based (3+ε)-approximation algorithm for k median forest, which leads to a (12+ε)-approximation algorithm for k-LocVRP, for any constant ε>0....

  13. Locating Depots for Capacitated Vehicle Routing

    DEFF Research Database (Denmark)

    Gørtz, Inge Li; Nagarajan, Viswanath

    2016-01-01

    depots, one for each vehicle, and compute routes for the vehicles so that all demands are satisfied and the total cost is minimized. Our main result is a constant-factor approximation algorithm for k-LocVRP. In obtaining this result, we introduce a common generalization of the k-median and minimum...... spanning tree problems (called k median forest), which might be of independent interest. We give a local-search based (3+ε)-approximation algorithm for k median forest, which leads to a (12+ε)-approximation algorithm for k-LocVRP, for any constant ε>0.......We study a location-routing problem in the context of capacitated vehicle routing. The input to the k-location capacitated vehicle routing problem (k-LocVRP) consists of a set of demand locations in a metric space and a fleet of k identical vehicles, each of capacity Q. The objective is to locate k...

  14. Bubble propagation in Hele-Shaw channels with centred constrictions

    Science.gov (United States)

    Franco-Gómez, Andrés; Thompson, Alice B.; Hazel, Andrew L.; Juel, Anne

    2018-04-01

    We study the propagation of finite bubbles in a Hele-Shaw channel, where a centred occlusion (termed a rail) is introduced to provide a small axially uniform depth constriction. For bubbles wide enough to span the channel, the system’s behaviour is similar to that of semi-infinite fingers and a symmetric static solution is stable. Here, we focus on smaller bubbles, in which case the symmetric static solution is unstable and the static bubble is displaced towards one of the deeper regions of the channel on either side of the rail. Using a combination of experiments and numerical simulations of a depth-averaged model, we show that a bubble propagating axially due to a small imposed flow rate can be stabilised in a steady symmetric mode centred on the rail through a subtle interaction between stabilising viscous forces and destabilising surface tension forces. However, for sufficiently large capillary numbers Ca, the ratio of viscous to surface tension forces, viscous forces in turn become destabilising thus returning the bubble to an off-centred propagation regime. With decreasing bubble size, the range of Ca for which steady centred propagation is stable decreases, and eventually vanishes through the coalescence of two supercritical pitchfork bifurcations. The depth-averaged model is found to accurately predict all the steady modes of propagation observed experimentally, and provides a comprehensive picture of the underlying steady bifurcation structure. However, for sufficiently large imposed flow rates, we find that initially centred bubbles do not converge onto a steady mode of propagation. Instead they transiently explore weakly unstable steady modes, an evolution which results in their break-up and eventual settling into a steady propagating state of changed topology.

  15. Immunobiological effects of AFB1 and AFB1-FB1 mixture in experimental subchronic mycotoxicoses in rats

    International Nuclear Information System (INIS)

    Theumer, M.G.; Lopez, A.G.; Masih, D.T.; Chulze, S.N.; Rubinstein, H.R.

    2003-01-01

    Maize co-contamination with aflatoxin B1 (AFB1) and fumonisin B1 (FB1) is frequently found in several countries. Although the alterations on nutritional and immunologic parameters induced by these mycotoxins, when administered individually, are partially characterised, little is known about the effects induced in animals by a subchronic administration of both toxins mixtures. We have studied the nutritional and immunological alterations induced in rats fed during 90 days with a diet without mycotoxins, containing 40 ppb AFB1, and with a diet containing a mixture of 40 ppb AFB1 and 100 ppm FB1. Animals fed with the mixture of toxins obtained lower body weight than the control ones. The mitogenic response of spleen mononuclear cells (SMC) in vivo was higher in animals fed with AFB1. In in vitro studies, lower proliferations of SMC pre-exposed to AFB1 and to the mixture of toxins were detected. The SMC of animals fed with AFB1 produced lower levels of IL-2, higher of IL-4 and equal levels of IL-10. The SMC of animals fed with both toxins produced higher levels of IL-4, lower of IL-10 and equal levels of IL-2. The SMC preincubated with an AFB1-FB1 mixture produced higher concentrations of IL-4, lower of IL-10 and equal levels of IL-2. The peritoneal macrophages of animals that consumed AFB1 released less H 2 O 2 , while animals fed with the mixture of toxins produced higher levels. In in vitro studies, macrophages pre-exposed to the mixture of toxins released less H 2 O 2 . These results show different immunobiological effects produced by a mixture of mycotoxins in comparison to the individual action of the same toxins

  16. Immunobiological effects of AFB1 and AFB1-FB1 mixture in experimental subchronic mycotoxicoses in rats

    Energy Technology Data Exchange (ETDEWEB)

    Theumer, M G; Lopez, A G; Masih, D T; Chulze, S N; Rubinstein, H R

    2003-04-15

    Maize co-contamination with aflatoxin B1 (AFB1) and fumonisin B1 (FB1) is frequently found in several countries. Although the alterations on nutritional and immunologic parameters induced by these mycotoxins, when administered individually, are partially characterised, little is known about the effects induced in animals by a subchronic administration of both toxins mixtures. We have studied the nutritional and immunological alterations induced in rats fed during 90 days with a diet without mycotoxins, containing 40 ppb AFB1, and with a diet containing a mixture of 40 ppb AFB1 and 100 ppm FB1. Animals fed with the mixture of toxins obtained lower body weight than the control ones. The mitogenic response of spleen mononuclear cells (SMC) in vivo was higher in animals fed with AFB1. In in vitro studies, lower proliferations of SMC pre-exposed to AFB1 and to the mixture of toxins were detected. The SMC of animals fed with AFB1 produced lower levels of IL-2, higher of IL-4 and equal levels of IL-10. The SMC of animals fed with both toxins produced higher levels of IL-4, lower of IL-10 and equal levels of IL-2. The SMC preincubated with an AFB1-FB1 mixture produced higher concentrations of IL-4, lower of IL-10 and equal levels of IL-2. The peritoneal macrophages of animals that consumed AFB1 released less H{sub 2}O{sub 2}, while animals fed with the mixture of toxins produced higher levels. In in vitro studies, macrophages pre-exposed to the mixture of toxins released less H{sub 2}O{sub 2}. These results show different immunobiological effects produced by a mixture of mycotoxins in comparison to the individual action of the same toxins.

  17. Expandable Cryogenic Tankage for On Orbit Depot Storage, Phase I

    Data.gov (United States)

    National Aeronautics and Space Administration — The proposed expandable depot storage tanks would make it possible to have an on-orbit tank larger in volume than any existing or planned launch vehicles. The size...

  18. Spatial Analysis of Depots for Advanced Biomass Processing

    Energy Technology Data Exchange (ETDEWEB)

    Hilliard, Michael R. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Brandt, Craig C. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Webb, Erin [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Sokhansanj, Shahabaddine [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Eaton, Laurence M. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Martinez Gonzalez, Maria I. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)

    2014-09-01

    The objective of this work was to perform a spatial analysis of the total feedstock cost at the conversion reactor for biomass supplied by a conventional system and an advanced system with depots to densify biomass into pellets. From these cost estimates, the conditions (feedstock cost and availability) for which advanced processing depots make it possible to achieve cost and volume targets can be identified.

  19. Rotating Hele-Shaw cell with a time-dependent angular velocity

    Science.gov (United States)

    Anjos, Pedro H. A.; Alvarez, Victor M. M.; Dias, Eduardo O.; Miranda, José A.

    2017-12-01

    Despite the large number of existing studies of viscous flows in rotating Hele-Shaw cells, most investigations analyze rotational motion with a constant angular velocity, under vanishing Reynolds number conditions in which inertial effects can be neglected. In this work, we examine the linear and weakly nonlinear dynamics of the interface between two immiscible fluids in a rotating Hele-Shaw cell, considering the action of a time-dependent angular velocity, and taking into account the contribution of inertia. By using a generalized Darcy's law, we derive a second-order mode-coupling equation which describes the time evolution of the interfacial perturbation amplitudes. For arbitrary values of viscosity and density ratios, and for a range of values of a rotational Reynolds number, we investigate how the time-dependent angular velocity and inertia affect the important finger competition events that traditionally arise in rotating Hele-Shaw flows.

  20. 77 FR 5781 - Record of Decision for the Air Space Training Initiative Shaw Air Force Base, South Carolina...

    Science.gov (United States)

    2012-02-06

    ... DEPARTMENT OF DEFENSE Department of the Air Force Record of Decision for the Air Space Training Initiative Shaw Air Force Base, South Carolina Final Environmental Impact Statement ACTION: Notice of... signed the ROD for the Airspace Training Initiative Shaw Air Force Base, South Carolina Final...

  1. Locating Depots for Capacitated Vehicle Routing

    DEFF Research Database (Denmark)

    Gørtz, Inge Li; Nagarajan, Viswanath

    2011-01-01

    that all demands are satisfied and the total cost is minimized. Our main result is a constant-factor approximation algorithm for k-LocVRP. To achieve this result, we reduce k-LocVRP to the following generalization of k median, which might be of independent interest. Given a metric (V, d), bound k...... median forest, which leads to a (12+E)-approximation algorithm for k-LocVRP, for any constant E > 0. The algorithm for k median forest is t-swap local search, and we prove that it has locality gap 3 + 2 t ; this generalizes the corresponding result for k median [3]. Finally we consider the k median......We study a location-routing problem in the context of capacitated vehicle routing. The input to k-LocVRP is a set of demand locations in a metric space and a fleet of k vehicles each of capacity Q. The objective is to locate k depots, one for each vehicle, and compute routes for the vehicles so...

  2. AFB/open cycle gas turbine conceptual design study

    Science.gov (United States)

    Dickinson, T. W.; Tashjian, R.

    1983-09-01

    Applications of coal fired atmospheric fluidized bed gas turbine systems in industrial cogeneration are identified. Based on site-specific conceptual designs, the potential benefits of the AFB/gas turbine system were compared with an atmospheric fluidized design steam boiler/steam turbine system. The application of these cogeneration systems at four industrial plant sites is reviewed. A performance and benefit analysis was made along with a study of the representativeness of the sites both in regard to their own industry and compared to industry as a whole. A site was selected for the conceptual design, which included detailed site definition, AFB/gas turbine and AFB/steam turbine cogeneration system designs, detailed cost estimates, and comparative performance and benefit analysis. Market and benefit analyses identified the potential market penetration for the cogeneration technologies and quantified the potential benefits.

  3. Self-Expression or Teacher Influence: The Shaw System of Finger-Painting.

    Science.gov (United States)

    Stankiewicz, Mary Ann

    1984-01-01

    Finger painting is often regarded as the epitome of free expression for children. However, a careful review of the history of Ruth Shaw's finger-painting system reveals that it was dominated by specific techniques and stylistic conventions taught without a critical understanding of art history or appreciation. (IS)

  4. Computer simulation of viscous fingering in a lifting Hele-Shaw cell

    Indian Academy of Sciences (India)

    We simulate viscous fingering generated by separating two plates with a constant force, in a lifting Hele-Shaw cell. Variation in the patterns for different fluid viscosity and lifting force is studied. Viscous fingering is strongly affected by anisotropy. We report a computer simulation study of fingering patterns, where circular or ...

  5. Hele-Shaw beach creation by breaking waves: a mathematics-inspired experiment

    NARCIS (Netherlands)

    Thornton, Anthony Richard; van der Horn, Avraham/Bram; van der Horn, Avraham J.; Gagarina, Elena; Zweers, Wout; van der Meer, Roger M.; Bokhove, Onno

    2014-01-01

    Fundamentals of nonlinear wave-particle interactions are studied experimentally in a Hele-Shaw configuration with wave breaking and a dynamic bed. To design this configuration, we determine, mathematically, the gap width which allows inertial flows to survive the viscous damping due to the side

  6. Architecture Study for a Fuel Depot Supplied from Lunar Assets

    Science.gov (United States)

    Perrin, Thomas M.; Casler, James G.

    2016-01-01

    This architecture study sought to determine the optimum architecture for a fuel depot supplied from lunar assets. Four factors - the location of propellant processing (on the Moon or on the depot), the depot location (on the Moon, L1, GEO, or LEO), the propellant transfer location (L1, GEO, or LEO), and the propellant transfer method (bulk fuel or canister exchange) were combined to identify 18 candidate architectures. Two design reference missions (DRMs) - a commercial satellite servicing mission and a Government cargo mission to Mars - created demand for propellants, while a propellant delivery DRM examined supply issues. The study concluded Earth-Moon L1 is the best location for an orbiting depot. For all architectures, propellant boiloff was less than anticipated, and was far overshadowed by delta-v requirements and resulting fuel consumption. Bulk transfer is the most flexible for both the supplier and customer. However, since canister exchange bypasses the transfer of bulk cryogens and necessary chilldown losses, canister exchange shows promise and merits further investigation. Overall, this work indicates propellant consumption and loss is an essential factor in assessing fuel depot architectures.

  7. Supply Inventory Management: Accountability and Control of Materiel at the Naval Air Depot, North Island

    National Research Council Canada - National Science Library

    2002-01-01

    ... of the $6.8 billion was for operation of three Naval Air Depots. A significant portion of the $1.5 billion was for purchasing materiel used in repair and overhaul processes at the depot maintenance facilities...

  8. Supply Inventory Managment: Accountability and Control of Materiel at the Naval Air Depot, North Island

    National Research Council Canada - National Science Library

    Young, Shelton

    2002-01-01

    ... of the $6.8 billion was for operation of three Naval Air Depots. A significant portion of the $1.5 billion was for purchasing materiel used in repair and overhaul processes at the depot maintenance facilities...

  9. Pengembangan Merek dan Pengkajian Strategi Pemasaran di Depot Rasa Suka Kediri

    OpenAIRE

    Raharjo, Rini; Surjani, Rosita Meitha; Rinawiyanti, Esti Dwi

    2013-01-01

    Depot Rasa Suka is a culinary business that provides a variety of Indonesian dishes. However people still do not know and yet loyal to Depot Rasa Suka due to the unavailability of parking space, quite a long serving time, hot room, less attractive promotion and room design. Therefore Depot Rasa Suka need to devise strategies to develop brands through brand equity analysis and improvement of brand elements as well as designing a marketing strategies. The goal of this research is to make Depot ...

  10. CloudSat Safety Operations at Vandenberg AFB

    Science.gov (United States)

    Greenberg, Steve

    2006-01-01

    CloudSat safety operations at Vendenberg AFB is given. The topics include: 1) CloudSat Project Overview; 2) Vandenberg Ground Operations; 3) Delta II Launch Vehicle; 4) The A-Train; 5) System Safety Management; 6) CALIPSO Hazards Assessment; 7) CALIPSO Supplemental Safeguards; 8) Joint System Safety Operations; 9) Extended Stand-down; 10) Launch Delay Safety Concerns; and 11) Lessons Learned.

  11. Environmental Assessment of Beale AFB Grazing Lease Program

    Science.gov (United States)

    2012-12-01

    Beale AFB will use livestock (cattle, sheep and goats ) on its properties throughout the year as needed for the control of noxious weeds, reduction...initiating a wildfire. California Farm Bureau Federation policy recognizes that grazing is the most practical and environmentally acceptable way to...Site Monitoring Well Installation and Annual Targeted Goat Grazing Project, Placer County, California. 21 September 2011.  

  12. DEPOT: Database for electronics parts and other things

    International Nuclear Information System (INIS)

    Logg, C.A.; Clancey, P.W.; Crane, G.

    1990-01-01

    DEPOT has been developed to provide tracking for the Stanford Linear Collider (SLC) control system equipment. For each piece of equipment entered in the database, a complete service, maintenance, modification, certification, location history, and, optionally, a radiation exposure history, can be maintained. To facilitate data entry accuracy, efficiency, and consistency, barcoding technology has been used extensively. DEPOT has been an important tool in improving the reliability of the microsystems controlling SLC. It is now being adopted by other systems at SLAC. 6 refs., 6 figs

  13. NASA Shuttle Logistics Depot (NSLD) - The application of ATE

    Science.gov (United States)

    Simpkins, Lorenz G.; Jenkins, Henry C.; Mauceri, A. Jack

    1990-01-01

    The concept of the NASA Shuttle Logistics Depot (NSLD) developed for the Space Shuttle Orbiter Program is described. The function of the NSLD at Cape Canaveral is to perform the acceptance and diagnostic testing of the Shuttle's space-rated line-replaceable units and shop-replaceable units (SRUs). The NSLD includes a comprehensive electronic automatic test station, program development stations, and assorted manufacturing support equipment (including thermal and vibration test equipment, special test equipment, and a card SRU test system). The depot activities also include the establishment of the functions for manufacturing of mechanical parts, soldering, welding, painting, clean room operation, procurement, and subcontract management.

  14. Prediction of Instability for Miscible Displacements in a Hele-Shaw Cell Prévision de l'instabilité pour des déplacements miscibles dans une cellule Hele-Shaw

    Directory of Open Access Journals (Sweden)

    Coskuner G.

    2006-11-01

    Full Text Available A universal dimensionless scaling group and its critical value at the onset of instability for a miscible displacement in a Hele-Shaw cell is derived. The derivation is based on a variational technique and it is capable of considering, for the first time, the effect of the length of a Hele-Shaw cell on the criterion for the onset of instability. The theory is verified by comparing it with forty-four Hele-Shaw cell experiments. On calcule un groupe universel sans dimension de mise à l'échelle et sa valeur critique au départ de l'instabilité dans un déplacement miscible dans une cellule Hele-Shaw. Ce calcul est basé sur une technique variationnelle et permet, pour la première fois, de prendre en compte l'effet de la longueur d'une cellule Hele-Shaw sur le critère d'apparition d'instabilité. La théorie est vérifiée en la comparant avec des expériences réalisées avec quarante-quatre cellules Hele-Shaw.

  15. Computer-aided acquisition and logistics support (CALS): Concept of Operations for Depot Maintenance

    Energy Technology Data Exchange (ETDEWEB)

    Bourgeois, N.C.; Greer, D.K.

    1993-04-01

    This CALS Concept of Operations for Depot Maintenance provides the foundation strategy and the near term tactical plan for CALS implementation in the depot maintenance environment. The user requirements enumerated and the overarching architecture outlined serve as the primary framework for implementation planning. The seamless integration of depot maintenance business processes and supporting information systems with the emerging global CALS environment will be critical to the efficient realization of depot user's information requirements, and as, such will be a fundamental theme in depot implementations.

  16. On a Hele-Shaw flow with a time-dependent gap in the presence of surface tension

    International Nuclear Information System (INIS)

    Savina, T V; Nepomnyashchy, A A

    2015-01-01

    The introduction of surface tension into a Hele-Shaw problem makes it more realistic from the physical viewpoint, but more difficult from the mathematical viewpoint. In this paper we discuss a Hele-Shaw flow with a time-dependent gap taking into account the surface tension of the free boundary. We use the Schwarz function method to find asymptotic solutions for the interior problem in the case when the initial shape of the droplet is a weakly distorted circle. (paper)

  17. Orbiting Depot and Reusable Lander for Lunar Transportation

    Science.gov (United States)

    Petro, Andrew

    2009-01-01

    A document describes a conceptual transportation system that would support exploratory visits by humans to locations dispersed across the surface of the Moon and provide transport of humans and cargo to sustain one or more permanent Lunar outpost. The system architecture reflects requirements to (1) minimize the amount of vehicle hardware that must be expended while maintaining high performance margins and (2) take advantage of emerging capabilities to produce propellants on the Moon while also enabling efficient operation using propellants transported from Earth. The system would include reusable single- stage lander spacecraft and a depot in a low orbit around the Moon. Each lander would have descent, landing, and ascent capabilities. A crew-taxi version of the lander would carry a pressurized crew module; a cargo version could carry a variety of cargo containers. The depot would serve as a facility for storage and for refueling with propellants delivered from Earth or propellants produced on the Moon. The depot could receive propellants and cargo sent from Earth on a variety of spacecraft. The depot could provide power and orbit maintenance for crew vehicles from Earth and could serve as a safe haven for lunar crews pending transport back to Earth.

  18. New Insights into Drug Absorption from Oil Depots

    NARCIS (Netherlands)

    Kalicharan, R.W.

    2017-01-01

    Sustained delivery formulations are used in order to prolong the pharmacological activity of a drug. A commonly used parenteral sustained delivery formulation is an oil depot which consists of a solution of lipophilic molecules in a vegetable oil. These are normally administered either

  19. Whole tree transportation system for timber processing depots

    Science.gov (United States)

    John Lancaster; Tom Gallagher; Tim  McDonald; Dana Mitchell

    2016-01-01

    The growing demand for alternative energy has led those who are interested in producing sustainable energy from renewable timber to devise new concepts to satisfy those demands. The concept of timber processing depots, where whole stem trees will be delivered for future processing into wood products and high quality energy fuel, has led to the re-evaluation of our...

  20. Fatty acid composition of subcutaneous and kidney fat depots of ...

    African Journals Online (AJOL)

    60. Fatty acid composition of subcutaneous and kidney fat depots of Boer goats and the response to varying levels of maize meal. N.H. Casey" and W.A. van Niekerk. Department of Animal Science, Faculty of Agriculture,. University of Pretoria, Pretoria, 0002 Republic of South Africa. xTo whom correspondence should be ...

  1. Redistributing Stock in Library Systems with a Depot

    NARCIS (Netherlands)

    van der Heide, Gerlach; Roodbergen, Kees Jan; van Foreest, Nicky

    Public library organizations often utilize depots for carrying out shipments to libraries in case of stock-outs and for storing low demand rental items at low cost. Similar systems may be employed by rental companies for other rental products such as tools, DVDs, and jewelry. Since shipments deplete

  2. Determining the number of fingers in the lifting Hele-Shaw problem

    Science.gov (United States)

    Miranda, Jose; Dias, Eduardo

    2013-11-01

    The lifting Hele-Shaw cell flow is a variation of the celebrated radial viscous fingering problem for which the upper cell plate is lifted uniformly at a specified rate. This procedure causes the formation of intricate interfacial patterns. Most theoretical studies determine the total number of emerging fingers by maximizing the linear growth rate, but this generates discrepancies between theory and experiments. In this work, we tackle the number of fingers selection problem in the lifting Hele-Shaw cell by employing the recently proposed maximum-amplitude criterion. Our linear stability analysis accounts for the action of capillary, viscous normal stresses, and wetting effects, as well as the cell confinement. The comparison of our results with very precise laboratory measurements for the total number of fingers shows a significantly improved agreement between theoretical predictions and experimental data. We thank CNPq (Brazilian Sponsor) for financial support.

  3. Genealogy of John and Charles Bell: their relationship with the children of Charles Shaw of Ayr.

    Science.gov (United States)

    Kaufman, M

    2005-11-01

    The Reverend William Bell had six children who survived infancy. Two of his sons entered the legal profession and two other sons became distinguished anatomists and surgeons--John Bell, said for 20 years to have been the leading operating surgeon in Britain and throughout the world--and Sir Charles Bell, possibly the most distinguished anatomist and physiologist of his day. Information is not known about the fifth son or their sister. Charles Shaw, a lawyer of Ayr, had four sons and two daughters who survived infancy. Two of his sons, John and Alexander, became anatomists and later surgeons at the Middlesex Hospital, and both worked closely with Charles Bell at the Great Windmill Street School of Anatomy. His third son entered the law and his fourth son became a distinguished soldier. The two daughters of Charles Shaw married into the Bell family: Barbara married George Joseph Bell and Marion married Mr (later Sir) Charles Bell.

  4. Environmental Assessment for Wing Infrastructure Development Outlook (WINDO) Plan Shaw Air Force Base, South Carolina

    Science.gov (United States)

    2004-10-01

    officially established on August 30, 1941 and was named after 1st Lt. Ervin D. Shaw, a Sumter County resident who was killed in action during World War I...Examples of the animal species likely to occur within this community include the cottontail, mockingbird , American robin, and crow. At the Poinsett...include the white-tailed deer, red fox, raccoon, opossum, striped skunk, cottontail, meadowlark, mockingbird , American kestrel, fence lizard, and

  5. A Special Class of Univalent Functions in Hele-Shaw Flow Problems

    Directory of Open Access Journals (Sweden)

    Paula Curt

    2011-01-01

    Full Text Available We study the time evolution of the free boundary of a viscous fluid for planar flows in Hele-Shaw cells under injection. Applying methods from the theory of univalent functions, we prove the invariance in time of Φ-likeness property (a geometric property which includes starlikeness and spiral-likeness for two basic cases: the inner problem and the outer problem. We study both zero and nonzero surface tension models. Certain particular cases are also presented.

  6. Henri Bergson y George Bernard Shaw: hábito, vida, muerte

    Directory of Open Access Journals (Sweden)

    Álvaro Cortina Urdampilleta

    2015-01-01

    Full Text Available Este artículo indaga en algunos aspectos de la antropología filosófica expuesta en la obra del francés Henri Bergson. Para ello, nos serviremos de la confrontación de su doctrina original con la de un bergsoniano sui generis, el intelectual y dramaturgo irlandés George Bernard Shaw. El Prefacio. A medio siglo infiel, de Shaw, incluido en su obra más ambiciosa, Vuelta a Matusalén. Un Pentateuco Metabiológico, de 1921, será el texto base con el que haremos dialogar a Bergson con este periférico bergsonismo. Tomaremos como hilo conductor la teoría sobre el hábito, en el contexto de la metafísica de la evolución de los seres orgánicos, y lo llevaremos hasta el concepto límite, que parece conciliar ambas posturas: la idea de muerte superable. Ni en Bergson ni en Shaw los hábitos (la Cultura forman parte integral de la esencia del hombre, y la muerte (cuestión en la que Bergson es mucho más elusivo juega en ellos un rol anfibio, entre Cultura y Naturaleza.

  7. Building Energy Audit Report, for Hickam AFB, HI

    Energy Technology Data Exchange (ETDEWEB)

    Chvala, William D.; De La Rosa, Marcus I.; Brown, Daryl R.; Dixon, Douglas R.

    2010-09-30

    A building energy assessment was performed by a team of engineers from Pacific Northwest National Laboratory (PNNL) under contract to the Department of Energy/Federal Energy Management program (FEMP). The effort used the Facility Energy Decision System (FEDS) model to determine how energy is consumed at Hickam AFB, identify the most cost-effective energy retrofit measures, and calculate the potential energy and cost savings. This documents reports the results of that assessment.

  8. Final Environmental Assessment: Replace Hanscom AFB Middle School

    Science.gov (United States)

    2012-04-01

    2012 iv RFTA Reserve Forces Training Area SAPS Satellite Accumulation Points SF Square feet SIP State Implementation Plan SO2 Sulfur dioxide...Restoration Program (IRP), now called the Environmental Restoration Program ( ERP ). Subsequent discoveries increased the number of sites to 22. Each...EPA under CERCLA or by the Commonwealth of Massachusetts. No sites listed in the ERP for Hanscom AFB are located on or near the existing Middle

  9. Robert R. Shaw, MD: thoracic surgical hero, Afghanistan medical pioneer, champion for the patient, never a surgical society president.

    Science.gov (United States)

    Urschel, Harold C; Urschel, Betsey Bradley

    2012-06-01

    Dr Robert R. Shaw arrived in Dallas to practice Thoracic Surgery in 1937, as John Alexander's 7th Thoracic Surgical Resident from Michigan University Medical Center. Dr Shaw's modus operandi was, "You can accomplish almost anything, if you don't care who gets the credit." He was a remarkable individual who cared the most about the patient and very little about getting credit for himself. From 1937 to 1970, Dr Shaw established one of the largest lung cancer surgical centers in the world in Dallas, Texas. It was larger than M.D. Anderson and Memorial Sloan-Kettering Hospitals put together regarding the surgical treatment of lung cancer patients. To accomplish this, he had the help of Dr Donald L. Paulson, who trained at the Mayo Clinic and served as Chief of Thoracic Surgery at Brook Army Hospital during the Second World War. Following the War, because of his love for Texas, he ended up as a partner of Dr Shaw in Dallas. Together, they pursued the development of this very large surgical lung cancer center. Dr Shaw and his wife Ruth went to Afghanistan with Medico multiple times to teach men modern cardiac and thoracic surgery. They also served as consultants on Medico's Ship of Hope in Africa. Dr Shaw initiated multiple new operations including: 1) resection of Pancoast's cancer of the lung after preoperative irradiation; 2) upper lobe of the lung bronchoplasty, reattaching (and saving) the lower lobe to prevent the "disabling" pneumonectomy; and 3) resections of pulmonary mucoid impaction of the lung in asthmatics. Because of his humility and giving "the credit to others," Dr Shaw was never President of a major medical or surgical association. Copyright © 2012 The Society of Thoracic Surgeons. Published by Elsevier Inc. All rights reserved.

  10. Master Environmental Plan: Fort Wingate Depot Activity, Gallup, New Mexico

    Energy Technology Data Exchange (ETDEWEB)

    Biang, C.A.; Yuen, C.R.; Biang, R.P.; Antonopoulos, A.A.; Ditmars, J.D.

    1990-12-01

    The master environmental plan is based on an environmental assessment of the areas requiring environmental evaluation (AREEs) at Fort Wingate Depot Activity near Gallup, New Mexico. The Fort Wingate Depot Activity is slated for closure under the Base Closure and Realignment Act, Public Law 100--526. The MEP assesses the current status, describes additional data requirements, recommends actions for the sites, and establishes a priority order for actions. The plan was developed so that actions comply with hazardous waste and water quality regulations of the State of New Mexico and applicable federal regulations. It contains a brief history of the site, relevant geological and hydrological information, and a description of the current status for each AREE along with a discussion of the available site-specific data that pertain to existing or potential contamination and the impact on the environment. 35 refs., 27 figs., 23 tabs.

  11. Radiological Final Status Survey of the Hammond Depot, Hammond, Indiana

    International Nuclear Information System (INIS)

    Vitkus, T.J.

    2008-01-01

    ORISE conducted extensive scoping, characterization, and final status surveys of land areas and structures at the DNSC's Hammond Depot located in Hammond, Indiana in multiple phases during 2005, 2006 and 2007. This report provides a detailed discussion of the radiological survey planning, survey implementation, remediation, and the results for these activities supporting the conclusion that radioactive contamination previously identified at the Hammond Depot (HD) has been reduced to levels such that the site may be released without radiological restrictions. The objective of the radiological final status survey (FSS) was to obtain the data necessary to demonstrate compliance with the U.S. Nuclear Regulatory Commission (NRC)-approved site-specific derived concentration guideline levels (DCGLs) for both structural surfaces and outdoor areas (ORISE 2006a and NRC 2007). The DCGLs were modeled such that any residual licensed material would not exceed the NRC's basic dose limit for license termination of 25 millirem per year (mrem/y)

  12. Use of depot medroxyprogesterone acetate and fracture risk

    OpenAIRE

    Meier, Christian; Brauchli, Yolanda B.; Jick, Susan S.; Kraenzlin, Marius E.; Meier, Christoph R.

    2010-01-01

    Depot medroxyprogesterone acetate (DMPA), which has a high rate of use among teenagers in Europe and the United States, has been associated with impaired bone mineral acquisition during adolescence and accelerated bone loss in later life. Studies on the association between DMPA use and fracture risk are limited.; We aimed at evaluating the relationship between use of hormonal contraceptives, specifically DMPA, and fracture risk.; We conducted a case-control analysis using the United Kingdom-b...

  13. Process and Energy Optimization Assessment, Tobyhanna Army Depot, PA

    Science.gov (United States)

    2006-04-17

    assembly of electronic-communication components, different welding processes are performed at TYAD. It uses shielded arc, metal inert gas (MIG...tungsten inert gas ( TIG ), and silver braz- ing oxygen/acetylene cutting plasma arc methods to complete mission re- quirements. Major welding jobs are...ER D C/ CE R L TR -0 6 -1 1 Process and Energy Optimization Assessment Tobyhanna Army Depot, PA Mike C.J. Lin, Alexander M. Zhivov

  14. Occupational Exposure of Petroleum Depot Workers to BTEX Compounds

    Directory of Open Access Journals (Sweden)

    M Rezazadeh Azari

    2011-12-01

    Full Text Available Background: Benzene, toluene, ethylbenzene and xylene (BTEX are the most important toxic volatile compounds in the air and could be easily absorbed through the respiratory tract. In recent years, the risk of exposure to BTEX compounds, especially benzene as a carcinogen, has been considered in petroleum depot stations. Objective: To assess the occupational exposure of petroleum depot workers in Iran to BTEX compounds. Methods: After completing a questionnaire and assessing occupational exposure to BTEX compounds, 78 (46 exposed and 32 non-exposed depot workers were randomly selected to participate in this study. Air sampling and analysis of BTEX was conducted according to the NIOSH method No. 1501. Analysis of urinary hippuric acid, as an indicator of toluene exposure, was carried out according to NIOSH method No. 8300. Personal monitoring of the high exposure group to BTEX compounds was repeated to verify the results obtained in the first phase of the monitoring. Results: Among the 9 operating groups studied, occupational exposure to benzene and toluene was higher in quality control and gasoline loading operators—the median exposure ranged from 0.16 to 1.63 ppm for benzene and 0.2 to 2.72 ppm for toluene. Median exposure of other group members to BTEX compounds was below the detection limit of analytical method (0.07, 0.06, 0.05, and 0.05 ppm, respectively. The level of toluene exposure measured showed correlation with neither post-shift urinary hippuric acid (Spearman's rho=0.128, p=0.982 nor with the difference between post- and pre-shift urinary hippuric acid (Spearman's rho=0.089, p=0.847 in depot operational workers. Conclusion: Gasoline loading operators are exposed to a relatively high level of benzene.

  15. [Treatment of Adult Schizophrenic Patients With Depot Antipsychotics].

    Science.gov (United States)

    Jaramillo González, Luis Eduardo; Gómez Restrepo, Carlos; García Valencia, Jenny; de la Hoz Bradford, Ana María; Ávila-Guerra, Mauricio; Bohórquez Peñaranda, Adriana

    2014-01-01

    To determine the indications of long-acting antipsychotic injection and what its effectiveness and safety in adult patients with schizophrenia during the treatment maintenance phase. A clinical practice guideline was elaborated under the parameters of the Methodological Guide of the Ministerio de Salud y Protección Social to identify, synthesize and evaluate the evidence and make recommendations about the treatment and follow-up of adult patients with schizophrenia. The evidence of NICE guide 82 was adopted and updated. The evidence was presented to the Guideline Developing Group and recommendations, employing the GRADE system, were produced. The literature review shows that the evidence has moderate to low quality. 8 articles were used. The risk of relapse was lower with depot risperidone and paliperidone palmitate when compared with placebo. For the risk of hospitalizations comparing depot antipsychotics (APD) versus oral AP, the result is inconclusive. Globally the second-generation APD had a lower risk of discontinuation when compared with placebo. The second generation AP had higher risk of extrapyramidal syndromes than placebo, as in the use of antiparkinsonian. The comparison of second-generation AP injections versus placebo showed an increased risk of early weight gain. The use of depot antipsychotics in the maintenance phase of adult patients diagnosed with schizophrenia is recommended if there is no adherence to oral antipsychotics as the patient's preference. It is not recommended depot antipsychotics in the acute phase of schizophrenia in adults. Copyright © 2014 Asociación Colombiana de Psiquiatría. Publicado por Elsevier España. All rights reserved.

  16. Depot Maintenance: Improvements to DODs Biennial Core Report Could Better Inform Oversight and Funding Decisions

    Science.gov (United States)

    2016-11-01

    military depots, and not workload performed by the private - sector . MDA officials told us that OSD guidance does not explain how to calculate the...military depots2—public- sector facilities that are government-owned and government-operated—and private - sector contractors. Depots have a key role...the public or private sectors . 3Pub. L. No. 98-525 § 307 (1984). This section was originally codified at 10 U.S.C. § 2304 (note). Letter

  17. Evaluation of Uniform Cost Accounting System to Fully Capture Depot Level Repair Costs.

    Science.gov (United States)

    1985-12-01

    RD-RI65 522 EVALUATION OF UNIFORM COST ACCOUNTING SYSTEM TO FULLY i/I CAPTURE DEPOT LEVEL REPAIR COSTS (U) NAVAL POSTGRADUATE SCHOOL MONTEREY CA D R...8217.LECTE B ,- THESIS EVALUATION OF UNIFORM COST ACCOUNTING SYSTEM 0TO FULLY CAPTURE DEPOT LEVEL REPAIR COSTS Jby __jDavid Richmond O’Brien lj,,, December...Include Security Classification) EVALUATION OF UNIFORM COST ACCOUNTING SYSTEM TO FULLY CAPTURE DEPOT LEVEL REPAIR COSTS 12 PERSONAL AUTHOR(S) O’Brien- David

  18. An assembly of steadily translating bubbles in a Hele–Shaw channel

    International Nuclear Information System (INIS)

    Crowdy, Darren

    2009-01-01

    This paper presents new solutions for any finite number of bubbles steadily translating along a Hele–Shaw channel. This constitutes a nonlinear free boundary problem. The solutions can be written down explicitly in terms of a special transcendental function called the Schottky–Klein prime function. This work generalizes the exact solutions for a single bubble in a channel found by Tanveer (1987 Phys. Fluids 30 651–8) as well as the solutions for streams of bubbles aligned along the channel centreline due to Vasconcelos (1994 Phys. Rev. E 50 R3306–9)

  19. Non-Newtonian Hele-Shaw Flow and the Saffman-Taylor Instability

    International Nuclear Information System (INIS)

    Kondic, L.; Shelley, M.J.; Palffy-Muhoray, P.

    1998-01-01

    We explore the Saffman-Taylor instability of a gas bubble expanding into a shear thinning liquid in a radial Hele-Shaw cell. Using Darcy close-quote s law generalized for non-Newtonian fluids, we perform simulations of the full dynamical problem. The simulations show that shear thinning significantly influences the developing interfacial patterns. Shear thinning can suppress tip splitting, and produce fingers which oscillate during growth and shed side branches. Emergent length scales show reasonable agreement with a general linear stability analysis. copyright 1998 The American Physical Society

  20. New archeointensity results from the reconstructed ancient kiln by the Tsunakawa-Shaw method

    Science.gov (United States)

    Yamamoto, Y.; Hatakeyama, T.; Kitahara, Y.; Saito, T.

    2017-12-01

    Yamamoto et al. (2015) reported that baked clay samples from the floor of a reconstructed ancient kiln provided a reliable Tsunakawa-Shaw (LTD-DHT Shaw) archeointensity (AI) estimate of 47.3 +/- 2.2 microT which is fairly consistent with the in situ geomagnetic field of 46.4 microT at the time of the reconstruction. The reconstruction was conducted to reproduce an excavated kiln of the seventh century in Japan and Sue-type potteries of contemporary style were also fired (Nakajima et al., 1974). Two of the potteries with reddish color were recently subjected to the Tsunakawa-Shaw archeointensity determinations, resulting in reliable AI estimates of 45.4 +/- 2.3 (N=6) and 48.2 +/- 2.7 microT (N=15) when specimens were heated in air in laboratory (Yamamoto et al., 2017 JpGU-AGU Joint Meeting). We have had another opportunity to take samples from a new reconstructed ancient kiln in Japan which was fired in autumn 2016. The samples were two Sue-type potteries with grayish color (bowl-type and plate-type) and some blocks collected from inner wall of the kiln body. They were cut into mini specimens and then subjected to the Tsunakawa-Shaw experiment. Heating in laboratory was done either in air or vacuum.For the bowl-type pottery, AIs of 46.9 +/- 2.8 (N=6, air) and 45.3 +/- 2.3 microT (N=6, vacuum) are obtained. They are indistinguishable each other and consistent with the IGRF field of 47.4 microT at the reconstructed location in 2016. For the plate-type pottery, AIs result in 41.8 +/- 1.3 (N=4, air) and 43.9 +/- 3.9 microT (N=4, vacuum). They are also indistinguishable each other but the former AI is slightly lower than the IGRF field.For the inner wall, AIs of 45.0 (N=1, air) and 46.8 microT (N=1, vacuum) are obtained from a right-side wall, and those of 45.5 +/- 2.5 (N=2, air) and 47.7 +/- 3.0 microT (N=2, vacuum) are observed from a left-side wall. They are all indistinguishable and consistent with the IGRF field.

  1. Premixed combustion of coconut oil in a hele-shaw cell

    Directory of Open Access Journals (Sweden)

    Hadi Saroso

    2014-12-01

    Full Text Available Coconut oil combustion characteristic is observed experimentally by evaporating oil in the boiler then mix it with air before being burned at various equivalence ratios in the Hele-shaw cell. The result shows that, coconut oil tends to break into glycerol and fatty acid due to hydrolysis reaction producing the flame propagation, where the fatty acid flame propagates first then glycerol flame. Micro-explosion occurs when moisture from fatty acid combustion is absorbed by glycerol and higher heating due to higher flame speed produces more micro-explosion.

  2. Analisis Isi Lambung Ikan Senangin (Eleutheronema tetradactylum Shaw di Perairan Dumai

    Directory of Open Access Journals (Sweden)

    Titrawani Titrawani

    2016-03-01

    Full Text Available The research about stomach content analysis of thraedfin fish (Eleutheronema tetradactylum Shaw “senangin fish” in Dumai aquatic was taken out on July until Maret 2011. The research aimed to know the kind of senangin fish’s food include main food, supplement food and additional food. The used analysis based on Natarjan and Jingran in Effendi (1979, by analysis index of preponderance (Higher Part Index. Based on them main food of senangin fish are  Crustacea,  Engraulidae and animal debric.

  3. Enhancement of polycyclic aromatic hydrocarbons in estuarine invertebrates by surface runoff at a decommissioned military fuel depot

    Science.gov (United States)

    Miles, A.K.; Roster, N.

    1999-01-01

    Accumulation of polycyclic aromatic hydrocarbons (PAHs) was determined in blue mussels (Mytilus spp.) and shore crabs (Hemigrapsus sp.) at a recently closed military fuel depot in central San Francisco Bay, California. In April 1996, during a period of above average precipitation, specimens were collected at the depot, near the depot, and at sites 10 and 20 km south of the depot. Four weeks after the rains ended, blue mussels were again collected at the depot, and at two additional sites in the central Bay region. In April, total PAHs in mussels from the depot were significantly higher only than that in mussels collected 20 km from the depot; however, seven specific, substituted PAHs were higher at the depot than at all other sites. In June, only two of the 38 PAHs common in mussels in April were detected at the depot; these concentrations were comparable to ambient concentrations in mussels at the Bay. It seemed that bioavailability of PAHs at the depot was enhanced by rainfall, probably due to the mobilization of PAHs via groundwater into the Bay. Concentrations in mussels from chronically contaminated sites were about five times higher than mussels collected from the depot. Low PAH concentrations were detected in shore crabs near the depot, and the highest levels were not associated with the depot. Observed PAH concentrations are discussed in relation to upper trophic organisms.

  4. Bubble extinction in Hele-Shaw flow with surface tension and kinetic undercooling regularization

    International Nuclear Information System (INIS)

    Dallaston, Michael C; McCue, Scott W

    2013-01-01

    We perform an analytic and numerical study of an inviscid contracting bubble in a two-dimensional Hele-Shaw cell, where the effects of both surface tension and kinetic undercooling on the moving bubble boundary are not neglected. In contrast to expanding bubbles, in which both boundary effects regularize the ill-posedness arising from the viscous (Saffman–Taylor) instability, we show that in contracting bubbles the two boundary effects are in competition, with surface tension stabilizing the boundary, and kinetic undercooling destabilizing it. This competition leads to interesting bifurcation behaviour in the asymptotic shape of the bubble in the limit it approaches extinction. In this limit, the boundary may tend to become either circular, or approach a line or ‘slit’ of zero thickness, depending on the initial condition and the value of a nondimensional surface tension parameter. We show that over a critical range of surface tension values, both these asymptotic shapes are stable. In this regime there exists a third, unstable branch of limiting self-similar bubble shapes, with an asymptotic aspect ratio (dependent on the surface tension) between zero and one. We support our asymptotic analysis with a numerical scheme that utilizes the applicability of complex variable theory to Hele-Shaw flow. (paper)

  5. Contracting bubbles in Hele-Shaw cells with a power-law fluid

    International Nuclear Information System (INIS)

    McCue, Scott W; King, John R

    2011-01-01

    The problem of bubble contraction in a Hele-Shaw cell is studied for the case in which the surrounding fluid is of power-law type. A small perturbation of the radially symmetric problem is first considered, focussing on the behaviour just before the bubble vanishes, it being found that for shear-thinning fluids the radially symmetric solution is stable, while for shear-thickening fluids the aspect ratio of the bubble boundary increases. The borderline (Newtonian) case considered previously is neutrally stable, the bubble boundary becoming elliptic in shape with the eccentricity of the ellipse depending on the initial data. Further light is shed on the bubble contraction problem by considering a long thin Hele-Shaw cell: for early times the leading-order behaviour is one-dimensional in this limit; however, as the bubble contracts its evolution is ultimately determined by the solution of a Wiener–Hopf problem, the transition between the long thin limit and the extinction limit in which the bubble vanishes being described by what is in effect a similarity solution of the second kind. This same solution describes the generic (slit-like) extinction behaviour for shear-thickening fluids, the interface profiles that generalize the ellipses that characterize the Newtonian case being constructed by the Wiener–Hopf calculation

  6. Gas driven displacement in a Hele-Shaw cell with chemical reaction

    Science.gov (United States)

    White, Andrew; Ward, Thomas

    2011-11-01

    Injecting a less viscous fluid into a more viscous fluid produces instabilities in the form of fingering which grow radially from the less viscous injection point (Saffman & Taylor, Proc. R. Soc. Lon. A, 1958). For two non-reacting fluids in a radial Hele-Shaw cell the ability of the gas phase to penetrate the liquid phase is largely dependent on the gap height, liquid viscosity and gas pressure. In contrast combining two reactive fluids such as aqueous calcium hydroxide and carbon dioxide, which form a precipitate, presents a more complex but technically relevant system. As the two species react calcium carbonate precipitates and increases the aqueous phase visocosity. This change in viscosity may have a significant impact on how the gas phase penetrates the liquid phase. Experimental are performed in a radial Hele-Shaw cell with gap heights O(10-100) microns by loading a single drop of aqueous calcium hydroxide and injecting carbon dioxide into the drop. The calcium hydroxide concentration, carbon dioxide pressure and gap height are varied and images of the gas penetration are analyzed to determine residual film thickness and bursting times.

  7. Narsisisme dan Kompleks Oedipus yang Tergambar dalam Pygmalion, Karya George Bernard Shaw

    Directory of Open Access Journals (Sweden)

    Essy Syam

    2017-06-01

    Full Text Available Abstract This writing analyzes narcisism and oedipuis complex as refelcted in a literary work entitles “pygmalion” written by George Bernard Shaw. Thus, the objective of this analysis is to show and to analyze how narcisism and Oedipus complex are suffered from the protagonist of this work. To reach that objective, this analysis applies psychoanalitical analysis  to demonstrate the mental condition of the main character. Related to that idea, this analysis applies adescriptive analysis method in which the result of the analysis will be described clearly. From teh presented description, it will show how the main character of this work lives his life and in his interaction with other characters will describe his mental condition.   Keywords: Pygmalion, psychoanalisis, Narcisism, Oedipus Complex.    Abstrak Tulisan ini menganalisis kasus Narsisme dan Kompleks Oedipus yang tergambar pada sebuah karya sastra berjudul Pygmalion yang ditulis oleh George  Bernard Shaw.  Maka tujuan penelitian ini adalah untuk memperlihatkan dan menganalisis bagaimana kasus narsisme dan kompleks oedipus yang dialami oleh tokoh utama karya ini. Untuk mencapai tujuan itu, kajian ini menerapkan kajian psikoanalisis  untuk memperlihatkan kondisi kejiwaan tokoh utama yang mengalami gangguan jiwa yang dimanakan Narsisime dan Kompleks Oedipus.  Kajian ini menerapkan metode deskriptif analisis dimana hasil analisis akan dideskripsikan dengan jelas. Dari deskripsi yang dijabarkan akan memperlihatkan bagaimana tokoh utama karya ini dalam kehidupannya dan interaksinya dengan tokoh yang lain memperlihatkan kondisi jiwanya.   Kata Kunci: Pygmalion, Psikoanalisis. Narsisime, Kompleks Oedipus

  8. 33 CFR 334.1130 - Pacific Ocean, Western Space and Missile Center (WSMC), Vandenberg AFB, Calif.; danger zones.

    Science.gov (United States)

    2010-07-01

    ... Missile Center (WSMC), Vandenberg AFB, Calif.; danger zones. 334.1130 Section 334.1130 Navigation and... RESTRICTED AREA REGULATIONS § 334.1130 Pacific Ocean, Western Space and Missile Center (WSMC), Vandenberg AFB... (WSMC) at Vandenberg AFB, California. (3) The impacting of missile debris from launch operations will...

  9. Analysis of Tobyhanna Army Depot's Radio Frequency Identification (RFID) Pilot Program: RFID as an Asset Management Tool

    National Research Council Canada - National Science Library

    Miertschin, Keith W; Forrest, Brian D

    2005-01-01

    ...) used for inventory and asset management at the Tobyhanna Army Maintenance Depot. Tobyhanna Army Depot recently partnered with WhereNet Corporation for a pilot program to incorporate a real-time locating system that uses RFID...

  10. Improving Air Force Depot Programming by Linking Resources to Capabilities

    Science.gov (United States)

    2012-01-01

    thank Rick Grisenthwaite at Warner Robins Air Logistics Center, Jamie Jeter at Okla- homa City Air Logistics Center, and Glen Brown at Ogden Air...consistency, we use the term block cycle instead of SCU in our F-16 discussions. 4 8 Im p ro vin g A ir Fo rce D ep o t Pro g ram m in g b y Lin kin...Requirements RAND TR905-B.8 Figure B.9 Depot Purchased Equipment Maintenance Model Output: Projected Aircraft Availability RAND TR905-B.9 A ir cr af t av

  11. Depot Maintenance Air Force Faces Challenges in Managing to 50-50 Ceiling

    National Research Council Canada - National Science Library

    Warren, David

    2000-01-01

    ... that is being moved from the closing Sacramento, California, and San Antonio, Texas, depots to other military depots or private sector sources. As you requested, my testimony today focuses on the basis for the waiver and the likelihood that the Air Force will need additional waivers in the future.

  12. Adipose tissue in muscle: a novel depot similar in size to visceral adipose tissue

    NARCIS (Netherlands)

    Gallagher, D.; Kuznia, P.; Heshka, S.; Albu, J.; Heymsfield, S.B.; Goodpaster, B.H.; Visser, M.; Harris, T.B.

    2005-01-01

    BACKGROUND: The manner in which fat depot volumes and distributions, particularly the adipose tissue (AT) between the muscles, vary by race is unknown. OBJECTIVE: The objective was to quantify a previously unstudied and novel intermuscular AT (IMAT) depot and subcutaneous AT, visceral AT (VAT), and

  13. A hybrid metaheuristic algorithm for the multi-depot covering tour vehicle routing problem

    NARCIS (Netherlands)

    Allahyari, S.; Salari, M.; Vigo, D.

    2015-01-01

    We propose a generalization of themulti-depot capacitated vehicle routing problem where the assumption of visiting each customer does not hold. In this problem, called the Multi-Depot Covering Tour Vehicle Routing Problem (MDCTVRP), the demand of each customer could be satisfied in two different

  14. Measuring Customer Satisfaction of Depot Maintenance: An Analysis of Customer Satisfaction of F/A-18 Maintenance at Naval Aviation Depot North Island, CA

    National Research Council Canada - National Science Library

    Forsyth, Brian

    1997-01-01

    .... A key focus of commercial practices is delivering customer satisfaction. To this extent, it is imperative that DoD depots understand and properly measure their customer's concerns if they wish to improve their performance...

  15. Modeling and Solving the Multi-depot Vehicle Routing Problem with Time Window by Considering the Flexible end Depot in Each Route

    Directory of Open Access Journals (Sweden)

    Mohammad Mirabi

    2016-11-01

    Full Text Available This paper considers the multi-depot vehicle routing problem with time window in which each vehicle starts from a depot and there is no need to return to its primary depot after serving customers. The mathematical model which is developed by new approach aims to minimizing the transportation cost including the travelled distance, the latest and the earliest arrival time penalties. Furthermore, in order to reduce the problem searching space, a novel GA clustering method is developed. Finally, Experiments are run on number problems of varying depots and time window, and customer sizes. The method is compared to two other clustering techniques, fuzzy C means (FCM and K-means algorithm. Experimental results show the robustness and effectiveness of the proposed algorithm.

  16. Financial incentives for antipsychotic depot medication: ethical issues.

    Science.gov (United States)

    Claassen, Dirk

    2007-04-01

    Giving money as a direct incentive for patients in exchange for depot medication has proved beneficial in some clinical cases in assertive outreach (AO). However, ethical concerns around this practice have been raised, and will be analysed in more detail here. Ethical concern voiced in a survey of all AO teams in England were analysed regarding their content. These were grouped into categories. 53 of 70 team managers mentioned concerns, many of them serious and expressing a negative attitude towards giving money for depot adherence. Four broad categories of ethical concern following Christensen's concept were distinguished: valid consent and refusal (n = 5), psychiatric paternalism (n = 31), resource allocation (n = 4), organisational relationships (n = 2), with a residual category others and unspecified (n = 11). The main concerns identified are discussed on the background of existing ethical theories in healthcare and the specific problems of community mental health and AO. Points for practice are derived from this discussion. A way forward is outlined that includes informed consent and an operational policy in the use of incentives, further randomised controlled trials and qualitative studies, and continuing discussions with all stakeholders, especially service users.

  17. Artificial immune algorithm for multi-depot vehicle scheduling problems

    Science.gov (United States)

    Wu, Zhongyi; Wang, Donggen; Xia, Linyuan; Chen, Xiaoling

    2008-10-01

    In the fast-developing logistics and supply chain management fields, one of the key problems in the decision support system is that how to arrange, for a lot of customers and suppliers, the supplier-to-customer assignment and produce a detailed supply schedule under a set of constraints. Solutions to the multi-depot vehicle scheduling problems (MDVRP) help in solving this problem in case of transportation applications. The objective of the MDVSP is to minimize the total distance covered by all vehicles, which can be considered as delivery costs or time consumption. The MDVSP is one of nondeterministic polynomial-time hard (NP-hard) problem which cannot be solved to optimality within polynomial bounded computational time. Many different approaches have been developed to tackle MDVSP, such as exact algorithm (EA), one-stage approach (OSA), two-phase heuristic method (TPHM), tabu search algorithm (TSA), genetic algorithm (GA) and hierarchical multiplex structure (HIMS). Most of the methods mentioned above are time consuming and have high risk to result in local optimum. In this paper, a new search algorithm is proposed to solve MDVSP based on Artificial Immune Systems (AIS), which are inspirited by vertebrate immune systems. The proposed AIS algorithm is tested with 30 customers and 6 vehicles located in 3 depots. Experimental results show that the artificial immune system algorithm is an effective and efficient method for solving MDVSP problems.

  18. AFB-NETT - business opportunities for European biomass industry

    International Nuclear Information System (INIS)

    Higham, I.

    1997-01-01

    The AFB-NETT is an ALTENER funded project lead by ETSU. The project was started in 1995 with 11 partner nations. The initial aim was to bring together the whole biomass supply and use chain, not just within countries but across the Europe. At present more than 280 people take part in the network. The four objectives of the project are: detection and promotion of business opportunities; transfer of knowledge and experience; promotion of collaboration and co-ordination; and implementation of National and European Strategies. The effort in 1997 split into four main activities, 2 of which based on market sectors and two on improving the market conditions. The activities for 1997 were (the leader in parentheses): Co-combustion and gasification (Finland); Small scale and district heat (Austria); Financial incentives (the Netherlands); Wood fuel and emission standards (UK)

  19. AFB-NETT - business opportunities for European biomass industry

    Energy Technology Data Exchange (ETDEWEB)

    Higham, I. [ETSU, Oxfordshire (United Kingdom)

    1997-12-31

    The AFB-NETT is an ALTENER funded project lead by ETSU. The project was started in 1995 with 11 partner nations. The initial aim was to bring together the whole biomass supply and use chain, not just within countries but across the Europe. At present more than 280 people take part in the network. The four objectives of the project are: detection and promotion of business opportunities; transfer of knowledge and experience; promotion of collaboration and co-ordination; and implementation of National and European Strategies. The effort in 1997 split into four main activities, 2 of which based on market sectors and two on improving the market conditions. The activities for 1997 were (the leader in parentheses): Co-combustion and gasification (Finland); Small scale and district heat (Austria); Financial incentives (the Netherlands); Wood fuel and emission standards (UK)

  20. AFB-NETT - business opportunities for European biomass industry

    Energy Technology Data Exchange (ETDEWEB)

    Higham, I [ETSU, Oxfordshire (United Kingdom)

    1998-12-31

    The AFB-NETT is an ALTENER funded project lead by ETSU. The project was started in 1995 with 11 partner nations. The initial aim was to bring together the whole biomass supply and use chain, not just within countries but across the Europe. At present more than 280 people take part in the network. The four objectives of the project are: detection and promotion of business opportunities; transfer of knowledge and experience; promotion of collaboration and co-ordination; and implementation of National and European Strategies. The effort in 1997 split into four main activities, 2 of which based on market sectors and two on improving the market conditions. The activities for 1997 were (the leader in parentheses): Co-combustion and gasification (Finland); Small scale and district heat (Austria); Financial incentives (the Netherlands); Wood fuel and emission standards (UK)

  1. Aerospace medicine at Brooks AFB, TX: hail and farewell.

    Science.gov (United States)

    Nunneley, Sarah A; Webb, James T

    2011-05-01

    With the impending termination of USAF operations at Brooks Air Force Base (AFB) in San Antonio, TX, it is time to consider its historic role in Aerospace Medicine. The base was established in 1917 as a flight training center for the U.S. Army Air Service and in 1926 became home to its School of Aviation Medicine. The school moved to San Antonio's Randolph Field in 1931, but in 1959 it returned to Brooks where it occupied new facilities to support its role as a national center for U.S. Air Force aerospace medicine, including teaching, clinical medicine, and research. The mission was then expanded to encompass support of U.S. military and civilian space programs. With the abrupt termination of the military space program in 1969, research at Brooks focused on clinical aviation medicine and support of advanced military aircraft while continuing close cooperation with NASA in support of orbital spaceflight and the journey to the Moon. Reorganization in the 1990s assigned all research functions at Brooks to the Human Systems Division and its successors, leaving to USAFSAM the missions related to clinical work and teaching. In 2002 the USAF and the city of San Antonio implemented shared operation of Brooks as a "City-Base" in the hope of deflecting threatened closure. Nevertheless, under continuing pressure to consolidate military facilities in the United States, the 2005 Base Closure and Realignment Commission ordered Brooks closed by 2011, with its aerospace medicine functions relocated to new facilities at Wright-Patterson AFB in Dayton, OH.

  2. Wavelength selection in injection-driven Hele-Shaw flows: A maximum amplitude criterion

    Science.gov (United States)

    Dias, Eduardo; Miranda, Jose

    2013-11-01

    As in most interfacial flow problems, the standard theoretical procedure to establish wavelength selection in the viscous fingering instability is to maximize the linear growth rate. However, there are important discrepancies between previous theoretical predictions and existing experimental data. In this work we perform a linear stability analysis of the radial Hele-Shaw flow system that takes into account the combined action of viscous normal stresses and wetting effects. Most importantly, we introduce an alternative selection criterion for which the selected wavelength is determined by the maximum of the interfacial perturbation amplitude. The effectiveness of such a criterion is substantiated by the significantly improved agreement between theory and experiments. We thank CNPq (Brazilian Sponsor) for financial support.

  3. Billy Shaw Dam and Reservoir: Environmental assessment and finding of no significant impacts

    International Nuclear Information System (INIS)

    1997-03-01

    This notice announces BPA's decision to fund the construction, operation, and maintenance of the Billy Shaw Dam and Reservoir on the Duck Valley Reservation. This project is part of a continuing effort to address system-wide fish and wildlife losses caused by the development of the hydropower system in the Columbia River Basin. BPA has prepared an Environmental Assessment (EA) evaluating the potential environmental impacts of the proposed project. Based on the analysis in the EA, BPA has determined that the Proposed Action is not a major Federal action significantly affecting the quality of the human environment, within the meaning of the National Environmental Policy Act (NEPA) of 1969. Therefore, the preparation of an Environmental Impact Statement (EIS) is not required and BPA is issuing this FONSI

  4. Universality Results for Multi-Layer Hele-Shaw and Porous Media Flows

    Science.gov (United States)

    Daripa, Prabir

    2012-11-01

    Saffman-Taylor instability is a well known viscosity driven instability of an interface. Motivated by a need to understand the effect of various injection policies currently in practice for chemical enhanced oil recovery, we study linear stability of displacement processes in a Hele-Shaw cell involving injection of an arbitrary number of immiscible fluid phases in succession. This is a problem involving many interfaces. Universal stability results have been obtained for this multi-layer (multi-region) flow in the sense that the results hold with arbitrary number of interfaces. These stability results have been applied to design injection policies that are considerably less unstable than the pure Saffman-Taylor case. In particular, we determine specific values of the viscosity of the fluid layers corresponding to smallest unstable band. Moreover, we discuss universal selection principle of optimal viscous profiles. The talk is based on following papers. Qatar National Fund (a member of the Qatar Foundation).

  5. Universality Results for Multi-layer Radial Hele-Shaw Flows

    Science.gov (United States)

    Daripa, Prabir; Gin, Craig; Daripa Research Team

    2014-03-01

    Saffman-Taylor instability is a well known viscosity driven instability of an interface separating two immiscible fluids. We study linear stability of this displacement process in multi-layer radial Hele-Shaw geometry involving an arbitrary number of immiscible fluid phases. Universal stability results have been obtained and applied to design displacement processes that are considerably less unstable than the pure Saffman-Taylor case. In particular, we derive universal formula which gives specific values of the viscosities of the fluid layers corresponding to smallest unstable band. Other similar universal results will also be presented. The talk is based on ongoing work. Supported by an NPRP Grant # 08-777-1-141 from the Qatar National Research Fund (a member of the Qatar Foundation). The statements made herein are solely the responsibility of the authors.

  6. Shocks and finite-time singularities in Hele-Shaw flow

    Energy Technology Data Exchange (ETDEWEB)

    Teodorescu, Razvan [Los Alamos National Laboratory; Wiegmann, P [UNIV OF MONTREAL; Lee, S-y [UNIV OF CHICAGO

    2008-01-01

    Hele-Shaw flow at vanishing surface tension is ill-defined. In finite time, the flow develops cusplike singularities. We show that the ill-defined problem admits a weak dispersive solution when singularities give rise to a graph of shock waves propagating in the viscous fluid. The graph of shocks grows and branches. Velocity and pressure jump across the shock. We formulate a few simple physical principles which single out the dispersive solution and interpret shocks as lines of decompressed fluid. We also formulate the dispersive solution in algebro-geometrical terms as an evolution of Krichever-Boutroux complex curve. We study in details the most generic (2,3) cusp singularity which gives rise to an elementary branching event. This solution is self-similar and expressed in terms of elliptic functions.

  7. Billy Shaw Dam and Reservoir : Environmental Assessment and Finding of No Significant Impacts.

    Energy Technology Data Exchange (ETDEWEB)

    United States. Bonneville Power Administration; Shoshone-Paiute Tribes of the Duck Valley Reservation, Nevada.

    1997-03-01

    This notice announces BPA`s decision to fund the construction, operation, and maintenance of the Billy Shaw Dam and Reservoir on the Duck Valley Reservation. This project is part of a continuing effort to address system-wide fish and wildlife losses caused by the development of the hydropower system in the Columbia River Basin. BPA has prepared an Environmental Assessment (EA) evaluating the potential environmental impacts of the proposed project. Based on the analysis in the EA, BPA has determined that the Proposed Action is not a major Federal action significantly affecting the quality of the human environment, within the meaning of the National Environmental Policy Act (NEPA) of 1969. Therefore, the preparation of an Environmental Impact Statement (EIS) is not required and BPA is issuing this FONSI.

  8. A study of gas bubbles in liquid mercury in a vertical Hele-Shaw cell

    Energy Technology Data Exchange (ETDEWEB)

    Klaasen, B.; Blanpain, B. [KU Leuven, Research Group for High Temperature Processes and Industrial Ecology, Department of Metallurgy and Materials Engineering, Leuven (Belgium); Verhaeghe, F. [KU Leuven, Research Group for High Temperature Processes and Industrial Ecology, Department of Metallurgy and Materials Engineering, Leuven (Belgium); Umicore Group Research and Development, Olen (Belgium); Fransaer, J. [KU Leuven, Research Group for Materials with Novel Functionality, Department of Metallurgy and Materials Engineering, Leuven (Belgium)

    2014-01-15

    High-quality observations of mesoscopic gas bubbles in liquid metal are vital for a further development of pyrometallurgical gas injection reactors. However, the opacity of metals enforces the use of indirect imaging techniques with limited temporal or spatial resolution. In addition, accurate interface tracking requires tomography which further complicates the design of a high-temperature experimental setup. In this paper, an alternative approach is suggested that circumvents these two main restrictions. By injecting gas in a thin layer of liquid metal entrapped between two flat and closely spaced plates, bubbles in a Hele-Shaw flow regime are generated. The resulting quasi-2D multiphase flow phenomena can be fully captured from a single point of view and, when using a non-wetted transparent plate material, the bubbles can be observed directly. The feasibility of this approach is demonstrated by observations on buoyancy-driven nitrogen bubbles in liquid mercury in a vertical Hele-Shaw cell. By using a moving high-speed camera to make continuous close up recordings of individual bubbles, the position and geometry of these bubbles are quantified with a high resolution along their entire path. After a thorough evaluation of the experimental accuracy, this information is used for a detailed analysis of the bubble expansion along the path. While the observed bubble growth is mainly caused by the hydrostatic pressure gradient, a careful assessment of the volume variations for smaller bubbles shows that an accurate bubble description should account for significant dynamic pressure variations that seem to be largely regime dependent. (orig.)

  9. Tsunakawa-Shaw method - an absolute paleointensity technique using alternating field demagnetization

    Science.gov (United States)

    Yamamoto, Y.; Mochizuki, N.; Shibuya, H.; Tsunakawa, H.

    2015-12-01

    Among geologic materials volcanic rocks have been typically used to deduce an absolute paleointensity. In the last decade, however, there seems a becoming consensus that volcanic rocks are not so ideal materials due to such as magnetic grains other than non-interacting single domain particles. One approach to obtain a good paleointensity estimate from the rocks is to reduce and correct the non-ideality, suppress alterations in laboratory and screen out suspicious results. We have been working on a development and an application of the Tsunakawa-Shaw method, which has been previously called the LTD-DHT Shaw method. This method is an AF(alternating field)-based technique and thus a paleointensity is estimated using coercivity spectra. To reduce the non-ideality, all remanences undergo low-temperature demagnetization (LTD) before any AF demagnetizations to remove multi-domain like component. To correct the non-ideality, anhysteretic remanent magnetizations (ARMs) are imparted with their directions parallel to natural remanent magnetizations and laboratory-imparted thermoremanent magnetizations (TRMs) and measured before and after laboratory heating. These ARMs are used to correct remanence anisotropies, possible interaction effects originated from the non-ideal grains and TRM changes caused by laboratory alterations. TRMs are imparted by heating specimens above their Curie temperatures and then cooling to room temperature at once to simulate nature conditions. These cycles are done in vacuum to suppress alterations in laboratory. Obtained results are judged by selection criteria, including a check for validity of the ARM corrections.It has been demonstrated that successful paleointensities are obtained from historical lavas in Japan and Hawaii, and from baked clay samples from a reconstructed ancient kiln, with the flow-mean precision of 5-10%. In case of old volcanic rocks, however, the method does not necessarily seem to be perfect. We will summarize these points in

  10. Very High-Performance Advanced Filter Bank Analog-to-Digital Converter (AFB ADC) Project

    National Research Council Canada - National Science Library

    Velazquez, Scott

    1999-01-01

    ... of the art by using a parallel array of individual commercial off the shelf converters. The significant performance improvements afforded by the Advanced Filter Bank Analog to Digital Converter (AFB ADC...

  11. The Linehaul-Feeder Vehicle Routing Problem with Virtual Depots and Time Windows

    Directory of Open Access Journals (Sweden)

    Huey-Kuo Chen

    2011-01-01

    Full Text Available This paper addresses the linehaul-feeder vehicle routing problem with virtual depots and time windows (LFVRPTW. Small and large vehicles deliver services to customers within time constraints; small vehicles en route may reload commodities from either the physical depot or from the larger vehicle at a virtual depot before continuing onward. A two-stage solution heuristic involving Tabu search is proposed to solve this problem. The test results show that the LFVRPTW performs better than the vehicle routing problem with time windows in terms of both objective value and the number of small vehicles dispatched.

  12. An Analysis of the Cost Accounting System for the Depot Maintenance Service, Air Force Industrial Fund.

    Science.gov (United States)

    1987-09-01

    AN A NALYSIS OF THE COST ACCOUNTING SYSTEM FOR THE DEPOT 1/1 MRINTENANCE SERVI..(U) MIR FORCE INST OF TECH IIGHT-PTTERSON RFB OH SCHOOL OF SYST.. 0 L...I "VV h S~ ~~i FiLE COV, THSI CIO ~OF AN ANALYSIS OF THE COST ACCOUNTING SYSTEM FOR THE DEPOT MAINTENANCE SERVICE, AIR FORCE INDUSTRIAL FUND...Patterson Air Force Base, Ohio ~ p~UOW~~ ’ I ~ 1 12 02 0 AFIT/GLM/LSY/87S-83 AN ANALYSIS OF THE COST ACCOUNTING SYSTEM FOR THE DEPOT MAINTENANCE SERVICE, AIR

  13. Policies for Positioning Empty Containers in an Inland Multi-depot System

    DEFF Research Database (Denmark)

    Dang, Vinh Quang; Nielsen, Izabela Ewa; Yun, Won-Young

    2011-01-01

    -container management are as follows: a coordinated (s, S) inventory policy for overseas positioning, (ri, Ri) policy at each depot for inland positioning; and a simple leasing policy with zero lead-time. For inland positioning policy, four different methods are proposed to reposition empty containers between depots....... Customer demands and returning containers in depots and lead-time for positioning from overseas are considered as uncertain factors. The objective is to obtain the optimal policy in order to minimize the expected total cost including inventory holding, overseas positioning, inland positioning and leasing...

  14. Burrowing Owl and Other Migratory Bird Mitigation for a Runway Construction Project at Edwards AFB

    OpenAIRE

    Hoehn, Amber L.; Hagan, Mark; Bratton, Mark

    2009-01-01

    Edwards Air Force Base (AFB) scheduled the construction of a runway in the spring of 2007. The runway would be in an area that contained migratory birds and their habitat. The construction project would be near Edwards AFB main runway and had the potential not only to impact species protected under the Migratory Bird Treaty Act (MBTA), including the burrowing owl (Athene cunicularia), but also to increase bird and wildlife–aircraft strike hazards in the active flightline areas. To discourage ...

  15. Cation ordering in orthopyroxenes and cooling rates of meteorites: Low temperature cooling rates of Estherville, Bondoc and Shaw

    Science.gov (United States)

    Ganguly, J.; Yang, H.; Ghose, S.

    1993-01-01

    The cooling rates of meteorites provide important constraints on the size of their parent bodies, and their accretionary and evolutionary histories. However, the cooling rates obtained so far from the commonly used metallographic, radiometric and fission-track methods have been sometimes quite controversial, such as in the case of the mesosiderites and the meteorite Shaw. We have undertaken a systematic study of the cooling rates of meteorites using a different approach, which involves single crystal x-ray determination of Fe(2+)-Mg ordering in orthopyroxenes (OP(x)) in meteorites, subject to bulk compositional constraints, and numerical simulation of the evolution of the ordering state as a function of cooling rate, within the framework of the thermodynamic and kinetic principles governing cation ordering. We report the results obtained for OP(x) crystals from Shaw and two mesosiderites, Estherville and Bondoc.

  16. Hotline Allegations Involving Contracts for Programmed Depot Maintenance of KC-135 Aircraft

    National Research Council Canada - National Science Library

    1998-01-01

    Introduction. We performed the audit in response to 15 allegations made to the Defense Hotline involving two contracts on the Programmed Depot Maintenance of the KC-135 Aircraft, which Oklahoma City Air logistics...

  17. Treatment patterns and clinical characteristics prior to initiating depot typical antipsychotics for nonadherent schizophrenia patients

    Directory of Open Access Journals (Sweden)

    Montgomery William

    2009-07-01

    Full Text Available Abstract Background Nonadherence with antipsychotic medication is an important clinical and economic problem in the treatment of schizophrenia. This study identified treatment patterns and clinical characteristics that immediately precede the initiation of depot typical antipsychotics in the usual treatment of schizophrenia patients with a recent history of nonadherence with oral antipsychotic regimens. Methods Data were drawn from a large, multisite, 3-year prospective noninterventional observational study of persons treated for schizophrenia in the United States, which was conducted between 7/1997 and 9/2003. The analytical sample included patients who, in the 6 months prior to enrollment, were considered nonadherent with oral antipsychotics and were not treated with depot antipsychotics (N = 314. Patients who were subsequently initiated on typical depots during the 3-year follow-up were compared with patients who continued therapy with only oral antipsychotic agents. Group comparisons were made on patient baseline characteristics and precedent variables that were assessed 1 to 6 months prior to depot initiation. Patient assessments were made at predetermined intervals throughout the 3-year study using standard psychiatric measures, a patient-reported questionnaire, and medical record information. Results A small proportion of patients (12.4% who were recently nonadherent with oral antipsychotics were subsequently initiated on depot therapy during the 3-year study. Compared to patients treated with only oral antipsychotics, those subsequently initiated on a depot were significantly more likely to be hospitalized at depot initiation or the previous 30 days, to have recent involvement with the criminal justice system (arrests, recent illicit drug use, recent switching or augmentation of oral antipsychotics, and recent treatment with oral typical antipsychotics. Conclusion Despite prior nonadherence with oral antipsychotic medication, only a

  18. Shemya AFB, Alaska 1992 IRP field investigation report

    Energy Technology Data Exchange (ETDEWEB)

    1993-02-01

    The US Air Force is currently investigating 22 sites on Shemya Air Force Base (AFB) to determine if past spill and disposal activities have caused environmental damage. These investigations are being carried out under the Air Force's Installation Restoration Program (IRP). Field investigations were performed in 1992 to obtain the information needed to assess what future actions will need to be carried out at each site. The island's drinking water supply was also investigated. Activities completed at 10 selected sites included surface sampling to determine the lateral extent of contamination, subsurface sampling to determine the vertical extent of contamination, and the installation of well points and monitoring wells to determine the direction of groundwater flow and if the groundwater has been affected by a site. Geophysical surveys were performed at most sites to identify site boundaries and check for the presence of buried metal to be avoided during drilling activities. This report, appendices B, C, and D contains information on the following: geophysical contour maps and profile plots; human health risk assessment; and ecological risk assessment.

  19. Shemya AFB, Alaska 1992 IRP field investigation report

    Energy Technology Data Exchange (ETDEWEB)

    1993-02-01

    The US Air Force is currently investigating 22 sites on Shemya Air Force Base (AFB) to determine if past spill and disposal activities have caused environmental damage. These investigations are being carried out under the Air Force's Installation Restoration Program (IRP). As a part of the IRP program, field investigations were performed in 1992 to obtain the information needed to assess what future actions willneed to be carried out at each site. The island's drinking water supply was also investigated. Activities completed at 10 selected sites during the 1992 field investigation included surface sampling to determine the lateral extent of contamination, subsurface sampling to determine the vertical extent of contamination, and the installation of well points and monitoring wells to determine the direction of groundwater flow and if the groundwater has been affected by a site. In addition, geophysical surveys were performed at most sites to identify site boundaries and check for the presence of buried metal to be avoided during drilling activities.

  20. Shemya AFB, Alaska 1992 IRP field investigation report

    Energy Technology Data Exchange (ETDEWEB)

    1993-02-01

    The US Air Force is currently investigating 22 sites on Shemya Air Force Base (AFB) to determine if past spill and disposal activities have caused environmental damage. These investigations are being carried out under the Air Force's Installation Restoration Program (IRP). Field investigations were performed in 1992 to obtain the information needed to assess what future actions will need to be carried out at each site. The island's drinking water supply was also investigated. Activities completed at 10 selected sites included surface sampling to determine the lateral extent of contamination, subsurface sampling to determine the vertical extent of contamination, and the installation of well points and monitoring wells to determine the direction of groundwater flow and if the groundwater has been affected by a site. In addition, geophysical surveys were performed at most sites to identify site boundaries and check for the presence of buried metal, to be avoided during drilling activities. This report contains appendices E and F with information on the following: soil boring logs, and data validation of samples analyzed.

  1. Multiple depots vehicle routing based on the ant colony with the genetic algorithm

    Directory of Open Access Journals (Sweden)

    ChunYing Liu

    2013-09-01

    Full Text Available Purpose: the distribution routing plans of multi-depots vehicle scheduling problem will increase exponentially along with the adding of customers. So, it becomes an important studying trend to solve the vehicle scheduling problem with heuristic algorithm. On the basis of building the model of multi-depots vehicle scheduling problem, in order to improve the efficiency of the multiple depots vehicle routing, the paper puts forward a fusion algorithm on multiple depots vehicle routing based on the ant colony algorithm with genetic algorithm. Design/methodology/approach: to achieve this objective, the genetic algorithm optimizes the parameters of the ant colony algorithm. The fusion algorithm on multiple depots vehicle based on the ant colony algorithm with genetic algorithm is proposed. Findings: simulation experiment indicates that the result of the fusion algorithm is more excellent than the other algorithm, and the improved algorithm has better convergence effective and global ability. Research limitations/implications: in this research, there are some assumption that might affect the accuracy of the model such as the pheromone volatile factor, heuristic factor in each period, and the selected multiple depots. These assumptions can be relaxed in future work. Originality/value: In this research, a new method for the multiple depots vehicle routing is proposed. The fusion algorithm eliminate the influence of the selected parameter by optimizing the heuristic factor, evaporation factor, initial pheromone distribute, and have the strong global searching ability. The Ant Colony algorithm imports cross operator and mutation operator for operating the first best solution and the second best solution in every iteration, and reserves the best solution. The cross and mutation operator extend the solution space and improve the convergence effective and the global ability. This research shows that considering both the ant colony and genetic algorithm

  2. Environmental Assessment: Conversion of the 820th Security Forces Group at Moody AFB, Georgia to a Contingency Response Group

    Science.gov (United States)

    2003-08-01

    Contingency Response Group (CRG) at Moody Air Force Base (AFB), GA . DESCRIPTION OF THE PROPOSED ACTION AND ALTERNATIVES. The United States Air Force...sinkhole formation. 3.5.3.3 Soils Moody AFB Moody AFB is located in the Tifton Upland District of the Lower Coastal Plain. In general, soils on...base. Arsenic, barium, chromium, copper, iron, selenium, and zinc have been found to be naturally occurring in the area. Predominant soils are Tifton

  3. The ethics of killing human/great-ape chimeras for their organs: a reply to Shaw et al.

    Science.gov (United States)

    Palacios-González, César

    2016-06-01

    The aim of this paper is to critically examine David Shaw, Wybo Dondorp, and Guido de Wert's arguments in favour of the procurement of human organs from human/nonhuman-primate chimeras, specifically from great-ape/human chimeras. My main claim is that their arguments fail and are in need of substantial revision. To prove this I first introduce the topic, and then reconstruct Shaw et al.'s position and arguments. Next, I show that Shaw et al.: (1) failed to properly apply the subsidiarity and proportionality principles; (2) neglected species overlapping cases in their ethical assessment; (3) ignored the ethics literature on borderline persons; and (4) misunderstood McMahan's two-tiered moral theory. These mistakes render an important part of their conclusions either false or problematic to the point that they would no longer endorse them. Finally I will briefly mention a possible multipolar solution to the human organ shortage problem that would reduce the need for chimeras' organs.

  4. Development of self-forming doxorubicin-loaded polymeric depots as an injectable drug delivery system for liver cancer chemotherapy.

    Science.gov (United States)

    Nittayacharn, Pinunta; Nasongkla, Norased

    2017-07-01

    The objective of this work was to develop self-forming doxorubicin-loaded polymeric depots as an injectable drug delivery system for liver cancer chemotherapy and studied the release profiles of doxorubicin (Dox) from different depot formulations. Tri-block copolymers of poly(ε-caprolactone), poly(D,L-lactide) and poly(ethylene glycol) named PLECs were successfully used as a biodegradable material to encapsulate Dox as the injectable local drug delivery system. Depot formation and encapsulation efficiency of these depots were evaluated. Results show that depots could be formed and encapsulate Dox with high drug loading content. For the release study, drug loading content (10, 15 and 20% w/w) and polymer concentration (25, 30, and 35% w/v) were varied. It could be observed that the burst release occurred within 1-2 days and this burst release could be reduced by physical mixing of hydroxypropyl-beta-cyclodextrin (HP-β-CD) into the depot system. The degradation at the surface and cross-section of the depots were examined by Scanning Electron Microscope (SEM). In addition, cytotoxicity of Dox-loaded depots and blank depots were tested against human liver cancer cell lines (HepG2). Dox released from depots significantly exhibited potent cytotoxic effect against HepG2 cell line compared to that of blank depots. Results from this study reveals an important insight in the development of injectable drug delivery system for liver cancer chemotherapy. Schematic diagram of self-forming doxorubicin-loaded polymeric depots as an injectable drug delivery system and in vitro characterizations. (a) Dox-loaded PLEC depots could be formed with more than 90% of sustained-release Dox at 25% polymer concentration and 20% Dox-loading content. The burst release occurred within 1-2 days and could be reduced by physical mixing of hydroxypropyl-beta-cyclodextrin (HP-β-CD) into the depot system. (b) Dox released from depots significantly exhibited potent cytotoxic effect against human

  5. Propagation of a finite bubble in a Hele-Shaw channel of variable depth

    Science.gov (United States)

    Juel, Anne; Franco-Gomez, Andres; Thompson, Alice; Hazel, Andrew

    2017-11-01

    We study the propagation of finite bubbles in a Hele-Shaw channel, where a centred rail is introduced to provide a small axially-uniform depth constriction. We demonstrate experimentally that this channel geometry can be used as a passive sorting device. Single air bubbles carried within silicone oil are generally transported on one side of the rail. However, for flow rates marginally larger than a critical value, a narrow band of bubble sizes on the order of the rail width can propagate over the rail, while bubbles of other sizes segregate to the side of the rail. The width of this band of bubble sizes increases with flow rate and the size of the most stable bubble can be tuned by varying the rail width. We present a depth-averaged theory which reveals that the mechanism relies on a non-trivial interaction between capillary and viscous forces that is fully dynamic, rather than being a simple modification of capillary static solutions. In contrast, for larger bubbles and sufficiently large imposed flow rates, we find that initially centred bubbles do not converge onto a steady mode of propagation. Instead they transiently explore weakly unstable steady modes, an evolution which results in their break-up and eventual settling into a steady state of changed topology. The financial support of CONICYT and the Leverhulme Trust are gratefully acknowledged.

  6. Instability of displacement of Oldroyd-B fluid by air in a Hele-Shaw cell

    Science.gov (United States)

    Daripa, Prabir

    2014-03-01

    We study the displacement of an Oldroyd-B fluid in a Hele-Shaw cell when driven by air. In particular, we explicitly obtain an analytical expression for the growth rate of instability which depends on the relaxation and retardation (time) constants, denoted by λ, and λ1 respectively, appearing in the Oldroyd-B constitutive relations. When these two constants are zero, we recover the classical Saffman-Taylor result for a Newtonian liquid displaced by air. Our results show that this displacement process is more unstable than the case when a Newtonian fluid is displaced by air. The analytical results are plotted and compared with numerical results on this unstable displacement process available in the literature. The agreement is found to be excellent. In particular, results show that the non-Newtonian case (i.e., Oldroyd-B) is more unstable than the Newtonian case. Supported by an NPRP Grant # 08-777-1-141 from the Qatar National Research Fund (a member of the Qatar Foundation). The statements made herein are solely the responsibility of the author.

  7. Interfacial elastic fingering in Hele-Shaw cells: A weakly nonlinear study

    KAUST Repository

    Carvalho, Gabriel D.

    2013-11-11

    We study a variant of the classic viscous fingering instability in Hele-Shaw cells where the interface separating the fluids is elastic, and presents a curvature-dependent bending rigidity. By employing a second-order mode-coupling approach we investigate how the elastic nature of the interface influences the morphology of emerging interfacial patterns. This is done by focusing our attention on a conventionally stable situation in which the fluids involved have the same viscosity. In this framework, we show that the inclusion of nonlinear effects plays a crucial role in inducing sizable interfacial instabilities, as well as in determining the ultimate shape of the pattern-forming structures. Particularly, we have found that the emergence of either narrow or wide fingers can be regulated by tuning a rigidity fraction parameter. Our weakly nonlinear findings reinforce the importance of the so-called curvature weakening effect, which favors the development of fingers in regions of lower rigidity. © 2013 American Physical Society.

  8. Interfacial elastic fingering in Hele-Shaw cells: A weakly nonlinear study

    KAUST Repository

    Carvalho, Gabriel D.; Miranda, José A.; Gadê lha, Hermes

    2013-01-01

    We study a variant of the classic viscous fingering instability in Hele-Shaw cells where the interface separating the fluids is elastic, and presents a curvature-dependent bending rigidity. By employing a second-order mode-coupling approach we investigate how the elastic nature of the interface influences the morphology of emerging interfacial patterns. This is done by focusing our attention on a conventionally stable situation in which the fluids involved have the same viscosity. In this framework, we show that the inclusion of nonlinear effects plays a crucial role in inducing sizable interfacial instabilities, as well as in determining the ultimate shape of the pattern-forming structures. Particularly, we have found that the emergence of either narrow or wide fingers can be regulated by tuning a rigidity fraction parameter. Our weakly nonlinear findings reinforce the importance of the so-called curvature weakening effect, which favors the development of fingers in regions of lower rigidity. © 2013 American Physical Society.

  9. Rayleigh-Benard convection in a Hele-Shaw cell - a numerical study

    International Nuclear Information System (INIS)

    Guenther, C.; Mueller, U.

    1987-05-01

    Free convection in narrow vertical gaps heated from below gives rise to several different flow patterns as has been demonstrated by previous experimental investigations. A numerical study is presented aimed at simulating the observed flow phenomena in Hele-Shaw cells of small lateral extend. The numerical study is based on the assumption that the flow is essentially two-dimensional. This allows an approach using a one-term Galerkin approximation with respect to the direction perpendicular to the gap and a finite difference scheme with regard to the coordinates in the plane of the gap. The calculations result in realistic values of the critical Rayleigh numbers for the onset of steady and oscillatory convection. Most of the observed unsteady flow patterns can be simulated numerically. It is shown that five different stable flow patterns can occur at one particular Rayleigh number. The different stable flow patterns are coupled by a variety of complex transitions. Moreover the calculations show that a realistic description of the observed flow phenomena can not be obtained by a simplified model using the Darcy law in the momentum equation and implying slip flow at the small confining boundaries. (orig.) [de

  10. Structure of thallium and lead calculated from Shaw local pseudopotential and molecular dynamics

    Directory of Open Access Journals (Sweden)

    Gasser J. G.

    2011-05-01

    Full Text Available Recently, we (Es Sbihi Phil. Mag 2010 have successfully calculated, by molecular dynamics, the static structure factor of liquid bismuth at different temperatures. Our results were in very good agreement with the Waseda experimental data. Our assumption was to consider the true density of states which presents a gap as measured by Indlekofer (J. Non-Cryst. Solids 1989 and calculated by Hafner-Jank (Phys. Rev. B 1990 for liquid bismuth. The number of electrons at the Fermi energy has been calculated with three conduction electrons for bismuth (number of p electrons. With this assumption, the structures were determined with an effective ion-ion potential constructed from the Shaw local Optimised Model Potential (OMP and the Ichimaru-Utsumi dielectric function. In the present paper, we generalize our assumptions to liquid thallium and lead which also present such a gap. Their calculated structures are also very close to the experimental ones. This confirms that the number of conduction electrons on the Fermi sphere is consistent with the number of p electrons as has been even shown for our electronic transport properties of liquid lead (A. Ben Abdellah, Phys. Rev. B 2003.

  11. Performance Gains of Propellant Management Devices for Liquid Hydrogen Depots

    Science.gov (United States)

    Hartwig, Jason W.; McQuillen, John B.; Chato, David J.

    2013-01-01

    This paper presents background, experimental design, and preliminary experimental results for the liquid hydrogen bubble point tests conducted at the Cryogenic Components Cell 7 facility at the NASA Glenn Research Center in Cleveland, Ohio. The purpose of the test series was to investigate the parameters that affect liquid acquisition device (LAD) performance in a liquid hydrogen (LH2) propellant tank, to mitigate risk in the final design of the LAD for the Cryogenic Propellant Storage and Transfer Technology Demonstration Mission, and to provide insight into optimal LAD operation for future LH2 depots. Preliminary test results show an increase in performance and screen retention over the low reference LH2 bubble point value for a 325 2300 screen in three separate ways, thus improving fundamental LH2 LAD performance. By using a finer mesh screen, operating at a colder liquid temperature, and pressurizing with a noncondensible pressurant gas, a significant increase in margin is achieved in bubble point pressure for LH2 screen channel LADs.

  12. ATTITUDES OF SHOP FLOOR EMPLOYEES TOWARD WOMEN MANAGERS IN FUEL DEPOTS: A CASE OF THE FUEL DEPOTS IN LUBUMBASHI, DEMOCRATIC REPUBLIC OF THE CONGO

    Directory of Open Access Journals (Sweden)

    Stephen N. M. Nzuve

    2014-12-01

    Full Text Available The International Labour Organization and all organizations of human rights advocate against any form of negative attitude in employment based on gender, its terms, promotion and relations. Shop floor employees play a very important role in the daily advancement and profitability of an organisation. The purpose of this study was to establish the attitude of shop floor employees toward women managers in fuel depots in Lubumbashi, Democratic Republic of the Congo. The study adopted a descriptive survey design with the population consisting of one hundred and ninety three (193 shop floor employees. A semi structured questionnaire was used to collect primary data. In total one hundred and twenty one (121 shop floor employees responded yielding a response rate of sixty three percent (63%. The findings of this study indicate that a negative attitude toward woman managers is prevalent in the Fuel Depots of Lubumbashi, Democratic Republic of the Congo. At the fuel depots, the number of women working was less than a third of the males. In spite of this, women managers are rated higher in management qualities and are considered to be more honest, diligent, compassionate, creative and intelligent when compared to their male counterparts. The study recommends a culture change among employees in fuel depots in Lubumbashi in order to enable them perceive women as equal partners at the work place.

  13. Measurement of ground and nearby building vibration and noise induced by trains in a metro depot.

    Science.gov (United States)

    Zou, Chao; Wang, Yimin; Wang, Peng; Guo, Jixing

    2015-12-01

    Metro depots are where subway trains are parked and where maintenance is carried out. They usually occupy the largest ground areas in metro projects. Due to land utilization problems, Chinese cities have begun to develop over-track buildings above metro depots for people's life and work. The frequently moving trains, when going into and out of metro depots, can cause excessive vibration and noise to over-track buildings and adversely affect the living quality of the building occupants. Considering the current need of reliable experimental data for the construction of metro depots, field measurements of vibration and noise on the ground and inside a nearby 3-story building subjected to moving subway trains were conducted in a metro depot at Guangzhou, China. The amplitudes and frequency contents of velocity levels were quantified and compared. The composite A-weighted equivalent sound levels and maximum sound levels were captured. The predicted models for vibration and noise of metro depot were proposed based on existing models and verified. It was found that the vertical vibrations were significantly greater than the horizontal vibrations on the ground and inside the building near the testing line. While at the throat area, the horizontal vibrations near the curved track were remarkably greater than the vertical vibrations. The attenuation of the vibrations with frequencies above 50 Hz was larger than the ones below 50 Hz, and the frequencies of vibration transmitting to adjacent buildings were mainly within 10-50 Hz. The largest equivalent sound level generated in the throat area was smaller than the testing line one, but the instantaneous maximum sound level induced by wheels squeal, contact between wheels and rail joints as well as turnout was close to or even greater than the testing line one. The predicted models gave a first estimation for design and assessment of newly built metro depots. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. Installation Restoration Program. Phase 1. Records Search, Hazardous Materials Disposal Sites, Eglin AFB, Florida

    Science.gov (United States)

    1981-10-01

    Okaloosa Co. 3-12 Crestview South Quadrangle, Florida-Okaloosa Co. -13 Mossy ead Quadrangle, Florida-Walton Co 3-14 E-1 EGUN AFB 4,h aa V, WRAMATIO...I) Um AYPM hIN1DS SP * So". AM T 0 Tou A is a O I. h E-2 ES ENGINEERING -SCIENCE V%777-7NN7 .7-7 EGUN AFB 0.4 .m ... (1) WMg LAN DOSAMU *Y* CO u...r Oumm *p S(S Ann~ Il~~O 0*aAMa 2-3 ES ENGINEER ING - SCIENCE EGUN AFB %Tt MAR ESTHER * : . . - . - ~ - ~ r W R G H T L A N D F I L L 3 SITE 0296

  15. Depo-Provera (depot medroxyprogesterone acetate) use after bariatric surgery.

    Science.gov (United States)

    Lam, Clarissa; Murthy, Amitasrigowri S

    2016-01-01

    In the US, obesity rates are increasing greatly. The Centers for Disease Control and Prevention estimates that 68.5% of Americans, including 63.9% of adult women older than 20 years, are overweight (body mass index between 25 kg/m 2 and 29.9 kg/m 2 ) or obese (body mass index >30 kg/m 2 ). In light of this, it is not surprising that the rates of bariatric surgery have also been increasing. When considering the metabolic changes associated with both bariatric surgery and contraceptive use, in combination with the unique medical considerations of obese women, it is indisputable that clear guidelines are needed when counseling obese patients of reproductive age after bariatric surgery. In this literature review, we focus on depot medroxyprogesterone acetate (DMPA) and the implications of its use in obese women, preweight and postweight loss following bariatric surgery. Both DMPA use and bariatric surgery are known to cause bone loss, but it is still unclear whether there is an additive effect of the two factors on bone loss and whether either of these factors directly leads to an increased risk of bone fracture. The current consensus guidelines do not impose a restriction on the use of DMPA after bariatric surgery. DMPA use is associated with weight gain, and it is unclear whether weight loss blunting occurs with the use of DMPA after bariatric surgery. Prior studies had demonstrated an association with weight gain in adolescents, and therefore, those prescribing DMPA use after bariatric surgery in adolescents should proceed with caution. Adult women do not have a similar response to the use of DMPA. DMPA use has rarely been associated with increased risk of venous thromboembolism (VTE). The obesity-associated increase in VTE should be mitigated by surgically induced weight loss. The concurrent use of DMPA in the post bariatric surgical period should not further increase the risk of VTE.

  16. Artificial intelligence technology assessment for the US Army Depot System Command

    Energy Technology Data Exchange (ETDEWEB)

    Pennock, K A

    1991-07-01

    This assessment of artificial intelligence (AI) has been prepared for the US Army's Depot System Command (DESCOM) by Pacific Northwest Laboratory. The report describes several of the more promising AI technologies, focusing primarily on knowledge-based systems because they have been more successful in commercial applications than any other AI technique. The report also identifies potential Depot applications in the areas of procedural support, scheduling and planning, automated inspection, training, diagnostics, and robotic systems. One of the principal objectives of the report is to help decisionmakers within DESCOM to evaluate AI as a possible tool for solving individual depot problems. The report identifies a number of factors that should be considered in such evaluations. 22 refs.

  17. Preparation and in vitro characterization of SN-38-loaded, self-forming polymeric depots as an injectable drug delivery system.

    Science.gov (United States)

    Manaspon, Chawan; Hongeng, Suradej; Boongird, Atthaporn; Nasongkla, Norased

    2012-10-01

    This work describes the preparation and characterization of anticancer-loaded injectable polymeric depots that consisted of D,L-lactide (LA), ε-caprolactone (CL), and poly(ethylene glycol) (PEG) or [poly(ε-caprolactone)-random-poly(D,L-lactide)]-block-poly(ethylene glycol)-block-[poly(ε-caprolactone)-random-poly(D,L-lactide)] (PLEC) copolymers for malignant gliomas treatment. PLECs were polymerized with different percentages of LA to deliver 7-ethyl-10-hydroxycamptothecin (SN-38), a highly potent anticancer drug. SN-38-loaded depots could form directly in phosphate buffer saline with more than 98% encapsulation efficiency. The release rate of SN-38 from depots was found to depend on the amount of LA in PLECs, loading content of SN-38 in the depots, and depot weight. Encapsulation of SN-38 inside depots could enhance the stability of SN-38 where all of SN-38 released after 60 days was in an active form. Depots without SN-38 were evaluated as noncytotoxic against U-87MG, whereas SN-38-loaded depots showed cytotoxic effect as a function of concentration. Copyright © 2012 Wiley Periodicals, Inc.

  18. The esophagus anatomic-histology of bull frog ("Rana catesbeiana" Shaw, 1802 Anatomo-histologia do esôfago da rã touro ("Rana catesbeiana" Shaw, 1802

    Directory of Open Access Journals (Sweden)

    Carlos Eduardo Lino Pinto

    2008-04-01

    Full Text Available Aiming to describe the esophage functional morpho – histology of bull frog (Rana catebeiana Shaw, 1802, twenty bull frog, mean body weight of 85.00 ± 2.03 g, were used. The esophageal mucosa architecture is defined by thick longitudinal folds, showing an esophageal ciliated pseudostratified epithelium with mucous cells and pluricellular glands; the esophageal muscular coat is composed by inner circular muscular lamina, and by outer longitudinal muscular lamina.Com o objetivo de descrever a anatomo histologia funcional do esôfago da rã touro (Rana catesbeiana Shaw, 1802, foram utilizados 20 (vinte exemplares de rã touro com peso médio de 85,00 ± 2,03 g. Verificou-se que a arquitetura da mucosa esofágica é definida por pregas espessas e longitudinais, com epitélio esofágico do tipo pseudo estratificado ciliado com células mucosas e glândulas pluricelulares; a túnica muscular esofágica é constituida pela túnica muscular circular, mais interna, e pela túnica muscular longitudinal, mais externa.

  19. Surface to 90 km winds for Kennedy Space Center, Florida, and Vandenberg AFB, California

    Science.gov (United States)

    Johnson, D. L.; Brown, S. C.

    1979-01-01

    Bivariate normal wind statistics for a 90 degree flight azimuth, from 0 through 90 km altitude, for Kennedy Space Center, Florida, and Vandenberg AFB, California are presented. Wind probability distributions and statistics for any rotation of axes can be computed from the five given parameters.

  20. Finding No Significant Impact: Aircraft Weather Shelter at Laughlin AFB, TX

    Science.gov (United States)

    2004-06-01

    surface water flow is southeast into the Ro Grande and down toward the Gulf of Mexico. Lake Amistad reservoir, located approximately 12 miles northwest...characterized Lake Amistad reservoir as having excellent water quality (USAF, 1997). Laughlin AFB contains a total of 19 acres of surface water

  1. Relocation of the Air National Guard 176th Wing to Elmendorf AFB, Alaska

    Science.gov (United States)

    2007-09-01

    Park. Between 20 and 70 moose are estimated by Alaska Fish and Game to live on Elmendorf AFB, depending on the time of year, as portions of the herd ...also supports populations of small mammals including beaver (Castor canadensis), muskrat (Ondatra zibethicus), porcupine (Erethizon dorsatum), red

  2. Waves on a Hele-Shaw Cell: Simulations of Acoustic Emissions During Aerofracture

    Science.gov (United States)

    Turkaya, Semih; Toussaint, Renaud; Kvalheim Eriksen, Fredrik; Daniel, Guillaume; Grude Flekkøy, Eirik; Jørgen Måløy, Knut

    2016-04-01

    In this work, we develop a numerical model to explain the lab scale experimental setup [1] modeling the aerofractures in a porous medium. The mentioned experimental setup consists in a rectangular Hele-Shaw cell with three closed boundaries and one semi-permeable boundary which enables the flow of the fluid but not the solid particles. During the experiments, the fluid (pressurized air) is injected into the system with a constant injection pressure from the point opposite to the semi-permeable boundary. At the large enough injection pressures, the fluid also displaces grains (80 μm grain size) and creates channels and fractures towards the semi-permeable boundary. This analogue model is developed in a linear geometry, with confinement and at a lower porosity to study the instabilities developing during the fast motion of a fluid in dense porous materials: fracturing, fingering, and channeling. Different sources of the signal (air vibration in the carved area, changes in the effective stress due to fluid-solid interactions [2]) are separately analyzed and are investigated further using a far field approximation of Lamb waves presented by Goyder & White [3]. In the analysis phase, power spectrum of different timewindows (5 ms) obtained from the recorded signal are computed. Then, the evolution of this power spectrum is compared with the experimental findings. In the power spectrum, it is possible to see some characteristic structure like peaks in specific frequency ranges. These "peaks" are strongly influenced by the size and branching of the channels, compaction of the medium, vibration of air in the pores and the fundamental frequency of the plate. We found that, in the synthetic dataset, the peaks in the low frequency range (f Daniel G, Flekkøy EG, Måløy KJ. "Bridging aero-fracture evolution with the characteristics of the acoustic emissions in a porous medium." Front. Phys., 3 (2015): 70. doi: 10.3389/fphy.2015.00070 2. Niebling MJ, Toussaint R, Flekkøy EG

  3. Male bovine GH transgenic mice have decreased adiposity with an adipose depot-specific increase in immune cell populations.

    Science.gov (United States)

    Benencia, Fabian; Harshman, Stephanie; Duran-Ortiz, Silvana; Lubbers, Ellen R; List, Edward O; Householder, Lara; Al-Naeeli, Mawadda; Liang, Xiaoyu; Welch, Lonnie; Kopchick, John J; Berryman, Darlene E

    2015-05-01

    White adipose tissue (WAT) is composed of mature adipocytes and a stromal vascular fraction (SVF), which contains a variety of cells, including immune cells that vary among the different WAT depots. Growth hormone (GH) impacts immune function and adiposity in an adipose depot-specific manner. However, its effects on WAT immune cell populations remain unstudied. Bovine GH transgenic (bGH) mice are commonly used to study the in vivo effects of GH. These giant mice have an excess of GH action, impaired glucose metabolism, decreased adiposity, increased lean mass, and a shortened lifespan. Therefore, the purpose of this study was to characterize the WAT depot-specific differences in immune cell populations in the presence of excess GH in vivo. Three WAT depots were assessed: inguinal (sc), epididymal (EPI), and mesenteric (MES). Subcutaneous and MES bGH WAT depots showed a significantly higher number of total SVF cells, yet only MES bGH WAT had higher leukocyte counts compared with control samples. By means of flow cytometry analysis of the SVF, we detected greater macrophage and regulatory T-cell infiltration in sc and MES bGH WAT depots compared with controls. However, no differences were observed in the EPI WAT depot. RNA-sequencing confirmed significant alterations in pathways related to T-cell infiltration and activation in the sc depot with fewer significant changes in the EPI bGH WAT depot. These findings collectively point to a previously unrecognized role for GH in influencing the distribution of WAT immune cell populations in a depot-specific manner.

  4. Depo-Provera (depot medroxyprogesterone acetate use after bariatric surgery

    Directory of Open Access Journals (Sweden)

    Lam C

    2016-09-01

    Full Text Available Clarissa Lam,1 Amitasrigowri S Murthy2,3 1New York University School of Medicine, 2Department of Obstetrics and Gynecology, Bellevue Hospital Center, New York University School of Medicine, 3New York University Langone Medical Center, New York, NY, USA Abstract: In the US, obesity rates are increasing greatly. The Centers for Disease Control and Prevention estimates that 68.5% of Americans, including 63.9% of adult women older than 20 years, are overweight (body mass index between 25 kg/m2 and 29.9 kg/m2 or obese (body mass index >30 kg/m2. In light of this, it is not surprising that the rates of bariatric surgery have also been increasing. When considering the metabolic changes associated with both bariatric surgery and contraceptive use, in combination with the unique medical considerations of obese women, it is indisputable that clear guidelines are needed when counseling obese patients of reproductive age after bariatric surgery. In this literature review, we focus on depot medroxyprogesterone acetate (DMPA and the implications of its use in obese women, preweight and postweight loss following bariatric surgery. Both DMPA use and bariatric surgery are known to cause bone loss, but it is still unclear whether there is an additive effect of the two factors on bone loss and whether either of these factors directly leads to an increased risk of bone fracture. The current consensus guidelines do not impose a restriction on the use of DMPA after bariatric surgery. DMPA use is associated with weight gain, and it is unclear whether weight loss blunting occurs with the use of DMPA after bariatric surgery. Prior studies had demonstrated an association with weight gain in adolescents, and therefore, those prescribing DMPA use after bariatric surgery in adolescents should proceed with caution. Adult women do not have a similar response to the use of DMPA. DMPA use has rarely been associated with increased risk of venous thromboembolism (VTE. The

  5. The angle of repose of spherical grains in granular Hele–Shaw cells: a molecular dynamics study

    International Nuclear Information System (INIS)

    Maleki, Hamed; Ebrahimi, Fatemeh; Oskoee, Ehsan Nedaaee

    2008-01-01

    We report the results of three-dimensional molecular dynamic simulations on the angle of repose of a sandpile formed by pouring mono-sized cohesionless spherical grains into a granular Hele–Shaw cell. In particular, we are interested in investigating the effects of those variables which may have a significant impact on the pattern formation of granular mixtures in Hele–Shaw cells. The results indicate that the frictional forces influence the formation of piles on the grain level remarkably. Furthermore, we see that increasing grain insertion rate decreases the angle of repose slightly. We also find that the cell thickness is a significant factor and the angle of repose decays when the size of the gap between the lateral walls increases. In addition to agreeing with the experimental exponential decay law, our results are in accordance with a recently proposed model which takes into account the arching effects. Using grains with different sizes reveals that the behaviour of the angle of repose when both size and cell thickness are varied is controlled by a scaled function of the ratio of these two variables

  6. Centrifugal fingering in a curved Hele-Shaw cell: A generalized Euler's elastica shape for the two-fluid interface

    Science.gov (United States)

    Miranda, Jose; Brandao, Rodolfo

    2017-11-01

    We study a family of generalized elastica-like equilibrium shapes that arise at the interface separating two fluids in a curved rotating Hele-Shaw cell. This family of stationary interface solutions consists of shapes that balance the competing capillary and centrifugal forces in such a curved flow environment. We investigate how the emerging interfacial patterns are impacted by changes in the geometric properties of the curved Hele-Shaw cell. A vortex-sheet formalism is used to calculate the two-fluid interface curvature, and a gallery of possible shapes is provided to highlight a number of peculiar morphological features. A linear perturbation theory is employed to show that the most prominent aspects of these complex stationary patterns can be fairly well reproduced by the interplay of just two interfacial modes. The connection of these dominant modes to the geometry of the curved cell, as well as to the fluid dynamic properties of the flow, is discussed. We thank CNPq (Brazilian Research Council) for financial support under Grant No. 304821/2015-2.

  7. Scaling crossover in thin-film drag dynamics of fluid drops in the Hele-Shaw cell

    Science.gov (United States)

    Okumura, Ko; Yahashi, Misato; Kimoto, Natsuki

    2016-11-01

    We study both experimentally and theoretically the descending motion due to gravity of a fluid drop surrounded by another immiscible fluid in a confined space between two parallel plates, i.e., in the Hele-Shaw cell. As a result, we show a new scaling regime of a nonlinear drag friction in viscous liquid that replaces the well-known Stokes' drag friction through a clear collapse of experimental data thanks to the scaling law. In the novel regime, the dissipation in the liquid thin film formed between the drop and cell walls governs the dynamics. The crossover of this scaling regime to another scaling regime in which the dissipation inside the droplet is dominant is clearly demonstrated and a phase diagram separating these scaling regimes is presented. To be published as, Y. Yahashi, N. Kimoto and K. Okumura, Scaling crossover in thin-film drag dynamics of fluid drops in the Hele-Shaw cell, Sci. Rep.(CC BY 4.0). This research was partly supported by ImPACT Program of Council for Science, Technology and Innovation (Cabinet Office, Government of Japan).

  8. Clinical outcome of one-third-dose depot triptorelin is the same as half-dose depot triptorelin in the long protocol of controlled ovarian stimulation

    Directory of Open Access Journals (Sweden)

    Yu Li

    2012-01-01

    Full Text Available Objective: Appropriate dosage of the long-acting depot gonadotrophin releasing hormone (GnRH agonist has not been determined in long protocol for IVF, and one-third-dose depot triptorelin was compared with half-dose in a luteal long protocol of in-vitro fertilization/ intra cytoplasmic sperm injection (IVF/ICSI treatment in this study. Materials and Methods: This is a prospective, randomized, open clinical trial. 100 patients were randomized into two groups. Group I received one-third-dose (1.25 mg depot triptorelin. Group II received half-dose (1.87 mg. The clinical and experimental parameters were compared between the two groups. Results: There was no premature luteinizing hormone (LH surge in both groups. On Day 3-5 of menstrual cycle after down-regulation, fewer patients showed low-level LH (<1.0 IU/L and estradiol (<30 pg/mL in group I (P <0.05. There were fewer oocytes retrieved (P =0.086, fewer total embryos and available embryos for cryopreservation in Group I (P <0.05, while good-quality embryo rate was higher in group I (P <0.05. The length and dose of ovarian stimulation was lower in Group I, but not significantly. The clinical pregnancy (52% versus 40%, implantation (48% versus 37.5%, delivery (46% versus 32%, or live birth (42% versus 32% rates and the abortion (8% versus 20% rates showed no significant differences. Conclusion: Depot triptorelin 1.25 mg can be successfully used with reduced pituitary suppression and lower cost in a long protocol for in-vitro fertilization.

  9. Multicenter clinical trial of leuprolide acetate depot (Luphere depot 3.75 mg for efficacy and safety in girls with central precocious puberty

    Directory of Open Access Journals (Sweden)

    You Jin Kim

    2013-12-01

    Full Text Available PurposeWe evaluated the efficacy, safety and psychological aspect of monthly administrations of the gonadotropin-releasing hormone agonists (GnRHa, leuprolide acetate depot (Luphere depot 3.75 mg, in patients with precocious puberty.MethodsA total of 54 girls with central precocious puberty were administered with leuprolide acetate (Luphere depot 3.75 mg every four weeks over 24 weeks. We evaluated the percentage of children exhibiting a suppressed luteinizing hormone (LH response to GnRH (LH peak≤3 IU/L, peak LH/follicle stimulating hormone (FSH ratio of GnRH stimulation test less than 1, change in bone age/chronologic age ratio, change in the Tanner stage and change in eating habit and psychological aspect.Results(1 The percentage of children exhibiting a suppressed LH response to GnRH, defined as an LH peak≤3 IU/L at 24 weeks was 96.3 % (52/54. (2 The percentage of children exhibiting peak LH/FSH ratio<1 at 24 weeks of the study was 94.4 % (51/54. (3 The ratio of bone age and chronological age significantly declined from 1.27±0.07 to 1.24±0.01 after the 6 months of the study. (4 The mean Tanner stage manifested a significant change 2.3±0.48 at baseline, down to 1.70±0.61 at 24 weeks. (5 Based on the questionnaires, the score for eating habits showed a significant change from the baseline 34.0±6.8 to 31.3±6.8. (6 The psychological assessment did not exhibit a significant difference except with scores for sociability, problem behavior total score and other problems.ConclusionThe leuprolide 3.75 mg (Luphere depot is useful and safety for treating children with central precocious puberty.

  10. Inflammation and race and gender differences in computerized tomography-measured adipose depots

    NARCIS (Netherlands)

    Beasley, L.E.; Koster, A.; Newman, A.B.; Javaid, M.K.; Ferucci, L.; Kritchevsky, S.B.; Kuller, L.H.; Pahor, M.; Visser, M.; Rubin, S.M.; Goodpaster, B.H.; Everhart, J.E.; Harris, T.B.

    2009-01-01

    A growing body of evidence has consistently shown a correlation between obesity and chronic subclinical inflammation. It is unclear whether the size of specific adipose depots is more closely associated with concentrations of inflammatory markers than overall adiposity. This study investigated the

  11. Clay Nanoparticles Elicit Long-Term Immune Responses by Forming Biodegradable Depots for Sustained Antigen Stimulation.

    Science.gov (United States)

    Chen, Weiyu; Zuo, Huali; Li, Bei; Duan, Chengcheng; Rolfe, Barbara; Zhang, Bing; Mahony, Timothy J; Xu, Zhi Ping

    2018-05-01

    Nanomaterials have been widely tested as new generation vaccine adjuvants, but few evoke efficient immunoreactions. Clay nanoparticles, for example, layered double hydroxide (LDH) and hectorite (HEC) nanoparticles, have shown their potent adjuvanticity in generating effective and durable immune responses. However, the mechanism by which clay nanoadjuvants stimulate the immune system is not well understood. Here, it is demonstrated that LDH and HEC-antigen complexes form loose agglomerates in culture medium/serum. They also form nodules with loose structures in tissue after subcutaneous injection, where they act as a depot for up to 35 d. More importantly, clay nanoparticles actively and continuously recruit immune cells into the depot for up to one month, and stimulate stronger immune responses than FDA-approved adjuvants, Alum and QuilA. Sustained antigen release is also observed in clay nanoparticle depots, with 50-60% antigen released after 35 d. In contrast, Alum-antigen complexes show minimal antigen release from the depot. Importantly, LDH and HEC are more effective than QuilA and Alum in promoting memory T-cell proliferation. These findings suggest that both clay nanoadjuvants can serve as active vaccine platforms for sustained and potent immune responses. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Pharmacodynamic effects of depot-medroxyprogesterone acetate (DMPA) administered to lactating women on their male infants

    NARCIS (Netherlands)

    Virutamasen, P; Leepipatpaiboon, S; Kriengsinyot, R; Vichaidith, P; Muia, PN; SekaddeKigondu, CB; Mati, JKG; Forest, MG; Dikkeschei, LD; Wolthers, BG; dArcangues, C

    Normal postpartum women, who had a spontaneous vaginal delivery of one full-term male infant, free of congenital abnormalities and other diseases, were recruited for this study. Thirteen women received 150 mg depot-medroxyprogesterone acetate (DMPA), intramuscularly on days 42 + 1 and 126 + 1

  13. Verspreiding van zout bij het terugwinnen van zeezand uit een depot in het Haringvliet

    NARCIS (Netherlands)

    Kranenburg, C.

    1991-01-01

    Dit rapport geeft een beknopte analyse van de verdunning en verspreiding van zout vanuit een gepland depot voor ontzilt zeezand in het Haringvliet. Beschouwd zijn de initiële menging van het zout bij terugwinnen van het zand, de verspreiding door stroming en turbulentie bij geopende spuisluis, en de

  14. Safety Extension Study Of Leuprolide Acetate (Lupron Depot) In The Treatment Of Central Precocious Puberty

    Science.gov (United States)

    2014-01-08

    Precocious; Leuprolide Acetate; Luteinizing Hormone (LH); Gonadotrophin-releasing Hormone Agonist (GnRHa); Tanner Staging; Depot Formulation; Suppression of LH; Central Precocious Puberty (CPP); Gonadotrophin-releasing Hormone (GnRH); Lupron; GnRH Analog; Pediatrics Central Precocious Puberty

  15. Sustained release of antibiotics from injectable and thermally responsive polypeptide depots.

    Science.gov (United States)

    Adams, Samuel B; Shamji, Mohammed F; Nettles, Dana L; Hwang, Priscilla; Setton, Lori A

    2009-07-01

    Biodegradable polymeric scaffolds are of interest for delivering antibiotics to local sites of infection in orthopaedic applications, such as bone and diarthrodial joints. The objective of this study was to develop a biodegradable scaffold with ease of drug loading in aqueous solution, while providing for drug depot delivery via syringe injection. Elastin-like polypeptides (ELPs) were used for this application, biopolymers of repeating pentapeptide sequences that were thermally triggered to undergo in situ depot formation at body temperature. ELPs were modified to enable loading with the antibiotics, cefazolin, and vancomycin, followed by induction of the phase transition in vitro. Cefazolin and vancomycin concentrations were monitored, as well as bioactivity of the released antibiotics, to test an ability of the ELP depot to provide for prolonged release of bioactive drugs. Further tests of formulation viscosity were conducted to test suitability as an injectable drug carrier. Results demonstrate sustained release of therapeutic concentrations of bioactive antibiotics by the ELP, with first-order time constants for drug release of approximately 25 h for cefazolin and approximately 500 h for vancomycin. These findings illustrate that an injectable, in situ forming ELP depot can provide for sustained release of antibiotics with an effect that varies across antibiotic formulation. ELPs have important advantages for drug delivery, as they are known to be biocompatible, biodegradable, and elicit no known immune response. These benefits suggest distinct advantages over currently used carriers for antibiotic drug delivery in orthopedic applications. (c) 2008 Wiley Periodicals, Inc.

  16. The contribution of the in-vivo fate of an oil depot to drug absorption

    NARCIS (Netherlands)

    Kalicharan, R. W.; Oussoren, C; Schot, Peter; Rijk, de, E.; Vromans, H.

    2017-01-01

    Sustained release of lipophilic compounds can be achieved with oil depots. These parenteral formulations are generally injected in the vastus lateralis and deltoid muscle. It is known that the absorption rate differs between these two muscles. The reason for this is not fully understood. The aim of

  17. Field Demonstration/Validation of Electrolytic Barriers for Energetic Compounds at Pueblo Chemical Depot

    Science.gov (United States)

    2010-01-01

    measuring the intensity of fluorescence at 517 nm using an Ocean Optics USB-2000TM spectrometer and an Ocean OpticsTM custom six-around-one fiber ...Umatilla Army Depot, OR Demilitarization (washout) Basalt Deep (>50 feet) NRC (2005) Installation Action Plan for UAAP March 2001 Hawthorne

  18. Implementation of Geographical Information System for Bacteriological Contamination Analysis on Refill Drinking Water Depot (Study in Tembalang District)

    Science.gov (United States)

    Rahmitha, Amelia; Utami, Endang Sri; Sitohang, Marya Yenita

    2018-02-01

    People used refilled-drinking-water for household and food stall because its efficient and low cost. Based on Indonesian Health Ministry regulation, it should not have any coliform bacteria. This study aimed to describe the bacteriological contamination of refilled drinking water using geographical information system (GIS). In this research, it was used an analytic observational method. The samples were from all available (37) depots in Tembalang district, one form each depot took used a sterile bottle. Contamination of bacteria was identified by Most Probable Number (MPN) method lactose broth media, Mac Conkey media, and IMVIC media. The depot samples were then plotted on (GIS). This study showed 95% samples were not feasible to consume since they contamined coliform. All sub-district had one that contaminated by coliform, 75% sub-districts had depots that contaminated Escherichia coli, while 55% sub-districts had depots that contaminated with other bacteria. The internal risk factors of the contamination were the absence of hygiene-sanitation worthy certificate (95%), depots location near to pollution sources (5%), and the misused of UV light. The external risk factor was lack of quality control that was not as the sterilization from office health Semarang city. Policy reinforcement should be done to all of the depots.

  19. Henry Selby Hele-Shaw LLD, DSc, EngD, FRS, WhSch (1854-1941: Engineer, inventor and educationist

    Directory of Open Access Journals (Sweden)

    Jane Carruthers

    2010-03-01

    Full Text Available H.S. Hele-Shaw (1854–1941 was one of the most outstanding engineering scientists of his generation and an eminent figure in engineering education during the late-19th and early-20th centuries. His work in hydrodynamics (the Hele-Shaw cell and Hele-Shaw pump and his important contribution to the successful development of high-speed aircraft (his variable pitch airscrew, continues to be relevant today. In 1922, as President of the Institution of Mechanical Engineers, he introduced the National Certificate scheme in Britain. It is not well known that Hele-Shaw spent two years in South Africa (1904–1905 attached to the Transvaal Technical Institute, a forerunner of the University of the Witwatersrand. One of only three Fellows of the Royal Society of London in southern Africa in 1905, he was a founder Council member of the Royal Society of South Africa and one of the hosts of the 1905 visit to southern Africa by the British Association for the Advancement of Science. The purpose of this paper is to highlight the time he spent in South Africa and to contextualise it within the larger perspective of his engineering career.

  20. Cost-Utility Analysis of Depot Atypical Antipsychotics for Chronic Schizophrenia in Croatia.

    Science.gov (United States)

    Jukic, Vlado; Jakovljevic, Miro; Filipcic, Igor; Herceg, Miroslav; Silic, Ante; Tomljanovic, Tatjana; Zilbershtein, Roman; Jensen, Rasmus C D; Hemels, Michiel E H; Einarson, Thomas R

    As a nation with a developing economy, Croatia is faced with making choices between pharmaceutical products, including depot injectable antipsychotics. We conducted a pharmacoeconomic analysis to determine the cost-effectiveness of atypical depots in Croatia. A 1-year decision-analytic framework modeled drug use. We determined the average direct cost to the Croatian Institute for Health Insurance of using depot formulations of paliperidone palmitate long-acting injectable (PP-LAI), risperidone LAI (RIS-LAI), or olanzapine LAI (OLZ-LAI). An expert panel plus literature-derived clinical rates populated the core model, along with costs adjusted to 2012 by using the Croatian consumer price index. Clinical outcomes included quality-adjusted life-years, hospitalization rates, emergency room treatment rates, and relapse days. Robustness of results was examined with one-way sensitivity analyses on important inputs; overall, all inputs were varied over 10,000 simulations in a Monte Carlo analysis. Costs (quality-adjusted life-years) per patient were €5061 (0.817) for PP-LAI, €5168 (0.807) for RIS-LAI, and €6410 (0.812) for OLZ-LAI. PP-LAI had the fewest relapse days, emergency room visits, and hospitalizations. Results were sensitive against RIS-LAI with respect to drug costs and adherence rates, but were generally robust overall, dominating OLZ-LAI in 77.3% and RIS-LAI in 56.8% of the simulations. PP-LAI dominated the other drugs because it had the lowest cost and best clinical outcomes. Compared with depots of olanzapine and risperidone and oral olanzapine, PP-LAI was the cost-effective atypical LAI for treating chronic schizophrenia in Croatia. Using depot paliperidone in place of either olanzapine or risperidone would reduce the overall costs of caring for these patients. Copyright © 2013, International Society for Pharmacoeconomics and Outcomes Research (ISPOR). Published by Elsevier Inc.

  1. Hypoxia induced VEGF synthesis in visceral adipose depots of obese diabetic patients.

    Science.gov (United States)

    Fusaru, Ana Marina; Pisoschi, Cătălina Gabriela; Bold, Adriana; Taisescu, C; Stănescu, R; Hîncu, Mihaela; Crăiţoiu, Stefania; Baniţă, Ileana Monica

    2012-01-01

    VEGF is one the pro-inflammatory adipokines synthesized by the "adipose secretoma" of obese subjects as a response to hypoxic conditions; but the main function of VEGF is angiogenesis, being recognized as the most important factor increasing blood capillaries in the adipose tissue by stimulating endothelial cell growth. In this paper, we propose a comparative study of the vascular response to VEGF synthesis in the subcutaneous and central-peritoneal adipose depots in lean, obese and obese diabetic patients. We used CD31 to label the endothelial cells in order to evaluate the response of the vascular network to VEGF synthesis. Our results showed an increase of VEGF protein synthesis in obese and obese-diabetic patients compared to lean subjects where the protein was absent. The positivity for VEGF in obese diabetic samples was observed in numerous structures from the adipose depots, both in the stromal vascular fraction--blood vessels and stromal cells--as well as in the cytoplasm of adipocytes. Positivity in the vascular wall was observed more frequently in areas of perivascular and intralobular fibrosis. Obese and diabetic patients showed similar incidence of CD31 immunoreactivity with lean subjects in both subcutaneous and peritoneal depots. In conclusion, human adipose depots show a different incidence of VEGF positive cells in relation with their disposal and the metabolic status. VEGF synthesis in visceral adipose tissue is inefficient being not followed by angiogenesis to counterbalance tissue hypoxia. We suggest that may be a pathogenic link between the degrees of intralobular fibrosis in adipose depots and VEGF expression.

  2. RATIONAL RECOVERY MODEL OF DEPOT PROCESSING EQUIPMENT AT THE INDUSTRIAL ENTERPRISE

    Directory of Open Access Journals (Sweden)

    M. I. Kapitsa

    2014-07-01

    Full Text Available Purpose. The problem of the maximum resources recovery of rolling stock repair depot of industrial enterprise with limited resources consumption, which are used in the system is today’s topical question.The main factors that affect the repair depot operation of industrial enterprise are reviewed. The most significant factors, affecting the quality of the repair depot, are emphasized for further study, specifically - the state of the major repair equipment of a sector. There is a need to minimize the impact of the unsatisfactory state of this factor. Methodology. The formed task of major equipment rational repairing in the mathematical sense is based on the solution of a vector optimization problem. In this case the target functions are the monetary funds spending and time expenditure for repairing. Findings. The mathematical model of optimal equipment maintainability of the repair department at the industrial enterprise was developed by the authors. On the example the choice model of optimal path for equipment repairing of enterprise repair department is described. Originality. As a result of the conducted research the repairing system of major equipment of industrial enterprise sectors was improved. As the mathematical model of rational system recovery of industrial enterprise repair depot we recommend apparatus of class problems of vector optimization. Practical value. Using the proposed model of major equipment repair system of the repair depot at the industrial enterprise will improve the quality of the department by increasing the efficiency of primary resources - time and monetary funds - which are spent by the sector in order to repair its techniques.

  3. Pengaruh Kepuasan Dan Kepercayaan Terhadap Keputusan Pembelian Ulang Pada Depot Air Minum Tris Water Reverse Osmosis System (Ro)

    OpenAIRE

    Fitria, Ika

    2011-01-01

    Kind of this survey is asociative survey which watch influence of customer satisfaction and trust to re-purchase decision on Depot Air Minum Tris Water Reverse Osmosis System (RO) and test of hypothesis use Multiple Linear Regression Analysist on α=5%. This survey used SPSS 16.00 version for windows. Research population is consumers of Depot Air Minum Tris Water Reverse Osmosis System (RO). Sample was used in this survey from customers of Depot Air Minum Tris Water Reverse Osmosis System (RO)...

  4. Final Confirmation Sampling and Analysis Report for the POL Yard, Sites SS-06 and ST-40, Wurtsmith AFB, Michigan

    National Research Council Canada - National Science Library

    1999-01-01

    .... Wurtsmith AFBCA and AFCEE/ERT had no comments on the draft final report. This report represents the final contract deliverable for the AFCEE Extended Bioventing Project at the Wurtsmith AFB POL Yard...

  5. Numerical simulation of particle jet formation induced by shock wave acceleration in a Hele-Shaw cell

    Science.gov (United States)

    Osnes, A. N.; Vartdal, M.; Pettersson Reif, B. A.

    2018-05-01

    The formation of jets from a shock-accelerated cylindrical shell of particles, confined in a Hele-Shaw cell, is studied by means of numerical simulation. A number of simulations have been performed, systematically varying the coupling between the gas and solid phases in an effort to identify the primary mechanism(s) responsible for jet formation. We find that coupling through drag is sufficient for the formation of jets. Including the effect of particle volume fraction and particle collisions did not alter the general behaviour, but had some influence on the length, spacing and number of jets. Furthermore, we find that the jet selection process starts early in the dispersal process, during the initial expansion of the particle layer.

  6. Of mice and men: evolution and the socialist utopia. William Morris, H.G. Wells, and George Bernard Shaw.

    Science.gov (United States)

    Hale, Piers J

    2010-01-01

    During the British socialist revival of the 1880s competing theories of evolution were central to disagreements about strategy for social change. In News from Nowhere (1891), William Morris had portrayed socialism as the result of Lamarckian processes, and imagined a non-Malthusian future. H.G. Wells, an enthusiastic admirer of Morris in the early days of the movement, became disillusioned as a result of the Malthusianism he learnt from Huxley and his subsequent rejection of Lamarckism in light of Weismann's experiments on mice. This brought him into conflict with his fellow Fabian, George Bernard Shaw, who rejected neo-Darwinism in favour of a Lamarckian conception of change he called "creative evolution."

  7. Experiences gained in the conditioning of radioactive wastes from regional depots by example of Kernforschungszentrum Karlsruhe, and recommendations for the establishment of regional depots in the new Federal States of unified Germany

    International Nuclear Information System (INIS)

    Pfeifer, W.

    1992-01-01

    Details are given about radioactive waste management and radioactive waste management fundamentals as well as about the respective methods applied by the Baden-Wuerttemberg radioacive waste depot. The waste treatment, quality assurance and internal inspection methods applied by Hauptabteilung Dekontaminationsbetriebe (HDB), Kernforschungszentrum Karlsruhe (KfK) are described, and recommendations are given for the establishment of regional depots in the new provinces of the Federal Republic of Germany. These recommendations which are based on Western German standards before unification suggest regional depots with combined administrative systems which watch over the depot use and charges, the foundation of a waste management association responsible for the disposal, transport, intermediate storage and conditioning of radioactive wastes in the new provinces, and the establishment of a facility to be run by the proposed waste management association for the intermediate storage of conditioned waste packages intended for final disposal. (orig.) [de

  8. Environmental Assessment Construction of a New Hazardous Cargo Pad Davis-Monthan AFB

    Science.gov (United States)

    2002-11-07

    PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES) 355th Civil Engineer Squadron (CES/CEVA),710 Third Street,Davis-Monthan AFB,AZ,85707 8. PERFORMING...agency for certain projects. Details of the preparation of this EA are mandated by the Council of Enviromental Quality (CEQ) in the series of...Base, Tucson, Arizona." October 1996. James M. Montgomery, Consulting Engineers for US army Corps of Engineers , Omaha Dist., Apri11990

  9. Williams AFB, Arizona Revised Uniform Summary of Surface Weather Observations (RUSSWO) Parts A-F.

    Science.gov (United States)

    1981-10-21

    N;I 1-L 9AL CLIMATOLOGY BRANCH ~.w~ .’ ETAC LJS. H A~(I EATV UMDT 2 f wEATHER SERVICE/MAC SEE FIRST HUMDIT 2 114 1 LLIAMS AFB AZ 69-70,73-80 JUL...4622 USAPETAC ’ol 0-87-5(01.A) , I roFql CL,-RAL CLIMATOLOGY BRANCH EATV 2 AFETAC SRVIE/ACATIVE UUTO HUMIDITY SEE FIRST PAGE Z Cl)4 AILLIAMS AFS AZ

  10. Maternal obesity programs increased leptin gene expression in rat male offspring via epigenetic modifications in a depot-specific manner

    Directory of Open Access Journals (Sweden)

    Simon Lecoutre

    2017-08-01

    Conclusions: Consistent with the DOHaD hypothesis, persistent epigenetic remodeling occurs at regulatory regions especially within intergenic sequences, linked to higher leptin gene expression in adult HF offspring in a depot-specific manner.

  11. Financial Reporting Procedures for Defense Distribution Depots - Defense Logistics Agency Business Area of the Defense Business Operations Fund

    National Research Council Canada - National Science Library

    Young, Shelton

    1994-01-01

    In our audit of the FY 1993 Financial Statements for the Distribution Depots--Defense Logistics Agency Business Mea of the Defense Business Operations Fund, we evaluated procedures and controls used...

  12. Examining a Paradigm Shift in Organic Depot-Level Software Maintenance for Army Communications and Electronics Equipment

    Science.gov (United States)

    2015-05-30

    scalable application of cutting edge technologies. 20 4. Responding to changing resources—With likely significant resource reductions the depot...deal with underutilized organic capability while continuing to increase outsourcing of depot workload. In addition the study states that a...the unique organic skills that TYAD could 40 bring to the software sustainment mission could be valuable based on the specific type of software

  13. Depot-medication compliance for patients with psychotic disorders: the importance of illness insight and treatment motivation.

    Science.gov (United States)

    Noordraven, Ernst L; Wierdsma, André I; Blanken, Peter; Bloemendaal, Anthony Ft; Mulder, Cornelis L

    2016-01-01

    Noncompliance is a major problem for patients with a psychotic disorder. Two important risk factors for noncompliance that have a severe negative impact on treatment outcomes are impaired illness insight and lack of motivation. Our cross-sectional study explored how they are related to each other and their compliance with depot medication. Interviews were conducted in 169 outpatients with a psychotic disorder taking depot medication. Four patient groups were defined based on low or high illness insight and on low or high motivation. The associations between depot-medication compliance, motivation, and insight were illustrated using generalized linear models. Generalized linear model showed a significant interaction effect between motivation and insight. Patients with poor insight and high motivation for treatment were more compliant (94%) (95% confidence interval [CI]: 1.821, 3.489) with their depot medication than patients with poor insight and low motivation (61%) (95% CI: 0.288, 0.615). Patients with both insight and high motivation for treatment were less compliant (73%) (95% CI: 0.719, 1.315) than those with poor insight and high motivation. Motivation for treatment was more strongly associated with depot-medication compliance than with illness insight. Being motivated to take medication, whether to get better or for other reasons, may be a more important factor than having illness insight in terms of improving depot-medication compliance. Possible implications for clinical practice are discussed.

  14. Intrinsic differences in adipocyte precursor cells from different white fat depots

    DEFF Research Database (Denmark)

    Macotela, Yazmín; Emanuelli, Brice; Mori, Marcelo A

    2012-01-01

    Obesity and body fat distribution are important risk factors for the development of type 2 diabetes and metabolic syndrome. Evidence has accumulated that this risk is related to intrinsic differences in behavior of adipocytes in different fat depots. In the current study, we demonstrate...... that adipocyte precursor cells (APCs) isolated from visceral and subcutaneous white adipose depots of mice have distinct patterns of gene expression, differentiation potential, and response to environmental and genetic influences. APCs derived from subcutaneous fat differentiate well in the presence of classical...... induction cocktail, whereas those from visceral fat differentiate poorly but can be induced to differentiate by addition of bone morphogenetic protein (BMP)-2 or BMP-4. This difference correlates with major differences in gene expression signature between subcutaneous and visceral APCs. The number of APCs...

  15. Understanding of empty container movement: A study on a bottleneck at an off-dock depot

    Science.gov (United States)

    Zain, Rosmaizura Mohd; Rahman, Mohd Nizam Ab; Nopiah, Zulkifli Mohd; Saibani, Nizaroyani

    2014-09-01

    Port not only function as connections between marine and land transportation but also as core business areas. In a port terminal, available space is limited, but the influx of container is growing. The off-dock depot is one of the key supply chain players that hold empty containers in the inventory. Therefore, this paper aims to identify the main factors of bottlenecks or congestion that hinder the rapid movement of empty containers from the off-dock depot to the customers. Thirty interviews were conducted with individuals who are key players in the container supply chain. The data were analyzed using Atlas.ti software and the analytic hierarchy process to rank the priority factors of bottlenecks. Findings show that several pertinent factors act as barriers to the key players in the container movement in the day-to-day operations. In future studies, strategies to overcome fragmentation in the container supply chain and logistics must be determined.

  16. Optimizing the Shunting Schedule of Electric Multiple Units Depot Using an Enhanced Particle Swarm Optimization Algorithm

    Directory of Open Access Journals (Sweden)

    Jiaxi Wang

    2016-01-01

    Full Text Available The shunting schedule of electric multiple units depot (SSED is one of the essential plans for high-speed train maintenance activities. This paper presents a 0-1 programming model to address the problem of determining an optimal SSED through automatic computing. The objective of the model is to minimize the number of shunting movements and the constraints include track occupation conflicts, shunting routes conflicts, time durations of maintenance processes, and shunting running time. An enhanced particle swarm optimization (EPSO algorithm is proposed to solve the optimization problem. Finally, an empirical study from Shanghai South EMU Depot is carried out to illustrate the model and EPSO algorithm. The optimization results indicate that the proposed method is valid for the SSED problem and that the EPSO algorithm outperforms the traditional PSO algorithm on the aspect of optimality.

  17. Optimizing the Shunting Schedule of Electric Multiple Units Depot Using an Enhanced Particle Swarm Optimization Algorithm

    Science.gov (United States)

    Jin, Junchen

    2016-01-01

    The shunting schedule of electric multiple units depot (SSED) is one of the essential plans for high-speed train maintenance activities. This paper presents a 0-1 programming model to address the problem of determining an optimal SSED through automatic computing. The objective of the model is to minimize the number of shunting movements and the constraints include track occupation conflicts, shunting routes conflicts, time durations of maintenance processes, and shunting running time. An enhanced particle swarm optimization (EPSO) algorithm is proposed to solve the optimization problem. Finally, an empirical study from Shanghai South EMU Depot is carried out to illustrate the model and EPSO algorithm. The optimization results indicate that the proposed method is valid for the SSED problem and that the EPSO algorithm outperforms the traditional PSO algorithm on the aspect of optimality. PMID:27436998

  18. On the multiple depots vehicle routing problem with heterogeneous fleet capacity and velocity

    Science.gov (United States)

    Hanum, F.; Hartono, A. P.; Bakhtiar, T.

    2018-03-01

    This current manuscript concerns with the optimization problem arising in a route determination of products distribution. The problem is formulated in the form of multiple depots and time windowed vehicle routing problem with heterogeneous capacity and velocity of fleet. Model includes a number of constraints such as route continuity, multiple depots availability and serving time in addition to generic constraints. In dealing with the unique feature of heterogeneous velocity, we generate a number of velocity profiles along the road segments, which then converted into traveling-time tables. An illustrative example of rice distribution among villages by bureau of logistics is provided. Exact approach is utilized to determine the optimal solution in term of vehicle routes and starting time of service.

  19. Environmental Assessment KC-46A Depot Maintenance Activation, Tinker Air Force Base, Oklahoma. Volume 1

    Science.gov (United States)

    2014-03-01

    Cultural Resources Tinker AFB is located in the south central Oklahoma archaeological region. Important research into the prehistory of central...No. 5. Oklahoma River Basin Survey Project. University of Oklahoma Research Institute. Norman. Bell, R. E. (editor). 1984. Prehistory of Oklahoma...February 2012. Galm, J.R. and P. Flynn. 1978. The Cultural Sequences of the Scott (34LF11) and Wann (34LF27) Sites and Prehistory of the Wister Valley

  20. Formative Evaluation of a Sociotechnical System Intervention at an Army Maintenance Depot

    Science.gov (United States)

    1986-07-01

    periodically reassess itself to determine if the balance between the technical and social systems remains adaptive and responsive to the requirements...developed a comprehensive set of recommendations for improving the balance between the social and technical systems of the depot. During 1983, most of...ity and quality of worklife . However, the nature and extent of the impact is highly elusive and resistant to quantification. 1-4 FORMATIVE

  1. DoD Depot-Level Reparable Supply Chain Management: Process Effectiveness and Opportunities for Improvement

    Science.gov (United States)

    2014-01-01

    Parts MIS Materiel Information Systems MRP material requirement planning NAVAIR Naval Air Systems Command viii DoD Depot-Level Reparable Supply...planning ( MRP ), which is run on the 15th of the month. The output of MRP is a time-phased buy and repair induction plan based on pro- jected demands...nine months in advance of the FY, planners begin work on the command schedule for the following year. From March through August, the monthly MRP

  2. DEPOT system for the creation of a translator from the COC language

    International Nuclear Information System (INIS)

    Kehnig, Kh.; Lehttsch, Yu.; Nefed'eva, L.S.; Shtiller, G.

    1976-01-01

    Approaches to the creation of specialized languages and their translators are given. The DENOT system for developing translators from various specialized languages is described. Use of the system was made to translate the STS (spectra treatment system) language into the FORTRAN language.The language of STS was realized with help of DEPOT on the BESM-6 computer. The DEROT system installed at various computer provides for simple and rapid transition from one computer to the other

  3. Tooele Army Depot Revised Final Site-Wide Ecological Risk Assessment. Volume I.

    Science.gov (United States)

    1998-02-01

    which is immediately east of the depot. Properties to the north of TEAD are used primarily for pasture and cultivation , and to the west and south, for...for the TEAD facility, the types of contaminants present, and the ecotoxicological effects that could be expected due to contaminant exposure. This...questions: • Were the analytical detection limits low enough to be ecotoxicologically relevant (i.e., to be protective of ecological receptors with

  4. Obesity associated disease risk: the role of inherent differences and location of adipose depots.

    Science.gov (United States)

    Hill, Jessica H; Solt, Claudia; Foster, Michelle T

    2018-03-16

    Obesity and associated metabolic co-morbidities are a worldwide public health problem. Negative health outcomes associated with obesity, however, do not arise from excessive adiposity alone. Rather, deleterious outcomes of adipose tissue accumulation are a result of how adipocytes are distributed to individual regions in the body. Due to our increased understanding of the dynamic relationship that exists between specific adipose depots and disease risk, an accurate characterization of total body adiposity as well as location is required to properly evaluate a population's disease risk. Specifically, distinctive tissue depots within the body include the lower body, upper body and abdominal (deep and superficial) subcutaneous regions, as well as visceral (mesenteric and omental) regions. Upper body and visceral adipose tissues are highly associated with metabolic dysfunction and chronic disease development, whereas lower body gluteofemoral subcutaneous adipose tissue imparts protection against diet-induced metabolic derangement. Each adipose depot functions distinctly as an endocrine organ hence it has a different level of impact on health outcomes. Effluent from adipose tissue can modulate the functions of other tissues, whilst receiving differential communication from the rest of the body via central nervous system innervation, metabolites and other signaling molecules. More so, adipose depots contain a diverse reservoir of tissue-resident immune cells that play an integral part in both maintaining tissue homeostasis, as well as propagating metabolically-induced inflammation. Overall, the conceptualization of obesity and associated risks needs updating to reflect the complexities of obesity. We review adipose tissue characteristics that are linked to deleterious or beneficial adipose tissue distributions.

  5. Implementation of Improved Management Control of Aviation Depot Level Repairable Funds

    Science.gov (United States)

    1986-12-01

    for comparing and testing. Pf ter Drucker states that ". . . control is an ambiguous word. It means the abiliti to direct oneself and one’s work. It...Frequency 50 LIST OF REFERENCES 1. Drucker , Peter F., The Practice of Management , Harper and Brothers Publishers, 1954. 2. Terry, George R., Principles of...NAVAL POSTGRADUATE SCHOOLMonterey, California 0- 6~~VI E1B9 87THESIS I IMPLEMENTATION OF IMPROVED MANAGEMENT CONTROL OF AVIATION DEPOT LEVEL

  6. Sustained Release of Antibiotics from Injectable and Thermally Responsive Polypeptide Depots

    OpenAIRE

    Adams, Samuel B.; Shamji, Mohammed F.; Nettles, Dana L.; Hwang, Priscilla; Setton, Lori A.

    2009-01-01

    Biodegradable polymeric scaffolds are of interest for delivering antibiotics to local sites of infection in orthopaedic applications, such as bone and diarthrodial joints. The objective of this study was to develop a biodegradable scaffold with ease of drug loading in aqueous solution, while providing for drug depot delivery via syringe injection. Elastin-like polypeptides (ELPs) were used for this application, biopolymers of repeating pentapeptide sequences that were thermally triggered to u...

  7. Control of Adipocyte Differentiation in Different Fat Depots; Implications for Pathophysiology or Therapy

    Directory of Open Access Journals (Sweden)

    Xiuquan eMa

    2015-01-01

    Full Text Available Adipocyte differentiation and its impact on restriction or expansion of particular adipose tissue depots has physiological and pathophysiological significance in view of the different functions of these depots. Brown or beige fat [BAT] expansion can enhance thermogenesis, lipid oxidation, insulin sensitivity and glucose tolerance; conversely expanded visceral fat [VAT] is associated with insulin resistance, low grade inflammation, dyslipidaemia and cardiometabolic risk. The largest depot, subcutaneous white fat [WAT], has important beneficial characteristics including storage of lipid out of harms way and secretion of adipokines, especially leptin and adiponectin, with positive metabolic effects including lipid oxidation, energy utilisation, enhanced insulin action and an anti-inflammatory role. The absence of these functions in lipodystrophies leads to major metabolic disturbances. An ability to expand WAT adipocyte differentiation would seem an important defence mechanism against the detrimental effects of energy excess and limit harmful accumulation of lipid in ectopic sites, such as liver and muscle.Adipocyte differentiation involves a transcriptional cascade with PPARg being most important in WAT but less so in VAT, with increased angiogenesis also critical. The transcription factor, Islet1, is fairly specific to VAT and in vitro inhibits adipocyte differentiation. The physiological importance of Islet1 requires further study. Basic control of differentiation is similar in BAT but important differences include the effect of PGC-1a on mitochondrial biosynthesis and upregulation of UCP1; also PRDM16 plays a pivotal role in expression of the BAT phenotype.Modulation of the capacity or function of these different adipose tissue depots, by altering adipocyte differentiation or other means, holds promise for interventions that can be helpful in human disease, particularly cardiometabolic disorders associated with the world wide explosion of

  8. Evidence for Environmental Contamination in Residential Neighborhoods Surrounding the Defense Depot of Memphis, Tennessee

    Directory of Open Access Journals (Sweden)

    Cynthia Warrick

    2006-09-01

    Full Text Available An interdisciplinary environmental assessment team from the Howard University Environmental Justice Partnership (HUEJP conducted a site visit and assessment of the Defense Depot of Memphis, Tennessee in February of 2000. This depot was built in the late 1940’s for storage of numerous chemicals and munitions. As the years progressed, many Memphis citizens have grown to believe that the activities and chemical stockpile located at this site have negatively affected the health environment of their residents. There is anecdotal evidence and documentation of numerous cancers and other illnesses in those local territories, and specifically, at the Memphis Depot site. Currently, this depot is closed and in remediation by the local government. Particularly, citizens of the Rozelle community have started a campaign to investigate any signs of exposure pathways to noted health risks. The HUEJP was contacted and asked to investigate the community concerns. Obliging to the request, we aimed to sample at three drainage sites and a residential site, talk to local citizens, and gain any additional information that would be helpful in relieving anxiety in the Rozelle community. Soil, sediment, and water samples were collected and analyzed for total organic carbon, inorganic anions, and heavy metals. These data show that for the four sites sampled, the highest concentrations of organic compounds and heavy metals were located either within a residential area or in an area with a direct transport pathway to the community. Atomic absorption analysis revealed detectable amounts of cadmium, lead and chromium metals at all sites with direct transport pathways into the residential community, with chromium concentrations being far in excess of the EPA standard limits.

  9. Employing organizational modeling and simulation of the KC-135 depot's flight controls repair cell

    OpenAIRE

    Paskin, Matthew A.; Trevino, Alice W.; Ferrer, Geraldo; Dillard, John T.

    2008-01-01

    Today’s environment of increased operations tempo is stressing the KC- 135 Stratotanker fleet. With an 80-year life span expectancy, effectively maintaining these aircraft is challenging. This research modeled the KC- 135 programmed depot maintenance (PDM) flight controls repair cell to identify improvement opportunities within the repair process. Computational organizational modeling (COM) incorporates the human element along with organizational design theory. By employing ...

  10. HALF-DOSE DEPOT TRIPTORELIN COMPARABLE TO REDUCED DAILY BUSERELIN: A RANDOMIZED CLINICAL TRIAL

    Directory of Open Access Journals (Sweden)

    L. Safdarian

    2007-09-01

    Full Text Available Pituitary suppression by depot GnRH agonist may be excessive for ovarian stimulation. This study compares the efficacy of a single half-dose depot triptorelin and reduced-dose daily buserelin in a long protocol ICSI/ET. METHODS: A total of 182 patients were randomized into two groups using sealed envelopes. Pituitary desensitization was obtained in group 1 (91 patients with half-dose (1.87 mg depot triptorelin in the mid-luteal phase of their menstrual cycle, and in group 2 (91 patients with standard daily dose (0.5 mg buserelin, which was then reduced to 0.25 mg at the start of human menopausal gonadotropin (HMG stimulation. RESULTS: No significant differences were found among those who received HCG in terms of clinical pregnancy rate (34.4% in both groups, implantation rate (14.8% in group 1 versus 11.1% in group 2, fertilization rate (93.3 versus 95.6%, poor response rate (11.1 versus 6.7%, and miscarriage rate (11.1 versus 7.8%. No significant differences were seen in number of HMG ampoules used, follicles at HCG administration, and oocytes retrieved. The number of days of stimulation was significantly reduced in group 2 (11.2 +/- 1.8 in group 1 versus 10.6 +/- 1.9, p = 0.030. CONCLUSION: A half-dose of depot triptorelin can be successfully used in ovarian stimulation instead of reduced-dose daily buserelin, with more patient comfort and reduced stress and cost of injections.

  11. The relationship between fat depot-specific preadipocyte differentiation and metabolic syndrome in obese women

    Directory of Open Access Journals (Sweden)

    N V Mazurina

    2013-03-01

    Full Text Available Реферат по материалам статьи The relationship between fat depot-specific preadipocyte differentiation and metabolic syndrome in obese women. Park HТ, Lee ES, Cheon EP, Lee DR, Yang K-S, Kim YT, Hur JY, Kim SH, Lee KW, Kim T. Clinical Endocrinology 2012; 76, 59-66.

  12. AUTOMATED DETECTION OF OIL DEPOTS FROM HIGH RESOLUTION IMAGES: A NEW PERSPECTIVE

    Directory of Open Access Journals (Sweden)

    A. O. Ok

    2015-03-01

    Full Text Available This paper presents an original approach to identify oil depots from single high resolution aerial/satellite images in an automated manner. The new approach considers the symmetric nature of circular oil depots, and it computes the radial symmetry in a unique way. An automated thresholding method to focus on circular regions and a new measure to verify circles are proposed. Experiments are performed on six GeoEye-1 test images. Besides, we perform tests on 16 Google Earth images of an industrial test site acquired in a time series manner (between the years 1995 and 2012. The results reveal that our approach is capable of detecting circle objects in very different/difficult images. We computed an overall performance of 95.8% for the GeoEye-1 dataset. The time series investigation reveals that our approach is robust enough to locate oil depots in industrial environments under varying illumination and environmental conditions. The overall performance is computed as 89.4% for the Google Earth dataset, and this result secures the success of our approach compared to a state-of-the-art approach.

  13. Innovation in hydroelectric power plant design in early twentieth century. Casto Fernández-Shaw's Engineering Architecture in La Jándula dam

    Directory of Open Access Journals (Sweden)

    A. B. Berrocal Menárguez

    2017-09-01

    Full Text Available The power plant location in the first hydroelectrial dams was a relevant issue at the end of XIX century and early XX. Different solutions were tried, some of them with very interesting aesthetics results and hydraulic and structural implications. Such is the case of La Jándula dam, inaugurated in 1930, that includes the power station inside the dam. This article examines the possible national and international inspirations of this singular solution, corroborating the hypothesis of its unprecedented nature. The collaboration of the architect Casto Fernández-Shaw in the design and integration of the engine room was decisive, because it achieved a result of an aesthetic quality and formal expressiveness unprecedented in a work of hydraulic engineering, as well as the birth of a style Shaw himself defined as architectural engineering.

  14. Employment-based reinforcement of adherence to depot naltrexone in unemployed opioid-dependent adults: a randomized controlled trial.

    Science.gov (United States)

    Everly, Jeffrey J; DeFulio, Anthony; Koffarnus, Mikhail N; Leoutsakos, Jeannie-Marie S; Donlin, Wendy D; Aklin, Will M; Umbricht, Annie; Fingerhood, Michael; Bigelow, George E; Silverman, Kenneth

    2011-07-01

    Naltrexone can be used to treat opioid dependence, but patients refuse to take it. Extended-release depot formulations may improve adherence, but long-term adherence rates to depot naltrexone are not known. This study determined long-term rates of adherence to depot naltrexone and whether employment-based reinforcement can improve adherence. Participants who were inducted onto oral naltrexone were assigned randomly to contingency (n = 18) or prescription (n = 17) groups. Participants were offered six depot naltrexone injections and invited to work at the therapeutic workplace on week days for 26 weeks, where they earned stipends for participating in job skills training. Contingency participants were required to accept naltrexone injections to maintain workplace access and to maintain maximum pay. Prescription participants could work independently of whether they accepted injections. The therapeutic workplace, a model employment-based intervention for drug addiction and unemployment. Opioid-dependent unemployed adults. Depot naltrexone injections accepted and opiate-negative urine samples. Contingency participants accepted significantly more naltrexone injections than prescription participants (81% versus 42%), and were more likely to accept all injections (66% versus 35%). At monthly assessments (with missing urine samples imputed as positive), the groups provided similar percentages of samples negative for opiates (74% versus 62%) and for cocaine (56% versus 54%). Opiate-positive samples were more likely when samples were also positive for cocaine. Employment-based reinforcement can maintain adherence to depot naltrexone. Future research should determine whether persistent cocaine use compromises naltrexone's effect on opiate use. Workplaces may be useful for promoting sustained adherence to depot naltrexone. © 2011 The Authors, Addiction © 2011 Society for the Study of Addiction.

  15. Investigation and visualization of liquid–liquid flow in a vertically mounted Hele-Shaw cell: flow regimes, velocity and shape of droplets

    International Nuclear Information System (INIS)

    Shad, S; Gates, I D; Maini, B B

    2009-01-01

    The motion and shape of a liquid drop flowing within a continuous, conveying liquid phase in a vertical Hele-Shaw cell were investigated experimentally. The continuous phase was more viscous and wetted the bounding walls of the Hele-Shaw cell. The gap between the Hele-Shaw plates was set equal to 0.0226 cm. Four different flow regimes were observed: (a) small-droplet flow, (b) elongated-droplet flow, (c) churn flow and (d) channel flow. At low capillary number, that is, when capillary forces are larger than viscous forces, the droplet shape was irregular and changed with time and distance, and it moved with lower velocity than that of the conveying phase. At higher capillary number, several different shapes of stabilized elongated and flattened drops were observed. In contrast to gas–liquid systems, the velocities of droplets are higher than that of conveying liquid. New correlations derived from dimensionless analysis and fitted to the experimental data were generated to predict the elongated-drop velocity and aspect ratio

  16. Investigation and visualization of liquid-liquid flow in a vertically mounted Hele-Shaw cell: flow regimes, velocity and shape of droplets

    Science.gov (United States)

    Shad, S.; Gates, I. D.; Maini, B. B.

    2009-11-01

    The motion and shape of a liquid drop flowing within a continuous, conveying liquid phase in a vertical Hele-Shaw cell were investigated experimentally. The continuous phase was more viscous and wetted the bounding walls of the Hele-Shaw cell. The gap between the Hele-Shaw plates was set equal to 0.0226 cm. Four different flow regimes were observed: (a) small-droplet flow, (b) elongated-droplet flow, (c) churn flow and (d) channel flow. At low capillary number, that is, when capillary forces are larger than viscous forces, the droplet shape was irregular and changed with time and distance, and it moved with lower velocity than that of the conveying phase. At higher capillary number, several different shapes of stabilized elongated and flattened drops were observed. In contrast to gas-liquid systems, the velocities of droplets are higher than that of conveying liquid. New correlations derived from dimensionless analysis and fitted to the experimental data were generated to predict the elongated-drop velocity and aspect ratio.

  17. A well-posed numerical method to track isolated conformal map singularities in Hele-Shaw flow

    International Nuclear Information System (INIS)

    Baker, G.; Siegel, M.; Tanveer, S.

    1995-01-01

    We present a new numerical method for calculating an evolving 2D Hele-Shaw interface when surface tension effects are neglected. In the case where the flow is directed from the less viscous fluid into the more viscous fluid, the motion of the interface is ill-posed; small deviations in the initial condition will produce significant changes in the ensuing motion. The situation is disastrous for numerical computation, as small roundoff errors can quickly lead to large inaccuracies in the computed solution. Our method of computation is most easily formulated using a conformal map from the fluid domain into a unit disk. The method relies on analytically continuing the initial data and equations of motion into the region exterior to the disk, where the evolution problem becomes well-posed. The equations are then numerically solved in the extended domain. The presence of singularities in the conformal map outside of the disk introduces specific structures along the fluid interface. Our method can explicitly track the location of isolated pole and branch point singularities, allowing us to draw connections between the development of interfacial patterns and the motion of singularities as they approach the unit disk. In particular, we are able to relate physical features such as finger shape, side-branch formation, and competition between fingers to the nature and location of the singularities. The usefulness of this method in studying the formation of topological singularities (self-intersections of the interface) is also pointed out. 47 refs., 10 figs., 1 tab

  18. Effects of testosterone on contractile properties of sexually dimorphic forelimb muscles in male bullfrogs (Rana catesbeiana, Shaw 1802

    Directory of Open Access Journals (Sweden)

    Aaron R. Kampe

    2013-07-01

    This study examined the effects of testosterone (T on the contractile properties of two sexually dimorphic forelimb muscles and one non-dimorphic muscle in male bullfrogs (Rana catesbeiana, Shaw 1802. The dimorphic muscles in castrated males with testosterone replacement (T+ achieved higher forces and lower fatigability than did castrated males without replaced testosterone (T0 males, but the magnitude of the differences was low and many of the pair-wise comparisons of each muscle property were not statistically significant. However, when taken as a whole, the means of seven contractile properties varied in the directions expected of masculine values in T+ animals in the sexually dimorphic muscles. Moreover, these data, compared with previous data on male and female bullfrogs, show that values for T+ males are similar to normal males and are significantly different from females. The T0 males tended to be intermediate in character between T+ males and females, generally retaining masculine values. This suggests that the exposure of young males to T in their first breeding season produces a masculinizing effect on the sexually dimorphic muscles that is not reversed between breeding seasons when T levels are low. The relatively minor differences in contractile properties between T+ and T0 males may indicate that as circulating T levels rise during breeding season in normal males, contractile properties can be enhanced rapidly to maximal functional levels for breeding success.

  19. Growth-direction dependence of steady-state Saffman-Taylor flow in an anisotropic Hele-Shaw cell

    International Nuclear Information System (INIS)

    McCloud, K.V.; Maher, J.V.

    1996-01-01

    Selection of steady-state fingers has been measured in a Hele-Shaw cell perturbed by having a square lattice etched onto one of the plates. Flows at different orientations θ between the direction of flow and the lattice axes have been studied, in a wide range of observable tip velocities where the perturbation was made microscopic in the sense that the capillary length of the flow was much greater than the etched lattice cell size. The full range of dynamically interesting angles for the square lattice was examined, and above a threshold, the microscopic perturbation always results in wider fingers than are selected in the unperturbed case. There is some dependence of the width of the fingers on the orientation of the flow, with fingers at θ=0 degree being the widest with respect to the unperturbed fingers, and fingers at 45 degree being the least wide, although still wider than the unperturbed fingers. All observed solutions are symmetric, centered in the channel, and have the relation between tip-curvature and finger width expected of members of the Saffman-Taylor family of solutions. Selected solutions narrow again at tip velocities where the perturbation can no longer be considered microscopic. copyright 1996 The American Physical Society

  20. Growth of fingers at an unstable diffusing interface in a porous medium or hele-shaw cell

    Energy Technology Data Exchange (ETDEWEB)

    Wooding, R A

    1969-11-27

    Waves at an unstable horizontal interface, between 2 fluids moving vertically through a saturated porous medium, are observed to grow rapidly to become fingers (i.e., the amplitude greatly exceeds the wavelength). For a diffusing interface, in experiments using a Hele-Shaw cell, the mean amplitude taken over many fingers grows approx. as (time)U2D, followed by a transition to a growth proportional to time. Correspondingly, the mean wave number decreases approx. as (time)U-1/2D. Because of the rapid increase in amplitude, longitudinal dispersion ultimately becomes negligible relative to wave growth. To represent the observed quantities at large time, the transport equation is suitably weighted and averaged over the horizontal plane. Hyperbolic equations result, and the ascending and descending zones containing the fronts of the fingers are replaced by discontinuities. These averaged equations form an open set, but closure is achieved by assuming a law for the mean wave number based on similarity. (22 refs.)

  1. Six-month gonadotropin releasing hormone (GnRH agonist depots provide efficacy, safety, convenience, and comfort

    Directory of Open Access Journals (Sweden)

    Phillips JM

    2011-07-01

    Full Text Available E David Crawford, Jason M PhillipsUniversity of Colorado Health Sciences Center, Aurora, CO, USAAbstract: Two different 6-month GnRH agonist depot formulations approved for palliative treatment of advanced and metastatic prostate cancer in the United States – leuprolide acetate 45 mg and triptorelinpalmoate 22.5 mg – provide patients with efficacy and safety comparable to those of existing 1-, 3-, and 4-month GnRH agonist depots. However, the 6-month formulations can increase patient convenience, comfort, and compliance by reducing the number of physician visits and injections required. At the conclusion of their pivotal trials, the 6-month formulations demonstrated efficacy rates in achieving chemical castration (serum testosterone #50 ng/dL that ranged between 93% and 99%. As with existing GnRH agonist depot formulations, hot flashes represented the most common adverse event reported in trials of 6-month leuprolide acetate or triptorelin. As such, these products may prove useful not only for their labeled indication, but also as adjuncts to other treatments such as radical prostatectomy, radiotherapy, and chemotherapy. We recommend further research, including head-to-head trials between the 6-month GnRH depots, to refine our understanding of these products.Keywords: prostate cancer, leuprorelin, leuprolide, triptorelin, 6-month depot, testosterone

  2. Paleomagnetic intensity of Aso pyroclastic flows: Additional results with LTD-DHT Shaw method, Thellier method with pTRM-tail check

    Science.gov (United States)

    Maruuchi, T.; Shibuya, H.

    2009-12-01

    For the sake to calibrate the absolute value of the ’relative paleointensity variation curve’ drawn from sediment cores, Takai et al. (2002) proposed to use pyroclastic flows co-bearing with wide spread tephras. The pyroclastic flows prepare volcanic rocks with TRM, which let us determine absolute paleointensity, and the tephras prepare the correlation with sediment stratigraphy. While 4 out of 6 pyroclastic flows are consistent with Sint-800 paleointensity variation curve, two flows, Aso-2 and Aso-4, show weaker and stronger than Sint-800 beyond the error, respectively. We revisited the paleointensity study of Aso pyroclastic flows, adding LTD- DHT Shaw method, the pTRM-tail check in Thellier experiment, and LTD-DHT Shaw method by using volcanic glasses. We prepared 11 specimens from 3 sites of Aso-1 welded tuff for LTD-DHT Shaw method experiments, and obtained 6 paleointensities satisfied a set of strict criteria. They yield an average paleointensity of 21.3±5.8uT, which is smaller than 31.0±3.4uT provided by Takai et al. (2002). For Aso-2 welded tuff, 11 samples from 3 sites were submitted to Thellier experiments, and 6 passed a set of pretty stringent criteria including pTRM-tail check, which is not performed by Takai et al. (2002). They give an average paleointensity of 20.2±1.5uT, which is virtually identical to 20.2±1.0uT (27 samples) given by Takai et al. (2002). Although the success rate was not good in LTD-DHT Shaw method, 2 out of 12 specimens passed the criteria, and gave 25.8±3.4uT, which is consistent with Takai et al. (2002). In addition, we obtained a reliable paleointensity from a volcanic glass in LTD-DHT Shaw method, it gives a paleointensity of 23.6 uT. It is also consitent with Takai et al. (2002). For Aso-3 welded tuff, we performed only LTD-DHT Shaw method for one specimen from one site yet. It gives a paleointensity of 43.0uT, which is higher than 31.8±3.6uT given by Takai et al. (2002). Eight sites were set for Aso-4 welded tuff

  3. Eradicating hepatitis C virus ameliorates insulin resistance without change in adipose depots.

    Science.gov (United States)

    Milner, K-L; Jenkins, A B; Trenell, M; Tid-Ang, J; Samocha-Bonet, D; Weltman, M; Xu, A; George, J; Chisholm, D J

    2014-05-01

    Chronic hepatitis C (CHC) is associated with lipid-related changes and insulin resistance; the latter predicts response to antiviral therapy, liver disease progression and the risk of diabetes. We sought to determine whether insulin sensitivity improves following CHC viral eradication after antiviral therapy and whether this is accompanied by changes in fat depots or adipokine levels. We compared 8 normoglycaemic men with CHC (genotype 1 or 3) before and at least 6 months post viral eradication and 15 hepatitis C antibody negative controls using an intravenous glucose tolerance test and two-step hyperinsulinaemic-euglycaemic clamp with [6,6-(2) H2 ] glucose to assess peripheral and hepatic insulin sensitivity. Magnetic resonance imaging and spectroscopy quantified abdominal fat compartments, liver and intramyocellular lipid. Peripheral insulin sensitivity improved (glucose infusion rate during high-dose insulin increased from 10.1 ± 1.6 to 12 ± 2.1 mg/kg/min/, P = 0.025), with no change in hepatic insulin response following successful viral eradication, without any accompanying change in muscle, liver or abdominal fat depots. There was corresponding improvement in incremental glycaemic response to intravenous glucose (pretreatment: 62.1 ± 8.3 vs post-treatment: 56.1 ± 8.5 mm, P = 0.008). Insulin sensitivity after viral clearance was comparable to matched controls without CHC. Post therapy, liver enzyme levels decreased but, interestingly, levels of glucagon, fatty acid-binding protein and lipocalin-2 remained elevated. Eradication of the hepatitis C virus improves insulin sensitivity without alteration in fat depots, adipokine or glucagon levels, consistent with a direct link of the virus with insulin resistance. © 2013 John Wiley & Sons Ltd.

  4. The nuclear retinoid-related orphan receptor RORα controls circadian thermogenic programming in white fat depots.

    Science.gov (United States)

    Monnier, Chloé; Auclair, Martine; Le Cam, Gala; Garcia, Marie-Pauline; Antoine, Bénédicte

    2018-04-01

    The RORα-deficient staggerer (sg/sg) mouse is lean and resistant to diet-induced obesity. Its thermogenic activity was shown to be increased not only in brown adipose tissue (BAT), but also in subcutaneous white adipose tissue (WAT) where UCP1 content was enhanced, however, without Prdm16 coexpression. Our observation of partial multilocular lipid morphology of WAT in sg/sg mice both in the inguinal and perigonadal sites led us to focus on the phenotype of both fat depots. Because RORα is a nuclear factor acting in the clock machinery, we looked at the circadian expression profile of genes involved in thermogenesis and browning in WAT and BAT depots of sg/sg and WT mice, through real-time quantitative PCR and western blotting. This 24-h period approach revealed both a rhythmic expression of thermogenic genes in WAT and an increased browning of all the WAT depots tested in sg/sg mice that indeed involved the canonical browning process (through induction of Pgc-1α and Prdm16). This was associated with an enhanced isoproterenol-induced oxygen consumption rate of WAT explants from sg/sg mice, which was reproducible in WT explants by treatment with a RORα inverse agonist SR 3335, that induced a parallel increase in the UCP1 protein. Inhibitors of browning differentiation, such as TLE3 and RIP140, could be new targets of RORα that would be rather implicated in the whitening of adipocytes. Our study showed the pivotal role of RORα as an inhibitor of the thermogenic program in WAT, the role that could be counteracted in vivo with the RORα antagonists currently in development. © 2018 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of The Physiological Society and the American Physiological Society.

  5. Abdominal fat sub-depots and energy expenditure: Magnetic resonance imaging study.

    Science.gov (United States)

    Serfaty, Dana; Rein, Michal; Schwarzfuchs, Dan; Shelef, Ilan; Gepner, Yftach; Bril, Nitzan; Cohen, Noa; Shemesh, Elad; Sarusi, Benjamin; Kovsan, Julia; Kenigsbuch, Shira; Chassidim, Yoash; Golan, Rachel; Witkow, Shula; Henkin, Yaakov; Stampfer, Meir J; Rudich, Assaf; Shai, Iris

    2017-06-01

    We aimed to assess the association between the distinct abdominal sub-depots and resting energy expenditure (REE). We performed magnetic resonance imaging (MRI) to quantify abdominal visceral-adipose-tissue (VAT), deep-subcutaneous-adipose-tissue (deep-SAT), and superficial-subcutaneous-adipose-tissue (superficial-SAT). We measured REE by indirect-calorimetry. Non-exercise activity thermogenesis (NEAT) [1-3 metabolic equivalents (METs)] and exercise thermogenesis (activities of 4+MET S ) were estimated based on 6-days of accelerometry to assess total physical activity energy expenditure (PAEE). We studied 282 participants: 249 men [mean age = 47.4 years, body-mass-index (BMI) = 31 kg/m 2 , mean VAT proportion from total abdominal fat = 34.5%, mean superficial-SAT proportion from total abdominal fat = 24.3%] and 33 women (mean age = 51.2 years, BMI = 30.1 kg/m 2 , mean VAT proportion from total abdominal fat = 22.8%, mean superficial-SAT proportion from total abdominal fat = 37.8%). As expected, women had lower REE [by 32.4% (1488 ± 234 kcal/day vs. 1971 ± 257 kcal/day; p abdominal VAT was the dominant proportional depot, had higher REE (1964 ± 297 kcal/day vs. 1654 ± 352 kcal/day; p Abdominal fat distribution patterns are associated with varying levels of resting energy expenditure, potentially reflecting different metabolic rates of adipose sub-depots and providing an anatomic/anthropometric link to physiological obese sub-phenotypes. Copyright © 2016 Elsevier Ltd and European Society for Clinical Nutrition and Metabolism. All rights reserved.

  6. Direct Evidence of Brown Adipocytes in Different Fat Depots in Children

    Science.gov (United States)

    Rockstroh, Denise; Landgraf, Kathrin; Wagner, Isabel Viola; Gesing, Julia; Tauscher, Roy; Lakowa, Nicole; Kiess, Wieland; Bühligen, Ulf; Wojan, Magdalena; Till, Holger; Blüher, Matthias; Körner, Antje

    2015-01-01

    Recent studies suggested the persistence of brown adipocytes in adult humans, as opposed to being exclusively present in infancy. In this study, we investigated the presence of brown-like adipocytes in adipose tissue (AT) samples of children and adolescents aged 0 to 18 years and evaluated the association with age, location, and obesity. For this, we analysed AT samples from 131 children and 23 adults by histological, immunohistochemical and expression analyses. We detected brown-like and UCP1 positive adipocytes in 10.3% of 87 lean children (aged 0.3 to 10.7 years) and in one overweight infant, whereas we did not find brown adipocytes in obese children or adults. In our samples, the brown-like adipocytes were interspersed within white AT of perirenal, visceral and also subcutaneous depots. Samples with brown-like adipocytes showed an increased expression of UCP1 (>200fold), PRDM16 (2.8fold), PGC1α and CIDEA while other brown/beige selective markers, such as PAT2, P2RX5, ZIC1, LHX8, TMEM26, HOXC9 and TBX1 were not significantly different between UCP1 positive and negative samples. We identified a positive correlation between UCP1 and PRDM16 within UCP1 positive samples, but not with any other brown/beige marker. In addition, we observed significantly increased PRDM16 and PAT2 expression in subcutaneous and visceral AT samples with high UCP1 expression in adults. Our data indicate that brown-like adipocytes are present well beyond infancy in subcutaneous depots of non-obese children. The presence was not restricted to typical perirenal locations, but they were also interspersed within WAT of visceral and subcutaneous depots. PMID:25706927

  7. Army Depot Maintenance: More Effective Use of Organic and Contractor Resources

    Science.gov (United States)

    1990-06-04

    terkerrny (PA) RRAD Red River (TX) IBAD Lexingtor).Bluegrass (KY) 3MPUAD Pueblo (CO) 2000 ANAD CCAD TEAD TOAD SAAO LEAD FMD LBAD PUAfl j] Aut)’onzed Onboard...until it is received by the contractor. That problem could be eliminated by redesigning the process. Specifically, the FTA document that notifies the...should revise CCSS to allow the FTM document to generate an image to LCA, the FTA to create a due-in to the contractor, and CCSS to determine the depot

  8. Combined use of Dexa-Scheroson and Primobolan-Depot in radiation therapy

    Energy Technology Data Exchange (ETDEWEB)

    Nagai, J [Shizuoka Rosai Hospital (Japan)

    1976-05-01

    Dexa-Scheroson and Primobolan-Depot were used together with radiation therapy (Linac therapy) required in 13 cases. The following results were obtained. The decrease in white cell counts, which often occurs in radiation therapy, was inhibited by the drugs. There was no case in which radiation therapy should necessarily withdraw because the number of leuckocytes was decreased to less than 3,000. The patients whose liver function was poor should be treated with both drugs at the beginning of radiation therapy. It was found that the combined use of the drugs is effective in the prevention and the treatment of cerebral edema in radiation therapy of intracranial lesion.

  9. KANDUNGAN Pb, Cd, Hg DALAM AIR MINUM DARI DEPOT AIR MINUM ISI ULANG DI JAKARTA, TANGERANG, DAN BEKASI

    Directory of Open Access Journals (Sweden)

    Athena Athena

    2012-11-01

    Full Text Available A study on chemical quality of drinking water from reffil depots was done in Jakarta, Tangerang, and Bekasi in 2003 to determine the contents of heavy metals such as lead (Pb, cadmium, (Cd, and Mercury (Hg. A total of 38 refill depots was selected as samples. Data were collected by water sampling collection and water analysis, and interview with operators and association personal using questionairs. Water samples were analyzed using Atomic Absorption Spectrophotometer (AAS to examine the contents of their heavy metals based on raw water and drinking water standards. The results showed that the treatment processed were filtration and disinfection. However, the contents of heavy metals in the two types of water samples still complied with the standards stated in Health Ministerial Decree no 906 in the year 2002.   Keywords: heavy metals, drinking water, drinking water refill depots

  10. PART I: Bioventing Pilot Test Work Plan for Fire Protection Training Area Site FY-03, Charleston AFB, South Carolina. PART II: Draft Interim Pilot Test Results Report for Fire Protection Training Area Site FT-03, Charleston AFB, South Carolina

    National Research Council Canada - National Science Library

    1993-01-01

    This site-specific work plan presents the scope of a bioventing pilot test for in situ treatment of fuel contaminated soils at the Fire Protection Training Area designated as Site FT-O3, Charleston Air Force Base (AFB), South Carolina...

  11. Elucidation of molecular mechanisms of physiological variations between bovine subcutaneous and visceral fat depots under different nutritional regimes.

    Directory of Open Access Journals (Sweden)

    Josue Moura Romao

    Full Text Available Adipose tissue plays a critical role in energy homeostasis and metabolism. There is sparse understanding of the molecular regulation at the protein level of bovine adipose tissues, especially within different fat depots under different nutritional regimes. The objective of this study was to analyze the differences in protein expression between bovine subcutaneous and visceral fat depots in steers fed different diets and to identify the potential regulatory molecular mechanisms of protein expression. Subcutaneous and visceral fat tissues were collected from 16 British-continental steers (15.5 month old fed a high-fat diet (7.1% fat, n=8 or a control diet (2.7% fat, n=8. Protein expression was profiled using label free quantification LC-MS/MS and expression of selected transcripts was evaluated using qRT-PCR. A total of 682 proteins were characterized and quantified with fat depot having more impact on protein expression, altering the level of 51.0% of the detected proteins, whereas diet affected only 5.3%. Functional analysis revealed that energy production and lipid metabolism were among the main functions associated with differentially expressed proteins between fat depots, with visceral fat being more metabolically active than subcutaneous fat as proteins associated with lipid and energy metabolism were upregulated. The expression of several proteins was significantly correlated to subcutaneous fat thickness and adipocyte size, indicating their potential as adiposity markers. A poor correlation (r=0.245 was observed between mRNA and protein levels for 9 genes, indicating that many proteins may be subjected to post-transcriptional regulation. A total of 8 miRNAs were predicted to regulate more than 20% of lipid metabolism proteins differentially expressed between fat depots, suggesting that miRNAs play a role in adipose tissue regulation. Our results show that proteomic changes support the distinct metabolic and physiological characteristics

  12. Elucidation of molecular mechanisms of physiological variations between bovine subcutaneous and visceral fat depots under different nutritional regimes.

    Science.gov (United States)

    Romao, Josue Moura; Jin, Weiwu; He, Maolong; McAllister, Tim; Guan, Le Luo

    2013-01-01

    Adipose tissue plays a critical role in energy homeostasis and metabolism. There is sparse understanding of the molecular regulation at the protein level of bovine adipose tissues, especially within different fat depots under different nutritional regimes. The objective of this study was to analyze the differences in protein expression between bovine subcutaneous and visceral fat depots in steers fed different diets and to identify the potential regulatory molecular mechanisms of protein expression. Subcutaneous and visceral fat tissues were collected from 16 British-continental steers (15.5 month old) fed a high-fat diet (7.1% fat, n=8) or a control diet (2.7% fat, n=8). Protein expression was profiled using label free quantification LC-MS/MS and expression of selected transcripts was evaluated using qRT-PCR. A total of 682 proteins were characterized and quantified with fat depot having more impact on protein expression, altering the level of 51.0% of the detected proteins, whereas diet affected only 5.3%. Functional analysis revealed that energy production and lipid metabolism were among the main functions associated with differentially expressed proteins between fat depots, with visceral fat being more metabolically active than subcutaneous fat as proteins associated with lipid and energy metabolism were upregulated. The expression of several proteins was significantly correlated to subcutaneous fat thickness and adipocyte size, indicating their potential as adiposity markers. A poor correlation (r=0.245) was observed between mRNA and protein levels for 9 genes, indicating that many proteins may be subjected to post-transcriptional regulation. A total of 8 miRNAs were predicted to regulate more than 20% of lipid metabolism proteins differentially expressed between fat depots, suggesting that miRNAs play a role in adipose tissue regulation. Our results show that proteomic changes support the distinct metabolic and physiological characteristics observed between

  13. A constructive heuristic for time-dependent multi-depot vehicle routing problem with time-windows and heterogeneous fleet

    Directory of Open Access Journals (Sweden)

    Behrouz Afshar-Nadjafi

    2017-01-01

    Full Text Available In this paper, we consider the time-dependent multi-depot vehicle routing problem. The objective is to minimize the total heterogeneous fleet cost assuming that the travel time between locations depends on the departure time. Also, hard time window constraints for the customers and limitation on maximum number of the vehicles in depots must be satisfied. The problem is formulated as a mixed integer programming model. A constructive heuristic procedure is proposed for the problem. Also, the efficiency of the proposed algorithm is evaluated on 180 test problems. The obtained computational results indicate that the procedure is capable to obtain a satisfying solution.

  14. Design of Hybrid Gels Based on Gellan-Cholesterol Derivative and P90G Liposomes for Drug Depot Applications

    Directory of Open Access Journals (Sweden)

    Nicole Zoratto

    2017-05-01

    Full Text Available Gels are extensively studied in the drug delivery field because of their potential benefits in therapeutics. Depot gel systems fall in this area, and the interest in their development has been focused on long-lasting, biocompatible, and resorbable delivery devices. The present work describes a new class of hybrid gels that stem from the interaction between liposomes based on P90G phospholipid and the cholesterol derivative of the polysaccharide gellan. The mechanical properties of these gels and the delivery profiles of the anti-inflammatory model drug diclofenac embedded in such systems confirmed the suitability of these hybrid gels as a good candidate for drug depot applications.

  15. Phytochemical screening, total phenolics and antioxidant activities of bark and leaf extracts of Goniothalamus velutinus (Airy Shaw from Brunei Darussalam

    Directory of Open Access Journals (Sweden)

    Erum Iqbal

    2015-07-01

    Full Text Available Goniothalamus velutinus Airy Shaw belongs to the family Annonaceae which is known to have anticancer, antitumor and many other bioactivities. Natives of Sabah and Sarawak use root decoction of G. velutinus for the treatment of headache and food poisoning while the bark was used as a mosquito repellent. Bark and leaf extracts of this plant, obtained from Brunei Darussalam, were tested for phytochemical and antioxidant activities. Phytochemical screening of plant extracts revealed the presence of alkaloids, steroids, terpenoids and cardiac glycosides. Quantitative determination of total phenolics, total flavonoids, and various in vitro antioxidant activities (DPPH, ABTS and FRAP of methanolic extract was carried out using colorimetric methods. The total phenolic content, expressed as mg of gallic acid equivalent (GAE per gram of extract, was found to be 68 mg GAE/g and 78 mg GAE/g for bark and leaves respectively. The radical scavenging activity measurement, expressed in terms of EC50 (effective concentration of extract in μg/mL that reduces DPPH absorbance to 50% as compared to negative control, for leaf and bark extracts was found to be 155 μg/mL and 204 μg/mL respectively. Standards trolox and ascorbic acid show EC50 value of 5 μg/mL and 4 μg/mL respectively. Trolox equivalent antioxidant capacity (TEAC was measured using the ABTS and FRAP method. Result for bark and leaf extracts was 79 mg and 106 mg trolox equivalent (TE/g respectively for the ABTS method. For FRAP assay, results for bark and leaf extracts were 80 and 89 mg TE/g respectively.

  16. Insulin, IGF-1, and GH Receptors Are Altered in an Adipose Tissue Depot-Specific Manner in Male Mice With Modified GH Action.

    Science.gov (United States)

    Hjortebjerg, Rikke; Berryman, Darlene E; Comisford, Ross; Frank, Stuart J; List, Edward O; Bjerre, Mette; Frystyk, Jan; Kopchick, John J

    2017-05-01

    Growth hormone (GH) is a determinant of glucose homeostasis and adipose tissue (AT) function. Using 7-month-old transgenic mice expressing the bovine growth hormone (bGH) gene and growth hormone receptor knockout (GHR-/-) mice, we examined whether changes in GH action affect glucose, insulin, and pyruvate tolerance and AT expression of proteins involved in the interrelated signaling pathways of GH, insulinlike growth factor 1 (IGF-1), and insulin. Furthermore, we searched for AT depot-specific differences in control mice. Glycated hemoglobin levels were reduced in bGH and GHR-/- mice, and bGH mice displayed impaired gluconeogenesis as judged by pyruvate tolerance testing. Serum IGF-1 was elevated by 90% in bGH mice, whereas IGF-1 and insulin were reduced by 97% and 61% in GHR-/- mice, respectively. Igf1 RNA was increased in subcutaneous, epididymal, retroperitoneal, and brown adipose tissue (BAT) depots in bGH mice (mean increase ± standard error of the mean in all five depots, 153% ± 27%) and decreased in all depots in GHR-/- mice (mean decrease, 62% ± 4%). IGF-1 receptor expression was decreased in all AT depots of bGH mice (mean decrease, 49% ± 6%) and increased in all AT depots of GHR-/- mice (mean increase, 94% ± 8%). Insulin receptor expression was reduced in retroperitoneal, mesenteric, and BAT depots in bGH mice (mean decrease in all depots, 56% ± 4%) and augmented in subcutaneous, retroperitoneal, mesenteric, and BAT depots in GHR-/- mice (mean increase: 51% ± 1%). Collectively, our findings indicate a role for GH in influencing hormone signaling in AT in a depot-dependent manner. Copyright © 2017 Endocrine Society.

  17. A tabu-search heuristic for solving the multi-depot vehicle scheduling problem

    Directory of Open Access Journals (Sweden)

    Gilmar D'Agostini Oliveira Casalinho

    2014-08-01

    Full Text Available Currently the logistical problems are relying quite significantly on Operational Research in order to achieve greater efficiency in their operations. Among the problems related to the vehicles scheduling in a logistics system, the Multiple Depot Vehicle Scheduling Problem (MDVSP has been addressed in several studies. The MDVSP presupposes the existence of depots that affect the planning of sequences to which travel must be performed. Often, exact methods cannot solve large instances encountered in practice and in order to take them into account, several heuristic approaches are being developed. The aim of this study was thus to solve the MDVSP using a meta-heuristic based on tabu-search method. The main motivation for this work came from the indication that only recently the use of meta-heuristics is being applied to MDVSP context (Pepin et al. 2008 and, also, the limitations listed by Rohde (2008 in his study, which used the branch-and-bound in one of the steps of the heuristic presented to solve the problem, which has increased the time resolution. The research method for solving this problem was based on adaptations of traditional techniques of Operational Research, and provided resolutions presenting very competitive results for the MDVSP such as the cost of the objective function, number of vehicles used and computational time.

  18. Performance of clustering techniques for solving multi depot vehicle routing problem

    Directory of Open Access Journals (Sweden)

    Eliana M. Toro-Ocampo

    2016-01-01

    Full Text Available The vehicle routing problem considering multiple depots is classified as NP-hard. MDVRP determines simultaneously the routes of a set of vehicles and aims to meet a set of clients with a known demand. The objective function of the problem is to minimize the total distance traveled by the routes given that all customers must be served considering capacity constraints in depots and vehicles. This paper presents a hybrid methodology that combines agglomerative clustering techniques to generate initial solutions with an iterated local search algorithm (ILS to solve the problem. Although previous studies clustering methods have been proposed like strategies to generate initial solutions, in this work the search is intensified on the information generated after applying the clustering technique. Besides an extensive analysis on the performance of techniques, and their effect in the final solution is performed. The operation of the proposed methodology is feasible and effective to solve the problem regarding the quality of the answers and computational times obtained on request evaluated literature

  19. Relationships between rodent white adipose fat pads and human white adipose fat depots

    Directory of Open Access Journals (Sweden)

    Daniella E. Chusyd

    2016-04-01

    Full Text Available The objective of this review was to compare and contrast the physiological and metabolic profiles of rodent white adipose fat pads with white adipose fat depots in humans. Human fat distribution and its metabolic consequences have received extensive attention, but much of what has been tested in translational research has relied heavily on rodents. Unfortunately, the validity of using rodent fat pads as a model of human adiposity has received less attention. There is a surprisingly lack of studies demonstrating an analogous relationship between rodent and human adiposity on obesity-related comorbidities. Therefore, we aimed to compare known similarities and disparities in terms of white adipose tissue development and distribution, sexual dimorphism, weight loss, adipokine secretion, and aging. While the literature supports the notion that many similarities exist between rodents and humans, notable differences emerge related to fat deposition and function of white adipose tissue. Thus, further research is warranted to more carefully define the strengths and limitations of rodent white adipose tissue as a model for humans, with a particular emphasis on comparable fat depots, such as mesenteric fat.

  20. Feasibility study on reduction of gasoline emissions from oil depots and gasoline stations in Indonesia

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2001-03-01

    A field survey was conducted of oil shipment depots in Java and Bali islands owned by Indonesia's state-run oil company to study measures for reduction in greenhouse effect gas emissions. Studies were made on the grasp of the amount of the hydrocarbon vapor emitted into the air, the amount of the gasoline recovered in case of adopting the vapor emission preventive technology, equipment cost/operational cost, etc. Concretely, the following three were studied: change of the gasoline storage tank to the inner floating roof type, and prevention of evaporation loss at the time of receiving and breathing loss caused by temperature changes; replacement with the vapor recovery type loading arm to recover gasoline vapor generated at the time of shipment/filling, and installation of the vapor recovery unit to recover vapor as gasoline; vapor balance system to recover in underground tank the gasoline vapor generated at the time of filling gasoline at gas station. As a result of the study, the recovered gasoline amount was 66,393 Kl/y and the CO2 reduction amount was 14,474 t/y at oil shipment depots and approximately 650 gasoline stations in Jakarta and Surabaya. (NEDO)

  1. [A preliminary study of low dosage zuclopenthixol depot in Alzheimer's disease].

    Science.gov (United States)

    Robles, A; Rodríguez Navarrete, F J; Taboada, O; Docasar, L; Páramo, M; Noya, M

    1996-03-01

    Persistent psychomotor agitation and psychotic ideation in patients with Alzheimer's disease are normally treated orally with antipsychotic drugs and are occasionally treated with other drugs. Neuroleptics administered intramuscularly at very low doses are an alternative, especially when the patient rejects medicine as a results of his or her anosognosia or of paranoid manifestations. We present the results we obtained after observing the effects of depot zuclopenthixol in six patients with probable Alzheimer's disease (based upon NINCDS-ADRDA criteria). Psychic abnormalities were assessed as per the Brief Psychiatric Rating Scale (BPRS), the Scale for the Assessment of Positive Symptoms (SAPS) and the Scale for the Assessment of Negative Symptoms (SANS). Possible extrapyramidal side effects were evaluated by means of the Abnormal Involuntary Movement Scale (AIMS). Initially 60 mg (0.3 ml) were administered intramuscularly and successive doses could be modified by +/-20 mg (0.1 ml) according to results seen on the various scales. During the first six weeks of treatment progressive improvement was noted on all three psychic functions scales in all patients. Between the sixth and twelfth weeks improvement continued although without significant change. The AIMS did not show significant changes in the twelve weeks of follow-up. We consider depot zuclopenthixol at low doses as efficacious in treating persistent psychomotor agitation and/or psychotic manifestations of Alzheimer's disease. No undesired side effects were observed in our group after a twelve week follow-up.

  2. A two-stage approach to the depot shunting driver assignment problem with workload balance considerations.

    Science.gov (United States)

    Wang, Jiaxi; Gronalt, Manfred; Sun, Yan

    2017-01-01

    Due to its environmentally sustainable and energy-saving characteristics, railway transportation nowadays plays a fundamental role in delivering passengers and goods. Emerged in the area of transportation planning, the crew (workforce) sizing problem and the crew scheduling problem have been attached great importance by the railway industry and the scientific community. In this paper, we aim to solve the two problems by proposing a novel two-stage optimization approach in the context of the electric multiple units (EMU) depot shunting driver assignment problem. Given a predefined depot shunting schedule, the first stage of the approach focuses on determining an optimal size of shunting drivers. While the second stage is formulated as a bi-objective optimization model, in which we comprehensively consider the objectives of minimizing the total walking distance and maximizing the workload balance. Then we combine the normalized normal constraint method with a modified Pareto filter algorithm to obtain Pareto solutions for the bi-objective optimization problem. Furthermore, we conduct a series of numerical experiments to demonstrate the proposed approach. Based on the computational results, the regression analysis yield a driver size predictor and the sensitivity analysis give some interesting insights that are useful for decision makers.

  3. A two-stage approach to the depot shunting driver assignment problem with workload balance considerations.

    Directory of Open Access Journals (Sweden)

    Jiaxi Wang

    Full Text Available Due to its environmentally sustainable and energy-saving characteristics, railway transportation nowadays plays a fundamental role in delivering passengers and goods. Emerged in the area of transportation planning, the crew (workforce sizing problem and the crew scheduling problem have been attached great importance by the railway industry and the scientific community. In this paper, we aim to solve the two problems by proposing a novel two-stage optimization approach in the context of the electric multiple units (EMU depot shunting driver assignment problem. Given a predefined depot shunting schedule, the first stage of the approach focuses on determining an optimal size of shunting drivers. While the second stage is formulated as a bi-objective optimization model, in which we comprehensively consider the objectives of minimizing the total walking distance and maximizing the workload balance. Then we combine the normalized normal constraint method with a modified Pareto filter algorithm to obtain Pareto solutions for the bi-objective optimization problem. Furthermore, we conduct a series of numerical experiments to demonstrate the proposed approach. Based on the computational results, the regression analysis yield a driver size predictor and the sensitivity analysis give some interesting insights that are useful for decision makers.

  4. The disposal of low and intermediate-level radioactive wastes: the Elstow Storage Depot

    International Nuclear Information System (INIS)

    1983-10-01

    This document explains the role of NIREX (Nuclear Industry Radioactive Waste Executive) in planning for the safe disposal of low and intermediate-level radioactive wastes and outlines the plans for the investigation and possible development of a new shallow repository at the CEGB's Elstow Storage Depot, Bedfordshire. The site is conveniently located and is situated on a suitable geologic formation, the Oxford Clay. The next step is for NIREX to undertake site investigations and assess in detail the site's suitability. On the basis of this assessment NIREX will either confirm its interest in the site or reject it as unsuitable. If the site proves to be adequate for the development of a shallow repository then NIREX will seek the necessary planning approvals and authorisations for such a development. The development would involve the construction of new buildings and a programme of trench excavation, waste positioning and trench closure. Existing tenants at the Depot will be accommodated as far as possible. The existing road and rail networks would be used for delivering the packaged wastes. In designing and operating any repository the safety of the public and workforce, both now and in the future, will be of paramount importance. (author)

  5. The multi-depot electric vehicle location routing problem with time windows

    Directory of Open Access Journals (Sweden)

    Juan Camilo Paz

    2018-01-01

    Full Text Available In this paper, the Multi-Depot Electric Vehicle Location Routing Problem with Time Windows (MDVLRP is addressed. This problem is an extension of the MDVLRP, where electric vehicles are used instead of internal combustion engine vehicles. The recent development of this model is explained by the advantages of this technology, such as the diminution of carbon dioxide emissions, and the support that they can provide to the design of the logistic and energy-support structure of electric vehicle fleets. There are many models that extend the classical VRP model to take electric vehicles into consideration, but the multi-depot case for location-routing models has not been worked out yet. Moreover, we consider the availability of two energy supply technologies: the “Plug-in” Conventional Charge technology, and Battery Swapping Stations; options in which the recharging time is a function of the amount of energy to charge and a fixed time, respectively. Three models are proposed: one for each of the technologies mentioned above, and another in which both options are taken in consideration. The models were solved for small scale instances using C++ and Cplex 12.5. The results show that the models can be used to design logistic and energy-support structures, and compare the performance of the different options of energy supply, as well as measure the impact of these decisions on the overall distance traveled or other optimization objectives that could be worked on in the future.

  6. Eielson AFB, Alaska. Revised Uniform Summary of Surface Weather Observations (RUSSWO). Parts A-F.

    Science.gov (United States)

    1983-07-22

    PERCENTACE FREQUENCY Of WIND DIRECTION AND SPEED (FROM HOURLY OBSERVATIONS) 7- 2650 EIELSON AF6 AK 73-8? *pp ALL WEATHER ISO -1 700 (KNEED I .3 4.6 7. 10...HOURLY OBSERVATIONS) 7 265C EIELSON AFB AX 73-82 DEC mn~y.. .y.rm,Io u ii. n~lu Sr.m ALL kEATHER ISO -1700 CLAm -- IL.S T.) SPEED i( MEA (KNTS) 1 - 3...fis r, i- &hS.2? q i- 7 &S2 kL%- &.S-2. fq 7Sf..7:p U8000 7Z.1 73. 73. 73. 73. ?6 73. 73. 38?8le 73.8 73.8 73.8 73.81 73., 27000 ’ ,i. L.bi~2~~ 800 I 8t

  7. A Multi-Depot Two-Echelon Vehicle Routing Problem with Delivery Options Arising in the Last Mile Distribution

    NARCIS (Netherlands)

    Zhou, Lin; Baldacci, Roberto; Vigo, Daniele; Wang, Xu

    2018-01-01

    In this paper, we introduce a new city logistics problem arising in the last mile distribution of e-commerce. The problem involves two levels of routing problems. The first requires a design of the routes for a vehicle fleet located at the depots to transport the customer demands to a subset of the

  8. Double stimuli-responsive polymer systems: How to use crosstalk between pH- and thermosensitivity for drug depots

    Czech Academy of Sciences Publication Activity Database

    Bogomolova, Anna; Kaberov, Leonid; Sedláček, Ondřej; Filippov, Sergey K.; Štěpánek, Petr; Král, V.; Wang, X. Y.; Liu, S. L.; Ye, X. D.; Hrubý, Martin

    2016-01-01

    Roč. 84, November (2016), s. 54-64 ISSN 0014-3057 R&D Projects: GA MŠk(CZ) LH14292; GA ČR(CZ) GC15-10527J Institutional support: RVO:61389013 Keywords : drug depot formulation * double responsive system * pH-responsive polymer Subject RIV: CC - Organic Chemistry Impact factor: 3.531, year: 2016

  9. Deployment Strategy for Car-Sharing Depots by Clustering Urban Traffic Big Data Based on Affinity Propagation

    Directory of Open Access Journals (Sweden)

    Zhihan Liu

    2018-01-01

    Full Text Available Car sharing is a type of car rental service, by which consumers rent cars for short periods of time, often charged by hours. The analysis of urban traffic big data is full of importance and significance to determine locations of depots for car-sharing system. Taxi OD (Origin-Destination is a typical dataset of urban traffic. The volume of the data is extremely large so that traditional data processing applications do not work well. In this paper, an optimization method to determine the depot locations by clustering taxi OD points with AP (Affinity Propagation clustering algorithm has been presented. By analyzing the characteristics of AP clustering algorithm, AP clustering has been optimized hierarchically based on administrative region segmentation. Considering sparse similarity matrix of taxi OD points, the input parameters of AP clustering have been adapted. In the case study, we choose the OD pairs information from Beijing’s taxi GPS trajectory data. The number and locations of depots are determined by clustering the OD points based on the optimization AP clustering. We describe experimental results of our approach and compare it with standard K-means method using quantitative and stationarity index. Experiments on the real datasets show that the proposed method for determining car-sharing depots has a superior performance.

  10. Perceptions on efficacy and side effects of conventional depot antipsychotics (CDA) and atypical depot antipsychotics (ADA): Psychiatrists versus patients in Hong Kong.

    Science.gov (United States)

    Tsang, Hector W H; Fong, Mandy W M; Fung, Kelvin M T; Chung, Raymond C K

    2010-03-01

    Abstract Objectives. We compared the satisfaction level of psychiatrists and psychiatric patients towards conventional (CDA) and atypical (ADA) depot antipsychotics on symptom management, role functioning, and side effects. Method. Patients from an out-patient clinic of a public hospital and psychiatrists from public hospitals participated in the survey in 2007-2008. A total of 153 patients were interviewed by a tailor-made questionnaire and 72 psychiatrists self-administered a similar questionnaire. Results. Both groups shared similar attitudes towards clinical effectiveness and treatment efficacy of ADA and CDA. More patients were ambivalent towards relapse prevention of CDA than psychiatrists (30.7 vs. 16.7%, PADA are associated with less side effects. More than half of the patients showed negative attitudes towards the effectiveness of CDA on improving quality of life (52.40%), work (57.50%), and recreation (55.50%). Psychiatrists were more aware of the limitation of CDA and severity of side effects of CDA. They did not, however, seem to incorporate patients' opinions and research findings into their clinical practice. Conclusion. Evidence-based practice and shared decision-making model between clinicians and mental patients should be advocated. More investigations should be devoted to examine the efficacy of ADA as the alternative to CDA.

  11. Sustained analgesic effect of clonidine co-polymer depot in a porcine incisional pain model

    Directory of Open Access Journals (Sweden)

    Wilsey JT

    2018-04-01

    Full Text Available Jared T Wilsey, Julie H Block Medtronic Spine Division, Memphis, TN, USA Background: Previous research suggests that the α2 adrenergic agonist clonidine, a centrally acting analgesic and antihypertensive, may also have direct effects on peripheral pain generators. However, aqueous injections are limited by rapid systemic absorption leading to off target effects and a brief analgesic duration of action. Purpose: The aim of this study was to examine the efficacy of a sustained-release clonidine depot, placed in the wound bed, in a pig incisional pain model. Methods: The depot was a 15 mm ×5 mm ×0.3 mm poly(lactide-co-caprolactone polymer film containing 3% (w/w clonidine HCl (MDT3. Fifty-two young adult mix Landrace pigs (9–11 kg were divided into seven groups. All subjects received a 6 cm, full-thickness, linear incision into the left lateral flank. Group 1 served as a Sham control group (Sham, n=8. Group 2 received three placebo strips (PBO, n=8, placed end-to-end in the subcutaneous wound bed before wound closure. Group 3 received one MDT3 and two PBO (n=8, Group 4 received two MDT3 and one PBO (n=8, and Group 5 received three MDT3 (n=8. Positive control groups received peri-incisional injections of bupivacaine solution (Group 6, 30 mg/day bupivacaine, n=8 or clonidine solution (Group 7, 225 µg/day, n=4. Results: The surgical procedure was associated with significant peri-incisional tactile allodynia. There was a dose-dependent effect of MDT3 in partially reversing the peri-incisional tactile allodynia, with maximum pain relief relative to Sham at 72 hours. Daily injections of bupivacaine (30 mg, but not clonidine (up to 225 µg, completely reversed allodynia within 48 hours. There was a statistically significant correlation between the dose of MDT3 and cumulative withdrawal threshold from 4 hours through the conclusion of the study on day 7. Conclusion: These data suggest that a sustained-release clonidine depot may be a

  12. Sustained analgesic effect of clonidine co-polymer depot in a porcine incisional pain model.

    Science.gov (United States)

    Wilsey, Jared T; Block, Julie H

    2018-01-01

    Previous research suggests that the α 2 adrenergic agonist clonidine, a centrally acting analgesic and antihypertensive, may also have direct effects on peripheral pain generators. However, aqueous injections are limited by rapid systemic absorption leading to off target effects and a brief analgesic duration of action. The aim of this study was to examine the efficacy of a sustained-release clonidine depot, placed in the wound bed, in a pig incisional pain model. The depot was a 15 mm ×5 mm ×0.3 mm poly(lactide-co-caprolactone) polymer film containing 3% (w/w) clonidine HCl (MDT3). Fifty-two young adult mix Landrace pigs (9-11 kg) were divided into seven groups. All subjects received a 6 cm, full-thickness, linear incision into the left lateral flank. Group 1 served as a Sham control group (Sham, n=8). Group 2 received three placebo strips (PBO, n=8), placed end-to-end in the subcutaneous wound bed before wound closure. Group 3 received one MDT3 and two PBO (n=8), Group 4 received two MDT3 and one PBO (n=8), and Group 5 received three MDT3 (n=8). Positive control groups received peri-incisional injections of bupivacaine solution (Group 6, 30 mg/day bupivacaine, n=8) or clonidine solution (Group 7, 225 µg/day, n=4). The surgical procedure was associated with significant peri-incisional tactile allodynia. There was a dose-dependent effect of MDT3 in partially reversing the peri-incisional tactile allodynia, with maximum pain relief relative to Sham at 72 hours. Daily injections of bupivacaine (30 mg), but not clonidine (up to 225 µg), completely reversed allodynia within 48 hours. There was a statistically significant correlation between the dose of MDT3 and cumulative withdrawal threshold from 4 hours through the conclusion of the study on day 7. These data suggest that a sustained-release clonidine depot may be a viable nonopioid, nonamide anesthetic therapy for the treatment of acute postsurgical nociceptive sensitization.

  13. Global adiposity and thickness of intraperitoneal and mesenteric adipose tissue depots are increased in women with polycystic ovary syndrome (PCOS).

    Science.gov (United States)

    Borruel, Susana; Fernández-Durán, Elena; Alpañés, Macarena; Martí, David; Alvarez-Blasco, Francisco; Luque-Ramírez, Manuel; Escobar-Morreale, Héctor F

    2013-03-01

    Sexual dimorphism suggests a role for androgens in body fat distribution. Women with polycystic ovary syndrome (PCOS), a mainly androgen excess disorder, often present with abdominal obesity and visceral adiposity. We hypothesized that women with PCOS have a masculinized body fat distribution favoring the deposition of fat in visceral and organ-specific adipose tissue depots. This was a case-control study. The study was conducted at an academic hospital. Women with PCOS (n = 55), women without androgen excess (n = 25), and men (n = 26) presenting with similar body mass index participated in the study. There were no interventions. Ultrasound measurements of adipose tissue depots including sc (minimum and maximum), preperitoneal, ip, mesenteric, epicardial, and perirenal fat thickness were obtained and total body fat mass was estimated using a body fat monitor. Men and patients with PCOS had increased amounts of total body fat compared with control women. Men had increased thickness of intraabdominal adipose tissue depots compared with the control women, with the women with PCOS showing intermediate values that were also higher than those of control women in the case of ip and mesenteric fat thickness and was close to reaching statistical significance in the case of epicardial fat thickness. Women with PCOS also showed increased minimum sc fat thickness compared with the control women. Obesity increased the thickness of all of the adipose tissue depots in the 3 groups of subjects. Women with PCOS have higher global adiposity and increased amounts of visceral adipose tissue compared with control women, especially in the ip and mesenteric depots.

  14. The effect of a crosslinking chemical reaction on pattern formation in viscous fingering of miscible fluids in a Hele-Shaw cell

    Science.gov (United States)

    Bunton, Patrick H.; Tullier, Michael P.; Meiburg, Eckart; Pojman, John A.

    2017-10-01

    Viscous fingering can occur in fluid motion whenever a high mobility fluid displaces a low mobility fluid in a Darcy type flow. When the mobility difference is primarily attributable to viscosity (e.g., flow between the two horizontal plates of a Hele-Shaw cell), viscous fingering (VF) occurs, which is sometimes termed the Saffman-Taylor instability. Alternatively, in the presence of differences in density in a gravity field, buoyancy-driven convection can occur. These instabilities have been studied for decades, in part because of their many applications in pollutant dispersal, ocean currents, enhanced petroleum recovery, and so on. More recent interest has emerged regarding the effects of chemical reactions on fingering instabilities. As chemical reactions change the key flow parameters (densities, viscosities, and concentrations), they may have either a destabilizing or stabilizing effect on the flow. Hence, new flow patterns can emerge; moreover, one can then hope to gain some control over flow instabilities through reaction rates, flow rates, and reaction products. We report effects of chemical reactions on VF in a Hele-Shaw cell for a reactive step-growth cross-linking polymerization system. The cross-linked reaction product results in a non-monotonic viscosity profile at the interface, which affects flow stability. Furthermore, three-dimensional internal flows influence the long-term pattern that results.

  15. Inoculation of weaned pigs with E. coli reduces depots of vitamin E

    DEFF Research Database (Denmark)

    Lauridsen, Charlotte; Vestergaard, Ellen-Margrethe; Højsgaard, Søren

    2011-01-01

    This study was designed to investigate the effect of vitamin E supplementation on vitamin E depots and immune responses in weaned pigs after an E. coli inoculation. The design was a 2 × 2 factorial with vitamin E supplementation (150 mg/kg RRR-α-tocopheryl acetate versus a control diet containing...... 60 mg all-rac-α-tocopheryl acetate) and E. coli 0 149 inoculation (inoculation of 1 × 108 CFU on day 2 and 3 after weaning versus inoculation of vehicle). The pigs were housed individually during the experiment which lasted for 10 days from weaning at 7 weeks of age. Blood was sampled on day 1 (day...... of weaning) and 9 of the experiment, and serum was analyzed for α-tocopherol concentration. On day 10 of the experiment, pigs were killed and samples of liver, heart, muscle, adipose tissue and intestinal epithelium were obtained, and immune cells (alveolar macrophages) were harvested, and analyzed for α...

  16. Electrolytic nickel deposits upon uranium; Depot electrolytique de nickel sur l'uraniun

    Energy Technology Data Exchange (ETDEWEB)

    Baudin, G; Chauvin, G; Coriou, H; Hure, J [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1958-07-01

    The authors present a new possibility to protect uranium by very adherent nickel deposits got by aqueous medium electrolysis. Surface treatment of uranium is based upon the chemical etching method from Lietazke. After thermal treatments at 600, 700 and 800 deg. C, under vacuum, a good intermetallic U-Ni diffusion is observed for each case. (author) [French] Les auteurs mettent en evidence une possibilite nouvelle de protection de l'uranium par des depots tres adherents de nickel realises par electrolyse en milieu aqueux. La preparation de surface de l'uranium est basee sur la methode du decapage chimique de Lietazke. Apres des traitements thermiques a 600, 700 et 800 deg. C, sous vide, on constate dans tous les cas une bonne diffusion intermetallique U-Ni. (auteur)

  17. Leuprolide Acetate 1-Month Depot for Central Precocious Puberty: Hormonal Suppression and Recovery

    Directory of Open Access Journals (Sweden)

    Neely EKirk

    2011-01-01

    Full Text Available Methods. This prospective US multicenter trial of leuprolide acetate 1-month depot (7.5–15 mg for central precocious puberty utilized an open-label treatment period, long-term follow-up, and adult callback. Forty-nine females Results. Subjects were treated for years. Mean peak GnRH-stimulated LH and FSH were prepubertal after the first dose and remained suppressed throughout treatment. During treatment, mean estradiol decreased to the limit of detection and mean testosterone decreased but remained above prepubertal norms. During posttreatment follow-up ( years, all patients achieved a pubertal hormonal response within 1 year and menses were reported in all females ≥12 years old. No impairment of reproductive function was observed at adulthood (mean age: 24.8 years.

  18. Improving Inventory Management and Supply Chain of Diesel Fuel in Pertamina 5 Main Depots

    Directory of Open Access Journals (Sweden)

    Togar M Simatupang

    2012-01-01

    Full Text Available Planning Operation subdivision at PT Pertamina has to generate supply decisions includingmain depot to supply, supply point and transportation mode. However, the variability inplanning a supply schedule renders the process of determining a supply decision asineffective. The last assessment on uncertainties was done at 2006 and has not beenconsidered during decision making process. On the other hand, the result of this researchindicates that the uncertainty level is too high to be ignored and the poor informationexchange between the regional offices and the head office decreases the Planning Operation’sability to create plans that covers the company condition. This paper proposes an appropriatesafety stock to withstand the uncertainties and a supply scheduling process that also considersuncertainties by using Monte-Carlo Simulation with random numbers to simulate the events inthe upcoming period.Key words: inventory management, distribution planning, managing uncertainties, montecarlosimulation

  19. Medical Cosmopolitanism in Global Dubai: A Twenty-first-century Transnational Intracytoplasmic Sperm Injection (ICSI) Depot.

    Science.gov (United States)

    Inhorn, Marcia C

    2017-03-01

    Dubai-one of the seven United Arab Emirates and the Middle East's only "global city"-is gaining a reputation as a transnational medical tourism hub. Characterized by its "medical cosmopolitanism," Dubai is now attracting medical travelers from around the world, some of whom are seeking assisted conception. Dubai is fast becoming known as a new transnational "reprohub" for intracytoplasmic sperm injection (ICSI), the variant of in vitro fertilization designed to overcome male infertility. Based on ethnographic research conducted in one of the country's most cosmopolitan clinics, this article explores the ICSI treatment quests of infertile men coming to Dubai from scores of other nations. The case of an infertile British-Moroccan man is highlighted to demonstrate why ICSI is a particularly compelling "masculine hope technology" for infertile Muslim men. Thus, Muslim men who face barriers to ICSI access in their home countries may become "reprotravelers" to Dubai, an emergent ICSI depot. © 2016 by the American Anthropological Association.

  20. Study on Multi-Depot Collaborative Transportation Problem of Milk-Run Pattern

    Directory of Open Access Journals (Sweden)

    Lou Zhenkai

    2016-01-01

    Full Text Available Analyze the relevance between Milk Run mode and collaborative transportation problem, put forward collaborative transportation problem of multiple-depot on Milk Run mode under the supply and demand separate nodes, consider the value of transport and transport costs, introduce the concept of node - arc flow, by comparing the size of traffic flow determine nodes collection, and then constructed multi-transport model of the problem. Considering one-way pickup and delivery closed, construct two-stage algorithm model, use dynamic programming recursive solution to determine the best route to pick up, and then solving delivery routing problem with different start and return point based on geometric method of Cosine. Finally use a numerical example illustrates the effectiveness of the algorithm and reasonable model.

  1. Design of PLGA-based depot delivery systems for biopharmaceuticals prepared by spray drying

    DEFF Research Database (Denmark)

    Wan, Feng; Yang, Mingshi

    2016-01-01

    Currently, most of the approved protein and peptide-based medicines are delivered via conventional parenteral injection (intramuscular, subcutaneous or intravenous). A frequent dosing regimen is often necessary because of their short plasma half-lives, causing poor patient compliance (e.g. pain......, abscess, etc.), side effects owing to typical peak-valley plasma concentration time profiles, and increased costs. Among many sustained-release formulations poly lactic-co-glycolic acid (PLGA)-based depot microparticle systems may represent one of the most promising approaches to provide protein...... and peptide drugs with a steady pharmacokinetic/pharmacodynamic profile maintained for a long period. However, the development of PLGA-based microparticle systems is still impeded by lack of easy, fast, effective manufacturing technologies. The aim of this paper is to review recent advances in spray drying...

  2. Location and multi-depot vehicle routing for emergency vehicles using tour coverage and random sampling

    Directory of Open Access Journals (Sweden)

    Alireza Goli

    2015-09-01

    Full Text Available Distribution and optimum allocation of emergency resources are the most important tasks, which need to be accomplished during crisis. When a natural disaster such as earthquake, flood, etc. takes place, it is necessary to deliver rescue efforts as quickly as possible. Therefore, it is important to find optimum location and distribution of emergency relief resources. When a natural disaster occurs, it is not possible to reach some damaged areas. In this paper, location and multi-depot vehicle routing for emergency vehicles using tour coverage and random sampling is investigated. In this study, there is no need to visit all the places and some demand points receive their needs from the nearest possible location. The proposed study is implemented for some randomly generated numbers in different sizes. The preliminary results indicate that the proposed method was capable of reaching desirable solutions in reasonable amount of time.

  3. Proposed Expansion of German Air Force Operations at Holloman AFB, New Mexico. Final Environmental Impact Statement. Volume III: Comment Letters and Responses to Comments

    National Research Council Canada - National Science Library

    1998-01-01

    The Final Environmental Impact Statement analyzed the potential environmental consequences from the proposal to beddown 30 additional German Air Force Tornado aircraft and 640 personnel at Holloman Air Force Base (AFB) New Mexico...

  4. Monoclonal antibody anti-AFB1: scale-up in vitro for biotools development Anticorpo monoclonal antiAFB1: produção in vitro visando desenvolvimento de bioferramentas

    Directory of Open Access Journals (Sweden)

    Eiko Nakagawa Itano

    2010-12-01

    Full Text Available Aflatoxin B1 (AFB1 is a mycotoxin classified as group 1 (human carcinogen by International Agency for Research on Cancer - IARC, causing hazardous contamination in a wide variety of food and feed, where the monitoring depends on precision and accuracy of analytical method. The culture of AFB1 specific monoclonal antibody (mAb secreting hybridoma was performed for further development of immunochemical methods. The growth of hybridoma AF2 was carried out in RPMI medium + 15 % fetal bovine serum (FBS, as well as the same medium gradually amended with H-SFM medium (25, 50, 75 and 100 % H-SFM. The protein concentration in the culture supernatant ranged from 1.80 to 10.88 mg/mL. The culture amended with FBS-free synthetic H-SFM medium reached production of reagent with higher degree of purity and lower risk, in addition to lower protein content (2.29 mg/mL reached with 100 % H-SFM, which approaches the real content of pure mAb. The indirect competitive enzyme-linked immunosorbent assay (ic-ELISA and SDS-polyacrylamide gel electrophoresis (SDS-PAGE showed anti-AFB1 activity and IgG corresponding bands, respectively, indicating feasible application of mAb produced in 100, 75 and 50 % H-SFM for further use in the development of AFB1 detecting biotools. This mAb production can be an initial step that can supply the self-sufficient immune-reagent in the rapid diagnosis at national condition, which is essential in the food quality and safety.Aflatoxina B1 (AFB1 é uma micotoxina classificada pela International Agency for Research on Cancer - IARC no Grupo 1 (carcinógeno ao humano, responsável pelo perigo de contaminação em ampla variedade de alimento e ração, cujo monitoramento depende de metodologia analítica precisa e exata. O trabalho visou cultivo do hibridoma secretor de anticorpo monoclonal (AcM específico para AFB1 visando desenvolvimento de métodos imunoquímicos. Hibridoma AF2 foi cultivado em meio RPMI + 15 % de soro fetal bovino (SFB

  5. Adipose tissue depot volume relationships with spinal trabecular bone mineral density in African Americans with diabetes.

    Directory of Open Access Journals (Sweden)

    Gary C Chan

    Full Text Available Changes in select adipose tissue volumes may differentially impact bone mineral density. This study was performed to assess cross-sectional and longitudinal relationships between computed tomography-determined visceral (VAT, subcutaneous (SAT, inter-muscular (IMAT, and pericardial adipose tissue (PAT volumes with respective changes in thoracic vertebral and lumbar vertebral volumetric trabecular bone mineral density (vBMD in African Americans with type 2 diabetes. Generalized linear models were fitted to test relationships between baseline and change in adipose volumes with change in vBMD in 300 African American-Diabetes Heart Study participants; adjustment was performed for age, sex, diabetes duration, study interval, smoking, hypertension, BMI, kidney function, and medications. Participants were 50% female with mean ± SD age 55.1±9.0 years, diabetes duration 10.2±7.2 years, and BMI 34.7±7.7 kg/m2. Over 5.3 ± 1.4 years, mean vBMD decreased in thoracic/lumbar spine, while mean adipose tissue volumes increased in SAT, IMAT, and PAT, but not VAT depots. In fully-adjusted models, changes in lumbar and thoracic vBMD were positively associated with change in SAT (β[SE] 0.045[0.011], p<0.0001; 0.40[0.013], p = 0.002, respectively. Change in thoracic vBMD was positively associated with change in IMAT (p = 0.029 and VAT (p = 0.016; and change in lumbar vBMD positively associated with baseline IMAT (p<0.0001. In contrast, vBMD was not associated with change in PAT. After adjusting for BMI, baseline and change in volumes of select adipose depots were associated with increases in thoracic and lumbar trabecular vBMD in African Americans. Effects of adiposity on trabecular bone appear to be site-specific and related to factors beyond mechanical load.

  6. Disposal of chemical agents and munitions stored at Umatilla Depot Activity, Hermiston, Oregon

    Energy Technology Data Exchange (ETDEWEB)

    Zimmerman, G.P.; Hillsman, E.L.; Johnson, R.O.; Miller, R.L.; Patton, T.G.; Schoepfle, G.M.; Tolbert, V.R.; Feldman, D.L.; Hunsaker, D.B. Jr.; Kroodsma, R.L.; Morrissey, J.; Rickert, L.W.; Staub, W.P.; West, D.C.

    1993-02-01

    The Umatilla Depot Activity (UMDA) near Hermiston, Oregon, is one of eight US Army installations in the continental United States where lethal unitary chemical agents and munitions are stored, and where destruction of agents and munitions is proposed under the Chemical Stockpile Disposal Program (CSDP). The chemical agent inventory at UMDA consists of 11.6%, by weight, of the total US stockpile. The destruction of the stockpile is necessary to eliminate the risk to the public from continued storage and to dispose of obsolete and leaking munitions. In 1988 the US Army issued a Final Programmatic Environmental Impact Statement (FPEIS) for the CSDP that identified on-site disposal of agents and munitions as the environmentally preferred alternative (i.e., the alternative with the least potential to cause significant adverse impacts), using a method based on five measures of risk for potential human health and ecosystem/environmental effects; the effectiveness and adequacy of emergency preparedness capabilities also played a key role in the FPEIS selection methodology. In some instances, the FPEIS included generic data and assumptions that were developed to allow a consistent comparison of potential impacts among programmatic alternatives and did not include detailed conditions at each of the eight installations. The purpose of this Phase 1 report is to examine the proposed implementation of on-site disposal at UMDA in light of more recent and more detailed data than those included in the FPEIS. Specifically, this Phase 1 report is intended to either confirm or reject the validity of on-site disposal for the UMDA stockpile. Using the same computation methods as in the FPEIS, new population data were used to compute potential fatalities from hypothetical disposal accidents. Results indicate that onsite disposal is clearly preferable to either continued storage at UMDA or transportation of the UMDA stockpile to another depot for disposal.

  7. Disposal of chemical agents and munitions stored at Anniston Army Depot, Anniston, Alabama

    Energy Technology Data Exchange (ETDEWEB)

    Hunsaker, D.B. Jr.; Zimmerman, G.P.; Hillsman, E.L.; Miller, R.L.; Schoepfle, G.M.; Johnson, R.O.; Tolbert, V.R.; Kroodsma, R.L.; Rickert, L.W.; Rogers, G.O.; Staub, W.P.

    1990-09-01

    The purpose of this Phase I report is to examined the proposed implementation of on-site disposal at Anniston Army Depot (ANAD) in light of more detailed and more recent data than those included in the Final Programmatic Environmental Impact Statement (EPEIS). Two principal issues are addressed: (1) whether or not the new data would result in identification of on-site disposal at ANAD as the environmentally preferred alternative (using the same selection method and data analysis tools as in the FPEIS), and (2) whether or not the new data indicate the presence of significant environmental resources that could be affected by on-site disposal at ANAD. In addition, a status report is presented on the maturity of the disposal technology (and now it could affect on-site disposal at ANAD). Inclusion of these more recent data into the FPEIS decision method resulted in confirmation of on-site disposal for ANAD. No unique resources with the potential to prevent or delay implementation of on-site disposal at ANAD have been identified. A review of the technology status identified four principal technology developments that have occurred since publication of the FPEIS and should be of value in the implementation of on-site disposal at ANAD: the disposal of nonlethal agent at Pine Bluff Arsenal, located near Pine Bluff, Arkansas; construction and testing of facilities for disposal of stored lethal agent at Johnston Atoll, located about 1300 km (800 miles) southwest of Hawaii in the Pacific Ocean; lethal agent disposal tests at the chemical agent pilot plant operations at Tooele Army Depot, located near Salt Lake City, Utah; and equipment advances. 18 references, 13 figs., 10 tabs.

  8. [Job stress in locomotive attendants in a locomotive depot and related influencing factors].

    Science.gov (United States)

    Kang, L; Jia, X C; Lu, F; Zhou, W H; Chen, R

    2017-10-20

    Objective: To investigate the current status of job stress in locomotive attendants in a locomotive depot and related influencing factors. Methods: From 2012 to 2013, cluster sampling was used to select 1500 locomotive attendants in a locomotive depot in Zhengzhou Railway Bureau as respondents.The contents of the investigation included general data and occupational information.A job satisfaction questionnaire was used to investigate the degree of satisfaction, a depression scale was used to investigate the frequency of symptoms, and a daily stress scale was used to investigate the frequency of fatigue and stress. Results: There was a significant difference in depression score between locomotive attendants with different ages, working years, degrees of education, working situations of spouse, total monthly family incomes, numbers of times of attendanceat night, monthly numbers of times of attendance,ormonthly attendance times( P job satisfaction score between locomotive attendants with different ages,working years, degrees of education, working situations of spouse, total monthly family incomes, numbers of times of attendance at night, monthly attendance times,or ways to work( P job satisfaction( β =1.546)and monthly number of times of attendance,working years,attendance time at night,and degree of education were negatively correlated with job satisfaction( β =-0.185,-0.097,-0.020,and -1.106); monthly number of times of attendance andcommute time were positively correlated with depression( β =0.243 and 0.029); attendance time at night,working situation of spouse,commute time,monthly number of times of attendance,degree of education,and working years were positively correlated with daily stress( β =0.006,0.473,0.010,0.043,0.585, and 0.028). Conclusion: Number of times of attendance, attendance time,working years,and spouse are influencing factors for job stress in locomotive attendants. Improvement in work process and care for their personal life help to reduce

  9. Transcriptome, antioxidant enzyme activity and histopathology analysis of hepatopancreas from the white shrimp Litopenaeus vannamei fed with aflatoxin B1(AFB1).

    Science.gov (United States)

    Zhao, Wei; Wang, Lei; Liu, Mei; Jiang, Keyong; Wang, Mengqiang; Yang, Guang; Qi, Cancan; Wang, Baojie

    2017-09-01

    Aflatoxin produced by Aspergillus flavus or Aspergillus parasiticus fungi during grain and feed processing and storage. Aflatoxins cause severe health problems reducing the yield and profitability of shrimp cultures. We sought to understand the interaction between shrimp immunity and aflatoxin B1 (AFB1), analyzing transcriptome expression, antioxidant enzyme activity, and histological features of the hepatopancreas of shrimp fed with AFB1. From over 4 million high-quality reads, de novo unigene assembly produced 103,644 fully annotated genes. A total of 1024 genes were differentially expressed in shrimp fed with AFB1, being involved in functions, such as peroxidase metabolism, signal transduction, transcriptional control, apoptosis, proteolysis, endocytosis, and cell adhesion and cell junction. Upon AFB1 challenge, there were severe histological alterations in shrimp hepatopancreas. AFB1 challenge increased the activity of several antioxidant enzymes. Our data contribute to improve the current understanding of host-AFB1 interaction, providing an abundant source for identification of novel genes. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Detection of serum AFB1-lysine adduct in Malaysia and its association with liver and kidney functions.

    Science.gov (United States)

    Mohd Redzwan, S; Rosita, Jamaluddin; Mohd Sokhini, A M; Nurul 'Aqilah, A R; Wang, Jia-Sheng; Kang, Min-Su; Zuraini, Ahmad

    2014-01-01

    Aflatoxin is ubiquitously found in many foodstuffs and produced by Aspergillus species of fungi. Of many aflatoxin metabolites, AFB1 is classified by the International Agency for Research on Cancer (IARC) as group one carcinogen and linked to the development of hepatocellular carcinoma (HCC). The study on molecular biomarker of aflatoxin provides a better assessment on the extent of human exposure to aflatoxin. In Malaysia, the occurrences of aflatoxin-contaminated foods have been documented, but there is a lack of data on human exposure to aflatoxin. Hence, this study investigated the occurrence of AFB1-lysine adduct in serum samples and its association with liver and kidney functions. 5ml fasting blood samples were collected from seventy-one subjects (n=71) for the measurement of AFB1-lysine adduct, albumin, total bilirubin, AST (aspartate aminotransferase), ALT (alanine transaminase), ALP (alkaline phosphatase), GGT (gamma-glutamyl transpeptidase), creatinine and BUN (blood urea nitrogen). The AFB1-lysine adduct was detected in all serum samples (100% detection rate) with a mean of 6.85±3.20pg/mg albumin (range: 1.13-18.85pg/mg albumin). Male subjects (mean: 8.03±3.41pg/mg albumin) had significantly higher adduct levels than female subjects (mean: 5.64±2.46pg/mg albumin) (p6.85pg/mg albumin) had significantly elevated level of total bilirubin (pMalaysia. Given that aflatoxin can pose serious problem to the health, intervention strategies should be implemented to limit/reduce human exposure to aflatoxin. Besides, a study with a big sample size should be warranted in order to assess aflatoxin exposure in the general population of Malaysia. Copyright © 2013 Elsevier GmbH. All rights reserved.

  11. Response of Intestinal Bacterial Flora to the Long-term Feeding of Aflatoxin B1 (AFB1) in Mice.

    Science.gov (United States)

    Yang, Xiai; Liu, Liangliang; Chen, Jing; Xiao, Aiping

    2017-10-12

    In order to investigate the influence of aflatoxin B1 (AFB1) on intestinal bacterial flora, 24 Kunming mice (KM mice) were randomly placed into four groups, which were labeled as control, low-dose, medium-dose, and high-dose groups. They were fed intragastrically with 0.4 mL of 0 mg/L, 2.5 mg/L, 4 mg/L, or 10 mg/L of AFB1 solutions, twice a day for 2 months. The hypervariable region V3 + V4 on 16S rDNA of intestinal bacterial flora was sequenced by the use of a high-flux sequencing system on a Miseq Illumina platform; then, the obtained sequences were analyzed. The results showed that, when compared with the control group, both genera and phyla of intestinal bacteria in the three treatment groups decreased. About one third of the total genera and one half of the total phyla remained in the high-dose group. The dominant flora were Lactobacillus and Bacteroides in all groups. There were significant differences in the relative abundance of intestinal bacterial flora among groups. Most bacteria decreased as a whole from the control to the high-dose groups, but several beneficial and pathogenic bacterial species increased significantly with increasing dose of AFB1. Thus, the conclusion was that intragastric feeding with 2.5~10 mg/mL AFB1 for 2 months could decrease the majority of intestinal bacterial flora and induce the proliferation of some intestinal bacteria flora.

  12. Audit Report on the Sacramento Army Depot Internal Review and Audit Compliance Office's "Audits of Warranties, Quality Deficiency Reports, and Reports of Discrepancies"

    National Research Council Canada - National Science Library

    1992-01-01

    The Sacramento Army Depot (SAAD) Internal Review and Audit Compliance Office (Internal Review) issued an audit report, "Audit of Warranties, Quality Deficiency Reports, and Reports of Discrepancies," on July 20, 1990...

  13. Siting Report for Theater Missile Defense Mid-Range Test Launch Complex at Ft. Wingate Depot Activity, NM: Based on Sit Survey, 14-18 February 1994

    National Research Council Canada - National Science Library

    1994-01-01

    This study is provided to assess the capability of Ft. Wingate Depot Activity to act as a Ballistic Missile Defense Test Support Complex for the launch of target missiles toward White Sands Missile Range...

  14. Adesão ao tratamento e hospitalizações entre pacientes que realizam aplicações de Flufenazina Depot Adhesión al tratamiento y hospitalización entre pacientes que realizan aplicaciones de Flufenazina Depot Compliance with treatment and hospitalization among patients using Flufenazine Depot

    Directory of Open Access Journals (Sweden)

    José Menna Oliveira

    2003-08-01

    Full Text Available OBJETIVOS: Os autores revisam a bibliografia sobre medicação depot e apresentam dados referentes à adesão ao tratamento e hospitalizações entre os pacientes que realizam aplicações de enantato de flufenazina em regime ambulatorial no Hospital Espírita de Pelotas. MÉTODO: Analisaram-se os prontuários de pacientes que foram incluídos no regime depot anteriormente a maio de 2001 e que realizaram pelo menos uma aplicação entre maio de 2001 e junho de 2002, quanto à adesão ao tratamento e eventuais hospitalizações. RESULTADOS: De um total de 100 pacientes, 66 permaneciam em regime depot ao término do período estudado. Destes, 40 (61% apresentavam boa adesão ao tratamento, enquanto 26 (39% apresentavam má adesão. Houve um total de 25 pacientes que sofreram hospitalizações, entre os quais a maioria não estava em tratamento no término do estudo ou apresentava má adesão. Entre os pacientes procedentes do mesmo bairro em que se situa o hospital, 10 (67% apresentavam boa adesão em comparação com 30 pacientes (59% procedentes de bairros distintos. DISCUSSÃO: O número de hospitalizações variou visivelmente, conforme a permanência ou não em tratamento e a adesão ao mesmo. Pacientes provenientes de bairros distantes do hospital tenderam a apresentar pior adesão ao tratamento. CONCLUSÕES: É possível que pacientes em regime de aplicação depot residentes próximos ao local de aplicação beneficiem-se mais do tratamento que aqueles residentes em locais distantes. São necessários mais estudos comparando administrações depot com VO em termos de adesão e investigando fatores preditores de boa adesão ao tratamento.OBJETIVOS: Los autores revisan la bibliografía sobre medicación depot y presentan datos referentes a la adhesión al tratamiento y hospitalizaciones entre los pacientes que realizan aplicaciones de enantato de flufenazina en régimen ambulatorio en el Hospital Espiritista de Pelotas. MÉTODO: Fueron

  15. An Analysis of the Factors Generating the Variance Between the Budgeted and Actual Operating Results of the Naval Aviation Depot at North Island, California

    Science.gov (United States)

    2008-06-01

    management structure employs free- market system principles and encourages business-like processes that are mission driven. Since no operating funds are...variable (Potvin, 2007). 2. Unit Cost Goal NWCFs use the unit cost goal ( UCG ) for planning purposes. The UCG is an estimate of what a unit of product...mission 6. Will not interfere with depot performance This section opens the depot to the private market . 53 Chapter 159 – Real Property

  16. Depot-Specific Response of Adipose Tissue to Diet-Induced Inflammation: The Retinoid-Related Orphan Receptor α (RORα) Involved?

    Science.gov (United States)

    Kadiri, Sarah; Auclair, Martine; Capeau, Jacqueline; Antoine, Bénédicte

    2017-11-01

    Epididymal adipose tissue (EAT), a visceral fat depot, is more closely associated with metabolic dysfunction than inguinal adipose tissue (IAT), a subcutaneous depot. This study evaluated whether the nuclear receptor RORα, which controls inflammatory processes, could be implicated. EAT and IAT were compared in a RORα loss-of-function mouse (sg/sg) and in wild-type (WT) littermates, fed a standard diet (SD) or a Western diet (WD), to evaluate the impact of RORα expression on inflammatory status and on insulin sensitivity (IS) of each fat depot according to the diet. Sg/sg mice fed the SD exhibited a decreased inflammatory status and a higher IS in their fat depots than WT mice. WD-induced obesity had distinct effects on the two fat depots. In WT mice, EAT exhibited increased inflammation and insulin resistance while IAT showed reduced inflammation and improved IS, together with a depot-specific increase of RORα, and its target gene IκBα, in the stroma vascular fraction (SVF). Conversely, in sg/sg mice, WD increased inflammation and lowered IS of IAT but not of EAT. These findings suggest an anti-inflammatory role for RORα in response to WD, which occurs at the level of SVF of IAT, thus possibly contributing to the "healthy" expansion of IAT. © 2017 The Obesity Society.

  17. Shemya AFB, Alaska 1992 IRP field investigation report. Volume 1: Final report

    Energy Technology Data Exchange (ETDEWEB)

    1993-02-01

    The US Air Force is currently investigating 22 sites on Shemya Air Force Base (AFB) to determine if past spill and disposal activities have caused environmental damage. These investigations are being carried out under the Air Force`s Installation Restoration Program (IRP). As a part of the IRP program, field investigations were performed in 1992 to obtain the information needed to assess what future actions willneed to be carried out at each site. The island`s drinking water supply was also investigated. Activities completed at 10 selected sites during the 1992 field investigation included surface sampling to determine the lateral extent of contamination, subsurface sampling to determine the vertical extent of contamination, and the installation of well points and monitoring wells to determine the direction of groundwater flow and if the groundwater has been affected by a site. In addition, geophysical surveys were performed at most sites to identify site boundaries and check for the presence of buried metal to be avoided during drilling activities.

  18. Shemya AFB, Alaska 1992 IRP field investigation report. Volume 4, Appendixes E and F: Final report

    Energy Technology Data Exchange (ETDEWEB)

    1993-02-01

    The US Air Force is currently investigating 22 sites on Shemya Air Force Base (AFB) to determine if past spill and disposal activities have caused environmental damage. These investigations are being carried out under the Air Force`s Installation Restoration Program (IRP). Field investigations were performed in 1992 to obtain the information needed to assess what future actions will need to be carried out at each site. The island`s drinking water supply was also investigated. Activities completed at 10 selected sites included surface sampling to determine the lateral extent of contamination, subsurface sampling to determine the vertical extent of contamination, and the installation of well points and monitoring wells to determine the direction of groundwater flow and if the groundwater has been affected by a site. In addition, geophysical surveys were performed at most sites to identify site boundaries and check for the presence of buried metal, to be avoided during drilling activities. This report contains appendices E and F with information on the following: soil boring logs, and data validation of samples analyzed.

  19. Association between individual fat depots and cardio-metabolic traits in normal- and overweight children, adolescents and adults.

    Science.gov (United States)

    Hübers, M; Geisler, C; Plachta-Danielzik, S; Müller, M J

    2017-05-08

    To determine age-related associations between fat mass (FM), regional fat depots and cardiometabolic traits in normal- and overweight children, adolescents and adults. Detailed body composition (regional subcutaneous and visceral adipose tissue; SAT, VAT) by whole-body magnetic resonance imaging (MRI), FM and fat-free mass by air-displacement plethysmography, systolic and diastolic blood pressure (SBP, DBP), triglycerides (TG), high-density lipoprotein cholesterol (HDL), plasma glucose and plasma insulin were measured in 433 subjects (BMI: 23.6 (21.0-27.7); 151 children and adolescents, aged 6-18 years, 150 young adults, aged 18-30 years and 132 adults, aged 30-60 years). Data were derived from pooled data of the 'Reference Center for Body Composition' in Kiel, Germany. Insulin resistance was determined by the homeostatic model assessment of insulin resistance (HOMA-IR). Partial correlations and multivariate linear regression analyses were used to evaluate the associations between body composition and cardiometabolic traits. A descriptive approach was used to demonstrate age-dependent differences in associations between body fat depots and insulin resistance, independent of BMI. FM, SAT, and VAT increased from childhood to adulthood with low VAT in children and adolescents. When compared to children, TG was higher in adults. HDL and DBP did not differ between age groups. Insulin resistance was highest in male adolescents and female young adults. Associations between body fat depots and cardiometabolic traits were seen after puberty with no associations in pre- and intrapubertal children. When compared to FM, SAT and VAT had the strongest association with insulin resistance in adults. This association was independent of BMI. Associations between individual body fat depots and most cardiometabolic traits became evident after puberty only. The strongest associations were observed between insulin resistance and abdominal fat in adults. The impact of VAT was independent

  20. Autonomy, Affinity, and the Assessment of Damages: Acb v Thomson Medical Pte Ltd [2017] SGCA 20 and Shaw v Kovak [2017] EWCA Civ 1028.

    Science.gov (United States)

    Purshouse, Craig

    2017-11-17

    In ACB v Thomson Medical Pte Ltd [2017] SGCA 20 and Shaw v Kovak [2017] EWCA Civ 1028, the idea that 'lost autonomy' should be recognised as a new form of actionable damage in the tort of negligence was rejected in Singapore and England, respectively. This, it will be argued, was the correct outcome. Protecting an interest in autonomy via the tort of negligence would undermine the coherence of that tort. In ACB, however, a new, different, form of damage was recognised: loss of 'genetic affinity'. This commentary will discuss some problems that protecting an interest in 'genetic affinity' raises before critiquing the approach to assessing damages in ACB. © The Author 2017. Published by Oxford University Press; all rights reserved. For Permissions, please email: journals.permissions@oup.com.

  1. Randomised controlled single-blind study of conventional versus depot mydriatic drug delivery prior to cataract surgery

    Directory of Open Access Journals (Sweden)

    Madge Simon

    2006-11-01

    Full Text Available Abstract Background A prerequisite for safe cataract surgery is an adequately dilated pupil. The authors conducted a trial to assess the efficacy (in terms of pupil diameter of a depot method of pre-operative pupil dilatation, as compared with repeated instillations of drops (which is time-consuming for the nursing staff and uncomfortable for the patient. Methods A prospective randomised masked trial was conducted comprising 130 patients with no significant ocular history undergoing elective clear corneal phacoemulsification. 65 patients had mydriatic drops (Tropicamide 1%, Phenylephrine 2.5%, Diclofenac sodium 0.1% instilled prior to surgery, 65 had a wick soaked in the same drop mixture placed in the inferior fornix. Horizontal pupil diameters were recorded on a millimetre scale immediately prior to surgery. Results There was no significant difference in pupil size between the two groups (p = 0.255, Student's t-test. Conclusion There was no significant difference between the mydriasis obtained with the depot system compared with conventional drop application. Use of a depot mydriatic delivery system appears to be a safe and efficient method of drug delivery. Trial Registration International Standard Randomised Controlled Trial Number Register ISRCTN78047760

  2. Endurance exercise training induces fat depot-specific differences in basal autophagic activity

    International Nuclear Information System (INIS)

    Tanaka, Goki; Kato, Hisashi; Izawa, Tetsuya

    2015-01-01

    The purpose of this study was to uncover the effect of exercise training on the expression of autophagy marker proteins in epididymal white adipose tissue (eWAT), inguinal WAT (iWAT), and the stromal vascular fraction (SVF) collected from eWAT. Male Wistar rats aged 4–5 weeks were randomly divided into two groups, sedentary control (n = 7) and exercise-trained (n = 7). Rats in the exercise-trained group were exercised on a treadmill set at a 5° incline 5 days/week for 9 weeks. We determined that the expression levels of an autophagosome-associating form of microtubule-associated protein 1 light chain 3 (LC3)-II and of p62 were significantly higher in eWAT from exercise-trained than from control rats, while those of adipose-specific deletion of autophagy-related protein (ATG7) and lysosomal-associated membrane protein type 2A (LAMP2a) showed no difference between groups. However, in iWAT, the expression levels of LC3-II and ATG7 were significantly higher in exercise-trained than in control rats. The expression of p62 was highly correlated with that of peroxisome proliferator-activated receptor γ (PPARγ), a master regulator of adipogenesis and lipid metabolism, in both WAT types (eWAT, r = 0.856, P < 0.05; iWAT, r = 0.762, P < 0.05), whereas LC3-II and PPARγ levels were highly correlated in eWAT (r = 0.765, P < 0.05) but not in iWAT (r = −0.306, ns). In SVF, the expression levels of LC3II, ATG7, and LAMP2a were significantly higher in exercise-trained than in control rats. These results suggest that exercise training suppresses basal autophagy activity in eWAT, but that this activity is enhanced in iWAT and SVF collected from eWAT. Thus, the adaptation of basal autophagic activity following exercise training exhibits fat depot-specific differences. - Highlights: • Autophagy has been associated with obesity and associated diseases. • We examined exercise-associated rat white adipose tissue (WAT) autophagy markers. • Exercise increased

  3. Endurance exercise training induces fat depot-specific differences in basal autophagic activity

    Energy Technology Data Exchange (ETDEWEB)

    Tanaka, Goki; Kato, Hisashi; Izawa, Tetsuya, E-mail: tizawa@mail.doshisha.ac.jp

    2015-10-23

    The purpose of this study was to uncover the effect of exercise training on the expression of autophagy marker proteins in epididymal white adipose tissue (eWAT), inguinal WAT (iWAT), and the stromal vascular fraction (SVF) collected from eWAT. Male Wistar rats aged 4–5 weeks were randomly divided into two groups, sedentary control (n = 7) and exercise-trained (n = 7). Rats in the exercise-trained group were exercised on a treadmill set at a 5° incline 5 days/week for 9 weeks. We determined that the expression levels of an autophagosome-associating form of microtubule-associated protein 1 light chain 3 (LC3)-II and of p62 were significantly higher in eWAT from exercise-trained than from control rats, while those of adipose-specific deletion of autophagy-related protein (ATG7) and lysosomal-associated membrane protein type 2A (LAMP2a) showed no difference between groups. However, in iWAT, the expression levels of LC3-II and ATG7 were significantly higher in exercise-trained than in control rats. The expression of p62 was highly correlated with that of peroxisome proliferator-activated receptor γ (PPARγ), a master regulator of adipogenesis and lipid metabolism, in both WAT types (eWAT, r = 0.856, P < 0.05; iWAT, r = 0.762, P < 0.05), whereas LC3-II and PPARγ levels were highly correlated in eWAT (r = 0.765, P < 0.05) but not in iWAT (r = −0.306, ns). In SVF, the expression levels of LC3II, ATG7, and LAMP2a were significantly higher in exercise-trained than in control rats. These results suggest that exercise training suppresses basal autophagy activity in eWAT, but that this activity is enhanced in iWAT and SVF collected from eWAT. Thus, the adaptation of basal autophagic activity following exercise training exhibits fat depot-specific differences. - Highlights: • Autophagy has been associated with obesity and associated diseases. • We examined exercise-associated rat white adipose tissue (WAT) autophagy markers. • Exercise increased

  4. Depot injectable atorvastatin biodegradable in situ gel: development, optimization, in vitro, and in vivo evaluation

    Directory of Open Access Journals (Sweden)

    Ahmed TA

    2016-01-01

    Full Text Available Tarek A Ahmed,1,2 Yasser A Alharby,1 Abdel-Rahim M El-Helw,1 Khaled M Hosny,1,3 Khalid M El-Say1,21Department of Pharmaceutics and Industrial Pharmacy, Faculty of Pharmacy, King Abdulaziz University, Jeddah, Saudi Arabia; 2Department of Pharmaceutics and Industrial Pharmacy, Faculty of Pharmacy, Al-Azhar University, Cairo, Egypt; 3Department of Pharmaceutics and Industrial Pharmacy, Faculty of Pharmacy, Beni Suef University, Beni Suef, EgyptAbstract: This study aimed to develop an optimized depot injectable atorvastatin (ATR biodegradable in situ gel (ISG system with minimum initial burst using a central composite design. The factors selected were poly (D, L-lactide-co-glycolide (PLGA concentration (X1, molecular weight of polyethylene glycol (PEG (X2, and PEG concentration (X3. The independent variables were the initial burst of ATR after 2 (Y1 and 24 hours (Y2. The optimized formulation was investigated using scanning electron microscopy, Fourier transform infrared spectroscopy, and in vitro drug release in phosphate-buffered saline of pH 7.4 for 72 hours. The in vivo pharmacokinetic study of the optimized ATR-ISG and the corresponding PEG-free ATR-ISG were conducted by intramuscular injection of a single dose (2 mg/kg of ATR in male New Zealand White rabbits. A double-blind, randomized, parallel design was used in comparison with those of the marketed ATR tablet. Statistical analysis revealed that PLGA concentration and the molecular weight of PEG have pronounced effects on both Y1 and Y2. The optimized formulation was composed of 36.10% PLGA, PEG 6000, and 15.69% PEG, and exhibited characteristic in vitro release pattern with minimal initial burst. Incorporation of PEG in the formulation causes a slight decrease in the glass transition temperature value of PLGA, leading to a slight change in Fourier transform infrared spectroscopy spectrum due to possible interaction. Moreover, scanning electron microscopy photomicrograph showed smooth

  5. Transformación de la aflatoxina B1 de alimentos, en el cancerígeno humano, aducto AFB1-ADN

    Directory of Open Access Journals (Sweden)

    Magda Carvajal

    2013-01-01

    Full Text Available Las aflatoxinas (AF son metabolitos secundarios tóxicos principalmente de los hongos Aspergillus flavus y A. parasiticus, son potentes mutágenos y cancerígenos de alimentos y la exposición del hombre a ellas es continuo. Las AF se ligan al ADN, ARN y proteínas formando aductos AFB1-ADN que se acumulan por años y dañan desde los virus hasta el hombre. Es importante identificar y cuantificar estos aductos como biomarcadores de largo tiempo de riesgo de enfermedad, ya que originan mutaciones y cáncer, y están validados en animales y humanos. Las AF se activan en presencia del citocromo P450 como una molécula inestable 8,9 epóxido AFB1, que se liga al N7 de la guanina, y se transforma en los cancerígenos activos o aductos AFB1-Gua y, finalmente, en los aductos AFB1-FAPY y son una medida objetiva de la exposición humana a cancerígenos ambientales. Los aductos representan la exposición, absorción, distribución, metabolismo, reparación del ADN y cambio celular. Los temas tratados aquí son la formación de aductos AFB1-ADN, estudios in vitro e in vivo, exposición a una dieta con AFB1, efectos, desarrollo de cáncer y mutaciones en el gen supresor p53, rutas de exposición, vitaminas, tipos de aducto AFB1-ADN, metodología y su control.

  6. Prompt Gamma Activation Analysis of the Nyírlugos obsidian core depot find

    Directory of Open Access Journals (Sweden)

    Zsolt Kasztovszky

    2014-03-01

    Full Text Available The Nyírlugos obsidian core depot find is one of the most important lithic assemblages in the collection of the Hungarian National Museum (HNM. The original set comprised 12 giant obsidian cores, of which 11 are currently on the permanent archaeological exhibition of the HNM. One of the cores is known to be inDebrecen. The first publication attributed the hoard, on the strength of giant (flint blades known from the Early and Middle Copper Age Tiszapolgár and Bodrogkeresztúr cultures, to the Copper Age. In the light of recent finds it is more likely to belong to the Middle Neolithic period. The source area was defined as Tokaj Mts., about100 kmto the NW from Nyírlugos. The size and beauty of the exceptional pieces exclude any invasive analysis. Using Prompt Gamma Activation Analysis (PGAA, we can measure major chemical components and some key trace elements of stone artefacts with adequate accuracy to successfully determine provenance of obsidian. Recent methodological development also facilitated the study of relatively large objects like the Nyírlugos cores. The cores were individually measured by PGAA. The results show that the cores originate from the Carpathian 1 sources, most probably the Viničky variety (C1b. The study of the hoard as a batch is an important contribution to the assessment of prehistoric trade and allows us to reconsider the so-called Carpathian, especially Carpathian 1 (Slovakian sources.

  7. Enhanced intelligent water drops algorithm for multi-depot vehicle routing problem.

    Science.gov (United States)

    Ezugwu, Absalom E; Akutsah, Francis; Olusanya, Micheal O; Adewumi, Aderemi O

    2018-01-01

    The intelligent water drop algorithm is a swarm-based metaheuristic algorithm, inspired by the characteristics of water drops in the river and the environmental changes resulting from the action of the flowing river. Since its appearance as an alternative stochastic optimization method, the algorithm has found applications in solving a wide range of combinatorial and functional optimization problems. This paper presents an improved intelligent water drop algorithm for solving multi-depot vehicle routing problems. A simulated annealing algorithm was introduced into the proposed algorithm as a local search metaheuristic to prevent the intelligent water drop algorithm from getting trapped into local minima and also improve its solution quality. In addition, some of the potential problematic issues associated with using simulated annealing that include high computational runtime and exponential calculation of the probability of acceptance criteria, are investigated. The exponential calculation of the probability of acceptance criteria for the simulated annealing based techniques is computationally expensive. Therefore, in order to maximize the performance of the intelligent water drop algorithm using simulated annealing, a better way of calculating the probability of acceptance criteria is considered. The performance of the proposed hybrid algorithm is evaluated by using 33 standard test problems, with the results obtained compared with the solutions offered by four well-known techniques from the subject literature. Experimental results and statistical tests show that the new method possesses outstanding performance in terms of solution quality and runtime consumed. In addition, the proposed algorithm is suitable for solving large-scale problems.

  8. Active motions of Brownian particles in a generalized energy-depot model

    International Nuclear Information System (INIS)

    Zhang Yong; Koo Kim, Chul; Lee, Kong-Ju-Bock

    2008-01-01

    We present a generalized energy-depot model in which the rate of conversion of the internal energy into motion can be dependent on the position and velocity of a particle. When the conversion rate is a general function of the velocity, the active particle exhibits diverse patterns of motion, including a braking mechanism and a stepping motion. The phase trajectories of the motion are investigated in a systematic way. With a particular form of the conversion rate dependent on the position and velocity, the particle shows a spontaneous oscillation characterizing a negative stiffness. These types of active behaviors are compared with similar phenomena observed in biology, such as the stepping motion of molecular motors and amplification in the hearing mechanism. Hence, our model can provide a generic understanding of the active motion related to the energy conversion and also a new control mechanism for nano-robots. We also investigate the effect of noise, especially on the stepping motion, and observe random walk-like behavior as expected.

  9. ANALISIS HIGIENE SANITASI DEPOT AIR MINUM ISI ULANG (DAMIU DI SEKITAR UNIVERSITAS ISLAM RIAU

    Directory of Open Access Journals (Sweden)

    Fitri Mairizki

    2017-10-01

    Full Text Available The existence of Drinking Water Refill Depot (DAMIU continues to increase appropriate with the dynamics of community needs for drinking water that has good quality and safe for consumption. Although it had a low price, not all DAMIU product guaranteed safety. DAMIU  as  an alternative choice to fulfill the community needs for drinking water becomes a risk that harmful to health if consumers did  not pay attention in DAMIU hygiene and sanitation. Therefore, the purpose of this study was to analyze hygiene and sanitation of  DAMIU building, equipment and operator. The type of this research was descriptive research.The data obtained in this study was primary data in the form of observation using checklist sheet. The data was presented in tabular form and discussed descriptively. In general, hygiene and sanitation of DAMIU building and equipment were good but the sanitation facilities still minimals, the wash basin for operators and its tools were not available. There were  several of operators hygiene must be considered. All operators did not using special uniform for work, did not conducting periodic medical examinations and did not have sertificate of hygiene sanitation course.

  10. RISK MANAGEMENT AND RISK COMMUNICATION IN MOZAMBIQUE: THE CASE OF ARMS AND AMMUNITION DEPOTS OF MALHAZINE

    Directory of Open Access Journals (Sweden)

    Luca Bussotti

    2017-12-01

    Full Text Available Risk management and risk communication affect everybody’s daily life. Local authorities have the duty to manage public structures, to inform civilians of the risks coming from these structures, to implement prophylaxis procedures. Military storage sites are fully included in this category. This article presents – through a qualitative methodology based on risk analysis – how risk management and communication in weapons and ammunition warehouses is managed in a “partially free” country, using as a case-study, the Malhazine depot in Mozambique, which resulted in more than 100 deaths. In 2007, an extraordinary accident related to the management of obsolete conventional weapons occurred at the Malazhine warehouse. In this circumstance, the Mozambican Government adopted a policy of classifying the information “highly confidential”. This policy aimed at obscuring facts and responsibilities by hiding the causes of such a huge tragedy. This article concludes with the consideration that a high level of confidentiality in treating issues of public interest, such as the one kept in regard to Malhazine, does not help public authorities to effectively manage and prevent similar risks from occurring again, with resulting negative impacts on local populations.

  11. Scaling up depot medroxyprogesterone acetate (DMPA): a systematic literature review illustrating the AIDED model.

    Science.gov (United States)

    Curry, Leslie; Taylor, Lauren; Pallas, Sarah Wood; Cherlin, Emily; Pérez-Escamilla, Rafael; Bradley, Elizabeth H

    2013-08-02

    Use of depot medroxyprogesterone acetate (DMPA), often known by the brand name Depo-Provera, has increased globally, particularly in multiple low- and middle-income countries (LMICs). As a reproductive health technology that has scaled up in diverse contexts, DMPA is an exemplar product innovation with which to illustrate the utility of the AIDED model for scaling up family health innovations. We conducted a systematic review of the enabling factors and barriers to scaling up DMPA use in LMICs. We searched 11 electronic databases for academic literature published through January 2013 (n = 284 articles), and grey literature from major health organizations. We applied exclusion criteria to identify relevant articles from peer-reviewed (n = 10) and grey literature (n = 9), extracting data on scale up of DMPA in 13 countries. We then mapped the resulting factors to the five AIDED model components: ASSESS, INNOVATE, DEVELOP, ENGAGE, and DEVOLVE. The final sample of sources included studies representing variation in geographies and methodologies. We identified 15 enabling factors and 10 barriers to dissemination, diffusion, scale up, and/or sustainability of DMPA use. The greatest number of factors were mapped to the ASSESS, DEVELOP, and ENGAGE components. Findings offer early empirical support for the AIDED model, and provide insights into scale up of DMPA that may be relevant for other family planning product innovations.

  12. Light Control of Insulin Release and Blood Glucose Using an Injectable Photoactivated Depot.

    Science.gov (United States)

    Sarode, Bhagyesh R; Kover, Karen; Tong, Pei Y; Zhang, Chaoying; Friedman, Simon H

    2016-11-07

    In this work we demonstrate that blood glucose can be controlled remotely through light stimulated release of insulin from an injected cutaneous depot. Human insulin was tethered to an insoluble but injectable polymer via a linker, which was based on the light cleavable di-methoxy nitrophenyl ethyl (DMNPE) group. This material was injected into the skin of streptozotocin-treated diabetic rats. We observed insulin being released into the bloodstream after a 2 min trans-cutaneous irradiation of this site by a compact LED light source. Control animals treated with the same material, but in which light was blocked from the site, showed no release of insulin into the bloodstream. We also demonstrate that additional pulses of light from the light source result in additional pulses of insulin being absorbed into circulation. A significant reduction in blood glucose was then observed. Together, these results demonstrate the feasibility of using light to allow for the continuously variable control of insulin release. This in turn has the potential to allow for the tight control of blood glucose without the invasiveness of insulin pumps and cannulas.

  13. Behavior of Particle Depots in Molten Silicon During Float-Zone Growth in Strong Magnetic Fields

    Science.gov (United States)

    Jauss, T.; Croell, A.; SorgenFrei, T.; Azizi, M.; Reimann, C.; Friedrich, J.; Volz, M. P.

    2014-01-01

    Solar cells made from directionally solidified silicon cover 57% of the photovoltaic industry's market [1]. One major issue during directional solidification of silicon is the precipitation of foreign phase particles. These particles, mainly SiC and Si3N4, are precipitated from the dissolved crucible coating, which is made of silicon nitride, and the dissolution of carbon monoxide from the furnace atmosphere. Due to their hardness and size of several hundred micrometers, those particles can lead to severe problems during the wire sawing process for wafering the ingots. Additionally, SiC particles can act as a shunt, short circuiting the solar cell. Even if the particles are too small to disturb the wafering process, they can lead to a grit structure of silicon micro grains and serve as sources for dislocations. All of this lowers the yield of solar cells and reduces the performance of cells and modules. We studied the behaviour of SiC particle depots during float-zone growth under an oxide skin, and strong static magnetic fields. For high field strengths of 3T and above and an oxide layer on the sample surface, convection is sufficiently suppressed to create a diffusive like regime, with strongly dampened convection [2, 3]. To investigate the difference between atomically rough phase boundaries and facetted growth, samples with [100] and [111] orientation were processed.

  14. Evaluation of bromide mass discharge in a sandy aquifer at Vandenberg AFB, CA

    Science.gov (United States)

    Mackay, D. M.; Rasa, E.; Einarson, M.; Kaiser, P.; Chakraborty, I.; Scow, K. M.

    2009-12-01

    Side-by-side experiments were conducted by UC Davis research team at a former fuel station at Vandenberg Air Force Base (AFB) to evaluate the rate of transformation of methyl tert-butyl ether (MTBE) to tert-butyl alcohol (TBA) impacted by ethanol and to investigate evidence of TBA degradation under sulfate reducing conditions. On one side we injected groundwater amended with ethanol and MTBE. In the other lane we injected groundwater amended with TBA. On both sides, injected ground water was spiked with bromide tracer to provide estimates of groundwater flow direction variations, flow velocity, dispersion, and mobile mass loss resulting from diffusive sequestration into aquitards. 162 monitoring wells were aligned into seven transects located downgradient of the injection wells. The mass discharge approach was used to evaluate the natural attenuation of the injected constituents. In this talk we will focus on calculations of mass discharge of the bromide tracer at each of the seven monitoring well transects. The amount of bromide mass discharged through each transect was calculated for any sampling time using field measurements of break through curves. Cumulative mass discharges were estimated and, by iteration based on mass balance, the flow properties of the aquifer were estimated. The calibration process resulted in subtle but quantitatively important changes in our assumptions regarding key physical properties of the aquifer (thickness, porosity) which could be only approximately estimated by standard methods (coring, CPT, etc.). On the basis of this calibration, a more robust approach was devised for evaluating the source and fate of TBA in the aquifer.

  15. Frequency of sputum positive AFB cases among patients of pulmonary tuberculosis in tertiary care hospitals of northern Pakistan

    International Nuclear Information System (INIS)

    Khattak, M.I.; Zaman, M.; Ihsanullah; Muhammad, A.; Khan, N.

    2010-01-01

    Objective: This study was aimed to find out the frequency of sputum positive Acid Fast Bacilli (AFB) cases among pulmonary tuberculosis patients and to determine those patients who are the potential source of transmitting infection. Methods: This study was conducted in four medical units of Khyber Teaching Hospital, Peshawar and Chest Unit, Ayub Teaching Hospital, Abbottabad in collaboration with the pathology unit of Khyber Teaching Hospital, Peshawar, and Kohat Institute of Medical Sciences, Kohat. Three specimens of sputum were collected for three consecutive days in the morning and were transported immediately to the laboratory along with full details of the patients. Results: Out of two hundred total patients studied, 104 patients (52%) were sputum AFB positive. Among the 104 patients 60 patients (57.4%) were females. Sixty-four (61.52%) individuals were between 20-50 years. Majority of the patients were from poor, deprived and lower social class. Fifty-two (50%) patients had monthly income of less than Rs. 4,000; only 8 patients (7.67%) had monthly income of more than Rs. 12,000). Forty-eight patients <46.12% were house wives, 10 patients (9.61%) were unemployed. Most of the patients were under weight for their age and height. 24 patients (23.06%) were below 42 kg. The maximum (53.84%) number of patients was in weight range of 43-50 kg. Conclusion: Sputum AFB positive pulmonary tuberculosis is more in individuals of low socioeconomic group and in females. The patients put their children and family members at risk of tuberculosis infection. For the control of this disease early diagnosis of active disease and their treatment under supervision is important. (author)

  16. Pope AFB, Fayetteville, North Carolina Revised Uniform Summary of Surface Weather Observations (RUSSWO). Parts A-F.

    Science.gov (United States)

    1984-06-01

    SERVICE/HAC T23030 POPE AFB NC 7[-81111 STAT ION STATION lNA&Ayl MSSgll’ TemN. WIT SULS TEMPERATURE DEPRESSIO (F) TOTAL TOTAL (F) 0 1.2 3 - 5 - 1- 19...STATINASha T PAGE 1 TWET BULB TEMPERATURE DEPRESSIO (F) TOTAL TOTAL * (F) 0 1.2 3-4 3-6 7-8 9.10 11-12113-14 15.16 17-1 19-.20 21.22123-24 25.2627.3 29.n 30 l

  17. Adipose tissue endocannabinoid system gene expression: depot differences and effects of diet and exercise

    Directory of Open Access Journals (Sweden)

    Yang Rongze

    2011-10-01

    Full Text Available Abstract Background Alterations of endocannabinoid system in adipose tissue play an important role in lipid regulation and metabolic dysfunction associated with obesity. The purpose of this study was to determine whether gene expression levels of cannabinoid type 1 receptor (CB1 and fatty acid amide hydrolase (FAAH are different in subcutaneous abdominal and gluteal adipose tissue, and whether hypocaloric diet and aerobic exercise influence subcutaneous adipose tissue CB1 and FAAH gene expression in obese women. Methods Thirty overweight or obese, middle-aged women (BMI = 34.3 ± 0.8 kg/m2, age = 59 ± 1 years underwent one of three 20-week weight loss interventions: caloric restriction only (CR, N = 9, caloric restriction plus moderate-intensity aerobic exercise (CRM, 45-50% HRR, N = 13, or caloric restriction plus vigorous-intensity aerobic exercise (CRV, 70-75% HRR, N = 8. Subcutaneous abdominal and gluteal adipose tissue samples were collected before and after the interventions to measure CB1 and FAAH gene expression. Results At baseline, FAAH gene expression was higher in abdominal, compared to gluteal adipose tissue (2.08 ± 0.11 vs. 1.78 ± 0.10, expressed as target gene/β-actin mRNA ratio × 10-3, P Conclusions There are depot differences in subcutaneous adipose tissue endocannabinoid system gene expression in obese individuals. Aerobic exercise training may preferentially modulate abdominal adipose tissue endocannabinoid-related gene expression during dietary weight loss. Trial Registration ClinicalTrials.gov: NCT00664729.

  18. A comparative study of Cyclofem and depot medroxyprogesterone acetate (DMPA) effects on endometrial vasculature.

    Science.gov (United States)

    Simbar, Masoumeh; Tehrani, Fahimeh Ramezani; Hashemi, Zeinab; Zham, Hananeh; Fraser, Ian S

    2007-10-01

    The most common reason for discontinuation of long-acting progestogen-only contraceptives is irregular bleeding following local endometrial vascular changes. To reduce unpredictable bleeding episodes among depot medroxyprogesterone acetate (DMPA) users, the combined injectable contraceptive, Cyclofem, was offered as an alternative. However, there is a gap in our knowledge about the effects of Cyclofem on the endometrial vasculature and patterns of bleeding. This study aimed to compare the effects of Cyclofem and DMPA on endometrial vascular density, endometrial histology and pattern of bleeding. Sixty-eight healthy women with regular menstrual bleeding and seeking injectable long-acting contraceptives were recruited. Two endometrial samples (before and 3 to 6 months after initial exposure to DMPA or Cyclofem) were collected from each participant. The samples were stained using an immunohistochemical method and anti-CD34 to visualise the endometrial vasculature. Endometrial vascular density was assessed using standard techniques. Sixty-eight women were randomly assigned to Cyclofem (38 women) or DMPA (30 women). Endometrial vascular density was 149.3 +/- 6.7 (mean +/- SD)/mm(2) before injection. This significantly decreased to 132.4 +/- 12.2 after DMPA use, and from 151.9 +/- 5.8 to 131.8 +/- 12.8 vessels/mm(2) following Cyclofem use (paired t-test, p Spotting was the most common type of bleeding experienced, and atrophic endometrium was the most common histological pattern observed in both groups. This study demonstrated that both Cyclofem and DMPA use are associated with decreased endometrial vascular density and atrophic endometrium, in addition to irregular bleeding, mainly spotting. There was no significant difference in bleeding patterns or endometrial findings observed for these two injectable contraceptives in Iranian women.

  19. IGFBP4 Is Required for Adipogenesis and Influences the Distribution of Adipose Depots.

    Science.gov (United States)

    Maridas, David E; DeMambro, Victoria E; Le, Phuong T; Mohan, Subburaman; Rosen, Clifford J

    2017-10-01

    Insulinlike growth factor (IGF) I induces adipogenesis in vitro. IGF-binding protein 4 (IGFBP4) is highly expressed in adipocytes and osteoblasts and is inhibitory of IGFs in vitro. We previously reported that Igfbp4 null mice (Igfbp4-/-) had decreased fat proportions at 8 and 16 weeks of age. However, the mechanism leading to the reduced adiposity remains unknown. The purpose of this study was to elucidate how IGFBP4 mediates adipose tissue development in vivo. Our results showed that inguinal and gonadal white adipose tissue (gWAT) from Igfbp4-/- mice had decreased weights and Pparγ expression. Cultures of primary bone marrow stromal cells (BMSCs) and ear mesenchymal stem cells (eMSCs) from mutant mice showed reduced adipogenesis. Both BMSCs and eMSC had a strong induction of Igfbp4 expression during adipogenesis. Furthermore, the increase in phosphorylated Akt (p-Akt), a downstream target of IGF-I signaling, in wild-type cells, was blunted in mutant eMSCs. On a high-fat diet (HFD) there were sexual differences in adipocyte expansion of Igfbp4-/- mice. Mutant males gained weight by expanding their white fat depots. However, Igfbp4-/- female mice were protected against diet-induced obesity. Ovariectomized Igfbp4-/- female mice gained weight in a manner similar to that seen in ovariectomized controls. Thus, Igfbp4 is required for inguinal fat expansion in female mice but not in male mice. However, gWAT expansion, which is prevented by estrogen during HFD, does not require Igfbp4. Copyright © 2017 Endocrine Society.

  20. Depot-Specific Changes in Fat Metabolism with Aging in a Type 2 Diabetic Animal Model.

    Science.gov (United States)

    Park, Se Eun; Park, Cheol-Young; Choi, Jung Mook; Chang, Eugene; Rhee, Eun-Jung; Lee, Won-Young; Oh, Ki Won; Park, Sung Woo; Kang, Eun Seok; Lee, Hyun Chul; Cha, Bong Soo

    2016-01-01

    Visceral fat accretion is a hallmark of aging and is associated with aging-induced metabolic dysfunction. PPARγ agonist was reported to improve insulin sensitivity by redistributing fat from visceral fat to subcutaneous fat. The purpose of this study was to investigate the underlying mechanisms by which aging affects adipose tissue remodeling in a type 2 diabetic animal model and through which PPARγ activation modulates aging-related fat tissue distribution. At the ages of 21, 31 and 43 weeks, OLETF rats as an animal model of type 2 diabetes were evaluated for aging-related effects on adipose tissue metabolism in subcutaneous and visceral fat depots. During aging, the ratio of visceral fat weight to subcutaneous fat weight (V/S ratio) increased. Aging significantly increased the mRNA expression of genes involved in lipogenesis such as lipoprotein lipase, fatty acid binding protein aP2, lipin 1, and diacylglycerol acyltransferase 1, which were more prominent in visceral fat than subcutaneous fat. The mRNA expression of adipose triglyceride lipase, which is involved in basal lipolysis and fatty acid recycling, was also increased, more in visceral fat compared to subcutaneous fat during aging. The mRNA levels of the genes associated with lipid oxidation were increased, whereas the mRNA levels of genes associated with energy expenditure showed no significant change during aging. PPARγ agonist treatment in OLETF rats resulted in fat redistribution with a decreasing V/S ratio and improved glucose intolerance. The genes involved in lipogenesis decreased in visceral fat of the PPARγ agonist-treated rats. During aging, fat distribution was changed by stimulating lipid uptake and esterification in visceral fat rather than subcutaneous fat, and by altering the lipid oxidation.

  1. Depot-Specific Changes in Fat Metabolism with Aging in a Type 2 Diabetic Animal Model.

    Directory of Open Access Journals (Sweden)

    Se Eun Park

    Full Text Available Visceral fat accretion is a hallmark of aging and is associated with aging-induced metabolic dysfunction. PPARγ agonist was reported to improve insulin sensitivity by redistributing fat from visceral fat to subcutaneous fat. The purpose of this study was to investigate the underlying mechanisms by which aging affects adipose tissue remodeling in a type 2 diabetic animal model and through which PPARγ activation modulates aging-related fat tissue distribution. At the ages of 21, 31 and 43 weeks, OLETF rats as an animal model of type 2 diabetes were evaluated for aging-related effects on adipose tissue metabolism in subcutaneous and visceral fat depots. During aging, the ratio of visceral fat weight to subcutaneous fat weight (V/S ratio increased. Aging significantly increased the mRNA expression of genes involved in lipogenesis such as lipoprotein lipase, fatty acid binding protein aP2, lipin 1, and diacylglycerol acyltransferase 1, which were more prominent in visceral fat than subcutaneous fat. The mRNA expression of adipose triglyceride lipase, which is involved in basal lipolysis and fatty acid recycling, was also increased, more in visceral fat compared to subcutaneous fat during aging. The mRNA levels of the genes associated with lipid oxidation were increased, whereas the mRNA levels of genes associated with energy expenditure showed no significant change during aging. PPARγ agonist treatment in OLETF rats resulted in fat redistribution with a decreasing V/S ratio and improved glucose intolerance. The genes involved in lipogenesis decreased in visceral fat of the PPARγ agonist-treated rats. During aging, fat distribution was changed by stimulating lipid uptake and esterification in visceral fat rather than subcutaneous fat, and by altering the lipid oxidation.

  2. CHAWS user`s guide: System description and standard operating procedures, Lexington-Blue Grass Army Depot

    Energy Technology Data Exchange (ETDEWEB)

    Martins, S.A.; Shinn, J.H. [eds.

    1993-05-01

    The Chemical Hazard Warning System (CHAWS) is designed to collect meteorological data and to display, in real time, the dispersion of hazardous chemicals that may result from an accidental release. Meteorological sensors have been placed strategically around the Lexington-Blue Grass Army Depot and are used to calculate direction and hazard distance for the release. Based on these data, arrows depicting the release direction and distance traveled are graphically displayed on a computer screen showing a site map of the facility. The objectives of CHAWS are as follows: To determine the trajectory of the center of mass of released material from the measured wind field; to calculate the dispersion of the released material based on the measured lateral turbulence intensity (sigma theta); to determine the height of the mixing zone by measurement of the inversion height and wind profiles up to an altitude of about 1 km at sites that have SODAR units installed; to archive meteorological data for potential use in climatological descriptions for emergency planning; to archive air-quality data for preparation of compliance reports; and to provide access to the data for near real time hazard analysis purposes. CHAWS sites are located at the Pine Bluff Arsenal, Arkansas, Edgewood area of Aberdeen Proving Ground, Maryland, Tooele Depot, Utah, Lexington-Blue Grass Depot, Kentucky, and Johnston Island in the Pacific. The systems vary between sites with different features and various types of hardware. The basic system, however, is the same. Nonetheless, we have tailored the manuals to the equipment found at each site.

  3. [French Society for Biological Psychiatry and Neuropsychopharmacology task force: Formal Consensus for the prescription of depot antipsychotics].

    Science.gov (United States)

    Samalin, L; Abbar, M; Courtet, P; Guillaume, S; Lancrenon, S; Llorca, P-M

    2013-12-01

    Compliance is often partial with oral antipsychotics and underestimated for patients with serious mental illness. Despite their demonstrated advantages in terms of relapse prevention, depot formulations are still poorly used in routine. As part of a process to improve the quality of care, French Association for Biological Psychiatry and Neuropsychopharmacology (AFPBN) Task Force elaborated a Formal Consensus for the prescription of depot antipsychotics in clinical practice. The Task Force recommends as first-line choice, the use of long-acting injectable (LAI) second-generation antipsychotics in patients with schizophrenia, schizoaffective disorder and delusional disorder. They can be considered as a second-line option as a monotherapy to prevent manic recurrence or in combination with mood stabilizer to prevent depressive recurrence in the maintenance treatment of bipolar disorder. LAI second-generation antipsychotics can also be used after a first episode of schizophrenia. Depot neuroleptics are not recommended during the early course of schizophrenia and are not appropriate in bipolar disorder. They are considered as a second-line option for maintenance treatment in schizophrenia. LAI formulations should be systematically proposed to any patients for whom maintenance antipsychotic treatment is indicated. LAI antipsychotics can be used preferentially for non-compliant patients with frequent relapses or aggressive behaviors. A specific information concerning the advantages and inconveniences of the LAI formulations, in the framework of shared-decision making must be delivered to each patient. Recommendations for switching from one oral/LAI form to another LAI and for using LAI antipsychotics in specific populations (pregnant women, elderly patients, subjects in a precarious situation, and subjects having to be treated in a prison establishment) are also proposed. Copyright © 2013 L’Encéphale. Published by Elsevier Masson SAS.. All rights reserved.

  4. Treatment of central precocious puberty by subcutaneous injections of leuprorelin 3-month depot (11.25 mg).

    Science.gov (United States)

    Carel, Jean-Claude; Lahlou, Najiba; Jaramillo, Orlando; Montauban, Vincent; Teinturier, Cécile; Colle, Michel; Lucas, Christel; Chaussain, Jean Louis

    2002-09-01

    Depot GnRH agonists are widely used for the treatment of precocious puberty. Leuprorelin 3-month depot is currently used in adults but has not been evaluated in children. We evaluated the efficacy of this new formulation (11.25 mg every 3 months), for the suppression of gonadotropic activation and pubertal signs in children with central precocious puberty. We included 44 children (40 girls) with early-onset pubertal development in a 6-month open trial. The inclusion criteria were clinical pubertal development before the age of 8 (girls) or 10 (boys), advanced bone age, enlarged uterus (>36 mm), testosterone more than 1.7 nmol/liter (boys), and pubertal response of LH to GnRH (peak >5 IU/liter). The principal criterion for efficacy assessment, GnRH-stimulated LH peak less than 3 IU/liter, was met in 81 of 85 (95%) of the tests performed at months 3 and 6. The remaining four values were slightly above the threshold. The levels of sex steroids were also significantly reduced and clinical pubertal development was arrested. Plasma leuprorelin levels, measured every 30 d, were essentially stable after d 60. Local intolerance was noted after 10 of 86 injections (12%), and was mild in four cases, moderate in five cases, and severe in one. Among these 10 events, 4 consisted in local pain at injection's site. In conclusion, leuprorelin 3-month depot efficiently inhibits the gonadotropic axis in 95% of children with central precocious puberty studied for a 6-month period. This regimen allows the reduction of the number of yearly injections from 12 to 4.

  5. A comparative study of cross sectional anatomy and computer tomography of perirenal fat depots in New Zealand White rabbits

    International Nuclear Information System (INIS)

    Yonkova, P.; Dimitrov, R.; Toneva, J.; Zapryanova, D.

    2010-01-01

    CT is a contemporary non-invasive imaging technique that gains an increasing importance for in vivo investigations of subcutaneous and visceral fat. The purpose of this investigation was to describe the topography and anatomy imaging features of perirenal fat depots at the level of both kidneys in clinically healthy New Zealand White rabbits that attained slaughter weight. The CT consecutive transverse scans from the last thoracic to the fifth lumbar vertebrae showed that in rabbits, perirenal fat appeared as a homogeneous hypodense structure at the background of denser shadows of lumbar and abdominal muscles, kidneys and abdominal organs. Perirenal fat depot exhibited a soft tissue density with average attenuation of −120.97±4.73 HU. On CT scans, the largest dimensions of the perirenal fat depot were 1.3±0.01 cm at the level of the right kidneys cranial pole; 1.96 cm in the plane where the right renal hilus was visualized; 1.66±0.08 cm at the level of the right kidneys caudal pole; 1.10±0.18 cm in the plane where the left renal hilus was visualized and 1.06±0.15 cm at the level of the left kidneys caudal pole. No subcutaneous fat deposits in the abdominal area were seen. Results obtained in the present study could be used as basic information for various anatomy investigations of rabbits as well as experimental designs for study of obesity in animals and humans. (author)

  6. Label Free QCM Immunobiosensor for AFB1 Detection Using Monoclonal IgA Antibody as Recognition Element

    Directory of Open Access Journals (Sweden)

    Özlem Ertekin

    2016-08-01

    Full Text Available This study introduces the use of an IgA isotype aflatoxin (AF specific monoclonal antibody for the development of a highly sensitive Quartz Crystal Microbalance (QCM immunobiosensor for the detection of AF in inhibitory immunoassay format. The higher molecular weight of IgA antibodies proved an advantage over commonly used IgG antibodies in label free immunobiosensor measurements. IgA and IgG antibodies with similar affinity for AF were used in the comparative studies. Sensor surface was prepared by covalent immobilization of AFB1, using self assembled monolayer (SAM formed on gold coated Quartz Crystal, with 1-Ethyl-3-(3-dimethylaminopropyl carbodiimide/N-hydroxy succinimide (EDC/NHS method using a diamine linker. Nonspecific binding to the surface was decreased by minimizing the duration of EDC/NHS activation. Sensor surface was chemically blocked after AF immobilization without any need for protein blocking. This protein free sensor chip endured harsh solutions with strong ionic detergent at high pH, which is required for the regeneration of the high affinity antibody-antigen interaction. According to the obtained results, the detection range with IgA antibodies was higher than IgG antibodies in QCM immunosensor developed for AFB1.

  7. Feasibility Study of Economics and Performance of Wind Turbine Generators at the Newport Indiana Chemical Depot Site

    Energy Technology Data Exchange (ETDEWEB)

    Roberts, Joseph Owen [National Renewable Energy Lab. (NREL), Golden, CO (United States); Mosey, Gail [National Renewable Energy Lab. (NREL), Golden, CO (United States)

    2013-11-01

    The U.S. Environmental Protection Agency (EPA), in accordance with the RE-Powering America's Land initiative, selected the Newport Indiana Chemical Depot site in Newport, Indiana, for a feasibility study of renewable energy production. The National Renewable Energy Laboratory (NREL) was contacted to provide technical assistance for this project. The purpose of this report is to assess the sitefor possible wind turbine electrical generator installation and estimate the cost, performance, and site impacts of different wind energy options. In addition, the report recommends financing options that could assist in the implementation of a wind system at the site.

  8. Desaturation of skeletal muscle structural and depot lipids in obese individuals during a very-low-calorie diet intervention

    DEFF Research Database (Denmark)

    Haugaard, Steen B; Vaag, Allan; Høy, Carl-Erik

    2007-01-01

    would decrease saturated fatty acids (FAs) and increase long-chain polyunsaturated FAs (LCPUFAs) in muscular structural lipids, as such changes have been associated with improved insulin sensitivity. RESEARCH METHODS AND PROCEDURES: Skeletal muscle biopsies (vastus lateralis) were obtained from 13 obese...... during the VLCD. DISCUSSION: Desaturation of both muscle cell membrane phospholipid and IMTG was significant but modest during a VLCD in obese subjects. Further research must delineate whether such changes in skeletal muscle structural and depot lipid composition themselves are enough to promote...

  9. Desaturation of skeletal muscle structural and depot lipids in obese individuals during a very-low-calorie diet intervention

    DEFF Research Database (Denmark)

    Haugaard, S.B.; Vaag, A.; Høy, Carl-Erik

    2007-01-01

    would decrease saturated fatty acids (FAs) and increase long-chain polyunsaturated FAs (LCPUFAs) in muscular structural lipids, as such changes have been associated with improved insulin sensitivity. Research Methods and Procedures: Skeletal muscle biopsies (vastus lateralis) were obtained from 13 obese....... Discussion: Desaturation of both muscle cell membrane phospholipid and IMTG was significant but modest during a VLCD in obese subjects. Further research must delineate whether such changes in skeletal muscle structural and depot lipid composition themselves are enough to promote the observed improvements...

  10. Contribution to the study of the electrodeposition of iron-nickel alloys; Contribution a l'etude du depot electrolytique des alliages fer-nickel

    Energy Technology Data Exchange (ETDEWEB)

    Valignat, J [Commissariat a l' Energie Atomique, Grenoble (France). Centre d' Etudes Nucleaires

    1967-12-01

    Using a coulometric technique based upon the anodic intentiostatic dissolution, we studied the potentiostatic, deposition of nickel, iron and nickel iron alloys. We have shown that the minimum of the curve I = f (t) (deposition current versus time) is probably due to the transitory blocking of the surface by hydrogen and that the syn-crystallisation of nickel and iron is responsible for the anomalous co-deposition of these two elements. (author) [French] En employant une methode coulometrique par dissolution anodique intensipstatique, nous avons etudie le depot potentiostatique du nickel, du fer et des alliages fer-nickel. Nous avons pu montrer que le minimum de la courbe I = f (t) enregistree au cours du depot est du probablement au blocage momentane de la surface par l'hydrogene et que la syncristallisation du fer et du nickel est responsable de l'anomalie du depot simultane de ces deux elements. (auteur)

  11. Assisted suicide and the killing of people? Maybe. Physician-assisted suicide and the killing of patients? No: the rejection of Shaw's new perspective on euthanasia.

    Science.gov (United States)

    McLachlan, Hugh V

    2010-05-01

    David Shaw presents a new argument to support the old claim that there is not a significant moral difference between killing and letting die and, by implication, between active and passive euthanasia. He concludes that doctors should not make a distinction between them. However, whether or not killing and letting die are morally equivalent is not as important a question as he suggests. One can justify legal distinctions on non-moral grounds. One might oppose physician-assisted suicide and active euthanasia when performed by doctors on patients whether or not one is in favour of the legalisation of assisted suicide and active euthanasia. Furthermore, one can consider particular actions to be contrary to appropriate professional conduct even in the absence of legal and ethical objections to them. Someone who wants to die might want only a doctor to kill him or to help him to kill himself. However, we are not entitled to everything that we want in life or death. A doctor cannot always fittingly provide all that a patient wants or needs. It is appropriate that doctors provide their expert advice with regard to the performance of active euthanasia but they can and should do so while, qua doctors, they remain hors de combat.

  12. Palaeointensity Results from 1951 and 1995 Lava Flows, Fogo, Cape Verde: A Comparison between Thellier and LTD-DHT Shaw Methods

    Science.gov (United States)

    Brown, M. C.; Cropsey, J.; Bowles, J. A.; Feinberg, J. M.

    2009-12-01

    As part of an ongoing effort to link the success rate of palaeointensity experiments to specific rock magnetic properties, we present new palaeointensity results from basaltic lavas erupted in 1951 and 1995 on the island of Fogo, Cape Verde. Both Thellier and LTD-DHT Shaw palaeointensity experiments were used to estimate the historical field strength. The intensity of the field during these eruptions is constrained by data from the Mbour geomagnetic observatory (Senegal) and IGRF10. In 1951, the magnetic field intensity at Fogo was approximately 33.8 µT during the eruption of three distinct surface flows, covering approximately 14 km2. The field intensity was approximately 32.5 µT during a 1995 eruption of one large flow that extends 4 km2 across the caldera floor. Different volcanic textures were sampled from multiple sites within both the 1951 and 1995 lava flows, including glass-rich pahoehoe and aa flows, highly vesicular flows, and massive non-vesicular lava. Detailed rock magnetic measurements demonstrate that each site and texture displays distinctively different rock magnetic properties. We assess possible links between the outcome of the Thellier and LTD-DHT palaeointensity experiments and the distribution of magnetic domain states, average oxidation state, and laboratory induced alteration.

  13. Vanadate impedes adipogenesis in mesenchymal stem cells derived from different depots within bone.

    Directory of Open Access Journals (Sweden)

    Frans Alexander Jacobs

    2016-08-01

    Full Text Available Glucocorticoid induced osteoporosis (GIO is associated with an increase in bone marrow adiposity which skews the differentiation of mesenchymal stem cell (MSC progenitors away from osteoblastogenesis and towards adipogenesis. We have previously found that vanadate, a non-specific protein tyrosine phosphatase inhibitor, prevents GIO in rats, but it was unclear whether vanadate directly influenced adipogenesis in bone-derived MSCs. For the present study, we investigated the effect of vanadate on adipogenesis in primary rat MSCs derived from bone marrow (bmMSCs and from the proximal end of the femur (pfMSCs. By passage 3 after isolation, both cell populations expressed the MSC cell surface markers CD90 and CD106, but not the haematopoietic marker CD45. However, although variable, expression of the fibroblast marker CD26 was higher in pfMSCs than in bmMSCs. Differentiation studies using osteogenic and adipogenic induction media (OM and AM, respectively demonstrated that pfMSCs rapidly accumulated lipid droplets within 1 week of exposure to AM, while bmMSCs isolated from the same femur only formed lipid droplets after 3 weeks of AM treatment. Conversely, pfMSCs exposed to OM produced mineralized extracellular matrix (ECM after 3 weeks, compared to 1 week for OM-treated bmMSCs. Vanadate (10 µM added to AM resulted in a significant reduction in AM-induced intracellular lipid accumulation and expression of adipogenic gene markers (PPARγ2, aP2, adipsin in both pfMSCs and bmMSCs. Pharmacological concentrations of glucocorticoids (1 µM alone did not induce lipid accumulation in either bmMSCs or pfMSCs, but resulted in significant cell death in pfMSCs. Our findings demonstrate the existence of at least two fundamentally different MSC depots within the femur, and highlights the presence of MSCs capable of rapid adipogenesis within the proximal femur, an area prone to osteoporotic fractures. In addition, our results suggest that the increased bone marrow

  14. Study on the thermal ignition of gasoline-air mixture in underground oil depots based on experiment and numerical simulation

    Science.gov (United States)

    Ou, Yihong; Du, Yang; Jiang, Xingsheng; Wang, Dong; Liang, Jianjun

    2010-04-01

    The study on the special phenomenon, occurrence process and control mechanism of gasoline-air mixture thermal ignition in underground oil depots is of important academic and applied value for enriching scientific theories of explosion safety, developing protective technology against fire and decreasing the number of fire accidents. In this paper, the research on thermal ignition process of gasoline-air mixture in model underground oil depots tunnel has been carried out by using experiment and numerical simulation methods. The calculation result has been demonstrated by the experiment data. The five stages of thermal ignition course, which are slow oxidation stage, rapid oxidation stage, fire stage, flameout stage and quench stage, have been firstly defined and accurately descried. According to the magnitude order of concentration, the species have been divided into six categories, which lay the foundation for explosion-proof design based on the role of different species. The influence of space scale on thermal ignition in small-scale space has been found, and the mechanism for not easy to fire is that the wall reflection causes the reflux of fluids and changes the distribution of heat and mass, so that the progress of chemical reactions in the whole space are also changed. The novel mathematical model on the basis of unification chemical kinetics and thermodynamics established in this paper provides supplementary means for the analysis of process and mechanism of thermal ignition.

  15. Environmental Assessment Preparation for Air Force Test Mission in the 21st Century: Upgrade and Improve the Test Capability at the Edwards AFB Test Complex

    Science.gov (United States)

    2015-04-01

    waste NAA Nonattainment Area NAAQS National Ambient Air Quality Standards NAGPRA Native American Graves Protection and Repatriation Act NDMA N...nitrate, and N- Nitrosodimethylamine ( NDMA ) plumes exist in these OUs. Locations of groundwater plumes at Edwards AFB are indicated by their respective

  16. Pure neuritic leprosy: Resolving diagnostic issues in acid fast bacilli (AFB)-negative nerve biopsies: A single centre experience from South India.

    Science.gov (United States)

    Hui, Monalisa; Uppin, Megha S; Challa, Sundaram; Meena, A K; Kaul, Subhash

    2015-01-01

    Demonstration of lepra bacilli is essential for definite or unequivocal diagnosis of pure neuritic leprosy (PNL) on nerve biopsy. However, nerves always do not show bacilli owing to the changes of previous therapy or due to low bacillary load in tuberculoid forms. In absence of granuloma or lepra bacilli, other morphologic changes in endoneurium and perineurium can be of help in making a probable diagnosis of PNL and treating the patient with multidrug therapy. Forty-six biopsies of PNL were retrospectively reviewed and histologic findings were compared with 25 biopsies of non leprosy neuropathies (NLN) including vasculitic neuropathy and chronic inflammatory demyelinating polyneuropathy (CIDP). The distribution of endoneurial infiltrate and fibrosis, perineurial thickening, and myelin abnormalities were compared between PNL and NLN biopsies and analyzed by Chi-square test. Out of 46 PNL casses, 24 (52.17 %) biopsies were negative for acid fast bacilli (AFB). In these cases, the features which favor a diagnosis of AFB-negative PNL were endoneurial infiltrate (51.1%), endoneurial fibrosis (54.2%), perineurial thickening (70.8%), and reduced number of myelinated nerve fibers (75%). Nerve biopsy is an efficient tool to diagnose PNL and differentiate it from other causes of NLN. In absence of AFB, the diagnosis of PNL is challenging. In this article, we have satisfactorily evaluated the various hisopthological features and found that endoneurial inflammation, dense fibrosis, and reduction in the number of myelinated nerve fibers are strong supportive indicators of PNL regardless of AFB positivity.

  17. Clinical value of whole-blood interferon-gamma assay in patients with suspected pulmonary tuberculosis and AFB smear- and polymerase chain reaction-negative bronchial aspirates.

    Science.gov (United States)

    Lee, Jaehee; Lee, Shin Yup; Yoo, Seung Soo; Cha, Seung Ick; Won, Dong Il; Park, Jae Yong; Lee, Won-Kil; Kim, Chang Ho

    2012-07-01

    Combining a polymerase chain reaction (PCR) test with bronchoscopy is frequently performed to allow a rapid diagnosis of smear-negative pulmonary tuberculosis (PTB). However, limited data are available concerning clinical judgment in patients with suspected PTB and AFB smear- and PCR-negative bronchial aspirates (BA). The present study evaluated the usefulness of whole-blood QuantiFERON-TB Gold In-Tube (QFT) testing in these patients. Of 166 patients with suspected PTB who had undergone bronchoscopy because of smear-negative sputum or inadequate sputum production, 93 (56%) were diagnosed with culture-positive PTB. Seventy-four patients were either AFB smear- or PCR-positive. In the 75 patients whose BA AFB smear and PCR results were both negative, 19 were finally diagnosed with PTB by culture. The QFT test had a negative predictive value of 91% for PTB. The QFT test may be useful for excluding PTB in patients with suspected PTB whose BA AFB smear and PCR results are both negative. Copyright © 2012 Elsevier Inc. All rights reserved.

  18. Radiation inactivation of Paenibacillus larvae and sterilization of American Foul Brood (AFB) infected hives using Co-60 gamma rays

    Energy Technology Data Exchange (ETDEWEB)

    De Guzman, Zenaida M. [Microbiological Research and Service Laboratory, Atomic Research Division, Philippine Nuclear Research Institute, Diliman, Quezon City (Philippines); Cervancia, Cleofas R. [Institute of Biological Sciences, College of Arts and Sciences, University of the Philippines, Los Banos, Laguna (Philippines); Dimasuay, Kris Genelyn B.; Tolentino, Mitos M.; Abrera, Gina B.; Cobar, Ma. Lucia C. [Microbiological Research and Service Laboratory, Atomic Research Division, Philippine Nuclear Research Institute, Diliman, Quezon City (Philippines); Fajardo, Alejandro C.; Sabino, Noel G.; Manila-Fajardo, Analinda C. [Institute of Biological Sciences, College of Arts and Sciences, University of the Philippines, Los Banos, Laguna (Philippines); Feliciano, Chitho P., E-mail: cpfeliciano@pnri.dost.gov.ph [Microbiological Research and Service Laboratory, Atomic Research Division, Philippine Nuclear Research Institute, Diliman, Quezon City (Philippines); Institute of Biology, College of Science, University of the Philippines, Diliman, Quezon City (Philippines)

    2011-10-15

    The effectiveness of gamma radiation in inactivating the Philippine isolate of Paenibacillus larvae was investigated. Spores of P. larvae were irradiated at incremental doses (0.1, 0.2, 0.4, 0.8 and 1.6 kGy) of gamma radiation emitted by a {sup 60}Co source. Surviving spores were counted and used to estimate the decimal reduction (D{sub 10}) value. A dose of 0.2 kGy was sufficient to inactivate 90% of the total recoverable spores from an initial count of 10{sup 5}-9x10{sup 3} spores per glass plate. The sterilizing effect of high doses of gamma radiation on the spores of P. larvae in infected hives was determined. In this study, a minimum dose (D{sub min}) of 15 kGy was tested. Beehives with sub-clinical infections of AFB were irradiated and examined for sterility. All the materials were found to be free of P. larvae indicating its susceptibility to {gamma}-rays. After irradiation, there were no visible changes in the physical appearance of the hives' body, wax and frames. Thus, a dose of 15 kGy is effective enough for sterilization of AFB-infected materials. - Highlights: > We characterized Paenibacillus larvae and determined its radiation sensitivity. > We investigated the effectiveness of gamma rays in inactivating P. larvae. > Gamma radiation inactivates P. larvae. > 15 kGy is effective for the sterilization of P. larvae-infected hives. > Irradiation produces no visible changes in the hives' body, waxes and frames.

  19. Radiation inactivation of Paenibacillus larvae and sterilization of American Foul Brood (AFB) infected hives using Co-60 gamma rays

    International Nuclear Information System (INIS)

    De Guzman, Zenaida M.; Cervancia, Cleofas R.; Dimasuay, Kris Genelyn B.; Tolentino, Mitos M.; Abrera, Gina B.; Cobar, Ma. Lucia C.; Fajardo, Alejandro C.; Sabino, Noel G.; Manila-Fajardo, Analinda C.; Feliciano, Chitho P.

    2011-01-01

    The effectiveness of gamma radiation in inactivating the Philippine isolate of Paenibacillus larvae was investigated. Spores of P. larvae were irradiated at incremental doses (0.1, 0.2, 0.4, 0.8 and 1.6 kGy) of gamma radiation emitted by a 60 Co source. Surviving spores were counted and used to estimate the decimal reduction (D 10 ) value. A dose of 0.2 kGy was sufficient to inactivate 90% of the total recoverable spores from an initial count of 10 5 -9x10 3 spores per glass plate. The sterilizing effect of high doses of gamma radiation on the spores of P. larvae in infected hives was determined. In this study, a minimum dose (D min ) of 15 kGy was tested. Beehives with sub-clinical infections of AFB were irradiated and examined for sterility. All the materials were found to be free of P. larvae indicating its susceptibility to γ-rays. After irradiation, there were no visible changes in the physical appearance of the hives' body, wax and frames. Thus, a dose of 15 kGy is effective enough for sterilization of AFB-infected materials. - Highlights: → We characterized Paenibacillus larvae and determined its radiation sensitivity. → We investigated the effectiveness of gamma rays in inactivating P. larvae. → Gamma radiation inactivates P. larvae. → 15 kGy is effective for the sterilization of P. larvae-infected hives. → Irradiation produces no visible changes in the hives' body, waxes and frames.

  20. The fatty acid profile of fat depots from Santa Inês sheep fed spineless cactus (Opuntia ficus-indica Mill.).

    Science.gov (United States)

    Costa, Roberto G; Almeida, Michelly DA; Cruz, George Rodrigo B; Beltrão Filho, Edvaldo M; Ribeiro, Neila L; Madruga, Marta S; Queiroga, Rita de Cássia Re

    2017-10-01

    Fat is the tissue that varies most in animals from both a quantitative and distribution perspective. It plays a fundamental biological role as energy storage during food scarcity. Renal, pelvic and internal fat are deposited first. These fats are used to identify fatty acid profiles that may be considered beneficial or unhealthy. The aim of this study is to evaluate the fatty acid profile of fat depots in Santa Inês sheep finished in confinement with spineless cactus in their diets. The treatments included increasing levels of spineless cactus (Opuntia fícus-indica Mill.): T1 = 0%, T2 = 30%, T3 = 50%, and T4 = 70%. The diets significantly affected the adipose depots. The orthogonal contrast between the diet with no cactus (control) and the other diets indicates that the quantity of saturated fatty acids decreased and that the levels of mono-unsaturated and polyunsaturated fatty acids increased in animals fed spineless cactus. The use of spineless cactus in the diets of Santa Inês sheep affects the lipid profile of their fat depots, reducing the quantity of saturated fatty acids and increasing the quantity of mono-unsaturated and polyunsaturated fatty acids. The fatty acid profile of the fat depots indicates that these fats can be used to formulate meat products and add economic and nutritional value to such products, which increases sheep farmers' incomes. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  1. Ethical acceptability of offering financial incentives for taking antipsychotic depot medication: Patients' and clinicians' perspectives after a 12-month randomized controlled trial

    NARCIS (Netherlands)

    E.L. Noordraven (Ernst); M.H.N. Schermer (Maartje); P. Blanken (Peter); C.L. Mulder (Niels); A.I. Wierdsma (André)

    2017-01-01

    textabstractBackground: A randomized controlled trial 'Money for Medication'(M4M) was conducted in which patients were offered financial incentives for taking antipsychotic depot medication. This study assessed the attitudes and ethical considerations of patients and clinicians who participated in

  2. Leptin deficiency-induced obesity affects the density of mast cells in abdominal fat depots and lymph nodes in mice

    Directory of Open Access Journals (Sweden)

    Altintas Mehmet M

    2012-02-01

    Full Text Available Abstract Background Mast cells are implicated in the pathogenesis of obesity and insulin resistance. Here, we explored the effects of leptin deficiency-induced obesity on the density of mast cells in metabolic (abdominal fat depots, skeletal muscle, and liver and lymphatic (abdominal lymph nodes, spleen, and thymus organs. Fourteen-week-old male leptin-deficient ob/ob mice and their controls fed a standard chow were studied. Tissue sections were stained with toluidine blue to determine the density of mast cells. CD117/c-kit protein expression analysis was also carried out. Furthermore, mast cells containing immunoreactive tumor necrosis factor-α (TNF-α, a proinflammatory cytokine involved in obesity-linked insulin resistance, were identified by immunostaining. Results ob/ob mice demonstrated adiposity and insulin resistance. In abdominal fat depots, mast cells were distributed differentially. While most prevalent in subcutaneous fat in controls, mast cells were most abundant in epididymal fat in ob/ob mice. Leptin deficiency-induced obesity was accompanied by a 20-fold increase in the density of mast cells in epididymal fat, but a 13-fold decrease in subcutaneous fat. This finding was confirmed by CD117/c-kit protein expression analysis. Furthermore, we found that a subset of mast cells in epididymal and subcutaneous fat were immunoreactive for TNF-α. The proportion of mast cells immunoreactive for TNF-α was higher in epididymal than in subcutaneous fat in both ob/ob and control mice. Mast cells were also distributed differentially in retroperitoneal, mesenteric, and inguinal lymph nodes. In both ob/ob mice and lean controls, mast cells were more prevalent in retroperitoneal than in mesenteric and inguinal lymph nodes. Leptin deficiency-induced obesity was accompanied by increased mast cell density in all lymph node stations examined. No significant difference in the density of mast cells in skeletal muscle, liver, spleen, and thymus was

  3. Use of depot medroxyprogesterone acetate and prevalent leiomyoma in young African American women.

    Science.gov (United States)

    Harmon, Q E; Baird, D D

    2015-06-01

    Is use of depot medroxyprogesterone acetate (DMPA) a risk factor for or a protective factor against prevalent uterine leiomyoma? Ever use of DMPA was associated with a decreased risk (adjusted risk ratio (RR): 0.8, 95% confidence interval (CI): 0.6, 0.9) of prevalent leiomyoma in young African American women. Although progesterone is associated with growth of leiomyoma, previous epidemiological studies have shown a protective association for DMPA use. These previous studies may have been biased by studying clinically diagnosed leiomyoma (DMPA may mask symptoms thus delaying diagnoses). Cross sectional analysis of baseline data from a cohort study of 1696 African American women. Community-based recruitment (e.g. letters, flyers, radio and TV announcements) were used to enroll African American women between 23 and 34 years old without a previous diagnosis of leiomyoma in the Metropolitan Detroit area. Extensive questionnaire data were used to determine DMPA use and screening ultrasound detected the presence of leiomyoma ≥0.5 cm in diameter. Relative risks with adjustment for covariates were calculated for the presence of leiomyoma based on ever use of DMPA as well as duration and recency of use. Among the 1696 volunteers who enrolled, 43% had used DMPA. Leiomyoma were detected in 17% of those who had ever used DMPA compared with 26% of those who had never used DMPA. The reduction in prevalence remained after adjustment for potential confounders and was highest among women who had used DMPA for more than 4 years (adjusted RR: 0.5, 95% CI: 0.3, 0.8). The reduction in risk was seen for women whose most recent use was up to 8 years prior to study enrollment. The use of cross-sectional data means that the timing of initial fibroid development is not known, so the temporality of the association is uncertain. However in this sample of young women, most fibroids were small, suggesting that DMPA exposure may have occurred before leiomyoma development. Our findings are in

  4. An integrative transcriptomic approach to identify depot differences in genes and microRNAs in adipose tissues from high fat fed mice.

    Science.gov (United States)

    Wijayatunga, Nadeeja N; Pahlavani, Mandana; Kalupahana, Nishan S; Kottapalli, Kameswara Rao; Gunaratne, Preethi H; Coarfa, Cristian; Ramalingam, Latha; Moustaid-Moussa, Naima

    2018-02-06

    Obesity contributes to metabolic disorders such as diabetes and cardiovascular disease. Characterization of differences between the main adipose tissue depots, white (WAT) [including subcutaneous (SAT) and visceral adipose tissue (VAT)] and brown adipose tissue (BAT) helps to identify their roles in obesity. Thus, we studied depot-specific differences in whole transcriptome and miRNA profiles of SAT, VAT and BAT from high fat diet (HFD/45% of calories from fat) fed mice using RNA sequencing and small RNA-Seq. Using quantitative real-time polymerase chain reaction, we validated depot-specific differences in endoplasmic reticulum (ER) stress related genes and miRNAs using mice fed a HFD vs. low fat diet (LFD/10% of calories from fat). According to the transcriptomic analysis, lipogenesis, adipogenesis, inflammation, endoplasmic reticulum (ER) stress and unfolded protein response (UPR) were higher in VAT compared to BAT, whereas energy expenditure, fatty acid oxidation and oxidative phosphorylation were higher in BAT than in VAT of the HFD fed mice. In contrast to BAT, ER stress marker genes were significantly upregulated in VAT of HFD fed mice than the LFD fed mice. For the first time, we report depot specific differences in ER stress related miRNAs including; downregulation of miR-125b-5p, upregulation miR-143-3p, and miR-222-3p in VAT following HFD and upregulation of miR-30c-2-3p only in BAT following a HFD in mice than the LFD mice. In conclusion, HFD differentially regulates miRNAs and genes in different adipose depots with significant induction of genes related to lipogenesis, adipogenesis, inflammation, ER stress, and UPR in WAT compared to BAT.

  5. Archeointensity study on baked clay samples taken from the reconstructed ancient kiln: implication for validity of the Tsunakawa-Shaw paleointensity method

    Science.gov (United States)

    Yamamoto, Yuhji; Torii, Masayuki; Natsuhara, Nobuyoshi

    2015-05-01

    In 1972, a reconstruction experiment of a kiln had been done to reproduce an excavated kiln of the seventh century in Japan. Baked clay samples were taken from the floor surface and -20 cm level, and they have been stored after determinations of the paleomagnetic directions by partial alternating field demagnetizations. We recently applied the Tsunakawa-Shaw method to the samples to assess how reliable archeointensity results are obtained from the samples. A suite of the rock magnetic experiments and the scanning electron microscope observations elucidate that dominant magnetic carriers of the floor surface samples are Ti-poor titanomagnetite grains in approximately 10 nm size with single-domain and/or super-paramagnetic states, whereas contributions of multi-domain grains seem to be relatively large for the -20-cm level samples. From the floor surface samples, six out of the eight successful results were obtained and they give an average of 47.3 μT with a standard deviation of 2.2 μT. This is fairly consistent with the in situ geomagnetic field of 46.4 μT at the time of the reconstruction. They are obtained with a built-in anisotropy correction using anhysteretic remanent magnetization and without any cooling rate corrections. In contrast, only one out of four was successful from the -20-cm level samples. It yields an archeointensity of 31.6 μT, which is inconsistent with the in situ geomagnetic field. Considering from the in situ temperature record during the firing of the kiln and the unblocking temperature spectra of the samples, the floor surface samples acquired full thermoremanent magnetizations (TRMs) as their natural remanent magnetizations whereas the -20-cm level samples only acquired partial TRMs, and these differences probably cause the difference in the archeointensity results between the two sample groups. For archeointensity researches, baked clay samples from a kiln floor are considered to be ideal materials.

  6. Lutzomyia wellcomei Fraiha, Shaw & Lainson (Diptera, Psychodidae, Phlebotominae em Fragmento de Mata Atlântica do Rio Grande do Norte, Nordeste do Brasil

    Directory of Open Access Journals (Sweden)

    Marcos Paulo Gomes Pinheiro

    2013-12-01

    Resumo. As leishmanioses podem afetar seres humanos e animais nas formas visceral e tegumentar. A forma tegumentar tem sido associada, entre outras espécies, a Lutzomyia wellcomei Fraiha, Shaw & Lainson, inicialmente encontrado na região amazônica. O estudo se baseou em coletas mensais de janeiro a dezembro em um fragmento de Mata Atlântica e em um ambiente peridomiciliar, com armadilhas luminosas CDC. Esse é o primeiro estudo sistematizado sobre essa espécie no Rio Grande do Norte. Os insetos foram identificados e analisados em relação às chuvas no local. Alguns espécimes de L. wellcomei foram metalizados sob fita de carbono, visualizados e fotografados em microscópio eletrônico de varredura. A espécie mais abundante na área de mata foi Lutzomyia walkeri Newstead seguida por L. wellcomei. Do total capturado no ambiente de mata e no peridomicílio, cerca de 8% corresponde a L. wellcomei, sendo esta a espécie predominante no ambiente de mata no período chuvoso. Flebotomíneos L. wellcomei não foram capturados em ambiente peridomiciliar. Na mata essa espécie foi encontrada juntamente às espécies Lutzomyia whitmani Antunes & Coutinho e Lutzomyia intermedia Lutz & Neiva. Machos e fêmeas Lutzomyia longipalpis Lutz & Neiva foram predominantes no ambiente peridomiciliar. A análise microscópica da morfologia externa de L. wellcomei revela detalhes da cabeça de machos e fêmeas.

  7. EFFICIENCY OF REPEATED AND UNSCHEDULED TRAINING AS THE MEASURES TO PREVENT ACCIDENTS AT SUPPLY DEPOTS AND WAREHOUSES

    Directory of Open Access Journals (Sweden)

    Bocharova Irina Nikolaevna

    2013-05-01

    Full Text Available This paper presents the results of the analysis of the state of occupational safety at supply depots and warehouses. It is revealed that most accidents involve the employees who have less than one year’s service. Experience has proven that the preventive activities to avoid occupational traumatism are efficient when a complex of workplace safety measures is implemented. The experts consider the repeated and unscheduled training to be very important events. This is supported by the fact that among the employees of the commercial establishments who underwent repeated and unscheduled training, the number of individuals who suffered an accident is small. The efficient functioning of the occupational safety training system is infeasible without ensuring the motivation for assimilating the knowledge and forming the complete foundation for safe labor. In order to reduce the number of accidents, one should proceed from the principle of responding to accidents to the system for professional risk management.

  8. Depot-specific differences in angiogenic capacity of adipose tissue in differential susceptibility to diet-induced obesity

    Directory of Open Access Journals (Sweden)

    Mun-Gyu Song

    2016-11-01

    Full Text Available Objective: Adipose tissue (AT expansion requires AT remodeling, which depends on AT angiogenesis. Modulation of AT angiogenesis could have therapeutic promise for the treatment of obesity. However, it is unclear how the capacity of angiogenesis in each adipose depot is affected by over-nutrition. Therefore, we investigated the angiogenic capacity (AC of subcutaneous and visceral fats in lean and obese mice. Methods: We compared the AC of epididymal fat (EF and inguinal fat (IF using an angiogenesis assay in diet-induced obese (DIO mice and diet-resistant (DR mice fed a high-fat diet (HFD. Furthermore, we compared the expression levels of genes related to angiogenesis, macrophage recruitment, and inflammation using RT-qPCR in the EF and IF of lean mice fed a low-fat diet (LFD, DIO mice, and DR mice fed a HFD. Results: DIO mice showed a significant increase in the AC of EF only at 22 weeks of age compared to DR mice. The expression levels of genes related to angiogenesis, macrophage recruitment, and inflammation were significantly higher in the EF of DIO mice than in those of LFD mice and DR mice, while expression levels of genes related to macrophages and their recruitment were higher in the IF of DIO mice than in those of LFD and DR mice. Expression of genes related to angiogenesis (including Hif1a, Vegfa, Fgf1, Kdr, and Pecam1, macrophage recruitment, and inflammation (including Emr1, Ccr2, Itgax, Ccl2, Tnf, and Il1b correlated more strongly with body weight in the EF of HFD-fed obese mice compared to that of IF. Conclusions: These results suggest depot-specific differences in AT angiogenesis and a potential role in the susceptibility to diet-induced obesity. Keywords: Angiogenesis, Inflammation, Adipose tissue, Diet-induced obese mice, Diet-resistant mice, High-fat diet

  9. Disposal of chemical agents and munitions stored at Umatilla Depot Activity, Hermiston, Oregon. Final Phase 1 environmental report

    Energy Technology Data Exchange (ETDEWEB)

    Zimmerman, G.P.; Hillsman, E.L.; Johnson, R.O.; Miller, R.L.; Patton, T.G.; Schoepfle, G.M.; Tolbert, V.R.; Feldman, D.L.; Hunsaker, D.B. Jr.; Kroodsma, R.L.; Morrissey, J.; Rickert, L.W.; Staub, W.P.; West, D.C.

    1993-02-01

    The Umatilla Depot Activity (UMDA) near Hermiston, Oregon, is one of eight US Army installations in the continental United States where lethal unitary chemical agents and munitions are stored, and where destruction of agents and munitions is proposed under the Chemical Stockpile Disposal Program (CSDP). The chemical agent inventory at UMDA consists of 11.6%, by weight, of the total US stockpile. The destruction of the stockpile is necessary to eliminate the risk to the public from continued storage and to dispose of obsolete and leaking munitions. In 1988 the US Army issued a Final Programmatic Environmental Impact Statement (FPEIS) for the CSDP that identified on-site disposal of agents and munitions as the environmentally preferred alternative (i.e., the alternative with the least potential to cause significant adverse impacts), using a method based on five measures of risk for potential human health and ecosystem/environmental effects; the effectiveness and adequacy of emergency preparedness capabilities also played a key role in the FPEIS selection methodology. In some instances, the FPEIS included generic data and assumptions that were developed to allow a consistent comparison of potential impacts among programmatic alternatives and did not include detailed conditions at each of the eight installations. The purpose of this Phase 1 report is to examine the proposed implementation of on-site disposal at UMDA in light of more recent and more detailed data than those included in the FPEIS. Specifically, this Phase 1 report is intended to either confirm or reject the validity of on-site disposal for the UMDA stockpile. Using the same computation methods as in the FPEIS, new population data were used to compute potential fatalities from hypothetical disposal accidents. Results indicate that onsite disposal is clearly preferable to either continued storage at UMDA or transportation of the UMDA stockpile to another depot for disposal.

  10. Regional Differences of Proteins Expressing in Adipose Depots Isolated from Cows, Steers and Bulls as Identified by a Proteomic Approach

    Directory of Open Access Journals (Sweden)

    Jin Hyoung Cho

    2016-08-01

    Full Text Available Adipose tissue in the loin muscle area of beef cattle as a marbling factor is directly associated with beef quality. To elucidate whether properties of proteins involved in depot specific adipose tissue were sex-dependent, we analyzed protein expression of intramuscular adipose tissue (IMAT and omental adipose tissue (OMAT from Hanwoo cows, steers, and bulls of Korean native beef cattle by liquid chromatography-tandem mass spectrometry (LC-MS/MS–based proteomic analysis, quantitative polymerase chain reaction (PCR and western blot analysis. Two different adipose depots (i.e. intramuscular and omental were collected from cows (n = 7, steers (n = 7, or bulls (n = 7. LC-MS/MS revealed a total of 55 and 35 proteins in IMAT and OMAT, respectively. Of the 55 proteins identified, 44, 40, and 42 proteins were confirmed to be differentially expressed in IMAT of cows, steers, and bulls, respectively. In OMAT of cows, steers, and bulls, 33, 33, and 22 were confirmed to be differentially expressed, respectively. Tropomyosin (TPM 1, TPM 2, and TPM3 were subjected to verification by quantitative PCR and western blot analysis in IMAT and OMAT of Hanwoo cows, steers, and bulls as key factors closely associated with muscle development. Both mRNA levels and protein levels of TPM1, TPM2, and TPM3 in IMAT were lower in bulls compared to in cows or steers suggesting that they were positively correlated with marbling score and quality grade. Our results may aid the regulation of marbling development and improvement of meat quality grades in beef cattle.

  11. Chemical Stockpile Disposal Program: Review and comment on the Phase 1 environmental report for the Pueblo Depot Activity, Pueblo, Colorado

    International Nuclear Information System (INIS)

    Olshansky, S.J.; Krummel, J.R.; Policastro, A.J.; McGinnis, L.D.

    1994-03-01

    As part of the Chemical Stockpile Disposal Program, an independent review is presented of the US Army Phase I environmental report for the disposal of chemical agents and munitions stored at the Pueblo Depot Activity (PUDA) in Pueblo, Colorado. The Phase I report addresses new and additional concerns not incorporated in the final programmatic environmental impact statement (FPEIS). These concerns are addressed by examining site-specific data for the PUDA. On the basis of our review of the Phase I report, we concluded that on-site meteorological data from December 1988 to June 1992 appear to be of insufficient quality to have been used instead of the off-site Pueblo airport data. No additional meteorological data have been collected since June 1992. The Phase I report briefly mentions problems with the air pollution control system. These problems will likely require the systems to be upgraded at the Johnston Atoll site and at each of the other depots in the continental United States. Without such improvements, the probability of accidents during start-up and shutdown would likely increase. The Army has a lessons-learned program to incorporate improvements into the design of future facilities. The Phase I report does not make any design change commitments. These issues need to be fully evaluated and resolved before any final conclusion concerning the adequacy of the decision in the FPEIS can be made with respect to the PUDA. With the exception of this issue, the inclusion of other more detailed site-specific data in the Phase I report does not change the decision reached in the FPEIS (which favored on-site disposal at the PUDA). We recommend that site-specific data on water, ecological, socioeconomic, and cultural resources and emergency planning and preparedness be considered explicitly in the site-specific EIS decision-making process

  12. Time to Detection in Culture Supports Prediction of Low Transmissibility of Tuberculosis and Discontinuation of Isolation for Low-Risk Patients With A Single AFB-Negative and NAAT-Negative Respiratory Specimen.

    Science.gov (United States)

    Khan, Saahir; Nakasone, Audrey; Ghajar, Minoo; Zhowandai, Mariam; Prabhu, Sunita; Alexander, Rick; Low, Julie; Peterson, Ellena; Thrupp, Lauri

    2018-05-01

    For 94 patients with culture-positive pulmonary tuberculosis, time-to-detection (TTD), acid-fast bacilli (AFB) smear, and nucleic acid amplification test (NAAT) results were reviewed. All 12 patients whose first specimen was negative by AFB smear and NAAT had prolonged TTD, indicating low transmissibility and supporting discontinuing isolation for low-risk patients.Infect Control Hosp Epidemiol 2018;39:619-621.

  13. Statistical analysis of ground-water contamination at the alert apron and northern landfill areas of Wurtsmith AFB, Michigan. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Hunter, P.; Naber, S.; Verducci, J.

    1988-07-01

    Two plumes of contamination are analyzed to determine their extent, composition, and movement. The large number of ground-water monitoring wells sampled over the past eight years at Wurtsmith AFB allow this analysis to be performed directly from empirical data, with minimal assumptions about solute transport mechanisms. Conclusions are drawn about the likely sources of contamination in the two plumes, the adequacy of the data for making risk assessments, and the likely consequences of alternative programs of remediation.

  14. Environmental Assessment Addressing FTFA07-1174, Repair Approach Lighting System at the North End of Runway 01/19 at Eglin AFB, Florida

    Science.gov (United States)

    2013-05-01

    Hyla andersonii Mammals American beaver Castor canadensis Florida black bear2 Ursus americanus floridanus Raccoon Procyon lotor Source: Eglin...water at a frequency and duration to support, and that under normal circumstances do support, a prevalence of vegetation typically adapted to life...virginiana American Beaver Castor canadensis Redbay Persea borbonia Little Blue Heron Egretta caerulea Source: USAF 2006 E-3 E.2 Eglin AFB

  15. Natural convection heat transfer in an anisotropic porous cavity heated from the side. 2nd Report. experiment by hele-shaw cell; Tosuiritsu ni ihosei wo yusuru howa takoshitsu sonai no sokuho kanetsu ni yoru shizen tairyu netsu dentatsu. 2. Hele shaw cell ni yoru jikken

    Energy Technology Data Exchange (ETDEWEB)

    Kimura, S; Okajima, A; Kiwata, T [Kanazawa University, Ishikawa (Japan). Faculty of Engineering

    2000-11-25

    Natural convection heat transfer and flow structure in an anisotropic porous medium of square cavity saturated with Boussinesq fluid has been studied experimentally using a Hele-Shaw cell. The permeability ratio defined by K=K{sub y}/K{sub x} was put to three different values; 0.4, 1 and 2.5. The convection patterns at three different permeability ratios are visualized for several different Rayleigh numbers by the pH indicator method. When K is 0.25, the visualized flow is mainly in the vertical direction. On the contrary for K=4 the convecting flow is in the horizontal direction. The average heat transfer coefficients are also measured, and the corresponding Nusselt number are plotted as a function of K. It is found that the corresponding Nusselt numbers are scaled with (KRa){sup 1/2}. The experimental results of flow pattern and heat transfer are accord with those obtained by our previous theory. (author)

  16. Aflatoxin B1 inhibition in Aspergillus flavus by Aspergillus niger through down-regulating expression of major biosynthetic genes and AFB1 degradation by atoxigenic A. flavus.

    Science.gov (United States)

    Xing, Fuguo; Wang, Limin; Liu, Xiao; Selvaraj, Jonathan Nimal; Wang, Yan; Zhao, Yueju; Liu, Yang

    2017-09-01

    Twenty Aspergillus niger strains were isolated from peanuts and 14 strains were able to completely inhibit AFB 1 production with co-cultivation. By using a Spin-X centrifuge system, it was confirmed that there are some soluble signal molecules or antibiotics involved in the inhibition by A. niger, although they are absent during the initial 24h of A. flavus growth when it is sensitive to inhibition. In A. flavus, 19 of 20 aflatoxin biosynthetic genes were down-regulated by A. niger. Importantly, the expression of aflS was significantly down-regulated, resulting in a reduction of AflS/AflR ratio. The results suggest that A. niger could directly inhibit AFB 1 biosynthesis through reducing the abundance of aflS to aflR mRNAs. Interestingly, atoxigenic A. flavus JZ2 and GZ15 effectively degrade AFB 1 . Two new metabolites were identified and the key toxic lactone and furofuran rings both were destroyed and hydrogenated, meaning that lactonase and reductase might be involved in the degradation process. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Factors which contributed for low quality sputum smears for the detection of acid fast bacilli (AFB) at selected health centers in Ethiopia: A quality control perspective.

    Science.gov (United States)

    Mekonen, Ayehu; Ayele, Yeshi; Berhan, Yifru; Woldeyohannes, Desalegn; Erku, Woldaregay; Sisay, Solomon

    2018-01-01

    Quality of tuberculosis (TB) microscopy diagnosis is not a guarantee despite implementation of External Quality Assurance (EQA) service in all laboratories of health facilities. Hence, we aimed at evaluating the technical quality and the findings of sputum smear microscopy for acid fast bacilli (AFB) at health centers in Hararge Zone, Oromia Region, Ethiopia. A cross-sectional study was carried out between July 8, 2014 and July 7, 2015.A pre-tested structured questionnaire was used to collect data. Lot Quality Assurance Sampling (LQAS) method was put into practice for collecting all necessary sample slides. Data were analyzed by using SPSS (Statistical Package for Social Sciences) version 20 software. P-value quality, smear size, smear thickness, staining and evenness were indicated in 40 (72.7%), 39 (70.9%), 37 (67.3%), 27(49.1%) and 37 (67.3%) of the collected samples, respectively. False negative AFB findings were significantly associated with lack of Internal Quality Control (IQC) measures (AOR (Adjusted Odds Ratio): 2.90 (95% CI (Confidence Interval): 1.25,6.75) and poor staining procedures (AOR: 2.16(95% CI: 1.01, 5.11). The qualities of AFB smear microscopy reading and smearing were low in most of the laboratories of the health centers. Therefore, it is essential to strength EQA program through building the capacity of laboratory professionals.

  18. The watershed-scale optimized and rearranged landscape design (WORLD) model and local biomass processing depots for sustainable biofuel production: Integrated life cycle assessments

    Energy Technology Data Exchange (ETDEWEB)

    Eranki, Pragnya L.; Manowitz, David H.; Bals, Bryan D.; Izaurralde, Roberto C.; Kim, Seungdo; Dale, Bruce E.

    2013-07-23

    An array of feedstock is being evaluated as potential raw material for cellulosic biofuel production. Thorough assessments are required in regional landscape settings before these feedstocks can be cultivated and sustainable management practices can be implemented. On the processing side, a potential solution to the logistical challenges of large biorefi neries is provided by a network of distributed processing facilities called local biomass processing depots. A large-scale cellulosic ethanol industry is likely to emerge soon in the United States. We have the opportunity to influence the sustainability of this emerging industry. The watershed-scale optimized and rearranged landscape design (WORLD) model estimates land allocations for different cellulosic feedstocks at biorefinery scale without displacing current animal nutrition requirements. This model also incorporates a network of the aforementioned depots. An integrated life cycle assessment is then conducted over the unified system of optimized feedstock production, processing, and associated transport operations to evaluate net energy yields (NEYs) and environmental impacts.

  19. Vector wind and vector wind shear models 0 to 27 km altitude for Cape Kennedy, Florida, and Vandenberg AFB, California

    Science.gov (United States)

    Smith, O. E.

    1976-01-01

    The techniques are presented to derive several statistical wind models. The techniques are from the properties of the multivariate normal probability function. Assuming that the winds can be considered as bivariate normally distributed, then (1) the wind components and conditional wind components are univariate normally distributed, (2) the wind speed is Rayleigh distributed, (3) the conditional distribution of wind speed given a wind direction is Rayleigh distributed, and (4) the frequency of wind direction can be derived. All of these distributions are derived from the 5-sample parameter of wind for the bivariate normal distribution. By further assuming that the winds at two altitudes are quadravariate normally distributed, then the vector wind shear is bivariate normally distributed and the modulus of the vector wind shear is Rayleigh distributed. The conditional probability of wind component shears given a wind component is normally distributed. Examples of these and other properties of the multivariate normal probability distribution function as applied to Cape Kennedy, Florida, and Vandenberg AFB, California, wind data samples are given. A technique to develop a synthetic vector wind profile model of interest to aerospace vehicle applications is presented.

  20. Shemya AFB, Alaska 1992 IRP field investigation report. Volume 3, Appendixes B, C, and D: Final report

    Energy Technology Data Exchange (ETDEWEB)

    1993-02-01

    The US Air Force is currently investigating 22 sites on Shemya Air Force Base (AFB) to determine if past spill and disposal activities have caused environmental damage. These investigations are being carried out under the Air Force`s Installation Restoration Program (IRP). Field investigations were performed in 1992 to obtain the information needed to assess what future actions will need to be carried out at each site. The island`s drinking water supply was also investigated. Activities completed at 10 selected sites included surface sampling to determine the lateral extent of contamination, subsurface sampling to determine the vertical extent of contamination, and the installation of well points and monitoring wells to determine the direction of groundwater flow and if the groundwater has been affected by a site. Geophysical surveys were performed at most sites to identify site boundaries and check for the presence of buried metal to be avoided during drilling activities. This report, appendices B, C, and D contains information on the following: geophysical contour maps and profile plots; human health risk assessment; and ecological risk assessment.

  1. A COMMUNITY-BASED COLLEGE STUDY ON ADHERENCE TO DOTS AND RELATED DIAGNOSTIC INNOVATIONS ON AFB STAINING METHOD

    Directory of Open Access Journals (Sweden)

    Nilotpal Banerjee

    2016-10-01

    Full Text Available BACKGROUND The geographically isolated underdeveloped state, Tripura of north-eastern region of India has been facing multidimensional problems like unemployment, lack of hygiene, illiteracy, lack of industrialisation, etc. So, it was intended to study the magnitude of reported tuberculosis in the community around the Tripura Medical College through RNTCP. MATERIALS AND METHODS Questionnaire, interrogative methods was primarily adopted. Inspection to different villages around and direct interrogation was done on awareness about the programme. Self-modified innovative method was also adopted to compare scientific reproducibility along with conventional method for AFB staining. RESULTS Analysis of results reveal 28% of people interrogated knew about RNTC programme. 16% of people had seen and heard about the TB staff. 56% of people said that no health staff enquired on other factors like drinking water, mosquito and hygiene, etc. The innovative method of staining proved 100% successful, which was also easier, cheaper and more rapid. CONCLUSION DMC and DOTs services had been quite good as evident from document records and on interrogation to the attendees. 80% of attendees said that they would complete the course of treatment. 83% were happy with the provisions of DOTs and DMC.

  2. Monitoring and documentation of side effects from depot antipsychotic medication: an interdisciplinary audit of practice in a regional mental health service.

    LENUS (Irish Health Repository)

    Cleary, A

    2012-01-01

    The aim of this audit was to review current practice within a rural mental health service area on the monitoring and documentation of side effects of antipsychotic depot medication. Following a review of the literature on best practice internationally, an evidence based audit tool was adapted. A sample of 60 case files, care plans and prescriptions were audited between January and May 2010. This represented 31% of the total number of service users receiving depot injections in the mental health service region (n=181). The audit results revealed that most service users had an annual documented medical review and a documented prescription. However, only 5 (8%) case notes examined had documentation recorded describing the condition of the injection site and alternation of the injection site was recorded in only 28 (47%) case notes. No case notes examined had written consent to commence treatment recorded, and only 3 (5%) of case notes had documented that information on the depot injection and side effects was given. In 57 (95%) of case notes no documentation of recorded information on the depot and on side effects was given. Documentation of physical observations and tests revealed that 58% of cases had full blood count, liver function tests, thyroid function tests and fasting lipids recorded. All other tests (i.e. temperature, pulse, respirations, blood pressure, ECG) were recorded in less than 50% of cases. Prolactin levels were not recorded in any case. The lack of written consent was partly attributed to lack of recording of consent. The failure to monitor and record some\\r\

  3. Documentation and Analysis of the ’Miscellaneous’ Account Category within the DoD Instruction 7220.29-H Depot Level Maintenance Cost Accounting System.

    Science.gov (United States)

    1984-12-01

    34MISCELLANEOUS" ACCOUNT CATEGORY WITHIN THE DOD INSTRUCTION 7220.29-H DEPOT LEVEL MAINTENANCE COST ACCOUNTING SYSTEM by a. Steven Eugene Lehr CDecember 1984...PERFORMING ONG. REPORT NUMBER Maintenance Cost Accounting System 7. AUTHOR(&) S. CONTRACT OR GRANT NUMBER(@) Steven Eugene Lehr 9. PERFORMING ORGANIZATION...Availability Codes IS. KEY WORDS (Continue on reverse *ids It necessary and Identify by block number) Dvi Special Uniform Cost Accounting System DoD

  4. External quality assessment of AFB smear microscopy performances and its associated factors in selected private health facilities in Addis Ababa, Ethiopia.

    Science.gov (United States)

    Mosissa, Lemi; Kebede, Abebaw; Mindaye, Tedla; Getahun, Muluwork; Tulu, Sisay; Desta, Kassu

    2016-01-01

    Tuberculosis (TB) is still a public health problem in sub Saharan African countries. In resource-limited settings, TB diagnosis relies on sputum smear microscopy, with low and variable sensitivities, especially in paucibacillary pediatric and HIV-associated TB patients. Tuberculosis microscopy centers have several weaknesses like overworking, insufficiently trained personnel, inconsistent reagent supplies, and poorly maintained equipments; thus, there is a critical need for investments in laboratory infrastructure, capacity building, and quality assurance schemes. The performance of TB microscopy centers in the private health facilities in Addis Ababa is not known so far. The main objective of the study was to assess laboratory performance of acid fast bacilli (AFB) smear microscopy and its associated factors in selected private health facilities in Addis Ababa, Ethiopia. A cross-sectional study was conducted in 33 selected private health facilities of Addis Ababa, Ethiopia comprising 7 hospitals, 2 NGO health centers, 23 higher clinics and 1 diagnostic laboratory that provide AFB smear microscopy services. The study was conducted from January to April 2014. A total of 283 stained sputum smears were randomly collected from participant laboratories for blinded rechecking, 320 panel slides were sent to 32 microscopy centers to evaluate their performance on AFB reading, staining and reporting. Checklists were used to assess quality issues of laboratories. Data were captured, cleaned, and analyzed using SPSS version 16.0; χ(2) tests, kappa statistics were used for comparison purpose. P value laboratories, 2-scored 100%, 15 scored 80-95% & the remaining 15 scored 50-75% for overall proficiency test performance. There were 10 (3.15%) major errors and 121 (37.8%) minor errors. The sensitivity, specificity, PPV and NPV of panel reading by microscopy centers were 89%, 96%, 96%, and 90% respectively. Out of 283 randomly selected slides for blind rechecking, 11 (3.9%) slides

  5. The effect of dietary copper supplementation on fatty acid profile and oxidative stability of adipose depots in Boer x Spanish goats.

    Science.gov (United States)

    Cummins, K A; Solaiman, S G; Bergen, W G

    2008-02-01

    A feeding trial was designed to examine the effects of copper sulfate pentahydrate (CuSO(4).5H(2)O) on the fatty acid composition and oxidative stability in muscle and adipose tissues of Boer x Spanish goat kids. Fifteen (n = 5 per treatment) goats were fed 0, 100, or 200 mg of supplemental Cu per day as copper sulfate for 98 d. The animals were slaughtered, and LM, s.c. adipose from the sternal region, and mesenteric adipose tissues were collected. Total lipids were extracted with chloroform:methanol (2:1), methylated and isolated via GLC from all tissues. The subsequent peaks were then positively identified by mass spectrometry. Thiobarbituric acid-reactive substances were measured also. In s.c. adipose, dietary Cu significantly decreased C14:0 (P = 0.03) and C16:0 (P = 0.01). In muscle, C15:0 (P = 0.03) was linearly increased by Cu. Dietary Cu supplementation did not influence oxidative stability in goat muscle or s.c. adipose. Copper supplementation at 200 mg/d resulted in a significant increase in malondialdehyde in mesenteric adipose (P = 0.01) compared with the 0 or 100 mg/d groups. These results indicate that lipid composition may differ from depot to depot and that depending on the depot, dietary Cu seems to elicit a variable response on the fatty acid composition.

  6. Effect of Buprenorphine Weekly Depot (CAM2038) and Hydromorphone Blockade in Individuals With Opioid Use Disorder: A Randomized Clinical Trial.

    Science.gov (United States)

    Walsh, Sharon L; Comer, Sandra D; Lofwall, Michelle R; Vince, Bradley; Levy-Cooperman, Naama; Kelsh, Debra; Coe, Marion A; Jones, Jermaine D; Nuzzo, Paul A; Tiberg, Fredrik; Sheldon, Behshad; Kim, Sonnie

    2017-09-01

    Buprenorphine is an efficacious, widely used treatment for opioid use disorder (OUD). Daily oral transmucosal formulations can be associated with misuse, diversion, and nonadherence; these limitations may be obviated by a sustained release formulation. To evaluate the ability of a novel, weekly, subcutaneous buprenorphine depot formulation, CAM2038, to block euphorigenic opioid effects and suppress opioid withdrawal in non-treatment-seeking individuals with OUD. This multisite, double-blind, randomized within-patient study was conducted at 3 controlled inpatient research facilities. It involved 47 adults with DSM-V moderate-to-severe OUD. The study was conducted from October 12, 2015 (first patient enrolled), to April 21, 2016 (last patient visit). A total of five 3-day test sessions evaluated the response to hydromorphone (0, 6, and 18 mg intramuscular in random order; 1 dose/session/day). After the first 3-day session (ie, qualification phase), participants were randomized to either CAM2038 weekly at 24 mg (n = 22) or 32 mg (n = 25); the assigned CAM2038 dose was given twice, 1 week apart (day 0 and 7). Four sets of sessions were conducted after randomization (days 1-3, 4-6, 8-10, and 11-13). The primary end point was maximum rating on the visual analog scale for drug liking. Secondary end points included other visual analog scale (eg, high and desire to use), opioid withdrawal scales, and physiological and pharmacokinetic outcomes. A total of 46 of 47 randomized participants (mean [SD] age, 35.5 [9] years; 76% male [n = 35]) completed the study. Both weekly CAM2038 doses produced immediate and sustained blockade of hydromorphone effects (liking maximum effect, CAM2038, 24 mg: effect size, 0.813; P withdrawal (Clinical Opiate Withdrawal Scale, CAM2038, 24 mg: effect size, 0.617; P opioid blockade and withdrawal suppression. The results support the use of this depot formulation for treatment initiation and stabilization of patients with OUD, with

  7. Meal from tilapia filleting industrial waste in the feed of the bullfrog tadpoles (Rana Catesbeiana Shaw, 1802/ Inclusão de farinha de resíduos da indústria de filetagem de tilápias na alimentação de girinos de rã-touro (Rana Catesbeiana Shaw,1802

    Directory of Open Access Journals (Sweden)

    Cleiton Manske

    2007-08-01

    Full Text Available The objective of this experiment was to evaluate the inclusion of meal of tilapia industrial waster in bullfrog tadpoles’ diets (Rana Catesbeina Shaw, 1802. Two hundred fifty tadpoles with initial weight and length of 0,18 ± 0,05g and 2,50 ± 0,18 centimeters were used, respectively, they were used and distributed in 25 aquariums of 30 liter each in a complete randomized design with five treatments and five repetitions. The tadpoles were fed four times a day with diets containing 0, 5, 10 and 15% of inclusion of tilapia filleting and another diet with 0% of supplemented tilapia filleting with synthetic methionine, being supplied four times a day at ease. The experiment period was 30 days. The diets with tilapia filleting inclusion and methionine supplementation did not have influence in the final weight and length averages, feed survival and conversion of bullfrog tadpoles. It cam be used until 15% of tilapia filleting inclusion in the bullfrog tadpoles food. The synthetic methionine supplementation in diets for bullfrog tadpoles is not necessary in diets with levels over 0,47% of the total methionine.Este experimento objetivou avaliar a inclusão da farinha de resíduos de filetagem de tilápias (FT em rações para girinos de rã-touro (Rana Catesbeina Shaw,1802. Foram utilizados 250 girinos com peso e comprimento inicial de 0,18 ± 0,05g e 2,50 ± 0,18 cm, respectivamente, distribuídos em 25 aquários de 30 L cada, em um delineamento inteiramente casualizado com cinco tratamentos e cinco repetições. Os girinos foram alimentados quatro vezes ao dia, com rações contendo 0, 5, 10, 15% de inclusão de FT e outra ração com 0% de FT suplementada com metionina sintética, sendo fornecidas quatro vezes ao dia a vontade. O período do experimento foi de 30 dias. As rações com inclusão de FT e suplementação de metionina não influenciaram nas médias de peso final, comprimento final, sobrevivência e conversão alimentar dos girinos de r

  8. Long-term effect of depot medroxyprogesterone acetate on vaginal microbiota, epithelial thickness and HIV target cells.

    Science.gov (United States)

    Mitchell, Caroline M; McLemore, Leslie; Westerberg, Katharine; Astronomo, Rena; Smythe, Kimberly; Gardella, Carolyn; Mack, Matthias; Magaret, Amalia; Patton, Dorothy; Agnew, Kathy; McElrath, M Juliana; Hladik, Florian; Eschenbach, David

    2014-08-15

    Depot medroxyprogesterone acetate (DMPA) has been linked to human immunodeficiency virus type 1 (HIV-1) acquisition. Vaginal microbiota of women using DMPA for up to 2 years were cultured. Mucosal immune cell populations were measured by immunohistological staining. Over 12 months, the proportion with H2O2-positive lactobacilli decreased (n = 32; 53% vs 27%; P = .03). Median vaginal CD3(+) cells also decreased (n = 15; 355 vs 237 cells/mm(2); P = .03), as did CD3(+)CCR5(+) cells (195 vs 128 cells/mm(2); P = .04), HLA-DR(+) cells (130 vs 96 cells/mm(2); P = .27), and HLA-DR(+)CCR5(+) cells (18 vs 10 cells/mm(2); P = .33). DMPA contraception does not increase vaginal mucosal CCR5(+) HIV target cells but does decrease CD3(+) T lymphocytes and vaginal H2O2-producing lactobacilli. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  9. Oil fuel delivery optimization for multi product and multi depot: the case of petrol station replenishment problem (PSRP)

    Science.gov (United States)

    Surjandari, Isti; Rachman, Amar; Dianawati, Fauzia; Wibowo, R. Pramono

    2011-10-01

    With the Oil and Gas Law No. 22 of 2001, national and foreign private enterprises can invest in all sectors of Oil and Gas in Indonesia. In anticipation of this free competition, Pertamina, as a state-owned enterprises, which previously had monopolized the oil and gas business activities in Indonesia, should be able to improve services as well as the efficiency in order to compete in the free market, especially in terms of cost efficiency of fuel distribution to gas station (SPBU). To optimize the distribution activity, it is necessary to design a scheduling system and its fuel delivery routes daily to every SPBU. The determination of routes and scheduling delivery of fuel to the SPBU can be modeled as a Petrol Station Replenishment Problem (PSRP) with the multi-depot, multi-product, time windows and split deliveries, which in this study will be completed by the Tabu Search algorithm (TS). This study was conducted in the area of Bandung, the capital of West Java province, which is a big city and the neighboring city of Jakarta, the capital city of Indonesia. By using the fuel delivery data for one day, the results showed a decrease of 16.38% of the distance of the route compared to the current conditions, which impacted on the reduction of distribution costs and decrease the number of total trips by 5.22% and 3.83%.

  10. The pea branching RMS2 gene encodes the PsAFB4/5 auxin receptor and is involved in an auxin-strigolactone regulation loop.

    Science.gov (United States)

    Ligerot, Yasmine; de Saint Germain, Alexandre; Waldie, Tanya; Troadec, Christelle; Citerne, Sylvie; Kadakia, Nikita; Pillot, Jean-Paul; Prigge, Michael; Aubert, Grégoire; Bendahmane, Abdelhafid; Leyser, Ottoline; Estelle, Mark; Debellé, Frédéric; Rameau, Catherine

    2017-12-01

    Strigolactones (SLs) are well known for their role in repressing shoot branching. In pea, increased transcript levels of SL biosynthesis genes are observed in stems of highly branched SL deficient (ramosus1 (rms1) and rms5) and SL response (rms3 and rms4) mutants indicative of negative feedback control. In contrast, the highly branched rms2 mutant has reduced transcript levels of SL biosynthesis genes. Grafting studies and hormone quantification led to a model where RMS2 mediates a shoot-to-root feedback signal that regulates both SL biosynthesis gene transcript levels and xylem sap levels of cytokinin exported from roots. Here we cloned RMS2 using synteny with Medicago truncatula and demonstrated that it encodes a putative auxin receptor of the AFB4/5 clade. Phenotypes similar to rms2 were found in Arabidopsis afb4/5 mutants, including increased shoot branching, low expression of SL biosynthesis genes and high auxin levels in stems. Moreover, afb4/5 and rms2 display a specific resistance to the herbicide picloram. Yeast-two-hybrid experiments supported the hypothesis that the RMS2 protein functions as an auxin receptor. SL root feeding using hydroponics repressed auxin levels in stems and down-regulated transcript levels of auxin biosynthesis genes within one hour. This auxin down-regulation was also observed in plants treated with the polar auxin transport inhibitor NPA. Together these data suggest a homeostatic feedback loop in which auxin up-regulates SL synthesis in an RMS2-dependent manner and SL down-regulates auxin synthesis in an RMS3 and RMS4-dependent manner.

  11. Differential patterns of serum concentration and adipose tissue expression of chemerin in obesity: adipose depot specificity and gender dimorphism.

    Science.gov (United States)

    Alfadda, Assim A; Sallam, Reem M; Chishti, Muhammad Azhar; Moustafa, Amr S; Fatma, Sumbul; Alomaim, Waleed S; Al-Naami, Mohammed Y; Bassas, Abdulelah F; Chrousos, George P; Jo, Hyunsun

    2012-06-01

    Chemerin, a recognized chemoattractant, is expressed in adipose tissue and plays a role in adipocytes differentiation and metabolism. Gender- and adipose tissue-specific differences in human chemerin expression have not been well characterized. Therefore, these differences were assessed in the present study. The body mass index (BMI) and the circulating levels of chemerin and other inflammatory, adiposity and insulin resistance markers were assessed in female and male adults of varying degree of obesity. Chemerin mRNA expression was also measured in paired subcutaneous and visceral adipose tissue samples obtained from a subset of the study subjects. Serum chemerin concentrations correlated positively with BMI and serum leptin levels and negatively with high density lipoprotein (HDL)-cholesterol levels. No correlation was found between serum chemerin concentrations and fasting glucose, total cholesterol, low density lipoprotein (LDL)-cholesterol, triglycerides, insulin, C-reactive protein or adiponectin. Similarly, no relation was observed with the homeostasis model assessment for insulin resistance (HOMA-IR) values. Gender- and adipose tissue-specific differences were observed in chemerin mRNA expression levels, with expression significantly higher in women than men and in subcutaneous than visceral adipose tissue. Interestingly, we found a significant negative correlation between circulating chemerin levels and chemerin mRNA expression in subcutaneous fat. Among the subjects studied, circulating chemerin levels were associated with obesity markers but not with markers of insulin resistance. At the tissue level, fat depot-specific differential regulation of chemerin mRNA expression might contribute to the distinctive roles of subcutaneous vs. visceral adipose tissue in human obesity.

  12. Changes in Vaginal Microbiota and Immune Mediators in HIV-1-Seronegative Kenyan Women Initiating Depot Medroxyprogesterone Acetate.

    Science.gov (United States)

    Roxby, Alison C; Fredricks, David N; Odem-Davis, Katherine; Ásbjörnsdóttir, Kristjana; Masese, Linnet; Fiedler, Tina L; De Rosa, Stephen; Jaoko, Walter; Kiarie, James N; Overbaugh, Julie; McClelland, R Scott

    2016-04-01

    Depot medroxyprogesterone acetate (DMPA) is associated with HIV acquisition. We studied changes in vaginal microbiota and inflammatory milieu after DMPA initiation. In a cohort of HIV-negative Kenyan women, we collected monthly vaginal swabs over 1 year before and after DMPA. Using quantitative polymerase chain reaction, we compared quantities of Lactobacillus crispatus, Lactobacillus jensenii, Lactobacillus iners, Gardnerella vaginalis, and total bacterial load (16S ribosomal RNA gene levels). Six vaginal immune mediators were measured with enzyme-linked immunosorbent assay. Trends in the detection and quantity of bacteria were estimated by logistic and linear mixed-effects regression. From 2010 to 2012, 15 HIV-seronegative women initiated DMPA, contributing 85 visits (median, 6 visits/woman; range, 3-8 visits/woman). The median time of DMPA-exposed follow-up was 8.4 months (range, 1.5-11.6 months). Seven women (46%) had bacterial vaginosis within 70 days before DMPA start. L. iners was detected in 13 women (87%) before DMPA start, but other lactobacilli were rarely detected. Gardnerella vaginalis decreased by 0.21 log10 copies per swab per month after DMPA exposure (P = 0.01). Total bacterial load decreased by 0.08 log10 copies per swab per month of DMPA (P = 0.02). Sustained decreases in interleukin (IL)-6 (P = 0.03), IL-8 (P = 0.04), and IL-1 receptor antagonist (P vaginal bacterial concentrations and levels of inflammatory mediators. Further studies are warranted to outline components of the vaginal microbiota influenced by DMPA use and impact on HIV susceptibility.

  13. Retrospective investigation of testosterone undecanoate depot for the long-term treatment of male hypogonadism in clinical practice.

    Science.gov (United States)

    Conaglen, Helen M; Paul, Ryan G; Yarndley, Tania; Kamp, Jozef; Elston, Marianne S; Conaglen, John V

    2014-02-01

    Testosterone undecanoate depot (TUD) administered intramuscularly is an effective form of testosterone replacement therapy (TRT) for male hypogonadism. Because of the ease of administration, TUD therapy may be preferable to subcutaneously implanted extended release T pellet implants (TI). The primary objective was to retrospectively assess the efficacy and safety of long-term (≥ 2 years therapy) TUD therapy in the clinical setting. The secondary objective was to retrospectively compare TUD with TI therapy. Retrospective data were collected from the Waikato Hospital Endocrine Database for 179 hypogonadal men treated with TUD for ≥ 2 years from 1998-2011, with 124 of these men receiving previous TI therapy. The main outcome measure for efficacy was serum trough total testosterone (TT), and for safety an increase in hemoglobin (Hb) and/or hematocrit (Hct), rise in prostate-specific antigen (PSA) and/or prostatic biopsy and alteration in body mass index and lipid profile. Additional outcome measures were changes in the dosing and/or interval regimens for TUD therapy. Overall, 72% of trough TT levels were in the normal range for TUD therapy compared with 53% of trough TT levels during TI therapy. TUD therapy was well tolerated with 162 men (90.5%) completing 2 years of treatment, and only seven men (3.9%) stopping TUD because of adverse effects. A rise in Hb and/or Hct occurred in 25 men (14%), and a significant rise in PSA in 20 men (13%) at some stage during TUD therapy. At 2 years, 91% of men received the standard 1,000 mg TUD dose with 66% at the standard dosing interval of 10-14 weekly. TUD is an efficacious, safe, and well tolerated form of TRT, and individual optimisation of the dose and/or interval is only required in the minority of men. Particularly given the ease of administration, TUD was the preferred TRT for both patients and clinicians. © 2013 International Society for Sexual Medicine.

  14. Rats and rabbits as pharmacokinetic screening tools for long acting intramuscular depots: case study with paliperidone palmitate suspension.

    Science.gov (United States)

    Patel, Harilal; Patel, Prakash; Modi, Nirav; Patel, Pinakin; Wagh, Yogesh; George, Alex; Desai, Nirmal; Srinivas, Nuggehally R

    2018-05-08

    Development of prodrug of 9-hydroxyrisperidone (paliperidone) long-acting intramuscular injection has enabled delivery over four-week time period with improved compliance. The key aim of this work was to establish a reliable preclinical model which may potentially serve as a screening tool for judging the pharmacokinetics of paliperidone formulation(s) prior to human clinical work. Sparse sampling composite study was used in rats, (Wistar/Sprague-Dawley (SD; n = 10)) and a serial blood sampling study design was used in rabbits (n = 4). Animals received intramuscular injection of paliperidone palmitate in the thigh muscle at dose of 16 (rats) and 4.5 mg/kg (rabbits). Samples were drawn in rats (retro-orbital sinus) and rabbits (central ear artery) and were analysed for paliperidone using liquid chromatography-mass spectrometry/ mass spectrometry (LC-MS/MS) assay. The plasma data was subjected to pharmacokinetic analysis. Following intramuscular injection of depot formulation in Wistar/SD rats and rabbits, absorption of paliperidone was slow and gradual with median value of time to reach maximum concentration (T max ) occurring on day 7. The exposures (i.e. area under the curve (AUC; 0-28) days) were 18,597, 21,865 and 18,120 ng.h/mL, in Wistar, SD and rabbits, respectively. The clearance was slow and supported long half-life (8-10 days). Either one of the two models can serve as a research tool for establishing pharmacokinetics of paliperidone formulation(s).

  15. Characterization of the fate and transport of nitroaromatic compounds at a former DoD ordnance depot site

    Energy Technology Data Exchange (ETDEWEB)

    Klausmeier, M.E.; Yoon, J.

    1999-07-01

    The 975-acre Former Nansemond Ordnance Depot (FNOD) in Suffolk, Virginia was used by the Department of Defense (DoD) from 1917 until the mid-1950's for preparation, storage, transportation, inspection and demilitarization of many classes of ammunition and ordnance. Approximately 28 areas of Concern (AOC) have been identified by the EPA as areas that could pose potential risk to human health or the environment. The primary contaminants of concern are some trace metals and explosive compounds. During a summer 1987 field investigation, a slab of crystalline TNT was found which was estimated to weigh several tons. An enhanced MODFLOW model is being used to identify subsurface flow patterns. The calibrated model will be used to identify contaminant fate and transport behavior at the site. Enhancements to the MODFLOW model include an updated block-centered flow package (BCF4) and an updated recharge-seepage face boundary package (RSF4) to utilize for the FNOD site flow characterization. BCF4 package accurately delineates the water table without relying on an ad hoc rewetting procedure. This is accomplished by calculating the hydraulic head value required to transmit recharging water through the unsaturated zone without inactivating dry cells. The recharge-seepage face package eliminates the projection of heads above the ground surface by adjusting recharge to a cell when a user supplied ponding depth is reached. Using a regional model, a telescoping grid refinement technique was implemented to calculate the boundary conditions around the area of interest and to model quantity and quality interactions between surface and subsurface water regimes in a realistic manner.

  16. Android fat depot is more closely associated with metabolic syndrome than abdominal visceral fat in elderly people.

    Science.gov (United States)

    Kang, Seon Mee; Yoon, Ji Won; Ahn, Hwa Young; Kim, So Yeon; Lee, Kyoung Ho; Shin, Hayley; Choi, Sung Hee; Park, Kyong Soo; Jang, Hak Chul; Lim, Soo

    2011-01-01

    Fat accumulation in android compartments may confer increased metabolic risk. The incremental utility of measuring regional fat deposition in association with metabolic syndrome (MS) has not been well described particularly in an elderly population. As part of the Korean Longitudinal Study on Health and Aging, which is a community-based cohort study of people aged more than 65 years, subjects (287 male, 75.9±8.6 years and 278 female, 76.0±8.8 years) with regional body composition data using Dual energy X-ray absorptiometry for android/gynoid area, computed tomography for visceral/subcutaneous adipose tissue (VAT/SAT), and cardiometabolic markers including adiponectin and high-sensitivity CRP were enrolled. We investigated the relationship between regional body composition and MS in multivariate regression models. Mean VAT and SAT area was 131.4±65.5 cm(2) and 126.9±55.2 cm(2) in men (P = 0.045) and 120.0±46.7 cm(2) and 211.8±65.9 cm(2) in women (Pandroid and gynoid fat amount was 1.8±0.8 kg and 2.5±0.8 kg in men and 2.0±0.6 kg and 3.3±0.8 kg in women, respectively (both Pandroid fat amount was strongly correlated with most metabolic risk factors compared to SAT or gynoid fat. Furthermore, android fat amount was significantly associated with clustering of MS components after adjustment for multiple parameters including age, gender, adiponectin, hsCRP, a surrogate marker of insulin resistance, whole body fat mass and VAT area. Our findings are consistent with the hypothesized role of android fat as a pathogenic fat depot in the MS. Measurement of android fat may provide a more complete understanding of metabolic risk associated with variations in fat distribution.

  17. Transgenerational Inheritance of Increased Fat Depot Size, Stem Cell Reprogramming, and Hepatic Steatosis Elicited by Prenatal Exposure to the Obesogen Tributyltin in Mice

    Science.gov (United States)

    Chamorro-García, Raquel; Sahu, Margaret; Abbey, Rachelle J.; Laude, Jhyme; Pham, Nhieu

    2013-01-01

    Background: We have previously shown that exposure to tributyltin (TBT) modulates critical steps of adipogenesis through RXR/PPARγ and that prenatal TBT exposure predisposes multipotent mesenchymal stem cells (MSCs) to become adipocytes by epigenetic imprinting into the memory of the MSC compartment. Objective: We tested whether the effects of prenatal TBT exposure were heritable in F2 and F3 generations. Methods: We exposed C57BL/6J female mice (F0) to DMSO vehicle, the pharmaceutical obesogen rosiglitazone (ROSI), or TBT (5.42, 54.2, or 542 nM) throughout pregnancy via the drinking water. F1 offspring were bred to yield F2, and F2 mice were bred to produce F3. F1 animals were exposed in utero and F2 mice were potentially exposed as germ cells in the F1, but F3 animals were never exposed to the chemicals. We analyzed the effects of these exposures on fat depot weights, adipocyte number, adipocyte size, MSC programming, hepatic lipid accumulation, and hepatic gene expression in all three generations. Discussion: Prenatal TBT exposure increased most white adipose tissue (WAT) depot weights, adipocyte size, and adipocyte number, and reprogrammed MSCs toward the adipocyte lineage at the expense of bone in all three generations. Prenatal TBT exposure led to hepatic lipid accumulation and up-regulated hepatic expression of genes involved in lipid storage/transport, lipogenesis, and lipolysis in all three subsequent generations. Conclusions: Prenatal TBT exposure produced transgenerational effects on fat depots and induced a phenotype resembling nonalcoholic fatty liver disease through at least the F3 generation. These results show that early-life obesogen exposure can have lasting effects. PMID:23322813

  18. Ethical acceptability of offering financial incentives for taking antipsychotic depot medication: patients' and clinicians' perspectives after a 12-month randomized controlled trial.

    Science.gov (United States)

    Noordraven, Ernst L; Schermer, Maartje H N; Blanken, Peter; Mulder, Cornelis L; Wierdsma, André I

    2017-08-29

    A randomized controlled trial 'Money for Medication'(M4M) was conducted in which patients were offered financial incentives for taking antipsychotic depot medication. This study assessed the attitudes and ethical considerations of patients and clinicians who participated in this trial. Three mental healthcare institutions in secondary psychiatric care in the Netherlands participated in this study. Patients (n = 169), 18-65 years, diagnosed with schizophrenia, schizoaffective disorder or another psychotic disorder who had been prescribed antipsychotic depot medication, were randomly assigned to receive 12 months of either treatment as usual plus a financial reward for each depot of medication received (intervention group) or treatment as usual alone (control group). Structured questionnaires were administered after the 12-month intervention period. Data were available for 133 patients (69 control and 64 intervention) and for 97 clinicians. Patients (88%) and clinicians (81%) indicated that financial incentives were a good approach to improve medication adherence. Ethical concerns were categorized according to the four-principles approach (autonomy, beneficence, non-maleficence, and justice). Patients and clinicians alike mentioned various advantages of M4M in clinical practice, such as increased medication adherence and improved illness insight; but also disadvantages such as reduced intrinsic motivation, loss of autonomy and feelings of dependence. Overall, patients evaluated financial incentives as an effective method of improving medication adherence and were willing to accept this reward during clinical treatment. Clinicians were also positive about the use of this intervention in daily practice. Ethical concerns are discussed in terms of patient autonomy, beneficence, non-maleficence and justice. We conclude that this intervention is ethically acceptable under certain conditions, and that further research is necessary to clarify issues of benefit

  19. The Hereptofauna of Letterkenny Army Depot, South-Central Pennsylvania: A Starting Point to the Long-Term Monitoring and Management of Amphibians and Reptiles

    Science.gov (United States)

    2010-06-01

    Journal of Kansas Herpetology Number 34 (June 2010) 11 www.cnah.org/khs ARtIClES tHE HERpEtofAUNA of lEttERKENNY ARMY dEpot, SoUtH-CENtRAl...compare the herpetological commu- nity currently present at the site with that expected from prior literature (felbaum, 1995; Hulse et al., 2001; tetra...Form 298 (Rev. 8-98) Prescribed by ANSI Std Z39-18 Journal of Kansas Herpetology Number 34 (June 2010) 12 www.cnah.org/khs agricultural and other

  20. Determination of lymph flow in murine oral mucosa using depot clearance of near-infrared-labeled albumin.

    Science.gov (United States)

    Papadakou, Panagiota; Karlsen, Tine Veronica; Wiig, Helge; Berggreen, Ellen

    2015-10-01

    The lymphatic vessels are playing an important role in inflammation since they return extravasated fluid, proteins, and cells back into the circulation and regulate immune cell trafficking. The oral mucosa, including gingiva, is well supplied with lymphatic vessels and is frequently challenged with inflammatory insults. Lymphatic vessels in gingiva protect against periodontal disease development, but quantification of lymph flow in this area has so far never been performed, due to lack of reliable methods. Mice of FVB strain (n=17) were anesthetized with isoflurane and placed on a jaw retraction board allowing the mouth to be kept open and stable. Albumin conjugated with Alexa680-fluorochrome (with or without LPS from Porphyromonas gingivalis) was injected superficially in oral mucosa mesio-buccal to the left first molar in each mouse. 60 min post-injection the mouse was transferred to an OptixMX3 optical imager where the total fluorescence was measured in the posterior facial area. The measurements continued further every 60 min for 7h for each mouse. The mice were awake and active between measurements. The in vivo washout of Alexa680-albumin was calculated using the natural logarithm of the relative values creating a negative slope for each mouse. Statistical analysis of variance was performed. The injection and distribution site for tracer was verified with India ink and shown to be in the interstitium below the oral mucosal epithelium, in an area well supplied with initial lymphatic vessels. Washout of the tracer Alexa680-albumin was log-linear, and the basal lymph flow calculated from depot clearance averaged -0.28 ± 0.08%/min (n=8). The clearance was significantly faster (-0.30 ± 0.08%/min, n=9) in acutely inflamed oral mucosa (p=0.0326). We developed a method that can successfully quantify the lymph flow in oral mucosa in steady state conditions and under acute perturbation. By use of this method, new information about the lymphatic function in oral mucosa

  1. Persistent organic pollutant levels in human visceral and subcutaneous adipose tissue in obese individuals—Depot differences and dysmetabolism implications

    Energy Technology Data Exchange (ETDEWEB)

    Pestana, Diogo, E-mail: diogopestana@gmail.com [Department of Biochemistry (U38-FCT), Faculty of Medicine, University of Porto, Centro de Investigação Médica, P-4200-450 Porto (Portugal); CINTESIS—Center for Research in Health Technologies and Information Systems, P-4200-450 Porto (Portugal); Faria, Gil [General Surgery Department, S. João Hospital, Faculty of Medicine, University of Porto, P-4200-450 Porto (Portugal); Sá, Carla [Department of Biochemistry (U38-FCT), Faculty of Medicine, University of Porto, Centro de Investigação Médica, P-4200-450 Porto (Portugal); Fernandes, Virgínia C. [Chemistry Investigation Centre (CIQ), Department of Chemistry, Faculty of Sciences, University of Porto, P-4169-007 Porto (Portugal); Requimte—Instituto Superior de Engenharia, Instituto Politécnico do Porto, P-4200-072 Porto (Portugal); Teixeira, Diana; Norberto, Sónia [Department of Biochemistry (U38-FCT), Faculty of Medicine, University of Porto, Centro de Investigação Médica, P-4200-450 Porto (Portugal); Faria, Ana [Department of Biochemistry (U38-FCT), Faculty of Medicine, University of Porto, Centro de Investigação Médica, P-4200-450 Porto (Portugal); Chemistry Investigation Centre (CIQ), Department of Chemistry, Faculty of Sciences, University of Porto, P-4169-007 Porto (Portugal); Faculty of Nutrition and Food Sciences, University of Porto, P-4200-465 Porto (Portugal); and others

    2014-08-15

    Background: The role of persistent organic pollutants (POPs) with endocrine disrupting activity in the aetiology of obesity and other metabolic dysfunctions has been recently highlighted. Adipose tissue (AT) is a common site of POPs accumulation where they can induce adverse effects on human health. Objectives: To evaluate the presence of POPs in human visceral (vAT) and subcutaneous (scAT) adipose tissue in a sample of Portuguese obese patients that underwent bariatric surgery, and assess their putative association with metabolic disruption preoperatively, as well as with subsequent body mass index (BMI) reduction. Methods: AT samples (n=189) from obese patients (BMI ≥35) were collected and the levels of 13 POPs were determined by gas chromatography with electron-capture detection (GC-ECD). Anthropometric and biochemical data were collected at the time of surgery. BMI variation was evaluated after 12 months and adipocyte size was measured in AT samples. Results: Our data confirm that POPs are pervasive in this obese population (96.3% of detection on both tissues), their abundance increasing with age (R{sub S}=0.310, p<0.01) and duration of obesity (R{sub S}=0.170, p<0.05). We observed a difference in AT depot POPs storage capability, with higher levels of ΣPOPs in vAT (213.9±204.2 compared to 155.1±147.4 ng/g of fat, p<0.001), extremely relevant when evaluating their metabolic impact. Furthermore, there was a positive correlation between POP levels and the presence of metabolic syndrome components, namely dysglycaemia and hypertension, and more importantly with cardiovascular risk (R{sub S}=0.277, p<0.01), with relevance for vAT (R{sub S}=0.315, p<0.01). Finally, we observed an interesting relation of higher POP levels with lower weight loss in older patients. Conclusion: Our sample of obese subjects allowed us to highlight the importance of POPs stored in AT on the development of metabolic dysfunction in a context of obesity, shifting the focus to their

  2. Persistent organic pollutant levels in human visceral and subcutaneous adipose tissue in obese individuals—Depot differences and dysmetabolism implications

    International Nuclear Information System (INIS)

    Pestana, Diogo; Faria, Gil; Sá, Carla; Fernandes, Virgínia C.; Teixeira, Diana; Norberto, Sónia; Faria, Ana

    2014-01-01

    Background: The role of persistent organic pollutants (POPs) with endocrine disrupting activity in the aetiology of obesity and other metabolic dysfunctions has been recently highlighted. Adipose tissue (AT) is a common site of POPs accumulation where they can induce adverse effects on human health. Objectives: To evaluate the presence of POPs in human visceral (vAT) and subcutaneous (scAT) adipose tissue in a sample of Portuguese obese patients that underwent bariatric surgery, and assess their putative association with metabolic disruption preoperatively, as well as with subsequent body mass index (BMI) reduction. Methods: AT samples (n=189) from obese patients (BMI ≥35) were collected and the levels of 13 POPs were determined by gas chromatography with electron-capture detection (GC-ECD). Anthropometric and biochemical data were collected at the time of surgery. BMI variation was evaluated after 12 months and adipocyte size was measured in AT samples. Results: Our data confirm that POPs are pervasive in this obese population (96.3% of detection on both tissues), their abundance increasing with age (R S =0.310, p<0.01) and duration of obesity (R S =0.170, p<0.05). We observed a difference in AT depot POPs storage capability, with higher levels of ΣPOPs in vAT (213.9±204.2 compared to 155.1±147.4 ng/g of fat, p<0.001), extremely relevant when evaluating their metabolic impact. Furthermore, there was a positive correlation between POP levels and the presence of metabolic syndrome components, namely dysglycaemia and hypertension, and more importantly with cardiovascular risk (R S =0.277, p<0.01), with relevance for vAT (R S =0.315, p<0.01). Finally, we observed an interesting relation of higher POP levels with lower weight loss in older patients. Conclusion: Our sample of obese subjects allowed us to highlight the importance of POPs stored in AT on the development of metabolic dysfunction in a context of obesity, shifting the focus to their metabolic effects

  3. Body frame size in school children is related to the amount of adipose tissue in different depots but not to adipose distribution.

    Science.gov (United States)

    Guzmán-de la Garza, Francisco J; González Ayala, Alejandra E; Gómez Nava, Marisol; Martínez Monsiváis, Leislie I; Salinas Martínez, Ana M; Ramírez López, Erik; Mathiew Quirós, Alvaro; Garcia Quintanilla, Francisco

    2017-09-10

    The main aim of this study was to test the hypothesis that body frame size is related to the amount of fat in different adipose tissue depots and to fat distribution in schoolchildren. Children aged between 5 and 10 years were included in this cross-sectional study (n = 565). Body frame size, adiposity markers (anthropometric, skinfolds thickness, and ultrasound measures), and fat distribution indices were analyzed. Correlation coefficients adjusted by reliability were estimated and analyzed by sex; the significance of the difference between two correlation coefficients was assessed using the Fisher z-transformation. The sample included primarily urban children; 58.6% were normal weight, 16.1% overweight, 19.6% obese, and the rest were underweight. Markers of subcutaneous adiposity, fat mass and fat-free mass, and preperitoneal adiposity showed higher and significant correlations with the sum of the biacromial + bitrochanteric diameter than with the elbow diameter, regardless of sex. The fat distribution conicity index presented significant but weak correlations; and visceral adipose tissue, hepatic steatosis, and the waist-for-hip ratio were not significantly correlated with body frame size measures. Body frame size in school children was related to the amount of adipose tissue in different depots, but not adipose distribution. More studies are needed to confirm this relationship and its importance to predict changes in visceral fat deposition during growth. © 2017 Wiley Periodicals, Inc.

  4. NeuronDepot: Keeping your colleagues in sync by combining modern cloud storage services, the local file system, and simple web applications

    Directory of Open Access Journals (Sweden)

    Philipp L Rautenberg

    2014-06-01

    Full Text Available Neuroscience today deals with a data deluge derived from the availability of high-throughput sensors of brain structure and brain activity, and increased computational resources for detailed simulations with complex output. We report here (1 a novel approach to data sharing between collaborating scientists that brings together file system tools and cloud technologies, (2 a service implementing this approach, called NeuronDepot, and (3 an example application of the service to a complex use case in the neurosciences. The main drivers for our approach are to facilitate collaborations with a transparent, automated data flow that shields scientists from having to learn new tools or data structuring paradigms. Using NeuronDepot is simple: one-time data assignment from the originator and cloud based syncing – thus making experimental and modeling data available across the collaboration with minimum overhead. Since data sharing is cloud based, our approach opens up the possibility of using new software developments and hardware scalabitliy which are associated with elastic cloud computing. We provide an implementation that relies on existing synchronization services and is usable from all devices via a reactive web interface. We are motivating our solution by solving the practical problems of the GinJang project, a collaboration of three universities across eight time zones with a complex workflow encompassing data from electrophysiological recordings, imaging, morphological reconstructions, and simulations.

  5. NeuronDepot: keeping your colleagues in sync by combining modern cloud storage services, the local file system, and simple web applications.

    Science.gov (United States)

    Rautenberg, Philipp L; Kumaraswamy, Ajayrama; Tejero-Cantero, Alvaro; Doblander, Christoph; Norouzian, Mohammad R; Kai, Kazuki; Jacobsen, Hans-Arno; Ai, Hiroyuki; Wachtler, Thomas; Ikeno, Hidetoshi

    2014-01-01

    Neuroscience today deals with a "data deluge" derived from the availability of high-throughput sensors of brain structure and brain activity, and increased computational resources for detailed simulations with complex output. We report here (1) a novel approach to data sharing between collaborating scientists that brings together file system tools and cloud technologies, (2) a service implementing this approach, called NeuronDepot, and (3) an example application of the service to a complex use case in the neurosciences. The main drivers for our approach are to facilitate collaborations with a transparent, automated data flow that shields scientists from having to learn new tools or data structuring paradigms. Using NeuronDepot is simple: one-time data assignment from the originator and cloud based syncing-thus making experimental and modeling data available across the collaboration with minimum overhead. Since data sharing is cloud based, our approach opens up the possibility of using new software developments and hardware scalabitliy which are associated with elastic cloud computing. We provide an implementation that relies on existing synchronization services and is usable from all devices via a reactive web interface. We are motivating our solution by solving the practical problems of the GinJang project, a collaboration of three universities across eight time zones with a complex workflow encompassing data from electrophysiological recordings, imaging, morphological reconstructions, and simulations.

  6. The adipose tissue of origin influences the biological potential of human adipose stromal cells isolated from mediastinal and subcutaneous fat depots

    Directory of Open Access Journals (Sweden)

    Camilla Siciliano

    2016-09-01

    Full Text Available Indirect evidence suggests that adipose tissue-derived stromal cells (ASCs possess different physiological and biological variations related to the anatomical localization of the adipose depots. Accordingly, to investigate the influence of the tissue origin on the intrinsic properties of ASCs and to assess their response to specific stimuli, we compared the biological, functional and ultrastructural properties of two ASC pools derived from mediastinal and subcutaneous depots (thoracic compartment by means of supplements such as platelet lysate (PL and FBS. Subcutaneous ASCs exhibited higher proliferative and clonogenic abilities than mediastinal counterpart, as well as increased secreted levels of IL-6 combined with lower amount of VEGF-C. In contrast, mediastinal ASCs displayed enhanced pro-angiogenic and adipogenic differentiation properties, increased cell diameter and early autophagic processes, highlighted by electron microscopy. Our results further support the hypothesis that the origin of adipose tissue significantly defines the biological properties of ASCs, and that a homogeneric function for all ASCs cannot be assumed.

  7. A multicenter, observational study of lanreotide depot/autogel (LAN) in patients with acromegaly in the United States: 2-year experience from the SODA registry.

    Science.gov (United States)

    Salvatori, Roberto; Gordon, Murray B; Woodmansee, Whitney W; Ioachimescu, Adriana G; Carver, Don W; Mirakhur, Beloo; Cox, David; Molitch, Mark E

    2017-12-01

    This analysis evaluates the 2-year effectiveness and safety of lanreotide depot/autogel (LAN), as well as treatment convenience and acromegaly symptom relief, from the Somatuline ® Depot for Acromegaly (SODA) registry, a post-marketing, open-label, observational, multicenter, United States registry study. Patients with acromegaly treated with LAN were eligible for enrollment. Demographics, LAN dose, extended dosing interval (EDI) (interval of injections ≥42 days), insulin-like growth factor 1 (IGF-1), growth hormone (GH), glycated hemoglobin, adverse events (AEs), injection convenience, and symptom data were collected. As of September 29, 2014, 241 patients were enrolled in SODA. IGF-1 levels below age- and gender-adjusted upper normal limit (ULN) were achieved in 71.2% at month (M) 12 and 74.4% at M24; GH ≤2.5 µg/L in 83.3% at M12 and 80.0% at M24; GH convenient. SODA indicates 2-year biochemical control with majority of patients achieving both IGF-1 < ULN and GH ≤2.5 µg/L. LAN was generally well tolerated with no new or unexpected safety signals reported during the observation period. clinicaltrials.gov Clinical Trial Identifier: NCT00686348.

  8. Functionalization of deproteinized bovine bone with a coating-incorporated depot of BMP-2 renders the material efficiently osteoinductive and suppresses foreign-body reactivity.

    Science.gov (United States)

    Wu, Gang; Hunziker, Ernst B; Zheng, Yuanna; Wismeijer, Daniel; Liu, Yuelian

    2011-12-01

    The repair of critical-sized bony defects remains a challenge in the fields of implantology, maxillofacial surgery and orthopaedics. As an alternative bone-defect filler to autologous bone grafts, deproteinized bovine bone (DBB) is highly osteoconductive and clinically now widely used. However, this product suffers from the disadvantage of not being intrinsically osteoinductive. In the present study, this property was conferred by coating DBB with a layer of calcium phosphate into which bone morphogenetic protein 2 (BMP-2) was incorporated. Granules of DBB bearing a coating-incorporated depot of BMP-2--together with the appropriate controls (DBB bearing a coating but no BMP-2; uncoated DBB bearing adsorbed BMP-2; uncoated DBB bearing no BMP-2)--were implanted subcutaneously in rats. Five weeks later, the implants were withdrawn for a histomorphometric analysis of the volume densities of (i) bone, (ii) bone marrow, (iii) foreign-body giant cells and (iv) fibrous capsular tissue. Parameters (i) and (ii) were highest, whilst parameters (iii) and (iv) were lowest in association with DBB bearing a coating-incorporated depot of BMP-2. Hence, this mode of functionalization not only confers DBB with the property of osteoinductivity but also improves its biocompatibility--thus dually enhancing its clinical potential in the repair of bony defects. Copyright © 2011 Elsevier Inc. All rights reserved.

  9. Permanent Access to the Records of Science - The International Role of the e-Depot at the Koninklijke Bibliotheek, National Library of the Netherlands

    Directory of Open Access Journals (Sweden)

    Gerard van Trier

    2006-10-01

    Full Text Available In 1994 the Koninklijke Bibliotheek (KB decided to include electronic publications in its deposit collection. This was considered as a logical extension of the deposit for printed publications already in place. In December 2002, after a few years of experimenting, the current e-Depot was delivered, with the IBM Digital Information and Archiving System (DIAS as its technical 'heart'. The e-Depot is now fully operational and imbedded in the KB organisation. The emergence of the electronic journal creates new challenges to the traditional deposit model. Because of the involvement of international publishers of Dutch origin, the e-Depot has had an international dimension right from the start. In 2002 the KB signed an historic electronic archiving agreement with Elsevier Science, which covered the entire set of Elsevier journals. This arrangement turned the KB into the first official digital archive in the world for journals published by international scientific publishers. A year later the KB concluded a similar agreement with Kluwer Academic Publishers. Other publishers followed, also from outside the Netherlands: Biomed Central, Blackwell, Oxford University Press, Taylor and Francis, Sage, Springer and Brill Academic Publishers. On the basis of these agreements the e-Depot will eventually hold 9 million articles. The annual increase in the number of articles from these publishers will be around 400,000. Publishers are required to deposit their publications free of charge. Access is restricted: only on-site, for any registered user of the KB. Remote access is only offered with permission of the publisher. On-site retrieval, access, printing, downloading is for private use only, systematic reproduction is not allowed. Documents are available for interlibrary document supply within the Netherlands. The archive serves as a guarantee to all licensees worldwide. In case of calamities or in case the publisher does not meet his obligations, the KB

  10. Risk assessment of aflatoxins B1 (AFB1) in corn arepas in Colombia and chemical risk assessment case study mercury in Fish

    International Nuclear Information System (INIS)

    Correa Lizarazo, D.

    2013-01-01

    The power point presentation is about: Identify the pair substrate (corn, wheat and rice) - mycotoxin (DON, AFB1) higher risk for the Colombian population, based on the exposure assessment and mercury in freshwater fish from Colombia. This report answer some the following questions: what are the most consumed products in the country, which may create a risk for the Colombian population, what are the prevention and control recommendations to reduce potential contamination of the products selected, what are economic activities and their impact areas that contribute most to the incorporation of of mercury in freshwater fish from Colombia,what are the species that may pose greater accumulation of mercury and methylmercury identified , what is the risk associated with the consumption of the species, what are the preventive measures to minimize exposure from consumption of fish with mercury and methylmercury and possible intervention strategies

  11. Pilot-Scale Demonstration of In-Situ Chemical Oxidation Involving Chlorinated Volatile Organic Compounds - Design and Deployment Guidelines (Parris Island, SC, U.S. Marine Corp Recruit Depot, Site 45 Pilot Study)

    Science.gov (United States)

    A pilot-scale in situ chemical oxidation (ISCO) demonstration, involving subsurface injections of sodium permanganate (NaMnO4), was performed at the US Marine Corp Recruit Depot (MCRD), site 45 (Parris Island (PI), SC). The ground water was originally contaminated with perchloroe...

  12. Interaction of mammary bovine ABCG2 with AFB1 and its metabolites and regulation by PCB 126 in a MDCKII in vitro model.

    Science.gov (United States)

    Manzini, L; Halwachs, S; Girolami, F; Badino, P; Honscha, W; Nebbia, C

    2017-12-01

    The ATP-binding cassette efflux transporter ABCG2 plays a key role in the mammary excretion of drugs and toxins in humans and animals. Aflatoxins (AF) are worldwide contaminants of food and feed commodities, while PCB 126 is a dioxin-like PCB which may contaminate milk and dairy products. Both compounds are known human carcinogens. The interactions between AF and bovine ABCG2 (bABCG2) as well as the effects of PCB 126 on its efflux activity have been investigated by means of the Hoechst H33342 transport assay in MDCKII cells stably expressing mammary bABCG2. Both AFB1 and its main milk metabolite AFM1 showed interaction with bABCG2 even at concentrations approaching the legal limits in feed and food commodities. Moreover, PCB 126 significantly enhanced bABCG2 functional activity. Specific inhibitors of either AhR (CH233191) or ABCG2 (Ko143) were able to reverse the PCB 126-induced increase in bABCG2 transport activity, showing the specific upregulation of the efflux protein by the AhR pathway. The incubation of PCB 126-pretreated cells with AFM1 was able to substantially reverse such effect, with still unknown mechanism(s). Overall, results from this study point to AFB1 and AFM1 as likely bABCG2 substrates. The PCB 126-dependent increased activity of the transporter could enhance the ABCG2-mediated excretion into dairy milk of chemicals (i.e., drugs and toxins) potentially harmful to neonates and consumers. © 2017 John Wiley & Sons Ltd.

  13. Attempt to evaluate the cumulative deposit of strontium 90 in several French centres; Essai d'evaluation du depot cumulatif de strontium 90 dans plusieurs stations francaises

    Energy Technology Data Exchange (ETDEWEB)

    Garnier, A [Commissariat a l' Energie Atomique, Fontenay aux Roses (France). Centre d' Etudes Nucleaires

    1966-07-01

    In order to be able to interpret results of radioactivity controls of the ambient atmosphere and of the supply chain carried out in several French centres, it is necessary to know the value of the cumulative strontium-90 deposit resulting from fall-out. The estimation of the fall-out which occurred locally in the years before systematic controls were established can be made by assuming that the {sup 90}Sr concentration in rain varies little from one place to another (if they are fairly close) and that the deposit can be deduced from that measured in a single station by making corrections for differences in the rainfall. This assumption is confirmed by applying the method to the calculation of {sup 90}Sr fall-out at Ispra, Mol and at several French centres: the values calculated are compared to those obtained by measurements carried out since 1958 in some cases, and since 1960 in others. The results show that the method is valid for calculating fall-out prior to 1960 (in the absence of information) and to deduce with sufficient approximation the subsequent cumulative deposits in the French centres under consideration. (author) [French] L'evaluation du depot cumulatif de Sr 90 consecutif aux retombees est necessaire a l'interpretation des resultats du controle de la radioactivite du milieu ambiant et de la cha e alimentaire effectue en plusieurs stations francaises. L'estimation des retombees locale des annees anterieures a la mise en oeuvre systematique des moyens de surveillance peut etre faite en admettant que la concentration de Sr 90 dans la pluie varie peu d'un endroit a l'autre (dans des regions assez rapprochees) et que le depot peut etre deduit de celui mesure en une station gr e a des corrections tenant compte de la variation de pluviosite. Cette hypothese est verifiee en appliquant la methode au calcul des retombees de Sr 90 a Ispra, a Mol, et en plusieurs stations francaises: les valeurs calculees sont comparees a celles obtenues par les mesures

  14. Description of Eimeria motelo sp. n. (Apicomplexa: Eimeriidae from the yellow footed tortoise, Geochelone denticulata (Chelonia: Testudinidae, and replacement of Eimeria carinii Lainson, Costa & Shaw, 1990 by Eimeria lainsoni nom. nov.

    Directory of Open Access Journals (Sweden)

    Lada Hurková

    2000-12-01

    Full Text Available Eimeria motelo sp. n. is described from faeces of the yellow-footed tortoise, Geochelone denticulata (L.. Oocysts are irregularly ellipsoidal or cylindrical, with slightly expressed lobed protrusions and irregularities at the poles, possibly caused by wrinkling of the oocyst wall, 17 (15-19 × 9.4 (8.5-11 µm, shape index (length/width being 1.81 (1.45-2. The oocyst wall is smooth, single-layered, 0.5 µm thick with no micropyle. There are no polar bodies. Sporocysts are ellipsoidal, 8.9 (7.5-10 × 4.4 (4-5 µm, shape index 2.03 (1.7-2.5. A sporocyst residuum is present, composed of many granules of irregular size. The sporozoites are elongate, lying lengthwise in the sporocysts. Comparison with other species of the genus Eimeria parasitising members of family Testudinidae indicates that the presently described coccidium represents a new species. The name of Eimeria carinii Lainson, Costa & Shaw, 1990 is found to be preoccupied by a homonym, Eimeria carinii Pinto 1928 given to a coccidium from Rattus norvegicus. Therefore, it is replaced by Eimeria lainsoni nom. nov.

  15. Opposite associations of trunk and leg fat depots with plasma ferritin levels in middle-aged and older Chinese men and women.

    Directory of Open Access Journals (Sweden)

    Hongyu Wu

    Full Text Available BACKGROUND: Few data have been published on the associations of ferritin with trunk and leg fat depots. We aimed to investigate these associations in a Chinese population. METHODOLOGY: Trunk fat mass and leg fat mass were determined in a cross-sectional sample of 1,150 Chinese (479 men and 671 women aged 50-70 years by dual-energy X-ray absorptiometry scan. Fasting plasma ferritin was measured. PRINCIPAL FINDINGS: Plasma ferritin was positively correlated with waist circumference, waist-to-hip ratio, total body fat and trunk fat mass, but inversely correlated with leg fat mass in men (r = 0.16, 0.26, 0.19, 0.22 and -0.12, respectively, all P<0.05 and women (r = 0.16, 0.16, 0.08, 0.17 and -0.12, respectively, all P<0.05. Multivariate regression analysis showed that ferritin levels increased with larger trunk fat mass (β = 0.33 ± 0.08 for men and β = 0.21 ± 0.05 for women, both P<0.001 while decreased with larger leg fat mass (β = -0.12 ± 0.09, P = 0.15 for men; and β = -0.14 ± 0.05, P = 0.005 for women. Moreover, plasma ferritin levels decreased with increasing tertile of leg fat mass among each tertile of trunk fat mass. CONCLUSION: This is the first study to report the opposite associations of trunk and leg fat depots with plasma ferritin levels.

  16. A Probabilistic Tool that Aids Logistics Engineers in the Establishment of High Confidence Repair Need-Dates at the NASA Shuttle Logistics Depot

    Science.gov (United States)

    Bullington, J. V.; Winkler, J. C.; Linton, D. G.; Khajenoori, S.

    1995-01-01

    The NASA Shuttle Logistics Depot (NSLD) is tasked with the responsibility for repair and manufacture of Line Replaceable Unit (LRU) hardware and components to support the Space Shuttle Orbiter. Due to shrinking budgets, cost effective repair of LRU's becomes a primary objective. To achieve this objective, is imperative that resources be assigned to those LRU's which have the greatest expectation of being needed as a spare. Forecasting the times at which spares are needed requires consideration of many significant factors including: failure rate, flight rate, spares availability, and desired level of support, among others. This paper summarizes the results of the research and development work that has been accomplished in producing an automated tool that assists in the assignment of effective repair start-times for LRU's at the NSLD. This system, called the Repair Start-time Assessment System (RSAS), uses probabilistic modeling technology to calculate a need date for a repair that considers the current repair pipeline status, as well as, serviceable spares and projections of future demands. The output from the system is a date for beginning the repair that has significantly greater confidence (in the sense that a desired probability of support is ensured) than times produced using other techniques. Since an important output of RSAS is the longest repair turn-around time that will ensure a desired probability of support, RSAS has the potential for being applied to operations at any repair depot where spares are on-hand and repair start-times are of interest. In addition, RSAS incorporates tenants of Just-in-Time (JIT) techniques in that the latest repair start-time (i.e., the latest time at which repair resources must be committed) may be calculated for every failed unit This could reduce the spares inventory for certain items, without significantly increasing the risk of unsatisfied demand.

  17. The Impact of Intra-articular Depot Betamethasone Injection on Insulin Resistance Among Diabetic Patients With Osteoarthritis of the Knee: A Case-Control Study.

    Science.gov (United States)

    Habib, George; Chernin, Mark; Sakas, Fahed; Artul, Suheil; Jabbour, Adel; Jabaly-Habib, Haneen

    2018-06-01

    The aim of this study was to evaluate the impact of intra-articular corticosteroid injection (IACI) of depot betamethasone at the knee joint on insulin resistance (IR). Patients with type 2 diabetes, non-insulin treated, with painful osteoarthritis of the knee were requested to participate in our study. After consent, demographic, clinical, and laboratory parameters were documented in addition to fasting blood glucose (FBG) and fasting blood insulin levels just prior to IACI of 1 mL of depot betamethasone. Fasting blood glucose and fasting blood insulin levels were repeated the next day following the IACI and 8 days later. Age- and sex-matched group of patients with type 2 diabetes from the same clinic were recruited as a control group (case-control study). Insulin resistance was calculated using Homeostasis Model Assessment-Insulin Resistance. Mann-Whitney U test, χ test, and Wilcoxon signed rank tests were used for statistical analysis. Eleven patients were recruited in the patients' group and 10 patients in the control group. Median FBG in the patients' group at baseline was 148 ± 51 mg/dL, and median IR was 5.12 ± 2.46. One day following the IACI, median FBG level was 247 ± 104 mg/dL (P = 0.004, compared with baseline), with median IR of 20.8 ± 7.01 (P = 0.0039). The median ratios of blood glucose and IR 1 day following the IACI compared with baseline were 1.7 and 4.1, respectively. Eight days following the IACI, mean FBG and IR levels were not significantly different from baseline. Intra-articular corticosteroid injection of betamethasone at the knee joint among patients with diabetes was associated with a significant increase in IR levels compared with baseline levels, 1 day following the injection. The mean percentage of increase in IR was higher than that for FBG levels.

  18. Smear-positive pulmonary tuberculosis and AFB examination practices according to the standard checklist of WHO's tuberculosis laboratory assessment tool in three governmental hospitals, Eastern Ethiopia.

    Science.gov (United States)

    Mekonnen, Abiyu

    2014-05-13

    Using the Directly Observed Treatment-Short course (DOTS) program the World Health Organization's global target was to detect 70% of new sputum-smear positive PTB cases. Smear positive PTB cases are more infectious than the smear negative cases. The TB case detection rate remains very low in Ethiopia, but there are increases in smear-negative PTB diagnosis which could be attributed to several factors including poor quality of sputum smear-microscopy. A five years retrospective record review of data between September, 2007 and August, 2012 and an in-depth assessment of AFB staining practices of sputum smear using a standard checklist were made. The proportion of smear positive cases relative to overall Acid Fast Bacilli (AFB) screened was determined over a five year period to indicate the overall prevalence and the trend. Odds ratio with 95 percent confidence interval was calculated for categorical variables using multivariate Logistic Regression model to assess the strength of association. A total of 1266 individuals' data were reviewed. The majority of the study participants were male, 704 (55.6%), and rural residents, 690 (54.5%). The overall prevalence rate of smear positive PTB was 21.6%. Age categories between 15-24 and 25-34 years were independent predictors of smear positive PTB with adjusted odds ratio of 2.246 [95% CI (1.098-4.597)] and 2.267 [95% CI (1.107-4.642)], respectively. More males were affected by PTB than females with an adjusted odds ratio of 1.426 [95% CI (1.083-1.879)]. An in-depth interview with the respective laboratory chiefs showed that quality control measures for sputum smear microscopy were used at different levels of the testing activities; however, equipment function verification as a quality control measure was not accomplished regularly in all of the study hospital laboratories. The smear positive PTB case detection rate indicated in this study is significantly lower than the countries which met the 70% target of the World Health

  19. Use of a molecular diagnostic test in AFB smear positive tuberculosis suspects greatly reduces time to detection of multidrug resistant tuberculosis.

    Directory of Open Access Journals (Sweden)

    Nestani Tukvadze

    Full Text Available The WHO has recommended the implementation of rapid diagnostic tests to detect and help combat M/XDR tuberculosis (TB. There are limited data on the performance and impact of these tests in field settings.The performance of the commercially available Genotype MTBDRplus molecular assay was compared to conventional methods including AFB smear, culture and drug susceptibility testing (DST using both an absolute concentration method on Löwenstein-Jensen media and broth-based method using the MGIT 960 system. Sputum specimens were obtained from TB suspects in the country of Georgia who received care through the National TB Program.Among 500 AFB smear-positive sputum specimens, 458 (91.6% had both a positive sputum culture for Mycobacterium tuberculosis and a valid MTBDRplus assay result. The MTBDRplus assay detected isoniazid (INH resistance directly from the sputum specimen in 159 (89.8% of 177 specimens and MDR-TB in 109 (95.6% of 114 specimens compared to conventional methods. There was high agreement between the MTBDRplus assay and conventional DST results in detecting MDR-TB (kappa = 0.95, p<0.01. The most prevalent INH resistance mutation was S315T (78% in the katG codon and the most common rifampicin resistance mutation was S531L (68% in the rpoB codon. Among 13 specimens from TB suspects with negative sputum cultures, 7 had a positive MTBDRplus assay (3 with MDR-TB. The time to detection of MDR-TB was significantly less using the MTBDRplus assay (4.2 days compared to the use of standard phenotypic tests (67.3 days with solid media and 21.6 days with broth-based media.Compared to conventional methods, the MTBDRplus assay had high accuracy and significantly reduced time to detection of MDR-TB in an area with high MDR-TB prevalence. The use of rapid molecular diagnostic tests for TB and drug resistance should increase the proportion of patients promptly placed on appropriate therapy.

  20. Intramuscular depot formulations of leuprolide acetate suppress testosterone levels below a 20 ng/dL threshold: a retrospective analysis of two Phase III studies

    Directory of Open Access Journals (Sweden)

    Spitz A

    2016-08-01

    Full Text Available Aaron Spitz,1 Marc Gittelman,2 Lawrence I Karsh,3 Sanja Dragnic,4 Ahmed M Soliman,5 Aditya Lele,6 Damian Gruca,7 Michael Norton4 1Orange County Urology Associates, Laguna Beach, CA, 221st Century Oncology/UroMedix-Aventura Division, Aventura, FL, 3The Urology Center of Colorado, Denver, CO, 4US Medical Affairs, 5Health Economics and Outcomes Research, 6Data and Statistical Sciences, AbbVie Inc., North Chicago, IL, USA; 7Global Medical Affairs, AbbVie Deutschland, Ludwigshafen, Germany Introduction: Androgen deprivation therapy (ADT with gonadotropin-releasing hormone (GnRH analogs is a standard treatment for advanced prostate cancer. GnRH analog therapy can reduce testosterone to “castrate” levels, historically defined as <50 ng/dL. With the advent of newer assays, a lower threshold of <20 ng/dL has recently been proposed. We report the results of a retrospective analysis of two Phase III trials of 4- and 6-month depot microsphere formulations of leuprolide acetate (LA, a GnRH agonist that has previously demonstrated efficacy in testosterone suppression to <50 ng/dL in patients on ADT. This analysis investigates the ability of these LA formulations to suppress to ≤20 ng/dL levels.Methods: In two of five AbbVie/Abbott clinical trials of microsphere formulations of LA for ADT, analytic technology permitting testosterone detection as low as 3 ng/dL was used and thus was selected for this analysis. Both trials were open-label, fixed-dose studies in prostate cancer patients, naïve to ADT. Patients received either 30 mg (4-month formulation; n=49 or 45 mg (6-month formulation; n=151 depot injections of LA microspheres. Treatment duration was up to 32 weeks for the 4-month formulation and 48 weeks for the 6-month formulation. The proportion of patients achieving the 20 ng/dL threshold was determined every 4 weeks.Results: Pooled analysis showed that 152 of 193 (79% of patients achieved serum testosterone levels of ≤20 ng/dL at 4 weeks, and

  1. Evaluación de adsorbentes para la reducción de aflatoxina M1 en leche de vacas alimentadas con dietas contaminadas artificialmente con AFB

    Directory of Open Access Journals (Sweden)

    Federico Rojo

    2014-01-01

    Full Text Available Los adsorbentes han sido utilizados ampliamente para prevenir las micotoxicosis y la transferencia d e toxinas o sus metabolitos dentro de la cadena alimentaria. Particularmente, se unen a las aflatoxinas dentro del tracto gastrointestinal de los rumiantes, disminuyendo su biodisponibilidad y la transferencia de aflatoxin a M 1 (AFM 1 a la leche. El presente estudio se desarrolló para evaluar dos métodos de exposición a aflatoxina B 1 en vacas Holstein y monitorear la transferencia AFM 1 a la leche. Adicionalmente, se analizó el potencial de tres adsorbentes de aflatoxinas en ambos experimentos. Los resultados mostraron una tasa de trasferencia de AFB 1 a AFM 1 / día de 3.35 y 1.8 % en los dos experimentos respectivamente. La transferencia estimada de AFM 1 en la leche observada en el segundo método fue cercana a las obtenidas de vacas alimentadas con alimentos natura lmente contaminados con aflatoxinas. A diferencia de los glucomananos de paredes cel ulares de levaduras, ambos adsorbentes de aluminosilicatos disminuyeron significativamente los niveles de AFM 1 en la leche ( P <0.05.

  2. Influence of adipocyte size and adipose depot on the in vitro lipolytic activity and insulin sensitivity of adipose tissue in dairy cows at the end of the dry period.

    Science.gov (United States)

    De Koster, J; Van den Broeck, W; Hulpio, L; Claeys, E; Van Eetvelde, M; Hermans, K; Hostens, M; Fievez, V; Opsomer, G

    2016-03-01

    The aim of the present research was to describe characteristics of adipose tissue lipolysis in dairy cows with a variable body condition score (BCS). Ten clinically healthy Holstein Friesian cows were selected based on BCS and euthanized 10 to 13 d before the expected parturition date. Immediately after euthanasia, adipose tissue samples were collected from subcutaneous and omental fat depots. In both depots, we observed an increase in adipocyte size with increasing BCS. Using an in vitro explant culture of subcutaneous and omental adipose tissue, we aimed to determine the influence of adipocyte size and localization of adipose depot on the lipolytic activity in basal conditions and after addition of isoproterenol (nonselective β-agonist) and insulin in different concentrations. Glycerol release in the medium was used as a measure for lipolytic activity. We observed that the basal lipolytic activity of subcutaneous and omental adipose tissue increased with adipocyte volume, meaning that larger fat cells have higher basal lipolytic activity independent of the location of the adipose depot. Dose-response curves were created between the concentration of isoproterenol or insulin and the amount of glycerol released. The shape of the dose-response curves is determined by the concentration of isoproterenol and insulin needed to elicit the half-maximal effect and the maximal amount of stimulated glycerol release or the maximal inhibitory effect of insulin. We observed that larger fat cells released more glycerol upon maximal stimulation with isoproterenol and this was more pronounced in subcutaneous adipose tissue. Additionally, larger fat cells had a higher sensitivity toward lipolytic signals. We observed a trend for larger adipocytes to be more resistant to the maximal antilipolytic effect of insulin. The insulin concentration needed to elicit the half-maximal inhibitory effect of insulin was within the physiological range of insulin and was not influenced by adipocyte

  3. Comparison of Continuation Rates and Reasons of Discontinuation for Cyclofem and Depot -medroxyprogesterone acetate in Rural Areas of East Azerbaijan Province, Iran

    Directory of Open Access Journals (Sweden)

    Robab Hassanzadeh

    2012-03-01

    Full Text Available Objective: In this study continuation rate and reasons for discontinuation of Depot-medroxyprogestroneacetate (DMPAand Cyclofem have been compared.Materials and methods: A retrospective cohort study was conducted with 422 women (202 Cyclofemand220 DMPA userswho had started using the methods 12-24 months before the study in East Azerbaijanhealth houses. Data were collected by reviewing the records and interview with the clients and analysedusing Kaplan-Meier and Cox Regression.Results: The 3, 6, 9, 12 months continuation rate were 56%, 37%, 30%, 27% respectively for Cyclofemversus 75%, 59.5%, 48%, 42.5% for DMPA. Menstrual changes were reported significantly more by theDMPA users than the Cyclofem users (85% vs. 73%, P=0.008 as the main reason for thediscontinuation, the difference mainly reflected of amenorrhea (50% vs. 23%, P=0.003. None of DMPAusers and 11% of Cyclofem users claimed frequency of visits and lack of method supplies as their maindiscontinuation reason.Conclusion: Discontinuation rate was high for the both methods but it was higher for Cyclofem.Thecommon side effects mentioned as the main reasons for discontinuation of the both methods are nothealth threatening. Therefore, health care providers may help to improve their continuation rate byappropriate consultation.

  4. One-week glucose control via zero-order release kinetics from an injectable depot of glucagon-like peptide-1 fused to a thermosensitive biopolymer.

    Science.gov (United States)

    Luginbuhl, Kelli M; Schaal, Jeffrey L; Umstead, Bret; Mastria, Eric M; Li, Xinghai; Banskota, Samagya; Arnold, Susan; Feinglos, Mark; D'Alessio, David; Chilkoti, Ashutosh

    2017-01-01

    Stimulation of the glucagon-like peptide-1 (GLP1) receptor is a useful treatment strategy for type 2 diabetes because of pleiotropic effects, including the regulation of islet hormones and the induction of satiety. However, the native ligand for the GLP1 receptor has a short half-live owing to enzymatic inactivation and rapid clearance. Here, we show that a subcutaneous depot formed after a single injection of GLP1 recombinantly fused to a thermosensitive elastin-like polypeptide results in zero-order release kinetics and circulation times of up to 10 days in mice and 17 days in monkeys. The optimized pharmacokinetics leads to 10 days of glycemic control in three different mouse models of diabetes, as well as to the reduction of glycosylated hemoglobin levels and weight gain in ob/ob mice treated once weekly for 8 weeks. Our results suggest that the optimized GLP1 formulation could enhance therapeutic outcomes by eliminating peak-and-valley pharmacokinetics and improving overall safety and tolerability. The design principles that we established should be broadly applicable for improving the pharmacological performance of other peptide and protein therapeutics.

  5. Simple anthropometric measures correlate with metabolic risk indicators as strongly as magnetic resonance imaging-measured adipose tissue depots in both HIV-infected and control subjects.

    Science.gov (United States)

    Scherzer, Rebecca; Shen, Wei; Bacchetti, Peter; Kotler, Donald; Lewis, Cora E; Shlipak, Michael G; Heymsfield, Steven B; Grunfeld, Carl

    2008-06-01

    Studies in persons without HIV infection have compared percentage body fat (%BF) and waist circumference as markers of risk for the complications of excess adiposity, but only limited study has been conducted in HIV-infected subjects. We compared anthropometric and magnetic resonance imaging (MRI)-based adiposity measures as correlates of metabolic complications of adiposity in HIV-infected and control subjects. The study was a cross-sectional analysis of 666 HIV-positive and 242 control subjects in the Fat Redistribution and Metabolic Change in HIV Infection (FRAM) study assessing body mass index (BMI), waist (WC) and hip (HC) circumferences, waist-to-hip ratio (WHR), %BF, and MRI-measured regional adipose tissue. Study outcomes were 3 metabolic risk variables [homeostatic model assessment (HOMA), triglycerides, and HDL cholesterol]. Analyses were stratified by sex and HIV status and adjusted for demographic, lifestyle, and HIV-related factors. In HIV-infected and control subjects, univariate associations with HOMA, triglycerides, and HDL were strongest for WC, MRI-measured visceral adipose tissue, and WHR; in all cases, differences in correlation between the strongest measures for each outcome were small (r HDL, WC appeared to be the best anthropometric correlate of metabolic complications, whereas, for triglycerides, the best was WHR. Relations of simple anthropometric measures with HOMA, triglycerides, and HDL cholesterol are approximately as strong as MRI-measured whole-body adipose tissue depots in both HIV-infected and control subjects.

  6. The role of social cost-benefit analysis in societal decision-making under large uncertainties with application to robbery at a cash depot

    International Nuclear Information System (INIS)

    Jones-Lee, M.; Aven, T.

    2009-01-01

    Social cost-benefit analysis is a well-established method for guiding decisions about safety investments, particularly in situations in which it is possible to make accurate predictions of future performance. However, its direct applicability to situations involving large degrees of uncertainty is less obvious and this raises the question of the extent to which social cost-benefit analysis can provide a useful input to the decision framework that has been explicitly developed to deal with safety decisions in which uncertainty is a major factor, namely risk analysis. This is the main focus of the arguments developed in this paper. In particular, we provide new insights by examining the fundamentals of both approaches and our principal conclusion is that social cost-benefit analysis and risk analysis represent complementary input bases to the decision-making process, and even in the case of large uncertainties social cost-benefit analysis may provide very useful decision support. What is required is the establishment of a proper contextual framework which structures and gives adequate weight to the uncertainties. An application to the possibility of a robbery at a cash depot is examined as a practical example.

  7. Effect of Injection Minimal Dosages of Depot Medroxyprogesterone acetate (DMPA to Body Weight and Blood Chemistry Male Rat Strain Sprague-Dawley

    Directory of Open Access Journals (Sweden)

    Nukman Moeloek

    2009-11-01

    Full Text Available Many family planning program focus more on men. Until now, vasectomy has been the commonly used method for male contraception. However, this method creates inconvenience such as irreversibility and psychological problems. One of the alternatives contraception is the combination of depot medroxyprogesterone acetate (DMPA and androgen. The minimum dosage of DMPA could suppress testosterone level that leads to reduced spermatogenesis and sperm viability. Nevertheless, until now it is not known whether minimum dosages of DMPA have an effect to body weight and blood chemistry. Therefore, this research aimed at determinate the effect of minimal dosages of DMPA to body mass and blood chemistry using male rats (Rattus norvegicus L. strain Sprague-Dawley as model. This research using completely randomized design, unequal size sample, castration treatments and several doses DMPA (1.25, 0.625, and 0.313 milligram. Injecting of DMPA conducted intramuscularly on week 0 and week 12. Normality/homogeneity Data normality were analyzed before ANOVA test. Then, abnormal data were tested using Kruskal-Wallis test. The result shows that injection of DMPA in various doses do not have an effect on body weight and blood chemistry such as erytrocytes, haemoglobin, hematocrite, HDL, LDL, total cholesterol, SGOT, SGPT and triglyseride (p>0,05. Furthermore, it is concluded that that no effect of minimal dosages of DMPA to body mass and blood chemistry of rat.

  8. The Washington Needle Depot: fitting healthcare to injection drug users rather than injection drug users to healthcare: moving from a syringe exchange to syringe distribution model

    Directory of Open Access Journals (Sweden)

    Glickman Andrea

    2010-01-01

    Full Text Available Abstract Needle exchange programs chase political as well as epidemiological dragons, carrying within them both implicit moral and political goals. In the exchange model of syringe distribution, injection drug users (IDUs must provide used needles in order to receive new needles. Distribution and retrieval are co-existent in the exchange model. Likewise, limitations on how many needles can be received at a time compel addicts to have multiple points of contact with professionals where the virtues of treatment and detox are impressed upon them. The centre of gravity for syringe distribution programs needs to shift from needle exchange to needle distribution, which provides unlimited access to syringes. This paper provides a case study of the Washington Needle Depot, a program operating under the syringe distribution model, showing that the distribution and retrieval of syringes can be separated with effective results. Further, the experience of IDUs is utilized, through paid employment, to provide a vulnerable population of people with clean syringes to prevent HIV and HCV.

  9. In situ depot comprising phase-change materials that can sustainably release a gasotransmitter H2S to treat diabetic wounds.

    Science.gov (United States)

    Lin, Wei-Chih; Huang, Chieh-Cheng; Lin, Shu-Jyuan; Li, Meng-Ju; Chang, Yen; Lin, Yu-Jung; Wan, Wei-Lin; Shih, Po-Chien; Sung, Hsing-Wen

    2017-11-01

    Patients with diabetes mellitus are prone to develop refractory wounds. They exhibit reduced synthesis and levels of circulating hydrogen sulfide (H 2 S), which is an ephemeral gaseous molecule. Physiologically, H 2 S is an endogenous gasotransmitter with multiple biological functions. An emulsion method is utilized to prepare a microparticle system that comprises phase-change materials with a nearly constant temperature of phase transitions to encapsulate sodium hydrosulfide (NaHS), a highly water-labile H 2 S donor. An emulsion technique that can minimize the loss of water-labile active compounds during emulsification must be developed. The as-prepared microparticles (NaHS@MPs) provide an in situ depot for the sustained release of exogenous H 2 S under physiological conditions. The sustained release of H 2 S promotes several cell behaviors, including epidermal/endothelial cell proliferation and migration, as well as angiogenesis, by extending the activation of cellular ERK1/2 and p38, accelerating the healing of full-thickness wounds in diabetic mice. These experimental results reveal the strong potential of NaHS@MPs for the sustained release of H 2 S for the treatment of diabetic wounds. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Quantity and quality of guinea pig (cavia porcellus) spermatozoa after administration of methanol extract of bitter melon (momordica charantia) seed and depot medroxy progesterone acetate (DMPA)

    Science.gov (United States)

    Ilyas, Syafruddin; Hutahaean, Salomo; Nursal

    2018-03-01

    The discovery of male contraceptive drugs continues to be pursued, due to the few participation of men associated with the lack of contraceptive options for men. The combination of bitter melon seed methanol extract and DMPA are the options that currently apply to men. Therefore, the use of guinea pigs as experimental animals conducted research using experimental methods with complete randomized design (CRD). There are 4 control groups and 4 treatment groups. The first group, control group of dimethyl sulphoxide (DMSO) for 0 week (K0), The second one, bitter melon seed extract of 50 mg/100g Body Weight/day for 0 week (P0), the third one, control group of dimethyl sulfoxide (DMSO) for 4 weeks (K1), the fourth one, bitter melon seed extract of 50 mg/100g BW/day for 4 weeks + Depot medroxy Progesterone Acetate (P1), the fifth one, control group of dimethyl sulfoxide (DMSO) for 8 weeks (K2), the sixth one, bitter melon seed extract of 50 mg/100g BW/day for 8 weeks + DMPA (P2), the seventh one, control group of dimethyl sulfoxide (DMSO) for 12 weeks (K3), the eighth one, bitter melon seed extract of 50 mg/100g BW/day for 12 weeks + DMPA (P3). Methanol extract of bitter melon seed to decrease the quantity and quality of guinea pig spermatozoa decreased significantly, i.e. viability and normal morphology of spermatozoa (p<0.05).

  11. Longitudinal profiling of the tissue-specific expression of genes related with insulin sensitivity in dairy cows during lactation focusing on different fat depots.

    Directory of Open Access Journals (Sweden)

    Behnam Saremi

    Full Text Available In dairy cows the milk associated energy output in early lactation exceeds the input via voluntary feed intake. To spare glucose for mammary lactose synthesis, peripheral insulin sensitivity (IS is reduced and fat mobilization is stimulated. For these processes a link between IS and the endocrine functions of adipose tissue (AT is likely; we thus aimed to characterise the mRNA expression from bovine AT derived proteins and receptors that are related to IS according to the literature in metabolically active tissues plus systemic IS throughout lactation. Conjugated linoleic acids (CLA reduce milk fat thus decreasing the milk drain of energy and potentially dampening lipolysis, but may also affect IS. Subcutaneous (s.c. AT and liver from pluriparous cows receiving either control fat or CLA supplement (100 g/day from 1 to 182 days in milk each were biopsied covering week -3 to 36 relative to parturition. In an additional trial with primiparous cows treated analogously and slaughtered on days in milk 1, 42 or 105, samples from liver, udder, skeletal muscle and 3 visceral and 3 s.c. AT were obtained and assayed for mRNA abundance of adiponectin, its receptors, leptin, leptin receptor, PPARγ, PPARγ2, IL-6, and TNF-α. In pluriparous animals, the mRNA abundance of most of the target genes decreased after parturition in s.c. AT but increased in liver. In primiparous cows, AT depot specific differences were mostly related to retroperitoneal AT; adiponectin receptor 1 and TNF-α were affected predominantly. CLA effects in primiparous cows were largely limited to decreased PPARγ2 mRNA abundance in udder tissue. In pluriparous cows, insulin secretion was increased by CLA resulting in decreased systemic IS but without consistent changes in tissue target mRNA abundance. The temporal gene expression profiles from the adipokines and related receptors support their coactive function in adapting to the needs of lactation.

  12. Longitudinal Profiling of the Tissue-Specific Expression of Genes Related with Insulin Sensitivity in Dairy Cows during Lactation Focusing on Different Fat Depots

    Science.gov (United States)

    Saremi, Behnam; Winand, Sarah; Friedrichs, Paula; Kinoshita, Asako; Rehage, Jürgen; Dänicke, Sven; Häussler, Susanne; Breves, Gerhard; Mielenz, Manfred; Sauerwein, Helga

    2014-01-01

    In dairy cows the milk associated energy output in early lactation exceeds the input via voluntary feed intake. To spare glucose for mammary lactose synthesis, peripheral insulin sensitivity (IS) is reduced and fat mobilization is stimulated. For these processes a link between IS and the endocrine functions of adipose tissue (AT) is likely; we thus aimed to characterise the mRNA expression from bovine AT derived proteins and receptors that are related to IS according to the literature in metabolically active tissues plus systemic IS throughout lactation. Conjugated linoleic acids (CLA) reduce milk fat thus decreasing the milk drain of energy and potentially dampening lipolysis, but may also affect IS. Subcutaneous (s.c.) AT and liver from pluriparous cows receiving either control fat or CLA supplement (100 g/day from 1 to 182 days in milk each) were biopsied covering week −3 to 36 relative to parturition. In an additional trial with primiparous cows treated analogously and slaughtered on days in milk 1, 42 or 105, samples from liver, udder, skeletal muscle and 3 visceral and 3 s.c. AT were obtained and assayed for mRNA abundance of adiponectin, its receptors, leptin, leptin receptor, PPARγ, PPARγ2, IL-6, and TNF-α. In pluriparous animals, the mRNA abundance of most of the target genes decreased after parturition in s.c. AT but increased in liver. In primiparous cows, AT depot specific differences were mostly related to retroperitoneal AT; adiponectin receptor 1 and TNF-α were affected predominantly. CLA effects in primiparous cows were largely limited to decreased PPARγ2 mRNA abundance in udder tissue. In pluriparous cows, insulin secretion was increased by CLA resulting in decreased systemic IS but without consistent changes in tissue target mRNA abundance. The temporal gene expression profiles from the adipokines and related receptors support their coactive function in adapting to the needs of lactation. PMID:24465964

  13. Effect of treatment with depot somatostatin analogue octreotide on primary hyperparathyroidism (PHP) in multiple endocrine neoplasia type 1 (MEN1) patients.

    Science.gov (United States)

    Faggiano, Antongiulio; Tavares, Lidice Brandao; Tauchmanova, Libuse; Milone, Francesco; Mansueto, Gelsomina; Ramundo, Valeria; De Caro, Maria Laura Del Basso; Lombardi, Gaetano; De Rosa, Gaetano; Colao, Annamaria

    2008-11-01

    In patients with multiple endocrine neoplasia type 1 (MEN1), expression of somatostatin receptor (SST) in parathyroid adenomas and effectiveness of therapy with somatostatin analogues on primary hyperparathyroidism (PHP) have been scarcely investigated. To evaluate the effects of depot long acting octreotide (OCT-LAR) in patients with MEN1-related PHP. Eight patients with a genetically confirmed MEN1, presenting both PHP and duodeno-pancreatic neuroendocrine tumours (NET), were enrolled. The initial treatment was OCT-LAR 30 mg every 4 weeks. This therapy was established to stabilize the duodeno-pancreatic NET before to perform parathyroidectomy for PHP. Before OCT-LAR therapy, a SST scintigraphy was performed in all patients. SST subtype 2A immunohistochemistry was performed on parathyroid tumour samples from three patients undergone parathyroidectomy after OCT-LAR therapy. Serum concentrations of PTH, calcium and phosphorus as well as the 24-h urine calcium : creatinine ratio and the renal threshold phosphate concentration were evaluated before and after OCT-LAR. After OCT-LAR therapy, hypercalcaemia and hypercalciuria normalized in 75% and 62.5% of patients, respectively, and serum phosphorus and renal threshold phosphate significantly increased. Serum PTH concentrations significantly decreased in all patients and normalized in two of them. SST subtype 2A immunostaining was found in all parathyroid adenomas investigated, while SST scintigraphy showed a positive parathyroid tumour uptake in three of eight patients (37.5%). Six months of OCT-LAR therapy controlled hypercalcaemia and hypercalciuria in two-thirds of patients with MEN1-related PHP. Direct OCT-LAR effects mediated by binding to SST expression on parathyroid tumour cells are likely the main mechanism to explain the activity of this compound on calcium and phosphorus abnormalities in MEN1 PHP.

  14. Comparison of dual-energy X-ray absorptiometry and magnetic resonance imaging-measured adipose tissue depots in HIV-infected and control subjects.

    Science.gov (United States)

    Scherzer, Rebecca; Shen, Wei; Bacchetti, Peter; Kotler, Donald; Lewis, Cora E; Shlipak, Michael G; Punyanitya, Mark; Heymsfield, Steven B; Grunfeld, Carl

    2008-10-01

    Studies in persons without HIV infection have compared adipose tissue measured by dual-energy X-ray absorptiometry (DXA) and magnetic resonance imaging (MRI), but no such study has been conducted in HIV-infected (HIV+) subjects, who have a high prevalence of regional fat loss. We compared DXA- with MRI-measured trunk, leg, arm, and total fat in HIV+ and control subjects. A cross-sectional analysis was conducted in 877 HIV+ subjects and 260 control subjects in FRAM (Study of Fat Redistribution and Metabolic Change in HIV Infection), stratified by sex and HIV status. Univariate associations of DXA with MRI were strongest for total and trunk fat (r > or = 0.92) and slightly weaker for leg (r > or = 0.87) and arm (r > or = 0.71) fat. The average estimated limb fat was substantially greater for DXA than for MRI for HIV+ and control men and women (all P < 0.0001). Less of a difference was observed in trunk fat measured by DXA and MRI, but the difference was still statistically significant (P < 0.0001). Bland-Altman plots showed increasing differences and variability. Greater average limb fat in control and HIV+ subjects (both P < 0.0001) was associated with greater differences between DXA and MRI measurements. Because the control subjects had more limb fat than did the HIV+ subjects, greater amounts of fat were measured by DXA than by MRI when control subjects were compared with HIV+ subjects. More HIV+ subjects had leg fat in the bottom decile of the control subjects by DXA than by MRI (P < 0.0001). Although DXA- and MRI-measured adipose tissue depots correlate strongly in HIV+ and control subjects, differences increase as average fat increases, particularly for limb fat. DXA may estimate a higher prevalence of peripheral lipoatrophy than does MRI in HIV+ subjects.

  15. Simple anthropometric measures correlate with metabolic risk indicators as strongly as magnetic resonance imaging–measured adipose tissue depots in both HIV-infected and control subjects2

    Science.gov (United States)

    Scherzer, Rebecca; Shen, Wei; Bacchetti, Peter; Kotler, Donald; Lewis, Cora E; Shlipak, Michael G; Heymsfield, Steven B

    2008-01-01

    Background Studies in persons without HIV infection have compared percentage body fat (%BF) and waist circumference as markers of risk for the complications of excess adiposity, but only limited study has been conducted in HIV-infected subjects. Objective We compared anthropometric and magnetic resonance imaging (MRI)–based adiposity measures as correlates of metabolic complications of adiposity in HIV-infected and control subjects. Design The study was a cross-sectional analysis of 666 HIV-positive and 242 control subjects in the Fat Redistribution and Metabolic Change in HIV Infection (FRAM) study assessing body mass index (BMI), waist (WC) and hip (HC) circumferences, waist-to-hip ratio (WHR), %BF, and MRI-measured regional adipose tissue. Study outcomes were 3 metabolic risk variables [homeostatic model assessment (HOMA), triglycerides, and HDL cholesterol]. Analyses were stratified by sex and HIV status and adjusted for demographic, lifestyle, and HIV-related factors. Results In HIV-infected and control subjects, univariate associations with HOMA, triglycerides, and HDL were strongest for WC, MRI-measured visceral adipose tissue, and WHR; in all cases, differences in correlation between the strongest measures for each outcome were small (r ≤ 0.07). Multivariate adjustment found no significant difference for optimally fitting models between the use of anthropometric and MRI measures, and the magnitudes of differences were small (adjusted R2 ≤ 0.06). For HOMA and HDL, WC appeared to be the best anthropometric correlate of metabolic complications, whereas, for triglycerides, the best was WHR. Conclusion Relations of simple anthropometric measures with HOMA, triglycerides, and HDL cholesterol are approximately as strong as MRI-measured whole-body adipose tissue depots in both HIV-infected and control subjects. PMID:18541572

  16. Effectiveness, pharmacokinetics, and safety of a new sustained-release leuprolide acetate 3.75-mg depot formulation for testosterone suppression in patients with prostate cancer: a Phase III, open-label, international multicenter study.

    Science.gov (United States)

    Marberger, Michael; Kaisary, Amir V; Shore, Neal D; Karlin, Gary S; Savulsky, Claudio; Mis, Ricard; Leuratti, Chiara; Germa, Josep R

    2010-04-01

    A microencapsulated, sustained-release formulation of leuprolide acetate 3.75 mg has been developed. This study investigated the effectiveness, pharmacokinetics, and safety profile of a 1-month leuprolide acetate 3.75-mg depot formulation for suppressing testosterone concentrations in patients with prostate cancer. This was a Phase III, open-label, international multicenter clinical trial. Patients with prostate cancer who, in the judgment of the investigators, could benefit from androgen deprivation therapy received 6 monthly intramuscular injections of leuprolide acetate 3.75-mg depot. Plasma testosterone concentrations were determined at specific times throughout the study. The primary end point was the proportion of successful patients over the total number of evaluable patients (ie, patients with evaluable testosterone concentrations at all monthly assessments and no missing values due to treatment-related adverse events). Treatment success was defined as testosterone suppression below the clinical castration level (ie, n = 12), showed sustained release of leuprolide from the formulation. Values for AUC(0-t) calculated from day 0 to day 28, days 28 to 56, and days 56 to 84 were 25,976.5 (7892.0), 30,685.5 (9348.4), and 31,030.9 (10,745.0) pg/mL per day, respectively. The most common treatment-related adverse event was hot flashes (45.0% [72/160]). Fatigue, hyperhidrosis, night sweats, and headache each occurred in depot was effective in achieving and maintaining testosterone suppression and was well tolerated throughout the study in this cohort of patients with prostate cancer. ClinicalTrials.gov identifier: NCT00128531.

  17. Deposition of pyrolytic carbon from methane in the pores of artificial graphites. Influence of the temperature (1961); Depot de carbone pyrolytique dans les pores de graphites artificiels a partir de methane. Influence de la temperature (1961)

    Energy Technology Data Exchange (ETDEWEB)

    Blanchard, R; Bochirol, L; Moreau, C; Philippot, J [Commissariat a l' Energie Atomique, Grenoble (France). Centre d' Etudes Nucleaires

    1961-07-01

    it is shown that below 1000 deg. C the carbon formed by the decomposition of methane is deposited at a depth of up to several centimetres in the porosity of graphitic supports; the probable mechanism of these reactions is given. (authors) [French] On montre qu'en dessous de 1000 deg. C le depot de carbone par decomposition de methane se produit jusqu'a une profondeur de plusieurs dizaines de millimetres dans la porosite de supports graphites, et l'on indique le mecanisme probable de ces reactions. (auteurs)

  18. Ergonomic Survey, Hill AFB, UT

    Science.gov (United States)

    1991-03-01

    Hygiene NIOSH a. CAPT Roger Jensen, Division of Safety Research b. LCDR Patricia Schnitzer, Division of Safety Research c. GS-14 Vern Putz-Anderson... Patricia Schnitzer was provided a current listing (October 1988-October 1990) of the CTD cases from the PHOENIX data base for review. There were a...MOTIVE AERO-MOTIVE U.K. LTD. RO. Box 2678 1090 Brevik Place Rassau Industrial Estate Kalamazoo, M1 49003 Mississauga, Ontario Ebbw Vale Gwent NP3 5SD Ph

  19. AFB Directory of Services Listings

    Science.gov (United States)

    ... radio-talking-book/index.jsp Minnesota STAR Program Centennial Office Building Room 358 658 Cedar Street St. ... and Human Services Nebraska State Office Building 301 Centennial Mall South Lincoln, NE 68508 http://www.adrcnebraska. ...

  20. GPS Measurements at Vandenberg, AFB

    Science.gov (United States)

    1993-02-22

    friorov, S A Ahic Aia.. SSSR DoAf US9. Ill𔃺 1113 I Iughison. J I (ec O Clmate chirie The 07CC scientific Assessment (Cambridge ni~v Pressý 16 snez. MC... Change or Climate (Wolo~ng GrOAI Viii eHefta Comm’ents 14 Timerev A A & Egorov S A A4lereotof G&droi lo 7 50-56 e91e .r condied 13 A A TsonoS...Complex. might easily be recovering from the mainshock accelerations An examination of the station displacements indicates that Comparing the changing

  1. Pre-injection of hyaluronic acid does not affect the systemic effects of intra-articular depot betamethasone injection at the knee joint.

    Science.gov (United States)

    Habib, George; Khatib, Muhamad; Sakas, Fahed; Artul, Suheil; Jabaly-Habib, Haneen

    2017-01-01

    Intra-articular injection (IAI) of both hyaluronic acid (HA) and depot-steroid preparations had the advantage of quick and prolonged favorable effects on pain relief among patients with symptomatic osteoarthritis of the knee (OAK). The effect of IAI of HA on the systemic effects of the intra-articular steroids had not been investigated. Non-selected patients attending the rheumatology clinic with symptomatic OAK who failed NSAIDS and physical therapy were offered an IAI of HA at the knee joint followed 20 min later by an IAI of 1 ml of Celestone Chronodose at the same joint (group 1). Morning serum levels of cortisol were obtained just prior to the IAI and 1, 2 and 8 days later. Demographic, clinical, and laboratory parameters were obtained also from all the patients. Age- and sex-matched group of patients from the same clinic were recruited as a control group (group 2). Mean baseline serum cortisol levels in group 1 was 381 ± 154 mmol/l vs. 376 ± 119 in group 2 (p = 0.954). Morning serum cortisol levels at day 1 and day 2 were 24 ± 6 and 22 ± 6 mmol/l, respectively, in group 1 patients vs. 27 ± 5.8 (p = 0.214) and 25 ± 5.6 mmol/l (p = 0.200), respectively, in group 2. These levels were significantly lower than baseline levels in each group. Morning serum cortisol levels at day 8 in group 1 and group 2 were 349 ± 128 and 314 ± 99 mmol/l, respectively (p = 0.419). Pre-injection of HA at the knee joint did not affect the systemic effect on the hypothalamic-pituitary-adrenal axis of IAI of Celestone Chronodose.

  2. Monte Carlo simulation of radiation transport and dose deposition from locally released gold nanoparticles labeled with 111In, 177Lu or 90Y incorporated into tissue implantable depots

    Science.gov (United States)

    Lai, Priscilla; Cai, Zhongli; Pignol, Jean-Philippe; Lechtman, Eli; Mashouf, Shahram; Lu, Yijie; Winnik, Mitchell A.; Jaffray, David A.; Reilly, Raymond M.

    2017-11-01

    Permanent seed implantation (PSI) brachytherapy is a highly conformal form of radiation therapy but is challenged with dose inhomogeneity due to its utilization of low energy radiation sources. Gold nanoparticles (AuNP) conjugated with electron emitting radionuclides have recently been developed as a novel form of brachytherapy and can aid in homogenizing dose through physical distribution of radiolabeled AuNP when injected intratumorally (IT) in suspension. However, the distribution is unpredictable and precise placement of many injections would be difficult. Previously, we reported the design of a nanoparticle depot (NPD) that can be implanted using PSI techniques and which facilitates controlled release of AuNP. We report here the 3D dose distribution resulting from a NPD incorporating AuNP labeled with electron emitters (90Y, 177Lu, 111In) of different energies using Monte Carlo based voxel level dosimetry. The MCNP5 Monte Carlo radiation transport code was used to assess differences in dose distribution from simulated NPD and conventional brachytherapy sources, positioned in breast tissue simulating material. We further compare these dose distributions in mice bearing subcutaneous human breast cancer xenografts implanted with 177Lu-AuNP NPD, or injected IT with 177Lu-AuNP in suspension. The radioactivity distributions were derived from registered SPECT/CT images and time-dependent dose was estimated. Results demonstrated that the dose distribution from NPD reduced the maximum dose 3-fold when compared to conventional seeds. For simulated NPD, as well as NPD implanted in vivo, 90Y delivered the most homogeneous dose distribution. The tumor radioactivity in mice IT injected with 177Lu-AuNP redistributed while radioactivity in the NPD remained confined to the implant site. The dose distribution from radiolabeled AuNP NPD were predictable and concentric in contrast to IT injected radiolabeled AuNP, which provided irregular and temporally variant dose distributions

  3. Measurements and Clinical Findings on Thorotrast Deposits in the Kidney; Mesures et Observations Cliniques Faites sur des Depots de Thorotrast dans le Rein; 0418 0417 041c 0414 ; Determinaciones y Datos Clinicos Relativos a los Depositos Renales de Torotrasto

    Energy Technology Data Exchange (ETDEWEB)

    Oberhausen, E.; Muth, H.; Grillmaier, R. [Institut Fuer Biophysik der Universitaet des Saarlandes, Homburg (Saar), Federal Republic of Germany (Germany)

    1964-11-15

    There exists a relatively large number of publications about Thorotrast deposits in, the reticulo-endothelial system and the clinical findings caused by these deposits. But only, a few cases with Thorotrast deposits in the kidney have been reported. Despite this it is to be expected that there are numerous patients with Thorotrast deposits in the kidneys, because Thorotrast has been used very often as a contrast medium in retrograde pyelographies. Under normal conditions all the Thorotrast should have been swept out of the kidney with, the urine. But if it was applied under higher pressure or if there existed an infection of the Sidney at the same time, part of the Thorotrast might have, been deposited in the tissues. It is possible that a higher number of these deposits is not recognized in X-ray pictures because they look very similar to calcium deposits in the kidney and some experience is needed to distinguish calcium from Thorotrast deposits. In co-operation with our urological clinic we have found seven cases in the last years. When there was only a deposit in one kidney, which was the case in six patients, the or organ was taken out. Histological examination showed five carcinomas and in one kidney there were already enormous degenerative changes. According to our observations the time necessary for the development of carcinoma is between 20 and 25 yr. In two cases we have been able to measure the patient in the whole-body counter and to measure the radioactive substances in the urine and the thoron in the breath. All these, measurements have been done before and after nephrectomy. The gamma-rays of the isolated organ itself have also been measured. From these measurements an evaluation of radiation dose is possible. (author) [French] Il existe un nombre relativement grand de publications sur les depots de thorotrast dans le systeme reticuloendothelial et les phenomenes cliniques provoques par ces depots. Par contre on n'a signale que peu de cas de depots de

  4. Geochemical evidence of groundwater flow paths and the fate and transport of constituents of concern in the alluvial aquifer at Fort Wingate Depot Activity, New Mexico, 2009

    Science.gov (United States)

    Robertson, Andrew J.; Henry, David W.; Langman, Jeffery B.

    2013-01-01

    As part of an environmental investigation at Fort Wingate Depot Activity, New Mexico, the U.S. Geological Survey, in cooperation with the U.S. Army Corps of Engineers, interpreted aqueous geochemical concentrations to better understand the groundwater flow paths and the fate and transport of constituents of concern in the alluvial aquifer underlying the study area. The fine-grained nature of the alluvial matrix creates a highly heterogeneous environment, which adds to the difficulty of characterizing the flow of groundwater and the fate of aqueous constituents of concern. The analysis of the groundwater geochemical data collected in October 2009 provides evidence that is used to identify four groundwater flow paths and their extent in the aquifer and indicates the dominant attenuation processes for the constituents of concern. The extent and interaction of groundwater flow paths were delineated by the major ion concentrations and their relations to each other. Four areas of groundwater recharge to the study area were identified based on groundwater elevations, hydrogeologic characteristics, and geochemical and isotopic evidence. One source of recharge enters the study area from the saturated alluvial deposits underlying the South Fork of the Puerco River to the north of the study area. A second source of recharge is shown to originate from a leaky cistern containing production water from the San Andres-Glorieta aquifer. The other two sources of recharge are shown to enter the study area from the south: one from an arroyo valley draining an area to the south and one from hill-front recharge that passes under the reported release of perchlorate and explosive constituents. The spatial extent and interaction of groundwater originating from these various sources along identified flow paths affect the persistence and attenuation of constituents of concern. It was determined that groundwater originating in the area of a former explosives’ wash-out operation and an

  5. The DHEA-sulfate depot following P450c17 inhibition supports the case for AKR1C3 inhibition in high risk localized and advanced castration resistant prostate cancer.

    Science.gov (United States)

    Tamae, Daniel; Mostaghel, Elahe; Montgomery, Bruce; Nelson, Peter S; Balk, Steven P; Kantoff, Philip W; Taplin, Mary-Ellen; Penning, Trevor M

    2015-06-05

    Prostate cancer is the second leading cause of cancer death in the United States. Treatment of localized high-risk disease and de novo metastatic disease frequently leads to relapse. These metastatic castration resistant prostate cancers (mCRPC) claim a high mortality rate, despite the extended survival afforded by the growing armamentarium of androgen deprivation, radiation and immunotherapies. Here, we review two studies of neoadjuvant treatment of high-risk localized prostate cancer prior to prostatectomy, the total androgen pathway suppression (TAPS) trial and the neoadjuvant abiraterone acetate (AA) trial. These two trials assessed the efficacy of the non-specific P450c17 inhibitor, ketoconazole and the specific P450c17 inhibitor, AA, to inhibit tissue and serum androgen levels. Furthermore, a novel and validated stable isotope dilution liquid chromatography electrospray ionization selected reaction monitoring mass spectrometry assay was used to accurately quantify adrenal and gonadal androgens in circulation during the course of these trials. The adrenal androgens, Δ(4)-androstene-3,17-dione, dehydroepiandrosterone and dehydroepiandrosterone sulfate were significantly reduced in the patients receiving ketoconazole or AA compared to those who did not. However, in both trials, a significant amount of DHEA-S (∼20 μg/dL) persists and thus may serve as a depot for intratumoral conversion to the potent androgen receptor ligands, testosterone (T) and 5α-dihydrotestosterone (DHT). The final step in conversion of Δ(4)-androstene-3,17-dione and 5α-androstanedione to T and DHT, respectively, is catalyzed by AKR1C3. We therefore present the case that in the context of the DHEA-S depot, P450c17 and AKR1C3 inhibition may be an effective combinatorial treatment strategy. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  6. Comparison between a single dose of goserelin (depot) and multiple daily doses of leuprolide acetate for pituitary suppression in IVF treatment: a clinical endocrinological study of the ovarian response.

    Science.gov (United States)

    Geber, Selmo; Sales, Liana; Sampaio, Marcos A C

    2002-07-01

    Compare the efficacy and safety of two different GnRHa, used for pituitary suppression in IVF cycles. A total of 292 patients using depot goserelin (Group 1) and 167 using daily leuprolide acetate (Group 2) were compared. Days required to achieve pituitary function suppression, duration of ovarian stimulation, total dose of HMG, number of aspirated follicles, number of oocytes retrieved, and presence of functional ovarian cyst were analyzed. The time taken to achieve downregulation was similar. The mean number of ampoules used for superovulation was higher in Group 1; however, this difference was observed only for patients >40 years old that started GnRHa in the follicular phase. There was no difference between the two groups in the duration of superovulation, in the number of follicles aspirated, and the number of oocytes retrieved. In the group of patients with >40 years the incidence of ovarian cysts was higher in Group 2. Both routes of GnRHa have similar effects for pituitary suppression and ovulation induction in assisted reproductive technology. Therefore the long-acting GnRHa is an excellent option, as only a single subcutaneous dose is necessary, decreasing the risk of the patient to forget its use and, most important, it does not interfere in the patient's quality of life.

  7. Theoretical and experimental study of a calorimetric technique for measuring energy deposition in materials caused by complex pile irradiation; Etude theorique et experimentale d'une technique calorimetrique de mesure des depots d'energie dans les materiaux dus au rayonnement complexe de pile

    Energy Technology Data Exchange (ETDEWEB)

    Mas, P; Sciers, P; Droulers, Y [Commissariat a l' Energie Atomique. Centre d' Etudes Nucleaires, 38 - Grenoble (France)

    1962-07-01

    Calorimetric methods may be used to measure gamma fluxes greater than 10{sup 6} r/h near the cores of swimming pool reactors. The theory, design, and properties of isothermal calorimeters are discussed, and experimental results obtained with two types are presented. Measurement of energy deposition in materials and the long term integration of energy depositions are other uses of these devices. Results of measurements on heat deposition in steel and water are given. Fluxes were also measured. (authors) [French] Une premiere partie traite de la theorie des calorimetres isothermes mis en oeuvre au C.K.N. Grenoble. La puissance deposee dans le calorimetre par les flux de rayonnement echauffe celui-ci. L'echauffement est mesure a l'aide d'un thermocouple. On montre que l'on a ainsi une mesure absolue de cette puissance. Une deuxieme partie traite de l'etude experimentale de: deux types d'appareils utilises: leur construction, les resultats experimentaux, leurs utilisations. Trois de celles-ci sont particulierement interessantes: - la mesure des hauts flux gamma, - la mesure du depot d'energie dans les materiaux, - l'integration pendant une longue duree des depots d'energie (un modele de calorimetre a fonctionne a ce jour 2 500 heures et a integre 9 x 10 puissance 10 rads gamma et 6 x 10 puissance 18 neutrons rapides). La troisieme partie est consacree a l'etude des qualites de l'appareil: robustesse, fidelite, precision, sensibilite, gamme de mesure. Enfin dans la derniere partie sont decrites deux applications de la methode calorimetrique a la mesure du depot d'energie dans un acier special et dans l'eau. (auteurs)

  8. Potential Impacts Related to the Air Training Command Realignments. Institutional Characteristics, Transportation, Civilian Community Utilities, Land Use for Craig AFB, Alabama, Webb AFB, Texas, Columbus AFB, Mississippi, Laughlin AFB, Texas, Reese AFB, Texas, Vance AFB, Oklahoma

    Science.gov (United States)

    1976-12-30

    response and 70.4 percent civilian response, extend to 100 percent population, 1975; Counity Census Data, General Social =0 Economic Characteristics. 25...transportation problems exist and the alternative action is not txpected to disturb the situation in the future. 86 On-Base (AFERN 4.4.1.3) No major problema of...values could increase in specific residential areas that are perceived as meeting certain economic and social needs where current 7acancies are minimal

  9. Jim Shaw's The Hidden World as a Book of Poetry

    DEFF Research Database (Denmark)

    Sørensen, Bent

    documents, ’found’ in pulp publications, in thrift stores, on billboards, and on the Internet. These documents are mostly word-image hybrids, and their original functions may have been as commercials or advertisements, religious propaganda, doomsday prophecies, or other forms of naïve “didactic art...... of pulp art (often cited as his source of inspiration for his ‘real’ art), but by utilizing the book medium for its presentation, and further visually imitating the format of holy scripture, he has also opened up for his work to be read as one would a collection of sacred texts, say, a Bible – or even...

  10. Exercise rehabilitation in pulmonary patients: a review | Shaw ...

    African Journals Online (AJOL)

    Although aerobic exercise (specifically lower-body) continues to be the most popular mode of exercise for pulmonary rehabilitation, many lung patients report disabling symptoms for daily activities involving the upper extremities. The principal difference between aerobic training and resistance training (RT) modes of ...

  11. Shaw Air Force Base Infrastructure Project Environmental Assessment

    Science.gov (United States)

    2008-09-01

    are the applied to the following factors depending on the corresponding years. Year 2009: VOCE = .016 * Trips NOXE = .015 * Trips PM10E...0022 * Trips COE = .262 * Trips Year 2010 and beyond: VOCE = .012 * Trips NOXE = .013 * Trips PM10E = .0022 * Trips COE = .262 * Trips To...convert from pounds per day to tons per year: VOC (tons/yr) = VOCE * DPYII/2000 Nox (tons/yr) = NOxE * DPYII/2000 PM10(tons/yr) = PM10E

  12. About some trematodes parasites of Haemulon sciurus (Shaw, 1803

    Directory of Open Access Journals (Sweden)

    A. Kohn

    1982-06-01

    Full Text Available From September, 1980 to August, 1981 forty specimens of Haemulon sciurus from "Praia da Ribeira, Ilha do Governador", Rio de Janeiro State, were examined for parasites. In this paper, parcial results concerning only the collected trematodes are reported: Diplomonorchis leiostomi Hopkins, 1941 (first record in Brazil and in a new host; Lasiotocus beauforti (Hopkins, 1941 Thomas, 1959 (new host record; Genolopa ampullacea Linton, 1910; Parahemiurus merus (Linton, 1910 Yamaguti, 1938 (new host record: Aponurus pyriformis (Linton, 1910 Overstreet, 1973 and Diplangus paxillus Linton, 1910. Figures, measurements and comments of each species are given.De setembro, 1980 a agosto, 1981 foram examinados 40 exemplares de Haemulon sciurus, provenientes da Praia da Ribeira, Ilha do Governador, Estado do Rio de Janeiro. Neste trabalho são apresentados os resultados parciais, correspondentes aos trematodeos, grupo que apresentou maior ocorrência de parasitismo. As especies estudadas foram: Diplomonorchis leiostomi Hopkins, 1941 (primeira ocorrencia no Brasil e em novo hospedeiro; Lasiotocus beauforti (Hopkins, 1941 Thomas, 1959 (em novo hospedeiro; Genolopa ampullacea Linton, 1910; Parahemiurus merus (Linton, 1910 Yamaguti, 1938 (em um novo hospedeiro; Aponurus pyriformis (Linton, 1910 Overstreet, 1973 e Diplangus paxillus Linton, 1910. São apresentadas figuras, medidas e comentários.

  13. COMBINATION OF A MINIMAL DOSAGE OF DEPOT MEDROXY PROGESTERONE ACETATE AND JAVANESSE LONG PEPPER EXTRACT ON THE BODY WEIGHT, HEMATOLOGY, AND BLOOD BIOCHEMISTRY OF MALE RATS AS A SAFETY CONTRACEPTION MODEL

    Directory of Open Access Journals (Sweden)

    Nukman Moeloek

    2011-11-01

    Full Text Available The development of male hormonal contraception is based on the decrease in the sperm concentration and it does notaffect libido and sexual potency. The combination of depot medroxy progesterone acetate (DMPA + extract ofJavanese long pepper (JLP with dosages of 0.94 mg and 1.88 mg decreases the concentration of spermatozoa.However, it remains unknown whether the combination influences body weight, hematology, and blood biochemistry.Therefore, it is necessary to investigate the effect of DMPA + JLP extracts on the body weight, hematology, and bloodbiochemistry of male rats (Rattus norvegicus L. strains of Sprague-Dawley. The research uses a completelyrandomized design (CRD; one group control and two treatment groups. In the first group, the castration rats were givenoral administration extracts of JLP (CJ with doses of 0, 0.94, 1.88, 2.82, and 3.76 mg. In the second group, the ratswere injected with 1.25 mg DMPA and given an oral administration extract of JLP. Injection was given in week-0 and12. Administration was conducted every day from week 7-18. Analysis of the normality and homogeneity of data isdone before the test ANOVA. Data that is abnormal and not homogeneous are tested with non-parametric statisticalKruskal-Wallis. This study shows that the combination of minimal doses of DMPA and administration various doses ofextracts of JLP does not affect body weight and hematology (erythrocyte, hemoglobin, hematocrite, and the bloodbiochemistry of rats, such as the values of SGPT, SGOT, HDL, and triglycerides (p < 0.05, but rather the totalcholesterol and LDL (p < 0.05. Furthermore, it is concluded that the combination of the minimal dosage of DMPA andweaned various dosages of JLP extracts affect the total value and LDL cholesterol but do not influence body weight,nor hematology and blood biochemistry. Such combination can be drawn on for a male contraceptive model that is safeby taking into account the value of the total cholesterol and LDL

  14. Baseline Noise Measurements at Vandenberg AFB, California.

    Science.gov (United States)

    1988-01-01

    CCCMCC0ACC. 4 4;; l;1;9 4CPI* ACCA . 9 ; 4 1 4 #mr nvvr.&%0naof w# ed .4 in l-4P" a a .4 mIAPl~ PlC C4 toi v rm--0ow.in .4 m t a A Cr l %n .Cl w o m a m ww...cooo, O 999944444992144.4449999 9. 49999999994444444449944944 in- Is f5 If 4n % r, A : O IV .0 :, :,o t g Xw g V ;o oe a w I fft w q on f" 4 f 4 ’ i w

  15. Severe Weather Forecasting for Laughlin AFB, TX

    National Research Council Canada - National Science Library

    Cercone, Eric J

    2007-01-01

    .... Indices, including convective available potential energy (CAPE) and mean layer CAPE (MLCAPE), along with sounding parameters and combinations of such as 0-2 and 0-6 km bulk shear, 700-500 mb lapse rate, lifted condensation level...

  16. Historic Landscape Survey, Randolph AFB, Texas

    Science.gov (United States)

    2013-09-01

    listed men. Throughout 1930 and 1931, construction at the base was steady in spite of the nation’s depressed economy.22 Figure 3. The road... centennial year of 1932, during which patriotic societies planted trees throughout the country in honor of the first president. During the next year, the

  17. Final Supplemental Environmental Impact Statement for Airborne Laser Program at Kirtland AFB, White Sands Missile Range/ Holloman AFB, New Mexico; Edwards AFB, Vandenberg AFB, California

    Science.gov (United States)

    2003-06-01

    Sneed pincushion cactus T Kuen_zler hedgehog cactus - Sacramento oricklv ooppy - I Sacramento Mountains checkerspot - ! butterfly . . Federal Status E...caiifomicus Coho salmon ~_j_Pncorhynchus kisutch , Unarmoured three- spined 1 C~asterosleus aculeatus- ----: stickleback , wi/liamsoni 1 E T E...septentrionalis) Kuenzler hedgehog cachts (Echinocereus fendleri var. kuenzleri) THREATENED Bald eagle (Haliaeetus /.:ucocephalus) Mexican spotted owl (Strix

  18. Herbicide Orange Site Characterization Study, Eglin AFB

    Science.gov (United States)

    1987-01-01

    F THIS PAGE Availabilit o this r is sp f o.n" the reverse of fo cove* . - .’.r. 717 CSAT CO ES ’SU JEC TE MS Coninu onrevrseif ece~ar an idntiy b...of Hardstand 7 and Surface Water Drainages ......... 4 3 Hardstand 7 Herbicide Oran&e Storage Locations .............. 5 4 Concentrations (in ppb) of...insoluble in water . The formula contained an approximate 50/50 mixture of the herbicides 2,4-dichlorophenoxyacetic acid (2,4,-D) and 2,4,5

  19. Historic Landscape Survey, Maxwell AFB, Alabama

    Science.gov (United States)

    2013-08-01

    signifies Maxwell AFB’s historic landscapes. 2.1 The pre-military landscape Prehistory in the southeastern United States is generally designated as...the period of Native American occupation before Spanish explorers made contact in the fifteenth and sixteenth centuries. In Alabama, the prehistory ... prehistory or history is made clear.56 A historic property is determined to be either significant or not significant by applying standardized National

  20. FY 2000 report on the basic survey to promote Joint Implementation, etc. Prevention of emissions of gasoline vapor from oil depots in Indonesia; 2000 nendo kyodo jisshi nado suishin kiso chosa hokokusho. Indonesia sekiyu kichi nado kara no gasoline joki hoshutsu no boshi

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2001-03-01

    A field survey was conducted of oil shipment depots in Java and Bali islands owned by Indonesia's state-run oil company to study measures for reduction in greenhouse effect gas emissions. Studies were made on the grasp of the amount of the hydrocarbon vapor emitted into the air, the amount of the gasoline recovered in case of adopting the vapor emission preventive technology, equipment cost/operational cost, etc. Concretely, the following three were studied: change of the gasoline storage tank to the inner floating roof type, and prevention of evaporation loss at the time of receiving and breathing loss caused by temperature changes; replacement with the vapor recovery type loading arm to recover gasoline vapor generated at the time of shipment/filling, and installation of the vapor recovery unit to recover vapor as gasoline; vapor balance system to recover in underground tank the gasoline vapor generated at the time of filling gasoline at gas station. As a result of the study, the recovered gasoline amount was 66,393 Kl/y and the CO2 reduction amount was 14,474 t/y at oil shipment depots and approximately 650 gasoline stations in Jakarta and Surabaya. (NEDO)

  1. Evaluation of Sierra Army Depot Groundwater Contamination

    National Research Council Canada - National Science Library

    Granetto, Paul

    1997-01-01

    ...), September 28, 1996. The Congressional conferees were concerned about allegations from a group of investors that the Army precipitously and abruptly changed its position on permits and applications to develop water...

  2. Radiological Survey of Seneca Army Depot

    Science.gov (United States)

    1986-01-01

    NUCON Smears 6. 1 ea Eberline AC-4 with planchettes and tweezers 7. 1 ea Eberline BC-4 with planchettes and tweezers 8. 1 foot locker with 4 air sampling...each detected isotope. c. sample Preparation. The smears were transferred to planchettes for counting. Approximately 500 grams of soil from each sample

  3. Depot medroxyprogesterone injectable contraception at the ...

    African Journals Online (AJOL)

    Materials and Methods: The record cards of all clients who accepted medroxyprogesterone ... center. With the establishment of the college of. Health Sciences, University of Uyo in 2001, the ... and surgical sterilization (both male and female).

  4. Possible use of wild-living rats (Rattus norvegicus) as bioindicators for heavy metal pollution. Part 2. Body burden calculations for identification of depot compartments; Untersuchungen zur Eignung wildlebender Wanderratten (Rattus norvegicus) als Indikatoren der Schwermetallbelastung. Teil 2. Die Berechnung der Koerperlast zur Identifikation von Depotkompartimenten

    Energy Technology Data Exchange (ETDEWEB)

    Wuenschmann, S. [Internationales Hochschulinstitut Zittau, Lehrstuhl Umweltverfahrenstechnik, Zittau (Germany); Hochschule Zittau/Goerlitz, Fachbereich Mathematik/Naturwissenschaften, Zittau (Germany); Oehlmann, J. [J.W. Goethe-Univ. Frankfurt, Zoologisches Inst., Frankfurt/M. (Germany); Delakowitz, B. [Hochschule Zittau/Goerlitz, Fachbereich Mathematik/Naturwissenschaften, Zittau (Germany); Markert, B. [Internationales Hochschulinstitut Zittau, Lehrstuhl Umweltverfahrenstechnik, Zittau (Germany)

    2002-07-01

    Background concentrations of eleven elements in tissues and organs of wild-living rats (Rattus norvegicus) obtained from a region (Euroregion Neisse, around the trilateral border region of Germany, Poland and the Czech Republic) distinguished by low to intermediate levels of environmental contaminations are given in part I of this work. In order to identify the most important depot compartments for certain elements, a body burden method was applied. Differences of affinity due to sex and age of analyzed rats are discussed, as are the suitability of specific organs and tissues with regard to bioaccumulation measurements concerning metals. The principal depot compartments for the heavy metals Cu, Mn, Cd, (in adult rats) and Tl are the liver and kidneys, whereas the elements Ni, Sr, Pb (for adult animals) and Ti are more affinitively to bones. Co and Zn displayed a more pronounced affinity towards tissues of the bones and liver. The analysis revealed large differences in Cd and Pb distributions both among young and adult rats, and with respect to sexes. It can be concluded that the distribution of the elements investigated in this study in free-living rats agrees with that in man, except for that of Ni. The above agreement gives proof of the possibility to use depot organs of rats for bioindication which was already mentioned in part I of this work. (Sex and age-related quantification of Al, As, Cd, Co, Cu, Mn, Ni, Pb, Sr, Ti, Tl and Zn in liver, heart, lung, kidney, muscle, brain and bones and establishment of distribution patterns'). (orig.) [German] Die in Teil I quantifizierten Hintergrundkonzentrationen von 11 Elementen in Geweben und Organen wildlebender Ratten (Rattus norvegicus) aus einem gering bis maessig belasteten Untersuchungsgebiet (Euroregion Neisse) werden im 2. Teil fuer die Berechnung ihres relativen Beitrags zur Gesamtkoerperbelastung (Koerperlast oder Bodyburden) verwendet, um bevorzugte Depotkompartimente fuer die untersuchten Elemente

  5. Final results of the prospective multicenter observational program RU-EGD-NI-001 for evaluation of efficacy and tolerability of the 6-month depot Eligard 45 mg in patients with advanced prostate carcinoma in routine clinical practice of uro-oncologists in the Russian Federation

    Directory of Open Access Journals (Sweden)

    V. B. Matveev

    2017-01-01

    Full Text Available Introduction. The 6-month depot formulation of leuproreline acetate 45 mg (Eligard, Astellas Pharma was shown to reduce the levels of prostate-specific antigen (PSA and testosterone and to be well tolerated in patients with advanced prostate cancer (PCa in clinical trials as well as other depot formulations of leuproreline acetate (1- and 3-month. However, clinical trials are limited by strict patient inclusion and exclusion criteria.Objective of this study, sponsored by Astellas Pharma Russia, was to assess whether the efficacy and tolerability of the 6-month leuprorelin depot formulation could be confirmed in a broad and heterogeneous patient population encountered in daily clinical practice in the Russian Federation.Materials and methods. A non-interventional multicenter study (a observational program was conducted in male patients with advanced PCa (T3–4, N+/M+, or with progression after local treatment to whom Eligard 45 mg had been prescribed. Patients were followed every 6 months up to 24 months of treatment. Fifty three uro-oncologists from out-patient clinics in the Russia participated in the study.Results. The study enrolled 640 patients, of which 524 met inclusion/exclusion criteria. Mean age of the patients was 69.0 ± 8.6 years old (from 46 to 96 years old. In most cases hormonal therapy with Eligard 45 mg was performed for locally advanced PCa (50 % of patients, distant metastases were detected in 15 % subjects only, nodal involvement was detected in 12 % patients. Patients with initially localized prostate cancer (41.4 % were prescribed Eligard 45 mg because of progression of their disease after local treatment or inability to receive any other treatment. Eligard 45 mg monotherapy was used in 92.75 % cases. Only 7.25 % patients received combined hormonal therapy with Eligard 45 mg and bicalutamide, flutamide and zoledronic acid. Mean serum PSA level was reduced by 81,7 % from 38,47 ng/ml at baseline to 7.05 ng/ml after 24 months

  6. Annual Targets, UAVs and Range Operations Symposium and Exhibition (49th) Held in Fort Walton Beach, Florida on October 25-27, 2011

    Science.gov (United States)

    2011-10-27

    COMP Mountain Home COMP Shaw COMP Barksdale COMP Hill COMP Homestead ARB COMP Savannah CRTC COMP Gulfport CRTC COMP Alpena CRTC COMP Montana...Spangdahlem AB Aviano AB Kadena AB Programmed: 165 Baseline Pods purchase in FY12 (del FY13) Alpena CRTC Holloman AFB Eielson AFB Planned: 368...ARQ-52(V)2 ARQ-52B(V)2 ARDS (HDIS) ASQ- T35A P4NS (NACTS-RSI) KITS (Kadena) ASQ-T34 ASQ-T46 AKITS ( Alpena ) Israel No Datalink No Datalink P4R1 ASQ

  7. Dover AFB Catchment Area TRICARE Marketing Plan, 436th Medical Group, Dover AFB, Delaware,

    Science.gov (United States)

    1997-06-01

    cosmetic changes (Nadiu, Kleimenhagen, and Pillari 1992). Berkowitz classifies the debate in terms of eras. During the production era, the function was to...facilities in Smyrna and Fenton , Delaware. KGH has aggressive marketing and community education programs which include classes on: cardiopulmonary

  8. Air and Space Power Journal. Volume 25, Number 2, Summer 2011

    Science.gov (United States)

    2011-01-01

    relationship with AFFOR stas at Shaw AFB, South Carolina, and Al Udeid Air Base, Qatar • AETF-A chief of sta coordinates AFFOR sta taskings through...fate of BTEX com- pounds with or without corelease of ethanol. Researchers conducted two experiments simultaneously in an aquifer at Vanden- berg...Toluene, and O-xylene in a Normally Sulfate-Reducing Aquifer ,” Environmental Science and Technology 40, no. 19 (2006): 6123–30. 5. Todd H

  9. Low-Cost Propellant Launch to LEO from a Tethered Balloon - 'Propulsion Depots' Not 'Propellant Depots'

    Science.gov (United States)

    Wilcox, Brian H.; Schneider, Evan G.; Vaughan, David A.; Hall, Jeffrey L.; Yu, Chi Yau

    2011-01-01

    As we have previously reported, it may be possible to launch payloads into low-Earth orbit (LEO) at a per-kilogram cost that is one to two orders of magnitude lower than current launch systems, using only a relatively small capital investment (comparable to a single large present-day launch). An attractive payload would be large quantities of high-performance chemical rocket propellant (e.g. Liquid Oxygen/Liquid Hydrogen (LO2/LH2)) that would greatly facilitate, if not enable, extensive exploration of the moon, Mars, and beyond.

  10. The application of {beta}-ray excitation fluorescence to the measurement of the thickness of deposits and to analysis; Applications de la fluorescence excitee au moyen des rayons {beta} a la mesure des epaisseurs des depots et a l'analyse

    Energy Technology Data Exchange (ETDEWEB)

    Martinelli, P [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires; Seibel, G [Institut de Recherches de la Siderurgie Francaise (IRSID), 78 - Saint-Germain-en-Laye (France)

    1961-07-01

    Principles of the method are first outlined and the instrumentation used is described. The different types of radiation detectors are subject of a detailed study. As a source of {beta}-radiation {sup 90}(Sr + Y) was used as well as {sup 147}Pm. Great care was taken to eliminate back-diffused electrons by deflection by a strong permanent magnet. The method was applied to the measurement of the thickness of deposits of Cr, Zn, Sn, Cd and Cu on iron as well as Zn, Cr, Ag and Au on copper and the results obtained are discussed. An attempt was made, to use {beta}-X-ray fluorescence for the analysis of minerals, iron ore and glass and for routine control of Si-Mn, Si-Ca, Fe-Mn and Fe-W. Finally the method of {beta}-X-ray fluorescence is compared with normal-X-ray fluorescence and possibilities of further development are cited. (author) [French] Les principes de la methode et l'instrumentation utilisee sont presentes. On decrit en particulier les detecteurs de rayonnement utilises. Comme source de rayonnement on utilise {sup 90}(Sr + Y) et {sup 147}Pm. Pour eliminer les electrons retrodiffuses on utilise un aimant permanent place sur le trajet du faisceau. La methode est appliquee a la mesure des epaisseurs des depots metalliques tels que le Cr, Zn, Sn, Cd et Cu sur fer et le Zn, Cr, Ag et Au sur cuivre. D'autre part, la fluorescence {beta}-X etait utilisee pour l'analyse des minerais et des verres et pour le controle des alliages Fe-Mn, Fe-W, Si-Mn, Si-Ca. Enfin, on passe a une comparaison entre la fluorescence {beta}-X et la fluorescence X normale et on discute les possibilites d'un developpement futur. (auteur)

  11. Antecedents to Organizational Performance: Theoretical and Practical Implications for Aircraft Maintenance Officer Force Development

    Science.gov (United States)

    2015-03-26

    Aviation Course 0 MOIC- Maintenance Officer Intermediate Course 0 NATO Nuclear Surety Managemen t Course D NWOC ·Nuclear Weapons Orientation Course 0...Arnold AFB, TN which performs a ground T &E mission. I do not perform many normal duties like a 21A assigned to an operational or depot. My answers to...THESIS Presented to the Faculty Department of Operational Sciences Graduate School of Engineering and Management Air Force Institute of

  12. TOPOGRAPHY AND VISCERAL MORPHOLOGY OF THE Melopsittacus undulatus, SHAW 1805 TOPOGRAFIA E MORFOLOGIA DAS VÍSCERAS DO PERIQUITO-AUSTRALIANO (Melopsittacus undulatus, SHAW 1805

    Directory of Open Access Journals (Sweden)

    Fabiana S. Matsumoto

    2009-12-01

    Full Text Available

    The aim of this research was to study the topography and morphology of Australian parakeet (Melopsittacus undulatus viscera. Ten Australian parakeet were used (5 males and 5 females. The animals were fixed in 10% formaldehyde solution, through perfusion in the musculature and visceral cavity. Macroscopically, the Australian parakeet viscera did not show expressive differences when compared to other domestic birds’ species. Microscopically, the main difference was the presence of mechanoreceptors (Corpuscles of Pacini in the tongue, found for the first time in this psittaciform  species.

    KEY WORDS: Melopsittacus undulatus, morphology, topography, viscera.

    Em virtude da escassez de dados referentes à morfologia e topografia das aves em geral, o presente estudo teve como objetivo descrever a topografia e morfologia das vísceras do periquito-australiano (Melopsittacus undulatus, para assim proporcionar um conhecimento mais amplo sobre características específicas dessa espécie. Para a descrição da morfologia e topografia das vísceras foram utilizados dez periquitos, sendo cinco machos e cinco fêmeas. Os animais foram fixados com solução de formaldeído 10%, através de perfusão na musculatura e cavidade visceral. Macroscopicamente, as vísceras do periquito não apresentaram muitas diferenças comparadas a outras espécies de aves domésticas. Microscopicamente, a principal diferença estava na presença de mecanorreceptores (corpúsculos de Pacini na língua, encontrados pela primeira vez nesta espécie de psitaciforme. 

    PALAVRAS-CHAVES: Melopsittacus undulatus, morfologia, topografia, vísceras.

  13. Terminal Forecast Reference Notebook (TFRN) for Luke AFB, Arizona,

    Science.gov (United States)

    1980-06-02

    due west of the base; the Sierra Estrella , 4,512 feet, about 12 miles to the south; the Phoenix Mountains, 2,740 feet, about 20 miles to the east...from any other direction will usually miss the base by more than 5 nautical miles because of the steering effect of the Sierra Estrella and the White...does the Sierra Estrella between 152 and 210 degrees. Most radar signal blocking can be eliminated, with the exception of the White Tanks, by raising

  14. Perseus B over Edwards AFB on a Development Flight

    Science.gov (United States)

    1998-01-01

    A long, slender wing and a pusher propeller at the rear characterize the Perseus B remotely-piloted research aircraft, seen here during a test flight in April1998. Perseus B is a remotely piloted aircraft developed as a design-performance testbed under NASA's Environmental Research Aircraft and Sensor Technology (ERAST) project. Perseus is one of several flight vehicles involved in the ERAST project. A piston engine, propeller-powered aircraft, Perseus was designed and built by Aurora Flight Sciences Corporation, Manassas, Virginia. The objectives of Perseus B's ERAST flight tests have been to reach and maintain horizontal flight above altitudes of 60,000 feet and demonstrate the capability to fly missions lasting from 8 to 24 hours, depending on payload and altitude requirements. The Perseus B aircraft established an unofficial altitude record for a single-engine, propeller-driven, remotely piloted aircraft on June 27, 1998. It reached an altitude of 60,280 feet. In 1999, several modifications were made to the Perseus aircraft including engine, avionics, and flight-control-system improvements. These improvements were evaluated in a series of operational readiness and test missions at the Dryden Flight Research Center, Edwards, California. Perseus is a high-wing monoplane with a conventional tail design. Its narrow, straight, high-aspect-ratio wing is mounted atop the fuselage. The aircraft is pusher-designed with the propeller mounted in the rear. This design allows for interchangeable scientific-instrument payloads to be placed in the forward fuselage. The design also allows for unobstructed airflow to the sensors and other devices mounted in the payload compartment. The Perseus B that underwent test and development in 1999 was the third generation of the Perseus design, which began with the Perseus Proof-Of-Concept aircraft. Perseus was initially developed as part of NASA's Small High-Altitude Science Aircraft (SHASA) program, which later evolved into the ERAST project. The Perseus Proof-Of-Concept aircraft first flew in November 1991 and made three low-altitude flights within a month to validate the Perseus aerodynamic model and flight control systems. Next came the redesigned Perseus A, which incorporated a closed-cycle combustion system that mixed oxygen carried aboard the aircraft with engine exhaust to compensate for the thin air at high altitudes. The Perseus A was towed into the air by a ground vehicle and its engine started after it became airborne. Prior to landing, the engine was stopped, the propeller locked in horizontal position, and the Perseus A glided to a landing on its unique bicycle-type landing gear. Two Perseus A aircraft were built and made 21 flights in 1993-1994. One of the Perseus A aircraft reached over 50,000 feet in altitude on its third test flight. Although one of the Perseus A aircraft was destroyed in a crash after a vertical gyroscope failed in flight, the other aircraft completed its test program and remains on display at Aurora's facility in Manassas. Perseus B first flew Oct. 7, 1994, and made two flights in 1996 before being damaged in a hard landing on the dry lakebed after a propeller shaft failure. After a number of improvements and upgrades-including extending the original 58.5-foot wingspan to 71.5 feet to enhance high-altitude performance--the Perseus B returned to Dryden in the spring of 1998 for a series of four flights. Thereafter, a series of modifications were made including external fuel pods on the wing that more than doubled the fuel capacity to 100 gallons. Engine power was increased by more than 20 percent by boosting the turbocharger output. Fuel consumption was reduced with fuel control modifications and a leaner fuel-air mixture that did not compromise power. The aircraft again crashed on Oct. 1, 1999, near Barstow, California, suffering moderate damage to the aircraft but no property damage, fire, or injuries in the area of the crash. Perseus B is flown remotely by a pilot from a mobile flight control station on the ground. A Global Positioning System (GPS) unit provides navigation data for continuous and precise location during flight. The ground control station features dual independent consoles for aircraft control and systems monitoring. A flight termination system, required for all remotely piloted aircraft being flown in military-restricted airspace, includes a parachute system deployed on command plus a C-Band radar beacon and a Mode-C transponder to aid in location. Dryden has provided hanger and office space for the Perseus B aircraft and for the flight test development team when on site for flight or ground testing. NASA's ERAST project is developing aeronautical technologies for a new generation of remotely piloted and autonomous aircraft for a variety of upper-atmospheric science missions and commercial applications. Dryden is the lead center in NASA for ERAST management and operations. Perseus B is approximately 25 feet long, has a wingspan of 71.5 feet, and stands 12 feet high. Perseus B is powered by a Rotax 914, four-cylinder piston engine mounted in the mid-fuselage area and integrated with an Aurora-designed three-stage turbocharger, connected to a lightweight two-blade propeller.

  15. Results and Lessons Learned Interim Report: Altus AFB Site

    National Research Council Canada - National Science Library

    McHugh, Thomas

    2005-01-01

    ...) to address the critical groundwater-to-indoor-air vapor intrusion pathway. By increasing our understanding of this critical pathway, guidelines can be improved, thereby better focusing Department of Defense (DoD...

  16. Surface Observation Climatic Summaries for McChord AFB Washington

    Science.gov (United States)

    1989-07-01

    0 .0 .0 .0 TRCE .0 f6 .6 __ 2_.. .. Q .. . __ .3 TR A n - _5.9 .- Z3, - ) 0 , (N T RA C: .9 .0 .3 .0 .0 .0 .2 .3...t 72-0 ....- 930 . .. . .. 7 .2 _ .. .....-3 .. .. i3 O_..... 1 72.) 1.0 7440 ...................... * aCCA *S& - . - -. & -- MO NLi AP-R iJR&j L

  17. Dicty_cDB: AFB241 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available esis elongation factor 1-alpha (tef2) gene, partial cds. 682 0.0 2 AF157274 |AF157274.1 Phascolomyces arti...culosus translation elongation factor 1-alpha (EF-1alpha) gene, partial cds. 105 2e

  18. Surface Observation Climatic Summaries for Richards-Gebaur AFB, Missouri

    Science.gov (United States)

    1991-04-01

    SUPERSEDES: N/A APR 91 LST TOUTC 406 I MONTH IJAN I FEB I MAR IAP IMAY I JUN I JUL IAUG ISEP IOCT INOV I DEC IANN IYOR- EXTRN MAX TERP(F) 71 82 85 92 94 104...ANDVSBILIT *JN I FEB IAR IM I JUN I JUL IAUG IsEP I OCT I V I DEC I YOR LST 00 - 02 10 03 - 05 10 CIG 06 - 08 23.8 31.5 31.0 22.1 24.0 15.0 12.7 17.4

  19. Waste Analysis Plan and Waste Characterization Survey, Barksdale AFB, Louisiana

    Science.gov (United States)

    1991-03-01

    4C ;J4 c Ia’) La C; c) 0C\\Jc 8 "= "A -’O ’ 04 CŔ" c C’j C-J CAJe~ .- 44 C’) 0% C% 40w 0 l0 O LCD LA O L O 0 0 -IT~ LA 0 00- -T 0 0 0 0 rC 0 0 1- -C (D...r" 3flP1 7, r, ’. hrm Ai IP mn- 3f 1 f r1~r~~ r*NP m r.4 . 4 .-1- 1n i ito NP Mn.’ 3 12fl n 4f c;I rn’." ’, rfi 3I A’. 7 7?A I (>nd ht ~ HIM S)A R46 S

  20. Proposed Closure of Myrtle Beach AFB, South Carolina

    Science.gov (United States)

    1990-07-01

    royal fern (Osmunda regalis), poison ivy (Toxicodendron radicans), and cane (Arundinaria gigantea). Common vines are yellow jasmine (Gelsemium... Ledbetter , Major, U.S. Air Force, Attorney, AFRCE-BMS/DES B.S., 1973, Mathematics, University of Georgia. Athens M.A., 1978, 1 ublic Administration...Richard Garthe F. Lee Howell Murray Geddes Sharon F. Howell Peggy J. Geddes Gary Hoyve Fred G. Gerty Greg Hucks C-5 Jeannine Hucks Jessie R. Lee Lacy K

  1. NOAA-L satellite arrives at Vandenberg AFB

    Science.gov (United States)

    2000-01-01

    Outside the B16-10 spacecraft processing hangar at Vandenberg Air Force Base, Calif., a crated National Oceanic and Atmospheric Administration (NOAA-L) satellite is lowered to the ground before being moved inside. NOAA-L is part of the Polar-Orbiting Operational Environmental Satellite (POES) program that provides atmospheric measurements of temperature, humidity, ozone and cloud images, tracking weather patterns that affect the global weather and climate. The launch of the NOAA-L satellite is scheduled no earlier than Sept. 12 aboard a Lockheed Martin Titan II rocket. Installation Restoration Program. Phase 1. Records Search, Scott AFB, Illinois

    Science.gov (United States)

    1985-04-01

    mission of defense of the United States, has long been engaged in a wide variety of opera- tions dealing with toxic and hazardous materials. Federal...Histopathology-Cytology Sewer Dental Clinic/Laboratory 1680 Yes Yes DPDO, Sanitary Sewer, Medical Logistics Radiology/X-Ray 1680 Yes Yes DPDO, Sanitary...disintegrate. HALOGEN: The class of chemical elements including fluorine , chlorine, i bromine, and iodine. HALON 1211: A fire extinguishing agent

  2. Surface Observation Climatic Summaries (SOCS) For Mather AFB, California

    Science.gov (United States)

    1992-02-01

    1100 SPEND (RTS) CE14 GEIS GE25 OBS GE14 GEl8 GE25 OBS GE14 GEl8 GE25 OBS GE14 GEl8 GE25 OBS CATEGORY A 1.7 .5 .1 930 1.6 .6 .1 930 1.6 .4 930 3.4 1.0...ITS) GE14 0E18 GE25 ORS GE14 GEIS GE25 OS GE14 GEl8 GE25 OBS GE14 GE18 GE25 OBS CATEGORY A 5.7 2.4 930 5.2 1.3 .2 930 1.7 .5 .2 930 1.5 .5 .1 930...TIME (LST) 0600 - 2000 ALL HOURS SPEED K75 GE14 GEl8 GE25 OBS GE14 GEl8 UE25 OS CAT Y A 3.5 1.1 .1 4650 2.8 .9

  3. Installation Restoration Program. Phase 1. Records Search, Lackland AFB, Texas

    Science.gov (United States)

    1985-02-01

    governmental environ- mental projects. Environmental Engineering Department Head (1973-1976). Supervised staff involved in auditing environmental practices...V. -4 a a ; to- w w M, 4-. c* a a M - ~ a -- ~= a a a a a aa as-au ’- aC aCca - ~~~ - aa:0 a 0 24 X4 JU 2 a -- a. -~a - .wZ 2kD.4 4 ob0 m C C w 4a

  4. Environmental Impact Statement Space Shuttle Program, Vandenberg AFB, California. Supplement.

    Science.gov (United States)

    1983-07-01

    2 of the Northern Channel Islands, have been motivated in part by concerns identified through interaction between the Air Force and the Coastal...ofA.SrZ 64 0 /OC 2SS - So#e.e. V, f-rrAq ~ WA~oJsie4,e~4 A-I 4&Ajt4 A fLA1//.t"lJAde~ R-SeI~u- dw rwy. £A4Pcr SL3*p~j* ps4 .Prm Al-fdc6k -5)’-ArFkAJ /7

  5. Installation Restoration Program. Phase I. Records Search, Brooks AFB, Texas

    Science.gov (United States)

    1985-03-01

    decay of the cadavers occurred. The waste was packaged in plastic bags, placed in seven 55-gallon drums and buried in a hole 7 to 8 feet deep. The drums...Receptors subscore (I x factor score subtotal/maximm score subtotal) 44 - II. WASTE CARACTERISTICS A. Select the factor score based on the estimated quantity...subtotal) 44 II. WASTE CARACTERISTICS A. Select the factor score based on the estimated quantity, the degree of hazard, and the confidence level of the

  6. Installation Restoration Program. Phase I. Records. Loring AFB, Maine.

    Science.gov (United States)

    1984-01-01

    periphyton from rivers and streams. Publications Dr. Knight has authored several technical papers on ecosystem metabolism, phytoplankton ecology, and...should be made of glacial till and esker (ice contact) deposits along with the calcareous bedrock (Carys Mills Formation) as they relate to the base...material defects of aircraft struc- tures, component parts, and related ground equipment. Wastes generated by the processes involved include PD-680

  7. Dicty_cDB: AFB514 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available TCACTGTTCATCCAAAATTCTTAACAACAAGAAGAAGCGGAACCAAGAACAAGAAGA ACA sequence update 2001. 6. 1 Translated Amino Acid sequence ---atsnnqlmip...skg*ihchrfshc*nq*treristsl rfirsnsreiclyf*fh*tnc*wycrqcfhlkii*cylsl*nhl*rchgyvqenhgkdlv ltvhpkflttrrsgtknkkn Frame B: ---atsnnqlmips

  8. Final Supplemental Environmental Impact Statement for Airborne Laser Program at Kirtland Air Force Base (AFB) and White Sands Missile Range/Holloman AFB, NM, and Edwards AFB and Vandenberg AFB, CA

    Science.gov (United States)

    2003-06-01

    californicus- _" -~ T ~ - 1" T - E I T Coho salmon Unarmoured three- spined stickleback I Tidewater goby 1 Eucyclogobius n e w b e p i ,.I...ENDANGERED Black-footed ferret (Mustela nigripes)"" Northern aplomado falcon (Falcofemoralis septentrionalis) Kuenzler hedgehog cachls (Echi...Empidonax traillii ertimus) Kuenzler hedgehog cactus (Echinocer~.~rendleri var. kuenzleri) Todsen’s pennyroyal (Hedeoma fodsenii) Sacramento

  9. Dicty_cDB: AFB744 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available lqhpkripplpfsfxixrxyanfc*xlfxgktiplever***h*kcqsqnprqrry spxstxfhfxw*tixxwpxsl*lqhpkxipxpfsxxikrwxanxcknlxwx...xhxigsxrf **hxkcxxqnsxqxrysxrstxinfxwxtixxwxxxx*lqxskgixxpfsxxikrwxanx c*nfnr*nxpxgsxr***x*kc*sqxprqxrxspxst

  10. Wastewater Characterization and Hazardous Waste Survey, Hickam AFB, Hawaii.

    Science.gov (United States)

    1987-05-01

    5200 20 Jan Bldg 2178 7.6 26 4400 20 Jan Lift Station 1A 7.2 26 9000 2" Jan Bldg 2045 6.5 26 12000 2’ Jan Bldg 358A 7.4 24 27000 21 Jan Lift Station 12...8217679b Toluene n/a 6850-00- 281-2002 Alum Alodine n/a 8030-00-779-4699 Methyl Iso Ketone n/a 6810-00-286-3785 Thinner MIL 81772 8010-O0-181-8080 1055 15

  11. AFB (Acid-Fast Bacillus) Smear and Culture

    Science.gov (United States)

    ... of Conditions Not Listed? Not Listed? Acidosis and Alkalosis Adrenal Insufficiency and Addison Disease Alcoholism Allergies Alzheimer ... to produce sputum, a health practitioner may collect respiratory samples using a procedure called a bronchoscopy. Bronchoscopy ...

  12. Dicty_cDB: AFB336 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available A009G02 of library BC0AA from strain CBS 767 of Debaryomyces hansenii. 48 3e-11 4 AA550135 |AA550135.1 1237m...3 gmbPfHB3.1, G. Roman Reddy Plasmodium falciparum genomic clone 1237m, DNA sequence. 60 3e-06 2 BP134604 |B

  13. Mercury and Silver in Clinic Wastewater Goodfellow AFB, Texas

    Science.gov (United States)

    1989-07-01

    SE(JrTY CLASSIFICATION 1b RESTRICTIVE MARINGSuncfassi I ed N/A 2a SCRITY CLASSIFICATION AUTHORITY 3 DISTRIBUTION / AVAiLABILIT OF REPORT N/A Approved...Material suctioned from teeth restoration are collected in a central separator/collection tank. The tank is automatically cleaned by rinsing it with water ...insoluble or sparingly soluble in water . In neutral or alkaline solutions, mercury is oxidized directly to the mercuric state with the formatin of

  14. Environmental Assessment Tent City at Grand Forks AFB, North Dakota

    Science.gov (United States)

    2004-11-15

    animals such as sponges, flatworms, nematode worms, segmented worms, snails, clams, and immature and adult insects , fish, amphibians, turtles, and... nettle (Laportea canadensis), stinging nettle (Urtica dioica), beggars’ ticks (Bidens frondosa), and waterleaf (Hydrophyllum viginianum) are

  15. Performance Monitoring of the Permeable Reactive Barrier at Dover AFB

    National Research Council Canada - National Science Library

    1999-01-01

    Based on column tests conducted between February and June 1997, NERL recommended that in terms of effectiveness in achieving cleanup standards and kinetics, a pyrite-iron combination ranked as the best reactive medium (EPA, 1997...

  16. Installation Restoration Program. Phase 1 - Records Search, Robins AFB, Georgia.

    Science.gov (United States)

    1982-04-01

    Environmental Biology , University of Florida, Gainesville, Florida Business Administration, Georgia State University Professional Affiliations 04 American Water...slay Irn IA lii a aswo vets* 16 40 saw. ben IT 11 Cad"~ L2 U . 5 clay.Sft W 10 isgwk 12 07 10 -ZA coeseedu osi tW streaks of 2W 0 coal" 12 S Koala lo

  17. Environmental Assessment: Space Innovation and Development Center Schriever AFB, Colorado

    Science.gov (United States)

    2006-03-01

    coloradensis T Greenback cutthroat trout Oncorhynchus clarki stomias T Least tern (interior population) .A Sterna antillarum E Mexican spotted owl Strix...Haliaeetus leucocephalus T Boreal toad Bufo boreas boreas c Canada lynx Lynx canadensis T Greenback cutthroat trout Oncorhynchus clarki stomias T Least...T CUSTER Bald eagle IIaliaeetus leucocephalus T Canada lynx Lynx canadensis T Greenback cutthroat trout Oncorhynchus clarki stomias T Mexican

  18. Water and Wastewater Characterization Survey, Williams AFB AZ

    Science.gov (United States)

    1991-03-01

    effluent discharges. Most industrial effluent originates from the flight line operations. The WWTP includes primary sedimentation , trickling filters...final sedimentation , plug-flow chlorine contact basin, and a stabilization pond. Samples were collected at the influent and effluent of the plant...Stispcndcd Solido ~ 60) 31 pit wvithll 6.0 to 90- *1 1*0 is Totil toxic 0, plan:*’ aq (leCiitc(l at .i10 (1 R Pitt 4133. 5 (IIIL)RINE REOPENEP T1 his permit

  19. External quality assessment of AFB smear microscopy performances ...

    African Journals Online (AJOL)

    Data were captured, cleaned, and analyzed using SPSS version 16.0; χ2 tests, kappa statistics were used for comparison purpose. P value < 0.05 considered statistically significant. Among the 32 participant laboratories, 2-scored 100%, 15 scored 80-95% & the remaining 15 scored 50-75% for overall proficiency test ...

  1. Compliance Testing of Grissom AFB Central Heating Plant Coal-Fired Boilers 3 and 4, Grissom AFB Indiana.

    Science.gov (United States)

    1988-03-01

    the absolute value of the flow angle taken at each traverse point must be less than or equal to 20 degrees. The flow angle in the bypass stack averaged...are permitted: with the test include a zero and span cedures approved by the Board or the (I) Fires celebrating Twelfth Night calibration check at the...HUMIDITY DATA ALL TEMPS INPUT IN DEGREES FARENHEIT AND CONVERTED TO DEG. K. AMBIENT DRY BULB (K) = 279.2611 AMBIENT WET BULB (K) = 276.4833 - SOURCE

  2. Compliance Testing of Grissom AFB Central Heating Plant Coal-Fired Boilers 3 and 5, Grissom AFB, Indiana

    Science.gov (United States)

    1988-06-01

    run, a flue gas sample for orsat analysis (measures oxygen, and carbon dioxide for stack gas molecular weight determination and emissions correction...was taken. Orsat sampling and analysis equipment are shown in Figures 5 and 6. Flue gas moisture content, also needed for determination of gas molecular ...where applicable) background a-e (B) Visible emisions shall not exceed is not limited to, monitoring results, opac- recorded on a field data sheet at

  3. Compliance Testing of Grissom AFB Central Heating Plant Coal-Fired Boilers 3, 4, and 5, Grissom AFB, Indiana

    Science.gov (United States)

    1989-06-01

    Occupational and Environmental Health Laboratory (AFSC) Human Systems Division Brooks Air Force Base, Texas 78235-5501 89 8 28 48 UNCLASSIFIED SE(t"cr...IIiZ .nQ ,P %.6 PO 9𔃼 TOTA I’A53O0 1~~jy &~J7 52c’ f.-~O Qri,_00i -Loc o I I or 0QQ~i -5mcI) 0 c 4003 -5 3 -00o ) Ivf 2 ’?00 13, 1-4I __ -0-31. rA4...The laboratory data sheets were not suitable for reproduction ; therefore, the coal analysis results are presented in the following table. AS RECEIVED

  4. Strategic Inventory Positioning of Navy Depot Level Repairable

    National Research Council Canada - National Science Library

    Burton, Larry

    2005-01-01

    ... the benefits in modifying their current inventory positioning policy for repairable items. NAVICP wishes to incorporate a strategic inventory positioning policy that reduces transportation costs...

  5. Trip Reports. Hazardous Waste Minimization and Control at Army Depots

    Science.gov (United States)

    1989-08-01

    Chief, Building 114; Major Robert Ronne; and Ken Rollins, Section Chief, Building 409. The purpose of this trip report Is to document the Information...hazardous. 6. Wf-TIM WOR Feosbility of a suitable p-etresaent f waste cuttins oil and sulleln coolant loach as 4iltratlan to remove metals. removal

  6. Depo-Provera (depot medroxyprogesterone acetate) use after bariatric surgery

    OpenAIRE

    Lam, Clarissa; Murthy, Amitasrigowri S

    2016-01-01

    Clarissa Lam,1 Amitasrigowri S Murthy2,3 1New York University School of Medicine, 2Department of Obstetrics and Gynecology, Bellevue Hospital Center, New York University School of Medicine, 3New York University Langone Medical Center, New York, NY, USA Abstract: In the US, obesity rates are increasing greatly. The Centers for Disease Control and Prevention estimates that 68.5% of Americans, including 63.9% of adult women older than 20 years, are overweight (body mas...

  7. Independent Evaluation of The Bay Area Supply Depot Consolidation Prototype

    Science.gov (United States)

    1991-12-01

    crane productivities of 40 and 25 lines per hour, respectively, compare with rates of 80 to 100 lines per hour for similar systems in ta.e private sector ...also made quality-of- worklife improvements including the addition of microwave ovens and refrigerators for personnel use, the refurbishing of rest rooms...packed for more than a short period of time is no longer an acceptable practice. * Enhancing the quality of worklife at Oakland by making the site a

  8. KC-46 Workforce Requirements for Depot Maintenance Activation

    Science.gov (United States)

    2014-03-27

    DISTRIBUTION STATEMENT A. APPROVED FOR PUBLIC RELEASE; DISTRIBUTION UNLIMITED. The views expressed in this thesis are those...Community College of the Air force CFR: Code of Federal Regulation CLS: Contract Logistic Service CoF: Complex of the Future CSR : Case Study...structures built on narrow pieces of a process,” breaks up the work into simplified tasks to ensure that the work can be performed by anyone properly

  9. Simulation of empty container logistic management at depot

    Science.gov (United States)

    Sze, San-Nah; Sek, Siaw-Ying Doreen; Chiew, Kang-Leng; Tiong, Wei-King

    2017-07-01

    This study focuses on the empty container management problem in a deficit regional area. Deficit area is the area having more export activities than the import activities, which always have a shortage of empty container. This environment has challenged the trading companies in the decision making in distributing the empty containers. A simulation model that fit to the environment is developed. Besides, a simple heuristic algorithm with some hard and soft constraints consideration are proposed to plan the logistic of empty container supply. Then, the feasible route with the minimum cost will be determined by applying the proposed heuristic algorithm. The heuristic algorithm can be divided into three main phases which are data sorting, data assigning and time window updating.

  10. Techno-economic analysis of a biomass depot

    Energy Technology Data Exchange (ETDEWEB)

    Jacobson, Jacob Jordan [Idaho National Lab. (INL), Idaho Falls, ID (United States); Lamers, Patrick [Idaho National Lab. (INL), Idaho Falls, ID (United States); Roni, Mohammad Sadekuzzaman [Idaho National Lab. (INL), Idaho Falls, ID (United States); Cafferty, Kara Grace [Idaho National Lab. (INL), Idaho Falls, ID (United States); Kenney, Kevin Louis [Idaho National Lab. (INL), Idaho Falls, ID (United States); Heath, Brendi May [Idaho National Lab. (INL), Idaho Falls, ID (United States); Hansen, Jason K [Idaho National Lab. (INL), Idaho Falls, ID (United States)

    2014-10-01

    The U.S. Department of Energy (DOE) Bioenergy Technologies Office (BETO) promotes the production of an array of liquid fuels and fuel blendstocks from lignocellulosic biomass feedstocks by funding fundamental and applied research that advances the state of technology in biomass collection, conversion, and sustainability. As part of its involvement in this program, the Idaho National Laboratory (INL) investigates the technical, economic, and environmental performance of different feedstock supply systems and their impacts on the downstream conversion processes.

  11. Simultaneously Recovering Rolling Stock Schedules and Depot Plans Under Disruption

    DEFF Research Database (Denmark)

    Haahr, Jørgen Thorlund; Lusby, Richard Martin; Larsen, Jesper

    2015-01-01

    to be applied in a disruption recovery setting. Furthermore, we provide a comparison of several solution strategies to the Train Unit Parking Problem, and, by way of an example prove the heuristic nature of a previously proposed optimal approach. We analyse the performance of the proposed methodology...

  12. Testosterone depot injection in male hypogonadism: a critical appraisal

    Directory of Open Access Journals (Sweden)

    Aksam A Yassin

    2008-01-01

    Full Text Available Aksam A Yassin1, Mohamed Haffejee21Clinic of Urology/Andrology, Segeberger Kliniken, Norderstedt-Hamburg, Germany and Department of Urology, Gulf Medical College School of Medicine, Ajman-UAE 2Urology Division at the University of Witwaterstrand & Johannesburg Hospital, Johannesburg, South AfricaAbstract: Testosterone compounds have been available for almost 70 years, but the pharmaceutical formulations have been less than ideal. Traditionally, injectable testosterone esters have been used for treatment, but they generate supranormal testosterone levels shortly after the 2- to 3-weekly injection interval and then testosterone levels decline very rapidly, becoming subnormal in the days before the next injection. The rapid fluctuations in plasma testosterone are subjectively experienced as disagreeable. Testosterone undecanoate is a new injectable testosterone preparation with a considerably better pharmacokinetic profile. After 2 initial injections with a 6-week interval, the following intervals between two injections are almost always 12-weeks, amounting eventually to a total of 4 injections per year. Plasma testosterone levels with this preparation are nearly always in the range of normal men, so are its metabolic products estradiol and dihydrotestosterone. The “roller coaster” effects of traditional parenteral testosterone injections are not apparent. It reverses the effects of hypogonadism on bone and muscle and metabolic parameters and on sexual functions. Its safety profile is excellent due to the continuous normalcy of plasma testosterone levels. No polycythemia has been observed, and no adverse effects on lipid profiles. Prostate safety parameters are well within reference limits. There was no impairment of uroflow. Testosterone undecanoate is a valuable contribution to the treatment options of androgen deficiency.Keywords: testosterone treatment, testosterone undecanoate, pharmacokinetic profile, clinical efficacy, side effects, sexual dysfunction

  13. Depot Maintenance Transformation: Successful Strategies in Capital Investing

    Science.gov (United States)

    2010-06-01

    the aircraft. Continually climbing up and down portable stands while wearing fully enclosed body suites, carrying large paint sprayers, and dragging...and fatigue. selected--Wrap around stands will minimize the number of trips up and down the stairs it takes to get around the aircraft. It is faster...our metal finishing operations into state-of-the-art processes consisting of the latest technologies. Items such as robotic shot penning

  14. Assessing menopausal status in women aged 40 - 49 using depot ...

    African Journals Online (AJOL)

    Background. Determining symptoms of menopause in older users of hormonal injectable contraceptives may be challenging, owing to method-induced amenorrhoea, suppression of follicle-stimulating hormone (FSH) and vasomotor symptoms. Objective. To investigate menopausal symptoms in women aged 40 - 49 using ...

  15. Improving Aviation Depot Level Repairable (AVDLR) Inventory and Repair Management

    National Research Council Canada - National Science Library

    Baird, Dennis

    1997-01-01

    .... Additionally, research was conducted to document the management process for determining repair requirements at the Naval Inventory Control Point Philadelphia and how those requirements are accepted...

  16. An Analysis of Unit Costs at a Consolidated Supply Depot

    Science.gov (United States)

    1990-12-01

    Not-For-Profit Setting,"The Accounting Review,July 1990. Horngren , C. T., Cost Accountinq:A Managerial Emphasis,3rd ed, Prentice-Hall Inc.,1972...sector has used concepts of unit costs for 4 decades. Any managerial or cost accounting text discusses in some length unit costs . For Defense contractors...the Cost Accounting Standards Board (CASB) provides guidance for contract costs . Unit costs include direct, indirect, and general and administrative

  17. Management of Labor Standards for Airframes at Aeronautical Depots

    National Research Council Canada - National Science Library

    1991-01-01

    .... There are two types of labor standards, engineered and nonengineered. Engineered standards are a series of observations and analyses of the performance of work, which result in a specific time for a recorded method of work...

  18. Defense Use of Certain Federal Property: Birmingham, Columbia, Detroit, Goldsboro, Jackson, Kansas City, Ravenna Depot, Rochester, Seneca Depot, Syracuse

    Science.gov (United States)

    1973-02-01

    weekend and annual training. The task assignment of the 926th to Childersburg would directly and immediately benefit the government as follows: a. Provide...and a bid has been submitted to purchase 10 acres in the suburb o< Chili , NY, 6 miles southwesl of the present center. The project calls for, the...Navy in Chili , NY as out- lined in ref (b). c. Designate Canandaigua, NY property as an Armed Forces Reserve Center. d. Commensurate with Army-Navy

  19. Enplanement and All Cargo Activity

    Science.gov (United States)

    1991-01-01

    49.747 $400.000 266 MI MUSKEGON MUSKEGON COUNTY MKG 49.176 $400.000 267 AK KOTZEBUE RALPH WIEN MEMORIA OTZ 48,421 S400.000 268 CO STEAMBOAT SPRINGS...RSm 1.154 718 AK SOUTH NAKNEK SOUTH NAKNEK MR 2 WSN 1.143 719 TX ORANGE ORANGE COUNTY ORG 1,139 72C IL MATTOON/CHARLESTO4 COLES COUNTY MEMORIA MTO...103 1043 FL KEY LARGO OCEAN REEF CLUB X09 103 1044 SC SUMTER SHAW AFB SSC 101 1045 AK CIRCLE HOT SPRINGS CIRCLE HCT SPRINGS CHP 100 1046 OR MADRAS

  20. Department of Defense Facilities Sustainment, Restoration, & Modernization Program Plan

    Science.gov (United States)

    2009-05-15

    09 Jul-09 Sep-09 Jan-11 1639 Fort Shafter HI Structural Termite Repairs, Palm Circle B102 $2,750 O 38431 Jul-09 Sep-09 Oct-09 Dec-09 Apr-11 1640...09 Dec-10 1891 Detroit Arsenal MI Mound Rd Improvements at Mound Rd Access Control Point $380 P 35285 May-09 Jul-09 Aug-09 Oct-09 Feb-11 1892...VLSB090070 N/A N/A Jul-09 Aug-09 Aug-10 1526 Shaw AFB SC Repr Termite /Structural Damage Family Housing $500 F VLSB090071 N/A N/A Jul-09 Aug-09 Apr-10 1527

  1. Nightmare on Shaw Street: Getting Lost in Shorty’s Private Collection

    OpenAIRE

    Emily Bullock

    2012-01-01

    This article discusses the semiotic and affective affordances of a regional museum on the west coast of Australia’s only island state, Tasmania. Shorty’s Private Collection is a small museum displaying items collected from around the region, with a focus on resuscitated mining materials. The owner also creates figures derived from popular culture from these items. The article uses the methodology of creative non-fiction in order to situate the museum within the marginal community ...

  2. Woman power in Corporate India In conversation with Kiran Mazumdar Shaw, Chairperson & MD, Biocon ltd

    Directory of Open Access Journals (Sweden)

    Anitha Kurup

    2011-12-01

    Empirical evidence suggests that though women directors on Indian corporate boards show an increase both in numbers and in percentage terms, they are very much behind men. Women are also less well represented on Indian corporate boards as compared to other countries. Family ties, public sector employment and private sector banks are major sources of directorships for women. There are very few first generation women entrepreneurs in India. Though initial thresholds are higher for women to achieve success, the problems they face afterwards are similar to problems faced by successful men. India has a long way to go before women can catch up with men in the corporate world.

  3. Mitochondrial control region haplotypes of the South American sea lion Otaria flavescens (Shaw, 1800).

    Science.gov (United States)

    Artico, L O; Bianchini, A; Grubel, K S; Monteiro, D S; Estima, S C; Oliveira, L R de; Bonatto, S L; Marins, L F

    2010-09-01

    The South American sea lion, Otaria flavescens, is widely distributed along the Pacific and Atlantic coasts of South America. However, along the Brazilian coast, there are only two nonbreeding sites for the species (Refúgio de Vida Silvestre da Ilha dos Lobos and Refúgio de Vida Silvestre do Molhe Leste da Barra do Rio Grande), both in Southern Brazil. In this region, the species is continuously under the effect of anthropic activities, mainly those related to environmental contamination with organic and inorganic chemicals and fishery interactions. This paper reports, for the first time, the genetic diversity of O. flavescens found along the Southern Brazilian coast. A 287-bp fragment of the mitochondrial DNA control region (D-loop) was analyzed. Seven novel haplotypes were found in 56 individuals (OFA1-OFA7), with OFA1 being the most frequent (47.54%). Nucleotide diversity was moderate (π = 0.62%) and haplotype diversity was relatively low (67%). Furthermore, the median joining network analysis indicated that Brazilian haplotypes formed a reciprocal monophyletic clade when compared to the haplotypes from the Peruvian population on the Pacific coast. These two populations do not share haplotypes and may have become isolated some time back. Further genetic studies covering the entire species distribution are necessary to better understand the biological implications of the results reported here for the management and conservation of South American sea lions.

  4. Mitochondrial control region haplotypes of the South American sea lion Otaria flavescens (Shaw, 1800

    Directory of Open Access Journals (Sweden)

    L.O. Artico

    2010-09-01

    Full Text Available The South American sea lion, Otaria flavescens, is widely distributed along the Pacific and Atlantic coasts of South America. However, along the Brazilian coast, there are only two nonbreeding sites for the species (Refúgio de Vida Silvestre da Ilha dos Lobos and Refúgio de Vida Silvestre do Molhe Leste da Barra do Rio Grande, both in Southern Brazil. In this region, the species is continuously under the effect of anthropic activities, mainly those related to environmental contamination with organic and inorganic chemicals and fishery interactions. This paper reports, for the first time, the genetic diversity of O. flavescens found along the Southern Brazilian coast. A 287-bp fragment of the mitochondrial DNA control region (D-loop was analyzed. Seven novel haplotypes were found in 56 individuals (OFA1-OFA7, with OFA1 being the most frequent (47.54%. Nucleotide diversity was moderate (π = 0.62% and haplotype diversity was relatively low (67%. Furthermore, the median joining network analysis indicated that Brazilian haplotypes formed a reciprocal monophyletic clade when compared to the haplotypes from the Peruvian population on the Pacific coast. These two populations do not share haplotypes and may have become isolated some time back. Further genetic studies covering the entire species distribution are necessary to better understand the biological implications of the results reported here for the management and conservation of South American sea lions.

  5. Aplikasi Berbagai Bahan ZPT Alami untuk Meningkatkan Pertumbuhan Bibit Kemiri Sunan (Reutealis trisperma (Blanco Airy Shaw

    Directory of Open Access Journals (Sweden)

    Fitri Kurniati

    2017-07-01

    Full Text Available Kemiri Sunan  merupakan tanaman alternatif penyediaan bahan bakar nabati dan bahan baku berbagai produk industri. Kulit benih kemiri yang keras menjadi penghalang dalam perkecambahan. Kondisi ini dapat diperbaiki dengan pemberian zat pengatur tumbuh (ZPT eksogen alami seperti umbi bawang merah sumber auksin, rebung bambu sumber giberelin, bonggol pisang dan air kelapa sebagai sumber sitokinin. Tujuan penelitian adalah mengetahui kemampuan berbagai bahan ZPT alami atau kombinasinya untuk menstimulasi perkecambahan dan pertumbuhan bibit kemiri sunan asal biji. Penelitian dilakukan pada bulan Juni sampai Oktober 2016, rancangan percobaan yaitu Rancangan Acak Kelompok yang diulang tiga kali, dengan perlakuan: a0 : kontrol (tanpa ZPT; a1 : ekstrak umbi bawang merah (BM; a2 : ekstrak rebung bambu (RB; a3: ekstrak bonggol pisang (BP;   a4 : air kelapa (AK; a5: BM + RB; a6 : BM + BP;  a7 : BM + AK; a8 : RB+ BP; a9 : RB+ AK;  a10  : BP+ AK; a11  : BM + RB + BP + AK. Hasil penelitian menunjukkan pengaruh yang berbeda terhadap daya kecambah, tinggi bibit umur 30 hari setelah tanam (HST, 37 HST, 44 HST, dan 51 HST, juga jumlah daun pada 51 HST. Aplikasi zpt BP + AK menghasilkan daya kecambah paling baik (97,78 %, namun tidak berbeda dengan aplikasi RB + BP; BM+ RB+ BP+ AK; BM + AK. Aplikasi zpt asal BP + AK menghasilkan tinggi bibit tertinggi (13,57 cm. Jumlah daun terbanyak dihasilkan pada aplikasi BP + AK (1,45 helai. Secara umum zpt bonggol pisang + air kelapa memberikan hasil paling baik, namun umbi bawang merah maupun rebung bambu mempunyai harapan untuk dikembangkan. Candlenut cv. Sunan is alternative biofuels plant also as raw of many industrial products. Its hard pulp seed becomes barrier of germination. This condition can be overcome by  giving natural plant growth regulators (PGRs, i,e shallot as auxin source, bamboo shoot as gibberellin source, banana bulb and coconut water as sources of cytokinin. The research aim was knowing effect of various PGRs and their combinations to promote germination and growth of seedling candlenut cv Sunan. The research was done from June to October 2016, in experimental design of Randomized Block Design (RBD, consisted of : a0 : control (without PGRs; a1 : shallot (BM; a2 : bamboo shoot (RB; a3: banana bulb (BP;  a4 : coconut water (AK; a5 : BM+ RB; a6 : BM + BP; a7 : BM + AK; a8 : RB+ BP;  a9 : RB + AK;  a10  : BP + AK;  a11 : BM + RB + BP + AK, all repeated three times. The result showed that application of natural PGRs had significant effect on germination percentage, plant height on 30 days after planting (dap, 37 dap, 44 dap, and 51 dap,  number of leaves 51 dap. Application of BP + AK gave the best effect on germination (97.78%, but no significant different with RB + BP; BM + RB + BP + AK. Application of BP + AK generated highest plant (13.57 cm. The best of the number of leaves was RB + AK (1.45 leaves. Overall application of natural PGRs from banana bulb + coconut water gave the best effect, besides bamboo shoot and shallot have opportunity to be developed.

  6. Environmental Impact Statement (EIS) for the Airspace Training Initiative Shaw Air Force Base, South Carolina

    Science.gov (United States)

    2011-12-09

    wildlife; and (3) special-status species. Because of their societal and economic importance, domestic animals (e.g., cattle, sheep, hogs, poultry , and... Thomas Jefferson, High and Industrial School Sandersville Bulldog A and B MOA Georgia Washington Holt Brothers Banking Company Building...MOA Georgia Washington Madden, Charles, House Tennille Bulldog A and B MOA Georgia Washington Smith, Thomas W., House Tennille Bulldog A and B MOA

  7. Hydatid disease of the liver | Shaw | South African Journal of Surgery

    African Journals Online (AJOL)

    ERCP) are reserved for complicated cases. The differential diagnosis includes any cystic lesion of the liver. Liver hydatid cysts can be treated by medical or minimally invasive (laparoscopic and percutaneous) means or by conventional open ...

  8. Environmental Assessment: Construct New AAFES Shopping Center Shaw Air Force Base, South Carolina

    Science.gov (United States)

    2008-10-01

    water supply after conventional treatment, fishing and the survival and propagation of a balanced indigenous aquatic community of flora and fauna. No...arrow-head West Indian meadow-beauty Wild petunia Amphibians Northern cricket frog Reptiles Eastern coral snake Mammals Rafinesque’s big-eared

  9. Environmental Assessment for a Fighter Detachment Facility, Shaw Air Force Base, South Carolina

    Science.gov (United States)

    2005-04-01

    provides for the protection and propagation of fish, shellfish, wildlife, and recreation in and on the water. The US Army Corps of Engineers (USACE) is...scirpoides Long-beaked baldrush - SC Floating mats in ponds; pond margins. Ruellia caroliniensis A petunia - SC Woods and wood margins. Sagittaria...supply after conventional treatment, fishing, and the survival and propagation of a balanced indigenous aquatic Final EA for a Fighter Detachment

  10. Hydrodynamic Capture and Release of Passively Driven Particles by Active Particles Under Hele-Shaw Flows

    Science.gov (United States)

    Mishler, Grant; Tsang, Alan Cheng Hou; Pak, On Shun

    2018-03-01

    The transport of active and passive particles plays central roles in diverse biological phenomena and engineering applications. In this paper, we present a theoretical investigation of a system consisting of an active particle and a passive particle in a confined micro-fluidic flow. The introduction of an external flow is found to induce the capture of the passive particle by the active particle via long-range hydrodynamic interactions among the particles. This hydrodynamic capture mechanism relies on an attracting stable equilibrium configuration formed by the particles, which occurs when the external flow intensity exceeds a certain threshold. We evaluate this threshold by studying the stability of the equilibrium configurations analytically and numerically. Furthermore, we study the dynamics of typical capture and non-capture events and characterize the basins of attraction of the equilibrium configurations. Our findings reveal a critical dependence of the hydrodynamic capture mechanism on the external flow intensity. Through adjusting the external flow intensity across the stability threshold, we demonstrate that the active particle can capture and release the passive particle in a controllable manner. Such a capture-and-release mechanism is desirable for biomedical applications such as the capture and release of therapeutic payloads by synthetic micro-swimmers in targeted drug delivery.

  11. Standardized UXO Technology Demonstration Site Open Field Scoring Record Number 492 (Shaw Environmental, Inc.)

    National Research Council Canada - National Science Library

    Overbay, Larry; Robitaille, George

    2005-01-01

    ...) utilizing the APG Standardized UXO Technology Demonstration Site Open Field. Scoring Records have been coordinated by Larry Overbay and the Standardized UXO Technology Demonstration Site Scoring Committee...

  12. The Inveterate Tinkerer 13. Experiments With Hele–Shaw Cells In ...

    Indian Academy of Sciences (India)

    to a linear dimension of the plates, having a fluid confined within the gap. Fluid flow in this setup ... Darcy's law [4] states that the velocity of a Newtonian fluid .... opening facing the gap, and the other end of the tube attached to a plastic microtip ...

  13. Microscopic morphology and testis morphometry of captivity-bred Adult bullfrogs (Lithobates catesbeianus Shaw, 1802

    Directory of Open Access Journals (Sweden)

    Jaqueline Carlos

    2009-12-01

    Full Text Available The aim of this work was to study the testicular morphometry of captivity-bred adult bullfrogs. Fifteen young adult male were studied, in the rainy season and a lengthy photoperiod. The GSI was established at 0.15%. The nuclear diameter of germinative and Leydig cells, the nucleolus diameter of Sertoli cells and the area of cysts and tubules were determined and the mean number of ISPC, IISPC and SPT per cyst and the mean number of cysts per tubule was estimated. The nucleoplasmatic proportion of the nucleus of the Leydig cell was 76.22%, indicating less cytoplasmic activity. Eight generations of spermatogonia were found. The spermatogenesis efficiency in meiosis and in mitosis was 63 and 49%, respectively. The spermatogenesis of bullfrog fited in the pattern of other captivity Anurans, with differences as the morphology of Sertoli and Leydig cells nuclei.A morfometria é uma importante ferramenta para a biologia estrutural, permitindo estudos estereológicos e análises quantitativas. Existem muitos pontos a serem esclarecidos sobre a morfometria testicular desta espécie, que objetivamos desvendar neste trabalho. Quinze machos adultos foram estudados, em período chuvoso e de fotoperíodo longo (dezembro, 2000. O IGS encontrado foi de 0.15%. O diâmetro nuclear das células germinativas e da célula de Leydig, o diâmetro nucleolar das células de Sertoli e a área dos cistos e túbulos foram determinados. O número médio de ISPC, IISPC e SPT por cisto e o número médio de cisto por túbulo foi estimado. A proporção nucleoplasmática do núcleo da célula de Leydig foi de 76.22%, indicando pouca atividade citoplasmática. Oito gerações de espermatogônia foram estimadas. A eficiência da espermatogênese na meiose e mitose foi de 63% e49%, respectivamente. A espermatogênese de rãtouro segue os padrões dos demais Anuros de cativeiro, apresentando diferenças nos núcleos das c��lulas de Sertoli e Leydig.

  14. Upaya Konservasi Cendrawasih Kecil (Paradisaea minor Shaw, 1809 YANG DILAKUKAN OLEH TAMAN BURUNG TMII DAN MBOF

    Directory of Open Access Journals (Sweden)

    Ken Dara Cita

    2016-11-01

    Full Text Available Ex situ conservation is one of the ways to save wildlife animal include lesser bird of paradise. Taman Mini Indonesia Indah (TMII Bird Park and Mega Bird And Orchid Farm (MBOF were two institutions that support ex-situ conservation program with different purposes. TMII Bird Park has non-commercial purpose breeding, while MBOF has commercial purpose in captivity breeding. The objectives of this research were to describe the management of captive breeding of lesser bird of paradise with the influencing factor for captive breeding success and the daily behavior of lesser bird of paradise in the cage. This research was conducted from March until April 2015. Focal animal sampling and one zero sampling methods were employed to observe daily behavior. The results showed that in both locations there were two kind of cages for lesser bird of paradise display cage and quarantine cage. The temperature in the TMII Bird Park display cage was 25,51⁰C, meanwhile the temperature in the MBOF display cage was 22,68⁰C. There were not differences in management between the two locations, included management of cage, feed, care and health. Two institutions did not success for captive breeding lesser bird of paradise. The behavior had been identified were: resting, ingestive, and maintenance behavior.Keywords: daily behavior, lesser bird of paradise, management of captivity

  15. Hyperbolic kaleidoscopes and Chaos in foams and Hele-Shaw cell

    International Nuclear Information System (INIS)

    Tufaile, A P B; Tufaile, A; Liger-Belair, G

    2011-01-01

    Liquid foams have fascinating optical properties, which are caused by the large number of light refractions and reflections by liquid films and Plateau borders. Due to refraction and reflection at the interfaces, the direction of the rays leaving a Plateau border can vary greatly for the same incident angle and a small positional offset. A close look in some configurations of the Plateau borders or liquid bridges reveals the existence of some triangular patterns surrounded by a complex structure, and these patterns bear a resemblance to those observed in some systems involving chaotic scattering and multiple light reflections between spheres. Provided the optical properties of the sphere surfaces are chosen appropriately, fractals are natural consequences of multiple scattering of light rays in these cavities. The cavity acts as a hyperbolic kaleidoscope multiplying the scattering of light rays generating patterns related to Poincare disks and Sierpinski gaskets in comparison to linear kaleidoscopes. We present some experimental results and simulations of these patterns explained by the light of the chaotic scattering.

  16. O efeito pigmaleão: Bernard Shaw e as releituras de os simpsons

    Directory of Open Access Journals (Sweden)

    Sílvia Maria Guerra Anastácio

    2014-07-01

    Full Text Available http://dx.doi.org/10.5007/2175-7968.2014v1n33p287 Este artigo surgiu do interesse de estudar o efeito Pigmaleão e o modo como esse tema tem se modificado ao longo do tempo. Busca-se investigar como o mito do Pigmaleão teria dado origem a uma variedade de hipertextos que ressignificam esse objeto de análise, especialmente na mídia contemporânea, em que os episódios das séries da animação Os Simpsons dialogam

  17. Hyperbolic kaleidoscopes and Chaos in foams and Hele-Shaw cell

    Energy Technology Data Exchange (ETDEWEB)

    Tufaile, A P B; Tufaile, A [Escola de Artes, Ciencias e Humanidades da Universidade de Sao Paulo, R. Arlindo Bettio, 1000, 03828-000, Sao Paulo (Brazil); Liger-Belair, G, E-mail: atufaile@usp.br [Laboratoire d' OEnologie et Chimie Appliquee, UPRES EA 2069, URVVC, Faculte de Sciences de Reims, Moulin de la Housse, B. P. 1039, 51687 Reims, Cedex 2 (France)

    2011-03-01

    Liquid foams have fascinating optical properties, which are caused by the large number of light refractions and reflections by liquid films and Plateau borders. Due to refraction and reflection at the interfaces, the direction of the rays leaving a Plateau border can vary greatly for the same incident angle and a small positional offset. A close look in some configurations of the Plateau borders or liquid bridges reveals the existence of some triangular patterns surrounded by a complex structure, and these patterns bear a resemblance to those observed in some systems involving chaotic scattering and multiple light reflections between spheres. Provided the optical properties of the sphere surfaces are chosen appropriately, fractals are natural consequences of multiple scattering of light rays in these cavities. The cavity acts as a hyperbolic kaleidoscope multiplying the scattering of light rays generating patterns related to Poincare disks and Sierpinski gaskets in comparison to linear kaleidoscopes. We present some experimental results and simulations of these patterns explained by the light of the chaotic scattering.

  18. Pathways to institutional equilibrium after a campus disaster / Mahauganee D. Shaw

    Index Scriptorium Estoniae

    Shaw, Mahauganee D.

    2017-01-01

    Institutsionaalse tasakaalu sõltuvus välisteguritest ja selle võime taastuda kui asutus on veel taastumisrežiimis. Antud uuringu tulemused aitavad kaasa organisatsioonilise arengu ja kriisiohje teoreetilistele alustele, samuti kriisijuhtimise praktikale kõrghariduses

  19. Decompression sickness rates for chamber personnel: case series from one facility.

    Science.gov (United States)

    Brandt, Megan S; Morrison, Thomas O; Butler, William P

    2009-06-01

    During 2004, a case series of decompression sickness (DCS) meeting the definition of epidemic DCS was observed in the Shaw AFB Physiological Training Program. There were 10 cases of chamber-induced altitude DCS observed. Internal and external investigations focused on time, place, person, and environment. No temporal trend was observed. Chamber, masks, regulators, crew positions, and oxygen sources revealed no defects. Among the cases, mean age was 27 yr. Peak altitude in four cases was 35,000 ft and in the other six cases was 25,000 ft. Six had joint pain, one skin symptoms, and three neurological findings. Four were treated with 100% ground-level oxygen and six with hyperbaric oxygen. Four were students and six were inside observers (IO). Four were women and six men. In the IO, where four of the six were women, no gender effect was seen. Examining the IO monthly exposure load (exposures per month) against DCS suggested a dose-response relationship. This relationship held true when 4 yr of Shaw AFB IO data was studied. Indeed, Poisson regression analysis demonstrated a statistically significant 2.1-fold rise in DCS risk with each monthly exposure. Consequently, the number of exposures per month may need to be considered when devising IO schedules.

  20. Flying Training Capacity Model: Initial Results

    National Research Council Canada - National Science Library

    Lynch, Susan

    2005-01-01

    OBJECTIVE: (1) Determine the flying training capacity for 6 bases: * Sheppard AFB * Randolph AFB * Moody AFB * Columbus AFB * Laughlin AFB * Vance AFB * (2) Develop versatile flying training capacity simulation model for AETC...

  1. Patrones reproductivos del lobo marino común, Otaria flavescens (Shaw 1800, en el centro-sur de Chile Breeding patterns in southern sea lions, Otaria flavescens (Shaw 1800, in south-central Chile

    Directory of Open Access Journals (Sweden)

    HÉCTOR J PAVÉS

    2005-12-01

    Full Text Available El desfase latitudinal de los eventos reproductivos en Otaria flavescens sugiere la existencia de una adaptación fisiológica y conductual a condiciones ambientales locales. La identificación de cambios en los patrones conductuales intraespecíficos frente a modificaciones ambientales sugieren una relación entre estos. Se pretende revisar los patrones reproductivos del O. flavescens, determinando la existencia de una sincronización y estabilidad en ellos durante las temporadas 1996-1997 y 1997-1998 en la colonia de Punta Lobería, Chile. Se realizaron observaciones directas de las agrupaciones y conductas reproductivas empleando binoculares, y apoyadas por el uso de material fílmico y fotográfico. Los resultados evidenciaron modificaciones en, (a el número de harenes (de 28 disminuye a 19, (b la distribución espacial de los harenes (70 % de los harenes durante 1997-1998 se establecieron en el lado norte de la playa reproductiva, durante la temporada anterior estos se distribuyeron a lo largo de toda la playa, (c proporción etaria (un macho: 12 hembras: un juvenil: siete cachorros, desciende a un macho: nueve hembras: dos juveniles: seis cachorros, (d índice de poliginia (de 12,4 a 7,8 HPMT y de 11 a 9 HP, y (e la población organizada en harenes (disminución del 10,3 %. Estas variaciones estarían relacionadas con la reducción del espacio óptimo para el establecimiento de harenes debido a la incorporación de suelo/roca posterior a un derrumbe invernal. Los patrones conductuales reproductivos que se mantuvieron invariables durante las temporadas fueron, (a la estacionalidad de los harenes (constitución durante la cuarta semana de diciembre y disolución en la cuarta semana de febrero, (b el período de partos (inicio durante la segunda semana de enero, finalización durante la cuarta semana de enero, y (c el período de cópulas (inicio durante la tercera semana de enero, finalización durante la segunda semana de febrero. Por lo tanto, O. flavescens presentaría conductas modificables y permanentes que se despliegan según las condiciones ambientales. Donde las conductas reproductivas modificadas potencialmente mitigarían pérdidas en aspectos reproductivos, y las conductas reproductivas permanentes, estarían relacionadas con procesos fisiológicos y conductuales seleccionados bajo las condiciones ambientales. Estos patrones reproductivos al ser comparados con las de otras localidades son congruente con un efecto latitudinal, debido a la variación registrada tanto en la estacionalidad de ellos como en la duración de los mismos (e.g., período de partos y cópulas.The latitudinal effect of reproductive patterns for Otaria flavescens suggests the existence of behavioral and physiological adaptation to local environmental conditions. The identification of intraspecific behavioral pattern changes due to these environmental conditions suggest a relation among them. We pretend here to determine reproductive synchronization and reproductive stability of O. flavescens in the Punta Lobería colony during two breeding seasons 1996-1997 and 1997-1998. Direct observations of groups and breeding behavior were watched with binoculars backed by video and photography. Results evidenced modification in (a the number of harems (decreased from 28 to 19 during first to the second seasons, (b the spatial distribution of harems (70 % of these were located in northern part of the reproductive beach during the 1997-1998 season whereas they occupied the whole beach rather uniformly during the previous season, (c age structure (one male: 12 females: one juvenile and seven pups decreased to one male: nine females: two juveniles and six pups, (d the polygyny index (decreased from 12.4 to 7.8 HPMT and from 11 to 9 HP, and (e the reproductive population organized in harems (decreased of up to 10.3 %. These variations would be related to optimum space reduction for harem establishment after an earth/rock slide over the area. Behavioral reproductive patterns remaining stable during both seasons were (a seasonality of harems (harem formation during the fourth week in December, dissolution during the fourth week of February, (b birth period (beginning during the second week of January and ending during the fourth week of January, and (c mating period (beginning during the third week of January, ending during the second week in February. Otaria flavescens exhibited modifiable and stable behavioral patterns according to environmental conditions. Modified breeding behavior potentially would mitigate loss of reproductive output, and stable breeding behavior would be related to physiological and behavioral processes according to environmental conditions. Thus, reproductive patterns when compared to other known reproductive localities in Chile are consistent with a latitudinal effect due to variations registered by their seasonality, as well as its duration (e.g., mating and birth periods

  2. Installation Restoration Program (IRP) Stage 7, Remedial Investigation/ Feasibility Study Comprehensive CERCLA Work PLan for McClellan AFB/EM, McClellan AFB, California

    Science.gov (United States)

    1991-07-01

    Systems Audits ; Preventive Maintenance; Data Assessment Procedures; Corrective Action; Quality Assurance Reports; and Site Management. General Data Quality...for verification and quality control audits . A copy of the QAPP will be in the possession of field sampling teams for all sampling efforts...L cc- acca C wi w-C P-3-- C I- usu 2; - at C4~~2 Q (( c ccc c-c C- 0L U -C 3- au S - - C3 . - acu tr - -a CL.43 C LU -C2 -C ul 0it S w- -C u Ocw - z i

  3. Installation Restoration Program (IRP) Stage 3, Operable Unit B engineering Evaluation/Cost Analysis - Environmental Assessment for McClellan AFB/EM, McClellan AFB, California

    Science.gov (United States)

    1990-12-01

    U U U � o 0. .. . .. .. . ..0 C f 88 11 g 88 2= c c= 61 =" l w oA ID - f mW CD 0 x P.- I- W x- hi 8I fmd /06ETLO/V’dI V0 0 a 1 -,, C 22 2t ? i2...aa a a I I I 1 a a a a U a fta a a a a a a a a a a a a a * a a a a a a a a a * a a a I a a a a ft a a a I * a a a a * a aa I* a I a a a ac~ a a a ft a...Ba J.Ja ’-ft a -. aB I a a fta a Oa a ~ afla ft a 0-aQa a ft * * a * ~ d aa OaeO B a* - a a SIa I ft a a ma a £ a a ~a 3 -di I a a saga a ft a a ~SJI

  4. Effects of the organophosphorus pesticide Folisuper 600 (methyl parathion on the heart function of bullfrog tadpoles, Lithobates catesbeianus (Shaw, 1802

    Directory of Open Access Journals (Sweden)

    M. J. Costa

    Full Text Available Abstract The aim of this work was to evaluate whether the heart function of bullfrog tadpoles (25 Gosner stage is affected by their acute exposure (48 h to a sub-lethal concentration (10 µg.L–1 of the active principle of the organophosphorus pesticide Folisuper 600R (methyl parathion - MP. Our results demonstrated that MP causes not only a reduction in tadpoles’ cardiac ventricular mass, resulting in a marked reduction in their cardiac twitch force, but also impairs their swimming performance, irrespective of increasing their heart rate. Together, these findings indicate that low and realistic concentration of MP have a negative impact on tadpoles’ performance, jeopardizing their survival.

  5. Final Environmental Assessment to Implement the Defense Base Closure and Realignment Commission Recommendations for Shaw Air Force Base, South Carolina

    Science.gov (United States)

    2007-07-01

    corresponding years. Year 2005 through 2009: VOCE = .016 * Trips NOxE = .015 * Trips PM10E = .0022 * Trips COE = .262 * Trips Year 2010 and beyond: VOCE ... VOCE * DPYII/2000 Nox (tons/yr) = NOxE * DPYII/2000 PM10(tons/yr) = PM10E * DPYII/2000 CO (tons/yr) = COE * DPYII/2000 Where: Commercial

  6. Use of feces to attract insects by a Glittering-bellied Emerald, Chlorostilbon lucidus (Shaw, 1812 (Apodiformes: Trochilidae

    Directory of Open Access Journals (Sweden)

    Fábio André Facco Jacomassa

    2014-09-01

    Full Text Available This study describes the occurrence of a female Glittering-bellied Emerald, Chlorostilbon lucidus, using feces to attract insects to the nesting site for predation. This is the first report of a hummingbird using feces to attract insects.

  7. Critique of An Analysis of the Blast Overpressure Study Data Comparing Three Exposure Criteria, by Murphy, Khan, and Shaw

    Science.gov (United States)

    2010-08-01

    actual determination of a risk threshold and (2) the article has laid the groundwork for such a determination. These statements misrepresent what...applied as a limit. This is a small point, but one that pervades the article and leads the authors to miss their main finding— namely, that an LAEQ8 of...WESTERN MICHIGAN UNIVERSITY G A FLAMME ASSOCIATE PROFESSOR DEPARTMENT OF SPEECH PATHOLOGY AND AUDIOLOGY 1903 W MICHIGAN AVE

  8. Phase III Prospective Randomized Comparison Trial of Depot Octreotide Plus Interferon Alfa-2b Versus Depot Octreotide Plus Bevacizumab in Patients With Advanced Carcinoid Tumors: SWOG S0518.

    Science.gov (United States)

    Yao, James C; Guthrie, Katherine A; Moran, Cesar; Strosberg, Jonathan R; Kulke, Matthew H; Chan, Jennifer A; LoConte, Noelle; McWilliams, Robert R; Wolin, Edward M; Mattar, Bassam; McDonough, Shannon; Chen, Helen; Blanke, Charles D; Hochster, Howard S

    2017-05-20

    Purpose Treatment options for neuroendocrine tumors (NETs) remain limited. This trial assessed the progression-free survival (PFS) of bevacizumab or interferon alfa-2b (IFN-α-2b) added to octreotide among patients with advanced NETs. Patients and Methods Southwest Oncology Group (SWOG) S0518, a phase III study conducted in a US cooperative group system, enrolled patients with advanced grades 1 and 2 NETs with progressive disease or other poor prognostic features. Patients were randomly assigned to treatment with octreotide LAR 20 mg every 21 days with either bevacizumab 15 mg/kg every 21 days or 5 million units of IFN-α-2b three times per week. The primary end point was centrally assessed PFS. This trial is registered with ClinicalTrials.gov as NCT00569127. Results A total of 427 patients was enrolled, of whom 214 were allocated to bevacizumab and 213 to IFN-α-2b. The median PFS by central review was 16.6 months (95% CI, 12.9 to 19.6 months) in the bevacizumab arm and was 15.4 months (95% CI, 9.6 to 18.6 months) in the IFN arm (hazard ratio [HR], 0.93; 95% CI, 0.73 to 1.18; P = .55). By site review, the median PFS times were 15.4 months (95% CI, 12.6 to 17.2 months) for bevacizumab and 10.6 months (95% CI, 8.5 to 14.4 months) for interferon (HR, 0.90; 95% CI, 0.72 to 1.12; P = .33). Time to treatment failure was longer with bevacizumab than with IFN (HR, 0.72; 95% CI, 0.58 to 0.89; P = .003). Confirmed radiologic response rates were 12% (95% CI, 8% to 18%) for bevacizumab and 4% (95% CI, 2% to 8%) for IFN. Common adverse events with bevacizumab and octreotide included hypertension (32%), proteinuria (9%), and fatigue (7%); with IFN and octreotide, they included fatigue (27%), neutropenia (12%), and nausea (6%). Conclusion No significant differences in PFS were observed between the bevacizumab and IFN arms, which suggests that these agents have similar antitumor activity among patients with advanced NETs.

  9. Final Environmental Assessment for Minuteman III Modification

    National Research Council Canada - National Science Library

    Huynh, Thomas; Kriz, Joseph; Lindman, Terry; Ramanujam, Ram

    2004-01-01

    .... The locations covered in this EA include: FE Warren Air Force Base (AFB), WY; Hill AFB, UT; Malmstrom AFB, MT; Minot AFB, ND; Vandenberg AFB, CA; and US Army Kwajalein Atoll, Republic of the Marshall Islands.

  10. Myrtle Beach AFB South Carolina. Revised Uniform Summary of Surface Weather Observations. Parts A-F

    Science.gov (United States)

    1975-07-03

    5 252--447 A-S ____ L53 !a7..9.. 42/ 41 .J . .4 * ~ ~ ~ -- 5198, 2,17066I 64881 __ __ 71____ 4j43637:~ :~:~ d ~______5132 15 64*2 Element (X’ z j x...1.I7 119o- 20i.21 .22123 24[25_262 2 29 30 3 D.6 W.B. tD ,, .1bIW,IBulb Dew Poin 70 ’, 1.J3 . . 1[Z . l l 1III , 2j2920 ’ -243 29-31---3 -Ja l -1s 𔄁-7

  11. Sewart AFB, Smyrna, Tennessee. Revised Uniform Summary of Surface Weather Observations (RUSSWO). Parts A-F

    Science.gov (United States)

    1967-07-10

    0 100.0 3.2 TOTAL NUMBER 0F OBSERVATIONS 2138 i i210 WS Uo o,4 0.8.5 (OL . 1) ,Rmvous tD ,5,o0 or ?His rO5 ARE OB0OLET ,0 0, all X;... • "N ,,I% t...2 TOTAL 2.8oL815-2-12.1 9.51 8*o? 6°4 3.21 2.1 e *2 .01 L53 11 6.2 I ____ Ele en (XI _ _X’ Elmn X°Z( _______x No. Obs Meon No ol Hours with

  12. Final Environmental Impact Statement, Peacekeeper in Minuteman Silos, F.E. Warren AFB, Wyoming. Volume 1.

    Science.gov (United States)

    1984-01-01

    Services and Facilities • .......... Uti I .ties. . % ? Energy Resources - - 0 Transportati on * 0) • ::::: ’:’::::’ ::::: Land Use - - :::~: i...RNs, 31 LPNs, 31 nurses aides, 3 pharmacists , 2 dieticians, 3 physical therapists, and 18 specialized technicians. The physician staff levels of

  13. Environmental Impact Analysis Process. Supplement to Final Environmental Impact Statement Space Shuttle Program, Vandenberg AFB, California

    Science.gov (United States)

    1983-07-01

    access roads to industrial parks and areas, public tourism facilities and vocational schools. Eligible applicants include states, cities, coun- ties...Fill tum f~rm tmkszc tUV&, stege pcopelintu, and supply pcopaL1ans to Smm aiattia whica at the mmo Pa. * Ibims - prape1int pumps, vapt boil-off

  14. Environmental Assessment: Replace Sanitary Sewer from Building 801 to Lagoons at Grand Forks AFB, North Dakota

    Science.gov (United States)

    2010-09-01

    emergent marsh (PEM) wetlands are characterized by erect, rooted , herbaceous hydrophytes, excluding mosses and lichens. This vegetation is present...species), chokecherry and wood rose (Rosa woodsii) are common in the under story in this area. Wood nettle (Laportea canadensis), stinging nettle ...minimized. In areas where excavation is not proposed but vegetation removal is necessary, vegetation should be cut at the ground level, leaving roots

  15. Final Environmental Assessment for Aerial Spraying for Invasive Species Control MacDill AFB, Florida

    Science.gov (United States)

    2007-09-01

    EYE PROTECTION: Chemical resistant gloves made of any waterproof material. Chemical goggles recommended. Shoes l!_lus socks. PRODUCT NAME...resistant coveralls, waterproof gloves, waterproof boots and face/eye protection. If dusting occurs, use NIOSH approved respirator protection. Initial...this product. Applicators and other handlers must wear: Long-sleeved shirt and long pants. Shoes plus socks. Follow manufacturer’s instructions for

  16. Justification for Closure for the Base Exchange Service Station (Site ST019), Randolph AFB, Texas

    National Research Council Canada - National Science Library

    1998-01-01

    .... In the summer of 1996, an abandoned aviation gasoline (AVGAS) line was severed during Base construction activities, resulting in the release of an unknown quantity of fuel to the subsurface (see Exhibit...

  17. Environmental Assessment, Construction of 315th Airlift Wing War Readiness Material Warehouse, Charleston AFB, South Carolina

    Science.gov (United States)

    2003-12-08

    INDOOR AND OUTDOOR NOISE SOURCES COMMON OUTDOOR NOISE LEVEL COMMON INDOOR NOISE LEVELS (dBA) NOISE LEVELS - ~ 110 Rock Band - r- 100 Gas Lawn Mower at...Shouting at 3 ft. Gas Lawn Mower at 100 ft. Vacuum Cleaner et 10ft. - ~ 70 Commercial Area Normal Speech at 3 ft. Heavy Traffic at 300 ft

  18. An Evaluation of the Limited Contract Warrant Experiment at March AFB.

    Science.gov (United States)

    1986-09-01

    than $1,000, and these account for only 4.5% of the total dollars expended (23). Statistics for the entire Air Force reflect a similar situation. In FY...sent with the workbook for the person administering the course.(2 1:1) The subjects covered in the coursebook are: Introduction to Defense Small...7 course as statistics are maintained by each of the 112 chapters separately. (56) There are some private consultants who provide training in this

  19. Installation Restoration Program. Phase 1. Records Search, Hazardous Materials Disposal Sites, Kirtland AFB, New Mexico

    Science.gov (United States)

    1981-11-01

    hikers, skiers and snowmobilers. 1960TH COMMUNICATIONS SQUADRON Mission: Provides operation and maintenance of common-user communications facilities for...public and private records, interviews with knowledgeable parties and site visits. G- 1 -- 1 a)0 o4 i.) U ~ -0 w0.u 4-I (0 00) 0 4J -4 ).$4d 4.) 4-4 0 04

  20. Chanute AFB, Rantoul, Illinois. Revised Uniform Summary of Surfae Weather Observations (RUSSWO). Parts A-F

    Science.gov (United States)

    1972-10-27

    ILLTNUS/RAN~fjUL -NV STATION STATION NAE YEARS MONTH PAGE 2 ALL....- -iOdR-5 (L. S. T.) Tcnmp WET BULB TEMPERATURE DEPRESSIO (F) TOTAL TOTAL (F) 0 -2 3...flC STATION S TIO NAME YAHS MONTH PAGE I O009-02O0 HOUR3 (L. S. T-p WET BULb TEMPERA’ URE DEPRESSIO . (F) ]- TOTAL TOTAL (F 1 0 -21 4T 5- 7 9. 10