WorldWideScience

Sample records for dependent gene regulation

  1. NF-1 Dependent Gene Regulation in Drosophila Melanogaster

    National Research Council Canada - National Science Library

    Zhong, Yi

    2004-01-01

    .... We have used an Affymetrix whole genome chip, containing all 13,500 genes of the fruit fly Drosophila, to identify 93 genes with altered expression patterns in flies that have no NF1 protein compared...

  2. NF-1 Dependent Gene Regulation in Drosophila Melanogaster

    Science.gov (United States)

    2004-04-01

    subclones used the Stratagene Chameleon kit with a pBSK-specific phosphorylated selection primer (50 pCCGCCACCGCGATGTAGCTCCAATTCGC 30) and mutation -specific...a P-element inserted in the first intron of the Nf1 gene. Both mutations abolish NF1 protein production (The et al., 1997). The k33 wild type...injections. The location of the six point mutations that were generated and successfully introduced into transgenic flies is diagrammed in Figure 1A

  3. Role of Hfq in iron-dependent and -independent gene regulation in Neisseria meningitidis.

    Science.gov (United States)

    Mellin, J R; McClure, Ryan; Lopez, Delia; Green, Olivia; Reinhard, Bjorn; Genco, Caroline

    2010-08-01

    In Neisseria meningitidis, iron-responsive gene regulation is mediated primarily by the ferric uptake regulator (Fur) protein. When complexed with iron, Fur represses gene expression by preventing transcription initiation. Fur can also indirectly activate gene expression via the repression of regulatory small RNAs (sRNA). One such Fur- and iron-regulated sRNA, NrrF, was previously identified in N. meningitidis and shown to repress expression of the sdhA and sdhC genes encoding subunits of the succinate dehydrogenase complex. In the majority of Gram-negative bacteria, sRNA-mediated regulation requires a cofactor RNA-binding protein (Hfq) for proper gene regulation and stabilization. In this study, we examined the role of Hfq in NrrF-mediated regulation of the succinate dehydrogenase genes in N. meningitidis and the effect of an hfq mutation on iron-responsive gene regulation more broadly. We first demonstrated that the stability of NrrF, as well as the regulation of sdhC and sdhA in vivo, was unaltered in the hfq mutant. Secondly, we established that iron-responsive gene regulation of the Fur-regulated sodB gene was dependent on Hfq. Finally, we demonstrated that in N. meningitidis, Hfq functions in a global manner to control expression of many ORFs and intergenic regions via iron-independent mechanisms. Collectively these studies demonstrate that in N. meningitidis, iron- and NrrF-mediated regulation of sdhC and sdhA can occur independently of Hfq, although Hfq functions more globally to control regulation of other N. meningitidis genes primarily by iron-independent mechanisms.

  4. Time-dependent regulation analysis dissects shifts between metabolic and gene-expression regulation during nitrogen starvation in baker's yeast

    NARCIS (Netherlands)

    van Eunen, Karen; Bouwman, Jildau; Lindenbergh, Alexander; Westerhoff, Hans V.; Bakker, Barbara M.

    2009-01-01

    Time-dependent regulation analysis is a new methodology that allows us to unravel, both quantitatively and dynamically, how and when functional changes in the cell are brought about by the interplay of gene expression and metabolism. In this first experimental implementation, we dissect the initial

  5. Regulation of RNA-dependent RNA polymerase 1 and isochorismate synthase gene expression in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Lydia J R Hunter

    Full Text Available RNA-dependent RNA polymerases (RDRs function in anti-viral silencing in Arabidopsis thaliana and other plants. Salicylic acid (SA, an important defensive signal, increases RDR1 gene expression, suggesting that RDR1 contributes to SA-induced virus resistance. In Nicotiana attenuata RDR1 also regulates plant-insect interactions and is induced by another important signal, jasmonic acid (JA. Despite its importance in defense RDR1 regulation has not been investigated in detail.In Arabidopsis, SA-induced RDR1 expression was dependent on 'NON-EXPRESSER OF PATHOGENESIS-RELATED GENES 1', indicating regulation involves the same mechanism controlling many other SA- defense-related genes, including pathogenesis-related 1 (PR1. Isochorismate synthase 1 (ICS1 is required for SA biosynthesis. In defensive signal transduction RDR1 lies downstream of ICS1. However, supplying exogenous SA to ics1-mutant plants did not induce RDR1 or PR1 expression to the same extent as seen in wild type plants. Analysing ICS1 gene expression using transgenic plants expressing ICS1 promoter:reporter gene (β-glucuronidase constructs and by measuring steady-state ICS1 transcript levels showed that SA positively regulates ICS1. In contrast, ICS2, which is expressed at lower levels than ICS1, is unaffected by SA. The wound-response hormone JA affects expression of Arabidopsis RDR1 but jasmonate-induced expression is independent of CORONATINE-INSENSITIVE 1, which conditions expression of many other JA-responsive genes. Transiently increased RDR1 expression following tobacco mosaic virus inoculation was due to wounding and was not a direct effect of infection. RDR1 gene expression was induced by ethylene and by abscisic acid (an important regulator of drought resistance. However, rdr1-mutant plants showed normal responses to drought.RDR1 is regulated by a much broader range of phytohormones than previously thought, indicating that it plays roles beyond those already suggested in virus

  6. Copper-dependent and -independent hypoxia-inducible factor-1 regulation of gene expression.

    Science.gov (United States)

    Zhang, Zhen; Qiu, Liying; Lin, Chen; Yang, Hong; Fu, Haiying; Li, Rui; Kang, Y James

    2014-10-01

    Hypoxia-inducible factor-1 (HIF-1) regulates the expression of the vascular endothelial growth factor (VEGF), a process requiring copper (Cu) participation. HIF-1 is also involved in the expression of more than a hundred of genes, but it is unknown how HIF-1 differentially controls the expression of these genes timely and spatially. The present study was undertaken to test the hypothesis that Cu is not required for the expression of all HIF-1-regulated genes, thus exploring mechanistic insights into the differential control of multiple gene expression by one transcription factor. Human umbilical vein endothelial cells (HUVECs) were treated with siRNA targeting HIF-1α to define the essential role of HIF-1 in the regulation of BCL2/adenovirus E1B 19 kDa protein-interacting protein 3 (BNIP3) and insulin-like growth factor 2 (IGF-2) expression. A Cu chelator, tetraethylenepentamine (TEPA), was used to reduce intracellular availability of Cu. In comparison, a zinc chelator, N,N,N',N'-tetrakis(2-pyridylmethyl) ethylenediamine (TPEN), was used to reduce intracellular zinc concentration. The expression of both BNIP3 and IGF-2 was completely suppressed in the HIF-1α deficient cells. The removal of Cu suppressed the expression of BNIP3, but did not affect that of IGF-2. The reduction of intracellular zinc did not cause the same effect. Further screening identified a group of genes whose expression required Cu and the others did not need Cu. The present study thus demonstrates Cu-dependent and -independent HIF-1 regulation of gene expression, indicating a mechanism for differential control of multiple gene expression by one transcription factor.

  7. Floral induction in tissue culture: a system for the analysis of LEAFY-dependent gene regulation.

    Science.gov (United States)

    Wagner, Doris; Wellmer, Frank; Dilks, Kieran; William, Dilusha; Smith, Michael R; Kumar, Prakash P; Riechmann, José Luis; Greenland, Andrew J; Meyerowitz, Elliot M

    2004-07-01

    We have developed a versatile floral induction system that is based on ectopic overexpression of the transcription factor LEAFY (LFY) in callus. During shoot regeneration, flowers or floral organs are formed directly from root explants without prior formation of rosette leaves. Morphological and reporter gene analyses show that leaf-like structures are converted to floral organs in response to LFY activity. Thus, increased levels of LFY activity are sufficient to bypass normal vegetative development and to direct formation of flowers in tissue culture. We found that about half of the cultured cells respond to inducible LFY activity with a rapid upregulation of the known direct target gene of LFY, APETALA1 (AP1). This dramatic increase in the number of LFY-responsive cells compared to whole plants suggested that the tissue culture system could greatly facilitate the analysis of LFY-dependent gene regulation by genomic approaches. To test this, we monitored the gene expression changes that occur in tissue culture after activation of LFY using a flower-specific cDNA microarray. Induction of known LFY target genes was readily detected in these experiments. In addition, several other genes were identified that had not been implicated in signaling downstream of LFY before. Thus, the floral induction system is suitable for the detection of low abundance transcripts whose expression is controlled in an LFY-dependent manner.

  8. Progesterone receptor-dependent regulation of genes in the oviducts of female mice.

    Science.gov (United States)

    Akison, Lisa K; Boden, Michael J; Kennaway, David J; Russell, Darryl L; Robker, Rebecca L

    2014-08-15

    Oviducts play a critical role in gamete and embryo transport, as well as supporting early embryo development. Progesterone receptor (PGR) is a transcription factor highly expressed in oviductal cells, while its activating ligand, progesterone, surges to peak levels as ovulation approaches. Progesterone is known to regulate oviduct cilia beating and muscular contractions in vitro, but how PGR may mediate this in vivo is poorly understood. We used PGR null mice to identify genes potentially regulated by PGR in the oviducts during the periovulatory period. Histologically, oviducts from PGR null mice showed no gross structural or morphological defects compared with normal littermates. However, microarray analysis of oviducts at 8 h posthuman chorionic gonadotropin revealed >1,000 PGR-dependent genes. Using reverse-transcription polymerase chain reaction (RT-PCR) we selected 10 genes for validation based on their potential roles in oocyte/embryo transport and support. Eight genes were confirmed to be downregulated (Adamts1, Itga8, Edn3, Prlr, Ptgfr, Des, Myocd, and Actg2) and one upregulated (Agtr2) in PGR null oviducts. Expression of these genes was also assessed in oviducts of naturally cycling mice during ovulation and day 1 and day 4 of pregnancy. Adamts1, Itga8, Edn3, Prlr, and Ptgfr were significantly upregulated in oviducts at ovulation/mating. However, most genes showed basal levels of expression at other times. The exceptions were Prlr and Ptgfr, which showed pulsatile increases on day 1 and/or day 4 of pregnancy. This is the first, comprehensive study to elucidate putative PGR-regulated genes in the oviduct and reveals key downstream targets potentially mediating oocyte and embryo transport. Copyright © 2014 the American Physiological Society.

  9. Introns regulate gene expression in Cryptococcus neoformans in a Pab2p dependent pathway.

    Directory of Open Access Journals (Sweden)

    Carolin Goebels

    Full Text Available Most Cryptococccus neoformans genes are interrupted by introns, and alternative splicing occurs very often. In this study, we examined the influence of introns on C. neoformans gene expression. For most tested genes, elimination of introns greatly reduces mRNA accumulation. Strikingly, the number and the position of introns modulate the gene expression level in a cumulative manner. A screen for mutant strains able to express functionally an intronless allele revealed that the nuclear poly(A binding protein Pab2 modulates intron-dependent regulation of gene expression in C. neoformans. PAB2 deletion partially restored accumulation of intronless mRNA. In addition, our results demonstrated that the essential nucleases Rrp44p and Xrn2p are implicated in the degradation of mRNA transcribed from an intronless allele in C. neoformans. Double mutant constructions and over-expression experiments suggested that Pab2p and Xrn2p could act in the same pathway whereas Rrp44p appears to act independently. Finally, deletion of the RRP6 or the CID14 gene, encoding the nuclear exosome nuclease and the TRAMP complex associated poly(A polymerase, respectively, has no effect on intronless allele expression.

  10. Introns Regulate Gene Expression in Cryptococcus neoformans in a Pab2p Dependent Pathway

    Science.gov (United States)

    Goebels, Carolin; Thonn, Aline; Gonzalez-Hilarion, Sara; Rolland, Olga; Moyrand, Frederique; Beilharz, Traude H.; Janbon, Guilhem

    2013-01-01

    Most Cryptococccus neoformans genes are interrupted by introns, and alternative splicing occurs very often. In this study, we examined the influence of introns on C. neoformans gene expression. For most tested genes, elimination of introns greatly reduces mRNA accumulation. Strikingly, the number and the position of introns modulate the gene expression level in a cumulative manner. A screen for mutant strains able to express functionally an intronless allele revealed that the nuclear poly(A) binding protein Pab2 modulates intron-dependent regulation of gene expression in C. neoformans. PAB2 deletion partially restored accumulation of intronless mRNA. In addition, our results demonstrated that the essential nucleases Rrp44p and Xrn2p are implicated in the degradation of mRNA transcribed from an intronless allele in C. neoformans. Double mutant constructions and over-expression experiments suggested that Pab2p and Xrn2p could act in the same pathway whereas Rrp44p appears to act independently. Finally, deletion of the RRP6 or the CID14 gene, encoding the nuclear exosome nuclease and the TRAMP complex associated poly(A) polymerase, respectively, has no effect on intronless allele expression. PMID:23966870

  11. Role of Dicer1-Dependent Factors in the Paracrine Regulation of Epididymal Gene Expression.

    Directory of Open Access Journals (Sweden)

    Olivia Jerczynski

    Full Text Available Dicer1 is an endoribonuclease involved in the biogenesis of functional molecules such as microRNAs (miRNAs and endogenous small interfering RNAs (endo-siRNAs. These small non-coding RNAs are important regulators of post-transcriptional gene expression and participate in the control of male fertility. With the knowledge that 1 Dicer1-dependent factors are required for proper sperm maturation in the epididymis, and that 2 miRNAs are potent mediators of intercellular communication in most biological systems, we investigated the role of Dicer1-dependent factors produced by the proximal epididymis (initial segment/caput- including miRNAs- on the regulation of epididymal gene expression in the distal epididymis regions (i.e. corpus and cauda. To this end, we performed comparative microarray and ANOVA analyses on control vs. Defb41iCre/wt;Dicer1fl/fl mice in which functional Dicer1 is absent from the principal cells of the proximal epididymis. We identified 35 and 33 transcripts that displayed significant expression level changes in the corpus and cauda regions (Fold change > 2 or 2 or < -2; p < 0.01. These miRNAs are secreted via extracellular vesicles (EVs derived from the DC2 epididymal principal cell line, and their expression correlates with target transcripts involved in distinct biological pathways, as evidenced by in silico analysis. Albeit correlative and based on in silico approach, our study proposes that Dicer1-dependent factors trigger- directly or not-significant genes expression changes in distinct regions of this organ. The paracrine control of functions important to post-testicular sperm maturation by Dicer1-dependent factors may open new avenues for the identification of molecular targets important to male fertility control.

  12. HES1 Is a Master Regulator of Glucocorticoid Receptor-Dependent Gene Expression

    Science.gov (United States)

    Revollo, Javier R.; Oakley, Robert H.; Lu, Nick Z.; Kadmiel, Mahita; Gandhavadi, Maheer; Cidlowski, John A.

    2014-01-01

    Hairy and enhancer of split-1 (HES1) is a basic helix-loop-helix transcription factor that is a key regulator of development and organogenesis. However, little is known about the role of HES1 after birth. Glucocorticoids, primary stress hormones that are essential for life, regulate numerous homeostatic processes that permit vertebrates to cope with physiological challenges. The molecular actions of glucocorticoids are mediated by glucocorticoid receptor-dependent regulation of nearly 25% of the genome. We now establish a genome wide molecular link between HES1 and glucocorticoid receptors that controls the ability of cells and animals to respond to stress. Glucocorticoid signaling rapidly and robustly silenced HES1 expression. This glucocorticoid-dependent repression of HES1 was necessary for the glucocorticoid receptor to regulate many of its target genes. Mice with conditional knockout of HES1 in the liver exhibited an expanded glucocorticoid receptor signaling profile and aberrant metabolic phenotype. Our results indicate that HES1 acts as a master repressor, the silencing of which is required for proper glucocorticoid signaling. PMID:24300895

  13. Promoter architecture and transcriptional regulation of Abf1-dependent ribosomal protein genes in Saccharomyces cerevisiae.

    Science.gov (United States)

    Fermi, Beatrice; Bosio, Maria Cristina; Dieci, Giorgio

    2016-07-27

    In Saccharomyces cerevisiae, ribosomal protein gene (RPG) promoters display binding sites for either Rap1 or Abf1 transcription factors. Unlike Rap1-associated promoters, the small cohort of Abf1-dependent RPGs (Abf1-RPGs) has not been extensively investigated. We show that RPL3, RPL4B, RPP1A, RPS22B and RPS28A/B share a common promoter architecture, with an Abf1 site upstream of a conserved element matching the sequence recognized by Fhl1, a transcription factor which together with Ifh1 orchestrates Rap1-associated RPG regulation. Abf1 and Fhl1 promoter association was confirmed by ChIP and/or gel retardation assays. Mutational analysis revealed a more severe requirement of Abf1 than Fhl1 binding sites for RPG transcription. In the case of RPS22B an unusual Tbf1 binding site promoted both RPS22B and intron-hosted SNR44 expression. Abf1-RPG down-regulation upon TOR pathway inhibition was much attenuated at defective mutant promoters unable to bind Abf1. TORC1 inactivation caused the expected reduction of Ifh1 occupancy at RPS22B and RPL3 promoters, but unexpectedly it entailed largely increased Abf1 association with Abf1-RPG promoters. We present evidence that Abf1 recruitment upon nutritional stress, also observed for representative ribosome biogenesis genes, favours RPG transcriptional rescue upon nutrient replenishment, thus pointing to nutrient-regulated Abf1 dynamics at promoters as a novel mechanism in ribosome biogenesis control. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. CREB-dependent gene regulation by prion protein: impact on MMP-9 and beta-dystroglycan.

    Science.gov (United States)

    Pradines, Elodie; Loubet, Damien; Schneider, Benoît; Launay, Jean-Marie; Kellermann, Odile; Mouillet-Richard, Sophie

    2008-11-01

    Corruption of the normal function of the cellular prion protein (PrP(C)) by the scrapie isoform (PrP(Sc)) emerges as a critical causal event in Transmissible Spongiform Encaphalopathies (TSE) pathogenesis. However, PrP(C) physiological role remains unclear. By exploiting the properties of the 1C11 neuroectodermal cell line, able to convert into 1C11(5-HT) serotonergic or 1C11(NE) noradrenergic neuronal cells, we assigned a signaling function to PrP(C). Here, we establish that antibody-mediated PrP(C) ligation promotes the recruitment of the cAMP responsive element binding protein (CREB) transcription factor downstream from the MAPK ERK1/2, in 1C11 precursor cells and their 1C11(5-HT) and 1C11(NE) neuronal progenies. Whatever the differentiation state of 1C11 cells, the PrP(C)-dependent CREB activation triggers Egr-1 and c-fos transcription, two immediate early genes that relay CREB's role in cell survival and proliferation as well as in neuronal plasticity. Furthermore, in 1C11-derived neuronal cells, we draw a link between the PrP(C)-CREB coupling and a transcriptional regulation of the metalloproteinase MMP-9 and its inhibitor TIMP-1, which play pivotal roles in neuronal pathophysiology. Finally, the PrP(C)-dependent control on MMP-9 impacts on the processing of the transmembrane protein, beta-dystroglycan. Taken together, our data define molecular mechanisms that likely mirror PrP(C) ubiquitous contribution to cytoprotection and its involvement in neuronal plasticity.

  15. Dose-dependent regulation of target gene expression and cell proliferation by c-Myc levels

    OpenAIRE

    Schuhmacher, Marino; Eick, Dirk

    2013-01-01

    The proto-oncogene c-myc encodes a basic helix-loop-helix leucine zipper transcription factor (c-Myc). c-Myc plays a crucial role in cell growth and proliferation. Here, we examined how expression of c-Myc target genes and cell proliferation depend on variation of c-Myc protein levels. We show that proliferation rates, the number of cells in S-phase, and cell size increased in a dose-dependent manner in response to increasing c-Myc levels. Likewise, the mRNA levels of c-Myc responsive genes s...

  16. The central role of CDE/CHR promoter elements in the regulation of cell cycle-dependent gene transcription.

    Science.gov (United States)

    Müller, Gerd A; Engeland, Kurt

    2010-02-01

    The cell cycle-dependent element (CDE) and the cell cycle genes homology region (CHR) control the transcription of genes with maximum expression in G(2) phase and in mitosis. Promoters of these genes are repressed by proteins binding to CDE/CHR elements in G(0) and G(1) phases. Relief from repression begins in S phase and continues into G(2) phase and mitosis. Generally, CDE sites are located four nucleotides upstream of CHR elements in TATA-less promoters of genes such as Cdc25C, Cdc2 and cyclin A. However, expression of some other genes, such as human cyclin B1 and cyclin B2, has been shown to be controlled only by a CHR lacking a functional CDE. To date, it is not fully understood which proteins bind to and control CDE/CHR-containing promoters. Recently, components of the DREAM complex were shown to be involved in CDE/CHR-dependent transcriptional regulation. In addition, the expression of genes regulated by CDE/CHR elements is mostly achieved through CCAAT-boxes, which bind heterotrimeric NF-Y proteins as well as the histone acetyltransferase p300. Importantly, many CDE/CHR promoters are downregulated by the tumor suppressor p53. In this review, we define criteria for CDE/CHR-regulated promoters and propose to distinguish two classes of CDE/CHR-regulated genes. The regulation through transcription factors potentially binding to the CDE/CHR is discussed, and recently discovered links to central pathways regulated by E2F, the pRB family and p53 are highlighted.

  17. Different promoter affinities account for specificity in MYC-dependent gene regulation

    Science.gov (United States)

    Lorenzin, Francesca; Benary, Uwe; Baluapuri, Apoorva; Walz, Susanne; Jung, Lisa Anna; von Eyss, Björn; Kisker, Caroline; Wolf, Jana; Eilers, Martin; Wolf, Elmar

    2016-01-01

    Enhanced expression of the MYC transcription factor is observed in the majority of tumors. Two seemingly conflicting models have been proposed for its function: one proposes that MYC enhances expression of all genes, while the other model suggests gene-specific regulation. Here, we have explored the hypothesis that specific gene expression profiles arise since promoters differ in affinity for MYC and high-affinity promoters are fully occupied by physiological levels of MYC. We determined cellular MYC levels and used RNA- and ChIP-sequencing to correlate promoter occupancy with gene expression at different concentrations of MYC. Mathematical modeling showed that binding affinities for interactions of MYC with DNA and with core promoter-bound factors, such as WDR5, are sufficient to explain promoter occupancies observed in vivo. Importantly, promoter affinity stratifies different biological processes that are regulated by MYC, explaining why tumor-specific MYC levels induce specific gene expression programs and alter defined biological properties of cells. DOI: http://dx.doi.org/10.7554/eLife.15161.001 PMID:27460974

  18. Models of Aire-Dependent Gene Regulation for Thymic Negative Selection

    OpenAIRE

    Danso-Abeam, Dina; Humblet-Baron, Stephanie; Dooley, James; Liston, Adrian

    2011-01-01

    Mutations in the autoimmune regulator (AIRE) gene lead to autoimmune polyendocrinopathy syndrome type 1 (APS1), characterized by the development of multi-organ autoimmune damage. The mechanism by which defects in AIRE result in autoimmunity has been the subject of intense scrutiny. At the cellular level, the working model explains most of the clinical and immunological characteristics of APS1, with AIRE driving the expression of tissue-restricted antigens (TRAs) in the epithelial cells of the...

  19. Models of Aire-dependent gene regulation for thymic negative selection

    Directory of Open Access Journals (Sweden)

    Dina eDanso-Abeam

    2011-05-01

    Full Text Available Mutations in the Autoimmune Regulator (AIRE gene lead to Autoimmune Polyendocrinopathy Syndrome type 1 (APS1, characterized by the development of multi-organ autoimmune damage. The mechanism by which defects in AIRE result in autoimmunity has been the subject of intense scrutiny. At the cellular level, the working model explains most of the clinical and immunological characteristics of APS1, with AIRE driving the expression of tissue restricted antigens (TRAs in the epithelial cells of the thymic medulla. This TRA expression results in effective negative selection of TRA-reactive thymocytes, preventing autoimmune disease. At the molecular level, the mechanism by which AIRE initiates TRA expression in the thymic medulla remains unclear. Multiple different models for the molecular mechanism have been proposed, ranging from classical transcriptional activity, to random induction of gene expression, to epigenetic tag recognition effect, to altered cell biology. In this review, we evaluate each of these models and discuss their relative strengths and weaknesses.

  20. Nidogen-1 regulates laminin-1-dependent mammary-specific gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Pujuguet, Philippe; Simian, Marina; Liaw, Jane; Timpl, Rupert; Werb, Zena; Bissell, Mina J..

    2000-02-01

    Nidogen-1 (entactin) acts as a bridge between the extracellular matrix molecules laminin-1 and type IV collagen, and thus participates in the assembly of basement membranes. To investigate the role of nidogen-1 in regulating cell-type-specific gene expression in mammary epithelium, we designed a culture microecosystem in which each component, including epithelial cells, mesenchymal cells, lactogenic hormones and extracellular matrix, could be controlled. We found that primary and established mesenchymal and myoepithelial cells synthesized and secreted nidogen-1, whereas expression was absent in primary and established epithelial cells. In an epithelial cell line containing mesenchymal cells, nidogen-1 was produced by the mesenchymal cells but deposited between the epithelial cells. In this mixed culture, mammary epithelial cells express b-casein in the presence of lactogenic hormones. Addition of either laminin-1 plus nidogen-1, or laminin-1 alone to mammary epithelial cells induced b- casein production. We asked whether recombinant nidogen-1 alone could signal directly for b-casein. Nidogen-1 did not induce b-casein synthesis in epithelial cells, but it augmented the inductive capacity of laminin-1. These data suggest that nidogen-1 can cooperate with laminin-1 to regulate b-casein expression. Addition of full length nidogen-1 to the mixed cultures had no effect on b-casein gene expression; however, a nidogen-1 fragment containing the laminin-1 binding domain, but lacking the type IV collagen-binding domain, had a dominant negative effect on b-casein expression. These data point to a physiological role for nidogen-1 in the basement membrane-induced gene expression by epithelial cells.

  1. RNA-seq transcriptional profiling of Leishmania amazonensis reveals an arginase-dependent gene expression regulation.

    Directory of Open Access Journals (Sweden)

    Juliana Ide Aoki

    2017-10-01

    Full Text Available Leishmania is a protozoan parasite that alternates its life cycle between the sand-fly vector and the mammalian host. This alternation involves environmental changes and leads the parasite to dynamic modifications in morphology, metabolism, cellular signaling and regulation of gene expression to allow for a rapid adaptation to new conditions. The L-arginine pathway in L. amazonensis is important during the parasite life cycle and interferes in the establishment and maintenance of the infection in mammalian macrophages. Host arginase is an immune-regulatory enzyme that can reduce the production of nitric oxide by activated macrophages, directing the availability of L-arginine to the polyamine pathway, resulting in parasite replication. In this work, we performed transcriptional profiling to identify differentially expressed genes in L. amazonensis wild-type (La-WT versus L. amazonensis arginase knockout (La-arg- promastigotes and axenic amastigotes.A total of 8253 transcripts were identified in La-WT and La-arg- promastigotes and axenic amastigotes, about 60% of them codifying hypothetical proteins and 443 novel transcripts, which did not match any previously annotated genes. Our RNA-seq data revealed that 85% of genes were constitutively expressed. The comparison of transcriptome and metabolome data showed lower levels of arginase and higher levels of glutamate-5-kinase in La-WT axenic amastigotes compared to promastigotes. The absence of arginase activity in promastigotes increased the levels of pyrroline 5-carboxylate reductase, but decreased the levels of arginosuccinate synthase, pyrroline 5-carboxylate dehydrogenase, acetylornithine deacetylase and spermidine synthase transcripts levels. These observations can explain previous metabolomic data pointing to the increase of L-arginine, citrulline and L-glutamate and reduction of aspartate, proline, ornithine and putrescine. Altogether, these results indicate that arginase activity is important

  2. GATA-dependent regulation of TPO-induced c-mpl gene expression during megakaryopoiesis.

    Science.gov (United States)

    Sunohara, Masataka; Morikawa, Shigeru; Fuse, Akira; Sato, Iwao

    2014-01-01

    Thrombopoietin (TPO) and its receptor, c-Mpl, play the crucial role during megakaryocytopoiesis. Previously, we have shown that the promoter activity of c-mpl induced by TPO is modulated by transcription through a PKC-dependent pathway and that GATA(-77) is involved as a positive regulatory element in TPO-induced c-mpl gene expression in the megakaryoblastic CMK cells. In this research, to examine participating possibility of GATA promoter element in TPO- induced c-mpl gene expression through a PKC-independent pathway, the promoter activity of site-directed mutagenesis and the effect of potein kinase C modulator were measured by a transient transfection assay system. Together with our previous results on the TPO-induced c-mpl promoter, this study indicates destruction of -77GATA in c-mpl promoter decreased the activity by 47.3% under existence of GF109203. These results suggest that GATA promoter element plays significant role in TPO-induced c-mpl gene expression through a PKC-independent pathway.

  3. PITX2-dependent gene regulation in atrial fibrillation and rhythm control.

    Science.gov (United States)

    Syeda, Fahima; Kirchhof, Paulus; Fabritz, Larissa

    2017-06-15

    Atrial fibrillation (AF) is a common arrhythmia. Better prevention and treatment of AF are needed to reduce AF-associated morbidity and mortality. There are several major mechanisms that cause AF in patients, including a genetic predisposition to develop AF. Genome-wide association studies have identified genetic variants associated with AF populations, with the strongest hits clustering on chromosome 4q25, close to the gene for the homeobox transcription factor PITX2. The effect of these common gene variants on cardiac PITX2 mRNA is currently under study. PITX2 protein regulates right-left differentiation of the embryonic heart, thorax and aorta. PITX2 is expressed in the adult left atrium, but much less so in other heart chambers. Pitx2 deficiency results in electrical and structural remodelling, and impaired repair of the heart in murine models, all of which may influence AF through divergent mechanisms. PITX2 levels and single nucleotide polymorphisms on chromosome 4q25 may also be a predictor of the effectiveness of anti-arrhythmic drug therapy. © 2017 The Authors. The Journal of Physiology published by John Wiley & Sons Ltd on behalf of The Physiological Society.

  4. PITX2‐dependent gene regulation in atrial fibrillation and rhythm control

    Science.gov (United States)

    Syeda, Fahima; Kirchhof, Paulus

    2017-01-01

    Abstract Atrial fibrillation (AF) is a common arrhythmia. Better prevention and treatment of AF are needed to reduce AF‐associated morbidity and mortality. There are several major mechanisms that cause AF in patients, including a genetic predisposition to develop AF. Genome‐wide association studies have identified genetic variants associated with AF populations, with the strongest hits clustering on chromosome 4q25, close to the gene for the homeobox transcription factor PITX2. The effect of these common gene variants on cardiac PITX2 mRNA is currently under study. PITX2 protein regulates right–left differentiation of the embryonic heart, thorax and aorta. PITX2 is expressed in the adult left atrium, but much less so in other heart chambers. Pitx2 deficiency results in electrical and structural remodelling, and impaired repair of the heart in murine models, all of which may influence AF through divergent mechanisms. PITX2 levels and single nucleotide polymorphisms on chromosome 4q25 may also be a predictor of the effectiveness of anti‐arrhythmic drug therapy. PMID:28217939

  5. Response and binding elements for ligand-dependent positive transcription factors integrate positive and negative regulation of gene expression

    International Nuclear Information System (INIS)

    Rosenfeld, M.G.; Glass, C.K.; Adler, S.; Crenshaw, E.B. III; He, X.; Lira, S.A.; Elsholtz, H.P.; Mangalam, H.J.; Holloway, J.M.; Nelson, C.; Albert, V.R.; Ingraham, H.A.

    1988-01-01

    Accurate, regulated initiation of mRNA transcription by RNA polymerase II is dependent on the actions of a variety of positive and negative trans-acting factors that bind cis-acting promoter and enhancer elements. These transcription factors may exert their actions in a tissue-specific manner or function under control of plasma membrane or intracellular ligand-dependent receptors. A major goal in the authors' laboratory has been to identify the molecular mechanisms responsible for the serial activation of hormone-encoding genes in the pituitary during development and the positive and negative regulation of their transcription. The anterior pituitary gland contains phenotypically distinct cell types, each of which expresses unique trophic hormones: adrenocorticotropic hormone, thyroid-stimulating hormone, prolactin, growth hormone, and follicle-stimulating hormone/luteinizing hormone. The structurally related prolactin and growth hormone genes are expressed in lactotrophs and somatotrophs, respectively, with their expression virtually limited to the pituitary gland. The reported transient coexpression of these two structurally related neuroendocrine genes raises the possibility that the prolactin and growth hormone genes are developmentally controlled by a common factor(s)

  6. Ethylene regulates Apple (Malus x domestica) fruit softening through a dose x time-dependent mechanism and through differential sensitivities and dependencies of cell wall-modifying genes.

    Science.gov (United States)

    Ireland, Hilary S; Gunaseelan, Kularajathevan; Muddumage, Ratnasiri; Tacken, Emma J; Putterill, Jo; Johnston, Jason W; Schaffer, Robert J

    2014-05-01

    In fleshy fruit species that have a strong requirement for ethylene to ripen, ethylene is synthesized autocatalytically, producing increasing concentrations as the fruits ripen. Apple fruit with the ACC OXIDASE 1 (ACO1) gene suppressed cannot produce ethylene autocatalytically at ripening. Using these apple lines, an ethylene sensitivity dependency model was previously proposed, with traits such as softening showing a high dependency for ethylene as well as low sensitivity. In this study, it is shown that the molecular control of fruit softening is a complex process, with different cell wall-related genes being independently regulated and exhibiting differential sensitivities to and dependencies on ethylene at the transcriptional level. This regulation is controlled through a dose × time mechanism, which results in a temporal transcriptional response that would allow for progressive cell wall disassembly and thus softening. This research builds on the sensitivity dependency model and shows that ethylene-dependent traits can progress over time to the same degree with lower levels of ethylene. This suggests that a developmental clock measuring cumulative ethylene controls the fruit ripening process.

  7. Oxidant-NO dependent gene regulation in dogs with type I diabetes: impact on cardiac function and metabolism

    Directory of Open Access Journals (Sweden)

    Ojaimi Caroline

    2010-08-01

    Full Text Available Abstract Background The mechanisms responsible for the cardiovascular mortality in type I diabetes (DM have not been defined completely. We have shown in conscious dogs with DM that: 1 baseline coronary blood flow (CBF was significantly decreased, 2 endothelium-dependent (ACh coronary vasodilation was impaired, and 3 reflex cholinergic NO-dependent coronary vasodilation was selectively depressed. The most likely mechanism responsible for the depressed reflex cholinergic NO-dependent coronary vasodilation was the decreased bioactivity of NO from the vascular endothelium. The goal of this study was to investigate changes in cardiac gene expression in a canine model of alloxan-induced type 1 diabetes. Methods Mongrel dogs were chronically instrumented and the dogs were divided into two groups: one normal and the other diabetic. In the diabetic group, the dogs were injected with alloxan monohydrate (40-60 mg/kg iv over 1 min. The global changes in cardiac gene expression in dogs with alloxan-induced diabetes were studied using Affymetrix Canine Array. Cardiac RNA was extracted from the control and DM (n = 4. Results The array data revealed that 797 genes were differentially expressed (P 2+ cycling genes (ryanodine receptor; SERCA2 Calcium ATPase, structural proteins (actin alpha. Of particular interests are genes involved in glutathione metabolism (glutathione peroxidase 1, glutathione reductase and glutathione S-transferase, which were markedly down regulated. Conclusion our findings suggest that type I diabetes might have a direct effect on the heart by impairing NO bioavailability through oxidative stress and perhaps lipid peroxidases.

  8. Genistein: a novel anthocyanin synthesis promoter that directly regulates biosynthetic genes in red cabbage in a light-dependent way

    Directory of Open Access Journals (Sweden)

    Na Zhang

    2016-12-01

    Full Text Available Genistein (GNT, an isoflavone, is used in the clinical treatment of various health disorders. GNT is found in primary food source plants and some medical plants. However, studies on the functions of GNT in plants are rarely reported. In this study, we demonstrated that GNT plays an important role in promoting anthocyanin accumulation in red cabbage. GNT solutions (10, 20, 30, 40, and 50 mg/L as foliar fertilizers were applied to red cabbage. Consequently, anthocyanin accumulation in red cabbage increased in a light-dependent manner. GNT solution at 30 mg/L exhibited the optimal effect on anthocyanin accumulation, which was twice that of the control. Quantitative real-time PCR analysis indicated that GNT application upregulated the expression of all structural genes, contributing to anthocyanin biosynthesis under light conditions. Under dark conditions, GNT exerted no significant promotive effect on anthocyanin accumulation; only early biosynthetic genes of anthocyanin biosynthesis responded to GNT. The promotive effect of GNT on anthocyanin biosynthesis is directly attributable to the regulation of structural gene expression. Transcription factors exhibited no response to GNT. The levels of anthocyanin in red cabbage positively correlated with the enzyme activities of antioxidant systems. This finding correlation suggested that the promotive effect of GNT on anthocyanin levels was correlated with improved antioxidant activity in the red cabbage.

  9. Regulation of gene expression by 17β-estradiol in the arcuate nucleus of the mouse through ERE-dependent and ERE-independent mechanisms.

    Science.gov (United States)

    Yang, Jennifer A; Mamounis, Kyle J; Yasrebi, Ali; Roepke, Troy A

    2016-03-01

    17β-Estradiol (E2) modulates gene expression in the hypothalamic arcuate nucleus (ARC) to control homeostatic functions. In the ARC, estrogen receptor (ER) α is highly expressed and is an important contributor to E2's actions, controlling gene expression through estrogen response element (ERE)-dependent and -independent mechanisms. The objective of this study was to determine if known E2-regulated genes are regulated through these mechanisms. The selected genes have been shown to regulate homeostasis and have been separated into three subsections: channels, receptors, and neuropeptides. To determine if ERE-dependent or ERE-independent mechanisms regulate gene expression, two transgenic mouse models, an ERα knock-out (ERKO) and an ERα knock-in/knock-out (KIKO), which lacks a functional ERE binding domain, were used in addition to their wild-type littermates. Females of all genotypes were ovariectomized and injected with oil or estradiol benzoate (E2B). Our results suggest that E2B regulates multiple genes through these mechanisms. Of note, Cacna1g and Kcnmb1 channel expression was increased by E2B in WT females only, suggesting an ERE-dependent regulation. Furthermore, the NKB receptor, Tac3r, was suppressed by E2B in WT and KIKO females but not ERKO females, suggesting that ERα-dependent, ERE-independent signaling is necessary for Tac3r regulation. The adrenergic receptor Adra1b was suppressed by E2B in all genotypes indicating that ERα is not the primary receptor for E2B's actions. The neuropeptide Tac2 was suppressed by E2B through ERE-dependent mechanisms. These results indicate that E2B activates both ERα-dependent and independent signaling in the ARC through ERE-dependent and ERE-independent mechanisms to control gene expression. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Variation in regulator of G-protein signaling 17 gene (RGS17 is associated with multiple substance dependence diagnoses

    Directory of Open Access Journals (Sweden)

    Zhang Huiping

    2012-05-01

    Full Text Available Abstract Background RGS17 and RGS20 encode two members of the regulator of G-protein signaling RGS-Rz subfamily. Variation in these genes may alter their transcription and thereby influence the function of G protein-coupled receptors, including opioid receptors, and modify risk for substance dependence. Methods The association of 13 RGS17 and eight RGS20 tag single nucleotide polymorphisms (SNPs was examined with four substance dependence diagnoses (alcohol (AD, cocaine (CD, opioid (OD or marijuana (MjD] in 1,905 African Americans (AAs: 1,562 cases and 343 controls and 1,332 European Americans (EAs: 981 cases and 351 controls. Analyses were performed using both χ2 tests and logistic regression analyses that covaried sex, age, and ancestry proportion. Correlation of genotypes and mRNA expression levels was assessed by linear regression analyses. Results Seven RGS17 SNPs showed a significant association with at least one of the four dependence traits after a permutation-based correction for multiple testing (0.003≤Pempirical≤0.037. The G allele of SNP rs596359, in the RGS17 promoter region, was associated with AD, CD, OD, or MjD in both populations (0.005≤Pempirical≤0.019. This allele was also associated with significantly lower mRNA expression levels of RGS17 in YRI subjects (P = 0.002 and non-significantly lower mRNA expression levels of RGS17 in CEU subjects (P = 0.185. No RGS20 SNPs were associated with any of the four dependence traits in either population. Conclusions This study demonstrated that variation in RGS17 was associated with risk for substance dependence diagnoses in both AA and EA populations.

  11. Identification of Y-box binding protein 1 as a core regulator of MEK/ERK pathway-dependent gene signatures in colorectal cancer cells.

    Directory of Open Access Journals (Sweden)

    Karsten Jürchott

    2010-12-01

    Full Text Available Transcriptional signatures are an indispensible source of correlative information on disease-related molecular alterations on a genome-wide level. Numerous candidate genes involved in disease and in factors of predictive, as well as of prognostic, value have been deduced from such molecular portraits, e.g. in cancer. However, mechanistic insights into the regulatory principles governing global transcriptional changes are lagging behind extensive compilations of deregulated genes. To identify regulators of transcriptome alterations, we used an integrated approach combining transcriptional profiling of colorectal cancer cell lines treated with inhibitors targeting the receptor tyrosine kinase (RTK/RAS/mitogen-activated protein kinase pathway, computational prediction of regulatory elements in promoters of co-regulated genes, chromatin-based and functional cellular assays. We identified commonly co-regulated, proliferation-associated target genes that respond to the MAPK pathway. We recognized E2F and NFY transcription factor binding sites as prevalent motifs in those pathway-responsive genes and confirmed the predicted regulatory role of Y-box binding protein 1 (YBX1 by reporter gene, gel shift, and chromatin immunoprecipitation assays. We also validated the MAPK-dependent gene signature in colorectal cancers and provided evidence for the association of YBX1 with poor prognosis in colorectal cancer patients. This suggests that MEK/ERK-dependent, YBX1-regulated target genes are involved in executing malignant properties.

  12. VEGF-A isoforms differentially regulate ATF-2-dependent VCAM-1 gene expression and endothelial-leukocyte interactions.

    Science.gov (United States)

    Fearnley, Gareth W; Odell, Adam F; Latham, Antony M; Mughal, Nadeem A; Bruns, Alexander F; Burgoyne, Nicholas J; Homer-Vanniasinkam, Shervanthi; Zachary, Ian C; Hollstein, Monica C; Wheatcroft, Stephen B; Ponnambalam, Sreenivasan

    2014-08-15

    Vascular endothelial growth factor A (VEGF-A) regulates many aspects of vascular physiology. VEGF-A stimulates signal transduction pathways that modulate endothelial outputs such as cell migration, proliferation, tubulogenesis, and cell-cell interactions. Multiple VEGF-A isoforms exist, but the biological significance of this is unclear. Here we analyzed VEGF-A isoform-specific stimulation of VCAM-1 gene expression, which controls endothelial-leukocyte interactions, and show that this is dependent on both ERK1/2 and activating transcription factor-2 (ATF-2). VEGF-A isoforms showed differential ERK1/2 and p38 MAPK phosphorylation kinetics. A key feature of VEGF-A isoform-specific ERK1/2 activation and nuclear translocation was increased phosphorylation of ATF-2 on threonine residue 71 (T71). Using reverse genetics, we showed ATF-2 to be functionally required for VEGF-A-stimulated endothelial VCAM-1 gene expression. ATF-2 knockdown blocked VEGF-A-stimulated VCAM-1 expression and endothelial-leukocyte interactions. ATF-2 was also required for other endothelial cell outputs, such as cell migration and tubulogenesis. In contrast, VCAM-1 was essential only for promoting endothelial-leukocyte interactions. This work presents a new paradigm for understanding how soluble growth factor isoforms program complex cellular outputs and responses by modulating signal transduction pathways. © 2014 Fearnley et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  13. Pitx2-dependent occupancy by histone deacetylases is associated with T-box gene regulation in mammalian abdominal tissue.

    Science.gov (United States)

    Hilton, Traci; Gross, Michael K; Kioussi, Chrissa

    2010-04-09

    The homeodomain transcription factor Pitx2 and the T-box transcription factors are essential for organogenesis. Pitx2 and T-box genes are induced by growth factors and function as transcriptional activators or repressors. Gene expression analyses on abdominal tissue were used to identify seven of the T-box genes of the genome as Pitx2 target genes in the abdomen at embryonic day.10.5. Pitx2 activated Tbx4, Tbx15, and Mga and repressed Tbx1, Tbx2, Tbx5, and Tbx6 expression. As expected, activated genes showed reduced expression patterns, and repressed T-box genes showed increased expression patterns in the abdomen of Pitx2 mutants. Pitx2 occupied chromatin sites near all of these T-box genes. Co-occupancy by coactivators, corepressors, and histone acetylation at these sites was frequently Pitx2-dependent. Genes repressed by Pitx2 generally showed increased histone acetylation and decreased histone deacetylase (HDAC)/corepressor occupancy in Pitx2 mutants. The lower N-CoR, HDAC1, and HDAC3 occupancy observed at multiple sites along Tbx1 chromatin in mutants is consistent with the model that increased histone acetylation and gene expression of Tbx1 may result from a loss of recruitment of corepressors by Pitx2. Genes activated by Pitx2 showed less consistent patterns in chromatin analyses. Reduced H4 acetylation and increased HDAC1/nuclear receptor corepressor (N-CoR) occupancy at some Tbx4 sites were accompanied by increased H3 acetylation and reduced HDAC3 occupancy at the same or other more distal chromatin sites in mutants. Pitx2-dependent occupancy by corepressors resulted in alteration of the acetylation levels of several T-box genes, whereas Pitx2-dependent occupancy by coactivators was more site-localized. These studies will provide the basic scientific underpinning to understand abdominal wall syndromes.

  14. CRAC channels drive digital activation and provide analog control and synergy to Ca(2+)-dependent gene regulation.

    Science.gov (United States)

    Kar, Pulak; Nelson, Charmaine; Parekh, Anant B

    2012-02-07

    Ca(2+)-dependent gene expression is critical for cell growth, proliferation, plasticity, and adaptation [1-3]. Because a common mechanism in vertebrates linking cytoplasmic Ca(2+) signals with activation of protein synthesis involves the nuclear factor of activated T cells (NFAT) family of transcription factors [4, 5], we have quantified protein expression in single cells following physiological Ca(2+) signals by using NFAT-driven expression of a genetically encoded fluorescent protein. We find that gene expression following CRAC channel activation is an all-or-nothing event over a range of stimulus intensities. Increasing agonist concentration recruits more cells but each responding cell does so in an essentially digital manner. Furthermore, Ca(2+)-dependent gene expression shows both short-term memory and strong synergy, where two pulses of agonist, which are ineffectual individually, robustly activate gene expression provided that the time interval between them is short. Such temporal filtering imparts coincidence detection to Ca(2+)-dependent gene activation. The underlying molecular basis mapped to time-dependent, nonlinear accumulation of nuclear NFAT. Local Ca(2+) near CRAC channels has to rise above a threshold level to drive gene expression, providing analog control to the digital activation process and a means to filter out fluctuations in background noise from activating transcription while ensuring robustness and high fidelity in the excitation-transcription coupling mechanism. Copyright © 2012 Elsevier Ltd. All rights reserved.

  15. Genome-Wide Dosage-Dependent and -Independent Regulation Contributes to Gene Expression and Evolutionary Novelty in Plant Polyploids.

    Science.gov (United States)

    Shi, Xiaoli; Zhang, Changqing; Ko, Dae Kwan; Chen, Z Jeffrey

    2015-09-01

    Polyploidy provides evolutionary and morphological novelties in many plants and some animals. However, the role of genome dosage and composition in gene expression changes remains poorly understood. Here, we generated a series of resynthesized Arabidopsis tetraploids that contain 0-4 copies of Arabidopsis thaliana and Arabidopsis arenosa genomes and investigated ploidy and hybridity effects on gene expression. Allelic expression can be defined as dosage dependent (expression levels correlate with genome dosages) or otherwise as dosage independent. Here, we show that many dosage-dependent genes contribute to cell cycle, photosynthesis, and metabolism, whereas dosage-independent genes are enriched in biotic and abiotic stress responses. Interestingly, dosage-dependent genes tend to be preserved in ancient biochemical pathways present in both plant and nonplant species, whereas many dosage-independent genes belong to plant-specific pathways. This is confirmed by an independent analysis using Arabidopsis phylostratigraphic map. For A. thaliana loci, the dosage-dependent alleles are devoid of TEs and tend to correlate with H3K9ac, H3K4me3, and CG methylation, whereas the majority of dosage-independent alleles are enriched with TEs and correspond to H3K27me1, H3K27me3, and CHG (H = A, T, or C) methylation. Furthermore, there is a parent-of-origin effect on nonadditively expressed genes in the reciprocal allotetraploids especially when A. arenosa is used as the pollen donor, leading to metabolic and morphological changes. Thus, ploidy, epigenetic modifications, and cytoplasmic-nuclear interactions shape gene expression diversity in polyploids. Dosage-dependent expression can maintain growth and developmental stability, whereas dosage-independent expression can facilitate functional divergence between homeologs (subfunctionalization and/or neofunctionalization) during polyploid evolution. © The Author 2015. Published by Oxford University Press on behalf of the Society for

  16. Genome-Wide Analysis of Chromatin States Reveals Distinct Mechanisms of Sex-Dependent Gene Regulation in Male and Female Mouse Liver

    Science.gov (United States)

    Sugathan, Aarathi

    2013-01-01

    Chromatin state maps were developed to elucidate sex differences in chromatin structure and their impact on sex-differential chromatin accessibility and sex-biased gene expression in mouse liver. Genes in active, inactive, and poised chromatin states exhibited differential responsiveness to ligand-activated nuclear receptors and distinct enrichments for functional gene categories. Sex-biased genes were clustered by chromatin environments and mapped to DNase-hypersensitive sites (DHS) classified by sex bias in chromatin accessibility and enhancer modifications. Results were integrated with genome-wide binding data for five transcription factors implicated in growth hormone-regulated, sex-biased liver gene expression, leading to the following findings. (i) Sex-biased DHS, but not sex-biased genes, are frequently characterized by sex-differential chromatin states, indicating distal regulation. (ii) Trimethylation of histone H3 at K27 (H3K27me3) is a major sex-biased repressive mark at highly female-biased but not at highly male-biased genes. (iii) FOXA factors are associated with sex-dependent chromatin opening at male-biased but not female-biased regulatory sites. (iv) Sex-biased STAT5 binding is enriched at sex-biased DHS marked as active enhancers and preferentially targets sex-biased genes with sex-differences in local chromatin marks. (v) The male-biased repressor BCL6 preferentially targets female-biased genes and regulatory sites in a sex-independent chromatin state. (vi) CUX2, a female-specific repressor of male-biased genes, also activates strongly female-biased genes, in association with loss of H3K27me3 marks. Chromatin states are thus a major determinant of sex-biased chromatin accessibility and gene expression, with FOXA pioneer factors proposed to confer sex-dependent chromatin opening and STAT5, but not BCL6, regulating sex-biased genes by binding to sites in a sex-biased chromatin state. PMID:23836885

  17. Regulation of per and cry genes reveals a central role for the D-box enhancer in light-dependent gene expression.

    Directory of Open Access Journals (Sweden)

    Philipp Mracek

    Full Text Available Light serves as a key environmental signal for synchronizing the circadian clock with the day night cycle. The zebrafish represents an attractive model for exploring how light influences the vertebrate clock mechanism. Direct illumination of most fish tissues and cell lines induces expression of a broad range of genes including DNA repair, stress response and key clock genes. We have previously identified D- and E-box elements within the promoter of the zebrafish per2 gene that together direct light-induced gene expression. However, is the combined regulation by E- and D-boxes a general feature for all light-induced gene expression? We have tackled this question by examining the regulation of additional light-inducible genes. Our results demonstrate that with the exception of per2, all other genes tested are not induced by light upon blocking of de novo protein synthesis. We reveal that a single D-box serves as the principal light responsive element within the cry1a promoter. Furthermore, upon inhibition of protein synthesis D-box mediated gene expression is abolished while the E-box confers light driven activation as observed in the per2 gene. Given the existence of different photoreceptors in fish cells, our results implicate the D-box enhancer as a general convergence point for light driven signaling.

  18. Core promoter-specific gene regulation: TATA box selectivity and Initiator-dependent bi-directionality of serum response factor-activated transcription.

    Science.gov (United States)

    Xu, Muyu; Gonzalez-Hurtado, Elsie; Martinez, Ernest

    2016-04-01

    Gene-specific activation by enhancers involves their communication with the basal RNA polymerase II transcription machinery at the core promoter. Core promoters are diverse and may contain a variety of sequence elements such as the TATA box, the Initiator (INR), and the downstream promoter element (DPE) recognized, respectively, by the TATA-binding protein (TBP) and TBP-associated factors of the TFIID complex. Core promoter elements contribute to the gene selectivity of enhancers, and INR/DPE-specific enhancers and activators have been identified. Here, we identify a TATA box-selective activating sequence upstream of the human β-actin (ACTB) gene that mediates serum response factor (SRF)-induced transcription from TATA-dependent but not INR-dependent promoters and requires the TATA-binding/bending activity of TBP, which is otherwise dispensable for transcription from a TATA-less promoter. The SRF-dependent ACTB sequence is stereospecific on TATA promoters but activates in an orientation-independent manner a composite TATA/INR-containing promoter. More generally, we show that SRF-regulated genes of the actin/cytoskeleton/contractile family tend to have a TATA box. These results suggest distinct TATA-dependent and INR-dependent mechanisms of TFIID-mediated transcription in mammalian cells that are compatible with only certain stereospecific combinations of activators, and that a TBP-TATA binding mechanism is important for SRF activation of the actin/cytoskeleton-related gene family. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Distinct mechanisms govern the dosage-dependent and developmentally regulated resistance conferred by the maize Hm2 gene.

    Science.gov (United States)

    Chintamanani, Satya; Multani, Dilbag S; Ruess, Holly; Johal, Gurmukh S

    2008-01-01

    The maize Hm2 gene provides protection against the leaf spot and ear mold disease caused by Cochliobolus carbonum race 1 (CCR1). In this regard, it is similar to Hm1, the better-known disease resistance gene of the maize-CCR1 pathosystem. However, in contrast to Hm1, which provides completely dominant resistance at all stages of plant development, Hm2-conferred resistance is only partially dominant and becomes fully effective only at maturity. To investigate why Hm2 behaves in this manner, we cloned it on the basis of its homology to Hm1. As expected, Hm2 is a duplicate of Hm1, although the protein it encodes is grossly truncated compared with HM1. The efficacy of Hm2 in conferring resistance improves gradually over time, changing from having little or no impact in seedling tissues to providing complete immunity at anthesis. The developmentally specified phenotype of Hm2 is not dictated transcriptionally, because the expression level of the gene, whether occurring constitutively or undergoing substantial and transient induction in response to infection, does not change with plant age. In contrast, however, the Hm2 transcript is much more abundant in plants homozygous for this gene compared with plants that contain only one copy of the gene, suggesting a transcriptional basis for the dosage-dependent nature of Hm2. Thus, different mechanisms seem to underlie the developmentally programmed versus the partially dominant resistance phenotype of Hm2.

  20. Transcriptome analysis of cyclic AMP-dependent protein kinase A–regulated genes reveals the production of the novel natural compound fumipyrrole by Aspergillus fumigatus

    Science.gov (United States)

    Macheleidt, Juliane; Scherlach, Kirstin; Neuwirth, Toni; Schmidt-Heck, Wolfgang; Straßburger, Maria; Spraker, Joseph; Baccile, Joshua A.; Schroeder, Frank C.; Keller, Nancy P.; Hertweck, Christian; Heinekamp, Thorsten; Brakhage, Axel A.

    2015-01-01

    Summary Aspergillus fumigatus is an opportunistic human pathogenic fungus causing life-threatening infections in immunocompromised patients. Adaptation to different habitats and also virulence of the fungus depends on signal perception and transduction by modules such as the cyclic AMP-dependent protein kinase A (PKA) pathway. Here, by transcriptome analysis, 632 differentially regulated genes of this important signaling cascade were identified, including 23 putative transcriptional regulators. The highest upregulated transcription factor gene was located in a previously unknown secondary metabolite gene cluster, which we named fmp, encoding an incomplete nonribosomal peptide synthetase, FmpE. Overexpression of the regulatory gene fmpR using the TetOn system led to the specific expression of the other six genes of the fmp cluster. Metabolic profiling of wild type and fmpR overexpressing strain by HPLC-DAD and HPLCHRESI-MS and structure elucidation by NMR led to identification of 5-benzyl-1H-pyrrole-2-carboxylic acid, which we named fumipyrrole. Fumipyrrole was not described as natural product yet. Chemical synthesis of fumipyrrole confirmed its structure. Interestingly, deletion of fmpR or fmpE led to reduced growth and sporulation of the mutant strains. Although fmp cluster genes were transcribed in infected mouse lungs, deletion of fmpR resulted in wild-type virulence in a murine infection model. PMID:25582336

  1. Hexamerin-based regulation of juvenile hormone-dependent gene expression underlies phenotypic plasticity in a social insect.

    Science.gov (United States)

    Zhou, Xuguo; Tarver, Matthew R; Scharf, Michael E

    2007-02-01

    Worker termites of the genus Reticulitermes are temporally-arrested juvenile forms that can terminally differentiate into adultsoldier- or reproductive-caste phenotypes. Soldier-caste differentiation is a developmental transition that is induced by high juvenile hormone (JH) titers. Recently, a status quo hexamerin mechanism was identified, which reduces JH efficacy and maximizes colony fitness via the maintenance of high worker-caste proportions. Our goal in these studies was to investigate more thoroughly the influences of the hexamerins on JH-dependent gene expression in termite workers. Our approach involved RNA interference (RNAi), bioassays and quantification of gene expression. We first investigated the expression of 17 morphogenesis-associated genes in response to RNAi-based hexamerin silencing. Hexamerin silencing resulted in significant downstream impacts on 15 out of the 17 genes, suggesting that these genes are members of a JH-responsive genomic network. Next, we compared gene-expression profiles in workers after RNAi-based hexamerin silencing to that of (i) untreated workers that were held away from the colony; and (ii) workers that were also held away from the colony, but with ectopic JH. Here, although there was no correlation between hexamerin silencing and colony-release effects, we observed a significant correlation between hexamerin silencing and JH-treatment effects. These findings provide further evidence supporting the hypothesis that the hexamerins modulate JH availability, thus limiting the impacts of JH on termite caste polyphenism. Results are discussed in a context relative to outstanding questions on termite developmental biology, particularly on regulatory gene networks that respond to JH-, colony- and environmental-cues.

  2. Melatonin regulates CRE-dependent gene transcription underlying osteoblast proliferation by activating Src and PKA in parallel.

    Science.gov (United States)

    Tao, Lin; Zhu, Yue

    2018-01-01

    Several studies have indicated a relationship between melatonin and idiopathic scoliosis, including our previous work which demonstrated that melatonin can inhibit osteoblast proliferation; however, the mechanism remains unclear. Here, we utilized a MTT assay to show that melatonin significantly reduces osteoblast proliferation in a concentration-and time-dependent manner. Through a combination of techniques, including real-time PCR, MTT assays, immunofluorescence, and luciferase assays, we confirmed that melatonin-induced changes in phosphorylated cAMP response element-binding protein (CREB) reduced transcriptional activity in a melatonin receptor-dependent manner. Surprisingly, treatment of osteoblasts with the mitogen-activated protein kinase/extracellular signal-regulated kinase kinase (MEK) inhibitor PD98059 up-regulated other cascades upstream of CREB. We next treated cells with PKA and Src inhibitors and observed that melatonin can also activate the protein kinase A (PKA) and Src pathways. To examine whether Src is upstream from the cAMP-PKA pathway, we measured cAMP levels in response to melatonin with and without a Src inhibitor (PP2) and found that PP2 had no additional effect. Therefore, the transcription-dependent mechanisms involved in CREB phosphorylation, along with melatonin, activated Src via a parallel signaling pathway that was separate from that of PKA. Finally, we transfected osteoblasts with lentiviral CREB short hairpin (sh) RNAs and found a decrease in the expression of proliferating cell nuclear antigen (PCNA) and osteoblast proliferation. These results suggest that CREB and PCNA are downstream targets of melatonin signaling, and that the down-regulation of CREB, which is regulated via PKA and Src pathways, contributes to the melatonin-induced inhibition of osteoblast proliferation.

  3. Role of CK2-dependent phosphorylation of Ifh1 and Crf1 in transcriptional regulation of ribosomal protein genes in Saccharomyces cerevisiae.

    Science.gov (United States)

    Kim, Myung Sup; Hahn, Ji-Sook

    2016-08-01

    In Saccharomyces cerevisiae, Fhl1 is involved in the regulation of ribosomal protein (RP) genes through interaction with either its coactivator Ifh1 or corepressor Crf1, depending on nutrient conditions. Interaction of Fhl1 with Ifh1 or Crf1 is achieved through a forkhead-associated (FHA) domain of Fhl1, which binds to forkhead-binding (FHB) domains of Ifh1 and Crf1. Here, we demonstrate that CK2-dependent phosphorylation of T681 and T348 residues, located in the FHB domains of Ifh1 and Crf1, respectively, provides binding sites for the FHA domain of Fhl1. Cells expressing Ifh1(T681A) mutant showed reduced association of Ifh1 at the RP gene promoters and decreased levels of RP gene transcripts, thereby reducing the growth rate. On the other hand, cells expressing Crf1(T348A) showed a defect in repressing RP gene transcription upon inhibition of target of rapamycin complex 1 (TORC1) by rapamycin treatment. Taken together, these findings suggest the mechanisms by which CK2-dependent recruitment of Ifh1 and Crf1 at the RP gene promoters governs the transcription of RP genes. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Aquaporin family genes exhibit developmentally-regulated and host-dependent transcription patterns in the sea louse Caligus rogercresseyi.

    Science.gov (United States)

    Farlora, Rodolfo; Valenzuela-Muñoz, Valentina; Chávez-Mardones, Jacqueline; Gallardo-Escárate, Cristian

    2016-07-01

    Aquaporins are small integral membrane proteins that function as pore channels for the transport of water and other small solutes across the cell membrane. Considering the important roles of these proteins in several biological processes, including host-parasite interactions, there has been increased research on aquaporin proteins recently. The present study expands on the knowledge of aquaporin family genes in parasitic copepods, examining diversity and expression during the ontogeny of the sea louse Caligus rogercresseyi. Furthermore, aquaporin expression was evaluated during the early infestation of Atlantic (Salmo salar) and Coho salmon (Oncorhynchus kisutch). Deep transcriptome sequencing data revealed eight full length and two partial open reading frames belonging to the aquaporin protein family. Clustering analyses with identified Caligidae sequences revealed three major clades of aquaglyceroporins (Cr-Glp), classical aquaporin channels (Cr-Bib and Cr-PripL), and unorthodox aquaporins (Cr-Aqp12-like). In silico analysis revealed differential expression of aquaporin genes between developmental stages and between sexes. Male-biased expression of Cr-Glp1_v1 and female-biased expression of Cr-Bib were further confirmed in adults by RT-qPCR. Additionally, gene expressions were measured for seven aquaporins during the early infestation stage. The majority of aquaporin genes showed significant differential transcription expressions between sea lice parasitizing different hosts, with Atlantic salmon sea lice exhibiting overall reduced expression as compared to Coho salmon. The observed differences in the regulation of aquaporin genes may reveal osmoregulatory adaptations associated with nutrient ingestion and metabolite waste export, exposing complex host-parasite relationships in C. rogercresseyi. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Activity-dependent calcium signaling and ERK-MAP kinases in neurons: a link to structural plasticity of the nucleus and gene transcription regulation.

    Science.gov (United States)

    Wiegert, J Simon; Bading, Hilmar

    2011-05-01

    Activity-dependent gene expression is important for the formation and maturation of neuronal networks, neuronal survival and for plastic modifications within mature networks. At the level of individual neurons, expression of new protein is required for dendritic branching, synapse formation and elimination. Experience-driven synaptic activity induces membrane depolarization, which in turn evokes intracellular calcium transients that are decoded according to their source and strength by intracellular calcium sensing proteins. In order to activate the gene transcription machinery of the cell, calcium signals have to be conveyed from the site of their generation in the cytoplasm to the cell nucleus. This can occur via a variety of mechanisms and with different kinetics depending on the source and amplitude of calcium influx. One mechanism involves the propagation of calcium itself, leading to nuclear calcium transients that subsequently activate transcription. The mitogen-activated protein kinase (MAPK) cascade represents a second central signaling module that transduces information from the site of calcium signal generation at the plasma membrane to the nucleus. Nuclear signaling of the MAPK cascades catalyzes the phosphorylation of transcription factors but also regulates gene transcription more globally at the level of chromatin remodeling as well as through its recently identified role in the modulation of nuclear shape. Here we discuss the possible mechanisms by which the MAPKs ERK1 and ERK2, activated by synaptically evoked calcium influx, can signal to the nucleus and regulate gene transcription. Moreover, we describe how MAPK-dependent structural plasticity of the nuclear envelope enhances nuclear calcium signaling and suggest possible implications for the regulation of gene transcription in the context of nuclear geometry. 2010 Elsevier Ltd. All rights reserved.

  6. Injury-Dependent and Disability-Specific Lumbar Spinal Gene Regulation following Sciatic Nerve Injury in the Rat.

    Directory of Open Access Journals (Sweden)

    Paul J Austin

    Full Text Available Allodynia, hyperalgesia and spontaneous pain are cardinal sensory signs of neuropathic pain. Clinically, many neuropathic pain patients experience affective-motivational state changes, including reduced familial and social interactions, decreased motivation, anhedonia and depression which are severely debilitating. In earlier studies we have shown that sciatic nerve chronic constriction injury (CCI disrupts social interactions, sleep-wake-cycle and endocrine function in one third of rats, a subgroup reliably identified six days after injury. CCI consistently produces allodynia and hyperalgesia, the intensity of which was unrelated either to the altered social interactions, sleep-wake-cycle or endocrine changes. This decoupling of the sensory consequences of nerve injury from the affective-motivational changes is reported in both animal experiments and human clinical data. The sensory changes triggered by CCI are mediated primarily by functional changes in the lumbar dorsal horn, however, whether lumbar spinal changes may drive different affective-motivational states has never been considered. In these studies, we used microarrays to identify the unique transcriptomes of rats with altered social behaviours following sciatic CCI to determine whether specific patterns of lumbar spinal adaptations characterised this subgroup. Rats underwent CCI and on the basis of reductions in dominance behaviour in resident-intruder social interactions were categorised as having Pain & Disability, Pain & Transient Disability or Pain alone. We examined the lumbar spinal transcriptomes two and six days after CCI. Fifty-four 'disability-specific' genes were identified. Sixty-five percent were unique to Pain & Disability rats, two-thirds of which were associated with neurotransmission, inflammation and/or cellular stress. In contrast, 40% of genes differentially regulated in rats without disabilities were involved with more general homeostatic processes (cellular

  7. Transcriptomic Profiling and H3K27me3 Distribution Reveal Both Demethylase-Dependent and Independent Regulation of Developmental Gene Transcription in Cell Differentiation.

    Science.gov (United States)

    Kang, Sung Chul; Kim, Se Kye; Chai, Jin Choul; Kim, Sun Hwa; Won, Kyoung-Jae; Lee, Young Seek; Jung, Kyoung Hwa; Chai, Young Gyu

    2015-01-01

    The removal of histone H3 trimethylation at lysine residue 27 (H3K27me3) plays a critical role in the transcriptional initiation of developmental genes. The H3K27me3-specific KDM6 demethylases JMJD3 and UTX are responsible for the transcriptional initiation of various developmental genes, but some genes are expressed in a KDM6 demethylase-independent manner. To address the role of H3K27me3 in the retinoic acid (RA)-induced differentiation of the human carcinoma NCCIT cell line, we inhibited JMJD3 and UTX using the H3K27me3 demethylase inhibitor GSK-J4. The commitment of JMJD3/UTX-inhibited cells to a specific fate was delayed, and transcriptome profiling also revealed the differential expression of genes related to cell fate specification in demethylase-inactivated cells; the expression levels of RA metabolism and HOX family genes significantly decreased. We observed a weak correlation between H3K27me3 enrichment and transcriptional repression in the control and JMJD/UTX-inhibited cells, except for a few sets of developmental genes that are indispensable for cell fate specification. Taken together, these results provide the H3K27me3 landscape of a differentiating cell line and suggest that both demethylase-dependent and demethylase-independent transcriptional regulation play a role in early differentiation and developmental gene expression activated by H3K27me3 demethylation.

  8. Diversification of both KIR and NKG2 natural killer cell receptor genes in macaques - implications for highly complex MHC-dependent regulation of natural killer cells.

    Science.gov (United States)

    Walter, Lutz; Petersen, Beatrix

    2017-02-01

    The killer immunoglobulin-like receptors (KIR) as well as their MHC class I ligands display enormous genetic diversity and polymorphism in macaque species. Signals resulting from interaction between KIR or CD94/NKG2 receptors and their cognate MHC class I proteins essentially regulate the activity of natural killer (NK) cells. Macaque and human KIR share many features, such as clonal expression patterns, gene copy number variations, specificity for particular MHC class I allotypes, or epistasis between KIR and MHC class I genes that influence susceptibility and resistance to immunodeficiency virus infection. In this review article we also annotated publicly available rhesus macaque BAC clone sequences and provide the first description of the CD94-NKG2 genomic region. Besides the presence of genes that are orthologous to human NKG2A and NKG2F, this region contains three NKG2C paralogues. Hence, the genome of rhesus macaques contains moderately expanded and diversified NKG2 genes in addition to highly diversified KIR genes. The presence of two diversified NK cell receptor families in one species has not been described before and is expected to require a complex MHC-dependent regulation of NK cells. © 2016 John Wiley & Sons Ltd.

  9. Methoxychlor and triclosan stimulates ovarian cancer growth by regulating cell cycle- and apoptosis-related genes via an estrogen receptor-dependent pathway.

    Science.gov (United States)

    Kim, Joo-Young; Yi, Bo-Rim; Go, Ryeo-Eun; Hwang, Kyung-A; Nam, Ki-Hoan; Choi, Kyung-Chul

    2014-05-01

    Methoxychlor and triclosan are emergent or suspected endocrine-disrupting chemicals (EDCs). Methoxychlor [MXC; 1,1,1-trichlor-2,2-bis (4-methoxyphenyl) ethane] is an organochlorine pesticide that has been primarily used since dichlorodiphenyltrichloroethane (DDT) was banned. In addition, triclosan (TCS) is used as a common component of soaps, deodorants, toothpastes, and other hygiene products at concentrations up to 0.3%. In the present study, the potential impact of MXC and TCS on ovarian cancer cell growth and underlying mechanism(s) was examined following their treatments in BG-1 ovarian cancer cells. As results, MXC and TCS induced BG-1 cell growth via regulating cyclin D1, p21 and Bax genes related with cell cycle and apoptosis. A methylthiazolyldiphenyl-tetrazolium bromide (MTT) assay confirmed that the proliferation of BG-1 ovarian cancer cells was stimulated by MXC (10(-6), 10(-7), 10(-8), and 10(-9)M) or TCS (10(-6), 10(-7), 10(-8), and 10(-9)M). Treatment of BG-1 cells with MXC or TCS resulted in the upregulation of cyclin D1 and downregulation of p21 and Bax transcriptions. In addition, the protein level of cyclin D1 was increased by MXC or TCS while p21 and Bax protein levels appeared to be reduced in these cells. Furthermore, MXC- or TCS-induced alterations of these genes were reversed in the presence of ICI 182,780 (10(-7)M), suggesting that the changes in these gene expressions may be regulated by an ER-dependent signaling pathway. In conclusion, the results of our investigation indicate that two potential EDCs, MXC and TCS, may stimulate ovarian cancer growth by regulating cell cycle- and apoptosis-related genes via an ER-dependent pathway. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. Activity-Dependent NPAS4 Expression and the Regulation of Gene Programs Underlying Plasticity in the Central Nervous System

    Directory of Open Access Journals (Sweden)

    José Fernando Maya-Vetencourt

    2013-01-01

    Full Text Available The capability of the brain to change functionally in response to sensory experience is most active during early stages of development but it decreases later in life when major alterations of neuronal network structures no longer take place in response to experience. This view has been recently challenged by experimental strategies based on the enhancement of environmental stimulation levels, genetic manipulations, and pharmacological treatments, which all have demonstrated that the adult brain retains a degree of plasticity that allows for a rewiring of neuronal circuitries over the entire life course. A hot spot in the field of neuronal plasticity centres on gene programs that underlie plastic phenomena in adulthood. Here, I discuss the role of the recently discovered neuronal-specific and activity-dependent transcription factor NPAS4 as a critical mediator of plasticity in the nervous system. A better understanding of how modifications in the connectivity of neuronal networks occur may shed light on the treatment of pathological conditions such as brain damage or disease in adult life, some of which were once considered untreatable.

  11. The gsp oncogene disrupts Ras/ERK-dependent prolactin gene regulation in gsp inducible somatotroph cell line.

    Science.gov (United States)

    Pertuit, M; Romano, D; Zeiller, C; Barlier, A; Enjalbert, A; Gerard, C

    2011-04-01

    The MAPK ERK1/2 cascade regulates all the critical cellular functions, and in many pathological situations, these regulatory processes are perturbed. It has been clearly established that this cascade is an integrative point in the control of the pituitary functions exerted by various extracellular signals. In particular, ERK1/2 cross talk with the cAMP pathway is determinant in the control of somatolactotroph hormonal secretion exerted via neuropeptide receptors. GH-secreting adenomas are characterized by frequent cAMP pathway alterations, such as constitutive activation of the α-subunit of the heterotrimeric Gs protein (the gsp oncogene), overexpression of Gsα, and changes in the protein kinase A regulatory subunits. However, it has not yet been established exactly how these alterations result in GH-secreting adenomas or how the ERK1/2 cascade contributes to the process of GH-secreting adenoma tumorigenesis. In this study on the conditional gsp-oncogene-expressing GH4C1 cell line, expression of the gsp oncogene, which was observed in up to 40% of GH-secreting adenomas, was found to induce sustained ERK1/2 activation, which required activation of the protein kinase A and the GTPases Ras and Rap1. All these signaling components contribute to the chronic activation of the human prolactin promoter. The data obtained here show that Ras plays a crucial role in these processes: in a physiopathological context, i.e. in the presence of the gsp oncogene, it switched from being a repressor of the cAMP/ protein kinase A ERK-sensitive prolactin gene control exerted by neuropeptides to an activator of the prolactin promoter.

  12. GPR54 regulates ERK1/2 activity and hypothalamic gene expression in a Gα(q/11 and β-arrestin-dependent manner.

    Directory of Open Access Journals (Sweden)

    Jacob M Szereszewski

    Full Text Available G protein-coupled receptor 54 (GPR54 is a G(q/11-coupled 7 transmembrane-spanning receptor (7TMR. Activation of GPR54 by kisspeptin (Kp stimulates PIP(2 hydrolysis, Ca(2+ mobilization and ERK1/2 MAPK phosphorylation. Kp and GPR54 are established regulators of the hypothalamic-pituitary-gonadal (HPG axis and loss-of-function mutations in GPR54 are associated with an absence of puberty and hypogonadotropic hypogonadism, thus defining an important role of the Kp/GPR54 signaling system in reproductive function. Given the tremendous physiological and clinical importance of the Kp/GPR54 signaling system, we explored the contributions of the GPR54-coupled G(q/11 and β-arrestin pathways on the activation of a major downstream signaling molecule, ERK, using G(q/11 and β-arrestin knockout mouse embryonic fibroblasts. Our study revealed that GPR54 employs the G(q/11 and β-arrestin-2 pathways in a co-dependent and temporally overlapping manner to positively regulate ERK activity and pERK nuclear localization. We also show that while β-arrestin-2 potentiates GPR54 signaling to ERK, β-arrestin-1 inhibits it. Our data also revealed that diminished β-arrestin-1 and -2 expression in the GT1-7 GnRH hypothalamic neuronal cell line triggered distinct patterns of gene expression following Kp-10 treatment. Thus, β-arrestin-1 and -2 also regulate distinct downstream responses in gene expression. Finally, we showed that GPR54, when uncoupled from the G(q/11 pathway, as is the case for several naturally occurring GPR54 mutants associated with hypogonadotropic hypogonadism, continues to regulate gene expression in a G protein-independent manner. These new and exciting findings add significantly to our mechanistic understanding of how this important receptor signals intracellularly in response to kisspeptin stimulation.

  13. Long-chain acyl-CoA-dependent regulation of gene expression in bacteria, yeast and mammals

    DEFF Research Database (Denmark)

    Black, P N; Færgeman, Nils J.; DiRusso, C C

    2000-01-01

    Saccharomyces cerevisiae, genes encoding peroxisomal proteins are activated in response to exogenously supplied fatty acids. In contrast, growth of yeast cells in media containing exogenous fatty acids results in repression of a number of genes, including that encoding the delta9-fatty acid desaturase (OLE1...

  14. Transcription of the Tollip gene is elevated in intestinal epithelial cells through impaired O-GlcNAcylation-dependent nuclear translocation of the negative regulator Elf-1

    International Nuclear Information System (INIS)

    Sugi, Yutaka; Takahashi, Kyoko; Nakano, Kou; Hosono, Akira; Kaminogawa, Shuichi

    2011-01-01

    Highlights: → Transcriptional activation of the Tollitip gene is higher in IECs than in monocytes. → Nt -194/-186 region acts as a cis-element and is recognized by Elf-1. → Elf-1 suppresses Tollip gene transcription in monocytes but not in IECs. → O-GlcNAc modification is necessary for nuclear translocation of Elf-1. → O-GlcNAcylation-dependent nuclear translocation of Elf-1 is impaired in IECs. -- Abstract: Intestinal epithelial cells (IECs) must be tolerant of the large number of commensal bacteria inhabiting the intestinal tract to avoid excessive inflammatory reactions. Toll-interacting protein (Tollip), a negative regulator of Toll-like receptor signaling, is known to be expressed at high levels in IECs, and to thereby contribute to the hyporesponsiveness of IECs to commensals. In this study, we analyzed the underlying mechanisms for elevated transcription of the Tollip gene in IECs using a human IEC line, Caco-2, and a human monocyte line, THP-1, as a control. Elf-1 was identified as a transcription factor that negatively regulates Tollip gene expression. The transcription factor Elf-1 was localized in the nucleus by O-linked N-acetylglucosamine (O-GlcNAc) modification, whereas the unmodified form was detected only in the cytoplasm. Comparison of Caco-2 and THP-1 cells revealed that O-GlcNAc modification of Elf-1 was significantly lower in IECs than in monocytes. Collectively, the results indicate that insufficient O-GlcNAc modification prevents Elf-1-mediated transcriptional repression and thereby upregulates Tollip gene expression in IECs.

  15. Transcription of the Tollip gene is elevated in intestinal epithelial cells through impaired O-GlcNAcylation-dependent nuclear translocation of the negative regulator Elf-1

    Energy Technology Data Exchange (ETDEWEB)

    Sugi, Yutaka [College of Bioresource Sciences, Nihon University, 1866 Kameino, Fujisawa-shi, Kanagawa 252-0880 (Japan); Takahashi, Kyoko, E-mail: ktaka@brs.nihon-u.ac.jp [College of Bioresource Sciences, Nihon University, 1866 Kameino, Fujisawa-shi, Kanagawa 252-0880 (Japan); Nakano, Kou; Hosono, Akira; Kaminogawa, Shuichi [College of Bioresource Sciences, Nihon University, 1866 Kameino, Fujisawa-shi, Kanagawa 252-0880 (Japan)

    2011-09-09

    Highlights: {yields} Transcriptional activation of the Tollitip gene is higher in IECs than in monocytes. {yields} Nt -194/-186 region acts as a cis-element and is recognized by Elf-1. {yields} Elf-1 suppresses Tollip gene transcription in monocytes but not in IECs. {yields} O-GlcNAc modification is necessary for nuclear translocation of Elf-1. {yields} O-GlcNAcylation-dependent nuclear translocation of Elf-1 is impaired in IECs. -- Abstract: Intestinal epithelial cells (IECs) must be tolerant of the large number of commensal bacteria inhabiting the intestinal tract to avoid excessive inflammatory reactions. Toll-interacting protein (Tollip), a negative regulator of Toll-like receptor signaling, is known to be expressed at high levels in IECs, and to thereby contribute to the hyporesponsiveness of IECs to commensals. In this study, we analyzed the underlying mechanisms for elevated transcription of the Tollip gene in IECs using a human IEC line, Caco-2, and a human monocyte line, THP-1, as a control. Elf-1 was identified as a transcription factor that negatively regulates Tollip gene expression. The transcription factor Elf-1 was localized in the nucleus by O-linked N-acetylglucosamine (O-GlcNAc) modification, whereas the unmodified form was detected only in the cytoplasm. Comparison of Caco-2 and THP-1 cells revealed that O-GlcNAc modification of Elf-1 was significantly lower in IECs than in monocytes. Collectively, the results indicate that insufficient O-GlcNAc modification prevents Elf-1-mediated transcriptional repression and thereby upregulates Tollip gene expression in IECs.

  16. The MLL fusion gene, MLL-AF4, regulates cyclin-dependent kinase inhibitor CDKN1B (p27kip1) expression

    Science.gov (United States)

    Xia, Zhen-Biao; Popovic, Relja; Chen, Jing; Theisler, Catherine; Stuart, Tara; Santillan, Donna A.; Erfurth, Frank; Diaz, Manuel O.; Zeleznik-Le, Nancy J.

    2005-01-01

    MLL, involved in many chromosomal translocations associated with acute myeloid and lymphoid leukemia, has >50 known partner genes with which it is able to form in-frame fusions. Characterizing important downstream target genes of MLL and of MLL fusion proteins may provide rational therapeutic strategies for the treatment of MLL-associated leukemia. We explored downstream target genes of the most prevalent MLL fusion protein, MLL-AF4. To this end, we developed inducible MLL-AF4 fusion cell lines in different backgrounds. Overexpression of MLL-AF4 does not lead to increased proliferation in either cell line, but rather, cell growth was slowed compared with similar cell lines inducibly expressing truncated MLL. We found that in the MLL-AF4-induced cell lines, the expression of the cyclin-dependent kinase inhibitor gene CDKN1B was dramatically changed at both the RNA and protein (p27kip1) levels. In contrast, the expression levels of CDKN1A (p21) and CDKN2A (p16) were unchanged. To explore whether CDKN1B might be a direct target of MLL and of MLL-AF4, we used chromatin immunoprecipitation (ChIP) assays and luciferase reporter gene assays. MLL-AF4 binds to the CDKN1B promoter in vivo and regulates CDKN1B promoter activity. Further, we confirmed CDKN1B promoter binding by ChIP in MLL-AF4 as well as in MLL-AF9 leukemia cell lines. Our results suggest that CDKN1B is a downstream target of MLL and of MLL-AF4, and that, depending on the background cell type, MLL-AF4 inhibits or activates CDKN1B expression. This finding may have implications in terms of leukemia stem cell resistance to chemotherapy in MLL-AF4 leukemias. PMID:16169901

  17. Protein Phosphatase 2A Catalytic Subunit α Plays a MyD88-Dependent, Central Role in the Gene-Specific Regulation of Endotoxin Tolerance

    Directory of Open Access Journals (Sweden)

    Ling Xie

    2013-03-01

    Full Text Available MyD88, the intracellular adaptor of most TLRs, mediates either proinflammatory or immunosuppressive signaling that contributes to chronic inflammation-associated diseases. Although gene-specific chromatin modifications regulate inflammation, the role of MyD88 signaling in establishing such epigenetic landscapes under different inflammatory states remains elusive. Using quantitative proteomics to enumerate the inflammation-phenotypic constituents of the MyD88 interactome, we found that in endotoxin-tolerant macrophages, protein phosphatase 2A catalytic subunit α (PP2Ac enhances its association with MyD88 and is constitutively activated. Knockdown of PP2Ac prevents suppression of proinflammatory genes and resistance to apoptosis. Through site-specific dephosphorylation, constitutively active PP2Ac disrupts the signal-promoting TLR4-MyD88 complex and broadly suppresses the activities of multiple proinflammatory/proapoptotic pathways as well, shifting proinflammatory MyD88 signaling to a prosurvival mode. Constitutively active PP2Ac translocated with MyD88 into the nuclei of tolerant macrophages establishes the immunosuppressive pattern of chromatin modifications and represses chromatin remodeling to selectively silence proinflammatory genes, coordinating the MyD88-dependent inflammation control at both signaling and epigenetic levels under endotoxin-tolerant conditions.

  18. Activity-dependent expression of miR-132 regulates immediate-early gene induction during olfactory learning in the greater short-nosed fruit bat, Cynopterus sphinx.

    Science.gov (United States)

    Mukilan, Murugan; Ragu Varman, Durairaj; Sudhakar, Sivasubramaniam; Rajan, Koilmani Emmanuvel

    2015-04-01

    The activity-dependent expression of immediate-early genes (IEGs) and microRNA (miR)-132 has been implicated in synaptic plasticity and the formation of long-term memory (LTM). In the present study, we show that olfactory training induces the expression of IEGs (EGR-1, C-fos, C-jun) and miR-132 at similar time scale in olfactory bulb (OB) of Cynopterus sphinx. We examined the role of miR-132 in the OB using antisense oligodeoxynucleotide (AS-ODN) and demonstrated that a local infusion of AS-ODN in the OB 2h prior to training impaired olfactory memory formation in C. sphinx. However, the infusion of AS-ODN post-training did not cause a deficit in memory formation. Furthermore, the inhibition of miR-132 reduced the olfactory training-induced expression of IEGs and post synaptic density protein-95 (PSD-95) in the OB. Additionally, we show that miR-132 regulates the activation of calcium/calmodulin-dependent protein kinase-II (CaMKII) and cAMP response element binding protein (CREB), possibly through miR-148a. These data suggest that olfactory training induces the expression of miR-132 and IEGs, which in turn activates post-synaptic proteins that regulate olfactory memory formation. Copyright © 2015 Elsevier Inc. All rights reserved.

  19. Regulation of eucaryotic gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Brent, R.; Ptashne, M.S

    1989-05-23

    This patent describes a method of regulating the expression of a gene in a eucaryotic cell. The method consists of: providing in the eucaryotic cell, a peptide, derived from or substantially similar to a peptide of a procaryotic cell able to bind to DNA upstream from or within the gene, the amount of the peptide being sufficient to bind to the gene and thereby control expression of the gene.

  20. The spinal muscular atrophy with pontocerebellar hypoplasia gene VRK1 regulates neuronal migration through an amyloid-β precursor protein-dependent mechanism.

    Science.gov (United States)

    Vinograd-Byk, Hadar; Sapir, Tamar; Cantarero, Lara; Lazo, Pedro A; Zeligson, Sharon; Lev, Dorit; Lerman-Sagie, Tally; Renbaum, Paul; Reiner, Orly; Levy-Lahad, Ephrat

    2015-01-21

    Spinal muscular atrophy with pontocerebellar hypoplasia (SMA-PCH) is an infantile SMA variant with additional manifestations, particularly severe microcephaly. We previously identified a nonsense mutation in Vaccinia-related kinase 1 (VRK1), R358X, as a cause of SMA-PCH. VRK1-R358X is a rare founder mutation in Ashkenazi Jews, and additional mutations in patients of different origins have recently been identified. VRK1 is a nuclear serine/threonine protein kinase known to play multiple roles in cellular proliferation, cell cycle regulation, and carcinogenesis. However, VRK1 was not known to have neuronal functions before its identification as a gene mutated in SMA-PCH. Here we show that VRK1-R358X homozygosity results in lack of VRK1 protein, and demonstrate a role for VRK1 in neuronal migration and neuronal stem cell proliferation. Using shRNA in utero electroporation in mice, we show that Vrk1 knockdown significantly impairs cortical neuronal migration, and affects the cell cycle of neuronal progenitors. Expression of wild-type human VRK1 rescues both proliferation and migration phenotypes. However, kinase-dead human VRK1 rescues only the migration impairment, suggesting the role of VRK1 in neuronal migration is partly noncatalytic. Furthermore, we found that VRK1 deficiency in human and mouse leads to downregulation of amyloid-β precursor protein (APP), a known neuronal migration gene. APP overexpression rescues the phenotype caused by Vrk1 knockdown, suggesting that VRK1 affects neuronal migration through an APP-dependent mechanism. Copyright © 2015 the authors 0270-6474/15/350936-08$15.00/0.

  1. Epigenetic regulation of estrogen-dependent memory

    Science.gov (United States)

    Fortress, Ashley M.; Frick, Karyn M.

    2014-01-01

    Hippocampal memory formation is highly regulated by post-translational histone modifications and DNA methylation. Accordingly, these epigenetic processes play a major role in the effects of modulatory factors, such as sex steroid hormones, on hippocampal memory. Our laboratory recently demonstrated that the ability of the potent estrogen 17β-estradiol (E2) to enhance hippocampal-dependent novel object recognition memory in ovariectomized female mice requires ERK-dependent histone H3 acetylation and DNA methylation in the dorsal hippocampus. Although these data provide valuable insight into the chromatin modifications that mediate the memory-enhancing effects of E2, epigenetic regulation of gene expression is enormously complex. Therefore, more research is needed to fully understand how E2 and other hormones employ epigenetic alterations to shape behavior. This review discusses the epigenetic alterations shown thus far to regulate hippocampal memory, briefly reviews the effects of E2 on hippocampal function, and describes in detail our work on epigenetic regulation of estrogenic memory enhancement. PMID:24878494

  2. Alteration of light-dependent gene regulation by the absence of the RCO-1/RCM-1 repressor complex in the fungus Neurospora crassa.

    Directory of Open Access Journals (Sweden)

    Carmen Ruger-Herreros

    Full Text Available The activation of transcription by light in the fungus Neurospora crassa requires the White Collar Complex (WCC, a photoreceptor and transcription factor complex. After light reception two WCCs interact and bind the promoters of light-regulated genes to activate transcription. This process is regulated by VVD, a small photoreceptor that disrupts the interaction between WCCs and leads to a reduction in transcription after long exposures to light. The N. crassa RCO-1/RCM-1 repressor complex is the homolog of the Tup1-Ssn6 repressor complex in yeast, and its absence modifies photoadaptation. We show that the absence of the RCO-1/RCM-1 repressor complex leads to several alterations in transcription that are gene-specific: an increase in the accumulation of mRNAs in the dark, a repression of transcription, and a derepression of transcription after long exposures to light. The absence of the RCO-1/RCM-1 repressor complex leads to lower VVD levels that are available for the regulation of the activity of the WCC. The reduction in the amount of VVD results in increased WCC binding to the promoters of light-regulated genes in the dark and after long exposures to light, leading to the modification of photoadaptation that has been observed in rco-1 and rcm-1 mutants. Our results show that the photoadaptation phenotype of mutants in the RCO-1/RCM-1 repressor complex is, at least in part, an indirect consequence of the reduction of vvd transcription, and the resulting modification in the regulation of transcription by the WCC.

  3. Gene regulation by growth factors

    International Nuclear Information System (INIS)

    Metz, R.; Gorham, J.; Siegfried, Z.; Leonard, D.; Gizang-Ginsberg, E.; Thompson, M.A.; Lawe, D.; Kouzarides, T.; Vosatka, R.; MacGregor, D.; Jamal, S.; Greenberg, M.E.; Ziff, E.B.

    1988-01-01

    To coordinate the proliferation and differentiation of diverse cell types, cells of higher eukaryotes communicate through the release of growth factors. These peptides interact with specific transmembrane receptors of other cells and thereby generate intracellular messengers. The many changes in cellular physiology and activity that can be induced by growth factors imply that growth factor-induced signals can reach the nucleus and control gene activity. Moreover, current evidence also suggests that unregulated signaling along such pathways can induce aberrant proliferation and the formation of tumors. This paper reviews investigations of growth factor regulation of gene expression conducted by the authors' laboratory

  4. Klotho-Dependent Cellular Transport Regulation.

    Science.gov (United States)

    Sopjani, M; Dërmaku-Sopjani, M

    2016-01-01

    Klotho is a transmembrane protein that in humans is encoded by the hKL gene. This protein is known to have aging suppressor effects and is predominantly expressed in the distal convoluted tubule of the kidney, parathyroid glands, and choroid plexus of the brain. The Klotho protein exists in both full-length membrane form and a soluble secreted form, which exerts numerous distinct functions. The extracellular domain of Klotho can be enzymatically cleaved off and released into the systemic circulation where it functions as β-glucuronidase and a hormone. Soluble Klotho is a multifunction protein present in the biological fluids including blood, urine, and cerebrospinal fluid of mammals. Klotho deficiency leads to multiple organ failure accompanied by early appearance of multiple age-related disorders and early death, whereas overexpression of Klotho results in the opposite effects. Klotho, an enzyme and hormone, has been reported to participate in the regulation of cellular transport processes across the plasma membrane either indirectly through inhibiting calcitriol (1,25(OH)2D3) formation or other mechanism, or by directly affecting transporter proteins, including ion channels, cellular carriers, and Na(+)/K(+)-ATPase. Accordingly, Klotho protein serves as a powerful regulator of cellular transport across the plasma membrane. Importantly, Klotho-dependent cellular transport regulation implies stimulatory or inhibitory effects. Klotho has been shown to play a key role in the regulation of multiple calcium and potassium ion channels, and various cellular carriers including the Na(+)-coupled cotransporters such as NaPi-IIa, NaPi-IIb, EAAT3, and EAAT4, CreaT1 as well as Na(+)/K(+)-ATPase. These regulations are parts of the antiaging function of Klotho, which will be discussing throughout this chapter. Clearly, further experimental efforts are required to investigate the effect of Klotho on other transport proteins and underlying molecular mechanisms by which Klotho

  5. WEE1 epigenetically modulates 5-hmC levels by pY37-H2B dependent regulation ofIDH2gene expression.

    Science.gov (United States)

    Mahajan, Nupam P; Malla, Pavani; Bhagwat, Shambhavi; Sharma, Vasundhara; Sarnaik, Amod; Kim, Jongphil; Pilon-Thomas, Shari; Weber, Jeffery; Mahajan, Kiran

    2017-12-05

    Epigenetic signaling networks dynamically regulate gene expression to maintain cellular homeostasis. Previously, we uncovered that WEE1 phosphorylates histone H2B at tyrosine 37 (pY37-H2B) to negatively regulate global histone transcriptional output. Although pY37-H2B is readily detected in cancer cells, its functional role in pathogenesis is not known. Herein, we show that WEE1 deposits the pY37-H2B marks within the tumor suppressor gene, isocitrate dehydrogenase 2 ( IDH2 ), to repress transcription in multiple cancer cells, including glioblastoma multiforme (GBMs), melanoma and prostate cancer. Consistently, GBMs and primary melanoma tumors that display elevated WEE1 mRNA expression exhibit significant down regulation of the IDH2 gene transcription. IDH2 catalyzes the oxidative decarboxylation of isocitrate to α-ketoglutarate (α-KG), an essential cofactor for the TET family of 5-methylcytosine (5mC) hydroxylases that convert 5-mC to 5-hydroxymethylcytosine (5-hmC). Significantly, the WEE1 inhibitor AZD1775 not only abrogated the suppressive H2B Y37-phosphorylation and upregulated IDH2 mRNA levels but also effectively reversed the 'loss of 5-hmC' phenotype in melanomas, GBMs and prostate cancer cells, as well as melanoma xenograft tumors. These data indicate that the epigenetic repression of IDH2 by WEE1/pY37-H2B circuit may be a hitherto unknown mechanism of global 5-hmC loss observed in human malignancies.

  6. Genome-wide Analysis of Gene Regulation

    DEFF Research Database (Denmark)

    Chen, Yun

    cells are capable of regulating their gene expression, so that each cell can only express a particular set of genes yielding limited numbers of proteins with specialized functions. Therefore a rigid control of differential gene expression is necessary for cellular diversity. On the other hand, aberrant...... gene regulation will disrupt the cell’s fundamental processes, which in turn can cause disease. Hence, understanding gene regulation is essential for deciphering the code of life. Along with the development of high throughput sequencing (HTS) technology and the subsequent large-scale data analysis......, genome-wide assays have increased our understanding of gene regulation significantly. This thesis describes the integration and analysis of HTS data across different important aspects of gene regulation. Gene expression can be regulated at different stages when the genetic information is passed from gene...

  7. QB1 - Stochastic Gene Regulation

    Energy Technology Data Exchange (ETDEWEB)

    Munsky, Brian [Los Alamos National Laboratory

    2012-07-23

    Summaries of this presentation are: (1) Stochastic fluctuations or 'noise' is present in the cell - Random motion and competition between reactants, Low copy, quantization of reactants, Upstream processes; (2) Fluctuations may be very important - Cell-to-cell variability, Cell fate decisions (switches), Signal amplification or damping, stochastic resonances; and (3) Some tools are available to mode these - Kinetic Monte Carlo simulations (SSA and variants), Moment approximation methods, Finite State Projection. We will see how modeling these reactions can tell us more about the underlying processes of gene regulation.

  8. Mathematical Models of Gene Regulation

    Science.gov (United States)

    Mackey, Michael C.

    2004-03-01

    This talk will focus on examples of mathematical models for the regulation of repressible operons (e.g. the tryptophan operon), inducible operons (e.g. the lactose operon), and the lysis/lysogeny switch in phage λ. These ``simple" gene regulatory elements can display characteristics experimentally of rapid response to perturbations and bistability, and biologically accurate mathematical models capture these aspects of the dynamics. The models, if realistic, are always nonlinear and contain significant time delays due to transcriptional and translational delays that pose substantial problems for the analysis of the possible ranges of dynamics.

  9. Path dependence and independent utility regulation

    DEFF Research Database (Denmark)

    Ibsen, Christian Lyhne; Skovgaard Poulsen, Lauge

    2007-01-01

    capable of influencing regulation in their interest. This condition made DERA relatively dependent on commercial interests compared to NITA. In contrast, the state had an early interest in controlling and regulating telecommunications services, which meant strong control of the telecommunications...... companies and a regulation contingent upon political interests that has continued to this day. We therefore suggest that sector-specific institutional processes have caused differences between the regulatory institutions mediating the influence of the EU....

  10. Age dependent differences in the regulation of hippocampal steroid hormones and receptor genes: relations to motivation and cognition in male rats.

    Science.gov (United States)

    Meyer, K; Korz, V

    2013-02-01

    Estrogen and estrogenic functions are age-dependently involved in the modulation of learning, memory and mood in female humans and animals. However, the investigation of estrogenic effects in males has been largely neglected. Therefore, we investigated the hippocampal gene expression of estrogen receptors α and β (ERα, β) in 8-week-old, 12-week-old and 24-week-old male rats. To control for possible interactions between the expression of the estrogen receptor genes and other learning-related steroid receptors, androgen receptors (AR), corticosterone-binding glucocorticoid receptors (GR) and mineralocorticoid receptors (MR) were also measured. Furthermore, the concentrations of the ligands 17β-estradiol, testosterone and corticosterone were measured. The spatial training was conducted in a hole-board. The 8-week-old rats exhibited higher levels of general activity and exploration during the training and performed best with respect to spatial learning and memory, whereas no difference was found between the 12-week-old and 24-week-old rats. The trained 8-week-old rats exhibited increased gene expression of ERα compared with the untrained rats in this age group as well as the trained 12-week-old and 24-week-old rats. The concentrations of estradiol and testosterone, however, were generally higher in the 24-week-old rats than in the 8-week-old and 12-week-old rats. The ERα mRNA concentrations correlated positively with behavior that indicate general learning motivation. These results suggest a specific role of ERα in the age-related differences in motivation and subsequent success in the task. Thus, estrogen and estrogenic functions may play a more prominent role in young male behavior and development than has been previously assumed. Copyright © 2012 Elsevier Inc. All rights reserved.

  11. Dynamics of bacterial gene regulation

    Science.gov (United States)

    Narang, Atul

    2009-03-01

    The phenomenon of diauxic growth is a classical problem of bacterial gene regulation. The most well studied example of this phenomenon is the glucose-lactose diauxie, which occurs because the expression of the lac operon is strongly repressed in the presence of glucose. This repression is often explained by appealing to molecular mechanisms such as cAMP activation and inducer exclusion. I will begin by analyzing data showing that these molecular mechanisms cannot explain the strong lac repression because they exert a relatively weak effect. I will then present a minimal model accounting only for enzyme induction and dilution, which yields strong repression despite the absence of catabolite repression and inducer exclusion. The model also explains the growth patterns observed in batch and continuous cultures of various bacterial strains and substrate mixtures. The talk will conclude with a discussion of the experimental evidence regarding positive feedback, the key component of the minimal model.

  12. Regulation of methane genes and genome expression

    Energy Technology Data Exchange (ETDEWEB)

    John N. Reeve

    2009-09-09

    At the start of this project, it was known that methanogens were Archaeabacteria (now Archaea) and were therefore predicted to have gene expression and regulatory systems different from Bacteria, but few of the molecular biology details were established. The goals were then to establish the structures and organizations of genes in methanogens, and to develop the genetic technologies needed to investigate and dissect methanogen gene expression and regulation in vivo. By cloning and sequencing, we established the gene and operon structures of all of the “methane” genes that encode the enzymes that catalyze methane biosynthesis from carbon dioxide and hydrogen. This work identified unique sequences in the methane gene that we designated mcrA, that encodes the largest subunit of methyl-coenzyme M reductase, that could be used to identify methanogen DNA and establish methanogen phylogenetic relationships. McrA sequences are now the accepted standard and used extensively as hybridization probes to identify and quantify methanogens in environmental research. With the methane genes in hand, we used northern blot and then later whole-genome microarray hybridization analyses to establish how growth phase and substrate availability regulated methane gene expression in Methanobacterium thermautotrophicus ΔH (now Methanothermobacter thermautotrophicus). Isoenzymes or pairs of functionally equivalent enzymes catalyze several steps in the hydrogen-dependent reduction of carbon dioxide to methane. We established that hydrogen availability determine which of these pairs of methane genes is expressed and therefore which of the alternative enzymes is employed to catalyze methane biosynthesis under different environmental conditions. As were unable to establish a reliable genetic system for M. thermautotrophicus, we developed in vitro transcription as an alternative system to investigate methanogen gene expression and regulation. This led to the discovery that an archaeal protein

  13. Epigenetic Regulation of Higher Order Chromatin Conformations and Gene Transcription

    OpenAIRE

    Göndör, Anita

    2007-01-01

    Epigenetic states constitute heritable features of the chromatin to regulate when, where and how genes are expressed in the developing conceptus. A special case of epigenetic regulation, genomic imprinting, is defined as parent of origin-dependent monoallelic expression. The Igf2-H19 locus is considered as paradigm of genomic imprinting with a growth-promoting gene, Igf2, expressed paternally and a growth antagonist, H19 encoding a non-coding transcript, expressed only from the maternal allel...

  14. The gdhB gene of Pseudomonas aeruginosa encodes an arginine-inducible NAD(+)-dependent glutamate dehydrogenase which is subject to allosteric regulation.

    Science.gov (United States)

    Lu, C D; Abdelal, A T

    2001-01-01

    The NAD(+)-dependent glutamate dehydrogenase (NAD-GDH) from Pseudomonas aeruginosa PAO1 was purified, and its amino-terminal amino acid sequence was determined. This sequence information was used in identifying and cloning the encoding gdhB gene and its flanking regions. The molecular mass predicted from the derived sequence for the encoded NAD-GDH was 182.6 kDa, in close agreement with that determined from sodium dodecyl sulfate-polyacrylamide gel electrophoresis of the purified enzyme (180 kDa). Cross-linking studies established that the native NAD-GDH is a tetramer of equal subunits. Comparison of the derived amino acid sequence of NAD-GDH from P. aeruginosa with the GenBank database showed the highest homology with hypothetical polypeptides from Pseudomonas putida, Mycobacterium tuberculosis, Rickettsia prowazakii, Legionella pneumophila, Vibrio cholerae, Shewanella putrefaciens, Sinorhizobium meliloti, and Caulobacter crescentus. A moderate degree of homology, primarily in the central domain, was observed with the smaller tetrameric NAD-GDH (protomeric mass of 110 kDa) from Saccharomyces cerevisiae or Neurospora crassa. Comparison with the yet smaller hexameric GDH (protomeric mass of 48 to 55 kDa) of other prokaryotes yielded a low degree of homology that was limited to residues important for binding of substrates and for catalytic function. NAD-GDH was induced 27-fold by exogenous arginine and only 3-fold by exogenous glutamate. Primer extension experiments established that transcription of gdhB is initiated from an arginine-inducible promoter and that this induction is dependent on the arginine regulatory protein, ArgR, a member of the AraC/XyIS family of regulatory proteins. NAD-GDH was purified to homogeneity from a recombinant strain of P. aeruginosa and characterized. The glutamate saturation curve was sigmoid, indicating positive cooperativity in the binding of glutamate. NAD-GDH activity was subject to allosteric control by arginine and citrate, which

  15. Counteraction of Oxidative Stress by Vitamin E Affects Epigenetic Regulation by Increasing Global Methylation and Gene Expression of MLH1 and DNMT1 Dose Dependently in Caco-2 Cells

    Directory of Open Access Journals (Sweden)

    Katja Zappe

    2018-01-01

    Full Text Available Obesity- or diabetes-induced oxidative stress is discussed as a major risk factor for DNA damage. Vitamin E and many polyphenols exhibit antioxidative activities with consequences on epigenetic regulation of inflammation and DNA repair. The present study investigated the counteraction of oxidative stress by vitamin E in the colorectal cancer cell line Caco-2 under normal (1 g/l and high (4.5 g/l glucose cell culture condition. Malondialdehyde (MDA as a surrogate marker of lipid peroxidation and reactive oxygen species (ROS was analyzed. Gene expression and promoter methylation of the DNA repair gene MutL homolog 1 (MLH1 and the DNA methyltransferase 1 (DNMT1 as well as global methylation by LINE-1 were investigated. Results revealed a dose-dependent counteracting effect of vitamin E on H2O2-induced oxidative stress. Thereby, 10 μM vitamin E proved to be more efficient than did 50 μM in reducing MDA. Further, an induction of MLH1 and DNMT1 gene expression was noticed, accompanied by an increase in global methylation. Whether LINE-1 hypomethylation is a cause or effect of oxidative stress is still unclear. In conclusion, supplementation of exogenous antioxidants like vitamin E in vitro exhibits beneficial effects concerning oxidative stress as well as epigenetic regulation involved in DNA repair.

  16. QTLminer: identifying genes regulating quantitative traits

    Directory of Open Access Journals (Sweden)

    Schughart Klaus

    2010-10-01

    Full Text Available Abstract Background Quantitative trait locus (QTL mapping identifies genomic regions that likely contain genes regulating a quantitative trait. However, QTL regions may encompass tens to hundreds of genes. To find the most promising candidate genes that regulate the trait, the biologist typically collects information from multiple resources about the genes in the QTL interval. This process is very laborious and time consuming. Results QTLminer is a bioinformatics tool that automatically performs QTL region analysis. It is available in GeneNetwork and it integrates information such as gene annotation, gene expression and sequence polymorphisms for all the genes within a given genomic interval. Conclusions QTLminer substantially speeds up discovery of the most promising candidate genes within a QTL region.

  17. Human glucagon gene promoter sequences regulating tissue-specific versus nutrient-regulated gene expression.

    Science.gov (United States)

    Nian, Min; Gu, Jun; Irwin, David M; Drucker, Daniel J

    2002-01-01

    The glucagon-like peptides (GLPs) are synthesized and secreted in a nutrient-dependent manner in rodents; however, the factors regulating human GLP-1 and GLP-2 biosynthesis remain unclear. To understand how nutrients regulate human proglucagon gene expression, we studied the expression of a human proglucagon promoter-growth hormone (GH) transgene in 1.6 human glucagon-GH transgenic mice. Fasting-refeeding significantly decreased and increased the levels of circulating mouse insulin and transgene-derived hGH (P fasting vs. refeeding) and decreased and upregulated, respectively, the levels of endogenous mouse proglucagon RNA in the ileum but not in the jejunum or colon. High-fiber feeding significantly increased the levels of glucose-stimulated circulating hGH and upregulated levels of mouse intestinal proglucagon gene expression in the jejunum, ileum, and colon (P fasting-refeeding nor a high-fiber diet upregulated the expression of the human proglucagon promoter-hGH transgene. These findings demonstrate that human proglucagon gene regulatory sequences specifying tissue-specific expression in gut endocrine cells are not sufficient for recognition of energy-derived signals regulating murine glucagon gene expression in enteroendocrine cells in vivo.

  18. Gene expression regulation of the TLR9 and MyD88-dependent pathways in rock bream against rock bream iridovirus (RBIV) infection.

    Science.gov (United States)

    Jung, Myung-Hwa; Jung, Sung-Ju

    2017-11-01

    Rock bream iridovirus (RBIV), which is a member of the Megalocytivirus genus, causes severe mass mortalities in rock bream in Korea. To date, the innate immune defense mechanisms of rock bream against RBIV is unclear. In this study, we assessed the expression levels of genes related to TLR9 and MyD88-dependent pathways in RBIV-infected rock bream in high, low or no mortality conditions. In the high mortality group (100% mortality at 15 days post infection (dpi)), high levels of TLR9 and MyD88 expressions (6.4- and 2.4-fold, respectively) were observed at 8 d and then reduced (0.6- and 0.1-fold, respectively) with heavy viral loads at 10 dpi (2.21 × 10 7 /μl). Moreover, TRAF6, IRF5, IL1β, IL8, IL12 and TNFα expression levels showed no statistical significance until 10 dpi. Conversely, in the low mortality group (28% expected mortality at 35 dpi), TLR9, MyD88 and TRAF6 expression levels were significantly higher than those in the control group at several sampling points until 30 dpi. Higher levels of IRF5, IL1β, IL8, IL12 and TNFα expression were also observed, however, these were not significantly different from those of the control group. In the no mortality group (0% mortality at 40 dpi), significantly higher levels of MyD88 (2 d, 4 d and 40 dpi), TRAF6 (2 dpi), IL1β (4 dpi) and IL8 (2 d and 4 dpi) expression were observed. In summary, RBIV-infected rock bream induces innate immune response, which could be a major contributing factor to effective fish control over viral transcription. MyD88, TRAF6, IL1β and IL8-related immune responses were activated in fish survivor condition (low or no mortality group). This is a critical factor for RBIV disease recovery; however, these immune responses did not efficiently respond in fish dead condition (high mortality group). Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. The MAPK-dependent regulation of the Jagged/Notch gene expression by VEGF, bFGF or PPAR gamma mediated angiogenesis in HUVEC

    DEFF Research Database (Denmark)

    Kiec-Wilk, B; Grzybowska-Galuszka, J; Polus, A

    2010-01-01

    The Jagged-Notch signalling, plays a crucial role in cell differentiation. Angiogenesis, is regulated by VEGF, bFGF as well as by the free fatty acid metabolites , which are regulators of transcription factors such as peroxisome proliferation activating receptors (PPARs). The study analyzed the s...

  20. Expression profiling of genes regulated by TGF-beta: Differential regulation in normal and tumour cells

    Directory of Open Access Journals (Sweden)

    Takahashi Takashi

    2007-04-01

    Full Text Available Abstract Background TGF-beta is one of the key cytokines implicated in various disease processes including cancer. TGF-beta inhibits growth and promotes apoptosis in normal epithelial cells and in contrast, acts as a pro-tumour cytokine by promoting tumour angiogenesis, immune-escape and metastasis. It is not clear if various actions of TGF-beta on normal and tumour cells are due to differential gene regulations. Hence we studied the regulation of gene expression by TGF-beta in normal and cancer cells. Results Using human 19 K cDNA microarrays, we show that 1757 genes are exclusively regulated by TGF-beta in A549 cells in contrast to 733 genes exclusively regulated in HPL1D cells. In addition, 267 genes are commonly regulated in both the cell-lines. Semi-quantitative and real-time qRT-PCR analysis of some genes agrees with the microarray data. In order to identify the signalling pathways that influence TGF-beta mediated gene regulation, we used specific inhibitors of p38 MAP kinase, ERK kinase, JNK kinase and integrin signalling pathways. The data suggest that regulation of majority of the selected genes is dependent on at least one of these pathways and this dependence is cell-type specific. Interestingly, an integrin pathway inhibitor, RGD peptide, significantly affected TGF-beta regulation of Thrombospondin 1 in A549 cells. Conclusion These data suggest major differences with respect to TGF-beta mediated gene regulation in normal and transformed cells and significant role of non-canonical TGF-beta pathways in the regulation of many genes by TGF-beta.

  1. Identification of let-7-regulated oncofetal genes

    DEFF Research Database (Denmark)

    Boyerinas, Benjamin; Park, Sun-Mi; Shomron, Noam

    2008-01-01

    -regulated at the end of embryonic development. Let-7 is often down-regulated early during cancer development, suggesting that let-7-regulated oncofetal genes (LOG) may become reexpressed in cancer cells. Using comparative bioinformatics, we have identified 12 conserved LOGs that include HMGA2 and IMP-1/CRD-BP. IMP-1...

  2. Amino acids regulate hepatic intermediary metabolism-related gene expression via mTORC1-dependent manner in rainbow trout (Oncorhynchus mykiss)

    OpenAIRE

    Dai, Wei Wei

    2015-01-01

    During my doctoral study, we used rainbow trout, a representative carnivorous fish and relevant diabetic model, to study the mechanisms underlying the regulation of hepatic intermediary metabolism by nutrients (amino acids (AAs) and glucose), and determine the potential involvement of insulin/Akt and mTORC1 signaling pathways in these regulations. Using acute administration of rapamycin, a pharmacological inhibitor of TOR, we first identified that mTORC1 activation promotes the expression of ...

  3. Nrf2-dependent gene expressions: a molecular toxicological aspect.

    Science.gov (United States)

    Numazawa, Satoshi; Yoshida, Takemi

    2004-05-01

    Although NF-E2 related factor 2 (Nrf2) was found to be a transcriptional regulator that controls an expression of the beta-globin gene, the notion is now widely accepted that this transfactor serves as a master regulator for the gene expression of a battery of proteins acting on anti-oxidative stress and detoxification of electrophiles. The function of Nrf2 that bears transcriptional activation depends solely on its nuclear localization, which is regulated by interaction with the cytosolic anchor protein Keap1 and its own turnover rate. In the present mini-review, we focus on the regulation of Nrf2 function and discuss the physiological and toxicological aspects of this transcriptional factor.

  4. Differential age-dependent import regulation by signal peptides.

    Directory of Open Access Journals (Sweden)

    Yi-Shan Teng

    Full Text Available Gene-specific, age-dependent regulations are common at the transcriptional and translational levels, while protein transport into organelles is generally thought to be constitutive. Here we report a new level of differential age-dependent regulation and show that chloroplast proteins are divided into three age-selective groups: group I proteins have a higher import efficiency into younger chloroplasts, import of group II proteins is nearly independent of chloroplast age, and group III proteins are preferentially imported into older chloroplasts. The age-selective signal is located within the transit peptide of each protein. A group III protein with its transit peptide replaced by a group I transit peptide failed to complement its own mutation. Two consecutive positive charges define the necessary motif in group III signals for older chloroplast preference. We further show that different members of a gene family often belong to different age-selective groups because of sequence differences in their transit peptides. These results indicate that organelle-targeting signal peptides are part of cells' differential age-dependent regulation networks. The sequence diversity of some organelle-targeting peptides is not a result of the lack of selection pressure but has evolved to mediate regulation.

  5. Ascorbic acid-dependent gene expression in Streptococcus pneumoniae and the activator function of the transcriptional regulator UlaR2

    NARCIS (Netherlands)

    Afzal, Muhammad; Shafeeq, Sulman; Kuipers, Oscar P

    2015-01-01

    In this study, we have explored the impact of ascorbic acid on the transcriptome of Streptococcus pneumoniae D39. The expression of several genes and operons, including the ula operon (which has been previously shown to be involved in ascorbic acid utilization), the AdcR regulon (which has been

  6. The interplay of StyR and IHF regulates substrate-dependent induction and carbon catabolite repression of styrene catabolism genes in Pseudomonas fluorescens ST

    Directory of Open Access Journals (Sweden)

    Leoni Livia

    2008-06-01

    Full Text Available Abstract Background In Pseudomonas fluorescens ST, the promoter of the styrene catabolic operon, PstyA, is induced by styrene and is subject to catabolite repression. PstyA regulation relies on the StyS/StyR two-component system and on the IHF global regulator. The phosphorylated response regulator StyR (StyR-P activates PstyA in inducing conditions when it binds to the high-affinity site STY2, located about -40 bp from the transcription start point. A cis-acting element upstream of STY2, named URE, contains a low-affinity StyR-P binding site (STY1, overlapping the IHF binding site. Deletion of the URE led to a decrease of promoter activity in inducing conditions and to a partial release of catabolite repression. This study was undertaken to assess the relative role played by IHF and StyR-P on the URE, and to clarify if PstyA catabolite repression could rely on the interplay of these regulators. Results StyR-P and IHF compete for binding to the URE region. PstyA full activity in inducing conditions is achieved when StyR-P and IHF bind to site STY2 and to the URE, respectively. Under catabolite repression conditions, StyR-P binds the STY1 site, replacing IHF at the URE region. StyR-P bound to both STY1 and STY2 sites oligomerizes, likely promoting the formation of a DNA loop that closes the promoter in a repressed conformation. We found that StyR and IHF protein levels did not change in catabolite repression conditions, implying that PstyA repression is achieved through an increase in the StyR-P/StyR ratio. Conclusion We propose a model according to which the activity of the PstyA promoter is determined by conformational changes. An open conformation is operative in inducing conditions when StyR-P is bound to STY2 site and IHF to the URE. Under catabolite repression conditions StyR-P cellular levels would increase, displacing IHF from the URE and closing the promoter in a repressed conformation. The balance between the open and the closed

  7. The TLR4 D299G and T399I SNPs are constitutively active to up-regulate expression of Trif-dependent genes.

    Directory of Open Access Journals (Sweden)

    Georgina L Hold

    Full Text Available Dysregulated Toll-Like Receptor (TLR signalling and genetic polymorphisms in these proteins are linked to many human diseases. We investigated TLR4 functional variants D299G and T399I to assess the impact on LPS-induced responsiveness in comparison to wild-type TLR4. The mechanism by which this occurs in unclear as these SNPs do not lie within the lipid A binding domain or dimerisation sites of the LPS-TLR4/MD2 receptor complexes. Transfection of TLR4D299G, TLR4T399I or TLR4D299G. T399I into HEK cells resulted in constitutive activation of an NF-κB reporter gene and a blunting of the LPS-induced reporter activation compared to WT-TLR4. Unstimulated human monocyte/macrophages, from patients with the D299G and T399I SNPs demonstrated a downregulation of many genes, particularly Tram/Trif signalling pathway constitutents compared to the TLR4 wild-type subjects supporting the concept of basal receptor activity. Monocyte/macrophages from carriers of the TLR4 D299G and T399I polymorphisms stimulated with LPS showed >6 fold lower levels of NF-κB and ∼12 fold higher IFN-β gene expression levels compared to wild-type subjects (P<0.05; MWU test and dramatically altered resultant cytokine profiles. We conclude that these TLR4 SNPs affect constitutive receptor activity which impacts on the hosts ability to respond to LPS challenge leading to a dysregulated sub-optimal immune response to infection.

  8. Expression of c-type lysozyme gene in sea cucumber (Apostichopus japonicus) is highly regulated and time dependent after salt stress.

    Science.gov (United States)

    Tian, Yi; Liang, Xue-Wang; Chang, Ya-Qing; Song, Jian

    2015-02-01

    Lysozymes have been confirmed to possess varieties of functions in a range of organisms. In the present study, we cloned and sequenced c-type lysozyme cDNAs, constructed the recombinant protein over-expression of c-type lysozyme and analyzed the expression of transcription level in various tissues. The c-type lysozyme cDNA contained an open reading frame of 759 bp encoding a polypeptide of 252 amino acids. The molecular weight of the deduced amino acid of AjcLYZ is 26.7 kDa with an estimated pI of 4.66. Multiple sequence alignments revealed that AjcLYZ had two highly conserved active sites (Glu147 and Asp159) and eight typical Cys residues. The tertiary structure and modeled AjcLYZ showed structural similarity to Meretrix lusoria LYZ. The results of mRNA transcripts showed that the highest expression was found in the tube foot, followed by the muscle, body wall, and coelomic fluid. In contrast, the intestine, tentacle and respiratory tree exhibited very low expression levels. Under salinity stress, significant down-regulation of AjcLYZ was observed in response to salinity stress in the intestine and coelomic fluid. Significant up-regulation and down-regulation of AjcLYZ were observed in response to salinity stress in body wall and respiratory tree. The purified recombinant protein was analyzed by SDS-PAGE and a single band with a molecular mass of 45.09 kDa, which was in agreement with the theoretical size (26.7 kDa for AjcLYZ and 18.39 kDa Trx-His-S tags) of the recombinant protein. Radial diffusion assay was employed to determine the antimicrobial spectrum of recombinant AjcLYZ against three Gram-positive and Gram-negative bacteria, and three sea cucumber pathogenic Vibrio species. From the radius of the antimicrobial zone, it was found that recombinant AjcLYZ harbored remarkable in vitro inhibitive effect on tested Gram-positive bacteria, while lytic activity against Gram-negative bacteria was relatively weak. The results will provide new clues about the

  9. Divergent regulation of Arabidopsis SAUR genes

    NARCIS (Netherlands)

    Mourik, van Hilda; Dijk, van Aalt D.J.; Stortenbeker, Niek; Angenent, Gerco C.; Bemer, Marian

    2017-01-01

    Background: Small Auxin-Upregulated RNA (SAUR) genes encode growth regulators that induce cell elongation. Arabidopsis contains more than 70 SAUR genes, of which the growth-promoting function has been unveiled in seedlings, while their role in other tissues remained largely unknown. Here, we

  10. Copper Regulates Cyclic AMP-Dependent Lipolysis

    Science.gov (United States)

    Krishnamoorthy, Lakshmi; Cotruvo, Joseph A.; Chan, Jefferson; Kaluarachchi, Harini; Muchenditsi, Abigael; Pendyala, Venkata S.; Jia, Shang; Aron, Allegra T.; Ackerman, Cheri M.; Vander Wal, Mark N.; Guan, Timothy; Smaga, Lukas P.; Farhi, Samouil L.; New, Elizabeth J.; Lutsenko, Svetlana; Chang, Christopher J.

    2016-01-01

    Cell signaling relies extensively on dynamic pools of redox-inactive metal ions such as sodium, potassium, calcium, and zinc, but their redox-active transition metal counterparts such as copper and iron have been studied primarily as static enzyme cofactors. Here we report that copper is an endogenous regulator of lipolysis, the breakdown of fat, which is an essential process in maintaining the body's weight and energy stores. Utilizing a murine model of genetic copper misregulation, in combination with pharmacological alterations in copper status and imaging studies in a 3T3-L1 white adipocyte model, we demonstrate that copper regulates lipolysis at the level of the second messenger, cyclic AMP (cAMP), by altering the activity of the cAMP-degrading phosphodiesterase PDE3B. Biochemical studies of the copper-PDE3B interaction establish copper-dependent inhibition of enzyme activity and identify a key conserved cysteine residue within a PDE3-specific loop that is essential for the observed copper-dependent lipolytic phenotype. PMID:27272565

  11. Small RNA regulation of rice homeobox genes.

    Science.gov (United States)

    Jain, Mukesh; Khurana, Jitendra P

    2008-11-01

    Recently, we reported the genome-wide identification of 107 homeobox genes in rice and classified them into ten distinct subfamilies based upon their domain composition and phylogenetic analysis. Microarray analysis revealed the tissue-specific and overlapping expression profiles of these genes during various stages of floral transition, panicle development and seed set. Several homeobox genes were also found to be differentially expressed under abiotic stress conditions. Based on massively parallel signature sequencing (MPSS) data analysis, we report here that a large number of small RNA signatures are associated with rice homeobox genes, which may be involved in their tissue-specific/developmental regulation and stress responses. The association of a very large number of small RNA signatures suggested an unusually high degree of regulation of homeobox genes by small RNAs during inflorescence development.

  12. Glucose Regulates the Expression of the Apolipoprotein A5 Gene

    Energy Technology Data Exchange (ETDEWEB)

    Fruchart, Jamila; Nowak, Maxime; Helleboid-Chapman, Audrey; Jakel, Heidelinde; Moitrot, Emmanuelle; Rommens, Corinne; Pennacchio, Len A.; Fruchart-Najib, Jamila; Fruchart, Jean-Charles

    2008-04-07

    The apolipoprotein A5 gene (APOA5) is a key player in determining triglyceride concentrations in humans and mice. Since diabetes is often associated with hypertriglyceridemia, this study explores whether APOA5 gene expression is regulated by alteration in glucose homeostasis and the related pathways. D-glucose activates APOA5 gene expression in a time- and dose-dependent manner in hepatocytes, and the glycolytic pathway involved was determined using D-glucose analogs and metabolites. Together, transient transfections, electrophoretic mobility shift assays and chromatin immunoprecipitation assays show that this regulation occurs at the transcriptional level through an increase of USF1/2 binding to an E-box in the APOA5 promoter. We show that this phenomenon is not due to an increase of mRNA or protein expression levels of USF. Using protein phosphatases 1 and 2A inhibitor, we demonstrate that D-glucose regulates APOA5 gene via a dephosphorylation mechanism, thereby resulting in an enhanced USF1/2-promoter binding. Last, subsequent suppressions of USF1/2 and phosphatases mRNA through siRNA gene silencing abolished the regulation. We demonstrate that APOA5 gene is up regulated by D-glucose and USF through phosphatase activation. These findings may provide a new cross talk between glucose and lipid metabolism.

  13. Gene regulation by steroid hormones III

    Energy Technology Data Exchange (ETDEWEB)

    Roy, A.K.; Clark, J.H.

    1987-01-01

    In this book, the authors discuss the latest advances in molecular endocrinology: - steroid receptor binding to DNA sequences of hormonally controlled genes, - structure of genes controlled by steroid hormones, - heterogeneity of steroid receptors, - immunochemical approaches to receptor studies, and - the most recent approaches to steroid hormone action and biological response. The Contents discussed are: Biochemical Evidence for the Exclusive Nuclear Localization of the Estrogen Receptor. - Structure, Dynamics, and Cloning of the Estrogen Receptor. - Structure, Dynamics, and Cloning of the Estrogen Receptor - Physical and Functional Parameters of Isolated Estrogen Receptor - Type II Binding Sites: Cellular Origin and an Endogeneous Ligand. - The Two Phosphorylation Reactions of the Progesterone Receptor. - Receptor Mediated Action of the Vitamin D Hormone. - Characterization of the Nuclear Binding Sites (Acceptor Sites) for a Steroid Receptor. Antibodies in Estrogen, Progesterone, Glucocorticoid, Vitamin D Receptors and Autoantibodies to Antrogene Receptor. - Isolation and Characterization of cDNA probes for Human CBG and Rat ABP. Ornithine Decarboxy lase mRNAs in Murine Kidney: Structure and Regulation by Androgens - Glucocorticoid Receptors and the Control of Gene Expression. - Activation and Regulation of the Vitellogenin Gene Family. - Intra- and Intercellular Aspects of the Hormonal Regulation of the ..cap alpha..2..mu.. Globulin Gene Expression. - Hormonal Regulation of Sexually Differentiated Isozymes of Cytochrome P-450 in Rat Liver. - Interaction of Thyroid Hormone and Carbohydrates on Hepatic Gene Expression.

  14. A copula method for modeling directional dependence of genes

    Directory of Open Access Journals (Sweden)

    Park Changyi

    2008-05-01

    our results with those from other methods in the literature. Although microarray results show a transcriptional co-regulation pattern and do not imply that the gene products are physically interactive, this tight genetic connection may suggest that each gene product has either direct or indirect connections between the other gene products. Indeed, recent comprehensive analysis of a protein interaction map revealed that those histone genes are physically connected with each other, supporting the results obtained by our method. Conclusion The results illustrate that our method can be an alternative to Bayesian networks in modeling gene interactions. One advantage of our approach is that dependence between genes is not assumed to be linear. Another advantage is that our approach can detect directional dependence. We expect that our study may help to design artificial drug candidates, which can block or activate biologically meaningful pathways. Moreover, our copula approach can be extended to investigate the effects of local environments on protein-protein interactions. The copula mutual information approach will help to propose the new variant of ARACNE (Algorithm for the Reconstruction of Accurate Cellular Networks: an algorithm for the reconstruction of gene regulatory networks.

  15. Path dependence and independent utility regulation

    DEFF Research Database (Denmark)

    Ibsen, Christian Lyhne; Skovgaard Poulsen, Lauge

    2007-01-01

    The establishment of the Danish independent regulatory authorities for the energy and telecommunications sectors was based upon EU directives as part of their liberalisation process. Following the concepts of transaction costs and path dependency this article analyses differences in independence...... between the two authorities - the Danish Energy Regulatory Authority (Energitilsynet) and the National IT and Telecommunications Agency (IT- og Telestyrelsen) respectively. We find that the state's negligible interest in the energy sector until the 1970s formed the basis for strong energy companies...... companies and a regulation contingent upon political interests that has continued to this day. We therefore suggest that sector-specific institutional processes have caused differences between the regulatory institutions mediating the influence of the EU....

  16. Inferring Gene Regulatory Networks Using Conditional Regulation Pattern to Guide Candidate Genes.

    Directory of Open Access Journals (Sweden)

    Fei Xiao

    Full Text Available Combining path consistency (PC algorithms with conditional mutual information (CMI are widely used in reconstruction of gene regulatory networks. CMI has many advantages over Pearson correlation coefficient in measuring non-linear dependence to infer gene regulatory networks. It can also discriminate the direct regulations from indirect ones. However, it is still a challenge to select the conditional genes in an optimal way, which affects the performance and computation complexity of the PC algorithm. In this study, we develop a novel conditional mutual information-based algorithm, namely RPNI (Regulation Pattern based Network Inference, to infer gene regulatory networks. For conditional gene selection, we define the co-regulation pattern, indirect-regulation pattern and mixture-regulation pattern as three candidate patterns to guide the selection of candidate genes. To demonstrate the potential of our algorithm, we apply it to gene expression data from DREAM challenge. Experimental results show that RPNI outperforms existing conditional mutual information-based methods in both accuracy and time complexity for different sizes of gene samples. Furthermore, the robustness of our algorithm is demonstrated by noisy interference analysis using different types of noise.

  17. FOXO-dependent regulation of innate immune homeostasis.

    Science.gov (United States)

    Becker, Thomas; Loch, Gerrit; Beyer, Marc; Zinke, Ingo; Aschenbrenner, Anna C; Carrera, Pilar; Inhester, Therese; Schultze, Joachim L; Hoch, Michael

    2010-01-21

    The innate immune system represents an ancient host defence mechanism that protects against invading microorganisms. An important class of immune effector molecules to fight pathogen infections are antimicrobial peptides (AMPs) that are produced in plants and animals. In Drosophila, the induction of AMPs in response to infection is regulated through the activation of the evolutionarily conserved Toll and immune deficiency (IMD) pathways. Here we show that AMP activation can be achieved independently of these immunoregulatory pathways by the transcription factor FOXO, a key regulator of stress resistance, metabolism and ageing. In non-infected animals, AMP genes are activated in response to nuclear FOXO activity when induced by starvation, using insulin signalling mutants, or by applying small molecule inhibitors. AMP induction is lost in foxo null mutants but enhanced when FOXO is overexpressed. Expression of AMP genes in response to FOXO activity can also be triggered in animals unable to respond to immune challenges due to defects in both the Toll and IMD pathways. Molecular experiments at the Drosomycin promoter indicate that FOXO directly binds to its regulatory region, thereby inducing its transcription. In vivo studies in Drosophila, but also studies in human lung, gut, kidney and skin cells indicate that a FOXO-dependent regulation of AMPs is evolutionarily conserved. Our results indicate a new mechanism of cross-regulation of metabolism and innate immunity by which AMP genes can be activated under normal physiological conditions in response to the oscillating energy status of cells and tissues. This regulation seems to be independent of the pathogen-responsive innate immunity pathways whose activation is often associated with tissue damage and repair. The sparse production of AMPs in epithelial tissues in response to FOXO may help modulating the defence reaction without harming the host tissues, in particular when animals are suffering from energy shortage

  18. Repositioning-dependent fate of duplicate genes.

    Science.gov (United States)

    Rodin, Sergei N; Parkhomchuk, Dmitri V; Rodin, Andrei S; Holmquist, Gerald P; Riggs, Arthur D

    2005-09-01

    Gene duplication is the main source of evolutionary novelties. However, the problem with duplicates is that the purifying selection overlooks deleterious mutations in the redundant sequence, which therefore, instead of gaining a new function, often degrades into a functionless pseudogene. This risk of functional loss instead of gain is much higher for small populations of higher organisms with a slow and complex development. We propose that it is the epigenetic tissue/stage-complementary silencing of duplicates that makes them exposable to the purifying selection, thus saving them from pseudogenization and opening the way towards new function(s). Our genome-wide analyses of gene duplicates in several eukaryotic species combined with the phylogenetic comparison of vertebrate alpha- and beta-globin gene clusters strongly support this epigenetic complementation (EC) model. The distinctive condition for a new duplicate to survive by the EC mechanism seems to be its repositioning to an ectopic site, which is accompanied by changes in the rate and direction of mutagenesis. The most distinguished in this respect is the human genome. In this review, we extend and discuss the data on the EC- and repositioning-dependent fate of gene duplicates with the special emphasis on the problem of detecting brief postduplication period of adaptive evolution driven by positive selection. Accordingly, we propose a new CpG-focused measure of selection that is insensitive to translocation-caused biases in mutagenesis.

  19. Gene regulation by dietary microRNAs.

    Science.gov (United States)

    Zempleni, Janos; Baier, Scott R; Howard, Katherine M; Cui, Juan

    2015-12-01

    MicroRNAs (miRNAs) silence genes through destabilizing mRNA or preventing translation of mRNA, thereby playing an essential role in gene silencing. Traditionally, miRNAs have been considered endogenous regulators of genes, i.e., miRNAs synthesized by an organism regulate the genes in that organism. Recently, that dogma has been challenged in studies suggesting that food-borne miRNAs are bioavailable and affect gene expression in mice and humans. While the evidence in support of this theory may be considered weak for miRNAs that originate in plants, there is compelling evidence to suggest that humans use bovine miRNAs in cow's milk and avian miRNAs in chicken eggs for gene regulation. Importantly, evidence also suggests that mice fed a miRNA-depleted diet cannot compensate for dietary depletion by increased endogenous synthesis. Bioinformatics predictions implicate bovine miRNAs in the regulation of genes that play roles in human health and development. Current challenges in this area of research include that some miRNAs are unable to establish a cause-and-effect between miRNA depletion and disease in miRNA knockout mice, and sequence similarities and identities for bovine and human miRNAs render it difficult to distinguish between exogenous and endogenous miRNAs. Based on what is currently known about dietary miRNAs, the body of evidence appears to be sufficient to consider milk miRNA bioactive compounds in foods, and to increase research activities in this field.

  20. BMP signaling regulates satellite cell-dependent postnatal muscle growth.

    Science.gov (United States)

    Stantzou, Amalia; Schirwis, Elija; Swist, Sandra; Alonso-Martin, Sonia; Polydorou, Ioanna; Zarrouki, Faouzi; Mouisel, Etienne; Beley, Cyriaque; Julien, Anaïs; Le Grand, Fabien; Garcia, Luis; Colnot, Céline; Birchmeier, Carmen; Braun, Thomas; Schuelke, Markus; Relaix, Frédéric; Amthor, Helge

    2017-08-01

    Postnatal growth of skeletal muscle largely depends on the expansion and differentiation of resident stem cells, the so-called satellite cells. Here, we demonstrate that postnatal satellite cells express components of the bone morphogenetic protein (BMP) signaling machinery. Overexpression of noggin in postnatal mice (to antagonize BMP ligands), satellite cell-specific knockout of Alk3 (the gene encoding the BMP transmembrane receptor) or overexpression of inhibitory SMAD6 decreased satellite cell proliferation and accretion during myofiber growth, and ultimately retarded muscle growth. Moreover, reduced BMP signaling diminished the adult satellite cell pool. Abrogation of BMP signaling in satellite cell-derived primary myoblasts strongly diminished cell proliferation and upregulated the expression of cell cycle inhibitors p21 and p57 In conclusion, these results show that BMP signaling defines postnatal muscle development by regulating satellite cell-dependent myofiber growth and the generation of the adult muscle stem cell pool. © 2017. Published by The Company of Biologists Ltd.

  1. Characterization of a Hormone Dependent Module Regulating Energy Balance

    Science.gov (United States)

    Wang, Biao; Moya, Noel; Niessen, Sherry; Hoover, Heather; Mihaylova, Maria M.; Shaw, Reuben J.; Yates, John R.; Fischer, Wolfgang H.; Thomas, John B.; Montminy, Marc

    2011-01-01

    SUMMARY Under fasting conditions, metazoans maintain energy balance by shifting from glucose to fat burning. In the fasted state, SIRT1 promotes catabolic gene expression by deacetylating the forkhead factor FOXO in response to stress and nutrient deprivation. The mechanisms by which hormonal signals regulate FOXO deacetylation remain unclear, however. We identified a hormone-dependent module, consisting of the Ser/Thr kinase SIK3 and the class IIa deacetylase HDAC4, which regulates FOXO activity in Drosophila. During feeding, HDAC4 is phosphorylated and sequestered in the cytoplasm by SIK3, whose activity is upregulated in response to insulin. SIK3 is inactivated during fasting, leading to the de-phosphorylation and nuclear translocation of HDAC4, and to FOXO deacetylation. SIK3 mutant flies are starvation-sensitive, reflecting FOXO-dependent increases in lipolysis that deplete triglyceride stores; reducing HDAC4 expression restored lipid accumulation. Our results reveal a hormone-regulated pathway that functions in parallel with the nutrient-sensing SIRT1 pathway to maintain energy balance. PMID:21565616

  2. A hormone-dependent module regulating energy balance.

    Science.gov (United States)

    Wang, Biao; Moya, Noel; Niessen, Sherry; Hoover, Heather; Mihaylova, Maria M; Shaw, Reuben J; Yates, John R; Fischer, Wolfgang H; Thomas, John B; Montminy, Marc

    2011-05-13

    Under fasting conditions, metazoans maintain energy balance by shifting from glucose to fat burning. In the fasted state, SIRT1 promotes catabolic gene expression by deacetylating the forkhead factor FOXO in response to stress and nutrient deprivation. The mechanisms by which hormonal signals regulate FOXO deacetylation remain unclear, however. We identified a hormone-dependent module, consisting of the Ser/Thr kinase SIK3 and the class IIa deacetylase HDAC4, which regulates FOXO activity in Drosophila. During feeding, HDAC4 is phosphorylated and sequestered in the cytoplasm by SIK3, whose activity is upregulated in response to insulin. SIK3 is inactivated during fasting, leading to the dephosphorylation and nuclear translocation of HDAC4 and to FOXO deacetylation. SIK3 mutant flies are starvation sensitive, reflecting FOXO-dependent increases in lipolysis that deplete triglyceride stores; reducing HDAC4 expression restored lipid accumulation. Our results reveal a hormone-regulated pathway that functions in parallel with the nutrient-sensing SIRT1 pathway to maintain energy balance. Copyright © 2011 Elsevier Inc. All rights reserved.

  3. Expression regulation of design process gene in product design

    DEFF Research Database (Denmark)

    Li, Bo; Fang, Lusheng; Li, Bo

    2011-01-01

    is proposed and analyzed, as well as its three categories i.e., the operator gene, the structural gene and the regulator gene. Second, the trigger mechanism that design objectives and constraints trigger the operator gene is constructed. Third, the expression principle of structural gene is analyzed...... with the example of design management gene. Last, the regulation mode that the regulator gene regulates the expression of the structural gene is established and it is illustrated by taking the design process management gene as an example. © (2011) Trans Tech Publications....

  4. PARP-1 and gene regulation: progress and puzzles.

    Science.gov (United States)

    Kraus, W Lee; Hottiger, Michael O

    2013-12-01

    Poly(ADP-ribose) polymerase-1 (PARP-1), also referred to as ADP-ribosyltransferase Diphtheria toxin-like 1 (ARTD1), is an abundant nuclear protein that plays key roles in a variety of nuclear processes, including the regulation of transcription. PARP-1 possesses an intrinsic enzymatic activity that catalyzes the transfer of ADP-ribose (ADPR) units from nicotinamide adenine dinucleotide (NAD(+)) onto target gene regulatory proteins, thereby modulating their activities. Although great strides have been made in the past decade in deciphering the seemingly opposing and varied roles of PARP-1 in gene regulation, many puzzles remain. In this review, we discuss the current state of understanding in this area, especially how PARP-1 interfaces with various components of gene regulatory pathways (e.g., the basal transcription machinery, DNA-binding transcription factors, coregulators, chromatin remodeling, histone modifications, and DNA methylation). In addition, we discuss some gene-specific, cell type-specific, and cell state-specific effects of PARP-1 on gene regulation, which might contribute to its biological functions. Finally, we review some of the recent progress targeting PARPs using chemical inhibitors, some of which may alter PARP-1-dependent gene regulatory programs to promote therapeutic outcomes. Copyright © 2013 Elsevier Ltd. All rights reserved.

  5. Gene expression regulation in roots under drought.

    Science.gov (United States)

    Janiak, Agnieszka; Kwaśniewski, Mirosław; Szarejko, Iwona

    2016-02-01

    Stress signalling and regulatory networks controlling expression of target genes are the basis of plant response to drought. Roots are the first organs exposed to water deficiency in the soil and are the place of drought sensing. Signalling cascades transfer chemical signals toward the shoot and initiate molecular responses that lead to the biochemical and morphological changes that allow plants to be protected against water loss and to tolerate stress conditions. Here, we present an overview of signalling network and gene expression regulation pathways that are actively induced in roots under drought stress. In particular, the role of several transcription factor (TF) families, including DREB, AP2/ERF, NAC, bZIP, MYC, CAMTA, Alfin-like and Q-type ZFP, in the regulation of root response to drought are highlighted. The information provided includes available data on mutual interactions between these TFs together with their regulation by plant hormones and other signalling molecules. The most significant downstream target genes and molecular processes that are controlled by the regulatory factors are given. These data are also coupled with information about the influence of the described regulatory networks on root traits and root development which may translate to enhanced drought tolerance. This is the first literature survey demonstrating the gene expression regulatory machinery that is induced by drought stress, presented from the perspective of roots. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  6. Genome-wide Analysis of Gene Regulation

    DEFF Research Database (Denmark)

    Chen, Yun

    gene regulation will disrupt the cell’s fundamental processes, which in turn can cause disease. Hence, understanding gene regulation is essential for deciphering the code of life. Along with the development of high throughput sequencing (HTS) technology and the subsequent large-scale data analysis...... and temporal alterations of histone modifications (Papers I and II). Coupling the data with machine learning approaches, we established a prediction framework to assess the most informative histone marks as well as their most influential nucleosome positions in predicting the promoter usages. (Papers I......). Focusing on the same promoter across the cell cycle, we observed that histone modification undergoes very distinct temporal lterations compared to their regulatory functions spatially at different promoters (Papers II). By aggregating different HTS methods including CAGE, 3’end-seq, GRO-seq, RNAPII Ch...

  7. Regulation of lipogenic genes in obesity

    OpenAIRE

    Mandard, Stéphane; Kersten, Sander

    2006-01-01

    Lipogenesis describes the process of fatty acid and triglyceride synthesis. Lipogenesis mainly occurs in liver and fat tissue and is under the coordinated control of hormonal, nutritional and transcription factors. Several transcription factors have been identified as critical regulators that mediate the effect of hormones and nutrients on gene transcription. This includes the Sterol Regulatory Element Binding Protein-1c “SREBP-1c”, the CCAAT/Enhancer-Binding Protein-alpha “C/EBPalpha”, the n...

  8. Homology-dependent Gene Silencing in Paramecium

    Science.gov (United States)

    Ruiz, Françoise; Vayssié, Laurence; Klotz, Catherine; Sperling, Linda; Madeddu, Luisa

    1998-01-01

    Microinjection at high copy number of plasmids containing only the coding region of a gene into the Paramecium somatic macronucleus led to a marked reduction in the expression of the corresponding endogenous gene(s). The silencing effect, which is stably maintained throughout vegetative growth, has been observed for all Paramecium genes examined so far: a single-copy gene (ND7), as well as members of multigene families (centrin genes and trichocyst matrix protein genes) in which all closely related paralogous genes appeared to be affected. This phenomenon may be related to posttranscriptional gene silencing in transgenic plants and quelling in Neurospora and allows the efficient creation of specific mutant phenotypes thus providing a potentially powerful tool to study gene function in Paramecium. For the two multigene families that encode proteins that coassemble to build up complex subcellular structures the analysis presented herein provides the first experimental evidence that the members of these gene families are not functionally redundant. PMID:9529389

  9. Iron homeostasis in Arabidopsis thaliana: transcriptomic analyses reveal novel FIT-regulated genes, iron deficiency marker genes and functional gene networks.

    Science.gov (United States)

    Mai, Hans-Jörg; Pateyron, Stéphanie; Bauer, Petra

    2016-10-03

    FIT (FER-LIKE IRON DEFICIENCY-INDUCED TRANSCRIPTION FACTOR) is the central regulator of iron uptake in Arabidopsis thaliana roots. We performed transcriptome analyses of six day-old seedlings and roots of six week-old plants using wild type, a fit knock-out mutant and a FIT over-expression line grown under iron-sufficient or iron-deficient conditions. We compared genes regulated in a FIT-dependent manner depending on the developmental stage of the plants. We assembled a high likelihood dataset which we used to perform co-expression and functional analysis of the most stably iron deficiency-induced genes. 448 genes were found FIT-regulated. Out of these, 34 genes were robustly FIT-regulated in root and seedling samples and included 13 novel FIT-dependent genes. Three hundred thirty-one genes showed differential regulation in response to the presence and absence of FIT only in the root samples, while this was the case for 83 genes in the seedling samples. We assembled a virtual dataset of iron-regulated genes based on a total of 14 transcriptomic analyses of iron-deficient and iron-sufficient wild-type plants to pinpoint the best marker genes for iron deficiency and analyzed this dataset in depth. Co-expression analysis of this dataset revealed 13 distinct regulons part of which predominantly contained functionally related genes. We could enlarge the list of FIT-dependent genes and discriminate between genes that are robustly FIT-regulated in roots and seedlings or only in one of those. FIT-regulated genes were mostly induced, few of them were repressed by FIT. With the analysis of a virtual dataset we could filter out and pinpoint new candidates among the most reliable marker genes for iron deficiency. Moreover, co-expression and functional analysis of this virtual dataset revealed iron deficiency-induced and functionally distinct regulons.

  10. Regulation of gene expression in human tendinopathy

    Directory of Open Access Journals (Sweden)

    Archambault Joanne M

    2011-05-01

    Full Text Available Abstract Background Chronic tendon injuries, also known as tendinopathies, are common among professional and recreational athletes. These injuries result in a significant amount of morbidity and health care expenditure, yet little is known about the molecular mechanisms leading to tendinopathy. Methods We have used histological evaluation and molecular profiling to determine gene expression changes in 23 human patients undergoing surgical procedures for the treatment of chronic tendinopathy. Results Diseased tendons exhibit altered extracellular matrix, fiber disorientation, increased cellular content and vasculature, and the absence of inflammatory cells. Global gene expression profiling identified 983 transcripts with significantly different expression patterns in the diseased tendons. Global pathway analysis further suggested altered expression of extracellular matrix proteins and the lack of an appreciable inflammatory response. Conclusions Identification of the pathways and genes that are differentially regulated in tendinopathy samples will contribute to our understanding of the disease and the development of novel therapeutics.

  11. Mechanisms of biotin-regulated gene expression in microbes

    Directory of Open Access Journals (Sweden)

    J. Satiaputra

    2016-03-01

    Full Text Available Biotin is an essential micronutrient that acts as a co-factor for biotin-dependent metabolic enzymes. In bacteria, the supply of biotin can be achieved by de novo synthesis or import from exogenous sources. Certain bacteria are able to obtain biotin through both mechanisms while others can only fulfill their biotin requirement through de novo synthesis. Inability to fulfill their cellular demand for biotin can have detrimental consequences on cell viability and virulence. Therefore understanding the transcriptional mechanisms that regulate biotin biosynthesis and transport will extend our knowledge about bacterial survival and metabolic adaptation during pathogenesis when the supply of biotin is limited. The most extensively characterized protein that regulates biotin synthesis and uptake is BirA. In certain bacteria, such as Escherichia coli and Staphylococcus aureus, BirA is a bi-functional protein that serves as a transcriptional repressor to regulate biotin biosynthesis genes, as well as acting as a ligase to catalyze the biotinylation of biotin-dependent enzymes. Recent studies have identified two other proteins that also regulate biotin synthesis and transport, namely BioQ and BioR. This review summarizes the different transcriptional repressors and their mechanism of action. Moreover, the ability to regulate the expression of target genes through the activity of a vitamin, such as biotin, may have biotechnological applications in synthetic biology.

  12. Time-dependent regulation analysis dissects shifts between metabolic and gen-expression regulation during differentiation of bloodstream forms.

    NARCIS (Netherlands)

    van Eunen, K.; Bouwman, J.; Lindenbergh, P.A.; Westerhoff, H.V.; Bakker, B.M.

    2009-01-01

    Time-dependent regulation analysis is a new methodology that allows us to unravel, both quantitatively and dynamically, how and when functional changes in the cell are brought about by the interplay of gene expression and metabolism. In this first experimental implementation, we dissect the initial

  13. Dietary Methanol Regulates Human Gene Activity

    Science.gov (United States)

    Komarova, Tatiana V.; Sheshukova, Ekaterina V.; Kosorukov, Vyacheslav S.; Kiryanov, Gleb I.; Dorokhov, Yuri L.

    2014-01-01

    Methanol (MeOH) is considered to be a poison in humans because of the alcohol dehydrogenase (ADH)-mediated conversion of MeOH to formaldehyde (FA), which is toxic. Our recent genome-wide analysis of the mouse brain demonstrated that an increase in endogenous MeOH after ADH inhibition led to a significant increase in the plasma MeOH concentration and a modification of mRNA synthesis. These findings suggest endogenous MeOH involvement in homeostasis regulation by controlling mRNA levels. Here, we demonstrate directly that study volunteers displayed increasing concentrations of MeOH and FA in their blood plasma when consuming citrus pectin, ethanol and red wine. A microarray analysis of white blood cells (WBC) from volunteers after pectin intake showed various responses for 30 significantly differentially regulated mRNAs, most of which were somehow involved in the pathogenesis of Alzheimer's disease (AD). There was also a decreased synthesis of hemoglobin mRNA, HBA and HBB, the presence of which in WBC RNA was not a result of red blood cells contamination because erythrocyte-specific marker genes were not significantly expressed. A qRT-PCR analysis of volunteer WBCs after pectin and red wine intake confirmed the complicated relationship between the plasma MeOH content and the mRNA accumulation of both genes that were previously identified, namely, GAPDH and SNX27, and genes revealed in this study, including MME, SORL1, DDIT4, HBA and HBB. We hypothesized that human plasma MeOH has an impact on the WBC mRNA levels of genes involved in cell signaling. PMID:25033451

  14. Dietary methanol regulates human gene activity.

    Directory of Open Access Journals (Sweden)

    Anastasia V Shindyapina

    Full Text Available Methanol (MeOH is considered to be a poison in humans because of the alcohol dehydrogenase (ADH-mediated conversion of MeOH to formaldehyde (FA, which is toxic. Our recent genome-wide analysis of the mouse brain demonstrated that an increase in endogenous MeOH after ADH inhibition led to a significant increase in the plasma MeOH concentration and a modification of mRNA synthesis. These findings suggest endogenous MeOH involvement in homeostasis regulation by controlling mRNA levels. Here, we demonstrate directly that study volunteers displayed increasing concentrations of MeOH and FA in their blood plasma when consuming citrus pectin, ethanol and red wine. A microarray analysis of white blood cells (WBC from volunteers after pectin intake showed various responses for 30 significantly differentially regulated mRNAs, most of which were somehow involved in the pathogenesis of Alzheimer's disease (AD. There was also a decreased synthesis of hemoglobin mRNA, HBA and HBB, the presence of which in WBC RNA was not a result of red blood cells contamination because erythrocyte-specific marker genes were not significantly expressed. A qRT-PCR analysis of volunteer WBCs after pectin and red wine intake confirmed the complicated relationship between the plasma MeOH content and the mRNA accumulation of both genes that were previously identified, namely, GAPDH and SNX27, and genes revealed in this study, including MME, SORL1, DDIT4, HBA and HBB. We hypothesized that human plasma MeOH has an impact on the WBC mRNA levels of genes involved in cell signaling.

  15. Limb development: a paradigm of gene regulation.

    Science.gov (United States)

    Petit, Florence; Sears, Karen E; Ahituv, Nadav

    2017-04-01

    The limb is a commonly used model system for developmental biology. Given the need for precise control of complex signalling pathways to achieve proper patterning, the limb is also becoming a model system for gene regulation studies. Recent developments in genomic technologies have enabled the genome-wide identification of regulatory elements that control limb development, yielding insights into the determination of limb morphology and forelimb versus hindlimb identity. The modulation of regulatory interactions - for example, through the modification of regulatory sequences or chromatin architecture - can lead to morphological evolution, acquired regeneration capacity or limb malformations in diverse species, including humans.

  16. Regulation of vesicular trafficking by Parkinson's disease-associated genes

    Directory of Open Access Journals (Sweden)

    Tsuyoshi Inoshita

    2015-10-01

    Full Text Available The regulatory mechanisms that control intracellular vesicular trafficking play important roles in cellular function and viability. Neurons have specific vesicular trafficking systems for synaptic vesicle formation, release and recycling. Synaptic vesicular trafficking impairments induce neuronal dysfunction and physiological and behavioral disorders. Parkinson's disease (PD is an age-dependent neurodegenerative disorder characterized by dopamine depletion and loss of dopamine neurons in the midbrain. The molecular mechanism responsible for the neurodegeneration that occurs during PD is still not understood; however, recent functional analyses of familial PD causative genes suggest that a number of PD causative genes regulate intracellular vesicular trafficking, including synaptic vesicular dynamics. This review focuses on recent insights regarding the functions of PD causative genes, their relationship with vesicular trafficking and how mutations associated with PD affect vesicular dynamics and neuronal survival.

  17. Nuclear pore complexes as hubs for gene regulation.

    Science.gov (United States)

    D'Angelo, Maximiliano A

    2018-01-01

    Nuclear pore complexes (NPCs), the channels connecting the nucleus with the cytoplasm, are the largest protein structures of the nuclear envelope. In addition to their role in regulating nucleocytoplasmic transport, increasing evidence shows that these multiprotein structures play central roles in the regulation of gene activity. In light of recent discoveries, NPCs are emerging as scaffolds that mediate the regulation of specific gene sets at the nuclear periphery. The function of NPCs as genome organizers and hubs for transcriptional regulation provides additional evidence that the compartmentalization of genes and transcriptional regulators within the nuclear space is an important mechanism of gene expression regulation.

  18. Overexpression of Poplar PtrWRKY89 in Transgenic Arabidopsis Leads to a Reduction of Disease Resistance by Regulating Defense-Related Genes in Salicylate- and Jasmonate-Dependent Signaling.

    Science.gov (United States)

    Jiang, Yuanzhong; Guo, Li; Liu, Rui; Jiao, Bo; Zhao, Xin; Ling, Zhengyi; Luo, Keming

    2016-01-01

    The plant hormones jasmonic acid (JA) and salicylic acid (SA) play key roles in plant defenses against pathogens and several WRKY transcription factors have been shown to have a role in SA/JA crosstalk. In a previous study, overexpression of the poplar WRKY gene PtrWRKY89 enhanced resistance to pathogens in transgenic poplars. In this study, the promoter of PtrWRKY89 (ProPtrWRKY89) was isolated and used to drive GUS reporter gene. High GUS activity was observed in old leaves of transgenic Arabidopsis containing ProPtrWRKY89-GUS construct and GUS expression was extremely induced by SA solution and SA+MeJA mixture but not by MeJA treatment. Subcellular localization and transactivation assays showed that PtrWRKY89 acted as a transcription activator in the nucleus. Constitutive expression of PtrWRKY89 in Arabidopsis resulted in more susceptible to Pseudomonas syringae and Botrytis cinerea compared to wild-type plants. Quantitative real-time PCR (qRT-PCR) analysis confirmed that marker genes of SA and JA pathways were down-regulated in transgenic Arabidopsis after pathogen inoculations. Overall, our results indicated that PtrWRKY89 modulates a cross talk in resistance to P. syringe and B. cinerea by negatively regulating both SA and JA pathways in Arabidopsis.

  19. Cobalt stimulates HIF-1-dependent but inhibits HIF-2-dependent gene expression in liver cancer cells

    Science.gov (United States)

    Befani, Christina; Mylonis, Ilias; Gkotinakou, Ioanna-Maria; Georgoulias, Panagiotis; Hu, Cheng-Jun; Simos, George; Liakos, Panagiotis

    2013-01-01

    Hypoxia-inducible factors (HIFs) are transcriptional regulators that mediate the cellular response to low oxygen. Although HIF-1 is usually considered as the principal mediator of hypoxic adaptation, several tissues and different cell types express both HIF-1 and HIF-2 isoforms under hypoxia or when treated with hypoxia mimetic chemicals such as cobalt. However, the similarities or differences between HIF-1 and HIF-2, in terms of their tissue- and inducer-specific activation and function, are not adequately characterized. To address this issue, we investigated the effects of true hypoxia and hypoxia mimetics on HIF-1 and HIF-2 induction and specific gene transcriptional activity in two hepatic cancer cell lines, Huh7 and HepG2. Both hypoxia and cobalt caused rapid induction of both HIF-1α and HIF-2α proteins. Hypoxia induced erythropoietin (EPO) expression and secretion in a HIF-2-dependent way. Surprisingly, however, EPO expression was not induced when cells were treated with cobalt. In agreement, both HIF-1- and HIF-2-dependent promoters (of PGK and SOD2 genes, respectively) were activated by hypoxia while cobalt only activated the HIF-1-dependent PGK promoter. Unlike cobalt, other hypoxia mimetics such as DFO and DMOG activated both types of promoters. Furthermore, cobalt impaired the hypoxic stimulation of HIF-2, but not HIF-1, activity and cobalt-induced HIF-2α interacted poorly with USF-2, a HIF-2-specific co-activator. These data show that, despite similar induction of HIF-1α and HIF-2α protein expression, HIF-1 and HIF-2 specific gene activating functions respond differently to different stimuli and suggest the operation of oxygen-independent and gene- or tissue-specific regulatory mechanisms involving additional transcription factors or co-activators. PMID:23958427

  20. Endogenous methanol regulates mammalian gene activity.

    Science.gov (United States)

    Komarova, Tatiana V; Petrunia, Igor V; Shindyapina, Anastasia V; Silachev, Denis N; Sheshukova, Ekaterina V; Kiryanov, Gleb I; Dorokhov, Yuri L

    2014-01-01

    We recently showed that methanol emitted by wounded plants might function as a signaling molecule for plant-to-plant and plant-to-animal communications. In mammals, methanol is considered a poison because the enzyme alcohol dehydrogenase (ADH) converts methanol into toxic formaldehyde. However, the detection of methanol in the blood and exhaled air of healthy volunteers suggests that methanol may be a chemical with specific functions rather than a metabolic waste product. Using a genome-wide analysis of the mouse brain, we demonstrated that an increase in blood methanol concentration led to a change in the accumulation of mRNAs from genes primarily involved in detoxification processes and regulation of the alcohol/aldehyde dehydrogenases gene cluster. To test the role of ADH in the maintenance of low methanol concentration in the plasma, we used the specific ADH inhibitor 4-methylpyrazole (4-MP) and showed that intraperitoneal administration of 4-MP resulted in a significant increase in the plasma methanol, ethanol and formaldehyde concentrations. Removal of the intestine significantly decreased the rate of methanol addition to the plasma and suggested that the gut flora may be involved in the endogenous production of methanol. ADH in the liver was identified as the main enzyme for metabolizing methanol because an increase in the methanol and ethanol contents in the liver homogenate was observed after 4-MP administration into the portal vein. Liver mRNA quantification showed changes in the accumulation of mRNAs from genes involved in cell signalling and detoxification processes. We hypothesized that endogenous methanol acts as a regulator of homeostasis by controlling the mRNA synthesis.

  1. Endogenous Methanol Regulates Mammalian Gene Activity

    Science.gov (United States)

    Komarova, Tatiana V.; Petrunia, Igor V.; Shindyapina, Anastasia V.; Silachev, Denis N.; Sheshukova, Ekaterina V.; Kiryanov, Gleb I.; Dorokhov, Yuri L.

    2014-01-01

    We recently showed that methanol emitted by wounded plants might function as a signaling molecule for plant-to-plant and plant-to-animal communications. In mammals, methanol is considered a poison because the enzyme alcohol dehydrogenase (ADH) converts methanol into toxic formaldehyde. However, the detection of methanol in the blood and exhaled air of healthy volunteers suggests that methanol may be a chemical with specific functions rather than a metabolic waste product. Using a genome-wide analysis of the mouse brain, we demonstrated that an increase in blood methanol concentration led to a change in the accumulation of mRNAs from genes primarily involved in detoxification processes and regulation of the alcohol/aldehyde dehydrogenases gene cluster. To test the role of ADH in the maintenance of low methanol concentration in the plasma, we used the specific ADH inhibitor 4-methylpyrazole (4-MP) and showed that intraperitoneal administration of 4-MP resulted in a significant increase in the plasma methanol, ethanol and formaldehyde concentrations. Removal of the intestine significantly decreased the rate of methanol addition to the plasma and suggested that the gut flora may be involved in the endogenous production of methanol. ADH in the liver was identified as the main enzyme for metabolizing methanol because an increase in the methanol and ethanol contents in the liver homogenate was observed after 4-MP administration into the portal vein. Liver mRNA quantification showed changes in the accumulation of mRNAs from genes involved in cell signalling and detoxification processes. We hypothesized that endogenous methanol acts as a regulator of homeostasis by controlling the mRNA synthesis. PMID:24587296

  2. Differential regulation of NAB corepressor genes in Schwann cells

    Directory of Open Access Journals (Sweden)

    Sachdev Shrikesh

    2007-12-01

    Full Text Available Abstract Background Myelination of peripheral nerves by Schwann cells requires not only the Egr2/Krox-20 transactivator, but also the NGFI-A/Egr-binding (NAB corepressors, which modulate activity of Egr2. Previous work has shown that axon-dependent expression of Egr2 is mediated by neuregulin stimulation, and NAB corepressors are co-regulated with Egr2 expression in peripheral nerve development. NAB corepressors have also been implicated in macrophage development, cardiac hypertrophy, prostate carcinogenesis, and feedback regulation involved in hindbrain development. Results To test the mechanism of NAB regulation in Schwann cells, transfection assays revealed that both Nab1 and Nab2 promoters are activated by Egr2 expression. Furthermore, direct binding of Egr2 at these promoters was demonstrated in vivo by chromatin immunoprecipitation analysis of myelinating sciatic nerve, and binding of Egr2 to the Nab2 promoter was stimulated by neuregulin in primary Schwann cells. Although Egr2 expression activates the Nab2 promoter more highly than Nab1, we surprisingly found that only Nab1 – but not Nab2 – expression levels were reduced in sciatic nerve from Egr2 null mice. Analysis of the Nab2 promoter showed that it is also activated by ETS proteins (Ets2 and Etv1/ER81 and is bound by Ets2 in vivo. Conclusion Overall, these results indicate that induction of Nab2 expression in Schwann cells involves not only Egr2, but also ETS proteins that are activated by neuregulin stimulation. Although Nab1 and Nab2 play partially redundant roles, regulation of Nab2 expression by ETS factors explains several observations regarding regulation of NAB genes. Finally, these data suggest that NAB proteins are not only feedback inhibitors of Egr2, but rather that co-induction of Egr2 and NAB genes is involved in forming an Egr2/NAB complex that is crucial for regulation of gene expression.

  3. Redox regulation of photosynthetic gene expression.

    Science.gov (United States)

    Queval, Guillaume; Foyer, Christine H

    2012-12-19

    Redox chemistry and redox regulation are central to the operation of photosynthesis and respiration. However, the roles of different oxidants and antioxidants in the regulation of photosynthetic or respiratory gene expression remain poorly understood. Leaf transcriptome profiles of a range of Arabidopsis thaliana genotypes that are deficient in either hydrogen peroxide processing enzymes or in low molecular weight antioxidant were therefore compared to determine how different antioxidant systems that process hydrogen peroxide influence transcripts encoding proteins targeted to the chloroplasts or mitochondria. Less than 10 per cent overlap was observed in the transcriptome patterns of leaves that are deficient in either photorespiratory (catalase (cat)2) or chloroplastic (thylakoid ascorbate peroxidase (tapx)) hydrogen peroxide processing. Transcripts encoding photosystem II (PSII) repair cycle components were lower in glutathione-deficient leaves, as were the thylakoid NAD(P)H (nicotinamide adenine dinucleotide (phosphate)) dehydrogenases (NDH) mRNAs. Some thylakoid NDH mRNAs were also less abundant in tAPX-deficient and ascorbate-deficient leaves. Transcripts encoding the external and internal respiratory NDHs were increased by low glutathione and low ascorbate. Regulation of transcripts encoding specific components of the photosynthetic and respiratory electron transport chains by hydrogen peroxide, ascorbate and glutathione may serve to balance non-cyclic and cyclic electron flow pathways in relation to oxidant production and reductant availability.

  4. Role of endocannabinoids in regulating drug dependence

    Directory of Open Access Journals (Sweden)

    Daniela Parolaro

    2007-01-01

    Full Text Available Daniela Parolaro, Daniela Vigano’, Natalia Realini, Tiziana RubinoNeuroscience Center, DBSF, University of Insubria, Busto Arsizio, ItalyAbstract: This review will discuss the latest knowledge of how the endocannabinoid system might be involved in treating addiction to the most common illicit drugs. Experimental models are providing increasing evidence for the pharmacological management of endocannabinoid signaling not only to block the direct reinforcing effects of cannabis, opioids, nicotine and ethanol, but also for preventing relapse to the various drugs of abuse, including opioids, cocaine, nicotine, alcohol and metamphetamine. Preclinical and clinical studies suggest that the endocannabinoid system can be manipulated by the CB1 receptor antagonist SR141716A, that might constitute a new generation of compounds for treating addiction across different classes of abused drugs.Keywords: Endocannabinoids, drug dependence, opioids, nicotine, alcohol, psychostimulants

  5. A CRE1- regulated cluster is responsible for light dependent production of dihydrotrichotetronin in Trichoderma reesei.

    Directory of Open Access Journals (Sweden)

    Alberto Alonso Monroy

    Full Text Available Changing light conditions, caused by the rotation of earth resulting in day and night or growth on the surface or within a substrate, result in considerably altered physiological processes in fungi. For the biotechnological workhorse Trichoderma reesei, regulation of glycoside hydrolase gene expression, especially cellulase expression was shown to be a target of light dependent gene regulation. Analysis of regulatory targets of the carbon catabolite repressor CRE1 under cellulase inducing conditions revealed a secondary metabolite cluster to be differentially regulated in light and darkness and by photoreceptors. We found that this cluster is involved in production of trichodimerol and that the two polyketide synthases of the cluster are essential for biosynthesis of dihydrotrichotetronine (syn. bislongiquinolide or bisorbibutenolide. Additionally, an indirect influence on production of the peptaibol antibiotic paracelsin was observed. The two polyketide synthetase genes as well as the monooxygenase gene of the cluster were found to be connected at the level of transcription in a positive feedback cycle in darkness, but negative feedback in light, indicating a cellular sensing and response mechanism for the products of these enzymes. The transcription factor TR_102497/YPR2 residing within the cluster regulates the cluster genes in a light dependent manner. Additionally, an interrelationship of this cluster with regulation of cellulase gene expression was detected. Hence the regulatory connection between primary and secondary metabolism appears more widespread than previously assumed, indicating a sophisticated distribution of resources either to degradation of substrate (feed or to antagonism of competitors (fight, which is influenced by light.

  6. Fine mapping of gene regions regulating neurodegeneration.

    Directory of Open Access Journals (Sweden)

    Maria Swanberg

    Full Text Available BACKGROUND: Damage to nerve cells and axons leading to neurodegeneration is a characteristic feature of many neurological diseases. The degree of genetic influence on susceptibility to axotomy-induced neuronal death has so far been unknown. We have examined two gene regions, Vra1 and Vra2, previously linked to nerve cell loss after ventral root avulsion in a rat F2 intercross between the DA and PVG inbred rat strains. METHODOLOGY/PRINCIPAL FINDINGS: In this study, we use two generations (G8 and G10 cohorts of an advanced intercross line between DA and PVG(av1 to reproduce linkage to Vra1 and to fine-map this region. By isolating the effect from Vra1 in congenic strains, we demonstrate that Vra1 significantly regulates the loss of motoneurons after avulsion. The regulatory effect mediated by Vra1 thus resides in a congenic fragment of 9 megabases. Furthermore, we have used the advanced intercross lines to give more support to Vra2, originally detected as a suggestive QTL. CONCLUSIONS/SIGNIFICANCE: The results demonstrated here show that naturally occurring allelic variations affect susceptibility to axotomy-induced nerve cell death. Vra1 and Vra2 represent the first quantitative trait loci regulating this phenotype that are characterized and fine mapped in an advanced intercross line. In addition, congenic strains provide experimental evidence for the Vra1 effect on the extent of injury-induced neurodegeneration. Identification of the underlying genetic variations will increase our understanding of the regulation and mechanisms of neurodegeneration.

  7. NHR-23 dependent collagen and hedgehog-related genes required for molting

    International Nuclear Information System (INIS)

    Kouns, Nathaniel A.; Nakielna, Johana; Behensky, Frantisek; Krause, Michael W.; Kostrouch, Zdenek; Kostrouchova, Marta

    2011-01-01

    Highlights: → NHR-23 is a critical regulator of nematode development and molting. → The manuscript characterizes the loss-of-function phenotype of an nhr-23 mutant. → Whole genome expression analysis identifies new potential targets of NHR-23. → Hedgehog-related genes are identified as NHR-23 dependent genes. → New link between sterol mediated signaling and regulation by NHR-23 is found. -- Abstract: NHR-23, a conserved member of the nuclear receptor family of transcription factors, is required for normal development in Caenorhabditis elegans where it plays a critical role in growth and molting. In a search for NHR-23 dependent genes, we performed whole genome comparative expression microarrays on both control and nhr-23 inhibited synchronized larvae. Genes that decreased in response to nhr-23 RNAi included several collagen genes. Unexpectedly, several hedgehog-related genes were also down-regulated after nhr-23 RNAi. A homozygous nhr-23 deletion allele was used to confirm the RNAi knockdown phenotypes and the changes in gene expression. Our results indicate that NHR-23 is a critical co-regulator of functionally linked genes involved in growth and molting and reveal evolutionary parallels among the ecdysozoa.

  8. NHR-23 dependent collagen and hedgehog-related genes required for molting

    Energy Technology Data Exchange (ETDEWEB)

    Kouns, Nathaniel A.; Nakielna, Johana; Behensky, Frantisek [Laboratory of Model Systems, Institute of Inherited Metabolic Disorders, First Faculty of Medicine, Charles University, Prague (Czech Republic); Krause, Michael W. [Laboratory of Molecular Biology, National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Bethesda, MD (United States); Kostrouch, Zdenek [Laboratory of Model Systems, Institute of Inherited Metabolic Disorders, First Faculty of Medicine, Charles University, Prague (Czech Republic); Kostrouchova, Marta, E-mail: marta.kostrouchova@lf1.cuni.cz [Laboratory of Model Systems, Institute of Inherited Metabolic Disorders, First Faculty of Medicine, Charles University, Prague (Czech Republic)

    2011-10-07

    Highlights: {yields} NHR-23 is a critical regulator of nematode development and molting. {yields} The manuscript characterizes the loss-of-function phenotype of an nhr-23 mutant. {yields} Whole genome expression analysis identifies new potential targets of NHR-23. {yields} Hedgehog-related genes are identified as NHR-23 dependent genes. {yields} New link between sterol mediated signaling and regulation by NHR-23 is found. -- Abstract: NHR-23, a conserved member of the nuclear receptor family of transcription factors, is required for normal development in Caenorhabditis elegans where it plays a critical role in growth and molting. In a search for NHR-23 dependent genes, we performed whole genome comparative expression microarrays on both control and nhr-23 inhibited synchronized larvae. Genes that decreased in response to nhr-23 RNAi included several collagen genes. Unexpectedly, several hedgehog-related genes were also down-regulated after nhr-23 RNAi. A homozygous nhr-23 deletion allele was used to confirm the RNAi knockdown phenotypes and the changes in gene expression. Our results indicate that NHR-23 is a critical co-regulator of functionally linked genes involved in growth and molting and reveal evolutionary parallels among the ecdysozoa.

  9. FRUITING GENES OF SCHIZOPHYLLUM-COMMUNE ARE TRANSCRIPTIONALLY REGULATED

    NARCIS (Netherlands)

    SCHUREN, FHJ; VANDERLENDE, TR; WESSELS, JGH

    Fruiting genes in Schizophyllum commune are controlled by the mating-type genes and other regulatory genes. To examine whether differential accumulation of mRNAs for these fruiting genes is caused by transcriptional regulation, run-on transcription assaYs were performed with nuclei isolated from

  10. Concentration and length dependence of DNA looping in transcriptional regulation.

    Directory of Open Access Journals (Sweden)

    Lin Han

    2009-05-01

    Full Text Available In many cases, transcriptional regulation involves the binding of transcription factors at sites on the DNA that are not immediately adjacent to the promoter of interest. This action at a distance is often mediated by the formation of DNA loops: Binding at two or more sites on the DNA results in the formation of a loop, which can bring the transcription factor into the immediate neighborhood of the relevant promoter. These processes are important in settings ranging from the historic bacterial examples (bacterial metabolism and the lytic-lysogeny decision in bacteriophage, to the modern concept of gene regulation to regulatory processes central to pattern formation during development of multicellular organisms. Though there have been a variety of insights into the combinatorial aspects of transcriptional control, the mechanism of DNA looping as an agent of combinatorial control in both prokaryotes and eukaryotes remains unclear. We use single-molecule techniques to dissect DNA looping in the lac operon. In particular, we measure the propensity for DNA looping by the Lac repressor as a function of the concentration of repressor protein and as a function of the distance between repressor binding sites. As with earlier single-molecule studies, we find (at least two distinct looped states and demonstrate that the presence of these two states depends both upon the concentration of repressor protein and the distance between the two repressor binding sites. We find that loops form even at interoperator spacings considerably shorter than the DNA persistence length, without the intervention of any other proteins to prebend the DNA. The concentration measurements also permit us to use a simple statistical mechanical model of DNA loop formation to determine the free energy of DNA looping, or equivalently, the for looping.

  11. Studying the Complex Expression Dependences between Sets of Coexpressed Genes

    Directory of Open Access Journals (Sweden)

    Mario Huerta

    2014-01-01

    Full Text Available Organisms simplify the orchestration of gene expression by coregulating genes whose products function together in the cell. The use of clustering methods to obtain sets of coexpressed genes from expression arrays is very common; nevertheless there are no appropriate tools to study the expression networks among these sets of coexpressed genes. The aim of the developed tools is to allow studying the complex expression dependences that exist between sets of coexpressed genes. For this purpose, we start detecting the nonlinear expression relationships between pairs of genes, plus the coexpressed genes. Next, we form networks among sets of coexpressed genes that maintain nonlinear expression dependences between all of them. The expression relationship between the sets of coexpressed genes is defined by the expression relationship between the skeletons of these sets, where this skeleton represents the coexpressed genes with a well-defined nonlinear expression relationship with the skeleton of the other sets. As a result, we can study the nonlinear expression relationships between a target gene and other sets of coexpressed genes, or start the study from the skeleton of the sets, to study the complex relationships of activation and deactivation between the sets of coexpressed genes that carry out the different cellular processes present in the expression experiments.

  12. Myeloid translocation genes differentially regulate colorectal cancer programs

    Science.gov (United States)

    Parang, Bobak; Bradley, Amber M.; Mittal, Mukul K.; Short, Sarah P.; Thompson, Joshua J.; Barrett, Caitlyn W.; Naik, Rishi D.; Bilotta, Anthony J.; Washington, Mary K.; Revetta, Frank L.; Smith, Jesse J.; Chen, Xi; Wilson, Keith T.; Hiebert, Scott W.; Williams, Christopher S.

    2016-01-01

    Myeloid translocation genes (MTGs), originally identified as chromosomal translocations in acute myelogenous leukemia, are transcriptional corepressors that regulate hematopoietic stem cell programs. Analysis of The Cancer Genome Atlas (TCGA) database revealed that MTGs were mutated in epithelial malignancy and suggested that loss of function might promote tumorigenesis. Genetic deletion of MTGR1 and MTG16 in the mouse has revealed unexpected and unique roles within the intestinal epithelium. Mtgr1−/− mice have progressive depletion of all intestinal secretory cells, and Mtg16−/− mice have a decrease in goblet cells. Furthermore, both Mtgr1−/− and Mtg16−/− mice have increased intestinal epithelial cell proliferation. We thus hypothesized that loss of MTGR1 or MTG16 would modify Apc1638/+-dependent intestinal tumorigenesis. Mtgr1−/− mice, but not Mtg16−/− mice, had a 10-fold increase in tumor multiplicity. This was associated with more advanced dysplasia, including progression to invasive adenocarcinoma, and augmented intratumoral proliferation. Analysis of ChIP-seq datasets for MTGR1 and MTG16 targets indicated that MTGR1 can regulate Wnt and Notch signaling. In support of this, immunohistochemistry and gene expression analysis revealed that both Wnt and Notch signaling pathways were hyperactive in Mtgr1−/− tumors. Furthermore, in human colorectal cancer (CRC) samples MTGR1 was downregulated at both the transcript and protein level. Overall our data indicates that MTGR1 has a context dependent effect on intestinal tumorigenesis. PMID:27270437

  13. Feedback regulation of DNA methyltransferase gene expression by methylation.

    Science.gov (United States)

    Slack, A; Cervoni, N; Pinard, M; Szyf, M

    1999-08-01

    This paper tests the hypothesis that expression of the DNA methyltransferase, dnmt1, gene is regulated by a methylation-sensitive DNA element. Methylation of DNA is an attractive system for feedback regulation of DNA methyltransferase as the final product of the reaction, methylated DNA, can regulate gene expression in cis. We show that an AP-1-dependent regulatory element of dnmt1 is heavily methylated in most somatic tissues and in the mouse embryonal cell line, P19, and completely unmethylated in a mouse adrenal carcinoma cell line, Y1. dnmt1 is highly over expressed in Y1 relative to P19 cell lines. Global inhibition of DNA methylation in P19 cells by 5-azadeoxycytidine results in demethylation of the AP-1 regulatory region and induction of dnmt1 expression in P19cells, but not Y1 cells. We propose that this regulatory region of dnmt1 acts as a sensor of the DNA methylation capacity of the cell. These results provide an explanation for the documented coexistence of global hypomethylation and high levels of DNA methyltransferase activity in many cancer cells and for the carcinogenic effect of hypomethylating diets.

  14. DNA methylation status of nuclear-encoded mitochondrial genes underlies the tissue-dependent mitochondrial functions

    Directory of Open Access Journals (Sweden)

    Takasugi Masaki

    2010-08-01

    Full Text Available Abstract Background Mitochondria are semi-autonomous, semi-self-replicating organelles harboring their own DNA (mitochondrial DNA, mtDNA, and their dysregulation is involved in the development of various diseases. While mtDNA does not generally undergo epigenetic modifications, almost all mitochondrial proteins are encoded by nuclear DNA. However, the epigenetic regulation of nuclear-encoded mitochondrial genes (nuclear mt genes has not been comprehensively analyzed. Results We analyzed the DNA methylation status of 899 nuclear mt genes in the liver, brain, and heart tissues of mouse, and identified 636 nuclear mt genes carrying tissue-dependent and differentially methylated regions (T-DMRs. These nuclar mt genes are involved in various mitochondrial functions and they also include genes related to human diseases. T-DMRs regulate the expression of nuclear mt genes. Nuclear mt genes with tissue-specific hypomethylated T-DMRs were characterized by enrichment of the target genes of specific transcription factors such as FOXA2 in the liver, and CEBPA and STAT1 in the brain. Conclusions A substantial proportion of nuclear mt genes contained T-DMRs, and the DNA methylation status of numerous T-DMRs should underlie tissue-dependent mitochondrial functions.

  15. Gene regulation and noise reduction by coupling of stochastic processes.

    Science.gov (United States)

    Ramos, Alexandre F; Hornos, José Eduardo M; Reinitz, John

    2015-02-01

    Here we characterize the low-noise regime of a stochastic model for a negative self-regulating binary gene. The model has two stochastic variables, the protein number and the state of the gene. Each state of the gene behaves as a protein source governed by a Poisson process. The coupling between the two gene states depends on protein number. This fact has a very important implication: There exist protein production regimes characterized by sub-Poissonian noise because of negative covariance between the two stochastic variables of the model. Hence the protein numbers obey a probability distribution that has a peak that is sharper than those of the two coupled Poisson processes that are combined to produce it. Biochemically, the noise reduction in protein number occurs when the switching of the genetic state is more rapid than protein synthesis or degradation. We consider the chemical reaction rates necessary for Poisson and sub-Poisson processes in prokaryotes and eucaryotes. Our results suggest that the coupling of multiple stochastic processes in a negative covariance regime might be a widespread mechanism for noise reduction.

  16. Gene networks and the neuroendocrine regulation of puberty.

    Science.gov (United States)

    Ojeda, Sergio R; Dubay, Christopher; Lomniczi, Alejandro; Kaidar, Gabi; Matagne, Valerie; Sandau, Ursula S; Dissen, Gregory A

    2010-08-05

    A sustained increase in pulsatile release of gonadotrophin releasing hormone (GnRH) from the hypothalamus is an essential, final event that defines the initiation of mammalian puberty. This increase depends on coordinated changes in transsynaptic and glial-neuronal communication, consisting of activating neuronal and glial excitatory inputs to the GnRH neuronal network and the loss of transsynaptic inhibitory tone. It is now clear that the prevalent excitatory systems stimulating GnRH secretion involve a neuronal component consisting of excitatory amino acids (glutamate) and at least one peptide (kisspeptin), and a glial component that uses growth factors and small molecules for cell-cell signaling. GABAergic and opiatergic neurons provide transsynaptic inhibitory control to the system, but GABA neurons also exert direct excitatory effects on GnRH neurons. The molecular mechanisms that provide encompassing coordination to this cellular network are not known, but they appear to involve a host of functionally related genes hierarchically arranged. We envision that, as observed in other gene networks, the highest level of control in this network is provided by transcriptional regulators that, by directing expression of key subordinate genes, impose an integrative level of coordination to the neuronal and glial subsets involved in initiating the pubertal process. The use of high-throughput and gene manipulation approaches coupled to systems biology strategies should provide not only the experimental bases supporting this concept, but also unveil the existence of crucial components of network control not yet identified. Copyright (c) 2009 Elsevier Ireland Ltd. All rights reserved.

  17. Transcription-factor-dependent enhancer transcription defines a gene regulatory network for cardiac rhythm.

    Science.gov (United States)

    Yang, Xinan H; Nadadur, Rangarajan D; Hilvering, Catharina Re; Bianchi, Valerio; Werner, Michael; Mazurek, Stefan R; Gadek, Margaret; Shen, Kaitlyn M; Goldman, Joseph Aaron; Tyan, Leonid; Bekeny, Jenna; Hall, Johnathon M; Lee, Nutishia; Perez-Cervantes, Carlos; Burnicka-Turek, Ozanna; Poss, Kenneth D; Weber, Christopher R; de Laat, Wouter; Ruthenburg, Alexander J; Moskowitz, Ivan P

    2017-12-27

    The noncoding genome is pervasively transcribed. Noncoding RNAs (ncRNAs) generated from enhancers have been proposed as a general facet of enhancer function and some have been shown to be required for enhancer activity. Here we examine the transcription-factor-(TF)-dependence of ncRNA expression to define enhancers and enhancer-associated ncRNAs that are involved in a TF-dependent regulatory network. TBX5, a cardiac TF, regulates a network of cardiac channel genes to maintain cardiac rhythm. We deep sequenced wildtype and Tbx5 -mutant mouse atria, identifying ~2600 novel Tbx5 -dependent ncRNAs. Tbx5-dependent ncRNAs were enriched for tissue-specific marks of active enhancers genome-wide. Tbx5-dependent ncRNAs emanated from regions that are enriched for TBX5-binding and that demonstrated Tbx5-dependent enhancer activity. Tbx5 -dependent ncRNA transcription provided a quantitative metric of Tbx5 -dependent enhancer activity, correlating with target gene expression. We identified RACER , a novel Tbx5 -dependent long noncoding RNA (lncRNA) required for the expression of the calcium-handling gene Ryr2 . We illustrate that TF-dependent enhancer transcription can illuminate components of TF-dependent gene regulatory networks.

  18. Dissecting specific and global transcriptional regulation of bacterial gene expression

    NARCIS (Netherlands)

    Gerosa, Luca; Kochanowski, Karl; Heinemann, Matthias; Sauer, Uwe

    Gene expression is regulated by specific transcriptional circuits but also by the global expression machinery as a function of growth. Simultaneous specific and global regulation thus constitutes an additional-but often neglected-layer of complexity in gene expression. Here, we develop an

  19. Mining significant high utility gene regulation sequential patterns.

    Science.gov (United States)

    Zihayat, Morteza; Davoudi, Heidar; An, Aijun

    2017-12-14

    Mining frequent gene regulation sequential patterns in time course microarray datasets is an important mining task in bioinformatics. Although finding such patterns are of paramount important for studying a disease, most existing work do not consider gene-disease association during gene regulation sequential pattern discovery. Moreover, they consider more absent/existence effects of genes during the mining process than taking the degrees of genes expression into account. Consequently, such techniques discover too many patterns which may not represent important information to biologists to investigate the relationships between the disease and underlying reasons hidden in gene regulation sequences. We propose a utility model by considering both the gene-disease association score and their degrees of expression levels under a biological investigation. We propose an efficient method called Top-HUGS, for discoverying significant high utility gene regulation sequential patterns from a time-course microarray dataset. In this study, the proposed methods were evaluated on a publicly available time course microarray dataset. The experimental results show higher accuracies compared to the baseline methods. Our proposed methods found that several new gene regulation sequential patterns involved in such patterns were useful for biologists and provided further insights into the mechanisms underpinning biological processes. To effectively work with the proposed method, a web interface is developed to our system using Java. To the best of our knowledge, this is the first demonstration for significant high utility gene regulation sequential pattern discovery.

  20. eRNAs are required for p53-dependent enhancer activity and gene transcription.

    Science.gov (United States)

    Melo, Carlos A; Drost, Jarno; Wijchers, Patrick J; van de Werken, Harmen; de Wit, Elzo; Oude Vrielink, Joachim A F; Elkon, Ran; Melo, Sónia A; Léveillé, Nicolas; Kalluri, Raghu; de Laat, Wouter; Agami, Reuven

    2013-02-07

    Binding within or nearby target genes involved in cell proliferation and survival enables the p53 tumor suppressor gene to regulate their transcription and cell-cycle progression. Using genome-wide chromatin-binding profiles, we describe binding of p53 also to regions located distantly from any known p53 target gene. Interestingly, many of these regions possess conserved p53-binding sites and all known hallmarks of enhancer regions. We demonstrate that these p53-bound enhancer regions (p53BERs) indeed contain enhancer activity and interact intrachromosomally with multiple neighboring genes to convey long-distance p53-dependent transcription regulation. Furthermore, p53BERs produce, in a p53-dependent manner, enhancer RNAs (eRNAs) that are required for efficient transcriptional enhancement of interacting target genes and induction of a p53-dependent cell-cycle arrest. Thus, our results ascribe transcription enhancement activity to p53 with the capacity to regulate multiple genes from a single genomic binding site. Moreover, eRNA production from p53BERs is required for efficient p53 transcription enhancement. Copyright © 2013 Elsevier Inc. All rights reserved.

  1. Variants of opioid system genes are associated with non-dependent opioid use and heroin dependence.

    Science.gov (United States)

    Randesi, Matthew; van den Brink, Wim; Levran, Orna; Blanken, Peter; Butelman, Eduardo R; Yuferov, Vadim; da Rosa, Joel Correa; Ott, Jurg; van Ree, Jan M; Kreek, Mary Jeanne

    2016-11-01

    Heroin addiction is a chronic, relapsing brain disease. Genetic factors are involved in the development of drug addiction. The aim of this study was to determine whether specific variants in genes of the opioid system are associated with non-dependent opioid use and heroin dependence. Genetic information from four subject groups was collected: non-dependent opioid users (NOD) [n=163]; opioid-dependent (OD) patients in methadone maintenance treatment (MMT) [n=143]; opioid-dependent MMT-resistant patients in heroin-assisted treatment (HAT) [n=138]; and healthy controls with no history of opioid use (HC) [n=153]. Eighty-two variants in eight opioid system genes were studied. To establish the role of these genes in (a) non-dependent opioid use, and (b) heroin dependence, the following groups were compared: HC vs. NOD; HC vs. OD (MMT+HAT); and NOD vs. OD (MMT+HAT). Five unique SNPs in four genes showed nominally significant associations with non-dependent opioid use and heroin dependence. The association of the delta opioid receptor (OPRD1) intronic SNP rs2236861 with non-dependent opioid use (HC vs. NOD) remained significant after correction for multiple testing (OR=0.032; p corrected =0.015). This SNP exhibited a significant gene-gene interaction with prepronociceptin (PNOC) SNP rs2722897 (OR=5.24; p corrected =0.041) (HC vs. NOD). This study identifies several new and some previously reported associations of variants with heroin dependence and with non-dependent opioid use, an important and difficult to obtain group not extensively studied previously. Further studies are warranted to confirm and elucidate the potential roles of these variants in the vulnerability to illicit drug use and drug addiction. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  2. Evidence for density dependent population regulation in southern ...

    African Journals Online (AJOL)

    The means by which populations are regulated form a central theme in conservation biology, and much debate has revolved around density dependence as a mechanism driving population ... A significant increase in adult female survival was evident which is likely to have given rise to recent changes in population growth.

  3. ALKBH4-dependent demethylation of actin regulates actomyosin dynamics

    DEFF Research Database (Denmark)

    Li, M.-M.; Shi, Y.; Niu, Y.

    2013-01-01

    -type but not catalytically inactive ALKBH4. Similar to actin and myosin knock-out mice, homozygous Alkbh4 mutant mice display early embryonic lethality. These findings imply that ALKBH4-dependent actin demethylation regulates actomyosin function by promoting actin-non-muscle myosin II interaction.......-dependent processes such as cytokinesis and cell migration. ALKBH4-deficient cells display elevated K84me1 levels. Non-muscle myosin II only interacts with unmethylated actin and its proper recruitment to and interaction with actin depend on ALKBH4. ALKBH4 co-localizes with the actomyosin-based contractile ring...

  4. [Gene networks that regulate secondary metabolism in actinomycetes: pleiotropic regulators].

    Science.gov (United States)

    Rabyk, M V; Ostash, B O; Fedorenko, V O

    2014-01-01

    Current advances in the research and practical applications of pleiotropic regulatory genes for antibiotic production in actinomycetes are reviewed. The basic regulatory mechanisms found in these bacteria are outlined. Examples described in the review show the importance of the manipulation of regulatory systems that affect the synthesis of antibiotics for the metabolic engineering of the actinomycetes. Also, the study of these genes is the basis for the development of genetic engineering approaches towards the induction of "cryptic" part of the actinomycetes secondary metabolome, which capacity for production of biologically active compounds is much bigger than the diversity of antibiotics underpinned by traditional microbiological screening. Besides the practical problems, the study of regulatory genes for antibiotic biosynthesis will provide insights into the process of evolution of complex regulatory systems that coordinate the expression of gene operons, clusters and regulons, involved in the control of secondary metabolism and morphogenesis of actinomycetes.

  5. Light-Dependent Expression of Four Cryptic Archaeal Circadian Gene Homologs

    Directory of Open Access Journals (Sweden)

    Michael eManiscalco

    2014-03-01

    Full Text Available Circadian rhythms are important biological signals that have been found in almost all major groups of life from bacteria to man, yet it remains unclear if any members of the second major prokaryotic domain of life, the Archaea, also possess a biological clock. To investigate this question, we examined the regulation of four cyanobacterial-like circadian gene homologs present in the genome of the haloarchaeon Haloferax volcanii. These genes, designated cirA, cirB, cirC, and cirD, display similarity to the KaiC-family of cyanobacterial clock proteins, which act to regulate rhythmic gene expression and to control the timing of cell division. Quantitative RT-PCR analysis was used to examine the expression of each of the four cir genes in response to 12 h light/12 h dark cycles (LD 12:12 during balanced growth in H. volcanii. Our data reveal that there is an approximately two to sixteen-fold increase in cir gene expression when cells are shifted from light to constant darkness and this pattern of gene expression oscillates with the light conditions in a rhythmic manner. Targeted single- and double-gene knockouts in the H. volcanii cir genes results in disruption of light-dependent, rhythmic gene expression, although it does not lead to any significant effect on growth under these conditions. Restoration of light-dependent, rhythmic gene expression was demonstrated by introducing, in trans, a wild-type copy of individual cir genes into knockout strains. These results are noteworthy as this is the first attempt to characterize the transcriptional expression and regulation of the ubiquitous kaiC homologs found among archaeal genomes.

  6. Proline-Dependent Regulation of Clostridium difficile Stickland Metabolism

    Science.gov (United States)

    Bouillaut, Laurent; Self, William T.

    2013-01-01

    Clostridium difficile, a proteolytic Gram-positive anaerobe, has emerged as a significant nosocomial pathogen. Stickland fermentation reactions are thought to be important for growth of C. difficile and appear to influence toxin production. In Stickland reactions, pairs of amino acids donate and accept electrons, generating ATP and reducing power in the process. Reduction of the electron acceptors proline and glycine requires the d-proline reductase (PR) and the glycine reductase (GR) enzyme complexes, respectively. Addition of proline in the medium increases the level of PR protein but decreases the level of GR. We report the identification of PrdR, a protein that activates transcription of the PR-encoding genes in the presence of proline and negatively regulates the GR-encoding genes. The results suggest that PrdR is a central metabolism regulator that controls preferential utilization of proline and glycine to produce energy via the Stickland reactions. PMID:23222730

  7. [Psychological aspects of emotional regulation in smoking dependency].

    Science.gov (United States)

    Carton, S

    2001-04-01

    We reviewed the literature on the relationships between smoking and affect regulation. There is strong evidence that vulnerability to smoking dependence is a function of a high initial sensitivity to nicotine, which produces reinforcing consequences that lead to chronic use. These strong reinforcers of tobacco dependence include regulation of mood and modulation of arousal. We focused on studies concerned with the subjective component of arousal and emotional experience. We discuss first the models and classifications used to differentiate types of smoking as related to the management of emotions and studies evaluating the stimulant and subjective effects of smoking behavior, questioning the paradoxical tranquilizing and anxiety-reducing effects of nicotine. We also looked into the mood regulation effects that may explain the strong relationships observed between depression and smoking and finally focus on some of the personality risk factors that may make individuals more susceptible to these rewarding properties of smoking.

  8. Pharmacogenomics genes show varying perceptibility to microRNA regulation

    DEFF Research Database (Denmark)

    Rukov, Jakob Lewin; Vinther, Jeppe; Shomron, Noam

    2011-01-01

    The aim of pharmacogenomics is to identify individual differences in genome and transcriptome composition and their effect on drug efficacy. MicroRNAs (miRNAs) are short noncoding RNAs that negatively regulate expression of the majority of animal genes, including many genes involved in drug...... efficacy. Consequently, differences in the miRNA expression among individuals could be an important factor contributing to differential drug response. Pharmacogenomics genes can be divided into drug target genes termed as pharmacodynamics genes (PD) and genes involved in drug transport and metabolism...

  9. Linear Energy Transfer-Dependent Change in Rice Gene Expression Profile after Heavy-Ion Beam Irradiation.

    Directory of Open Access Journals (Sweden)

    Kotaro Ishii

    Full Text Available A heavy-ion beam has been recognized as an effective mutagen for plant breeding and applied to the many kinds of crops including rice. In contrast with X-ray or γ-ray, the heavy-ion beam is characterized by a high linear energy transfer (LET. LET is an important factor affecting several aspects of the irradiation effect, e.g. cell survival and mutation frequency, making the heavy-ion beam an effective mutagen. To study the mechanisms behind LET-dependent effects, expression profiling was performed after heavy-ion beam irradiation of imbibed rice seeds. Array-based experiments at three time points (0.5, 1, 2 h after the irradiation revealed that the number of up- or down-regulated genes was highest 2 h after irradiation. Array-based experiments with four different LETs at 2 h after irradiation identified LET-independent regulated genes that were up/down-regulated regardless of the value of LET; LET-dependent regulated genes, whose expression level increased with the rise of LET value, were also identified. Gene ontology (GO analysis of LET-independent up-regulated genes showed that some GO terms were commonly enriched, both 2 hours and 3 weeks after irradiation. GO terms enriched in LET-dependent regulated genes implied that some factor regulates genes that have kinase activity or DNA-binding activity in cooperation with the ATM gene. Of the LET-dependent up-regulated genes, OsPARP3 and OsPCNA were identified, which are involved in DNA repair pathways. This indicates that the Ku-independent alternative non-homologous end-joining pathway may contribute to repairing complex DNA legions induced by high-LET irradiation. These findings may clarify various LET-dependent responses in rice.

  10. Linear Energy Transfer-Dependent Change in Rice Gene Expression Profile after Heavy-Ion Beam Irradiation.

    Science.gov (United States)

    Ishii, Kotaro; Kazama, Yusuke; Morita, Ryouhei; Hirano, Tomonari; Ikeda, Tokihiro; Usuda, Sachiko; Hayashi, Yoriko; Ohbu, Sumie; Motoyama, Ritsuko; Nagamura, Yoshiaki; Abe, Tomoko

    2016-01-01

    A heavy-ion beam has been recognized as an effective mutagen for plant breeding and applied to the many kinds of crops including rice. In contrast with X-ray or γ-ray, the heavy-ion beam is characterized by a high linear energy transfer (LET). LET is an important factor affecting several aspects of the irradiation effect, e.g. cell survival and mutation frequency, making the heavy-ion beam an effective mutagen. To study the mechanisms behind LET-dependent effects, expression profiling was performed after heavy-ion beam irradiation of imbibed rice seeds. Array-based experiments at three time points (0.5, 1, 2 h after the irradiation) revealed that the number of up- or down-regulated genes was highest 2 h after irradiation. Array-based experiments with four different LETs at 2 h after irradiation identified LET-independent regulated genes that were up/down-regulated regardless of the value of LET; LET-dependent regulated genes, whose expression level increased with the rise of LET value, were also identified. Gene ontology (GO) analysis of LET-independent up-regulated genes showed that some GO terms were commonly enriched, both 2 hours and 3 weeks after irradiation. GO terms enriched in LET-dependent regulated genes implied that some factor regulates genes that have kinase activity or DNA-binding activity in cooperation with the ATM gene. Of the LET-dependent up-regulated genes, OsPARP3 and OsPCNA were identified, which are involved in DNA repair pathways. This indicates that the Ku-independent alternative non-homologous end-joining pathway may contribute to repairing complex DNA legions induced by high-LET irradiation. These findings may clarify various LET-dependent responses in rice.

  11. Ubiquitination-dependent mechanisms regulate synaptic growth and function.

    Science.gov (United States)

    DiAntonio, A; Haghighi, A P; Portman, S L; Lee, J D; Amaranto, A M; Goodman, C S

    2001-07-26

    The covalent attachment of ubiquitin to cellular proteins is a powerful mechanism for controlling protein activity and localization. Ubiquitination is a reversible modification promoted by ubiquitin ligases and antagonized by deubiquitinating proteases. Ubiquitin-dependent mechanisms regulate many important processes including cell-cycle progression, apoptosis and transcriptional regulation. Here we show that ubiquitin-dependent mechanisms regulate synaptic development at the Drosophila neuromuscular junction (NMJ). Neuronal overexpression of the deubiquitinating protease fat facets leads to a profound disruption of synaptic growth control; there is a large increase in the number of synaptic boutons, an elaboration of the synaptic branching pattern, and a disruption of synaptic function. Antagonizing the ubiquitination pathway in neurons by expression of the yeast deubiquitinating protease UBP2 (ref. 5) also produces synaptic overgrowth and dysfunction. Genetic interactions between fat facets and highwire, a negative regulator of synaptic growth that has structural homology to a family of ubiquitin ligases, suggest that synaptic development may be controlled by the balance between positive and negative regulators of ubiquitination.

  12. Prediction of epigenetically regulated genes in breast cancer cell lines

    Energy Technology Data Exchange (ETDEWEB)

    Loss, Leandro A; Sadanandam, Anguraj; Durinck, Steffen; Nautiyal, Shivani; Flaucher, Diane; Carlton, Victoria EH; Moorhead, Martin; Lu, Yontao; Gray, Joe W; Faham, Malek; Spellman, Paul; Parvin, Bahram

    2010-05-04

    Methylation of CpG islands within the DNA promoter regions is one mechanism that leads to aberrant gene expression in cancer. In particular, the abnormal methylation of CpG islands may silence associated genes. Therefore, using high-throughput microarrays to measure CpG island methylation will lead to better understanding of tumor pathobiology and progression, while revealing potentially new biomarkers. We have examined a recently developed high-throughput technology for measuring genome-wide methylation patterns called mTACL. Here, we propose a computational pipeline for integrating gene expression and CpG island methylation profles to identify epigenetically regulated genes for a panel of 45 breast cancer cell lines, which is widely used in the Integrative Cancer Biology Program (ICBP). The pipeline (i) reduces the dimensionality of the methylation data, (ii) associates the reduced methylation data with gene expression data, and (iii) ranks methylation-expression associations according to their epigenetic regulation. Dimensionality reduction is performed in two steps: (i) methylation sites are grouped across the genome to identify regions of interest, and (ii) methylation profles are clustered within each region. Associations between the clustered methylation and the gene expression data sets generate candidate matches within a fxed neighborhood around each gene. Finally, the methylation-expression associations are ranked through a logistic regression, and their significance is quantified through permutation analysis. Our two-step dimensionality reduction compressed 90% of the original data, reducing 137,688 methylation sites to 14,505 clusters. Methylation-expression associations produced 18,312 correspondences, which were used to further analyze epigenetic regulation. Logistic regression was used to identify 58 genes from these correspondences that showed a statistically signifcant negative correlation between methylation profles and gene expression in the

  13. Global regulator SATB1 recruits beta-catenin and regulates T(H2 differentiation in Wnt-dependent manner.

    Directory of Open Access Journals (Sweden)

    Dimple Notani

    2010-01-01

    Full Text Available In vertebrates, the conserved Wnt signalling cascade promotes the stabilization and nuclear accumulation of beta-catenin, which then associates with the lymphoid enhancer factor/T cell factor proteins (LEF/TCFs to activate target genes. Wnt/beta -catenin signalling is essential for T cell development and differentiation. Here we show that special AT-rich binding protein 1 (SATB1, the T lineage-enriched chromatin organizer and global regulator, interacts with beta-catenin and recruits it to SATB1's genomic binding sites. Gene expression profiling revealed that the genes repressed by SATB1 are upregulated upon Wnt signalling. Competition between SATB1 and TCF affects the transcription of TCF-regulated genes upon beta-catenin signalling. GATA-3 is a T helper type 2 (T(H2 specific transcription factor that regulates production of T(H2 cytokines and functions as T(H2 lineage determinant. SATB1 positively regulated GATA-3 and siRNA-mediated knockdown of SATB1 downregulated GATA-3 expression in differentiating human CD4(+ T cells, suggesting that SATB1 influences T(H2 lineage commitment by reprogramming gene expression. In the presence of Dickkopf 1 (Dkk1, an inhibitor of Wnt signalling, GATA-3 is downregulated and the expression of signature T(H2 cytokines such as IL-4, IL-10, and IL-13 is reduced, indicating that Wnt signalling is essential for T(H2 differentiation. Knockdown of beta-catenin also produced similar results, confirming the role of Wnt/beta-catenin signalling in T(H2 differentiation. Furthermore, chromatin immunoprecipitation analysis revealed that SATB1 recruits beta-catenin and p300 acetyltransferase on GATA-3 promoter in differentiating T(H2 cells in a Wnt-dependent manner. SATB1 coordinates T(H2 lineage commitment by reprogramming gene expression. The SATB1:beta-catenin complex activates a number of SATB1 regulated genes, and hence this study has potential to find novel Wnt responsive genes. These results demonstrate that SATB1

  14. FAD-dependent lysine-specific demethylase-1 regulates cellular energy expenditure

    OpenAIRE

    Hino, Shinjiro; Sakamoto, Akihisa; Nagaoka, Katsuya; Anan, Kotaro; Wang, Yuqing; Mimasu, Shinya; Umehara, Takashi; Yokoyama, Shigeyuki; Kosai, Ken-ichiro; Nakao, Mitsuyoshi

    2012-01-01

    Environmental factors such as nutritional state may act on the epigenome that consequently contributes to the metabolic adaptation of cells and the organisms. The lysine-specific demethylase-1 (LSD1) is a unique nuclear protein that utilizes flavin adenosine dinucleotide (FAD) as a cofactor. Here we show that LSD1 epigenetically regulates energy-expenditure genes in adipocytes depending on the cellular FAD availability. We find that the loss of LSD1 function, either by short interfering RNA o...

  15. The Developmental Intestinal Regulator ELT-2 Controls p38-Dependent Immune Responses in Adult C. elegans.

    Science.gov (United States)

    Block, Dena H S; Twumasi-Boateng, Kwame; Kang, Hae Sung; Carlisle, Jolie A; Hanganu, Alexandru; Lai, Ty Yu-Jen; Shapira, Michael

    2015-05-01

    GATA transcription factors play critical roles in cellular differentiation and development. However, their roles in mature tissues are less understood. In C. elegans larvae, the transcription factor ELT-2 regulates terminal differentiation of the intestine. It is also expressed in the adult intestine, where it was suggested to maintain intestinal structure and function, and where it was additionally shown to contribute to infection resistance. To study the function of elt-2 in adults we characterized elt-2-dependent gene expression following its knock-down specifically in adults. Microarray analysis identified two ELT-2-regulated gene subsets: one, enriched for hydrolytic enzymes, pointed at regulation of constitutive digestive functions as a dominant role of adult elt-2; the second was enriched for immune genes that are induced in response to Pseudomonas aeruginosa infection. Focusing on the latter, we used genetic analyses coupled to survival assays and quantitative RT-PCR to interrogate the mechanism(s) through which elt-2 contributes to immunity. We show that elt-2 controls p38-dependent gene induction, cooperating with two p38-activated transcription factors, ATF-7 and SKN-1. This demonstrates a mechanism through which the constitutively nuclear elt-2 can impact induced responses, and play a dominant role in C. elegans immunity.

  16. Cell cycle-regulated expression of mammalian CDC6 is dependent on E2F

    DEFF Research Database (Denmark)

    Hateboer, G; Wobst, A; Petersen, B O

    1998-01-01

    The E2F transcription factors are essential regulators of cell growth in multicellular organisms, controlling the expression of a number of genes whose products are involved in DNA replication and cell proliferation. In Saccharomyces cerevisiae, the MBF and SBF transcription complexes have...... of this gene is dependent on E2F. In vivo footprinting data demonstrate that the identified E2F sites are occupied in resting cells and in exponentially growing cells, suggesting that E2F is responsible for downregulating the promoter in early phases of the cell cycle and the subsequent upregulation when cells...

  17. Cell fate determination by ubiquitin-dependent regulation of translation

    Science.gov (United States)

    Werner, Achim; Iwasaki, Shintaro; McGourty, Colleen; Medina-Ruiz, Sofia; Teerikorpi, Nia; Fedrigo, Indro; Ingolia, Nicholas T.; Rape, Michael

    2015-01-01

    Metazoan development depends on accurate execution of differentiation programs that allow pluripotent stem cells to adopt specific fates 1. Differentiation requires changes to chromatin architecture and transcriptional networks, yet whether other regulatory events support cell fate determination is less well understood. Here, we have identified the vertebrate-specific ubiquitin ligase CUL3KBTBD8 as an essential regulator of neural crest specification. CUL3KBTBD8 monoubiquitylates NOLC1 and its paralog TCOF1, whose mutation underlies the neurocristopathy Treacher Collins Syndrome 2,3. Ubiquitylation drives formation of a TCOF1-NOLC1 platform that connects RNA polymerase I with ribosome modification enzymes and remodels the translational program of differentiating cells in favor of neural crest specification. We conclude that ubiquitin-dependent regulation of translation is an important feature of cell fate determination. PMID:26399832

  18. Transcriptional regulation in adipogenesis through PPARγ-dependent and -independent mechanisms by prostaglandins.

    Science.gov (United States)

    Fujimori, Ko; Urade, Yoshihiro

    2014-01-01

    Adipogenesis is controlled by complex mechanisms, and transcription factors are involved in its regulation. PPARγ is a ligand-dependent transcription factor and the most important one for adipogenesis. Although prostaglandin (PG) D2 metabolites have been reported as being the ligands of PPARγ, the endogenous PPARγ ligand in adipocytes remains unclear. Here, we show the methods for the general analysis of adipocyte differentiation and the protocols for promoter analysis, fluorescence EMSA, and chromatin immunoprecipitation assay for the transcriptional regulation of the SREBP-1c-activated lipocalin-type PGD synthase gene in adipocytes. Moreover, we describe that PGD2 and its metabolites are involved in the regulation of adipogenesis through PPARγ-dependent and -independent mechanisms.

  19. Unraveling the complex epigenetic mechanisms that regulate gene activity

    NARCIS (Netherlands)

    Bemer, Marian

    2018-01-01

    Our understanding of the epigenetic mechanisms that regulate gene expression has been largely increased in recent years by the development and refinement of different techniques. This has revealed that gene transcription is highly influenced by epigenetic mechanisms, i.e., those that do not involve

  20. DksA-dependent transcriptional regulation in Salmonella experiencing nitrosative stress

    Directory of Open Access Journals (Sweden)

    Matthew A Crawford

    2016-03-01

    Full Text Available Redox-based signaling is fundamental to the capacity of bacteria to sense, and respond to, nitrosative and oxidative stress encountered in natural and host environments. The conserved RNA polymerase regulatory protein DksA is a thiol-based sensor of reactive nitrogen and oxygen species. DksA-dependent transcriptional control promotes antinitrosative and antioxidative defenses that contribute to Salmonella pathogenesis. The specific adaptive changes mediated by DksA in response to reactive species, however, have not been elucidated. Herein, we characterize DksA-dependent changes in gene expression in Salmonella enterica experiencing nitrosative stress. Genome-wide expression analysis of wild-type and delta-dksA Salmonella exposed to the nitric oxide (•NO donor DETA NONOate demonstrated •NO- and DksA-dependent regulatory control of 427 target genes. Transcriptional changes centered primarily on genes encoding aspects of cellular metabolism. Several antioxidants and oxidoreductases important in redox buffering, •NO detoxification, and damage repair were also observed to be up-regulated in an •NO- and DksA-dependent manner. Compared to wild-type bacteria, •NO-treated delta-dksA Salmonella exhibited a de-repression of genes encoding components of iron homeostasis and failed to activate sulfur assimilation and cysteine biosynthetic operons. As cysteine is integral to efficient antinitrosative and antioxidative defense and repair programs, we further examined the redox-responsive transcriptional control of cysteine biosynthesis by DksA. These investigations revealed that the activation of genes comprising cysteine biosynthesis also occurs in response to hydrogen peroxide, is dependent upon the redox-sensing zinc finger domain of DksA, and requires the transcriptional regulator CysB. Our observations demonstrate that DksA mediates global adaptation to nitrosative stress in Salmonella and provide unique insight into a novel regulatory mechanism

  1. Phosphorylation-dependent down-regulation of apolipoprotein A5 by insulin

    Energy Technology Data Exchange (ETDEWEB)

    Nowak, Maxine; Helleboid-Chapman, Audrey; Jakel, Heidelinde; Rommens, Corinne; Martin, Genevieve; Duran-Sandoval, Daniel; Staels, Bart; Rubin, Edward M.; Pennacchio, Len A.; Taskinen, Marja-Riitta; Fruchart-Najib, Jamila; Fruchart, Jean-Charles

    2004-02-15

    The apolipoprotein A5 (APOA5) gene has been shown to be important in lowering plasma triglyceride levels. Since several studies have shown that hyperinsulinemia is associated with hypertriglyceridemia, we sought to determine whether APOA5 gene is regulated by insulin. We show here that cell and mouse treatments with insulin down-regulated APOA5 expression in a dose-dependent manner. Furthermore, we determined that insulin decreases APOA5 promoter activity and subsequent deletion analyses revealed an E-box-containing fragment. We showed that Upstream Stimulatory Factors, USF1/USF2, bind to the identified E-box in the APOA5 promoter. Moreover, in cotransfection studies, USF1 stimulates APOA5 promoter activity. The treatment with insulin reduces the binding of USF1/USF2 to APOA5 promoter. The inhibition of PI3K pathway with wortmannin abolished the insulin s effect on APOA5 gene transcription. Using oligoprecipitation method of USF from nuclear extracts, we demonstrated that phosphorylated USF1 failed to bind to APOA5 promoter. This indicates that the APOA5 gene transrepression by insulin involves a phosphorylation of USF through PI3K, that modulate their binding to APOA5 promoter and results in APOA5 down-regulation. The effect of exogenous hyperinsulinemia in healthy men shows a decrease of the plasma ApoAV level. These data suggest a potential mechanism involving APOA5 gene in hypertriglyceridemia associated with hyperinsulinemia.

  2. Antisense long noncoding RNAs regulate var gene activation in the malaria parasite Plasmodium falciparum.

    Science.gov (United States)

    Amit-Avraham, Inbar; Pozner, Guy; Eshar, Shiri; Fastman, Yair; Kolevzon, Netanel; Yavin, Eylon; Dzikowski, Ron

    2015-03-03

    The virulence of Plasmodium falciparum, the causative agent of the deadliest form of human malaria, is attributed to its ability to evade human immunity through antigenic variation. These parasites alternate between expression of variable antigens, encoded by members of a multicopy gene family named var. Immune evasion through antigenic variation depends on tight regulation of var gene expression, ensuring that only a single var gene is expressed at a time while the rest of the family is maintained transcriptionally silent. Understanding how a single gene is chosen for activation is critical for understanding mutually exclusive expression but remains a mystery. Here, we show that antisense long noncoding RNAs (lncRNAs) initiating from var introns are associated with the single active var gene at the time in the cell cycle when the single var upstream promoter is active. We demonstrate that these antisense transcripts are incorporated into chromatin, and that expression of these antisense lncRNAs in trans triggers activation of a silent var gene in a sequence- and dose-dependent manner. On the other hand, interference with these lncRNAs using complement peptide nucleic acid molecules down-regulated the active var gene, erased the epigenetic memory, and induced expression switching. Altogether, our data provide evidence that these antisense lncRNAs play a key role in regulating var gene activation and mutually exclusive expression.

  3. Autism and increased paternal age related changes in global levels of gene expression regulation.

    Directory of Open Access Journals (Sweden)

    Mark D Alter

    2011-02-01

    Full Text Available A causal role of mutations in multiple general transcription factors in neurodevelopmental disorders including autism suggested that alterations in global levels of gene expression regulation might also relate to disease risk in sporadic cases of autism. This premise can be tested by evaluating for changes in the overall distribution of gene expression levels. For instance, in mice, variability in hippocampal-dependent behaviors was associated with variability in the pattern of the overall distribution of gene expression levels, as assessed by variance in the distribution of gene expression levels in the hippocampus. We hypothesized that a similar change in variance might be found in children with autism. Gene expression microarrays covering greater than 47,000 unique RNA transcripts were done on RNA from peripheral blood lymphocytes (PBL of children with autism (n = 82 and controls (n = 64. Variance in the distribution of gene expression levels from each microarray was compared between groups of children. Also tested was whether a risk factor for autism, increased paternal age, was associated with variance. A decrease in the variance in the distribution of gene expression levels in PBL was associated with the diagnosis of autism and a risk factor for autism, increased paternal age. Traditional approaches to microarray analysis of gene expression suggested a possible mechanism for decreased variance in gene expression. Gene expression pathways involved in transcriptional regulation were down-regulated in the blood of children with autism and children of older fathers. Thus, results from global and gene specific approaches to studying microarray data were complimentary and supported the hypothesis that alterations at the global level of gene expression regulation are related to autism and increased paternal age. Global regulation of transcription, thus, represents a possible point of convergence for multiple etiologies of autism and other

  4. Regulation of gene expression in entomopathogenic fungi in three ...

    African Journals Online (AJOL)

    The entomopathogenic fungi are subject to regulation system known as signal transduction that regulates the expression of the different genes required for each life stage, first comprising cuticle adhesion and degradation, later the survival in the hemolymph, and finally the fungal growth in soils. There are two ...

  5. The CHR Promoter Element Controls Cell Cycle-Dependent Gene Transcription and Binds the DREAM and MMB Complexes

    OpenAIRE

    Müller, Gerd A.; Quaas, Marianne; Schümann, Michael; Krause, Eberhard; Fischer, Martin; Engeland, Kurt; Padi, Megha; Litovchick, Larisa; DeCaprio, James A.

    2011-01-01

    Cell cycle-dependent gene expression is often controlled on the transcriptional level. Genes like \\(cyclin B, CDC2\\) and \\(CDC25C\\) are regulated by cell cycle-dependent element (CDE) and cell cycle genes homology region (CHR) promoter elements mainly through repression in \\(G_0/G_1\\). It had been suggested that E2F4 binding to CDE sites is central to transcriptional regulation. However, some promoters are only controlled by a CHR. We identify the DREAM complex binding to the CHR of mouse and...

  6. Posttranscriptional Regulation of the Neurofibromatosis 2 Gene

    Science.gov (United States)

    2006-07-01

    S., Bertucci, F., Birnbaum, D., Nguyen, C., Harousseau, J.L., Bataille , R., Houlgatte, R., and Minvielle, S. 2003. Gene expression profiling of...role of Rho in cell transformation by oncogenic Ras. Oncogene 10:2289-2296. 182. Pykett, M.J., Murphy, M., Harnish, P.R., and George , D.L. 1994. The

  7. Regulation of Clock Genes by Adrenergic Receptor Signaling in Osteoblasts.

    Science.gov (United States)

    Hirai, Takao

    2018-01-01

    The clock system has been identified as one of the major mechanisms controlling cellular functions. Circadian clock gene oscillations also actively participate in the functions of various cell types including bone-related cells. Previous studies demonstrated that clock genes were expressed in bone tissue and also that their expression exhibited circadian rhythmicity. Recent findings have shown that sympathetic tone plays a central role in biological oscillations in bone. Adrenergic receptor (AR) signaling regulates the expression of clock genes in cancellous bone. Furthermore, α 1 -AR signaling in osteoblasts is known to negatively regulate the expression of bone morphogenetic protein-4 (Bmp4) by up-regulating nuclear factor IL-3 (Nfil3)/e4 promoter-binding protein 4 (E4BP4). The ablation of α 1B -AR signaling also increases the expression of the Bmp4 gene in bone. The findings of transient overexpression and siRNA experiments have supported the involvement of the transcription factor CCAAT/enhancer-binding protein delta (C/EBPδ, Cebpd) in Nfil3 and Bmp4 expression in MC3T3-E1 cells. These findings suggest that the effects of Cebpd are due to the circadian regulation of Bmp4 expression, at least in part, by the up-regulated expression of the clock gene Nfil3 in response to α 1B -AR signaling in osteoblasts. Therefore, AR signaling appears to modulate cellular functionality through the expression of clock genes that are circadian rhythm regulators in osteoblasts. The expression of clock genes regulated by the sympathetic nervous system and clock-controlled genes that affect bone metabolism are described herein.

  8. Co-regulation of metabolic genes is better explained by flux coupling than by network distance.

    Directory of Open Access Journals (Sweden)

    Richard A Notebaart

    2008-01-01

    Full Text Available To what extent can modes of gene regulation be explained by systems-level properties of metabolic networks? Prior studies on co-regulation of metabolic genes have mainly focused on graph-theoretical features of metabolic networks and demonstrated a decreasing level of co-expression with increasing network distance, a naïve, but widely used, topological index. Others have suggested that static graph representations can poorly capture dynamic functional associations, e.g., in the form of dependence of metabolic fluxes across genes in the network. Here, we systematically tested the relative importance of metabolic flux coupling and network position on gene co-regulation, using a genome-scale metabolic model of Escherichia coli. After validating the computational method with empirical data on flux correlations, we confirm that genes coupled by their enzymatic fluxes not only show similar expression patterns, but also share transcriptional regulators and frequently reside in the same operon. In contrast, we demonstrate that network distance per se has relatively minor influence on gene co-regulation. Moreover, the type of flux coupling can explain refined properties of the regulatory network that are ignored by simple graph-theoretical indices. Our results underline the importance of studying functional states of cellular networks to define physiologically relevant associations between genes and should stimulate future developments of novel functional genomic tools.

  9. Sibling genes as environment: Sibling dopamine genotypes and adolescent health support frequency dependent selection.

    Science.gov (United States)

    Rauscher, Emily; Conley, Dalton; Siegal, Mark L

    2015-11-01

    While research consistently suggests siblings matter for individual outcomes, it remains unclear why. At the same time, studies of genetic effects on health typically correlate variants of a gene with the average level of behavioral or health measures, ignoring more complicated genetic dynamics. Using National Longitudinal Study of Adolescent Health data, we investigate whether sibling genes moderate individual genetic expression. We compare twin variation in health-related absences and self-rated health by genetic differences at three locations related to dopamine regulation and transport to test sibship-level cross-person gene-gene interactions. Results suggest effects of variation at these genetic locations are moderated by sibling genes. Although the mechanism remains unclear, this evidence is consistent with frequency dependent selection and suggests much genetic research may violate the stable unit treatment value assumption. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. Plant defense genes are regulated by ethylene

    Energy Technology Data Exchange (ETDEWEB)

    Ecker, J.R.; Davis, R.W.

    1987-08-01

    One of the earliest detectable events during plant-pathogen interaction is a rapid increase in ethylene biosynthesis. This gaseous plant stress hormone may be a signal for plants to activate defense mechanisms against invading pathogens such as bacteria, fungi, and viruses. The effect of ethylene on four plant genes involved in three separate plant defense response pathways was examined; these included (i and ii) genes that encode L-phenylalanine ammonia-lyase (EC 4.3.1.5) and 4-coumarate:CoA ligase (4-coumarate:CoA ligase (AMP-forming), EC 6.2.1.12), enzymes of the phenylpropanoid pathway, (iii) the gene encoding chalcone synthase, an enzyme of the flavonoid glycoside pathway, and (iv) the genes encoding hydroxyproline-rich glycoprotein, a major protein component(s) of plant cell walls. Blot hybridization analysis of mRNA from ethylene-treated carrot roots reveals marked increases in the levels of phenylalanine ammonia-lyase mRNA, 4-coumarate CoA ligase mRNA, chalcone synthase mRNA, and certain hydroxyproline-rich glycoprotein transcripts. The effect of ethylene on hydroxyproline-rich glycoprotein mRNA accumulation was different from that of wounding. Ethylene induces two hydroxyproline-rich glycoprotein mRNAs (1.8 and 4.0 kilobases), whereas wounding of carrot root leads to accumulation of an additional hydroxyproline-rich mRNA (1.5 kilobases). These results indicate that at least two distinct signals, ethylene and a wound signal, can affect the expression of plant defense-response genes.

  11. NLR-Dependent Regulation of Inflammation in Multiple Sclerosis

    Directory of Open Access Journals (Sweden)

    Marjan Gharagozloo

    2018-01-01

    Full Text Available Multiple sclerosis (MS is an autoimmune disease of the central nervous system (CNS associated with inappropriate activation of lymphocytes, hyperinflammatory responses, demyelination, and neuronal damage. In the past decade, a number of biological immunomodulators have been developed that suppress the peripheral immune responses and slow down the progression of the disease. However, once the inflammation of the CNS has commenced, it can cause serious permanent neuronal damage. Therefore, there is a need for developing novel therapeutic approaches that control and regulate inflammatory responses within the CNS. Nucleotide-binding oligomerization domain (NOD-like receptors (NLRs are intracellular regulators of inflammation expressed by many cell types within the CNS. They redirect multiple signaling pathways initiated by pathogens and molecules released by injured tissues. NLR family members include positive regulators of inflammation, such as NLRP3 and NLRC4 and anti-inflammatory NLRs, such as NLRX1 and NLRP12. They exert immunomodulatory effect at the level of peripheral immune responses, including antigen recognition and lymphocyte activation and differentiation. Also, NLRs regulate tissue inflammatory responses. Understanding the molecular mechanisms that are placed at the crossroad of innate and adaptive immune responses, such as NLR-dependent pathways, could lead to the discovery of new therapeutic targets. In this review, we provide a summary of the role of NLRs in the pathogenesis of MS. We also summarize how anti-inflammatory NLRs regulate the immune response within the CNS. Finally, we speculate the therapeutic potential of targeting NLRs in MS.

  12. Regulation of bacterial gene expression by ribosome stalling and rescuing.

    Science.gov (United States)

    Jin, Yongxin; Jin, Shouguang; Wu, Weihui

    2016-05-01

    Ribosome is responsible for protein synthesis and is able to monitor the sequence and structure of the nascent peptide. Such ability plays an important role in determining overall gene expression profile of the bacteria through ribosome stalling and rescuing. In this review, we briefly summarize our current understanding of the regulation of gene expression through ribosome stalling and rescuing in bacteria, as well as mechanisms that modulate ribosome activity. Understanding the mechanisms of how bacteria modulate ribosome activity will provide not only fundamental insights into bacterial gene regulation, but also new candidate targets for the development of novel antimicrobial agents.

  13. Gene regulation by MAP kinase cascades

    DEFF Research Database (Denmark)

    Fiil, Berthe Katrine; Petersen, Klaus; Petersen, Morten

    2009-01-01

    Mitogen-activated protein kinase (MAPK) cascades are signaling modules that transduce extracellular stimuli to a range of cellular responses. Research in yeast and metazoans has shown that MAPK-mediated phosphorylation directly or indirectly regulates the activity of transcription factors. Plant ...

  14. Overexpression and Down-Regulation of Barley Lipoxygenase LOX2.2 Affects Jasmonate-Regulated Genes and Aphid Fecundity

    Directory of Open Access Journals (Sweden)

    Aleksandra Losvik

    2017-12-01

    Full Text Available Aphids are pests on many crops and depend on plant phloem sap as their food source. In an attempt to find factors improving plant resistance against aphids, we studied the effects of overexpression and down-regulation of the lipoxygenase gene LOX2.2 in barley (Hordeum vulgare L. on the performance of two aphid species. A specialist, bird cherry-oat aphid (Rhopalosiphum padi L. and a generalist, green peach aphid (Myzus persicae Sulzer were studied. LOX2.2 overexpressing lines showed up-regulation of some other jasmonic acid (JA-regulated genes, and antisense lines showed down-regulation of such genes. Overexpression or suppression of LOX2.2 did not affect aphid settling or the life span on the plants, but in short term fecundity tests, overexpressing plants supported lower aphid numbers and antisense plants higher aphid numbers. The amounts and composition of released volatile organic compounds did not differ between control and LOX2.2 overexpressing lines. Up-regulation of genes was similar for both aphid species. The results suggest that LOX2.2 plays a role in the activation of JA-mediated responses and indicates the involvement of LOX2.2 in basic defense responses.

  15. Sex-Dependent Gene Expression in Human Pluripotent Stem Cells

    Directory of Open Access Journals (Sweden)

    Daniel Ronen

    2014-08-01

    Full Text Available Males and females have a variety of sexually dimorphic traits, most of which result from hormonal differences. However, differences between male and female embryos initiate very early in development, before hormonal influence begins, suggesting the presence of genetically driven sexual dimorphisms. By comparing the gene expression profiles of male and X-inactivated female human pluripotent stem cells, we detected Y-chromosome-driven effects. We discovered that the sex-determining gene SRY is expressed in human male pluripotent stem cells and is induced by reprogramming. In addition, we detected more than 200 differentially expressed autosomal genes in male and female embryonic stem cells. Some of these genes are involved in steroid metabolism pathways and lead to sex-dependent differentiation in response to the estrogen precursor estrone. Thus, we propose that the presence of the Y chromosome and specifically SRY may drive sex-specific differences in the growth and differentiation of pluripotent stem cells.

  16. Post-transcriptional regulation of gene expression in Yersinia species

    Directory of Open Access Journals (Sweden)

    Chelsea A Schiano

    2012-11-01

    Full Text Available Proper regulation of gene expression is required by bacterial pathogens to respond to continually changing environmental conditions and the host response during the infectious process. While transcriptional regulation is perhaps the most well understood form of controlling gene expression, recent studies have demonstrated the importance of post-transcriptional mechanisms of gene regulation that allow for more refined management of the bacterial response to host conditions. Yersinia species of bacteria are known to use various forms of post-transcriptional regulation for control of many virulence-associated genes. These include regulation by cis- and trans-acting small non-coding RNAs, RNA-binding proteins, RNases, and thermoswitches. The effects of these and other regulatory mechanisms on Yersinia physiology can be profound and have been shown to influence type III secretion, motility, biofilm formation, host cell invasion, intracellular survival and replication, and more. In this review, we will discuss these and other post-transcriptional mechanisms and their influence on virulence gene regulation, with a particular emphasis on how these processes influence the virulence of Yersinia in the host.

  17. Link between the causative genes of holoprosencephaly: Zic2 directly regulates Tgif1 expression.

    Science.gov (United States)

    Ishiguro, Akira; Hatayama, Minoru; Otsuka, Maky I; Aruga, Jun

    2018-02-01

    One of the causal genes for holoprosencephaly (HPE) is ZIC2 (HPE5). It belongs to the zinc finger protein of the cerebellum (Zic) family of genes that share a C2H2-type zinc finger domain, similar to the GLI family of genes. In order to clarify the role of Zic2 in gene regulation, we searched for its direct target genes using chromatin immunoprecipitation (ChIP). We identified TGIF1 (HPE4), another holoprosencephaly-causative gene in humans. We identified Zic2-binding sites (ZBS) on the 5' flanking region of Tgif1 by in vitro DNA binding assays. ZBS were essential for Zic2-dependent transcriptional activation in reporter gene assays. Zic2 showed a higher affinity to ZBS than GLI-binding sequences. Zic2-binding to the cis-regulatory element near the Tgif1 promoter may be involved in the mechanism underlying forebrain development and incidences of HPE.

  18. Novel Sfp1 Transcriptional Regulation of Saccharomyces cerevisiae Gene Expression Changes During Spaceflight

    Science.gov (United States)

    Coleman, Chasity B.; Allen, Patricia L.; Rupert, Mark; Goulart, Carla; Hoehn, Alexander; Stodieck, Louis S.; Hammond, Timothy G.

    2008-12-01

    This study identifies transcriptional regulation of stress response element (STRE) genes in space in the model eukaryotic organism, Saccharomyces cerevisiae. To determine transcription-factor dependence, gene expression changes in space were examined in strains bearing green fluorescent protein tagged (GFP-tagged) reporters for YIL052C (Sfp1 dependent with stress), YST-2 (Sfp1/Rap1 dependent with stress), or SSA4 (Msn4 dependent with stress), along with strains of SSA4-GFP and YIL052C-GFP with individual deletions of the Msn4 or Sfp1. When compared to parallel ground controls, spaceflight induces significant gene expression changes in SSA4 (35% decrease) and YIL052C (45% decrease), while expression of YST-2 (0.08% decrease) did not change. In space, deletion of Sfp1 reversed the SSA4 gene expression effect (0.00% change), but Msn4 deletion yielded a similar decrease in SSA4 expression (34% change), which indicates that SSA4 gene expression is dependent on the Sfp1 transcription factor in space, unlike other stresses. For YIL052C, deletion of Sfp1 reversed the effect (0.01% change), and the Msn4 deletion maintained the decrease in expression (30% change), which indicates that expression of YIL052C is also dependent on Sfp1 in space. Spaceflight has selective and specific effects on SSA4 and YIL052C gene expression, indicated by novel dependence on Sfp1.

  19. Light-dependent expression of flg22-induced defense genes in Arabidopsis

    Directory of Open Access Journals (Sweden)

    Satoshi eSano

    2014-10-01

    Full Text Available Chloroplasts have been reported to generate retrograde immune signals that activate defense gene expression in the nucleus. However, the roles of light and photosynthesis in plant immunity remain largely elusive. In this study, we evaluated the effects of light on the expression of defense genes induced by flg22, a peptide derived from bacterial flagellins which acts as a potent elicitor in plants. Whole-transcriptome analysis of flg22-treated Arabidopsis thaliana seedlings under light and dark conditions for 30 min revealed that a number of (30% genes strongly induced by flg22 (>4.0 require light for their rapid expression, whereas flg22-repressed genes include a significant number of genes that are down-regulated by light. Furthermore, light is responsible for the flg22-induced accumulation of salicylic acid, indicating that light is indispensable for basal defense responses in plants. To elucidate the role of photosynthesis in defense, we further examined flg22-induced defense gene expression in the presence of specific inhibitors of photosynthetic electron transport: 3-(3,4-dichlorophenyl-1,1-dimethylurea (DCMU and 2,5-dibromo-3-methyl-6-isopropyl-benzoquinone (DBMIB. Light-dependent expression of defense genes was largely suppressed by DBMIB, but only partially suppressed by DCMU. These findings suggest that photosynthetic electron flow plays a role in controling the light-dependent expression of flg22-inducible defense genes.

  20. Y Chromosome Regulation of Autism Susceptibility Genes

    Science.gov (United States)

    2009-06-01

    autistic children. Such distorted ratio could be as high as 8:1 in some populations [12, 13]. Sexual dimorphism in autism is a key and consistent... autism [18-24]. Recent studies in our laboratory suggest that genes on the Y chromosome could contribute to such sexual dimorphisms, thereby raising the...contribute to autism susceptibility, have provided a critical clue that the male-only chromosome is potentially a key player in the sexual dimorphism

  1. Estrogen Receptor Alpha (ESR1-Dependent Regulation of the Mouse Oviductal Transcriptome.

    Directory of Open Access Journals (Sweden)

    Katheryn L Cerny

    Full Text Available Estrogen receptor-α (ESR1 is an important transcriptional regulator in the mammalian oviduct, however ESR1-dependent regulation of the transcriptome of this organ is not well defined, especially at the genomic level. The objective of this study was therefore to investigate estradiol- and ESR1-dependent regulation of the transcriptome of the oviduct using transgenic mice, both with (ESR1KO and without (wild-type, WT a global deletion of ESR1. Oviducts were collected from ESR1KO and WT littermates at 23 days of age, or ESR1KO and WT mice were treated with 5 IU PMSG to stimulate follicular development and the production of ovarian estradiol, and the oviducts collected 48 h later. RNA extracted from whole oviducts was hybridized to Affymetrix Genechip Mouse Genome 430-2.0 arrays (n = 3 arrays per genotype and treatment or reverse transcribed to cDNA for analysis of the expression of selected mRNAs by real-time PCR. Following microarray analysis, a statistical two-way ANOVA and pairwise comparison (LSD test revealed 2428 differentially expressed transcripts (DEG's, P < 0.01. Genotype affected the expression of 2215 genes, treatment (PMSG affected the expression of 465 genes, and genotype x treatment affected the expression of 438 genes. With the goal of determining estradiol/ESR1-regulated function, gene ontology (GO and bioinformatic pathway analyses were performed on DEG's in the oviducts of PMSG-treated ESR1KO versus PMSG-treated WT mice. Significantly enriched GO molecular function categories included binding and catalytic activity. Significantly enriched GO cellular component categories indicated the extracellular region. Significantly enriched GO biological process categories involved a single organism, modulation of a measurable attribute and developmental processes. Bioinformatic analysis revealed ESR1-regulation of the immune response within the oviduct as the primary canonical pathway. In summary, a transcriptomal profile of estradiol- and

  2. Does negative auto-regulation increase gene duplicability?

    Directory of Open Access Journals (Sweden)

    Lercher Martin J

    2009-08-01

    Full Text Available Abstract Background A prerequisite for a duplication to spread through and persist in a given population is retaining expression of both gene copies. Yet changing a gene's dosage is frequently detrimental to fitness. Consequently, dosage-sensitive genes are less likely to duplicate. However, in cases where the level of gene product is controlled, via negative feedback, by its own abundance, an increase in gene copy number can in principle be decoupled from an increase in protein while both copies remain expressed. Using data from the transcriptional networks of E. coli and S. cerevisiae, we test the hypothesis that genes under negative auto-regulation show enhanced duplicability. Results Controlling for several known correlates of duplicability, we find no statistically significant support in either E. coli or S. cerevisiae that transcription factors under negative auto-regulation hold a duplicability advantage over transcription factors with no auto-regulation. Conclusion Based on the analysis of transcriptional networks in E. coli and S. cerevisiae, there is no evidence that negative auto-regulation has contributed, on a genome-wide scale, to the variability in gene family sizes in these species.

  3. Identification of Human HK Genes and Gene Expression Regulation Study in Cancer from Transcriptomics Data Analysis

    Science.gov (United States)

    Zhang, Zhang; Liu, Jingxing; Wu, Jiayan; Yu, Jun

    2013-01-01

    The regulation of gene expression is essential for eukaryotes, as it drives the processes of cellular differentiation and morphogenesis, leading to the creation of different cell types in multicellular organisms. RNA-Sequencing (RNA-Seq) provides researchers with a powerful toolbox for characterization and quantification of transcriptome. Many different human tissue/cell transcriptome datasets coming from RNA-Seq technology are available on public data resource. The fundamental issue here is how to develop an effective analysis method to estimate expression pattern similarities between different tumor tissues and their corresponding normal tissues. We define the gene expression pattern from three directions: 1) expression breadth, which reflects gene expression on/off status, and mainly concerns ubiquitously expressed genes; 2) low/high or constant/variable expression genes, based on gene expression level and variation; and 3) the regulation of gene expression at the gene structure level. The cluster analysis indicates that gene expression pattern is higher related to physiological condition rather than tissue spatial distance. Two sets of human housekeeping (HK) genes are defined according to cell/tissue types, respectively. To characterize the gene expression pattern in gene expression level and variation, we firstly apply improved K-means algorithm and a gene expression variance model. We find that cancer-associated HK genes (a HK gene is specific in cancer group, while not in normal group) are expressed higher and more variable in cancer condition than in normal condition. Cancer-associated HK genes prefer to AT-rich genes, and they are enriched in cell cycle regulation related functions and constitute some cancer signatures. The expression of large genes is also avoided in cancer group. These studies will help us understand which cell type-specific patterns of gene expression differ among different cell types, and particularly for cancer. PMID:23382867

  4. Opposing roles of STAT4 and Dnmt3a in Th1 gene regulation

    Science.gov (United States)

    Pham, Duy; Yu, Qing; Walline, Crystal C.; Muthukrishnan, Rajarajeswari; Blum, Janice S.; Kaplan, Mark H.

    2013-01-01

    The Signal Transducer and Activator of Transcription factor STAT4 is a critical regulator of Th1 differentiation and inflammatory disease. Yet, how STAT4 regulates gene expression is still unclear. In this report, we define a STAT4-dependent sequence of events including H3K4 methylation, Jmjd3 association with STAT4 target loci, and a Jmjd3-dependent decrease in H3K27 trimethylation and DNA methyltransferase (Dnmt) 3a association with STAT4 target loci. Dnmt3a has an obligate role in repressing Th1 gene expression, and in Th1 cultures deficient in both STAT4 and Dnmt3a, there is recovery in the expression of a subset of Th1 genes that is sufficient to increase IFNγ production. Moreover, although STAT4-deficient mice are protected from the development of EAE, mice deficient in STAT4 and conditionally-deficient in Dnmt3a in T cells develop paralysis. Th1 genes that are de-repressed in the absence of Dnmt3a have greater induction following the ectopic expression of the Th1-associated transcription factors T-bet and Hlx1. Together, these data demonstrate that STAT4 and Dnmt3a play opposing roles in regulating Th1 gene expression, and that one mechanism for STAT4-dependent gene programming is in establishing a de-repressed genetic state susceptible to transactivation by additional fate-determining transcription factors. PMID:23772023

  5. Expansion of the Tetracycline-Dependent Regulation Toolbox for Helicobacter pylori

    Science.gov (United States)

    Sehnal, Miriam; Liao, Tingting; Stubbs, Keith A.; Marshall, Barry J.; Benghezal, Mohammed

    2015-01-01

    In an effort to gain greater understanding of the biology and infection processes of Helicobacter pylori, we have expanded the functionality of the tetracycline-dependent gene regulation (tet) system to provide more improved and versatile genetic control and facilitate the generation of conditional mutants to study essential genes. Second-generation tetracycline-responsive H. pylori uPtetO5 promoters were based on the mutated core ureA promoter. Single point mutations at either the ribosomal binding site or the start codon were introduced to shift the regulatory range of three uPtetO5 derivatives. All promoters were tested for regulation by TetR and revTetR using dapD, a gene essential to peptidoglycan biosynthesis, as a reporter. All tet promoters were effectively regulated by both TetR and revTetR, and their regulation windows overlapped so as to cover a broad range of expression levels. tet promoters uPtetO5m1 and uPtetO5m2 could be sufficiently silenced by both TetR and revTetR so that the conditional mutants could not grow in the absence of diaminopimelic acid (DAP). Furthermore, through the use of these inducible promoters, we reveal that insufficient DAP biosynthesis results in viable cells with altered morphology. Overall, the development and optimization of tet regulation for H. pylori will not only permit the study of essential genes but also facilitate investigations into gene dosage effects on H. pylori physiology. PMID:26362986

  6. Identification of a cis-regulatory element by transient analysis of co-ordinately regulated genes

    Directory of Open Access Journals (Sweden)

    Allan Andrew C

    2008-07-01

    Full Text Available Abstract Background Transcription factors (TFs co-ordinately regulate target genes that are dispersed throughout the genome. This co-ordinate regulation is achieved, in part, through the interaction of transcription factors with conserved cis-regulatory motifs that are in close proximity to the target genes. While much is known about the families of transcription factors that regulate gene expression in plants, there are few well characterised cis-regulatory motifs. In Arabidopsis, over-expression of the MYB transcription factor PAP1 (PRODUCTION OF ANTHOCYANIN PIGMENT 1 leads to transgenic plants with elevated anthocyanin levels due to the co-ordinated up-regulation of genes in the anthocyanin biosynthetic pathway. In addition to the anthocyanin biosynthetic genes, there are a number of un-associated genes that also change in expression level. This may be a direct or indirect consequence of the over-expression of PAP1. Results Oligo array analysis of PAP1 over-expression Arabidopsis plants identified genes co-ordinately up-regulated in response to the elevated expression of this transcription factor. Transient assays on the promoter regions of 33 of these up-regulated genes identified eight promoter fragments that were transactivated by PAP1. Bioinformatic analysis on these promoters revealed a common cis-regulatory motif that we showed is required for PAP1 dependent transactivation. Conclusion Co-ordinated gene regulation by individual transcription factors is a complex collection of both direct and indirect effects. Transient transactivation assays provide a rapid method to identify direct target genes from indirect target genes. Bioinformatic analysis of the promoters of these direct target genes is able to locate motifs that are common to this sub-set of promoters, which is impossible to identify with the larger set of direct and indirect target genes. While this type of analysis does not prove a direct interaction between protein and DNA

  7. The NSL Complex Regulates Housekeeping Genes in Drosophila

    Science.gov (United States)

    Raja, Sunil Jayaramaiah; Holz, Herbert; Luscombe, Nicholas M.; Manke, Thomas; Akhtar, Asifa

    2012-01-01

    MOF is the major histone H4 lysine 16-specific (H4K16) acetyltransferase in mammals and Drosophila. In flies, it is involved in the regulation of X-chromosomal and autosomal genes as part of the MSL and the NSL complexes, respectively. While the function of the MSL complex as a dosage compensation regulator is fairly well understood, the role of the NSL complex in gene regulation is still poorly characterized. Here we report a comprehensive ChIP–seq analysis of four NSL complex members (NSL1, NSL3, MBD-R2, and MCRS2) throughout the Drosophila melanogaster genome. Strikingly, the majority (85.5%) of NSL-bound genes are constitutively expressed across different cell types. We find that an increased abundance of the histone modifications H4K16ac, H3K4me2, H3K4me3, and H3K9ac in gene promoter regions is characteristic of NSL-targeted genes. Furthermore, we show that these genes have a well-defined nucleosome free region and broad transcription initiation patterns. Finally, by performing ChIP–seq analyses of RNA polymerase II (Pol II) in NSL1- and NSL3-depleted cells, we demonstrate that both NSL proteins are required for efficient recruitment of Pol II to NSL target gene promoters. The observed Pol II reduction coincides with compromised binding of TBP and TFIIB to target promoters, indicating that the NSL complex is required for optimal recruitment of the pre-initiation complex on target genes. Moreover, genes that undergo the most dramatic loss of Pol II upon NSL knockdowns tend to be enriched in DNA Replication–related Element (DRE). Taken together, our findings show that the MOF-containing NSL complex acts as a major regulator of housekeeping genes in flies by modulating initiation of Pol II transcription. PMID:22723752

  8. Divergence of gene regulation through chromosomal rearrangements

    Directory of Open Access Journals (Sweden)

    Messing Joachim

    2010-11-01

    Full Text Available Abstract Background The molecular mechanisms that modify genome structures to give birth and death to alleles are still not well understood. To investigate the causative chromosomal rearrangements, we took advantage of the allelic diversity of the duplicated p1 and p2 genes in maize. Both genes encode a transcription factor involved in maysin synthesis, which confers resistance to corn earworm. However, p1 also controls accumulation of reddish pigments in floral tissues and has therefore acquired a new function after gene duplication. p1 alleles vary in their tissue-specific expression, which is indicated in their allele designation: the first suffix refers to red or white pericarp pigmentation and the second to red or white glume pigmentation. Results Comparing chromosomal regions comprising p1-ww[4Co63], P1-rw1077 and P1-rr4B2 alleles with that of the reference genome, P1-wr[B73], enabled us to reconstruct additive events of transposition, chromosome breaks and repairs, and recombination that resulted in phenotypic variation and chimeric regulatory signals. The p1-ww[4Co63] null allele is probably derived from P1-wr[B73] by unequal crossover between large flanking sequences. A transposon insertion in a P1-wr-like allele and NHEJ (non-homologous end-joining could have resulted in the formation of the P1-rw1077 allele. A second NHEJ event, followed by unequal crossover, probably led to the duplication of an enhancer region, creating the P1-rr4B2 allele. Moreover, a rather dynamic picture emerged in the use of polyadenylation signals by different p1 alleles. Interestingly, p1 alleles can be placed on both sides of a large retrotransposon cluster through recombination, while functional p2 alleles have only been found proximal to the cluster. Conclusions Allelic diversity of the p locus exemplifies how gene duplications promote phenotypic variability through composite regulatory signals. Transposition events increase the level of genomic complexity

  9. Regulation of potassium dependent ATPase (kdp) operon of Deinococcus radiodurans.

    Science.gov (United States)

    Dani, Pratiksha; Ujaoney, Aman Kumar; Apte, Shree Kumar; Basu, Bhakti

    2017-01-01

    The genome of D. radiodurans harbors genes for structural and regulatory proteins of Kdp ATPase, in an operon pattern, on Mega plasmid 1. Organization of its two-component regulatory genes is unique. Here we demonstrate that both, the structural as well as regulatory components of the kdp operon of D. radiodurans are expressed quickly as the cells experience potassium limitation but are not expressed upon increase in osmolarity. The cognate DNA binding response regulator (RR) effects the expression of kdp operon during potassium deficiency through specific interaction with the kdp promoter. Deletion of the gene encoding RR protein renders the mutant D. radiodurans (ΔRR) unable to express kdp operon under potassium limitation. The ΔRR D. radiodurans displays no growth defect when grown on rich media or when exposed to oxidative or heat stress but shows reduced growth following gamma irradiation. The study elucidates the functional and regulatory aspects of the novel kdp operon of this extremophile, for the first time.

  10. Evolution of Nova-dependent splicing regulation in the brain.

    Directory of Open Access Journals (Sweden)

    Nejc Jelen

    2007-10-01

    Full Text Available A large number of alternative exons are spliced with tissue-specific patterns, but little is known about how such patterns have evolved. Here, we study the conservation of the neuron-specific splicing factors Nova1 and Nova2 and of the alternatively spliced exons they regulate in mouse brain. Whereas Nova RNA binding domains are 94% identical across vertebrate species, Nova-dependent splicing silencer and enhancer elements (YCAY clusters show much greater divergence, as less than 50% of mouse YCAY clusters are conserved at orthologous positions in the zebrafish genome. To study the relation between the evolution of tissue-specific splicing and YCAY clusters, we compared the brain-specific splicing of Nova-regulated exons in zebrafish, chicken, and mouse. The presence of YCAY clusters in lower vertebrates invariably predicted conservation of brain-specific splicing across species, whereas their absence in lower vertebrates correlated with a loss of alternative splicing. We hypothesize that evolution of Nova-regulated splicing in higher vertebrates proceeds mainly through changes in cis-acting elements, that tissue-specific splicing might in some cases evolve in a single step corresponding to evolution of a YCAY cluster, and that the conservation level of YCAY clusters relates to the functions encoded by the regulated RNAs.

  11. Activity Dependency and Aging in the Regulation of Adult Neurogenesis

    Science.gov (United States)

    Kempermann, Gerd

    2015-01-01

    Age and activity might be considered the two antagonistic key regulators of adult neurogenesis. Adult neurogenesis decreases with age but remains present, albeit at a very low level, even in the oldest individuals. Activity, be it physical or cognitive, increases adult neurogenesis and thereby seems to counteract age effects. It is, thus, proposed that activity-dependent regulation of adult neurogenesis might contribute to some sort of “neural reserve,” the brain’s ability to compensate functional loss associated with aging or neurodegeneration. Activity can have nonspecific and specific effects on adult neurogenesis. Mechanistically, nonspecific stimuli that largely affect precursor cell stages might be related by the local microenvironment, whereas more specific, survival-promoting effects take place at later stages of neuronal development and require the synaptic integration of the new cell and its particular synaptic plasticity. PMID:26525149

  12. Oxygen-dependent regulation of aquaporin-3 expression

    Directory of Open Access Journals (Sweden)

    Hoogewijs D

    2016-04-01

    Full Text Available David Hoogewijs,1,2 Melanie Vogler,3 Eveline Zwenger,3 Sabine Krull,3 Anke Zieseniss3 1Institute of Physiology, University of Duisburg-Essen, Essen, Germany; 2Institute of Physiology, University of Zürich, Zürich, Switzerland; 3Institute of Cardiovascular Physiology, University Medical Center Göttingen, University of Göttingen, Göttingen, GermanyAbstract: The purpose of this study was to investigate whether aquaporin-3 (AQP3 expression is altered in hypoxia and whether hypoxia-inducible transcription factor (HIF-1 regulates the hypoxic expression. AQP3 mRNA expression was studied in L929 fibrosarcoma cells and in several tissues derived from mice that were subjected to hypoxia. Computational analysis of the AQP3 promoter revealed conserved HIF binding sites within close proximity to the translational start site, and chromatin immunoprecipitation assays confirmed binding of HIF-1 to the endogenous hypoxia response elements. Furthermore, hypoxia resulted in increased expression of AQP3 mRNA in L929 fibrosarcoma cells. Consistently, shRNA-mediated knockdown of HIF-1 greatly reduced the hypoxic induction of AQP3. In addition, mRNA analysis of organs from mice exposed to inspiratory hypoxia demonstrated pronounced hypoxia-inducible expression of AQP3 in the kidney. Overall, our findings suggest that AQP3 expression can be regulated at the transcriptional level and that AQP3 represents a novel HIF-1 target gene. Keywords: transcriptional regulation, oxygen, hypoxia-inducible factor, hypoxia response element

  13. Resveratrol inhibits LXRα-dependent hepatic lipogenesis through novel antioxidant Sestrin2 gene induction

    Energy Technology Data Exchange (ETDEWEB)

    Jin, So Hee; Yang, Ji Hye; Shin, Bo Yeon; Seo, Kyuhwa; Shin, Sang Mi [College of Pharmacy, Chosun University, Gwangju 501-759 (Korea, Republic of); Cho, Il Je, E-mail: skek023@dhu.ac.kr [MRC-GHF, College of Korean Medicine, Daegu Haany University, Gyeongsan, Gyeongsangbukdo 712-715 (Korea, Republic of); Ki, Sung Hwan, E-mail: shki@chosun.ac.kr [College of Pharmacy, Chosun University, Gwangju 501-759 (Korea, Republic of)

    2013-08-15

    Liver X receptor-α (LXRα), a member of the nuclear receptor superfamily of ligand-activated transcription factors, regulates de novo fatty acid synthesis that leads to stimulate hepatic steatosis. Although, resveratrol has beneficial effects on metabolic disease, it is not known whether resveratrol affects LXRα-dependent lipogenic gene expression. This study investigated the effect of resveratrol in LXRα-mediated lipogenesis and the underlying molecular mechanism. Resveratrol inhibited the ability of LXRα to activate sterol regulatory element binding protein-1c (SREBP-1c) and thereby inhibited target gene expression in hepatocytes. Moreover, resveratrol decreased LXRα–RXRα DNA binding activity and LXRE-luciferase transactivation. Resveratrol is known to activate Sirtuin 1 (Sirt1) and AMP-activated protein kinase (AMPK), although its precise mechanism of action remains controversial. We found that the ability of resveratrol to repress T0901317-induced SREBP-1c expression was not dependent on AMPK and Sirt1. It is well established that hepatic steatosis is associated with antioxidant and redox signaling. Our data showing that expression of Sestrin2 (Sesn2), which is a novel antioxidant gene, was significantly down-regulated in the livers of high-fat diet-fed mice. Moreover, resveratrol up-regulated Sesn2 expression, but not Sesn1 and Sesn3. Sesn2 overexpression repressed LXRα-activated SREBP-1c expression and LXRE-luciferase activity. Finally, Sesn2 knockdown using siRNA abolished the effect of resveratrol in LXRα-induced FAS luciferase gene transactivation. We conclude that resveratrol affects Sesn2 gene induction and contributes to the inhibition of LXRα-mediated hepatic lipogenesis. - Highlights: • We investigated the effect of resveratrol in LXRα-mediated lipogenesis. • Resveratrol attenuated the ability of the LXRα-mediated lipogenic gene expression. • Resveratrol’s effects on T090-induced lipogenesis is not dependent on Sirt1 or AMPK.

  14. Analysis of the role of the Aspergillus niger aminolevulinic acid synthase (hemA) gene illustrates the difference between regulation of yeast and fungal haem- and sirohaem-dependent pathways

    NARCIS (Netherlands)

    Franken, A.C.; Christien Lokman, B.; Ram, A.F.; Hondel, C.A. van den; Weert, S. de; Punt, P.J.

    2012-01-01

    To increase knowledge on haem biosynthesis in filamentous fungi like Aspergillus niger, pathway-specific gene expression in response to haem and haem intermediates was analysed. This analysis showed that iron, 5′-aminolevulinic acid (ALA) and possibly haem control haem biosynthesis mostly via

  15. Analysis of the role of the A. niger aminolevulinic acid synthase (hemA) gene illustrates the difference between regulation of yeast and fungal heme and siroheme dependent pathways

    NARCIS (Netherlands)

    A.F. Ram; C.A. van den Hondel; Christien Lokman; P.J. Punt; S. de Weert; A. Franken

    2012-01-01

    To increase knowledge on haem biosynthesis in filamentous fungi like Aspergillus niger, pathway-specific gene expression in response to haem and haem intermediates was analysed. This analysis showed that iron, 5'-aminolevulinic acid (ALA) and possibly haem control haem biosynthesis mostly via

  16. Regulation of Intracellular Signaling Leading to Gene Expression in Lipopolysaccharide Stimulated Murine Macrophages

    Science.gov (United States)

    1995-09-20

    responsive Promoter Elements 9 Cytoplasmic Regulation of LPS-inducible Gene Expression 10 LPS-inducible Phospholipid Metabolism 11 Ion Mobilization in LPS...existence of NO·-dependent and NO·-independent mechanisms of LPS-induced hypotension depending on the experimental inducers of endotoxemia . 3 It is clear...Inducible Phospholipid Metabolism Phospholipid metabolism results in the activation of at least three second messengers. Phosphatidylinositol 4,5

  17. Regulation of resveratrol production in Vitis amurensis cell cultures by calcium-dependent protein kinases.

    Science.gov (United States)

    Aleynova, O A; Dubrovina, A S; Manyakhin, A Y; Karetin, Y A; Kiselev, K V

    2015-02-01

    Resveratrol is a naturally occurring plant stilbene that exhibits a wide range of valuable biological and pharmacological properties. Although the beneficial effects of trans-resveratrol to human health and plant protection against fungal pathogens are well-established, little is known about the molecular mechanisms regulating stilbene biosynthesis in plant cells. It has been recently shown that overexpression of the calcium-dependent protein kinase VaCPK20 gene considerably increased resveratrol accumulation in cell cultures of Vitis amurensis. It is possible that calcium-dependent protein kinases (CDPKs) play an important role in the regulation of resveratrol biosynthesis. In the present work, we investigated the effects of overexpression of other members of the CDPK multigene family (VaCPK9, VaCPK13, VaCPK21, and VaCPK29) on resveratrol accumulation and growth parameters of grape cell cultures. The obtained data show that overexpression of VaCPK29 increased resveratrol content 1.6-2.4-fold and fresh biomass accumulation 1.1-1.4-fold in the four independently transformed cell lines of V. amurensis compared with that in the empty vector-transformed calli. However, overexpression of the VaCPK9, VaCPK13, and VaCPK21 genes did not considerably affect resveratrol content and fresh/dry biomass accumulation in the independently transformed cell lines of V. amurensis. VaCPK29-transformed calli were capable of producing between 1.02 and 1.39 mg/l of resveratrol, while the control calli produced 0.48 to 0.79 mg/l of resveratrol. The data indicate that the VaCPK9, VaCPK13, and VaCPK21 genes are not involved in the regulation of stilbene biosynthesis in grape cells, while the VaCPK29 and VaCPK20 genes are implicated in resveratrol biosynthesis as positive regulators.

  18. Alu Elements as Novel Regulators of Gene Expression in Type 1 Diabetes Susceptibility Genes?

    Science.gov (United States)

    Kaur, Simranjeet; Pociot, Flemming

    2015-07-13

    Despite numerous studies implicating Alu repeat elements in various diseases, there is sparse information available with respect to the potential functional and biological roles of the repeat elements in Type 1 diabetes (T1D). Therefore, we performed a genome-wide sequence analysis of T1D candidate genes to identify embedded Alu elements within these genes. We observed significant enrichment of Alu elements within the T1D genes (p-value genes harboring Alus revealed significant enrichment for immune-mediated processes (p-value genes harboring inverted Alus (IRAlus) within their 3' untranslated regions (UTRs) that are known to regulate the expression of host mRNAs by generating double stranded RNA duplexes. Our in silico analysis predicted the formation of duplex structures by IRAlus within the 3'UTRs of T1D genes. We propose that IRAlus might be involved in regulating the expression levels of the host T1D genes.

  19. Regulation of gene expression in Escherichia coli and its bacteriophage

    International Nuclear Information System (INIS)

    Higgins, C.F.

    1986-01-01

    This chapter reviews the study of prokaryotic gene expression beginning with a look at the regulation of the lactose operon and the mechanism of attenuation in the tryptophan operon to the more recent development of recombinant DNA technology. The chapter deals almost entirely with escherichia coli and its bacteriophage. The only experimental technique which the authors explore in some detail is the construction and use of gene and operon fusions which have revolutionized the study of gene expression. Various mechanisms by which E. Coli regulate the cellular levels of individual messenger-RNA species are described. Translational regulation of the cellular levels of messenger-RNA include signals encoded within the messenger-RNA molecule itself and regulatory molecules which interact with the messenger-RNA and alter it translational efficiency

  20. The dynamic landscape of gene regulation during Bombyx mori oogenesis.

    Science.gov (United States)

    Zhang, Qiang; Sun, Wei; Sun, Bang-Yong; Xiao, Yang; Zhang, Ze

    2017-09-11

    Oogenesis in the domestic silkworm (Bombyx mori) is a complex process involving previtellogenesis, vitellogenesis and choriogenesis. During this process, follicles show drastic morphological and physiological changes. However, the genome-wide regulatory profiles of gene expression during oogenesis remain to be determined. In this study, we obtained time-series transcriptome data and used these data to reveal the dynamic landscape of gene regulation during oogenesis. A total of 1932 genes were identified to be differentially expressed among different stages, most of which occurred during the transition from late vitellogenesis to early choriogenesis. Using weighted gene co-expression network analysis, we identified six stage-specific gene modules that correspond to multiple regulatory pathways. Strikingly, the biosynthesis pathway of the molting hormone 20-hydroxyecdysone (20E) was enriched in one of the modules. Further analysis showed that the ecdysteroid 20-hydroxylase gene (CYP314A1) of steroidgenesis genes was mainly expressed in previtellogenesis and early vitellogenesis. However, the 20E-inactivated genes, particularly the ecdysteroid 26-hydroxylase encoding gene (Cyp18a1), were highly expressed in late vitellogenesis. These distinct expression patterns between 20E synthesis and catabolism-related genes might ensure the rapid decline of the hormone titer at the transition point from vitellogenesis to choriogenesis. In addition, we compared landscapes of gene regulation between silkworm (Lepidoptera) and fruit fly (Diptera) oogeneses. Our results show that there is some consensus in the modules of gene co-expression during oogenesis in these insects. The data presented in this study provide new insights into the regulatory mechanisms underlying oogenesis in insects with polytrophic meroistic ovaries. The results also provide clues for further investigating the roles of epigenetic reconfiguration and circadian rhythm in insect oogenesis.

  1. Epigenetic regulation on the gene expression signature in esophagus adenocarcinoma.

    Science.gov (United States)

    Xi, Ting; Zhang, Guizhi

    2017-02-01

    Understanding the molecular mechanisms represents an important step in the development of diagnostic and therapeutic measures of esophagus adenocarcinoma (NOS). The objective of this study is to identify the epigenetic regulation on gene expression in NOS, shedding light on the molecular mechanisms of NOS. In this study, 78 patients with NOS were included and the data of mRNA, miRNA and DNA methylation of were downloaded from The Cancer Genome Atlas (TCGA). Differential analysis between NOS and controls was performed in terms of gene expression, miRNA expression, and DNA methylation. Bioinformatic analysis was followed to explore the regulation mechanisms of miRNA and DNA methylationon gene expression. Totally, up to 1320 differentially expressed genes (DEGs) and 32 differentially expressed miRNAs were identified. 240 DEGs that were not only the target genes but also negatively correlated with the screened differentially expressed miRNAs. 101 DEGs were found to be highlymethylated in CpG islands. Then, 8 differentially methylated genes (DMGs) were selected, which showed down-regulated expression in NOS. Among of these genes, 6 genes including ADHFE1, DPP6, GRIA4, CNKSR2, RPS6KA6 and ZNF135 were target genes of differentially expressed miRNAs (hsa-mir-335, hsa-mir-18a, hsa-mir-93, hsa-mir-106b and hsa-mir-21). The identified altered miRNA, genes and DNA methylation site may be applied as biomarkers for diagnosis and prognosis of NOS. Copyright © 2016 Elsevier GmbH. All rights reserved.

  2. Gene regulation and genetics in neurochemistry, past to future.

    Science.gov (United States)

    Barger, Steven W

    2016-10-01

    Ask any neuroscientist to name the most profound discoveries in the field in the past 60 years, and at or near the top of the list will be a phenomenon or technique related to genes and their expression. Indeed, our understanding of genetics and gene regulation has ushered in whole new systems of knowledge and new empirical approaches, many of which could not have even been imagined prior to the molecular biology boon of recent decades. Neurochemistry, in the classic sense, intersects with these concepts in the manifestation of neuropeptides, obviously dependent upon the central dogma (the established rules by which DNA sequence is eventually converted into protein primary structure) not only for their conformation but also for their levels and locales of expression. But, expanding these considerations to non-peptide neurotransmitters illustrates how gene regulatory events impact neurochemistry in a much broader sense, extending beyond the neurochemicals that translate electrical signals into chemical ones in the synapse, to also include every aspect of neural development, structure, function, and pathology. From the beginning, the mutability - yet relative stability - of genes and their expression patterns were recognized as potential substrates for some of the most intriguing phenomena in neurobiology - those instances of plasticity required for learning and memory. Near-heretical speculation was offered in the idea that perhaps the very sequence of the genome was altered to encode memories. A fascinating component of the intervening progress includes evidence that the central dogma is not nearly as rigid and consistent as we once thought. And this mutability extends to the potential to manipulate that code for both experimental and clinical purposes. Astonishing progress has been made in the molecular biology of neurochemistry during the 60 years since this journal debuted. Many of the gains in conceptual understanding have been driven by methodological

  3. [Regulation of extramitochondrial malic enzyme gene expression in lipogenic tissues].

    Science.gov (United States)

    Stelmańska, Ewa

    2007-11-06

    Extramitochondrial malic enzyme is widely distributed in mammalian tissues, including humans. The major role of this protein in the liver and white adipose tissue is the production of NADPH required for fatty-acid synthesis. Malic enzyme thus belongs to the family of lipogenic enzymes. Malic enzyme activity is regulated both by gene transcription and mRNA stability. Malic enzyme gene expression is tightly controlled by hormonal (i.e. insulin, glucagon, triiodothyronine) and nutritional conditions. There are many transcription factors which recognize special response elements present in the malic enzyme gene promoter. In this paper some important information about the structure and regulation of malic enzyme gene expression in mammalian lipogenic tissues is presented.

  4. CcpA-Dependent Carbohydrate Catabolite Repression Regulates Galactose Metabolism in Streptococcus oligofermentans

    Science.gov (United States)

    Cai, Jun; Qi, Fengxia

    2012-01-01

    Streptococcus oligofermentans is an oral commensal that inhibits the growth of the caries pathogen Streptococcus mutans by producing copious amounts of H2O2 and that grows faster than S. mutans on galactose. In this study, we identified a novel eight-gene galactose (gal) operon in S. oligofermentans that was comprised of lacABCD, lacX, and three genes encoding a galactose-specific transporter. Disruption of lacA caused more growth reduction on galactose than mutation of galK, a gene in the Leloir pathway, indicating that the principal role of this operon is in galactose metabolism. Diauxic growth was observed in cultures containing glucose and galactose, and a luciferase reporter fusion to the putative gal promoter demonstrated 12-fold repression of the operon expression by glucose but was induced by galactose, suggesting a carbon catabolite repression (CCR) control in galactose utilization. Interestingly, none of the single-gene mutations in the well-known CCR regulators ccpA and manL affected diauxic growth, although the operon expression was upregulated in these mutants in glucose. A double mutation of ccpA and manL eliminated glucose repression of galactose utilization, suggesting that these genes have parallel functions in regulating gal operon expression and mediating CCR. Electrophoretic mobility shift assays demonstrated binding of CcpA to the putative catabolite response element motif in the promoter regions of the gal operon and manL, suggesting that CcpA regulates CCR through direct regulation of the transcription of the gal operon and manL. This provides the first example of oral streptococci using two parallel CcpA-dependent CCR pathways in controlling carbohydrate metabolism. PMID:22609925

  5. Veratramine modulates AP-1-dependent gene transcription by directly binding to programmable DNA.

    Science.gov (United States)

    Bai, Fang; Liu, Kangdong; Li, Huiliang; Wang, Jiawei; Zhu, Junsheng; Hao, Pei; Zhu, Lili; Zhang, Shoude; Shan, Lei; Ma, Weiya; Bode, Ann M; Zhang, Weidong; Li, Honglin; Dong, Zigang

    2018-01-25

    Because the transcription factor activator protein-1 (AP-1) regulates a variety of protein-encoding genes, it is a participant in many cellular functions, including proliferation, transformation, epithelial mesenchymal transition (EMT), and apoptosis. Inhibitors targeting AP-1 have potential use in the treatment of cancer and other inflammatory diseases. Here, we identify veratramine as a potent natural modulator of AP-1, which selectively binds to a specific site (TRE 5'-TGACTCA-3') of the AP-1 target DNA sequence and regulates AP-1-dependent gene transcription without interfering with cystosolic signaling cascades that might lead to AP-1 activation. Moreover, RNA-seq experiments demonstrate that veratramine does not act on the Hedgehog signaling pathway in contrast to its analogue, cyclopamine, and likely does not harbor the same teratogenicity and toxicity. Additionally, veratramine effectively suppresses EGF-induced AP-1 transactivation and transformation of JB6 P+ cells. Finally, we demonstrate that veratramine inhibits solar-ultraviolet-induced AP-1 activation in mice. The identification of veratramine and new findings in its specific regulation of AP-1 down stream genes pave ways to discovering and designing regulators to regulate transcription factor. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. Gene profile analysis of osteoblast genes differentially regulated by histone deacetylase inhibitors

    Directory of Open Access Journals (Sweden)

    Lamblin Anne-Francoise

    2007-10-01

    Full Text Available Abstract Background Osteoblast differentiation requires the coordinated stepwise expression of multiple genes. Histone deacetylase inhibitors (HDIs accelerate the osteoblast differentiation process by blocking the activity of histone deacetylases (HDACs, which alter gene expression by modifying chromatin structure. We previously demonstrated that HDIs and HDAC3 shRNAs accelerate matrix mineralization and the expression of osteoblast maturation genes (e.g. alkaline phosphatase, osteocalcin. Identifying other genes that are differentially regulated by HDIs might identify new pathways that contribute to osteoblast differentiation. Results To identify other osteoblast genes that are altered early by HDIs, we incubated MC3T3-E1 preosteoblasts with HDIs (trichostatin A, MS-275, or valproic acid for 18 hours in osteogenic conditions. The promotion of osteoblast differentiation by HDIs in this experiment was confirmed by osteogenic assays. Gene expression profiles relative to vehicle-treated cells were assessed by microarray analysis with Affymetrix GeneChip 430 2.0 arrays. The regulation of several genes by HDIs in MC3T3-E1 cells and primary osteoblasts was verified by quantitative real-time PCR. Nine genes were differentially regulated by at least two-fold after exposure to each of the three HDIs and six were verified by PCR in osteoblasts. Four of the verified genes (solute carrier family 9 isoform 3 regulator 1 (Slc9a3r1, sorbitol dehydrogenase 1, a kinase anchor protein, and glutathione S-transferase alpha 4 were induced. Two genes (proteasome subunit, beta type 10 and adaptor-related protein complex AP-4 sigma 1 were suppressed. We also identified eight growth factors and growth factor receptor genes that are significantly altered by each of the HDIs, including Frizzled related proteins 1 and 4, which modulate the Wnt signaling pathway. Conclusion This study identifies osteoblast genes that are regulated early by HDIs and indicates pathways that

  7. Keap1 redox-dependent regulation of doxorubicin-induced oxidative stress response in cardiac myoblasts

    Energy Technology Data Exchange (ETDEWEB)

    Nordgren, Kendra K.S., E-mail: knordgre@d.umn.edu; Wallace, Kendall B., E-mail: kwallace@d.umn.edu

    2014-01-01

    Doxorubicin (DOX) is a widely prescribed treatment for a broad scope of cancers, but clinical utility is limited by the cumulative, dose-dependent cardiomyopathy that occurs with repeated administration. DOX-induced cardiotoxicity is associated with the production of reactive oxygen species (ROS) and oxidation of lipids, DNA and proteins. A major cellular defense mechanism against such oxidative stress is activation of the Keap1/Nrf2-antioxidant response element (ARE) signaling pathway, which transcriptionally regulates expression of antioxidant genes such as Nqo1 and Gstp1. In the present study, we address the hypothesis that an initial event associated with DOX-induced oxidative stress is activation of the Keap1/Nrf2-dependent expression of antioxidant genes and that this is regulated through drug-induced changes in redox status of the Keap1 protein. Incubation of H9c2 rat cardiac myoblasts with DOX resulted in a time- and dose-dependent decrease in non-protein sulfhydryl groups. Associated with this was a near 2-fold increase in Nrf2 protein content and enhanced transcription of several of the Nrf2-regulated down-stream genes, including Gstp1, Ugt1a1, and Nqo1; the expression of Nfe2l2 (Nrf2) itself was unaltered. Furthermore, both the redox status and the total amount of Keap1 protein were significantly decreased by DOX, with the loss of Keap1 being due to both inhibited gene expression and increased autophagic, but not proteasomal, degradation. These findings identify the Keap1/Nrf2 pathway as a potentially important initial response to acute DOX-induced oxidative injury, with the primary regulatory events being the oxidation and autophagic degradation of the redox sensor Keap1 protein. - Highlights: • DOX caused a ∼2-fold increase in Nrf2 protein content. • DOX enhanced transcription of several Nrf2-regulated down-stream genes. • Redox status and total amount of Keap1 protein were significantly decreased by DOX. • Loss of Keap1 protein was due to

  8. Keap1 redox-dependent regulation of doxorubicin-induced oxidative stress response in cardiac myoblasts

    International Nuclear Information System (INIS)

    Nordgren, Kendra K.S.; Wallace, Kendall B.

    2014-01-01

    Doxorubicin (DOX) is a widely prescribed treatment for a broad scope of cancers, but clinical utility is limited by the cumulative, dose-dependent cardiomyopathy that occurs with repeated administration. DOX-induced cardiotoxicity is associated with the production of reactive oxygen species (ROS) and oxidation of lipids, DNA and proteins. A major cellular defense mechanism against such oxidative stress is activation of the Keap1/Nrf2-antioxidant response element (ARE) signaling pathway, which transcriptionally regulates expression of antioxidant genes such as Nqo1 and Gstp1. In the present study, we address the hypothesis that an initial event associated with DOX-induced oxidative stress is activation of the Keap1/Nrf2-dependent expression of antioxidant genes and that this is regulated through drug-induced changes in redox status of the Keap1 protein. Incubation of H9c2 rat cardiac myoblasts with DOX resulted in a time- and dose-dependent decrease in non-protein sulfhydryl groups. Associated with this was a near 2-fold increase in Nrf2 protein content and enhanced transcription of several of the Nrf2-regulated down-stream genes, including Gstp1, Ugt1a1, and Nqo1; the expression of Nfe2l2 (Nrf2) itself was unaltered. Furthermore, both the redox status and the total amount of Keap1 protein were significantly decreased by DOX, with the loss of Keap1 being due to both inhibited gene expression and increased autophagic, but not proteasomal, degradation. These findings identify the Keap1/Nrf2 pathway as a potentially important initial response to acute DOX-induced oxidative injury, with the primary regulatory events being the oxidation and autophagic degradation of the redox sensor Keap1 protein. - Highlights: • DOX caused a ∼2-fold increase in Nrf2 protein content. • DOX enhanced transcription of several Nrf2-regulated down-stream genes. • Redox status and total amount of Keap1 protein were significantly decreased by DOX. • Loss of Keap1 protein was due to

  9. Mapping Condition-Dependent Regulation of Lipid Metabolism in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Jewett, Michael Christopher; Workman, Christopher; Nookaew, Intawat

    2013-01-01

    Lipids play a central role in cellular function as constituents of membranes, as signaling molecules, and as storage materials. Although much is known about the role of lipids in regulating specific steps of metabolism, comprehensive studies integrating genome-wide expression data, metabolite...... levels, and lipid levels are currently lacking. Here, we map condition-dependent regulation controlling lipid metabolism in Saccharomyces cerevisiae by measuring 5636 mRNAs, 50 metabolites, 97 lipids, and 57 13C-reaction fluxes in yeast using a three-factor full-factorial design. Correlation analysis...... across eight environmental conditions revealed 2279 gene expression level-metabolite/lipid relationships that characterize the extent of transcriptional regulation in lipid metabolism relative to major metabolic hubs within the cell. To query this network, we developed integrative methods for correlation...

  10. Androgen regulated genes in human prostate xenografts in mice: relation to BPH and prostate cancer.

    Directory of Open Access Journals (Sweden)

    Harold D Love

    2009-12-01

    Full Text Available Benign prostatic hyperplasia (BPH and prostate carcinoma (CaP are linked to aging and the presence of androgens, suggesting that androgen regulated genes play a major role in these common diseases. Androgen regulation of prostate growth and development depends on the presence of intact epithelial-stromal interactions. Further, the prostatic stroma is implicated in BPH. This suggests that epithelial cell lines are inadequate to identify androgen regulated genes that could contribute to BPH and CaP and which could serve as potential clinical biomarkers. In this study, we used a human prostate xenograft model to define a profile of genes regulated in vivo by androgens, with an emphasis on identifying candidate biomarkers. Benign transition zone (TZ human prostate tissue from radical prostatectomies was grafted to the sub-renal capsule site of intact or castrated male immunodeficient mice, followed by the removal or addition of androgens, respectively. Microarray analysis of RNA from these tissues was used to identify genes that were; 1 highly expressed in prostate, 2 had significant expression changes in response to androgens, and, 3 encode extracellular proteins. A total of 95 genes meeting these criteria were selected for analysis and validation of expression in patient prostate tissues using quantitative real-time PCR. Expression levels of these genes were measured in pooled RNAs from human prostate tissues with varying severity of BPH pathologic changes and CaP of varying Gleason score. A number of androgen regulated genes were identified. Additionally, a subset of these genes were over-expressed in RNA from clinical BPH tissues, and the levels of many were found to correlate with disease status. Our results demonstrate the feasibility, and some of the problems, of using a mouse xenograft model to characterize the androgen regulated expression profiles of intact human prostate tissues.

  11. Nitrogen regulates chitinase gene expression in a marine bacterium

    DEFF Research Database (Denmark)

    Delpin, Marina; Goodman, A.E.

    2009-01-01

    Ammonium concentration and nitrogen source regulate promoter activity and use for the transcription of chiA, the major chitinase gene of Pseudoalteromonas sp. S91 and S91CX, an S91 transposon lacZ fusion mutant. The activity of chiA was quantified by beta-galactosidase assay of S91CX cultures...... containing different ammonium concentrations (NH4+; 0, 9.5 or 191 mM) and with different nitrogen sources (N-acetylglucosamine (GlcNAc) or glutamate (glt)). S91 chiA expression was found to depend on both the NH4+ concentration and source of nitrogen in marine minimal medium (MMM). Pseudoalteromonas sp. S91...... and S91CX can use either GlcNAc or glt as a sole source of carbon in MMM containing a standard concentration of 9.5 mM NH4+. Adding excess NH4+, 20 times the standard concentration, to MMM significantly reduced chiA activity below that found in the presence of either GlcNAc or glt. When no NH4...

  12. Decapping of long noncoding RNAs regulates inducible genes.

    Science.gov (United States)

    Geisler, Sarah; Lojek, Lisa; Khalil, Ahmad M; Baker, Kristian E; Coller, Jeff

    2012-02-10

    Decapping represents a critical control point in regulating expression of protein coding genes. Here, we demonstrate that decapping also modulates expression of long noncoding RNAs (lncRNAs). Specifically, levels of >100 lncRNAs in yeast are controlled by decapping and are degraded by a pathway that occurs independent of decapping regulators. We find many lncRNAs degraded by DCP2 are expressed proximal to inducible genes. Of these, we show several genes required for galactose utilization are associated with lncRNAs that have expression patterns inversely correlated with their mRNA counterpart. Moreover, decapping of these lncRNAs is critical for rapid and robust induction of GAL gene expression. Failure to destabilize a lncRNA known to exert repressive histone modifications results in perpetuation of a repressive chromatin state that contributes to reduced plasticity of gene activation. We propose that decapping and lncRNA degradation serve a vital role in transcriptional regulation specifically at inducible genes. Copyright © 2012 Elsevier Inc. All rights reserved.

  13. Characterization of a small PlcR-regulated gene co-expressed with cereolysin O

    Directory of Open Access Journals (Sweden)

    Lereclus Didier

    2007-06-01

    Full Text Available Abstract Background In the human pathogen Bacillus cereus, the expression of most extracellular virulence factors is controlled by the transcriptional activator PlcR. Among these virulence factors, cereolysin O (Clo is an haemolysin belonging to the cholesterol-dependant cytolysins, a protein family extensively studied in Gram-positive bacteria. Results In the genomes of bacteria belonging to the B. cereus group, including Bacillus anthracis and Bacillus thuringiensis, a small gene encoding a 26-amino acid peptide was present in multicopy. One copy was always found upstream from the gene encoding Clo. In B. cereus ATCC 14579, the small gene and the clo gene are co-transcribed. Transcriptional fusions showed that the three paralogues identified in this strain were expressed in a PlcR-dependent manner. We propose to name these peptides Spp for small PlcR-regulated peptides. We show that a synthetic peptide corresponding to the deduced product of the spp genes displayed antibacterial activity. Conclusion The co-expression of spp, a small PlcR-regulated multicopy gene with clo suggests a yet unidentified relationship between Spp and the cholesterol-dependent cytolysin in bacteria belonging to the B.cereus group.

  14. Iron-dependent gene expression in Actinomyces oris

    Directory of Open Access Journals (Sweden)

    Matthew P. Mulé

    2015-12-01

    Results: When A. oris was grown under iron-limiting conditions, the genes encoding iron/siderophore transporters fetA and sidD showed increased expression. One of these genes (sidD was mutated, and the sidD::Km strain exhibited a 50% reduction in growth in late log and stationary phase cells in media that contained iron. This growth defect was restored when the sidD gene was provided in a complemented strain. We were able to isolate the AmdR-encoding gene in seven clinical isolates of Actinomyces. When these protein sequences were aligned to the laboratory strain, there was a high degree of sequence similarity. Conclusions: The growth of the sidD::Km mutant in iron-replete medium mirrored the growth of the wild-type strain grown in iron-limiting medium, suggesting that the sidD::Km mutant was compromised in iron uptake. The known iron regulator AmdR is well conserved in clinical isolates of A. oris. This work provides additional insight into iron metabolism in this important oral microbe.

  15. Genes adopt non-optimal codon usage to generate cell cycle-dependent oscillations in protein levels

    DEFF Research Database (Denmark)

    Frenkel-Morgenstern, Milana; Danon, Tamar; Christian, Thomas

    2012-01-01

    The cell cycle is a temporal program that regulates DNA synthesis and cell division. When we compared the codon usage of cell cycle-regulated genes with that of other genes, we discovered that there is a significant preference for non-optimal codons. Moreover, genes encoding proteins that cycle...... at the protein level exhibit non-optimal codon preferences. Remarkably, cell cycle-regulated genes expressed in different phases display different codon preferences. Here, we show empirically that transfer RNA (tRNA) expression is indeed highest in the G2 phase of the cell cycle, consistent with the non...... that non-optimal (wobbly) matching codons influence protein synthesis during the cell cycle. We describe a new mathematical model that shows how codon usage can give rise to cell-cycle regulation. In summary, our data indicate that cells exploit wobbling to generate cell cycle-dependent dynamics...

  16. Basal transcription of APOBEC3G is regulated by USF1 gene in hepatocyte

    Energy Technology Data Exchange (ETDEWEB)

    Zeng, Yanli [Department of Infectious Diseases, Zhengzhou University People' s Hospital (Henan Provincial People' s Hospital), Zhengzhou, 450003 (China); Li, Hui [The Central Hospital of Wuhan, Tongji Medical College Huazhong University of Science Technology, Wuhan, 430000 (China); Zhang, Xiaoju [Department of Respiratory Medicine, Zhengzhou University People' s Hospital (Henan Provincial People' s Hospital), Zhengzhou, 450003 (China); Shang, Jia [Department of Infectious Diseases, Zhengzhou University People' s Hospital (Henan Provincial People' s Hospital), Zhengzhou, 450003 (China); Kang, Yi, E-mail: kykangyi@163.com [Department of Infectious Diseases, Zhengzhou University People' s Hospital (Henan Provincial People' s Hospital), Zhengzhou, 450003 (China)

    2016-01-29

    Apolipoprotein B mRNA-editing enzyme catalytic polypeptide-like 3G (APOBEC3G, A3G) exert antiviral defense as an important factor of innate immunity. A variety of cytokines such as IFN-γ,IL2,IL15,IL7 could induce the transcription of A3G. However, the regulation of other nuclear factor on the transcription of A3G have not been reported at the present. To gain new insights into the transcriptional regulation of this restriction factor, we cloned and characterized the promoter region of A3G and investigate the modulation of USF1 gene on the transcription of A3G. We identified a 232 bp region that was sufficient to regulate the activity of full promoter. Transcriptional start sites (TSS) were identified by the luciferase reporter assays of plasmids containing full or shorter fragments of the A3G promoter. The results demonstrated that the core promoter of A3G is located within the region -159/-84 relative to the TSS. Transcriptional activity of A3G core promoter regulated by USF1 was dependent on an E-box (located at position -91/-86 relative to the major TSS) and was abolished after mutation of this DNA element. USF1 gene can take part in basal transcription regulation of the human A3G gene in hepatocyte, and the identified E-box represented a binding site for the USF1. - Highlights: • The core promoter of A3G is located within the region −159/−84 relative to the TSS. • Transcriptional activity of A3G core promoter regulated by USF1 was dependent on an E-box (located at position −91/−86 relative to the major TSS). • USF1 gene can take part in basal transcription regulation of the human A3G gene in hepatocyte.

  17. Positive regulation of botulinum neurotoxin gene expression by CodY in Clostridium botulinum ATCC 3502.

    Science.gov (United States)

    Zhang, Zhen; Dahlsten, Elias; Korkeala, Hannu; Lindström, Miia

    2014-12-01

    Botulinum neurotoxin, produced mainly by the spore-forming bacterium Clostridium botulinum, is the most poisonous biological substance known. Here, we show that CodY, a global regulator conserved in low-G+C Gram-positive bacteria, positively regulates the botulinum neurotoxin gene expression. Inactivation of codY resulted in decreased expression of botA, encoding the neurotoxin, as well as in reduced neurotoxin synthesis. Complementation of the codY mutation in trans rescued neurotoxin synthesis, and overexpression of codY in trans caused elevated neurotoxin production. Recombinant CodY was found to bind to a 30-bp region containing the botA transcription start site, suggesting regulation of the neurotoxin gene transcription through direct interaction. GTP enhanced the binding affinity of CodY to the botA promoter, suggesting that CodY-dependent neurotoxin regulation is associated with nutritional status. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  18. Clustering gene expression regulators: new approach to disease subtyping.

    Directory of Open Access Journals (Sweden)

    Mikhail Pyatnitskiy

    Full Text Available One of the main challenges in modern medicine is to stratify different patient groups in terms of underlying disease molecular mechanisms as to develop more personalized approach to therapy. Here we propose novel method for disease subtyping based on analysis of activated expression regulators on a sample-by-sample basis. Our approach relies on Sub-Network Enrichment Analysis algorithm (SNEA which identifies gene subnetworks with significant concordant changes in expression between two conditions. Subnetwork consists of central regulator and downstream genes connected by relations extracted from global literature-extracted regulation database. Regulators found in each patient separately are clustered together and assigned activity scores which are used for final patients grouping. We show that our approach performs well compared to other related methods and at the same time provides researchers with complementary level of understanding of pathway-level biology behind a disease by identification of significant expression regulators. We have observed the reasonable grouping of neuromuscular disorders (triggered by structural damage vs triggered by unknown mechanisms, that was not revealed using standard expression profile clustering. For another experiment we were able to suggest the clusters of regulators, responsible for colorectal carcinoma vs adenoma discrimination and identify frequently genetically changed regulators that could be of specific importance for the individual characteristics of cancer development. Proposed approach can be regarded as biologically meaningful feature selection, reducing tens of thousands of genes down to dozens of clusters of regulators. Obtained clusters of regulators make possible to generate valuable biological hypotheses about molecular mechanisms related to a clinical outcome for individual patient.

  19. Regulation of the pancreatic duodenal homeobox-1 protein by DNA-dependent protein kinase.

    Science.gov (United States)

    Lebrun, Patricia; Montminy, Marc R; Van Obberghen, Emmanuel

    2005-11-18

    The transcription factor PDX-1 plays a crucial role during pancreatic development and in the function of insulin-producing beta cells. Disruption of the pdx-1 gene in these cells induces overt diabetes in mice, and this gene is modified in several type 2 diabetic families. It is thus crucial to determine the molecular mechanisms involved in the regulation of PDX-1 expression and/or activation. We identified new proteins associated with PDX-1 by mass spectrometry. These proteins, Ku70 and Ku80, are regulatory subunits of DNA-dependent protein kinase (DNA-PK). We determined that the interaction between PDX-1 and Ku70 or Ku80 is dependent on the homeodomain of PDX-1. Most interestingly, we demonstrated in vitro that the DNA-PK phosphorylates PDX-1 on threonine 11. Although this residue is located in the transactivation domain, this phosphorylation does not seem to be implicated in the transcriptional activation of PDX-1. However, in response to radiation, which activates DNA-PK, a second form of the PDX-1 protein appears rapidly. This form is phosphorylated on threonine and seems to drive PDX-1 degradation by the proteosome. In correlation with this degradation, we observed a subsequent reduction in the activation of the insulin promoter and a decrease in PDX-1-mediated gene expression, i.e. glut2 and glucokinase. Our study demonstrates that radiation, through the activation of DNA-PK, may regulate PDX-1 protein expression.

  20. Gravity-regulated gene expression in Arabidopsis thaliana

    Science.gov (United States)

    Sederoff, Heike; Brown, Christopher S.; Heber, Steffen; Kajla, Jyoti D.; Kumar, Sandeep; Lomax, Terri L.; Wheeler, Benjamin; Yalamanchili, Roopa

    Plant growth and development is regulated by changes in environmental signals. Plants sense environmental changes and respond to them by modifying gene expression programs to ad-just cell growth, differentiation, and metabolism. Functional expression of genes comprises many different processes including transcription, translation, post-transcriptional and post-translational modifications, as well as the degradation of RNA and proteins. Recently, it was discovered that small RNAs (sRNA, 18-24 nucleotides long), which are heritable and systemic, are key elements in regulating gene expression in response to biotic and abiotic changes. Sev-eral different classes of sRNAs have been identified that are part of a non-cell autonomous and phloem-mobile network of regulators affecting transcript stability, translational kinetics, and DNA methylation patterns responsible for heritable transcriptional silencing (epigenetics). Our research has focused on gene expression changes in response to gravistimulation of Arabidopsis roots. Using high-throughput technologies including microarrays and 454 sequencing, we iden-tified rapid changes in transcript abundance of genes as well as differential expression of small RNA in Arabidopsis root apices after minutes of reorientation. Some of the differentially regu-lated transcripts are encoded by genes that are important for the bending response. Functional mutants of those genes respond faster to reorientation than the respective wild type plants, indicating that these proteins are repressors of differential cell elongation. We compared the gravity responsive sRNAs to the changes in transcript abundances of their putative targets and identified several potential miRNA: target pairs. Currently, we are using mutant and transgenic Arabidopsis plants to characterize the function of those miRNAs and their putative targets in gravitropic and phototropic responses in Arabidopsis.

  1. Epigenetic regulation of inducible gene expression in the immune system.

    Science.gov (United States)

    Lim, Pek Siew; Li, Jasmine; Holloway, Adele F; Rao, Sudha

    2013-07-01

    T cells are exquisitely poised to respond rapidly to pathogens and have proved an instructive model for exploring the regulation of inducible genes. Individual genes respond to antigenic stimulation in different ways, and it has become clear that the interplay between transcription factors and the chromatin platform of individual genes governs these responses. Our understanding of the complexity of the chromatin platform and the epigenetic mechanisms that contribute to transcriptional control has expanded dramatically in recent years. These mechanisms include the presence/absence of histone modification marks, which form an epigenetic signature to mark active or inactive genes. These signatures are dynamically added or removed by epigenetic enzymes, comprising an array of histone-modifying enzymes, including the more recently recognized chromatin-associated signalling kinases. In addition, chromatin-remodelling complexes physically alter the chromatin structure to regulate chromatin accessibility to transcriptional regulatory factors. The advent of genome-wide technologies has enabled characterization of the chromatin landscape of T cells in terms of histone occupancy, histone modification patterns and transcription factor association with specific genomic regulatory regions, generating a picture of the T-cell epigenome. Here, we discuss the multi-layered regulation of inducible gene expression in the immune system, focusing on the interplay between transcription factors, and the T-cell epigenome, including the role played by chromatin remodellers and epigenetic enzymes. We will also use IL2, a key inducible cytokine gene in T cells, as an example of how the different layers of epigenetic mechanisms regulate immune responsive genes during T-cell activation. © 2013 John Wiley & Sons Ltd.

  2. Rheb1 mediates DISC1-dependent regulation of new neuron development in the adult hippocampus.

    Science.gov (United States)

    Kang, Eunchai; Kim, Ju Young; Liu, Cindy Y; Xiao, Bo; Chen, Po Yu; Christian, Kimberly M; Worley, Paul F; Song, Hongjun; Ming, Guo-Li

    2015-01-01

    A large number of susceptibility genes have been implicated in psychiatric disorders with a developmental origin, yet their biological roles and signaling mechanisms in neurodevelopment are largely unknown. Disrupted-In-Schizophrenia 1 (DISC1), a susceptibility gene for several major psychiatric disorders, regulates the development of newborn neurons in the adult hippocampus. Systemic pharmacological inhibition of mTOR signaling with rapamycin has been shown to rescue DISC1 deficiency-induced neurodevelopmental defects, as well as cognitive and affective deficits. Whether mTOR signaling plays a cell-autonomous and/or non-cell-autonomous role in DISC1-dependent regulation of neuronal development is not clear. Here we provide genetic evidence that hyper-activation of mTOR activator Rheb1 (Ras homolog enriched in brain 1) in newborn neurons recapitulates DISC1 deficiency-induced neurodevelopmental defects, including neuronal morphogenesis and migration. We further show that genetic deletion of Rheb1 rescues those defects in a cell-autonomous fashion in developing newborn neurons in the adult hippocampus. Our genetic and functional studies demonstrate that Rheb1 acts as a key mediator of DISC1-dependent regulation of mTOR signaling and neuronal development during adult hippocampal neurogenesis.

  3. A cautionary tale of sense-antisense gene pairs: independent regulation despite inverse correlation of expression.

    Science.gov (United States)

    Goyal, Ashish; Fiškin, Evgenij; Gutschner, Tony; Polycarpou-Schwarz, Maria; Groß, Matthias; Neugebauer, Julia; Gandhi, Minakshi; Caudron-Herger, Maiwen; Benes, Vladimir; Diederichs, Sven

    2017-12-01

    Long non-coding RNAs (lncRNAs) have been proven to play important roles in diverse cellular processes including the DNA damage response. Nearly 40% of annotated lncRNAs are transcribed in antisense direction to other genes and have often been implicated in their regulation via transcript- or transcription-dependent mechanisms. However, it remains unclear whether inverse correlation of gene expression would generally point toward a regulatory interaction between the genes. Here, we profiled lncRNA and mRNA expression in lung and liver cancer cells after exposure to DNA damage. Our analysis revealed two pairs of mRNA-lncRNA sense-antisense transcripts being inversely expressed upon DNA damage. The lncRNA NOP14-AS1 was strongly upregulated upon DNA damage, while the mRNA for NOP14 was downregulated, both in a p53-dependent manner. For another pair, the lncRNA LIPE-AS1 was downregulated, while its antisense mRNA CEACAM1 was upregulated. To test whether as expected the antisense genes would regulate each other resulting in this highly significant inverse correlation, we employed antisense oligonucleotides and RNAi to study transcript-dependent effects as well as dCas9-based transcriptional modulation by CRISPRi/CRISPRa for transcription-dependent effects. Surprisingly, despite the strong stimulus-dependent inverse correlation, our data indicate that neither transcript- nor transcription-dependent mechanisms explain the inverse regulation of NOP14-AS1:NOP14 or LIPE-AS1:CEACAM1 expression. Hence, sense-antisense pairs whose expression is strongly-positively or negatively-correlated can be nonetheless regulated independently. This highlights the requirement of individual experimental studies for each antisense pair and prohibits drawing conclusions on regulatory mechanisms from expression correlations. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. Integrative Regulation of Drought Escape through ABA-Dependent and -Independent Pathways in Rice.

    Science.gov (United States)

    Du, Hao; Huang, Fei; Wu, Nai; Li, Xianghua; Hu, Honghong; Xiong, Lizhong

    2018-04-02

    Many plants have evolved a drought escape (DE) mechanism to shorten their life cycle when facing water-deficit conditions. While drought tolerance has been intensively investigated, the genetic and molecular mechanisms of DE remain elusive. In this study, we found that low water-deficit treatment (LWT) at the early stage of rice development can trigger early flowering and reduced tiller numbers. LWT induced the accumulation of abscisic acid (ABA), which in turn has feed-back effects on light perception and circadian clock by synchronously regulating many flowering-related genes to promote early flowering. Moreover, some of light receptors, circadian components, and flowering-related genes including OsTOC1, Ghd7, and PhyB were found to be involved in LWT in an ABA-dependent manner, whereas some of the other flowering-related genes including OsGI, OsELF3, OsPRR37, and OsMADS50 were involved in the regulation of DE independent of ABA. In addition, we found that strigolactones and OsTB1 are involved in the tillering inhibition under LWT, which is independent of the flowering pathway in rice. Taken together, our findings provide compelling evidence that DE in rice is coordinately regulated by multiple pathways during the reproduction (flowering) switch. Copyright © 2018 The Author. Published by Elsevier Inc. All rights reserved.

  5. Expression Regulation of Polycistronic lee3 Genes of Enterohaemorrhagic Escherichia coli.

    Directory of Open Access Journals (Sweden)

    Wei-Sheng W Sun

    Full Text Available Enterohaemorrhagic Escherichia coli O157:H7 (EHEC carries a pathogenic island LEE that is consisted mainly of five polycistronic operons. In the lee3 operon, mpc is the first gene and has been reported to down regulate the type-3 secretion system of EHEC when its gene product is over-expressed. Furthermore, mpc has been suggested to have a regulation function via translation but the mechanism remains unclear. To clarify this hypothesis, we dissected the polycistron and examined the translated products. We conclude that translation of mpc detrimentally governs the translation of the second gene, escV, which in turn affects the translation of the third gene, escN. Then sequentially, escN affects the expression of the downstream genes. Furthermore, we located a critical cis element within the mpc open-reading frame that plays a negative role in the translation-dependent regulation of lee3. Using qRT-PCR, we found that the amount of mpc RNA transcript present in EHEC was relatively limited when compared to any other genes within lee3. Taken together, when the transcription of LEE is activated, expression of mpc is tightly controlled by a restriction of the RNA transcript of mpc, translation of which is then critical for the efficient production of the operon's downstream gene products.

  6. Cyclin-dependent kinases regulate apoptosis of intestinal epithelial cells

    Science.gov (United States)

    Bhattacharya, Sujoy; Ray, Ramesh M.; Johnson, Leonard R.

    2014-01-01

    Homeostasis of the gastrointestinal epithelium is dependent upon a balance between cell proliferation and apoptosis. Cyclin-dependent kinases (Cdks) are well known for their role in cell proliferation. Previous studies from our group have shown that polyamine-depletion of intestinal epithelial cells (IEC-6) decreases cyclin-dependent kinase 2 (Cdk2) activity, increases p53 and p21Cip1 protein levels, induces G1 arrest, and protects cells from camptothecin (CPT)-induced apoptosis. Although emerging evidence suggests that members of the Cdk family are involved in the regulation of apoptosis, their roles directing apoptosis of IEC-6 cells are not known. In this study, we report that inhibition of Cdk1, 2, and 9 (with the broad range Cdk inhibitor, AZD5438) in proliferating IEC-6 cells triggered DNA damage, activated p53 signaling, inhibited proliferation, and induced apoptosis. By contrast, inhibition of Cdk2 (with NU6140) increased p53 protein and activity, inhibited proliferation, but had no effect on apoptosis. Notably, AZD5438 sensitized, whereas, NU6140 rescued proliferating IEC-6 cells from CPT-induced apoptosis. However, in colon carcinoma (Caco2) cells with mutant p53, treatment with either AZD5438 or NU6140 blocked proliferation, albeit more robustly with AZD5438. Both Cdk inhibitors induced apoptosis in Caco2 cells in a p53-independent manner. In serum starved quiescent IEC-6 cells, both AZD5438 and NU6140 decreased TNF- /CPT-induced activation of p53 and, consequently, rescued cells from apoptosis, indicating that sustained Cdk activity is required for apoptosis of quiescent cells. Furthermore, AZD5438 partially reversed the protective effect of polyamine depletion whereas NU6140 had no effect. Together, these results demonstrate that Cdks possess opposing roles in the control of apoptosis in quiescent and proliferating cells. In addition, Cdk inhibitors uncouple proliferation from apoptosis in a p53-dependent manner. PMID:24242917

  7. Regulation of human autoimmune regulator (AIRE) gene translation by miR-220b.

    Science.gov (United States)

    Matsuo, Tomohito; Noguchi, Yukiko; Shindo, Mieko; Morita, Yoshifumi; Oda, Yoshie; Yoshida, Eiko; Hamada, Hiroko; Harada, Mine; Shiokawa, Yuichi; Nishida, Takahiro; Tominaga, Ryuji; Kikushige, Yoshikane; Akashi, Koichi; Kudoh, Jun; Shimizu, Nobuyoshi; Tanaka, Yuka; Umemura, Tsukuru; Taniguchi, Taketoshi; Yoshimura, Akihiko; Kobayashi, Takashi; Mitsuyama, Masao; Kurisaki, Hironori; Katsuta, Hitoshi; Nagafuchi, Seiho

    2013-11-01

    Although mutations of autoimmune regulator (AIRE) gene are responsible for autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy (APECED), presenting a wide spectrum of many characteristic and non-characteristic clinical features, some patients lack AIRE gene mutations. Therefore, something other than a mutation, such as dysregulation of AIRE gene, may be a causal factor for APECED or its related diseases. However, regulatory mechanisms for AIRE gene expression and/or translation have still remained elusive. We found that IL-2-stimulated CD4(+) T (IL-2T) cells showed a high expression of AIRE gene, but very low AIRE protein production, while Epstein-Barr virus-transformed B (EBV-B) cells express both AIRE gene and AIRE protein. By using microarray analysis, we could identify miR-220b as a possible regulatory mechanism for AIRE gene translation in IL-2T cells. Here we report that miR-220b significantly reduced the expression of AIRE protein in AIRE gene with 3'UTR region transfected 293T cells, whereas no alteration of AIRE protein production was observed in the open reading frame of AIRE gene alone transfected cells. In addition, anti-miR-220b reversed the inhibitory function of miR-220b for the expression of AIRE protein in AIRE gene with 3'UTR region transfected cells. Moreover, when AIRE gene transfected cells with mutated 3'UTR were transfected with miR-220b, no reduction of AIRE protein production was observed. Taken together, it was concluded that miR-220b inhibited the AIRE gene translation through the 3'UTR region of AIRE gene, indicating that miR-220b could serve as a regulator for human AIRE gene translation. © 2013.

  8. [Regulation of heat shock gene expression in response to stress].

    Science.gov (United States)

    Garbuz, D G

    2017-01-01

    Heat shock (HS) genes, or stress genes, code for a number of proteins that collectively form the most ancient and universal stress defense system. The system determines the cell capability of adaptation to various adverse factors and performs a variety of auxiliary functions in normal physiological conditions. Common stress factors, such as higher temperatures, hypoxia, heavy metals, and others, suppress transcription and translation for the majority of genes, while HS genes are upregulated. Transcription of HS genes is controlled by transcription factors of the HS factor (HSF) family. Certain HSFs are activated on exposure to higher temperatures or other adverse factors to ensure stress-induced HS gene expression, while other HSFs are specifically activated at particular developmental stages. The regulation of the main mammalian stress-inducible factor HSF1 and Drosophila melanogaster HSF includes many components, such as a variety of early warning signals indicative of abnormal cell activity (e.g., increases in intracellular ceramide, cytosolic calcium ions, or partly denatured proteins); protein kinases, which phosphorylate HSFs at various Ser residues; acetyltransferases; and regulatory proteins, such as SUMO and HSBP1. Transcription factors other than HSFs are also involved in activating HS gene transcription; the set includes D. melanogaster GAF, mammalian Sp1 and NF-Y, and other factors. Transcription of several stress genes coding for molecular chaperones of the glucose-regulated protein (GRP) family is predominantly regulated by another stress-detecting system, which is known as the unfolded protein response (UPR) system and is activated in response to massive protein misfolding in the endoplasmic reticulum and mitochondrial matrix. A translational fine tuning of HS protein expression occurs via changing the phosphorylation status of several proteins involved in translation initiation. In addition, specific signal sequences in the 5'-UTRs of some HS

  9. Arabidopsis MAP kinase 4 regulates salicylic acid- and jasmonic acid/ethylene-dependent responses via EDS1 and PAD4

    DEFF Research Database (Denmark)

    Brodersen, P; Petersen, M; Nielsen, Henrik Bjørn

    2006-01-01

    Arabidopsis MPK4 has been implicated in plant defense regulation because mpk4 knockout plants exhibit constitutive activation of salicylic acid (SA)-dependent defenses, but fail to induce jasmonic acid (JA) defense marker genes in response to JA. We show here that mpk4 mutants are also defective...

  10. Regulation of expression of Na+,K+-ATPase in androgen-dependent and androgen-independent prostate cancer

    NARCIS (Netherlands)

    L.J. Blok (Leen); G.T.G. Chang; M. Steenbeek-Slotboom (M.); W.M. van Weerden (Wytske); H.G. Swarts; J.J.H.H.M. de Pont (J. J H H M); G.J. van Steenbrugge (Gert Jan); A.O. Brinkmann (Albert)

    1999-01-01

    textabstractThe β1-subunit of Na+,K+-ATPase was isolated and identified as an androgen down-regulated gene. Expression was observed at high levels in androgen-independent as compared to androgen-dependent (responsive) human prostate cancer cell lines and xenografts when grown in the presence of

  11. The transcription factor FoxK participates with Nup98 to regulate antiviral gene expression.

    Science.gov (United States)

    Panda, Debasis; Gold, Beth; Tartell, Michael A; Rausch, Keiko; Casas-Tinto, Sergio; Cherry, Sara

    2015-04-07

    Upon infection, pathogen recognition leads to a rapidly activated gene expression program that induces antimicrobial effectors to clear the invader. We recently found that Nup98 regulates the expression of a subset of rapidly activated antiviral genes to restrict disparate RNA virus infections in Drosophila by promoting RNA polymerase occupancy at the promoters of these antiviral genes. How Nup98 specifically targets these loci was unclear; however, it is known that Nup98 participates with transcription factors to regulate developmental-gene activation. We reasoned that additional transcription factors may facilitate the Nup98-dependent expression of antiviral genes. In a genome-wide RNA interference (RNAi) screen, we identified a relatively understudied forkhead transcription factor, FoxK, as active against Sindbis virus (SINV) in Drosophila. Here we find that FoxK is active against the panel of viruses that are restricted by Nup98, including SINV and vesicular stomatitis virus (VSV). Mechanistically, we show that FoxK coordinately regulates the Nup98-dependent expression of antiviral genes. Depletion of FoxK significantly reduces Nup98-dependent induction of antiviral genes and reduces the expression of a forkhead response element-containing luciferase reporter. Together, these data show that FoxK-mediated activation of gene expression is Nup98 dependent. We extended our studies to mammalian cells and found that the mammalian ortholog FOXK1 is antiviral against two disparate RNA viruses, SINV and VSV, in human cells. Interestingly, FOXK1 also plays a role in the expression of antiviral genes in mammals: depletion of FOXK1 attenuates virus-inducible interferon-stimulated response element (ISRE) reporter expression. Overall, our results demonstrate a novel role for FOXK1 in regulating the expression of antiviral genes, from insects to humans. Innate immunity is characterized by rapid gene expression programs, from insects to mammals. Furthermore, we find that Nup98

  12. Genes, epigenetics and miRNA regulation in the placenta.

    Science.gov (United States)

    Vaiman, Daniel

    2017-04-01

    This text reviews briefly the context in which epigenetics regulate gene expression in trophoblast development and function. It is an attempt to focus on a limited number of recent papers that, according to the author, shed new light on placental development, and constitute possible trails for improving knowledge and women follow-up in pathological pregnancies. Copyright © 2016. Published by Elsevier Ltd.

  13. What DNA sequence tells us about gene regulation - The ...

    Indian Academy of Sciences (India)

    Rahul Siddharthan

    2007-11-03

    Nov 3, 2007 ... Predicting cis-regulatory modules: eve enhancers. Performance, even without prior WMs, comparable to dedicated CRM prediction programs like Stubb. Rahul Siddharthan. (The Institute of Mathematical Sciences, Chennai 600 113. What DNA sequence tells us about gene regulation. 03/11/2007. 27 / 34 ...

  14. Developmentally regulated expression of reporter gene in adult ...

    Indian Academy of Sciences (India)

    Introduction. The genetic regulation of adult brain development has re- mained enigmatic to developmental biologists since long. The practical difficulty in understanding the adult brain de- velopment is that most of the mutational searches done for genes in different model systems yield mutations inducing embryonic ...

  15. Gene Expression Profiling of Apoptosis Regulators in Patients with Sepsis

    NARCIS (Netherlands)

    Hoogerwerf, Jacobien J.; van Zoelen, Marieke A.; Wiersinga, W. Joost; van 't Veer, Cornelis; de Vos, Alex F.; de Boer, Anita; Schultz, Marcus J.; Hooibrink, Berend; de Jonge, Evert; van der Poll, Tom

    2010-01-01

    Introduction: Sepsis is associated with a dysregulation of apoptosis in immune cells, which has been implicated in both immunosuppression and multiple organ failure. We describe the expression profiles of genes encoding key regulators of apoptosis in highly purified monocytes, granulocytes and CD4+

  16. ApoM: gene regulation and effects on HDL metabolism

    DEFF Research Database (Denmark)

    Nielsen, Lars B; Christoffersen, Christina; Ahnström, Josefin

    2009-01-01

    The recently discovered apolipoprotein M (apoM) is a plasma protein of the lipocalin family associated with the lipoproteins (mainly high-density lipoproteins, or HDLs). Expression of the apoM gene in the liver is regulated by transcription factors that control key steps in hepatic lipid and gluc...

  17. LncRNAs: emerging players in gene regulation and disease ...

    Indian Academy of Sciences (India)

    2Flinders Centre for Innovation in Cancer, School of Medicine, Flinders University, Flinders Medical Centre,. Adelaide 5042, Australia .... gene regulation mechanisms, lncRNAs have distinct features from other regulatory ncRNAs ...... blastoma (RB) in human colorectal cancer (Tsang et al. 2010; Hauptman and Glavac 2013) ...

  18. ERK Oscillation-Dependent Gene Expression Patterns and Deregulation by Stress-Response

    Energy Technology Data Exchange (ETDEWEB)

    Waters, Katrina M.; Cummings, Brian S.; Shankaran, Harish; Scholpa, Natalie E.; Weber, Thomas J.

    2014-09-15

    Studies were undertaken to determine whether ERK oscillations regulate a unique subset of genes in human keratinocytes and subsequently, whether the p38 stress response inhibits ERK oscillations. A DNA microarray identified many genes that were unique to ERK oscillations, and network reconstruction predicted an important role for the mediator complex subunit 1 (MED1) node in mediating ERK oscillation-dependent gene expression. Increased ERK-dependent phosphorylation of MED1 was observed in oscillating cells compared to non-oscillating counterparts as validation. Treatment of keratinocytes with a p38 inhibitor (SB203580) increased ERK oscillation amplitudes and MED1 and phospho-MED1 protein levels. Bromate is a probable human carcinogen that activates p38. Bromate inhibited ERK oscillations in human keratinocytes and JB6 cells and induced an increase in phospho-p38 and decrease in phospho-MED1 protein levels. Treatment of normal rat kidney cells and primary salivary gland epithelial cells with bromate decreased phospho-MED1 levels in a reversible fashion upon treatment with p38 inhibitors (SB202190; SB203580). Our results indicate that oscillatory behavior in the ERK pathway alters homeostatic gene regulation patterns and that the cellular response to perturbation may manifest differently in oscillating vs non-oscillating cells.

  19. Bromodomain Protein BRD4 Is Required for Estrogen Receptor-Dependent Enhancer Activation and Gene Transcription

    Directory of Open Access Journals (Sweden)

    Sankari Nagarajan

    2014-07-01

    Full Text Available The estrogen receptor α (ERα controls cell proliferation and tumorigenesis by recruiting various cofactors to estrogen response elements (EREs to control gene transcription. A deeper understanding of these transcriptional mechanisms may uncover therapeutic targets for ERα-dependent cancers. We show that BRD4 regulates ERα-induced gene expression by affecting elongation-associated phosphorylation of RNA polymerase II (RNAPII and histone H2B monoubiquitination. Consistently, BRD4 activity is required for proliferation of ER+ breast and endometrial cancer cells and uterine growth in mice. Genome-wide studies revealed an enrichment of BRD4 on transcriptional start sites of active genes and a requirement of BRD4 for H2B monoubiquitination in the transcribed region of estrogen-responsive genes. Importantly, we demonstrate that BRD4 occupancy on distal EREs enriched for H3K27ac is required for recruitment and elongation of RNAPII on EREs and the production of ERα-dependent enhancer RNAs. These results uncover BRD4 as a central regulator of ERα function and potential therapeutic target.

  20. Global identification of genes regulated by estrogen signaling and demethylation in MCF-7 breast cancer cells

    International Nuclear Information System (INIS)

    Putnik, Milica; Zhao, Chunyan; Gustafsson, Jan-Åke; Dahlman-Wright, Karin

    2012-01-01

    Highlights: ► Estrogen signaling and demethylation can both control gene expression in breast cancers. ► Cross-talk between these mechanisms is investigated in human MCF-7 breast cancer cells. ► 137 genes are influenced by both 17β-estradiol and demethylating agent 5-aza-2′-deoxycytidine. ► A set of genes is identified as targets of both estrogen signaling and demethylation. ► There is no direct molecular interplay of mediators of estrogen and epigenetic signaling. -- Abstract: Estrogen signaling and epigenetic modifications, in particular DNA methylation, are involved in regulation of gene expression in breast cancers. Here we investigated a potential regulatory cross-talk between these two pathways by identifying their common target genes and exploring underlying molecular mechanisms in human MCF-7 breast cancer cells. Gene expression profiling revealed that the expression of approximately 140 genes was influenced by both 17β-estradiol (E2) and a demethylating agent 5-aza-2′-deoxycytidine (DAC). Gene ontology (GO) analysis suggests that these genes are involved in intracellular signaling cascades, regulation of cell proliferation and apoptosis. Based on previously reported association with breast cancer, estrogen signaling and/or DNA methylation, CpG island prediction and GO analysis, we selected six genes (BTG3, FHL2, PMAIP1, BTG2, CDKN1A and TGFB2) for further analysis. Tamoxifen reverses the effect of E2 on the expression of all selected genes, suggesting that they are direct targets of estrogen receptor. Furthermore, DAC treatment reactivates the expression of all selected genes in a dose-dependent manner. Promoter CpG island methylation status analysis revealed that only the promoters of BTG3 and FHL2 genes are methylated, with DAC inducing demethylation, suggesting DNA methylation directs repression of these genes in MCF-7 cells. In a further analysis of the potential interplay between estrogen signaling and DNA methylation, E2 treatment

  1. Androgen-Dependent Regulation of Human MUC1 Mucin Expression

    Directory of Open Access Journals (Sweden)

    Stephen Mitchell

    2002-01-01

    Full Text Available MUC1 mucin is transcriptionally regulated by estrogen, progesterone, and glucocorticoids. Our objective was to determine whether androgen receptor. (20AR activation regulates expression of MUC1. The following breast and prostatic cell lines were phenotyped and grouped according to AR and MUC1protein expression: 1 AR+MUCi + [DAR17+19. (20AR transfectants of DU-145, ZR-75-1, MDA-MB-453, and T47D]; 2 AR-MUCi+ [DZeoi. (20AR- vector control, DU-145, BT20, MDA-MB231, and MCF7]; 3 AIR +MUCi -. (20LNCaP and LNCaP-r. Cell proliferation was determined using the MTT assay in the presence of synthetic androgen R1881, 0.1 pM to 1 µM. Cell surface MUC1expression was determined by flow cytometry in the presence or absence of oestradiol, medroxy progesterone acetate or R1881, with and without 4 hydroxy-flutamide. (204-OH, a nonsteroidal AR antagonist. The functional significance of MUC1expression was investigated with a cell-cell aggregation assay. Only AR+ MUC1 + cell lines showed a significant increase in MUC1expression with AR activation. (20P. (20range =.01 to .0001, reversed in the presence of 4-OHF. Cell proliferation was unaffected. Increased expression of MUC1was associated with a significant. (20P. (20range =.002 to .001 reduction in cell-cell adhesion. To our knowledge, this is the first description of androgen-dependent regulation of MUC1mucin. This is also functionally associated with decreased cell-cell adhesion, a recognised feature of progressive malignancy. These findings have important implications for physiological and pathological processes.

  2. TEAD mediates YAP-dependent gene induction and growth control.

    Science.gov (United States)

    Zhao, Bin; Ye, Xin; Yu, Jindan; Li, Li; Li, Weiquan; Li, Siming; Yu, Jianjun; Lin, Jiandie D; Wang, Cun-Yu; Chinnaiyan, Arul M; Lai, Zhi-Chun; Guan, Kun-Liang

    2008-07-15

    The YAP transcription coactivator has been implicated as an oncogene and is amplified in human cancers. Recent studies have established that YAP is phosphorylated and inhibited by the Hippo tumor suppressor pathway. Here we demonstrate that the TEAD family transcription factors are essential in mediating YAP-dependent gene expression. TEAD is also required for YAP-induced cell growth, oncogenic transformation, and epithelial-mesenchymal transition. CTGF is identified as a direct YAP target gene important for cell growth. Moreover, the functional relationship between YAP and TEAD is conserved in Drosophila Yki (the YAP homolog) and Scalloped (the TEAD homolog). Our study reveals TEAD as a new component in the Hippo pathway playing essential roles in mediating biological functions of YAP.

  3. MDP up-regulates the gene expression of type I interferons in human aortic endothelial cells.

    Science.gov (United States)

    Lv, Qingshan; Yang, Mei; Liu, Xueting; Zhou, Lina; Xiao, Zhilin; Chen, Xiaobin; Chen, Meifang; Xie, Xiumei; Hu, Jinyue

    2012-03-23

    Muramyldipeptide (MDP), the minimum essential structure responsible for the immuno-adjuvant activity of peptidoglycan, is recognized by intracellular nuclear-binding oligomerization domain 2 (NOD2). Here, we obtained evidence that the treatment of human aortic endothelial cells (HAECs) with MDP up-regulated the gene expression of type I interferons in a dose- and time-dependent manner. MDP also up-regulated the expression of the receptor NOD2, suggesting that MDP may induce a positive feedback response. The up-regulation of interferons was not dependent on the TNFa signaling, as HAECs did not express TNFa with the stimulation of MDP, and TNFa neutralizing antibody did not decrease the induction of IFNs induced by MDP. RT-PCR results showed that HAECs expressed the gene transcripts of interferon regulatory factor (IRF) 1, 2, 3, 9. The western blot results showed that MDP induced the phosphorylation of IRF3. These results suggested that MDP induced the up-regulation of gene transcript of interferons through the activation of IRF3 signaling pathway. Meanwhile, MDP induced the gene expression of pro-inflammatory cytokines, including IL-1ß, IL-8, and MCP-1. Taken together, these results suggested that HAECs may play roles in the anti-infection immune response and in the induction of innate immunity.

  4. MDP Up-Regulates the Gene Expression of Type I Interferons in Human Aortic Endothelial Cells

    Directory of Open Access Journals (Sweden)

    Xiumei Xie

    2012-03-01

    Full Text Available Muramyldipeptide (MDP, the minimum essential structure responsible for the immuno-adjuvant activity of peptidoglycan, is recognized by intracellular nuclear-binding oligomerization domain 2 (NOD2. Here, we obtained evidence that the treatment of human aortic endothelial cells (HAECs with MDP up-regulated the gene expression of type I interferons in a dose- and time-dependent manner. MDP also up-regulated the expression of the receptor NOD2, suggesting that MDP may induce a positive feedback response. The up-regulation of interferons was not dependent on the TNFa signaling, as HAECs did not express TNFa with the stimulation of MDP, and TNFa neutralizing antibody did not decrease the induction of IFNs induced by MDP. RT-PCR results showed that HAECs expressed the gene transcripts of interferon regulatory factor (IRF 1, 2, 3, 9. The western blot results showed that MDP induced the phosphorylation of IRF3. These results suggested that MDP induced the up-regulation of gene transcript of interferons through the activation of IRF3 signaling pathway. Meanwhile, MDP induced the gene expression of pro-inflammatory cytokines, including IL-1ß, IL-8, and MCP-1. Taken together, these results suggested that HAECs may play roles in the anti-infection immune response and in the induction of innate immunity.

  5. Early development of Moniliophthora perniciosa basidiomata and developmentally regulated genes

    Directory of Open Access Journals (Sweden)

    Pereira Gonçalo AG

    2009-08-01

    Full Text Available Abstract Background The hemibiotrophic fungus Moniliophthora perniciosa is the causal agent of Witches' broom, a disease of Theobroma cacao. The pathogen life cycle ends with the production of basidiocarps in dead tissues of the infected host. This structure generates millions of basidiospores that reinfect young tissues of the same or other plants. A deeper understanding of the mechanisms underlying the sexual phase of this fungus may help develop chemical, biological or genetic strategies to control the disease. Results Mycelium was morphologically analyzed prior to emergence of basidiomata by stereomicroscopy, light microscopy and scanning electron microscopy. The morphological changes in the mycelium before fructification show a pattern similar to other members of the order Agaricales. Changes and appearance of hyphae forming a surface layer by fusion were correlated with primordia emergence. The stages of hyphal nodules, aggregation, initial primordium and differentiated primordium were detected. The morphological analysis also allowed conclusions on morphogenetic aspects. To analyze the genes involved in basidiomata development, the expression of some selected EST genes from a non-normalized cDNA library, representative of the fruiting stage of M. perniciosa, was evaluated. A macroarray analysis was performed with 192 selected clones and hybridized with two distinct RNA pools extracted from mycelium in different phases of basidiomata formation. This analysis showed two groups of up and down-regulated genes in primordial phases of mycelia. Hydrophobin coding, glucose transporter, Rho-GEF, Rheb, extensin precursor and cytochrome p450 monooxygenase genes were grouped among the up-regulated. In the down-regulated group relevant genes clustered coding calmodulin, lanosterol 14 alpha demethylase and PIM1. In addition, 12 genes with more detailed expression profiles were analyzed by RT-qPCR. One aegerolysin gene had a peak of expression in

  6. Early development of Moniliophthora perniciosa basidiomata and developmentally regulated genes

    Science.gov (United States)

    2009-01-01

    Background The hemibiotrophic fungus Moniliophthora perniciosa is the causal agent of Witches' broom, a disease of Theobroma cacao. The pathogen life cycle ends with the production of basidiocarps in dead tissues of the infected host. This structure generates millions of basidiospores that reinfect young tissues of the same or other plants. A deeper understanding of the mechanisms underlying the sexual phase of this fungus may help develop chemical, biological or genetic strategies to control the disease. Results Mycelium was morphologically analyzed prior to emergence of basidiomata by stereomicroscopy, light microscopy and scanning electron microscopy. The morphological changes in the mycelium before fructification show a pattern similar to other members of the order Agaricales. Changes and appearance of hyphae forming a surface layer by fusion were correlated with primordia emergence. The stages of hyphal nodules, aggregation, initial primordium and differentiated primordium were detected. The morphological analysis also allowed conclusions on morphogenetic aspects. To analyze the genes involved in basidiomata development, the expression of some selected EST genes from a non-normalized cDNA library, representative of the fruiting stage of M. perniciosa, was evaluated. A macroarray analysis was performed with 192 selected clones and hybridized with two distinct RNA pools extracted from mycelium in different phases of basidiomata formation. This analysis showed two groups of up and down-regulated genes in primordial phases of mycelia. Hydrophobin coding, glucose transporter, Rho-GEF, Rheb, extensin precursor and cytochrome p450 monooxygenase genes were grouped among the up-regulated. In the down-regulated group relevant genes clustered coding calmodulin, lanosterol 14 alpha demethylase and PIM1. In addition, 12 genes with more detailed expression profiles were analyzed by RT-qPCR. One aegerolysin gene had a peak of expression in mycelium with primordia and a

  7. Differential regulation of the foraging gene associated with task behaviors in harvester ants

    Directory of Open Access Journals (Sweden)

    Kleeman Lindsay

    2011-08-01

    Full Text Available Abstract Background The division of labor in social insect colonies involves transitions by workers from one task to another and is critical to the organization and ecological success of colonies. The differential regulation of genetic pathways is likely to be a key mechanism involved in plasticity of social insect task behavior. One of the few pathways implicated in social organization involves the cGMP-activated protein kinase gene, foraging, a gene associated with foraging behavior in social insect species. The association of the foraging gene with behavior is conserved across diverse species, but the observed expression patterns and proposed functions of this gene vary across taxa. We compared the protein sequence of foraging across social insects and explored whether the differential regulation of this gene is associated with task behaviors in the harvester ant, Pogonomyrmex occidentalis. Results Phylogenetic analysis of the coding region of the foraging gene reveals considerable conservation in protein sequence across insects, particularly among hymenopteran species. The absence of amino acid variation in key active and binding sites suggests that differences in behaviors associated with this gene among species may be the result of changes in gene expression rather than gene divergence. Using real time qPCR analyses with a harvester ant ortholog to foraging (Pofor, we found that the brains of harvester ant foragers have a daily fluctuation in expression of foraging with mRNA levels peaking at midday. In contrast, young workers inside the nest have low levels of Pofor mRNA with no evidence of daily fluctuations in expression. As a result, the association of foraging expression with task behavior within a species changes depending on the time of day the individuals are sampled. Conclusions The amino acid protein sequence of foraging is highly conserved across social insects. Differences in foraging behaviors associated with this gene among

  8. Reptin regulates pluripotency of embryonic stem cells and somatic cell reprogramming through Oct4-dependent mechanism.

    Science.gov (United States)

    Do, Eun Kyoung; Cheon, Hyo Cheon; Jang, Il Ho; Choi, Eun Jung; Heo, Soon Chul; Kang, Kyung Taek; Bae, Kwang Hee; Cho, Yee Sook; Seo, Jeong Kon; Yoon, Jong Hyuk; Lee, Taehoon G; Kim, Jae Ho

    2014-12-01

    Oct4 has been implicated in regulation of pluripotency in embryonic stem cells (ESCs) and reprogramming of somatic cells into induced pluripotent stem cells. However, the molecular mechanisms involved in Oct4-dependent regulation of pluripotency and reprogramming have not been clear. To gain insight into the mechanism of regulation of Oct4-mediated self-renewal of ESCs and reprogramming of somatic cells, we attempted to identify Oct4-binding proteins using affinity purification and mass spectrometry. We identified Reptin, a key component of ATP-dependent chromatin remodeling complexes, as an Oct4-binding protein. Depletion of endogenous Reptin using lentiviral short hairpin RNA (shRNA) led to a decrease in the number and size of alkaline phosphatase-positive colonies of mouse ESCs. In addition, shRNA-mediated silencing of Reptin resulted in decreased expression of pluripotency-specific marker genes, including Oct4, Sox2, Nanog, and SSEA-1. Results of the Oct4 reporter assay showed synergism between Oct4 and Reptin, and depletion of endogenous Reptin abolished Oct4 transcriptional activity. Results of a chromatin immunoprecipitation assay showed the overlapping interaction of Reptin and Oct4 to CR4 in the Oct4 enhancer in ESCs. Knockdown of Reptin using shRNA suppressed the reprogramming of mouse embryonic fibroblasts to induced pluripotent stem cells, whereas overexpression of Reptin resulted in enhanced efficiency of induced pluripotent stem cell generation. These results strongly suggest that Reptin plays a key role in maintaining the pluripotency of ESCs and in establishing the pluripotency during reprogramming of somatic cells by regulation of Oct4-mediated gene regulation. © 2014 AlphaMed Press.

  9. Hox gene regulation in the central nervous system of Drosophila

    Directory of Open Access Journals (Sweden)

    Maheshwar eGummalla

    2014-04-01

    Full Text Available Hox genes specify the structures that form along the anteroposterior (AP axis of bilateria. Within the genome, they often form clusters where, remarkably enough, their position within the clusters reflects the relative positions of the structures they specify along the AP axis. This correspondence between genomic organization and gene expression pattern has been conserved through evolution and provides a unique opportunity to study how chromosomal context affects gene regulation. In Drosophila, a general rule, often called posterior dominance, states that Hox genes specifying more posterior structures repress the expression of more anterior Hox genes. This rule explains the apparent spatial complementarity of Hox gene expression patterns in Drosophila. Here we review a noticeable exception to this rule where the more-posteriorly expressed Abd-B hox gene fails to repress the more-anterior abd-A gene in cells of the central nervous system (CNS. While Abd-B is required to repress ectopic expression of abd-A in the posterior epidermis, abd-A repression in the posterior CNS is accomplished by a different mechanism that involves a large 92kb long non-coding RNA (lncRNA encoded by the intergenic region separating abd-A and Abd-B (the iab8ncRNA. Dissection of this lncRNA revealed that abd-A is repressed by the lncRNA using two redundant mechanisms. The 1st mechanism is mediated by a microRNA (mir-iab-8 encoded by intronic sequence within the large iab8-ncRNA. Meanwhile, the second mechanism seems to involve transcriptional interference by the long iab-8 ncRNA on the abd-A promoter. Recent work demonstrating CNS-specific regulation of genes by ncRNAs in Drosophila, seem to highlight a potential role for the iab-8-ncRNA in the evolution of the Drosophila hox complexes

  10. Identification of Master Regulator Genes in Human Periodontitis.

    Science.gov (United States)

    Sawle, A D; Kebschull, M; Demmer, R T; Papapanou, P N

    2016-08-01

    Analytic approaches confined to fold-change comparisons of gene expression patterns between states of health and disease are unable to distinguish between primary causal disease drivers and secondary noncausal events. Genome-wide reverse engineering approaches can facilitate the identification of candidate genes that may distinguish between causal and associative interactions and may account for the emergence or maintenance of pathologic phenotypes. In this work, we used the algorithm for the reconstruction of accurate cellular networks (ARACNE) to analyze a large gene expression profile data set (313 gingival tissue samples from a cross-sectional study of 120 periodontitis patients) obtained from clinically healthy (n = 70) or periodontitis-affected (n = 243) gingival sites. The generated transcriptional regulatory network of the gingival interactome was subsequently interrogated with the master regulator inference algorithm (MARINA) and gene expression signature data from healthy and periodontitis-affected gingiva. Our analyses identified 41 consensus master regulator genes (MRs), the regulons of which comprised between 25 and 833 genes. Regulons of 7 MRs (HCLS1, ZNF823, XBP1, ZNF750, RORA, TFAP2C, and ZNF57) included >500 genes each. Gene set enrichment analysis indicated differential expression of these regulons in gingival health versus disease with a type 1 error between 2% and 0.5% and with >80% of the regulon genes in the leading edge. Ingenuity pathway analysis showed significant enrichment of 36 regulons for several pathways, while 6 regulons (those of MRs HCLS1, IKZF3, ETS1, NHLH2, POU2F2, and VAV1) were enriched for >10 pathways. Pathways related to immune system signaling and development were the ones most frequently enriched across all regulons. The unbiased analysis of genome-wide regulatory networks can enhance our understanding of the pathobiology of human periodontitis and, after appropriate validation, ultimately identify target molecules of

  11. Activity-Dependent Bidirectional Regulation of GAD Expression in a Homeostatic Fashion Is Mediated by BDNF-Dependent and Independent Pathways

    Science.gov (United States)

    Hanno-Iijima, Yoko; Tanaka, Masami; Iijima, Takatoshi

    2015-01-01

    Homeostatic synaptic plasticity, or synaptic scaling, is a mechanism that tunes neuronal transmission to compensate for prolonged, excessive changes in neuronal activity. Both excitatory and inhibitory neurons undergo homeostatic changes based on synaptic transmission strength, which could effectively contribute to a fine-tuning of circuit activity. However, gene regulation that underlies homeostatic synaptic plasticity in GABAergic (GABA, gamma aminobutyric) neurons is still poorly understood. The present study demonstrated activity-dependent dynamic scaling in which NMDA-R (N-methyl-D-aspartic acid receptor) activity regulated the expression of GABA synthetic enzymes: glutamic acid decarboxylase 65 and 67 (GAD65 and GAD67). Results revealed that activity-regulated BDNF (brain-derived neurotrophic factor) release is necessary, but not sufficient, for activity-dependent up-scaling of these GAD isoforms. Bidirectional forms of activity-dependent GAD expression require both BDNF-dependent and BDNF-independent pathways, both triggered by NMDA-R activity. Additional results indicated that these two GAD genes differ in their responsiveness to chronic changes in neuronal activity, which could be partially caused by differential dependence on BDNF. In parallel to activity-dependent bidirectional scaling in GAD expression, the present study further observed that a chronic change in neuronal activity leads to an alteration in neurotransmitter release from GABAergic neurons in a homeostatic, bidirectional fashion. Therefore, the differential expression of GAD65 and 67 during prolonged changes in neuronal activity may be implicated in some aspects of bidirectional homeostatic plasticity within mature GABAergic presynapses. PMID:26241953

  12. Activity-Dependent Bidirectional Regulation of GAD Expression in a Homeostatic Fashion Is Mediated by BDNF-Dependent and Independent Pathways.

    Science.gov (United States)

    Hanno-Iijima, Yoko; Tanaka, Masami; Iijima, Takatoshi

    2015-01-01

    Homeostatic synaptic plasticity, or synaptic scaling, is a mechanism that tunes neuronal transmission to compensate for prolonged, excessive changes in neuronal activity. Both excitatory and inhibitory neurons undergo homeostatic changes based on synaptic transmission strength, which could effectively contribute to a fine-tuning of circuit activity. However, gene regulation that underlies homeostatic synaptic plasticity in GABAergic (GABA, gamma aminobutyric) neurons is still poorly understood. The present study demonstrated activity-dependent dynamic scaling in which NMDA-R (N-methyl-D-aspartic acid receptor) activity regulated the expression of GABA synthetic enzymes: glutamic acid decarboxylase 65 and 67 (GAD65 and GAD67). Results revealed that activity-regulated BDNF (brain-derived neurotrophic factor) release is necessary, but not sufficient, for activity-dependent up-scaling of these GAD isoforms. Bidirectional forms of activity-dependent GAD expression require both BDNF-dependent and BDNF-independent pathways, both triggered by NMDA-R activity. Additional results indicated that these two GAD genes differ in their responsiveness to chronic changes in neuronal activity, which could be partially caused by differential dependence on BDNF. In parallel to activity-dependent bidirectional scaling in GAD expression, the present study further observed that a chronic change in neuronal activity leads to an alteration in neurotransmitter release from GABAergic neurons in a homeostatic, bidirectional fashion. Therefore, the differential expression of GAD65 and 67 during prolonged changes in neuronal activity may be implicated in some aspects of bidirectional homeostatic plasticity within mature GABAergic presynapses.

  13. Pilocarpine-induced seizures trigger differential regulation of microRNA-stability related genes in rat hippocampal neurons

    OpenAIRE

    Kinjo, Erika R.; Higa, Guilherme S. V.; Santos, Bianca A.; de Sousa, Erica; Damico, Marcio V.; Walter, Lais T.; Morya, Edgard; Valle, Angela C.; Britto, Luiz R. G.; Kihara, Alexandre H.

    2016-01-01

    Epileptogenesis in the temporal lobe elicits regulation of gene expression and protein translation, leading to reorganization of neuronal networks. In this process, miRNAs were described as being regulated in a cell-specific manner, although mechanistics of miRNAs activity are poorly understood. The specificity of miRNAs on their target genes depends on their intracellular concentration, reflecting the balance of biosynthesis and degradation. Herein, we confirmed that pilocarpine application ...

  14. IL-4 dependent alternatively-activated macrophages have a distinctive in vivo gene expression phenotype

    Directory of Open Access Journals (Sweden)

    Guiliano David

    2002-07-01

    Full Text Available Abstract Background "Alternatively-activated" macrophages are found in Th2-mediated inflammatory settings such as nematode infection and allergic pulmonary inflammation. Due in part to a lack of markers, these cells have not been well characterized in vivo and their function remains unknown. Results We have used murine macrophages elicited by nematode infection (NeMφ as a source of in vivo derived alternatively activated macrophages. Using three distinct yet complementary molecular approaches we have established a gene expression profile of alternatively activated macrophages and identified macrophage genes that are regulated in vivo by IL-4. First, genes abundantly expressed were identified by an expressed sequence tag strategy. Second, an array of 1176 known mouse genes was screened for differential expression between NeMφ from wild type or IL-4 deficient mice. Third, a subtractive library was screened to identify novel IL-4 dependent macrophage genes. Differential expression was confirmed by real time RT-PCR analysis. Conclusions Our data demonstrate that alternatively activated macrophages generated in vivo have a gene expression profile distinct from any macrophage population described to date. Several of the genes we identified, including those most abundantly expressed, have not previously been associated with macrophages and thus this study provides unique new information regarding the phenotype of macrophages found in Th2-mediated, chronic inflammatory settings. Our data also provide additional in vivo evidence for parallels between the inflammatory processes involved in nematode infection and allergy.

  15. Age-dependent gene expression in the inner ear of big brown bats (Eptesicus fuscus.

    Directory of Open Access Journals (Sweden)

    Beatrice Mao

    Full Text Available For echolocating bats, hearing is essential for survival. Specializations for detecting and processing high frequency sounds are apparent throughout their auditory systems. Recent studies on echolocating mammals have reported evidence of parallel evolution in some hearing-related genes in which distantly related groups of echolocating animals (bats and toothed whales, cluster together in gene trees due to apparent amino acid convergence. However, molecular adaptations can occur not only in coding sequences, but also in the regulation of gene expression. The aim of this study was to examine the expression of hearing-related genes in the inner ear of developing big brown bats, Eptesicus fuscus, during the period in which echolocation vocalizations increase dramatically in frequency. We found that seven genes were significantly upregulated in juveniles relative to adults, and that the expression of four genes through development correlated with estimated age. Compared to available data for mice, it appears that expression of some hearing genes is extended in juvenile bats. These results are consistent with a prolonged growth period required to develop larger cochlea relative to body size, a later maturation of high frequency hearing, and a greater dependence on high frequency hearing in echolocating bats.

  16. Mutations in some Polycomb group genes of Drosophila interfere with regulation of segmentation genes.

    Science.gov (United States)

    McKeon, J; Slade, E; Sinclair, D A; Cheng, N; Couling, M; Brock, H W

    1994-09-01

    Mutations in several Polycomb (Pc) group genes cause maternal-effect or zygotic segmentation defects, suggesting that Pc group genes may regulate the segmentation genes of Drosophila. We show that individuals doubly heterozygous for mutations in polyhomeotic and six other Pc group genes show gap, pair rule, and segment polarity segmentation defects. We examined double heterozygous combinations of Pc group and segmentation mutations for enhancement of adult and embryonic segmentation defects. Posterior sex combs and polyhomeotic interact with Krüppel and enhance embryonic phenotypes of hunchback and knirps, and polyhomeotic enhances even-skipped. Surprisingly, flies carrying duplications of extra sex combs (esc), that were heterozygous for mutations of even-skipped (eve), were extremely subvital. Embryos and surviving adults of this genotype showed strong segmentation defects in even-numbered segments. Antibody studies confirm that expression of eve is suppressed by duplications of esc. However, esc duplications have no effect on other gap or pair rule genes tested. To our knowledge, this is only the second triplo-abnormal phenotype associated with Pc group genes. Duplications of nine other Pc group genes have no detectable effect on eve. Expression of engrailed (en) was abnormal in the central nervous systems of most Pc group mutants. These results support a role for Pc genes in regulation of some segmentation genes, and suggest that esc may act differently from other Pc group genes.

  17. Differential alterations in gene expression profiles contribute to time-dependent effects of nandrolone to prevent denervation atrophy

    Directory of Open Access Journals (Sweden)

    Bauman William A

    2010-10-01

    Full Text Available Abstract Background Anabolic steroids, such as nandrolone, slow muscle atrophy, but the mechanisms responsible for this effect are largely unknown. Their effects on muscle size and gene expression depend upon time, and the cause of muscle atrophy. Administration of nandrolone for 7 days beginning either concomitantly with sciatic nerve transection (7 days or 29 days later (35 days attenuated denervation atrophy at 35 but not 7 days. We reasoned that this model could be used to identify genes that are regulated by nandrolone and slow denervation atrophy, as well as genes that might explain the time-dependence of nandrolone effects on such atrophy. Affymetrix microarrays were used to profile gene expression changes due to nandrolone at 7 and 35 days and to identify major gene expression changes in denervated muscle between 7 and 35 days. Results Nandrolone selectively altered expression of 124 genes at 7 days and 122 genes at 35 days, with only 20 genes being regulated at both time points. Marked differences in biological function of genes regulated by nandrolone at 7 and 35 days were observed. At 35, but not 7 days, nandrolone reduced mRNA and protein levels for FOXO1, the mTOR inhibitor REDD2, and the calcineurin inhibitor RCAN2 and increased those for ApoD. At 35 days, correlations between mRNA levels and the size of denervated muscle were negative for RCAN2, and positive for ApoD. Nandrolone also regulated genes for Wnt signaling molecules. Comparison of gene expression at 7 and 35 days after denervation revealed marked alterations in the expression of 9 transcriptional coregulators, including Ankrd1 and 2, and many transcription factors and kinases. Conclusions Genes regulated in denervated muscle after 7 days administration of nandrolone are almost entirely different at 7 versus 35 days. Alterations in levels of FOXO1, and of genes involved in signaling through calcineurin, mTOR and Wnt may be linked to the favorable action of nandrolone on

  18. Global regulation of nucleotide biosynthetic genes by c-Myc.

    Directory of Open Access Journals (Sweden)

    Yen-Chun Liu

    2008-07-01

    Full Text Available The c-Myc transcription factor is a master regulator and integrates cell proliferation, cell growth and metabolism through activating thousands of target genes. Our identification of direct c-Myc target genes by chromatin immunoprecipitation (ChIP coupled with pair-end ditag sequencing analysis (ChIP-PET revealed that nucleotide metabolic genes are enriched among c-Myc targets, but the role of Myc in regulating nucleotide metabolic genes has not been comprehensively delineated.Here, we report that the majority of genes in human purine and pyrimidine biosynthesis pathway were induced and directly bound by c-Myc in the P493-6 human Burkitt's lymphoma model cell line. The majority of these genes were also responsive to the ligand-activated Myc-estrogen receptor fusion protein, Myc-ER, in a Myc null rat fibroblast cell line, HO.15 MYC-ER. Furthermore, these targets are also responsive to Myc activation in transgenic mouse livers in vivo. To determine the functional significance of c-Myc regulation of nucleotide metabolism, we sought to determine the effect of loss of function of direct Myc targets inosine monophosphate dehydrogenases (IMPDH1 and IMPDH2 on c-Myc-induced cell growth and proliferation. In this regard, we used a specific IMPDH inhibitor mycophenolic acid (MPA and found that MPA dramatically inhibits c-Myc-induced P493-6 cell proliferation through S-phase arrest and apoptosis.Taken together, these results demonstrate the direct induction of nucleotide metabolic genes by c-Myc in multiple systems. Our finding of an S-phase arrest in cells with diminished IMPDH activity suggests that nucleotide pool balance is essential for c-Myc's orchestration of DNA replication, such that uncoupling of these two processes create DNA replication stress and apoptosis.

  19. Tumor suppressor gene p16/INK4A/CDKN2A-dependent regulation into and out of the cell cycle in a spontaneous canine model of breast cancer.

    Science.gov (United States)

    Agarwal, Payal; Sandey, Maninder; DeInnocentes, Patricia; Bird, R Curtis

    2013-06-01

    p16/INK4A/CDKN2A is an important tumor suppressor gene that arrests cell cycle in G1 phase inhibiting binding of CDK4/6 with cyclin D1, leaving the Rb tumor suppressor protein unphosphorylated and E2F bound and inactive. We hypothesized that p16 has a role in exit from cell cycle that becomes defective in cancer cells. Well characterized p16-defective canine mammary cancer cell lines (CMT28, CMT27, and CMT12), derived stably p16-transfected CMT cell clones (CMT27A, CMT27H, CMT28A, and CMT28F), and normal canine fibroblasts (NCF), were used to investigate expression of p16 after serum starvation into quiescence followed by re-feeding to induce cell cycle re-entry. The parental CMT cell lines used lack p16 expression either at the mRNA or protein expression levels, while p27 and other p16-associated proteins, including CDK4, CDK6, cyclin D1, and Rb, were expressed. We have successfully demonstrated cell cycle arrest and relatively synchronous cell cycle re-entry in parental CMT12, CMT28 and NCF cells as well as p16 transfected CMT27A, CMT27H, CMT28A, and CMT28F cells and confirmed this by (3)H-thymidine incorporation and flow cytometric analysis of cell cycle phase distribution. p16-transfected CMT27A and CMT27H cells exited cell cycle post-serum-starvation in contrast to parental CMT27 cells. NCF, CMT27A, and CMT28F cells expressed upregulated levels of p27 and p16 mRNA, post-serum starvation, as cells exited cell cycle and entered quiescence. Because quiescence and differentiation are associated with increased levels of p27, our data demonstrating that p16 was upregulated along with p27 during quiescence, suggests a potential role for p16 in maintaining these non-proliferative states. Copyright © 2012 Wiley Periodicals, Inc.

  20. Examination of the phosphoenolpyruvate carboxykinase gene promoter in patients with noninsulin-dependent diabetes mellitus

    Energy Technology Data Exchange (ETDEWEB)

    Ludwig, D.S. [Beth Israel Hospital, Boston, MA (United States)]|[Children`s Hospital, Boston, MA (United States); Vidal-Puig, A.; Moller, D.E. [Beth Israel Hospital, Boston, MA (United States)] [and others

    1996-02-01

    Expression of phosphoenolpyruvate carboxykinase (PEPCK), a rate-limiting enzyme in gluconeogenesis, is under dominant negative regulation by insulin. In this study, we sought to test the hypothesis that mutations in the PEPCK gene promoter may impair the ability of insulin to suppress hepatic glucose production, thereby contributing to both the insulin resistance and increased rate of gluconeogenesis characteristic of NIDDM. The proximal PEPCK promoter region in 117 patients with noninsulin-dependent diabetes mellitus and 20 obese Pima Indians was amplified by PCR and analyzed with single strand conformation of polymorphism techniques. In addition, limited direct DNA sequencing was performed on the insulin response sequence and flanking regions. No DNA sequence polymorphisms were found in any patient. This result suggests that mutations in cis-acting PEPCK gene regulatory elements do not constitute a common cause of noninsulin-dependent diabetes mellitus. The significance of genetic variation in promoter regions to human disease is discussed. 40 refs., 1 figs., 1 tab.

  1. Thyroid hormone signalling genes are regulated by photoperiod in the hypothalamus of F344 rats.

    Directory of Open Access Journals (Sweden)

    Alexander W Ross

    Full Text Available Seasonal animals adapt their physiology and behaviour in anticipation of climate change to optimise survival of their offspring. Intra-hypothalamic thyroid hormone signalling plays an important role in seasonal responses in mammals and birds. In the F344 rat, photoperiod stimulates profound changes in food intake, body weight and reproductive status. Previous investigations of the F344 rat have suggested a role for thyroid hormone metabolism, but have only considered Dio2 expression, which was elevated in long day photoperiods. Microarray analysis was used to identify time-dependent changes in photoperiod responsive genes, which may underlie the photoperiod-dependent phenotypes of the juvenile F344 rat. The most significant changes are those related to thyroid hormone metabolism and transport. Using photoperiod manipulations and melatonin injections into long day photoperiod (LD rats to mimic short day (SD, we show photoinduction and photosuppression gene expression profiles and melatonin responsiveness of genes by in situ hybridization; TSHβ, CGA, Dio2 and Oatp1c1 genes were all elevated in LD whilst in SD, Dio3 and MCT-8 mRNA were increased. NPY was elevated in SD whilst GALP increased in LD. The photoinduction and photosuppression profiles for GALP were compared to that of GHRH with GALP expression following GHRH temporally. We also reveal gene sets involved in photoperiodic responses, including retinoic acid and Wnt/ß-catenin signalling. This study extends our knowledge of hypothalamic regulation by photoperiod, by revealing large temporal changes in expression of thyroid hormone signalling genes following photoperiod switch. Surprisingly, large changes in hypothalamic thyroid hormone levels or TRH expression were not detected. Expression of NPY and GALP, two genes known to regulate GHRH, were also changed by photoperiod. Whether these genes could provide links between thyroid hormone signalling and the regulation of the growth axis

  2. Functional Enhancers As Master Regulators of Tissue-Specific Gene Regulation and Cancer Development

    Science.gov (United States)

    Ko, Je Yeong; Oh, Sumin; Yoo, Kyung Hyun

    2017-01-01

    Tissue-specific transcription is critical for normal development, and abnormalities causing undesirable gene expression may lead to diseases such as cancer. Such highly organized transcription is controlled by enhancers with specific DNA sequences recognized by transcription factors. Enhancers are associated with chromatin modifications that are distinct epigenetic features in a tissue-specific manner. Recently, super-enhancers comprising enhancer clusters co-occupied by lineage-specific factors have been identified in diverse cell types such as adipocytes, hair follicle stem cells, and mammary epithelial cells. In addition, noncoding RNAs, named eRNAs, are synthesized at super-enhancer regions before their target genes are transcribed. Many functional studies revealed that super-enhancers and eRNAs are essential for the regulation of tissue-specific gene expression. In this review, we summarize recent findings concerning enhancer function in tissue-specific gene regulation and cancer development. PMID:28359147

  3. Signal Transduction Pathways that Regulate CAB Gene Expression

    Energy Technology Data Exchange (ETDEWEB)

    Chory, Joanne

    2004-12-31

    The process of chloroplast differentiation, involves the coordinate regulation of many nuclear and chloroplast genes. The cues for the initiation of this developmental program are both extrinsic (e.g., light) and intrinsic (cell-type and plastid signals). During this project period, we utilized a molecular genetic approach to select for Arabidopsis mutants that did not respond properly to environmental light conditions, as well as mutants that were unable to perceive plastid damage. These latter mutants, called gun mutants, define two retrograde signaling pathways that regulate nuclear gene expression in response to chloroplasts. A major finding was to identify a signal from chloroplasts that regulates nuclear gene transcription. This signal is the build-up of Mg-Protoporphyrin IX, a key intermediate of the chlorophyll biosynthetic pathway. The signaling pathways downstream of this signal are currently being studied. Completion of this project has provided an increased understanding of the input signals and retrograde signaling pathways that control nuclear gene expression in response to the functional state of chloroplasts. These studies should ultimately influence our abilities to manipulate plant growth and development, and will aid in the understanding of the developmental control of photosynthesis.

  4. Signal Transduction Pathways that Regulate CAB Gene Expression

    Energy Technology Data Exchange (ETDEWEB)

    Chory, Joanne

    2006-01-16

    The process of chloroplast differentiation, involves the coordinate regulation of many nuclear and chloroplast genes. The cues for the initiation of this developmental program are both extrinsic (e.g., light) and intrinsic (cell-type and plastid signals). During this project period, we utilized a molecular genetic approach to select for Arabidopsis mutants that did not respond properly to environmental light conditions, as well as mutants that were unable to perceive plastid damage. These latter mutants, called gun mutants, define two retrograde signaling pathways that regulate nuclear gene expression in response to chloroplasts. A major finding was to identify a signal from chloroplasts that regulates nuclear gene transcription. This signal is the build-up of Mg-Protoporphyrin IX, a key intermediate of the chlorophyll biosynthetic pathway. The signaling pathways downstream of this signal are currently being studied. Completion of this project has provided an increased understanding of the input signals and retrograde signaling pathways that control nuclear gene expression in response to the functional state of chloroplasts. These studies should ultimately influence our abilities to manipulate plant growth and development, and will aid in the understanding of the developmental control of photosynthesis.

  5. Gene Regulation System of Vasopressin and Corticotoropin-Releasing Hormone

    Directory of Open Access Journals (Sweden)

    Masanori Yoshida

    2008-01-01

    Full Text Available The neurohypophyseal hormones, arginine vasopressin and corticotropin-releasing hormone (CRH, play a crucial role in the physiological and behavioral response to various kinds of stresses. Both neuropeptides activate the hypophysialpituitary-adrenal (HPA axis, which is a central mediator of the stress response in the body. Conversely, they receive the negative regulation by glucocorticoid, which is an end product of the HPA axis. Vasopressin and CRH are closely linked to immune response; they also interact with pro-inflammatory cytokines. Moreover, as for vasopressin, it has another important role, which is the regulation of water balance through its potent antidiuretic effect. Hence, it is conceivable that vasopressin and CRH mediate the homeostatic responses for survival and protect organisms from the external world. A tight and elaborate regulation system of the vasopressin and CRH gene is required for the rapid and flexible response to the alteration of the surrounding environments. Several important regulatory elements have been identified in the proximal promoter region in the vasopressin and CRH gene. Many transcription factors and intracellular signaling cascades are involved in the complicated gene regulation system. This review focuses on the current status of the basic research of vasopressin and CRH. In addition to the numerous known facts about their divergent physiological roles, the recent topics of promoter analyses will be discussed.

  6. Brucella abortus: pathogenicity and gene regulation of virulence

    Directory of Open Access Journals (Sweden)

    Olga Rivas-Solano

    2015-06-01

    Full Text Available Brucella abortus is a zoonotic intracellular facultative pathogen belonging to the subdivision α2 of class Proteobacteria. It causes a worldwide distributed zoonotic disease called brucellosis. The main symptoms are abortion and sterility in cattle, as well as an undulant febrile condition in humans. In endemic regions like Central America, brucellosis has a high socioeconomic impact. A basic research project was recently conducted at the ITCR with the purpose of studying gene regulation of virulence, structure and immunogenicity in B. abortus. The present review was written as part of this project. B. abortus virulence seems to be determined by its ability to invade, survive and replicate inside professional and non-professional phagocytes. It reaches its intracellular replicative niche without the activation of host antimicrobial mechanisms of innate immunity. It also has gene regulation mechanisms for a rapid adaptation to an intracellular environment such as the two-component signal transduction system BvrR/BvrS and the quorum sensing regulator called Vjbr, as well as other transcription factors. All of them integrate a complex gene regulation network.

  7. Epigenetic Modification of the Repair Donor Regulates Targeted Gene Correction

    Directory of Open Access Journals (Sweden)

    Olivier Humbert

    2012-01-01

    Full Text Available Optimizing design of vectors is critical to effective gene therapy. In targeted gene correction (TGC, cleavage of chromosomal DNA near a mutation stimulates homology-directed repair of a target gene using a donor provided in trans. We have systematically addressed epigenetic parameters of donor design, using a flow-based assay to quantify correction frequencies and expression levels of a green fluorescent protein (GFP reporter gene in a human cell line. We show that active transcription of the donor increased correction frequency by threefold, establishing that a proximal promoter enhances donor use. Conversely, CpG methylation of the donor diminished correction frequency and reduced expression of the repaired gene. However, bisulfite sequencing of the target revealed no transfer of methylation marks during repair with a methylated donor. Treatment with histone deacetylase (HDAC inhibitors can partially compensate for epigenetic inactivation, suggesting a role for class I and II HDACs in regulation of donor use. These results establish that epigenetic status of a trans-donor determines both the efficiency and outcome of gene correction, and identify and clarify parameters that should guide donor design for targeted gene therapy.

  8. Carbon Catabolite Repression Regulates Glyoxylate Cycle Gene Expression in Cucumber.

    Science.gov (United States)

    Graham, I. A.; Denby, K. J.; Leaver, C. J.

    1994-01-01

    We have previously proposed that metabolic status is important in the regulation of cucumber malate synthase (MS) and isocitrate lyase (ICL) gene expression during plant development. In this article, we used a cell culture system to demonstrate that intracellular metabolic status does influence expression of both of these genes. Starvation of cucumber cell cultures resulted in the coordinate induction of the expression of MS and ICL genes, and this effect was reversed when sucrose was returned to the culture media. The induction of gene expression was closely correlated with a drop in intracellular sucrose, glucose, and fructose below threshold concentrations, but it was not correlated with a decrease in respiration rate. Glucose, fructose, or raffinose in the culture media also resulted in repression of MS and ICL. Both 2-deoxyglucose and mannose, which are phosphorylated by hexokinase but not further metabolized, specifically repressed MS and ICL gene expression relative to a third glyoxylate cycle gene, malate dehydrogenase. However, the addition of 3-methylglucose, an analog of glucose that is not phosphorylated, did not result in repression of either MS or ICL. It is proposed that the signal giving rise to a change in gene expression originates from the intracellular concentration of hexose sugars or the flux of hexose sugars into glycolysis. PMID:12244257

  9. Proposed Regulation of Gene Expression by Glucose in Rodent Heart

    Directory of Open Access Journals (Sweden)

    Martin E. Young

    2007-01-01

    Full Text Available Background: During pressure overload-induced hypertrophy, unloading-induced atrophy, and diabetes mellitus, the heart induces ‘fetal’ genes (e.g. myosin heavy chain β; mhcβ.Hypothesis: We propose that altered glucose homeostasis within the cardiomyocyte acts as a central mechanism for the regulation of gene expression in response to environmental stresses. The evidence is as follows. Methods and Results: Forced glucose uptake both ex vivo and in vivo results in mhc isoform switching. Restricting dietary glucose prevents mhc isoform switching in hearts of both GLUT1-Tg mice and rats subjected to pressure overload-induced hypertrophy. Thus, glucose availability correlates with mhc isoform switching under all conditions investigated. A potential mechanism by which glucose affects gene expression is through O-linked glycosylation of specific transcription factors. Glutamine:fructose-6-phosphate amidotransferase (GFAT catalyzes the flux generating step in UDP-N-acetylglucosamine biosynthesis, the rate determining metabolite in protein glycosylation. Ascending aortic constriction increased intracellular levels of UDP-N-acetylglucosamine, and the expression of gfat2, but not gfat1, in the rat heart.Conclusions: Collectively, the results strongly suggest glucose-regulated gene expression in the heart, and the involvement of glucose metabolites in isoform switching of sarcomeric proteins characteristic for the fetal gene program.

  10. Mapping condition-dependent regulation of lipid metabolism in Saccharomyces cerevisiae.

    Science.gov (United States)

    Jewett, Michael C; Workman, Christopher T; Nookaew, Intawat; Pizarro, Francisco A; Agosin, Eduardo; Hellgren, Lars I; Nielsen, Jens

    2013-11-06

    Lipids play a central role in cellular function as constituents of membranes, as signaling molecules, and as storage materials. Although much is known about the role of lipids in regulating specific steps of metabolism, comprehensive studies integrating genome-wide expression data, metabolite levels, and lipid levels are currently lacking. Here, we map condition-dependent regulation controlling lipid metabolism in Saccharomyces cerevisiae by measuring 5636 mRNAs, 50 metabolites, 97 lipids, and 57 (13)C-reaction fluxes in yeast using a three-factor full-factorial design. Correlation analysis across eight environmental conditions revealed 2279 gene expression level-metabolite/lipid relationships that characterize the extent of transcriptional regulation in lipid metabolism relative to major metabolic hubs within the cell. To query this network, we developed integrative methods for correlation of multi-omics datasets that elucidate global regulatory signatures. Our data highlight many characterized regulators of lipid metabolism and reveal that sterols are regulated more at the transcriptional level than are amino acids. Beyond providing insights into the systems-level organization of lipid metabolism, we anticipate that our dataset and approach can join an emerging number of studies to be widely used for interrogating cellular systems through the combination of mathematical modeling and experimental biology.

  11. Gene expression regulation in photomorphogenesis from the perspective of the central dogma.

    Science.gov (United States)

    Wu, Shu-Hsing

    2014-01-01

    Depending on the environment a young seedling encounters, the developmental program following seed germination could be skotomorphogenesis in the dark or photomorphogenesis in the light. Light signals are interpreted by a repertoire of photoreceptors followed by sophisticated gene expression networks, eventually resulting in developmental changes. The expression and functions of photoreceptors and key signaling molecules are highly coordinated and regulated at multiple levels of the central dogma in molecular biology. Light activates gene expression through the actions of positive transcriptional regulators and the relaxation of chromatin by histone acetylation. Small regulatory RNAs help attenuate the expression of light-responsive genes. Alternative splicing, protein phosphorylation/dephosphorylation, the formation of diverse transcriptional complexes, and selective protein degradation all contribute to proteome diversity and change the functions of individual proteins.

  12. RNAi-Based Identification of Gene-Specific Nuclear Cofactor Networks Regulating Interleukin-1 Target Genes

    Directory of Open Access Journals (Sweden)

    Johanna Meier-Soelch

    2018-04-01

    Full Text Available The potent proinflammatory cytokine interleukin (IL-1 triggers gene expression through the NF-κB signaling pathway. Here, we investigated the cofactor requirements of strongly regulated IL-1 target genes whose expression is impaired in p65 NF-κB-deficient murine embryonic fibroblasts. By two independent small-hairpin (shRNA screens, we examined 170 genes annotated to encode nuclear cofactors for their role in Cxcl2 mRNA expression and identified 22 factors that modulated basal or IL-1-inducible Cxcl2 levels. The functions of 16 of these factors were validated for Cxcl2 and further analyzed for their role in regulation of 10 additional IL-1 target genes by RT-qPCR. These data reveal that each inducible gene has its own (quantitative requirement of cofactors to maintain basal levels and to respond to IL-1. Twelve factors (Epc1, H2afz, Kdm2b, Kdm6a, Mbd3, Mta2, Phf21a, Ruvbl1, Sin3b, Suv420h1, Taf1, and Ube3a have not been previously implicated in inflammatory cytokine functions. Bioinformatics analysis indicates that they are components of complex nuclear protein networks that regulate chromatin functions and gene transcription. Collectively, these data suggest that downstream from the essential NF-κB signal each cytokine-inducible target gene has further subtle requirements for individual sets of nuclear cofactors that shape its transcriptional activation profile.

  13. AT(1) receptor Gαq protein-independent signalling transcriptionally activates only a few genes directly, but robustly potentiates gene regulation from the β2-adrenergic receptor

    DEFF Research Database (Denmark)

    Christensen, Gitte Lund; Knudsen, Steen; Schneider, Mikael

    2011-01-01

    signalling from the AT(1)R interact with transcriptional regulators and promote phosphorylation of nuclear proteins. However, the relative contribution of Gαq protein-independent signalling in AT(1)R mediated transcriptional regulation remains elusive. We here present a comprehensive comparative analysis...... of Gαq protein-dependent and -independent regulation of AT(1)R mediated gene expression. We found angiotensin II to regulate 212 genes, whereas Gαq-independent signalling obtained with the biased agonist, SII angiotensin II only regulated few genes. Interestingly, SII angiotensin II, like Ang II vastly......The angiotensin II type 1 receptor (AT(1)R) is known to signal through heterotrimeric G proteins, and Gαq protein-independent signalling has only recently gained appreciation for profound impact on a diverse range of biological functions. β-Arrestins, among other central mediators of Gαq protein-independent...

  14. The transcription factor ABI4 Is required for the ascorbic acid-dependent regulation of growth and regulation of jasmonate-dependent defense signaling pathways in Arabidopsis.

    Science.gov (United States)

    Kerchev, Pavel I; Pellny, Till K; Vivancos, Pedro Diaz; Kiddle, Guy; Hedden, Peter; Driscoll, Simon; Vanacker, Hélène; Verrier, Paul; Hancock, Robert D; Foyer, Christine H

    2011-09-01

    Cellular redox homeostasis is a hub for signal integration. Interactions between redox metabolism and the ABSCISIC ACID-INSENSITIVE-4 (ABI4) transcription factor were characterized in the Arabidopsis thaliana vitamin c defective1 (vtc1) and vtc2 mutants, which are defective in ascorbic acid synthesis and show a slow growth phenotype together with enhanced abscisic acid (ABA) levels relative to the wild type (Columbia-0). The 75% decrease in the leaf ascorbate pool in the vtc2 mutants was not sufficient to adversely affect GA metabolism. The transcriptome signatures of the abi4, vtc1, and vtc2 mutants showed significant overlap, with a large number of transcription factors or signaling components similarly repressed or induced. Moreover, lincomycin-dependent changes in LIGHT HARVESTING CHLOROPHYLL A/B BINDING PROTEIN 1.1 expression were comparable in these mutants, suggesting overlapping participation in chloroplast to nucleus signaling. The slow growth phenotype of vtc2 was absent in the abi4 vtc2 double mutant, as was the sugar-insensitive phenotype of the abi4 mutant. Octadecanoid derivative-responsive AP2/ERF-domain transcription factor 47 (ORA47) and AP3 (an ABI5 binding factor) transcripts were enhanced in vtc2 but repressed in abi4 vtc2, suggesting that ABI4 and ascorbate modulate growth and defense gene expression through jasmonate signaling. We conclude that low ascorbate triggers ABA- and jasmonate-dependent signaling pathways that together regulate growth through ABI4. Moreover, cellular redox homeostasis exerts a strong influence on sugar-dependent growth regulation.

  15. Drosha regulates gene expression independently of RNA cleavage function

    DEFF Research Database (Denmark)

    Gromak, Natalia; Dienstbier, Martin; Macias, Sara

    2013-01-01

    Drosha is the main RNase III-like enzyme involved in the process of microRNA (miRNA) biogenesis in the nucleus. Using whole-genome ChIP-on-chip analysis, we demonstrate that, in addition to miRNA sequences, Drosha specifically binds promoter-proximal regions of many human genes in a transcription......-terminal protein-interaction domain, which associates with the RNA-binding protein CBP80 and RNA Polymerase II. Consequently, we uncover a previously unsuspected RNA cleavage-independent function of Drosha in the regulation of human gene expression....

  16. Fanconi anemia core complex-dependent HES1 mono-ubiquitination regulates its transcriptional activity.

    Science.gov (United States)

    Tremblay, Cédric S; Huang, Feng Fei; Lévesque, Georges; Carreau, Madeleine

    2018-02-20

    The Hairy Enhancer of Split 1 (HES1) is a transcriptional repressor that regulates cellular proliferation and differentiation during development. We previously found an interaction between HES1 and Fanconi anemia (FA) proteins. FA is a hematological and developmental disorder caused by mutations in more than 20 different genes. Eight FA gene products form a nuclear core complex containing E3 ligase activity required for mono-ubiquitination of FANCD2 and FANCI, both of which are FA proteins. Given that HES1 interacts with members of the FA core complex, the aim of this study was to determine whether HES1 is mono-ubiquitinated via the FA core complex. We show that HES1 is mono-ubiquitinated on a highly-conserved lysine residue that is located within a FA-like recognition motif. HES1 modification is dependent on a functional FA complex. Absence of HES1 mono-ubiquitination affects transcriptional repression of its own promoter. This study uncovers a novel post-translational modification of HES1 that regulates its transcriptional activity and suggests that ubiquitination of HES1 occurs in a FA core complex-dependent manner.

  17. Identification of a Hydrophobin Gene That is Developmentally Regulated in the Ectomycorrhizal Fungus Tricholoma terreum

    OpenAIRE

    Mankel, Angela; Krause, Katrin; Kothe, Erika

    2002-01-01

    The symbiosis between ectomycorrhizal fungi and trees is an essential part of forest ecology and depends entirely on the communication between the two partners for establishing and maintaining the relationship. The identification and characterization of differentially expressed genes is a step to identifying such signals and to understanding the regulation of this process. We determined the role of hydrophobins produced by Tricholoma terreum in mycorrhiza formation and hyphal development. A h...

  18. Genome-wide screening of Saccharomyces cerevisiae genes regulated by vanillin.

    Science.gov (United States)

    Park, Eun-Hee; Kim, Myoung-Dong

    2015-01-01

    During pretreatment of lignocellulosic biomass, a variety of fermentation inhibitors, including acetic acid and vanillin, are released. Using DNA microarray analysis, this study explored genes of the budding yeast Saccharomyces cerevisiae that respond to vanillin-induced stress. The expression of 273 genes was upregulated and that of 205 genes was downregulated under vanillin stress. Significantly induced genes included MCH2, SNG1, GPH1, and TMA10, whereas NOP2, UTP18, FUR1, and SPR1 were down regulated. Sequence analysis of the 5'-flanking region of upregulated genes suggested that vanillin might regulate gene expression in a stress response element (STRE)-dependent manner, in addition to a pathway that involved the transcription factor Yap1p. Retardation in the cell growth of mutant strains indicated that MCH2, SNG1, and GPH1 are intimately involved in vanillin stress response. Deletion of the genes whose expression levels were decreased under vanillin stress did not result in a notable change in S. cerevisiae growth under vanillin stress. This study will provide the basis for a better understanding of the stress response of the yeast S. cerevisiae to fermentation inhibitors.

  19. [Factor analysis of interactions between alfalfa nodule bacteria (Sinorhizobium meliloti) genes that regulate symbiotic nitrogen fixation].

    Science.gov (United States)

    Provorov, N A; Chuklina, E; Vorob'ev, N I; Onishchuk, O P; Simarov, B V

    2013-04-01

    Factor analysis has been conducted for the data on the interaction between the genes of the root nodule bacteria (rhizobia), which influence the efficiency of symbiosis with leguminous plants, including dctA (encoding succinate permease), dctBD (activating the dctA gene due to binding its enhancer in the presence of succinate), rpoN (activating the promoters of dctA and nitrogenase genes nifHDK), and nifA (activating the nitrogenase genes due to binding their enhancers). The analysis of the alfalfa rhizobia (Sinorhizobium meliloti) recombinants that contain additional copies ofthese genes suggested the antagonistic (epistatic) interaction between nifA and rpoN. It may be associated either with the competition for C compounds imported into the nodules between the energy production and nitrogen assimilation processes or with the competition for redox potentials between the oxidative phosphorylation and nitrogen fixation processes. Since the phenotypic effects of the studied genes depend on the activity of nitrogen export into the aerial parts of plants, we suppose that its accumulation in bacteroids impairs the activation of the nifHDK genes by the NifA protein due to its interaction with the GlnB protein (the nitrogen metabolism regulator) or with the FixLJ and ActSR proteins (the redox potential regulators).

  20. C/EBPβ Mediates Growth Hormone-Regulated Expression of Multiple Target Genes

    Science.gov (United States)

    Cui, Tracy X.; Lin, Grace; LaPensee, Christopher R.; Calinescu, Anda-Alexandra; Rathore, Maanjot; Streeter, Cale; Piwien-Pilipuk, Graciela; Lanning, Nathan; Jin, Hui; Carter-Su, Christin; Qin, Zhaohui S.

    2011-01-01

    Regulation of c-Fos transcription by GH is mediated by CCAAT/enhancer binding protein β (C/EBPβ). This study examines the role of C/EBPβ in mediating GH activation of other early response genes, including Cyr61, Btg2, Socs3, Zfp36, and Socs1. C/EBPβ depletion using short hairpin RNA impaired responsiveness of these genes to GH, as seen for c-Fos. Rescue with wild-type C/EBPβ led to GH-dependent recruitment of the coactivator p300 to the c-Fos promoter. In contrast, rescue with C/EBPβ mutated at the ERK phosphorylation site at T188 failed to induce GH-dependent recruitment of p300, indicating that ERK-mediated phosphorylation of C/EBPβ at T188 is required for GH-induced recruitment of p300 to c-Fos. GH also induced the occupancy of phosphorylated C/EBPβ and p300 on Cyr61, Btg2, and Socs3 at predicted C/EBP-cAMP response element-binding protein motifs in their promoters. Consistent with a role for ERKs in GH-induced expression of these genes, treatment with U0126 to block ERK phosphorylation inhibited their GH-induced expression. In contrast, GH-dependent expression of Zfp36 and Socs1 was not inhibited by U0126. Thus, induction of multiple early response genes by GH in 3T3-F442A cells is mediated by C/EBPβ. A subset of these genes is regulated similarly to c-Fos, through a mechanism involving GH-stimulated ERK 1/2 activation, phosphorylation of C/EBPβ, and recruitment of p300. Overall, these studies suggest that C/EBPβ, like the signal transducer and activator of transcription proteins, regulates multiple genes in response to GH. PMID:21292824

  1. IKKε modulates RSV-induced NF-κB-dependent gene transcription

    International Nuclear Information System (INIS)

    Bao Xiaoyong; Indukuri, Hemalatha; Liu Tianshuang; Liao Suiling; Tian, Bing; Brasier, Allan R.; Garofalo, Roberto P.; Casola, Antonella

    2010-01-01

    Respiratory syncytial virus (RSV), a negative-strand RNA virus, is the most common cause of epidemic respiratory disease in infants and young children. RSV infection of airway epithelial cells induces the expression of immune/inflammatory genes through the activation of a subset of transcription factors, including Nuclear Factor-κB (NF-κB). In this study we have investigated the role of the non canonical IκB kinase (IKK)ε in modulating RSV-induced NF-κB activation. Our results show that inhibition of IKKε activation results in significant impairment of viral-induced NF-κB-dependent gene expression, through a reduction in NF-κB transcriptional activity, without changes in nuclear translocation or DNA-binding activity. Absence of IKKε results in a significant decrease of RSV-induced NF-κB phosphorylation on serine 536, a post-translational modification important for RSV-induced NF-κB-dependent gene expression, known to regulate NF-κB transcriptional activity without affecting nuclear translocation. This study identifies a novel mechanism by which IKKε regulates viral-induced cellular signaling.

  2. HDAC-4 regulates claudin-2 expression in EGFR-ERK1/2 dependent manner to regulate colonic epithelial cell differentiation.

    Science.gov (United States)

    Ahmad, Rizwan; Kumar, Balawant; Pan, Kaichao; Dhawan, Punita; Singh, Amar B

    2017-10-20

    In normal colon, claudin-2 expression is restricted to the crypt bottom containing the undifferentiated and proliferative colonocytes. Claudin-2 expression is also upregulated in colorectal cancer (CRC) and promotes carcinogenesis. However, cellular mechanism/s regulated by increased claudin-2 expression during the CRC and mechanism/s regulating this increase remain poorly understood. Epigenetic mechanisms help regulate expression of cancer-associated genes and inhibition of Histone Deacetylases (HDACs) induces cell cycle arrest and differentiation. Accordingly, based on a comprehensive in vitro and in vivo analysis we here report that Histone Deacetylases regulate claudin-2 expression in causal association with colonocyte dedifferentiation to promote CRC. Detailed differentiation analyses using colon cancer cells demonstrated inverse association between claudin-2 expression and epithelial differentiation. Genetic manipulation studies revealed the causal role of HDAC-4 in regulating claudin-2 expression during this process. Further analysis identified transcriptional regulation as the underlying mechanism, which was dependent on HDAC-4 dependent modulation of the EGFR-ERK1/2 signaling. Accordingly, colon tumors demonstrated marked upregulation of the HDAC-4/ERK1/2/Claudin-2 signaling. Taken together, we demonstrate a novel role for HDAC-4/EGFR/ERK1/2 signaling in regulating claudin-2 expression to modulate colonocyte differentiation. These findings are of clinical significance and highlight epigenetic regulation as potential mechanism to regulate claudin-2 expression during mucosal pathologies including CRC.

  3. FAD-dependent lysine-specific demethylase-1 regulates cellular energy expenditure.

    Science.gov (United States)

    Hino, Shinjiro; Sakamoto, Akihisa; Nagaoka, Katsuya; Anan, Kotaro; Wang, Yuqing; Mimasu, Shinya; Umehara, Takashi; Yokoyama, Shigeyuki; Kosai, Ken-Ichiro; Nakao, Mitsuyoshi

    2012-03-27

    Environmental factors such as nutritional state may act on the epigenome that consequently contributes to the metabolic adaptation of cells and the organisms. The lysine-specific demethylase-1 (LSD1) is a unique nuclear protein that utilizes flavin adenosine dinucleotide (FAD) as a cofactor. Here we show that LSD1 epigenetically regulates energy-expenditure genes in adipocytes depending on the cellular FAD availability. We find that the loss of LSD1 function, either by short interfering RNA or by selective inhibitors in adipocytes, induces a number of regulators of energy expenditure and mitochondrial metabolism such as PPARγ coactivator-1α resulting in the activation of mitochondrial respiration. In the adipose tissues from mice on a high-fat diet, expression of LSD1-target genes is reduced, compared with that in tissues from mice on a normal diet, which can be reverted by suppressing LSD1 function. Our data suggest a novel mechanism where LSD1 regulates cellular energy balance through coupling with cellular FAD biosynthesis.

  4. Evolution of stress-regulated gene expression in duplicate genes of Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Cheng Zou

    2009-07-01

    Full Text Available Due to the selection pressure imposed by highly variable environmental conditions, stress sensing and regulatory response mechanisms in plants are expected to evolve rapidly. One potential source of innovation in plant stress response mechanisms is gene duplication. In this study, we examined the evolution of stress-regulated gene expression among duplicated genes in the model plant Arabidopsis thaliana. Key to this analysis was reconstructing the putative ancestral stress regulation pattern. By comparing the expression patterns of duplicated genes with the patterns of their ancestors, duplicated genes likely lost and gained stress responses at a rapid rate initially, but the rate is close to zero when the synonymous substitution rate (a proxy for time is > approximately 0.8. When considering duplicated gene pairs, we found that partitioning of putative ancestral stress responses occurred more frequently compared to cases of parallel retention and loss. Furthermore, the pattern of stress response partitioning was extremely asymmetric. An analysis of putative cis-acting DNA regulatory elements in the promoters of the duplicated stress-regulated genes indicated that the asymmetric partitioning of ancestral stress responses are likely due, at least in part, to differential loss of DNA regulatory elements; the duplicated genes losing most of their stress responses were those that had lost more of the putative cis-acting elements. Finally, duplicate genes that lost most or all of the ancestral responses are more likely to have gained responses to other stresses. Therefore, the retention of duplicates that inherit few or no functions seems to be coupled to neofunctionalization. Taken together, our findings provide new insight into the patterns of evolutionary changes in gene stress responses after duplication and lay the foundation for testing the adaptive significance of stress regulatory changes under highly variable biotic and abiotic environments.

  5. Physiological roles of Regulated Ire1 Dependent Decay

    Directory of Open Access Journals (Sweden)

    Dina S. Coelho

    2014-04-01

    Full Text Available Ire1 is an important transducer of the Unfolded Protein Response (UPR that is activated by the accumulation of misfolded proteins in the Endoplamic Reticulum (ER stress. Activated Ire1 mediates the splicing of an intron from the mRNA of Xbp1, causing a frame-shift during translation and introducing a new carboxyl domain in the Xbp1 protein, which only then becomes a fully functional transcription factor. Studies using cell culture systems demonstrated that Ire1 also promotes the degradation of mRNAs encoding mostly ER-targeted proteins, to reduce the load of incoming ER client proteins during ER stress. This process was called RIDD (regulated Ire1-dependent decay, but its physiological significance remained poorly characterized beyond cell culture systems. Here we review several recent studies that have highlighted the physiological roles of RIDD in specific biological paradigms, such as photoreceptor differentiation in Drosophila or mammalian liver and endocrine pancreas function. These studies demonstrate the importance of RIDD in tissues undergoing intense secretory function and highlight the physiologic role of RIDD during UPR activation in cells and organisms.

  6. Using riboswitches to regulate gene expression and define gene function in mycobacteria.

    Science.gov (United States)

    Van Vlack, Erik R; Seeliger, Jessica C

    2015-01-01

    Mycobacteria include both environmental species and many pathogenic species such as Mycobacterium tuberculosis, an intracellular pathogen that is the causative agent of tuberculosis in humans. Inducible gene expression is a powerful tool for examining gene function and essentiality, both in in vitro culture and in host cell infections. The theophylline-inducible artificial riboswitch has recently emerged as an alternative to protein repressor-based systems. The riboswitch is translationally regulated and is combined with a mycobacterial promoter that provides transcriptional control. We here provide methods used by our laboratory to characterize the riboswitch response to theophylline in reporter strains, recombinant organisms containing riboswitch-regulated endogenous genes, and in host cell infections. These protocols should facilitate the application of both existing and novel artificial riboswitches to the exploration of gene function in mycobacteria. © 2015 Elsevier Inc. All rights reserved.

  7. Gene regulation in the immune system by long noncoding RNAs.

    Science.gov (United States)

    Chen, Y Grace; Satpathy, Ansuman T; Chang, Howard Y

    2017-08-22

    Long noncoding RNAs (lncRNAs) are emerging as critical regulators of gene expression in the immune system. Studies have shown that lncRNAs are expressed in a highly lineage-specific manner and control the differentiation and function of innate and adaptive cell types. In this Review, we focus on mechanisms used by lncRNAs to regulate genes encoding products involved in the immune response, including direct interactions with chromatin, RNA and proteins. In addition, we address new areas of lncRNA biology, such as the functions of enhancer RNAs, circular RNAs and chemical modifications to RNA in cellular processes. We emphasize critical gaps in knowledge and future prospects for the roles of lncRNAs in the immune system and autoimmune disease.

  8. The CHR promoter element controls cell cycle-dependent gene transcription and binds the DREAM and MMB complexes.

    Science.gov (United States)

    Müller, Gerd A; Quaas, Marianne; Schümann, Michael; Krause, Eberhard; Padi, Megha; Fischer, Martin; Litovchick, Larisa; DeCaprio, James A; Engeland, Kurt

    2012-02-01

    Cell cycle-dependent gene expression is often controlled on the transcriptional level. Genes like cyclin B, CDC2 and CDC25C are regulated by cell cycle-dependent element (CDE) and cell cycle genes homology region (CHR) promoter elements mainly through repression in G(0)/G(1). It had been suggested that E2F4 binding to CDE sites is central to transcriptional regulation. However, some promoters are only controlled by a CHR. We identify the DREAM complex binding to the CHR of mouse and human cyclin B2 promoters in G(0). Association of DREAM and cell cycle-dependent regulation is abrogated when the CHR is mutated. Although E2f4 is part of the complex, a CDE is not essential but can enhance binding of DREAM. We show that the CHR element is not only necessary for repression of gene transcription in G(0)/G(1), but also for activation in S, G(2) and M phases. In proliferating cells, the B-myb-containing MMB complex binds the CHR of both promoters independently of the CDE. Bioinformatic analyses identify many genes which contain conserved CHR elements in promoters binding the DREAM complex. With Ube2c as an example from that screen, we show that inverse CHR sites are functional promoter elements that can bind DREAM and MMB. Our findings indicate that the CHR is central to DREAM/MMB-dependent transcriptional control during the cell cycle.

  9. Regulation of clock-controlled genes in mammals.

    Directory of Open Access Journals (Sweden)

    Katarzyna Bozek

    Full Text Available The complexity of tissue- and day time-specific regulation of thousands of clock-controlled genes (CCGs suggests that many regulatory mechanisms contribute to the transcriptional output of the circadian clock. We aim to predict these mechanisms using a large scale promoter analysis of CCGs.Our study is based on a meta-analysis of DNA-array data from rodent tissues. We searched in the promoter regions of 2065 CCGs for highly overrepresented transcription factor binding sites. In order to compensate the relatively high GC-content of CCG promoters, a novel background model to avoid a bias towards GC-rich motifs was employed. We found that many of the transcription factors with overrepresented binding sites in CCG promoters exhibit themselves circadian rhythms. Among the predicted factors are known regulators such as CLOCKratioBMAL1, DBP, HLF, E4BP4, CREB, RORalpha and the recently described regulators HSF1, STAT3, SP1 and HNF-4alpha. As additional promising candidates of circadian transcriptional regulators PAX-4, C/EBP, EVI-1, IRF, E2F, AP-1, HIF-1 and NF-Y were identified. Moreover, GC-rich motifs (SP1, EGR, ZF5, AP-2, WT1, NRF-1 and AT-rich motifs (MEF-2, HMGIY, HNF-1, OCT-1 are significantly overrepresented in promoter regions of CCGs. Putative tissue-specific binding sites such as HNF-3 for liver, NKX2.5 for heart or Myogenin for skeletal muscle were found. The regulation of the erythropoietin (Epo gene was analysed, which exhibits many binding sites for circadian regulators. We provide experimental evidence for its circadian regulated expression in the adult murine kidney. Basing on a comprehensive literature search we integrate our predictions into a regulatory network of core clock and clock-controlled genes. Our large scale analysis of the CCG promoters reveals the complexity and extensiveness of the circadian regulation in mammals. Results of this study point to connections of the circadian clock to other functional systems including

  10. Statistical modelling of transcript profiles of differentially regulated genes

    Directory of Open Access Journals (Sweden)

    Sergeant Martin J

    2008-07-01

    Full Text Available Abstract Background The vast quantities of gene expression profiling data produced in microarray studies, and the more precise quantitative PCR, are often not statistically analysed to their full potential. Previous studies have summarised gene expression profiles using simple descriptive statistics, basic analysis of variance (ANOVA and the clustering of genes based on simple models fitted to their expression profiles over time. We report the novel application of statistical non-linear regression modelling techniques to describe the shapes of expression profiles for the fungus Agaricus bisporus, quantified by PCR, and for E. coli and Rattus norvegicus, using microarray technology. The use of parametric non-linear regression models provides a more precise description of expression profiles, reducing the "noise" of the raw data to produce a clear "signal" given by the fitted curve, and describing each profile with a small number of biologically interpretable parameters. This approach then allows the direct comparison and clustering of the shapes of response patterns between genes and potentially enables a greater exploration and interpretation of the biological processes driving gene expression. Results Quantitative reverse transcriptase PCR-derived time-course data of genes were modelled. "Split-line" or "broken-stick" regression identified the initial time of gene up-regulation, enabling the classification of genes into those with primary and secondary responses. Five-day profiles were modelled using the biologically-oriented, critical exponential curve, y(t = A + (B + CtRt + ε. This non-linear regression approach allowed the expression patterns for different genes to be compared in terms of curve shape, time of maximal transcript level and the decline and asymptotic response levels. Three distinct regulatory patterns were identified for the five genes studied. Applying the regression modelling approach to microarray-derived time course data

  11. Phenazines regulate Nap-dependent denitrification inPseudomonas aeruginosabiofilms.

    Science.gov (United States)

    Lin, Yu-Cheng; Sekedat, Matthew D; Cornell, William Cole; Silva, Gustavo M; Okegbe, Chinweike; Price-Whelan, Alexa; Vogel, Christine; Dietrich, Lars E P

    2018-02-20

    Microbes in biofilms face the challenge of substrate limitation. In particular, cells in Pseudomonas aeruginosa biofilms growing in the laboratory or during host colonization often become limited for oxygen. Previously we found that phenazines, antibiotics produced by P. aeruginosa , balance the intracellular redox state for cells in biofilms. Here, we show that genes involved in denitrification are induced in phenazine-null (Δ phz ) mutant biofilms grown under an aerobic atmosphere, even in the absence of nitrate. This finding suggests that resident cells employ a bet-hedging strategy to anticipate the potential availability of nitrate and counterbalance their highly reduced redox state. Consistent with our previous characterization of aerobically-grown colonies supplemented with nitrate, we find that the pathway that is induced in Δ phz colonies combines the nitrate reductase activity of the periplasmic enzyme Nap with downstream reduction of nitrite to nitrogen gas catalyzed by the enzymes Nir, Nor, and Nos. This regulatory relationship differs from the denitrification pathway that functions under anaerobic growth with nitrate as the terminal electron acceptor, which depends on the membrane-associated nitrate reductase Nar. We identify sequences in the promoter regions of the nap and nir operons that are required for the effects of phenazines on expression. We also show that specific phenazines have differential effects on nap gene expression. Finally, we provide evidence that individual steps of the denitrification pathway are catalyzed at different depths within aerobically grown biofilms, suggesting metabolic cross-feeding between community subpopulations. IMPORTANCE An understanding of the unique physiology of cells in biofilms is critical to our ability to treat fungal and bacterial infections. Colony biofilms of the opportunistic pathogen Pseudomonas aeruginosa , grown under an aerobic atmosphere but without nitrate, express a denitrification pathway

  12. Down-Regulation of Gene Expression by RNA-Induced Gene Silencing

    Science.gov (United States)

    Travella, Silvia; Keller, Beat

    Down-regulation of endogenous genes via post-transcriptional gene silencing (PTGS) is a key to the characterization of gene function in plants. Many RNA-based silencing mechanisms such as post-transcriptional gene silencing, co-suppression, quelling, and RNA interference (RNAi) have been discovered among species of different kingdoms (plants, fungi, and animals). One of the most interesting discoveries was RNAi, a sequence-specific gene-silencing mechanism initiated by the introduction of double-stranded RNA (dsRNA), homologous in sequence to the silenced gene, which triggers degradation of mRNA. Infection of plants with modified viruses can also induce RNA silencing and is referred to as virus-induced gene silencing (VIGS). In contrast to insertional mutagenesis, these emerging new reverse genetic approaches represent a powerful tool for exploring gene function and for manipulating gene expression experimentally in cereal species such as barley and wheat. We examined how RNAi and VIGS have been used to assess gene function in barley and wheat, including molecular mechanisms involved in the process and available methodological elements, such as vectors, inoculation procedures, and analysis of silenced phenotypes.

  13. Alternative RNA Structure-Coupled Gene Regulations in Tumorigenesis

    Directory of Open Access Journals (Sweden)

    Feng-Chi Chen

    2014-12-01

    Full Text Available Alternative RNA structures (ARSs, or alternative transcript isoforms, are critical for regulating cellular phenotypes in humans. In addition to generating functionally diverse protein isoforms from a single gene, ARS can alter the sequence contents of 5'/3' untranslated regions (UTRs and intronic regions, thus also affecting the regulatory effects of these regions. ARS may introduce premature stop codon(s into a transcript, and render the transcript susceptible to nonsense-mediated decay, which in turn can influence the overall gene expression level. Meanwhile, ARS can regulate the presence/absence of upstream open reading frames and microRNA targeting sites in 5'UTRs and 3'UTRs, respectively, thus affecting translational efficiencies and protein expression levels. Furthermore, since ARS may alter exon-intron structures, it can influence the biogenesis of intronic microRNAs and indirectly affect the expression of the target genes of these microRNAs. The connections between ARS and multiple regulatory mechanisms underline the importance of ARS in determining cell fate. Accumulating evidence indicates that ARS-coupled regulations play important roles in tumorigenesis. Here I will review our current knowledge in this field, and discuss potential future directions.

  14. Identification of sigmaB-dependent genes in Bacillus cereus by proteome and in vitro transcription analysis.

    Science.gov (United States)

    van Schaik, Willem; Zwietering, Marcel H; de Vos, Willem M; Abee, Tjakko

    2004-07-01

    The alternative sigma factor sigmaB of the food pathogen Bacillus cereus is activated upon stress exposure and plays a role in the adaptive response of vegetative cells. This study describes the identification of sigmaB-dependent genes in B. cereus. Two-dimensional gel electrophoresis was performed with protein extracts from a sigmaB-overproducing B. cereus strain. Nine protein spots, which were absent from the negative control, were identified by matrix-assisted laser desorption ionization-time of flight mass spectrometry or N-terminal sequencing. The sigmaB-dependent expression of the corresponding genes was confirmed by Northern blot analysis with RNA isolated from B. cereus ATCC 14579 and its sigB null mutant. Northern blot analysis also revealed that six other genes were part of sigmaB-dependent operons. The proteins that are predicted to be encoded by the sigmaB-dependent genes include an intracellular protease, a Mg2+ transporter, and a thiamine biosynthesis protein (ThiG). Highly conserved promoter sites were found to precede all sigmaB-dependent genes, with the exception of thiG. By searching the B. cereus genome for this conserved promoter sequence, five more candidate sigmaB-dependent genes were identified. Northern blot analysis and in vitro transcription experiments with a reconstituted B. cereus sigmaB-RNA polymerase holoenzyme confirmed the sigmaB dependency of two of these genes and strongly suggested that two other genes, encoding an oligopeptide-binding OppA-like protein and subunit II of the cytochrome d ubiquinol oxidase, are also sigmaB dependent. In conclusion, sigmaB of B. cereus not only regulates genes directly involved in the stress response but may also control specific metabolic rearrangements.

  15. Globalisation reaches gene regulation: the case for vertebrate limb development.

    Science.gov (United States)

    Zuniga, Aimée

    2005-08-01

    Analysis of key regulators of vertebrate limb development has revealed that the cis-regulatory regions controlling their expression are often located several hundred kilobases upstream of the transcription units. These far up- or down-stream cis-regulatory regions tend to reside within rather large, functionally and structurally unrelated genes. Molecular analysis is beginning to reveal the complexity of these large genomic landscapes, which control the co-expression of clusters of diverse genes by this novel type of long-range and globally acting cis-regulatory region. An increasing number of spontaneous mutations in vertebrates, including humans, are being discovered inactivating or altering such global control regions. Thereby, the functions of a seemingly distant but essential gene are disrupted rather than the closest.

  16. Methods and compositions for regulating gene expression in plant cells

    Science.gov (United States)

    Beachy, Roger N. (Inventor); Luis, Maria Isabel Ordiz (Inventor); Dai, Shunhong (Inventor)

    2010-01-01

    Novel chimeric plant promoter sequences are provided, together with plant gene expression cassettes comprising such sequences. In certain preferred embodiments, the chimeric plant promoters comprise the BoxII cis element and/or derivatives thereof. In addition, novel transcription factors are provided, together with nucleic acid sequences encoding such transcription factors and plant gene expression cassettes comprising such nucleic acid sequences. In certain preferred embodiments, the novel transcription factors comprise the acidic domain, or fragments thereof, of the RF2a transcription factor. Methods for using the chimeric plant promoter sequences and novel transcription factors in regulating the expression of at least one gene of interest are provided, together with transgenic plants comprising such chimeric plant promoter sequences and novel transcription factors.

  17. LEF-1 Regulates Tyrosinase Gene Transcription In Vitro.

    Directory of Open Access Journals (Sweden)

    Xueping Wang

    Full Text Available TYR, DCT and MITF are three important genes involved in maintaining the mature phenotype and producing melanin; they therefore participate in neural crest cell development into melanocytes. Previous studies have revealed that the Wnt signaling factor lymphoid enhancer-binding factor (LEF-1 can enhance DCT and MITF gene expression. However, whether LEF-1 also affects TYR gene expression remains unclear. In the present study, we found that LEF-1 regulated TYR transcription in vitro. LEF-1 overexpression increased TYR gene promoter activity, whereas LEF-1 knockdown by RNA interference significantly decreased TYR expression. Moreover, the core GTTTGAT sequence (-56 to -50 within the TYR promoter is essential for the effect of LEF-1 on TYR expression, and chromatin immunoprecipitation (ChIP assay indicated that endogenous LEF-1 interacts with the TYR promoter. In addition, we observed a synergistic transactivation of the TYR promoter by LEF-1 and MITF. These data suggest that Wnt signaling plays an important role in regulating melanocyte development and differentiation.

  18. Gene regulation networks generate diverse pigmentation patterns in plants.

    Science.gov (United States)

    Albert, Nick W; Davies, Kevin M; Schwinn, Kathy E

    2014-01-01

    The diversity of pigmentation patterns observed in plants occurs due to the spatial distribution and accumulation of colored compounds, which may also be associated with structural changes to the tissue. Anthocyanins are flavonoids that provide red/purple/blue coloration to plants, often forming complex patterns such as spots, stripes, and vein-associated pigmentation, particularly in flowers. These patterns are determined by the activity of MYB-bHLH-WDR (MBW) transcription factor complexes, which activate the anthocyanin biosynthesis genes, resulting in anthocyanin pigment accumulation. Recently, we established that the MBW complex controlling anthocyanin synthesis acts within a gene regulation network that is conserved within at least the Eudicots. This network involves hierarchy, reinforcement, and feedback mechanisms that allow for stringent and responsive regulation of the anthocyanin biosynthesis genes. The gene network and mobile nature of the WDR and R3-MYB proteins provide exciting new opportunities to explore the basis of pigmentation patterning, and to investigate the evolutionary history of the MBW components in land plants.

  19. Regulation of myelin genes implicated in psychiatric disorders by functional activity in axons

    Directory of Open Access Journals (Sweden)

    Philip R Lee

    2009-06-01

    Full Text Available Myelination is a highly dynamic process that continues well into adulthood in humans. Several recent gene expression studies have found abnormal expression of genes involved in myelination in the prefrontal cortex of brains from patients with schizophrenia and other psychiatric illnesses. Defects in myelination could contribute to the pathophysiology of psychiatric illness by impairing information processing as a consequence of altered impulse conduction velocity and synchrony between cortical regions carrying out higher level cognitive functions. Myelination can be altered by impulse activity in axons and by environmental experience. Psychiatric illness is treated by psychotherapy, behavioral modification, and drugs affecting neurotransmission, raising the possibility that myelinating glia may not only contribute to such disorders, but that activity-dependent effects on myelinating glia could provide one of the cellular mechanisms contributing to the therapeutic effects of these treatments. This review examines evidence showing that genes and gene networks important for myelination can be regulated by functional activity in axons.

  20. Undifferentiated embryonic cell transcription factor 1 regulates ESC chromatin organization and gene expression

    DEFF Research Database (Denmark)

    Kooistra, Susanne M; van den Boom, Vincent; Thummer, Rajkumar P

    2010-01-01

    Previous reports showed that embryonic stem (ES) cells contain hyperdynamic and globally transcribed chromatin-properties that are important for ES cell pluripotency and differentiation. Here, we demonstrate a role for undifferentiated embryonic cell transcription factor 1 (UTF1) in regulating ES...... cell chromatin structure. Using chromatin immunoprecipitation-on-chip analysis, we identified >1,700 UTF1 target genes that significantly overlap with previously identified Nanog, Oct4, Klf-4, c-Myc, and Rex1 targets. Gene expression profiling showed that UTF1 knock down results in increased expression...... of a large set of genes, including a significant number of UTF1 targets. UTF1 knock down (KD) ES cells are, irrespective of the increased expression of several self-renewal genes, Leukemia inhibitory factor (LIF) dependent. However, UTF1 KD ES cells are perturbed in their differentiation in response...

  1. MTA3 regulates CGB5 and Snail genes in trophoblast

    International Nuclear Information System (INIS)

    Chen, Ying; Miyazaki, Jun; Nishizawa, Haruki; Kurahashi, Hiroki; Leach, Richard; Wang, Kai

    2013-01-01

    Highlights: •Impaired MTA3, raised CGB5 and Snail expression are associated with preeclampsia. •Knock-down of MTA3 causes up-regulation of CGB5 and Snail genes in BeWo cells. •MTA3 occupies CGB5 and Snail gene promoters in BeWo cells. -- Abstract: Secreted by the placental trophoblast, human chorionic gonadotropin (hCG) is an important hormone during pregnancy and is required for the maintenance of pregnancy. Previous studies have shown that dys-regulation of hCG expression is associated with preeclampsia. However, the exact relationship between altered hCG levels and development of preeclampsia is unknown. Metastasis associated protein 3 (MTA3), a chromatin remodeling protein, is abundantly expressed in the placental trophoblasts, but its function is unknown. In breast cancer, MTA3 has been shown to repress the expression of Snail and cell migration. However, whether MTA3 acts similarly in the trophoblast has not been investigated. In the present study, we examined the role of MTA3 in regulating the hCG β-subunit gene (gene name: CGB5) and Snail expression in the trophoblast cell line, BeWo, as well as its relevance to the high hCG expression levels seen in preeclampsia. First, we investigated MTA3 expression in preeclamptic placenta as compared to normal control placenta via gene expression microarray and qRT-PCR and found that MTA3 was significantly down-regulated, whereas both CGB5 and Snail were up-regulated in preeclamptic placenta. Secondly, we knocked down MTA3 gene in trophoblast cell line BeWo and found Snail and hCG were both up-regulated, suggesting that MTA3 represses Snail and hCG gene expression in trophoblasts. Next, we cloned the CGB5 and Snail promoters into the pGL3-basic vector individually and found that silencing of MTA3 by siRNA resulted in an increase of both CGB5 and Snail promoter activities. To confirm that this MTA3 inhibition is a direct effect, we performed a chromatin immune-precipitation (ChIP) assay and found that MTA3

  2. MTA3 regulates CGB5 and Snail genes in trophoblast

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Ying [Department of Obstetrics, Gynecology and Reproductive Biology, Michigan State University, Grand Rapids, MI 49503 (United States); Miyazaki, Jun [Department of Obstetrics and Gynecology, Fujita Health University School of Medicine, Fujita Health University, Toyoake (Japan); Division of Molecular Genetics, Institute for Comprehensive Medical Science, Fujita Health University, Toyoake (Japan); Nishizawa, Haruki [Department of Obstetrics and Gynecology, Fujita Health University School of Medicine, Fujita Health University, Toyoake (Japan); Kurahashi, Hiroki [Division of Molecular Genetics, Institute for Comprehensive Medical Science, Fujita Health University, Toyoake (Japan); Leach, Richard, E-mail: Richard.Leach@hc.msu.edu [Department of Obstetrics, Gynecology and Reproductive Biology, Michigan State University, Grand Rapids, MI 49503 (United States); Department of Obstetrics, Gynecology and Women’s Health, Spectrum Health Medical Group, Grand Rapids, MI 49503 (United States); Wang, Kai, E-mail: Kai.Wang@hc.msu.edu [Department of Obstetrics, Gynecology and Reproductive Biology, Michigan State University, Grand Rapids, MI 49503 (United States)

    2013-04-19

    Highlights: •Impaired MTA3, raised CGB5 and Snail expression are associated with preeclampsia. •Knock-down of MTA3 causes up-regulation of CGB5 and Snail genes in BeWo cells. •MTA3 occupies CGB5 and Snail gene promoters in BeWo cells. -- Abstract: Secreted by the placental trophoblast, human chorionic gonadotropin (hCG) is an important hormone during pregnancy and is required for the maintenance of pregnancy. Previous studies have shown that dys-regulation of hCG expression is associated with preeclampsia. However, the exact relationship between altered hCG levels and development of preeclampsia is unknown. Metastasis associated protein 3 (MTA3), a chromatin remodeling protein, is abundantly expressed in the placental trophoblasts, but its function is unknown. In breast cancer, MTA3 has been shown to repress the expression of Snail and cell migration. However, whether MTA3 acts similarly in the trophoblast has not been investigated. In the present study, we examined the role of MTA3 in regulating the hCG β-subunit gene (gene name: CGB5) and Snail expression in the trophoblast cell line, BeWo, as well as its relevance to the high hCG expression levels seen in preeclampsia. First, we investigated MTA3 expression in preeclamptic placenta as compared to normal control placenta via gene expression microarray and qRT-PCR and found that MTA3 was significantly down-regulated, whereas both CGB5 and Snail were up-regulated in preeclamptic placenta. Secondly, we knocked down MTA3 gene in trophoblast cell line BeWo and found Snail and hCG were both up-regulated, suggesting that MTA3 represses Snail and hCG gene expression in trophoblasts. Next, we cloned the CGB5 and Snail promoters into the pGL3-basic vector individually and found that silencing of MTA3 by siRNA resulted in an increase of both CGB5 and Snail promoter activities. To confirm that this MTA3 inhibition is a direct effect, we performed a chromatin immune-precipitation (ChIP) assay and found that MTA3

  3. Efficient Gene Delivery to Pig Airway Epithelia and Submucosal Glands Using Helper-Dependent Adenoviral Vectors

    Directory of Open Access Journals (Sweden)

    Huibi Cao

    2013-01-01

    Full Text Available Airway gene delivery is a promising strategy to treat patients with life-threatening lung diseases such as cystic fibrosis (CF. However, this strategy has to be evaluated in large animal preclinical studies in order to translate it to human applications. Because of anatomic and physiological similarities between the human and pig lungs, we utilized pig as a large animal model to examine the safety and efficiency of airway gene delivery with helper-dependent adenoviral vectors. Helper-dependent vectors carrying human CFTR or reporter gene LacZ were aerosolized intratracheally into pigs under bronchoscopic guidance. We found that the LacZ reporter and hCFTR transgene products were efficiently expressed in lung airway epithelial cells. The transgene vectors with this delivery can also reach to submucosal glands. Moreover, the hCFTR transgene protein localized to the apical membrane of both ciliated and nonciliated epithelial cells, mirroring the location of wild-type CF transmembrane conductance regulator (CFTR. Aerosol delivery procedure was well tolerated by pigs without showing systemic toxicity based on the limited number of pigs tested. These results provide important insights into developing clinical strategies for human CF lung gene therapy.

  4. Decorin gene expression and its regulation in human keratinocytes

    International Nuclear Information System (INIS)

    Highlights: → We showed that cultured human diploid epidermal keratinocytes express and synthesize decorin. → Decorin is found intracytoplasmic in suprabasal cells of cultures and in human epidermis. → Decorin mRNA expression in cHEK is regulated by pro-inflammatory and proliferative cytokines. → Decorin immunostaining of psoriatic lesions showed a lower intensity and altered intracytoplasmic arrangements. -- Abstract: In various cell types, including cancer cells, decorin is involved in regulation of cell attachment, migration and proliferation. In skin, decorin is seen in dermis, but not in keratinocytes. We show that decorin gene (DCN) is expressed in the cultured keratinocytes, and the protein is found in the cytoplasm of differentiating keratinocytes and in suprabasal layers of human epidermis. RT-PCR experiments showed that DCN expression is regulated by pro-inflammatory and proliferative cytokines. Our data suggest that decorin should play a significant role in keratinocyte terminal differentiation, cutaneous homeostasis and dermatological diseases.

  5. Decorin gene expression and its regulation in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Velez-DelValle, Cristina; Marsch-Moreno, Meytha; Castro-Munozledo, Federico [Department of Cell Biology, Centro de Investigacion y de Estudios Avanzados del IPN, Apdo. Postal 14-740, Mexico D.F. 07000 (Mexico); Kuri-Harcuch, Walid, E-mail: walidkuri@gmail.com [Department of Cell Biology, Centro de Investigacion y de Estudios Avanzados del IPN, Apdo. Postal 14-740, Mexico D.F. 07000 (Mexico)

    2011-07-22

    Highlights: {yields} We showed that cultured human diploid epidermal keratinocytes express and synthesize decorin. {yields} Decorin is found intracytoplasmic in suprabasal cells of cultures and in human epidermis. {yields} Decorin mRNA expression in cHEK is regulated by pro-inflammatory and proliferative cytokines. {yields} Decorin immunostaining of psoriatic lesions showed a lower intensity and altered intracytoplasmic arrangements. -- Abstract: In various cell types, including cancer cells, decorin is involved in regulation of cell attachment, migration and proliferation. In skin, decorin is seen in dermis, but not in keratinocytes. We show that decorin gene (DCN) is expressed in the cultured keratinocytes, and the protein is found in the cytoplasm of differentiating keratinocytes and in suprabasal layers of human epidermis. RT-PCR experiments showed that DCN expression is regulated by pro-inflammatory and proliferative cytokines. Our data suggest that decorin should play a significant role in keratinocyte terminal differentiation, cutaneous homeostasis and dermatological diseases.

  6. Neurons and neuronal activity control gene expression in astrocytes to regulate their development and metabolism.

    Science.gov (United States)

    Hasel, Philip; Dando, Owen; Jiwaji, Zoeb; Baxter, Paul; Todd, Alison C; Heron, Samuel; Márkus, Nóra M; McQueen, Jamie; Hampton, David W; Torvell, Megan; Tiwari, Sachin S; McKay, Sean; Eraso-Pichot, Abel; Zorzano, Antonio; Masgrau, Roser; Galea, Elena; Chandran, Siddharthan; Wyllie, David J A; Simpson, T Ian; Hardingham, Giles E

    2017-05-02

    The influence that neurons exert on astrocytic function is poorly understood. To investigate this, we first developed a system combining cortical neurons and astrocytes from closely related species, followed by RNA-seq and in silico species separation. This approach uncovers a wide programme of neuron-induced astrocytic gene expression, involving Notch signalling, which drives and maintains astrocytic maturity and neurotransmitter uptake function, is conserved in human development, and is disrupted by neurodegeneration. Separately, hundreds of astrocytic genes are acutely regulated by synaptic activity via mechanisms involving cAMP/PKA-dependent CREB activation. This includes the coordinated activity-dependent upregulation of major astrocytic components of the astrocyte-neuron lactate shuttle, leading to a CREB-dependent increase in astrocytic glucose metabolism and elevated lactate export. Moreover, the groups of astrocytic genes induced by neurons or neuronal activity both show age-dependent decline in humans. Thus, neurons and neuronal activity regulate the astrocytic transcriptome with the potential to shape astrocyte-neuron metabolic cooperation.

  7. Detection and sequence analysis of accessory gene regulator genes of Staphylococcus pseudintermedius isolates

    Directory of Open Access Journals (Sweden)

    M. Ananda Chitra

    2015-07-01

    Full Text Available Background: Staphylococcus pseudintermedius (SP is the major pathogenic species of dogs involved in a wide variety of skin and soft tissue infections. The accessory gene regulator (agr locus of Staphylococcus aureus has been extensively studied, and it influences the expression of many virulence genes. It encodes a two-component signal transduction system that leads to down-regulation of surface proteins and up-regulation of secreted proteins during in vitro growth of S. aureus. The objective of this study was to detect and sequence analyzing the AgrA, B, and D of SP isolated from canine skin infections. Materials and Methods: In this study, we have isolated and identified SP from canine pyoderma and otitis cases by polymerase chain reaction (PCR and confirmed by PCR-restriction fragment length polymorphism. Primers for SP agrA and agrBD genes were designed using online primer designing software and BLAST searched for its specificity. Amplification of the agr genes was carried out for 53 isolates of SP by PCR and sequencing of agrA, B, and D were carried out for five isolates and analyzed using DNAstar and Mega5.2 software. Results: A total of 53 (59% SP isolates were obtained from 90 samples. 15 isolates (28% were confirmed to be methicillinresistant SP (MRSP with the detection of the mecA gene. Accessory gene regulator A, B, and D genes were detected in all the SP isolates. Complete nucleotide sequences of the above three genes for five isolates were submitted to GenBank, and their accession numbers are from KJ133557 to KJ133571. AgrA amino acid sequence analysis showed that it is mainly made of alpha-helices and is hydrophilic in nature. AgrB is a transmembrane protein, and AgrD encodes the precursor of the autoinducing peptide (AIP. Sequencing of the agrD gene revealed that the 5 canine SP strains tested could be divided into three Agr specificity groups (RIPTSTGFF, KIPTSTGFF, and RIPISTGFF based on the putative AIP produced by each strain

  8. Glutamate-Dependent BMAL1 Regulation in Cultured Bergmann Glia Cells.

    Science.gov (United States)

    Chi-Castañeda, Donají; Waliszewski, Stefan M; Zepeda, Rossana C; Hernández-Kelly, Luisa C R; Caba, Mario; Ortega, Arturo

    2015-05-01

    Glutamate, the major excitatory amino acid, activates a wide variety of signal transduction cascades. This neurotransmitter is involved in photic entrainment of circadian rhythms, which regulate physiological and behavioral functions. The circadian clock in vertebrates is based on a transcription-translation feedback loop in which Brain and muscle aryl hydrocarbon receptor nuclear translocator (ARNT)-like protein 1 (BMAL1) acts as transcriptional activator of others clock genes. This protein is expressed in nearly all suprachiasmatic nucleus neurons, as well as in the granular layer of the cerebellum. In this context, we decided to investigate the role of glutamate in the molecular mechanisms involved in the processes of transcription/translation of BMAL1 protein. To this end, primary cultures of chick cerebellar Bergmann glial cells were stimulated with glutamatergic ligands and we found that BMAL1 levels increased in a dose- and time dependent manner. Additionally, we studied the phosphorylation of serine residues in BMAL1 under glutamate stimulation and we were able to detect an increase in the phosphorylation of this protein. The increased expression of BMAL1 is most probably the result of a stabilization of the protein after it has been phosphorylated by the cyclic AMP-dependent protein kinase and/or the Ca(2+)/diacylglycerol dependent protein kinase. The present results strongly suggest that glutamate participates in regulating BMAL1 in glial cells and that these cells might prove to be important in the control of circadian rhythms in the cerebellum.

  9. Transcriptional regulator-mediated activation of adaptation genes triggers CRISPR de novo spacer acquisition

    DEFF Research Database (Denmark)

    Liu, Tao; Li, Yingjun; Wang, Xiaodi

    2015-01-01

    Acquisition of de novo spacer sequences confers CRISPR-Cas with a memory to defend against invading genetic elements. However, the mechanism of regulation of CRISPR spacer acquisition remains unknown. Here we examine the transcriptional regulation of the conserved spacer acquisition genes in Type I......, it was demonstrated that the transcription level of csa1, cas1, cas2 and cas4 was significantly enhanced in a csa3a-overexpression strain and, moreover, the Csa1 and Cas1 protein levels were increased in this strain. Furthermore, we demonstrated the hyperactive uptake of unique spacers within both CRISPR loci...... in the presence of the csa3a overexpression vector. The spacer acquisition process is dependent on the CCN PAM sequence and protospacer selection is random and non-directional. These results suggested a regulation mechanism of CRISPR spacer acquisition where a single transcriptional regulator senses the presence...

  10. Learning-dependent gene expression of CREB1 isoforms in the molluscan brain

    Directory of Open Access Journals (Sweden)

    Hisayo Sadamoto

    2010-05-01

    Full Text Available Cyclic AMP-responsive element binding protein1 (CREB1 has multiple functions in gene regulation. Various studies have reported that CREB1-dependent gene induction is necessary for memory formation and long-lasting behavioral changes in both vertebrates and invertebrates. In the present study, we characterized Lymnaea CREB1 (LymCREB1 mRNA isoforms of spliced variants in the central nervous system (CNS of the pond snail Lymnaea stagnalis. Among these spliced variants, the three isoforms that code a whole LymCREB1 protein are considered to be the activators for gene regulation. The other four isoforms, which code truncated LymCREB1 proteins with no kinase inducible domain, are the repressors. For a better understanding of the possible roles of different LymCREB1 isoforms, the expression level of these isoform mRNAs was investigated by a real-time quantitative RT-PCR method. Further, we examined the changes in gene expression for all the isoforms in the CNS after conditioned taste aversion (CTA learning or backward conditioning as a control. The results showed that CTA learning increased LymCREB1 gene expression, but it did not change the activator/repressor ratio. Our findings showed that the repressor isoforms, as well as the activator ones, are expressed in large amounts in the CNS, and the gene expression of CREB1 isoforms appeared to be specific for the given stimulus. This was the first quantitative analysis of the expression patterns of CREB1 isoforms at the mRNA level and their association with learning behavior.

  11. Ethylene is differentially regulated during sugar beet germination and affects early root growth in a dose-dependent manner.

    Science.gov (United States)

    Abts, Willem; Van de Poel, Bram; Vandenbussche, Bert; De Proft, Maurice P

    2014-10-01

    By integrating molecular, biochemical, and physiological data, ethylene biosynthesis in sugar beet was shown to be differentially regulated, affecting root elongation in a concentration-dependent manner. There is a close relation between ethylene production and seedling growth of sugar beet (Beta vulgaris L.), yet the exact function of ethylene during this early developmental stage is still unclear. While ethylene is mostly considered to be a root growth inhibitor, we found that external 1-aminocyclopropane-1-carboxylic acid (ACC) regulates root growth in sugar beet in a concentration-dependent manner: low concentrations stimulate root growth while high concentrations inhibit root growth. These results reveal that ethylene action during root elongation is strongly concentration dependent. Furthermore our detailed study of ethylene biosynthesis kinetics revealed a very strict gene regulation pattern of ACC synthase (ACS) and ACC oxidase (ACO), in which ACS is the rate liming step during sugar beet seedling development.

  12. Inhibitory PAS domain protein is a negative regulator of hypoxia-inducible gene expression

    Science.gov (United States)

    Makino, Yuichi; Cao, Renhai; Svensson, Kristian; Bertilsson, Göran; Asman, Mikael; Tanaka, Hirotoshi; Cao, Yihai; Berkenstam, Anders; Poellinger, Lorenz

    2001-11-01

    Alteration of gene expression is a crucial component of adaptive responses to hypoxia. These responses are mediated by hypoxia-inducible transcription factors (HIFs). Here we describe an inhibitory PAS (Per/Arnt/Sim) domain protein, IPAS, which is a basic helix-loop-helix (bHLH)/PAS protein structurally related to HIFs. IPAS contains no endogenous transactivation function but demonstrates dominant negative regulation of HIF-mediated control of gene expression. Ectopic expression of IPAS in hepatoma cells selectively impairs induction of genes involved in adaptation to a hypoxic environment, notably the vascular endothelial growth factor (VEGF) gene, and results in retarded tumour growth and tumour vascular density in vivo. In mice, IPAS was predominantly expressed in Purkinje cells of the cerebellum and in corneal epithelium of the eye. Expression of IPAS in the cornea correlates with low levels of expression of the VEGF gene under hypoxic conditions. Application of an IPAS antisense oligonucleotide to the mouse cornea induced angiogenesis under normal oxygen conditions, and demonstrated hypoxia-dependent induction of VEGF gene expression in hypoxic corneal cells. These results indicate a previously unknown mechanism for negative regulation of angiogenesis and maintenance of an avascular phenotype.

  13. Regulation of dsr genes encoding proteins responsible for the oxidation of stored sulfur in Allochromatium vinosum.

    Science.gov (United States)

    Grimm, Frauke; Dobler, Nadine; Dahl, Christiane

    2010-03-01

    Sulfur globules are formed as obligatory intermediates during the oxidation of reduced sulfur compounds in many environmentally important photo- and chemolithoautotrophic bacteria. It is well established that the so-called Dsr proteins are essential for the oxidation of zero-valent sulfur accumulated in the globules; however, hardly anything is known about the regulation of dsr gene expression. Here, we present a closer look at the regulation of the dsr genes in the phototrophic sulfur bacterium Allochromatium vinosum. The dsr genes are expressed in a reduced sulfur compound-dependent manner and neither sulfite, the product of the reverse-acting dissimilatory sulfite reductase DsrAB, nor the alternative electron donor malate inhibit the gene expression. Moreover, we show the oxidation of sulfur to sulfite to be the rate-limiting step in the oxidation of sulfur to sulfate as sulfate production starts concomitantly with the upregulation of the expression of the dsr genes. Real-time RT-PCR experiments suggest that the genes dsrC and dsrS are additionally expressed from secondary internal promoters, pointing to a special function of the encoded proteins. Earlier structural analyses indicated the presence of a helix-turn-helix (HTH)-like motif in DsrC. We therefore assessed the DNA-binding capability of the protein and provide evidence for a possible regulatory function of DsrC.

  14. DNA breaks and chromatin structural changes enhance the transcription of autoimmune regulator target genes.

    Science.gov (United States)

    Guha, Mithu; Saare, Mario; Maslovskaja, Julia; Kisand, Kai; Liiv, Ingrid; Haljasorg, Uku; Tasa, Tõnis; Metspalu, Andres; Milani, Lili; Peterson, Pärt

    2017-04-21

    The autoimmune regulator (AIRE) protein is the key factor in thymic negative selection of autoreactive T cells by promoting the ectopic expression of tissue-specific genes in the thymic medullary epithelium. Mutations in AIRE cause a monogenic autoimmune disease called autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy. AIRE has been shown to promote DNA breaks via its interaction with topoisomerase 2 (TOP2). In this study, we investigated topoisomerase-induced DNA breaks and chromatin structural alterations in conjunction with AIRE-dependent gene expression. Using RNA sequencing, we found that inhibition of TOP2 religation activity by etoposide in AIRE-expressing cells had a synergistic effect on genes with low expression levels. AIRE-mediated transcription was not only enhanced by TOP2 inhibition but also by the TOP1 inhibitor camptothecin. The transcriptional activation was associated with structural rearrangements in chromatin, notably the accumulation of γH2AX and the exchange of histone H1 with HMGB1 at AIRE target gene promoters. In addition, we found the transcriptional up-regulation to co-occur with the chromatin structural changes within the genomic cluster of carcinoembryonic antigen-like cellular adhesion molecule genes. Overall, our results suggest that the presence of AIRE can trigger molecular events leading to an altered chromatin landscape and the enhanced transcription of low-expressed genes. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  15. Global analysis of epigenetic regulation of gene expression in response to drought stress in Sorghum.

    Energy Technology Data Exchange (ETDEWEB)

    Reddy, Anireddy [Colorado State Univ., Fort Collins, CO (United States); Ben-Hur, Asa [Colorado State Univ., Fort Collins, CO (United States)

    2017-11-22

    Abiotic stresses including drought are major limiting factors of crop yields and cause significant crop losses. Acquisition of stress tolerance to abiotic stresses requires coordinated regulation of a multitude of biochemical and physiological changes, and most of these changes depend on alterations in gene expression. The goal of this work is to perform global analysis of differential regulation of gene expression and alternative splicing, and their relationship with chromatin landscape in drought sensitive and tolerant cultivars. our Iso-Seq study revealed transcriptome-wide full-length isoforms at an unprecedented scale with over 11000 novel splice isoforms. Additionally, we uncovered alternative polyadenylation sites of ~11000 expressed genes and many novel genes. Overall, Iso-Seq results greatly enhanced sorghum gene annotations that are not only useful in analyzing all our RNA-seq, ChIP-seq and ATAC-seq data but also serve as a great resource to the plant biology community. Our studies identified differentially expressed genes and splicing events that are correlated with the drought-resistant phenotype. An association between alternative splicing and chromatin accessibility was also revealed. Several computational tools developed here (TAPIS and iDiffIR) have been made freely available to the research community in analyzing alternative splicing and differential alternative splicing.

  16. Precise regulation of gene expression dynamics favors complex promoter architectures.

    Directory of Open Access Journals (Sweden)

    Dirk Müller

    2009-01-01

    Full Text Available Promoters process signals through recruitment of transcription factors and RNA polymerase, and dynamic changes in promoter activity constitute a major noise source in gene expression. However, it is barely understood how complex promoter architectures determine key features of promoter dynamics. Here, we employ prototypical promoters of yeast ribosomal protein genes as well as simplified versions thereof to analyze the relations among promoter design, complexity, and function. These promoters combine the action of a general regulatory factor with that of specific transcription factors, a common motif of many eukaryotic promoters. By comprehensively analyzing stationary and dynamic promoter properties, this model-based approach enables us to pinpoint the structural characteristics underlying the observed behavior. Functional tradeoffs impose constraints on the promoter architecture of ribosomal protein genes. We find that a stable scaffold in the natural design results in low transcriptional noise and strong co-regulation of target genes in the presence of gene silencing. This configuration also exhibits superior shut-off properties, and it can serve as a tunable switch in living cells. Model validation with independent experimental data suggests that the models are sufficiently realistic. When combined, our results offer a mechanistic explanation for why specific factors are associated with low protein noise in vivo. Many of these findings hold for a broad range of model parameters and likely apply to other eukaryotic promoters of similar structure.

  17. ABI3 mediates dehydration stress recovery response in Arabidopsis thaliana by regulating expression of downstream genes.

    Science.gov (United States)

    Bedi, Sonia; Sengupta, Sourabh; Ray, Anagh; Nag Chaudhuri, Ronita

    2016-09-01

    ABI3, originally discovered as a seed-specific transcription factor is now implicated to act beyond seed physiology, especially during abiotic stress. In non-seed plants, ABI3 is known to act in desiccation stress signaling. Here we show that ABI3 plays a role in dehydration stress response in Arabidopsis. ABI3 gene was upregulated during dehydration stress and its expression was maintained during subsequent stress recovery phases. Comparative gene expression studies in response to dehydration stress and stress recovery were done with genes which had potential ABI3 binding sites in their upstream regulatory regions. Such studies showed that several genes including known seed-specific factors like CRUCIFERIN1, CRUCIFERIN3 and LEA-group of genes like LEA76, LEA6, DEHYDRIN LEA and LEA-LIKE got upregulated in an ABI3-dependent manner, especially during the stress recovery phase. ABI3 got recruited to regions upstream to the transcription start site of these genes during dehydration stress response through direct or indirect DNA binding. Interestingly, ABI3 also binds to its own promoter region during such stress signaling. Nucleosomes covering potential ABI3 binding sites in the upstream sequences of the above-mentioned genes alter positions, and show increased H3 K9 acetylation during stress-induced transcription. ABI3 thus mediates dehydration stress signaling in Arabidopsis through regulation of a group of genes that play a role primarily during stress recovery phase. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  18. A framework for modelling gene regulation which accommodates non-equilibrium mechanisms.

    Science.gov (United States)

    Ahsendorf, Tobias; Wong, Felix; Eils, Roland; Gunawardena, Jeremy

    2014-12-05

    Gene regulation has, for the most part, been quantitatively analysed by assuming that regulatory mechanisms operate at thermodynamic equilibrium. This formalism was originally developed to analyse the binding and unbinding of transcription factors from naked DNA in eubacteria. Although widely used, it has made it difficult to understand the role of energy-dissipating, epigenetic mechanisms, such as DNA methylation, nucleosome remodelling and post-translational modification of histones and co-regulators, which act together with transcription factors to regulate gene expression in eukaryotes. Here, we introduce a graph-based framework that can accommodate non-equilibrium mechanisms. A gene-regulatory system is described as a graph, which specifies the DNA microstates (vertices), the transitions between microstates (edges) and the transition rates (edge labels). The graph yields a stochastic master equation for how microstate probabilities change over time. We show that this framework has broad scope by providing new insights into three very different ad hoc models, of steroid-hormone responsive genes, of inherently bounded chromatin domains and of the yeast PHO5 gene. We find, moreover, surprising complexity in the regulation of PHO5, which has not yet been experimentally explored, and we show that this complexity is an inherent feature of being away from equilibrium. At equilibrium, microstate probabilities do not depend on how a microstate is reached but, away from equilibrium, each path to a microstate can contribute to its steady-state probability. Systems that are far from equilibrium thereby become dependent on history and the resulting complexity is a fundamental challenge. To begin addressing this, we introduce a graph-based concept of independence, which can be applied to sub-systems that are far from equilibrium, and prove that history-dependent complexity can be circumvented when sub-systems operate independently. As epigenomic data become increasingly

  19. Phasevarion mediated epigenetic gene regulation in Helicobacter pylori.

    Directory of Open Access Journals (Sweden)

    Yogitha N Srikhanta

    Full Text Available Many host-adapted bacterial pathogens contain DNA methyltransferases (mod genes that are subject to phase-variable expression (high-frequency reversible ON/OFF switching of gene expression. In Haemophilus influenzae and pathogenic Neisseria, the random switching of the modA gene, associated with a phase-variable type III restriction modification (R-M system, controls expression of a phase-variable regulon of genes (a "phasevarion", via differential methylation of the genome in the modA ON and OFF states. Phase-variable type III R-M systems are also found in Helicobacter pylori, suggesting that phasevarions may also exist in this key human pathogen. Phylogenetic studies on the phase-variable type III modH gene revealed that there are 17 distinct alleles in H. pylori, which differ only in their DNA recognition domain. One of the most commonly found alleles was modH5 (16% of isolates. Microarray analysis comparing the wild-type P12modH5 ON strain to a P12ΔmodH5 mutant revealed that six genes were either up- or down-regulated, and some were virulence-associated. These included flaA, which encodes a flagella protein important in motility and hopG, an outer membrane protein essential for colonization and associated with gastric cancer. This study provides the first evidence of this epigenetic mechanism of gene expression in H. pylori. Characterisation of H. pylori modH phasevarions to define stable immunological targets will be essential for vaccine development and may also contribute to understanding H. pylori pathogenesis.

  20. The Prolactin Gene: A Paradigm of Tissue-Specific Gene Regulation with Complex Temporal Transcription Dynamics

    Science.gov (United States)

    Featherstone, K; White, M R H; Davis, J R E

    2012-01-01

    Transcription of numerous mammalian genes is highly pulsatile, with bursts of expression occurring with variable duration and frequency. The presence of this stochastic or ‘noisy’ expression pattern has been relatively unexplored in tissue systems. The prolactin gene provides a model of tissue-specific gene regulation resulting in pulsatile transcription dynamics in both cell lines and endocrine tissues. In most cell culture models, prolactin transcription appears to be highly variable between cells, with differences in transcription pulse duration and frequency. This apparently stochastic transcription is constrained by a transcriptional refractory period, which may be related to cycles of chromatin remodelling. We propose that prolactin transcription dynamics result from the summation of oscillatory cellular inputs and by regulation through chromatin remodelling cycles. Observations of transcription dynamics in cells within pituitary tissue show reduced transcriptional heterogeneity and can be grouped into a small number of distinct patterns. Thus, it appears that the tissue environment is able to reduce transcriptional noise to enable coordinated tissue responses to environmental change. We review the current knowledge on the complex tissue-specific regulation of the prolactin gene in pituitary and extra-pituitary sites, highlighting differences between humans and rodent experimental animal models. Within this context, we describe the transcription dynamics of prolactin gene expression and how this may relate to specific processes occurring within the cell. PMID:22420298

  1. Apple juice intervention modulates expression of ARE-dependent genes in rat colon and liver.

    Science.gov (United States)

    Soyalan, Bülent; Minn, Jutta; Schmitz, Hans J; Schrenk, Dieter; Will, Frank; Dietrich, Helmut; Baum, Matthias; Eisenbrand, Gerhard; Janzowski, Christine

    2011-03-01

    The risk of cancer and other degenerative diseases is inversely correlated with consumption of fruits and vegetables. This beneficial effect is mainly attributed to secondary plant constituents such as polyphenols, supposed to play a major role in protection against ROS (reactive oxygen species)-associated toxicity. To elucidate the potential of differently manufactured apple juices (clear AJ/cloudy AJ/smoothie, in comparison with a polyphenol-free control juice) to modulate expression of ARE-dependent genes. In male Sprague-Dawley rats (n = 8/group; 10d juice intervention, 4d wash-out; 4 treatment cycles), expression of target genes (superoxide dismutase, SOD1/SOD2; glutathione peroxidase, GPX1/GPX2; γ-glutamylcysteine ligase, GCLC/GCLM; glutathione reductase, GSR; catalase, CAT; NAD(P)H:quinone oxidoreductase-1, NQO1 and transcription factor erythroid-derived 2-like-2, Nrf2) was quantified with duplex RT-PCR, using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as control. In colon and liver of rats consuming polyphenol-free control juice, rather similar basic expressions were observed (relative GAPDH ratios ranging from 2 to 0.7 and 2.5-0.3, respectively). In the distal colon, apple juice intervention slightly but significantly induced most genes (e.g. GPX2, GSR, CAT, Nrf2; p target genes were not affected or down-regulated (SOD1, SOD2, GCLC/M, GSR), concomitant with the absence of Nrf2 induction. Induction of antioxidant gene expression differed with juice type (cloudy AJ > clear AJ ~ smoothie). Taken together, the results underline the potential of polyphenol-rich apple juice to increase the expression of ARE-dependent antioxidant genes.

  2. Efficient control of gene expression by a tetracycline-dependent transactivator in single Dictyostelium discoideum cells

    NARCIS (Netherlands)

    Blaauw, M; Linskens, MHK; van Haastert, PJM

    2000-01-01

    We established a tetracycline-regulated gene expression system that tightly controls expression of genes in Dictyostelium discoideum. The control elements are contained in two plasmid vectors, one being an integrated plasmid encoding a chimeric tetracycline-controlled transcriptional activator

  3. Implication of p53-dependent cellular senescence related gene, TARSH in tumor suppression

    International Nuclear Information System (INIS)

    Wakoh, Takeshi; Uekawa, Natsuko; Terauchi, Kunihiko; Sugimoto, Masataka; Ishigami, Akihito; Shimada, Jun-ichi; Maruyama, Mitsuo

    2009-01-01

    A novel target of NESH-SH3 (TARSH) was identified as a cellular senescence related gene in mouse embryonic fibroblasts (MEFs) replicative senescence, the expression of which has been suppressed in primary clinical lung cancer specimens. However, the molecular mechanism underlying the regulation of TARSH involved in pulmonary tumorigenesis remains unclear. Here we demonstrate that the reduction of TARSH gene expression by short hairpin RNA (shRNA) system robustly inhibited the MEFs proliferation with increase in senescence-associated β-galactosidase (SA-β-gal) activity. Using p53 -/- MEFs, we further suggest that this growth arrest by loss of TARSH is evoked by p53-dependent p21 Cip1 accumulation. Moreover, we also reveal that TARSH reduction induces multicentrosome in MEFs, which is linked in chromosome instability and tumor development. These results suggest that TARSH plays an important role in proliferation of replicative senescence and may serve as a trigger of tumor development.

  4. A substrate dependent biological containment systems for Pseudomonas putida based on the Escherichia coli gef gene

    DEFF Research Database (Denmark)

    Jensen, Lars Bogø; Ramos, J. L.; Kaneva, Z.

    1993-01-01

    A model substrate-dependent suicide system to biologically contain Pseudomonas putida KT2440 is reported. The system consists of two elements. One element carries a fusion between a synthetic lac promoter (PA1-04/03) and the gef gene, which encodes a killing function. This element is contained...... within a transposaseless mini-Tn5 transposon so that it can be integrated at random locations on the Pseudomonas chromosome. The second element, harbored by plasmid pCC102, is designed to control the first and bears a fusion between the promoter of the P. putida TOL plasmid-encoded meta-cleavage pathway...... operon (Pm) and the lacI gene, encoding the Lac repressor, plus xylS2, coding for a positive regulator of Pm. In liquid culture under optimal growth conditions and in sterile and nonsterile soil microcosms, P. putida KT2440 (pWWO) bearing the containment system behaves as designed. In the presence...

  5. CBFβ and the leukemogenic fusion protein CBFβ-SMMHC associate with mitotic chromosomes to epigenetically regulate ribosomal genes.

    Science.gov (United States)

    Lopez-Camacho, Cesar; van Wijnen, Andre J; Lian, Jane B; Stein, Janet L; Stein, Gary S

    2014-12-01

    Mitotic bookmarking is an epigenetic control mechanism that sustains gene expression in progeny cells; it is often found in genes related to the maintenance of cellular phenotype and growth control. RUNX transcription factors regulate a broad spectrum of RNA Polymerase (Pol II) transcribed genes important for lineage commitment but also regulate RNA Polymerase I (Pol I) driven ribosomal gene expression, thus coordinating control of cellular identity and proliferation. In this study, using fluorescence microscopy and biochemical approaches we show that the principal RUNX co-factor, CBFβ, associates with nucleolar organizing regions (NORs) during mitosis to negatively regulate RUNX-dependent ribosomal gene expression. Of clinical relevance, we establish for the first time that the leukemogenic fusion protein CBFβ-SMMHC (smooth muscle myosin heavy chain) also associates with ribosomal genes in interphase chromatin and mitotic chromosomes to promote and epigenetically sustain regulation of ribosomal genes through RUNX factor interactions. Our results demonstrate that CBFβ contributes to the transcriptional regulation of ribosomal gene expression and provide further understanding of the epigenetic role of CBFβ-SMMHC in proliferation and maintenance of the leukemic phenotype. © 2014 Wiley Periodicals, Inc.

  6. DMPD: Interferon gene regulation: not all roads lead to Tolls. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 16095970 Interferon gene regulation: not all roads lead to Tolls. Jefferies CA, Fit...zgerald KA. Trends Mol Med. 2005 Sep;11(9):403-11. (.png) (.svg) (.html) (.csml) Show Interferon gene regulation: not all roads lead... to Tolls. PubmedID 16095970 Title Interferon gene regulation: not all roads lead to

  7. Strategies to identify long noncoding RNAs involved in gene regulation

    Directory of Open Access Journals (Sweden)

    Lee Catherine

    2012-11-01

    Full Text Available Abstract Long noncoding RNAs (lncRNAs have been detected in nearly every cell type and found to be fundamentally involved in many biological processes. The characterization of lncRNAs has immense potential to advance our comprehensive understanding of cellular processes and gene regulation, along with implications for the treatment of human disease. The recent ENCODE (Encyclopedia of DNA Elements study reported 9,640 lncRNA loci in the human genome, which corresponds to around half the number of protein-coding genes. Because of this sheer number and their functional diversity, it is crucial to identify a pool of potentially relevant lncRNAs early on in a given study. In this review, we evaluate the methods for isolating lncRNAs by immunoprecipitation and review the advantages, disadvantages, and applications of three widely used approaches – microarray, tiling array, and RNA-seq – for identifying lncRNAs involved in gene regulation. We also look at ways in which data from publicly available databases such as ENCODE can support the study of lncRNAs.

  8. Regulation of Flavonoid Biosynthetic Genes in Germinating Arabidopsis Seedlings.

    Science.gov (United States)

    Kubasek, WL; Shirley, BW; McKillop, A; Goodman, HM; Briggs, W; Ausubel, FM

    1992-01-01

    Many higher plants, including Arabidopsis, transiently display purple anthocyanin pigments just after seed germination. We observed that steady state levels of mRNAs encoded by four flavonoid biosynthetic genes, PAL1 (encoding phenylalanine ammonia-lyase 1), CHS (encoding chalcone synthase), CHI (encoding chalcone isomerase), and DFR (encoding dihydroflavonol reductase), were temporally regulated, peaking in 3-day-old seedlings grown in continuous white light. Except for the case of PAL1 mRNA, mRNA levels for these flavonoid genes were very low in seedlings grown in darkness. Light induction studies using seedlings grown in darkness showed that PAL1 mRNA began to accumulate before CHS and CHI mRNAs, which, in turn, began to accumulate before DFR mRNA. This order of induction is the same as the order of the biosynthetic steps in flavonoid biosynthesis. Our results suggest that the flavonoid biosynthetic pathway is coordinately regulated by a developmental timing mechanism during germination. Blue light and UVB light induction experiments using red light- and dark-grown seedlings showed that the flavonoid biosynthetic genes are induced most effectively by UVB light and that blue light induction is mediated by a specific blue light receptor. PMID:12297632

  9. Synthetic RNAs for Gene Regulation: Design Principles and Computational Tools

    International Nuclear Information System (INIS)

    Laganà, Alessandro; Shasha, Dennis; Croce, Carlo Maria

    2014-01-01

    The use of synthetic non-coding RNAs for post-transcriptional regulation of gene expression has not only become a standard laboratory tool for gene functional studies but it has also opened up new perspectives in the design of new and potentially promising therapeutic strategies. Bioinformatics has provided researchers with a variety of tools for the design, the analysis, and the evaluation of RNAi agents such as small-interfering RNA (siRNA), short-hairpin RNA (shRNA), artificial microRNA (a-miR), and microRNA sponges. More recently, a new system for genome engineering based on the bacterial CRISPR-Cas9 system (Clustered Regularly Interspaced Short Palindromic Repeats), was shown to have the potential to also regulate gene expression at both transcriptional and post-transcriptional level in a more specific way. In this mini review, we present RNAi and CRISPRi design principles and discuss the advantages and limitations of the current design approaches.

  10. AT(1) receptor Gαq protein-independent signalling transcriptionally activates only a few genes directly, but robustly potentiates gene regulation from the β2-adrenergic receptor.

    Science.gov (United States)

    Christensen, Gitte L; Knudsen, Steen; Schneider, Mikael; Aplin, Mark; Gammeltoft, Steen; Sheikh, Søren P; Hansen, Jakob L

    2011-01-01

    The angiotensin II type 1 receptor (AT(1)R) is known to signal through heterotrimeric G proteins, and Gαq protein-independent signalling has only recently gained appreciation for profound impact on a diverse range of biological functions. β-Arrestins, among other central mediators of Gαq protein-independent signalling from the AT(1)R interact with transcriptional regulators and promote phosphorylation of nuclear proteins. However, the relative contribution of Gαq protein-independent signalling in AT(1)R mediated transcriptional regulation remains elusive. We here present a comprehensive comparative analysis of Gαq protein-dependent and -independent regulation of AT(1)R mediated gene expression. We found angiotensin II to regulate 212 genes, whereas Gαq-independent signalling obtained with the biased agonist, SII angiotensin II only regulated few genes. Interestingly, SII angiotensin II, like Ang II vastly potentiated β2-adrenergic receptor-stimulated gene expression. These novel findings indicate that the Gαq protein-independent signalling mainly modifies the transcriptional response governed by other signalling pathways, while direct induction of gene expression by the AT(1)R is dependent on classical Gαq protein activation. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  11. Intron retention as a component of regulated gene expression programs.

    Science.gov (United States)

    Jacob, Aishwarya G; Smith, Christopher W J

    2017-09-01

    Intron retention has long been an exemplar of regulated splicing with case studies of individual events serving as models that provided key mechanistic insights into the process of splicing control. In organisms such as plants and budding yeast, intron retention is well understood as a major mechanism of gene expression regulation. In contrast, in mammalian systems, the extent and functional significance of intron retention have, until recently, remained greatly underappreciated. Technical challenges to the global detection and quantitation of transcripts with retained introns have often led to intron retention being overlooked or dismissed as "noise". Now, however, with the wealth of information available from high-throughput deep sequencing, combined with focused computational and statistical analyses, we are able to distinguish clear intron retention patterns in various physiological and pathological contexts. Several recent studies have demonstrated intron retention as a central component of gene expression programs during normal development as well as in response to stress and disease. Furthermore, these studies revealed various ways in which intron retention regulates protein isoform production, RNA stability and translation efficiency, and rapid induction of expression via post-transcriptional splicing of retained introns. In this review, we highlight critical findings from these transcriptomic studies and discuss commonalties in the patterns prevalent in intron retention networks at the functional and regulatory levels.

  12. MAPK ERK signaling regulates the TGF-beta1-dependent mosquito response to Plasmodium falciparum.

    Science.gov (United States)

    Surachetpong, Win; Singh, Naresh; Cheung, Kong Wai; Luckhart, Shirley

    2009-04-01

    Malaria is caused by infection with intraerythrocytic protozoa of the genus Plasmodium that are transmitted by Anopheles mosquitoes. Although a variety of anti-parasite effector genes have been identified in anopheline mosquitoes, little is known about the signaling pathways that regulate these responses during parasite development. Here we demonstrate that the MEK-ERK signaling pathway in Anopheles is controlled by ingested human TGF-beta1 and finely tunes mosquito innate immunity to parasite infection. Specifically, MEK-ERK signaling was dose-dependently induced in response to TGF-beta1 in immortalized cells in vitro and in the A. stephensi midgut epithelium in vivo. At the highest treatment dose of TGF-beta1, inhibition of ERK phosphorylation increased TGF-beta1-induced expression of the anti-parasite effector gene nitric oxide synthase (NOS), suggesting that increasing levels of ERK activation negatively feed back on induced NOS expression. At infection levels similar to those found in nature, inhibition of ERK activation reduced P. falciparum oocyst loads and infection prevalence in A. stephensi and enhanced TGF-beta1-mediated control of P. falciparum development. Taken together, our data demonstrate that malaria parasite development in the mosquito is regulated by a conserved MAPK signaling pathway that mediates the effects of an ingested cytokine.

  13. MAPK ERK Signaling Regulates the TGF-β1-Dependent Mosquito Response to Plasmodium falciparum

    Science.gov (United States)

    Surachetpong, Win; Singh, Naresh; Cheung, Kong Wai; Luckhart, Shirley

    2009-01-01

    Malaria is caused by infection with intraerythrocytic protozoa of the genus Plasmodium that are transmitted by Anopheles mosquitoes. Although a variety of anti-parasite effector genes have been identified in anopheline mosquitoes, little is known about the signaling pathways that regulate these responses during parasite development. Here we demonstrate that the MEK-ERK signaling pathway in Anopheles is controlled by ingested human TGF-β1 and finely tunes mosquito innate immunity to parasite infection. Specifically, MEK-ERK signaling was dose-dependently induced in response to TGF-β1 in immortalized cells in vitro and in the A. stephensi midgut epithelium in vivo. At the highest treatment dose of TGF-β1, inhibition of ERK phosphorylation increased TGF-β1-induced expression of the anti-parasite effector gene nitric oxide synthase (NOS), suggesting that increasing levels of ERK activation negatively feed back on induced NOS expression. At infection levels similar to those found in nature, inhibition of ERK activation reduced P. falciparum oocyst loads and infection prevalence in A. stephensi and enhanced TGF-β1-mediated control of P. falciparum development. Taken together, our data demonstrate that malaria parasite development in the mosquito is regulated by a conserved MAPK signaling pathway that mediates the effects of an ingested cytokine. PMID:19343212

  14. Mig-6 regulates endometrial genes involved in cell cycle and progesterone signaling

    Energy Technology Data Exchange (ETDEWEB)

    Yoo, Jung-Yoon; Kim, Tae Hoon; Lee, Jae Hee [Department of Obstetrics, Gynecology & Reproductive Biology, Michigan State University, Grand Rapids, MI (United States); Dunwoodie, Sally L. [Developmental and Stem Cell Biology Division, Victor Chang Cardiac Research Institute, Darlinghurst, New South Wales 2010 (Australia); St. Vincent' s Clinical School and the School of Biotechnology and Biomolecular Sciences, University of New South Wales, Kensington, New South Wales 2033 (Australia); Ku, Bon Jeong, E-mail: bonjeong@cnu.ac.kr [Department of Internal Medicine, Chungnam National University School of Medicine, Daejeon (Korea, Republic of); Jeong, Jae-Wook, E-mail: JaeWook.Jeong@hc.msu.edu [Department of Obstetrics, Gynecology & Reproductive Biology, Michigan State University, Grand Rapids, MI (United States); Department of Women' s Health, Spectrum Health System, Grand Rapids, MI (United States)

    2015-07-10

    Mitogen inducible gene 6 (Mig-6) is an important mediator of progesterone (P4) signaling to inhibit estrogen (E2) signaling in the uterus. Ablation of Mig-6 in the murine uterus leads to the development of endometrial hyperplasia and E2-induced endometrial cancer. To identify the molecular pathways regulated by Mig-6, we performed microarray analysis on the uterus of ovariectomized Mig-6{sup f/f} and PGR{sup cre/+}Mig-6{sup f/f} (Mig-6{sup d/d}) mice treated with vehicle or P4 for 6 h. The results revealed that 772 transcripts were significantly regulated in the Mig-6{sup d/d} uterus treated with vehicle as compared with Mig-6{sup f/f} mice. The pathway analysis showed that Mig-6 suppressed the expression of gene-related cell cycle regulation in the absence of ovarian steroid hormone. The epithelium of Mig-6{sup d/d} mice showed a significant increase in the number of proliferative cells compared to Mig-6{sup f/f} mice. This microarray analysis also revealed that 324 genes are regulated by P4 as well as Mig-6. Cited2, the developmentally important transcription factor, was identified as being regulated by the P4-Mig-6 axis. To determine the role of Cited2 in the uterus, we used the mice with Cited2 that were conditionally ablated in progesterone receptor-positive cells (PGR{sup cre/+}Cited2{sup f/f}; Cited2{sup d/d}). Ablation of Cited2 in the uterus resulted in a significant reduction in the ability of the uterus to undergo a hormonally induced decidual reaction. Identification and analysis of these responsive genes will help define the role of P4 as well as Mig-6 in regulating uterine biology. - Highlights: • We identify Mig-6- and P4-regulated uterine genes by microarray analysis. • Mig-6 suppresses cell cycle progression and epithelial cell proliferation in uterus. • We identify the Mig-6 dependent induced genes by P4. • Cited2 plays an important role for decidualization as a P4 and Mig-6 target gene.

  15. Virulence meets metabolism: Cra and KdpE gene regulation in enterohemorrhagic Escherichia coli.

    Science.gov (United States)

    Njoroge, Jacqueline W; Nguyen, Y; Curtis, Meredith M; Moreira, Cristiano G; Sperandio, Vanessa

    2012-10-16

    Gastrointestinal (GI) bacteria sense diverse environmental signals as cues for differential gene regulation and niche adaptation. Pathogens such as enterohemorrhagic Escherichia coli (EHEC), which causes bloody diarrhea, use these signals for the temporal and energy-efficient regulation of their virulence factors. One of the main virulence strategies employed by EHEC is the formation of attaching and effacing (AE) lesions on enterocytes. Most of the genes necessary for the formation of these lesions are grouped within a pathogenicity island, the locus of enterocyte effacement (LEE), whose expression requires the LEE-encoded regulator Ler. Here we show that growth of EHEC in glycolytic environments inhibits the expression of ler and consequently all other LEE genes. Conversely, growth within a gluconeogenic environment activates expression of these genes. This sugar-dependent regulation is achieved through two transcription factors: KdpE and Cra. Both Cra and KdpE directly bind to the ler promoter, and Cra's affinity to this promoter is catabolite dependent. Moreover, we show that the Cra and KdpE proteins interact in vitro and that KdpE's ability to bind DNA is enhanced by the presence of Cra. Cra is important for AE lesion formation, and KdpE contributes to this Cra-dependent regulation. The deletion of cra and kdpE resulted in the ablation of AE lesions. One of the many challenges that bacteria face within the GI tract is to successfully compete for carbon sources. Linking carbon metabolism to the precise coordination of virulence expression is a key step in the adaptation of pathogens to the GI environment. IMPORTANCE An appropriate and prompt response to environmental cues is crucial for bacterial survival. Cra and KdpE are two proteins found in both nonpathogenic and pathogenic bacteria that regulate genes in response to differences in metabolite concentration. In this work, we show that, in the deadly pathogen enterohemorrhagic Escherichia coli (EHEC) O157:H7

  16. Current major advances in the regulation of milk protein gene expression.

    Science.gov (United States)

    Qian, Xi; Zhao, Feng-Qi

    2014-01-01

    During lactation, functionally differentiated mammary epithelial cells convert circulating nutrients into various milk components, providing all essential nutrients for the growth and development of mammal neonates. One of the major milk components is milk protein, which includes the casein and whey proteins. Regulation of milk protein gene expression is dependent on hormonal and developmental cues that modulate the activity of specific transcription factors and change the chromatin structure in mammary epithelial cells. Understanding the underlying mechanisms involved in mammary-specific milk protein gene regulation will help improve the yield, quality, and efficiency of milk production and identify important signaling factors and pathways involved in mammary development, differentiation, lactation, and disease. In this review we first review advances in the understanding of the regulatory mechanisms of milk protein genes by hormones, growth factors, and the extracellular matrix, with a focus on transcriptional regulation. We then discuss the relationship between chromatin structure and milk protein gene expression from an epigenetic perspective. Finally, we summarize recent achievements using the mammary gland as a bioreactor for producing pharmaceutical proteins for human use.

  17. Developmental transitions in Arabidopsis are regulated by antisense RNAs resulting from bidirectionally transcribed genes.

    Science.gov (United States)

    Krzyczmonik, Katarzyna; Wroblewska-Swiniarska, Agata; Swiezewski, Szymon

    2017-07-03

    Transcription terminators are DNA elements located at the 3' end of genes that ensure efficient cleavage of nascent RNA generating the 3' end of mRNA, as well as facilitating disengagement of elongating DNA-dependent RNA polymerase II. Surprisingly, terminators are also a potent source of antisense transcription. We have recently described an Arabidopsis antisense transcript originating from the 3' end of a master regulator of Arabidopsis thaliana seed dormancy DOG1. In this review, we discuss the broader implications of our discovery in light of recent developments in yeast and Arabidopsis. We show that, surprisingly, the key features of terminators that give rise to antisense transcription are preserved between Arabidopsis and yeast, suggesting a conserved mechanism. We also compare our discovery to known antisense-based regulatory mechanisms, highlighting the link between antisense-based gene expression regulation and major developmental transitions in plants.

  18. Genomic-wide transcriptional profiling in primary myoblasts reveals Runx1-regulated genes in muscle regeneration

    Directory of Open Access Journals (Sweden)

    Kfir Baruch Umansky

    2015-12-01

    Full Text Available In response to muscle damage the muscle adult stem cells are activated and differentiate into myoblasts that regenerate the damaged tissue. We have recently showed that following myopathic damage the level of the Runx1 transcription factor (TF is elevated and that during muscle regeneration this TF regulates the balance between myoblast proliferation and differentiation (Umansky et al.. We employed Runx1-dependent gene expression, Chromatin Immunoprecipitation sequencing (ChIP-seq, Assay for Transposase-Accessible Chromatin with high-throughput sequencing (ATAC-seq and histone H3K4me1/H3K27ac modification analyses to identify a subset of Runx1-regulated genes that are co-occupied by the TFs MyoD and c-Jun and are involved in muscle regeneration (Umansky et al.. The data is available at the GEO database under the superseries accession number GSE56131.

  19. Hedgehog signaling regulates gene expression in planarian glia.

    Science.gov (United States)

    Wang, Irving E; Lapan, Sylvain W; Scimone, M Lucila; Clandinin, Thomas R; Reddien, Peter W

    2016-09-09

    Hedgehog signaling is critical for vertebrate central nervous system (CNS) development, but its role in CNS biology in other organisms is poorly characterized. In the planarian Schmidtea mediterranea, hedgehog (hh ) is expressed in medial cephalic ganglia neurons, suggesting a possible role in CNS maintenance or regeneration. We performed RNA sequencing of planarian brain tissue following RNAi of hh and patched (ptc) , which encodes the Hh receptor. Two misregulated genes, intermediate filament-1 (if-1 ) and calamari (cali ), were expressed in a previously unidentified non-neural CNS cell type. These cells expressed orthologs of astrocyte-associated genes involved in neurotransmitter uptake and metabolism, and extended processes enveloping regions of high synapse concentration. We propose that these cells are planarian glia. Planarian glia were distributed broadly, but only expressed if-1 and cali in the neuropil near hh + neurons. Planarian glia and their regulation by Hedgehog signaling present a novel tractable system for dissection of glia biology.

  20. Thermodynamics-based models of transcriptional regulation with gene sequence.

    Science.gov (United States)

    Wang, Shuqiang; Shen, Yanyan; Hu, Jinxing

    2015-12-01

    Quantitative models of gene regulatory activity have the potential to improve our mechanistic understanding of transcriptional regulation. However, the few models available today have been based on simplistic assumptions about the sequences being modeled or heuristic approximations of the underlying regulatory mechanisms. In this work, we have developed a thermodynamics-based model to predict gene expression driven by any DNA sequence. The proposed model relies on a continuous time, differential equation description of transcriptional dynamics. The sequence features of the promoter are exploited to derive the binding affinity which is derived based on statistical molecular thermodynamics. Experimental results show that the proposed model can effectively identify the activity levels of transcription factors and the regulatory parameters. Comparing with the previous models, the proposed model can reveal more biological sense.

  1. Dynamic regulation of cerebral DNA repair genes by psychological stress

    DEFF Research Database (Denmark)

    Forsberg, Kristin; Aalling, Nadia; Wörtwein, Gitta

    2015-01-01

    for maintaining genomic integrity. The aim of the present study was to characterize the pattern of cerebral DNA repair enzyme regulation after stress through the quantification of a targeted range of gene products involved in different types of DNA repair. 72 male Sprague-Dawley rats were subjected to either......Neuronal genotoxic insults from oxidative stress constitute a putative molecular link between stress and depression on the one hand, and cognitive dysfunction and dementia risk on the other. Oxidative modifications to DNA are repaired by specific enzymes; a process that plays a critical role...... restraint stress (6h/day) or daily handling (controls), and sacrificed after 1, 7 or 21 stress sessions. The mRNA expression of seven genes (Ogg1, Ape1, Ung1, Neil1, Xrcc1, Ercc1, Nudt1) involved in the repair of oxidatively damaged DNA was determined by quantitative real time polymerase chain reaction...

  2. Structure and Chromosomal Organization of Yeast Genes Regulated by Topoisomerase II.

    Science.gov (United States)

    Joshi, Ricky S; Nikolaou, Christoforos; Roca, Joaquim

    2018-01-03

    Cellular DNA topoisomerases (topo I and topo II) are highly conserved enzymes that regulate the topology of DNA during normal genome transactions, such as DNA transcription and replication. In budding yeast, topo I is dispensable whereas topo II is essential, suggesting fundamental and exclusive roles for topo II, which might include the functions of the topo IIa and topo IIb isoforms found in mammalian cells. In this review, we discuss major findings of the structure and chromosomal organization of genes regulated by topo II in budding yeast. Experimental data was derived from short (10 min) and long term (120 min) responses to topo II inactivation in top-2 ts mutants. First, we discuss how short term responses reveal a subset of yeast genes that are regulated by topo II depending on their promoter architecture. These short term responses also uncovered topo II regulation of transcription across multi-gene clusters, plausibly by common DNA topology management. Finally, we examine the effects of deactivated topo II on the elongation of RNA transcripts. Each study provides an insight into the particular chromatin structure that interacts with the activity of topo II. These findings are of notable clinical interest as numerous anti-cancer therapies interfere with topo II activity.

  3. Gibberellic acid and cGMP-dependent transcriptional regulation in arabidopsis thaliana

    KAUST Repository

    Bastian, René

    2010-03-01

    An ever increasing amount of transcriptomic data and analysis tools provide novel insight into complex responses of biological systems. Given these resources we have undertaken to review aspects of transcriptional regulation in response to the plant hormone gibberellic acid (GA) and its second messenger guanosine 3\\',5\\'-cyclic monophosphate (cGMP) in Arabidopsis thaliana, both wild type and selected mutants. Evidence suggests enrichment of GA-responsive (GARE) elements in promoters of genes that are transcriptionally upregulated in response to cGMP but downregulated in a GA insensitive mutant (ga1-3). In contrast, in the genes upregulated in the mutant, no enrichment in the GARE is observed suggesting that GARE motifs are diagnostic for GA-induced and cGMP-dependent transcriptional upregulation. Further, we review how expression studies of GA-dependent transcription factors and transcriptional networks based on common promoter signatures derived from ab initio analyses can contribute to our understanding of plant responses at the systems level. © 2010 Landes Bioscience.

  4. SUPERMAN, a regulator of floral homeotic genes in Arabidopsis.

    Science.gov (United States)

    Bowman, J L; Sakai, H; Jack, T; Weigel, D; Mayer, U; Meyerowitz, E M

    1992-03-01

    We describe a locus, SUPERMAN, mutations in which result in extra stamens developing at the expense of the central carpels in the Arabidopsis thaliana flower. The development of superman flowers, from initial primordium to mature flower, is described by scanning electron microscopy. The development of doubly and triply mutant strains, constructed with superman alleles and previously identified homeotic mutations that cause alterations in floral organ identity, is also described. Essentially additive phenotypes are observed in superman agamous and superman apetala2 double mutants. The epistatic relationships observed between either apetala3 or pistillata and superman alleles suggest that the SUPERMAN gene product could be a regulator of these floral homeotic genes. To test this, the expression patterns of AGAMOUS and APETALA3 were examined in superman flowers. In wild-type flowers, APETALA3 expression is restricted to the second and third whorls where it is required for the specification of petals and stamens. In contrast, in superman flowers, APETALA3 expression expands to include most of the cells that would normally constitute the fourth whorl. This ectopic APETALA3 expression is proposed to be one of the causes of the development of the extra stamens in superman flowers. The spatial pattern of AGAMOUS expression remains unaltered in superman flowers as compared to wild-type flowers. Taken together these data indicate that one of the functions of the wild-type SUPERMAN gene product is to negatively regulate APETALA3 in the fourth whorl of the flower. In addition, superman mutants exhibit a loss of determinacy of the floral meristem, an effect that appears to be mediated by the APETALA3 and PISTILLATA gene products.

  5. Up-regulation of SNCA gene expression: implications to synucleinopathies.

    Science.gov (United States)

    Tagliafierro, L; Chiba-Falek, O

    2016-07-01

    Synucleinopathies are a group of neurodegenerative diseases that share a common pathological lesion of intracellular protein inclusions largely composed by aggregates of alpha-synuclein protein. Accumulating evidence, including genome wide association studies, has implicated alpha-synuclein (SNCA) gene in the etiology of synucleinopathies. However, the precise variants within SNCA gene that contribute to the sporadic forms of Parkinson's disease (PD), dementia with Lewy bodies (DLB), multiple system atrophy (MSA), and other synucleinopathies and their molecular mechanisms of action remain elusive. It has been suggested that SNCA expression levels are critical for the development of these diseases. Here, we review several model systems that have been developed to advance the understanding of the role of SNCA expression levels in the etiology of synucleinopathies. We also describe different molecular mechanisms that regulate SNCA gene expression and discuss possible strategies for SNCA down-regulation as means for therapeutic approaches. Finally, we highlight some examples that underscore the relationships between the genetic association findings and the regulatory mechanisms of SNCA expression, which suggest that genetic variability in SNCA locus is directly responsible, at least in part, to the changes in gene expression and explain the reported associations of SNCA with synucleinopathies. Future studies utilizing induced pluripotent stem cells (iPSCs)-derived neuronal lines and genome editing by CRISPR/Cas9, will allow us to validate, characterize, and manipulate the effects of particular cis-genetic variants on SNCA expression. Moreover, this model system will enable us to compare different neuronal and glial lineages involved in synucleinopathies representing an attractive strategy to elucidate-common and specific-SNCA-genetic variants, regulatory mechanisms, and vulnerable expression levels underlying synucleinopathy spectrum disorders. This forthcoming

  6. VHL-dependent regulation of a β-dystroglycan glycoform and glycogene expression in renal cancer.

    Science.gov (United States)

    Aggelis, Vassilis; Craven, Rachel A; Peng, Jianhe; Harnden, Patricia; Schaffer, Lana; Hernandez, Gilberto E; Head, Steven R; Maher, Eamonn R; Tonge, Robert; Selby, Peter J; Banks, Rosamonde E

    2013-11-01

    Identification of novel biomarkers and targets in renal cell carcinoma (RCC) remains a priority and one cellular compartment that is a rich potential source of such molecules is the plasma membrane. A shotgun proteomic analysis of cell surface proteins enriched by cell surface biotinylation and avidin affinity chromatography was explored using the UMRC2- renal cancer cell line, which lacks von Hippel-Lindau (VHL) tumour suppressor gene function, to determine whether proteins of interest could be detected. Of the 814 proteins identified ~22% were plasma membrane or membrane-associated, including several with known associations with cancer. This included β-dystroglycan, the transmembrane subunit of the DAG1 gene product. VHL-dependent changes in the form of β-dystroglycan were detected in UMRC2-/+VHL transfectants. Deglycosylation experiments showed that this was due to differential sialylation. Analysis of normal kidney cortex and conventional RCC tissues showed that a similar change also occurred in vivo. Investigation of the expression of genes involved in glycosylation in UMRC2-/+VHL cells using a focussed microarray highlighted a number of enzymes involved in sialylation; upregulation of bifunctional UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase (GNE) was validated in UMRC2- cells compared with their +VHL counterparts and also found in conventional RCC tissue. These results implicate VHL in the regulation of glycosylation and raise interesting questions regarding the extent and importance of such changes in RCC.

  7. Dynamic model of gene regulation for the lac operon

    Science.gov (United States)

    Angelova, Maia; Ben-Halim, Asma

    2011-03-01

    Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.

  8. Dynamic model of gene regulation for the lac operon

    International Nuclear Information System (INIS)

    Angelova, Maia; Ben-Halim, Asma

    2011-01-01

    Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.

  9. Dynamical Processes in Ageing, Gene Regulation and Communication

    DEFF Research Database (Denmark)

    Bendtsen, Kristian Moss

    project we constructed a mathematical model and showed that if DNA damage is primarily caused by geno-toxic agents, it would be advantageous for cells to have a fragile DNA repair mechanism. The second part of my Ph.D. thesis covers gene regulation. In the first project we show how RNA polymerase can...... is that unstable activation and stable repression is a requirement for the motif to produce oscillations. The last part of this thesis studies the emergence of communication networks. In this study we constructed a simple e-mail game. E-mails from two session with 16 players, who had never met before, showed how...

  10. Gene Regulation and Quality Control in Murine Polyomavirus Infection

    Directory of Open Access Journals (Sweden)

    Gordon G. Carmichael

    2016-10-01

    Full Text Available Murine polyomavirus (MPyV infects mouse cells and is highly oncogenic in immunocompromised hosts and in other rodents. Its genome is a small, circular DNA molecule of just over 5000 base pairs and it encodes only seven polypeptides. While seemingly simply organized, this virus has adopted an unusual genome structure and some unusual uses of cellular quality control pathways that, together, allow an amazingly complex and varied pattern of gene regulation. In this review we discuss how MPyV leverages these various pathways to control its life cycle.

  11. Dynamical Processes in Ageing, Gene Regulation and Communication

    DEFF Research Database (Denmark)

    Bendtsen, Kristian Moss

    My thesis consists of three parts. The first part covers ageing phenomena. In the first project I measured the mobility of two DNA repair proteins. Contrasting diffusion coefficients from literature I was able to classify DNA repair protein into either "scanners" or "responders". In a second...... project we constructed a mathematical model and showed that if DNA damage is primarily caused by geno-toxic agents, it would be advantageous for cells to have a fragile DNA repair mechanism. The second part of my Ph.D. thesis covers gene regulation. In the first project we show how RNA polymerase can...

  12. Structural Basis for Bc12-Regulated Mitochondrion-Dependent Apoptosis

    National Research Council Canada - National Science Library

    Marassi, Francesca M

    2005-01-01

    ...; by dimerization with other Bcl-2 family members; by binding to other non-homologous proteins; and by formation of membrane pores that are believed to regulate apoptosis by perturbing mitochondrial physiology...

  13. Shh regulates chick Ebf1 gene expression in somite development.

    Science.gov (United States)

    El-Magd, Mohammed Abu; Allen, Steve; McGonnell, Imelda; Mansour, Ali A; Otto, Anthony; Patel, Ketan

    2015-01-01

    The chick early B-cell factor 1 (cEbf1) is a member of EBF family of helix loop helix transcription factors. Recently, we have proved that cEbf1 expression in feather is regulated by Shh. It is therefore possible that the somitic expression of cEbf1 is controlled by Shh signals from the notochord. To assess this hypothesis, the expression profile of cEbf1 was first detailed in somites of chick embryos (from HH8 to HH28). cEbf1 expression was mainly localised in the medial sclerotome and later around the vertebral cartilage anlagen of body and pedicles. Tissue manipulations (notochord ablation) and Shh gain and loss of function experiments were then performed to analyse whether the notochord and/or Shh regulate cEbf1 expression. Results from these experiments confirmed our hypothesis that the medial somitic expression of cEbf1 is regulated by Shh from the notochord. In conclusion, cEbf1 gene is considered as a medial sclerotome marker, downstream to and regulated by the notochord derived Shh, which may be functionally involved in somitogenesis. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. Gene expression in human hippocampus from cocaine abusers identifies genes which regulate extracellular matrix remodeling.

    Directory of Open Access Journals (Sweden)

    Deborah C Mash

    2007-11-01

    Full Text Available The chronic effects of cocaine abuse on brain structure and function are blamed for the inability of most addicts to remain abstinent. Part of the difficulty in preventing relapse is the persisting memory of the intense euphoria or cocaine "rush". Most abused drugs and alcohol induce neuroplastic changes in brain pathways subserving emotion and cognition. Such changes may account for the consolidation and structural reconfiguration of synaptic connections with exposure to cocaine. Adaptive hippocampal plasticity could be related to specific patterns of gene expression with chronic cocaine abuse. Here, we compare gene expression profiles in the human hippocampus from cocaine addicts and age-matched drug-free control subjects. Cocaine abusers had 151 gene transcripts upregulated, while 91 gene transcripts were downregulated. Topping the list of cocaine-regulated transcripts was RECK in the human hippocampus (FC = 2.0; p<0.05. RECK is a membrane-anchored MMP inhibitor that is implicated in the coordinated regulation of extracellular matrix integrity and angiogenesis. In keeping with elevated RECK expression, active MMP9 protein levels were decreased in the hippocampus from cocaine abusers. Pathway analysis identified other genes regulated by cocaine that code for proteins involved in the remodeling of the cytomatrix and synaptic connections and the inhibition of blood vessel proliferation (PCDH8, LAMB1, ITGB6, CTGF and EphB4. The observed microarray phenotype in the human hippocampus identified RECK and other region-specific genes that may promote long-lasting structural changes with repeated cocaine abuse. Extracellular matrix remodeling in the hippocampus may be a persisting effect of chronic abuse that contributes to the compulsive and relapsing nature of cocaine addiction.

  15. Whole-exome sequencing and homozygosity analysis implicate depolarization-regulated neuronal genes in autism.

    Directory of Open Access Journals (Sweden)

    Maria H Chahrour

    Full Text Available Although autism has a clear genetic component, the high genetic heterogeneity of the disorder has been a challenge for the identification of causative genes. We used homozygosity analysis to identify probands from nonconsanguineous families that showed evidence of distant shared ancestry, suggesting potentially recessive mutations. Whole-exome sequencing of 16 probands revealed validated homozygous, potentially pathogenic recessive mutations that segregated perfectly with disease in 4/16 families. The candidate genes (UBE3B, CLTCL1, NCKAP5L, ZNF18 encode proteins involved in proteolysis, GTPase-mediated signaling, cytoskeletal organization, and other pathways. Furthermore, neuronal depolarization regulated the transcription of these genes, suggesting potential activity-dependent roles in neurons. We present a multidimensional strategy for filtering whole-exome sequence data to find candidate recessive mutations in autism, which may have broader applicability to other complex, heterogeneous disorders.

  16. Quorum Sensing Gene Regulation by LuxR/HapR Master Regulators in Vibrios.

    Science.gov (United States)

    Ball, Alyssa S; Chaparian, Ryan R; van Kessel, Julia C

    2017-10-01

    The coordination of group behaviors in bacteria is accomplished via the cell-cell signaling process called quorum sensing. Vibrios have historically been models for studying bacterial communication due to the diverse and remarkable behaviors controlled by quorum sensing in these bacteria, including bioluminescence, type III and type VI secretion, biofilm formation, and motility. Here, we discuss the Vibrio LuxR/HapR family of proteins, the master global transcription factors that direct downstream gene expression in response to changes in cell density. These proteins are structurally similar to TetR transcription factors but exhibit distinct biochemical and genetic features from TetR that determine their regulatory influence on the quorum sensing gene network. We review here the gene groups regulated by LuxR/HapR and quorum sensing and explore the targets that are common and unique among Vibrio species. Copyright © 2017 American Society for Microbiology.

  17. WEREWOLF, a MYB-related protein in Arabidopsis, is a position-dependent regulator of epidermal cell patterning.

    Science.gov (United States)

    Lee, M M; Schiefelbein, J

    1999-11-24

    The formation of the root epidermis of Arabidopsis provides a simple and elegant model for the analysis of cell patterning. A novel gene, WEREWOLF (WER), is described here that is required for position-dependent patterning of the epidermal cell types. The WER gene encodes a MYB-type protein and is preferentially expressed within cells destined to adopt the non-hair fate. Furthermore, WER is shown to regulate the position-dependent expression of the GLABRA2 homeobox gene, to interact with a bHLH protein, and to act in opposition to the CAPRICE MYB. These results suggest a simple model to explain the specification of the two root epidermal cell types, and they provide insight into the molecular mechanisms used to control cell patterning.

  18. Hypoxia favors myosin heavy chain beta gene expression in an Hif-1alpha-dependent manner.

    Science.gov (United States)

    Binó, Lucia; Procházková, Jiřina; Radaszkiewicz, Katarzyna Anna; Kučera, Jan; Kudová, Jana; Pacherník, Jiří; Kubala, Lukáš

    2017-10-13

    The potentiation of the naturally limited regenerative capacity of the heart is dependent on an understanding of the mechanisms that are activated in response to pathological conditions such as hypoxia. Under these conditions, the expression of genes suggested to support cardiomyocyte survival and heart adaptation is triggered. Particularly important are changes in the expression of myosin heavy chain (MHC) isoforms. We propose here that alterations in the expression profiles of MHC genes are induced in response to hypoxia and are primarily mediated by hypoxia inducible factor (HIF). In in vitro models of mouse embryonic stem cell-derived cardiomyocytes, we showed that hypoxia (1% O 2 ) or the pharmacological stabilization of HIFs significantly increased MHCbeta ( Myh7 ) gene expression. The key role of HIF-1alpha is supported by the absence of these effects in HIF-1alpha-deficient cells, even in the presence of HIF-2alpha. Interestingly, ChIP analysis did not confirm the direct interaction of HIF-1alpha with putative HIF response elements predicted in the MHCalpha and beta encoding DNA region. Further analyses showed the significant effect of the mTOR signaling inhibitor rapamycin in inducing Myh7 expression and a hypoxia-triggered reduction in the levels of antisense RNA transcripts associated with the Myh7 gene locus. Overall, the recognized and important role of HIF in the regulation of heart regenerative processes could be highly significant for the development of novel therapeutic interventions in heart failure.

  19. Poly(C)-binding proteins as transcriptional regulators of gene expression

    International Nuclear Information System (INIS)

    Choi, Hack Sun; Hwang, Cheol Kyu; Song, Kyu Young; Law, P.-Y.; Wei, L.-N.; Loh, Horace H.

    2009-01-01

    Poly(C)-binding proteins (PCBPs) are generally known as RNA-binding proteins that interact in a sequence-specific fashion with single-stranded poly(C). They can be divided into two groups: hnRNP K and PCBP1-4. These proteins are involved mainly in various posttranscriptional regulations (e.g., mRNA stabilization or translational activation/silencing). In this review, we summarize and discuss how PCBPs act as transcriptional regulators by binding to specific elements in gene promoters that interact with the RNA polymerase II transcription machinery. Transcriptional regulation of PCBPs might itself be regulated by their localization within the cell. For example, activation by p21-activated kinase 1 induces increased nuclear retention of PCBP1, as well as increased promoter activity. PCBPs can function as a signal-dependent and coordinated regulator of transcription in eukaryotic cells. We address the molecular mechanisms by which PCBPs binding to single- and double-stranded DNA mediates gene expression.

  20. KAP1 regulates type I interferon/STAT1-mediated IRF-1 gene expression

    International Nuclear Information System (INIS)

    Kamitani, Shinya; Ohbayashi, Norihiko; Ikeda, Osamu; Togi, Sumihito; Muromoto, Ryuta; Sekine, Yuichi; Ohta, Kazuhide; Ishiyama, Hironobu; Matsuda, Tadashi

    2008-01-01

    Signal transducers and activators of transcription (STATs) mediate cell proliferation, differentiation, and survival in immune responses, hematopoiesis, neurogenesis, and other biological processes. Recently, we showed that KAP1 is a novel STAT-binding partner that regulates STAT3-mediated transactivation. KAP1 is a universal co-repressor protein for the KRAB zinc finger protein superfamily of transcriptional repressors. In this study, we found KAP1-dependent repression of interferon (IFN)/STAT1-mediated signaling. We also demonstrated that endogenous KAP1 associates with endogenous STAT1 in vivo. Importantly, a small-interfering RNA-mediated reduction in KAP1 expression enhanced IFN-induced STAT1-dependent IRF-1 gene expression. These results indicate that KAP1 may act as an endogenous regulator of the IFN/STAT1 signaling pathway

  1. The role of the epigenetic signal, DNA methylation, in gene regulation during erythroid development.

    Science.gov (United States)

    Ginder, Gordon D; Gnanapragasam, Merlin N; Mian, Omar Y

    2008-01-01

    The sequence complexity of the known vertebrate genomes alone is insufficient to account for the diversity between individuals of a species. Although our knowledge of vertebrate biology has evolved substantially with the growing compilation of sequenced genomes, understanding the temporal and spatial regulation of genes remains fundamental to fully exploiting this information. The importance of epigenetic factors in gene regulation was first hypothesized decades ago when biologists posited that methylation of DNA could heritably alter gene expression [Holliday and Pugh, 1975. Science 187(4173), 226-232; Riggs, 1975. Cytogenet. and Cell Genet.14(1), 9-25; Scarano et al., 1967. Proc. Natl. Acad. Sci. USA 57(5), 1394-1400)]. It was subsequently shown that vertebrate DNA methylation, almost exclusively at the 5' position of cytosine in the dinucleotide CpG, played a role in a number of processes including embryonic development, genetic imprinting, cell differentiation, and tumorigenesis. At the time of this writing, a large and growing list of genes is known to exhibit DNA methylation-dependent regulation, and we understand in some detail the mechanisms employed by cells in using methylation as a regulatory modality. In this context, we revisit one of the original systems in which the role of DNA methylation in vertebrate gene regulation during development was described and studied: erythroid cells. We briefly review the recent advances in our understanding of DNA methylation and, in particular, its regulatory role in red blood cells during differentiation and development. We also address DNA methylation as a component of erythroid chromatin architecture, and the interdependence of CpG methylation and histone modification.

  2. Prolyl hydroxylase-1 regulates hepatocyte apoptosis in an NF-κB-dependent manner

    Energy Technology Data Exchange (ETDEWEB)

    Fitzpatrick, Susan F.; Fábián, Zsolt; Schaible, Bettina; Lenihan, Colin R.; Schwarzl, Thomas [School of Medicine and Medical Science, The Conway Institute, University College Dublin, Belfield, Dublin 4 Ireland (Ireland); Rodriguez, Javier [Systems Biology Ireland, University College Dublin, Dublin 4 (Ireland); Zheng, Xingnan; Li, Zongwei [Lineberger Comprehensive Cancer Center, University of North Carolina School of Medicine, Chapel Hill, NC (United States); Tambuwala, Murtaza M. [School of Pharmacy and Pharmaceutical Sciences, Ulster University, Coleraine, BT52 1SA, Northern Ireland (United Kingdom); Higgins, Desmond G.; O' Meara, Yvonne [School of Medicine and Medical Science, The Conway Institute, University College Dublin, Belfield, Dublin 4 Ireland (Ireland); Slattery, Craig [School of Biomolecular and Biomedical Science, The Conway Institute, University College Dublin, Belfield, Dublin 4 Ireland (Ireland); Manresa, Mario C. [School of Medicine and Medical Science, The Conway Institute, University College Dublin, Belfield, Dublin 4 Ireland (Ireland); Fraisl, Peter; Bruning, Ulrike [Laboratory of Angiogenesis and Vascular Metabolism, Department of Oncology, University of Leuven, Vesalius Research Center, VIB, B-3000 (Belgium); Baes, Myriam [Laboratory for Cell Metabolism, Department of Pharmaceutical and Pharmacological Sciences, KU Leuven (Belgium); Carmeliet, Peter; Doherty, Glen [Laboratory of Angiogenesis and Vascular Metabolism, Department of Oncology, University of Leuven, Vesalius Research Center, VIB, B-3000 (Belgium); Kriegsheim, Alex von [Systems Biology Ireland, University College Dublin, Dublin 4 (Ireland); Cummins, Eoin P. [School of Medicine and Medical Science, The Conway Institute, University College Dublin, Belfield, Dublin 4 Ireland (Ireland); and others

    2016-06-03

    Hepatocyte death is an important contributing factor in a number of diseases of the liver. PHD1 confers hypoxic sensitivity upon transcription factors including the hypoxia inducible factor (HIF) and nuclear factor-kappaB (NF-κB). Reduced PHD1 activity is linked to decreased apoptosis. Here, we investigated the underlying mechanism(s) in hepatocytes. Basal NF-κB activity was elevated in PHD1{sup −/−} hepatocytes compared to wild type controls. ChIP-seq analysis confirmed enhanced binding of NF-κB to chromatin in regions proximal to the promoters of genes involved in the regulation of apoptosis. Inhibition of NF-κB (but not knock-out of HIF-1 or HIF-2) reversed the anti-apoptotic effects of pharmacologic hydroxylase inhibition. We hypothesize that PHD1 inhibition leads to altered expression of NF-κB-dependent genes resulting in reduced apoptosis. This study provides new information relating to the possible mechanism of therapeutic action of hydroxylase inhibitors that has been reported in pre-clinical models of intestinal and hepatic disease. -- Highlights: •Genetic ablation of PHD1 upregulates NF-kappaB (NF-κB) in hepatocytes. •Activation of NF-κB leads to differential DNA-binding of p50/p65 and results in differential regulation of apoptotic genes. •We identified proline 191 in the beta subunit of the I-kappaB kinase as a target for PHD1-mediated hydroxylation. •Blockade of prolyl-4-hydroxylases has been found cytoprotective in liver cells.

  3. Neuronal identity genes regulated by super-enhancers are preferentially down-regulated in the striatum of Huntington's disease mice.

    Science.gov (United States)

    Achour, Mayada; Le Gras, Stéphanie; Keime, Céline; Parmentier, Frédéric; Lejeune, François-Xavier; Boutillier, Anne-Laurence; Néri, Christian; Davidson, Irwin; Merienne, Karine

    2015-06-15

    Huntington's disease (HD) is a neurodegenerative disease associated with extensive down-regulation of genes controlling neuronal function, particularly in the striatum. Whether altered epigenetic regulation underlies transcriptional defects in HD is unclear. Integrating RNA-sequencing (RNA-seq) and chromatin-immunoprecipitation followed by massively parallel sequencing (ChIP-seq), we show that down-regulated genes in HD mouse striatum associate with selective decrease in H3K27ac, a mark of active enhancers, and RNA Polymerase II (RNAPII). In addition, we reveal that decreased genes in HD mouse striatum display a specific epigenetic signature, characterized by high levels and broad patterns of H3K27ac and RNAPII. Our results indicate that this signature is that of super-enhancers, a category of broad enhancers regulating genes defining tissue identity and function. Specifically, we reveal that striatal super-enhancers display extensive H3K27 acetylation within gene bodies, drive transcription characterized by low levels of paused RNAPII, regulate neuronal function genes and are enriched in binding motifs for Gata transcription factors, such as Gata2 regulating striatal identity genes. Together, our results provide evidence for preferential down-regulation of genes controlled by super-enhancers in HD striatum and indicate that enhancer topography is a major parameter determining the propensity of a gene to be deregulated in a neurodegenerative disease. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  4. Expression of conjoined genes: another mechanism for gene regulation in eukaryotes.

    Directory of Open Access Journals (Sweden)

    Tulika Prakash

    Full Text Available From the ENCODE project, it is realized that almost every base of the entire human genome is transcribed. One class of transcripts resulting from this arises from the conjoined gene, which is formed by combining the exons of two or more distinct (parent genes lying on the same strand of a chromosome. Only a very limited number of such genes are known, and the definition and terminologies used for them are highly variable in the public databases. In this work, we have computationally identified and manually curated 751 conjoined genes (CGs in the human genome that are supported by at least one mRNA or EST sequence available in the NCBI database. 353 representative CGs, of which 291 (82% could be confirmed, were subjected to experimental validation using RT-PCR and sequencing methods. We speculate that these genes are arising out of novel functional requirements and are not merely artifacts of transcription, since more than 70% of them are conserved in other vertebrate genomes. The unique splicing patterns exhibited by CGs reveal their possible roles in protein evolution or gene regulation. Novel CGs, for which no transcript is available, could be identified in 80% of randomly selected potential CG forming regions, indicating that their formation is a routine process. Formation of CGs is not only limited to human, as we have also identified 270 CGs in mouse and 227 in drosophila using our approach. Additionally, we propose a novel mechanism for the formation of CGs. Finally, we developed a database, ConjoinG, which contains detailed information about all the CGs (800 in total identified in the human genome. In summary, our findings reveal new insights about the functionality of CGs in terms of another possible mechanism for gene regulation and genomic evolution and the mechanism leading to their formation.

  5. Inter-chromosomal gene regulation in the mammalian cell nucleus.

    Science.gov (United States)

    de Laat, Wouter; Grosveld, Frank

    2007-10-01

    Cellular phenotypes can critically rely on mono-allelic gene expression. Recent studies suggest that in mammalian cells inter-chromosomal DNA interactions may mediate the decision which allele to activate and which to silence. Here, these findings are discussed in the context of knowledge on gene competition, chromatin dynamics, and nuclear organization. We argue that data obtained by 4C technology strongly support the idea that chromatin folds according to self-organizing principles. In this concept, the nuclear positioning of a given locus is probabilistic as it also depends on the properties of neighbouring DNA segments and, by extrapolation, the whole chromosome. The linear distribution of repetitive DNA sequences and of active and inactive DNA regions is important for the folding and relative positioning of chromosomes. This stochastic concept of nuclear organization predicts that tissue-specific interactions between two selected loci present on different chromosomes will be rare.

  6. An alternative pathway for gene regulation by Myc

    DEFF Research Database (Denmark)

    Peukert, K; Staller, P; Schneider, A

    1997-01-01

    The c-Myc protein activates transcription as part of a heteromeric complex with Max. However, Myc-transformed cells are characterized by loss of expression of several genes, suggesting that Myc may also repress gene expression. Two-hybrid cloning identifies a novel POZ domain Zn finger protein (Miz......-1; Myc-interacting Zn finger protein-1) that specifically interacts with Myc, but not with Max or USF. Miz-1 binds to start sites of the adenovirus major late and cyclin D1 promoters and activates transcription from both promoters. Miz-1 has a potent growth arrest function. Binding of Myc to Miz-1...... requires the helix-loop-helix domain of Myc and a short amphipathic helix located in the carboxy-terminus of Miz-1. Expression of Myc inhibits transactivation, overcomes Miz-1-induced growth arrest and renders Miz-1 insoluble in vivo. These processes depend on Myc and Miz-1 association and on the integrity...

  7. EBF2 regulates osteoblast-dependent differentiation of osteoclasts

    DEFF Research Database (Denmark)

    Kieslinger, Matthias; Folberth, Stephanie; Dobreva, Gergana

    2005-01-01

    of osteoclast differentiation. We find that mice homozygous for a targeted inactivation of Ebf2 show reduced bone mass and an increase in the number of osteoclasts. These defects are accompanied by a marked downregulation of the osteoprotegerin (Opg) gene, encoding a RANK decoy receptor. EBF2 binds to sequences...

  8. Pyroglutamylated RF-amide peptide (QRFP) gene is regulated by metabolic endotoxemia.

    Science.gov (United States)

    Jossart, Christian; Mulumba, Mukandila; Granata, Riccarda; Gallo, Davide; Ghigo, Ezio; Marleau, Sylvie; Servant, Marc J; Ong, Huy

    2014-01-01

    Pyroglutamylated RF-amide peptide (QRFP) is involved in the regulation of food intake, thermogenesis, adipogenesis, and lipolysis. The expression of QRFP in adipose tissue is reduced in diet-induced obesity, a mouse model in which plasma concentrations of endotoxins are slightly elevated. The present study investigated the role of metabolic endotoxemia (ME) on QRFP gene regulation. Our results uncovered the expression of QRFP in murine macrophages and cell lines. This expression has been found to be decreased in mice with ME. Low doses of lipopolysaccharide (LPS) transiently down-regulated QRFP by 59% in RAW264.7 macrophages but not in 3T3-L1 adipocytes. The effect of LPS on QRFP expression in macrophages was dependent on the inhibitor of kB kinase and TIR-domain-containing adapter-inducing interferon (IFN)-β (TRIF) but not myeloid differentiation primary response gene 88. IFN-β was induced by ME in macrophages. IFN-β sustainably reduced QRFP expression in macrophages (64%) and adipocytes (49%). IFN-γ down-regulated QRFP (74%) in macrophages only. Both IFNs inhibited QRFP secretion from macrophages. LPS-stimulated macrophage-conditioned medium reduced QRFP expression in adipocytes, an effect blocked by IFN-β neutralizing antibody. The effect of IFN-β on QRFP expression was dependent on phosphoinositide 3-kinase, p38 MAPK, and histone deacetylases. The effect of IFN-γ was dependent on MAPK/ERK kinase 1/2 and histone deacetylases. Macrophage-conditioned medium containing increased amounts of QRFP preserved adipogenesis in adipocytes. In conclusion, LPS induces IFN-β release from macrophages, which reduces QRFP expression in both macrophages and adipocytes in an autocrine/paracrine-dependent manner, suggesting QRFP as a potential biomarker in ME.

  9. Diverse patterns of cyclooxygenase-independent metalloproteinase gene regulation in human monocytes.

    Science.gov (United States)

    Reel, Buket; Sala-Newby, Graciela B; Huang, Wei-Chun; Newby, Andrew C

    2011-08-01

    BACKGROUND AND PURPOSE Matrix metalloproteinase (MMP) production from monocyte/macrophages is implicated in matrix remodelling and modulation of inflammation. However, knowledge of the patterns and mechanisms of gene regulation of MMPs and their endogenous tissue inhibitors (TIMPs) is fragmentary. MMP up-regulation may be a target for cyclooxygenase (COX) and prostaglandin (PG) receptor inhibition, but the extent and mechanisms of COX-independent MMP up-regulation are unclear. EXPERIMENTAL APPROACH We studied MMP mRNA expression and selected protein levels in human peripheral blood monocytes before and after adhesion, upon stimulation with bacterial lipopolysaccharide (LPS), PGE(2) or forskolin and after culturing with monocyte colony-stimulating factor on plastic or human fibronectin for up to 7 days. KEY RESULTS Monocyte adherence for 2 h transiently up-regulated COX-2, MMP-1, MMP-7 and MMP-10 mRNAs, and persistently up-regulated MMP-2, MMP-9, MMP-14 and MMP-19 mRNAs. LPS, PGE(2) or forskolin selectively increased MMP-1, MMP-9, MMP-10, MMP-12 and MMP-14 mRNAs. LPS increased PGE(2) production through COX but up-regulated MMP levels independently of COX. Differential dependence on inhibition of p42/44 and p38 mitogen-activated protein kinases, c-jun N-terminal kinase and inhibitor of κB kinase2 paralleled the diverse patterns of MMP stimulation by LPS. Differentiation on plastic increased mRNA levels of MMP-7, MMP-9, MMP-12 and MMP-14 and TIMP-2 and TIMP-3 independently of COX; fibronectin accelerated MMP but not TIMP up-regulation. CONCLUSIONS AND IMPLICATIONS Adhesion, LPS stimulation and maturation of human monocytes lead to selective, COX-independent MMP and TIMP gene regulation, which is a potential target for selective inhibition by signalling kinase inhibitors. © 2011 The Authors. British Journal of Pharmacology © 2011 The British Pharmacological Society.

  10. Distinctive features and differential regulation of the DRTS genes of Arabidopsis thaliana.

    Science.gov (United States)

    Maniga, Antonio; Ghisaura, Stefania; Perrotta, Lara; Marche, Maria Giovanna; Cella, Rino; Albani, Diego

    2017-01-01

    In plants and protists, dihydrofolate reductase (DHFR) and thymidylate synthase (TS) are part of a bifunctional enzyme (DRTS) that allows efficient recycling of the dihydrofolate resulting from TS activity. Arabidopsis thaliana possesses three DRTS genes, called AtDRTS1, AtDRTS2 and AtDRTS3, that are located downstream of three members of the sec14-like SFH gene family. In this study, a characterization of the AtDRTS genes identified alternatively spliced transcripts coding for AtDRTS isoforms which may account for monofunctional DHFR enzymes supporting pathways unrelated to DNA synthesis. Moreover, we discovered a complex differential regulation of the AtDRTS genes that confirms the expected involvement of the AtDRTS genes in cell proliferation and endoreduplication, but indicates also functions related to other cellular activities. AtDRTS1 is widely expressed in both meristematic and differentiated tissues, whereas AtDRTS2 expression is almost exclusively limited to the apical meristems and AtDRTS3 is preferentially expressed in the shoot apex, in stipules and in root cap cells. The differential regulation of the AtDRTS genes is associated to distinctive promoter architectures and the expression of AtDRTS1 in the apical meristems is strictly dependent on the presence of an intragenic region that includes the second intron of the gene. Upon activation of cell proliferation in germinating seeds, the activity of the AtDRTS1 and AtDRTS2 promoters in meristematic cells appears to be maximal at the G1/S phase of the cell cycle. In addition, the promoters of AtDRTS2 and AtDRTS3 are negatively regulated through E2F cis-acting elements and both genes, but not AtDRTS1, are downregulated in plants overexpressing the AtE2Fa factor. Our study provides new information concerning the function and the regulation of plant DRTS genes and opens the way to further investigations addressing the importance of folate synthesis with respect to specific cellular activities.

  11. Regulation of Corticosteroidogenic Genes by MicroRNAs

    Directory of Open Access Journals (Sweden)

    Stacy Robertson

    2017-01-01

    Full Text Available The loss of normal regulation of corticosteroid secretion is important in the development of cardiovascular disease. We previously showed that microRNAs regulate the terminal stages of corticosteroid biosynthesis. Here, we assess microRNA regulation across the whole corticosteroid pathway. Knockdown of microRNA using Dicer1 siRNA in H295R adrenocortical cells increased levels of CYP11A1, CYP21A1, and CYP17A1 mRNA and the secretion of cortisol, corticosterone, 11-deoxycorticosterone, 18-hydroxycorticosterone, and aldosterone. Bioinformatic analysis of genes involved in corticosteroid biosynthesis or metabolism identified many putative microRNA-binding sites, and some were selected for further study. Manipulation of individual microRNA levels demonstrated a direct effect of miR-125a-5p and miR-125b-5p on CYP11B2 and of miR-320a-3p levels on CYP11A1 and CYP17A1 mRNA. Finally, comparison of microRNA expression profiles from human aldosterone-producing adenoma and normal adrenal tissue showed levels of various microRNAs, including miR-125a-5p to be significantly different. This study demonstrates that corticosteroidogenesis is regulated at multiple points by several microRNAs and that certain of these microRNAs are differentially expressed in tumorous adrenal tissue, which may contribute to dysregulation of corticosteroid secretion. These findings provide new insights into the regulation of corticosteroid production and have implications for understanding the pathology of disease states where abnormal hormone secretion is a feature.

  12. Homologues of Genetic Transformation DNA Import Genes Are Required for Rhodobacter capsulatus Gene Transfer Agent Recipient Capability Regulated by the Response Regulator CtrA.

    Science.gov (United States)

    Brimacombe, Cedric A; Ding, Hao; Johnson, Jeanette A; Beatty, J Thomas

    2015-08-01

    Gene transfer agents (GTAs) morphologically resemble small, double-stranded DNA (dsDNA) bacteriophages; however, their only known role is to package and transfer random pieces of the producing cell genome to recipient cells. The best understood GTA is that of Rhodobacter capsulatus, termed RcGTA. We discovered that homologues of three genes involved in natural transformation in other bacteria, comEC, comF, and comM, are essential for RcGTA-mediated gene acquisition. This paper gives genetic and biochemical evidence that RcGTA-borne DNA entry into cells requires the ComEC and ComF putative DNA transport proteins and genetic evidence that putative cytoplasmic ComM protein of unknown function is required for recipient capability. Furthermore, the master regulator of RcGTA production in bacterial horizontal gene transfer mechanisms, where donor DNA is packaged in transducing phage-like particles and recipient cells take up DNA using natural transformation-related machinery. Both of these differentiated subsets of a culture population, donors and recipients, are dependent on the same response regulator, CtrA. Horizontal gene transfer (HGT) is a major driver of bacterial evolution and adaptation to environmental stresses. Traits such as antibiotic resistance or metabolic properties can be transferred between bacteria via HGT; thus, HGT can have a tremendous effect on the fitness of a bacterial population. The three classically described HGT mechanisms are conjugation, transformation, and phage-mediated transduction. More recently, the HGT factor GTA was described, where random pieces of producing cell genome are packaged into phage-like particles that deliver DNA to recipient cells. In this report, we show that transport of DNA borne by the R. capsulatus RcGTA into recipient cells requires key genes previously thought to be specific to natural transformation pathways. These findings indicate that RcGTA combines central aspects of phage-mediated transduction and natural

  13. G0/G1 switch gene-2 regulates human adipocyte lipolysis by affecting activity and localization of adipose triglyceride lipase

    NARCIS (Netherlands)

    Schweiger, M.; Paar, M.; Eder, C.; Brandis, J.; Moser, E.; Gorkiewisz, G.; Grond, S.; Radner, F.P.W.; Cerk, I.; Cornaciu, I.; Oberer, M.; Kersten, A.H.; Zechner, R.; Zimmermann, M.B.; Lass, A.

    2012-01-01

    The hydrolysis of triglycerides in adipocytes, termed lipolysis, provides free fatty acids as energy fuel. Murine lipolysis largely depends on the activity of adipose triglyceride lipase (ATGL)5, which is regulated by two proteins annotated as comparative gene identification-58 (CGI-58) and G0/G1

  14. Feeding Regulates the Expression of Pancreatic Genes in Gastric Mucosa

    Directory of Open Access Journals (Sweden)

    Maria Rita De Giorgio

    2010-01-01

    Full Text Available The ineffective short-term control of feeding behavior compromises energy homeostasis and can lead to obesity. The gastrointestinal tract secretes several regulatory peptides. However, little is known about the stomach peptide contribution to the acute regulation of intake. In an attempt to identify new gastric signals, the serial analysis of gene expression (SAGE method was used for the transcription profiling of stomach mucosa in 7 groups of mice: fasting and sacrificed 30 minutes, 1 hour, 3 hours after a low-fat (LF or high-fat (HF ad libitum meal. In total, 35 genes were differentially modulated by LF and HF meals compared to fasting, including 15 mRNAs coding for digestive enzymes/secretory proteins, and 10 novel transcripts. Although the basic expression profile did not undergo substantial variations, both LF and HF meals influenced the transcription. This study represents the first global analysis of stomach transcriptome as induced by different nutritional stimuli. Further studies including the characterization of novel genes may help to identify new targets for the therapy and prevention of obesity.

  15. The Evolution of gene regulation research in Lactococcus lactis.

    Science.gov (United States)

    Kok, Jan; van Gijtenbeek, Lieke A; de Jong, Anne; van der Meulen, Sjoerd B; Solopova, Ana; Kuipers, Oscar P

    2017-08-01

    Lactococcus lactis is a major microbe. This lactic acid bacterium (LAB) is used worldwide in the production of safe, healthy, tasteful and nutritious milk fermentation products. Its huge industrial importance has led to an explosion of research on the organism, particularly since the early 1970s. The upsurge in the research on L. lactis coincided not accidentally with the advent of recombinant DNA technology in these years. The development of methods to take out and re-introduce DNA in L. lactis, to clone genes and to mutate the chromosome in a targeted way, to control (over)expression of proteins and, ultimately, the availability of the nucleotide sequence of its genome and the use of that information in transcriptomics and proteomics research have enabled to peek deep into the functioning of the organism. Among many other things, this has provided an unprecedented view of the major gene regulatory pathways involved in nitrogen and carbon metabolism and their overlap, and has led to the blossoming of the field of L. lactis systems biology. All of these advances have made L. lactis the paradigm of the LAB. This review will deal with the exciting path along which the research on the genetics of and gene regulation in L. lactis has trodden. © FEMS 2017.

  16. The Hos2 Histone Deacetylase Controls Ustilago maydis Virulence through Direct Regulation of Mating-Type Genes.

    Directory of Open Access Journals (Sweden)

    Alberto Elías-Villalobos

    2015-08-01

    Full Text Available Morphological changes are critical for host colonisation in plant pathogenic fungi. These changes occur at specific stages of their pathogenic cycle in response to environmental signals and are mediated by transcription factors, which act as master regulators. Histone deacetylases (HDACs play crucial roles in regulating gene expression, for example by locally modulating the accessibility of chromatin to transcriptional regulators. It has been reported that HDACs play important roles in the virulence of plant fungi. However, the specific environment-sensing pathways that control fungal virulence via HDACs remain poorly characterised. Here we address this question using the maize pathogen Ustilago maydis. We find that the HDAC Hos2 is required for the dimorphic switch and pathogenic development in U. maydis. The deletion of hos2 abolishes the cAMP-dependent expression of mating type genes. Moreover, ChIP experiments detect Hos2 binding to the gene bodies of mating-type genes, which increases in proportion to their expression level following cAMP addition. These observations suggest that Hos2 acts as a downstream component of the cAMP-PKA pathway to control the expression of mating-type genes. Interestingly, we found that Clr3, another HDAC present in U. maydis, also contributes to the cAMP-dependent regulation of mating-type gene expression, demonstrating that Hos2 is not the only HDAC involved in this control system. Overall, our results provide new insights into the role of HDACs in fungal phytopathogenesis.

  17. Folliculin regulates ampk-dependent autophagy and metabolic stress survival.

    Directory of Open Access Journals (Sweden)

    Elite Possik

    2014-04-01

    Full Text Available Dysregulation of AMPK signaling has been implicated in many human diseases, which emphasizes the importance of characterizing AMPK regulators. The tumor suppressor FLCN, responsible for the Birt-Hogg Dubé renal neoplasia syndrome (BHD, is an AMPK-binding partner but the genetic and functional links between FLCN and AMPK have not been established. Strikingly, the majority of naturally occurring FLCN mutations predisposing to BHD are predicted to produce truncated proteins unable to bind AMPK, pointing to the critical role of this interaction in the tumor suppression mechanism. Here, we demonstrate that FLCN is an evolutionarily conserved negative regulator of AMPK. Using Caenorhabditis elegans and mammalian cells, we show that loss of FLCN results in constitutive activation of AMPK which induces autophagy, inhibits apoptosis, improves cellular bioenergetics, and confers resistance to energy-depleting stresses including oxidative stress, heat, anoxia, and serum deprivation. We further show that AMPK activation conferred by FLCN loss is independent of the cellular energy state suggesting that FLCN controls the AMPK energy sensing ability. Together, our data suggest that FLCN is an evolutionarily conserved regulator of AMPK signaling that may act as a tumor suppressor by negatively regulating AMPK function.

  18. Pitx2, an atrial fibrillation predisposition gene, directly regulates ion transport and intercalated disc genes.

    Science.gov (United States)

    Tao, Ye; Zhang, Min; Li, Lele; Bai, Yan; Zhou, Yuefang; Moon, Anne M; Kaminski, Henry J; Martin, James F

    2014-02-01

    Pitx2 is the homeobox gene located in proximity to the human 4q25 familial atrial fibrillation (AF) locus. When deleted in the mouse germline, Pitx2 haploinsufficiency predisposes to pacing-induced AF, indicating that reduced Pitx2 promotes an arrhythmogenic substrate. Previous work focused on Pitx2 developmental functions that predispose to AF. Although Pitx2 is expressed in postnatal left atrium, it is unknown whether Pitx2 has distinct postnatal and developmental functions. To investigate Pitx2 postnatal function, we conditionally inactivated Pitx2 in the postnatal atrium while leaving its developmental function intact. Unstressed adult Pitx2 homozygous mutant mice display variable R-R interval with diminished P-wave amplitude characteristic of sinus node dysfunction, an AF risk factor in human patients. An integrated genomics approach in the adult heart revealed Pitx2 target genes encoding cell junction proteins, ion channels, and critical transcriptional regulators. Importantly, many Pitx2 target genes have been implicated in human AF by genome-wide association studies. Immunofluorescence and transmission electron microscopy studies in adult Pitx2 mutant mice revealed structural remodeling of the intercalated disc characteristic of human patients with AF. Our findings, revealing that Pitx2 has genetically separable postnatal and developmental functions, unveil direct Pitx2 target genes that include channel and calcium handling genes, as well as genes that stabilize the intercalated disc in postnatal atrium.

  19. NUDT2 Disruption Elevates Diadenosine Tetraphosphate (Ap4A and Down-Regulates Immune Response and Cancer Promotion Genes.

    Directory of Open Access Journals (Sweden)

    Andrew S Marriott

    Full Text Available Regulation of gene expression is one of several roles proposed for the stress-induced nucleotide diadenosine tetraphosphate (Ap4A. We have examined this directly by a comparative RNA-Seq analysis of KBM-7 chronic myelogenous leukemia cells and KBM-7 cells in which the NUDT2 Ap4A hydrolase gene had been disrupted (NuKO cells, causing a 175-fold increase in intracellular Ap4A. 6,288 differentially expressed genes were identified with P < 0.05. Of these, 980 were up-regulated and 705 down-regulated in NuKO cells with a fold-change ≥ 2. Ingenuity® Pathway Analysis (IPA® was used to assign these genes to known canonical pathways and functional networks. Pathways associated with interferon responses, pattern recognition receptors and inflammation scored highly in the down-regulated set of genes while functions associated with MHC class II antigens were prominent among the up-regulated genes, which otherwise showed little organization into major functional gene sets. Tryptophan catabolism was also strongly down-regulated as were numerous genes known to be involved in tumor promotion in other systems, with roles in the epithelial-mesenchymal transition, proliferation, invasion and metastasis. Conversely, some pro-apoptotic genes were up-regulated. Major upstream factors predicted by IPA® for gene down-regulation included NFκB, STAT1/2, IRF3/4 and SP1 but no major factors controlling gene up-regulation were identified. Potential mechanisms for gene regulation mediated by Ap4A and/or NUDT2 disruption include binding of Ap4A to the HINT1 co-repressor, autocrine activation of purinoceptors by Ap4A, chromatin remodeling, effects of NUDT2 loss on transcript stability, and inhibition of ATP-dependent regulatory factors such as protein kinases by Ap4A. Existing evidence favors the last of these as the most probable mechanism. Regardless, our results suggest that the NUDT2 protein could be a novel cancer chemotherapeutic target, with its inhibition

  20. The Cpx System Regulates Virulence Gene Expression in Vibrio cholerae

    Science.gov (United States)

    Acosta, Nicole; Pukatzki, Stefan

    2015-01-01

    Bacteria possess signal transduction pathways capable of sensing and responding to a wide variety of signals. The Cpx envelope stress response, composed of the sensor histidine kinase CpxA and the response regulator CpxR, senses and mediates adaptation to insults to the bacterial envelope. The Cpx response has been implicated in the regulation of a number of envelope-localized virulence determinants across bacterial species. Here, we show that activation of the Cpx pathway in Vibrio cholerae El Tor strain C6706 leads to a decrease in expression of the major virulence factors in this organism, cholera toxin (CT) and the toxin-coregulated pilus (TCP). Our results indicate that this occurs through the repression of production of the ToxT regulator and an additional upstream transcription factor, TcpP. The effect of the Cpx response on CT and TCP expression is mostly abrogated in a cyclic AMP receptor protein (CRP) mutant, although expression of the crp gene is unaltered. Since TcpP production is controlled by CRP, our data suggest a model whereby the Cpx response affects CRP function, which leads to diminished TcpP, ToxT, CT, and TCP production. PMID:25824837

  1. Mobile gene silencing in Arabidopsis is regulated by hydrogen peroxide

    Directory of Open Access Journals (Sweden)

    Dacheng Liang

    2014-12-01

    Full Text Available In plants and nematodes, RNAi can spread from cells from which it is initiated to other cells in the organism. The underlying mechanism controlling the mobility of RNAi signals is not known, especially in the case of plants. A genetic screen designed to recover plants impaired in the movement but not the production or effectiveness of the RNAi signal identified RCI3, which encodes a hydrogen peroxide (H2O2-producing type III peroxidase, as a key regulator of silencing mobility in Arabidopsis thaliana. Silencing initiated in the roots of rci3 plants failed to spread into leaf tissue or floral tissue. Application of exogenous H2O2 reinstated the spread in rci3 plants and accelerated it in wild-type plants. The addition of catalase or MnO2, which breaks down H2O2, slowed the spread of silencing in wild-type plants. We propose that endogenous H2O2, under the control of peroxidases, regulates the spread of gene silencing by altering plasmodesmata permeability through remodelling of local cell wall structure, and may play a role in regulating systemic viral defence.

  2. Epigenetic Regulation of Hormone-dependent Plant Growth Processes

    Energy Technology Data Exchange (ETDEWEB)

    Ecker, Joseph Robert [The Salk Inst. for Biological Studies, La Jolla, CA (United States)

    2016-11-18

    Impact of EIN6, EEN and ethylene on the H3K27me3 dynamics in Arabidopsis: To assess the dynamic responsiveness of H3K27me3 levels to ethylene and how this might affect ethylene-induced gene expression, we plan to perform H3K27me3 ChIP-seq and RNA- seq experiments in parallel with etiolated seedlings in the absence and presence of ethylene. Further implementation of ein6, een and ein6een mutants will visualize how the H3K27me3 landscape (-/+ET) is altered when H3K27me3 demethylation and/or INO80-mediated chromatin remodeling is compromised. Additional ChIP-seq analyses with EIN6 will show if ethylene- induced H3K27me3 removal at certain genes is always accompanied by the presence of EIN6.

  3. Sinorhizobium meliloti putA gene regulation: a new model within the family Rhizobiaceae.

    Science.gov (United States)

    Soto, M J; Jiménez-Zurdo, J I; van Dillewijn, P; Toro, N

    2000-04-01

    Proline dehydrogenase (PutA) is a bifunctional enzyme that catalyzes the oxidation of proline to glutamate. In Sinorhizobium meliloti, as in other microorganisms, the putA gene is transcriptionally activated in response to proline. In Rhodobacter capsulatus, Agrobacterium, and most probably in Bradyrhizobium, this activation is dependent on an Lrp-like protein encoded by the putR gene, located immediately upstream of putA. Interestingly, sequence and genetic analysis of the region upstream of the S. meliloti putA gene did not reveal such a putR locus or any other encoded transcriptional activator of putA. Furthermore, results obtained with an S. meliloti putA null mutation indicate the absence of any proline-responsive transcriptional activator and that PutA serves as an autogenous repressor. Therefore, the model of S. meliloti putA regulation completely diverges from that of its Rhizobiaceae relatives and resembles more that of enteric bacteria. However, some differences have been found with the latter model: (i) S. meliloti putA gene is not catabolite repressed, and (ii) the gene encoding for the major proline permease (putP) does not form part of an operon with the putA gene.

  4. Cytomegalovirus replicon-based regulation of gene expression in vitro and in vivo.

    Directory of Open Access Journals (Sweden)

    Hermine Mohr

    Full Text Available There is increasing evidence for a connection between DNA replication and the expression of adjacent genes. Therefore, this study addressed the question of whether a herpesvirus origin of replication can be used to activate or increase the expression of adjacent genes. Cell lines carrying an episomal vector, in which reporter genes are linked to the murine cytomegalovirus (MCMV origin of lytic replication (oriLyt, were constructed. Reporter gene expression was silenced by a histone-deacetylase-dependent mechanism, but was resolved upon lytic infection with MCMV. Replication of the episome was observed subsequent to infection, leading to the induction of gene expression by more than 1000-fold. oriLyt-based regulation thus provided a unique opportunity for virus-induced conditional gene expression without the need for an additional induction mechanism. This principle was exploited to show effective late trans-complementation of the toxic viral protein M50 and the glycoprotein gO of MCMV. Moreover, the application of this principle for intracellular immunization against herpesvirus infection was demonstrated. The results of the present study show that viral infection specifically activated the expression of a dominant-negative transgene, which inhibited viral growth. This conditional system was operative in explant cultures of transgenic mice, but not in vivo. Several applications are discussed.

  5. UDP-glucose is a potential intracellular signal molecule in the control of expression of sigma S and sigma S-dependent genes in Escherichia coli.

    OpenAIRE

    Böhringer, J; Fischer, D; Mosler, G; Hengge-Aronis, R

    1995-01-01

    The sigma S subunit of RNA polymerase is the master regulator of a regulatory network that controls stationary-phase induction as well as osmotic regulation of many genes in Escherichia coli. In an attempt to identify additional regulatory components in this network, we have isolated Tn10 insertion mutations that in trans alter the expression of osmY and other sigma S-dependent genes. One of these mutations conferred glucose sensitivity and was localized in pgi (encoding phosphoglucose isomer...

  6. Self-cytoprotection against stress: feedback regulation of heme- dependent metabolism

    OpenAIRE

    Schwartsburd, P.M.

    2001-01-01

    This minireview provides insight into feedback regulation of heme-dependent metabolism as a defensive cellular response against stress. Interactions among heme-, iron-, porphyrin-, and CO/NO-dependent metabolic pathways during the stress-induced response are emphasized in the context of feedback regulation. The hypothetical model of the latter interactions is presented as tightly controlled feedback cycles.

  7. Differential regulation of Ku gene expression in etiolated mung bean hypocotyls by auxins.

    Science.gov (United States)

    Liu, Pei-Feng; Chang, Wen-Chi; Wang, Yung-Kai; Munisamy, Suresh-Babu; Hsu, Shen-Hsing; Chang, Hwan-You; Wu, Shu-Hsing; Pan, Rong-Long

    2007-01-01

    Plant Ku genes were identified very recently in Arabidopsis thaliana, and their roles in repair of double-stranded break DNA and maintenance of telomere integrity were scrutinized. In this study, the cDNAs encoding Ku70 (VrKu70) and Ku80 (VrKu80) were isolated from mung bean (Vigna radiata L.) hypocotyls. Both genes were expressed widely among different tissues of mung bean with the highest levels in hypocotyls and leaves. The VrKu gene expression was stimulated by exogenous auxins in a concentration- and time-dependent manner. The stimulation could be abolished by auxin transport inhibitors, N-(1-naphthyl) phthalamic acid and 2,3,5-triiodobenzoic acid implicating that exogenous auxins triggered the effects following their uptake by the cells. Further analysis using specific inhibitors of auxin signaling showed that the stimulation of VrKu expression by 2,4-dichlorophenoxyacetic acid (2,4-D) was suppressed by intracellular Ca(2+) chelators, calmodulin antagonists, and calcium/calmodulin dependent protein kinase inhibitors, suggesting the involvement of calmodulin in the signaling pathway. On the other hand, exogenous indole-3-acetic acid (IAA) and alpha-naphthalene acetic acid (NAA) stimulated VrKu expression through the mitogen-activated protein kinase/extracellular signal-regulated kinase pathway. Altogether, it is thus proposed that 2,4-D and IAA (or NAA) regulate the expression of VrKu through two distinct pathways.

  8. EXPRESSION OF CALCIUM-DEPENDENT PROTEIN KINASE (CDPK GENES IN VITIS AMURENSIS UNDER ABIOTIC STRESS CONDITIONS

    Directory of Open Access Journals (Sweden)

    Dubrovina A.S.

    2012-08-01

    Full Text Available Abiotic stresses, such as extreme temperatures, soil salinity, or water deficit, are one of the major limiting factors of crop productivity worldwide. Examination of molecular and genetic mechanisms of abiotic stress tolerance in plants is of great interest to plant biologists. Calcium-dependent protein kinases (CDPKs, which are the most important Ca2+ sensors in plants, are known to play one of the key roles in plant adaptation to abiotic stress. CDPK is a multigene family of enzymes. Analysis of CDPK gene expression under various abiotic stress conditions would help identify those CDPKs that might play important roles in plant adaptation to abiotic stress. We focused on studying CDPK gene expression under osmotic, water deficit, and temperature stress conditions in a wild-growing grapevine Vitis amurensis Rurp., which is native to the Russian Far East and is known to possess high adaptive potential and high level of resistance against adverse environmental conditions. Healthy V. amurensis cuttings (excised young stems with one healthy leaf were used for the treatments. For the non-stress treatment, we placed the cuttings in distilled water for 12 h at room temperature. For the water-deficit stress, detached cuttings were laid on a paper towel for 12 h at room temperature. For osmotic stress treatments, the cuttings were placed in 0.4 М NaCl and 0.4 М mannitol solutions for 12 h at room temperature. To examine temperature stress tolerance, the V. amurensis cuttings were placed in a growth chamber at +10oC and +37oC for 12 h. The total expression of VaCDPK genes was examined by semiquantitative RT-PCR with degenerate primers designed to the CDPK kinase domain. The total level of CDPK gene expression increased under salt and decreased under low temperature stress conditions. We sequenced 300 clones of the amplified part of different CDPK transcripts obtained from the analyzed cDNA probes. Analysis of the cDNA sequences identified 8 different

  9. [Prediction and bioinformatics analysis of human gene expression profiling regulated by amifostine].

    Science.gov (United States)

    Yang, Bo; Cai, Li-Li; Chi, Xiao-Hua; Lu, Xue-Chun; Zhang, Feng; Tuo, Shuai; Zhu, Hong-Li; Liu, Li-Hong; Yan, Jiang-Wei; Tuo, Chao-Wei

    2011-06-01

    Objective of this study was to perform bioinformatics analysis of the characteristics of gene expression profiling regulated by amifostine and predict its novel potential biological function to provide a direction for further exploring pharmacological actions of amifostine and study methods. Amifostine was used as a key word to search internet-based free gene expression database including GEO, affymetrix gene chip database, GenBank, SAGE, GeneCard, InterPro, ProtoNet, UniProt and BLOCKS and the sifted amifostine-regulated gene expression profiling data was subjected to validity testing, gene expression difference analysis and functional clustering and gene annotation. The results showed that only one data of gene expression profiling regulated by amifostine was sifted from GEO database (accession: GSE3212). Through validity testing and gene expression difference analysis, significant difference (p < 0.01) was only found in 2.14% of the whole genome (460/192000). Gene annotation analysis showed that 139 out of 460 genes were known genes, in which 77 genes were up-regulated and 62 genes were down-regulated. 13 out of 139 genes were newly expressed following amifostine treatment of K562 cells, however expression of 5 genes was completely inhibited. Functional clustering displayed that 139 genes were divided into 11 categories and their biological function was involved in hematopoietic and immunologic regulation, apoptosis and cell cycle. It is concluded that bioinformatics method can be applied to analysis of gene expression profiling regulated by amifostine. Amifostine has a regulatory effect on human gene expression profiling and this action is mainly presented in biological processes including hematopoiesis, immunologic regulation, apoptosis and cell cycle and so on. The effect of amifostine on human gene expression need to be further testified in experimental condition.

  10. Histone Acetylation Modifications Affect Tissue-Dependent Expression of Poplar Homologs of C4 Photosynthetic Enzyme Genes

    Directory of Open Access Journals (Sweden)

    Yuan Li

    2017-06-01

    Full Text Available Histone modifications play important roles in regulating the expression of C4 photosynthetic genes. Given that all enzymes required for the C4 photosynthesis pathway are present in C3 plants, it has been hypothesized that this expression regulatory mechanism has been conserved. However, the relationship between histone modification and the expression of homologs of C4 photosynthetic enzyme genes has not been well determined in C3 plants. In the present study, we cloned nine hybrid poplar (Populus simonii × Populus nigra homologs of maize (Zea mays C4 photosynthetic enzyme genes, carbonic anhydrase (CA, pyruvate orthophosphate dikinase (PPDK, phosphoenolpyruvate carboxykinase (PCK, and phosphoenolpyruvate carboxylase (PEPC, and investigated the correlation between the expression levels of these genes and the levels of promoter histone acetylation modifications in four vegetative tissues. We found that poplar homologs of C4 homologous genes had tissue-dependent expression patterns that were mostly well-correlated with the level of histone acetylation modification (H3K9ac and H4K5ac determined by chromatin immunoprecipitation assays. Treatment with the histone deacetylase inhibitor trichostatin A further confirmed the role of histone acetylation in the regulation of the nine target genes. Collectively, these results suggest that both H3K9ac and H4K5ac positively regulate the tissue-dependent expression pattern of the PsnCAs, PsnPPDKs, PsnPCKs, and PsnPEPCs genes and that this regulatory mechanism seems to be conserved among the C3 and C4 species. Our findings provide new insight that will aid efforts to modify the expression pattern of these homologs of C4 genes to engineer C4 plants from C3 plants.

  11. Gene expression dosage regulation in an allopolyploid fish.

    Directory of Open Access Journals (Sweden)

    I Matos

    Full Text Available How allopolyploids are able not only to cope but profit from their condition is a question that remains elusive, but is of great importance within the context of successful allopolyploid evolution. One outstanding example of successful allopolyploidy is the endemic Iberian cyprinid Squalius alburnoides. Previously, based on the evaluation of a few genes, it was reported that the transcription levels between diploid and triploid S. alburnoides were similar. If this phenomenon occurs on a full genomic scale, a wide functional ''diploidization'' could be related to the success of these polyploids. We generated RNA-seq data from whole juvenile fish and from adult livers, to perform the first comparative quantitative transcriptomic analysis between diploid and triploid individuals of a vertebrate allopolyploid. Together with an assay to estimate relative expression per cell, it was possible to infer the relative sizes of transcriptomes. This showed that diploid and triploid S. alburnoides hybrids have similar liver transcriptome sizes. This in turn made it valid to directly compare the S. alburnoides RNA-seq transcript data sets and obtain a profile of dosage responses across the S. alburnoides transcriptome. We found that 64% of transcripts in juveniles' samples and 44% in liver samples differed less than twofold between diploid and triploid hybrids (similar expression. Yet, respectively 29% and 15% of transcripts presented accurate dosage compensation (PAA/PA expression ratio of 1 instead of 1.5. Therefore, an exact functional diploidization of the triploid genome does not occur, but a significant down regulation of gene expression in triploids was observed. However, for those genes with similar expression levels between diploids and triploids, expression is not globally strictly proportional to gene dosage nor is it set to a perfect diploid level. This quantitative expression flexibility may be a strong contributor to overcome the genomic shock

  12. Protracted abstinence from distinct drugs of abuse shows regulation of a common gene network.

    Science.gov (United States)

    Le Merrer, Julie; Befort, Katia; Gardon, Olivier; Filliol, Dominique; Darcq, Emmanuel; Dembele, Doulaye; Becker, Jerome A J; Kieffer, Brigitte L

    2012-01-01

    Addiction is a chronic brain disorder. Prolonged abstinence from drugs of abuse involves dysphoria, high stress responsiveness and craving. The neurobiology of drug abstinence, however, is poorly understood. We previously identified a unique set of hundred mu-opioid receptor-dependent genes in the extended amygdala, a key site for hedonic and stress processing in the brain. Here we examined these candidate genes either immediately after chronic morphine, nicotine, Δ9-tetrahydrocannabinol or alcohol, or following 4 weeks of abstinence. Regulation patterns strongly differed among chronic groups. In contrast, gene regulations strikingly converged in the abstinent groups and revealed unforeseen common adaptations within a novel huntingtin-centered molecular network previously unreported in addiction research. This study demonstrates that, regardless the drug, a specific set of transcriptional regulations develops in the abstinent brain, which possibly contributes to the negative affect characterizing protracted abstinence. This transcriptional signature may represent a hallmark of drug abstinence and a unitary adaptive molecular mechanism in substance abuse disorders. © 2011 The Authors, Addiction Biology © 2011 Society for the Study of Addiction.

  13. Spatial proximity of homologous alleles and long noncoding RNAs regulate a switch in allelic gene expression.

    Science.gov (United States)

    Stratigi, Kalliopi; Kapsetaki, Manouela; Aivaliotis, Michalis; Town, Terrence; Flavell, Richard A; Spilianakis, Charalampos G

    2015-03-31

    Physiological processes rely on the regulation of total mRNA levels in a cell. In diploid organisms, the transcriptional activation of one or both alleles of a gene may involve trans-allelic interactions that provide a tight spatial and temporal level of gene expression regulation. The mechanisms underlying such interactions still remain poorly understood. Here, we demonstrate that lipopolysaccharide stimulation of murine macrophages rapidly resulted in the actin-mediated and transient homologous spatial proximity of Tnfα alleles, which was necessary for the mono- to biallelic switch in gene expression. We identified two new complementary long noncoding RNAs transcribed from the TNFα locus and showed that their knockdown had opposite effects in Tnfα spatial proximity and allelic expression. Moreover, the observed spatial proximity of Tnfα alleles depended on pyruvate kinase muscle isoform 2 (PKM2) and T-helper-inducing POZ-Krüppel-like factor (ThPOK). This study suggests a role for lncRNAs in the regulation of somatic homologous spatial proximity and allelic expression control necessary for fine-tuning mammalian immune responses.

  14. Cyclin-Dependent Kinase 9 Activity Regulates Neutrophil Spontaneous Apoptosis

    Czech Academy of Sciences Publication Activity Database

    Wang, K.; Hampson, P.; Hazeldine, J.; Kryštof, Vladimír; Strnad, Miroslav; Pechan, P.; Lord, J. M.

    2012-01-01

    Roč. 7, č. 1 (2012), "e30128" E-ISSN 1932-6203 R&D Projects: GA ČR GA301/08/1649 Grant - others:GA ČR(CZ) GA204/08/0511 Program:GA Institutional research plan: CEZ:AV0Z50380511 Keywords : COLONY-STIMULATING FACTOR * PROGRAMMED CELL-DEATH * DOWN-REGULATION Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.730, year: 2012

  15. Mitogen activated protein kinases selectively regulate palytoxin-stimulated gene expression in mouse keratinocytes

    International Nuclear Information System (INIS)

    Zeliadt, Nicholette A.; Warmka, Janel K.; Wattenberg, Elizabeth V.

    2003-01-01

    We have been investigating how the novel skin tumor promoter palytoxin transmits signals through mitogen activated protein kinases (MAPKs). Palytoxin activates three major MAPKs, extracellular signal-regulated kinase (ERK), c-Jun N-terminal kinase (JNK), and p38, in a keratinocyte cell line derived from initiated mouse skin (308). We previously showed that palytoxin requires ERK to increase matrix metalloproteinase-13 (MMP-13) gene expression, an enzyme implicated in carcinogenesis. Diverse stimuli require JNK and p38 to increase MMP-13 gene expression, however. We therefore used the JNK and p38 inhibitors SP 600125 and SB 202190, respectively, to investigate the role of these MAPKs in palytoxin-induced MMP-13 gene expression. Surprisingly, palytoxin does not require JNK and p38 to increase MMP-13 gene expression. Accordingly, ERK activation, independent of palytoxin and in the absence of JNK and p38 activation, is sufficient to induce MMP-13 gene expression in 308 keratinocytes. Dexamethasone, a synthetic glucocorticoid that inhibits activator protein-1 (AP-1), blocked palytoxin-stimulated MMP-13 gene expression. Therefore, the AP-1 site present in the promoter of the MMP-13 gene appears to be functional and to play a key role in palytoxin-stimulated gene expression. Previous studies showed that palytoxin simulates an ERK-dependent selective increase in the c-Fos content of AP-1 complexes that bind to the promoter of the MMP-13 gene. JNK and p38 can also modulate c-Fos. Palytoxin does not require JNK or p38 to increase c-Fos binding, however. Altogether, these studies indicate that ERK plays a distinctly essential role in transmitting palytoxin-stimulated signals to specific nuclear targets in keratinocytes derived from initiated mouse skin

  16. Cell cycle-regulated expression of mammalian CDC6 is dependent on E2F

    DEFF Research Database (Denmark)

    Hateboer, G; Wobst, A; Petersen, B O

    1998-01-01

    functions similar to those of E2F proteins in higher eukaryotes, by regulating the timed expression of genes implicated in cell cycle progression and DNA synthesis. The CDC6 gene is a target for MBF and SBF-regulated transcription. S. cerevisiae Cdc6p induces the formation of the prereplication complex......The E2F transcription factors are essential regulators of cell growth in multicellular organisms, controlling the expression of a number of genes whose products are involved in DNA replication and cell proliferation. In Saccharomyces cerevisiae, the MBF and SBF transcription complexes have...... and is essential for initiation of DNA replication. Interestingly, the Cdc6p homolog in Schizosaccharomyces pombe, Cdc18p, is regulated by DSC1, the S. pombe homolog of MBF. By cloning the promoter for the human homolog of Cdc6p and Cdc18p, we demonstrate here that the cell cycle-regulated transcription...

  17. Regulation of Gene Expression with Double-Stranded Phosphorothioate Oligonucleotides

    Science.gov (United States)

    Bielinska, Anna; Shivdasani, Ramesh A.; Zhang, Liquan; Nabel, Gary J.

    1990-11-01

    Alteration of gene transcription by inhibition of specific transcriptional regulatory proteins is necessary for determining how these factors participate in cellular differentiation. The functions of these proteins can be antagonized by several methods, each with specific limitations. Inhibition of sequence-specific DNA-binding proteins was achieved with double-stranded (ds) phosphorothioate oligonucleotides that contained octamer or kappaB consensus sequences. The phosphorothioate oligonucleotides specifically bound either octamer transcription factor or nuclear factor (NF)-kappaB. The modified oligonucleotides accumulated in cells more effectively than standard ds oligonucleotides and modulated gene expression in a specific manner. Octamer-dependent activation of a reporter plasmid or NF-kappaB-dependent activation of the human immunodeficiency virus (HIV) enhancer was inhibited when the appropriate phosphorothioate oligonucleotide was added to a transiently transfected B cell line. Addition of phosphorothioate oligonucleotides that contained the octamer consensus to Jurkat T leukemia cells inhibited interleukin-2 (IL-2) secretion to a degree similar to that observed with a mutated octamer site in the IL-2 enhancer. The ds phosphorothioate oligonucleotides probably compete for binding of specific transcription factors and may provide anti-viral, immunosuppressive, or other therapeutic effects.

  18. Extracellular Matrix-Regulated Gene Expression RequiresCooperation of SWI/SNF and Transcription Factors

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Ren; Spencer, Virginia A.; Bissell, Mina J.

    2006-05-25

    Extracellular cues play crucial roles in the transcriptional regulation of tissue-specific genes, but whether and how these signals lead to chromatin remodeling is not understood and subject to debate. Using chromatin immunoprecipitation (ChIP) assays and mammary-specific genes as models, we show here that extracellular matrix (ECM) molecules and prolactin cooperate to induce histone acetylation and binding of transcription factors and the SWI/SNF complex to the {beta}- and ?-casein promoters. Introduction of a dominant negative Brg1, an ATPase subunit of SWI/SNF complex, significantly reduced both {beta}- and ?-casein expression, suggesting that SWI/SNF-dependent chromatin remodeling is required for transcription of mammary-specific genes. ChIP analyses demonstrated that the ATPase activity of SWI/SNF is necessary for recruitment of RNA transcriptional machinery, but not for binding of transcription factors or for histone acetylation. Coimmunoprecipitation analyses showed that the SWI/SNF complex is associated with STAT5, C/EBP{beta}, and glucocorticoid receptor (GR). Thus, ECM- and prolactin-regulated transcription of the mammary-specific casein genes requires the concerted action of chromatin remodeling enzymes and transcription factors.

  19. A systems level predictive model for global gene regulation of methanogenesis in a hydrogenotrophic methanogen.

    Science.gov (United States)

    Yoon, Sung Ho; Turkarslan, Serdar; Reiss, David J; Pan, Min; Burn, June A; Costa, Kyle C; Lie, Thomas J; Slagel, Joseph; Moritz, Robert L; Hackett, Murray; Leigh, John A; Baliga, Nitin S

    2013-11-01

    Methanogens catalyze the critical methane-producing step (called methanogenesis) in the anaerobic decomposition of organic matter. Here, we present the first predictive model of global gene regulation of methanogenesis in a hydrogenotrophic methanogen, Methanococcus maripaludis. We generated a comprehensive list of genes (protein-coding and noncoding) for M. maripaludis through integrated analysis of the transcriptome structure and a newly constructed Peptide Atlas. The environment and gene-regulatory influence network (EGRIN) model of the strain was constructed from a compendium of transcriptome data that was collected over 58 different steady-state and time-course experiments that were performed in chemostats or batch cultures under a spectrum of environmental perturbations that modulated methanogenesis. Analyses of the EGRIN model have revealed novel components of methanogenesis that included at least three additional protein-coding genes of previously unknown function as well as one noncoding RNA. We discovered that at least five regulatory mechanisms act in a combinatorial scheme to intercoordinate key steps of methanogenesis with different processes such as motility, ATP biosynthesis, and carbon assimilation. Through a combination of genetic and environmental perturbation experiments we have validated the EGRIN-predicted role of two novel transcription factors in the regulation of phosphate-dependent repression of formate dehydrogenase-a key enzyme in the methanogenesis pathway. The EGRIN model demonstrates regulatory affiliations within methanogenesis as well as between methanogenesis and other cellular functions.

  20. Nuclear Dynamics of BRCA1-Dependent Transcription Regulation

    National Research Council Canada - National Science Library

    Sharp, Zelton D

    2005-01-01

    ...) Construction of fluorescent GAL4-DBD and ZBRK1 fusion protein has been achieved, and BRCA1 derivatives are in progress. When operational, this system will document real time nuclear dynamics of ZBRK1/BRCA1-dependent chromatin modification systems, as cells mount transcriptional responses to genotoxins.

  1. Scaling the Drosophila Wing: TOR-Dependent Target Gene Access by the Hippo Pathway Transducer Yorkie.

    Science.gov (United States)

    Parker, Joseph; Struhl, Gary

    2015-10-01

    Organ growth is controlled by patterning signals that operate locally (e.g., Wingless/Ints [Wnts], Bone Morphogenetic Proteins [BMPs], and Hedgehogs [Hhs]) and scaled by nutrient-dependent signals that act systemically (e.g., Insulin-like peptides [ILPs] transduced by the Target of Rapamycin [TOR] pathway). How cells integrate these distinct inputs to generate organs of the appropriate size and shape is largely unknown. The transcriptional coactivator Yorkie (Yki, a YES-Associated Protein, or YAP) acts downstream of patterning morphogens and other tissue-intrinsic signals to promote organ growth. Yki activity is regulated primarily by the Warts/Hippo (Wts/Hpo) tumour suppressor pathway, which impedes nuclear access of Yki by a cytoplasmic tethering mechanism. Here, we show that the TOR pathway regulates Yki by a separate and novel mechanism in the Drosophila wing. Instead of controlling Yki nuclear access, TOR signaling governs Yki action after it reaches the nucleus by allowing it to gain access to its target genes. When TOR activity is inhibited, Yki accumulates in the nucleus but is sequestered from its normal growth-promoting target genes--a phenomenon we term "nuclear seclusion." Hence, we posit that in addition to its well-known role in stimulating cellular metabolism in response to nutrients, TOR also promotes wing growth by liberating Yki from nuclear seclusion, a parallel pathway that we propose contributes to the scaling of wing size with nutrient availability.

  2. Endocrine-dependent expression of circadian clock genes in insects

    Czech Academy of Sciences Publication Activity Database

    Doležel, David; Zdechovanová, L.; Šauman, Ivo; Hodková, Magdalena

    2008-01-01

    Roč. 65, č. 6 (2008), s. 964-969 ISSN 1420-682X R&D Projects: GA ČR GA206/05/2222; GA MŠk LC07032 Institutional research plan: CEZ:AV0Z50070508 Keywords : period gene * Pdp1 gene * photoperiodism Subject RIV: ED - Physiology Impact factor: 5.511, year: 2008

  3. Sky1 regulates the expression of sulfur metabolism genes in response to cisplatin.

    Science.gov (United States)

    Rodríguez-Lombardero, Silvia; Vizoso-Vázquez, Ángel; Lombardía, Luis J; Becerra, Manuel; González-Siso, M Isabel; Cerdán, M Esperanza

    2014-07-01

    Cisplatin is commonly used in cancer therapy and yeast cells are also sensitive to this compound. We present a transcriptome analysis discriminating between RNA changes induced by cisplatin treatment, which are dependent on or independent of SKY1 function--a gene whose deletion increases resistance to the drug. Gene expression changes produced by addition of cisplatin to W303 and W303-Δsky1 cells were recorded using DNA microarrays. The data, validated by quantitative PCR, revealed 122 differentially expressed genes: 69 upregulated and 53 downregulated. Among the upregulated genes, those related to sulfur metabolism were over-represented and partially dependent on Sky1. Deletions of MET4 or other genes encoding co-regulators of the expression of sulfur-metabolism-related genes, with the exception of MET28, did not modify the cisplatin sensitivity of yeast cells. One of the genes with the highest cisplatin-induced upregulation was SEO1, encoding a putative permease of sulfur compounds. We also measured the platinum, sulfur and glutathione content in W303, W303-Δsky1 and W303-Δseo1 cells after cisplatin treatment, and integration of the data suggested that these transcriptional changes might represent a cellular response that allowed chelation of cisplatin with sulfur-containing amino acids and also helped DNA repair by stimulating purine biosynthesis. The transcription pattern of stimulation of sulfur-containing amino acids and purine synthesis decreased, or even disappeared, in the W303-Δsky1 strain. © 2014 The Authors.

  4. Regulation of Plastid Gene Expression during Photooxidative Stress.

    Science.gov (United States)

    Tonkyn, J C; Deng, X W; Gruissem, W

    1992-08-01

    We have used the carotenoid biosynthesis inhibitor norflurazon to study the relationship between chloroplast and nuclear gene expression and the mechanisms by which plastid mRNA accumulation is regulated in response to photooxidative stress. By treating 4-week-old hydroponic spinach plants (Spinacea oleracea), we were able to determine the response at two distinct stages of chloroplast development. For all parameters studied, differences were found between the norflurazon-treated young and mature leaves. Young leaves lost essentially all pigment content in the presence of norflurazon, whereas mature leaves retained more than 60% of their chlorophyll and carotenoids. The accumulation of plastid mRNA was determined for several genes, and we found a decrease in mRNA levels for all genes except psbA in herbicide-treated young leaves. For genes such as atpB, psbB, and psaA, there was a corresponding change in the relative level of transcription, but for psbA and rbcL, transcription and mRNA accumulation were uncoupled. In norflurazon-treated mature leaves, all plastid mRNAs except psaA accumulated to normal levels, and transcription levels were either normal or higher than corresponding controls. This led to the conclusion that plastid mRNA accumulation is regulated both transcriptionally and posttranscriptionally in response to photooxidative stress. Although direct photooxidative damage is confined to the plastid and peroxisome, there is a feedback of information controlling the transcription of nuclear-encoded plastid proteins. Considerable evidence has accumulated implicating a "plastid factor" in this control. Therefore, the expression of several nuclear-encoded plastid proteins and the corresponding mRNAs were determined. Although the levels of both the small subunit of ribulose-1,5-bisphosphate carboxylase and the light harvesting chlorophyll a/b-binding protein and corresponding mRNAs were reduced, a 28-kilodalton chloroplast RNA-binding protein and

  5. Regulation of Plastid Gene Expression during Photooxidative Stress 1

    Science.gov (United States)

    Tonkyn, John C.; Deng, Xing-Wang; Gruissem, Wilhelm

    1992-01-01

    We have used the carotenoid biosynthesis inhibitor norflurazon to study the relationship between chloroplast and nuclear gene expression and the mechanisms by which plastid mRNA accumulation is regulated in response to photooxidative stress. By treating 4-week-old hydroponic spinach plants (Spinacea oleracea), we were able to determine the response at two distinct stages of chloroplast development. For all parameters studied, differences were found between the norflurazon-treated young and mature leaves. Young leaves lost essentially all pigment content in the presence of norflurazon, whereas mature leaves retained more than 60% of their chlorophyll and carotenoids. The accumulation of plastid mRNA was determined for several genes, and we found a decrease in mRNA levels for all genes except psbA in herbicide-treated young leaves. For genes such as atpB, psbB, and psaA, there was a corresponding change in the relative level of transcription, but for psbA and rbcL, transcription and mRNA accumulation were uncoupled. In norflurazon-treated mature leaves, all plastid mRNAs except psaA accumulated to normal levels, and transcription levels were either normal or higher than corresponding controls. This led to the conclusion that plastid mRNA accumulation is regulated both transcriptionally and posttranscriptionally in response to photooxidative stress. Although direct photooxidative damage is confined to the plastid and peroxisome, there is a feedback of information controlling the transcription of nuclear-encoded plastid proteins. Considerable evidence has accumulated implicating a “plastid factor” in this control. Therefore, the expression of several nuclear-encoded plastid proteins and the corresponding mRNAs were determined. Although the levels of both the small subunit of ribulose-1,5-bisphosphate carboxylase and the light harvesting chlorophyll a/b-binding protein and corresponding mRNAs were reduced, a 28-kilodalton chloroplast RNA-binding protein and

  6. Structural Basis for Bc12-Regulated Mitochondrion-Dependent Apoptosis

    Science.gov (United States)

    2005-04-01

    preparation against two changes 11 mg 1-1 CaC12, 120 mg 1-1 MgSO 4, 50 mg 1-1 thiamine , 1% of 41 of buffer, followed by two changes of 41 of water, (v/v...bilayer samples. In the absence of phate, 150 mm sodium chloride , pH 7.2), and then the resin was washed lipids, tBid is soluble and retains a largely...deleted to be replaced with a hydro - have found TLE to be useful for the production of Mat-8 phobic polypeptide gene of interest by insertion at an engi

  7. Transcription factor control of growth rate dependent genes in Saccharomyces cerevisiae: A three factor design

    DEFF Research Database (Denmark)

    Fazio, Alessandro; Jewett, Michael Christopher; Daran-Lapujade, Pascale

    2008-01-01

    transcription factor target sets, transcription factors that coordinate balanced growth were also identified. Our analysis shows that FhII, Rap1, and Sfp1, regulating protein biosynthesis, have significantly enriched target sets for genes up-regulated with increasing growth rate. Cell cycle regulators...

  8. Substrate availability and transcriptional regulation of metabolic genes in human skeletal muscle during recovery from exercise

    DEFF Research Database (Denmark)

    Pilegaard, Henriette; Osada, Takuya; Andersen, Lisbeth Tingsted

    2005-01-01

    In skeletal muscle of humans, transcription of several metabolic genes is transiently induced during recovery from exercise when no food is consumed. To determine the potential influence of substrate availability on the transcriptional regulation of metabolic genes during recovery from exercise, 9...... the transcriptional regulation of metabolic genes in skeletal muscle of humans during recovery from exercise....

  9. Silicon Regulates Potential Genes Involved in Major Physiological Processes in Plants to Combat Stress

    Directory of Open Access Journals (Sweden)

    Abinaya Manivannan

    2017-08-01

    Full Text Available Silicon (Si, the quasi-essential element occurs as the second most abundant element in the earth's crust. Biological importance of Si in plant kingdom has become inevitable particularly under stressed environment. In general, plants are classified as high, medium, and low silicon accumulators based on the ability of roots to absorb Si. The uptake of Si directly influence the positive effects attributed to the plant but Si supplementation proves to mitigate stress and recover plant growth even in low accumulating plants like tomato. The application of Si in soil as well as soil-less cultivation systems have resulted in the enhancement of quantitative and qualitative traits of plants even under stressed environment. Silicon possesses several mechanisms to regulate the physiological, biochemical, and antioxidant metabolism in plants to combat abiotic and biotic stresses. Nevertheless, very few reports are available on the aspect of Si-mediated molecular regulation of genes with potential role in stress tolerance. The recent advancements in the era of genomics and transcriptomics have opened an avenue for the determination of molecular rationale associated with the Si amendment to the stress alleviation in plants. Therefore, the present endeavor has attempted to describe the recent discoveries related to the regulation of vital genes involved in photosynthesis, transcription regulation, defense, water transport, polyamine synthesis, and housekeeping genes during abiotic and biotic stress alleviation by Si. Furthermore, an overview of Si-mediated modulation of multiple genes involved in stress response pathways such as phenylpropanoid pathway, jasmonic acid pathway, ABA-dependent or independent regulatory pathway have been discussed in this review.

  10. Silicon Regulates Potential Genes Involved in Major Physiological Processes in Plants to Combat Stress.

    Science.gov (United States)

    Manivannan, Abinaya; Ahn, Yul-Kuyn

    2017-01-01

    Silicon (Si), the quasi-essential element occurs as the second most abundant element in the earth's crust. Biological importance of Si in plant kingdom has become inevitable particularly under stressed environment. In general, plants are classified as high, medium, and low silicon accumulators based on the ability of roots to absorb Si. The uptake of Si directly influence the positive effects attributed to the plant but Si supplementation proves to mitigate stress and recover plant growth even in low accumulating plants like tomato. The application of Si in soil as well as soil-less cultivation systems have resulted in the enhancement of quantitative and qualitative traits of plants even under stressed environment. Silicon possesses several mechanisms to regulate the physiological, biochemical, and antioxidant metabolism in plants to combat abiotic and biotic stresses. Nevertheless, very few reports are available on the aspect of Si-mediated molecular regulation of genes with potential role in stress tolerance. The recent advancements in the era of genomics and transcriptomics have opened an avenue for the determination of molecular rationale associated with the Si amendment to the stress alleviation in plants. Therefore, the present endeavor has attempted to describe the recent discoveries related to the regulation of vital genes involved in photosynthesis, transcription regulation, defense, water transport, polyamine synthesis, and housekeeping genes during abiotic and biotic stress alleviation by Si. Furthermore, an overview of Si-mediated modulation of multiple genes involved in stress response pathways such as phenylpropanoid pathway, jasmonic acid pathway, ABA-dependent or independent regulatory pathway have been discussed in this review.

  11. Burkholderia cenocepacia ShvR-regulated genes that influence colony morphology, biofilm formation, and virulence.

    Science.gov (United States)

    Subramoni, Sujatha; Nguyen, David T; Sokol, Pamela A

    2011-08-01

    Burkholderia cenocepacia is an opportunistic pathogen that primarily infects cystic fibrosis (CF) patients. Previously, we reported that ShvR, a LysR regulator, influences colony morphology, virulence, and biofilm formation and regulates the expression of an adjacent 24-kb genomic region encoding 24 genes. In this study, we report the functional characterization of selected genes in this region. A Tn5 mutant with shiny colony morphology was identified with a polar mutation in BCAS0208, predicted to encode an acyl-coenzyme A dehydrogenase. Mutagenesis of BCAS0208 and complementation analyses revealed that BCAS0208 is required for rough colony morphology, biofilm formation, and virulence on alfalfa seedlings. It was not possible to complement with BCAS0208 containing a mutation in the catalytic site. BCAS0201, encoding a putative flavin adenine dinucleotide (FAD)-dependent oxidoreductase, and BCAS0207, encoding a putative citrate synthase, do not influence colony morphology but are required for optimum levels of biofilm formation and virulence. Both BCAS0208 and BCAS0201 contribute to pellicle formation, although individual mutations in each of these genes had no appreciable effect on pellicle formation. A mutant with a polar insertion in BCAS0208 was significantly less virulent in a rat model of chronic lung infection as well as in the alfalfa model. Genes in this region were shown to influence utilization of branched-chain fatty acids, tricarboxylic acid cycle substrates, l-arabinose, and branched-chain amino acids. Together, our data show that the ShvR-regulated genes BCAS0208 to BCAS0201 are required for the rough colony morphotype, biofilm and pellicle formation, and virulence in B. cenocepacia.

  12. Regulation of p73 by Hck through kinase-dependent and independent mechanisms

    Directory of Open Access Journals (Sweden)

    Radha Vegesna

    2007-05-01

    Full Text Available Abstract Background p73, a p53 family member is a transcription factor that plays a role in cell cycle, differentiation and apoptosis. p73 is regulated through post translational modifications and protein interactions. c-Abl is the only known tyrosine kinase that phosphorylates and activates p73. Here we have analyzed the role of Src family kinases, which are involved in diverse signaling pathways, in regulating p73. Results Exogenously expressed as well as cellular Hck and p73 interact in vivo. In vitro binding assays show that SH3 domain of Hck interacts with p73. Co-expression of p73 with Hck or c-Src in mammalian cells resulted in tyrosine phosphorylation of p73. Using site directed mutational analysis, we determined that Tyr-28 was the major site of phosphorylation by Hck and c-Src, unlike c-Abl which phosphorylates Tyr-99. In a kinase dependent manner, Hck co-expression resulted in stabilization of p73 protein in the cytoplasm. Activation of Hck in HL-60 cells resulted in tyrosine phosphorylation of endogenous p73. Both exogenous and endogenous Hck localize to the nuclear as well as cytoplasmic compartment, just as does p73. Ectopically expressed Hck repressed the transcriptional activity of p73 as determined by promoter assays and semi-quantitative RT-PCR analysis of the p73 target, Ipaf and MDM2. SH3 domain- dependent function of Hck was required for its effect on p73 activity, which was also reflected in its ability to inhibit p73-mediated apoptosis. We also show that Hck interacts with Yes associated protein (YAP, a transcriptional co-activator of p73, and shRNA mediated knockdown of YAP protein reduces p73 induced Ipaf promoter activation. Conclusion We have identified p73 as a novel substrate and interacting partner of Hck and show that it regulates p73 through mechanisms that are dependent on either catalytic activity or protein interaction domains. Hck-SH3 domain-mediated interactions play an important role in the inhibition of p73

  13. 3-OST-7 regulates BMP-dependent cardiac contraction.

    Directory of Open Access Journals (Sweden)

    Shiela C Samson

    2013-12-01

    Full Text Available The 3-O-sulfotransferase (3-OST family catalyzes rare modifications of glycosaminoglycan chains on heparan sulfate proteoglycans, yet their biological functions are largely unknown. Knockdown of 3-OST-7 in zebrafish uncouples cardiac ventricular contraction from normal calcium cycling and electrophysiology by reducing tropomyosin4 (tpm4 expression. Normal 3-OST-7 activity prevents the expansion of BMP signaling into ventricular myocytes, and ectopic activation of BMP mimics the ventricular noncontraction phenotype seen in 3-OST-7 depleted embryos. In 3-OST-7 morphants, ventricular contraction can be rescued by overexpression of tropomyosin tpm4 but not by troponin tnnt2, indicating that tpm4 serves as a lynchpin for ventricular sarcomere organization downstream of 3-OST-7. Contraction can be rescued by expression of 3-OST-7 in endocardium, or by genetic loss of bmp4. Strikingly, BMP misregulation seen in 3-OST-7 morphants also occurs in multiple cardiac noncontraction models, including potassium voltage-gated channel gene, kcnh2, affected in Romano-Ward syndrome and long-QT syndrome, and cardiac troponin T gene, tnnt2, affected in human cardiomyopathies. Together these results reveal 3-OST-7 as a key component of a novel pathway that constrains BMP signaling from ventricular myocytes, coordinates sarcomere assembly, and promotes cardiac contractile function.

  14. "Glucose and ethanol-dependent transcriptional regulation of the astaxanthin biosynthesis pathway in Xanthophyllomyces dendrorhous"

    Directory of Open Access Journals (Sweden)

    Cifuentes Víctor

    2011-08-01

    Full Text Available Abstract Background The yeast Xanthophyllomyces dendrorhous is one of the most promising and economically attractive natural sources of astaxanthin. The biosynthesis of this valuable carotenoid is a complex process for which the regulatory mechanisms remain mostly unknown. Several studies have shown a strong correlation between the carbon source present in the medium and the amount of pigments synthesized. Carotenoid production is especially low when high glucose concentrations are used in the medium, while a significant increase is observed with non-fermentable carbon sources. However, the molecular basis of this phenomenon has not been established. Results In this work, we showed that glucose caused transcriptional repression of the three genes involved in the synthesis of astaxanthin from geranylgeranyl pyrophosphate in X. dendrorhous, which correlates with a complete inhibition of pigment synthesis. Strikingly, this regulatory response was completely altered in mutant strains that are incapable of synthesizing astaxanthin. However, we found that addition of ethanol caused the induction of crtYB and crtS gene expression and promoted de novo synthesis of carotenoids. The induction of carotenogenesis was noticeable as early as 24 h after ethanol addition. Conclusion For the first time, we demonstrated that carbon source-dependent regulation of astaxanthin biosynthesis in X. dendrorhous involves changes at the transcriptional level. Such regulatory mechanism provides an explanation for the strong and early inhibitory effect of glucose on the biosynthesis of this carotenoid.

  15. Combinatorial regulation of a signal-dependent activator by phosphorylation and acetylation.

    Science.gov (United States)

    Paz, Jose C; Park, Sangho; Phillips, Naomi; Matsumura, Shigenobu; Tsai, Wen-Wei; Kasper, Lawryn; Brindle, Paul K; Zhang, Guangtao; Zhou, Ming-Ming; Wright, Peter E; Montminy, Marc

    2014-12-02

    In the fasted state, increases in catecholamine signaling promote adipocyte function via the protein kinase A-mediated phosphorylation of cyclic AMP response element binding protein (CREB). CREB activity is further up-regulated in obesity, despite reductions in catecholamine signaling, where it contributes to the development of insulin resistance. Here we show that obesity promotes the CREB binding protein (CBP)-mediated acetylation of CREB at Lys136 in adipose. Under lean conditions, CREB acetylation was low due to an association with the energy-sensing NAD(+)-dependent deacetylase SirT1; amounts of acetylated CREB were increased in obesity, when SirT1 undergoes proteolytic degradation. Whereas CREB phosphorylation stimulated an association with the KIX domain of CBP, Lys136 acetylation triggered an interaction with the CBP bromodomain (BRD) that augmented recruitment of this coactivator to the promoter. Indeed, coincident Ser133 phosphorylation and Lys136 acetylation of CREB stimulated the formation of a ternary complex with the KIX and BRD domains of CBP by NMR analysis. As disruption of the CREB:BRD complex with a CBP-specific BRD inhibitor blocked effects of CREB acetylation on target gene expression, our results demonstrate how changes in nutrient status modulate cellular gene expression in response to hormonal signals.

  16. Peroxisome proliferator-activated receptor γ-dependent regulation of lipolytic nodes and metabolic flexibility.

    Science.gov (United States)

    Rodriguez-Cuenca, Sergio; Carobbio, Stefania; Velagapudi, Vidya R; Barbarroja, Nuria; Moreno-Navarrete, Jose Maria; Tinahones, Francisco Jose; Fernandez-Real, Jose Manuel; Orešic, Matej; Vidal-Puig, Antonio

    2012-04-01

    Optimal lipid storage and mobilization are essential for efficient adipose tissue. Nuclear receptor peroxisome proliferator-activated receptor γ (PPARγ) regulates adipocyte differentiation and lipid deposition, but its role in lipolysis and dysregulation in obesity is not well defined. This investigation aimed to understand the molecular impact of dysfunctional PPARγ on the lipolytic axis and to explore whether these defects are also confirmed in common forms of human obesity. For this purpose, we used the P465L PPARγ mouse as a model of dysfunctional PPARγ that recapitulates the human pparγ mutation (P467L). We demonstrated that defective PPARγ impairs catecholamine-induced lipolysis. This abnormal lipolytic response is exacerbated by a state of positive energy balance in leptin-deficient ob/ob mice. We identified the protein kinase A (PKA) network as a PPARγ-dependent regulatory node of the lipolytic response. Specifically, defective PPARγ is associated with decreased basal expression of prkaca (PKAcatα) and d-akap1, the lipase genes Pnplaz (ATGL) and Lipe (HSL), and lipid droplet protein genes fsp27 and adrp in vivo and in vitro. Our data indicate that PPARγ is required for activation of the lipolytic regulatory network, dysregulation of which is an important feature of obesity-induced insulin resistance in humans.

  17. 4EGI-1 represses cap-dependent translation and regulates genome-wide translation in malignant pleural mesothelioma.

    Science.gov (United States)

    De, Arpita; Jacobson, Blake A; Peterson, Mark S; Jay-Dixon, Joe; Kratzke, Marian G; Sadiq, Ahad A; Patel, Manish R; Kratzke, Robert A

    2018-04-01

    Deregulation of cap-dependent translation has been implicated in the malignant transformation of numerous human tissues. 4EGI-1, a novel small-molecule inhibitor of cap-dependent translation, disrupts formation of the eukaryotic initiation factor 4F (eIF4F) complex. The effects of 4EGI-1-mediated inhibition of translation initiation in malignant pleural mesothelioma (MPM) were examined. 4EGI-1 preferentially inhibited cell viability and induced apoptosis in MPM cells compared to normal mesothelial (LP9) cells. This effect was associated with hypophosphorylation of 4E-binding protein 1 (4E-BP1) and decreased protein levels of the cancer-related genes, c-myc and osteopontin. 4EGI-1 showed enhanced cytotoxicity in combination with pemetrexed or gemcitabine. Translatome-wide polysome microarray analysis revealed a large cohort of genes that were translationally regulated upon treatment with 4EGI-1. The 4EGI-1-regulated translatome was negatively correlated to a previously published translatome regulated by eIF4E overexpression in human mammary epithelial cells, which is in agreement with the notion that 4EGI-1 inhibits the eIF4F complex. These data indicate that inhibition of the eIF4F complex by 4EGI-1 or similar translation inhibitors could be a strategy for treating mesothelioma. Genome wide translational profiling identified a large cohort of promising target genes that should be further evaluated for their potential significance in the treatment of MPM.

  18. Regulation and Function of Adult Neurogenesis: From Genes to Cognition

    Science.gov (United States)

    Aimone, James B.; Li, Yan; Lee, Star W.; Clemenson, Gregory D.; Deng, Wei; Gage, Fred H.

    2014-01-01

    Adult neurogenesis in the hippocampus is a notable process due not only to its uniqueness and potential impact on cognition but also to its localized vertical integration of different scales of neuroscience, ranging from molecular and cellular biology to behavior. This review summarizes the recent research regarding the process of adult neurogenesis from these different perspectives, with particular emphasis on the differentiation and development of new neurons, the regulation of the process by extrinsic and intrinsic factors, and their ultimate function in the hippocampus circuit. Arising from a local neural stem cell population, new neurons progress through several stages of maturation, ultimately integrating into the adult dentate gyrus network. The increased appreciation of the full neurogenesis process, from genes and cells to behavior and cognition, makes neurogenesis both a unique case study for how scales in neuroscience can link together and suggests neurogenesis as a potential target for therapeutic intervention for a number of disorders. PMID:25287858

  19. ROG, repressor of GATA, regulates the expression of cytokine genes.

    Science.gov (United States)

    Miaw, S C; Choi, A; Yu, E; Kishikawa, H; Ho, I C

    2000-03-01

    GATA-3 is a T cell-specific transcription factor and is essential for the development of the T cell lineage. Recently, it was shown that the expression of GATA-3 is further induced in CD4+ helper T cells upon differentiation into type 2 but not type 1 effector cells. Here, we report the molecular cloning of a GATA-3 interacting protein, repressor of GATA (ROG). ROG is a lymphoid-specific gene and is rapidly induced in Th cells upon stimulation with anti-CD3. In in vitro assays, ROG represses the GATA-3-induced transactivation. Furthermore, overexpression of ROG in Th clones inhibits the production of Th cytokines. Taken together, our results suggest that ROG might play a critical role in regulating the differentiation and activation of Th cells.

  20. Cohesin mediates Esco2-dependent transcriptional regulation in a zebrafish regenerating fin model of Roberts Syndrome

    Directory of Open Access Journals (Sweden)

    Rajeswari Banerji

    2017-12-01

    Full Text Available Robert syndrome (RBS and Cornelia de Lange syndrome (CdLS are human developmental disorders characterized by craniofacial deformities, limb malformation and mental retardation. These birth defects are collectively termed cohesinopathies as both arise from mutations in cohesion genes. CdLS arises due to autosomal dominant mutations or haploinsufficiencies in cohesin subunits (SMC1A, SMC3 and RAD21 or cohesin auxiliary factors (NIPBL and HDAC8 that result in transcriptional dysregulation of developmental programs. RBS arises due to autosomal recessive mutations in cohesin auxiliary factor ESCO2, the gene that encodes an N-acetyltransferase which targets the SMC3 subunit of the cohesin complex. The mechanism that underlies RBS, however, remains unknown. A popular model states that RBS arises due to mitotic failure and loss of progenitor stem cells through apoptosis. Previous findings in the zebrafish regenerating fin, however, suggest that Esco2-knockdown results in transcription dysregulation, independent of apoptosis, similar to that observed in CdLS patients. Previously, we used the clinically relevant CX43 to demonstrate a transcriptional role for Esco2. CX43 is a gap junction gene conserved among all vertebrates that is required for direct cell-cell communication between adjacent cells such that cx43 mutations result in oculodentodigital dysplasia. Here, we show that morpholino-mediated knockdown of smc3 reduces cx43 expression and perturbs zebrafish bone and tissue regeneration similar to those previously reported for esco2 knockdown. Also similar to Esco2-dependent phenotypes, Smc3-dependent bone and tissue regeneration defects are rescued by transgenic Cx43 overexpression, suggesting that Smc3 and Esco2 cooperatively act to regulate cx43 transcription. In support of this model, chromatin immunoprecipitation assays reveal that Smc3 binds to a discrete region of the cx43 promoter, suggesting that Esco2 exerts transcriptional regulation of cx

  1. The effect of 5-HTT gene promoter polymorphism on impulsivity depends on family relations in girls.

    Science.gov (United States)

    Paaver, Marika; Kurrikoff, Triin; Nordquist, Niklas; Oreland, Lars; Harro, Jaanus

    2008-07-01

    The short (S) allele of the 5-HTT gene promoter region polymorphism (5-HTTLPR), in combination with adverse environmental influence, leads to higher likelihood of depression. Impulsivity has been related to low serotonin turnover, poor regulation of affect, and problems in the family, including child maltreatment. The current study explored the effect of the 5-HTTLPR polymorphism in the serotonin transporter gene and adverse family environment on impulsivity in adolescents. Healthy adolescents participating in the Estonian Children Personality Behaviour and Health Study (n=483) filled the Adaptive and Maladaptive Impulsivity Scale (AMIS), Barratt Impulsiveness Scale (BIS-11), a scale measuring family relations, and were genotyped. While genotype alone was not associated with thoughtlessness, BIS-11 impulsiveness, fast decision-making or excitement seeking, 5-HTTLPR S allele carriers, however, had higher scores of disinhibition. In girls carrying the S allele, scores of thoughtlessness and disinhibition depended on family relations, being higher with less warmth in the family. Adverse family relations had no effect on impulsivity in girls with LL genotype. In boys, the effects of family relations on maladaptive impulsivity did not depend on genotype. However, the S allele and high maltreatment in the family both independently increased disinhibition and the BIS-11 score in boys. Family environment and the 5-HTTLPR genotype had no interactive effect on excitement seeking or fast decision-making. In summary, carrying the S allele may lead to high maladaptive impulsivity due to higher sensitivity to environmental adversity, which is more significantly expressed in girls.

  2. Intracellular calcium levels can regulate Importin-dependent nuclear import

    International Nuclear Information System (INIS)

    Kaur, Gurpreet; Ly-Huynh, Jennifer D.; Jans, David A.

    2014-01-01

    Highlights: • High intracellular calcium inhibits Impα/β1- or Impβ1-dependent nuclear protein import. • The effect of Ca 2+ on nuclear import does not relate to changes in the nuclear pore. • High intracellular calcium can result in mislocalisation of Impβ1, Ran and RCC1. - Abstract: We previously showed that increased intracellular calcium can modulate Importin (Imp)β1-dependent nuclear import of SRY-related chromatin remodeling proteins. Here we extend this work to show for the first time that high intracellular calcium inhibits Impα/β1- or Impβ1-dependent nuclear protein import generally. The basis of this relates to the mislocalisation of the transport factors Impβ1 and Ran, which show significantly higher nuclear localization in contrast to various other factors, and RCC1, which shows altered subnuclear localisation. The results here establish for the first time that intracellular calcium modulates conventional nuclear import through direct effects on the nuclear transport machinery

  3. Regulation of Th17 Differentiation by IKKα-Dependent and -Independent Phosphorylation of RORγt.

    Science.gov (United States)

    He, Zhiheng; Wang, Fei; Zhang, Jing; Sen, Subha; Pang, Qihua; Luo, Shengwei; Gwack, Yousang; Sun, Zuoming

    2017-08-01

    Transcription factor retinoid acid-related orphan receptor (ROR)γt transcriptionally regulates the genes required for differentiation of Th17 cells that mediate both protective and pathogenic immunity. However, little is known about the function of posttranslational modifications in the regulation of RORγt activity. Mass spectrometric analysis of immunoprecipitated RORγt from Th17 cells identified multiple phosphorylation sites. Systematic mutation analysis of the identified phosphorylation sites found that phosphorylation of S376 enhances whereas phosphorylation of S484 inhibits Th17 differentiation. IκB kinase (IKK)α binds and phosphorylates RORγt at S376 but not S484. Knockdown of IKKα, dominant-negative IKKα, and RORγt mutants incapable of interacting with IKKα all decrease Th17 differentiation. Furthermore, nonphosophorylatable RORγt mutant (S376A) impairs whereas phosphomimetic mutant (S376E) stimulates Th17 differentiation independent of IKKα. Therefore, IKKα-dependent phosphorylation of S376 stimulated whereas IKKα-independent phosphorylation of S484 inhibited RORγt function in Th17 differentiation. Copyright © 2017 by The American Association of Immunologists, Inc.

  4. Frank-ter Haar syndrome protein Tks4 regulates epidermal growth factor-dependent cell migration.

    Science.gov (United States)

    Bögel, Gábor; Gujdár, Annamária; Geiszt, Miklós; Lányi, Árpád; Fekete, Anna; Sipeki, Szabolcs; Downward, Julian; Buday, László

    2012-09-07

    Mutations in the SH3PXD2B gene coding for the Tks4 protein are responsible for the autosomal recessive Frank-ter Haar syndrome. Tks4, a substrate of Src tyrosine kinase, is implicated in the regulation of podosome formation. Here, we report a novel role for Tks4 in the EGF signaling pathway. In EGF-treated cells, Tks4 is tyrosine-phosphorylated and associated with the activated EGF receptor. This association is not direct but requires the presence of Src tyrosine kinase. In addition, treatment of cells with LY294002, an inhibitor of PI 3-kinase, or mutations of the PX domain reduces tyrosine phosphorylation and membrane translocation of Tks4. Furthermore, a PX domain mutant (R43W) Tks4 carrying a reported point mutation in a Frank-ter Haar syndrome patient showed aberrant intracellular expression and reduced phosphoinositide binding. Finally, silencing of Tks4 was shown to markedly inhibit HeLa cell migration in a Boyden chamber assay in response to EGF or serum. Our results therefore reveal a new function for Tks4 in the regulation of growth factor-dependent cell migration.

  5. Competition between target sites of regulators shapes post-transcriptional gene regulation.

    Science.gov (United States)

    Jens, Marvin; Rajewsky, Nikolaus

    2015-02-01

    Post-transcriptional gene regulation (PTGR) of mRNA turnover, localization and translation is mediated by microRNAs (miRNAs) and RNA-binding proteins (RBPs). These regulators exert their effects by binding to specific sequences within their target mRNAs. Increasing evidence suggests that competition for binding is a fundamental principle of PTGR. Not only can miRNAs be sequestered and neutralized by the targets with which they interact through a process termed 'sponging', but competition between binding sites on different RNAs may also lead to regulatory crosstalk between transcripts. Here, we quantitatively model competition effects under physiological conditions and review the role of endogenous sponges for PTGR in light of the key features that emerge.

  6. Regulators of cyclin-dependent kinases are crucial for maintaining genome integrity in S phase

    DEFF Research Database (Denmark)

    Beck, Halfdan; Nähse, Viola; Larsen, Marie Sofie Yoo

    2010-01-01

    Maintenance of genome integrity is of critical importance to cells. To identify key regulators of genomic integrity, we screened a human cell line with a kinome small interfering RNA library. WEE1, a major regulator of mitotic entry, and CHK1 were among the genes identified. Both kinases...

  7. Quorum Sensing Regulation of Adhesion in Serratia Marcescens MG1 is surface dependent

    DEFF Research Database (Denmark)

    Labbate, M.; Zhu, H.; Thung, L.

    2007-01-01

    in a non-QS-controlled fashion. Therefore, the expression of these two genes appears to be cocontrolled by regulators other than the QS system for mediation of attachment to HCE cells. We also found that QS in S. marcescens regulates other potential cell surface adhesins, including exopolysaccharide...

  8. The p53-p21-DREAM-CDE/CHR pathway regulates G2/M cell cycle genes

    Science.gov (United States)

    Fischer, Martin; Quaas, Marianne; Steiner, Lydia; Engeland, Kurt

    2016-01-01

    The tumor suppressor p53 functions predominantly as a transcription factor by activating and downregulating gene expression, leading to cell cycle arrest or apoptosis. p53 was shown to indirectly repress transcription of the CCNB2, KIF23 and PLK4 cell cycle genes through the recently discovered p53-p21-DREAM-CDE/CHR pathway. However, it remained unclear whether this pathway is commonly used. Here, we identify genes regulated by p53 through this pathway in a genome-wide computational approach. The bioinformatic analysis is based on genome-wide DREAM complex binding data, p53-depedent mRNA expression data and a genome-wide definition of phylogenetically conserved CHR promoter elements. We find 210 target genes that are expected to be regulated by the p53-p21-DREAM-CDE/CHR pathway. The target gene list was verified by detailed analysis of p53-dependent repression of the cell cycle genes B-MYB (MYBL2), BUB1, CCNA2, CCNB1, CHEK2, MELK, POLD1, RAD18 and RAD54L. Most of the 210 target genes are essential regulators of G2 phase and mitosis. Thus, downregulation of these genes through the p53-p21-DREAM-CDE/CHR pathway appears to be a principal mechanism for G2/M cell cycle arrest by p53. PMID:26384566

  9. XIAP gene expression and function is regulated by autocrine and paracrine TGF-β signaling

    Directory of Open Access Journals (Sweden)

    Van Themsche Céline

    2010-08-01

    Full Text Available Abstract Background X-linked inhibitor of apoptosis protein (XIAP is often overexpressed in cancer cells, where it plays a key role in survival and also promotes invasiveness. To date however, the extracellular signals and intracellular pathways regulating its expression and activity remain incompletely understood. We have previously showed that exposure to each of the three TGF-β (transforming growth factor beta isoforms upregulates XIAP protein content in endometrial carcinoma cells in vitro. In the present study, we have investigated the clinical relevance of TGF-β isoforms in endometrial tumours and the mechanisms through which TGF-β isoforms regulate XIAP content in uterine cancer cells. Methods TGF-β isoforms immunoreactivity in clinical samples from endometrial tumours was assessed using immunofluorescence. Two model cancer cell lines (KLE endometrial carcinoma cells and HeLa cervical cancer cells and pharmacological inhibitors were used to investigate the signalling pathways regulating XIAP expression and activity in response to autocrine and paracrine TGF-β in cancer cell. Results We have found immunoreactivity for each TGF-β isoform in clinical samples from endometrial tumours, localizing to both stromal and epithelial/cancer cells. Blockade of autocrine TGF-β signaling in KLE endometrial carcinoma cells and HeLa cervical cancer cells reduced endogenous XIAP mRNA and protein levels. In addition, each TGF-β isoform upregulated XIAP gene expression when given exogenously, in a Smad/NF-κB dependent manner. This resulted in increased polyubiquitination of PTEN (phosphatase and tensin homolog on chromosome ten, a newly identified substrate for XIAP E3 ligase activity, and in a XIAP-dependent decrease of PTEN protein levels. Although each TGF-β isoform decreased PTEN content in a XIAP- and a Smad-dependent manner, decrease of PTEN levels in response to only one isoform, TGF-β3, was blocked by PI3-K inhibitor LY294002. Conclusions

  10. From synapse to nucleus: calcium-dependent gene transcription in the control of synapse development and function.

    Science.gov (United States)

    Greer, Paul L; Greenberg, Michael E

    2008-09-25

    One of the unique characteristics of higher organisms is their ability to learn and adapt to changes in their environment. This plasticity is largely a result of the brain's ability to convert transient stimuli into long-lasting alterations in neuronal structure and function. This process is complex and involves changes in receptor trafficking, local mRNA translation, protein turnover, and new gene synthesis. Here, we review how neuronal activity triggers calcium-dependent gene expression to regulate synapse development, maturation, and refinement. Interestingly, many components of the activity-dependent gene expression program are mutated in human cognitive disorders, which suggest that this program is essential for proper brain development and function.

  11. Stimuli-Regulated Smart Polymeric Systems for Gene Therapy

    Directory of Open Access Journals (Sweden)

    Ansuja Pulickal Mathew

    2017-04-01

    Full Text Available The physiological condition of the human body is a composite of different environments, each with its own parameters that may differ under normal, as well as diseased conditions. These environmental conditions include factors, such as pH, temperature and enzymes that are specific to a type of cell, tissue or organ or a pathological state, such as inflammation, cancer or infection. These conditions can act as specific triggers or stimuli for the efficient release of therapeutics at their destination by overcoming many physiological and biological barriers. The efficacy of conventional treatment modalities can be enhanced, side effects decreased and patient compliance improved by using stimuli-responsive material that respond to these triggers at the target site. These stimuli or triggers can be physical, chemical or biological and can be internal or external in nature. Many smart/intelligent stimuli-responsive therapeutic gene carriers have been developed that can respond to either internal stimuli, which may be normally present, overexpressed or present in decreased levels, owing to a disease, or to stimuli that are applied externally, such as magnetic fields. This review focuses on the effects of various internal stimuli, such as temperature, pH, redox potential, enzymes, osmotic activity and other biomolecules that are present in the body, on modulating gene expression by using stimuli-regulated smart polymeric carriers.

  12. Coenzyme Recognition and Gene Regulation by a Flavin Mononucleotide Riboswitch

    Energy Technology Data Exchange (ETDEWEB)

    Serganov, A.; Huang, L; Patel, D

    2009-01-01

    The biosynthesis of several protein cofactors is subject to feedback regulation by riboswitches. Flavin mononucleotide (FMN)-specific riboswitches also known as RFN elements, direct expression of bacterial genes involved in the biosynthesis and transport of riboflavin (vitamin B2) and related compounds. Here we present the crystal structures of the Fusobacterium nucleatum riboswitch bound to FMN, riboflavin and antibiotic roseoflavin. The FMN riboswitch structure, centred on an FMN-bound six-stem junction, does not fold by collinear stacking of adjacent helices, typical for folding of large RNAs. Rather, it adopts a butterfly-like scaffold, stapled together by opposingly directed but nearly identically folded peripheral domains. FMN is positioned asymmetrically within the junctional site and is specifically bound to RNA through interactions with the isoalloxazine ring chromophore and direct and Mg{sup 2+}-mediated contacts with the phosphate moiety. Our structural data, complemented by binding and footprinting experiments, imply a largely pre-folded tertiary RNA architecture and FMN recognition mediated by conformational transitions within the junctional binding pocket. The inherent plasticity of the FMN-binding pocket and the availability of large openings make the riboswitch an attractive target for structure-based design of FMN-like antimicrobial compounds. Our studies also explain the effects of spontaneous and antibiotic-induced deregulatory mutations and provided molecular insights into FMN-based control of gene expression in normal and riboflavin-overproducing bacterial strains.

  13. Flg22-triggered immunity negatively regulates key BR biosynthetic genes

    Directory of Open Access Journals (Sweden)

    Tamara eJiménez-Góngora

    2015-11-01

    Full Text Available In plants, activation of growth and activation of immunity are opposing processes that define a trade-off. In the past few years, the growth-promoting hormones brassinosteroids (BR have emerged as negative regulators of pathogen-associated molecular pattern (PAMP-triggered immunity (PTI, promoting growth at the expense of defence. The crosstalk between BR and PTI signalling was described as negative and unidirectional, since activation of PTI does not affect several analysed steps in the BR signalling pathway. In this work, we describe that activation of PTI by the bacterial PAMP flg22 results in the reduced expression of BR biosynthetic genes. This effect does not require BR perception or signalling, and occurs within 15 minutes of flg22 treatment. Since the described PTI-induced repression of gene expression may result in a reduction in BR biosynthesis, the crosstalk between PTI and BR could actually be negative and bidirectional, a possibility that should be taken into account when considering the interaction between these two pathways.

  14. Reconstructing nonlinear dynamic models of gene regulation using stochastic sampling

    Directory of Open Access Journals (Sweden)

    Reinelt Gerhard

    2009-12-01

    Full Text Available Abstract Background The reconstruction of gene regulatory networks from time series gene expression data is one of the most difficult problems in systems biology. This is due to several reasons, among them the combinatorial explosion of possible network topologies, limited information content of the experimental data with high levels of noise, and the complexity of gene regulation at the transcriptional, translational and post-translational levels. At the same time, quantitative, dynamic models, ideally with probability distributions over model topologies and parameters, are highly desirable. Results We present a novel approach to infer such models from data, based on nonlinear differential equations, which we embed into a stochastic Bayesian framework. We thus address both the stochasticity of experimental data and the need for quantitative dynamic models. Furthermore, the Bayesian framework allows it to easily integrate prior knowledge into the inference process. Using stochastic sampling from the Bayes' posterior distribution, our approach can infer different likely network topologies and model parameters along with their respective probabilities from given data. We evaluate our approach on simulated data and the challenge #3 data from the DREAM 2 initiative. On the simulated data, we study effects of different levels of noise and dataset sizes. Results on real data show that the dynamics and main regulatory interactions are correctly reconstructed. Conclusions Our approach combines dynamic modeling using differential equations with a stochastic learning framework, thus bridging the gap between biophysical modeling and stochastic inference approaches. Results show that the method can reap the advantages of both worlds, and allows the reconstruction of biophysically accurate dynamic models from noisy data. In addition, the stochastic learning framework used permits the computation of probability distributions over models and model parameters

  15. Structure and promoter analysis of an ABA- and stress-regulated barley gene, HVA1.

    Science.gov (United States)

    Straub, P F; Shen, Q; Ho, T D

    1994-10-01

    A single-copy barley gene, HVA1, encoding a class 3 late embryogenesis-abundant protein, can be induced by either treatment with abscisic acid (ABA) or by stress conditions such as drought, cold, heat and salinity. We have isolated an HVA1 genomic clone containing about 400 bp of 5'-upstream sequence, a single 109 bp intron, and the full coding sequence. Linker scan mutagenesis and transient expression studies were used to test the function of four HVA1 promoter elements conserved in ABA-responsive genes. Mutations in two of these elements, the C box and the putative ABRE 1 (ABA-responsive element) containing an ACGT core, resulted in no significant change in transcription level or ABA induction. In contrast, mutations of the other two elements, putative ABRE 2 & 3 cause the level of transcription to drop to 10-20% of that obtained with the wild-type promoter indicating that the high level of expression of HVA1 is dependent on both pABRE 2 & 3. Interestingly, despite their low level of expression, the mutated promoters still gave more than 20-fold induction in response to ABA treatment. We suggest that the ABA induction of barley HVA1 gene is governed by a complex consisting of pABRE 2 & 3 working together to regulate the absolute level of expression, and either of these elements or a possible third element may regulate ABA inducibility. Phylogenetic analysis by parsimony indicates that the barley HVA1 and wheat pMA2005 sequences share a recent common ancester. These two genes are closely related to the carrot Dc3 and cotton D-7 genes with which they share a similar structural gene organization.

  16. TiGER: a database for tissue-specific gene expression and regulation.

    Science.gov (United States)

    Liu, Xiong; Yu, Xueping; Zack, Donald J; Zhu, Heng; Qian, Jiang

    2008-06-09

    Understanding how genes are expressed and regulated in different tissues is a fundamental and challenging question. However, most of currently available biological databases do not focus on tissue-specific gene regulation. The recent development of computational methods for tissue-specific combinational gene regulation, based on transcription factor binding sites, enables us to perform a large-scale analysis of tissue-specific gene regulation in human tissues. The results are stored in a web database called TiGER (Tissue-specific Gene Expression and Regulation). The database contains three types of data including tissue-specific gene expression profiles, combinatorial gene regulations, and cis-regulatory module (CRM) detections. At present the database contains expression profiles for 19,526 UniGene genes, combinatorial regulations for 7,341 transcription factor pairs and 6,232 putative CRMs for 2,130 RefSeq genes. We have developed and made publicly available a database, TiGER, which summarizes and provides large scale data sets for tissue-specific gene expression and regulation in a variety of human tissues. This resource is available at 1.

  17. TiGER: A database for tissue-specific gene expression and regulation

    Directory of Open Access Journals (Sweden)

    Zack Donald J

    2008-06-01

    Full Text Available Abstract Background Understanding how genes are expressed and regulated in different tissues is a fundamental and challenging question. However, most of currently available biological databases do not focus on tissue-specific gene regulation. Results The recent development of computational methods for tissue-specific combinational gene regulation, based on transcription factor binding sites, enables us to perform a large-scale analysis of tissue-specific gene regulation in human tissues. The results are stored in a web database called TiGER (Tissue-specific Gene Expression and Regulation. The database contains three types of data including tissue-specific gene expression profiles, combinatorial gene regulations, and cis-regulatory module (CRM detections. At present the database contains expression profiles for 19,526 UniGene genes, combinatorial regulations for 7,341 transcription factor pairs and 6,232 putative CRMs for 2,130 RefSeq genes. Conclusion We have developed and made publicly available a database, TiGER, which summarizes and provides large scale data sets for tissue-specific gene expression and regulation in a variety of human tissues. This resource is available at 1.

  18. Mitochondrial Sirt3 supports cell proliferation by regulating glutamine-dependent oxidation in renal cell carcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Jieun; Koh, Eunjin; Lee, Yu Shin; Lee, Hyun-Woo; Kang, Hyeok Gu [Department of Biochemistry and Molecular Biology, Brain Korea 21 PLUS Project for Medical Sciences, Institute of Genetic Science, Integrated Genomic Research Center for Metabolic Regulation, Yonsei University College of Medicine, Seoul 120-752 (Korea, Republic of); Yoon, Young Eun; Han, Woong Kyu [Department of Urology, Urological Science Institute, Yonsei University College of Medicine, Seoul 120-752 (Korea, Republic of); Choi, Kyung Hwa [Department of Urology, CHA Bundang Medical Center, CHA University, Seongnam 463-712 (Korea, Republic of); Kim, Kyung-Sup, E-mail: KYUNGSUP59@yuhs.ac [Department of Biochemistry and Molecular Biology, Brain Korea 21 PLUS Project for Medical Sciences, Institute of Genetic Science, Integrated Genomic Research Center for Metabolic Regulation, Yonsei University College of Medicine, Seoul 120-752 (Korea, Republic of)

    2016-06-03

    Clear cell renal carcinoma (RCC), the most common malignancy arising in the adult kidney, exhibits increased aerobic glycolysis and low mitochondrial respiration due to von Hippel-Lindau gene defects and constitutive hypoxia-inducible factor-α expression. Sirt3 is a major mitochondrial deacetylase that mediates various types of energy metabolism. However, the role of Sirt3 as a tumor suppressor or oncogene in cancer depends on cell types. We show increased Sirt3 expression in the mitochondrial fraction of human RCC tissues. Sirt3 depletion by lentiviral short-hairpin RNA, as well as the stable expression of the inactive mutant of Sirt3, inhibited cell proliferation and tumor growth in xenograft nude mice, respectively. Furthermore, mitochondrial pyruvate, which was used for oxidation in RCC, might be derived from glutamine, but not from glucose and cytosolic pyruvate, due to depletion of mitochondrial pyruvate carrier and the relatively high expression of malic enzyme 2. Depletion of Sirt3 suppressed glutamate dehydrogenase activity, leading to impaired mitochondrial oxygen consumption. Our findings suggest that Sirt3 plays a tumor-progressive role in human RCC by regulating glutamine-derived mitochondrial respiration, particularly in cells where mitochondrial usage of cytosolic pyruvate is severely compromised. -- Highlights: •Sirt3 is required for the maintenance of RCC cell proliferation. •Mitochondrial usage of cytosolic pyruvate is severely compromised in RCC. •Sirt3 supports glutamine-dependent oxidation in RCC.

  19. Mitochondrial Sirt3 supports cell proliferation by regulating glutamine-dependent oxidation in renal cell carcinoma

    International Nuclear Information System (INIS)

    Choi, Jieun; Koh, Eunjin; Lee, Yu Shin; Lee, Hyun-Woo; Kang, Hyeok Gu; Yoon, Young Eun; Han, Woong Kyu; Choi, Kyung Hwa; Kim, Kyung-Sup

    2016-01-01

    Clear cell renal carcinoma (RCC), the most common malignancy arising in the adult kidney, exhibits increased aerobic glycolysis and low mitochondrial respiration due to von Hippel-Lindau gene defects and constitutive hypoxia-inducible factor-α expression. Sirt3 is a major mitochondrial deacetylase that mediates various types of energy metabolism. However, the role of Sirt3 as a tumor suppressor or oncogene in cancer depends on cell types. We show increased Sirt3 expression in the mitochondrial fraction of human RCC tissues. Sirt3 depletion by lentiviral short-hairpin RNA, as well as the stable expression of the inactive mutant of Sirt3, inhibited cell proliferation and tumor growth in xenograft nude mice, respectively. Furthermore, mitochondrial pyruvate, which was used for oxidation in RCC, might be derived from glutamine, but not from glucose and cytosolic pyruvate, due to depletion of mitochondrial pyruvate carrier and the relatively high expression of malic enzyme 2. Depletion of Sirt3 suppressed glutamate dehydrogenase activity, leading to impaired mitochondrial oxygen consumption. Our findings suggest that Sirt3 plays a tumor-progressive role in human RCC by regulating glutamine-derived mitochondrial respiration, particularly in cells where mitochondrial usage of cytosolic pyruvate is severely compromised. -- Highlights: •Sirt3 is required for the maintenance of RCC cell proliferation. •Mitochondrial usage of cytosolic pyruvate is severely compromised in RCC. •Sirt3 supports glutamine-dependent oxidation in RCC.

  20. Effect of amiodarone and dronedarone administration in rats on thyroid hormone-dependent gene expression in different cardiac components.

    Science.gov (United States)

    Stoykov, I; van Beeren, H C; Moorman, A F M; Christoffels, V M; Wiersinga, W M; Bakker, O

    2007-06-01

    In view of their different actions on thyroid hormone receptor (TR) isoforms we set out to investigate whether amiodarone (AM) and dronedarone (Dron) have different and/or component-specific effects on cardiac gene expression. Rats were treated with AM or Dron and the expression of TRalpha 1, TRalpha 2, TRbeta 1 and several tri-iodothyronine (T3)-regulated genes was studied in different parts of the heart, namely the right atrium (RA), left ventricular wall (LVW) and apex. Rats were treated for 14 days with 100 mg/kg body weight AM or Dron. The expression of TRalpha 1, TRalpha 2, TRbeta 1 and T3-regulated genes was studied using real-time PCR and non-radioactive in situ hybridisation. AM and Dron affected TR expression in the RA similarly by decreasing TRalpha 1 and beta 1 expression by about 50%. In the LVW, AM and Dron decreased TRbeta 1 and, interestingly, AM increased TRalpha 1. In the apex, AM also increased TRalpha 2. The changes seen in T3-dependent gene expression are reminiscent of foetal reprogramming. Taken together, our results indicate that AM and Dron have similar effects on the expression of TR isoforms in the RA, which could partly contribute to their ability to decrease heart rate. On the other hand, the more profound effect of AM appears on TR- and T3-dependent gene expression in the left ventricle suggests foetal reprogramming.

  1. Translational regulation of gene expression by an anaerobically induced small non-coding RNA in Escherichia coli

    DEFF Research Database (Denmark)

    Boysen, Anders; Møller-Jensen, Jakob; Kallipolitis, Birgitte H.

    2010-01-01

    of at least one sRNA regulator. Here, we extend this view by the identification and characterization of a highly conserved, anaerobically induced small sRNA in E. coli, whose expression is strictly dependent on the anaerobic transcriptional fumarate and nitrate reductase regulator (FNR). The sRNA, named Fnr......Small non-coding RNAs (sRNA) have emerged as important elements of gene regulatory circuits. In enterobacteria such as Escherichia coli and Salmonella many of these sRNAs interact with the Hfq protein, an RNA chaperone similar to mammalian Sm-like proteins and act in the post....... Furthermore, in previous work most of the potential target genes have been shown to be repressed by FNR through an undetermined mechanism. Collectively, our results provide insight into the mechanism by which FNR negatively regulates genes such as sodA, sodB, cydDC, and metE, thereby demonstrating...

  2. CSL protein regulates transcription of genes required to prevent catastrophic mitosis in fission yeast.

    Science.gov (United States)

    Převorovský, Martin; Oravcová, Martina; Zach, Róbert; Jordáková, Anna; Bähler, Jürg; Půta, František; Folk, Petr

    2016-11-16

    For every eukaryotic cell to grow and divide, intricately coordinated action of numerous proteins is required to ensure proper cell-cycle progression. The fission yeast Schizosaccharomyces pombe has been instrumental in elucidating the fundamental principles of cell-cycle control. Mutations in S. pombe 'cut' (cell untimely torn) genes cause failed coordination between cell and nuclear division, resulting in catastrophic mitosis. Deletion of cbf11, a fission yeast CSL transcription factor gene, triggers a 'cut' phenotype, but the precise role of Cbf11 in promoting mitotic fidelity is not known. We report that Cbf11 directly activates the transcription of the acetyl-coenzyme A carboxylase gene cut6, and the biotin uptake/biosynthesis genes vht1 and bio2, with the former 2 implicated in mitotic fidelity. Cbf11 binds to a canonical, metazoan-like CSL response element (GTGGGAA) in the cut6 promoter. Expression of Cbf11 target genes shows apparent oscillations during the cell cycle using temperature-sensitive cdc25-22 and cdc10-M17 block-release experiments, but not with other synchronization methods. The penetrance of catastrophic mitosis in cbf11 and cut6 mutants is nutrient-dependent. We also show that drastic decrease in biotin availability arrests cell proliferation but does not cause mitotic defects. Taken together, our results raise the possibility that CSL proteins play conserved roles in regulating cell-cycle progression, and they could guide experiments into mitotic CSL functions in mammals.

  3. Motif analysis unveils the possible co-regulation of chloroplast genes and nuclear genes encoding chloroplast proteins.

    Science.gov (United States)

    Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman

    2012-09-01

    Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.

  4. Insecticide-Mediated Up-Regulation of Cytochrome P450 Genes in the Red Flour Beetle (Tribolium castaneum

    Directory of Open Access Journals (Sweden)

    Xiao Liang

    2015-01-01

    Full Text Available Some cytochrome P450 (CYP genes are known for their rapid up-regulation in response to insecticide exposures in insects. To date, however, limited information is available with respect to the relationships among the insecticide type, insecticide concentration, exposure duration and the up-regulated CYP genes. In this study, we examined the transcriptional response of eight selected CYP genes, including CYP4G7, CYP4Q4, CYP4BR3, CYP12H1, CYP6BK11, CYP9D4, CYP9Z5 and CYP345A1, to each of four insecticides in the red flour beetle, Tribolium castaneum. Reverse transcription quantitative PCR (RT-qPCR revealed that CYP4G7 and CYP345A1 can be significantly up-regulated by cypermethrin (1.97- and 2.06-fold, respectively, permethrin (2.00- and 2.03-fold and lambda-cyhalothrin (1.73- and 1.81-fold, whereas CYP4BR3 and CYP345A1 can be significantly up-regulated by imidacloprid (1.99- and 1.83-fold when 20-day larvae were exposed to each of these insecticides at the concentration of LC20 for 24 h. Our studies also showed that similar levels of up-regulation can be achieved for CYP4G7, CYP4BR3 and CYP345A1 by cypermethrin, permethrin, lambda-cyhalothrin or imidacloprid with approximately one fourth of LC20 in 6 h. Our study demonstrated that up-regulation of these CYP genes was rapid and only required low concentrations of insecticides, and the up-regulation not only depended on the CYP genes but also the type of insecticides. Our results along with those from previous studies also indicated that there were no specific patterns for predicting the up-regulation of specific CYP gene families based on the insecticide classification.

  5. Quasi-Genes: The Many-Body Theory of Gene Regulation in the Presence of Decoys

    Science.gov (United States)

    Burger, Anat

    During transcriptional regulation, transcription factor proteins bind to particular sites in the genome in order to switch genes on or off. The regulatory binding site intended for a transcription factor is just one out of millions of potential sites where the transcription factor can bind. Specificity of a binding motif determines whether less than one or up to tens of thousands of strong affinity binding sites can be expected by pure chance. The roles that these additional "decoy" binding sites play in the functioning of a cell are currently unknown. We incorporate decoys into traditional mass action and stochastic models of a simple gene network-the self-regulated gene-and use numerical and analytical techniques to quantify the effects that these extra sites have on altering gene expression properties. Counter-intuitively, we find that if bound transcription factors are protected from degradation, the mean steady state concentration of unbound transcription factors, , is insensitive to the addition of decoys. Many other gene expression properties do change as decoys are added. Decoys linearly increase the time necessary to reach steady state. Noise buffering by decoys occurs because of a coupling between the unbound proteomic environment and the reservoir of sites that can be very large, but the noise reduction is limited Poisson statistics because of the inherent noise resulting from binding and unbinding of transcription factors to DNA. This noise buffering is optimized for a given protein concentration when decoys have a 1/2 probability of being occupied. Decoys are able to preferentially stabilize one state of a bimodal system over the other, and exponentially increase the time to epigenetically switch between these states. In the limit that binding and unbinding rates are fast compared to the fluctuations in transcription factor copy number, we exploit timescale differences to collapse the model and derive analytical expressions that explain our numerical

  6. Gene-environment interactions and alcohol use and dependence: current status and future challenges

    NARCIS (Netherlands)

    Zwaluw, C.S. van der; Engels, R.C.M.E.

    2009-01-01

    To discuss the current status of gene-environment interaction research with regard to alcohol use and dependence. Further, we highlight the difficulties concerning gene-environment studies. Overview of the current evidence for gene-environment interactions in alcohol outcomes, and of the associated

  7. MicroRNA-dependent regulation of transcription in non-small cell lung cancer.

    Directory of Open Access Journals (Sweden)

    Sonia Molina-Pinelo

    Full Text Available Squamous cell lung cancer (SCC and adenocarcinoma are the most common histological subtypes of non-small cell lung cancer (NSCLC, and have been traditionally managed in the clinic as a single entity. Increasing evidence, however, illustrates the biological diversity of these two histological subgroups of lung cancer, and supports the need to improve our understanding of the molecular basis beyond the different phenotypes if we aim to develop more specific and individualized targeted therapy. The purpose of this study was to identify microRNA (miRNA-dependent transcriptional regulation differences between SCC and adenocarcinoma histological lung cancer subtypes. In this work, paired miRNA (667 miRNAs by TaqMan Low Density Arrays (TLDA and mRNA profiling (Whole Genome 44 K array G112A, Agilent was performed in tumor samples of 44 NSCLC patients. Nine miRNAs and 56 mRNAs were found to be differentially expressed in SCC versus adenocarcinoma samples. Eleven of these 56 mRNA were predicted as targets of the miRNAs identified to be differently expressed in these two histological conditions. Of them, 6 miRNAs (miR-149, miR-205, miR-375, miR-378, miR-422a and miR-708 and 9 target genes (CEACAM6, CGN, CLDN3, ABCC3, MLPH, ACSL5, TMEM45B, MUC1 were validated by quantitative PCR in an independent cohort of 41 lung cancer patients. Furthermore, the inverse correlation between mRNAs and microRNAs expression was also validated. These results suggest miRNA-dependent transcriptional regulation differences play an important role in determining key hallmarks of NSCLC, and may provide new biomarkers for personalized treatment strategies.

  8. Orthogonal Cas9 proteins for RNA-guided gene regulation and editing

    Science.gov (United States)

    Church, George M.; Esvelt, Kevin; Mali, Prashant

    2017-03-07

    Methods of modulating expression of a target nucleic acid in a cell are provided including use of multiple orthogonal Cas9 proteins to simultaneously and independently regulate corresponding genes or simultaneously and independently edit corresponding genes.

  9. Clock-dependent temporal regulation of IL-33/ST2-mediated mast cell response.

    Science.gov (United States)

    Kawauchi, Takahiro; Ishimaru, Kayoko; Nakamura, Yuki; Nakano, Nobuhiro; Hara, Mutsuko; Ogawa, Hideoki; Okumura, Ko; Shibata, Shigenobu; Nakao, Atsuhito

    2017-07-01

    Interleukin-33 (IL-33) is an alarmin cytokine that binds to the interleukin 1 receptor-like 1 protein ST2. Clock is a key circadian gene that is essential for endogenous clockworks in mammals. This study investigated whether Clock temporally regulated IL-33-mediated responses in mast cells. The kinetics of IL-33-mediated IL-6, IL-13, and TNF-α productions were compared between bone marrow-derived mast cells (BMMCs) from wild-type and Clock-mutated mice (Clock Δ19/Δ19 mice). The kinetics of the neutrophil influx into the peritoneal cavity or expression of IL-13 and Gob-5 in the lung in response to IL-33 were compared between wild-type and Clock Δ19/Δ19 mice. We also examined the kinetics of ST2 expression in mast cells and its association with Clock expression. There was a time-of-day-dependent variation in IL-33-mediated IL-6, IL-13, and TNF-α production in wild-type BMMCs, which was absent in Clock-mutated BMMCs. IL-33-induced neutrophil infiltration into the peritoneal cavity also showed a time-of-day-dependent variation in wild-type mice, which was absent in Clock Δ19/Δ19 mice. Furthermore, IL-33-induced IL-13 and Gob-5 expression in the lung exhibited a time-of-day-dependent variation in wild-type mice. These temporal variations in IL-33-mediated mast cell responses were associated with temporal variations of ST2 expression in mast cells. In addition, CLOCK bound to the promoter region of ST2 and Clock deletion resulted in down-regulation of ST2 expression in mast cells. CLOCK temporally gates mast cell responses to IL-33 via regulation of ST2 expression. Our findings provide novel insights into IL-33/mast cell-associated physiology and pathologies. Copyright © 2017 Japanese Society of Allergology. Production and hosting by Elsevier B.V. All rights reserved.

  10. Transcriptomic analysis in the developing zebrafish embryo after compound exposure: Individual gene expression and pathway regulation

    Energy Technology Data Exchange (ETDEWEB)

    Hermsen, Sanne A.B., E-mail: Sanne.Hermsen@rivm.nl [Centre for Health Protection, National Institute for Public Health and the Environment (RIVM), P.O. Box 1, 3720 BA Bilthoven (Netherlands); Department of Toxicogenomics, Maastricht University, P.O. Box 616, 6200 MD, Maastricht (Netherlands); Institute for Risk Assessment Sciences (IRAS), Utrecht University, P.O. Box 80.178, 3508 TD, Utrecht (Netherlands); Pronk, Tessa E. [Centre for Health Protection, National Institute for Public Health and the Environment (RIVM), P.O. Box 1, 3720 BA Bilthoven (Netherlands); Department of Toxicogenomics, Maastricht University, P.O. Box 616, 6200 MD, Maastricht (Netherlands); Brandhof, Evert-Jan van den [Centre for Environmental Quality, National Institute for Public Health and the Environment (RIVM), P.O. Box 1, 3720 BA Bilthoven (Netherlands); Ven, Leo T.M. van der [Centre for Health Protection, National Institute for Public Health and the Environment (RIVM), P.O. Box 1, 3720 BA Bilthoven (Netherlands); Piersma, Aldert H. [Centre for Health Protection, National Institute for Public Health and the Environment (RIVM), P.O. Box 1, 3720 BA Bilthoven (Netherlands); Institute for Risk Assessment Sciences (IRAS), Utrecht University, P.O. Box 80.178, 3508 TD, Utrecht (Netherlands)

    2013-10-01

    The zebrafish embryotoxicity test is a promising alternative assay for developmental toxicity. Classically, morphological assessment of the embryos is applied to evaluate the effects of compound exposure. However, by applying differential gene expression analysis the sensitivity and predictability of the test may be increased. For defining gene expression signatures of developmental toxicity, we explored the possibility of using gene expression signatures of compound exposures based on commonly expressed individual genes as well as based on regulated gene pathways. Four developmental toxic compounds were tested in concentration-response design, caffeine, carbamazepine, retinoic acid and valproic acid, and two non-embryotoxic compounds, D-mannitol and saccharin, were included. With transcriptomic analyses we were able to identify commonly expressed genes, which were mostly development related, after exposure to the embryotoxicants. We also identified gene pathways regulated by the embryotoxicants, suggestive of their modes of action. Furthermore, whereas pathways may be regulated by all compounds, individual gene expression within these pathways can differ for each compound. Overall, the present study suggests that the use of individual gene expression signatures as well as pathway regulation may be useful starting points for defining gene biomarkers for predicting embryotoxicity. - Highlights: • The zebrafish embryotoxicity test in combination with transcriptomics was used. • We explored two approaches of defining gene biomarkers for developmental toxicity. • Four compounds in concentration-response design were tested. • We identified commonly expressed individual genes as well as regulated gene pathways. • Both approaches seem suitable starting points for defining gene biomarkers.

  11. The ATP-Dependent RNA Helicase DDX3X Modulates Herpes Simplex Virus 1 Gene Expression.

    Science.gov (United States)

    Khadivjam, Bita; Stegen, Camille; Hogue-Racine, Marc-Aurèle; El Bilali, Nabil; Döhner, Katinka; Sodeik, Beate; Lippé, Roger

    2017-04-15

    The human protein DDX3X is a DEAD box ATP-dependent RNA helicase that regulates transcription, mRNA maturation, and mRNA export and translation. DDX3X concomitantly modulates the replication of several RNA viruses and promotes innate immunity. We previously showed that herpes simplex virus 1 (HSV-1), a human DNA virus, incorporates DDX3X into its mature particles and that DDX3X is required for optimal HSV-1 infectivity. Here, we show that viral gene expression, replication, and propagation depend on optimal DDX3X protein levels. Surprisingly, DDX3X from incoming viral particles was not required for the early stages of the HSV-1 infection, but, rather, the protein controlled the assembly of new viral particles. This was independent of the previously reported ability of DDX3X to stimulate interferon type I production. Instead, both the lack and overexpression of DDX3X disturbed viral gene transcription and thus subsequent genome replication. This suggests that in addition to its effect on RNA viruses, DDX3X impacts DNA viruses such as HSV-1 by an interferon-independent pathway. IMPORTANCE Viruses interact with a variety of cellular proteins to complete their life cycle. Among them is DDX3X, an RNA helicase that participates in most aspects of RNA biology, including transcription, splic