WorldWideScience

Sample records for deleted patients identified

  1. 49 CFR 7.6 - Deletion of identifying detail.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 1 2010-10-01 2010-10-01 false Deletion of identifying detail. 7.6 Section 7.6... To Be Made Public by DOT § 7.6 Deletion of identifying detail. Whenever it is determined to be... the deletion will accompany the record published or made available for inspection. ...

  2. 44 CFR 5.27 - Deletion of identifying details.

    Science.gov (United States)

    2010-10-01

    ... 44 Emergency Management and Assistance 1 2010-10-01 2010-10-01 false Deletion of identifying... Availability of General Agency Information, Rules, Orders, Policies, and Similar Material § 5.27 Deletion of..., interpretation, or staff manual or instruction. However, the justification for each deletion will be explained...

  3. 42 CFR 401.118 - Deletion of identifying details.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 2 2010-10-01 2010-10-01 false Deletion of identifying details. 401.118 Section 401.118 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN... Deletion of identifying details. When CMS publishes or otherwise makes available an opinion or order...

  4. 34 CFR 5.16 - Deletion of identifying details.

    Science.gov (United States)

    2010-07-01

    ... 34 Education 1 2010-07-01 2010-07-01 false Deletion of identifying details. 5.16 Section 5.16 Education Office of the Secretary, Department of Education AVAILABILITY OF INFORMATION TO THE PUBLIC PURSUANT TO PUB. L. 90-23 (Eff. until 7-14-10) What Records Are Available § 5.16 Deletion of identifying...

  5. The first Dutch SDHB founder deletion in paraganglioma – pheochromocytoma patients

    Directory of Open Access Journals (Sweden)

    Devilee Peter

    2009-04-01

    Full Text Available Abstract Background Germline mutations of the tumor suppressor genes SDHB, SDHC and SDHD play a major role in hereditary paraganglioma and pheochromocytoma. These three genes encode subunits of succinate dehydrogenase (SDH, the mitochondrial tricarboxylic acid cycle enzyme and complex II component of the electron transport chain. The majority of variants of the SDH genes are missense and nonsense mutations. To date few large deletions of the SDH genes have been described. Methods We carried out gene deletion scanning using MLPA in 126 patients negative for point mutations in the SDH genes. We then proceeded to the molecular characterization of deletions, mapping breakpoints in each patient and used haplotype analysis to determine whether the deletions are due to a mutation hotspot or if a common haplotype indicated a single founder mutation. Results A novel deletion of exon 3 of the SDHB gene was identified in nine apparently unrelated Dutch patients. An identical 7905 bp deletion, c.201-4429_287-933del, was found in all patients, resulting in a frameshift and a predicted truncated protein, p.Cys68HisfsX21. Haplotype analysis demonstrated a common haplotype at the SDHB locus. Index patients presented with pheochromocytoma, extra-adrenal PGL and HN-PGL. A lack of family history was seen in seven of the nine cases. Conclusion The identical exon 3 deletions and common haplotype in nine patients indicates that this mutation is the first Dutch SDHB founder mutation. The predominantly non-familial presentation of these patients strongly suggests reduced penetrance. In this small series HN-PGL occurs as frequently as pheochromocytoma and extra-adrenal PGL.

  6. Evaluation of 22q11.2 deletion in Cleft Palate patients

    Science.gov (United States)

    Prabodha, L. B. Lahiru; Dias, Dayanath Kumara; Nanayakkara, B. Ganananda; de Silva, Deepthi C.; Chandrasekharan, N. Vishvanath; Ileyperuma, Isurani

    2012-01-01

    Background: Cleft palate is the commonest multifactorial epigenetic disorder with a prevalence of 0.43-2.45 per 1000. The objectives of this study were to evaluate the clinical features and identify the 22q11.2 deletion in patients with cleft palate in Sri Lanka. Materials and Methods: Cleft patients attending a Teaching Hospital in Sri Lanka were recruited for this study. The relevant data were obtained from review of case notes, interviews, and examination of patients according to a standard evaluation sheet. Quantitative multiplex polymerase chain reaction (PCR) was performed to identify the 22q11.2 deletion. A gel documentation system (Bio-Doc) was used to quantify the PCR product following electrophoresis on 0.8% agarose gel. Results and Conclusion: There were 162 cleft palate patients of whom 59% were females. A total of 92 cleft palate subjects (56.2%) had other associated clinical features. Dysmorphic features (25.27%) and developmental delays (25.27%) were the commonest medical problems encountered. The cleft was limited to the soft palate in 125 patients, while in 25 patients it involved both the hard and the soft palate. There were seven subjects with bifid uvula and five subjects with submucous cleft palate. None of the patients had 22q11.2 deletion in this study population. A multicentered large population-based study is needed to confirm the results of this study and to develop guidelines on the appropriate use of 22q11.2 deletion testing, which are valid for cleft palate patients in Sri Lanka. PMID:23483617

  7. Deletion of 7q33-q35 in a Patient with Intellectual Disability and Dysmorphic Features: Further Characterization of 7q Interstitial Deletion Syndrome

    Directory of Open Access Journals (Sweden)

    Kristen Dilzell

    2015-01-01

    Full Text Available This case report concerns a 16-year-old girl with a 9.92 Mb, heterozygous interstitial chromosome deletion at 7q33-q35, identified using array comparative genomic hybridization. The patient has dysmorphic facial features, intellectual disability, recurrent infections, self-injurious behavior, obesity, and recent onset of hemihypertrophy. This patient has overlapping features with previously reported individuals who have similar deletions spanning the 7q32-q36 region. It has been difficult to describe an interstitial 7q deletion syndrome due to variations in the sizes and regions in the few patients reported in the literature. This case contributes to the further characterization of an interstitial distal 7q deletion syndrome.

  8. Partial protoporphyrinogen oxidase (PPOX gene deletions, due to different Alu-mediated mechanisms, identified by MLPA analysis in patients with variegate porphyria

    Directory of Open Access Journals (Sweden)

    Barbaro Michela

    2013-01-01

    Full Text Available Abstract Variegate porphyria (VP is an autosomal dominantly inherited hepatic porphyria. The genetic defect in the PPOX gene leads to a partial defect of protoporphyrinogen oxidase, the penultimate enzyme of heme biosynthesis. Affected individuals can develop cutaneous symptoms in sun-exposed areas of the skin and/or neuropsychiatric acute attacks. The identification of the genetic defect in VP families is of crucial importance to detect the carrier status which allows counseling to prevent potentially life threatening neurovisceral attacks, usually triggered by factors such as certain drugs, alcohol or fasting. In a total of 31 Swedish VP families sequence analysis had identified a genetic defect in 26. In the remaining five families an extended genetic investigation was necessary. After the development of a synthetic probe set, MLPA analysis to screen for single exon deletions/duplications was performed. We describe here, for the first time, two partial deletions within the PPOX gene detected by MLPA analysis. One deletion affects exon 5 and 6 (c.339-197_616+320del1099 and has been identified in four families, most probably after a founder effect. The other extends from exon 5 to exon 9 (c.339-350_987+229del2609 and was found in one family. We show that both deletions are mediated by Alu repeats. Our findings emphasize the usefulness of MLPA analysis as a complement to PPOX gene sequencing analysis for comprehensive genetic diagnostics in patients with VP.

  9. 10 CFR 9.19 - Segregation of exempt information and deletion of identifying details.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 1 2010-01-01 2010-01-01 false Segregation of exempt information and deletion of... Information Act Regulations § 9.19 Segregation of exempt information and deletion of identifying details. (a... deletions are made from parts of the record by computer, the amount of information deleted will be indicated...

  10. Large-scale deletions of the ABCA1 gene in patients with hypoalphalipoproteinemia.

    Science.gov (United States)

    Dron, Jacqueline S; Wang, Jian; Berberich, Amanda J; Iacocca, Michael A; Cao, Henian; Yang, Ping; Knoll, Joan; Tremblay, Karine; Brisson, Diane; Netzer, Christian; Gouni-Berthold, Ioanna; Gaudet, Daniel; Hegele, Robert A

    2018-06-04

    Copy-number variations (CNVs) have been studied in the context of familial hypercholesterolemia but have not yet been evaluated in patients with extremes of high-density lipoprotein (HDL) cholesterol levels. We evaluated targeted next-generation sequencing data from patients with very low HDL cholesterol (i.e. hypoalphalipoproteinemia) using the VarSeq-CNV caller algorithm to screen for CNVs disrupting the ABCA1, LCAT or APOA1 genes. In four individuals, we found three unique deletions in ABCA1: a heterozygous deletion of exon 4, a heterozygous deletion spanning exons 8 to 31, and a heterozygous deletion of the entire ABCA1 gene. Breakpoints were identified using Sanger sequencing, and the full-gene deletion was also confirmed using exome sequencing and the Affymetrix CytoScanTM HD Array. Before now, large-scale deletions in candidate HDL genes have not been associated with hypoalphalipoproteinemia; our findings indicate that CNVs in ABCA1 may be a previously unappreciated genetic determinant of low HDL cholesterol levels. By coupling bioinformatic analyses with next-generation sequencing data, we can successfully assess the spectrum of genetic determinants of many dyslipidemias, now including hypoalphalipoproteinemia. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.

  11. Biallelic ATM alterations detected at diagnosis identify a subset of treatment-naïve chronic lymphocytic leukemia patients with reduced overall survival similar to patients with p53 deletion.

    Science.gov (United States)

    Lozano-Santos, Carol; García-Vela, José A; Pérez-Sanz, Nuria; Nova-Gurumeta, Sara; Fernandez-Cuevas, Belen; Gomez-Lozano, Natalia; Sánchez-Beato, Margarita; Sanchez-Godoy, Pedro; Bueno, José Luis; Garcia-Marco, José A

    2017-04-01

    The prognostic impact of biallelic ATM abnormalities (ATM mutation and concurrent 11q deletion) remains unknown. We studied ATM, BIRC3, SF3B1, and NOTCH1 genes in 118 treatment-naïve CLL patients at diagnosis. Patients with biallelic ATM alteration had a similar time to first treatment (TTFT) and shorter overall survival (OS) compared with patients with isolated 11q deletion and shorter TTFT and OS when compared to patients with wild-type ATM. Furthermore, biallelic ATM alteration (HR: 6.4; p ≤ 0.007) was significantly associated with an increased risk of death similar to p53 deletion (HR: 6.1; p ≤ 0.004), superior to 11q deletion alone (HR: 2.8; p ≤ 0.022) and independent of other significant parameters such as age, advanced clinical stage, and complex karyotype. Our results suggest the identification of ATM mutations in CLL patients with 11q deletion at diagnosis is clinically relevant and predicts disease progression, poor response to the treatment, and reduced OS independent of other molecular prognostic factors.

  12. Genome-wide association study identifies a maternal copy-number deletion in PSG11 enriched among preeclampsia patients

    Directory of Open Access Journals (Sweden)

    Zhao Linlu

    2012-06-01

    Full Text Available Abstract Background Specific genetic contributions for preeclampsia (PE are currently unknown. This genome-wide association study (GWAS aims to identify maternal single nucleotide polymorphisms (SNPs and copy-number variants (CNVs involved in the etiology of PE. Methods A genome-wide scan was performed on 177 PE cases (diagnosed according to National Heart, Lung and Blood Institute guidelines and 116 normotensive controls. White female study subjects from Iowa were genotyped on Affymetrix SNP 6.0 microarrays. CNV calls made using a combination of four detection algorithms (Birdseye, Canary, PennCNV, and QuantiSNP were merged using CNVision and screened with stringent prioritization criteria. Due to limited DNA quantities and the deleterious nature of copy-number deletions, it was decided a priori that only deletions would be selected for assay on the entire case-control dataset using quantitative real-time PCR. Results The top four SNP candidates had an allelic or genotypic p-value between 10-5 and 10-6, however, none surpassed the Bonferroni-corrected significance threshold. Three recurrent rare deletions meeting prioritization criteria detected in multiple cases were selected for targeted genotyping. A locus of particular interest was found showing an enrichment of case deletions in 19q13.31 (5/169 cases and 1/114 controls, which encompasses the PSG11 gene contiguous to a highly plastic genomic region. All algorithm calls for these regions were assay confirmed. Conclusions CNVs may confer risk for PE and represent interesting regions that warrant further investigation. Top SNP candidates identified from the GWAS, although not genome-wide significant, may be useful to inform future studies in PE genetics.

  13. Diagnosis and fine localization of deletion region in Wolf-Hirschhorn syndrome patients.

    Science.gov (United States)

    Ji, Tao-Yun; Chia, David; Wang, Jing-Min; Wu, Ye; Li, Jie; Xiao, Jing; Jiang, Yu-Wu

    2010-07-01

    Wolf-Hirschhorn syndrome (WHS) results from the partial deletion of 4p. This study aimed to identify and fine map the chromosome deletion regions of Chinese children with Wolf-Hirschhorn syndrome among the developmental delay/mental retardation (DD/MR) patients. We analyzed the relationship of phenotype and genotype. Inclusion criteria were: moderate to severe DD/MR, no definite perinatal brain injury, and no trauma, toxication, hypoxia, infection of central nervous system; routine karyotyping was normal, no evidence of typical inherited metabolic disorder or specific neurodegenerative disorders from cranial neuro-imaging and blood/urinary metabolic diseases screening; no mutation of FMR1 in male patients, no typical clinical manifestation of Rett syndrome in female patients. Multiplex ligation-dependent probe amplification (MLPA) and Affymetrix genome-wide human SNP array 6.0 assays were applied to accurately define the exact size of subtelomeric aberration region of four WHS patients. All four WHS patients presented with severe DD, hypotonia and microcephaly, failure to thrive, 3/4 patients with typical facial features and seizures, 2/4 patients with congenital heart defects and cleft lip/palate, 1/4 patients with other malformations. The length of the deletions ranged from 3.3 Mb to 9.8 Mb. Two of four patients had "classic" WHS, 1/4 patients had "mild"-to-"classic" WHS, and 1/4 patients had "mild" WHS. WHS patients in China appear to be consistent with those previously reported. The prevalence of signs and symptoms, distribution of cases between "mild" and "classic" WHS, and the correlation between length of deletion and severity of disease of these patients were all similar to those of the patients from other populations.

  14. A novel common large genomic deletion and two new missense mutations identified in the Romanian phenylketonuria population.

    Science.gov (United States)

    Gemperle-Britschgi, Corinne; Iorgulescu, Daniela; Mager, Monica Alina; Anton-Paduraru, Dana; Vulturar, Romana; Thöny, Beat

    2016-01-15

    The mutation spectrum for the phenylalanine hydroxylase (PAH) gene was investigated in a cohort of 84 hyperphenylalaninemia (HPA) patients from Romania identified through newborn screening or neurometabolic investigations. Differential diagnosis identified 81 patients with classic PAH deficiency while 3 had tetrahydropterin-cofactor deficiency and/or remained uncertain due to insufficient specimen. PAH-genetic analysis included a combination of Sanger sequencing of exons and exon–intron boundaries, MLPA and NGS with genomic DNA, and cDNA analysis from immortalized lymphoblasts. A diagnostic efficiency of 99.4% was achieved, as for one allele (out of a total of 162 alleles) no mutation could be identified. The most prevalent mutation was p.Arg408Trp which was found in ~ 38% of all PKU alleles. Three novel mutations were identified, including the two missense mutations p.Gln226Lys and p.Tyr268Cys that were both disease causing by prediction algorithms, and the large genomic deletion EX6del7831 (c.509 + 4140_706 + 510del7831) that resulted in skipping of exon 6 based on PAH-cDNA analysis in immortalized lymphocytes. The genomic deletion was present in a heterozygous state in 12 patients, i.e. in ~ 8% of all the analyzed PKU alleles, and might have originated from a Romanian founder.

  15. Novel deletions involving the USH2A gene in patients with Usher syndrome and retinitis pigmentosa.

    Science.gov (United States)

    García-García, Gema; Aller, Elena; Jaijo, Teresa; Aparisi, Maria J; Larrieu, Lise; Faugère, Valérie; Blanco-Kelly, Fiona; Ayuso, Carmen; Roux, Anne-Francoise; Millán, José M

    2014-01-01

    The aim of the present work was to identify and characterize large rearrangements involving the USH2A gene in patients with Usher syndrome and nonsyndromic retinitis pigmentosa. The multiplex ligation-dependent probe amplification (MLPA) technique combined with a customized array-based comparative genomic hybridization (aCGH) analysis was applied to 40 unrelated patients previously screened for point mutations in the USH2A gene in which none or only one pathologic mutation was identified. We detected six large deletions involving USH2A in six out of the 40 cases studied. Three of the patients were homozygous for the deletion, and the remaining three were compound heterozygous with a previously identified USH2A point mutation. In five of these cases, the patients displayed Usher type 2, and the remaining case displayed nonsyndromic retinitis pigmentosa. The exact breakpoint junctions of the deletions found in USH2A in four of these cases were characterized. Our study highlights the need to develop improved efficient strategies of mutation screening based upon next generation sequencing (NGS) that reduce cost, time, and complexity and allow simultaneous identification of all types of disease-causing mutations in diagnostic procedures.

  16. 4977-bp mitochondrial DNA deletion in infertile patients with varicocele.

    Science.gov (United States)

    Gashti, N G; Salehi, Z; Madani, A H; Dalivandan, S T

    2014-04-01

    Varicocele is the abnormal inflexion and distension of veins of the pampiniform plexus within spermatic cord and is one of the amendable causes of male infertility. It can increase reactive oxygen species (ROS) production in semen and cause oxidative stress. The purpose of this study was to analyse spermatozoa mtDNA 4977-bp deletion in infertile men with varicocele. To detect 4977-bp deletion in spermatozoa mtDNA, semen samples of 60 infertile patients with clinical varicocele and 90 normal men from northern Iran were prepared. After extraction of spermatozoa total DNA, Gap polymerase chain reaction (Gap PCR) was performed. 4977-bp deletion was observed in 81.66% of patients with varicocele, while approximately 15.55% of controls had this deletion. As spermatozoa from patients with varicocele had a high frequency of occurrence of 4977-bp deletion in mtDNA [OR = 24.18, 95% confidence interval (CI) = 10.15-57.57, P deletion in spermatozoa and cause infertility in north Iranian men. However, to determine the relation between sperm mtDNA 4977-bp deletion and varicocele-induced infertility, larger population-based studies are needed. It is concluded that there is an association between sperm mtDNA 4977-bp deletion and varicocele-induced infertility in the population studied. © 2013 Blackwell Verlag GmbH.

  17. Partial USH2A deletions contribute to Usher syndrome in Denmark.

    Science.gov (United States)

    Dad, Shzeena; Rendtorff, Nanna D; Kann, Erik; Albrechtsen, Anders; Mehrjouy, Mana M; Bak, Mads; Tommerup, Niels; Tranebjærg, Lisbeth; Rosenberg, Thomas; Jensen, Hanne; Møller, Lisbeth B

    2015-12-01

    Usher syndrome is an autosomal recessive disorder characterized by congenital hearing impairment, progressive visual loss owing to retinitis pigmentosa and in some cases vestibular dysfunction. Usher syndrome is divided into three subtypes, USH1, USH2 and USH3. Twelve loci and eleven genes have so far been identified. Duplications and deletions in PCDH15 and USH2A that lead to USH1 and USH2, respectively, have previously been identified in patients from United Kingdom, Spain and Italy. In this study, we investigate the proportion of exon deletions and duplications in PCDH15 and USH2A in 20 USH1 and 30 USH2 patients from Denmark using multiplex ligation-dependent probe amplification (MLPA). Two heterozygous deletions were identified in USH2A, but no deletions or duplications were identified in PCDH15. Next-generation mate-pair sequencing was used to identify the exact breakpoints of the two deletions identified in USH2A. Our results suggest that USH2 is caused by USH2A exon deletions in a small fraction of the patients, whereas deletions or duplications in PCDH15 might be rare in Danish Usher patients.

  18. Heterozygous deletion at the SOX10 gene locus in two patients from a Chinese family with Waardenburg syndrome type II.

    Science.gov (United States)

    Wenzhi, He; Ruijin, Wen; Jieliang, Li; Xiaoyan, Ma; Haibo, Liu; Xiaoman, Wang; Jiajia, Xian; Shaoying, Li; Shuanglin, Li; Qing, Li

    2015-10-01

    Waardenburg syndrome (WS) is a rare disease characterized by sensorineural deafness and pigment disturbance. To date, almost 100 mutations have been reported, but few reports on cases with SOX10 gene deletion. The inheritance pattern of SOX10 gene deletion is still unclear. Our objective was to identify the genetic causes of Waardenburg syndrome type II in a two-generation Chinese family. Clinical evaluations were conducted in both of the patients. Microarray analysis and multiplex ligation-dependent probe amplification (MLPA) were performed to identify disease-related copy number variants (CNVs). DNA sequencing of the SOX10, MITF and SNAI2 genes was performed to identify the pathogenic mutation responsible for WS2. A 280kb heterozygous deletion at the 22q13.1 chromosome region (including SOX10) was detected in both of the patients. No mutation was found in the patients, unaffected family members and 30 unrelated healthy controls. This report is the first to describe SOX10 heterozygous deletions in Chinese WS2 patients. Our result conform the thesis that heterozygous deletions at SOX10 is an important pathogenicity for WS, and present as autosomal dominant inheritance. Nevertheless, heterozygous deletion of the SOX10 gene would be worth investigating to understand their functions and contributions to neurologic phenotypes. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  19. Phenotypic and molecular assessment of seven patients with 6p25 deletion syndrome: Relevance to ocular dysgenesis and hearing impairment

    Directory of Open Access Journals (Sweden)

    Ritch Robert

    2004-06-01

    Full Text Available Abstract Background Thirty-nine patients have been described with deletions involving chromosome 6p25. However, relatively few of these deletions have had molecular characterization. Common phenotypes of 6p25 deletion syndrome patients include hydrocephalus, hearing loss, and ocular, craniofacial, skeletal, cardiac, and renal malformations. Molecular characterization of deletions can identify genes that are responsible for these phenotypes. Methods We report the clinical phenotype of seven patients with terminal deletions of chromosome 6p25 and compare them to previously reported patients. Molecular characterization of the deletions was performed using polymorphic marker analysis to determine the extents of the deletions in these seven 6p25 deletion syndrome patients. Results Our results, and previous data, show that ocular dysgenesis and hearing impairment are the two most highly penetrant phenotypes of the 6p25 deletion syndrome. While deletion of the forkhead box C1 gene (FOXC1 probably underlies the ocular dysgenesis, no gene in this region is known to be involved in hearing impairment. Conclusions Ocular dysgenesis and hearing impairment are the two most common phenotypes of 6p25 deletion syndrome. We conclude that a locus for dominant hearing loss is present at 6p25 and that this locus is restricted to a region distal to D6S1617. Molecular characterization of more 6p25 deletion patients will aid in refinement of this locus and the identification of a gene involved in dominant hearing loss.

  20. Clinical and molecuar characterization of Brazilian patients with growth hormone gene deletions

    Directory of Open Access Journals (Sweden)

    I.J.P. Arnhold

    1998-04-01

    Full Text Available Genomic DNA from 23 patients with isolated growth hormone (GH deficiency (12 males and 11 females: heights -4.9 ± 1.4 SDS was screened for GH gene deletions by restriction endonuclease analysis of polymerase chain reaction amplification products. Three unrelated patients had typical features of severe GH deficiency and deletions (6.7 kb in two and 7.6 kb in one of the GH gene. The two patients with 6.7-kb deletions developed growth-attenuating anti-GH antibodies whereas the patient with the 7.6-kb deletion continued to grow with GH replacement therapy. Our finding that 3/23 (~13% Brazilian subjects had GH gene deletions agrees with previous studies of severe isolated GH deficiency subjects in other populations. Two of three subjects (67% with deletions developed blocking antibodies despite administration of exogenous GH at low doses. Interestingly, only 1/10 of cases with affected relatives or parental consanguinity had GH-1 gene deletions

  1. Analysis of Dystrophin Gene Deletions by Multiplex PCR in Moroccan Patients

    Directory of Open Access Journals (Sweden)

    Aziza Sbiti

    2002-01-01

    Full Text Available Duchenne and Becker muscular dystrophy (DMD and BMD are X-linked diseases resulting from a defect in the dystrophin gene located on Xp21. DMD is the most frequent neuromuscular disease in humans (1/3500 male newborn. Deletions in the dystrophin gene represent 65% of mutations in DMD/BMD patients. We have analyzed DNA from 72 Moroccan patients with DMD/BMD using the multiplex polymerase chain reaction (PCR to screen for exon deletions within the dystrophin gene, and to estimate the frequency of these abnormalities. We found dystrophin gene deletions in 37 cases. Therefore the frequency in Moroccan DMD/BMD patients is about 51.3%. All deletions were clustered in the two known hot-spots regions, and in 81% of cases deletions were detected in the region from exon 43 to exon 52. These findings are comparable to those reported in other studies. It is important to note that in our population, we can first search for deletions of DMD gene in the most frequently deleted exons determined by this study. This may facilitate the molecular diagnosis of DMD and BMD in our country.

  2. Whole genome HBV deletion profiles and the accumulation of preS deletion mutant during antiviral treatment

    Science.gov (United States)

    2012-01-01

    Background Hepatitis B virus (HBV), because of its error-prone viral polymerase, has a high mutation rate leading to widespread substitutions, deletions, and insertions in the HBV genome. Deletions may significantly change viral biological features complicating the progression of liver diseases. However, the clinical conditions correlating to the accumulation of deleted mutants remain unclear. In this study, we explored HBV deletion patterns and their association with disease status and antiviral treatment by performing whole genome sequencing on samples from 51 hepatitis B patients and by monitoring changes in deletion variants during treatment. Clone sequencing was used to analyze preS regions in another cohort of 52 patients. Results Among the core, preS, and basic core promoter (BCP) deletion hotspots, we identified preS to have the highest frequency and the most complex deletion pattern using whole genome sequencing. Further clone sequencing analysis on preS identified 70 deletions which were classified into 4 types, the most common being preS2. Also, in contrast to the core and BCP regions, most preS deletions were in-frame. Most deletions interrupted viral surface epitopes, and are possibly involved in evading immuno-surveillance. Among various clinical factors examined, logistic regression showed that antiviral medication affected the accumulation of deletion mutants (OR = 6.81, 95% CI = 1.296 ~ 35.817, P = 0.023). In chronic carriers of the virus, and individuals with chronic hepatitis, the deletion rate was significantly higher in the antiviral treatment group (Fisher exact test, P = 0.007). Particularly, preS2 deletions were associated with the usage of nucleos(t)ide analog therapy (Fisher exact test, P = 0.023). Dynamic increases in preS1 or preS2 deletions were also observed in quasispecies from samples taken from patients before and after three months of ADV therapy. In vitro experiments demonstrated that preS2 deletions alone

  3. A 7666-bp genomic deletion is frequent in Chinese Han deaf patients with non-syndromic enlarged vestibular aqueduct but without bi-allelic SLC26A4 mutations.

    Science.gov (United States)

    Pang, Xiuhong; Chai, Yongchuan; He, Longxia; Chen, Penghui; Wang, Xiaowen; Li, Lei; Jia, Huan; Wu, Hao; Yang, Tao

    2015-12-01

    To investigate the genetic cause of the patients with non-syndromic enlarged vestibular aqueduct (EVA) but without bi-allelic SLC26A4 mutations. Presence of a homozygous genomic deletion was detected in a Chinese Han deaf patient (D1467-1) who failed to amplify the first three exons of SLC26A4. The breakpoints of the deletion were fine-mapped and revealed by PCR amplification and sequencing. This deletion was subsequently screened in 22 Chinese Han EVA probands with mono-allelic SLC26A4 mutations. The possible founder effect of the newly identified genomic deletion was evaluated by haplotype analysis. A homozygous c.-2071_307+3801del7666 deletion of SLC26A4 was identified in patient D1467-1. This novel genomic deletion was subsequently identified in 18% (4/22) of the Chinese Han EVA probands with mono-allelic SLC26A4 mutations. Haplotype analysis showed that this genomic deletion is likely a founder mutation in Chinese Hans. Our results suggested that the cryptic c.-2071_307+3801del7666 deletion of SLC26A4 is relatively frequent in Chinese Han non-syndromic EVA patients without bi-allelic SLC26A4 mutations. Screening of this genomic deletion should be incorporated into the routine DNA testing of SLC26A4 in Chinese Hans. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  4. Multiple Patterns of FHIT Gene Homozygous Deletion in Egyptian Breast Cancer Patients

    International Nuclear Information System (INIS)

    Ismail, H.M.S.; Zakhary, N.I.; Medhat, A.M.; Karim, A.M.

    2011-01-01

    Fragile histidine triad (FHIT) gene encodes a putative tumour suppressor protein. Loss of Fhit protein in cancer is attributed to different genetic alterations that affect the FHIT gene structure. In this study, we investigated the pattern of homozygous deletion that target the FHIT gene exons 3 to 9 genomic structure in Egyptian breast cancer patients. We have found that 65% (40 out of 62) of the cases exhibited homozygous deletion in at least one FHIT exon. The incidence of homozygous deletion was not associated with patients clinico pathological parameters including patients age, tumour grade, tumour type, and lymph node involvement. Using correlation analysis, we have observed a strong correlation between homozygous deletions of exon 3 and exon 4 (P<0.0001). Deletions in exon 5 were positively correlated with deletions in exon 7 (P<0.0001), Exon 8 (P<0.027), and exon 9 (P=0.04). Additionally, a strong correlation was observed between exons 8 and exon 9 (P<0.0001).We conclude that FHIT gene exons are homozygously deleted at high frequency in Egyptian women population diagnosed with breast cancer. Three different patterns of homozygous deletion were observed in this population indicating different mechanisms of targeting FHIT gene genomic structure.

  5. What is the best frontline therapy for patients with CLL and 17p deletion?

    Science.gov (United States)

    Badoux, Xavier C; Keating, Michael J; Wierda, William G

    2011-03-01

    Chronic lymphocytic leukemia (CLL) is a lymphoproliferative disease with significant variation in disease progression, response to therapy, and survival outcome. Deletions of 17p or mutations of TP53 have been identified as one of the poorest prognostic factors, being predictive of short time for disease progression, lack of response to therapy, short response duration, and short overall survival. The treatment of patients with CLL has improved significantly with the development of chemoimmunotherapy, but this benefit was not pronounced in patients with 17p deletion. We compare various treatment strategies used in these patients, including FCR-like chemoimmunotherapy, alemtuzumab, other antibody combinations, or novel targeted therapies with promising results. Allogeneic stem cell transplantation offers the possibility for long-term disease control in these patients and should be considered early in younger, transplant-eligible patients. The current state of therapy is far from optimal and resources should be applied to studying therapeutic options for patients who have CLL with loss of p53 function.

  6. Contribution of Large Genomic Rearrangements in Italian Lynch Syndrome Patients: Characterization of a Novel Alu-Mediated Deletion

    Directory of Open Access Journals (Sweden)

    Francesca Duraturo

    2013-01-01

    Full Text Available Lynch syndrome is associated with germ-line mutations in the DNA mismatch repair (MMR genes, mainly MLH1 and MSH2. Most of the mutations reported in these genes to date are point mutations, small deletions, and insertions. Large genomic rearrangements in the MMR genes predisposing to Lynch syndrome also occur, but the frequency varies depending on the population studied on average from 5 to 20%. The aim of this study was to examine the contribution of large rearrangements in the MLH1 and MSH2 genes in a well-characterised series of 63 unrelated Southern Italian Lynch syndrome patients who were negative for pathogenic point mutations in the MLH1, MSH2, and MSH6 genes. We identified a large novel deletion in the MSH2 gene, including exon 6 in one of the patients analysed (1.6% frequency. This deletion was confirmed and localised by long-range PCR. The breakpoints of this rearrangement were characterised by sequencing. Further analysis of the breakpoints revealed that this rearrangement was a product of Alu-mediated recombination. Our findings identified a novel Alu-mediated rearrangement within MSH2 gene and showed that large deletions or duplications in MLH1 and MSH2 genes are low-frequency mutational events in Southern Italian patients with an inherited predisposition to colon cancer.

  7. Partial USH2A deletions contribute to Usher syndrome in Denmark

    DEFF Research Database (Denmark)

    Dad, Shzeena; Rendtorff, Nanna Dahl; Kann, Erik

    2015-01-01

    deletions identified in USH2A. Our results suggest that USH2 is caused by USH2A exon deletions in a small fraction of the patients, whereas deletions or duplications in PCDH15 might be rare in Danish Usher patients.European Journal of Human Genetics advance online publication, 25 March 2015; doi:10.1038...

  8. Dystrophin in frameshift deletion patients with Becker Muscular Dystrophy

    Energy Technology Data Exchange (ETDEWEB)

    Gangopadhyay, S.B.; Ray, P.N.; Worton, R.G.; Sherratt, T.G.; Heckmatt, J.Z.; Dubowitz, V.; Strong, P.N.; Miller, G. (Penn State College of Medicine, Hershey, PA (United States)); Shokeir, M. (Univ. Hospital, Saskatchewan (Canada))

    1992-09-01

    In a previous study the authors identified 14 cases with Duchenne muscular dystrophy (DMD) or its milder variant, Becker muscular dystrophy (BMD), with a deletion of exons 3-7, a deletion that would be expected to shift the translational reading frame of the mRNA and give a severe phenotype. They have examined dystrophin and its mRNA from muscle biopsies of seven cases with either mild or intermediate phenotypes. In all cases they detected slightly lower-molecular-weight dystrophin in 12%-15% abundance relative to the normal. By sequencing amplified mRNA they have found that exon 2 is spliced to exon 8, a splice that produces a frameshifted mRNA, and have found no evidence for alternate splicing that might be involved in restoration of dystrophin mRNA reading frame in the patients with a mild phenotype. Other transcriptional and posttranscriptional mechanisms such as cryptic promoter, ribosomal frameshifting, and reinitiation are suggested that might play some role in restoring the reading frame. 34 refs., 5 figs. 1 tab.

  9. High proportion of 22q13 deletions and SHANK3 mutations in Chinese patients with intellectual disability.

    Directory of Open Access Journals (Sweden)

    Xiaohong Gong

    Full Text Available Intellectual disability (ID is a heterogeneous disorder caused by chromosomal abnormalities, monogenic factors and environmental factors. 22q13 deletion syndrome is a genetic disorder characterized by severe ID. Although the frequency of 22q13 deletions in ID is unclear, it is believed to be largely underestimated. To address this issue, we used Affymetrix Human SNP 6.0 array to detect the 22q13 deletions in 234 Chinese unexplained ID patients and 103 controls. After the Quality Control (QC test of raw data, 22q13 deletions were found in four out of 230 cases (1.7%, while absent in parents of the cases and 101 controls. A review of genome-wide microarray studies in ID was performed and the frequency of 22q13 deletions from the literatures was 0.24%, much lower than our report. The overlapping region shared by all 4 cases encompasses the gene SHANK3. A heterozygous de novo nonsense mutation Y1015X of SHANK3 was identified in one ID patient. Cortical neurons were prepared from embryonic mice and were transfected with a control plasmid, shank3 wild-type (WT or mutant plasmids. Overexpression of the Y1015 mutant in neurons significantly affected neurite outgrowth compared with shank3 WT. These findings suggest that 22q13 deletions may be a more frequent cause for Chinese ID patients than previously thought, and the SHANK3 gene is involved in the neurite development.

  10. Genomic profiling in Down syndrome acute lymphoblastic leukemia identifies histone gene deletions associated with altered methylation profiles

    Science.gov (United States)

    Loudin, Michael G.; Wang, Jinhua; Leung, Hon-Chiu Eastwood; Gurusiddappa, Sivashankarappa; Meyer, Julia; Condos, Gregory; Morrison, Debra; Tsimelzon, Anna; Devidas, Meenakshi; Heerema, Nyla A.; Carroll, Andrew J.; Plon, Sharon E.; Hunger, Stephen P.; Basso, Giuseppe; Pession, Andrea; Bhojwani, Deepa; Carroll, William L.; Rabin, Karen R.

    2014-01-01

    Patients with Down syndrome (DS) and acute lymphoblastic leukemia (ALL) have distinct clinical and biological features. Whereas most DS-ALL cases lack the sentinel cytogenetic lesions that guide risk assignment in childhood ALL, JAK2 mutations and CRLF2 overexpression are highly enriched. To further characterize the unique biology of DS-ALL, we performed genome-wide profiling of 58 DS-ALL and 68 non-Down syndrome (NDS) ALL cases by DNA copy number, loss of heterozygosity, gene expression, and methylation analyses. We report a novel deletion within the 6p22 histone gene cluster as significantly more frequent in DS-ALL, occurring in 11 DS (22%) and only two NDS cases (3.1%) (Fisher’s exact p = 0.002). Homozygous deletions yielded significantly lower histone expression levels, and were associated with higher methylation levels, distinct spatial localization of methylated promoters, and enrichment of highly methylated genes for specific pathways and transcription factor binding motifs. Gene expression profiling demonstrated heterogeneity of DS-ALL cases overall, with supervised analysis defining a 45-transcript signature associated with CRLF2 overexpression. Further characterization of pathways associated with histone deletions may identify opportunities for novel targeted interventions. PMID:21647151

  11. Disparities in visuo-spatial constructive abilities in Williams syndrome patients with typical deletion on chromosome 7q11.23.

    Science.gov (United States)

    Muramatsu, Yukako; Tokita, Yoshihito; Mizuno, Seiji; Nakamura, Miho

    2017-02-01

    Williams syndrome (WS) is known for its uneven cognitive abilities, especially the difficulty in visuo-spatial cognition, though there are some inter-individual phenotypic differences. It has been proposed that the difficulty in visuo-spatial cognition of WS patients can be attributed to a haploinsufficiency of some genes located on the deleted region in 7q11.23, based on an examination of atypical deletions identified in WS patients with atypical cognitive deficits. According to this hypothesis, the inter-individual differences in visuo-spatial cognitive ability arise from variations in deletion. We investigated whether there were inter-individual differences in the visuo-spatial constructive abilities of five unrelated WS patients with the typical deletion on chromosome 7q11.23 that includes the candidate genes contributing visuo-spatial difficulty in WS patients. We used tests with three-dimensional factors such as Benton's three-dimensional block construction test, which are considered to be more sensitive than those with only two-dimensional factors. There were diverse inter-individual differences in the visuo-spatial constructive abilities among the present participants who shared the same typical genomic deletion of WS. One of the participants showed almost equivalent performances to typically developing adults in those tests. In the present study, we found a wide range of cognitive abilities in visuo-spatial construction even among the patients with a common deletion pattern of WS. The findings suggest that attributing differences in the phenotypes entirely to genetic factors such as an atypical deletion may not be always correct. Copyright © 2016 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

  12. Analysis of 22q11.2 deletions by FISH in a series of velocardiofacial syndrome patients

    Energy Technology Data Exchange (ETDEWEB)

    Ravnan, J.B.; Golabi, M.; Lebo, R.V. [Univ. of California, San Francisco, CA (United States)

    1994-09-01

    Deletions in chromosome 22 band q11.2 have been associated with velocardiofacial (VCF or Shprintzen) syndrome and the DiGeorge anomaly. A study of VCF patients evaluated at the UCSF Medical Center was undertaken to correlate disease phenotype with presence or absence of a deletion. Patients referred for this study had at least two of the following: dysmorphic facial features, frequent ear infections or hearing loss, palate abnormalities, thymic hypoplasia, hypocalcemia, congenital heart defect, hypotonia, and growth or language delay. Fluorescence in situ hybridization (FISH) using the DiGeorge critical region probe N25 was used to classify patients according to the presence or absence of a deletion in 22q11.2, and the results were compared to clinical characteristics. We have completed studies on 58 patients with features of VCF. Twenty-one patients (36%) were found to have a deletion in 22q11.2 by FISH. A retrospective study of archived slides from 14 patients originally studied only by prometaphase GTG banding found six patients had a deletion detected by FISH; of these, only two had a microscopically visible chromosome deletion. Our study of 11 sets of parents of children with the deletion found two clinically affected mothers with the deletion, including one with three of three children clinically affected. A few patients who did not fit the classical VCF description had a 22q11.2 deletion detected by FISH. These included one patient with both cleft lip and palate, and another with developmental delay and typical facial features but no cardiac or palate abnormalities. Both patients with the DiGeorge anomaly as part of VCF had the deletion. On the other hand, a number of patients diagnosed clinically with classical VCF did not have a detectable deletion. This raises the question whether they represent a subset of patients with a defect of 22q11.2 not detected by the N25 probe, or whether they represent a phenocopy of VCF.

  13. Novel and differential accumulation of mitochondrial DNA deletions in Swedish and vietnamese patients with colorectal cancer.

    Science.gov (United States)

    Dimberg, Jan; Hong, Thai Trinh; Skarstedt, Marita; Löfgren, Sture; Zar, Niklas; Matussek, Andreas

    2014-01-01

    Mitochondrial DNA (mtDNA) has been proposed to be involved in carcinogenesis and aging. The mtDNA 4977 bp deletion is one of the most frequently observed mtDNA mutations in human tissues and may play a role in colorectal cancer (CRC). In the present study, we aimed to evaluate the frequency of mtDNA 4977 bp deletion in CRC tissues and its association with clinical factors. We determined the presence of the 4977 bp common deletion in cancer and normal paired tissue samples from 105 Swedish and 88 Vietnamese patients with CRC using polymerase chain reaction (PCR) assays. The mtDNA 4977 bp deletion was shown to be significantly more frequent in normal tissues in comparison with paired cancer tissues in both Swedish and Vietnamese patients. The 4977 bp common deletion was significantly more frequent in cancer tissues of the Vietnamese patients compared to the Swedish patients, and in Vietnamese cancer tissues, the 4977 bp deletion was significantly over represented in those with localized disease compared to those with disseminated disease. Moreover, we detected nine novel mtDNA deletions and found a significantly higher rate of these in CRC tissues in Swedish in comparison to Vietnamese patients. The mtDNA 4977 bp deletion seems to have an impact on the clinical outcome of CRC in Vietnamese patients, that the Swedish patients accumulate more of the detected novel deletions in CRC tissue compared to Vietnamese patients probably indicates divergent mechanisms in colorectal carcinogenesis.

  14. MYD88 L265P Mutations Are Correlated with 6q Deletion in Korean Patients with Waldenström Macroglobulinemia

    Directory of Open Access Journals (Sweden)

    Jung-Ah Kim

    2014-01-01

    Full Text Available Waldenström macroglobulinemia (WM is a malignant lymphoplasma-proliferative disorder with IgM monoclonal gammopathy. A recent whole-genome study identified MYD88 L265P as the key mutation in WM. We investigated MYD88 mutations in conjunction with cytogenetic study in 22 consecutive Korean WM patients. Conventional G-banding and interphase fluorescence in situ hybridization (FISH were performed at regions including 6q21 using bone marrow (BM aspirates. Sixteen patients were subjected to Sanger sequencing-based MYD88 mutation study. Five patients (28% showed cytogenetic aberrations in G-banding. The incidence of 6q21 deletion was 17% by conventional G-banding and 37% by FISH. Ten patients (45% showed cytogenetic aberrations using FISH: 6q deletion in eight (37% and IGH rearrangement in four (18%. Two patients had both the 6q deletion and IGH rearrangement, and two had only the IGH rearrangement. Eleven patients (69% presented with the MYD88 L265P mutation. MYD88 mutations were significantly associated with the presence of 6q deletions (P=0.037. Six patients with the 6q deletion for whom sequencing was possible were found to harbor MYD88 mutations. The MYD88 L265P mutation was also associated with increased lymphocyte burden in BM biopsy. This is the first report of high frequency MYD88 L265P mutations in Korean WM patients.

  15. Array-based FMR1 sequencing and deletion analysis in patients with a fragile X syndrome-like phenotype.

    Directory of Open Access Journals (Sweden)

    Stephen C Collins

    2010-03-01

    Full Text Available Fragile X syndrome (FXS is caused by loss of function mutations in the FMR1 gene. Trinucleotide CGG-repeat expansions, resulting in FMR1 gene silencing, are the most common mutations observed at this locus. Even though the repeat expansion mutation is a functional null mutation, few conventional mutations have been identified at this locus, largely due to the clinical laboratory focus on the repeat tract.To more thoroughly evaluate the frequency of conventional mutations in FXS-like patients, we used an array-based method to sequence FMR1 in 51 unrelated males exhibiting several features characteristic of FXS but with normal CGG-repeat tracts of FMR1. One patient was identified with a deletion in FMR1, but none of the patients were found to have other conventional mutations.These data suggest that missense mutations in FMR1 are not a common cause of the FXS phenotype in patients who have normal-length CGG-repeat tracts. However, screening for small deletions of FMR1 may be of clinically utility.

  16. Molecular characterization of NRXN1 deletions from 19,263 clinical microarray cases identifies exons important for neurodevelopmental disease expression

    Science.gov (United States)

    Lowther, Chelsea; Speevak, Marsha; Armour, Christine M.; Goh, Elaine S.; Graham, Gail E.; Li, Chumei; Zeesman, Susan; Nowaczyk, Malgorzata J.M.; Schultz, Lee-Anne; Morra, Antonella; Nicolson, Rob; Bikangaga, Peter; Samdup, Dawa; Zaazou, Mostafa; Boyd, Kerry; Jung, Jack H.; Siu, Victoria; Rajguru, Manjulata; Goobie, Sharan; Tarnopolsky, Mark A.; Prasad, Chitra; Dick, Paul T.; Hussain, Asmaa S.; Walinga, Margreet; Reijenga, Renske G.; Gazzellone, Matthew; Lionel, Anath C.; Marshall, Christian R.; Scherer, Stephen W.; Stavropoulos, Dimitri J.; McCready, Elizabeth; Bassett, Anne S.

    2016-01-01

    Purpose The purpose of the current study was to assess the penetrance of NRXN1 deletions. Methods We compared the prevalence and genomic extent of NRXN1 deletions identified among 19,263 clinically referred cases to that of 15,264 controls. The burden of additional clinically relevant CNVs was used as a proxy to estimate the relative penetrance of NRXN1 deletions. Results We identified 41 (0.21%) previously unreported exonic NRXN1 deletions ascertained for developmental delay/intellectual disability, significantly greater than in controls [OR=8.14 (95% CI 2.91–22.72), p< 0.0001)]. Ten (22.7%) of these had a second clinically relevant CNV. Subjects with a deletion near the 3′ end of NRXN1 were significantly more likely to have a second rare CNV than subjects with a 5′ NRXN1 deletion [OR=7.47 (95% CI 2.36–23.61), p=0.0006]. The prevalence of intronic NRXN1 deletions was not statistically different between cases and controls (p=0.618). The majority (63.2%) of intronic NRXN1 deletion cases had a second rare CNV, a two-fold greater prevalence than for exonic NRXN1 deletion cases (p=0.0035). Conclusions The results support the importance of exons near the 5′ end of NRXN1 in the expression of neurodevelopmental disorders. Intronic NRXN1 deletions do not appear to substantially increase the risk for clinical phenotypes. PMID:27195815

  17. A 4q35.2 subtelomeric deletion identified in a screen of patients with co-morbid psychiatric illness and mental retardation.

    Science.gov (United States)

    Pickard, Ben S; Hollox, Edward J; Malloy, M Pat; Porteous, David J; Blackwood, Douglas H R; Armour, John A L; Muir, Walter J

    2004-08-13

    Cryptic structural abnormalities within the subtelomeric regions of chromosomes have been the focus of much recent research because of their discovery in a percentage of people with mental retardation (UK terminology: learning disability). These studies focused on subjects (largely children) with various severities of intellectual impairment with or without additional physical clinical features such as dysmorphisms. However it is well established that prevalence of schizophrenia is around three times greater in those with mild mental retardation. The rates of bipolar disorder and major depressive disorder have also been reported as increased in people with mental retardation. We describe here a screen for telomeric abnormalities in a cohort of 69 patients in which mental retardation co-exists with severe psychiatric illness. We have applied two techniques, subtelomeric fluorescence in situ hybridisation (FISH) and multiplex amplifiable probe hybridisation (MAPH) to detect abnormalities in the patient group. A subtelomeric deletion was discovered involving loss of 4q in a patient with co-morbid schizoaffective disorder and mental retardation. The precise region of loss has been defined allowing us to identify genes that may contribute to the clinical phenotype through hemizygosity. Interestingly, the region of 4q loss exactly matches that linked to bipolar affective disorder in a large multiply affected Australian kindred.

  18. A recessive contiguous gene deletion causing infantile hyperinsulinism, enteropathy and deafness identifies the Usher type 1C gene.

    Science.gov (United States)

    Bitner-Glindzicz, M; Lindley, K J; Rutland, P; Blaydon, D; Smith, V V; Milla, P J; Hussain, K; Furth-Lavi, J; Cosgrove, K E; Shepherd, R M; Barnes, P D; O'Brien, R E; Farndon, P A; Sowden, J; Liu, X Z; Scanlan, M J; Malcolm, S; Dunne, M J; Aynsley-Green, A; Glaser, B

    2000-09-01

    Usher syndrome type 1 describes the association of profound, congenital sensorineural deafness, vestibular hypofunction and childhood onset retinitis pigmentosa. It is an autosomal recessive condition and is subdivided on the basis of linkage analysis into types 1A through 1E. Usher type 1C maps to the region containing the genes ABCC8 and KCNJ11 (encoding components of ATP-sensitive K + (KATP) channels), which may be mutated in patients with hyperinsulinism. We identified three individuals from two consanguineous families with severe hyperinsulinism, profound congenital sensorineural deafness, enteropathy and renal tubular dysfunction. The molecular basis of the disorder is a homozygous 122-kb deletion of 11p14-15, which includes part of ABCC8 and overlaps with the locus for Usher syndrome type 1C and DFNB18. The centromeric boundary of this deletion includes part of a gene shown to be mutated in families with type 1C Usher syndrome, and is hence assigned the name USH1C. The pattern of expression of the USH1C protein is consistent with the clinical features exhibited by individuals with the contiguous gene deletion and with isolated Usher type 1C.

  19. Skin fibroblasts from a D-deletion type retinoblastoma patient are abnormally X-ray sensitive

    International Nuclear Information System (INIS)

    Weichselbaum, R.R.; Nove, J.; Little, J.B.

    1977-01-01

    Retinoblastoma is a rare malignant eye tumour that appears either spontaneously or in genetically predisposed persons. The latter group is composed of persons who inherit the tumour with a dominant mode of transmission (the familial type) and those who have a deletion in the long arm of chromosome 13 referred to as the D-deletion type. When this deletion is present it is observed in many somatic cells and is often associated with structural defects. Survivors of the genetic forms of retinoblastoma have an increased risk of the development of cancers at other sites. A single genetic locus is unlikely to predispose many somatic cells to tumour formation unless a fundamental molecular defect, possibly related to DNA repair, is present. In order to investigate this hypothesis a study was made of the in vitro X-ray sensitivity of skin fibroblasts derived from three retinoblastoma patients, comprising a pair of twins with the familial type accompanied by no gross chromosome abnormalities, and a patient with the D-deletion type. It was found that fibroblasts derived from the D-deletion patient were significantly more radiosensitive than those from the other two patients. X-ray survival curves are shown. It is concluded that skin fibroblasts derived from a patient with the D-deletion variant of retinoblastoma are abnormally radiosensitive. Future investigations may indicate a specific defect in molecular repair of DNA that will explain the predisposition of these patients to the development of other tumours. (U.K.)

  20. TBX1 mutation identified by exome sequencing in a Japanese family with 22q11.2 deletion syndrome-like craniofacial features and hypocalcemia.

    Directory of Open Access Journals (Sweden)

    Tsutomu Ogata

    Full Text Available BACKGROUND: Although TBX1 mutations have been identified in patients with 22q11.2 deletion syndrome (22q11.2DS-like phenotypes including characteristic craniofacial features, cardiovascular anomalies, hypoparathyroidism, and thymic hypoplasia, the frequency of TBX1 mutations remains rare in deletion-negative patients. Thus, it would be reasonable to perform a comprehensive genetic analysis in deletion-negative patients with 22q11.2DS-like phenotypes. METHODOLOGY/PRINCIPAL FINDINGS: We studied three subjects with craniofacial features and hypocalcemia (group 1, two subjects with craniofacial features alone (group 2, and three subjects with normal phenotype within a single Japanese family. Fluorescence in situ hybridization analysis excluded chromosome 22q11.2 deletion, and genomewide array comparative genomic hybridization analysis revealed no copy number change specific to group 1 or groups 1+2. However, exome sequencing identified a heterozygous TBX1 frameshift mutation (c.1253delA, p.Y418fsX459 specific to groups 1+2, as well as six missense variants and two in-frame microdeletions specific to groups 1+2 and two missense variants specific to group 1. The TBX1 mutation resided at exon 9C and was predicted to produce a non-functional truncated protein missing the nuclear localization signal and most of the transactivation domain. CONCLUSIONS/SIGNIFICANCE: Clinical features in groups 1+2 are well explained by the TBX1 mutation, while the clinical effects of the remaining variants are largely unknown. Thus, the results exemplify the usefulness of exome sequencing in the identification of disease-causing mutations in familial disorders. Furthermore, the results, in conjunction with the previous data, imply that TBX1 isoform C is the biologically essential variant and that TBX1 mutations are associated with a wide phenotypic spectrum, including most of 22q11.2DS phenotypes.

  1. IKAROS Gene Deleted B-Cell Acute Lymphoblastic Leukemia in Mexican Mestizos: Observations in Seven Patients and a Short Review of the Literature.

    Science.gov (United States)

    Ruiz-Delgado, Guillermo José; Cantero-Fortiz, Yahveth; León-Peña, Andrés Aurelio; León-González, Mónica; Nuñez-Cortés, Ana Karen; Ruiz-Argüelles, Guillermo José

    2016-01-01

    In B-cell acute lymphoblastic leukemia, one of the most frequent cytogenetic alterations is the presence of the Philadelphia chromosome. Recently, newly identified genetic alterations have been studied, among them the IKZF1 deletion. IKZF1 encodes IKAROS, a zinc finger protein that plays an important role in hematopoiesis involving the regulation process of adhesion, cellular migration, and as a tumor suppressor. We aimed to study the impact of IKAROS deletion in the evolution and prognosis of B-cell acute lymphoblastic leukemia. At a single center we prospectively studied patients diagnosed with B-cell acute lymphoblastic leukemia and screened for IKZF1 deletion using the multiplex ligation-dependent probe amplification method. We did a descriptive analysis of patients positive for the IKZF1 deletion to determine its impact on the evolution of the disease and survival rate. Between 2010 and 2015, 16 Mexican mestizo patients with B-cell acute lymphoblastic leukemia were prospectively screened for IKZF1 deletion; seven (43%) were positive and were included for further analysis. The age range of patients was 13-60 years; six were males and one female. All cases had type B acute lymphoblastic leukemia. Of the seven patients, two died, three were lost to follow-up, and two continue in complete remission with treatment. Results are worse than those in a group of patients with non-mutated IKAROS B-cell acute lymphoblastic leukemia previously studied in our center. Although this is a small sample, the presence of IKAROS deletion in acute lymphoblastic leukemia patients could represent a poor-prognosis marker and was probably related to therapy failure. It is also possible that this variant of leukemia may be more prevalent in Mexico. More studies are needed to define the role of IKZF1 deletion in acute lymphoblastic leukemia and the real prevalence of the disease in different populations.

  2. A 4q35.2 subtelomeric deletion identified in a screen of patients with co-morbid psychiatric illness and mental retardation

    Directory of Open Access Journals (Sweden)

    Blackwood Douglas HR

    2004-08-01

    Full Text Available Abstract Background Cryptic structural abnormalities within the subtelomeric regions of chromosomes have been the focus of much recent research because of their discovery in a percentage of people with mental retardation (UK terminology: learning disability. These studies focused on subjects (largely children with various severities of intellectual impairment with or without additional physical clinical features such as dysmorphisms. However it is well established that prevalence of schizophrenia is around three times greater in those with mild mental retardation. The rates of bipolar disorder and major depressive disorder have also been reported as increased in people with mental retardation. We describe here a screen for telomeric abnormalities in a cohort of 69 patients in which mental retardation co-exists with severe psychiatric illness. Methods We have applied two techniques, subtelomeric fluorescence in situ hybridisation (FISH and multiplex amplifiable probe hybridisation (MAPH to detect abnormalities in the patient group. Results A subtelomeric deletion was discovered involving loss of 4q in a patient with co-morbid schizoaffective disorder and mental retardation. Conclusion The precise region of loss has been defined allowing us to identify genes that may contribute to the clinical phenotype through hemizygosity. Interestingly, the region of 4q loss exactly matches that linked to bipolar affective disorder in a large multiply affected Australian kindred.

  3. Frequency of heterozygous TET2 deletions in myeloproliferative neoplasms

    Directory of Open Access Journals (Sweden)

    Joseph Tripodi

    2010-09-01

    Full Text Available Joseph Tripodi1, Ronald Hoffman1, Vesna Najfeld2, Rona Weinberg31The Myeloproliferative Disorders Program, Tisch Cancer Institute, Department of Medicine and 2Department of Medicine and Pathology, Mount Sinai School of Medicine, 3The Myeloproliferative Disorders Program, Cellular Therapy Laboratory, The New York Blood Center, New York, NY, USAAbstract: The Philadelphia chromosome (Ph-negative myeloproliferative neoplasms (MPNs, including polycythemia vera, essential thrombocythemia, and primary myelofibrosis, are a group of clonal hematopoietic stem cell disorders with overlapping clinical and cytogenetic features and a variable tendency to evolve into acute leukemia. These diseases not only share overlapping chromosomal abnormalities but also a number of acquired somatic mutations. Recently, mutations in a putative tumor suppressor gene, ten-eleven translocation 2 (TET2 on chromosome 4q24 have been identified in 12% of patients with MPN. Additionally 4q24 chromosomal rearrangements in MPN, including TET2 deletions, have also been observed using conventional cytogenetics. The goal of this study was to investigate the frequency of genomic TET2 rearrangements in MPN using fluorescence in situ hybridization as a more sensitive method for screening and identifying genomic deletions. Among 146 MPN patients, we identified two patients (1.4% who showed a common 4q24 deletion, including TET2. Our observations also indicated that the frequency of TET2 deletion is increased in patients with an abnormal karyotype (5%.Keywords: TET2, myeloproliferative neoplasms, fluorescence in situ hybridization, cytogenetics

  4. Usefulness of MLPA in the detection of SHOX deletions.

    Science.gov (United States)

    Funari, Mariana F A; Jorge, Alexander A L; Souza, Silvia C A L; Billerbeck, Ana E C; Arnhold, Ivo J P; Mendonca, Berenice B; Nishi, Mirian Y

    2010-01-01

    SHOX haploinsufficiency causes a wide spectrum of short stature phenotypes, such as Leri-Weill dyschondrosteosis (LWD) and disproportionate short stature (DSS). SHOX deletions are responsible for approximately two thirds of isolated haploinsufficiency; therefore, it is important to determine the most appropriate methodology for detection of gene deletion. In this study, three methodologies for the detection of SHOX deletions were compared: the fluorescence in situ hybridization (FISH), microsatellite analysis and multiplex ligation-dependent probe amplification (MLPA). Forty-four patients (8 LWD and 36 DSS) were analyzed. The cosmid LLNOYCO3'M'34F5 was used as a probe for the FISH analysis and microsatellite analysis were performed using three intragenic microsatellite markers. MLPA was performed using commercial kits. Twelve patients (8 LWD and 4 DSS) had deletions in SHOX area detected by MLPA and 2 patients generated discordant results with the other methodologies. In the first case, the deletion was not detected by FISH. In the second case, both FISH and microsatellite analyses were unable to identify the intragenic deletion. In conclusion, MLPA was more sensitive, less expensive and less laborious; therefore, it should be used as the initial molecular method for the detection of SHOX gene deletion. Copyright © 2010 Elsevier Masson SAS. All rights reserved.

  5. Using data mining and OLAP to discover patterns in a database of patients with Y-chromosome deletions.

    Science.gov (United States)

    Dzeroski, S; Hristovski, D; Peterlin, B

    2000-01-01

    The paper presents a database of published Y chromosome deletions and the results of analyzing the database with data mining techniques. The database describes 382 patients for which 177 different markers were tested: 364 of the 382 patients had deletions. Two data mining techniques, clustering and decision tree induction were used. Clustering was used to group patients according to the overall presence/absence of deletions at the tested markers. Decision trees and On-Line-Analytical-Processing (OLAP) were used to inspect the resulting clustering and look for correlations between deletion patterns, populations and the clinical picture of infertility. The results of the analysis indicate that there are correlations between deletion patterns and patient populations, as well as clinical phenotype severity.

  6. Spectrum of phenotypic anomalies in four families with deletion of the SHOX enhancer region.

    Science.gov (United States)

    Gatta, Valentina; Palka, Chiara; Chiavaroli, Valentina; Franchi, Sara; Cannataro, Giovanni; Savastano, Massimo; Cotroneo, Antonio Raffaele; Chiarelli, Francesco; Mohn, Angelika; Stuppia, Liborio

    2014-07-23

    SHOX alterations have been reported in 67% of patients affected by Léri-Weill dyschondrosteosis (LWD), with a larger prevalence of gene deletions than point mutations. It has been recently demonstrated that these deletions can involve the SHOX enhancer region, rather that the coding region, with variable phenotype of the affected patients.Here, we report a SHOX gene analysis carried out by MLPA in 14 LWD patients from 4 families with variable phenotype. All patients presented a SHOX enhancer deletion. In particular, a patient with a severe bilateral Madelung deformity without short stature showed a homozygous alteration identical to the recently described 47.5 kb PAR1 deletion. Moreover, we identified, for the first time, in three related patients with a severe bilateral Madelung deformity, a smaller deletion than the 47.5 kb PAR1 deletion encompassing the same enhancer region (ECR1/CNE7). Data reported in this study provide new information about the spectrum of phenotypic alterations showed by LWD patients with different deletions of the SHOX enhancer region.

  7. Intragenic deletions affecting two alternative transcripts of the IMMP2L gene in patients with Tourette syndrome

    Science.gov (United States)

    Bertelsen, Birgitte; Melchior, Linea; Jensen, Lars R; Groth, Camilla; Glenthøj, Birte; Rizzo, Renata; Debes, Nanette Mol; Skov, Liselotte; Brøndum-Nielsen, Karen; Paschou, Peristera; Silahtaroglu, Asli; Tümer, Zeynep

    2014-01-01

    Tourette syndrome is a neurodevelopmental disorder characterized by multiple motor and vocal tics, and the disorder is often accompanied by comorbidities such as attention-deficit hyperactivity-disorder and obsessive compulsive disorder. Tourette syndrome has a complex etiology, but the underlying environmental and genetic factors are largely unknown. IMMP2L (inner mitochondrial membrane peptidase, subunit 2) located on chromosome 7q31 is one of the genes suggested as a susceptibility factor in disease pathogenesis. Through screening of a Danish cohort comprising 188 unrelated Tourette syndrome patients for copy number variations, we identified seven patients with intragenic IMMP2L deletions (3.7%), and this frequency was significantly higher (P=0.0447) compared with a Danish control cohort (0.9%). Four of the seven deletions identified did not include any known exons of IMMP2L, but were within intron 3. These deletions were found to affect a shorter IMMP2L mRNA species with two alternative 5′-exons (one including the ATG start codon). We showed that both transcripts (long and short) were expressed in several brain regions, with a particularly high expression in cerebellum and hippocampus. The current findings give further evidence for the role of IMMP2L as a susceptibility factor in Tourette syndrome and suggest that intronic changes in disease susceptibility genes should be investigated further for presence of alternatively spliced exons. PMID:24549057

  8. Rare deletions at 16p13.11 predispose to a diverse spectrum of sporadic epilepsy syndromes.

    Science.gov (United States)

    Heinzen, Erin L; Radtke, Rodney A; Urban, Thomas J; Cavalleri, Gianpiero L; Depondt, Chantal; Need, Anna C; Walley, Nicole M; Nicoletti, Paola; Ge, Dongliang; Catarino, Claudia B; Duncan, John S; Kasperaviciūte, Dalia; Tate, Sarah K; Caboclo, Luis O; Sander, Josemir W; Clayton, Lisa; Linney, Kristen N; Shianna, Kevin V; Gumbs, Curtis E; Smith, Jason; Cronin, Kenneth D; Maia, Jessica M; Doherty, Colin P; Pandolfo, Massimo; Leppert, David; Middleton, Lefkos T; Gibson, Rachel A; Johnson, Michael R; Matthews, Paul M; Hosford, David; Kälviäinen, Reetta; Eriksson, Kai; Kantanen, Anne-Mari; Dorn, Thomas; Hansen, Jörg; Krämer, Günter; Steinhoff, Bernhard J; Wieser, Heinz-Gregor; Zumsteg, Dominik; Ortega, Marcos; Wood, Nicholas W; Huxley-Jones, Julie; Mikati, Mohamad; Gallentine, William B; Husain, Aatif M; Buckley, Patrick G; Stallings, Ray L; Podgoreanu, Mihai V; Delanty, Norman; Sisodiya, Sanjay M; Goldstein, David B

    2010-05-14

    Deletions at 16p13.11 are associated with schizophrenia, mental retardation, and most recently idiopathic generalized epilepsy. To evaluate the role of 16p13.11 deletions, as well as other structural variation, in epilepsy disorders, we used genome-wide screens to identify copy number variation in 3812 patients with a diverse spectrum of epilepsy syndromes and in 1299 neurologically-normal controls. Large deletions (> 100 kb) at 16p13.11 were observed in 23 patients, whereas no control had a deletion greater than 16 kb. Patients, even those with identically sized 16p13.11 deletions, presented with highly variable epilepsy phenotypes. For a subset of patients with a 16p13.11 deletion, we show a consistent reduction of expression for included genes, suggesting that haploinsufficiency might contribute to pathogenicity. We also investigated another possible mechanism of pathogenicity by using hybridization-based capture and next-generation sequencing of the homologous chromosome for ten 16p13.11-deletion patients to look for unmasked recessive mutations. Follow-up genotyping of suggestive polymorphisms failed to identify any convincing recessive-acting mutations in the homologous interval corresponding to the deletion. The observation that two of the 16p13.11 deletions were larger than 2 Mb in size led us to screen for other large deletions. We found 12 additional genomic regions harboring deletions > 2 Mb in epilepsy patients, and none in controls. Additional evaluation is needed to characterize the role of these exceedingly large, non-locus-specific deletions in epilepsy. Collectively, these data implicate 16p13.11 and possibly other large deletions as risk factors for a wide range of epilepsy disorders, and they appear to point toward haploinsufficiency as a contributor to the pathogenicity of deletions. Copyright (c) 2010 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  9. Small regions of overlapping deletions on 6q26 in human astrocytic tumours identified using chromosome 6 tile path array CGH

    Science.gov (United States)

    Ichimura, Koichi; Mungall, Andrew J; Fiegler, Heike; Pearson, Danita M.; Dunham, Ian; Carter, Nigel P; Collins, V. Peter

    2009-01-01

    Deletions of chromosome 6 are a common abnormality in diverse human malignancies including astrocytic tumours, suggesting the presence of tumour suppressor genes (TSG). In order to help identify candidate TSGs, we have constructed a chromosome 6 tile path microarray. The array contains 1780 clones (778 PACs and 1002 BACs) that cover 98.3% of the published chromosome 6 sequences. A total of 104 adult astrocytic tumours (10 diffuse astrocytomas, 30 anaplastic astrocytomas (AA), 64 glioblastomas (GB)) were analysed using this array. Single copy number change was successfully detected and the result was in general concordant with a microsatellite analysis. The pattern of copy number change was complex with multiple interstitial deletions/gains. However, a predominance of telomeric 6q deletions was seen. Two small common and overlapping regions of deletion at 6q26 were identified. One was 1002 kb in size and contained PACRG and QKI, while the second was 199 kb and harbours a single gene, ARID1B. The data show that the chromosome 6 tile path array is useful in mapping copy number changes with high resolution and accuracy. We confirmed the high frequency of chromosome 6 deletions in AA and GB, and identified two novel commonly deleted regions that may harbour TSGs. PMID:16205629

  10. Array-CGH in patients with Kabuki-like phenotype: identification of two patients with complex rearrangements including 2q37 deletions and no other recurrent aberration.

    Science.gov (United States)

    Cuscó, Ivon; del Campo, Miguel; Vilardell, Mireia; González, Eva; Gener, Blanca; Galán, Enrique; Toledo, Laura; Pérez-Jurado, Luis A

    2008-04-11

    Kabuki syndrome (KS) is a multiple congenital anomaly syndrome characterized by specific facial features, mild to moderate mental retardation, postnatal growth delay, skeletal abnormalities, and unusual dermatoglyphic patterns with prominent fingertip pads. A 3.5 Mb duplication at 8p23.1-p22 was once reported as a specific alteration in KS but has not been confirmed in other patients. The molecular basis of KS remains unknown. We have studied 16 Spanish patients with a clinical diagnosis of KS or KS-like to search for genomic imbalances using genome-wide array technologies. All putative rearrangements were confirmed by FISH, microsatellite markers and/or MLPA assays, which also determined whether the imbalance was de novo or inherited. No duplication at 8p23.1-p22 was observed in our patients. We detected complex rearrangements involving 2q in two patients with Kabuki-like features: 1) a de novo inverted duplication of 11 Mb with a 4.5 Mb terminal deletion, and 2) a de novo 7.2 Mb-terminal deletion in a patient with an additional de novo 0.5 Mb interstitial deletion in 16p. Additional copy number variations (CNV), either inherited or reported in normal controls, were identified and interpreted as polymorphic variants. No specific CNV was significantly increased in the KS group. Our results further confirmed that genomic duplications of 8p23 region are not a common cause of KS and failed to detect other recurrent rearrangement causing this disorder. The detection of two patients with 2q37 deletions suggests that there is a phenotypic overlap between the two conditions, and screening this region in the Kabuki-like patients should be considered.

  11. Deletion mutagenesis identifies a haploinsufficient role for gamma-zein in opaque-2 endosperm modification

    Science.gov (United States)

    Quality Protein Maize (QPM) is a hard kernel variant of the high-lysine mutant, opaque-2. Using gamma irradiation, we created opaque QPM variants to identify opaque-2 modifier genes and to investigate deletion mutagenesis combined with Illumina sequencing as a maize functional genomics tool. A K0326...

  12. Clinical and genetic characterization of chanarin-dorfman syndrome patients: first report of large deletions in the ABHD5 gene

    Directory of Open Access Journals (Sweden)

    Prati Daniele

    2010-12-01

    Full Text Available Abstract Background Chanarin-Dorfman syndrome (CDS is a rare autosomal recessive disorder characterized by nonbullous congenital ichthyosiform erythroderma (NCIE and an intracellular accumulation of triacylglycerol (TG droplets in most tissues. The clinical phenotype involves multiple organs and systems, including liver, eyes, ears, skeletal muscle and central nervous system (CNS. Mutations in ABHD5/CGI58 gene are associated with CDS. Methods Eight CDS patients belonging to six different families from Mediterranean countries were enrolled for genetic study. Molecular analysis of the ABHD5 gene included the sequencing of the 7 coding exons and of the putative 5' regulatory regions, as well as reverse transcript-polymerase chain reaction analysis and sequencing of normal and aberrant ABHD5 cDNAs. Results Five different mutations were identified, four of which were novel, including two splice-site mutations (c.47+1G>A and c.960+5G>A and two large deletions (c.898_*320del and c.662-1330_773+46del. All the reported mutations are predicted to be pathogenic because they lead to an early stop codon or a frameshift producing a premature termination of translation. While nonsense, missense, frameshift and splice-site mutations have been identified in CDS patients, large genomic deletions have not previously been described. Conclusions These results emphasize the need for an efficient approach for genomic deletion screening to ensure an accurate molecular diagnosis of CDS. Moreover, in spite of intensive molecular screening, no mutations were identified in one patient with a confirmed clinical diagnosis of CDS, appointing to genetic heterogeneity of the syndrome.

  13. Mitochondrial common deletion is elevated in blood of breast cancer patients mediated by oxidative stress.

    Science.gov (United States)

    Nie, Hezhongrong; Chen, Guorong; He, Jing; Zhang, Fengjiao; Li, Ming; Wang, Qiufeng; Zhou, Huaibin; Lyu, Jianxin; Bai, Yidong

    2016-01-01

    The 4977 bp common deletion is one of the most frequently observed mitochondrial DNA (mtDNA) mutations in human tissues and has been implicated in various human cancer types. It is generally believed that continuous generation of intracellular reactive oxygen species (ROS) during oxidative phosphorylation (OXPHOS) is a major underlying mechanism for generation of such mtDNA deletions while antioxidant systems, including Manganese superoxide dismutase (MnSOD), mitigating the deleterious effects of ROS. However, the clinical significance of this common deletion remains to be explored. A comprehensive investigation on occurrence and accumulation of the common deletion and mtDNA copy number was carried out in breast carcinoma (BC) patients, benign breast disease (BBD) patients and age-matched healthy donors in our study. Meanwhile, the representative oxidative (ROS production, mtDNA and lipid oxidative damage) and anti-oxidative features (MnSOD expression level and variation) in blood samples from these groups were also analyzed. We found that the mtDNA common deletion is much more likely to be detected in BC patients at relatively high levels while the mtDNA content is lower. This alteration has been associated with a higher MnSOD level and higher oxidative damages in both BC and BBD patients. Our results indicate that the mtDNA common deletion in blood may serve a biomarker for the breast cancer. Copyright © 2015 Elsevier B.V. and Mitochondria Research Society. All rights reserved.

  14. Genotype-Phenotype Analysis, Neuropsychological Assessment, and Growth Hormone Response in a Patient with 18p Deletion Syndrome.

    Science.gov (United States)

    Sun, Huihui; Wan, Naijun; Wang, Xinli; Chang, Liang; Cheng, Dazhi

    2018-01-01

    18p deletion syndrome is a rare chromosomal disease caused by deletion of the short arm of chromosome 18. By using cytogenetic and SNP array analysis, we identified a girl with 18p deletion syndrome exhibiting craniofacial anomalies, intellectual disability, and short stature. G-banding analysis of metaphase cells revealed an abnormal karyotype 46,XX,del(18)(p10). Further, SNP array detected a 15.3-Mb deletion at 18p11.21p11.32 (chr18:12842-15375878) including 61 OMIM genes. Genotype-phenotype correlation analysis showed that clinical manifestations of the patient were correlated with LAMA1, TWSG1, and GNAL deletions. Her neuropsychological assessment test demonstrated delay in most cognitive functions including impaired mathematics, linguistic skills, visual motor perception, respond speed, and executive function. Meanwhile, her integrated visual and auditory continuous performance test (IVA-CPT) indicated a severe comprehensive attention deficit. At age 7 and 1/12 years, her height was 110.8 cm (-2.5 SD height for age). Growth hormone (GH) treatment was initiated. After 27 months treatment, her height was increased to 129.6 cm (-1.0 SD height for age) at 9 and 4/12 years, indicating an effective response to GH treatment. © 2018 S. Karger AG, Basel.

  15. Diagnostic screening identifies a wide range of mutations involving the SHOX gene, including a common 47.5 kb deletion 160 kb downstream with a variable phenotypic effect.

    Science.gov (United States)

    Bunyan, David J; Baker, Kevin R; Harvey, John F; Thomas, N Simon

    2013-06-01

    Léri-Weill dyschondrosteosis (LWD) results from heterozygous mutations of the SHOX gene, with homozygosity or compound heterozygosity resulting in the more severe form, Langer mesomelic dysplasia (LMD). These mutations typically take the form of whole or partial gene deletions, point mutations within the coding sequence, or large (>100 kb) 3' deletions of downstream regulatory elements. We have analyzed the coding sequence of the SHOX gene and its downstream regulatory regions in a cohort of 377 individuals referred with symptoms of LWD, LMD or short stature. A causative mutation was identified in 68% of the probands with LWD or LMD (91/134). In addition, a 47.5 kb deletion was found 160 kb downstream of the SHOX gene in 17 of the 377 patients (12% of the LWD referrals, 4.5% of all referrals). In 14 of these 17 patients, this was the only potentially causative abnormality detected (13 had symptoms consistent with LWD and one had short stature only), but the other three 47.5 kb deletions were found in patients with an additional causative SHOX mutation (with symptoms of LWD rather than LMD). Parental samples were available on 14/17 of these families, and analysis of these showed a more variable phenotype ranging from apparently unaffected to LWD. Breakpoint sequence analysis has shown that the 47.5 kb deletion is identical in all 17 patients, most likely due to an ancient founder mutation rather than recurrence. This deletion was not seen in 471 normal controls (P<0.0001), providing further evidence for a phenotypic effect, albeit one with variable penetration. Copyright © 2013 Wiley Periodicals, Inc.

  16. Characterization of novel RS1 exonic deletions in juvenile X-linked retinoschisis.

    Science.gov (United States)

    D'Souza, Leera; Cukras, Catherine; Antolik, Christian; Craig, Candice; Lee, Ji-Yun; He, Hong; Li, Shibo; Smaoui, Nizar; Hejtmancik, James F; Sieving, Paul A; Wang, Xinjing

    2013-01-01

    X-linked juvenile retinoschisis (XLRS) is a vitreoretinal dystrophy characterized by schisis (splitting) of the inner layers of the neuroretina. Mutations within the retinoschisis (RS1) gene are responsible for this disease. The mutation spectrum consists of amino acid substitutions, splice site variations, small indels, and larger genomic deletions. Clinically, genomic deletions are rarely reported. Here, we characterize two novel full exonic deletions: one encompassing exon 1 and the other spanning exons 4-5 of the RS1 gene. We also report the clinical findings in these patients with XLRS with two different exonic deletions. Unrelated XLRS men and boys and their mothers (if available) were enrolled for molecular genetics evaluation. The patients also underwent ophthalmologic examination and in some cases electroretinogram (ERG) recording. All the exons and the flanking intronic regions of the RS1 gene were analyzed with direct sequencing. Two patients with exonic deletions were further evaluated with array comparative genomic hybridization to define the scope of the genomic aberrations. After the deleted genomic region was identified, primer walking followed by direct sequencing was used to determine the exact breakpoints. Two novel exonic deletions of the RS1 gene were identified: one including exon 1 and the other spanning exons 4 and 5. The exon 1 deletion extends from the 5' region of the RS1 gene (including the promoter) through intron 1 (c.(-35)-1723_c.51+2664del4472). The exon 4-5 deletion spans introns 3 to intron 5 (c.185-1020_c.522+1844del5764). Here we report two novel exonic deletions within the RS1 gene locus. We have also described the clinical presentations and hypothesized the genomic mechanisms underlying these schisis phenotypes.

  17. Patients Carrying 9q31.1-q32 Deletion Share Common Features with Cornelia de Lange Syndrome

    Directory of Open Access Journals (Sweden)

    Ruixue Cao

    2015-01-01

    Full Text Available Background: Cornelia de Lange Syndrome (CdLS is a rare but severe clinically heterogeneous developmental disorder characterized by facial dysmorphia, growth and cognitive retardation, and abnormalities of limb development. Objectives: To determine the pathogenesis of a patient with CdLS. Methods: We studied a patient with CdLS by whole exome sequencing, karyotyping and Agilent CGH Array. The results were confirmed by quantitative real-time PCR analysis of the patient and her parents. Further comparison of our patient and cases with partially overlapping deletions retrieved from the literature and databases was undertaken. Results: Whole exome sequencing had excluded the mutation of cohesion genes such as NIPBL,SMC1A and SMC3. The result of karyotyping showed a deletion of chromosome 9q31.1-q32 and the result of Agilent CGH Array further displayed a 12.01-Mb region of deletion at chromosome bands 9q31.1-q32. Reported cases with the deletion of 9q31.1-q32 share similar features with our CdLS patient. One of the genes in the deleted region, SMC2, belongs to the Structural Maintenance of Chromosomes (SMC family and regulates gene expression and DNA repair. Conclusions: Patients carrying the deletion of 9q31.1-q32 showed similar phenotypes with CdLS.

  18. Parallel analysis of tagged deletion mutants efficiently identifies genes involved in endoplasmic reticulum biogenesis.

    Science.gov (United States)

    Wright, Robin; Parrish, Mark L; Cadera, Emily; Larson, Lynnelle; Matson, Clinton K; Garrett-Engele, Philip; Armour, Chris; Lum, Pek Yee; Shoemaker, Daniel D

    2003-07-30

    Increased levels of HMG-CoA reductase induce cell type- and isozyme-specific proliferation of the endoplasmic reticulum. In yeast, the ER proliferations induced by Hmg1p consist of nuclear-associated stacks of smooth ER membranes known as karmellae. To identify genes required for karmellae assembly, we compared the composition of populations of homozygous diploid S. cerevisiae deletion mutants following 20 generations of growth with and without karmellae. Using an initial population of 1,557 deletion mutants, 120 potential mutants were identified as a result of three independent experiments. Each experiment produced a largely non-overlapping set of potential mutants, suggesting that differences in specific growth conditions could be used to maximize the comprehensiveness of similar parallel analysis screens. Only two genes, UBC7 and YAL011W, were identified in all three experiments. Subsequent analysis of individual mutant strains confirmed that each experiment was identifying valid mutations, based on the mutant's sensitivity to elevated HMG-CoA reductase and inability to assemble normal karmellae. The largest class of HMG-CoA reductase-sensitive mutations was a subset of genes that are involved in chromatin structure and transcriptional regulation, suggesting that karmellae assembly requires changes in transcription or that the presence of karmellae may interfere with normal transcriptional regulation. Copyright 2003 John Wiley & Sons, Ltd.

  19. Characteristic face: a key indicator for direct diagnosis of 22q11.2 deletions in Chinese velocardiofacial syndrome patients.

    Science.gov (United States)

    Wu, Dandan; Chen, Yang; Xu, Chen; Wang, Ke; Wang, Huijun; Zheng, Fengyun; Ma, Duan; Wang, Guomin

    2013-01-01

    Velocardiofacial syndrome (VCFS) is a disease in human with an expansive phenotypic spectrum and diverse genetic mechanisms mainly associated with copy number variations (CNVs) on 22q11.2 or other chromosomes. However, the correlations between CNVs and phenotypes remain ambiguous. This study aims to analyze the types and sizes of CNVs in VCFS patients, to define whether correlations exist between CNVs and clinical manifestations in Chinese VCFS patients. In total, 55 clinically suspected Chinese VCFS patients and 100 normal controls were detected by multiplex ligation-dependent probe amplification (MLPA). The data from MLPA and all the detailed clinical features of the objects were documented and analyzed. A total of 44 patients (80.0%) were diagnosed with CNVs on 22q11.2. Among them, 43 (78.2%) presented with 22q11.2 heterozygous deletions, of whom 40 (93.0%) had typical 3-Mb deletion, and 3 (7.0%) exhibited proximal 1.5-Mb deletion; no patient was found with atypical deletion on 22q11.2. One patient (1.8%) presented with a 3-Mb duplication mapping to the typical 3-Mb region on 22q11.2, while none of the chromosomal abnormalities in the MLPA kit were found in the other 11 patients and 100 normal controls. All the 43 patients with 22q11.2 deletions displayed characteristic face and palatal anomalies; 37 of them (86.0%) had cognitive or behavioral disorders, and 23 (53.5%) suffered from immune deficiencies; 10 patients (23.3%) manifested congenital heart diseases. Interestingly, all patients with the characteristic face had 22q11.2 heterozygous deletions, but no difference in phenotypic spectrum was observed between 3-Mb and 1.5-Mb deletions. Our data suggest that the characteristic face can be used as a key indicator for direct diagnosis of 22q11.2 deletions in Chinese VCFS patients.

  20. Molecular and cytogenetic investigation of Y chromosome deletions over three generations facilitated by intracytoplasmic sperm injection.

    Science.gov (United States)

    Minor, Agata; Wong, Edgar Chan; Harmer, Karynn; Ma, Sai

    2007-08-01

    The azoospermic factor (AZF) region is critical for normal spermatogenesis since microdeletions and partial deletions have been associated with infertility. We investigate the diagnostic ability of karyotyping in detecting clinically relevant Y chromosome deletions. The clinical significance of heterochromatin deletions, microdeletions and partial AZFc deletions is also evaluated. A patient with a Yq deletion, affected by severe oligoasthenoteratozoospermia, underwent intracytoplasmic sperm injection (ICSI) which resulted in the birth of a healthy baby boy. The patient, his father and his son underwent Y chromosome microdeletion and partial AZFc deletion screening. We also studied the aneuploidy rate in the sperm of the patient by fluorescent in situ hybridization. AZF microdeletions were absent in the family. However, microdeletion analysis confirmed that the Yq deletion was limited to the heterochromatin. We found a partial AZFc gr/gr deletion in all three family members. We observed an increased rate of sex chromosome aneuploidy in the infertile patient. Cytogenetic analysis was misleading in identifying the Yq breakpoint. Infertility observed in the patient was associated with the gr/gr partial deletion. However, because of the incomplete penetrance of gr/gr deletions, the consequence of the vertical transmission of the deletion through ICSI remains unknown. Copyright (c) 2007 John Wiley & Sons, Ltd.

  1. Schizophrenia and chromosomal deletions

    Energy Technology Data Exchange (ETDEWEB)

    Lindsay, E.A.; Baldini, A. [Baylor College of Medicine, Houston, TX (United States); Morris, M. A. [Univ. of Geneva School of Medicine, NY (United States)] [and others

    1995-06-01

    Recent genetic linkage analysis studies have suggested the presence of a schizophrenia locus on the chromosomal region 22q11-q13. Schizophrenia has also been frequently observed in patients affected with velo-cardio-facial syndrome (VCFS), a disorder frequently associated with deletions within 22q11.1. It has been hypothesized that psychosis in VCFS may be due to deletion of the catechol-o-methyl transferase gene. Prompted by these observations, we screened for 22q11 deletions in a population of 100 schizophrenics selected from the Maryland Epidemiological Sample. Our results show that there are schizophrenic patients carrying a deletion of 22q11.1 and a mild VCFS phenotype that might remain unrecognized. These findings should encourage a search for a schizophrenia-susceptibility gene within the deleted region and alert those in clinical practice to the possible presence of a mild VCFS phenotype associated with schizophrenia. 9 refs.

  2. An Interstitial Deletion at 7q33-36.1 in a Patient with Intellectual Disability, Significant Language Delay, and Severe Microcephaly

    Directory of Open Access Journals (Sweden)

    Trupti Kale

    2016-01-01

    Full Text Available Interstitial deletions of the distal 7q region are considered a rare entity. In this report, we describe a seven-year-old male with a heterozygous interstitial deletion at 7q33-36.1 with characteristic dysmorphic facial features, intellectual disability, severe microcephaly, and significant language delay. The primary focus of our report is to compare our case with the few others in the literature describing interstitial deletions at the long arm of chromosome 7. Based on the various breakpoints in prior studies, a number of phenotypic variations have been identified that are unique to each of the reports. However, there are also a number of similarities among these cases as well. We hope to provide a concise review of the literature and genes involved within our deletion sequence in the hope that it will contribute to creating a phenotypic profile for this patient population.

  3. [Clinical features of patients with Becker muscular dystrophy and deletions of the rod domain of dystrophin gene].

    Science.gov (United States)

    Wang, Yanyun; Zhu, Yuling; Yang, Juan; Li, Yaqin; Sun, Jiangwen; Zhan, Yixin; Zhang, Cheng

    2018-02-10

    OBJECTIVE To explore the clinical features of patients carrying deletions of the rod domain of the dystrophin gene. METHODS Clinical data of 12 Chinese patients with Becker muscular dystrophy (BMD) and such deletions was reviewed. RESULTS Most patients complained of muscle weakness of lower limbs. Two patients had muscle cramps, one had increased creatine kinase (CK) level, and one had dilated cardiomyopathy. CONCLUSION Compared with DMD, the clinical features of BMD are much more variable, particularly for those carrying deletions of the rod domain of the dystrophin gene. Muscular weakness may not be the sole complaint of BMD. The diagnosis of BMD cannot be excluded by moderately elevated CK. For male patients with dilated cardiomyopathy, the possibility of BMD should be considered.

  4. Antisense PMO found in dystrophic dog model was effective in cells from exon 7-deleted DMD patient.

    Directory of Open Access Journals (Sweden)

    Takashi Saito

    Full Text Available BACKGROUND: Antisense oligonucleotide-induced exon skipping is a promising approach for treatment of Duchenne muscular dystrophy (DMD. We have systemically administered an antisense phosphorodiamidate morpholino oligomer (PMO targeting dystrophin exons 6 and 8 to a dog with canine X-linked muscular dystrophy in Japan (CXMD(J lacking exon 7 and achieved recovery of dystrophin in skeletal muscle. To date, however, antisense chemical compounds used in DMD animal models have not been directly applied to a DMD patient having the same type of exon deletion. We recently identified a DMD patient with an exon 7 deletion and tried direct translation of the antisense PMO used in dog models to the DMD patient's cells. METHODOLOGY/PRINCIPAL FINDINGS: We converted fibroblasts of CXMD(J and the DMD patient to myotubes by FACS-aided MyoD transduction. Antisense PMOs targeting identical regions of dog and human dystrophin exons 6 and 8 were designed. These antisense PMOs were mixed and administered as a cocktail to either dog or human cells in vitro. In the CXMD(J and human DMD cells, we observed a similar efficacy of skipping of exons 6 and 8 and a similar extent of dystrophin protein recovery. The accompanying skipping of exon 9, which did not alter the reading frame, was different between cells of these two species. CONCLUSION/SIGNIFICANCE: Antisense PMOs, the effectiveness of which has been demonstrated in a dog model, achieved multi-exon skipping of dystrophin gene on the FACS-aided MyoD-transduced fibroblasts from an exon 7-deleted DMD patient, suggesting the feasibility of systemic multi-exon skipping in humans.

  5. Clinical comparison of overlapping deletions of 19p13.3.

    Science.gov (United States)

    Risheg, Hiba; Pasion, Romela; Sacharow, Stephanie; Proud, Virginia; Immken, LaDonna; Schwartz, Stuart; Tepperberg, Jim H; Papenhausen, Peter; Tan, Tiong Y; Andrieux, Joris; Plessis, Ghislaine; Amor, David J; Keitges, Elisabeth A

    2013-05-01

    We present three patients with overlapping interstitial deletions of 19p13.3 identified by high resolution SNP microarray analysis. All three had a similar phenotype characterized by intellectual disability or developmental delay, structural heart abnormalities, large head relative to height and weight or macrocephaly, and minor facial anomalies. Deletion sizes ranged from 792 Kb to 1.0 Mb and included a common region arr [hg19] 19p13.3 (3,814,392-4,136,989), containing eight genes: ZFR2, ATCAY, NMRK2, DAPK3, EEF2, PIAS4, ZBTB7A, MAP2K2, and two non-coding RNA's MIR637 and SNORDU37. The patient phenotypes were compared with three previous single patient reports with similar interstitial 19p13.3 deletions and six additional patients from the DECIPHER and ISCA databases to determine if a common haploinsufficient phenotype for the region can be established. Copyright © 2013 Wiley Periodicals, Inc.

  6. Plasma amine oxidase activities in Norrie disease patients with an X-chromosomal deletion affecting monoamine oxidase.

    Science.gov (United States)

    Murphy, D L; Sims, K B; Karoum, F; Garrick, N A; de la Chapelle, A; Sankila, E M; Norio, R; Breakefield, X O

    1991-01-01

    Two individuals with an X-chromosomal deletion were recently found to lack the genes encoding monoamine oxidase type A (MAO-A) and MAO-B. This abnormality was associated with almost total (90%) reductions in the oxidatively deaminated urinary metabolites of the MAO-A substrate, norepinephrine, and with marked (100-fold) increases in an MAO-B substrate, phenylethylamine, confirming systemic functional consequences of the genetic enzyme deficiency. However, urinary concentrations of the deaminated metabolites of dopamine and serotonin (5-HT) were essentially normal. To investigate other deaminating systems besides MAO-A and MAO-B that might produce these metabolites of dopamine and 5-HT, we examined plasma amine oxidase (AO) activity in these two patients and two additional patients with the same X-chromosomal deletion. Normal plasma AO activity was found in all four Norrie disease-deletion patients, in four patients with classic Norrie disease without a chromosomal deletion, and in family members of patients from both groups. Marked plasma amine metabolite abnormalities and essentially absent platelet MAO-B activity were found in all four Norrie disease-deletion patients, but in none of the other subjects in the two comparison groups. These results indicate that plasma AO is encoded by gene(s) independent of those for MAO-A and MAO-B, and raise the possibility that plasma AO, and perhaps the closely related tissue AO, benzylamine oxidase, as well as other atypical AOs or MAOs encoded independently from MAO-A and MAO-B may contribute to the oxidative deamination of dopamine and 5-HT in humans.

  7. Novel deletion alleles carrying CYP21A1P/A2 chimeric genes in Brazilian patients with 21-hydroxylase deficiency

    Directory of Open Access Journals (Sweden)

    Guerra-Júnior Gil

    2010-06-01

    Full Text Available Abstract Background Congenital adrenal hyperplasia due to 21-hydroxylase deficiency is caused by deletions, large gene conversions or mutations in CYP21A2 gene. The human gene is located at 6p21.3 within a locus containing the genes for putative serine/threonine Kinase RP, complement C4, steroid 21-hydroxylase CYP21 tenascin TNX, normally, in a duplicated cluster known as RCCX module. The CYP21 extra copy is a pseudogene (CYP21A1P. In Brazil, 30-kb deletion forming monomodular alleles that carry chimeric CYP21A1P/A2 genes corresponds to ~9% of disease-causing alleles. Such alleles are considered to result from unequal crossovers within the bimodular C4/CYP21 locus. Depending on the localization of recombination breakpoint, different alleles can be generated conferring the locus high degree of allelic variability. The purpose of the study was to investigate the variability of deleted alleles in patients with 21-hydroxylase deficiency. Methods We used different techniques to investigate the variability of 30-kb deletion alleles in patients with 21-hydroxylase deficiency. Alleles were first selected after Southern blotting. The composition of CYP21A1P/A2 chimeric genes was investigated by ASO-PCR and MLPA analyses followed by sequencing to refine the location of recombination breakpoints. Twenty patients carrying at least one allele with C4/CYP21 30-kb deletion were included in the study. Results An allele carrying a CYP21A1P/A2 chimeric gene was found unusually associated to a C4B/C4A Taq I 6.4-kb fragment, generally associated to C4B and CYP21A1P deletions. A novel haplotype bearing both p.P34L and p.H62L, novel and rare mutations, respectively, was identified in exon 1, however p.P30L, the most frequent pseudogene-derived mutation in this exon, was absent. Four unrelated patients showed this haplotype. Absence of p.P34L in CYP21A1P of normal controls indicated that it is not derived from pseudogene. In addition, the combination of different

  8. Mosaic deletion of 20pter due to rescue by somatic recombination.

    Science.gov (United States)

    Martin, Megan M; Vanzo, Rena J; Sdano, Mallory R; Baxter, Adrianne L; South, Sarah T

    2016-01-01

    We report on a unique case of a mosaic 20pter-p13 deletion due to a somatic repair event identified by allele differentiating single nucleotide polymorphism (SNP) probes on chromosomal microarray. Small terminal deletions of 20p have been reported in a few individuals and appear to result in a variable phenotype. This patient was a 24-month-old female who presented with failure to thrive and speech delay. Chromosomal microarray analysis (CMA) performed on peripheral blood showed a 1.6 Mb deletion involving the terminus of 20p (20pter-20p13). This deletion appeared mosaic by CMA and this suspicion was confirmed by fluorescence in situ hybridization (FISH) analysis. Additionally, the deletion interval at 20p was directly adjacent to 15 Mb of mosaic copy-neutral loss of heterozygosity (LOH). The pattern of SNP probes was highly suggestive of a somatic repair event that resulted in rescue of the deleted region using the non-deleted homologue as a template. Structural mosaicism is rare and most often believed to be due to a postzygotic mechanism. This case demonstrates the additional utility of allele patterns to help distinguish mechanisms and in this case identified the possibility of either a post-zygotic repair of a germline deletion or a post-zygotic deletion with somatic recombination repair in a single step. © 2015 Wiley Periodicals, Inc.

  9. PAR1 deletions downstream of SHOX are the most frequent defect in a Spanish cohort of Léri-Weill dyschondrosteosis (LWD) probands.

    Science.gov (United States)

    Benito-Sanz, Sara; del Blanco, Darya Gorbenko; Aza-Carmona, Miriam; Magano, Luis F; Lapunzina, Pablo; Argente, Jesús; Campos-Barros, Angel; Heath, Karen E

    2006-10-01

    Léri-Weill dyschondrosteosis (LWD) is a skeletal dysplasia characterized by disproportionate short stature and Madelung deformity. Mutations or deletions of the SHOX gene have been previously identified as the main cause of LWD. We recently identified the existence of a second class of pseudoautosomal region 1 (PAR1) deletions which do not include SHOX, implicated in the etiopathogenesis of LWD. The deletions map at least 30-250 kb downstream of SHOX, are variable in size and clearly cosegregate with the LWD phenotype. In order to determine the frequency of this new type of deletions in the Spanish population we analyzed the distribution of PAR1 defects, including the screening of SHOX deletions, mutations, and PAR1 deletions downstream of SHOX, in a total of 26 LWD probands by a combination of MLPA, microsatellite analysis, SNP genotyping, dHPLC, and DNA sequencing. A molecular defect was identified in 16/26 LWD patients (61.5%): 10 PAR1 deletions downstream of SHOX, four SHOX encompassing deletions, and two SHOX mutations. No apparent phenotypic differences were observed between patients with SHOX defects and those with PAR1 deletions downstream of SHOX. In the examined cohort of Spanish LWD probands, PAR1 deletions downstream of SHOX represent the highest proportion of identified mutations (38%) compared to SHOX deletions (15%) and mutations (8%). As a consequence of our findings, the screening of this region should be included in the routine genetic testing of LWD. Also, LWD patients who tested negative for SHOX defects should be re-evaluated for PAR1 deletions downstream of SHOX.

  10. PHKA2 mutation spectrum in Korean patients with glycogen storage disease type IX: prevalence of deletion mutations.

    Science.gov (United States)

    Choi, Rihwa; Park, Hyung-Doo; Kang, Ben; Choi, So Yoon; Ki, Chang-Seok; Lee, Soo-Youn; Kim, Jong-Won; Song, Junghan; Choe, Yon Ho

    2016-04-21

    Molecular diagnosis of glycogen storage diseases (GSDs) is important to enable accurate diagnoses and make appropriate therapeutic plans. The aim of this study was to evaluate the PHKA2 mutation spectrum in Korean patients with GSD type IX. Thirteen Korean patients were tested for PHKA2 mutations using direct sequencing and a multiplex polymerase chain reaction method. A comprehensive review of the literature on previously reported PHKA2 mutations in other ethnic populations was conducted for comparison. Among 13 patients tested, six unrelated male patients with GSD IX aged 2 to 6 years at the first diagnostic work-up for hepatomegaly with elevated aspartate transaminase (AST) and alanine transaminase (ALT) were found to have PHKA2 mutations. These patients had different PHKA2 mutations: five were known mutations (c.537 + 5G > A, c.884G > A [p.Arg295His], c.3210_3212delGAG [p.Arg1072del], exon 8 deletion, and exons 27-33 deletion) and one was a novel mutation (exons 18-33 deletion). Notably, the most common type of mutation was gross deletion, in contrast to other ethnic populations in which the most common mutation type was sequence variant. This study expands our knowledge of the PHKA2 mutation spectrum of GSD IX. Considering the PHKA2 mutation spectrum in Korean patients with GSD IX, molecular diagnostic methods for deletions should be conducted in conjunction with direct sequence analysis to enable accurate molecular diagnosis of this disease in the Korean population.

  11. Neonatal hyperinsulinemic hypoglycemia in a patient with 9p deletion syndrome

    DEFF Research Database (Denmark)

    Bayat, Allan; Kirchhoff, Maria; Madsen, Camilla Gøbel

    2018-01-01

    We report the clinical and neuroradiological findings in a young boy harboring the 9p deletion syndrome including the novel findings of thalamic infarction and germinal matrix haemorrhage and neonatal hyperinsulinemic hypoglycemia. Both the hypoglycemic events and the ventriculomegaly found...... in this patient have previously only been reported in two patients, while the thalamic infarction and germinal matrix haemorrhage are novel features....

  12. Association between BIM deletion polymorphism and clinical outcome of EGFR-mutated NSCLC patient with EGFR-TKI therapy: A meta-analysis.

    Science.gov (United States)

    Ma, Ji-Yong; Yan, Hai-Jun; Gu, Wei

    2015-01-01

    BIM deletion polymorphism was deemed to be associated with downregulation of BIM, resulting in a decreased apoptosis induced by epidermal growth factor receptor-tyrosine kinase inhibitors (EGFR-TKIs) in EGFR mutation-positive non-small cell lung cancer (NSCLC). However, accumulating evidences concerning the association between BIM deletion polymorphism and efficacy of EGFR-TKI and survival in EGFR-mutation-driven NSCLC patient reported contradictory results. A meta-analysis was conducted by combing six original eligible studies including 871 NSCLC patients. Our study showed that BIM deletion polymorphism was significantly associated with poor response to EGFR-TKI therapy in mutant EGFRNSCLC patients (P(h) = 0.309, P(z) = 0.001, OR = 0.39, 95% confidence interval (CI) = 0.23-0.67). Disease control rate (DCR) in mutant EGFRNSCLC patient with treatment of EGFR-TKI was significantly decreased in patients with BIM deletion polymorphism comparing to patients harbored BIM wild variant (P(h) = 0.583, P(Z) = 0.007, OR = 0.46, 95%CI = 0.25-0.85). EGFR mutation-derived NSCLC patient carrying BIM deletion polymorphism had a shorter progression-free survival (PFS; P(h) deletion polymorphism might be a cause that contributes to primary EGFR-TKI resistance, and it could be used as a genetic predictor for EGFR-TKI outcome and an independent prognostic factor of EGFR mutation-driven NSCLC patient.

  13. Copy number variants in attention-deficit hyperactive disorder: identification of the 15q13 deletion and its functional role.

    Science.gov (United States)

    Valbonesi, Stefano; Magri, Chiara; Traversa, Michele; Faraone, Stephen V; Cattaneo, Annamaria; Milanesi, Elena; Valenti, Vera; Gennarelli, Massimo; Scassellati, Catia

    2015-04-01

    Evidence has supported a role for rare copy number variants in the etiology of attention-deficit hyperactivity disorder (ADHD), in particular, the region 15q13, which is also a hot spot for several neuropsychiatric disorders. This region spans several genes, but their role and the biological implications remain unclear. We carried out, for the first time, an analysis of the 15q13 region in an Italian cohort of 117 ADHD patients and 77 controls using the MLPA method, confirmed by a genome single-nucleotide polymorphism array. In addition, we probed for downstream effects of the 15q13 deletions on gene expression by carrying out a transcriptomic analysis in blood. We found 15q13 deletions in two ADHD patients and identified 129 genes as significantly dysregulated in the blood of the two ADHD patients carrying 15q13 deletions compared with ADHD patients without 15q13 deletions. As expected, genes in the deleted region (KLF13, MTMR10) were downregulated in the two patients with deletions. Moreover, a pathway analysis identified apoptosis, oxidation reduction, and immune response as the mechanisms that were altered most significantly in the ADHD patients with 15q13 deletions. Interestingly, we showed that deletions in KLF13 and CHRNA7 influenced the expression of genes belonging to the same immune/inflammatory and oxidative stress signaling pathways. Our findings are consistent with the presence of 15q13 deletions in Italian ADHD patients. More interestingly, we show that pathways related to immune/inflammatory response and oxidative stress signaling are affected by the deletion of KFL13 and CHRNA7. Because the phenotypic effects of 15q13 are pleiotropic, our findings suggest that there are shared biologic pathways among multiple neuropsychiatric conditions.

  14. Nonalcoholic fatty liver in patients with Laron syndrome and GH gene deletion - preliminary report.

    Science.gov (United States)

    Laron, Zvi; Ginsberg, Shira; Webb, Muriel

    2008-10-01

    There is little information on the relationship between growth hormone/insulin-like growth factor-I (GH/IGF-I) deficiency or IGF-I treatment on nonalcoholic fatty liver disease (NAFLD) a disorder linked to obesity and insulin resistance. To find out whether the markedly obese patients with Laron syndrome (LS) and GH gene deletion have fatty livers. We studied 11 untreated adult patients with LS (5M, 6F), five girls with LS treated by IGF-I and five adult patients with GH gene deletion (3M, 3F), four previously treated by hGH in childhood. Fatty liver was quantitatively evaluated by ultrasonography using a phase array US system (HITACHI 6500, Japan). Body adiposity was determined by DEXA, and insulin resistance was estimated by HOMA-IR using the fasting serum glucose and insulin values. Six out of 11 adult patients with LS, two out of the five IGF-I treated girls with LS and three out of five adult hGH gene deletion patients were found to have NAFLD (nonalcoholic fatty liver disease). NAFLD is a frequent complication in untreated and treated congenital IGF-I deficiency. No correlation between NAFLD and age, sex, degree of obesity, blood lipids, or degree of insulin resistance was observed.

  15. Screening of Dystrophin Gene Deletions in Egyptian Patients with DMD/BMD Muscular Dystrophies

    Directory of Open Access Journals (Sweden)

    Laila K. Effat

    2000-01-01

    Full Text Available Duchenne muscular dystrophy (DMD and Becker muscular dystrophy (BMD are allelic disorders caused by mutations within the dystrophin gene. Our study has identified 100 Egyptian families collected from the Human Genetics Clinic, National Research Center, Cairo. All cases were subjected to complete clinical evaluation pedigree analysis, electromyography studies, estimation of serum creatine phosphokinase enzyme (CPK levels and DNA analysis. Multiplex PCR using 18 pairs of specific primers were used for screening of deletion mutations within the dystrophin gene. A frequency of 55% among the families. Sixty per cent of detected deletions involved multiple exons spanning the major or the minor hot spot of the dystrophin gene. The remainder 40% which mainly involved exon 45. Comparing these findings with frequencies of other countries it was found that our figures fall within the reported range of 40%– for deletions. The distribution of deletions in our study and other different studies was variable and specific ethnic differences do not apparently account for specific deletions. In addition this study concluded that employment of the 18 exon analysis is a cost effective and a highly accurate (97% to launch a nationwide program.

  16. Relatively low proportion of dystrophin gene deletions in Israeili Duchenne and Becker muscular dystrophy patients

    Energy Technology Data Exchange (ETDEWEB)

    Shomrat, R.; Gluck, E.; Legum, C.; Shiloh, Y. [Tel Aviv Univ. (Israel)

    1994-02-15

    Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD) are allelic disorders caused by mutations in the X-linked dystrophin gene. The most common mutations in western populations are deletions that are spread non-randomly throughout the gene. Molecular analysis of the dystrophin gene structure by hybridization of the full length cDNA to Southern blots and by PCR in 62 unrelated Israeli male DMD/BMD patients showed deletions in 23 (37%). This proportion is significantly lower than that found in European and North American populations (55-65%). Seventy-eight percent of the deletions were confined to exons 44-52, half of these exons 44-45, and the remaining 22% to exons 1 and 19. There was no correlation between the size of the deletion and the severity of the disease. All the deletions causing frameshift resulted in the DMD phenotypes. 43 refs., 1 fig., 1 tab.

  17. Deletion 1q43 encompassing only CHRM3 in a patient with autistic disorder.

    Science.gov (United States)

    Petersen, Andrea Klunder; Ahmad, Ausaf; Shafiq, Mustafa; Brown-Kipphut, Brigette; Fong, Chin-To; Anwar Iqbal, M

    2013-02-01

    Deletions on the distal portion of the long arm of chromosome 1 result in complex and highly variable clinical phenotypes which include intellectual disability, autism, seizures, microcephaly/craniofacial dysmorphology, corpus callosal agenesis/hypogenesis, cardiac and genital anomalies, hand and foot abnormalities and short stature. Genotype-phenotype correlation reported a minimum region of 2 Mb at 1q43-q44. We report on a 3 ½ year old male patient diagnosed with autistic disorder who has social withdrawal, eating problems, repetitive stereotypic behaviors including self-injurious head banging and hair pulling, and no seizures, anxiety, or mood swings. Array comparative genomic hybridization (aCGH) showed an interstitial deletion of 473 kb at 1q43 region (239,412,391-239,885,394; NCBI build37/hg19) harboring only CHRM3 (Acetylcholine Receptor, Muscarinic, 3; OMIM: 118494). Recently, another case with a de novo interstitial deletion of 911 kb at 1q43 encompassing three genes including CHRM3 was reported. The M3 muscarinic receptor influences a multitude of central and peripheral nervous system processes via its interaction with acetylcholine and may be an important modulator of behavior, learning and memory. We propose CHRM3 as a candidate gene responsible for our patient's specific phenotype as well as the overlapping phenotypic features of other patients with 1q43 or 1q43-q44 deletions. Copyright © 2013. Published by Elsevier Masson SAS.

  18. 17q12 Deletion in a patient with Williams syndrome: Case report and review of the literature.

    Science.gov (United States)

    Cohen, Lilian; Samanich, Joy; Pan, Quilu; Mehta, Lakshmi; Marion, Robert

    2012-06-01

    Williams syndrome (WS) is a complex genomic disorder entailing distinctive facial dysmorphism, cardiovascular abnormalities, intellectual disabilities, unusual behavioral features, and a specific cognitive profile with considerable variability. Additional symptoms include endocrine abnormalities, renal anomalies and connective tissue disorders. We report a monozygotic twin patient with WS who presented with multicystic kidneys in the newborn period, and, in addition to the typical WS deletion at 7q11.23, was found to have a de novo 1.7 Mb deletion in the 17q12 region on microarray comparative genomic hybridization. The co-twin was selectively terminated at 23 wk of gestation after being diagnosed with bilateral multicystic dysplastic kidneys and anhydramnios. Review of the literature shows that deletion of chromosome 17q12, encompassing hepatocyte nuclear factor 1beta gene, is associated with cystic renal disease and is the first recurrent genomic deletion associated with maturity onset diabetes of the young. In addition, reports of female reproductive tract malformations and patients with neurocognitive or psychiatric phenotypes have recently been described. This review of the literature summarizes 47 other cases involving 17q12 deletions with wide variability in phenotype, possibly suggesting a contiguous gene syndrome. It is likely that the additional 17q12 deletion has played a role in modifying the phenotype in our patient. This case highlights the importance of using array comparative genomic hybridization in the clinical setting to uncover the etiology of atypical findings in individuals with known microdeletion syndromes.

  19. [Polymorphisms of KITLG, SPRY4, and BAK1 genes in patients with testicular germ cell tumors and individuals with infertility associated with AZFc deletion of the Y chromosome].

    Science.gov (United States)

    Nemtsova, M V; Ivkin, E V; Simonova, O A; Rudenko, V V; Chernykh, V B; Mikhaylenko, D S; Loran, O B

    2016-01-01

    Testicular cancer is the most common form of solid cancer in young men. Testicular cancer is represented by testicular germ cell tumors (TGCTs) derived from embryonic stem cells with different degrees of differentiation in about 95% of cases. The development of these tumors is related to the formation of a pool of male germ cells and gametogenesis. Clinical factors that are predisposed to the development of germ-cell tumors include cryptorchidism and testicular microlithiasis, as well as infertility associated with the gr/gr deletion within the AZFс locus. KITLG, SPRY4, and BAK1 genes affect the development of the testes and gametogenesis; mutations and polymorphisms of these genes lead to a significant increase in the risk of the TGCT development. To determine the relationship between gene polymorphisms and the development of TGCTs, we developed a system for detection and studied the allele and genotype frequencies of the KITLG (rs995030, rs1508595), SPRY4 (rs4624820, rs6897876), and BAK1 (rs210138) genes in fertile men, patients with TGCTs, and patients with infertility that have the AZFс deletion. A significant association of rs995030 of the KITLG gene with the development of TGCTs (p = 0.029 for the allele G, p = 0.0124 for the genotype GG) was revealed. Significant differences in the frequencies of the studied polymorphisms in patients with the AZFc deletion and the control group of fertile men were not found. We showed significant differences in the frequencies for the combination of all high-risk polymorphisms in the control group, patients with the AZFc deletion and patients with TGCTs (p (TGCTs-AZF-control) = 0.0207). A fivefold increase in the frequency of the combination of all genotypes in the TGCT group (p = 0.0116; OR = 5.25 [1.44-19.15]) and 3.7-fold increase was identified in patients with the AZFc deletion (p = 0.045; OR = 3.69 [1.11-12.29]) were revealed. The genotyping of patients with infertility caused by the AZFc deletion can be used to

  20. PDGFB partial deletion: a new, rare mechanism causing brain calcification with leukoencephalopathy.

    Science.gov (United States)

    Nicolas, Gaël; Rovelet-Lecrux, Anne; Pottier, Cyril; Martinaud, Olivier; Wallon, David; Vernier, Louis; Landemore, Gérard; Chapon, Françoise; Prieto-Morin, Carol; Tournier-Lasserve, Elisabeth; Frébourg, Thierry; Campion, Dominique; Hannequin, Didier

    2014-06-01

    Idiopathic basal ganglia calcification (IBGC) is a progressive cerebral disorder with diverse motor, cognitive, and psychiatric expression. It is inherited as an autosomal dominant trait. Three IBGC-causing genes have been identified in the past 2 years: SLC20A2, PDGFRB, and PDGFB. Biological and genetic evidence showed that loss of function of either SLC20A2 or the PDGFB/PDGFRB pathway was the mechanism underlying calcification in patients with a mutation. Recently, in a study focusing on SLC20A2, a large deletion at this locus was reported. No study has systematically searched for copy number variants (CNV) involving these three genes. We designed a quantitative PCR assay of multiple short fluorescent fragments (QMPSF) to detect CNVs involving one of these three genes in a single assay. Among the 27 unrelated patients from our IBGC case series with no mutation in SLC20A2, PDGFRB, and PDGFB, we identified in one patient a heterozygous partial deletion involving exons 2 to 5 of PDGFB. This patient exhibited both strio-pallido-dentate calcification and white matter hyperintensity of presumed vascular origin, associated with mood disorder, subtle cognitive decline, and gait disorder. We confirmed by RT-PCR experiments that the allele carrying the deletion was transcribed. The resulting cDNA lacks sequence for several critical functional domains of the protein. Intragenic deletion of PDGFB is a new and rare mechanism causing IBGC. CNVs involving the three IBGC-causing genes should be investigated in patients with no point mutation.

  1. Use of deep whole-genome sequencing data to identify structure risk variants in breast cancer susceptibility genes.

    Science.gov (United States)

    Guo, Xingyi; Shi, Jiajun; Cai, Qiuyin; Shu, Xiao-Ou; He, Jing; Wen, Wanqing; Allen, Jamie; Pharoah, Paul; Dunning, Alison; Hunter, David J; Kraft, Peter; Easton, Douglas F; Zheng, Wei; Long, Jirong

    2018-03-01

    Functional disruptions of susceptibility genes by large genomic structure variant (SV) deletions in germlines are known to be associated with cancer risk. However, few studies have been conducted to systematically search for SV deletions in breast cancer susceptibility genes. We analysed deep (> 30x) whole-genome sequencing (WGS) data generated in blood samples from 128 breast cancer patients of Asian and European descent with either a strong family history of breast cancer or early cancer onset disease. To identify SV deletions in known or suspected breast cancer susceptibility genes, we used multiple SV calling tools including Genome STRiP, Delly, Manta, BreakDancer and Pindel. SV deletions were detected by at least three of these bioinformatics tools in five genes. Specifically, we identified heterozygous deletions covering a fraction of the coding regions of BRCA1 (with approximately 80kb in two patients), and TP53 genes (with ∼1.6 kb in two patients), and of intronic regions (∼1 kb) of the PALB2 (one patient), PTEN (three patients) and RAD51C genes (one patient). We confirmed the presence of these deletions using real-time quantitative PCR (qPCR). Our study identified novel SV deletions in breast cancer susceptibility genes and the identification of such SV deletions may improve clinical testing.

  2. Chromosomal deletion unmasking a recessive disease: 22q13 deletion syndrome and metachromatic leukodystrophy

    DEFF Research Database (Denmark)

    Bisgaard, A-M; Kirchhoff, M; Nielsen, J E

    2008-01-01

    A deletion on one chromosome and a mutant allele on the other may cause an autosomal recessive disease. We report on two patients with mental retardation, dysmorphic features and low catalytic activity of arylsulfatase A. One patient had a pathogenic mutation in the arylsulfatase A gene (ARSA......) and succumbed to metachromatic leukodystrophy (MLD). The other patient had a pseudoallele, which does not lead to MLD. The presenting clinical features and low arylsulfatase A activity were explained, in each patients, by a deletion of 22q13 and, thereby, of one allele of ARSA....

  3. A novel growth hormone receptor gene deletion mutation in a patient with primary growth hormone insensitivity syndrome (Laron syndrome).

    Science.gov (United States)

    Yamamoto, Hiroyasu; Kouhara, Haruhiko; Iida, Keiji; Chihara, Kazuo; Kasayama, Soji

    2008-04-01

    Growth hormone (GH) insensitivity syndrome (Laron syndrome) is known to be caused by genetic disorders of the GH-IGF-1 axis. Although many mutations in the GH receptor have been identified, there have been only a few reports of deletions of the GH receptor gene. A Japanese adult female patient with Laron syndrome was subjected to chromosome analysis with basic G-banding and also with a high accuracy technique. Each exon of the GH receptor gene was amplified by means of PCR. Since this patient was diagnosed with osteoporosis, the effects of alendronate on bone mineral density (BMD) were also examined. The chromosome analysis with the high accuracy technique demonstrated a large deletion of the short arm in one allele of chromosome 5 from p11 to p13.1 [46, XX, del (5) (p11-p13.1)]. PCR amplification of exons of the GH receptor gene showed that only exons 2 and 3 were amplified. Low-dose IGF-1 administration (30microg/kg body weight) failed to increase her BMD, whereas alendronate administration resulted in an increase associated with a decrease in urinary deoxypyridinoline (DPD) and serum osteocalcin concentrations. The GH receptor gene of the patient was shown to lack exons 4-10. To the best of our knowledge, this is the third case report of Laron syndrome with large GH receptor deletion. Alendronate was effective for the enhancement of BMD.

  4. De novo deletion of HOXB gene cluster in a patient with failure to thrive, developmental delay, gastroesophageal reflux and bronchiectasis.

    Science.gov (United States)

    Pajusalu, Sander; Reimand, Tiia; Uibo, Oivi; Vasar, Maire; Talvik, Inga; Zilina, Olga; Tammur, Pille; Õunap, Katrin

    2015-01-01

    We report a female patient with a complex phenotype consisting of failure to thrive, developmental delay, congenital bronchiectasis, gastroesophageal reflux and bilateral inguinal hernias. Chromosomal microarray analysis revealed a 230 kilobase deletion in chromosomal region 17q21.32 (arr[hg19] 17q21.32(46 550 362-46 784 039)×1) encompassing only 9 genes - HOXB1 to HOXB9. The deletion was not found in her mother or father. This is the first report of a patient with a HOXB gene cluster deletion involving only HOXB1 to HOXB9 genes. By comparing our case to previously reported five patients with larger chromosomal aberrations involving the HOXB gene cluster, we can suppose that HOXB gene cluster deletions are responsible for growth retardation, developmental delay, and specific facial dysmorphic features. Also, we suppose that bilateral inguinal hernias, tracheo-esophageal abnormalities, and lung malformations represent features with incomplete penetrance. Interestingly, previously published knock-out mice with targeted heterozygous deletion comparable to our patient did not show phenotypic alterations. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  5. Clinical implications of cytosine deletion of exon 5 of P53 gene in non small cell lung cancer patients

    Directory of Open Access Journals (Sweden)

    Rashid Mir

    2016-01-01

    Full Text Available Aim: Lung cancer is considered to be the most common cancer in the world. In humans, about 50% or more cancers have a mutated tumor suppressor p53 gene thereby resulting in accumulation of p53 protein and losing its function to activate the target genes that regulate the cell cycle and apoptosis. Extensive research conducted in murine cancer models with activated p53, loss of p53, or p53 missense mutations have facilitated researchers to understand the role of this key protein. Our study was aimed to evaluate the frequency of cytosine deletion in nonsmall cell lung cancer (NSCLC patients. Methods: One hundred NSCLC patients were genotyped for P53 (exon5, codon168 cytosine deletion leading to loss of its function and activate the target genes by allele-specific polymerase chain reaction. The P53 cytosine deletion was correlated with all the clinicopathological parameters of the patients. Results and Analysis: 59% cases were carrying P53 cytosine deletion. Similarly, the significantly higher incidence of cytosine deletion was reported in current smokers (75% in comparison to exsmoker and nonsmoker. Significantly higher frequency of cytosine deletion was reported in adenocarcinoma (68.08% than squamous cell carcinoma (52.83%. Also, a significant difference was reported between p53 cytosine deletion and metastasis (64.28%. Further, the majority of the cases assessed for response carrying P53 cytosine deletion were found to show faster disease progression. Conclusion: The data suggests that there is a significant association of the P53 exon 5 deletion of cytosine in codon 168 with metastasis and staging of the disease.

  6. SOX2 anophthalmia syndrome: 12 new cases demonstrating broader phenotype and high frequency of large gene deletions.

    Science.gov (United States)

    Bakrania, P; Robinson, D O; Bunyan, D J; Salt, A; Martin, A; Crolla, J A; Wyatt, A; Fielder, A; Ainsworth, J; Moore, A; Read, S; Uddin, J; Laws, D; Pascuel-Salcedo, D; Ayuso, C; Allen, L; Collin, J R O; Ragge, N K

    2007-11-01

    Developmental eye anomalies, which include anophthalmia (absent eye) or microphthalmia (small eye) are an important cause of severe visual impairment in infants and young children. Heterozygous mutations in SOX2, a SOX1B-HMG box transcription factor, have been found in up to 10% of individuals with severe microphthalmia or anophthalmia and such mutations could also be associated with a range of non-ocular abnormalities. We performed mutation analysis on a new cohort of 120 patients with congenital eye abnormalities, mainly anophthalmia, microphthalmia and coloboma. Multiplex ligation-dependent probe amplification (MLPA) and fluorescence in situ hybridisation (FISH) were used to detect whole gene deletion. We identified four novel intragenic SOX2 mutations (one single base deletion, one single base duplication and two point mutations generating premature translational termination codons) and two further cases with the previously reported c.70del20 mutation. Of 52 patients with severe microphthalmia or anophthalmia analysed by MLPA, 5 were found to be deleted for the whole SOX2 gene and 1 had a partial deletion. In two of these, FISH studies identified sub-microscopic deletions involving a minimum of 328 Kb and 550 Kb. The SOX2 phenotypes include a patient with anophthalmia, oesophageal abnormalities and horseshoe kidney, and a patient with a retinal dystrophy implicating SOX2 in retinal development. Our results provide further evidence that SOX2 haploinsufficiency is a common cause of severe developmental ocular malformations and that background genetic variation determines the varying phenotypes. Given the high incidence of whole gene deletion we recommend that all patients with severe microphthalmia or anophthalmia, including unilateral cases be screened by MLPA and FISH for SOX2 deletions.

  7. Prevalence of glutathione S-transferase gene deletions and their effect on sickle cell patients

    Directory of Open Access Journals (Sweden)

    Pandey Sanjay

    2012-01-01

    Full Text Available BACKGROUND: Glutathione S-transferase gene deletions are known detoxification agents and cause oxidative damage. Due to the different pathophysiology of anemia in thalassemia and sickle cell disease, there are significant differences in the pathophysiology of iron overload and iron-related complications in these disorders. OBJECTIVE: The aim of this study was to estimate the frequency of the GSTM1 and GSTT1 genotypes in sickle cell disease patients and their effect on iron status. METHODS: Forty sickle cell anemia and sixty sickle ß-thalassemia patients and 100 controls were evaluated to determine the frequency of GST gene deletions. Complete blood counts were performed by an automated cell analyzer. Hemoglobin F, hemoglobin A, hemoglobin A2 and hemoglobin S were measured and diagnosis of patients was achieved by high performance liquid chromatography with DNA extraction by the phenol-chloroform method. The GST null genotype was determined using multiplex polymerase chain reaction and serum ferritin was measured using an ELISA kit. Statistical analysis was by EpiInfo and GraphPad statistics software. RESULTS: An increased frequency of the GSTT1 null genotype (p-value = 0.05 was seen in the patients. The mean serum ferritin level was higher in patients with the GST genotypes than in controls; this was statistically significant for all genotypes except GSTM1, however the higher levels of serum ferritin were due to blood transfusions in patients. CONCLUSION: GST deletions do not play a direct role in iron overload of sickle cell patients.

  8. Epilepsy is a possible feature in Williams-Beuren syndrome patients harboring typical deletions of the 7q11.23 critical region.

    Science.gov (United States)

    Nicita, Francesco; Garone, Giacomo; Spalice, Alberto; Savasta, Salvatore; Striano, Pasquale; Pantaleoni, Chiara; Spartà, Maria Valentina; Kluger, Gerhard; Capovilla, Giuseppe; Pruna, Dario; Freri, Elena; D'Arrigo, Stefano; Verrotti, Alberto

    2016-01-01

    Seizures are rarely reported in Williams-Beuren syndrome (WBS)--a contiguous-gene-deletion disorder caused by a 7q11.23 heterozygous deletion of 1.5-1.8 Mb--and no previous study evaluated electro-clinical features of epilepsy in this syndrome. Furthermore, it has been hypothesized that atypical deletion (e.g., larger than 1.8 Mb) may be responsible for a more pronounced neurological phenotypes, especially including seizures. Our objectives are to describe the electro-clinical features in WBS and to correlate the epileptic phenotype with deletion of the 7q11.23 critical region. We evaluate the electro-clinical features in one case of distal 7q11.23 deletion syndrome and in eight epileptic WBS (eWBS) patients. Additionally, we compare the deletion size-and deleted genes-of four epileptic WBS (eWBS) with that of four non-epileptic WBS (neWBS) patients. Infantile spasms, focal (e.g., motor and dyscognitive with autonomic features) and generalized (e.g., tonic-clonic, tonic, clonic, myoclonic) seizures were encountered. Drug-resistance was observed in one patient. Neuroimaging discovered one case of focal cortical dysplasia, one case of fronto-temporal cortical atrophy and one case of periventricular nodular heterotopia. Comparison of deletion size between eWBS and neWBS patients did not reveal candidate genes potentially underlying epilepsy. This is the largest series describing electro-clinical features of epilepsy in WBS. In WBS, epilepsy should be considered both in case of typical and atypical deletions, which do not involve HIP1, YWHAG or MAGI2. © 2015 Wiley Periodicals, Inc.

  9. DNA amplification of a further exon of Duchenne muscular dystrophy locus increase possibilities for deletion screening

    Energy Technology Data Exchange (ETDEWEB)

    Speer, A.; Rosenthal, A.; Billwitz, H.; Hanke, R.; Forrest, S.M; Love, D.; Davies, K.E.; Coutelle, C. (John Radcliffe Hospital, Oxford (England))

    1989-06-26

    The data of Chamberlain et al allow the detection of 76% of deletions in the region Cf56A/Cf23a identified by hybridization in their patients. The authors have generated two oligonucleotides allowing the amplification of a further exon which is included in the 3.4 kb hybridization of fragment of Cf56a. This exon is deleted in about 10% of their patients.

  10. Quantum deletion: Beyond the no-deletion principle

    International Nuclear Information System (INIS)

    Adhikari, Satyabrata

    2005-01-01

    Suppose we are given two identical copies of an unknown quantum state and we wish to delete one copy from among the given two copies. The quantum no-deletion principle restricts us from perfectly deleting a copy but it does not prohibit us from deleting a copy approximately. Here we construct two types of a 'universal quantum deletion machine' which approximately deletes a copy such that the fidelity of deletion does not depend on the input state. The two types of universal quantum deletion machines are (1) a conventional deletion machine described by one unitary operator and (2) a modified deletion machine described by two unitary operators. Here it is shown that the modified deletion machine deletes a qubit with fidelity 3/4, which is the maximum limit for deleting an unknown quantum state. In addition to this we also show that the modified deletion machine retains the qubit in the first mode with average fidelity 0.77 (approx.) which is slightly greater than the fidelity of measurement for two given identical states, showing how precisely one can determine its state [S. Massar and S. Popescu, Phys. Rev. Lett. 74, 1259 (1995)]. We also show that the deletion machine itself is input state independent, i.e., the information is not hidden in the deleting machine, and hence we can delete the information completely from the deletion machine

  11. Prevalence of 22q11.2 deletions in 311 Dutch patients with schizophrenia

    NARCIS (Netherlands)

    Hoogendoorn, Mechteld L C; Vorstman, Jacob A S; Jalali, Gholam R; Selten, Jean-Paul; Sinke, Richard J; Emanuel, Beverly S; Kahn, René S

    UNLABELLED: The objectives of this study were 1) to examine whether the prevalence of 22q11.2 deletion syndrome (22q11DS) in schizophrenia patients with the Deficit syndrome is higher than the reported approximately 2% for the population of schizophrenia patients as a whole, and 2) to estimate the

  12. Characterization of genetic deletions in Becker muscular dystrophy using monoclonal antibodies against a deletion-prone region of dystrophin

    Energy Technology Data Exchange (ETDEWEB)

    Thanh, L.T.; Man, Nguyen Thi; Morris, G.E. [Wales Institute, Clwyd (United Kingdom)] [and others

    1995-08-28

    We have produced a new panel of 20 monoclonal antibodies (mAbs) against a region of the dystrophin protein corresponding to a deletion-prone region of the Duchenne muscular dystrophy gene (exons 45-50). We show that immunohistochemistry or Western blotting with these {open_quotes}exon-specific{close_quotes} mAbs can provide a valuable addition to Southern blotting or PCR methods for the accurate identification of genetic deletions in Becker muscular dystrophy patients. The antibodies were mapped to the following exons: exon 45 (2 mAbs), exon 46 (6), exon 47 (1), exons 47/48 (4), exons 48-50 (6), and exon 50 (1). PCR amplification of single exons or groups of exons was used both to produce specific dystrophin immunogens and to map the mAbs obtained. PCR-mediated mutagenesis was also used to identify regions of dystrophin important for mAb binding. Because the mAbs can be used to characterize the dystrophin produced by individual muscle fibres, they will also be useful for studying {open_quotes}revertant{close_quotes} fibres in Duchenne muscle and for monitoring the results of myoblast therapy trials in MD patients with deletions in this region of the dystrophin gene. 27 refs., 7 figs., 3 tabs.

  13. Avoidance of pseudogene interference in the detection of 3' deletions in PMS2.

    Science.gov (United States)

    Vaughn, Cecily P; Hart, Kimberly J; Samowitz, Wade S; Swensen, Jeffrey J

    2011-09-01

    Lynch syndrome is characterized by mutations in the mismatch repair genes MLH1, MSH2, MSH6, and PMS2. In PMS2, detection of mutations is confounded by numerous pseudogenes. Detection of 3' deletions is particularly complicated by the pseudogene PMS2CL, which has strong similarity to PMS2 exons 9 and 11-15, due to extensive gene conversion. A newly designed multiplex ligation-dependent probe amplification (MLPA) kit incorporates probes for variants found in both PMS2 and PMS2CL. This provides detection of deletions, but does not allow localization of deletions to the gene or pseudogene. To address this, we have developed a methodology incorporating reference samples with known copy numbers of variants, and paired MLPA results with sequencing of PMS2 and PMS2CL. We tested a subset of clinically indicated samples for which mutations were either unidentified or not fully characterized using existing methods. We identified eight unrelated patients with deletions encompassing exons 9-15, 11-15, 13-15, 14-15, and 15. By incorporating specific, characterized reference samples and sequencing the gene and pseudogene it is possible to identify deletions in this region of PMS2 and provide clinically relevant results. This methodology represents a significant advance in the diagnosis of patients with Lynch syndrome caused by PMS2 mutations. © 2011 Wiley-Liss, Inc.

  14. Identification of the first PAR1 deletion encompassing upstream SHOX enhancers in a family with idiopathic short stature.

    Science.gov (United States)

    Benito-Sanz, Sara; Aza-Carmona, Miriam; Rodríguez-Estevez, Amaya; Rica-Etxebarria, Ixaso; Gracia, Ricardo; Campos-Barros, Angel; Heath, Karen E

    2012-01-01

    Short stature homeobox-containing gene, MIM 312865 (SHOX) is located within the pseudoautosomal region 1 (PAR1) of the sex chromosomes. Mutations in SHOX or its downstream transcriptional regulatory elements represent the underlying molecular defect in ~60% of Léri-Weill dyschondrosteosis (LWD) and ~5-15% of idiopathic short stature (ISS) patients. Recently, three novel enhancer elements have been identified upstream of SHOX but to date, no PAR1 deletions upstream of SHOX have been observed that only encompass these enhancers in LWD or ISS patients. We set out to search for genetic alterations of the upstream SHOX regulatory elements in 63 LWD and 100 ISS patients with no known alteration in SHOX or the downstream enhancer regions using a specifically designed MLPA assay, which covers the PAR1 upstream of SHOX. An upstream SHOX deletion was identified in an ISS proband and her affected father. The deletion was confirmed and delimited by array-CGH, to extend ~286 kb. The deletion included two of the upstream SHOX enhancers without affecting SHOX. The 13.3-year-old proband had proportionate short stature with normal GH and IGF-I levels. In conclusion, we have identified the first PAR1 deletion encompassing only the upstream SHOX transcription regulatory elements in a family with ISS. The loss of these elements may result in SHOX haploinsufficiency because of decreased SHOX transcription. Therefore, this upstream region should be included in the routine analysis of PAR1 in patients with LWD, LMD and ISS.

  15. A New Intergenic α-Globin Deletion (α-αΔ125) Found in a Kabyle Population.

    Science.gov (United States)

    Singh, Amrathlal Rabbind; Lacan, Philippe; Cadet, Estelle; Bignet, Patricia; Dumesnil, Cécile; Vannier, Jean-Pierre; Joly, Philippe; Rochette, Jacques

    2016-01-01

    We have identified a deletion of 125 bp (α-α(Δ125)) (NG_000006.1: g.37040_37164del) in the α-globin gene cluster in a Kabyle population. A combination of singlex and multiplex polymerase chain reaction (PCR)-based assays have been used to identify the molecular defect. Sequencing of the abnormal PCR amplification product revealed a novel α1-globin promoter deletion. The endpoints of the deletion were characterized by sequencing the deletion junctions of the mutated allele. The observed deletion was located 378 bp upstream of the α1-globin gene transcription initiation site and leaves the α2 gene intact. In some patients, the α-α(Δ125) deletion was shown to segregate with Hb S (HBB: c.20A>T) and/or Hb C (HBB: c.19G>A) or a β-thalassemic allele. The α-α(Δ125) deletion has no discernible effect on red cell indices when inherited with no other abnormal globin genes. The family study demonstrated that the deletion is heritable. This is the only example of an intergenic α2-α1 non coding DNA deletion, leaving the α2-globin gene and the α1 coding part intact.

  16. Subtelomeric Copy Number Variations: The Importance of 4p/4q Deletions in Patients with Congenital Anomalies and Developmental Disability.

    Science.gov (United States)

    Novo-Filho, Gil M; Montenegro, Marília M; Zanardo, Évelin A; Dutra, Roberta L; Dias, Alexandre T; Piazzon, Flavia B; Costa, Taís V M M; Nascimento, Amom M; Honjo, Rachel S; Kim, Chong A; Kulikowski, Leslie D

    2016-01-01

    The most prevalent structural variations in the human genome are copy number variations (CNVs), which appear predominantly in the subtelomeric regions. Variable sizes of 4p/4q CNVs have been associated with several different psychiatric findings and developmental disability (DD). We analyzed 105 patients with congenital anomalies (CA) and developmental and/or intellectual disabilities (DD/ID) using MLPA subtelomeric specific kits (P036 /P070) and 4 of them using microarrays. We found abnormal subtelomeric CNVs in 15 patients (14.3%), including 8 patients with subtelomeric deletions at 4p/4q (53.3%). Additional genomic changes were observed at 1p36, 2q37.3, 5p15.3, 5q35.3, 8p23.3, 13q11, 14q32.3, 15q11.2, and Xq28/Yq12. This indicates the prevalence of independent deletions at 4p/4q, involving PIGG, TRIML2, and FRG1. Furthermore, we identified 15 genes with changes in copy number that contribute to neurological development and/or function, among them CRMP1, SORCS2, SLC25A4, and HELT. Our results highlight the association of genes with changes in copy number at 4p and 4q subtelomeric regions and the DD phenotype. Cytogenomic characterization of additional cases with distal deletions should help clarifying the role of subtelomeric CNVs in neurological diseases. © 2016 S. Karger AG, Basel.

  17. Investigation of deletions at 7q11.23 in 44 patients referred for Williams-Beuren syndrome, using FISH and four DNA polymorphisms

    DEFF Research Database (Denmark)

    Brøndum-Nielsen, K; Beck, B; Gyftodimou, J

    1997-01-01

    Williams syndrome (WS) is associated with a submicroscopic deletion of the elastin gene (ELN) at 7q11.23. The deletion encompasses closely linked DNA markers. We have investigated 44 patients referred for possible WS using fluorescence in situ hybridization (FISH) analysis with a P1 clone...... containing an insert from the ELN, as well as performing genotype analysis of patients and parents with four DNA polymorphisms. Twenty-four patients were found to have deletions, 19 of whom were found clinically to have typical WS. The facial features were especially characteristic. None of the patients...

  18. Large Genomic Deletions in CACNA1A Cause Episodic Ataxia Type 2

    Directory of Open Access Journals (Sweden)

    Jijun eWan

    2011-09-01

    Full Text Available Episodic ataxia (EA syndromes are heritable diseases characterized by dramatic episodes of imbalance and incoordination. Episodic ataxia type 2 (EA2, the most common and the best characterized subtype, is caused by mostly nonsense, splice site, small indel and sometimes missense mutations in CACNA1A. Direct sequencing of CACNA1A fails to identify mutations in some patients with EA2-like features, possibly due to incomplete interrogation of CACNA1A or defects in other EA genes not yet defined. Previous reports described genomic deletions between 4-40kb in EA2. In 47 subjects with EA (26 with EA2-like features who tested negative for mutations in the known EA genes, we used Multiplex Ligation-dependent Probe Amplification (MLPA to analyze CACNA1A for exonic copy number variations. Breakpoints were further defined by long-range PCR. We identified distinct multi-exonic deletions in three probands with classic EA2-like features: episodes of prolonged vertigo and ataxia triggered by stress and fatigue, interictal nystagmus, with onset during infancy or early childhood. The breakpoints in all three probands are located in Alu sequences, indicating errors in homologous recombination of Alu sequences as the underlying mechanism. The smallest deletion spanned exons 39 and 40, while the largest deletion spanned 200kb, missing all but the first three exons. One deletion involving exons 39 through 47 arose spontaneously. The search for mutations in CACNA1A appears most fruitful in EA patients with interictal nystagmus and onset early in life. The finding of large heterozygous deletions suggests haploinsufficiency as a possible pathomechanism of EA2.

  19. Detection of 1p36 deletion by clinical exome-first diagnostic approach.

    Science.gov (United States)

    Watanabe, Miki; Hayabuchi, Yasunobu; Ono, Akemi; Naruto, Takuya; Horikawa, Hideaki; Kohmoto, Tomohiro; Masuda, Kiyoshi; Nakagawa, Ryuji; Ito, Hiromichi; Kagami, Shoji; Imoto, Issei

    2016-01-01

    Although chromosome 1p36 deletion syndrome is considered clinically recognizable based on characteristic features, the clinical manifestations of patients during infancy are often not consistent with those observed later in life. We report a 4-month-old girl who showed multiple congenital anomalies and developmental delay, but no clinical signs of syndromic disease caused by a terminal deletion in 1p36.32-p36.33 that was first identified by targeted-exome sequencing for molecular diagnosis.

  20. Abnormal protein in the cerebrospinal fluid of patients with a submicroscopic X-chromosomal deletion associated with Norrie disease: preliminary report.

    Science.gov (United States)

    Joy, J E; Poglod, R; Murphy, D L; Sims, K B; de la Chapelle, A; Sankila, E M; Norio, R; Merril, C R

    1991-01-01

    Norrie disease is an X-linked recessive disorder characterized by congenital blindness and, in many cases, mental retardation. Some Norrie disease cases have been shown to be associated with a submicroscopic deletion in chromosomal region Xp11.3. Cerebrospinal fluid (CSF) was collected from four male patients with an X-chromosomal deletion associated with Norrie disease. CSF proteins were resolved using two-dimensional gel electrophoresis and then analyzed by computer using the Elsie V program. Our analysis revealed a protein that appears to be altered in patients with Norrie disease deletion.

  1. Isolation of anonymous DNA sequences from within a submicroscopic X chromosomal deletion in a patient with choroideremia, deafness, and mental retardation

    International Nuclear Information System (INIS)

    Nussbaum, R.L.; Lesko, J.G.; Lewis, R.A.; Ledbetter, S.A.; Ledbetter, D.H.

    1987-01-01

    Choroideremia, an X-chromosome linked retinal dystrophy of unknown pathogenesis, causes progressive nightblindness and eventual central blindness in affected males by the third to fourth decade of life. Choroideremia has been mapped to Xq13-21 by tight linkage to restriction fragment length polymorphism loci. The authors have recently identified two families in which choroideremia is inherited with mental retardation and deafness. In family XL-62, an interstitial deletion Xq21 is visible by cytogenetic analysis and two linked anonymous DNA markers, DXYS1 and DXS72, are deleted. In the second family, XL-45, an interstitial deletion was suspected on phenotypic grounds but could not be confirmed by high-resolution cytogenetic analysis. They used phenol-enhanced reassociation of 48,XXXX DNA in competition with excess XL-45 DNA to generate a library of cloned DNA enriched for sequences that might be deleted in XL-45. Two of the first 83 sequences characterized from the library were found to be deleted in probands from family XL-45 as well as from family XL-62. Isolation of these sequences proves that XL-45 does contain a submicroscopic deletion and provides a starting point for identifying overlapping genomic sequences that span the XL-45 deletion. Each overlapping sequence will be studied to identify exons from the choroideremia locus

  2. Association between F508 deletion in CFTR and chronic pancreatitis risk.

    Science.gov (United States)

    Zhao, Dong; Xu, Yanzhen; Li, Jiatong; Fu, Shien; Xiao, Feifan; Song, Xiaowei; Xie, Zhibin; Jiang, Min; He, Yan; Liu, Chengwu; Wen, Qiongxian; Yang, Xiaoli

    2017-09-01

    The cystic fibrosis transmembrane conductance regulator (CFTR) has been reported to influence individual susceptibility to chronic pancreatitis (CP), but the results of previous studies are controversial. We performed a study to demonstrate the relationship between CFTR and CP. We searched PubMed, Scopus, and Embase for studies of patients with CP. Seven studies from 1995 to 2016 were identified, and included 64,832 patients. Pooled prevalence and 95% confidence intervals (CIs) were calculated. F508 deletion in CFTR was significantly positively associated with CP risk in the overall analysis (odds ratio [OR]=3.20, 95% CI: 2.30-4.44, I 2 =31.7%). In subgroup analysis stratified by ethnicity, F508 deletion was significantly associated with CP risk in Indian populations, using a fixed effects model (ORs=5.45, 95% CI: 2.52-11.79, I 2 =0.0%), and in non-Indian populations, using a random effects model (ORs=3.59, 95% CI: 1.73-7.48, I 2 =60.9%). At the same time, we found that Indians with F508 deletion had much higher CP prevalence than non-Indians. Interestingly, F508 deletion was also associated with CP and idiopathic CP risk in subgroup analysis stratified by aeitiology, using the fixed effects model. Based on current evidence, F508 deletion is a risk factor for CP, and Indians with F508 deletion have much higher CP morbidity. Copyright © 2017 Editrice Gastroenterologica Italiana S.r.l. Published by Elsevier Ltd. All rights reserved.

  3. Identification of a Novel Deletion in AVP-NPII Gene in a Patient with Central Diabetes Insipidus.

    Science.gov (United States)

    Deniz, Ferhat; Acar, Ceren; Saglar, Emel; Erdem, Beril; Karaduman, Tugce; Yonem, Arif; Cagiltay, Eylem; Ay, Seyit Ahmet; Mergen, Hatice

    2015-01-01

    Central Diabetes Insipidus (CDI) is caused by a deficiency of antidiuretic hormone and characterized by polyuria, polydipsia and inability to concentrate urine. Our objective was to present the results of the molecular analyses of AVP-neurophysin II (AVP-NPII) gene in a large familial neurohypophyseal (central) DI pedigree. A male patient and his family members were analyzed and the prospective clinical data were collected. The proband applied to hospital for eligibility to be a recruit in Armed Forces. The patient had severe polyuria (20 L/day), polydipsia (20.5 L/day), fatique, and deep thirstiness. CDI was confirmed with the water deprivation-desmopressin test according to an increase in urine osmolality from 162 mOsm/kg to 432 mOsm/kg after desmopressin acetate injection. To evaluate the coding regions of AVP-NPII gene, polymerase chain reactions were performed and amplified regions were submitted to direct sequence analysis. We detected a heterozygous three base pair deletion at codon 69-70 (207_209delGGC) in exon 2, which lead to a deletion of the amino acid alanine. A three-dimensional protein structure prediction was shown for the deleted AVP-NPII and compared with the wild type. The three base pair deletion may yield an abnormal AVP precursor in neurophysin moiety, but further functional analyses are needed to understand the function of the deleted protein. © 2015 by the Association of Clinical Scientists, Inc.

  4. Patients with High-Grade Gliomas Harboring Deletions of Chromosomes 9p and 10q Benefit from Temozolomide Treatment

    Directory of Open Access Journals (Sweden)

    Silke Wemmert

    2005-10-01

    Full Text Available Surgical cure of glioblastomas is virtually impossible and their clinical course is mainly determined by the biologic behavior of the tumor cells and their response to radiation and chemotherapy. We investigated whether response to temozolomide (TMZ chemotherapy differs in subsets of malignant glioblastomas defined by genetic lesions. Eighty patients with newly diagnosed glioblastoma were analyzed with comparative genomic hybridization and loss of heterozygosity. All patients underwent radical resection. Fifty patients received TMZ after radiotherapy (TMZ group and 30 patients received radiotherapy alone (RT group. The most common aberrations detected were gains of parts of chromosome 7 and losses of 10% 9p, or 13q. The spectrum of genetic aberrations did not differ between the TMZ and RT groups. Patients treated with TMZ showed significantly better survival than patients treated with radiotherapy alone (19.5 vs 9.3 months. Genomic deletions on chromosomes 9 and 10 are typical for glioblastoma and associated with poor prognosis. However, patients with these aberrations benefited significantly from TMZ in univariate analysis. In multivariate analysis, this effect was pronounced for 9p deletion and for elderly patients with 10q deletions, respectively. This study demonstrates that molecular genetic and cytogenetic analyses potentially predict responses to chemotherapy in patients with newly diagnosed glioblastomas.

  5. Xp21 contiguous gene syndromes: Deletion quantitation with bivariate flow karyotyping allows mapping of patient breakpoints

    Energy Technology Data Exchange (ETDEWEB)

    McCabe, E.R.B.; Towbin, J.A. (Baylor College of Medicine, Houston, TX (United States)); Engh, G. van den; Trask, B.J. (Lawrence Livermore National Lab., CA (United States))

    1992-12-01

    Bivariate flow karyotyping was used to estimate the deletion sizes for a series of patients with Xp21 contiguous gene syndromes. The deletion estimates were used to develop an approximate scale for the genomic map in Xp21. The bivariate flow karyotype results were compared with clinical and molecular genetic information on the extent of the patients' deletions, and these various types of data were consistent. The resulting map spans >15 Mb, from the telomeric interval between DXS41 (99-6) and DXS68 (1-4) to a position centromeric to the ornithine transcarbamylase locus. The deletion sizing was considered to be accurate to [plus minus]1 Mb. The map provides information on the relative localization of genes and markers within this region. For example, the map suggests that the adrenal hypoplasia congenita and glycerol kinase genes are physically close to each other, are within 1-2 Mb of the telomeric end of the Duchenne muscular dystrophy (DMD) gene, and are nearer to the DMD locus than to the more distal marker DXS28 (C7). Information of this type is useful in developing genomic strategies for positional cloning in Xp21. These investigations demonstrate that the DNA from patients with Xp21 contiguous gene syndromes can be valuable reagents, not only for ordering loci and markers but also for providing an approximate scale to the map of the Xp21 region surrounding DMD. 44 refs., 3 figs.

  6. Quantitative PCR analysis reveals a high incidence of large intragenic deletions in the FANCA gene in Spanish Fanconi anemia patients.

    Science.gov (United States)

    Callén, E; Tischkowitz, M D; Creus, A; Marcos, R; Bueren, J A; Casado, J A; Mathew, C G; Surrallés, J

    2004-01-01

    Fanconi anaemia is an autosomal recessive disease characterized by chromosome fragility, multiple congenital abnormalities, progressive bone marrow failure and a high predisposition to develop malignancies. Most of the Fanconi anaemia patients belong to complementation group FA-A due to mutations in the FANCA gene. This gene contains 43 exons along a 4.3-kb coding sequence with a very heterogeneous mutational spectrum that makes the mutation screening of FANCA a difficult task. In addition, as the FANCA gene is rich in Alu sequences, it was reported that Alu-mediated recombination led to large intragenic deletions that cannot be detected in heterozygous state by conventional PCR, SSCP analysis, or DNA sequencing. To overcome this problem, a method based on quantitative fluorescent multiplex PCR was proposed to detect intragenic deletions in FANCA involving the most frequently deleted exons (exons 5, 11, 17, 21 and 31). Here we apply the proposed method to detect intragenic deletions in 25 Spanish FA-A patients previously assigned to complementation group FA-A by FANCA cDNA retroviral transduction. A total of eight heterozygous deletions involving from one to more than 26 exons were detected. Thus, one third of the patients carried a large intragenic deletion that would have not been detected by conventional methods. These results are in agreement with previously published data and indicate that large intragenic deletions are one of the most frequent mutations leading to Fanconi anaemia. Consequently, this technology should be applied in future studies on FANCA to improve the mutation detection rate. Copyright 2003 S. Karger AG, Basel

  7. Two deletion variants of Middle East respiratory syndrome coronavirus found in a patient with characteristic symptoms.

    Science.gov (United States)

    Xie, Qian; Cao, Yujuan; Su, Juan; Wu, Jie; Wu, Xianbo; Wan, Chengsong; He, Mingliang; Ke, Changwen; Zhang, Bao; Zhao, Wei

    2017-08-01

    Significant sequence variation of Middle East respiratory syndrome coronavirus (MERS CoV) has never been detected since it was first reported in 2012. A MERS patient came from Korea to China in late May 2015. The patient was 44 years old and had symptoms including high fever, dry cough with a little phlegm, and shortness of breath, which are roughly consistent with those associated with MERS, and had had close contact with individuals with confirmed cases of MERS.After one month of therapy with antiviral, anti-infection, and immune-enhancing agents, the patient recovered in the hospital and was discharged. A nasopharyngeal swab sample was collected for direct sequencing, which revealed two deletion variants of MERS CoV. Deletions of 414 and 419 nt occurred between ORF5 and the E protein, resulting in a partial protein fusion or truncation of ORF5 and the E protein. Functional analysis by bioinformatics and comparison to previous studies implied that the two variants might be defective in their ability to package MERS CoV. However, the mechanism of how these deletions occurred and what effects they have need to be further investigated.

  8. Sequence homology at the breakpoint and clinical phenotype of mitochondrial DNA deletion syndromes.

    Science.gov (United States)

    Sadikovic, Bekim; Wang, Jing; El-Hattab, Ayman W; Landsverk, Megan; Douglas, Ganka; Brundage, Ellen K; Craigen, William J; Schmitt, Eric S; Wong, Lee-Jun C

    2010-12-20

    Mitochondrial DNA (mtDNA) deletions are a common cause of mitochondrial disorders. Large mtDNA deletions can lead to a broad spectrum of clinical features with different age of onset, ranging from mild mitochondrial myopathies (MM), progressive external ophthalmoplegia (PEO), and Kearns-Sayre syndrome (KSS), to severe Pearson syndrome. The aim of this study is to investigate the molecular signatures surrounding the deletion breakpoints and their association with the clinical phenotype and age at onset. MtDNA deletions in 67 patients were characterized using array comparative genomic hybridization (aCGH) followed by PCR-sequencing of the deletion junctions. Sequence homology including both perfect and imperfect short repeats flanking the deletion regions were analyzed and correlated with clinical features and patients' age group. In all age groups, there was a significant increase in sequence homology flanking the deletion compared to mtDNA background. The youngest patient group (deletion distribution in size and locations, with a significantly lower sequence homology flanking the deletion, and the highest percentage of deletion mutant heteroplasmy. The older age groups showed rather discrete pattern of deletions with 44% of all patients over 6 years old carrying the most common 5 kb mtDNA deletion, which was found mostly in muscle specimens (22/41). Only 15% (3/20) of the young patients (deletion, which is usually present in blood rather than muscle. This group of patients predominantly (16 out of 17) exhibit multisystem disorder and/or Pearson syndrome, while older patients had predominantly neuromuscular manifestations including KSS, PEO, and MM. In conclusion, sequence homology at the deletion flanking regions is a consistent feature of mtDNA deletions. Decreased levels of sequence homology and increased levels of deletion mutant heteroplasmy appear to correlate with earlier onset and more severe disease with multisystem involvement.

  9. Effect of 13q deletion on IL-6 production in patients with multiple myeloma: a hypothesis may hold true.

    Science.gov (United States)

    Neemat, Kassem; Rania, Khalifa; Tarek, Mohamed; Hamdy, Abdel Azim

    2014-01-01

    Numerous studies have shown a correlation between 13q deletion and poor prognosis in multiple myeloma (MM), but the mechanisms are not fully understood. Earlier studies suggest that this lesion involves large segments or the entire long arm involving the retinoblastoma (Rb) gene. In myeloma, Rb gene is believed to down regulate interleukin-6 (IL-6) which plays a central role in the pathogenesis of MM. Therefore, it has been hypothesized that loss of the Rb gene might be associated with very high expression of IL-6 and subsequent bad prognosis. Hence this study evaluates IL-6 production in MM patients with and without 13q deletions and assesses their response to conventional and new therapeutic regimens. Forty MM patients and 20 matched controls were included in this study. Interphase fluorescence in situ hybridization (FISH) analysis was performed using LSI 13q14-specific probe. Serum levels of IL-6 were determined by ELISA. All patients received conventional chemotherapy. Refractory patients received other therapeutic regimens of Thalidomide or Bortezomib. Significant increase (p < 0.001) of IL-6 production was recorded in patients with a 13q deletion compared to patients with normal chromosome 13q status. These patients were also refractory to conventional chemotherapy but showed striking response to Thalidomide or Bortezomib. This study suggests that 13q deletions are associated with increased production of IL-6 in MM and this could be a possible cause of the associated bad prognosis. In addition, the results also show the potential to improve responses in patients with refractory MM with the introduction of novel therapies.

  10. Deletions of the long arm of chromosome 5 define subgroups of T-cell acute lymphoblastic leukemia.

    Science.gov (United States)

    La Starza, Roberta; Barba, Gianluca; Demeyer, Sofie; Pierini, Valentina; Di Giacomo, Danika; Gianfelici, Valentina; Schwab, Claire; Matteucci, Caterina; Vicente, Carmen; Cools, Jan; Messina, Monica; Crescenzi, Barbara; Chiaretti, Sabina; Foà, Robin; Basso, Giuseppe; Harrison, Christine J; Mecucci, Cristina

    2016-08-01

    Recurrent deletions of the long arm of chromosome 5 were detected in 23/200 cases of T-cell acute lymphoblastic leukemia. Genomic studies identified two types of deletions: interstitial and terminal. Interstitial 5q deletions, found in five cases, were present in both adults and children with a female predominance (chi-square, P=0.012). Interestingly, these cases resembled immature/early T-cell precursor acute lymphoblastic leukemia showing significant down-regulation of five out of the ten top differentially expressed genes in this leukemia group, including TCF7 which maps within the 5q31 common deleted region. Mutations of genes known to be associated with immature/early T-cell precursor acute lymphoblastic leukemia, i.e. WT1, ETV6, JAK1, JAK3, and RUNX1, were present, while CDKN2A/B deletions/mutations were never detected. All patients had relapsed/resistant disease and blasts showed an early differentiation arrest with expression of myeloid markers. Terminal 5q deletions, found in 18 of patients, were more prevalent in adults (chi-square, P=0.010) and defined a subgroup of HOXA-positive T-cell acute lymphoblastic leukemia characterized by 130 up- and 197 down-regulated genes. Down-regulated genes included TRIM41, ZFP62, MAPK9, MGAT1, and CNOT6, all mapping within the 1.4 Mb common deleted region at 5q35.3. Of interest, besides CNOT6 down-regulation, these cases also showed low BTG1 expression and a high incidence of CNOT3 mutations, suggesting that the CCR4-NOT complex plays a crucial role in the pathogenesis of HOXA-positive T-cell acute lymphoblastic leukemia with terminal 5q deletions. In conclusion, interstitial and terminal 5q deletions are recurrent genomic losses identifying distinct subtypes of T-cell acute lymphoblastic leukemia. Copyright© Ferrata Storti Foundation.

  11. A novel large deletion of the ICR1 region including H19 and putative enhancer elements.

    Science.gov (United States)

    Fryssira, Helen; Amenta, Stella; Kanber, Deniz; Sofocleous, Christalena; Lykopoulou, Evangelia; Kanaka-Gantenbein, Christina; Cerrato, Flavia; Lüdecke, Hermann-Josef; Bens, Susanne; Riccio, Andrea; Buiting, Karin

    2015-05-06

    Beckwith-Wiedemann syndrome (BWS) is a rare pediatric overgrowth disorder with a variable clinical phenotype caused by deregulation affecting imprinted genes in the chromosomal region 11p15. Alterations of the imprinting control region 1 (ICR1) at the IGF2/H19 locus resulting in biallelic expression of IGF2 and biallelic silencing of H19 account for approximately 10% of patients with BWS. The majority of these patients have epimutations of the ICR1 without detectable DNA sequence changes. Only a few patients were found to have deletions. Most of these deletions are small affecting different parts of the ICR1 differentially methylated region (ICR1-DMR) removing target sequences for CTCF. Only a very few deletions reported so far include the H19 gene in addition to the CTCF binding sites. None of these deletions include IGF2. A male patient was born with hypotonia, facial dysmorphisms and hypoglycemia suggestive of Beckwith-Wiedemann syndrome. Using methylation-specific (MS)-MLPA (Multiplex ligation-dependent probe amplification) we have identified a maternally inherited large deletion of the ICR1 region in a patient and his mother. The deletion results in a variable clinical expression with a classical BWS in the mother and a more severe presentation of BWS in her son. By genome-wide SNP array analysis the deletion was found to span ~100 kb genomic DNA including the ICR1DMR, H19, two adjacent non-imprinted genes and two of three predicted enhancer elements downstream to H19. Methylation analysis by deep bisulfite next generation sequencing revealed hypermethylation of the maternal allele at the IGF2 locus in both, mother and child, although IGF2 is not affected by the deletion. We here report on a novel large familial deletion of the ICR1 region in a BWS family. Due to the deletion of the ICR1-DMR CTCF binding cannot take place and the residual enhancer elements have access to the IGF2 promoters. The aberrant methylation (hypermethylation) of the maternal IGF2

  12. Monoamine oxidase deficiency in males with an X chromosome deletion.

    Science.gov (United States)

    Sims, K B; de la Chapelle, A; Norio, R; Sankila, E M; Hsu, Y P; Rinehart, W B; Corey, T J; Ozelius, L; Powell, J F; Bruns, G

    1989-01-01

    Mapping of the human MAOA gene to chromosomal region Xp21-p11 prompted our study of two affected males in a family previously reported to have Norrie disease resulting from a submicroscopic deletion in this chromosomal region. In this investigation we demonstrate in these cousins deletion of the MAOA gene, undetectable levels of MAO-A and MAO-B activities in their fibroblasts and platelets, respectively, loss of mRNA for MAO-A in fibroblasts, and substantial alterations in urinary catecholamine metabolites. The present study documents that a marked deficiency of MAO activity is compatible with life and that genes for MAO-A and MAO-B are near each other in this Xp chromosomal region. Some of the clinical features of these MAO deletion patients may help to identify X-linked MAO deficiency diseases in humans.

  13. Chromosome 12q24.31-q24.33 deletion causes multiple dysmorphic features and developmental delay: First mosaic patient and overview of the phenotype related to 12q24qter defects

    Directory of Open Access Journals (Sweden)

    Sakati Nadia

    2011-04-01

    Full Text Available Abstract Background Genomic imbalances of the 12q telomere are rare; only a few patients having 12q24.31-q24.33 deletions were reported. Interestingly none of these were mosaic. Although some attempts have been made to establish phenotype/genotype interaction for the deletions in this region, no clear relationship has been established to date. Results We have clinically screened more than 100 patients with dysmorphic features, mental retardation and normal karyotype using high density oligo array-CGH (aCGH and identified a ~9.2 Mb hemizygous interstitial deletion at the 12q telomere (Chromosome 12: 46,XY,del(12(q24.31q24.33 in a severely developmentally retarded patient having dysmorphic features such as low set ears, microcephaly, undescended testicles, bent elbow, kyphoscoliosis, and micropenis. Parents were found to be not carriers. MLPA experiments confirmed the aCGH result. Interphase FISH revealed mosaicism in cultured peripheral blood lymphocytes. Conclusions Since conventional G-Banding technique missed the abnormality; this work re-confirms that any child with unexplained developmental delay and systemic involvement should be studied by aCGH techniques. The FISH technique, however, would still be useful to further delineate the research work and identify such rare mosaicism. Among the 52 deleted genes, P2RX2, ULK1, FZD10, RAN, NCOR2 STX2, TESC, FBXW8, and TBX3 are noteworthy since they may have a role in observed phenotype.

  14. Exon skipping and translation in patients with frameshift deletions in the dystrophin gene

    Energy Technology Data Exchange (ETDEWEB)

    Sherratt, T.G.; Dubowitz, V.; Sewry, C.A.; Strong, P.N. (Royal Postgraduate Medical School, London (United Kingdom)); Vulliamy, T. (Hammersmith Hospital, London (United Kingdom))

    1993-11-01

    Although many Duchenne muscular dystrophy patients have a deletion in the dystrophin gene which disrupts the translational reading frame, they express dystrophin in a small proportion of skeletal muscle fibers ([open quotes]revertant fibers[close quotes]). Antibody studies have shown, indirectly, that dystrophin synthesis in revertant fibers is facilitated by a frame-restoring mechanism; in the present study, the feasibility of mRNA splicing was investigated. Dystrophin transcripts were analyzed in skeletal muscle from individuals possessing revertant fibers and a frameshift deletion in the dystrophin gene. In each case a minor in-frame transcript was detected, in which exons adjacent to those deleted from the genome had been skipped. There appeared to be some correlation between the levels of in-frame transcripts and the predicted translation products. Low levels of alternatively spliced transcripts were also present in normal muscle. The results provide further evidence of exon skipping in the dystrophin gene and indicate that this may be involved in the synthesis of dystrophin by revertant fibers. 44 refs., 12 figs.

  15. Interstitial deletion of 14q24.3-q32.2 in a male patient with plagiocephaly, BPES features, developmental delay, and congenital heart defects

    DEFF Research Database (Denmark)

    Cingöz, Sultan; Bache, Iben; Bjerglund, Lise

    2011-01-01

    Distal interstitial deletions of chromosome 14 involving the 14q24-q23.2 region are rare, and only been reported so far in 20 patients. Ten of these patients were analyzed both clinically and genetically. Here we present a de novo interstitial deletion of chromosome 14q24.3-q32.2 in a male patient...... on genotype-phenotype comparisons of the 10 previously published patients and the present case, we suggest that the shortest regions for deletion overlap may include candidate genes for speech impairment, mental retardation, and hypotonia....

  16. Detection of genomic deletions in rice using oligonucleotide microarrays

    Directory of Open Access Journals (Sweden)

    Bordeos Alicia

    2009-03-01

    Full Text Available Abstract Background The induction of genomic deletions by physical- or chemical- agents is an easy and inexpensive means to generate a genome-saturating collection of mutations. Different mutagens can be selected to ensure a mutant collection with a range of deletion sizes. This would allow identification of mutations in single genes or, alternatively, a deleted group of genes that might collectively govern a trait (e.g., quantitative trait loci, QTL. However, deletion mutants have not been widely used in functional genomics, because the mutated genes are not tagged and therefore, difficult to identify. Here, we present a microarray-based approach to identify deleted genomic regions in rice mutants selected from a large collection generated by gamma ray or fast neutron treatment. Our study focuses not only on the utility of this method for forward genetics, but also its potential as a reverse genetics tool through accumulation of hybridization data for a collection of deletion mutants harboring multiple genetic lesions. Results We demonstrate that hybridization of labeled genomic DNA directly onto the Affymetrix Rice GeneChip® allows rapid localization of deleted regions in rice mutants. Deletions ranged in size from one gene model to ~500 kb and were predicted on all 12 rice chromosomes. The utility of the technique as a tool in forward genetics was demonstrated in combination with an allelic series of mutants to rapidly narrow the genomic region, and eventually identify a candidate gene responsible for a lesion mimic phenotype. Finally, the positions of mutations in 14 mutants were aligned onto the rice pseudomolecules in a user-friendly genome browser to allow for rapid identification of untagged mutations http://irfgc.irri.org/cgi-bin/gbrowse/IR64_deletion_mutants/. Conclusion We demonstrate the utility of oligonucleotide arrays to discover deleted genes in rice. The density and distribution of deletions suggests the feasibility of a

  17. An interictal schizophrenia-like psychosis in an adult patient with 22q11.2 deletion syndrome

    OpenAIRE

    Yasutaka Tastuzawa; Kanako Sekinaka; Tetsufumi Suda; Hiroshi Matsumoto; Hiroyuki Otabe; Shigeaki Nonoyama; Aihide Yoshino

    2015-01-01

    In addition to causing polymalformative syndrome, 22q11.2 deletion can lead to various neuropsychiatric disorders including mental retardation, psychosis, and epilepsy. However, few reports regarding epilepsy-related psychosis in 22q11.2 deletion syndrome (22q11.2DS) exist. We describe the clinical characteristics and course of 22q11.2DS in a Japanese patient with comorbid mild mental retardation, childhood-onset localization-related epilepsy, and adult-onset, interictal schizophrenia-like ps...

  18. Characterization of five partial deletions of the factor VIII gene

    International Nuclear Information System (INIS)

    Youssoufian, H.; Antonarakis, S.E.; Aronis, S.; Tsiftis, G.; Phillips, D.G.; Kazazian, H.H. Jr.

    1987-01-01

    Hemophilia A is an X-linked disorder of coagulation caused by a deficiency of factor VIII. By using cloned DNA probes, the authors have characterized the following five different partial deletions of the factor VIII gene from a panel of 83 patients with hemophilia A: (i) a 7-kilobase (kb) deletion that eliminates exon 6; (ii) a 2.5-kb deletion that eliminates 5' sequences of exon 14; (iii) a deletion of at least 7 kb that eliminates exons 24 and 25; (iv) a deletion of at least 16 kb that eliminates exons 23-25; and (v) a 5.5-kb deletion that eliminates exon 22. The first four deletions are associated with severe hemophilia A. By contrast, the last deletion is associated with moderate disease, possibly because of in-frame splicing from adjacent exons. None of those patients with partial gene deletions had circulating inhibitors to factor VIII. One deletion occurred de novo in a germ cell of the maternal grandmother, while a second deletion occurred in a germ cell of the maternal grandfather. These observations demonstrate that de novo deletions of X-linked genes can occur in either male or female gametes

  19. Deletion Mutations in an Australian Series of HNPCC Patients

    Directory of Open Access Journals (Sweden)

    McPhillips Mary

    2005-11-01

    Full Text Available Abstract Hereditary non polyposis colorectal cancer (HNPCC is characterized by the presence of early onset colorectal cancer and other epithelial malignancies. The genetic basis of HNPCC is a deficiency in DNA mismatch repair, which manifests itself as DNA microsatellite instability in tumours. There are four genes involved in DNA mismatch repair that have been linked to HNPCC; these include hMSH2, hMLH1, hMSH6 and hPMS2. Of these four genes hMLH1 and hMSH2 account for the majority of families diagnosed with the disease. Notwithstanding, up to 40 percent of families do not appear to harbour a change in either hMSH2 or hMLH1 that can be detected using standard screening procedures such as direct DNA sequencing or a variety of methods all based on a heteroduplex analysis. In this report we have screened a series of 118 probands that all have the clinical diagnosis of HNPCC for medium to large deletions by the Multiplex Ligation-Dependent Probe Amplification assay (MLPA to determine the frequency of this type of mutation. The results indicate that a significant proportion of Australian HNPCC patients harbour deletion or duplication mutations primarily in hMSH2 but also in hMLH1.

  20. Deficiency of Interleukin-1 Receptor Antagonist (DIRA): Report of the First Indian Patient and a Novel Deletion Affecting IL1RN.

    Science.gov (United States)

    Mendonca, Leonardo O; Malle, Louise; Donovan, Frank X; Chandrasekharappa, Settara C; Montealegre Sanchez, Gina A; Garg, Megha; Tedgard, Ulf; Castells, Mariana; Saini, Shiv S; Dutta, Sourabh; Goldbach-Mansky, Raphaela; Suri, Deepti; Jesus, Adriana A

    2017-07-01

    Deficiency of interleukin-1 receptor antagonist (DIRA) is a rare life-threatening autoinflammatory disease caused by autosomal recessive mutations in IL1RN. DIRA presents clinically with early onset generalized pustulosis, multifocal osteomyelitis, and elevation of acute phase reactants. We evaluated and treated an antibiotic-unresponsive patient with presumed DIRA with recombinant IL-1Ra (anakinra). The patient developed anaphylaxis to anakinra and was subsequently desensitized. Genetic analysis of IL1RN was undertaken and treatment with anakinra was initiated. A 5-month-old Indian girl born to healthy non-consanguineous parents presented at the third week of life with irritability, sterile multifocal osteomyelitis including ribs and clavicles, a mild pustular rash, and elevated acute phase reactants. SNP array of the patient's genomic DNA revealed a previously unrecognized homozygous deletion of approximately 22.5 Kb. PCR and Sanger sequencing of the borders of the deleted area allowed identification of the breakpoints of the deletion, thus confirming a homozygous 22,216 bp deletion that spans the first four exons of IL1RN. Due to a clinical suspicion of DIRA, anakinra was initiated which resulted in an anaphylactic reaction that triggered desensitization with subsequent marked and sustained clinical and laboratory improvement. We report a novel DIRA-causing homozygous deletion affecting IL1RN in an Indian patient. The mutation likely is a founder mutation; the design of breakpoint-specific primers will enable genetic screening in Indian patients suspected of DIRA. The patient developed anaphylaxis to anakinra, was desensitized, and is in clinical remission on continued treatment.

  1. Deletion analysis of SMN1 and NAIP genes in southern Chinese children with spinal muscular atrophy

    Institute of Scientific and Technical Information of China (English)

    Yu-hua LIANG; Xiao-ling CHEN; Zhong-sheng YU; Chun-yue CHEN; Sheng BI; Lian-gen MAO; Bo-lin ZHOU; Xian-ning ZHANG

    2009-01-01

    Spinal muscular atrophy (SMA) is a disorder characterized by degeneration of lower motor neurons and occasionally bulbar motor neurons leading to progressive limb and trunk paralysis as well as muscular atrophy. Three types of SMA are rec-ognized depending on the age of onset, the maximum muscular activity achieved, and survivorship: SMA1, SMA2, and SMA3. The survival of motor neuron (SMN) gene has been identified as an SMA determining gene, whereas the neuronal apoptosis inhibitory protein (NAIP) gene is considered to be a modifying factor of the severity of SMA. The main objective of this study was to analyze the deletion of SMN1 and NAIP genes in southern Chinese children with SMA. Here, polymerase chain reaction (PCR) combined with restriction fragment length polymorphism (RFLP) was performed to detect the deletion of both exon 7 and exon 8 of SMNI and exon 5 of NAIP in 62 southern Chinese children with strongly suspected clinical symptoms of SMA. All the 32 SMAI patients and 76% (13/17) of SMA2 patients showed homozygous deletions for exon 7 and exon 8, and all the 13 SMA3 patients showed single deletion of SMN1 exon 7 along with 24% (4/17) of SMA2 patients. Eleven out of 32 (34%) SMA1 patients showed NAIP deletion, and none of SMA2 and SMA3 patients was found to have NAIP deletion. The findings of homozygous deletions of exon 7 and/or exon 8 of SMN1 gene confirmed the diagnosis of SMA, and suggested that the deletion of SMN1 exon 7 is a major cause of SMA in southern Chinese children, and that the NA1P gene may be a modifying factor for disease severity of SMA 1. The molecular diagnosis system based on PCR-RFLP analysis can conveniently be applied in the clinical testing, genetic counseling, prenatal diagnosis and preimplantation genetic diagnosis of SMA.

  2. Telomeric 1p36.3 deletion and Ki-67 expression in B-Non-Hodgkin's Lymphoma patients associated with chronic hepatitis C virus infection.

    Science.gov (United States)

    Mosad, E; Said Abd El-Rahman Allam, M; Moustafa, H M; Mohammed, A Eliaw; El kebeer, A M; Abdel-Moneim, S S

    2014-12-01

    The hepatitis C virus (HCV) core protein is able to accumulate genetic p53 mutations and may be considered co-oncogenic. This study investigates 1p36.3 telomere deletion in B-non-Hodgkin's lymphoma (NHL) patients with chronic HCV infection using fluorescence in situ hybridization (FISH) in relation to survival to assess Ki-67 antigen expression. A study group and a control group of 100 patients with B-NHL (50 HCV positive and 50 HCV negative) and 60 control bone marrow biopsies were subjected to FISH for the detection of 1P36.3 deletion and to immunohistochemical staining with Ki-67 antigens. 1p36.3 deletion by FISH was detected in 40% of the study group, and Ki-67 was expressed in approximately 74% of patients. A significant difference was found between positive and negative HCV patients in their overall survival, the qualitative expression of Ki-67 and the quantitative detection of 1p36.3 deletion by FISH. The overall survival was shorter with the presence of an 1p36 deletion by FISH and HCV positive. We concluded that the coexistence of Ki-67 positivity, HCV positivity and 1p36.3 deletion may contribute to infection-related cancers at the 1p36.3 locus. © 2014 John Wiley & Sons Ltd.

  3. Hypertensive Cerebral Hemorrhage in a Patient with Turner Syndrome Caused by Deletion in the Short Arm of the X Chromosome.

    Science.gov (United States)

    Hori, Yusuke S; Ohkura, Takahiro; Ebisudani, Yuki; Umakoshi, Michiari; Ishi, Masato; Oda, Kazunori; Aoi, Mizuho; Inoue, Takushi; Furujo, Mahoko; Tanaka, Hiroyuki; Fukuhara, Toru

    2018-01-01

    Turner syndrome is a chromosomal disorder usually caused by complete deletion of an X chromosome, with deletion in the short arm of the X chromosome being a rare cause of the condition. Patients with Turner syndrome commonly develop hypertension, and associated vascular complications such as aortic dissection or cerebral hemorrhage have been reported. Cerebral hemorrhage in Turner syndrome is a rare complication, and only a few reports have been published. In these reports, all patients have XO karyotypes or a mosaic type as the cause of Turner syndrome, while no other Turner syndrome types have been documented. In this report, we present for the first time a patient with Turner syndrome caused by deletion in the short arm of the X chromosome who experienced hypertensive hemorrhage as a late complication. © 2017 S. Karger AG, Basel.

  4. Identification of a two base pair deletion in five unrelated families with adrenoleukodystrophy: a possible hot spot for mutations

    NARCIS (Netherlands)

    Kemp, S.; Ligtenberg, M. J.; van Geel, B. M.; Barth, P. G.; Wolterman, R. A.; Schoute, F.; Sarde, C. O.; Mandel, J. L.; van Oost, B. A.; Bolhuis, P. A.

    1994-01-01

    The gene for X-linked adrenoleukodystrophy (ALD) was recently identified. Intragenic deletions of several kilobases were found in about 7% of patients. Point mutations, expected to be very heterogeneous, were identified so far in only two patients. We report the identification of a two base pair

  5. DNA studies are necessary for accurate patient diagnosis in compound heterozygosity for Hb Adana (HBA2:c.179>A) with deletional or nondeletional α-thalassaemia.

    Science.gov (United States)

    Tan, Jin Ai Mary Anne; Kho, Siew Leng; Ngim, Chin Fang; Chua, Kek Heng; Goh, Ai Sim; Yeoh, Seoh Leng; George, Elizabeth

    2016-06-08

    Haemoglobin (Hb) Adana (HBA2:c.179>A) interacts with deletional and nondeletional α-thalassaemia mutations to produce HbH disorders with varying clinical manifestations from asymptomatic to severe anaemia with significant hepatosplenomegaly. Hb Adana carriers are generally asymptomatic and haemoglobin subtyping is unable to detect this highly unstable α-haemoglobin variant. This study identified 13 patients with compound heterozygosity for Hb Adana with either the 3.7 kb gene deletion (-α(3.7)), Hb Constant Spring (HbCS) (HBA2:c.427T>C) or Hb Paksé (HBA2:429A>T). Multiplex Amplification Refractory Mutation System was used for the detection of five deletional and six nondeletional α-thalassaemia mutations. Duplex-PCR was used to confirm Hb Paksé and HbCS. Results showed 84.6% of the Hb Adana patients were Malays. Using DNA studies, compound heterozygosity for Hb Adana and HbCS (α(codon 59)α/α(CS)α) was confirmed in 11 patients. A novel point in this investigation was that DNA studies confirmed Hb Paksé for the first time in a Malaysian patient (α(codon 59)α/α(Paksé)α) after nine years of being misdiagnosis with Hb Adana and HbCS (α(codon 59)α/α(CS)α). Thus, the reliance on haematology studies and Hb subtyping to detect Hb variants is inadequate in countries where thalassaemia is prevalent and caused by a wide spectrum of mutations.

  6. HbA2 levels in β-thalassaemia carriers with the Filipino β0-deletion: are the levels higher than what is found with non-deletional forms of β0-thalassaemia?

    Science.gov (United States)

    George, E; Teh, Lai Kuan; Tan, Jama; Lai, Mei I; Wong, Lily

    2013-01-01

    Classical carriers of β-thalassaemia are identified by a raised HbA2 level. Earlier studies indicated that the Filipino β-deletion has high raised HbA2 levels. The introduction of automated high performance liquid chromatography (HPLC) for thalassaemia screening is an important advance in technology for haematology laboratories. The BioRad Variant II Hb analyser is a common instrument used to quantify HbA2 levels in thalassaemia screening. This study aimed to determine HbA2 levels in carriers of Filipino β-mutation using the BioRad Variant II Hb analyser. The Filipino β-deletion was identified using gap-polymerase chain reaction (PCR) in the parents of transfusion dependent β-thalassaemia patients who were homozygous for the Filipino β-deletion in the indigenous population of Sabah, Malaysia. Hb subtypes were quantified on the BioRad Variant II Hb analyser. Concurrent α-thalassaemia was identified by multiplex gap-PCR for deletions and amplification refractory mutation system (ARMS)-PCR for non-deletional mutations. The mean HbA2 level for Filipino β-thalassaemia trait was 5.9 ± 0.47 and with coinheritance of α-thalassaemia was 6.3 ± 0.44 (-α heterozygous) and 6.7 ± 0.36 (-α homozygous). The HbA2 levels were all >4% in keeping with the findings of classical β-thalassaemia trait and significantly higher than levels seen in non-deletional forms of β-thalassaemia. The HbA2 level measured on the BioRad Variant II Hb analyser was lower than the level in the first description of the Filipino β-thalassaemia. β-thalassaemia trait with coinheritance of α-thalassaemia (-α) is associated with significantly higher HbA2 level.

  7. Reduced expression of APC-1B but not APC-1A by the deletion of promoter 1B is responsible for familial adenomatous polyposis.

    Science.gov (United States)

    Yamaguchi, Kiyoshi; Nagayama, Satoshi; Shimizu, Eigo; Komura, Mitsuhiro; Yamaguchi, Rui; Shibuya, Tetsuo; Arai, Masami; Hatakeyama, Seira; Ikenoue, Tsuneo; Ueno, Masashi; Miyano, Satoru; Imoto, Seiya; Furukawa, Yoichi

    2016-05-24

    Germline mutations in the tumor suppressor gene APC are associated with familial adenomatous polyposis (FAP). Here we applied whole-genome sequencing (WGS) to the DNA of a sporadic FAP patient in which we did not find any pathological APC mutations by direct sequencing. WGS identified a promoter deletion of approximately 10 kb encompassing promoter 1B and exon1B of APC. Additional allele-specific expression analysis by deep cDNA sequencing revealed that the deletion reduced the expression of the mutated APC allele to as low as 11.2% in the total APC transcripts, suggesting that the residual mutant transcripts were driven by other promoter(s). Furthermore, cap analysis of gene expression (CAGE) demonstrated that the deleted promoter 1B region is responsible for the great majority of APC transcription in many tissues except the brain. The deletion decreased the transcripts of APC-1B to 39-45% in the patient compared to the healthy controls, but it did not decrease those of APC-1A. Different deletions including promoter 1B have been reported in FAP patients. Taken together, our results strengthen the evidence that analysis of structural variations in promoter 1B should be considered for the FAP patients whose pathological mutations are not identified by conventional direct sequencing.

  8. An interictal schizophrenia-like psychosis in an adult patient with 22q11.2 deletion syndrome

    Directory of Open Access Journals (Sweden)

    Yasutaka Tastuzawa

    2015-01-01

    Full Text Available In addition to causing polymalformative syndrome, 22q11.2 deletion can lead to various neuropsychiatric disorders including mental retardation, psychosis, and epilepsy. However, few reports regarding epilepsy-related psychosis in 22q11.2 deletion syndrome (22q11.2DS exist. We describe the clinical characteristics and course of 22q11.2DS in a Japanese patient with comorbid mild mental retardation, childhood-onset localization-related epilepsy, and adult-onset, interictal schizophrenia-like psychosis. From a diagnostic viewpoint, early detection of impaired intellectual functioning and hyperprolinemia in patients with epilepsy with 22q11.2DS may be helpful in predicting the developmental timing of interictal psychosis. From a therapeutic viewpoint, special attention needs to be paid to phenytoin-induced hypocalcemia in this syndrome.

  9. Ocular Findings in Children With 22q11.2 Deletion Syndrome.

    Science.gov (United States)

    Gokturk, Bahar; Topcu-Yilmaz, Pinar; Bozkurt, Banu; Yildirim, Mahmut Selman; Guner, Sukru Nail; Sayar, Esra Hazar; Reisli, Ismail

    2016-07-01

    To identify the ocular features of children diagnosed as having 22q11.2 deletion syndrome in a Turkish population, which is the most common microdeletion syndrome with a wide range of facial and ocular abnormalities. Sixteen children aged between 4 months and 18 years with a microdeletion in chromosome 22q11.2 underwent a detailed ophthalmological examination including uncorrected and best corrected visual acuity testing, stereoscopic vision examination, biomicroscopic and indirect fundus examination, and ocular motility testing. All patients had at least one ocular abnormality. The major abnormalities were eyelid abnormalities (eye hooding, narrow palpebral fissure, telecanthus, hypertelorism, sparse and thin eyebrows and eyelashes, blepharitis, and distichiasis), posterior embryotoxon, and tortuous retinal vessels in at least half of the patients. Other ophthalmological disorders were refractive errors, iris remnants, and strabismus. The chromosome 22q11.2 deletion syndrome is associated with a wide range of ocular disorders, which necessitates a comprehensive eye examination for appropriate treatment and follow-up. Ocular findings sometimes can provide a clue to the diagnosis of 22q11.2 deletion. [J Pediatr Ophthalmol Strabismus. 2016;53(4):218-222]. Copyright 2016, SLACK Incorporated.

  10. Clinical variability of Waardenburg-Shah syndrome in patients with proximal 13q deletion syndrome including the endothelin-B receptor locus.

    Science.gov (United States)

    Tüysüz, Beyhan; Collin, Anna; Arapoğlu, Müjde; Suyugül, Nezir

    2009-10-01

    Waardenburg-Shah syndrome (Waardenburg syndrome type IV-WS4) is an auditory-pigmentary disorder that combines clinical features of pigmentary abnormalities of the skin, hair and irides, sensorineural hearing loss, and Hirschsprung disease (HSCR). Mutations in the endothelin-B receptor (EDNRB) gene on 13q22 have been found to cause this syndrome. Mutations in both alleles cause the full phenotype, while heterozygous mutations cause isolated HSCR or HSCR with minor pigmentary anomalies and/or sensorineural deafness. We investigated the status of the EDNRB gene, by FISH analysis, in three patients with de novo proximal 13q deletions detected at cytogenetic analysis and examined the clinical variability of WS4 among these patients. Chromosome 13q was screened with locus specific FISH probes and breakpoints were determined at 13q22.1q31.3 in Patients 1 and 3, and at 13q21.1q31.3 in Patient 2. An EDNRB specific FISH probe was deleted in all three patients. All patients had common facial features seen in proximal 13q deletion syndrome and mild mental retardation. However, findings related to WS4 were variable; Patient 1 had hypopigmentation of the irides and HSCR, Patient 2 had prominent bicolored irides and mild bilateral hearing loss, and Patient 3 had only mild unilateral hearing loss. These data contribute new insights into the pathogenesis of WS4.

  11. APC promoter 1B deletion in seven American families with familial adenomatous polyposis.

    Science.gov (United States)

    Snow, A K; Tuohy, T M F; Sargent, N R; Smith, L J; Burt, R W; Neklason, D W

    2015-10-01

    Familial adenomatous polyposis (FAP) is a colorectal cancer predisposition syndrome caused by mutations in the adenomatous polyposis coli (APC) gene. Clinical genetic testing fails to identify disease causing mutations in up to 20% of clinically apparent FAP cases. Following the inclusion of multiplex ligation-dependent probe amplification (MLPA) probes specific for APC promoter 1B, seven probands were identified with a deletion of promoter 1B. Using haplotype analysis spanning the APC locus, the seven families appear to be identical by descent from a common founder. The clinical phenotype of 19 mutation carriers is classical FAP with colectomy at an average age of 24. The majority of cases had a large number of duodenal and gastric polyps. Measurements of allele-specific expression of APC mRNA using TaqMan assay confirmed that relative expression in the allele containing the promoter 1B deletion was reduced 42-98%, depending on tissue type. This study confirms the importance of APC promoter deletions as a cause of FAP and identifies a founder mutation in FAP patients from the United States. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  12. Deletion/duplication mutation screening of TP53 gene in patients with transitional cell carcinoma of urinary bladder using multiplex ligation-dependent probe amplification.

    Science.gov (United States)

    Bazrafshani, Mohammad Reza R; Nowshadi, Pouriaali A; Shirian, Sadegh; Daneshbod, Yahya; Nabipour, Fatemeh; Mokhtari, Maral; Hosseini, Fatemehsadat; Dehghan, Somayeh; Saeedzadeh, Abolfazl; Mosayebi, Ziba

    2016-02-01

    Bladder cancer is a molecular disease driven by the accumulation of genetic, epigenetic, and environmental factors. The aim of this study was to detect the deletions/duplication mutations in TP53 gene exons using multiplex ligation-dependent probe amplification (MLPA) method in the patients with transitional cell carcinoma (TCC). The achieved formalin-fixed paraffin-embedded tissues from 60 patients with TCC of bladder were screened for exonal deletions or duplications of every 12 TP53 gene exons using MLPA. The pathological sections were examined by three pathologists and categorized according to the WHO scoring guideline as 18 (30%) grade I, 22 (37%) grade II, 13 (22%) grade III, and 7 (11%) grade IV cases of TCC. None mutation changes of TP53 gene were detected in 24 (40%) of the patients. Furthermore, mutation changes including, 15 (25%) deletion, 17 (28%) duplication, and 4 (7%) both deletion and duplication cases were observed among 60 samples. From 12 exons of TP53 gene, exon 1 was more subjected to exonal deletion. Deletion of exon 1 of TP53 gene has occurred in 11 (35.4%) patients with TCC. In general, most mutations of TP53, either deletion or duplication, were found in exon 1, which was statistically significant. In addition, no relation between the TCC tumor grade and any type of mutation were observed in this research. MLPA is a simple and efficient method to analyze genomic deletions and duplications of all 12 exons of TP53 gene. The finding of this report that most of the mutations of TP53 occur in exon 1 is in contrast to that of the other reports suggesting that exons 5-8 are the most (frequently) mutated exons of TP53 gene. The mutations of exon 1 of TP53 gene may play an important role in the tumorogenesis of TCC. © 2015 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  13. Interleukin 3 gene is located on human chromosome 5 and is deleted in myeloid leukemias with a deletion of 5q

    International Nuclear Information System (INIS)

    Le Beau, M.M.; Epstein, N.D.; O'Brien, S.J.; Nienhuis, A.W.; Yang, Y.C.; Clark, S.C.; Rowley, J.D.

    1987-01-01

    The gene IL-3 encodes interleukin 3, a hematopoietic colony-stimulating factor (CSF) that is capable of supporting the proliferation of a broad range of hematopoietic cell types. By using somatic cell hybrids and in situ chromosomal hybridization, the authors localized this gene to human chromosome 5 at bands q23-31, a chromosomal region that is frequently deleted [del(5q)] in patients with myeloid disorders. By in situ hybridization, IL-3 was found to be deleted in the 5q-chromosome of one patient with refractory anemia who had a del(5)(q15q33.3), of three patients with refractory anemia (two patients) or acute nonlymphocytic leukemia (ANLL) de novo who had a similar distal breakpoint [del(5)(q13q33.3)], and of a fifth patient, with therapy-related ANLL, who had a similar distal breakpoint in band q33[del(5)(q14q33.3)]. Southern blot analysis of somatic cell hybrids retaining the normal or the deleted chromosome 5 from two patients with the refractory anemia 5q- syndrome indicated that IL-3 sequences were absent from the hybrids retaining the deleted chromosome 5 but not from hybrids that had a cytologically normal chromosome 5. Thus, a small segment of chromosome 5 contains IL-3, GM-CSF, CSF-1, and FMS. The findings and earlier results indicating that GM-CSF, CSF-1, and FMS were deleted in the 5q- chromosome, suggest that loss of IL-3 or of other CSF genes may play an important role in the pathogenesis of hematologic disorders associated with a del(5q)

  14. Novel large-range mitochondrial DNA deletions and fatal multisystemic disorder with prominent hepatopathy

    International Nuclear Information System (INIS)

    Bianchi, Marzia; Rizza, Teresa; Verrigni, Daniela; Martinelli, Diego; Tozzi, Giulia; Torraco, Alessandra; Piemonte, Fiorella; Dionisi-Vici, Carlo; Nobili, Valerio; Francalanci, Paola; Boldrini, Renata; Callea, Francesco; Santorelli, Filippo Maria; Bertini, Enrico

    2011-01-01

    Highlights: ► Expanded array of mtDNA deletions. ► Pearson syndrome with prominent hepatopathy associated with single mtDNA deletions. ► Detection of deletions in fibroblasts and blood avoids muscle and liver biopsy. ► Look for mtDNA deletions before to study nuclear genes related to mtDNA depletion. -- Abstract: Hepatic involvement in mitochondrial cytopathies rarely manifests in adulthood, but is a common feature in children. Multiple OXPHOS enzyme defects in children with liver involvement are often associated with dramatically reduced amounts of mtDNA. We investigated two novel large scale deletions in two infants with a multisystem disorder and prominent hepatopathy. Amount of mtDNA deletions and protein content were measured in different post-mortem tissues. The highest levels of deleted mtDNA were in liver, kidney, pancreas of both patients. Moreover, mtDNA deletions were detected in cultured skin fibroblasts in both patients and in blood of one during life. Biochemical analysis showed impairment of mainly complex I enzyme activity. Patients manifesting multisystem disorders in childhood may harbour rare mtDNA deletions in multiple tissues. For these patients, less invasive blood specimens or cultured fibroblasts can be used for molecular diagnosis. Our data further expand the array of deletions in the mitochondrial genomes in association with liver failure. Thus analysis of mtDNA should be considered in the diagnosis of childhood-onset hepatopathies.

  15. Deletion at the GCNT2 Locus Causes Autosomal Recessive Congenital Cataracts.

    Science.gov (United States)

    Irum, Bushra; Khan, Shahid Y; Ali, Muhammad; Daud, Muhammad; Kabir, Firoz; Rauf, Bushra; Fatima, Fareeha; Iqbal, Hira; Khan, Arif O; Al Obaisi, Saif; Naeem, Muhammad Asif; Nasir, Idrees A; Khan, Shaheen N; Husnain, Tayyab; Riazuddin, Sheikh; Akram, Javed; Eghrari, Allen O; Riazuddin, S Amer

    2016-01-01

    The aim of this study is to identify the molecular basis of autosomal recessive congenital cataracts (arCC) in a large consanguineous pedigree. All participating individuals underwent a detailed ophthalmic examination. Each patient's medical history, particularly of cataracts and other ocular abnormalities, was compiled from available medical records and interviews with family elders. Blood samples were donated by all participating family members and used to extract genomic DNA. Genetic analysis was performed to rule out linkage to known arCC loci and genes. Whole-exome sequencing libraries were prepared and paired-end sequenced. A large deletion was found that segregated with arCC in the family, and chromosome walking was conducted to estimate the proximal and distal boundaries of the deletion mutation. Exclusion and linkage analysis suggested linkage to a region of chromosome 6p24 harboring GCNT2 (glucosaminyl (N-acetyl) transferase 2) with a two-point logarithm of odds score of 5.78. PCR amplifications of the coding exons of GCNT2 failed in individuals with arCC, and whole-exome data analysis revealed a large deletion on chromosome 6p in the region harboring GCNT2. Chromosomal walking using multiple primer pairs delineated the extent of the deletion to approximately 190 kb. Interestingly, a failure to amplify a junctional fragment of the deletion break strongly suggests an insertion in addition to the large deletion. Here, we report a novel insertion/deletion mutation at the GCNT2 locus that is responsible for congenital cataracts in a large consanguineous family.

  16. Failure to thrive as primary feature in two patients with subtle chromosomal aneuploidy: Interstitial deletion 2q33

    Energy Technology Data Exchange (ETDEWEB)

    Grace, K.; Mulla, W.; Stump, T. [Children`s Hospital of Philadelpha, PA (United States)] [and others

    1994-09-01

    It is well known that patients with chromosomal aneuploidy present with multiple congenital anomalies and dysmorphia, and that they may have associated failure to thrive. However, rarely is failure to thrive the predominant presenting feature. We report two such patients. Patient 1 had a marked history of failure to thrive, (weight 50% for 5 1/2 months at 20 months, length 50% for 15 months at 20 months). Patient 2 was noted to be growth retarded at 2 months upon presenting to the hospital with respiratory symptoms (weight 50% for a newborn, length 50% for 36 weeks gestation). There was relative head sparing in both patients. Chromosome analysis in patient 1, prompted by a negative work-up for the failure to thrive, and emerging evidence of developmental delay, revealed a 46,XY,del(2)(q32.2q33) karyotype. Chromosome analysis in patient 2, done as part of a complete workup for the failure to thrive, revealed a 46,XX,del(2)(q33.2q33.2 or q33.2q33.3) karyotype. On careful examination, subtle dysmorphic features were seen. In both patients these included a long flat philtrum, thin upper lip and high arched palate. Patient 1 also had a small posterior cleft of the palate. These patients have the smallest interstitial deletions of chromosome 2 so far reported. Their deletions overlap within 2q33 although they are not identical. Review of the literature reveals 15 patients with interstitial deletions which include 2q33. Marked growth retardation is reported in 14 of these cases. Cleft palate/abnormal uvula were frequently associated. These cases illustrate the need to include high resolution chromosomal studies as part of a complete work-up for unexplained failure to thrive.

  17. Contiguous gene deletion of chromosome 2p16.3-p21 as a cause of Lynch syndrome.

    Science.gov (United States)

    Salo-Mullen, Erin E; Lynn, Patricio B; Wang, Lu; Walsh, Michael; Gopalan, Anuradha; Shia, Jinru; Tran, Christina; Man, Fung Ying; McBride, Sean; Schattner, Mark; Zhang, Liying; Weiser, Martin R; Stadler, Zsofia K

    2018-01-01

    Lynch syndrome is an autosomal dominant condition caused by pathogenic mutations in the DNA mismatch repair (MMR) genes. Although commonly associated with clinical features such as intellectual disability and congenital anomalies, contiguous gene deletions may also result in cancer predisposition syndromes. We report on a 52-year-old male with Lynch syndrome caused by deletion of chromosome 2p16.3-p21. The patient had intellectual disability and presented with a prostatic adenocarcinoma with an incidentally identified synchronous sigmoid adenocarcinoma that exhibited deficient MMR with an absence of MSH2 and MSH6 protein expression. Family history was unrevealing. Physical exam revealed short stature, brachycephaly with a narrow forehead and short philtrum, brachydactyly of the hands, palmar transverse crease, broad and small feet with hyperpigmentation of the soles. The patient underwent total colectomy with ileorectal anastomosis for a pT3N1 sigmoid adenocarcinoma. Germline genetic testing of the MSH2, MSH6, and EPCAM genes revealed full gene deletions. SNP-array based DNA copy number analysis identified a deletion of 4.8 Mb at 2p16.3-p21. In addition to the three Lynch syndrome associated genes, the deleted chromosomal section encompassed genes including NRXN1, CRIPT, CALM2, FBXO11, LHCGR, MCFD2, TTC7A, EPAS1, PRKCE, and 15 others. Contiguous gene deletions have been described in other inherited cancer predisposition syndromes, such as Familial Adenomatous Polyposis. Our report and review of the literature suggests that contiguous gene deletion within the 2p16-p21 chromosomal region is a rare cause of Lynch syndrome, but presents with distinct phenotypic features, highlighting the need for recognition and awareness of this syndromic entity.

  18. Contiguous 22.1-kb deletion embracing AVPR2 and ARHGAP4 genes at novel breakpoints leads to nephrogenic diabetes insipidus in a Chinese pedigree.

    Science.gov (United States)

    Bai, Ying; Chen, Yibing; Kong, Xiangdong

    2018-02-02

    It has been reported that mutations in arginine vasopressin type 2 receptor (AVPR2) cause congenital X-linked nephrogenic diabetes insipidus (NDI). However, only a few cases of AVPR2 deletion have been documented in China. An NDI pedigree was included in this study, including the proband and his mother. All NDI patients had polyuria, polydipsia, and growth retardation. PCR mapping, long range PCR and sanger sequencing were used to identify genetic causes of NDI. A novel 22,110 bp deletion comprising AVPR2 and ARH4GAP4 genes was identified by PCR mapping, long range PCR and sanger sequencing. The deletion happened perhaps due to the 4-bp homologous sequence (TTTT) at the junctions of both 5' and 3' breakpoints. The gross deletion co-segregates with NDI. After analyzing available data of putative clinical signs of AVPR2 and ARH4GAP4 deletion, we reconsider the potential role of AVPR2 deletion in short stature. We identified a novel 22.1-kb deletion leading to X-linked NDI in a Chinese pedigree, which would increase the current knowledge in AVPR2 mutation.

  19. Novel large-range mitochondrial DNA deletions and fatal multisystemic disorder with prominent hepatopathy

    Energy Technology Data Exchange (ETDEWEB)

    Bianchi, Marzia; Rizza, Teresa; Verrigni, Daniela [Unit of Molecular Medicine for Neuromuscular and Neurodegenerative Diseases, ' Bambino Gesu' Children' s Hospital, Rome (Italy); Martinelli, Diego [Division of Metabolism, ' Bambino Gesu' Children' s Hospital, Rome (Italy); Tozzi, Giulia; Torraco, Alessandra; Piemonte, Fiorella [Unit of Molecular Medicine for Neuromuscular and Neurodegenerative Diseases, ' Bambino Gesu' Children' s Hospital, Rome (Italy); Dionisi-Vici, Carlo [Division of Metabolism, ' Bambino Gesu' Children' s Hospital, Rome (Italy); Nobili, Valerio [Gastroenterology and Liver Unit, ' Bambino Gesu' Children' s Hospital, Rome (Italy); Francalanci, Paola; Boldrini, Renata; Callea, Francesco [Dept. Pathology, ' Bambino Gesu' Children' s Hospital, Rome (Italy); Santorelli, Filippo Maria [UOC Neurogenetica e Malattie Neuromuscolari, Fondazione Stella Maris, Pisa (Italy); Bertini, Enrico [Unit of Molecular Medicine for Neuromuscular and Neurodegenerative Diseases, ' Bambino Gesu' Children' s Hospital, Rome (Italy); and others

    2011-11-18

    Highlights: Black-Right-Pointing-Pointer Expanded array of mtDNA deletions. Black-Right-Pointing-Pointer Pearson syndrome with prominent hepatopathy associated with single mtDNA deletions. Black-Right-Pointing-Pointer Detection of deletions in fibroblasts and blood avoids muscle and liver biopsy. Black-Right-Pointing-Pointer Look for mtDNA deletions before to study nuclear genes related to mtDNA depletion. -- Abstract: Hepatic involvement in mitochondrial cytopathies rarely manifests in adulthood, but is a common feature in children. Multiple OXPHOS enzyme defects in children with liver involvement are often associated with dramatically reduced amounts of mtDNA. We investigated two novel large scale deletions in two infants with a multisystem disorder and prominent hepatopathy. Amount of mtDNA deletions and protein content were measured in different post-mortem tissues. The highest levels of deleted mtDNA were in liver, kidney, pancreas of both patients. Moreover, mtDNA deletions were detected in cultured skin fibroblasts in both patients and in blood of one during life. Biochemical analysis showed impairment of mainly complex I enzyme activity. Patients manifesting multisystem disorders in childhood may harbour rare mtDNA deletions in multiple tissues. For these patients, less invasive blood specimens or cultured fibroblasts can be used for molecular diagnosis. Our data further expand the array of deletions in the mitochondrial genomes in association with liver failure. Thus analysis of mtDNA should be considered in the diagnosis of childhood-onset hepatopathies.

  20. Pathological mechanisms underlying single large‐scale mitochondrial DNA deletions

    Science.gov (United States)

    Rocha, Mariana C.; Rosa, Hannah S.; Grady, John P.; Blakely, Emma L.; He, Langping; Romain, Nadine; Haller, Ronald G.; Newman, Jane; McFarland, Robert; Ng, Yi Shiau; Gorman, Grainne S.; Schaefer, Andrew M.; Tuppen, Helen A.; Taylor, Robert W.

    2018-01-01

    Objective Single, large‐scale deletions in mitochondrial DNA (mtDNA) are a common cause of mitochondrial disease. This study aimed to investigate the relationship between the genetic defect and molecular phenotype to improve understanding of pathogenic mechanisms associated with single, large‐scale mtDNA deletions in skeletal muscle. Methods We investigated 23 muscle biopsies taken from adult patients (6 males/17 females with a mean age of 43 years) with characterized single, large‐scale mtDNA deletions. Mitochondrial respiratory chain deficiency in skeletal muscle biopsies was quantified by immunoreactivity levels for complex I and complex IV proteins. Single muscle fibers with varying degrees of deficiency were selected from 6 patient biopsies for determination of mtDNA deletion level and copy number by quantitative polymerase chain reaction. Results We have defined 3 “classes” of single, large‐scale deletion with distinct patterns of mitochondrial deficiency, determined by the size and location of the deletion. Single fiber analyses showed that fibers with greater respiratory chain deficiency harbored higher levels of mtDNA deletion with an increase in total mtDNA copy number. For the first time, we have demonstrated that threshold levels for complex I and complex IV deficiency differ based on deletion class. Interpretation Combining genetic and immunofluorescent assays, we conclude that thresholds for complex I and complex IV deficiency are modulated by the deletion of complex‐specific protein‐encoding genes. Furthermore, removal of mt‐tRNA genes impacts specific complexes only at high deletion levels, when complex‐specific protein‐encoding genes remain. These novel findings provide valuable insight into the pathogenic mechanisms associated with these mutations. Ann Neurol 2018;83:115–130 PMID:29283441

  1. Allogeneic stem cell transplant in patients with chronic lymphocytic leukemia with 17p deletion: consult-transplant versus consult- no-transplant analysis.

    Science.gov (United States)

    Poon, Michelle L; Fox, Patricia S; Samuels, Barry I; O'Brien, Susan; Jabbour, Elias; Hsu, Yvonne; Gulbis, Alison; Korbling, Martin; Champlin, Richard; Abruzzo, Lynne V; Bassett, Roland L; Khouri, Issa F

    2015-03-01

    Allogeneic stem cell transplant (alloSCT) can overcome the adverse prognosis of chronic lymphocytic leukemia with 17p deletion (17p- CLL). However, its applicability remains unclear. Since 2007, our leukemia service has referred patients with 17p- CLL for alloSCT at presentation. In this study, the outcomes of these patients were reviewed retrospectively to determine whether they underwent alloSCT and why patients did not undergo alloSCT. Fifty-two patients with 17p- CLL who were referred to the transplant service from 2007 to 2010 were identified. Of these patients, 32 (62%) did not undergo alloSCT, mainly because of treatment- or disease-related complications (n = 15). The 2-year post-referral overall survival rates of the alloSCT and non-SCT groups were 64% and 25%, respectively (p = 0.001). These findings suggest that while alloSCT is an effective therapy in patients with 17p- CLL, pre-SCT complications may preclude a significant proportion of patients from undergoing the procedure.

  2. A recurrent deletion syndrome at chromosome bands 2p11.2-2p12 flanked by segmental duplications at the breakpoints and including REEP1.

    Science.gov (United States)

    Stevens, Servi J C; Blom, Eveline W; Siegelaer, Ingrid T J; Smeets, Eric E J G L

    2015-04-01

    We identified an identical and recurrent 9.4-Mbp deletion at chromosome bands 2p11.2-2p12, which occurred de novo in two unrelated patients. It is flanked at the distal and proximal breakpoints by two homologous segmental duplications consisting of low copy repeat (LCR) blocks in direct orientation, which have >99% sequence identity. Despite the fact that the deletion was almost 10 Mbp in size, the patients showed a relatively mild clinical phenotype, that is, mild-to-moderate intellectual disability, a happy disposition, speech delay and delayed motor development. Their phenotype matches with that of previously described patients. The 2p11.2-2p12 deletion includes the REEP1 gene that is associated with spastic paraplegia and phenotypic features related to this are apparent in most 2p11.2-2p12 deletion patients, but not in all. Other hemizygous genes that may contribute to the clinical phenotype include LRRTM1 and CTNNA2. We propose a recurrent but rare 2p11.2-2p12 deletion syndrome based on (1) the identical, non-random localisation of the de novo deletion breakpoints in two unrelated patients and a patient from literature, (2) the patients' phenotypic similarity and their phenotypic overlap with other 2p deletions and (3) the presence of highly identical LCR blocks flanking both breakpoints, consistent with a non-allelic homologous recombination (NAHR)-mediated rearrangement.

  3. A strong deletion bias in nonallelic gene conversion.

    Directory of Open Access Journals (Sweden)

    Raquel Assis

    Full Text Available Gene conversion is the unidirectional transfer of genetic information between orthologous (allelic or paralogous (nonallelic genomic segments. Though a number of studies have examined nucleotide replacements, little is known about length difference mutations produced by gene conversion. Here, we investigate insertions and deletions produced by nonallelic gene conversion in 338 Drosophila and 10,149 primate paralogs. Using a direct phylogenetic approach, we identify 179 insertions and 614 deletions in Drosophila paralogs, and 132 insertions and 455 deletions in primate paralogs. Thus, nonallelic gene conversion is strongly deletion-biased in both lineages, with almost 3.5 times as many conversion-induced deletions as insertions. In primates, the deletion bias is considerably stronger for long indels and, in both lineages, the per-site rate of gene conversion is orders of magnitudes higher than that of ordinary mutation. Due to this high rate, deletion-biased nonallelic gene conversion plays a key role in genome size evolution, leading to the cooperative shrinkage and eventual disappearance of selectively neutral paralogs.

  4. Do mtDNA Deletions Play a Role in the Development of Nasal Polyposis?

    Directory of Open Access Journals (Sweden)

    Arzu Tatar

    2014-04-01

    Full Text Available Objective:Nasal polyposis (NP is an inflammatory disease of the nasal mucosa and paranasal sinuses. Mitochondria are the cellular organelles which produce cellular energy by Oxidative Phosphorylation (OXPHOS, and they have own inheritance material, mtDNA. mtDNA is affected by reactive oxygen samples (ROS which are produced by both OXPHOS and the inflammatory process. The aim of this study was to investigate the 4977 bp and 7400 bp deletions of mtDNA in nasal polyposis tissue, and to indicate the possible association of mtDNA deletions with NP. Methods:Thirty-three patients, aged 15 to 65 years, with nasal polyposis were selected to be assessed for mitochondrial DNA deletions. The patients with possible mtDNA mutations due to mitochondrial disease, being treated with radiotherapy, of advanced age, with a familiar history, aspirin hypersensitivity, or a history of asthma, were excluded. Polyp excision surgery was applied to the treatment of the NP, and after histopathological diagnosis 1x1 cm of polyp tissue samples were used to isolate mtDNA. The 4977 bp and 7400 bp deletion regions, and two control regions of mtDNA were assessed by using four pairs of primers. DNA extractions from the NP tissues and peripheral blood samples of the patients were made, and then Polymerase Chain Reactions (PCR were made. PCR products were separated in 2% agarose gel.Results:No patient had either the 4977 bp deletion or the 7400 bp deletion in their NP tissue, and neither were these deletions evident in their peripheral blood. Two control sequences, one of them from a non-deleted region, and the other from a possible deletion region, were detected in the NP tissues and peripheral blood of all the patients.Conclusions:We had anticipated that some mtDNA deletion might have occurred in NP tissue due to the increased ROS levels caused by chronic inflammation, but we did not detect any deletion. Probably, the duration of inflammation in NP is insufficient to form mt

  5. Outcome of patients treated for myelodysplastic syndromes without deletion 5q after failure of lenalidomide therapy

    OpenAIRE

    Prebet, Thomas; Toma, Andrea; Cluzeau, Thomas; Sekeres, Mikkael A.; Vey, Norbert; Park, Sophie; Al Ali, Najla; Sugrue, Marie M.; Komrokji, Rami; Fenaux, Pierre; Gore, Steven D.

    2017-01-01

    Anemia is a key survival prognostic factor in lower-risk myelodysplastic syndromes (MDS). Lenalidomide (LEN) can correct anemia in 25% of MDS patients without deletion 5q (del5q). As this therapy will inevitably fail, understanding the outcome of these patients will facilitate development of subsequent treatment strategies. To answer this question, an international retrospective study focused on LEN-treated lower-risk, non-del5q, MDS patients was performed. We analyzed the overall survival af...

  6. Deletion of MAOA and MAOB in a male patient causes severe developmental delay, intermittent hypotonia and stereotypical hand movements

    OpenAIRE

    Whibley, Annabel; Urquhart, Jill; Dore, Jonathan; Willatt, Lionel; Parkin, Georgina; Gaunt, Lorraine; Black, Graeme; Donnai, Dian; Raymond, F Lucy

    2010-01-01

    Monoamine oxidases (MAO-A and MAO-B) have a key role in the degradation of amine neurotransmitters, such as dopamine, norepinephrine and serotonin. We identified an inherited 240 kb deletion on Xp11.3–p11.4, which encompasses both monoamine oxidase genes but, unlike other published reports, does not affect the adjacent Norrie disease gene (NDP). The brothers who inherited the deletion, and thus have no monoamine oxidase function, presented with severe developmental delay, intermittent hypoton...

  7. Association of BIM Deletion Polymorphism and BIM-γ RNA Expression in NSCLC with EGFR Mutation.

    Science.gov (United States)

    Isobe, Kazutoshi; Kakimoto, Atsushi; Mikami, Tetsuo; Kaburaki, Kyohei; Kobayashi, Hiroshi; Yoshizawa, Takahiro; Makino, Takashi; Otsuka, Hajime; Sano, G O; Sugino, Keishi; Sakamoto, Susumu; Takai, Yujiro; Tochigi, Naobumi; Iyoda, Akira; Homma, Sakae

    This pilot study assessed the association of BIM deletion polymorphism and BIM RNA isoform in patients with EGFR-positive non-small cell lung cancer (NSCLC). The study included 33 patients with EGFR-positive NSCLC treated with gefitinib. BIM deletion polymorphism and BIM RNA isoform (EL/L/S/γ) were determined by polymerase chain reaction (PCR). BIM-γ expression was significantly higher in patients with BIM deletion polymorphism than among those without BIM deletion polymorphism inside tumors (p=0.038) and around tumors (p=0.0024). Relative BIM-γ expression was significantly higher in patients with BIM deletion polymorphism than among those without BIM deletion polymorphism (p=0.0017). Patients with BIM-γ had significantly shorter progression-free survival than those without BIM-γ (median: 304 vs. 732 days; p=0.023). Expression of BIM-γ mRNA and BIM deletion polymorphism were strongly associated. BIM-γ overexpression may have a role in apoptosis related to EGFR-tyrosine kinase inhibitor. Copyright© 2016, International Institute of Anticancer Research (Dr. John G. Delinasios), All rights reserved.

  8. Identification of a new DPY19L2 mutation and a better definition of DPY19L2 deletion breakpoints leading to globozoospermia.

    Science.gov (United States)

    Ghédir, Houda; Ibala-Romdhane, Samira; Okutman, Ozlem; Viot, Géraldine; Saad, Ali; Viville, Stéphane

    2016-01-01

    The purpose of this study was to analyze DPY19L2 sequence variants to investigate the mechanism leading to the entire DPY19L2 deletion in a large cohort of infertile globozoospermic patients. An improved analysis of the DPY19L2 deletion breakpoints (BPs) allowed us to identify two BPs located in a small 1 kb region and to more precisely localize the BPs reported previously. Three genes [spermatogenesis associated 16 (SPATA16), protein interacting with PRKCA (PICK1) and DPY19L2] were previously correlated with globozoospermia, but a homozygous deletion of the entire DPY19L2 was identified as the most frequent alteration causing this phenotype. In addition, several point mutations in this gene were reported. In previous work, we have identified nine BPs for the DPY19L2 deletion clustered in two hotspot regions, while others reported a total of five BPs. We screened for the DPY19L2 deletion and for mutations in the DPY19L2, SPATA16 and PICK1 genes in a cohort of 21 Tunisian globozoospermic patients. In order to characterize the DPY19L2 deletion BPs, we sequenced a 2 kb fragment on low copy repeat (LCR) 1 and LCR2 in Tunisian fertile controls to distinguish between single-nucleotide polymorphisms (SNPs) and LCR-specific markers. Molecular analyses performed on 18 genetically independent individuals showed that 11 (61.1%) were homozygous for the DPY19L2 deletion, 2 (11.1%) were homozygous for the non-synonymous mutation (p.R298C) in exon 8, 1 patient (5.6%) was homozygous for a new splice-site mutation at the junction exon-intron 16 [c.1579_1580+4delAGGTAAinsTCAT] and no DPY19L2, SPATA16 or PICK1 mutations were identified for 4 patients (22.2%). By defining 15 specific LCR markers, we characterized 2 BPs for the DPY19L2 deletion in 11 patients showing the homozygous deletion. Using 20 non-LCR-specific SNPs, we identified 8 distinct haplotypes. A limitation of this study is the small number of patients owing to the rarity of this form of male infertility. Our data showed

  9. ABCA7 frameshift deletion associated with Alzheimer disease in African Americans

    Science.gov (United States)

    Cukier, Holly N.; Kunkle, Brian W.; Vardarajan, Badri N.; Rolati, Sophie; Hamilton-Nelson, Kara L.; Kohli, Martin A.; Whitehead, Patrice L.; Dombroski, Beth A.; Van Booven, Derek; Lang, Rosalyn; Dykxhoorn, Derek M.; Farrer, Lindsay A.; Cuccaro, Michael L.; Vance, Jeffery M.; Gilbert, John R.; Beecham, Gary W.; Martin, Eden R.; Carney, Regina M.; Mayeux, Richard; Schellenberg, Gerard D.; Byrd, Goldie S.; Haines, Jonathan L.

    2016-01-01

    Objective: To identify a causative variant(s) that may contribute to Alzheimer disease (AD) in African Americans (AA) in the ATP-binding cassette, subfamily A (ABC1), member 7 (ABCA7) gene, a known risk factor for late-onset AD. Methods: Custom capture sequencing was performed on ∼150 kb encompassing ABCA7 in 40 AA cases and 37 AA controls carrying the AA risk allele (rs115550680). Association testing was performed for an ABCA7 deletion identified in large AA data sets (discovery n = 1,068; replication n = 1,749) and whole exome sequencing of Caribbean Hispanic (CH) AD families. Results: A 44-base pair deletion (rs142076058) was identified in all 77 risk genotype carriers, which shows that the deletion is in high linkage disequilibrium with the risk allele. The deletion was assessed in a large data set (531 cases and 527 controls) and, after adjustments for age, sex, and APOE status, was significantly associated with disease (p = 0.0002, odds ratio [OR] = 2.13 [95% confidence interval (CI): 1.42–3.20]). An independent data set replicated the association (447 cases and 880 controls, p = 0.0117, OR = 1.65 [95% CI: 1.12–2.44]), and joint analysis increased the significance (p = 1.414 × 10−5, OR = 1.81 [95% CI: 1.38–2.37]). The deletion is common in AA cases (15.2%) and AA controls (9.74%), but in only 0.12% of our non-Hispanic white cohort. Whole exome sequencing of multiplex, CH families identified the deletion cosegregating with disease in a large sibship. The deleted allele produces a stable, detectable RNA strand and is predicted to result in a frameshift mutation (p.Arg578Alafs) that could interfere with protein function. Conclusions: This common ABCA7 deletion could represent an ethnic-specific pathogenic alteration in AD. PMID:27231719

  10. Outcome of patients treated for myelodysplastic syndromes with 5q deletion after failure of lenalidomide therapy

    OpenAIRE

    Prebet, Thomas; Cluzeau, Thomas; Park, Sophie; Sekeres, Mikkael A.; Germing, Ulrich; Ades, Lionel; Platzbecker, Uwe; Gotze, Katharina; Vey, Norbert; Oliva, Esther; Sugrue, Mary M.; Bally, Cecile; Kelaidi, Charikleia; Al Ali, Najla; Fenaux, Pierre

    2017-01-01

    While lenalidomide (LEN) is the standard of care for the lower-risk myelodysplastic syndromes (MDS) patients with deletion 5q, 35% will not respond to or do not tolerate the drug. Moreover, most of the patients will lose their response after a few years. Defining the outcome of patients with LEN failure and determining the impact of subsequent therapies is therefore important to develop alternative strategies. Based on an international collaboration, we were able to compile a total of 392 pat...

  11. A 590 kb deletion caused by non-allelic homologous recombination between two LINE-1 elements in a patient with mesomelia-synostosis syndrome.

    Science.gov (United States)

    Kohmoto, Tomohiro; Naruto, Takuya; Watanabe, Miki; Fujita, Yuji; Ujiro, Sae; Okamoto, Nana; Horikawa, Hideaki; Masuda, Kiyoshi; Imoto, Issei

    2017-04-01

    Mesomelia-synostoses syndrome (MSS) is a rare, autosomal-dominant, syndromal osteochondrodysplasia characterized by mesomelic limb shortening, acral synostoses, and multiple congenital malformations due to a non-recurrent deletion at 8q13 that always encompasses two coding-genes, SULF1 and SLCO5A1. To date, five unrelated patients have been reported worldwide, and MMS was previously proposed to not be a genomic disorder associated with deletions recurring from non-allelic homologous recombination (NAHR) in at least two analyzed cases. We conducted targeted gene panel sequencing and subsequent array-based copy number analysis in an 11-year-old undiagnosed Japanese female patient with multiple congenital anomalies that included mesomelic limb shortening and detected a novel 590 Kb deletion at 8q13 encompassing the same gene set as reported previously, resulting in the diagnosis of MSS. Breakpoint sequences of the deleted region in our case demonstrated the first LINE-1s (L1s)-mediated unequal NAHR event utilizing two distant L1 elements as homology substrates in this disease, which may represent a novel causative mechanism of the 8q13 deletion, expanding the range of mechanisms involved in the chromosomal rearrangements responsible for MSS. © 2017 Wiley Periodicals, Inc.

  12. Deletion Analysis Of The Duchenne/Becker Muscular Dystrophy Gene Using Multiplex Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Dastur P

    2004-01-01

    Full Text Available The diagnosis of Duchenna Muscular Dystrophy (DMD and Becker Muscular Dystorphy (BMD is mainly based on clinical profile, serum CPK values, muscle biopsy and immunostaining for dystrophin. This was done in 100 unrelated patients using 19 exons including the promoter region in two sets of multiplex polymerase chain reaction (PCR. These primers amplify most of the exons in the deletion prone ′hot spot′ regions allowing determinations of deletion end points. Intragenic deletions were detected in 74 patients indicating that the use of PCR- based assays will allow deletion detection help in prenatal diagnosis for most of the DMD/BMD patients. The frequency of deletions observed in the present study was 74%.

  13. Recurrent deletion of ZNF630 at Xp11.23 is not associated with mental retardation

    DEFF Research Database (Denmark)

    Lugtenberg, Dorien; Zangrande-Vieira, Luiz; Kirchhoff, Maria

    2010-01-01

    that the deletions resulted from non-allelic homologous recombination. In 2,121 healthy male controls, 10 ZNF630 deletions were identified. In total, there was a 1.6-fold higher frequency of this deletion in males with mental retardation as compared to controls, but this increase was not statistically significant (P......ZNF630 is a member of the primate-specific Xp11 zinc finger gene cluster that consists of six closely related genes, of which ZNF41, ZNF81, and ZNF674 have been shown to be involved in mental retardation. This suggests that mutations of ZNF630 might influence cognitive function. Here, we detected...... 12 ZNF630 deletions in a total of 1,562 male patients with mental retardation from Brazil, USA, Australia, and Europe. The breakpoints were analyzed in 10 families, and in all cases they were located within two segmental duplications that share more than 99% sequence identity, indicating...

  14. A Novel 3670-Base Pair Mitochondrial DNA Deletion Resulting in Multi-systemic Manifestations in a Child

    Directory of Open Access Journals (Sweden)

    Hsin-Ming Liu

    2012-08-01

    Full Text Available Mitochondrial DNA (mtDNA deletion is a rare occurrence that results in defects to oxidative phosphorylation. The common clinical presentations of mtDNA deletion vary but include mitochondrial myopathy, Pearson syndrome, Kearns-Sayre syndrome, and progressive external ophthalmoplegia. Here, we report the case of a 10-year-old boy who presented with progressive deterioration of his clinical status (which included hypoglycemia, short stature, sensorineural hearing loss, retinitis pigmentosa, and chronic gastrointestinal dysmotility that progressed to acute deterioration with pancreatitis, Fanconi syndrome, lactic acidosis, and acute encephalopathy. Following treatment, the patient was stabilized and his neurological condition improved. Through a combination of histological examinations and biochemical and molecular analyses, mitochondrial disease was confirmed. A novel 3670-base pair deletion (deletion of mtDNA nt 7,628-11,297 was identified in the muscle tissue. A direct repeat of CTACT at the breakpoints was also detected.

  15. Chassis organism from Corynebacterium glutamicum--a top-down approach to identify and delete irrelevant gene clusters.

    Science.gov (United States)

    Unthan, Simon; Baumgart, Meike; Radek, Andreas; Herbst, Marius; Siebert, Daniel; Brühl, Natalie; Bartsch, Anna; Bott, Michael; Wiechert, Wolfgang; Marin, Kay; Hans, Stephan; Krämer, Reinhard; Seibold, Gerd; Frunzke, Julia; Kalinowski, Jörn; Rückert, Christian; Wendisch, Volker F; Noack, Stephan

    2015-02-01

    For synthetic biology applications, a robust structural basis is required, which can be constructed either from scratch or in a top-down approach starting from any existing organism. In this study, we initiated the top-down construction of a chassis organism from Corynebacterium glutamicum ATCC 13032, aiming for the relevant gene set to maintain its fast growth on defined medium. We evaluated each native gene for its essentiality considering expression levels, phylogenetic conservation, and knockout data. Based on this classification, we determined 41 gene clusters ranging from 3.7 to 49.7 kbp as target sites for deletion. 36 deletions were successful and 10 genome-reduced strains showed impaired growth rates, indicating that genes were hit, which are relevant to maintain biological fitness at wild-type level. In contrast, 26 deleted clusters were found to include exclusively irrelevant genes for growth on defined medium. A combinatory deletion of all irrelevant gene clusters would, in a prophage-free strain, decrease the size of the native genome by about 722 kbp (22%) to 2561 kbp. Finally, five combinatory deletions of irrelevant gene clusters were investigated. The study introduces the novel concept of relevant genes and demonstrates general strategies to construct a chassis suitable for biotechnological application. © 2014 The Authors. Biotechnology Journal published by Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim. This is an open access article under the terms of the Creative Commons Attribution-Non-Commercial-NoDerivs Licence, which permits use and distribution in any medium, provided the original work is properly cited, the use is non- commercial and no modifications or adaptations are made.

  16. Angiotensin Converting Enzyme Gene Insertion/Deletion Polymorphism in Migraine Patients

    Directory of Open Access Journals (Sweden)

    Belgin Alaşehirli

    2009-12-01

    Full Text Available OBJECTIVE: The beneficial effects of angiotensin converting enzyme inhibitor drugs on migraine attack frequency have been shown. We aimed to study the relationship between the angiotensin converting enzyme gene and migraine pathophysiology. METHODS: In the present study, to assess whether the angiotensin converting enzyme insertion/deletion (I/D gene polymorphisms have an effect on migraine attacks, we studied the angiotensin converting enzyme genotypes of 102 migraine patients (35 cases of migraine with aura and 67 of migraine without aura and 75 age-and sex-matched normal volunteers. Frequency and age of onset of migraine attacks were also assessed according to angiotensin converting enzyme genotypes. RESULTS: Patients with migraine with and without aura were comparable with each other and the control group with respect to angiotensin converting enzyme genotypes (respectively; p= 0.88 and p= 0.76, p= 0.624. We could not determine a relationship between angiotensin converting enzyme genotypes and attack frequency (p= 0.125, but cases with angiotensin converting enzyme-II genotype showed a significantly younger age for onset of migraine attacks in comparison with the I/D genotype patients (p= 0.021. CONCLUSION: We believe that further angiotensin converting enzyme gene studies are warranted in younger age groups of patients with migraine and also in different populations

  17. 6q deletion detected by fluorescence in situ hybridization using bacterial artificial chromosome in chronic lymphocytic leukemia.

    Science.gov (United States)

    Dalsass, Alessia; Mestichelli, Francesca; Ruggieri, Miriana; Gaspari, Paola; Pezzoni, Valerio; Vagnoni, Davide; Angelini, Mario; Angelini, Stefano; Bigazzi, Catia; Falcioni, Sadia; Troiani, Emanuela; Alesiani, Francesco; Catarini, Massimo; Attolico, Immacolata; Scortechini, Ilaria; Discepoli, Giancarlo; Galieni, Piero

    2013-07-01

    Deletions of the long arm of chromosome 6 are known to occur at relatively low frequency (3-6%) in chronic lymphocytic leukemia (CLL), and they are more frequently observed in 6q21. Few data have been reported regarding other bands on 6q involved by cytogenetic alterations in CLL. The cytogenetic study was performed in nuclei and metaphases obtained after stimulation with a combination of CpG-oligonucleotide DSP30 and interleukin-2. Four bacterial artificial chromosome (BAC) clones mapping regions in bands 6q16, 6q23, 6q25, 6q27 were used as probes for fluorescence in situ hybridization in 107 CLL cases in order to analyze the occurrence and localization of 6q aberrations. We identified 11 cases (10.2%) with 6q deletion of 107 patients studied with CLL. The trends of survival curves and the treatment-free intervals (TFI) of patients with deletion suggest a better outcome than the other cytogenetic risk groups. We observed two subgroups with 6q deletion as the sole anomaly: two cases with 6q16 deletion, and three cases with 6q25.2-27 deletion. There were differences of age, stage, and TFI between both subgroups. By using BAC probes, we observed that 6q deletion has a higher frequency in CLL and is linked with a good prognosis. In addition, it was observed that the deletion in 6q16 appears to be the most frequent and, if present as the only abnormality, it could be associated with a most widespread disease. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  18. Molecular dissection of a contiguous gene syndrome: Frequent submicroscopic deletions, evolutionarily conserved sequences, and a hypomethylated island in the Miller-Dieker chromosome region

    International Nuclear Information System (INIS)

    Ledbetter, D.H.; Ledbetter, S.A.; vanTuinen, P.

    1989-01-01

    The Miller-Dieker syndrome (MDS), composed of characteristic facial abnormalities and a severe neuronal migration disorder affecting the cerebral cortex, is caused by visible or submicroscopic deletions of chromosome band 17p13. Twelve anonymous DNA markers were tested against a panel of somatic cell hybrids containing 17p deletions from seven MDS patients. All patients, including three with normal karyotypes, are deleted for a variable set of 5-12 markers. Two highly polymorphic VNTR (variable number of tandem repeats) probes, YNZ22 and YNH37, are codeleted in all patients tested and make molecular diagnosis for this disorder feasible. By pulsed-field gel electrophoresis, YNZ22 and YNH37 were shown to be within 30 kilobases (kb) of each other. Cosmid clones containing both VNTR sequences were identified, and restriction mapping showed them to be 100 kb were completely deleted in all patients, providing a minimum estimate of the size of the MDS critical region. A hypomethylated island and evolutionarily conserved sequences were identified within this 100-kb region, indications of the presence of one or more expressed sequences potentially involved in the pathophysiology of this disorder. The conserved sequences were mapped to mouse chromosome 11 by using mouse-rat somatic cell hybrids, extending the remarkable homology between human chromosome 17 and mouse chromosome 11 by 30 centimorgans, into the 17p telomere region

  19. Fast detection of deletion breakpoints using quantitative PCR

    Directory of Open Access Journals (Sweden)

    Gulshara Abildinova

    2016-01-01

    Full Text Available Abstract The routine detection of large and medium copy number variants (CNVs is well established. Hemizygotic deletions or duplications in the large Duchenne muscular dystrophy DMD gene responsible for Duchenne and Becker muscular dystrophies are routinely identified using multiple ligation probe amplification and array-based comparative genomic hybridization. These methods only map deleted or duplicated exons, without providing the exact location of breakpoints. Commonly used methods for the detection of CNV breakpoints include long-range PCR and primer walking, their success being limited by the deletion size, GC content and presence of DNA repeats. Here, we present a strategy for detecting the breakpoints of medium and large CNVs regardless of their size. The hemizygous deletion of exons 45-50 in the DMD gene and the large autosomal heterozygous PARK2 deletion were used to demonstrate the workflow that relies on real-time quantitative PCR to narrow down the deletion region and Sanger sequencing for breakpoint confirmation. The strategy is fast, reliable and cost-efficient, making it amenable to widespread use in genetic laboratories.

  20. Heart defects and other features of the 22q11 distal deletion syndrome

    DEFF Research Database (Denmark)

    Fagerberg, Christina Ringmann; Graakjaer, Jesper; Heinl, Ulrike D

    2013-01-01

    patients with 22q11 distal deletions, of whom two have complex congenital heart malformation, thus broadening the phenotypic spectrum. We compare cardiac malformations reported in 22q11 distal deletion to those reported in the common 22q11 deletion syndrome. We also review the literature for patients...... with 22q11 distal deletions, and discuss the possible roles of haploinsufficiency of the MAPK1 gene. We find the most frequent features in 22q11 distal deletion to be developmental delay or learning disability, short stature, microcephalus, premature birth with low birth weight, and congenital heart...... malformation ranging from minor anomalies to complex malformations. Behavioral problems are also seen in a substantial portion of patients. The following dysmorphic features are relatively common: smooth philtrum, abnormally structured ears, cleft palate/bifid uvula, micro-/retrognathia, upslanting palpebral...

  1. A novel deletion in the thyrotropin Beta-subunit gene identified by array comparative genomic hybridization analysis causes central congenital hypothyroidism in a boy originating from Turkey.

    Science.gov (United States)

    Hermanns, Pia; Couch, Robert; Leonard, Norma; Klotz, Cherise; Pohlenz, Joachim

    2014-01-01

    Isolated central congenital hypothyroidism (ICCH) is rare but important. Most ICCH patients are diagnosed later, which results in severe growth failure and intellectual disability. We describe a boy with ICCH due to a large homozygous TSHβ gene deletion. A 51-day-old male Turkish infant, whose parents were first cousins, was admitted for evaluation of prolonged jaundice. His clinical appearance was compatible with hypothyroidism. Venous thyrotropin (TSH) was undetectably low, with a subsequent low free T4 and a low free T3, suggestive of central hypothyroidism. Using different PCR protocols, we could not amplify both coding exons of the boy's TSHβ gene, which suggested a deletion. An array comparative genomic hybridization (aCGH) using specific probes around the TSHβ gene locus showed him to be homozygous for a 6-kb deletion spanning all exons and parts of the 5' untranslated region of the gene. Infants who are clinically suspected of having hypothyroidism should be evaluated thoroughly, even if their TSH-based screening result is normal. In cases with ICCH and undetectably low TSH serum concentrations, a TSHβ gene deletion should be considered; aCGH should be performed when gene deletions are suspected. In such cases, PCR-based sequencing techniques give negative results.

  2. Cognitive decline preceding the onset of psychosis in patients with 22q11.2 deletion syndrome

    NARCIS (Netherlands)

    Vorstman, Jacob A S; Breetvelt, Elemi J.; Duijff, Sasja N.; Eliez, Stephan; Schneider, Maude; Jalbrzikowski, Maria; Armando, Marco; Vicari, Stefano; Shashi, Vandana; Hooper, Stephen R.; Chow, Eva W C; Fung, Wai Lun Alan; Butcher, Nancy J.; Young, Donald A.; McDonald-McGinn, Donna M.; Vogels, Annick; Van Amelsvoort, Therese; Gothelf, Doron; Weinberger, Ronnie; Weizman, Abraham; Klaassen, Petra W J; Koops, Sanne; Kates, Wendy R.; Antshel, Kevin M.; Simon, Tony J.; Ousley, Opal Y.; Swillen, Ann; Gur, Raquel E.; Bearden, Carrie E.; Kahn, René S.; Bassett, Anne S.; Emanuel, Beverly S.; Zackai, Elaine H.; Kushan, Leila; Fremont, Wanda; Schoch, Kelly; Stoddard, Joel; Cubells, Joseph; Fu, Fiona; Campbell, Linda E.; Fritsch, Rosemarie; Vergaelen, Elfi; Neeleman, Marjolein; Boot, Erik; Debbané, Martin; Philip, Nicole; Green, Tamar; Van DenBree, Marianne B M; Murphy, Declan; Canyelles, Jaume Morey; Arango, Celso; Murphy, Kieran C.; Pontillo, Maria

    2015-01-01

    Importance: Patients with 22q11.2 deletion syndrome (22q11DS) have an elevated (25%) risk of developing schizophrenia. Recent reports have suggested that a subgroup of children with 22q11DS display a substantial decline in cognitive abilities starting at a young age.Objective: To determine whether

  3. Rare human diseases: 9p deletion syndrome

    Directory of Open Access Journals (Sweden)

    Galagan V.O.

    2014-09-01

    Full Text Available Objective of the study was to review the anamnesis, pheno - and genotype in patients with rare chromosome disorders such as 9p deletion syndrome. Genetic methods of investigation (clinical and genealogical, cytogenetic, FISH- method, paraclinical and instrumental methods of examination were used. Karyotyping was performed by the G-method of differential staining of chromosomes. Only three cases of pathology were diagnosed in the Medical Genetics Center over the last 10 years. By anamnesis data nobody in the probands’ families had bad habits, was exposed to occupational hazards, took part in the elimination of the Chernobyl accident or lived in contaminated areas. Clinical signs of diseases have not been identified in probands’ parents. All probands had trigonocephaly, bilateral epicanthal folds, ocular hypertelorism, downslanting palpebral fissures, long philtrum, flat face and nasal bridge, low set ears with malformed auricles. Two patients of three ones had exophthalmos, contracture of the second and third fingers, abnormal external genitalia. In all three cases there was monosomy of chromosome 9 of critical segment p 24. Normal karyotypes were seen in all parents, so there were three cases of new mutations of 9p deletion syndrome. Retardation of physical, psycho-spech, mental development in proband with or without congenital anomalies requires medical genetic counseling in a specialized institution. Cases of reproductive loss in anamnesis require cytogenetic investigation of fetal membranes and amniotic fluid.

  4. The mitochondrial ND1 m.3337G>A mutation associated to multiple mitochondrial DNA deletions in a patient with Wolfram syndrome and cardiomyopathy

    Energy Technology Data Exchange (ETDEWEB)

    Mezghani, Najla [Laboratoire de Genetique Moleculaire Humaine, Faculte de Medecine de Sfax, Universite de Sfax (Tunisia); Mnif, Mouna [Service d' endocrinologie, C.H.U. Habib Bourguiba de Sfax (Tunisia); Mkaouar-Rebai, Emna, E-mail: emna_mkaouar@mail2world.com [Laboratoire de Genetique Moleculaire Humaine, Faculte de Medecine de Sfax, Universite de Sfax (Tunisia); Kallel, Nozha [Service d' endocrinologie, C.H.U. Habib Bourguiba de Sfax (Tunisia); Salem, Ikhlass Haj [Laboratoire de Genetique Moleculaire Humaine, Faculte de Medecine de Sfax, Universite de Sfax (Tunisia); Charfi, Nadia; Abid, Mohamed [Service d' endocrinologie, C.H.U. Habib Bourguiba de Sfax (Tunisia); Fakhfakh, Faiza [Laboratoire de Genetique Moleculaire Humaine, Faculte de Medecine de Sfax, Universite de Sfax (Tunisia)

    2011-07-29

    Highlights: {yields} We reported a patient with Wolfram syndrome and dilated cardiomyopathy. {yields} We detected the ND1 mitochondrial m.3337G>A mutation in 3 tested tissues (blood leukocytes, buccal mucosa and skeletal muscle). {yields} Long-range PCR amplification revealed the presence of multiple mitochondrial deletions in the skeletal muscle. {yields} The deletions remove several tRNA and protein-coding genes. -- Abstract: Wolfram syndrome (WFS) is a rare hereditary disorder also known as DIDMOAD (diabetes insipidus, diabetes mellitus, optic atrophy, and deafness). It is a heterogeneous disease and full characterization of all clinical and biological features of this disorder is difficult. The wide spectrum of clinical expression, affecting several organs and tissues, and the similarity in phenotype between patients with Wolfram syndrome and those with certain types of respiratory chain diseases suggests mitochondrial DNA (mtDNA) involvement in Wolfram syndrome patients. We report a Tunisian patient with clinical features of moderate Wolfram syndrome including diabetes, dilated cardiomyopathy and neurological complications. The results showed the presence of the mitochondrial ND1 m.3337G>A mutation in almost homoplasmic form in 3 tested tissues of the proband (blood leukocytes, buccal mucosa and skeletal muscle). In addition, the long-range PCR amplifications revealed the presence of multiple deletions of the mitochondrial DNA extracted from the patient's skeletal muscle removing several tRNA and protein-coding genes. Our study reported a Tunisian patient with clinical features of moderate Wolfram syndrome associated with cardiomyopathy, in whom we detected the ND1 m.3337G>A mutation with mitochondrial multiple deletions.

  5. The mitochondrial ND1 m.3337G>A mutation associated to multiple mitochondrial DNA deletions in a patient with Wolfram syndrome and cardiomyopathy

    International Nuclear Information System (INIS)

    Mezghani, Najla; Mnif, Mouna; Mkaouar-Rebai, Emna; Kallel, Nozha; Salem, Ikhlass Haj; Charfi, Nadia; Abid, Mohamed; Fakhfakh, Faiza

    2011-01-01

    Highlights: → We reported a patient with Wolfram syndrome and dilated cardiomyopathy. → We detected the ND1 mitochondrial m.3337G>A mutation in 3 tested tissues (blood leukocytes, buccal mucosa and skeletal muscle). → Long-range PCR amplification revealed the presence of multiple mitochondrial deletions in the skeletal muscle. → The deletions remove several tRNA and protein-coding genes. -- Abstract: Wolfram syndrome (WFS) is a rare hereditary disorder also known as DIDMOAD (diabetes insipidus, diabetes mellitus, optic atrophy, and deafness). It is a heterogeneous disease and full characterization of all clinical and biological features of this disorder is difficult. The wide spectrum of clinical expression, affecting several organs and tissues, and the similarity in phenotype between patients with Wolfram syndrome and those with certain types of respiratory chain diseases suggests mitochondrial DNA (mtDNA) involvement in Wolfram syndrome patients. We report a Tunisian patient with clinical features of moderate Wolfram syndrome including diabetes, dilated cardiomyopathy and neurological complications. The results showed the presence of the mitochondrial ND1 m.3337G>A mutation in almost homoplasmic form in 3 tested tissues of the proband (blood leukocytes, buccal mucosa and skeletal muscle). In addition, the long-range PCR amplifications revealed the presence of multiple deletions of the mitochondrial DNA extracted from the patient's skeletal muscle removing several tRNA and protein-coding genes. Our study reported a Tunisian patient with clinical features of moderate Wolfram syndrome associated with cardiomyopathy, in whom we detected the ND1 m.3337G>A mutation with mitochondrial multiple deletions.

  6. Detection of three-base deletion by exciplex formation with perylene derivatives.

    Science.gov (United States)

    Kashida, Hiromu; Kondo, Nobuyo; Sekiguchi, Koji; Asanuma, Hiroyuki

    2011-06-14

    Here, we synthesized fluorescent DNA probes labeled with two perylene derivatives for the detection of a three-base deletion mutant. One such probe discriminated the three-base deletion mutant from the wild-type sequence by exciplex emission, and the deletion mutant was identifiable even by the naked eye. This journal is © The Royal Society of Chemistry 2011

  7. Association between the SMN2 gene copy number and clinical characteristics of patients with spinal muscular atrophy with homozygous deletion of exon 7 of the SMN1 gene

    Directory of Open Access Journals (Sweden)

    Žarkov Marija

    2015-01-01

    Full Text Available Background/Aim. Spinal muscular atrophy (SMA is an autosomal recessive disease characterized by degeneration of alpha motor neurons in the spinal cord and the medulla oblongata, causing progressive muscle weakness and atrophy. The aim of this study was to determine association between the SMN2 gene copy number and disease phenotype in Serbian patients with SMA with homozygous deletion of exon 7 of the SMN1 gene. Methods. The patients were identified using regional Serbian hospital databases. Investigated clinical characteristics of the disease were: patients’ gender, age at disease onset, achieved and current developmental milestones, disease duration, current age, and the presence of the spinal deformities and joint contractures. The number of SMN1 and SMN2 gene copies was determined using real-time polymerase chain reaction (PCR. Results. Among 43 identified patients, 37 (86.0% showed homozygous deletion of SMN1 exon 7. One (2.7% of 37 patients had SMA type I with 3 SMN2 copies, 11 (29.7% patients had SMA type II with 3.1 ± 0.7 copies, 17 (45.9% patients had SMA type III with 3.7 ± 0.9 copies, while 8 (21.6% patients had SMA type IV with 4.2 ± 0.9 copies. There was a progressive increase in the SMN2 gene copy number from type II towards type IV (p < 0.05. A higher SMN2 gene copy number was associated with better current motor performance (p < 0.05. Conclusion. In the Serbian patients with SMA, a higher SMN2 gene copy number correlated with less severe disease phenotype. A possible effect of other phenotype modifiers should not be neglected.

  8. Early-onset seizures due to mosaic exonic deletions of CDKL5 in a male and two females.

    Science.gov (United States)

    Bartnik, Magdalena; Derwińska, Katarzyna; Gos, Monika; Obersztyn, Ewa; Kołodziejska, Katarzyna E; Erez, Ayelet; Szpecht-Potocka, Agnieszka; Fang, Ping; Terczyńska, Iwona; Mierzewska, Hanna; Lohr, Naomi J; Bellus, Gary A; Reimschisel, Tyler; Bocian, Ewa; Mazurczak, Tadeusz; Cheung, Sau Wai; Stankiewicz, Paweł

    2011-05-01

    Mutations in the CDKL5 gene have been associated with an X-linked dominant early infantile epileptic encephalopathy-2. The clinical presentation is usually of severe encephalopathy with refractory seizures and Rett syndrome (RTT)-like phenotype. We attempted to assess the role of mosaic intragenic copy number variation in CDKL5. We have used comparative genomic hybridization with a custom-designed clinical oligonucleotide array targeting exons of selected disease and candidate genes, including CDKL5. We have identified mosaic exonic deletions of CDKL5 in one male and two females with developmental delay and medically intractable seizures. These three mosaic changes represent 60% of all deletions detected in 12,000 patients analyzed by array comparative genomic hybridization and involving the exonic portion of CDKL5. We report the first case of an exonic deletion of CDKL5 in a male and emphasize the importance of underappreciated mosaic exonic copy number variation in patients with early-onset seizures and RTT-like features of both genders.

  9. IKZF1 deletion is associated with a poor outcome in pediatric B-cell precursor acute lymphoblastic leukemia in Japan

    International Nuclear Information System (INIS)

    Asai, Daisuke; Imamura, Toshihiko; Suenobu, So-ichi; Saito, Akiko; Hasegawa, Daiichiro; Deguchi, Takao; Hashii, Yoshiko; Matsumoto, Kimikazu; Kawasaki, Hirohide; Hori, Hiroki; Iguchi, Akihiro; Kosaka, Yoshiyuki; Kato, Koji; Horibe, Keizo; Yumura-Yagi, Keiko; Hara, Junichi; Oda, Megumi

    2013-01-01

    Genetic alterations of Ikaros family zinc finger protein 1 (IKZF1), point mutations in Janus kinase 2 (JAK2), and overexpression of cytokine receptor-like factor 2 (CRLF2) were recently reported to be associated with poor outcomes in pediatric B-cell precursor (BCP)-ALL. Herein, we conducted genetic analyses of IKZF1 deletion, point mutation of JAK2 exon 16, 17, and 21, CRLF2 expression, the presence of P2RY8-CRLF2 fusion and F232C mutation in CRLF2 in 202 pediatric BCP-ALL patients newly diagnosed and registered in Japan Childhood Leukemia Study ALL02 protocol to find out if alterations in these genes are determinants of poor outcome. All patients showed good response to initial prednisolone (PSL) treatment. Ph + , infantile, and Down syndrome–associated ALL were excluded. Deletion of IKZF1 occurred in 19/202 patients (9.4%) and CRLF2 overexpression occurred in 16/107 (15.0%), which are similar to previous reports. Patients with IKZF1 deletion had reduced event-free survival (EFS) and overall survival (OS) compared to those in patients without IKZF1 deletion (5-year EFS, 62.7% vs. 88.8%, 5-year OS, 71.8% vs. 90.2%). Our data also showed significantly inferior 5-year EFS (48.6% vs. 84.7%, log rank P = 0.0003) and 5-year OS (62.3% vs. 85.4%, log rank P = 0.009) in NCI-HR patients (n = 97). JAK2 mutations and P2RY8-CRLF2 fusion were rarely detected. IKZF1 deletion was identified as adverse prognostic factor even in pediatric BCP-ALL in NCI-HR showing good response to PSL

  10. Penetrance and clinical consequences of a gross SDHB deletion in a large family.

    Science.gov (United States)

    Solis, D C; Burnichon, N; Timmers, H J L M; Raygada, M J; Kozupa, A; Merino, M J; Makey, D; Adams, K T; Venisse, A; Gimenez-Roqueplo, A-P; Pacak, K

    2009-04-01

    Mutations in the gene encoding subunit B of the mitochondrial enzyme succinate dehydrogenase (SDHB) are inherited in an autosomal dominant manner and are associated with hereditary paraganglioma (PGL) and pheochromocytoma. The phenotype of patients with SDHB point mutations has been previously described. However, the phenotype and penetrance of gross SDHB deletions have not been well characterized as they are rarely described. The objective was to describe the phenotype and estimate the penetrance of an exon 1 large SDHB deletion in one kindred. A retrospective and prospective study of 41 relatives across five generations was carried out. The main outcome measures were genetic testing, clinical presentations, plasma catecholamines and their O-methylated metabolites. Of the 41 mutation carriers identified, 11 were diagnosed with PGL, 12 were found to be healthy carriers after evaluation, and 18 were reportedly healthy based on family history accounts. The penetrance of PGL related to the exon 1 large SDHB deletion in this family was estimated to be 35% by age 40. Variable expressivity of the phenotype associated with a large exon 1 SDHB deletion was observed, including low penetrance, diverse primary PGL tumor locations, and malignant potential.

  11. Deletion Analysis Of The Duchenne/Becker Muscular Dystrophy Gene Using Multiplex Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Dastur R

    2003-01-01

    Full Text Available The diagnosis of Duchenne Muscular Dystrophy (DMD and Becker Muscular Dystrophy (BMD is mainly based on clinical profile, serum CPK values, muscle biopsy and immunostaining for dystrophin. Most recent and accurate method for diagnosing DMD/BMD is by detection of mutations in the DMD gene. This was done in 100 unrelated patients using 19 exons including the promoter region in two sets of multiplex polymerase chain reaction (PCR. These primers amplify most of the exons in the deletion prone ′hotspot′ regions allowing determination of deletion end point. Intragenic deletions were detected in 74 patients indicating that the use of PCR-based assays will allow deletion detection help in prenatal diagnosis for most of the DMD/BMD patients. The frequency of deletions observed in the present study was 74%.

  12. Deletions at the SOX10 gene locus cause Waardenburg syndrome types 2 and 4.

    Science.gov (United States)

    Bondurand, Nadege; Dastot-Le Moal, Florence; Stanchina, Laure; Collot, Nathalie; Baral, Viviane; Marlin, Sandrine; Attie-Bitach, Tania; Giurgea, Irina; Skopinski, Laurent; Reardon, William; Toutain, Annick; Sarda, Pierre; Echaieb, Anis; Lackmy-Port-Lis, Marilyn; Touraine, Renaud; Amiel, Jeanne; Goossens, Michel; Pingault, Veronique

    2007-12-01

    Waardenburg syndrome (WS) is an auditory-pigmentary disorder that exhibits varying combinations of sensorineural hearing loss and abnormal pigmentation of the hair and skin. Depending on additional symptoms, WS is classified into four subtypes, WS1-WS4. Absence of additional features characterizes WS2. The association of facial dysmorphic features defines WS1 and WS3, whereas the association with Hirschsprung disease (aganglionic megacolon) characterizes WS4, also called "Waardenburg-Hirschsprung disease." Mutations within the genes MITF and SNAI2 have been identified in WS2, whereas mutations of EDN3, EDNRB, and SOX10 have been observed in patients with WS4. However, not all cases are explained at the molecular level, which raises the possibility that other genes are involved or that some mutations within the known genes are not detected by commonly used genotyping methods. We used a combination of semiquantitative fluorescent multiplex polymerase chain reaction and fluorescent in situ hybridization to search for SOX10 heterozygous deletions. We describe the first characterization of SOX10 deletions in patients presenting with WS4. We also found SOX10 deletions in WS2 cases, making SOX10 a new gene of WS2. Interestingly, neurological phenotypes reminiscent of that observed in WS4 (PCWH syndrome [peripheral demyelinating neuropathy, central dysmyelinating leukodystrophy, WS, and Hirschsprung disease]) were observed in some WS2-affected patients with SOX10 deletions. This study further characterizes the molecular complexity and the close relationship that links the different subtypes of WS.

  13. Analysis of colorectal cancers in British Bangladeshi identifies early onset, frequent mucinous histotype and a high prevalence of RBFOX1 deletion

    Directory of Open Access Journals (Sweden)

    Sengupta Neel

    2013-01-01

    Full Text Available Abstract Background Prevalence of colorectal cancer (CRC in the British Bangladeshi population (BAN is low compared to British Caucasians (CAU. Genetic background may influence mutations and disease features. Methods We characterized the clinicopathological features of BAN CRCs and interrogated their genomes using mutation profiling and high-density single nucleotide polymorphism (SNP arrays and compared findings to CAU CRCs. Results Age of onset of BAN CRC was significantly lower than for CAU patients (p=3.0 x 10-5 and this difference was not due to Lynch syndrome or the polyposis syndromes. KRAS mutations in BAN microsatellite stable (MSS CRCs were comparatively rare (5.4% compared to CAU MSS CRCs (25%; p=0.04, which correlates with the high percentage of mucinous histotype observed (31% in the BAN samples. No BRAF mutations was seen in our BAN MSS CRCs (CAU CRCs, 12%; p=0.08. Array data revealed similar patterns of gains (chromosome 7 and 8q, losses (8p, 17p and 18q and LOH (4q, 17p and 18q in BAN and CAU CRCs. A small deletion on chromosome 16p13.2 involving the alternative splicing factor RBFOX1 only was found in significantly more BAN (50% than CAU CRCs (15% cases (p=0.04. Focal deletions targeting the 5’ end of the gene were also identified. Novel RBFOX1 mutations were found in CRC cell lines and tumours; mRNA and protein expression was reduced in tumours. Conclusions KRAS mutations were rare in BAN MSS CRC and a mucinous histotype common. Loss of RBFOX1 may explain the anomalous splicing activity associated with CRC.

  14. Novel 31.2 kb α0 Deletion in a Palestinian Family with α-Thalassemia

    DEFF Research Database (Denmark)

    Brieghel, Christian; Birgens, Henrik; Frederiksen, Henrik

    2015-01-01

    A previously unknown α(0) deletion, designated - -(DANE), was found in three generations of a Danish family of Palestinian origin. Six patients were heterozygous and three patients had deletional Hb H (β4) disease with a compound heterozygosity for the common -α(3.7) (rightward) deletion. Multipl...

  15. Mapping genomic deletions down to the base

    DEFF Research Database (Denmark)

    Dunø, Morten; Hove, Hanne; Kirchhoff, Maria

    2004-01-01

    the breakpoint of the third patient was mapped to a region previously predicted to be prone for rearrangements. One patient also harboured an inversion in connection with the deletion that disrupted the HDAC9 gene. All three patients showed clinical characteristics reminiscent of the hand-foot-genital syndrome...

  16. Distinct phenotype of PHF6 deletions in females.

    Science.gov (United States)

    Di Donato, N; Isidor, B; Lopez Cazaux, S; Le Caignec, C; Klink, B; Kraus, C; Schrock, E; Hackmann, K

    2014-02-01

    We report on two female patients carrying small overlapping Xq26.2 deletions of 100 kb and 270 kb involving the PHF6 gene. Mutations in PHF6 have been reported in individuals with Borjeson-Forssman-Lehmann syndrome, a condition present almost exclusively in males. Two very recent papers revealed de novo PHF6 defects in seven female patients with intellectual disability and a phenotype resembling Coffin-Siris syndrome (sparse hair, bitemporal narrowing, arched eyebrows, synophrys, high nasal root, bulbous nasal tip, marked clinodactyly with the hypoplastic terminal phalanges of the fifth fingers and cutaneous syndactyly of the toes, Blaschkoid linear skin hyperpigmentation, dental anomalies and occasional major malformations). The clinical presentation of these patients overlaps completely with our first patient, who carries a germline deletion involving PHF6. The second patient has a mosaic deletion and presented with a very mild phenotype of PHF6 loss in females. Our report confirms that PHF6 loss in females results in a recognizable phenotype overlapping with Coffin-Siris syndrome and distinct from Borjeson-Forssman-Lehmann syndrome. We expand the clinical spectrum and provide the first summary of the recommended medical evaluation. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  17. The mitochondrial DNA 4,977-bp deletion and its implication in copy number alteration in colorectal cancer

    Science.gov (United States)

    2011-01-01

    Background Qualitative and quantitative changes in human mitochondrial DNA (mtDNA) have been implicated in various cancer types. A 4,977 bp deletion in the major arch of the mitochondrial genome is one of the most common mutations associated with a variety of human diseases and aging. Methods We conducted a comprehensive study on clinical features and mtDNA of 104 colorectal cancer patients in the Wenzhou area of China. In particular, using a quantitative real time PCR method, we analyzed the 4,977 bp deletion and mtDNA content in tumor tissues and paired non-tumor areas from these patients. Results We found that the 4,977 bp deletion was more likely to be present in patients of younger age (≤65 years, p = 0.027). In patients with the 4,977 bp deletion, the deletion level decreased as the cancer stage advanced (p = 0.031). Moreover, mtDNA copy number in tumor tissues of patients with this deletion increased, both compared with that in adjacent non-tumor tissues and with in tumors of patients without the deletion. Such mtDNA content increase correlated with the levels of the 4,977 bp deletion and with cancer stage (p deletion may play a role in the early stage of colorectal cancer, and it is also implicated in alteration of mtDNA content in cancer cells. PMID:21232124

  18. Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.

    Science.gov (United States)

    Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth

    2015-01-01

    Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.

  19. Identification of the first large deletion in the CLDN16 gene in a patient with FHHNC and late-onset of chronic kidney disease: case report.

    Science.gov (United States)

    Yamaguti, Paulo Marcio; dos Santos, Pollyanna Almeida Costa; Leal, Bruno Sakamoto; Santana, Viviane Brandão Bandeira de Mello; Mazzeu, Juliana Forte; Acevedo, Ana Carolina; Neves, Francisco de Assis Rocha

    2015-07-02

    Familial hypomagnesemia with hypercalciuria and nephrocalcinosis is a rare autosomal recessive renal disease characterized by tubular disorders at the thick ascending limb of Henle's loop. It is caused by mutations in the tight junction structural proteins claudin-16 or claudin-19, which are encoded by the CLDN16 and CLDN19 genes, respectively. Patients exhibit excessive wasting of calcium and magnesium, nephrocalcinosis, chronic kidney disease, and early progression to end-stage renal failure during infancy. We here report the phenotype and molecular analysis of a female Brazilian patient with a novel large homozygous deletion in the CLDN16 gene. The proband, born from consanguineous parents, presented the first symptoms at age 20. Clinical examination revealed hypocalcemia, hypomagnesemia, nephrocalcinosis, mild myopia, high serum levels of uric acid and intact parathyroid hormone, and moderate chronic kidney disease (stage 3). She and her mother were subjected to CLDN16 and CLDN19 mutational analysis. In addition, the multiplex ligation-dependent probe amplification method was used to confirm a CLDN16 multi-exon deletion. Direct sequencing revealed a normal CLDN19 sequence and suggested a large deletion in the CLDN16 gene. Multiplex ligation-dependent probe amplification showed a homozygous CLDN16 multi-exon deletion (E2_E5del). The patient initiated conventional treatment for familial hypomagnesemia with hypercalciuria and nephrocalcinosis and progressed to end-stage kidney disease after five years. This study provides the first report of a large homozygous deletion in the CLDN16 gene causing familial hypomagnesemia with hypercalciuria and nephrocalcinosis with late onset of the first symptoms. This description expands the phenotypic and genotypic characterization of the disease. The late-onset chronic kidney disease in the presence of a homozygous deletion in the CLDN16 gene reinforces the great variability of genotype-phenotype manifestation in patients with

  20. [Grave's disease in children with 22q11 deletion. Report of three cases].

    Science.gov (United States)

    Gosselin, J; Lebon-Labich, B; Lucron, H; Marçon, F; Leheup, B

    2004-12-01

    Hypothyroidism is a well recognized complication of 22q11.2 deletion syndrome. Auto-immune hyperthyroidism is less common. We report three patients with a 22q11.2 deletion and Graves' disease diagnosed at age 17, 14 and 11 years, respectively. The clinical and biological presentation was typical for auto-immune hyperthyroidism. Graves' disease should be periodically sought during the follow-up program of patients with 22q11.2 deletion syndrome.

  1. Association between the CCR5 32-bp deletion allele and late onset of schizophrenia

    DEFF Research Database (Denmark)

    Rasmussen, H.B.; Timm, S.; Wang, A.G.

    2006-01-01

    OBJECTIVE: The 32-bp deletion allele in chemokine receptor CCR5 has been associated with several immune-mediated diseases and might be implicated in schizophrenia as well. METHOD: The authors genotyped DNA samples from 268 schizophrenia patients and 323 healthy subjects. Age at first admission...... to a psychiatric hospital department served as a measure of disease onset. RESULTS: Patients and comparison subjects differed marginally in their genotype distribution, with a slightly higher frequency of the deletion allele seen in the patients. The authors found the deletion allele to be associated with higher......-onset schizophrenia) and healthy subjects differed significantly. This was reflected in an increased frequency of the deletion allele in the patient subgroup. Patients with ages at first admission below and above 40 years significantly differed in distribution of genotypes and alleles, with an overrepresentation...

  2. Haploid deletion strains of Saccharomyces cerevisiae that determine survival during space flight

    Science.gov (United States)

    Johanson, Kelly; Allen, Patricia L.; Gonzalez-Villalobos, Romer A.; Nesbit, Jacqueline; Nickerson, Cheryl A.; Höner zu Bentrup, Kerstin; Wilson, James W.; Ramamurthy, Rajee; D'Elia, Riccardo; Muse, Kenneth E.; Hammond, Jeffrey; Freeman, Jake; Stodieck, Louis S.; Hammond, Timothy G.

    2007-02-01

    This study identifies genes that determine survival during a space flight, using the model eukaryotic organism, Saccharomyces cerevisiae. Select strains of a haploid yeast deletion series grew during storage in distilled water in space, but not in ground based static or clinorotation controls. The survival advantages in space in distilled water include a 133-fold advantage for the deletion of PEX19, a chaperone and import receptor for newly- synthesized class I peroxisomal membrane proteins, to 77-40 fold for deletion strains lacking elements of aerobic respiration, isocitrate metabolism, and mitochondrial electron transport. Following automated addition of rich growth media, the space flight was associated with a marked survival advantage of strains with deletions in catalytically active genes including hydrolases, oxidoreductases and transferases. When compared to static controls, space flight was associated with a marked survival disadvantage of deletion strains lacking transporter, antioxidant and catalytic activity. This study identifies yeast deletion strains with a survival advantage during storage in distilled water and space flight, and amplifies our understanding of the genes critical for survival in space.

  3. Identification of a Novel De Novo Heterozygous Deletion in the SOX10 Gene in Waardenburg Syndrome Type II Using Next-Generation Sequencing.

    Science.gov (United States)

    Li, Haonan; Jin, Peng; Hao, Qian; Zhu, Wei; Chen, Xia; Wang, Ping

    2017-11-01

    Waardenburg syndrome (WS) is a rare autosomal dominant disorder associated with pigmentation abnormalities and sensorineural hearing loss. In this study, we investigated the genetic cause of WSII in a patient and evaluated the reliability of the targeted next-generation exome sequencing method for the genetic diagnosis of WS. Clinical evaluations were conducted on the patient and targeted next-generation sequencing (NGS) was used to identify the candidate genes responsible for WSII. Multiplex ligation-dependent probe amplification (MLPA) and real-time quantitative polymerase chain reaction (qPCR) were performed to confirm the targeted NGS results. Targeted NGS detected the entire deletion of the coding sequence (CDS) of the SOX10 gene in the WSII patient. MLPA results indicated that all exons of the SOX10 heterozygous deletion were detected; no aberrant copy number in the PAX3 and microphthalmia-associated transcription factor (MITF) genes was found. Real-time qPCR results identified the mutation as a de novo heterozygous deletion. This is the first report of using a targeted NGS method for WS candidate gene sequencing; its accuracy was verified by using the MLPA and qPCR methods. Our research provides a valuable method for the genetic diagnosis of WS.

  4. GALC deletions increase the risk of primary open-angle glaucoma: the role of Mendelian variants in complex disease.

    Directory of Open Access Journals (Sweden)

    Yutao Liu

    Full Text Available DNA copy number variants (CNVs have been reported in many human diseases including autism and schizophrenia. Primary Open Angle Glaucoma (POAG is a complex adult-onset disorder characterized by progressive optic neuropathy and vision loss. Previous studies have identified rare CNVs in POAG; however, their low frequencies prevented formal association testing. We present here the association between POAG risk and a heterozygous deletion in the galactosylceramidase gene (GALC. This CNV was initially identified in a dataset containing 71 Caucasian POAG cases and 478 ethnically matched controls obtained from dbGAP (study accession phs000126.v1.p1. (p = 0.017, fisher's exact test. It was validated with array comparative genomic hybridization (arrayCGH and realtime PCR, and replicated in an independent POAG dataset containing 959 cases and 1852 controls (p = 0.021, OR (odds ratio = 3.5, 95% CI -1.1-12.0. Evidence for association was strengthened when the discovery and replication datasets were combined (p = 0.002; OR = 5.0, 95% CI 1.6-16.4. Several deletions with different endpoints were identified by array CGH of POAG patients. Homozygous deletions that eliminate GALC enzymatic activity cause Krabbe disease, a recessive Mendelian disorder of childhood displaying bilateral optic neuropathy and vision loss. Our findings suggest that heterozygous deletions that reduce GALC activity are a novel mechanism increasing risk of POAG. This is the first report of a statistically-significant association of a CNV with POAG risk, contributing to a growing body of evidence that CNVs play an important role in complex, inherited disorders. Our findings suggest an attractive biomarker and potential therapeutic target for patients with this form of POAG.

  5. Splice, insertion-deletion and nonsense mutations that perturb the phenylalanine hydroxylase transcript cause phenylketonuria in India.

    Science.gov (United States)

    Bashyam, Murali D; Chaudhary, Ajay K; Kiran, Manjari; Nagarajaram, Hampapathalu A; Devi, Radha Rama; Ranganath, Prajnya; Dalal, Ashwin; Bashyam, Leena; Gupta, Neerja; Kabra, Madhulika; Muranjan, Mamta; Puri, Ratna D; Verma, Ishwar C; Nampoothiri, Sheela; Kadandale, Jayarama S

    2014-03-01

    Phenylketonuria (PKU) is an autosomal recessive metabolic disorder caused by mutational inactivation of the phenylalanine hydroxylase (PAH) gene. Missense mutations are the most common PAH mutation type detected in PKU patients worldwide. We performed PAH mutation analysis in 27 suspected Indian PKU families (including 7 from our previous study) followed by structure and function analysis of specific missense and splice/insertion-deletion/nonsense mutations, respectively. Of the 27 families, disease-causing mutations were detected in 25. A total of 20 different mutations were identified of which 7 "unique" mutations accounted for 13 of 25 mutation positive families. The unique mutations detected exclusively in Indian PKU patients included three recurrent mutations detected in three families each. The 20 mutations included only 5 missense mutations in addition to 5 splice, 4 each nonsense and insertion-deletion mutations, a silent variant in coding region and a 3'UTR mutation. One deletion and two nonsense mutations were characterized to confirm significant reduction in mutant transcript levels possibly through activation of nonsense mediated decay. All missense mutations affected conserved amino acid residues and sequence and structure analysis suggested significant perturbations in the enzyme activity of respective mutant proteins. This is probably the first report of identification of a significantly low proportion of missense PAH mutations from PKU families and together with the presence of a high proportion of splice, insertion-deletion, and nonsense mutations, points to a unique PAH mutation profile in Indian PKU patients. © 2013 Wiley Periodicals, Inc.

  6. Unmasking of a hemizygous WFS1 gene mutation by a chromosome 4p deletion of 8.3 Mb in a patient with Wolf-Hirschhorn syndrome.

    Science.gov (United States)

    Flipsen-ten Berg, Klara; van Hasselt, Peter M; Eleveld, Marc J; van der Wijst, Suzanne E; Hol, Frans A; de Vroede, Monique A M; Beemer, Frits A; Hochstenbach, P F Ron; Poot, Martin

    2007-11-01

    The Wolf-Hirschhorn syndrome (WHS (MIM 194190)), which is characterized by growth delay, mental retardation, epilepsy, facial dysmorphisms, and midline fusion defects, shows extensive phenotypic variability. Several of the proposed mutational and epigenetic mechanisms in this and other chromosomal deletion syndromes fail to explain the observed phenotypic variability. To explain the complex phenotype of a patient with WHS and features reminiscent of Wolfram syndrome (WFS (MIM 222300)), we performed extensive clinical evaluation and classical and molecular cytogenetic (GTG banding, FISH and array-CGH) and WFS1 gene mutation analyses. We detected an 8.3 Mb terminal deletion and an adjacent 2.6 Mb inverted duplication in the short arm of chromosome 4, which encompasses a gene associated with WFS (WFS1). In addition, a nonsense mutation in exon 8 of the WFS1 gene was found on the structurally normal chromosome 4. The combination of the 4p deletion with the WFS1 point mutation explains the complex phenotype presented by our patient. This case further illustrates that unmasking of hemizygous recessive mutations by chromosomal deletions represents an additional explanation for the phenotypic variability observed in chromosomal deletion disorders.

  7. Recurrence and Variability of Germline EPCAM Deletions in Lynch Syndrome

    NARCIS (Netherlands)

    Kuiper, Roland P.; Vissers, Lisenka E. L. M.; Venkatachalam, Ramprasath; Bodmer, Danielle; Hoenselaar, Eveline; Goossens, Monique; Haufe, Aline; Kamping, Eveline; Niessen, Renee C.; Hogervorst, Frans B. L.; Gille, Johan J. P.; Redeker, Bert; Tops, Carli M. J.; van Gijn, Marielle E.; van den Ouweland, Ans M. W.; Rahner, Nils; Steinke, Verena; Kahl, Philip; Holinski-Feder, Elke; Morak, Monika; Kloor, Matthias; Stemmler, Susanne; Betz, Beate; Hutter, Pierre; Bunyan, David J.; Syngal, Sapna; Culver, Julie O.; Graham, Tracy; Chan, Tsun L.; Nagtegaal, Iris D.; van Krieken, J. Han J. M.; Schackert, Hans K.; Hoogerbrugge, Nicoline; van Kessel, Ad Geurts; Ligtenberg, Marjolijn J. L.

    Recently, we identified 3' end deletions in the EPCAM gene as a novel cause of Lynch syndrome. These truncating EPCAM deletions cause allele-specific epigenetic silencing of the neighboring DNA mismatch repair gene MSH2 in tissues expressing EPCAM. Here we screened a cohort of unexplained Lynch-like

  8. A novel BRCA2 in frame deletion in a Tunisian woman with early onset sporadic breast cancer.

    Science.gov (United States)

    Hadiji-Abbes, N; Trifa, F; Choura, M; Khabir, A; Sellami-Boudawara, T; Frikha, M; Daoud, J; Mokdad-Gargouri, R

    2015-09-01

    Breast cancer is increasing among young women in Tunisia. Germline mutations in the BRCA1/2 genes are associated with a high risk for breast cancer development. However, the true contribution of BRCA1/2 mutation in sporadic breast cancer is not well documented. Our aim is to identify the BRCA2 mutation spectrum in Tunisian young women with breast cancer. Screening the BRCA2 gene was performed using DHPLC, DNA sequencing and PCR-RFLP. We identified, in a woman diagnosed with early onset breast cancer, and without family history, a novel in frame deletion 5456delGTAGCA in the exon 11 of the BRCA2 gene which causes a loss of two residues Ser1743-Ser1744. The absence of this deletion in the patients' parents suggests that it is a de novo variant. Furthermore, we screened 108 sporadic cases, 50 familial cases, and 60 controls for the identified del6bp using PCR-RFLP. None of them carried this deletion suggesting that this variant is not a benign polymorphism and probably rare in our population. With regards to the position of the Ser1743-1744 in the BRCT domain, sequence alignment revealed that the Ser1743 is conserved among several species, which may reflect its importance in the BRCA2 function. A modeling of the wild-type and mutated BRC5-BRC6 domain revealed that the deletion of the 2 Serine residues might affect the structure of this BRCA2 domain. A novel in frame deletion 5456del6bp in BRCA2 gene was identified in an early onset woman with breast cancer and without family history. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  9. Diagnosis of a terminal deletion of 4p with duplication of Xp22.31 in a patient with findings of Opitz G/BBB syndrome and Wolf-Hirschhorn syndrome.

    Science.gov (United States)

    So, Joyce; Müller, Ines; Kunath, Melanie; Herrmann, Susanne; Ullmann, Reinhard; Schweiger, Susann

    2008-01-01

    Opitz G/BBB syndrome (OS) is a congenital midline malformation syndrome characterized by hypertelorism, hypospadias, cleft lip/palate, laryngotracheoesophageal abnormalities, imperforate anus, developmental delay and cardiac defects. The X-linked form is caused by mutations in the MID1 gene, while no gene has yet been identified for the autosomal dominant form. Here, we report on a 15-year-old boy who was referred for MID1 mutation analysis with findings typical of OS, including apparent hypertelorism, hypospadias, a history of feeding difficulties, dysphagia secondary to esophageal arteria lusoria, growth retardation and developmental delay. No MID1 mutation was found, but subsequent sub-megabase resolution array CGH unexpectedly documented a 2.34 Mb terminal 4p deletion, suggesting a diagnosis of WHS, and a duplication in Xp22.31. Wolf-Hirschhorn syndrome (WHS) is a contiguous gene deletion syndrome involving terminal chromosome 4p deletions, in particular 4p16.3. WHS is characterized by typical facial appearance ("Greek helmet facies"), mental retardation, congenital hypotonia, and growth retardation. While the severity of developmental delay in this patient supports the diagnosis of WHS rather than OS, this case illustrates the striking similarities of clinical findings in seemingly unrelated syndromes, suggesting common or interacting pathways at the molecular and pathogenetic level. This is the first report of arteria lusoria (esophageal vascular ring) in a patient with WHS. (c) 2007 Wiley-Liss, Inc.

  10. Prognostic significance of 1p36 locus deletion in adenoid cystic carcinoma of the salivary glands

    DEFF Research Database (Denmark)

    Šteiner, Petr; Andreasen, Simon; Grossmann, Petr

    2018-01-01

    Adenoid cystic carcinoma (AdCC) of the salivary glands is characterized by MYB-NFIB or MYBL1-NFIB fusion, prolonged but relentlessly progressive clinical course with frequent recurrences, and development of distant metastasis resulting in high long-term mortality. Currently, no effective therapy...... is available for patients with advanced non-resectable and/or metastatic disease. Complicating the clinical management of this patient group is the lack of prognostic markers. The purpose of this study is to investigate the prognostic value of 1p36 loss in patients with AdCC. The presence of 1p36 deletion...... and gene fusions involving the MYB, NFIB, and MYBL1 genes in a cohort of 93 salivary gland AdCCs was studied using fluorescence in situ hybridization. These results were statistically correlated with clinical data and outcome. Deletion of 1p36 in AdCC was identified in 13 of 85 analyzable cases (15...

  11. Exome-first approach identified a novel gloss deletion associated with Lowe syndrome.

    Science.gov (United States)

    Watanabe, Miki; Nakagawa, Ryuji; Kohmoto, Tomohiro; Naruto, Takuya; Suga, Ken-Ichi; Goji, Aya; Horikawa, Hideaki; Masuda, Kiyoshi; Kagami, Shoji; Imoto, Issei

    2016-01-01

    Lowe syndrome (LS) is an X-linked disorder affecting the eyes, nervous system and kidneys, typically caused by missense or nonsense/frameshift OCRL mutations. We report a 6-month-old male clinically suspected to have LS, but without the Fanconi-type renal dysfunction. Using a targeted-exome sequencing-first approach, LS was diagnosed by the identification of a deletion involving 1.7 Mb at Xq25-q26.1, encompassing the entire OCRL gene and neighboring loci.

  12. Comprehensive analysis of pathogenic deletion variants in Fanconi anemia genes.

    Science.gov (United States)

    Flynn, Elizabeth K; Kamat, Aparna; Lach, Francis P; Donovan, Frank X; Kimble, Danielle C; Narisu, Narisu; Sanborn, Erica; Boulad, Farid; Davies, Stella M; Gillio, Alfred P; Harris, Richard E; MacMillan, Margaret L; Wagner, John E; Smogorzewska, Agata; Auerbach, Arleen D; Ostrander, Elaine A; Chandrasekharappa, Settara C

    2014-11-01

    Fanconi anemia (FA) is a rare recessive disease resulting from mutations in one of at least 16 different genes. Mutation types and phenotypic manifestations of FA are highly heterogeneous and influence the clinical management of the disease. We analyzed 202 FA families for large deletions, using high-resolution comparative genome hybridization arrays, single-nucleotide polymorphism arrays, and DNA sequencing. We found pathogenic deletions in 88 FANCA, seven FANCC, two FANCD2, and one FANCB families. We find 35% of FA families carry large deletions, accounting for 18% of all FA pathogenic variants. Cloning and sequencing across the deletion breakpoints revealed that 52 FANCA deletion ends, and one FANCC deletion end extended beyond the gene boundaries, potentially affecting neighboring genes with phenotypic consequences. Seventy-five percent of the FANCA deletions are Alu-Alu mediated, predominantly by AluY elements, and appear to be caused by nonallelic homologous recombination. Individual Alu hotspots were identified. Defining the haplotypes of four FANCA deletions shared by multiple families revealed that three share a common ancestry. Knowing the exact molecular changes that lead to the disease may be critical for a better understanding of the FA phenotype, and to gain insight into the mechanisms driving these pathogenic deletion variants. © 2014 WILEY PERIODICALS, INC.

  13. Small mosaic deletion encompassing the snoRNAs and SNURF-SNRPN results in an atypical Prader-Willi syndrome phenotype.

    Science.gov (United States)

    Anderlid, Britt-Marie; Lundin, Johanna; Malmgren, Helena; Lehtihet, Mikael; Nordgren, Ann

    2014-02-01

    Genetic analyses were performed in a male patient with suspected Prader-Willi syndrome who presented with hypogonadism, excessive eating, central obesity, small hands and feet and cognition within the low normal range. However, he had no neonatal hypotonia or feeding problems during infancy. Chromosome analysis showed a normal male karyotype. Further analysis with array-CGH identified a mosaic 847 kb deletion in 15q11-q13, including SNURF-SNRPN, the snoRNA gene clusters SNORD116 (HBII-85), SNORD115, (HBII-52), SNORD109 A and B (HBII-438A and B), SNORD64 (HBII-13), and NPAP1 (C15ORF2). MLPA confirmed the deletion and the results were compatible with a paternal origin. Metaphase-FISH verified the mosaicism with the deletion present in 58% of leukocytes analyzed. Three smaller deletions in this region have previously been reported in patients with Prader-Willi syndrome phenotype. All three deletions included SNORD116, but only two encompassed parts of SNURF-SNRPN, implicating SNORD116 as the major contributor to the Prader-Willi phenotype. Our case adds further information about genotype-phenotype correlation and supports the hypothesis that SNORD116 plays a major role in the pathogenesis of Prader-Willi syndrome. Furthermore, it examplifies diagnostic difficulties in atypical cases and illustrates the need for additional testing methods when Prader-Willi syndrome is suspected. © 2013 Wiley Periodicals, Inc.

  14. Targeted next-generation sequencing analysis identifies novel mutations in families with severe familial exudative vitreoretinopathy

    Science.gov (United States)

    Huang, Xiao-Yan; Zhuang, Hong; Wu, Ji-Hong; Li, Jian-Kang; Hu, Fang-Yuan; Zheng, Yu; Tellier, Laurent Christian Asker M.; Zhang, Sheng-Hai; Gao, Feng-Juan; Zhang, Jian-Guo

    2017-01-01

    Purpose Familial exudative vitreoretinopathy (FEVR) is a genetically and clinically heterogeneous disease, characterized by failure of vascular development of the peripheral retina. The symptoms of FEVR vary widely among patients in the same family, and even between the two eyes of a given patient. This study was designed to identify the genetic defect in a patient cohort of ten Chinese families with a definitive diagnosis of FEVR. Methods To identify the causative gene, next-generation sequencing (NGS)-based target capture sequencing was performed. Segregation analysis of the candidate variant was performed in additional family members by using Sanger sequencing and quantitative real-time PCR (QPCR). Results Of the cohort of ten FEVR families, six pathogenic variants were identified, including four novel and two known heterozygous mutations. Of the variants identified, four were missense variants, and two were novel heterozygous deletion mutations [LRP5, c.4053 DelC (p.Ile1351IlefsX88); TSPAN12, EX8Del]. The two novel heterozygous deletion mutations were not observed in the control subjects and could give rise to a relatively severe FEVR phenotype, which could be explained by the protein function prediction. Conclusions We identified two novel heterozygous deletion mutations [LRP5, c.4053 DelC (p.Ile1351IlefsX88); TSPAN12, EX8Del] using targeted NGS as a causative mutation for FEVR. These genetic deletion variations exhibit a severe form of FEVR, with tractional retinal detachments compared with other known point mutations. The data further enrich the mutation spectrum of FEVR and enhance our understanding of genotype–phenotype correlations to provide useful information for disease diagnosis, prognosis, and effective genetic counseling. PMID:28867931

  15. Wolf-Hirschhorn Syndrome with Epibulbar Dermoid: An Unusual Association in a Patient with 4p Deletion and Functional Xp Disomy.

    Science.gov (United States)

    Bragagnolo, Silvia; Colovati, Mileny E S; Guilherme, Roberta S; Dantas, Anelisa G; de Souza, Malú Zamariolli; de Soares, Maria F; Melaragno, Maria I; Perez, Ana B

    2016-01-01

    Wolf-Hirschhorn syndrome (WHS) is a contiguous gene and multiple malformation syndrome that results from a deletion in the 4p16.3 region. We describe here a 6-month-old girl that presented with WHS features but also displayed unusual findings, such as epibulbar dermoid in the left eye, ear tags, and left microtia. Although on G-banding her karyotype appeared to be normal, chromosomal microarray analysis revealed an ∼13-Mb 4p16.3p15.33 deletion and an ∼9-Mb Xp22.33p22.31 duplication, resulting from a balanced maternal t(X;4)(p22.31;p15.33) translocation. The patient presented with functional Xp disomy due to an unbalanced X-autosome translocation, a rare cytogenetic finding in females with unbalanced rearrangements. Sequencing of both chromosome breakpoints detected no gene disruption. To the best of our knowledge, this is the first patient described in the literature with WHS and epibulbar dermoid, a typical characteristic of the oculoauriculovertebral spectrum (OAVS). Our data suggest that possible candidate genes for OAVS may have been deleted along with the WHS critical region. © 2016 S. Karger AG, Basel.

  16. Association between the CCR5 32-bp deletion allele and late onset of schizophrenia

    DEFF Research Database (Denmark)

    Rasmussen, Henrik Berg; Timm, Sally; Wang, August G

    2006-01-01

    OBJECTIVE: The 32-bp deletion allele in chemokine receptor CCR5 has been associated with several immune-mediated diseases and might be implicated in schizophrenia as well. METHOD: The authors genotyped DNA samples from 268 schizophrenia patients and 323 healthy subjects. Age at first admission...... of the deletion allele in the latter subgroup of patients. CONCLUSIONS: These findings suggest that the CCR5 32-bp deletion allele is a susceptibility factor for schizophrenia with late onset. Alternatively, the CCR5 32-bp deletion allele may act as a modifier by delaying the onset of schizophrenia without...

  17. The relationship of the factor V Leiden mutation or the deletion-deletion polymorphism of the angiotensin converting enzyme to postoperative thromboembolic events following total joint arthroplasty

    Directory of Open Access Journals (Sweden)

    Fang Carrie

    2001-04-01

    Full Text Available Abstract Background Although all patients undergoing total joint arthroplasty are subjected to similar risk factors that predispose to thromboembolism, only a subset of patients develop this complication. The objective of this study was to determine whether a specific genetic profile is associated with a higher risk of developing a postoperative thromboembolic complication. Specifically, we examined if the Factor V Leiden (FVL mutation or the deletion polymorphism of the angiotensin-converting enzyme (ACE gene increased a patient's risk for postoperative thromboembolic events. The FVL mutation has been associated with an increased risk of idiopathic thromboembolism and the deletion polymorphism of the ACE gene has been associated with increased vascular tone, attenuated fibrinolysis and increased platelet aggregation. Methods The presence of these genetic profiles was determined for 38 patients who had a postoperative symptomatic pulmonary embolus or proximal deep venous thrombosis and 241 control patients without thrombosis using molecular biological techniques. Results The Factor V Leiden mutation was present in none of the 38 experimental patients and in 3% or 8 of the 241 controls (p = 0.26. Similarly there was no difference detected in the distribution of polymorphisms for the ACE gene with the deletion-deletion genotype present in 36% or 13 of the 38 experimental patients and in 31% or 74 of the 241 controls (p = 0.32. Conclusions Our results suggest that neither of these potentially hypercoaguable states are associated with an increased risk of symptomatic thromboembolic events following total hip or knee arthroplasty in patients receiving pharmacological thromboprophylaxis.

  18. Attenuation of monkeypox virus by deletion of genomic regions

    Science.gov (United States)

    Lopera, Juan G.; Falendysz, Elizabeth A.; Rocke, Tonie E.; Osorio, Jorge E.

    2015-01-01

    Monkeypox virus (MPXV) is an emerging pathogen from Africa that causes disease similar to smallpox. Two clades with different geographic distributions and virulence have been described. Here, we utilized bioinformatic tools to identify genomic regions in MPXV containing multiple virulence genes and explored their roles in pathogenicity; two selected regions were then deleted singularly or in combination. In vitro and in vivostudies indicated that these regions play a significant role in MPXV replication, tissue spread, and mortality in mice. Interestingly, while deletion of either region led to decreased virulence in mice, one region had no effect on in vitro replication. Deletion of both regions simultaneously also reduced cell culture replication and significantly increased the attenuation in vivo over either single deletion. Attenuated MPXV with genomic deletions present a safe and efficacious tool in the study of MPX pathogenesis and in the identification of genetic factors associated with virulence.

  19. Malan syndrome: Sotos-like overgrowth with de novo NFIX sequence variants and deletions in six new patients and a review of the literature.

    Science.gov (United States)

    Klaassens, Merel; Morrogh, Deborah; Rosser, Elisabeth M; Jaffer, Fatima; Vreeburg, Maaike; Bok, Levinus A; Segboer, Tim; van Belzen, Martine; Quinlivan, Ros M; Kumar, Ajith; Hurst, Jane A; Scott, Richard H

    2015-05-01

    De novo monoallelic variants in NFIX cause two distinct syndromes. Whole gene deletions, nonsense variants and missense variants affecting the DNA-binding domain have been seen in association with a Sotos-like phenotype that we propose is referred to as Malan syndrome. Frameshift and splice-site variants thought to avoid nonsense-mediated RNA decay have been seen in Marshall-Smith syndrome. We report six additional patients with Malan syndrome and de novo NFIX deletions or sequence variants and review the 20 patients now reported. The phenotype is characterised by moderate postnatal overgrowth and macrocephaly. Median height and head circumference in childhood are 2.0 and 2.3 standard deviations (SD) above the mean, respectively. There is overlap of the facial phenotype with NSD1-positive Sotos syndrome in some cases including a prominent forehead, high anterior hairline, downslanting palpebral fissures and prominent chin. Neonatal feeding difficulties and/or hypotonia have been reported in 30% of patients. Developmental delay/learning disability have been reported in all cases and are typically moderate. Ocular phenotypes are common, including strabismus (65%), nystagmus (25% ) and optic disc pallor/hypoplasia (25%). Other recurrent features include pectus excavatum (40%) and scoliosis (25%). Eight reported patients have a deletion also encompassing CACNA1A, haploinsufficiency of which causes episodic ataxia type 2 or familial hemiplegic migraine. One previous case had episodic ataxia and one case we report has had cyclical vomiting responsive to pizotifen. In individuals with this contiguous gene deletion syndrome, awareness of possible later neurological manifestations is important, although their penetrance is not yet clear.

  20. Impaired spermatogenesis and gr/gr deletions related to Y chromosome haplogroups in Korean men.

    Directory of Open Access Journals (Sweden)

    Jin Choi

    Full Text Available Microdeletion of the Azoospermia Factor (AZF regions in Y chromosome is a well-known genetic cause of male infertility resulting from spermatogenetic impairment. However, the partial deletions of AZFc region related to spermatogenetic impairment are controversial. In this study, we characterized partial deletion of AZFc region in Korean patients with spermatogenetic impairment and assessed whether the DAZ and CDY1 contributes to the phenotype in patients with gr/gr deletions. Total of 377 patients with azoo-/oligozoospermia and 217 controls were analyzed using multiplex polymerase chain reaction (PCR, analysis of DAZ-CDY1 sequence family variants (SFVs, and quantitative fluorescent (QF-PCR. Of the 377 men with impaired spermatogenesis, 59 cases (15.6% had partial AZFc deletions, including 32 gr/gr (8.5%, 22 b2/b3 (5.8%, four b1/b3 (1.1% and one b3/b4 (0.3% deletion. In comparison, 14 of 217 normozoospermic controls (6.5% had partial AZFc deletions, including five gr/gr (2.3% and nine b2/b3 (4.1% deletions. The frequency of gr/gr deletions was significantly higher in the azoo-/oligozoospermic group than in the normozoospermic control group (p = 0.003; OR = 3.933; 95% CI = 1.509-10.250. Concerning Y haplogroup, we observed no significant differences in the frequency of gr/gr deletions between the case and the control groups in the YAP+ lineages, while gr/gr deletion were significantly higher in azoo-/oligozoospermia than normozoospermia in the YAP- lineage (p = 0.004; OR = 6.341; 95% CI = 1.472-27.312. Our data suggested that gr/gr deletion is associated with impaired spermatogenesis in Koreans with YAP- lineage, regardless of the gr/gr subtypes.

  1. A French multicenter study of over 700 patients with 22q11 deletions diagnosed using FISH or aCGH.

    Science.gov (United States)

    Poirsier, Céline; Besseau-Ayasse, Justine; Schluth-Bolard, Caroline; Toutain, Jérôme; Missirian, Chantal; Le Caignec, Cédric; Bazin, Anne; de Blois, Marie Christine; Kuentz, Paul; Catty, Marie; Choiset, Agnès; Plessis, Ghislaine; Basinko, Audrey; Letard, Pascaline; Flori, Elisabeth; Jimenez, Mélanie; Valduga, Mylène; Landais, Emilie; Lallaoui, Hakima; Cartault, François; Lespinasse, James; Martin-Coignard, Dominique; Callier, Patrick; Pebrel-Richard, Céline; Portnoi, Marie-France; Busa, Tiffany; Receveur, Aline; Amblard, Florence; Yardin, Catherine; Harbuz, Radu; Prieur, Fabienne; Le Meur, Nathalie; Pipiras, Eva; Kleinfinger, Pascale; Vialard, François; Doco-Fenzy, Martine

    2016-06-01

    Although 22q11.2 deletion syndrome (22q11.2DS) is the most recurrent human microdeletion syndrome associated with a highly variable phenotype, little is known about the condition's true incidence and the phenotype at diagnosis. We performed a multicenter, retrospective analysis of postnatally diagnosed patients recruited by members of the Association des Cytogénéticiens de Langue Française (the French-Speaking Cytogeneticists Association). Clinical and cytogenetic data on 749 cases diagnosed between 1995 and 2013 were collected by 31 French cytogenetics laboratories. The most frequent reasons for referral of postnatally diagnosed cases were a congenital heart defect (CHD, 48.6%), facial dysmorphism (49.7%) and developmental delay (40.7%). Since 2007 (the year in which array comparative genomic hybridization (aCGH) was introduced for the routine screening of patients with intellectual disability), almost all cases have been diagnosed using FISH (96.1%). Only 15 cases (all with an atypical phenotype) were diagnosed with aCGH; the deletion size ranged from 745 to 2904 kb. The deletion was inherited in 15.0% of cases and was of maternal origin in 85.5% of the latter. This is the largest yet documented cohort of patients with 22q11.2DS (the most commonly diagnosed microdeletion) from the same population. French cytogenetics laboratories diagnosed at least 108 affected patients (including fetuses) per year from among a national population of ∼66 million. As observed for prenatal diagnoses, CHDs were the most frequently detected malformation in postnatal diagnoses. The most common CHD in postnatal diagnoses was an isolated septal defect.

  2. On two patients with and without the classical Wolf-Hirschhorn syndrome (WHS) sharing the same chromosome 4p16.3 specific probe deletion: evidence of a contiguous gene deletion syndrome.

    Science.gov (United States)

    Petit, P; Schmit, J; Van den Berghe, H; Fryns, J P

    1996-07-01

    We report here on phenotype-karyotype correlations in two patients with and without complete features of the WHS but sharing the lack of a specific cosmic probe (D4S96/D4Z1) from 4p16.3. These findings indicate that WHS is true a contiguous gene deletion syndrome in nature and expression.

  3. Correlation between chromosome 9p21 locus deletion and prognosis in clinically localized prostate cancer.

    Science.gov (United States)

    Barros, Érika Aparecida Felix de; Pontes-Junior, José; Reis, Sabrina Thalita; Lima, Amanda Eunice Ramos; Souza, Isida C; Salgueiro, Jose Lucas; Fontes, Douglas; Dellê, Humberto; Coelho, Rafael Ferreira; Viana, Nayara Izabel; Leite, Kátia Ramos Moreira; Nahas, William C; Srougi, Miguel

    2017-05-04

    Some studies have reported that deletions at chromosome arm 9p occur frequently and represent a critical step in carcinogenesis of some neoplasms. Our aim was to evaluate the deletion of locus 9p21 and chromosomes 3, 7 and 17 in localized prostate cancer (PC) and correlate these alterations with prognostic factors and biochemical recurrence after surgery. We retrospectively evaluated surgical specimens from 111 patients with localized PC who underwent radical prostatectomy. Biochemical recurrence was defined as a prostate-specific antigen (PSA) >0.2 ng/mL and the mean postoperative follow-up was 123 months. The deletions were evaluated using fluorescence in situ hybridization with centromeric and locus-specific probes in a tissue microarray containing 2 samples from each patient. We correlated the occurrence of any deletion with pathological stage, Gleason score, ISUP grade group, PSA and biochemical recurrence. We observed a loss of any probe in only 8 patients (7.2%). The most common deletion was the loss of locus 9p21, which occurred in 6.4% of cases. Deletions of chromosomes 3, 7 and 17 were observed in 2.3%, 1.2% and 1.8% patients, respectively. There was no correlation between chromosome loss and Gleason score, ISUP, PSA or stage. Biochemical recurrence occurred in 83% cases involving 9p21 deletions. Loss of 9p21 locus was significantly associated with time to recurrence (p = 0.038). We found low rates of deletion in chromosomes 3, 7 and 17 and 9p21 locus. We observed that 9p21 locus deletion was associated with worse prognosis in localized PC treated by radical prostatectomy.

  4. Deletion 22q13.3 syndrome

    Directory of Open Access Journals (Sweden)

    Phelan Mary C

    2008-05-01

    Full Text Available Abstract The deletion 22q13.3 syndrome (deletion 22q13 syndrome or Phelan-McDermid syndrome is a chromosome microdeletion syndrome characterized by neonatal hypotonia, global developmental delay, normal to accelerated growth, absent to severely delayed speech, and minor dysmorphic features. The deletion occurs with equal frequency in males and females and has been reported in mosaic and non-mosaic forms. Due to lack of clinical recognition and often insufficient laboratory testing, the syndrome is under-diagnosed and its true incidence remains unknown. Common physical traits include long eye lashes, large or unusual ears, relatively large hands, dysplastic toenails, full brow, dolicocephaly, full cheeks, bulbous nose, and pointed chin. Behavior is autistic-like with decreased perception of pain and habitual chewing or mouthing. The loss of 22q13.3 can result from simple deletion, translocation, ring chromosome formation and less common structural changes affecting the long arm of chromosome 22, specifically the region containing the SHANK3 gene. The diagnosis of deletion 22q13 syndrome should be considered in all cases of hypotonia of unknown etiology and in individuals with absent speech. Although the deletion can sometimes be detected by high resolution chromosome analysis, fluorescence in situ hybridization (FISH or array comparative genomic hybridization (CGH is recommended for confirmation. Differential diagnosis includes syndromes associated with hypotonia, developmental delay, speech delay and/or autistic-like affect (Prader-Willi, Angelman, Williams, Smith-Magenis, Fragile X, Sotos, FG, trichorhinophalangeal and velocardiofacial syndromes, autism spectrum disorders, cerebral palsy. Genetic counseling is recommended and parental laboratory studies should be considered to identify cryptic rearrangements and detect parental mosaicism. Prenatal diagnosis should be offered for future pregnancies in those families with inherited rearrangements

  5. Subtelomeric deletion of chromosome 10p15.3: clinical findings and molecular cytogenetic characterization.

    Science.gov (United States)

    DeScipio, Cheryl; Conlin, Laura; Rosenfeld, Jill; Tepperberg, James; Pasion, Romela; Patel, Ankita; McDonald, Marie T; Aradhya, Swaroop; Ho, Darlene; Goldstein, Jennifer; McGuire, Marianne; Mulchandani, Surabhi; Medne, Livija; Rupps, Rosemarie; Serrano, Alvaro H; Thorland, Erik C; Tsai, Anne C-H; Hilhorst-Hofstee, Yvonne; Ruivenkamp, Claudia A L; Van Esch, Hilde; Addor, Marie-Claude; Martinet, Danielle; Mason, Thornton B A; Clark, Dinah; Spinner, Nancy B; Krantz, Ian D

    2012-09-01

    We describe 19 unrelated individuals with submicroscopic deletions involving 10p15.3 characterized by chromosomal microarray (CMA). Interestingly, to our knowledge, only two individuals with isolated, submicroscopic 10p15.3 deletion have been reported to date; however, only limited clinical information is available for these probands and the deleted region has not been molecularly mapped. Comprehensive clinical history was obtained for 12 of the 19 individuals described in this study. Common features among these 12 individuals include: cognitive/behavioral/developmental differences (11/11), speech delay/language disorder (10/10), motor delay (10/10), craniofacial dysmorphism (9/12), hypotonia (7/11), brain anomalies (4/6) and seizures (3/7). Parental studies were performed for nine of the 19 individuals; the 10p15.3 deletion was de novo in seven of the probands, not maternally inherited in one proband and inherited from an apparently affected mother in one proband. Molecular mapping of the 19 individuals reported in this study has identified two genes, ZMYND11 (OMIM 608668) and DIP2C (OMIM 611380; UCSC Genome Browser), mapping within 10p15.3 which are most commonly deleted. Although no single gene has been identified which is deleted in all 19 individuals studied, the deleted region in all but one individual includes ZMYND11 and the deleted region in all but one other individual includes DIP2C. There is not a clearly identifiable phenotypic difference between these two individuals and the size of the deleted region does not generally predict clinical features. Little is currently known about these genes complicating a direct genotype/phenotype correlation at this time. These data however, suggest that ZMYND11 and/or DIP2C haploinsufficiency contributes to the clinical features associated with 10p15 deletions in probands described in this study. Copyright © 2012 Wiley Periodicals, Inc.

  6. Angiotensin-converting enzyme insertion/deletion gene ...

    Indian Academy of Sciences (India)

    Angiotensin-converting enzyme insertion/deletion gene polymorphism in cystic fibrosis patients. Sabrine Oueslati Sondess Hadj Fredj Hajer Siala Amina Bibi Hajer Aloulou Lamia Boughamoura Khadija Boussetta Sihem Barsaoui Taieb Messaoud. Research Note Volume 95 Issue 1 March 2016 pp 193-196 ...

  7. Fluorescence in situ hybridization evaluation of chromosome deletion patterns in prostate cancer.

    Science.gov (United States)

    Huang, S F; Xiao, S; Renshaw, A A; Loughlin, K R; Hudson, T J; Fletcher, J A

    1996-11-01

    Various nonrandom chromosomal aberrations have been identified in prostate carcinoma. These aberrations include deletions of several chromosome regions, particularly the chromosome 8 short arm. Large-scale numerical aberrations, reflected in aberrant DNA ploidy, are also found in a minority of cases. However, it is unclear whether prostate carcinomas contain aberrations of certain chromosome regions that are deleted frequently in other common types of cancer. In this study, we performed dual-color fluorescence in situ hybridization on intact nuclei from touch preparations of 16 prostate cancers. Chromosome copy number was determined using pericentromeric probes, whereas potential chromosome arm deletions were evaluated using yeast artificial chromosome (YAC) and P1 probes. Two YAC probes targeted chromosome 8 short arm regions known to be deleted frequently in prostate cancer. Other YACs and P1s were for chromosome regions, including 1p22, 3p14, 6q21, 9p21, and 22q12, that are deletion targets in a variety of cancers although not extensively studied in prostate cancer. Hybridization efficiencies and signal intensities were excellent for both repeat sequence (alpha-satellite) and single, copy (YAC and P1) fluorescence in situ hybridization probes. Of 16 prostate cancers, 11 had clonal aberrations of 1 or more of the 13 chromosome regions evaluated, and 10 cases (62.5%) had 8p deletions, including 4 cases with 8p deletion in virtually all cells and aneuploidy in only a subset of those deleted cells. Deletions at 3p14, 6q21, and 22q12 were identified in 2, 1, and 1 case, respectively, and each of those cases had a similarly sized cell population with 8p deletion. These studies confirm 8p deletion in the majority of prostate carcinomas. 8p deletions appear to be early events in prostate tumorigenesis, often antedating aneuploidy. Fluorescence in situ hybridization strategies incorporating pericentromeric and single-copy regional chromosome probes offer a powerful and

  8. SVA retrotransposon insertion-associated deletion represents a novel mutational mechanism underlying large genomic copy number changes with non-recurrent breakpoints

    Science.gov (United States)

    2014-01-01

    Background Genomic disorders are caused by copy number changes that may exhibit recurrent breakpoints processed by nonallelic homologous recombination. However, region-specific disease-associated copy number changes have also been observed which exhibit non-recurrent breakpoints. The mechanisms underlying these non-recurrent copy number changes have not yet been fully elucidated. Results We analyze large NF1 deletions with non-recurrent breakpoints as a model to investigate the full spectrum of causative mechanisms, and observe that they are mediated by various DNA double strand break repair mechanisms, as well as aberrant replication. Further, two of the 17 NF1 deletions with non-recurrent breakpoints, identified in unrelated patients, occur in association with the concomitant insertion of SINE/variable number of tandem repeats/Alu (SVA) retrotransposons at the deletion breakpoints. The respective breakpoints are refractory to analysis by standard breakpoint-spanning PCRs and are only identified by means of optimized PCR protocols designed to amplify across GC-rich sequences. The SVA elements are integrated within SUZ12P intron 8 in both patients, and were mediated by target-primed reverse transcription of SVA mRNA intermediates derived from retrotranspositionally active source elements. Both SVA insertions occurred during early postzygotic development and are uniquely associated with large deletions of 1 Mb and 867 kb, respectively, at the insertion sites. Conclusions Since active SVA elements are abundant in the human genome and the retrotranspositional activity of many SVA source elements is high, SVA insertion-associated large genomic deletions encompassing many hundreds of kilobases could constitute a novel and as yet under-appreciated mechanism underlying large-scale copy number changes in the human genome. PMID:24958239

  9. Duchenne muscular dystrophy in a female with compound heterozygous contiguous exon deletions.

    Science.gov (United States)

    Takeshita, Eri; Minami, Narihiro; Minami, Kumiko; Suzuki, Mikiya; Awashima, Takeya; Ishiyama, Akihiko; Komaki, Hirofumi; Nishino, Ichizo; Sasaki, Masayuki

    2017-06-01

    Females with Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD) mutations rarely exhibit clinical symptoms from childhood, although potential mechanisms for symptoms associated with DMD and BMD in females have been reported. We report the case of a female DMD patient with a clinical course indistinguishable from that of a male DMD patient, and who possessed compound heterozygous contiguous exon deletions in the dystrophin gene. She exhibited Gowers' sign, calf muscle hypertrophy, and a high serum creatine kinase level at 2 years. Her muscle pathology showed most of the fibers were negative for dystrophin immunohistochemical staining. She lost ambulation at 11 years. Multiplex ligation-dependent probe amplification analysis of this gene detected one copy of exons 48-53; she was found to be a BMD carrier with an in-frame deletion. Messenger RNA from her muscle demonstrated out-of-frame deletions of exons 48-50 and 51-53 occurring on separate alleles. Genomic DNA from her lymphocytes demonstrated the accurate deletion region on each allele. To our knowledge, this is the first report on a female patient possessing compound heterozygous contiguous exon deletions in the dystrophin gene, leading to DMD. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Juvenile Moyamoya and Craniosynostosis in a Child with Deletion 1p32p31: Expanding the Clinical Spectrum of 1p32p31 Deletion Syndrome and a Review of the Literature

    Directory of Open Access Journals (Sweden)

    Paolo Prontera

    2017-09-01

    Full Text Available Moyamoya angiopathy (MA is a rare cerebrovascular disorder characterised by the progressive occlusion of the internal carotid artery. Its aetiology is uncertain, but a genetic background seems likely, given the high MA familial rate. To investigate the aetiology of craniosynostosis and juvenile moyamoya in a 14-year-old male patient, we performed an array-comparative genomic hybridisation revealing a de novo interstitial deletion of 8.5 Mb in chromosome region 1p32p31. The deletion involved 34 protein coding genes, including NF1A, whose haploinsufficiency is indicated as being mainly responsible for the 1p32-p31 chromosome deletion syndrome phenotype (OMIM 613735. Our patient also has a deleted FOXD3 of the FOX gene family of transcription factors, which plays an important role in neural crest cell growth and differentiation. As the murine FOXD3−/− model shows craniofacial anomalies and abnormal common carotid artery morphology, it can be hypothesised that FOXD3 is involved in the pathogenesis of the craniofacial and vascular defects observed in our patient. In support of our assumption, we found in the literature another patient with a syndromic form of MA who had a deletion involving another FOX gene (FOXC1. In addition to describing the clinical history of our patient, we have reviewed all of the available literature concerning other patients with a 1p32p31 deletion, including cases from the Decipher database, and we have also reviewed the genetic disorders associated with MA, which is a useful guide for the diagnosis of syndromic form of MA.

  11. The del(2)(q32.2q33) deletion syndrome defined by clinical and molecular characterization of four patients.

    NARCIS (Netherlands)

    Buggenhout, G.J.C.M. van; Ravenswaaij-Arts, C.M.A. van; Maas, N.; Thoelen, R.; Vogels, A.; Smeets, D.F.C.M.; Salden, I.; Matthijs, G.; Fryns, J.P.; Vermeesch, J.

    2005-01-01

    We report four patients with an interstitial deletion of chromosome 2q32-->2q33. They presented similar clinical findings including pre- and postnatal growth retardation, distinct facial dysmorphism, thin and sparse hair and fair built, micrognathia, cleft or high palate, relative macroglossia,

  12. Norrie disease resulting from a gene deletion: clinical features and DNA studies.

    OpenAIRE

    Donnai, D; Mountford, R C; Read, A P

    1988-01-01

    We describe a family in which two boys with Norrie disease have a deletion of the DXS7 locus. The deletion does not extend as far distally as the OTC or DXS84 loci. A full clinical description of the patients is given to help establish the range of manifestations of Norrie disease. There is no evidence of any other X linked disease in our patients.

  13. Norrie disease resulting from a gene deletion: clinical features and DNA studies.

    Science.gov (United States)

    Donnai, D; Mountford, R C; Read, A P

    1988-02-01

    We describe a family in which two boys with Norrie disease have a deletion of the DXS7 locus. The deletion does not extend as far distally as the OTC or DXS84 loci. A full clinical description of the patients is given to help establish the range of manifestations of Norrie disease. There is no evidence of any other X linked disease in our patients.

  14. A Rare Syndrome of Deletion in 2 Siblings

    Directory of Open Access Journals (Sweden)

    Aravindhan Veerapandiyan MBBS

    2017-08-01

    Full Text Available The Glutamate receptor, ionotropic, delta 2 gene codes for an ionotropic glutamate delta-2 receptor, which is selectively expressed in cerebellar Purkinje cells, and facilitates cerebellar synapse organization and transmission. The phenotype associated with the deletion of Glutamate receptor, ionotropic, delta 2 gene in humans was initially defined in 2013. In this case report, the authors describe 2 brothers who presented with developmental delay, tonic upward gaze, nystagmus, oculomotor apraxia, hypotonia, hyperreflexia, and ataxia. They were found to have a homozygous intragenic deletion within the Glutamate receptor, ionotropic, delta 2 gene at exon 2. Our patients serve as an addition to the literature of previously reported children with this rare clinical syndrome associated with Glutamate receptor, ionotropic, delta 2 deletion.

  15. 9q22 Deletion - First Familial Case

    Directory of Open Access Journals (Sweden)

    Yamamoto Toshiyuki

    2011-06-01

    Full Text Available Abstract Background Only 29 cases of constitutional 9q22 deletions have been published and all have been sporadic. Most associate with Gorlin syndrome or nevoid basal cell carcinoma syndrome (NBCCS, MIM #109400 due to haploinsufficiency of the PTCH1 gene (MIM *601309. Methods and Results We report two mentally retarded female siblings and their cognitively normal father, all carrying a similar 5.3 Mb microdeletion at 9q22.2q22.32, detected by array CGH (244 K. The deletion does not involve the PTCH1 gene, but instead 30 other gene,s including the ROR2 gene (MIM *602337 which causing both brachydactyly type 1 (MIM #113000 and Robinow syndrome (MIM #268310, and the immunologically active SYK gene (MIM *600085. The deletion in the father was de novo and FISH analysis of blood lymphocytes did not suggest mosaicism. All three patients share similar mild dysmorphic features with downslanting palpebral fissures, narrow, high bridged nose with small nares, long, deeply grooved philtrum, ears with broad helix and uplifted lobuli, and small toenails. All have significant dysarthria and suffer from continuous middle ear and upper respiratory infections. The father also has a funnel chest and unilateral hypoplastic kidney but the daughters have no malformations. Conclusions This is the first report of a familial constitutional 9q22 deletion and the first deletion studied by array-CGH which does not involve the PTCH1 gene. The phenotype and penetrance are variable and the deletion found in the cognitively normal normal father poses a challenge in genetic counseling.

  16. SNORD116 deletions cause Prader-Willi syndrome with a mild phenotype and macrocephaly.

    Science.gov (United States)

    Fontana, P; Grasso, M; Acquaviva, F; Gennaro, E; Galli, M L; Falco, M; Scarano, F; Scarano, G; Lonardo, F

    2017-10-01

    Prader-Willi syndrome is a complex condition caused by lack of expression of imprinted genes in the paternally derived region of chromosome 15 (15q11q13). A small number of patients with Prader-Willi phenotype have been discovered to have narrow deletions, not encompassing the whole critical region, but only the SNORD116 cluster, which includes genes codifying for small nucleolar RNAs. This kind of deletion usually is not detected by the classic DNA methylation analysis test. We present the case of a male patient with a mild Prader-Willi phenotype and a small deletion including SNORD116, diagnosed by methylation-sensitive multiplex ligation-dependent probe amplification (MLPA. The patient showed neonatal hypotonia, hyperphagia, obesity, central hypogonadism, hypothyroidism, strabismus. Stature and intellectual development are within the normal range. The presence of macrocephaly, observed in other cases of SNORD116 deletions as well, is uncommon for the classic phenotype of the syndrome. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  17. 17q12 Deletion in a patient with Williams syndrome: Case report and review of the literature

    OpenAIRE

    Cohen, Lilian; Samanich, Joy; Pan, Quilu; Mehta, Lakshmi; Marion, Robert

    2012-01-01

    Williams syndrome (WS) is a complex genomic disorder entailing distinctive facial dysmorphism, cardiovascular abnormalities, intellectual disabilities, unusual behavioral features, and a specific cognitive profile with considerable variability. Additional symptoms include endocrine abnormalities, renal anomalies and connective tissue disorders. We report a monozygotic twin patient with WS who presented with multicystic kidneys in the newborn period, and, in addition to the typical WS deletion...

  18. Retrospective analysis in oculocutaneous albinism patients for the 2.7 kb deletion in the OCA2 gene revealed a co-segregation of the controversial variant, p.R305W.

    Science.gov (United States)

    Gao, Jackson; D'Souza, Leera; Wetherby, Keith; Antolik, Christian; Reeves, Melissa; Adams, David R; Tumminia, Santa; Wang, Xinjing

    2017-01-01

    Oculocutaneous albinism (OCA) is an autosomal recessive disorder. A significant portion of OCA patients has been found with a single pathogenic variant either in the TYR or the OCA2 gene. Diagnostic sequencing of the TYR and OCA2 genes is routinely used for molecular diagnosis of OCA subtypes. To study the possibility that genomic abnormalities with single or multiple exon involvement may account for a portion of the potential missing pathogenic variants (the second), we retrospectively analyzed the TYR gene by long range PCR and analyzed the target 2.7 kb deletion in the OCA2 gene spanning exon 7 in OCA patients with a single pathogenic variant in the target genes. In the 108 patients analyzed, we found that one patient was heterozygous for the 2.7 kb OCA2 gene deletion and this patient was positive with one pathogenic variant and one possibly pathogenic variant [c.1103C>T (p.Ala368Val) + c.913C>T (p.R305W)]. Further analysis of maternal DNA, and two additional OCA DNA homozygous for the 2.7 kb deletion, revealed that the phenotypically normal mother is heterozygous of the 2.7 kb deletion and homozygous of the p.R305W. The two previously reported patients with homozygous of the 2.7 kb deletion are also homozygous of p.R305W. Among the reported pathogenic variants, the pathogenicity of the p.R305W has been discussed intensively in literature. Our results indicate that p.R305W is unlikely a pathogenic variant. The possibility of linkage disequilibrium between p.R305W with the 2.7 kb deletion in OCA2 gene is also suggested.

  19. Deletion Mutagenesis and Identification of Causative Mutations in Maize.

    Science.gov (United States)

    Jia, Shangang; Li, Aixia; Zhang, Chi; Holding, David

    2018-01-01

    We describe a method for gamma-irradiation of mature maize seeds to generate mutants with opaque endosperm and reduced kernel fill phenotypes. We also describe methods for mapping mutants and identifying causal gene mutations. Using this method, a population of 1788M2 families and 47 Mo17 × F2s showing stable, segregating, and viable kernel phenotypes was developed. For molecular characterization of the mutants, we utilized a novel functional genomics platform that combines separate Bulked Segregant RNA and exome sequencing data sets (BSREx-seq) to map causative mutations and identify candidate genes within mapping intervals. We also describe the use of exome capture sequencing of F2 mutant and normal pools to perform mapping and candidate gene identification without the need for separate RNA-seq (BSEx-seq). To exemplify the utility of the deletion mutants for functional genomics and provide proof-of-concept for the bioinformatics platform, we summarize the identification of the causative deletion in two mutants. Mutant 937, which was characterized by BSREx-seq, harbors a 6203-bp in-frame deletion covering six exons within the Opaque-1 gene on chromosome 4. Preliminary investigation of opaque mutant 1486 with BSEx-seq shows a tight mapping interval and associated deletion on chromosome 10.

  20. Comparative genome analysis identifies two large deletions in the genome of highly-passaged attenuated Streptococcus agalactiae strain YM001 compared to the parental pathogenic strain HN016.

    Science.gov (United States)

    Wang, Rui; Li, Liping; Huang, Yan; Luo, Fuguang; Liang, Wanwen; Gan, Xi; Huang, Ting; Lei, Aiying; Chen, Ming; Chen, Lianfu

    2015-11-04

    Streptococcus agalactiae (S. agalactiae), also known as group B Streptococcus (GBS), is an important pathogen for neonatal pneumonia, meningitis, bovine mastitis, and fish meningoencephalitis. The global outbreaks of Streptococcus disease in tilapia cause huge economic losses and threaten human food hygiene safety as well. To investigate the mechanism of S. agalactiae pathogenesis in tilapia and develop attenuated S. agalactiae vaccine, this study sequenced and comparatively analyzed the whole genomes of virulent wild-type S. agalactiae strain HN016 and its highly-passaged attenuated strain YM001 derived from tilapia. We performed Illumina sequencing of DNA prepared from strain HN016 and YM001. Sequencedreads were assembled and nucleotide comparisons, single nucleotide polymorphism (SNP) , indels were analyzed between the draft genomes of HN016 and YM001. Clustered regularly interspaced short palindromic repeats (CRISPRs) and prophage were detected and analyzed in different S. agalactiae strains. The genome of S. agalactiae YM001 was 2,047,957 bp with a GC content of 35.61 %; it contained 2044 genes and 88 RNAs. Meanwhile, the genome of S. agalactiae HN016 was 2,064,722 bp with a GC content of 35.66 %; it had 2063 genes and 101 RNAs. Comparative genome analysis indicated that compared with HN016, YM001 genome had two significant large deletions, at the sizes of 5832 and 11,116 bp respectively, resulting in the deletion of three rRNA and ten tRNA genes, as well as the deletion and functional damage of ten genes related to metabolism, transport, growth, anti-stress, etc. Besides these two large deletions, other ten deletions and 28 single nucleotide variations (SNVs) were also identified, mainly affecting the metabolism- and growth-related genes. The genome of attenuated S. agalactiae YM001 showed significant variations, resulting in the deletion of 10 functional genes, compared to the parental pathogenic strain HN016. The deleted and mutated functional genes all

  1. Unusual Presentation of Pelizaeus-Merzbacher Disease: Female Patient with Deletion of the Proteolipid Protein 1 Gene

    Directory of Open Access Journals (Sweden)

    Teva Brender

    2015-01-01

    Full Text Available Pelizaeus-Merzbacher disease (PMD is neurodegenerative leukodystrophy caused by dysfunction of the proteolipid protein 1 (PLP1 gene on Xq22, which codes for an essential myelin protein. As an X-linked condition, PMD primarily affects males; however there have been a small number of affected females reported in the medical literature with a variety of different mutations in this gene. No affected females to date have a deletion like our patient. In addition to this, our patient has skewed X chromosome inactivation which adds to her presentation as her unaffected mother also carries the mutation.

  2. A recurrent deletion mutation in OPA1 causes autosomal dominant optic atrophy in a Chinese family

    Science.gov (United States)

    Zhang, Liping; Shi, Wei; Song, Liming; Zhang, Xiao; Cheng, Lulu; Wang, Yanfang; Ge, Xianglian; Li, Wei; Zhang, Wei; Min, Qingjie; Jin, Zi-Bing; Qu, Jia; Gu, Feng

    2014-11-01

    Autosomal dominant optic atrophy (ADOA) is the most frequent form of hereditary optic neuropathy and occurs due to the degeneration of the retinal ganglion cells. To identify the genetic defect in a family with putative ADOA, we performed capture next generation sequencing (CNGS) to screen known retinal disease genes. However, six exons failed to be sequenced by CNGS in optic atrophy 1 gene (OPA1). Sequencing of those exons identified a 4 bp deletion mutation (c.2983-1_2985del) in OPA1. Furthermore, we sequenced the transcripts of OPA1 from the patient skin fibroblasts and found there is six-nucleotide deletion (c.2984-c.2989, AGAAAG). Quantitative-PCR and Western blotting showed that OPA1 mRNA and its protein expression have no obvious difference between patient skin fibroblast and control. The analysis of protein structure by molecular modeling suggests that the mutation may change the structure of OPA1 by formation of an alpha helix protruding into an existing pocket. Taken together, we identified an OPA1 mutation in a family with ADOA by filling the missing CNGS data. We also showed that this mutation affects the structural intactness of OPA1. It provides molecular insights for clinical genetic diagnosis and treatment of optic atrophy.

  3. Refinement of the deletion in 8q22.2-q22.3: the minimum deletion size at 8q22.3 related to intellectual disability and epilepsy.

    Science.gov (United States)

    Kuroda, Yukiko; Ohashi, Ikuko; Saito, Toshiyuki; Nagai, Jun-ichi; Ida, Kazumi; Naruto, Takuya; Iai, Mizue; Kurosawa, Kenji

    2014-08-01

    Kuechler et al. [2011] reported five patients with interstitial deletions in 8q22.2-q22.3 who had intellectual disability, epilepsy, and dysmorphic features. We report on a new patient with the smallest overlapping de novo deletion in 8q22.3 and refined the phenotype. The proposita was an 8-year-old girl, who developed seizures at 10 months, and her epileptic seizure became severe and difficult to control with antiepileptic drugs. She also exhibited developmental delay and walked alone at 24 months. She was referred to us for evaluation for developmental delay and epilepsy at the age of 8 years. She had intellectual disability (IQ 37 at 7 years) and autistic behavior, and spoke two word sentences at 8 years. She had mild dysmorphic features, including telecanthus and thick vermilion of the lips. Array comparative genomic hybridization detected a 1.36 Mb deletion in 8q22.3 that encompassed RRM2B and NCALD, which encode the small subunit of p53-inducible ribonucleotide reductase and neurocalcin delta in the neuronal calcium sensor family of calcium-binding proteins, respectively. The minimum overlapping region between the present and previously reported patients is considered to be a critical region for the phenotype of the deletion in 8q22.3. We suggest that the deletion in 8q22.3 may represent a clinically recognizable condition, which is characterized by intellectual disability and epilepsy. © 2014 Wiley Periodicals, Inc.

  4. Molecular studies of deletions at the human steroid sulfatase locus

    International Nuclear Information System (INIS)

    Shapiro, L.J.; Yen, P.; Pomerantz, D.; Martin, E.; Rolewic, L.; Mohandas, T.

    1989-01-01

    The human steroid sulfatase gene (STS) is located on the distal X chromosome short arm close to the pseudoautosomal region but in a segment of DNA that is unique to the X chromosome. In contrast to most X chromosome-encoded genes, STS expression is not extinguished during the process of X chromosome inactivation. Deficiency of STS activity produced the syndrome of X chromosome-linked ichthyosis, which is one of the most common inborn errors of metabolism in man. Approximately 90% of STS - individuals have large deletions at the STS locus. The authors and others have found that the end points of such deletions are heterogeneous in their location. One recently ascertained subject was observed to have a 40-kilobase deletion that is entirely intragenic, permitting the cloning and sequencing of the deletion junction. Studies of this patient and of other X chromosome sequences in other subjects permit some insight into the mechanism(s) responsible for generating frequent deletions on the short arm of the X chromosome

  5. IKZF1 DELETIONS ARE INDEPENDENT PROGNOSTIC FACTOR IN PEDIATRIC B-CELL PRECURSOR ACUTE LYMPHOBLASTIC LEUKEMIA

    Directory of Open Access Journals (Sweden)

    G. A. Tsaur

    2016-01-01

    Full Text Available We assessed the prognostic significance of IKZF1 gene deletions in 141 pediatric patients with B-cell precursor acute lymphoblastic leukemia (BCP-ALL  on Russian multicenter trial in pediatric clinics of Ekaterinburg and Orenburg. IKZF1 deletions were estimated by multiplex ligation-dependent probe amplification. IKZF1 deletions were revealed in 15 (10.6 % patients. IKZF1 deletions were associated with age older than 10 years (p = 0.007, initial white blood cell count higher than 30 × 109/l (p = 0.003, t(9;22(q34.q11 (p = 0.003 and delayed blast clearance: М3 status of bone marrow at day 15 of remission induction (p = 0.003, lack of hematological remission at day 36 (p < 0.001 and high levels of minimal residual disease at days 15, 36 and 85 (p = 0.014; p < 0.001; p = 0.001 correspondingly. Patients with IKZF1 deletions had significantly lower event-free survival (EFS (0.30 ± 0.15 vs 0.89 ± 0.03; p < 0.001 and overall survival (OS (0.44 ± 0.19 vs 0.93 ± 0.02; p < 0.001, while cumulative incidence of relapse was higher (0.67 ± 0.18 vs 0.07 ± 0.02; p < 0.001. In the multivariate analysis IKZF1 deletions were associated with decreased EFS (hazard ratio (HR 4.755; 95 % confidence interval (CI 1.856–12.185; p = 0.001, and OS (HR 4.208; 95 % CI 1.322–13.393; p = 0.015, but increased relapse risk (HR 9,083; 95 % CI 3.119–26.451; p < 0.001. IKZF1 deletions retained their prognostic significance in the intermediate risk group patients (p < 0.001, but not in standard or high-risk groups. Majority of IKZF1 deletions – 12 (80 % of 15 – were revealed in the “B-other” group (n = 83. In this cohort of patients IKZF1 deletions led to inferior EFS (HR 6.172; 95 % CI 1.834–20.767; p = 0.003 and higher relapse rate (HR 16.303; 95 % CI 3.324–79.965; p = 0.015. Thus, our results showed that IKZF1 deletions are independent risk factor in BCP-ALL patients.

  6. An Interstitial 4q Deletion with a Mosaic Complementary Ring Chromosome in a Child with Dysmorphism, Linear Skin Pigmentation, and Hepatomegaly

    Directory of Open Access Journals (Sweden)

    J. Carter

    2017-01-01

    Full Text Available Interstitial deletions of 4q are rarely reported, vary in size, and have limited genotype-phenotype correlations. Here, genome-wide array CGH analysis identified a 21.6 Mb region of copy number loss at 4q12-q21.1 in a patient diagnosed with dysmorphism, linear skin pigmentation, and hepatomegaly. An additional small ring chromosome was detected in 5/30 cells examined via G-banding. Confirmation of the origin of the ring chromosome was obtained by FISH analysis which identified that the ring chromosome contained material from the deleted region of chromosome 4 and was therefore complementary to the 21.6 Mb deletion. Further microarray studies in the proband using a different microarray platform showed no evidence of mosaicism. This case highlights the importance of an integrated approach to cytogenetic analysis and demonstrates the value of G-banding for detecting mosaicism, as current microarray platforms are unable to detect low level mosaics.

  7. A novel small deletion in the NHS gene associated with Nance-Horan syndrome

    OpenAIRE

    Li, Huajin; Yang, Lizhu; Sun, Zixi; Yuan, Zhisheng; Wu, Shijing; Sui, Ruifang

    2018-01-01

    Nance-Horan syndrome is a rare X-linked recessive inherited disease with clinical features including severe bilateral congenital cataracts, characteristic facial and dental abnormalities. Data from Chinese Nance-Horan syndrome patients are limited. We assessed the clinical manifestations of a Chinese Nance-Horan syndrome pedigree and identified the genetic defect. Genetic analysis showed that 3 affected males carried a novel small deletion in NHS gene, c.263_266delCGTC (p.Ala89TrpfsTer106), a...

  8. Mutation spectrum of Chinese patients with Bartter syndrome.

    Science.gov (United States)

    Han, Yue; Lin, Yi; Sun, Qing; Wang, Shujuan; Gao, Yanxia; Shao, Leping

    2017-11-24

    Bartter syndrome (BS) has been rarely reported in Chinese population except for a few case reports. This investigation was aimed to analyze the mutations of the causal genes in sixteen Chinese patients with BS, and review their followup and treatment. Identify mutations by the next generation sequencing and the multiplex ligation-dependent probe amplification (MLPA). Clinical characteristics and biochemical findings at the first presentation as well as follow-up were reviewed. 15 different CLCNKB gene mutations were identified in fourteen patients with BS, including 11 novel ones. A novel missense mutation and a novel small deletion were found from SLC12A1 gene. A novel gross deletion was found in CLCNKA gene. A recurrent missense mutation was identified from BSND gene. We found that the whole gene deletion mutation of CLCNKB gene was the most frequent mutation (32%), and the rate of gross deletion was up to 50 percent in this group of Chinese patients. The present study has found 19 mutations, including 14 novel ones, which would enrich the human gene mutation database (HGMD) and provide valuable references to the genetic counseling and diagnosis of the Chinese population.

  9. Exonal deletion of SLC24A4 causes hypomaturation amelogenesis imperfecta.

    Science.gov (United States)

    Seymen, F; Lee, K-E; Tran Le, C G; Yildirim, M; Gencay, K; Lee, Z H; Kim, J-W

    2014-04-01

    Amelogenesis imperfecta is a heterogeneous group of genetic conditions affecting enamel formation. Recently, mutations in solute carrier family 24 member 4 (SLC24A4) have been identified to cause autosomal recessive hypomaturation amelogenesis imperfecta. We recruited a consanguineous family with hypomaturation amelogenesis imperfecta with generalized brown discoloration. Sequencing of the candidate genes identified a 10-kb deletion, including exons 15, 16, and most of the last exon of the SLC24A4 gene. Interestingly, this deletion was caused by homologous recombination between two 354-bp-long homologous sequences located in intron 14 and the 3' UTR. This is the first report of exonal deletion in SLC24A4 providing confirmatory evidence that the function of SLC24A4 in calcium transport has a crucial role in the maturation stage of amelogenesis.

  10. Dysphagia is prevalent in patients with CPEO and single, large-scale deletions in mtDNA

    DEFF Research Database (Denmark)

    Pedersen, Gitte Hedermann; Løkken, Nicoline; Dahlqvist, Julia R.

    2017-01-01

    Background  The aim of this study was to assess the frequency of subjective and objective dysphagia in patients with chronic progressive external ophthalmoplegia (CPEO) due to single, large-scale deletions (LSDs) of mitochondrial DNA (mtDNA). Methods  Sixteen patients with CPEO and single LSDs...... and single LSDs of mtDNA had a prolonged cold-water test, including one with a PEG-tube, who was unable to perform the test, and nine patients reported subjective swallowing problems (56.3%). All mitochondrial myopathy patients in the control group had a normal duration of the cold-water test.  Conclusions......  The study shows that dysphagia is a common problem in patients with CPEO and LSDs of mtDNA. Dysphagia seems to be progressive with age as abnormal swallowing occurred preferentially in persons ≥ 45 years. The study shows that increased awareness of this symptom should be given to address appropriate...

  11. What Can We Learn From Point-of-Care Blood Glucose Values Deleted and Repeated by Nurses?

    Science.gov (United States)

    Corl, Dawn; Yin, Tom; Ulibarri, May; Lien, Heather; Tylee, Tracy; Chao, Jing; Wisse, Brent E

    2018-03-01

    Hospitals rely on point-of-care (POC) blood glucose (BG) values to guide important decisions related to insulin administration and glycemic control. Evaluation of POC BG in hospitalized patients is associated with measurement and operator errors. Based on a previous quality improvement (QI) project we introduced an option for operators to delete and repeat POC BG values suspected as erroneous. The current project evaluated our experience with deleted POC BG values over a 2-year period. A retrospective QI project included all patients hospitalized at two regional academic medical centers in the Pacific Northwest during 2014 and 2015. Laboratory Medicine POC BG data were reviewed to evaluate all inpatient episodes of deleted and repeated POC BG. Inpatient operators choose to delete and repeat only 0.8% of all POC BG tests. Hypoglycemic and extreme hyperglycemic BG values are more likely to be deleted and repeated. Of initial values values (18% of all values) are errors. Of values >400 mg/dL, 40% of deleted values (5% of all values) are errors. Not all repeated POC BG values are first deleted. Optimal use of the option to delete and repeat POC BG values values that are measurement/operator errors. Eliminating these errors significantly reduces documented rates of severe hypoglycemia and hyperglycemia, and has the potential to improve patient safety.

  12. Contiguous deletion of the NDP, MAOA, MAOB, and EFHC2 genes in a patient with Norrie disease, severe psychomotor retardation and myoclonic epilepsy.

    Science.gov (United States)

    Rodriguez-Revenga, L; Madrigal, I; Alkhalidi, L S; Armengol, L; González, E; Badenas, C; Estivill, X; Milà, M

    2007-05-01

    Norrie disease (ND) is an X-linked disorder, inherited as a recessive trait that, therefore, mostly affects males. The gene responsible for ND, called NDP, maps to the short arm of chromosome X (Xp11.4-p11.3). We report here an atypical case of ND, consisting of a patient harboring a large submicroscopic deletion affecting not only the NDP gene but also the MAOA, MAOB, and EFHC2 genes. Microarray comparative genomic hybridization (CGH) analysis showed that 11 consecutive bacterial artificial chromosome (BAC) clones, mapping around the NDP gene, were deleted. These clones span a region of about 1 Mb on Xp11.3. The deletion was ascertained by fluorescent in situ hybridization (FISH) analysis with different BAC clones located within the region. Clinical features of the proband include bilateral retinal detachment, microcephaly, severe psychomotor retardation without verbal language skills acquired, and epilepsy. The identification and molecular characterization of this case reinforces the idea of a new contiguous gene syndrome that would explain the complex phenotype shared by atypical ND patients.

  13. High frequency of exon 15 deletion in the FANCA gene in Tunisian patients affected with Fanconi anemia disease: implication for diagnosis.

    Science.gov (United States)

    Amouri, Ahlem; Talmoudi, Faten; Messaoud, Olfa; d'Enghien, Catherine D; Rekaya, Mariem B; Allegui, Ines; Azaiez, Héla; Kefi, Rym; Abdelhak, Ahlem; Meseddi, Sondes H; Torjemane, Lamia; Ouederni, Monia; Mellouli, Fethi; Abid, Héla B; Aissaoui, Lamia; Bejaoui, Mohamed; Othmen, Tarek B; Lyonnet, Dominique S; Soulier, Jean; Hachicha, Mongia; Dellagi, Koussay; Abdelhak, Sonia; Fanconi, Tunisian

    2014-03-01

    Tunisian population is characterized by its heterogeneous ethnic background and high rate of consanguinity. In consequence, there is an increase in the frequency of recessive genetic disorders including Fanconi anemia (FA). The aim of this study was to confirm the existence of a founder haplotype among FA Tunisian patients and to identify the associated mutation in order to develop a simple tool for FA diagnosis. Seventy-four unrelated families with a total of 95 FA patients were investigated. All available family members were genotyped with four microsatellite markers flanking FANCA gene. Haplotype analysis and homozygosity mapping assigned 83 patients belonging to 62 families to the FA-A group. A common haplotype was shared by 42 patients from 26 families at a homozygous state while five patients from five families were heterozygous. Among them, 85% were from southern Tunisia suggesting a founder effect. Using multiplex ligation-dependent probe amplification (MLPA) technique, we have also demonstrated that this haplotype is associated with a total deletion of exon 15 in FANCA gene. Identification of a founder mutation allowed genetic counseling in relatives of these families, better bone marrow graft donor selection and prenatal diagnosis. This mutation should be investigated in priority for patients originating from North Africa and Middle East.

  14. Analysis of human HPRT- deletion mutants by the microarray-CGH (comparative genomic hybridization)

    International Nuclear Information System (INIS)

    Kodaira, M.; Sasaki, K.; Tagawa, H.; Omine, H.; Kushiro, J.; Takahashi, N.; Katayama, H.

    2003-01-01

    We are trying to evaluate genetic effects of radiation on human using mutation frequency as an indicator. For the efficient detection of mutations, it is important to understand the mechanism and the characteristics of radiation-induced mutations. We have started the analysis of hypoxanthine-guanine phosphoribosyl transferase (HPRT) mutants induced by X-ray in order to clarify the deletion size and the mutation-distribution. We analyzed 39 human X-ray induced HPRT-deletion mutants by using the microarray-CGH. The array for this analysis contains 57 BAC clones covering as much as possible of the 4Mb of the 5' side and 10Mb of the 3' side of the HPRT gene based on the NCBI genome database. DNA from parent strain and each HPRT-mutant strain are labeled with Cy5 and Cy3 respectively, and were mixed and hybridized on the array. Fluorescent intensity ratio of the obtained spots was analyzed using software we developed to identify clones corresponding to the deletion region. The deletion in these strains ranged up to 3.5 Mb on the 5' side and 6 Mb on the 3' side of the HPRT gene. Deletions in 13 strains ended around BAC clones located at about 3 Mb on the 5' side. On the 3' side, deletions extended up to the specific clones located at 1.5 Mb in 11 strains. The mutations seem to be complex on the 3' end of deletion; some accompanied duplications with deletions and others could not be explained by one mutation event. We need to confirm these results, taking into account the experimental reproducibility and the accuracy of the published genetic map. The results of the research using the microarray-CGH help us to search the regions where deletions are easily induced and to identify the factors affecting the range of deletions

  15. Muscle hypertrophy as the presenting sign in a patient with a complete FHL1 deletion.

    Science.gov (United States)

    Willis, T A; Wood, C L; Hudson, J; Polvikoski, T; Barresi, R; Lochmüller, H; Bushby, K; Straub, V

    2016-08-01

    Four and a half LIM protein 1 (FHL1/SLIM1) has recently been identified as the causative gene mutated in four distinct diseases affecting skeletal muscle that have overlapping features, including reducing body myopathy, X-linked myopathy, X-linked dominant scapuloperoneal myopathy and Emery-Dreifuss muscular dystrophy. FHL1 localises to the sarcomere and the sarcolemma and is believed to participate in muscle growth and differentiation as well as in sarcomere assembly. We describe in this case report a boy with a deletion of the entire FHL1 gene who is now 15 years of age and presented with muscle hypertrophy, reduced subcutaneous fat, rigid spine and short stature. This case is the first, to our knowledge, with a complete loss of the FHL1 protein and MAP7D3 in combination. It supports the theory that dominant negative effects (accumulation of cytotoxic-mutated FHL1 protein) worsen the pathogenesis. It extends the phenotype of FHL1-related myopathies and should prompt future testing in undiagnosed patients who present with unexplained muscle hypertrophy, contractures and rigid spine, particularly if male. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  16. Analysis of large deletions in BRCA1, BRCA2 and PALB2 genes in Finnish breast and ovarian cancer families

    International Nuclear Information System (INIS)

    Pylkäs, Katri; Erkko, Hannele; Nikkilä, Jenni; Sólyom, Szilvia; Winqvist, Robert

    2008-01-01

    BRCA1 and BRCA2 are the two most important genes associated with familial breast and ovarian cancer susceptibility. In addition, PALB2 has recently been identified as a breast cancer susceptibility gene in several populations. Here we have evaluated whether large genomic rearrangement in these genes could explain some of Finnish breast and/or ovarian cancer families. Altogether 61 index patients of Northern Finnish breast and/or ovarian cancer families were analyzed by Multiplex ligation-dependent probe amplification (MLPA) method in order to identify exon deletions and duplications in BRCA1, BRCA2 and PALB2. The families have been comprehensively screened for germline mutation in these genes by conventional methods of mutation analysis and were found negative. We identified one large deletion in BRCA1, deleting the most part of the gene (exon 1A-13) in one family with family history of ovarian cancer. No large genomic rearrangements were identified in either BRCA2 or PALB2. In Finland, women eligible for BRCA1 or BRCA2 mutation screening, when found negative, could benefit from screening for large genomic rearrangements at least in BRCA1. On the contrary, the genomic rearrangements in PALB2 seem not to contribute to the hereditary breast cancer susceptibility

  17. Partial Gene Deletions of PMP22 Causing Hereditary Neuropathy with Liability to Pressure Palsies

    Directory of Open Access Journals (Sweden)

    Sun-Mi Cho

    2014-01-01

    Full Text Available Hereditary neuropathy with liability to pressure palsies (HNPP is an autosomal neuropathy that is commonly caused by a reciprocal 1.5 Mb deletion on chromosome 17p11.2, at the site of the peripheral myelin protein 22 (PMP22 gene. Other patients with similar phenotypes have been shown to harbor point mutations or small deletions, although there is some clinical variation across these patients. In this report, we describe a case of HNPP with copy number changes in exon or promoter regions of PMP22. Multiplex ligation-dependent probe analysis revealed an exon 1b deletion in the patient, who had been diagnosed with HNPP in the first decade of life using molecular analysis.

  18. R3-R4 deletion in the PRNP gene is associated with Creutzfeldt-Jakob disease (CJD)

    Energy Technology Data Exchange (ETDEWEB)

    Cervenakova, L.; Brown, P.; Nagle, J. [and others

    1994-09-01

    There are conflicting reports on the association of deletions in the PRNP gene on chromosome 20 with CJD, a rapidly progressive fatal spongiform encephalopathy. We accumulated data suggesting that a deletion of R3-R4 type (parts of the third and fourth repeats are deleted from the area of four repeating 24 bp sequences in the 5{prime} region of the gene) is causing CJD. Screening of 129 unaffected control individuals demonstrated presence of a deletion of R2 type in four (1.55% of the studied chromosomes), but none of them had the R3-R4 type. Of 181 screened patients with spongiform encephalopathies, two had a deletion of R3-R4 type with no other mutations in the coding sequence. Both patients had a classical rapidly progressive dementing disease and diffuse spongiform degeneration, and both cases were apparently sporadic. The same R3-R4 type of deletion was detected in three additional neuropathologically confirmed spongiform encephalopathy patients, of which two had other known pathogenic mutations in the PRNP gene: at codon 178 on the methionine allele exhibiting the phenotype of fatal familial insomnia, and codon 200 causing CJD with severe dementia; the third was a patient with iatrogenic CJD who developed the disease after treatment with growth hormone extracted from cadaveric human pituitary glands. In all cases the deletion coincided with a variant sequence at position 129 coding for methionine.

  19. Intronic deletions in the SLC34A3 gene: A cautionary tale for mutation analysis of hereditary hypophosphatemic rickets with hypercalciuria

    Science.gov (United States)

    Ichikawa, Shoji; Tuchman, Shamir; Padgett, Leah R.; Gray, Amie K.; Baluarte, H. Jorge; Econs, Michael J.

    2013-01-01

    Hereditary hypophosphatemic rickets with hypercalciuria (HHRH) is a rare metabolic disorder, characterized by hypophosphatemia, variable degrees of rickets/osteomalacia, and hypercalciuria secondary to increased serum 1,25-dihydroxyvitamin D [1,25(OH)2D] levels. HHRH is caused by mutations in the SLC34A3 gene, which encodes sodium-phosphate co-transporter type IIc. A 6 ½-year-old female presented with a history of nephrolithiasis. Her metabolic evaluation revealed increased 24- hour urine calcium excretion with high serum calcium, low intact parathyroid hormone (PTH) levels, and elevated 1,25(OH)2D level. In addition, the patient had low to low-normal serum phosphorus with high urine phosphorus. The patient had normal stature; without rachitic or boney deformities or a history of fractures. Genetic analysis of SLC34A3 revealed the patient to be a compound heterozygote for a novel single base pair deletion in exon 12 (c.1304delG) and 30-base pair deletion in intron 6 (g.1440–1469del). The single-base pair mutation causes a frameshift, which results in premature stop codon. The intronic deletion is likely caused by misalignment of the 4-basepair homologous repeats and results in the truncation of an already small intron to 63 bp, which would impair proper RNA splicing of the intron. This is the fourth unique intronic deletion identified in patients with HHRH, suggesting the frequent occurrence of sequence misalignments in SLC34A3 and the importance of screening introns in patients with HHRH. PMID:24176905

  20. Genome-wide copy number variation analysis identified deletions in SFMBT1 associated with fasting plasma glucose in a Han Chinese population.

    Science.gov (United States)

    Chung, Ren-Hua; Chiu, Yen-Feng; Hung, Yi-Jen; Lee, Wen-Jane; Wu, Kwan-Dun; Chen, Hui-Ling; Lin, Ming-Wei; Chen, Yii-Der I; Quertermous, Thomas; Hsiung, Chao A

    2017-08-08

    Fasting glucose and fasting insulin are glycemic traits closely related to diabetes, and understanding the role of genetic factors in these traits can help reveal the etiology of type 2 diabetes. Although single nucleotide polymorphisms (SNPs) in several candidate genes have been found to be associated with fasting glucose and fasting insulin, copy number variations (CNVs), which have been reported to be associated with several complex traits, have not been reported for association with these two traits. We aimed to identify CNVs associated with fasting glucose and fasting insulin. We conducted a genome-wide CNV association analysis for fasting plasma glucose (FPG) and fasting plasma insulin (FPI) using a family-based genome-wide association study sample from a Han Chinese population in Taiwan. A family-based CNV association test was developed in this study to identify common CNVs (i.e., CNVs with frequencies ≥ 5%), and a generalized estimating equation approach was used to test the associations between the traits and counts of global rare CNVs (i.e., CNVs with frequencies <5%). We found a significant genome-wide association for common deletions with a frequency of 5.2% in the Scm-like with four mbt domains 1 (SFMBT1) gene with FPG (association p-value = 2×10 -4 and an adjusted p-value = 0.0478 for multiple testing). No significant association was observed between global rare CNVs and FPG or FPI. The deletions in 20 individuals with DNA samples available were successfully validated using PCR-based amplification. The association of the deletions in SFMBT1 with FPG was further evaluated using an independent population-based replication sample obtained from the Taiwan Biobank. An association p-value of 0.065, which was close to the significance level of 0.05, for FPG was obtained by testing 9 individuals with CNVs in the SFMBT1 gene region and 11,692 individuals with normal copies in the replication cohort. Previous studies have found that SNPs in SFMBT1 are

  1. The fate of deleted DNA produced during programmed genomic deletion events in Tetrahymena thermophila.

    Science.gov (United States)

    Saveliev, S V; Cox, M M

    1994-01-01

    Thousands of DNA deletion events occur during macronuclear development in the ciliate Tetrahymena thermophila. In two deleted genomic regions, designated M and R, the eliminated sequences form circles that can be detected by PCR. However, the circles are not normal products of the reaction pathway. The circular forms occur at very low levels in conjugating cells, but are stable. Sequencing analysis showed that many of the circles (as many as 50% of those examined) reflected a precise deletion in the M and R regions. The remaining circles were either smaller or larger and contained varying lengths of sequences derived from the chromosomal DNA surrounding the eliminated region. The chromosomal junctions left behind after deletion were more precise, although deletions in either the M or R regions can generate any of several alternative junctions (1). Some new chromosomal junctions were detected in the present study. The results suggest that the deleted segment is released as a linear DNA species that is degraded rapidly. The species is only rarely converted to the stable circles we detect. The deletion mechanism is different from those proposed for deletion events in hypotrichous ciliates (2-4), and does not reflect a conservative site-specific recombination process such as that promoted by the bacteriophage lambda integrase (5). Images PMID:7838724

  2. Familial deletion 18p syndrome: case report

    Directory of Open Access Journals (Sweden)

    Lemyre Emmanuelle

    2006-07-01

    Full Text Available Abstract Background Deletion 18p is a frequent deletion syndrome characterized by dysmorphic features, growth deficiencies, and mental retardation with a poorer verbal performance. Until now, five families have been described with limited clinical description. We report transmission of deletion 18p from a mother to her two daughters and review the previous cases. Case presentation The proband is 12 years old and has short stature, dysmorphic features and moderate mental retardation. Her sister is 9 years old and also has short stature and similar dysmorphic features. Her cognitive performance is within the borderline to mild mental retardation range. The mother also presents short stature. Psychological evaluation showed moderate mental retardation. Chromosome analysis from the sisters and their mother revealed the same chromosomal deletion: 46, XX, del(18(p11.2. Previous familial cases were consistent regarding the transmission of mental retardation. Our family differs in this regard with variable cognitive impairment and does not display poorer verbal than non-verbal abilities. An exclusive maternal transmission is observed throughout those families. Women with del(18p are fertile and seem to have a normal miscarriage rate. Conclusion Genetic counseling for these patients should take into account a greater range of cognitive outcome than previously reported.

  3. The frequency of previously undetectable deletions involving 3' Exons of the PMS2 gene.

    Science.gov (United States)

    Vaughn, Cecily P; Baker, Christine L; Samowitz, Wade S; Swensen, Jeffrey J

    2013-01-01

    Lynch syndrome is characterized by mutations in one of four mismatch repair genes, MLH1, MSH2, MSH6, or PMS2. Clinical mutation analysis of these genes includes sequencing of exonic regions and deletion/duplication analysis. However, detection of deletions and duplications in PMS2 has previously been confined to Exons 1-11 due to gene conversion between PMS2 and the pseudogene PMS2CL in the remaining 3' exons (Exons 12-15). We have recently described an MLPA-based method that permits detection of deletions of PMS2 Exons 12-15; however, the frequency of such deletions has not yet been determined. To address this question, we tested for 3' deletions in 58 samples that were reported to be negative for PMS2 mutations using previously available methods. All samples were from individuals whose tumors exhibited loss of PMS2 immunohistochemical staining without concomitant loss of MLH1 immunostaining. We identified seven samples in this cohort with deletions in the 3' region of PMS2, including three previously reported samples with deletions of Exons 13-15 (two samples) and Exons 14-15. Also detected were deletions of Exons 12-15, Exon 13, and Exon 14 (two samples). Breakpoint analysis of the intragenic deletions suggests they occurred through Alu-mediated recombination. Our results indicate that ∼12% of samples suspected of harboring a PMS2 mutation based on immunohistochemical staining, for which mutations have not yet been identified, would benefit from testing using the new methodology. Copyright © 2012 Wiley Periodicals, Inc.

  4. A de novo 1.58 Mb deletion, including MAP2K6 and mapping 1.28 Mb upstream to SOX9, identified in a patient with Pierre Robin sequence and osteopenia with multiple fractures.

    Science.gov (United States)

    Smyk, Marta; Roeder, Elizabeth; Cheung, Sau Wai; Szafranski, Przemyslaw; Stankiewicz, Paweł

    2015-08-01

    Defects of long-range regulatory elements of dosage-sensitive genes represent an under-recognized mechanism underlying genetic diseases. Haploinsufficiency of SOX9, the gene essential for development of testes and differentiation of chondrocytes, results in campomelic dysplasia, a skeletal malformation syndrome often associated with sex reversal. Chromosomal rearrangements with breakpoints mapping up to 1.6 Mb up- and downstream to SOX9, and disrupting its distant cis-regulatory elements, have been described in patients with milder forms of campomelic dysplasia, Pierre Robin sequence, and sex reversal. We present an ∼1.58 Mb deletion mapping ∼1.28 Mb upstream to SOX9 that encompasses its putative long-range cis-regulatory element(s) and MAP2K6 in a patient with Pierre Robin sequence and osteopenia with multiple fractures. Low bone mass panel testing using massively parallel sequencing of 23 nuclear genes, including COL1A1 and COL1A2 was negative. Based on the previous mouse model of Map2k6, suggesting that Sox9 is likely a downstream target of the p38 MAPK pathway, and our previous chromosome conformation capture-on-chip (4C) data showing potential interactions between SOX9 promoter and MAP2K6, we hypothesize that deletion of MAP2K6 might have affected SOX9 expression and contributed to our patient's phenotype. © 2015 Wiley Periodicals, Inc.

  5. A de novo 11q23 deletion in a patient presenting with severe ophthalmologic findings, psychomotor retardation and facial dysmorphism.

    Science.gov (United States)

    Şimşek-Kiper, Pelin Özlem; Bayram, Yavuz; Ütine, Gülen Eda; Alanay, Yasemin; Boduroğlu, Koray

    2014-01-01

    Distal 11q deletion, previously known as Jacobsen syndrome, is caused by segmental aneusomy for the distal end of the long arm of chromosome 11. Typical clinical features include facial dysmorphism, mild-to-moderate psychomotor retardation, trigonocephaly, cardiac defects, and thrombocytopenia. There is a significant variability in the range of clinical features. We report herein a five-year-old girl with severe ophthalmological findings, facial dysmorphism, and psychomotor retardation with normal platelet function, in whom a de novo 11q23 deletion was detected, suggesting that distal 11q monosomy should be kept in mind in patients presenting with dysmorphic facial features and psychomotor retardation even in the absence of hematological findings.

  6. Periventricular nodular heterotopia and bilateral intraventricular xanthogranulomas in 22q11.2 deletion syndrome

    Directory of Open Access Journals (Sweden)

    Moogeh Baharnoori

    2017-09-01

    Full Text Available 22q11.2 deletion syndrome (22q11DS is the most common pathogenic copy number variant in humans. Neuropsychiatric phenotypes, including schizophrenia, are prominent. Imaging studies of individuals with this syndrome show a variety of abnormalities that may indicate abnormal neuronal migration. Here we present the neuroimaging and neuropathologic features of a 22q11DS patient with bilateral periventricular nodular heterotopias (PNH and intraventricular xanthogranulomas that were identified by post-mortem examination.

  7. Three patients with Wolf-Hirschhorn syndrome carrying a satellited chromosome 4p.

    Science.gov (United States)

    Liang, Desheng; Zhou, Zhongmin; Meng, Dahua; Du, Juan; Wen, Juan; Niikawa, Norio; Wu, Lingqian

    2012-07-01

    Wolf-Hirschhorn syndrome (WHS) is caused by a deletion involving the 4p16.3 region. Approximately 70% of WHS patients have a de novo isolated deletion and 22% involve unbalanced translocations. However, WHS with unbalanced rearrangements involving the short arm of an acrocentric chromosome are infrequently reported. Cytogenetic and molecular analyses by using standard G-banding, argyrophilic nucleolar organiser region (Ag-NOR) staining, fluorescence in situ hybridization, and single nucleotide polymorphism array for copy number detection were performed in three patients with WHS phenotype from two Chinese families. A heterozygous 2,767,380-bp terminal 4p deletion was detected in patients 1 and 2 and a heterozygous 5,047,291-bp terminal 4p deletion was detected in patient3. Clinical comparisons among our patients and previously reported cases have been reviewed. Two terminal 4p deletions were identified in three WHS patients with a satellited 4p and an attempt was made to refine the genotypic-phenotypic correlations of the deleted regions. Copyright © 2012 Wiley Periodicals, Inc.

  8. Induced pluripotent stem cells with a pathological mitochondrial DNA deletion

    Science.gov (United States)

    Cherry, Anne B. C.; Gagne, Katelyn E.; McLoughlin, Erin M.; Baccei, Anna; Gorman, Bryan; Hartung, Odelya; Miller, Justine D.; Zhang, Jin; Zon, Rebecca L.; Ince, Tan A.; Neufeld, Ellis J.; Lerou, Paul H.; Fleming, Mark D.; Daley, George Q.; Agarwal, Suneet

    2013-01-01

    In congenital mitochondrial DNA (mtDNA) disorders, a mixture of normal and mutated mtDNA (termed heteroplasmy) exists at varying levels in different tissues, which determines the severity and phenotypic expression of disease. Pearson marrow pancreas syndrome (PS) is a congenital bone marrow failure disorder caused by heteroplasmic deletions in mtDNA. The cause of the hematopoietic failure in PS is unknown, and adequate cellular and animal models are lacking. Induced pluripotent stem (iPS) cells are particularly amenable for studying mtDNA disorders, as cytoplasmic genetic material is retained during direct reprogramming. Here we derive and characterize iPS cells from a patient with PS. Taking advantage of the tendency for heteroplasmy to change with cell passage, we isolated isogenic PS-iPS cells without detectable levels of deleted mtDNA. We found that PS-iPS cells carrying a high burden of deleted mtDNA displayed differences in growth, mitochondrial function, and hematopoietic phenotype when differentiated in vitro, compared to isogenic iPS cells without deleted mtDNA. Our results demonstrate that reprogramming somatic cells from patients with mtDNA disorders can yield pluripotent stem cells with varying burdens of heteroplasmy that might be useful in the study and treatment of mitochondrial diseases. PMID:23400930

  9. A DNA fragment from Xq21 replaces a deleted region containing the entire FVIII gene in a severe hemophilia A patient

    Energy Technology Data Exchange (ETDEWEB)

    Murru, S.; Casula, L.; Moi, P. [Insituto di Clinica e Biologia dell` Eta Evolutiva, Cagliari (Italy)] [and others

    1994-09-15

    In this paper the authors report the molecular characterization of a large deletion that removes the entire Factor VIII gene in a severe hemophilia A patient. Accurate DNA analysis of the breakpoint region revealed that a large DNA fragment replaced the 300-kb one, which was removed by the deletion. Pulsed-field gel electrophoresis analysis revealed that the size of the inserted fragment is about 550 kb. In situ hybridization demonstrated that part of the inserted region normally maps to Xq21 and to the tip of the short arm of the Y chromosome (Yp). In this patient this locus is present both in Xq21 and in Xq28, in addition to the Yp, being thus duplicated in the X chromosome. Sequence analysis of the 3` breakpoint suggested that an illegitimate recombination is probably the cause of this complex rearrangement. 52 refs., 7 figs.

  10. Three types of preS1 start codon deletion variants in the natural course of chronic hepatitis B infection.

    Science.gov (United States)

    Choe, Won Hyeok; Kim, Hong; Lee, So-Young; Choi, Yu-Min; Kwon, So Young; Moon, Hee Won; Hur, Mina; Kim, Bum-Joon

    2017-12-12

    Naturally occurring hepatitis B virus variants carrying a deletion in the preS1 start codon region may evolve during long-lasting virus-host interactions in chronic hepatitis B (CHB). The aim of this study was to determine the immune phase-specific prevalent patterns of preS1 start codon deletion variants and related factors during the natural course of CHB. A total of 399 CHB patients were enrolled. Genotypic analysis of three different preS1 start codon deletion variants (classified by deletion size: 15-base pair [bp], 18-bp, and 21-bp deletion variants) was performed. PreS1 start codon deletion variants were detected in 155 of 399 patients (38.8%). The predominant variant was a 15-bp deletion in the immune-tolerance phase (18/50, 36%) and an 18-bp deletion in the immune-clearance phase (69/183, 37.7%). A 21-bp deletion was the predominant variant in the low replicative phase (3/25, 12.0%) and reactivated hepatitis Be antigen (HBeAg)-negative phase (22/141, 15.6%). The 15-bp and 18-bp deletion variants were more frequently found in HBeAg-positive patients (P start codon deletion variants changes according to the immune phases of CHB infection, and each variant type is associated with different clinical parameters. PreS1 start codon deletion variants might interact with the host immune response differently according to their variant types. © 2017 Journal of Gastroenterology and Hepatology Foundation and John Wiley & Sons Australia, Ltd.

  11. Solid renal tumor severity in von Hippel Lindau disease is related to germline deletion length and location.

    Science.gov (United States)

    Maranchie, Jodi K; Afonso, Anoushka; Albert, Paul S; Kalyandrug, Sivaram; Phillips, John L; Zhou, Shubo; Peterson, James; Ghadimi, Bijan M; Hurley, Katheen; Riss, Joseph; Vasselli, James R; Ried, Thomas; Zbar, Berton; Choyke, Peter; Walther, McClellan M; Klausner, Richard D; Linehan, W Marston

    2004-01-01

    von Hippel Lindau disease (VHL) is an autosomal dominant familial cancer syndrome linked to alteration of the VHL tumor suppressor gene. Affected patients are predisposed to develop pheochromocytomas and cystic and solid tumors of the kidney, CNS, pancreas, retina, and epididymis. However, organ involvement varies considerably among families and has been shown to correlate with the underlying germline alteration. Clinically, we observed a paradoxically lower prevalence of renal cell carcinoma (RCC) in patients with complete germline deletion of VHL. To determine if a relationship existed between the type of VHL deletion and disease, we retrospectively evaluated 123 patients from 55 families with large germline VHL deletions, including 42 intragenic partial deletions and 13 complete VHL deletions, by history and radiographic imaging. Each individual and family was scored for cystic or solid involvement of CNS, pancreas, and kidney, and for pheochromocytoma. Germline deletions were mapped using a combination of fluorescent in situ hybridization (FISH) and quantitative Southern and Southern blot analysis. An age-adjusted comparison demonstrated a higher prevalence of RCC in patients with partial germline VHL deletions relative to complete deletions (48.9 vs. 22.6%, p=0.007). This striking phenotypic dichotomy was not seen for cystic renal lesions or for CNS (p=0.22), pancreas (p=0.72), or pheochromocytoma (p=0.34). Deletion mapping revealed that development of RCC had an even greater correlation with retention of HSPC300 (C3orf10), located within the 30-kb region of chromosome 3p, immediately telomeric to VHL (52.3 vs. 18.9%, p <0.001), suggesting the presence of a neighboring gene or genes critical to the development and maintenance of RCC. Careful correlation of genotypic data with objective phenotypic measures will provide further insight into the mechanisms of tumor formation. Copyright 2003 Wiley-Liss, Inc.

  12. An unusual insertion/deletion in the gene encoding the β-subunit of propionyl-CoA carboxylase is a frequent mutation in Caucasian propionic acidemia

    International Nuclear Information System (INIS)

    Tahara, T.; Kraus, J.P.; Rosenberg, L.E.

    1990-01-01

    Propionic acidemia is an inherited disorder of organic acid metabolism that is caused by deficiency of propionly-CoA carboxylase. Affected patients fall into two complementation groups, pccA and pccBC (subgroups B, C, and BC), resulting from deficiency of the nonidentical α and β subunits of PCC, respectively. The authors have detected an unusual insertion/deletion in the DNA of patients from the pccBC and pccC subgroups that replaces 14 nucleotides in the coding sequence of the β subunit with 12 nucleotides unrelated to this region of the gene. Among 14 unrelated Caucasian patients in the pccBc complementation group, this unique mutation was found in 8 of 28 mutant alleles examined. Mutant allele-specific oligonucleotide hybridization to amplified genomic DNAs revealed that the inserted 12 nucleotides do not originate in an ∼1000-bp region around the mutation. In the course of the investigation, they identified another mutation in the same exon: a 3-bp in-frame deletion that eliminates one of two isoleucine codons immediately preceding the Msp I site. Two unrelated patients were compound heterozygotes for this single-codon deletion and for the insertion/deletion described above. They conclude that either there is a propensity for the PCC β-subunit gene to undergo mutations of this sort at this position or, more likely, the mutations in all of the involved Caucasian patients have a common origin in preceding generations

  13. Deletion mutations of bacteriophage

    International Nuclear Information System (INIS)

    Ryo, Yeikou

    1975-01-01

    Resolution of mutation mechanism with structural changes of DNA was discussed through the studies using bacteriophage lambda. One of deletion mutations inductions of phage lambda is the irradiation of ultraviolet ray. It is not clear if the inductions are caused by errors in reparation of ultraviolet-induced damage or by the activation of int gene. Because the effective site of int gene lies within the regions unnecessary for existing, it is considered that int gene is connected to deletion mutations induction. A certain system using prophage complementarity enables to detect deletion mutations at essential hereditary sites and to solve the relations of deletion mutations with other recombination system, DNA reproduction and repairment system. Duplication and multiplication of hereditary elements were discussed. If lambda deletion mutations of the system, which can control recombination, reproduction and repairment of added DNA, are constructed, mutations mechanism with great changes of DNA structure can be solved by phage lambda. (Ichikawa, K.)

  14. Alu-mediated large deletion of the CDSN gene as a cause of peeling skin disease.

    Science.gov (United States)

    Wada, T; Matsuda, Y; Muraoka, M; Toma, T; Takehara, K; Fujimoto, M; Yachie, A

    2014-10-01

    Peeling skin disease (PSD) is an autosomal recessive skin disorder caused by mutations in CDSN and is characterized by superficial peeling of the upper epidermis. Corneodesmosin (CDSN) is a major component of corneodesmosomes that plays an important role in maintaining epidermis integrity. Herein, we report a patient with PSD caused by a novel homozygous large deletion in the 6p21.3 region encompassing the CDSN gene, which abrogates CDSN expression. Several genes including C6orf15, PSORS1C1, PSORS1C2, CCHCR1, and TCF19 were also deleted, however, the patient showed only clinical features typical of PSD. The deletion size was 59.1 kb. Analysis of the sequence surrounding the breakpoint showed that both telomeric and centromeric breakpoints existed within Alu-S sequences that were oriented in opposite directions. These results suggest an Alu-mediated recombination event as the mechanism underlying the deletion in our patient. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  15. Allele-specific deletions in mouse tumors identify Fbxw7 as germline modifier of tumor susceptibility.

    Directory of Open Access Journals (Sweden)

    Jesus Perez-Losada

    Full Text Available Genome-wide association studies (GWAS have been successful in finding associations between specific genetic variants and cancer susceptibility in human populations. These studies have identified a range of highly statistically significant associations between single nucleotide polymorphisms (SNPs and susceptibility to development of a range of human tumors. However, the effect of each SNP in isolation is very small, and all of the SNPs combined only account for a relatively minor proportion of the total genetic risk (5-10%. There is therefore a major requirement for alternative routes to the discovery of genetic risk factors for cancer. We have previously shown using mouse models that chromosomal regions harboring susceptibility genes identified by linkage analysis frequently exhibit allele-specific genetic alterations in tumors. We demonstrate here that the Fbxw7 gene, a commonly mutated gene in a wide range of mouse and human cancers, shows allele-specific deletions in mouse lymphomas and skin tumors. Lymphomas from three different F1 hybrids show 100% allele-specificity in the patterns of allelic loss. Parental alleles from 129/Sv or Spretus/Gla mice are lost in tumors from F1 hybrids with C57BL/6 animals, due to the presence of a specific non-synonymous coding sequence polymorphism at the N-terminal portion of the gene. A specific genetic test of association between this SNP and lymphoma susceptibility in interspecific backcross mice showed a significant linkage (p = 0.001, but only in animals with a functional p53 gene. These data therefore identify Fbxw7 as a p53-dependent tumor susceptibility gene. Increased p53-dependent tumor susceptibility and allele-specific losses were also seen in a mouse skin model of skin tumor development. We propose that analysis of preferential allelic imbalances in tumors may provide an efficient means of uncovering genetic variants that affect mouse and human tumor susceptibility.

  16. The Genetic Deletion of 6q21 and PRDM1 and Clinical Implications in Extranodal NK/T Cell Lymphoma, Nasal Type

    Directory of Open Access Journals (Sweden)

    Li Liang

    2015-01-01

    Full Text Available 6q21 genetic deletion has been frequently detected in extranodal NK/T cell lymphoma, nasal type (EN-NK/T-NT, and PRDM1 is considered as candidate gene. However, direct detection of PRDM1 deletion has not been well documented. We investigated genetic alterations of 6q21 and PRDM1 in 43 cases of EN-NK/T-NT and cell lines by FISH. PRDM1 expression was evaluated by immunohistochemistry and Western blot. The correlation between genetic alteration and PRDM1 expression and the significance in clinic-pathologic were analyzed. Heterozygous deletion of 6q21 and/or PRDM1 was observed in 24 of 43 cases (55.81% of EN-NK/T-NT including 16 cases (37.21% for 6q21 deletion and 19 cases (44.19% for PRDM1 deletion. Similarly, heterozygous codeletion of 6q21 and PRDM1 was identified in NK92 and NKL cells. The heterozygous deletion of 6q21 and/or PRDM1 was correlated with PRDM1 expression. However, genetic deletion of 6q21 and/or PRDM1 was not correlated with clinicopathological features of EN-NK/T-NT, while PRDM1 expression showed positive effect on the outcome of patients as those as disease site, B symptom, and clinical stage. Thus, heterozygous deletion of 6q21 and/or PRDM1 was frequently detected in EN-NK/T-NT and correlated with downregulation of PRDM1. But the prognostic role of genetic deletion needs to be further evaluated in larger cohort.

  17. Prevalence and spectrum of large deletions or duplications in the major long QT syndrome-susceptibility genes and implications for long QT syndrome genetic testing.

    Science.gov (United States)

    Tester, David J; Benton, Amber J; Train, Laura; Deal, Barbara; Baudhuin, Linnea M; Ackerman, Michael J

    2010-10-15

    Long QT syndrome (LQTS) is a cardiac channelopathy associated with syncope, seizures, and sudden death. Approximately 75% of LQTS is due to mutations in genes encoding for 3 cardiac ion channel α-subunits (LQT1 to LQT3). However, traditional mutational analyses have limited detection capabilities for atypical mutations such as large gene rearrangements. We set out to determine the prevalence and spectrum of large deletions/duplications in the major LQTS-susceptibility genes in unrelated patients who were mutation negative after point mutation analysis of LQT1- to LQT12-susceptibility genes. Forty-two unrelated, clinically strong LQTS patients were analyzed using multiplex ligation-dependent probe amplification, a quantitative fluorescent technique for detecting multiple exon deletions and duplications. The SALSA multiplex ligation-dependent probe amplification LQTS kit from MRC-Holland was used to analyze the 3 major LQTS-associated genes, KCNQ1, KCNH2, and SCN5A, and the 2 minor genes, KCNE1 and KCNE2. Overall, 2 gene rearrangements were found in 2 of 42 unrelated patients (4.8%, confidence interval 1.7 to 11). A deletion of KCNQ1 exon 3 was identified in a 10-year-old Caucasian boy with a corrected QT duration of 660 ms, a personal history of exercise-induced syncope, and a family history of syncope. A deletion of KCNQ1 exon 7 was identified in a 17-year-old Caucasian girl with a corrected QT duration of 480 ms, a personal history of exercise-induced syncope, and a family history of sudden cardiac death. In conclusion, because nearly 5% of patients with genetically elusive LQTS had large genomic rearrangements involving the canonical LQTS-susceptibility genes, reflex genetic testing to investigate genomic rearrangements may be of clinical value. Copyright © 2010 Elsevier Inc. All rights reserved.

  18. AluY-mediated germline deletion, duplication and somatic stem cell reversion in UBE2T defines a new subtype of Fanconi anemia.

    Science.gov (United States)

    Virts, Elizabeth L; Jankowska, Anna; Mackay, Craig; Glaas, Marcel F; Wiek, Constanze; Kelich, Stephanie L; Lottmann, Nadine; Kennedy, Felicia M; Marchal, Christophe; Lehnert, Erik; Scharf, Rüdiger E; Dufour, Carlo; Lanciotti, Marina; Farruggia, Piero; Santoro, Alessandra; Savasan, Süreyya; Scheckenbach, Kathrin; Schipper, Jörg; Wagenmann, Martin; Lewis, Todd; Leffak, Michael; Farlow, Janice L; Foroud, Tatiana M; Honisch, Ellen; Niederacher, Dieter; Chakraborty, Sujata C; Vance, Gail H; Pruss, Dmitry; Timms, Kirsten M; Lanchbury, Jerry S; Alpi, Arno F; Hanenberg, Helmut

    2015-09-15

    Fanconi anemia (FA) is a rare inherited disorder clinically characterized by congenital malformations, progressive bone marrow failure and cancer susceptibility. At the cellular level, FA is associated with hypersensitivity to DNA-crosslinking genotoxins. Eight of 17 known FA genes assemble the FA E3 ligase complex, which catalyzes monoubiquitination of FANCD2 and is essential for replicative DNA crosslink repair. Here, we identify the first FA patient with biallelic germline mutations in the ubiquitin E2 conjugase UBE2T. Both mutations were aluY-mediated: a paternal deletion and maternal duplication of exons 2-6. These loss-of-function mutations in UBE2T induced a cellular phenotype similar to biallelic defects in early FA genes with the absence of FANCD2 monoubiquitination. The maternal duplication produced a mutant mRNA that could encode a functional protein but was degraded by nonsense-mediated mRNA decay. In the patient's hematopoietic stem cells, the maternal allele with the duplication of exons 2-6 spontaneously reverted to a wild-type allele by monoallelic recombination at the duplicated aluY repeat, thereby preventing bone marrow failure. Analysis of germline DNA of 814 normal individuals and 850 breast cancer patients for deletion or duplication of UBE2T exons 2-6 identified the deletion in only two controls, suggesting aluY-mediated recombinations within the UBE2T locus are rare and not associated with an increased breast cancer risk. Finally, a loss-of-function germline mutation in UBE2T was detected in a high-risk breast cancer patient with wild-type BRCA1/2. Cumulatively, we identified UBE2T as a bona fide FA gene (FANCT) that also may be a rare cancer susceptibility gene. © The Author 2015. Published by Oxford University Press.

  19. Strategies for state-dependent quantum deleting

    International Nuclear Information System (INIS)

    Song Wei; Yang Ming; Cao Zhuoliang

    2004-01-01

    A quantum state-dependent quantum deleting machine is constructed. We obtain a upper bound of the global fidelity on N-to-M quantum deleting from a set of K non-orthogonal states. Quantum networks are constructed for the above state-dependent quantum deleting machine when K=2. Our deleting protocol only involves a unitary interaction among the initial copies, with no ancilla. We also present some analogies between quantum cloning and deleting

  20. SLUG (SNAI2) deletions in patients with Waardenburg disease.

    Science.gov (United States)

    Sánchez-Martín, Manuel; Rodríguez-García, Arancha; Pérez-Losada, Jesús; Sagrera, Ana; Read, Andrew P; Sánchez-García, Isidro

    2002-12-01

    Waardenburg syndrome (WS; deafness with pigmentary abnormalities) is a congenital disorder caused by defective function of the embryonic neural crest. Depending on additional symptoms, WS is classified into four types: WS1, WS2, WS3 and WS4. WS1 and WS3 are caused by mutations in PAX3, whereas WS2 is heterogenous, being caused by mutations in the microphthalmia (MITF) gene in some but not all affected families. The identification of Slugh, a zinc-finger transcription factor expressed in migratory neural crest cells, as the gene responsible for pigmentary disturbances in mice prompted us to analyse the role of its human homologue SLUG in neural crest defects. Here we show that two unrelated patients with WS2 have homozygous deletions in SLUG which result in absence of the SLUG product. We further show that Mitf is present in Slug-deficient cells and transactivates the SLUG promoter, and that Slugh and Kit genetically interact in vivo. Our findings further define the locus heterogeneity of WS2 and point to an essential role of SLUG in the development of neural crest-derived human cell lineages: its absence causes the auditory-pigmentary symptoms in at least some individuals with WS2.

  1. Pseudotumor of the pituitary due to PROP-1 deletion.

    Science.gov (United States)

    Teinturier, C; Vallette, S; Adamsbaum, C; Bendaoud, M; Brue, T; Bougnères, P F

    2002-01-01

    Hypopituitarism associated with pituitary mass in childhood is most frequently the consequence of craniopharyngioma or Rathke's cleft cyst. We report a patient with an intrasellar pseudotumor associated with hypopituitarism, which led us to a misdiagnosis of intrasellar craniopharyngioma. After spontaneous involution of the mass, diagnosis was revised. DNA analysis showed a deletion in the Prophet of Pit-1 (PROP-1) gene, a pituitary transcription factor. It is important to recognize that a PROP-1 deletion can cause pituitary pseudotumor that can be mistaken for a craniopharyngioma or Rathke's pouch cyst.

  2. Haemophilia A: Database of nucleotide substitutions, deletions, insertions and rearrangements of the factor VIII gene

    Energy Technology Data Exchange (ETDEWEB)

    Tuddenham, E.G.D. (Clinical Research Centre, Harrow (United Kingdom)); Cooper, D.N. (Thrombosis Research Inst., London (United Kingdom)); Gitschier, J. (Univ. of California, San Francisco (United States)); Higuchi, M.; Kazazian, H.H.; Antonarakis, S.E. (Johns Hopkins Univ., Baltimore (United States)); Hoyer, L.W. (American Red Cross, Rockville (United States)); Yoshioka, A. (Nara Medical Coll., Kashihara City (Japan)); Peake, I.R. (Royal Hallamshire Hospital, Sheffield (United Kingdom)); Schwaab, R. (Inst. fuer Klinische Biochemie der Univ. Bonn (West Germany)); Lavergne, J.M. (Hopital de Bicetre (France)); Giannelli, F. (Guy' s Hospital, London (United Kingdom))

    1991-09-25

    Mutations at the factor VIII gene locus causing Haemophilia A have now been identified in many patients from a many ethnic groups. Earlier studies used biased methods which detected repetitive mutations at a few CG dinucleotides. More recently rapid gene scanning methods have uncovered an extreme diversity of mutations. Over 80 different point mutations, 6 insertions, 7 small deletions, and 60 large deletions have been characterized. Repetitive mutation has been proved for at least 16 CpG sites. All nonsense mutations cause severe disease. Most missense mutations appear to cause instability of the protein, but some are associated with production of dysfunctional factor VIII molecules, thereby localizing functionally critical regions of the cofactor. Variable phenotype has been observed in association with three of the latter class of genotype. This catalogue of gene lesions in Haemophilia A will be updated annually.

  3. An intronic deletion in the PROM1 gene leads to autosomal recessive cone-rod dystrophy.

    Science.gov (United States)

    Eidinger, Osnat; Leibu, Rina; Newman, Hadas; Rizel, Leah; Perlman, Ido; Ben-Yosef, Tamar

    2015-01-01

    To investigate the genetic basis for autosomal recessive cone-rod dystrophy (CRD) in a consanguineous Israeli Jewish family. Patients underwent a detailed ophthalmic evaluation, including eye examination, visual field testing, optical coherence tomography (OCT), and electrophysiological tests, electroretinography (ERG) and visual evoked potential (VEP). Genome-wide homozygosity mapping using a single nucleotide polymorphism (SNP) array was performed to identify homozygous regions shared among two of the affected individuals. Mutation screening of the underlying gene was performed with direct sequencing. In silico and in vitro analyses were used to predict the effect of the identified mutation on splicing. The affected family members are three siblings who have various degrees of progressive visual deterioration, glare, color vision abnormalities, and night vision difficulties. Visual field tests revealed central scotomas of different extension. Cone and rod ERG responses were reduced, with cones more severely affected. Homozygosity mapping revealed several homozygous intervals shared among two of the affected individuals. One included the PROM1 gene. Sequence analysis of the 26 coding exons of PROM1 in one affected individual revealed no mutations in the coding sequence or in intronic splice sites. However, in intron 21, proximate to the intron-exon junction, we observed a homozygous 10 bp deletion between positions -26 and -17 (c.2281-26_-17del). The deletion was linked to a known SNP, c.2281-6C>G. The deletion cosegregated with the disease in the family, and was not detected in public databases or in 101 ethnically-matched control individuals. In silico analysis predicted that this deletion would lead to altered intron 21 splicing. Bioinformatic analysis predicted that a recognition site for the SRSF2 splicing factor is located within the deleted sequence. The in vitro splicing assay demonstrated that c.2281-26_-17del leads to complete exon 22 skipping. A novel

  4. Genes commonly deleted in childhood B-cell precursor acute lymphoblastic leukemia: association with cytogenetics and clinical features

    Science.gov (United States)

    Schwab, Claire J.; Chilton, Lucy; Morrison, Heather; Jones, Lisa; Al-Shehhi, Halima; Erhorn, Amy; Russell, Lisa J.; Moorman, Anthony V.; Harrison, Christine J.

    2013-01-01

    In childhood B-cell precursor acute lymphoblastic leukemia, cytogenetics is important in diagnosis and as an indicator of response to therapy, thus playing a key role in risk stratification of patients for treatment. Little is known of the relationship between different cytogenetic subtypes in B-cell precursor acute lymphoblastic leukemia and the recently reported copy number abnormalities affecting significant leukemia associated genes. In a consecutive series of 1427 childhood B-cell precursor acute lymphoblastic leukemia patients, we have determined the incidence and type of copy number abnormalities using multiplex ligation-dependent probe amplification. We have shown strong links between certain deletions and cytogenetic subtypes, including the novel association between RB1 deletions and intrachromosomal amplification of chromosome 21. In this study, we characterized the different copy number abnormalities and show heterogeneity of PAX5 and IKZF1 deletions and the recurrent nature of RB1 deletions. Whole gene losses are often indicative of larger deletions, visible by conventional cytogenetics. An increased number of copy number abnormalities is associated with NCI high risk, specifically deletions of IKZF1 and CDKN2A/B, which occur more frequently among these patients. IKZF1 deletions and rearrangements of CRLF2 among patients with undefined karyotypes may point to the poor risk BCR-ABL1-like group. In conclusion, this study has demonstrated in a large representative cohort of children with B-cell precursor acute lymphoblastic leukemia that the pattern of copy number abnormalities is highly variable according to the primary genetic abnormality. PMID:23508010

  5. Screening for duplications, deletions and a common intronic mutation detects 35% of second mutations in patients with USH2A monoallelic mutations on Sanger sequencing.

    Science.gov (United States)

    Steele-Stallard, Heather B; Le Quesne Stabej, Polona; Lenassi, Eva; Luxon, Linda M; Claustres, Mireille; Roux, Anne-Francoise; Webster, Andrew R; Bitner-Glindzicz, Maria

    2013-08-08

    Usher Syndrome is the leading cause of inherited deaf-blindness. It is divided into three subtypes, of which the most common is Usher type 2, and the USH2A gene accounts for 75-80% of cases. Despite recent sequencing strategies, in our cohort a significant proportion of individuals with Usher type 2 have just one heterozygous disease-causing mutation in USH2A, or no convincing disease-causing mutations across nine Usher genes. The purpose of this study was to improve the molecular diagnosis in these families by screening USH2A for duplications, heterozygous deletions and a common pathogenic deep intronic variant USH2A: c.7595-2144A>G. Forty-nine Usher type 2 or atypical Usher families who had missing mutations (mono-allelic USH2A or no mutations following Sanger sequencing of nine Usher genes) were screened for duplications/deletions using the USH2A SALSA MLPA reagent kit (MRC-Holland). Identification of USH2A: c.7595-2144A>G was achieved by Sanger sequencing. Mutations were confirmed by a combination of reverse transcription PCR using RNA extracted from nasal epithelial cells or fibroblasts, and by array comparative genomic hybridisation with sequencing across the genomic breakpoints. Eight mutations were identified in 23 Usher type 2 families (35%) with one previously identified heterozygous disease-causing mutation in USH2A. These consisted of five heterozygous deletions, one duplication, and two heterozygous instances of the pathogenic variant USH2A: c.7595-2144A>G. No variants were found in the 15 Usher type 2 families with no previously identified disease-causing mutations. In 11 atypical families, none of whom had any previously identified convincing disease-causing mutations, the mutation USH2A: c.7595-2144A>G was identified in a heterozygous state in one family. All five deletions and the heterozygous duplication we report here are novel. This is the first time that a duplication in USH2A has been reported as a cause of Usher syndrome. We found that 8 of

  6. The rates and patterns of deletions in the human factor IX gene

    Energy Technology Data Exchange (ETDEWEB)

    Ketterling, R.P.; Vielhaber, E.L.; Lind, T.J.; Thorland, E.C.; Sommer S.S. (Mayo Clinic/Foundation, Rochester, MN (United States))

    1994-02-01

    Deletions are commonly observed in genes with either segments of highly homologous sequences or excessive gene length. However, in the factor IX gene and in most genes, deletions (of [ge]21 bp) are uncommon. The authors have analyzed DNA from 290 families with hemophilia B (203 independent mutations) and have found 12 deletions >20 bp. Eleven of these are >2 kb (range >3-163 kb), and one is 1.1 kb. The junctions of the four deletions that are completely contained within the factor IX gene have been determined. A novel mutation occurred in patient HB128: the data suggest that a 26.8-kb deletion occurred between two segments of alternating purines and pyrimidines and that a 2.3-kb sense strand segment derived from the deleted region was inserted. For a sample of 203 independent mutations, the authors estimate the [open quotes]baseline[close quotes] rates of deletional mutation per base pair per generation as a function of size. The rate for large (>2 kb)I deletions is exceedingly low. For every mutational event in which a given base is at the junction of a large deletion, there are an estimated 58 microdeletions (<20 bp) and 985 single-base substitutions at that base. Analysis of the nine reported deletion junctions in the factor IX gene literature reveals that (i) five are associated with inversion, orphan sequences, or sense strand insertions; (ii) four are simple deletions that display an excess of short direct repeats at their junctions; (iii) there is no dramatic clustering of junctions within the gene; and (iv) with the exception of alternating purines and pyrimidines, deletion junctions are not preferentially associated with repetitive DNA. 58 refs., 5 figs., 5 tabs.

  7. Insertion/deletion polymorphism in the angiotensin-I-converting enzyme gene is associated with coronary heart disease in IDDM patients with diabetic nephropathy

    DEFF Research Database (Denmark)

    Tarnow, L; Cambien, Francois; Rossing, P

    1995-01-01

    Insulin-dependent diabetic (IDDM) patients with diabetic nephropathy have a highly increased morbidity and mortality from coronary heart disease. An insertion (I) /deletion (D) polymorphism in the angiotensin-I-converting enzyme (ACE) gene has been shown to be associated with coronary heart disea...

  8. Paracentric inversion of chromosome 2 associated with cryptic duplication of 2q14 and deletion of 2q37 in a patient with autism.

    Science.gov (United States)

    Devillard, Françoise; Guinchat, Vincent; Moreno-De-Luca, Daniel; Tabet, Anne-Claude; Gruchy, Nicolas; Guillem, Pascale; Nguyen Morel, Marie-Ange; Leporrier, Nathalie; Leboyer, Marion; Jouk, Pierre-Simon; Lespinasse, James; Betancur, Catalina

    2010-09-01

    We describe a patient with autism and a paracentric inversion of chromosome 2q14.2q37.3, with a concurrent duplication of the proximal breakpoint at 2q14.1q14.2 and a deletion of the distal breakpoint at 2q37.3. The abnormality was derived from his mother with a balanced paracentric inversion. The inversion in the child appeared to be cytogenetically balanced but subtelomere FISH revealed a cryptic deletion at the 2q37.3 breakpoint. High-resolution single nucleotide polymorphism array confirmed the presence of a 3.5 Mb deletion that extended to the telomere, and showed a 4.2 Mb duplication at 2q14.1q14.2. FISH studies using a 2q14.2 probe showed that the duplicated segment was located at the telomeric end of chromosome 2q. This recombinant probably resulted from breakage of a dicentric chromosome. The child had autism, mental retardation, speech and language delay, hyperactivity, growth retardation with growth hormone deficiency, insulin-dependent diabetes, and mild facial dysmorphism. Most of these features have been previously described in individuals with simple terminal deletion of 2q37. Pure duplications of the proximal chromosome 2q are rare and no specific syndrome has been defined yet, so the contribution of the 2q14.1q14.2 duplication to the phenotype of the patient is unknown. These findings underscore the need to explore apparently balanced chromosomal rearrangements inherited from a phenotypically normal parent in subjects with autism and/or developmental delay. In addition, they provide further evidence indicating that chromosome 2q terminal deletions are among the most frequently reported cytogenetic abnormalities in individuals with autism.

  9. Klf5 deletion promotes Pten deletion-initiated luminal-type mouse prostate tumors through multiple oncogenic signaling pathways.

    Science.gov (United States)

    Xing, Changsheng; Ci, Xinpei; Sun, Xiaodong; Fu, Xiaoying; Zhang, Zhiqian; Dong, Eric N; Hao, Zhao-Zhe; Dong, Jin-Tang

    2014-11-01

    Krüppel-like factor 5 (KLF5) regulates multiple biologic processes. Its function in tumorigenesis appears contradictory though, showing both tumor suppressor and tumor promoting activities. In this study, we examined whether and how Klf5 functions in prostatic tumorigenesis using mice with prostate-specific deletion of Klf5 and phosphatase and tensin homolog (Pten), both of which are frequently inactivated in human prostate cancer. Histologic analysis demonstrated that when one Pten allele was deleted, which causes mouse prostatic intraepithelial neoplasia (mPIN), Klf5 deletion accelerated the emergence and progression of mPIN. When both Pten alleles were deleted, which causes prostate cancer, Klf5 deletion promoted tumor growth, increased cell proliferation, and caused more severe morphologic and molecular alterations. Homozygous deletion of Klf5 was more effective than hemizygous deletion. Unexpectedly, while Pten deletion alone expanded basal cell population in a tumor as reported, Klf5 deletion in the Pten-null background clearly reduced basal cell population while expanding luminal cell population. Global gene expression profiling, pathway analysis, and experimental validation indicate that multiple mechanisms could mediate the tumor-promoting effect of Klf5 deletion, including the up-regulation of epidermal growth factor and its downstream signaling molecules AKT and ERK and the inactivation of the p15 cell cycle inhibitor. KLF5 also appears to cooperate with several transcription factors, including CREB1, Sp1, Myc, ER and AR, to regulate gene expression. These findings validate the tumor suppressor function of KLF5. They also yield a mouse model that shares two common genetic alterations with human prostate cancer-mutation/deletion of Pten and deletion of Klf5.

  10. Deletion of exons 9 and 10 of the Presenilin 1 gene in a patient with Early-onset Alzheimer Disease generates longer amyloid seeds.

    Science.gov (United States)

    Le Guennec, Kilan; Veugelen, Sarah; Quenez, Olivier; Szaruga, Maria; Rousseau, Stéphane; Nicolas, Gaël; Wallon, David; Fluchere, Frédérique; Frébourg, Thierry; De Strooper, Bart; Campion, Dominique; Chávez-Gutiérrez, Lucía; Rovelet-Lecrux, Anne

    2017-08-01

    Presenilin 1 (PSEN1) mutations are the main cause of autosomal dominant Early-onset Alzheimer Disease (EOAD). Among them, deletions of exon 9 have been reported to be associated with a phenotype of spastic paraparesis. Using exome data from a large sample of 522 EOAD cases and 584 controls to search for genomic copy-number variations (CNVs), we report here a novel partial, in-frame deletion of PSEN1, removing both exons 9 and 10. The patient presented with memory impairment associated with spastic paraparesis, both starting from the age of 56years. He presented a positive family history of EOAD. We performed functional analysis to elucidate the impact of this novel deletion on PSEN1 activity as part of the γ-secretase complex. The deletion does not affect the assembly of a mature protease complex but has an extreme impact on its global endopeptidase activity. The mutant carboxypeptidase-like activity is also strongly impaired and the deleterious mutant effect leads to an incomplete digestion of long Aβ peptides and enhances the production of Aβ43, which has been shown to be potently amyloidogenic and neurotoxic in vivo. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. A novel 3q29 deletion associated with autism, intellectual disability, psychiatric disorders, and obesity.

    Science.gov (United States)

    Biamino, Elisa; Di Gregorio, Eleonora; Belligni, Elga Fabia; Keller, Roberto; Riberi, Evelise; Gandione, Marina; Calcia, Alessandro; Mancini, Cecilia; Giorgio, Elisa; Cavalieri, Simona; Pappi, Patrizia; Talarico, Flavia; Fea, Antonio M; De Rubeis, Silvia; Cirillo Silengo, Margherita; Ferrero, Giovanni Battista; Brusco, Alfredo

    2016-03-01

    Copy number variation (CNV) has been associated with a variety of neuropsychiatric disorders, including intellectual disability/developmental delay (ID/DD), autism spectrum disorder (ASD), and schizophrenia (SCZ). Often, individuals carrying the same pathogenic CNV display high clinical variability. By array-CGH analysis, we identified a novel familial 3q29 deletion (1.36 Mb), centromeric to the 3q29 deletion region, which manifests with variable expressivity. The deletion was identified in a 3-year-old girl diagnosed with ID/DD and autism and segregated in six family members, all affected by severe psychiatric disorders including schizophrenia, major depression, anxiety disorder, and personality disorder. All individuals carrying the deletion were overweight or obese, and anomalies compatible with optic atrophy were observed in three out of four cases examined. Amongst the 10 genes encompassed by the deletion, the haploinsufficiency of Optic Atrophy 1 (OPA1), associated with autosomal dominant optic atrophy, is likely responsible for the ophthalmological anomalies. We hypothesize that the haploinsufficiency of ATPase type 13A4 (ATP13A4) and/or Hairy/Enhancer of Split Drosophila homolog 1 (HES1) contribute to the neuropsychiatric phenotype, while HES1 deletion might underlie the overweight/obesity. In conclusion, we propose a novel contiguous gene syndrome due to a proximal 3q29 deletion variably associated with autism, ID/DD, psychiatric traits and overweight/obesity. © 2015 Wiley Periodicals, Inc.

  12. BCL2-like 11 intron 2 deletion polymorphism is not associated with non-small cell lung cancer risk and prognosis.

    Science.gov (United States)

    Cho, Eun Na; Kim, Eun Young; Jung, Ji Ye; Kim, Arum; Oh, In Jae; Kim, Young Chul; Chang, Yoon Soo

    2015-10-01

    BCL2-Like 11(BIM), which encodes a BH3-only protein, is a major pro-apoptotic molecule that facilitates cell death. We hypothesized that a BIM intron 2 deletion polymorphism increases lung cancer risk and predicts poor prognosis in non-small lung cancer (NSCLC) patients. We prospectively recruited 450 lung cancer patients and 1:1 age, sex, and smoking status matched control subjects from February 2013 to April 2014 among patients treated at Severance, Gangnam Severance, and Chonnam Hwasoon Hospital. The presence of a 2903-bp genomic DNA deletion polymorphism of intron 2 of BIM was analyzed by PCR and validated by sequencing. Odds ratios were calculated by chi-square tests and survival analysis with Kaplan-Meier estimation. Sixty-nine out of 450 (15.3%) lung cancer patients carried the BIM deletion polymorphism, while 66 out of 450 (14.7%) control subjects carried the BIM deletion polymorphism, with an odds ratio of for lung cancer of 1.054 (95% CI; 0.731-1.519). We categorized 406 NSCLC patients according to the presence of the polymorphism and found that there were no statistically significant differences in age, sex, histologic type, or stage between subjects with and without the deletion polymorphism. The BIM deletion polymorphism did not influence overall survival (OS) or progression free survival (PFS) in our sample (OS; 37.6 vs 34.4 months (P=0.759), PFS; 49.6 vs 26.0 months (P=0.434)). These findings indicate that the BIM deletion polymorphism is common in Korean NSCLC patients but does not significantly affect the intrinsic biologic function of BH3-only protein. Furthermore, the BIM deletion polymorphism did not predict clinical outcomes in patients with NSCLC. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  13. A patient with de-novo partial deletion of Xp (p11.4-pter) and partial duplication of 22q (q11.2-qter).

    Science.gov (United States)

    Armour, Christine M; McGowan-Jordan, Jean; Lawrence, Sarah E; Bouchard, Amélie; Basik, Mark; Allanson, Judith E

    2008-01-01

    We report on a girl with partial deletion of Xp and partial duplication of 22q. Family studies demonstrate that both the patient's mother and her nonidentical twin sister carry the corresponding balanced translocation; 46,X,t(X;22)(p11.4;q11.2). This girl has developmental delay, microcephaly, mild dysmorphisms and hearing loss but otherwise shows few of the features described in individuals with duplications of the long arm of chromosome 22. She does manifest characteristics, such as short stature and biochemical evidence of ovarian failure, which are seen in partial or complete Xp deletions and Turner's syndrome.

  14. Constitutional 11q14-q22 chromosome deletion syndrome in a child with neuroblastoma MYCN single copy.

    Science.gov (United States)

    Passariello, Annalisa; De Brasi, Daniele; Defferrari, Raffaella; Genesio, Rita; Tufano, Maria; Mazzocco, Katia; Capasso, Maria; Migliorati, Roberta; Martinsson, Tommy; Siani, Paolo; Nitsch, Lucio; Tonini, Gian Paolo

    2013-11-01

    Constitutional 11q deletion is a chromosome imbalance possibly found in MCA/MR patients analyzed for chromosomal anomalies. Its role in determining the phenotype depends on extension and position of deleted region. Loss of heterozygosity of 11q (region 11q23) is also associated with neuroblastoma, the most frequent extra cranial cancer in children. It represents one of the most frequent cytogenetic abnormalities observed in the tumor of patients with high-risk disease even if germline deletion of 11q in neuroblastoma is rare. Hereby, we describe a 18 months old girl presenting with trigonocephaly and dysmorphic facial features, including hypotelorism, broad depressed nasal bridge, micrognathia, synophrys, epicanthal folds, and with a stage 4 neuroblastoma without MYCN amplification, carrying a germline 11q deletion (11q14.1-q22.3), outside from Jacobsen syndrome and from neuroblastoma 11q critical regions. The role of 11q deletion in determining the clinical phenotype and its association with neuroblastoma development in the patient are discussed. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  15. 22q13.3 Deletion Syndrome: An Underdiagnosed Cause of Mental Retardation

    Directory of Open Access Journals (Sweden)

    ilknur Erol

    2015-03-01

    Full Text Available Phelan-McDermid syndrome, also known as 22q13.3 deletion syndrome, is characterized by global developmental delay, absent or delayed speech, generalized hypotonia, and minor physical anomalies. The deletion typically involves the terminal band 22q13.3 and has been associated with both familial and de-novo translocations. We report the case of an 11-year-old Turkish girl with 22q13.3 deletion syndrome presenting with repeated seizures during the course of a rubella infection. We also review the clinical features of 22q13.3 deletion syndrome and emphasize the importance of considering a rare microdeletion syndrome for idiopathic mental retardation when results of a routine karyotype analysis are normal. To the best of our knowledge, this is the first reported case of a Turkish patient with isolated 22q13.3 deletion syndrome. [Cukurova Med J 2015; 40(1.000: 169-173

  16. Y chromosome gr/gr deletions are a risk factor for low semen quality

    NARCIS (Netherlands)

    Visser, L.; Westerveld, G. H.; Korver, C. M.; van Daalen, S. K. M.; Hovingh, S. E.; Rozen, S.; van der Veen, F.; Repping, S.

    2009-01-01

    Subfertility affects one in eight couples. In up to 50% of cases, the male partner has low semen quality. Four Y chromosome deletions, i.e. Azoospermia factor a (AZFa), P5/proximal-P1 (AZFb), P5/distal-P1 and AZFc deletions, are established causes of low semen quality. Whether a recently identified

  17. Clinical characterization and proposed mechanism of juvenile glaucoma--a patient with a chromosome 4p deletion, Wolf-Hirschhorn Syndrome.

    Science.gov (United States)

    Curtin, Jeremy; Moloney, Greg; Grigg, John; Sharota Franzco, Dorian

    2010-09-01

    The case presented is that of a 22-year-old male with Wolf-Hirschhorn syndrome who was referred with glaucoma refractory to medical treatment. Six other patients have been described with Wolf-Hirschhorn syndrome (WHS) and glaucoma, most being congenital glaucoma with diagnosis in infancy. We describe the first case of juvenile onset glaucoma in this syndrome. Our patient had narrow angles on gonioscopy, with ultrasound biomicroscopy revealing ciliary body cysts. We alert others to the possibility of this mechanism of secondary narrow angle glaucoma associated with this chromosomal deletion syndrome.

  18. Marfan syndrome with a complex chromosomal rearrangement including deletion of the FBN1 gene

    Directory of Open Access Journals (Sweden)

    Colovati Mileny ES

    2012-01-01

    Full Text Available Abstract Background The majority of Marfan syndrome (MFS cases is caused by mutations in the fibrillin-1 gene (FBN1, mapped to chromosome 15q21.1. Only few reports on deletions including the whole FBN1 gene, detected by molecular cytogenetic techniques, were found in literature. Results We report here on a female patient with clinical symptoms of the MFS spectrum plus craniostenosis, hypothyroidism and intellectual deficiency who presents a 1.9 Mb deletion, including the FBN1 gene and a complex rearrangement with eight breakpoints involving chromosomes 6, 12 and 15. Discussion This is the first report of MFS with a complex chromosome rearrangement involving a deletion of FBN1 and contiguous genes. In addition to the typical clinical findings of the Marfan syndrome due to FBN1 gene haploinsufficiency, the patient presents features which may be due to the other gene deletions and possibly to the complex chromosome rearrangement.

  19. RBPJ is disrupted in a case of proximal 4p deletion syndrome with epilepsy.

    Science.gov (United States)

    Nakayama, Tojo; Saitsu, Hirotomo; Endo, Wakaba; Kikuchi, Atsuo; Uematsu, Mitsugu; Haginoya, Kazuhiro; Hino-fukuyo, Naomi; Kobayashi, Tomoko; Iwasaki, Masaki; Tominaga, Teiji; Kure, Shigeo; Matsumoto, Naomichi

    2014-06-01

    Proximal 4p deletion syndrome is characterized clinically by mental retardation, minor dysmorphic facial features, and is occasionally complicated with epilepsy. More than 20 cases of proximal 4p deletion syndrome have been reported, but the causative gene(s) remain elusive. We describe here a 2-year-old female patient with a common manifestation of proximal 4p deletion syndrome and infantile epileptic encephalopathy possessing a de novo balanced translocation t(4;13)(p15.2;q12.13). The patient was diagnosed as infantile spasms at 9 months of age. She presented with dysmorphic facial features and global developmental delay, compatible with proximal 4p deletion syndrome. Using fluorescence in situ hybridization, we determined the translocation breakpoint at 4p15.2 to be within RBPJ. RBPJ is a transcription factor in the Notch/RBPJ signaling pathway, playing a crucial role in the developing human brain, and particularly telencephalon development. Our findings, combined with those of previous studies, strongly suggest that RBPJ is causative for proximal 4p deletion syndrome and epilepsy in this case. Copyright © 2013 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

  20. Complex mosaic CDKL5 deletion with two distinct mutant alleles in a 4-year-old girl.

    Science.gov (United States)

    Boutry-Kryza, Nadia; Ville, Dorothée; Labalme, Audrey; Calender, Alain; Dupont, Jean-Michel; Touraine, Renaud; Edery, Patrick; des Portes, Vincent; Sanlaville, Damien; Lesca, Gaetan

    2014-08-01

    Mutations of the CDKL5 gene cause early epileptic encephalopathy. Patients manifest refractory epilepsy, beginning before the age of 3 months, which is associated with severe psychomotor delay and features that overlap with Rett syndrome. We report here a patient with mosaicism for CDKL5 exonic deletion, with the presence of two mutant alleles. The affected 4-year-old girl presented with infantile spasms, beginning at the age of 9 months, but subsequent progression of the disease was consistent with the classical CDKL5-related phenotype. A deletion of exons 17 and 18 was suspected on the basis of Multiplex Ligation Probe Amplification analysis, but unexpected results for cDNA analysis, which showed the presence of an abnormal transcript with the deletion of exon 18 only, led us to suspect that two distinct events might have occurred. We used custom array-CGH to determine the size and breakpoints of these deletions. Exon 18 was deleted from one of the abnormal alleles, and exon 17 was deleted from the other. A Fork Stalling and Template Switching (FoSTeS) mechanism was proposed to explain the two events, given the presence of regions of microhomology at the breakpoints. We propose here an original involvement of the FoSTeS mechanism to explain the co-occurrence of these two events in the CDKL5 gene in a single patient. This patient highlights the difficulties involved in the detection of such abnormalities, particularly when they occur in a mosaic state and involve two distinct mutational events in a single gene. © 2014 Wiley Periodicals, Inc.

  1. Patient-Identified Priorities Leading to Attempted Suicide.

    Science.gov (United States)

    Stulz, Niklaus; Hepp, Urs; Gosoniu, Dominic G; Grize, Leticia; Muheim, Flavio; Weiss, Mitchell G; Riecher-Rössler, Anita

    2018-01-01

    Attempted suicide is a major public health problem. The aim of this study was to identify patient-identified problems and triggers typically leading to attempted suicide. A representative sample of 66 adult patients was recruited from all clinical sites and psychiatrists who treat patients after attempted suicide in the Canton of Basel-City (Switzerland). Patients were diagnosed using the Structured Clinical Interview for DSM-IV (SCID) and interviewed with a local adaptation of the Explanatory Model Interview Catalogue (EMIC) to study underlying problems and triggers of attempted suicide. Of the patients, 92.4% had at least one DSM-IV disorder, with depressive disorders being the most prevalent disorder. Although half (50.0%) of the patients identified a health problem, 71.2% identified an interpersonal conflict as underlying problem leading to the suicide attempt. Furthermore, an interpersonal conflict was identified as the trigger of the suicide attempt by more than half of the patients (54.5%). The study included German-speaking patients only. According to patients, interpersonal problems often amplify underlying psychiatric problems, leading to suicide attempts. Social and interpersonal stressors should be acknowledged with integrated clinical and social interventions to prevent suicidal behavior in patients and populations.

  2. Genetic association study identifies a functional CNV in the WWOX gene contributes to the risk of intracranial aneurysms.

    Science.gov (United States)

    Fan, Jin; Sun, Wen; Lin, Min; Yu, Ke; Wang, Jian; Duan, Dan; Zheng, Bo; Yang, Zhenghui; Wang, Qingsong

    2016-03-29

    Intracranial aneurysms (IAs) accounts for 85% of hemorrhagic stroke. Genetic factors have been known to play an important role in the development of IAs. A functional CNV (CNV-67048) of human WW domain-containing oxidoreductase (WWOX), which has been identified as a tumor suppressor gene in multiple cancers, was identified to be associated with gliomas risk previously. Here, we hypothesized that the CNV-67048 could also affect susceptibility of IAs. Based on a two-stage, case- control study with a total of 976 patients of IAs and 1,200 matched healthy controls, we found the effect size for per copy deletion was 1.35 (95% CI = 1.16-1.57; Ptrend = 1.18 × 10-4). Compared with the individuals having no deletion, significantly higher risk of IAs was detected for both subjects carrying 1 copy deletion (OR = 1.24, 95% CI = 1.02-1.52) and subjects carrying 2 copy deletion (OR = 1.77, 95% CI = 1.24-2.53). Real-time PCR was used to confirm the abnormal expression of WWOX in tissues of IA patients and influence of genotypes of CNV-67048. The expression level of WWOX in IA tissues was significantly lower than that in corresponding normal tissues (P = 0.004), and the deletion genotypes of CNV-67048 have lower WWOX mRNA levels in both tumor tissues and border tissues (P 48 in WWOX predispose their carriers to IAs, which might be a genetic biomarker to predict risk of IAs in Chinese.

  3. A re-sequencing based assessment of genomic heterogeneity and fast neutron-induced deletions in a common bean cultivar

    Directory of Open Access Journals (Sweden)

    Jamie A. O'Rourke

    2013-06-01

    Full Text Available A small fast neutron mutant population has been established from Phaseolus vulgaris cv. Red Hawk. We leveraged the available P. vulgaris genome sequence and high throughput next generation DNA sequencing to examine the genomic structure of five Phaseolus vulgaris cv. Red Hawk fast neutron mutants with striking visual phenotypes. Analysis of these genomes identified three classes of structural variation; between cultivar variation, natural variation within the fast neutron mutant population, and fast neutron induced mutagenesis. Our analyses focused on the latter two classes. We identified 23 large deletions (>40 bp common to multiple individuals, illustrating residual heterogeneity and regions of structural variation within the common bean cv. Red Hawk. An additional 18 large deletions were identified in individual mutant plants. These deletions, ranging in size from 40 bp to 43,000 bp, are potentially the result of fast neutron mutagenesis. Six of the 18 deletions lie near or within gene coding regions, identifying potential candidate genes causing the mutant phenotype.

  4. Deletion analysis of susy-sl promoter for the identification of optimal promoter sequence

    International Nuclear Information System (INIS)

    Bacha, S.; Khatoon, A.; Asif, M.; Bshir, A.

    2015-01-01

    The promoter region of sucrose synthase (susy-Sl) was identified and isolated from tomato. The 5? deletion analysis was carried out for the identification of minimum optimal promoter. Transgenic lines of Arabidopsis thaliana were developed by floral dip method incorporating various promoter deletion cassettes controlling GUS reporter gene. GUS assay of transgenic tissues indicated that full length susy-Sl promoter and its deletion mutants were constitutively expressed in vegetative and floral tissues of A. thaliana. The expression was observed in roots, shoots and flowers of A. thaliana. Analysis of 5? deletion series of susy-Sl promoter showed that a minimum of 679 bp fragment of the promoter was sufficient to drive expression of GUS reporter gene in the major tissues of transgenic A. thaliana. (author)

  5. The 29.5 kb APOBEC3B Deletion Polymorphism Is Not Associated with Clinical Outcome of Breast Cancer.

    Science.gov (United States)

    Liu, Jingjing; Sieuwerts, Anieta M; Look, Maxime P; van der Vlugt-Daane, Michelle; Meijer-van Gelder, Marion E; Foekens, John A; Hollestelle, Antoinette; Martens, John W M

    2016-01-01

    Increased APOBEC3B mRNA levels are associated with a hypermutator phenotype and poor prognosis in ER-positive breast cancer patients. In addition, a 29.5 kb deletion polymorphism of APOBEC3B, resulting in an APOBEC3A-B hybrid transcript, has been associated with an increased breast cancer risk and the hypermutator phenotype. Here we evaluated whether the APOBEC3B deletion polymorphism also associates with clinical outcome of breast cancer. Copy number analysis was performed by quantitative PCR (qPCR) in primary tumors of 1,756 Dutch breast cancer patients. The APOBEC3B deletion was found in 187 patients of whom 16 carried a two-copy deletion and 171 carried a one-copy deletion. The prognostic value of the APOBEC3B deletion for the natural course of the disease was evaluated among 1,076 lymph-node negative (LNN) patients who did not receive adjuvant systemic treatment. No association was found between APOBEC3B copy number values and the length of metastasis-free survival (MFS; hazard ratio (HR) = 1.00, 95% confidence interval (CI) = 0.90-1.11, P = 0.96). Subgroup analysis by ER status also did not reveal an association between APOBEC3B copy number values and the length of MFS. The predictive value of the APOBEC3B deletion was assessed among 329 ER-positive breast cancer patients who received tamoxifen as the first-line therapy for recurrent disease and 226 breast cancer patients who received first-line chemotherapy for recurrent disease. No association between APOBEC3B copy number values and the overall response rate (ORR) to either tamoxifen (odds ratio (OR) = 0.88, 95% CI = 0.69-1.13, P = 0.31) or chemotherapy (OR = 0.97, 95% CI = 0.71-1.33, P = 0.87) was found. Thus, in contrast to APOBEC3B mRNA levels, the APOBEC3B deletion polymorphism has neither a prognostic nor a predictive value for breast cancer patients. Although a correlation exists between APOBEC3B copy number and mRNA expression, it is relatively weak. This suggests that other mechanisms exist that may

  6. DELISHUS: an efficient and exact algorithm for genome-wide detection of deletion polymorphism in autism

    Science.gov (United States)

    Aguiar, Derek; Halldórsson, Bjarni V.; Morrow, Eric M.; Istrail, Sorin

    2012-01-01

    Motivation: The understanding of the genetic determinants of complex disease is undergoing a paradigm shift. Genetic heterogeneity of rare mutations with deleterious effects is more commonly being viewed as a major component of disease. Autism is an excellent example where research is active in identifying matches between the phenotypic and genomic heterogeneities. A considerable portion of autism appears to be correlated with copy number variation, which is not directly probed by single nucleotide polymorphism (SNP) array or sequencing technologies. Identifying the genetic heterogeneity of small deletions remains a major unresolved computational problem partly due to the inability of algorithms to detect them. Results: In this article, we present an algorithmic framework, which we term DELISHUS, that implements three exact algorithms for inferring regions of hemizygosity containing genomic deletions of all sizes and frequencies in SNP genotype data. We implement an efficient backtracking algorithm—that processes a 1 billion entry genome-wide association study SNP matrix in a few minutes—to compute all inherited deletions in a dataset. We further extend our model to give an efficient algorithm for detecting de novo deletions. Finally, given a set of called deletions, we also give a polynomial time algorithm for computing the critical regions of recurrent deletions. DELISHUS achieves significantly lower false-positive rates and higher power than previously published algorithms partly because it considers all individuals in the sample simultaneously. DELISHUS may be applied to SNP array or sequencing data to identify the deletion spectrum for family-based association studies. Availability: DELISHUS is available at http://www.brown.edu/Research/Istrail_Lab/. Contact: Eric_Morrow@brown.edu and Sorin_Istrail@brown.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:22689755

  7. 22q11.2 Deletion Syndrome Is Associated With Impaired Auditory Steady-State Gamma Response

    DEFF Research Database (Denmark)

    Larsen, Kit Melissa; Pellegrino, Giovanni; Birknow, Michelle Rosgaard

    2017-01-01

    The 22q11.2 deletion syndrome confers a markedly increased risk for schizophrenia. 22q11.2 deletion carriers without manifest psychotic disorder offer the possibility to identify functional abnormalities that precede clinical onset. Since schizophrenia is associated with a reduced cortical gamma...

  8. 17q12 deletion and duplication syndrome in Denmark-A clinical cohort of 38 patients and review of the literature

    DEFF Research Database (Denmark)

    Rasmussen, Maria; Vestergaard, Else Marie; Graakjaer, Jesper

    2016-01-01

    deletions and 26 phenotyped patients with 17q12 duplications. The total cohort includes 19 index patients and 19 family members. We also reviewed the literature in order to further improve the basis for the counseling. We emphasize that renal disease, learning disability, behavioral abnormalities, epilepsy...... a variable degree of learning disabilities, delayed language development, delayed motor milestones, and a broad range of psychiatric and neurological features. This patient group also included adults achieving an academic degree. Assessing index patients and non-index patients separately, our observations...... illustrate that an overall milder disease burden is seen, in particular in patients with 17q12 duplications who are ascertained on the duplication rather than the phenotype. This evidence may be useful in prenatal counseling...

  9. Screening of Duchenne muscular dystrophy (DMD mutations and investigating its mutational mechanism in Chinese patients.

    Directory of Open Access Journals (Sweden)

    Chen Chen

    Full Text Available Duchenne muscular dystrophy (DMD is a common X-linked recessive disease of muscle degeneration and death. In order to provide accurate and reliable genetic counseling and prenatal diagnosis, we screened DMD mutations in a cohort of 119 Chinese patients using multiplex ligation-dependent probe amplification (MLPA and denaturing high performance liquid chromatography (DHPLC followed by Sanger sequencing. In these unrelated DMD patients, we identified 11 patients with DMD small mutations (9.2% and 81 patients with DMD deletions/duplications (del/dup (68.1%, of which 64 (79.0% were deletions, 16 (19.8% were duplications, and one (1.2% was both deletion and duplication. Furthermore, we analyzed the frequency of DMD breakpoint in the 64 deletion cases by calculating exon-deletion events of certain exon interval that revealed a novel mutation hotspot boundary. To explore why DMD rearrangement breakpoints were predisposed to specific regions (hotspot, we precisely characterized junction sequences of breakpoints at the nucleotide level in 21 patients with exon deleted/duplicated in DMD with a high-resolution SNP microarray assay. There were no exactly recurrent breakpoints and there was also no significant difference between single-exon del/dup and multiple-exon del/dup cases. The data from the current study provided a comprehensive strategy to detect DMD mutations for clinical practice, and identified two deletion hotspots at exon 43-55 and exon 10-23 by calculating exon-deletion events of certain exon interval. Furthermore, this is the first study to characterize DMD breakpoint at the nucleotide level in a Chinese population. Our observations provide better understanding of the mechanism for DMD gene rearrangements.

  10. Periventricular heterotopia in a boy with interstitial deletion of chromosome 4p.

    Science.gov (United States)

    Gawlik-Kuklinska, Katarzyna; Wierzba, Jolanta; Wozniak, Agnieszka; Iliszko, Mariola; Debiec-Rychter, Maria; Dubaniewicz-Wybieralska, Miroslawa; Limon, Janusz

    2008-01-01

    We report on a 4-year-old boy with a proximal interstitial deletion in the short arm of chromosome 4p with the karyotype 46,XY,del(4)(p14p15.32),inv(9)(p13q13). For a precise delineation of the deleted region, an array-based comparative genomic hybridization (a-CGH) analysis was performed. The proband's phenotype and cytogenetic findings are compared with previously reported cases with proximal 4p deletion syndrome. The syndrome is associated with normal growth, varying degrees of mental retardation, characteristic facial appearance and minor dysmorphic features. Additionally, our patient developed a seizure disorder due to abnormal neuronal migration, i.e., periventricular heterotopia.

  11. Mitochondrial DNA deletion in a patient with combined features of Leigh and Pearson syndromes

    Energy Technology Data Exchange (ETDEWEB)

    Blok, R.B.; Thorburn, D.R.; Danks, D.M. [Royal Children`s Hospital, Melbourne (Australia)] [and others

    1994-09-01

    We describe a heteroplasmic 4237 bp mitochondrial DNA (mtDNA) deletion in an 11 year old girl who has suffered from progressive illness since birth. She has some features of Leigh syndrome (global developmental delay with regression, brainstem dysfunction and lactic acidosis), together with other features suggestive of Pearson syndrome (history of pancytopenia and failure to thrive). The deletion was present at a level greater than 50% in skeletal muscle, but barely detectable in skin fibroblasts following Southern blot analysis, and only observed in blood following PCR analysis. The deletion spanned nt 9498 to nt 13734, and was flanked by a 12 bp direct repeat. Genes for cytochrome c oxidase subunit III, NADH dehydrogenase subunits 3, 4L, 4 and 5, and tRNAs for glycine, arginine, histidine, serine({sup AGY}) and leucine({sup CUN}) were deleted. Southern blotting also revealed an altered Apa I restriction site which was shown by sequence analysis to be caused by G{r_arrow}A nucleotide substitution at nt 1462 in the 12S rRNA gene. This was presumed to be a polymorphism. No abnormalities of mitochondrial ultrastructure, distribution or of respiratory chain enzyme complexes I-IV in skeletal muscle were observed. Mitochondrial disorders with clinical features overlapping more than one syndrome have been reported previously. This case further demonstrates the difficulty in correlating observed clinical features with a specific mitochondrial DNA mutation.

  12. Two rare deletions upstream of the NRXN1 gene (2p16.3) affecting the non-coding mRNA AK127244 segregate with diverse psychopathological phenotypes in a family

    DEFF Research Database (Denmark)

    Duong, L. T. T.; Hoeffding, L. K.; Petersen, K. B.

    2015-01-01

    127244 in addition to the pathogenic 15q11.2 deletion in distinct family members. The two deletions upstream of the NRXN1 gene were found to segregate with psychiatric disorders in the family and further similar deletions have been observed in patients diagnosed with autism spectrum disorder. Thus, we...... susceptibility. In this study, we describe a family affected by a wide range of psychiatric disorders including early onset schizophrenia, schizophreniform disorder, and affective disorders. Microarray analysis identified two rare deletions immediately upstream of the NRXN1 gene affecting the non-coding mRNA AK...... suggest that non-coding regions upstream of the NRXN1 gene affecting AK127244 might (as NRXN1) contain susceptibility regions for a wide spectrum of neuropsychiatric disorders. (C) 2015 Elsevier Masson SAS. All rights reserved....

  13. Case report: cytogenetic and molecular analysis of proximal interstitial deletion of 4p, review of the literature and comparison with wolf-hirschhorn syndrome.

    Science.gov (United States)

    Bailey, Nathanael G; South, Sarah T; Hummel, Marybeth; Wenger, Sharon L

    2010-01-01

    We report on a two-year-old female with a de novo proximal interstitial deletion of the short arm of chromosome 4 and a tetralogy of Fallot malformation. The patient had a karyotype of 46,XX,del(4)(p14p15.33) that was further characterized by array comparative genomic hybridization (aCGH). Phenotypic abnormalities for our patient are compared with those of previously reported patients with similar proximal 4p deletions as well as more distal deletions. The functions of genes that are deleted within this segment are reviewed.

  14. Deletion of P2 promoter of GJB1 gene a cause of Charcot-Marie-Tooth disease.

    Science.gov (United States)

    Kulshrestha, R; Burton-Jones, S; Antoniadi, T; Rogers, M; Jaunmuktane, Z; Brandner, S; Kiely, N; Manuel, R; Willis, T

    2017-08-01

    X-linked Charcot-Marie-Tooth disease (CMT) is the second most common cause of CMT, and is usually caused by mutations in the gap junction protein beta 1 (GJB1) gene. This gene has nerve specific P2 promoter that work synergistically with SOX10 and EGR2 genes to initiate transcription. Mutation in this region is known to cause Schwann cell dysfunction. A single large family of X linked peripheral neuropathy was identified in our practice. Next generation sequencing for targeted panel assay identified an upstream exon-splicing deletion identified extending from nucleotide c.-5413 to approximately - c.-49. This matches the sequence of 32 nucleotides at positions c.*218-*249 in the 3'UTR downstream of the GJB1 gene. The deleted fragment included the entire P2 promoter region. The deletion segregated with the disease. To our knowledge a deletion of the P2 promoter alone as a cause of CMT has not been reported previously. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Novel features of 3q29 deletion syndrome: Results from the 3q29 registry

    Science.gov (United States)

    Glassford, Megan R.; Rosenfeld, Jill A.; Freedman, Alexa A.; Zwick, Michael E.

    2016-01-01

    3q29 deletion syndrome is caused by a recurrent, typically de novo heterozygous 1.6 Mb deletion, but because incidence of the deletion is rare (1 in 30,000 births) the phenotype is not well described. To characterize the range of phenotypic manifestations associated with 3q29 deletion syndrome, we have developed an online registry (3q29deletion.org) for ascertainment of study subjects and phenotypic data collection via Internet‐based survey instruments. We report here on data collected during the first 18 months of registry operation, from 44 patients. This is the largest cohort of 3q29 deletion carriers ever assembled and surveyed in a systematic way. Our data reveal that 28% of registry participants report neuropsychiatric phenotypes, including anxiety disorder, panic attacks, depression, bipolar disorder, and schizophrenia. Other novel findings include a high prevalence (64%) of feeding problems in infancy and reduced weight at birth for 3q29 deletion carriers (average reduction 13.9 oz (394 g), adjusted for gestational age and sex, P = 6.5e‐07). We further report on the frequency of heart defects, autism, recurrent ear infections, gastrointestinal phenotypes, and dental phenotypes, among others. We also report on the expected timing of delayed developmental milestones. This is the most comprehensive description of the 3q29 deletion phenotype to date. These results are clinically actionable toward improving patient care for 3q29 deletion carriers, and can guide the expectations of physicians and parents. These data also demonstrate the value of patient‐reported outcomes to reveal the full phenotypic spectrum of rare genomic disorders. © 2016 The Authors. American Journal of Medical Genetics Part A Published by Wiley Periodicals, Inc. PMID:26738761

  16. TTY2 genes deletions as genetic risk factor of male infertility.

    Science.gov (United States)

    Shaveisi-Zadeh, F; Alibakhshi, R; Asgari, R; Rostami-Far, Z; Bakhtiari, M; Abdi, H; Movafagh, A; Mirfakhraie, R

    2017-02-28

    Y chromosome has a number of genes that are expressed in testis and have a role in spermatogenesis. TTY2L12A and TTY2L2A are the members of testis transcript Y2 (TTY2) that are Y linked multi-copy gene families, located on Yp11 and Yq11 loci respectively. The aim of this study was to investigate frequency of TTY2L12A and TTY2L2A deletions in azoospermic patients compared with fertile males. This study was performed on 45 infertile males with idiopathic azoospermia without any AZF micro deletions (group A), 33 infertile males with azoospermia which do not screened for AZF micro deletions (group B) and 65 fertile males (group C), from October 2013 to April 2015 in west of Iran. Polymerase chain reaction (PCR) method was used for detection of TTY2L12A and TTY2L2A gene deletions in studied groups. No deletions were detected in normal fertile males of group C. 1 out of 45 azoospermic males of group A (2.22%) and 3 out of 33 azoospermic males of group B (9.09%) had TTY2L2A deletion (p= 0.409 and p= 0.036 respectively), also 1 out of 45 azoospermic males of group A (2.22%) and 4 out of 33 azoospermic males of group B (12.12%) had TTY2L12A deletion (p= 0.409 and p= 0.011 respectively).  None of azoospermic males in Group A and B had deletions in both genes. Our data showed significant correlation between non-obstructive azoospermia and TTY2L12A and TTY2L2A deletions. Thus, it seems that TTY2L12A and TTY2L2A deletions can consider as one of the genetic risk factors for non-obstructive azoospermia.

  17. The mitochondrial ND1 m.3337G>A mutation associated to multiple mitochondrial DNA deletions in a patient with Wolfram syndrome and cardiomyopathy.

    Science.gov (United States)

    Mezghani, Najla; Mnif, Mouna; Mkaouar-Rebai, Emna; Kallel, Nozha; Salem, Ikhlass Haj; Charfi, Nadia; Abid, Mohamed; Fakhfakh, Faiza

    2011-07-29

    Wolfram syndrome (WFS) is a rare hereditary disorder also known as DIDMOAD (diabetes insipidus, diabetes mellitus, optic atrophy, and deafness). It is a heterogeneous disease and full characterization of all clinical and biological features of this disorder is difficult. The wide spectrum of clinical expression, affecting several organs and tissues, and the similarity in phenotype between patients with Wolfram syndrome and those with certain types of respiratory chain diseases suggests mitochondrial DNA (mtDNA) involvement in Wolfram syndrome patients. We report a Tunisian patient with clinical features of moderate Wolfram syndrome including diabetes, dilated cardiomyopathy and neurological complications. The results showed the presence of the mitochondrial ND1 m.3337G>A mutation in almost homoplasmic form in 3 tested tissues of the proband (blood leukocytes, buccal mucosa and skeletal muscle). In addition, the long-range PCR amplifications revealed the presence of multiple deletions of the mitochondrial DNA extracted from the patient's skeletal muscle removing several tRNA and protein-coding genes. Our study reported a Tunisian patient with clinical features of moderate Wolfram syndrome associated with cardiomyopathy, in whom we detected the ND1 m.3337G>A mutation with mitochondrial multiple deletions. Copyright © 2011 Elsevier Inc. All rights reserved.

  18. A 3-base pair deletion, c.9711_9713del, in DMD results in intellectual disability without muscular dystrophy

    NARCIS (Netherlands)

    Brouwer, A.P.M. de; Nabuurs, S.B.; Verhaart, I.E.; Oudakker, A.R.; Hordijk, R.; Yntema, H.G.; Hordijk-Hos, J.M.; Voesenek, K.E.; Vries, B. de; Essen, T. van; Chen, W.; Hu, H; Chelly, J.; Dunnen, J.T. den; Kalscheuer, V.M.M.; Aartsma-Rus, A.M.; Hamel, B.C.J.; Bokhoven, H. van; Kleefstra, T.

    2014-01-01

    We have identified a deletion of 3 base pairs in the dystrophin gene (DMD), c.9711_9713del, in a family with nonspecific X-linked intellectual disability (ID) by sequencing of the exons of 86 known X-linked ID genes. This in-frame deletion results in the deletion of a single-amino-acid residue,

  19. Novel interstitial deletion of 10q24.3-25.1 associated with multiple congenital anomalies including lobar holoprosencephaly, cleft lip and palate, and hypoplastic kidneys.

    Science.gov (United States)

    Peltekova, Iskra T; Hurteau-Millar, Julie; Armour, Christine M

    2014-12-01

    Chromosome 10q deletions are rare and phenotypically diverse. Such deletions differ in length and occur in numerous regions on the long arm of chromosome 10, accounting for the wide clinical variability. Commonly reported findings include dysmorphic facial features, microcephaly, developmental delay, and genitourinary abnormalities. Here, we report on a female patient with a novel interstitial 5.54 Mb deletion at 10q24.31-q25.1. This patient had findings in common with a previously reported patient with an overlapping deletion, including renal anomalies and an orofacial cleft, but also demonstrated lobar holoprosencephaly and a Dandy-Walker malformation, features which have not been previously reported with 10q deletions. An analysis of the region deleted in our patient showed numerous genes, such as KAZALD1, PAX2, SEMA4G, ACTRA1, INA, and FGF8, whose putative functions may have played a role in the phenotype seen in our patient. © 2014 Wiley Periodicals, Inc.

  20. Spontaneous and mutagen-induced deletions: mechanistic studies in Salmonella tester strain TA102

    International Nuclear Information System (INIS)

    Levin, D.E.; Marnett, L.J.; Ames, B.N.

    1984-01-01

    Salmonella tester strain TA102 carries the hisG428 ochre mutation on the multicopy plasmid pAQ1. DNA sequence analysis of 45 spontaneous revertants of hisG428 on the chromosome in the presence of pKM101 (strain TA103) indicates that hisG428 revertants fall into three major categories: (i) small, in-frame deletions (3 or 6 base pairs) that remove part or all of the ochre triplet; (ii) base substitution mutations at the ochre site; (iii) extragenic ochre suppressors. Deletion revertants are identified in a simple phenotypic screen by their resistance to the inhibitory histidine analog thiazolealanine, which feedback inhibits the wild-type hisG enzyme but not the enzyme resulting from the deletions. The effect of various genetic backgrounds on the generation of spontaneous deletion revertants was examined. The presence of a uvrB mutation or a recA mutation suppressed the generation of spontaneous deletion revertants to approximately 1/2.5. When hisG428 was in multiple copies on pAQ1, the frequency of spontaneous deletion revertants increased by 40-fold, which is the approximate copy number of pAQ1. Mutagenic agents that induce single-strand breaks in DNA (e.g., x-rays, bleomycin, and nalidixic acid) induced deletion revertants in TA102. These agents induced deletion revertants only in hisG428 on pAQ1 and only in the presence of pKM101. Deletion revertants were not induced by frameshift mutagens (i.e., ICR-191 and 9aminoacridine). These results indicate that different pathways exist for the generation of spontaneous and mutagen-induced deletion revertants of hisG428. 41 references, 2 figures, 3 tables

  1. Myeloablation-associated deletion of ORF4 in a human coronavirus 229E infection.

    Science.gov (United States)

    Greninger, Alexander L; Pepper, Gregory; Shean, Ryan C; Cent, Anne; Palileo, Isabel; Kuypers, Jane M; Schiffer, Joshua T; Jerome, Keith R

    2017-01-01

    We describe metagenomic next-generation sequencing (mNGS) of a human coronavirus 229E from a patient with AML and persistent upper respiratory symptoms, who underwent hematopoietic cell transplantation (HCT). mNGS revealed a 548-nucleotide deletion, which comprised the near entirety of the ORF4 gene, and no minor allele variants were detected to suggest a mixed infection. As part of her pre-HCT conditioning regimen, the patient received myeloablative treatment with cyclophosphamide and 12 Gy total body irradiation. Iterative sequencing and RT-PCR confirmation of four respiratory samples over the 4-week peritransplant period revealed that the pre-conditioning strain contained an intact ORF4 gene, while the deletion strain appeared just after conditioning and persisted over a 2.5-week period. This sequence represents one of the largest genomic deletions detected in a human RNA virus and describes large-scale viral mutation associated with myeloablation for HCT.

  2. Rapid deletion production in fungi via Agrobacterium mediated transformation of OSCAR deletion contructs.

    Science.gov (United States)

    Precise deletion of gene(s) of interest, while leaving the rest of the genome unchanged, provides the ideal product to determine that particular gene’s function in the living organism. In this protocol we describe the OSCAR method of precise and rapid deletion plasmid construction. OSCAR relies on t...

  3. ReacKnock: identifying reaction deletion strategies for microbial strain optimization based on genome-scale metabolic network.

    Directory of Open Access Journals (Sweden)

    Zixiang Xu

    Full Text Available Gene knockout has been used as a common strategy to improve microbial strains for producing chemicals. Several algorithms are available to predict the target reactions to be deleted. Most of them apply mixed integer bi-level linear programming (MIBLP based on metabolic networks, and use duality theory to transform bi-level optimization problem of large-scale MIBLP to single-level programming. However, the validity of the transformation was not proved. Solution of MIBLP depends on the structure of inner problem. If the inner problem is continuous, Karush-Kuhn-Tucker (KKT method can be used to reformulate the MIBLP to a single-level one. We adopt KKT technique in our algorithm ReacKnock to attack the intractable problem of the solution of MIBLP, demonstrated with the genome-scale metabolic network model of E. coli for producing various chemicals such as succinate, ethanol, threonine and etc. Compared to the previous methods, our algorithm is fast, stable and reliable to find the optimal solutions for all the chemical products tested, and able to provide all the alternative deletion strategies which lead to the same industrial objective.

  4. Discrimination of Deletion and Duplication Subtypes of the Deleted in Azoospermia Gene Family in the Context of Frequent Interloci Gene Conversion

    Science.gov (United States)

    Vaszkó, Tibor; Papp, János; Krausz, Csilla; Casamonti, Elena; Géczi, Lajos; Olah, Edith

    2016-01-01

    Due to its palindromic setup, AZFc (Azoospermia Factor c) region of chromosome Y is one of the most unstable regions of the human genome. It contains eight gene families expressed mainly in the testes. Several types of rearrangement resulting in changes in the cumulative copy number of the gene families were reported to be associated with diseases such as male infertility and testicular germ cell tumors. The best studied AZFc rearrangement is gr/gr deletion. Its carriers show widespread phenotypic variation from azoospermia to normospermia. This phenomenon was initially attributed to different gr/gr subtypes that would eliminate distinct members of the affected gene families. However, studies conducted to confirm this hypothesis have brought controversial results, perhaps, in part, due to the shortcomings of the utilized subtyping methodology. This proof-of-concept paper is meant to introduce here a novel method aimed at subtyping AZFc rearrangements. It is able to differentiate the partial deletion and partial duplication subtypes of the Deleted in Azoospermia (DAZ) gene family. The keystone of the method is the determination of the copy number of the gene family member-specific variant(s) in a series of sequence family variant (SFV) positions. Most importantly, we present a novel approach for the correct interpretation of the variant copy number data to determine the copy number of the individual DAZ family members in the context of frequent interloci gene conversion.Besides DAZ1/DAZ2 and DAZ3/DAZ4 deletions, not yet described rearrangements such as DAZ2/DAZ4 deletion and three duplication subtypes were also found by the utilization of the novel approach. A striking feature is the extremely high concordance among the individual data pointing to a certain type of rearrangement. In addition to being able to identify DAZ deletion subtypes more reliably than the methods used previously, this approach is the first that can discriminate DAZ duplication subtypes as well

  5. Towards a new point of view on the phenotype of patients with a 17q12 microdeletion syndrome.

    Science.gov (United States)

    Laffargue, Fanny; Bourthoumieu, Sylvie; Llanas, Brigitte; Baudouin, Véronique; Lahoche, Annie; Morin, Denis; Bessenay, Lucie; De Parscau, Loïc; Cloarec, Sylvie; Delrue, Marie-Ange; Taupiac, Emmanuelle; Dizier, Emilie; Laroche, Cécile; Bahans, Claire; Yardin, Catherine; Lacombe, Didier; Guigonis, Vincent

    2015-03-01

    17q12 microdeletion syndrome involves 15 genes, including HNF1B, and is considered to confer a high risk of neuropsychiatric disorders. Patients with HNF1B gene deletion diagnosed secondary to renal disorders are only very rarely reported to have neuropsychiatric disorders. Interestingly, however, when tested, patients with HNF1B gene deletion are found to have 17q12 deletion. This brings into question the extent to which 17q12 deletion is genuinely associated with severe neuropsychological disorders and in which patients. In this study, we sought to confirm 17q12 microdeletion in kidney patients initially diagnosed with HNF1B gene deletion and evaluate neuropsychological disorders in these patients compared with those with HNF1B point mutation. Thirty-nine children with HNF1B disorders (26 with deletions) diagnosed secondary to renal abnormalities were included in this prospective study and tested for 17q12 microdeletion and neuropsychological disorders. The same 17q12 microdeletion found in patients with neuropsychological disorders was identified in all of our patients with HNF1B deletion. Neurological examinations found no severe impairments except for one patient with autism. No significant differences were found between patients with deletions and those with point mutations as concerns learning abilities and schooling. Nevertheless, patients with deletions tended to have lower developmental quotients and more difficulties at school. Complete deletion of the HNF1B gene and 17q12 microdeletion syndrome are actually the same genetic disorder. The neuropsychological phenotype of patients appears less severe when 17q12 deletion is diagnosed secondary to kidney rather than neuropsychological abnormalities. These data may influence antenatal counselling. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  6. Partial deletion 11q

    DEFF Research Database (Denmark)

    Hertz, Jens Michael; Tommerup, N; Sørensen, F B

    1995-01-01

    We describe the cytogenetic findings and the dysmorphic features in a stillborn girl with a large de novo terminal deletion of the long arm of chromosome 11. The karyotype was 46,XX,del(11)(q21qter). By reviewing previous reports of deletion 11q, we found that cleft lip and palate are most...

  7. Clinical and molecular consequences of exon 78 deletion in DMD gene.

    Science.gov (United States)

    Traverso, Monica; Assereto, Stefania; Baratto, Serena; Iacomino, Michele; Pedemonte, Marina; Diana, Maria Cristina; Ferretti, Marta; Broda, Paolo; Minetti, Carlo; Gazzerro, Elisabetta; Madia, Francesca; Bruno, Claudio; Zara, Federico; Fiorillo, Chiara

    2018-03-19

    We present a 13-year-old patient with persistent increase of serum Creatine Kinase (CK) and myalgia after exertion. Skeletal muscle biopsy showed marked reduction of dystrophin expression leading to genetic analysis of DMD gene by MLPA, which detected a single deletion of exon 78. To the best of our knowledge, DMD exon 78 deletion has never been described in literature and, according to prediction, it should lead to loss of reading frame in the dystrophin gene. To further assess the actual effect of exon 78 deletion, we analysed cDNA from muscle mRNA. This analysis confirmed the absence of 32 bp of exon 78. Exclusion of exon 78 changes the open reading frame of exon 79 and generate a downstream stop codon, producing a dystrophin protein of 3703 amino acids instead of 3685 amino acids. Albeit loss of reading frame usually leads to protein degradation and severe phenotype, in this case, we demonstrated that deletion of DMD exon 78 can be associated with a functional protein able to bind DGC complex and a very mild phenotype. This study adds a novel deletion in DMD gene in human and helps to define the compliance between maintaining/disrupting the reading frame and clinical form of the disease.

  8. Refinement of genotype-phenotype correlation in 18 patients carrying a 1q24q25 deletion

    DEFF Research Database (Denmark)

    Chatron, Nicolas; Haddad, Véronique; Andrieux, Joris

    2015-01-01

    of different sizes (490 kb to 20.95 Mb) localized within chromosome bands 1q23.3-q31.2 (chr1:160797550-192912120, hg19). The 490 kb deletion is the smallest deletion reported to date associated with this phenotype. We delineated three regions that may contribute to the phenotype: a proximal one (chr1...

  9. Transcriptome Profiling of Peripheral Blood in 22q11.2 Deletion Syndrome Reveals Functional Pathways Related to Psychosis and Autism Spectrum Disorder.

    Directory of Open Access Journals (Sweden)

    Maria Jalbrzikowski

    Full Text Available 22q11.2 Deletion Syndrome (22q11DS represents one of the greatest known genetic risk factors for the development of psychotic illness, and is also associated with high rates of autistic spectrum disorders (ASD in childhood. We performed integrated genomic analyses of 22q11DS to identify genes and pathways related to specific phenotypes.We used a high-resolution aCGH array to precisely characterize deletion breakpoints. Using peripheral blood, we examined differential expression (DE and networks of co-expressed genes related to phenotypic variation within 22q11DS patients. Whole-genome transcriptional profiling was performed using Illumina Human HT-12 microarrays. Data mining techniques were used to validate our results against independent samples of both peripheral blood and brain tissue from idiopathic psychosis and ASD cases.Eighty-five percent of 22q11DS individuals (N = 39 carried the typical 3 Mb deletion, with significant variability in deletion characteristics in the remainder of the sample (N = 7. DE analysis and weighted gene co-expression network analysis (WGCNA identified expression changes related to psychotic symptoms in patients, including a module of co-expressed genes which was associated with psychosis in 22q11DS and involved in pathways associated with transcriptional regulation. This module was enriched for brain-expressed genes, was not related to antipsychotic medication use, and significantly overlapped with transcriptional changes in idiopathic schizophrenia. In 22q11DS-ASD, both DE and WGCNA analyses implicated dysregulation of immune response pathways. The ASD-associated module showed significant overlap with genes previously associated with idiopathic ASD.These findings further support the use of peripheral tissue in the study of major mutational models of diseases affecting the brain, and point towards specific pathways dysregulated in 22q11DS carriers with psychosis and ASD.

  10. Deletion of ameloblastin exon 6 is associated with amelogenesis imperfecta.

    Science.gov (United States)

    Poulter, James A; Murillo, Gina; Brookes, Steven J; Smith, Claire E L; Parry, David A; Silva, Sandra; Kirkham, Jennifer; Inglehearn, Chris F; Mighell, Alan J

    2014-10-15

    Amelogenesis imperfecta (AI) describes a heterogeneous group of inherited dental enamel defects reflecting failure of normal amelogenesis. Ameloblastin (AMBN) is the second most abundant enamel matrix protein expressed during amelogenesis. The pivotal role of AMBN in amelogenesis has been confirmed experimentally using mouse models. However, no AMBN mutations have been associated with human AI. Using autozygosity mapping and exome sequencing, we identified genomic deletion of AMBN exon 6 in a second cousin consanguineous family with three of the six children having hypoplastic AI. The genomic deletion corresponds to an in-frame deletion of 79 amino acids, shortening the protein from 447 to 368 residues. Exfoliated primary teeth (unmatched to genotype) were available from family members. The most severely affected had thin, aprismatic enamel (similar to that reported in mice homozygous for Ambn lacking exons 5 and 6). Other teeth exhibited thicker but largely aprismatic enamel. One tooth had apparently normal enamel. It has been suggested that AMBN may function in bone development. No clinically obvious bone or other co-segregating health problems were identified in the family investigated. This study confirms for the first time that AMBN mutations cause non-syndromic human AI and that mouse models with disrupted Ambn function are valid. © The Author 2014. Published by Oxford University Press.

  11. Network topologies and convergent aetiologies arising from deletions and duplications observed in individuals with autism.

    Science.gov (United States)

    Noh, Hyun Ji; Ponting, Chris P; Boulding, Hannah C; Meader, Stephen; Betancur, Catalina; Buxbaum, Joseph D; Pinto, Dalila; Marshall, Christian R; Lionel, Anath C; Scherer, Stephen W; Webber, Caleb

    2013-06-01

    Autism Spectrum Disorders (ASD) are highly heritable and characterised by impairments in social interaction and communication, and restricted and repetitive behaviours. Considering four sets of de novo copy number variants (CNVs) identified in 181 individuals with autism and exploiting mouse functional genomics and known protein-protein interactions, we identified a large and significantly interconnected interaction network. This network contains 187 genes affected by CNVs drawn from 45% of the patients we considered and 22 genes previously implicated in ASD, of which 192 form a single interconnected cluster. On average, those patients with copy number changed genes from this network possess changes in 3 network genes, suggesting that epistasis mediated through the network is extensive. Correspondingly, genes that are highly connected within the network, and thus whose copy number change is predicted by the network to be more phenotypically consequential, are significantly enriched among patients that possess only a single ASD-associated network copy number changed gene (p = 0.002). Strikingly, deleted or disrupted genes from the network are significantly enriched in GO-annotated positive regulators (2.3-fold enrichment, corrected p = 2×10(-5)), whereas duplicated genes are significantly enriched in GO-annotated negative regulators (2.2-fold enrichment, corrected p = 0.005). The direction of copy change is highly informative in the context of the network, providing the means through which perturbations arising from distinct deletions or duplications can yield a common outcome. These findings reveal an extensive ASD-associated molecular network, whose topology indicates ASD-relevant mutational deleteriousness and that mechanistically details how convergent aetiologies can result extensively from CNVs affecting pathways causally implicated in ASD.

  12. The Role of Dicentric Chromosome Formation and Secondary Centromere Deletion in the Evolution of Myeloid Malignancy

    Science.gov (United States)

    MacKinnon, Ruth N.; Campbell, Lynda J.

    2011-01-01

    Dicentric chromosomes have been identified as instigators of the genome instability associated with cancer, but this instability is often resolved by one of a number of different secondary events. These include centromere inactivation, inversion, and intercentromeric deletion. Deletion or excision of one of the centromeres may be a significant occurrence in myeloid malignancy and other malignancies but has not previously been widely recognized, and our reports are the first describing centromere deletion in cancer cells. We review what is known about dicentric chromosomes and the mechanisms by which they can undergo stabilization in both constitutional and cancer genomes. The failure to identify centromere deletion in cancer cells until recently can be partly explained by the standard approaches to routine diagnostic cancer genome analysis, which do not identify centromeres in the context of chromosome organization. This hitherto hidden group of primary dicentric, secondary monocentric chromosomes, together with other unrecognized dicentric chromosomes, points to a greater role for dicentric chromosomes in cancer initiation and progression than is generally acknowledged. We present a model that predicts and explains a significant role for dicentric chromosomes in the formation of unbalanced translocations in malignancy. PMID:22567363

  13. The Role of Dicentric Chromosome Formation and Secondary Centromere Deletion in the Evolution of Myeloid Malignancy

    Directory of Open Access Journals (Sweden)

    Ruth N. MacKinnon

    2011-01-01

    Full Text Available Dicentric chromosomes have been identified as instigators of the genome instability associated with cancer, but this instability is often resolved by one of a number of different secondary events. These include centromere inactivation, inversion, and intercentromeric deletion. Deletion or excision of one of the centromeres may be a significant occurrence in myeloid malignancy and other malignancies but has not previously been widely recognized, and our reports are the first describing centromere deletion in cancer cells. We review what is known about dicentric chromosomes and the mechanisms by which they can undergo stabilization in both constitutional and cancer genomes. The failure to identify centromere deletion in cancer cells until recently can be partly explained by the standard approaches to routine diagnostic cancer genome analysis, which do not identify centromeres in the context of chromosome organization. This hitherto hidden group of primary dicentric, secondary monocentric chromosomes, together with other unrecognized dicentric chromosomes, points to a greater role for dicentric chromosomes in cancer initiation and progression than is generally acknowledged. We present a model that predicts and explains a significant role for dicentric chromosomes in the formation of unbalanced translocations in malignancy.

  14. Brand deletion: How the decision-making approach affects deletion success

    Directory of Open Access Journals (Sweden)

    Víctor Temprano-García

    2018-04-01

    Full Text Available Literature on brand deletion (BD, a critical and topical decision within a firm's marketing strategy, is extremely scarce. The present research is concerned with the decision-making process and examines the effect on BD success of three different approaches to decision-making – rational, intuitive and political – and of the interaction between the rational and political approaches. The moderating effect of the type of BD – i.e., total brand killing or disposal vs. brand name change – is also analyzed. The model is tested on a sample of 155 cases of BD. Results point to positive effects on BD success of both rationality and intuition, and a negative effect of politics. Findings also indicate that the negative impact of political behavior on BD success is minimized in the absence of evidence and objective information and when the BD is undertaken through a brand name change. JEL classification: L10, M31, Keywords: Brand deletion, Rational decision-making, Intuitive decision-making, Political decision-making, Brand deletion success

  15. Name Recognition to Identify Patients of South Asian Ethnicity within the Cancer Registry

    Directory of Open Access Journals (Sweden)

    Savitri Singh-Carlson

    2016-01-01

    Full Text Available Objective: The goal of this project was to develop a list of forenames and surnames of South Asian (SA women that could be used to identify SA breast cancer patients within the cancer registry. This list was compiled, evaluated, and validated to ensure comprehensiveness, accuracy, and applicability of SA names. Methods: This project was conducted by Canadian researchers who are immersed in conducting behavioral studies with SA women diagnosed with cancer in the province of British Columbia. Recruiting SA cancer patients for research can be a difficult task due to social and cultural factors. Methods used by other researchers to identify ethnicity related unique names were employed to filter surnames and forenames that were not common to this ethnic group. Co-author (Gurpreet Oshan of SA ethnicity rigorously identified and deleted multiple lists and redundant entries along with common English forenames which resulted in a list of 16,888 SA forenames. All co-authors of Indian ethnicity (Gurpreet Oshan, Savitri Singh-Carlson, Harajit Lail were involved in critiquing and manually reviewing the names list throughout this process. Comprehensive lists of SA surnames and women′s forenames were reviewed to identify those that were unique to SA ethnicity. Accuracy was ensured by constantly filtering the redundancy by using an Excel program which helped to illustrate the number of times each name was spelled in different ways. Results: The final lists included 9112 surnames and 16,888 forenames of SA ethnicity. On the basis of the surname linkage only, the sensitivity of the list was 76.6%, specificity was 62.9%, and the positive predictive value was 58.5%. On the basis of both the surname and forename linkage, the specificity of the list was 88.6%. These lists include variations in spelling forenames and surnames as well. Conclusions: The list of surnames and forenames can be useful tools to identify SA ethnic groups from large population database in

  16. Genetics Home Reference: 22q13.3 deletion syndrome

    Science.gov (United States)

    ... 5 links) Diagnostic Tests Drug Therapy Genetic Counseling Palliative Care Surgery and Rehabilitation Related Information How are genetic ... Veltman JA, de Vries BB. Molecular characterisation of patients with subtelomeric 22q ... L, Enns GM, Hoyme HE. Terminal 22q deletion syndrome: a newly recognized cause of ...

  17. MicroRNA Dysregulation, Gene Networks, and Risk for Schizophrenia in 22q11.2 Deletion Syndrome

    OpenAIRE

    Merico, Daniele; Costain, Gregory; Butcher, Nancy J.; Warnica, William; Ogura, Lucas; Alfred, Simon E.; Brzustowicz, Linda M.; Bassett, Anne S.

    2014-01-01

    The role of microRNAs (miRNAs) in the etiology of schizophrenia is increasingly recognized. Microdeletions at chromosome 22q11.2 are recurrent structural variants that impart a high risk for schizophrenia and are found in up to 1% of all patients with schizophrenia. The 22q11.2 deletion region overlaps gene DGCR8, encoding a subunit of the miRNA microprocessor complex. We identified miRNAs overlapped by the 22q11.2 microdeletion and for the first time investigated their predicted target genes...

  18. Some analogies between quantum cloning and quantum deleting

    International Nuclear Information System (INIS)

    Qiu Daowen

    2002-01-01

    We further verify the impossibility of deleting an arbitrary unknown quantum state, and also show it is impossible to delete two nonorthogonal quantum states as a consequence of unitarity of quantum mechanics. A quantum approximate (deterministic) deleting machine and a probabilistic (exact) deleting machine are constructed. The estimation for the global fidelity characterizing the efficiency of the quantum approximate deleting is given. We then demonstrate that unknown nonorthogonal states chosen from a set with their multiple copies can evolve into a linear superposition of multiple deletions and failure branches by a unitary process if and only if the states are linearly independent. It is notable that the proof for necessity is somewhat different from Pati's [Phys. Rev. Lett. 83, 2849 (1999)]. Another deleting machine for the input states that are unnecessarily linearly independent is also presented. The bounds on the success probabilities of these deleting machines are derived. So we expound some preliminary analogies between quantum cloning and deleting

  19. New recurrent deletions in the PPARgamma and TP53 genes are associated with childhood myelodysplastic syndrome

    DEFF Research Database (Denmark)

    Silveira, Cássia G T; Oliveira, Fábio M; Valera, Elvis T

    2009-01-01

    Myelodysplastic syndrome (MDS) is a rare hematological malignancy in children. It was performed FISH analysis in 19 pediatric MDS patients to investigate deletions involving the PPARgamma and TP53 genes. Significant losses in the PPARgamma gene and deletions in the tumor suppressor gene TP53 were...

  20. Deletions and de novo mutations of SOX11 are associated with a neurodevelopmental disorder with features of Coffin–Siris syndrome

    Science.gov (United States)

    Hempel, Annmarie; Pagnamenta, Alistair T; Blyth, Moira; Mansour, Sahar; McConnell, Vivienne; Kou, Ikuyo; Ikegawa, Shiro; Tsurusaki, Yoshinori; Matsumoto, Naomichi; Lo-Castro, Adriana; Plessis, Ghislaine; Albrecht, Beate; Battaglia, Agatino; Taylor, Jenny C; Howard, Malcolm F; Keays, David; Sohal, Aman Singh; Kühl, Susanne J; Kini, Usha; McNeill, Alisdair

    2016-01-01

    Background SOX11 is a transcription factor proposed to play a role in brain development. The relevance of SOX11 to human developmental disorders was suggested by a recent report of SOX11 mutations in two patients with Coffin–Siris syndrome. Here we further investigate the role of SOX11 variants in neurodevelopmental disorders. Methods We used array based comparative genomic hybridisation and trio exome sequencing to identify children with intellectual disability who have deletions or de novo point mutations disrupting SOX11. The pathogenicity of the SOX11 mutations was assessed using an in vitro gene expression reporter system. Loss-of-function experiments were performed in xenopus by knockdown of Sox11 expression. Results We identified seven individuals with chromosome 2p25 deletions involving SOX11. Trio exome sequencing identified three de novo SOX11 variants, two missense (p.K50N; p.P120H) and one nonsense (p.C29*). The biological consequences of the missense mutations were assessed using an in vitro gene expression system. These individuals had microcephaly, developmental delay and shared dysmorphic features compatible with mild Coffin–Siris syndrome. To further investigate the function of SOX11, we knocked down the orthologous gene in xenopus. Morphants had significant reduction in head size compared with controls. This suggests that SOX11 loss of function can be associated with microcephaly. Conclusions We thus propose that SOX11 deletion or mutation can present with a Coffin–Siris phenotype. PMID:26543203

  1. Renal Failure Associated with APECED and Terminal 4q Deletion: Evidence of Autoimmune Nephropathy

    Directory of Open Access Journals (Sweden)

    Mohammed Al-Owain

    2010-01-01

    Full Text Available Autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy (APECED is a rare autosomal recessive disorder caused by mutations in the autoimmune regulator gene (AIRE. Terminal 4q deletion is also a rare cytogenetic abnormality that causes a variable syndrome of dysmorphic features, mental retardation, growth retardation, and heart and limb defects. We report a 12-year-old Saudi boy with mucocutaneous candidiasis, hypoparathyroidism, and adrenocortical failure consistent with APECED. In addition, he has dysmorphic facial features, growth retardation, and severe global developmental delay. Patient had late development of chronic renal failure. The blastogenesis revealed depressed lymphocytes' response to Candida albicans at 38% when compared to control. Chromosome analysis of the patient revealed 46,XY,del(4(q33. FISH using a 4p/4q subtelomere DNA probe assay confirmed the deletion of qter subtelomere on chromosome 4. Parental chromosomes were normal. The deleted array was further defined using array CGH. AIRE full gene sequencing revealed a homozygous mutation namely 845_846insC. Renal biopsy revealed chronic interstitial nephritis with advanced fibrosis. In addition, there was mesangial deposition of C3, C1q, and IgM. This is, to the best of our knowledge, the first paper showing evidence of autoimmune nephropathy by renal immunofluorescence in a patient with APECED and terminal 4q deletion.

  2. A previously unidentified deletion in G protein-coupled receptor 143 causing X-linked congenital nystagmus in a Chinese family

    Directory of Open Access Journals (Sweden)

    Jing Liu

    2016-01-01

    Full Text Available Background: Congenital nystagmus (CN is characterized by conjugated, spontaneous, and involuntary ocular oscillations. It is an inherited disease and the most common inheritance pattern is X-linked CN. In this study, our aim is to identify the disease-causing mutation in a large sixth-generation Chinese family with X-linked CN. Methods: It has been reported that mutations in four-point-one, ezrin, radixin, moesin domain-containing 7 gene (FRMD7 and G protein-coupled receptor 143 gene (GPR143 account for the majority patients of X-linked nystagmus. We collected 8 ml blood samples from members of a large sixth-generation pedigree with X-linked CN and 100 normal controls. FRMD7 and GPR143 were scanned by polymerase chain reaction (PCR-based DNA sequencing assays, and multiplex PCR assays were applied to detect deletions. Results: We identified a previously unreported deletion covering 7 exons in GPR143 in a Chinese family. The heterozygous deletion from exon 3 to exon 9 of GPR143 was detected in all affected males in the family, while it was not detected in other unaffected relatives or 100 normal controls. Conclusions: This is the first report of molecular characterization in GPR143 gene in the CN family. Our results expand the spectrum of GPR143 mutations causing CN and further confirm the role of GPR143 in the pathogenesis of CN.

  3. Identification of the first recurrent PAR1 deletion in Léri-Weill dyschondrosteosis and idiopathic short stature reveals the presence of a novel SHOX enhancer.

    Science.gov (United States)

    Benito-Sanz, Sara; Royo, Jose Luis; Barroso, Eva; Paumard-Hernández, Beatriz; Barreda-Bonis, Ana C; Liu, Pengfei; Gracía, Ricardo; Lupski, James R; Campos-Barros, Ángel; Gómez-Skarmeta, José Luis; Heath, Karen Elise

    2012-07-01

    SHOX, located in the pseudoautosomal region 1 (PAR1) of the sexual chromosomes, encodes a transcription factor implicated in human growth. Defects in SHOX or its enhancers have been observed in ∼60% of Leri-Weill dyschondrosteosis (LWD) patients, a skeletal dysplasia characterised by short stature and/or the characteristic Madelung deformity, and in 2-5% of idiopathic short stature (ISS). To identify the molecular defect in the remaining genetically undiagnosed LWD and ISS patients, this study screened previously unanalysed PAR1 regions in 124 LWD and 576 ISS probands. PAR1 screening was undertaken by multiplex ligation dependent probe amplification (MLPA). Copy number alterations were subsequently confirmed and delimited by locus-specific custom-designed MLPA, array comparative genomic hybridisation (CGH) and breakpoint junction PCR/sequencing. A recurrent PAR1 deletion downstream of SHOX spanning 47543 bp with identical breakpoints was identified in 19 LWD (15.3%) and 11 ISS (1.9%) probands, from 30 unrelated families. Eight evolutionarily conserved regions (ECRs 1-8) identified within the deleted sequence were evaluated for SHOX regulatory activity by means of chromosome conformation capture (3C) in chicken embryo limbs and luciferase reporter assays in human U2OS osteosarcoma cells. The 3C assay indicated potential SHOX regulatory activity by ECR1, which was subsequently confirmed to act as a SHOX enhancer, operating in an orientation and position independent manner, in human U2OS cells. This study has identified the first recurrent PAR1 deletion in LWD and ISS, which results in the loss of a previously uncharacterised SHOX enhancer. The loss of this enhancer may decrease SHOX transcription, resulting in LWD or ISS due to SHOX haploinsufficiency.

  4. Congenital disorder of glycosylation Ic due to a de novo deletion and an hALG-6 mutation.

    Science.gov (United States)

    Eklund, Erik A; Sun, Liangwu; Yang, Samuel P; Pasion, Romela M; Thorland, Erik C; Freeze, Hudson H

    2006-01-20

    We describe a new cause of congenital disorder of glycosylation-Ic (CDG-Ic) in a young girl with a rather mild CDG phenotype. Her cells accumulated lipid-linked oligosaccharides lacking three glucose residues, and sequencing of the ALG6 gene showed what initially appeared to be a homozygous novel point mutation (338G>A). However, haplotype analysis showed that the patient does not carry any paternal DNA markers extending 33kb in the telomeric direction from the ALG6 region, and microsatellite analysis extended the abnormal region to at least 2.5Mb. We used high-resolution karyotyping to confirm a deletion (10-12Mb) [del(1)(p31.2p32.3)] and found no structural abnormalities in the father, suggesting a de novo event. Our findings extend the causes of CDG to larger DNA deletions and identify the first Japanese CDG-Ic mutation.

  5. Frontonasal malformation with tetralogy of Fallot associated with a submicroscopic deletion of 22q11

    Energy Technology Data Exchange (ETDEWEB)

    Stratton, R.F. [South Texas Genetics Center, San Antonio, TX (United States); Payne, R.M. [Central Texas Genetics Center, Austin, TX (United States)

    1997-03-31

    We report on a 14-month-old girl with bifid nasal tip and tetralogy of Fallot. Several similar patients have been described with CNS or eye abnormalities. Chromosome analysis with FISH, using Oncor DiGeorge probes, confirmed a submicroscopic deletion of 22q11. Many patients with Shprintzen (velo-cardio-facial) syndrome have a similar deletion with conotruncal cardiac defects and an abnormal nasal shape, suggesting that a gene in this area, possibly affecting neural crest cells, influences facial and other midline development. 13 refs., 1 fig.

  6. Interstitial deletion of 5q33.3q35.1 in a boy with severe mental retardation

    OpenAIRE

    Lee, Jin Hwan; Kim, Hyo Jeong; Yoon, Jung Min; Cheon, Eun Jung; Lim, Jae Woo; Ko, Kyong Og; Lee, Gyung Min

    2016-01-01

    Constitutional interstitial deletions of the long arm of chromosome 5 (5q) are quite rare, and the corresponding phenotype is not yet clearly delineated. Severe mental retardation has been described in most patients who present 5q deletions. Specifically, the interstitial deletion of chromosome 5q33.3q35.1, an extremely rare chromosomal aberration, is characterized by mental retardation, developmental delay, and facial dysmorphism. Although the severity of mental retardation varies across cas...

  7. Multi-agent chemotherapy overcomes glucocorticoid resistance conferred by a BIM deletion polymorphism in pediatric acute lymphoblastic leukemia.

    Directory of Open Access Journals (Sweden)

    Sheila Xinxuan Soh

    Full Text Available A broad range of anti-cancer agents, including glucocorticoids (GCs and tyrosine kinase inhibitors (TKIs, kill cells by upregulating the pro-apoptotic BCL2 family member, BIM. A common germline deletion in the BIM gene was recently shown to favor the production of non-apoptotic BIM isoforms, and to predict inferior responses in TKI-treated chronic myeloid leukemia (CML and EGFR-driven lung cancer patients. Given that both in vitro and in vivo GC resistance are predictive of adverse outcomes in acute lymphoblastic leukemia (ALL, we hypothesized that this polymorphism would mediate GC resistance, and serve as a biomarker of poor response in ALL. Accordingly, we used zinc finger nucleases to generate ALL cell lines with the BIM deletion, and confirmed the ability of the deletion to mediate GC resistance in vitro. In contrast to CML and lung cancer, the BIM deletion did not predict for poorer clinical outcome in a retrospective analysis of 411 pediatric ALL patients who were uniformly treated with GCs and chemotherapy. Underlying the lack of prognostic significance, we found that the chemotherapy agents used in our cohort (vincristine, L-asparaginase, and methotrexate were each able to induce ALL cell death in a BIM-independent fashion, and resensitize BIM deletion-containing cells to GCs. Together, our work demonstrates how effective therapy can overcome intrinsic resistance in ALL patients, and suggests the potential of using combinations of drugs that work via divergent mechanisms of cell killing to surmount BIM deletion-mediated drug resistance in other cancers.

  8. Association of promoter methylation and 32-bp deletion of the PTEN gene with susceptibility to metabolic syndrome.

    Science.gov (United States)

    Hashemi, Mohammad; Rezaei, Hamzeh; Eskandari-Nasab, Ebrahim; Kaykhaei, Mahmoud-Ali; Taheri, Mohsen

    2013-01-01

    Metabolic syndrome (MeS), a cluster of several metabolic disorders, is increasingly being recognized as a risk factor for type II diabetes (T2D) and cardiovascular disease. Genetic and epigenetic alteration of the phosphatase and tensin homolog deleted on chromosome ten (PTEN) has been associated with components of MeS. The aim of the present study was to investigate the possible association of a 32-bp deletion polymorphism and promoter methylation of the PTEN gene with MeS. DNA was extracted from the peripheral blood of 151 subjects with and 149 subjects without MeS. The 32-bp deletion variant of PTEN was detected by polymerase chain reaction (PCR) and PTEN promoter methylation was defined by a nested methylation‑specific PCR (MSP) method. No significant differences were found in the allelic and genotypic frequencies of the 32-bp deletion variant of PTEN between the groups [odds ratio (OR), 0.77; 95% confidence interval (CI), 0.41-1.45; P=0.431]. However, patients with MeS were identified to have lower levels of PTEN promoter hypermethylation than subjects without MeS. Promoter methylation may be a protective factor against susceptibility to MeS (OR, 0.52; 95% CI, 0.29-0.92; P=0.029). Our findings suggest that PTEN promoter methylation may be a mechanism for PTEN downregulation or silencing in MeS, which remains to be fully clarified.

  9. 22q11.2 deletion syndrome lowers seizure threshold in adult patients without epilepsy.

    Science.gov (United States)

    Wither, Robert G; Borlot, Felippe; MacDonald, Alex; Butcher, Nancy J; Chow, Eva W C; Bassett, Anne S; Andrade, Danielle M

    2017-06-01

    Previous studies examining seizures in patients with 22q11.2 deletion syndrome (22q11.2DS) have focused primarily on children and adolescents. In this study we investigated the prevalence and characteristics of seizures and epilepsy in an adult 22q11.2DS population. The medical records of 202 adult patients with 22q11.2DS were retrospectively reviewed for documentation of seizures, electroencephalography (EEG) reports, and magnetic resonance imaging (MRI) findings. Epilepsy status was assigned in accordance with 2010 International League Against Epilepsy Classification. Of 202 patients, 32 (15.8%) had a documented history of seizure. Of these 32, 23 (71.8%) had acute symptomatic seizures, usually associated with hypocalcemia and/or antipsychotic or antidepressant use. Nine patients (9/32, 28%; 9/202, 4%) met diagnostic criteria for epilepsy. Two patients had genetic generalized epilepsy; two patients had focal seizures of unknown etiology; two had epilepsy due to malformations of cortical development; in two the epilepsy was due to acquired structural changes; and in one patient the epilepsy could not be further classified. Similarly to children, the prevalence of epilepsy and acute symptomatic seizures in adults with 22q11.2DS is higher than in the general population. Hypocalcemia continues to be a risk factor for adults, but differently from kids, the main cause of seizures in adults with 22q11.2DS is exposure to antipsychotics and antidepressants. Further prospective studies are warranted to investigate how 22q11.2 microdeletion leads to an overall decreased seizure threshold. Wiley Periodicals, Inc. © 2017 International League Against Epilepsy.

  10. Syndrome of proximal interstitial deletion 4p15

    Energy Technology Data Exchange (ETDEWEB)

    Fryns, J.P. [Univ. of Leuven (Belgium)

    1995-09-11

    In this journal, Chitayat et al. reported on 2 boys and a girl with interstitial deletion in the short arm of chromosome 4, including p15.2p15.33. All 3 patients had a characteristic face distinct from that of Wolf-Hirschhorn syndrome and multiple minor congenital anomalies. One patient had a congenitally enlarged penis. The authors noted that all had normal growth, and all had moderate psychomotor retardation (patient 1, developmental age of 4-6 years at age 9 years; patient 2, mental age 6 years at age 25 years; and patient 3, global delay with hypotonia, difficulties in both gross and fine motor development, and persistent delay in language skills). 5 refs., 1 fig.

  11. Identifying patient risks during hospitalization

    Directory of Open Access Journals (Sweden)

    Lucélia Ferreira Lima

    2008-12-01

    Full Text Available Objective: To identify the risks reported at a public institution andto know the main patient risks from the nursing staff point of view.Methods: A retrospective, descriptive and exploratory study. Thesurvey was developed at a hospital in the city of Taboão da Serra, SãoPaulo, Brazil. The study included all nurses working in care areas whoagreed to participate in the study. At the same time, sentinel eventsoccurring in the period from July 2006 to July 2007 were identified.Results: There were 440 sentinel events reported, and the main risksincluded patient falls, medication errors and pressure ulcers. Sixty-fivenurses were interviewed. They also reported patient falls, medicationerrors and pressure ulcers as the main risks. Conclusions: Riskassessment and implementation of effective preventive actions arenecessary to ensure patient’s safety. Involvement of a multidisciplinaryteam is one of the steps for a successful process.

  12. Clinical and genetic spectrum of Birt–Hogg–Dubé syndrome patients in whom pneumothorax and/or multiple lung cysts are the presenting feature

    Science.gov (United States)

    Kunogi, Makiko; Kurihara, Masatoshi; Ikegami, Takako Shigihara; Kobayashi, Toshiyuki; Shindo, Noriko; Kumasaka, Toshio; Gunji, Yoko; Kikkawa, Mika; Iwakami, Shin-ichiro; Hino, Okio; Takahashi, Kazuhisa

    2010-01-01

    Background Birt–Hogg–Dubé syndrome (BHDS) is an inherited autosomal genodermatosis characterised by fibrofolliculomas of the skin, renal tumours and multiple lung cysts. Genetic studies have disclosed that the clinical picture as well as responsible germline FLCN mutations are diverse. Objectives BHDS may be caused by a germline deletion which cannot be detected by a conventional genetic approach. Real-time quantitative polymerase chain reaction (qPCR) may be able to identify such a mutation and thus provide us with a more accurate clinical picture of BHDS. Methods This study analysed 36 patients with multiple lung cysts of undetermined causes. Denaturing high performance liquid chromatography (DHPLC) was applied for mutation screening. If no abnormality was detected by DHPLC, the amount of each FLCN exon in genome was quantified by qPCR. Results An FLCN germline mutation was found in 23 (63.9%) of the 36 patients by DHPLC and direct sequencing (13 unique small nucleotide alterations which included 11 novel mutations). A large genomic deletion was identified in two of the remaining 13 patients by qPCR (one patient with exon 14 deletion and one patient with a deletion encompassing exons 9 to 14). Mutations including genomic deletions were most frequently identified in the 3′-end of the FLCN gene including exons 12 and 13 (13/25=52.0%). The BHDS patients whose multiple cysts prompted the diagnosis in this study showed a very low incidence of skin and renal involvement. Conclusions BHDS is due to large deletions as well as small nucleotide alterations. Racial differences may occur between Japanese and patients of European decent in terms of FLCN mutations and clinical manifestations. PMID:20413710

  13. Exon Deletion Pattern in Duchene Muscular Dystrophy in North West of Iran

    OpenAIRE

    BARZEGAR, Mohammad; HABIBI, Parinaz; BONYADY, Mortaza; TOPCHIZADEH, Vahideh; SHIVA, Shadi

    2015-01-01

    How to Cite This Article: Barzegar M, Habibi P, Bonyady M, Topchizadeh V, Shiva Sh. Exon Deletion Pattern in Duchene Muscular Dystrophy in North West of Iran. Iran J Child Neurol. 2015 Winter; 9(1): 42-48.AbstractObjectiveDuchene and Becker Muscular Dystrophy (DMD/ BMD) are x-linked disorders that both are the result of heterogeneous mutations in the dystrophin gene. The frequency and distribution of dystrophin gene deletions in DMD/ BMD patients show different patterns among different popula...

  14. Probabilistic cloning and deleting of quantum states

    International Nuclear Information System (INIS)

    Feng Yuan; Zhang Shengyu; Ying Mingsheng

    2002-01-01

    We construct a probabilistic cloning and deleting machine which, taking several copies of an input quantum state, can output a linear superposition of multiple cloning and deleting states. Since the machine can perform cloning and deleting in a single unitary evolution, the probabilistic cloning and other cloning machines proposed in the previous literature can be thought of as special cases of our machine. A sufficient and necessary condition for successful cloning and deleting is presented, and it requires that the copies of an arbitrarily presumed number of the input states are linearly independent. This simply generalizes some results for cloning. We also derive an upper bound for the success probability of the cloning and deleting machine

  15. 46 CFR 67.171 - Deletion; requirement and procedure.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 2 2010-10-01 2010-10-01 false Deletion; requirement and procedure. 67.171 Section 67...; Requirement for Exchange, Replacement, Deletion, Cancellation § 67.171 Deletion; requirement and procedure. (a... provided in § 67.161, and the vessel is subject to deletion from the roll of actively documented vessels...

  16. Detection of a molecular deletion at the DXS732 locus in a patient with X-linked hypohidrotic ectodermal dysplasia (EDA), with the identification of a unique junctional fragment

    Energy Technology Data Exchange (ETDEWEB)

    Zonana, J.; Gault, J.; Jones, M.; Browne, D.; Litt, M. (Oregon Health Sciences Univ., Portland (United States)); Davies, K.J.P.; Clarke, A.; Thomas, N.S.T. (Univ. of Wales, Cardiff (United Kingdom)); Brockdorff, N.; Rastan, S. (Medical Research Council Clinical Research Centre, Harrow (United Kingdom))

    1993-01-01

    X-linked hypohidrotic ectodermal dysplasia (EDA) has been localized to the Xq12-q13.1. A panel of genomic DNA samples from 80 unrelated males with EDA has been screened for deletions at seven genetic loci within the Xq12-13 region. A single individual was identified with a deletion at the DXS732 locus by hybridization with the mouse genomic probe pcos169E/4. This highly conserved DNA probe is from locus DXCrc169, which is tightly linked to the Ta locus, the putative mouse homologue of EDA. The proband had the classical phenotype of EDA, with no other phenotypic abnormalities, and a normal cytogenetic analysis. A human genomic DNA clone, homologous to pcos169E/4, was isolated from a human X-chromosome cosmid library. On hybridization with the cosmid, the proband was found to be only partially deleted at the DXS732 locus, with a unique junctional fragment identified in the proband and in three of his maternal relatives. This is the first determination of carrier status for EDA in females, by direct mutation analysis. Failure to detect deletion of the other loci tested in the proband suggests that the DXS732 locus is the closest known locus to the EDA gene. Since the DXS732 locus contains a highly conserved sequence, it must be considered to be a candidate locus for the EDA gene itself. 18 refs., 3 figs., 1 tab.

  17. Two novel partial deletions of LDL-receptor gene in Italian patients with familial hypercholesterolemia (FH Siracusa and FH Reggio Emilia).

    Science.gov (United States)

    Garuti, R; Lelli, N; Barozzini, M; Tiozzo, R; Ghisellini, M; Simone, M L; Li Volti, S; Garozzo, R; Mollica, F; Vergoni, W; Bertolini, S; Calandra, S

    1996-03-01

    In the present study we report two novel partial deletions of the LDL-R gene. The first (FH Siracusa), found in an FH-heterozygote, consists of a 20 kb deletion spanning from the 5' flanking region to the intron 2 of the LDL-receptor gene. The elimination of the promoter and the first two exons prevents the transcription of the deleted allele, as shown by Northern blot analysis of LDL-R mRNA isolated from the proband's fibroblasts. The second deletion (FH Reggio Emilia), which eliminates 11 nucleotides of exon 10, was also found in an FH heterozygote. The characterization of this deletion was made possible by a combination of techniques such as single strand conformation polymorphism (SSCP) analysis, direct sequence of exon 10 and cloning of the normal and deleted exon 10 from the proband's DNA. The 11 nt deletion occurs in a region of exon 10 which contains three triplets (CTG) and two four-nucleotides (CTGG) direct repeats. This structural feature might render this region more susceptible to a slipped mispairing during DNA duplication. Since this deletion causes a shift of the BamHI site at the 5' end of exon 10, a method has been devised for its rapid screening which is based on the PCR amplification of exon 10 followed by BamHI digestion. FH Reggio Emilia deletion produces a shift in the reading frame downstream from Lys458, leading to a sequence of 51 novel amino acids before the occurrence of a premature stop codon (truncated receptor). However, since RT-PCR failed to demonstrate the presence of the mutant LDL-R mRNA in proband fibroblasts, it is likely that the amount of truncated receptor produced in these cells is negligible.

  18. Age-related differences in 1p and 19q deletions in oligodendrogliomas

    Directory of Open Access Journals (Sweden)

    Del Bigio Marc R

    2003-12-01

    Full Text Available Abstract Background Recent reports indicate that anaplastic oligodendrogliomas frequently show allelic losses on chromosome arms 1p and 19q, and that these deletions are associated with better chemotherapeutic response and overall patient survival. Because of the diversified genetic makeup of the population and the centralized provincial referral system for brain tumor patients in Manitoba, the epidemiological features of such tumors sometimes differ from the published data acquired from non-community based settings. In this study, we assessed the prevalence of allelic deletions for chromosome arms 1p and 19q in anaplastic and in low-grade oligodendrogliomas in the Manitoba population. Methods Loss of heterozygosity (LOH analysis of brain tumors was carried out using 4 microsatellite markers (D1S508, D1S2734, D19S219 and D19S412 and a PCR based assay. The tumors were consecutively acquired during the period September 1999–March 2001 and a total of 63 tumors were assessed. Results We found that allelic loss of chromosome 1p and 19q was higher in oligodendrogliomas than in other diffuse gliomas and that for anaplastic oligodendrogliomas, younger patients exhibited significantly more deletions than older patients (>60 years of age. Conclusions These studies suggest that age may be a factor in the genetic alterations of oligodendrogliomas. In addition, these studies demonstrate that this assay can easily be carried out in a cost-effective manner in a small tertiary center.

  19. Syndrome of proximal interstitial deletion 4p15: Report of three cases and review of the literature

    Energy Technology Data Exchange (ETDEWEB)

    Chitayat, D.; Babul, R.; Teshima, I.E. [Univ. of Toronto, Ontario (Canada)] [and others

    1995-01-16

    We report on two boys and a girl with interstitial deletion in the short arm of chromosome 4 including the segment p15.2p15.33. All had normal growth with psychomotor retardation, multiple minor congenital anomalies, and a characteristic face distinct from that of the Wolf-Hirschhorn syndrome. One of the patients had congenitally enlarged penis. These patients resemble some of the previously reported patients with similar cytogenetic abnormalities and suggests the recognition of a specific clinical chromosome deletion syndrome. 12 refs., 6 figs., 1 tab.

  20. Use of a wine yeast deletion collection reveals genes that influence fermentation performance under low-nitrogen conditions.

    Science.gov (United States)

    Peter, Josephine J; Watson, Tommaso L; Walker, Michelle E; Gardner, Jennifer M; Lang, Tom A; Borneman, Anthony; Forgan, Angus; Tran, Tina; Jiranek, Vladimir

    2018-05-01

    A deficiency of nitrogenous nutrients in grape juice can cause stuck and sluggish alcoholic fermentation, which has long been a problem in winemaking. Nitrogen requirements vary between wine yeast strains, and the ability of yeast to assimilate nitrogen depends on the nature and concentration of nitrogen present in the medium. In this study, a wine yeast gene deletion collection (1844 deletants in the haploid AWRI1631 background) was screened to identify genes whose deletion resulted in a reduction in the time taken to utilise all sugars when grown in a chemically defined grape juice medium supplemented with limited nitrogen (75 mg L-1 as a free amino acid mixture). Through micro-scale and laboratory-scale fermentations, 15 deletants were identified that completed fermentation in a shorter time than the wildtype (c.a. 15%-59% time reduction). This group of genes was annotated to biological processes including protein modification, transport, metabolism and ubiquitination (UBC13, MMS2, UBP7, UBI4, BRO1, TPK2, EAR1, MRP17, MFA2 and MVB12), signalling (MFA2) and amino acid metabolism (AAT2). Deletion of MFA2, encoding mating factor-a, resulted in a 55% decrease in fermentation duration. Mfa2Δ was chosen for further investigation to understand how this gene deletion conferred fermentation efficiency in limited nitrogen conditions.

  1. Alu-mediated deletion of SOX10 regulatory elements in Waardenburg syndrome type 4.

    Science.gov (United States)

    Bondurand, Nadége; Fouquet, Virginie; Baral, Viviane; Lecerf, Laure; Loundon, Natalie; Goossens, Michel; Duriez, Benedicte; Labrune, Philippe; Pingault, Veronique

    2012-09-01

    Waardenburg syndrome type 4 (WS4) is a rare neural crest disorder defined by the combination of Waardenburg syndrome (sensorineural hearing loss and pigmentation defects) and Hirschsprung disease (intestinal aganglionosis). Three genes are known to be involved in this syndrome, that is, EDN3 (endothelin-3), EDNRB (endothelin receptor type B), and SOX10. However, 15-35% of WS4 remains unexplained at the molecular level, suggesting that other genes could be involved and/or that mutations within known genes may have escaped previous screenings. Here, we searched for deletions within recently identified SOX10 regulatory sequences and describe the first characterization of a WS4 patient presenting with a large deletion encompassing three of these enhancers. Analysis of the breakpoint region suggests a complex rearrangement involving three Alu sequences that could be mediated by a FosTes/MMBIR replication mechanism. Taken together with recent reports, our results demonstrate that the disruption of highly conserved non-coding elements located within or at a long distance from the coding sequences of key genes can result in several neurocristopathies. This opens up new routes to the molecular dissection of neural crest disorders.

  2. Genomic deletion of a long-range bone enhancer misregulatessclerostin in Van Buchem disease

    Energy Technology Data Exchange (ETDEWEB)

    Loots, Gabriela G.; Kneissel, Michaela; Keller, Hansjoerg; Baptist, Myma; Chang, Jessie; Collette, Nicole M.; Ovcharenko, Dmitriy; Plajzer-Frick, Ingrid; Rubin, Edward M.

    2005-04-15

    Mutations in distant regulatory elements can negatively impact human development and health, yet due to the difficulty of detecting these critical sequences we predominantly focus on coding sequences for diagnostic purposes. We have undertaken a comparative sequence-based approach to characterize a large noncoding region deleted in patients affected by Van Buchem disease (VB), a severe sclerosing bone dysplasia. Using BAC recombination and transgenesis we characterized the expression of human sclerostin (sost) from normal (hSOSTwt) or Van Buchem(hSOSTvb D) alleles. Only the hSOSTwt allele faithfully expressed high levels of human sost in the adult bone and impacted bone metabolism, consistent with the model that the VB noncoding deletion removes a sost specific regulatory element. By exploiting cross-species sequence comparisons with in vitro and in vivo enhancer assays we were able to identify a candidate enhancer element that drives human sost expression in osteoblast-like cell lines in vitro and in the skeletal anlage of the E14.5 mouse embryo, and discovered a novel function for sclerostin during limb development. Our approach represents a framework for characterizing distant regulatory elements associated with abnormal human phenotypes.

  3. High Prevalence of the BIM Deletion Polymorphism in Young Female Breast Cancer in an East Asian Country.

    Directory of Open Access Journals (Sweden)

    Ching-Hung Lin

    Full Text Available A rapid surge of female breast cancer has been observed in young women in several East Asian countries. The BIM deletion polymorphism, which confers cell resistance to apoptosis, was recently found exclusively in East Asian people with prevalence rate of 12%. We aimed to evaluate the possible role of this genetic alteration in carcinogenesis of breast cancer in East Asians.Female healthy volunteers (n = 307, patients in one consecutive stage I-III breast cancer cohort (n = 692 and one metastatic breast cancer cohort (n = 189 were evaluated. BIM wild-type and deletion alleles were separately genotyped in genomic DNAs.Both cancer cohorts consistently showed inverse associations between the BIM deletion polymorphism and patient age (≤35 y vs. 36-50 y vs. >50 y: 29% vs. 22% vs. 15%, P = 0.006 in the consecutive cohort, and 40% vs. 23% vs. 13%, P = 0.023 in the metastatic cohort. In healthy volunteers, the frequencies of the BIM deletion polymorphism were similar (13%-14% in all age groups. Further analyses indicated that the BIM deletion polymorphism was not associated with specific clinicopathologic features, but it was associated with poor overall survival (adjusted hazard ratio 1.71 in the consecutive cohort.BIM deletion polymorphism may be involved in the tumorigenesis of the early-onset breast cancer among East Asians.

  4. Distinctive phenotype in 9 patients with deletion of chromosome 1q24-q25.

    Science.gov (United States)

    Burkardt, Deepika D'Cunha; Rosenfeld, Jill A; Helgeson, Maria L; Angle, Brad; Banks, Valerie; Smith, Wendy E; Gripp, Karen W; Moline, Jessica; Moran, Rocio T; Niyazov, Dmitriy M; Stevens, Cathy A; Zackai, Elaine; Lebel, Robert Roger; Ashley, Douglas G; Kramer, Nancy; Lachman, Ralph S; Graham, John M

    2011-06-01

    Reports of individuals with deletions of 1q24→q25 share common features of prenatal onset growth deficiency, microcephaly, small hands and feet, dysmorphic face and severe cognitive deficits. We report nine individuals with 1q24q25 deletions, who show distinctive features of a clinically recognizable 1q24q25 microdeletion syndrome: prenatal-onset microcephaly and proportionate growth deficiency, severe cognitive disability, small hands and feet with distinctive brachydactyly, single transverse palmar flexion creases, fifth finger clinodactyly and distinctive facial features: upper eyelid fullness, small ears, short nose with bulbous nasal tip, tented upper lip, and micrognathia. Radiographs demonstrate disharmonic osseous maturation with markedly delayed bone age. Occasional features include cleft lip and/or palate, cryptorchidism, brain and spinal cord defects, and seizures. Using oligonucleotide-based array comparative genomic hybridization, we defined the critical deletion region as 1.9 Mb at 1q24.3q25.1 (chr1: 170,135,865-172,099,327, hg18 coordinates), containing 13 genes and including CENPL, which encodes centromeric protein L, a protein essential for proper kinetochore function and mitotic progression. The growth deficiency in this syndrome is similar to what is seen in other types of primordial short stature with microcephaly, such as Majewski osteodysplastic primordial dwarfism, type II (MOPD2) and Seckel syndrome, which result from loss-of-function mutations in genes coding for centrosomal proteins. DNM3 is also in the deleted region and expressed in the brain, where it participates in the Shank-Homer complex and increases synaptic strength. Therefore, DNM3 is a candidate for the cognitive disability, and CENPL is a candidate for growth deficiency in this 1q24q25 microdeletion syndrome. Copyright © 2011 Wiley-Liss, Inc.

  5. Genesis by meiotic unequal crossover of a de novo deletion that contributes to steroid 21-hydroxylase deficiency

    International Nuclear Information System (INIS)

    Sinnott, P.; Collier, S.; Dyer, P.A.; Harris, R.; Strachan, T.; Costigan, C.

    1990-01-01

    The HLA-linked human steroid 21-hydroxylase gene CYP21B and its closely homologous pseudogene CYP21A are each normally located centromeric to a fourth component of complement (C4) gene, C4B and C4A, respectively, in an organization suggesting tandem duplication of a ca. 30-kilobase DNA unit containing a CYP21 gene and a C4 gene. Such an organization has been considered to facilitate gene deletion and addition events by unequal crossover between the tandem repeats. The authors have identified a steroid 21-hydroxylase deficiency patient who has a maternally inherited disease haplotype that carries a de novo deletion of a ca. 30-kilobase repeat unit including the CYP21B gene and associated C4B gene. This disease haplotype appears to have been generated as a result of meiotic unequal crossover between maternal homologous chromosomes. One of the maternal haplotypes is the frequently occurring HLA-DR3,B8,A1 haplotype that normally carries a deletion of a ca. 30-kilobase unit including the CYP21A gene and C4A gene. Haplotypes of this type may possible act as premutations, increasing the susceptibility of developing a 21-hydroxylase deficiency mutation by facilitating unequal chromosome pairing

  6. Chromosome breakage in Prader-Willi and Angelman syndrome deletions may involve recombination between a repeat at the proximal and distal breakpoints

    Energy Technology Data Exchange (ETDEWEB)

    Amos-Landgraf J.; Nicholls, R.D. [Case Western Reserve Univ., Cleveland, OH (United States); Gottlieb, W. [Univ. of Florida, Gainesville, FL (United States)] [and others

    1994-09-01

    Prader-Willi (PWS) and Angelman (AS) syndromes most commonly arise from large deletions of 15q11-q13. Deletions in PWS are paternal in origin, while those in AS are maternal in origin, clearly demonstrating genomic imprinting in these clinically distinct neurobehavioural disorders. In at least 90% of PWS and AS deletion patients, the same 4 Mb region within 15q11-q13 is deleted with breakpoints clustering in single YAC clones at the proximal and distal ends. To study the mechanism of chromosome breakage in PWS and AS, we have previously isolated 25 independent clones from these three YACs using Alu-vector PCR. Four clones were selected that appear to detect a low copy repeat that is located in the proximal and distal breakpoint regions of chromosome 15q11-q13. Three clones detect the same 4 HindIII bands in genomic DNA, all from 15q11-q13, with differing intensities for the probes located at the proximal or distal breakpoints region, respectively. This suggests that these probes detect related members of a low-copy repeat at either location. Moreover, the 254RL2 probe detects a novel HindIII band in two unrelated PWS deletion patients, suggesting that this may represent a breakpoint fragment, with recombination occurring within a similar interval in both patients. A fourth clone, 318RL3 detects 5 bands in HindIII-digested genomic DNA, all from 15q11-q13. This YAC endclone itself is not deleted in PWS and AS deletion patients, as seen by an invariant strong band. Two other strong bands are variably intact or deleted in different PWS or AS deletion patients, suggesting a relationship of this sequence to the breakpoints. Moreover, PCR using 318RL3 primers from the distal 93C9 YAC led to the isolation of a related clone with 96% identity, demonstrating the existence of a low-copy repeat with members close to the proximal and distal breakpoints. Taken together, our data suggest a complex, low-copy repeat with members at both the proximal and distal boundaries.

  7. Gene expression patterns of chicken neuregulin 3 in association with copy number variation and frameshift deletion.

    Science.gov (United States)

    Abe, Hideaki; Aoya, Daiki; Takeuchi, Hiro-Aki; Inoue-Murayama, Miho

    2017-07-21

    Neuregulin 3 (NRG3) plays a key role in central nervous system development and is a strong candidate for human mental disorders. Thus, genetic variation in NRG3 may have some impact on a variety of phenotypes in non-mammalian vertebrates. Recently, genome-wide screening for short insertions and deletions in chicken (Gallus gallus) genomes has provided useful information about structural variation in functionally important genes. NRG3 is one such gene that has a putative frameshift deletion in exon 2, resulting in premature termination of translation. Our aims were to characterize the structure of chicken NRG3 and to compare expression patterns between NRG3 isoforms. Depending on the presence or absence of the 2-bp deletion in chicken NRG3, 3 breeds (red junglefowl [RJF], Boris Brown [BB], and Hinai-jidori [HJ]) were genotyped using flanking primers. In the commercial breeds (BB and HJ), approximately 45% of individuals had at least one exon 2 allele with the 2-bp deletion, whereas there was no deletion allele in RJF. The lack of a homozygous mutant indicated the existence of duplicated NRG3 segments in the chicken genome. Indeed, highly conserved elements consisting of exon 1, intron 1, exon 2, and part of intron 2 were found in the reference RJF genome, and quantitative PCR detected copy number variation (CNV) between breeds as well as between individuals. The copy number of conserved elements was significantly higher in chicks harboring the 2-bp deletion in exon 2. We identified 7 novel transcript variants using total mRNA isolated from the amygdala. Novel isoforms were found to lack the exon 2 cassette, which probably harbored the premature termination codon. The relative transcription levels of the newly identified isoforms were almost the same between chick groups with and without the 2-bp deletion, while chicks with the deletion showed significant suppression of the expression of previously reported isoforms. A putative frameshift deletion and CNV in chicken

  8. X-ray survival characteristics and genetic analysis for nine saccharomyces deletion mutants that show altered radiation sensitivity

    Energy Technology Data Exchange (ETDEWEB)

    Game, John C.; Williamson, Marsha S.; Baccari, Clelia

    2004-01-07

    The availability of a genome-wide set of Saccharomyces deletion mutants provides a chance to identify all the yeast genes involved in DNA repair. Using X-rays, we are screening these mutants to identify additional genes that show increased sensitivity to the lethal effects of ionizing radiation. For each mutant identified as sensitive, we are confirming that the sensitivity phenotype co-segregates with the deletion allele and are obtaining multipoint survival-versus-dose assays in at least two haploid and one homozygous diploid strains. We present data for deletion mutants involving the genes DOT1, MDM20, NAT3, SPT7, SPT20, GCN5, HFI1, DCC1 and VID21/EAF1, and discuss their potential roles in repair. Eight of these genes have a clear radiation-sensitive phenotype when deleted, but the ninth, GCN5, has at most a borderline phenotype. None of the deletions confer substantial sensitivity to ultra-violet radiation, although one or two may confer marginal sensitivity. The DOT1 gene is of interest because its only known function is to methylate one lysine residue in the core of the histone H3 protein. We find that histone H3 mutants (supplied by K. Struhl) in which this residue is replaced by other amino-acids are also X-ray sensitive, seeming to confirm that methylation of the lysine-79 residue is required for effective repair of radiation damage.

  9. Rare copy number deletions predict individual variation in intelligence.

    Directory of Open Access Journals (Sweden)

    Ronald A Yeo

    2011-01-01

    Full Text Available Phenotypic variation in human intellectual functioning shows substantial heritability, as demonstrated by a long history of behavior genetic studies. Many recent molecular genetic studies have attempted to uncover specific genetic variations responsible for this heritability, but identified effects capture little variance and have proven difficult to replicate. The present study, motivated an interest in "mutation load" emerging from evolutionary perspectives, examined the importance of the number of rare (or infrequent copy number variations (CNVs, and the total number of base pairs included in such deletions, for psychometric intelligence. Genetic data was collected using the Illumina 1MDuoBeadChip Array from a sample of 202 adult individuals with alcohol dependence, and a subset of these (N = 77 had been administered the Wechsler Abbreviated Scale of Intelligence (WASI. After removing CNV outliers, the impact of rare genetic deletions on psychometric intelligence was investigated in 74 individuals. The total length of the rare deletions significantly and negatively predicted intelligence (r = -.30, p = .01. As prior studies have indicated greater heritability in individuals with relatively higher parental socioeconomic status (SES, we also examined the impact of ethnicity (Anglo/White vs. Other, as a proxy measure of SES; these groups did not differ on any genetic variable. This categorical variable significantly moderated the effect of length of deletions on intelligence, with larger effects being noted in the Anglo/White group. Overall, these results suggest that rare deletions (between 5% and 1% population frequency or less adversely affect intellectual functioning, and that pleotropic effects might partly account for the association of intelligence with health and mental health status. Significant limitations of this research, including issues of generalizability and CNV measurement, are discussed.

  10. Rare Copy Number Deletions Predict Individual Variation in Intelligence

    Science.gov (United States)

    Yeo, Ronald A.; Gangestad, Steven W.; Liu, Jingyu; Calhoun, Vince D.; Hutchison, Kent E.

    2011-01-01

    Phenotypic variation in human intellectual functioning shows substantial heritability, as demonstrated by a long history of behavior genetic studies. Many recent molecular genetic studies have attempted to uncover specific genetic variations responsible for this heritability, but identified effects capture little variance and have proven difficult to replicate. The present study, motivated an interest in “mutation load” emerging from evolutionary perspectives, examined the importance of the number of rare (or infrequent) copy number variations (CNVs), and the total number of base pairs included in such deletions, for psychometric intelligence. Genetic data was collected using the Illumina 1MDuoBeadChip Array from a sample of 202 adult individuals with alcohol dependence, and a subset of these (N = 77) had been administered the Wechsler Abbreviated Scale of Intelligence (WASI). After removing CNV outliers, the impact of rare genetic deletions on psychometric intelligence was investigated in 74 individuals. The total length of the rare deletions significantly and negatively predicted intelligence (r = −.30, p = .01). As prior studies have indicated greater heritability in individuals with relatively higher parental socioeconomic status (SES), we also examined the impact of ethnicity (Anglo/White vs. Other), as a proxy measure of SES; these groups did not differ on any genetic variable. This categorical variable significantly moderated the effect of length of deletions on intelligence, with larger effects being noted in the Anglo/White group. Overall, these results suggest that rare deletions (between 5% and 1% population frequency or less) adversely affect intellectual functioning, and that pleotropic effects might partly account for the association of intelligence with health and mental health status. Significant limitations of this research, including issues of generalizability and CNV measurement, are discussed. PMID:21298096

  11. On Deletion of Sutra Translation

    Institute of Scientific and Technical Information of China (English)

    CHEN Shu-juan

    2017-01-01

    Dao An's the metaphor of translation "wine diluted with water' ' expressed a view about translation that had been abridged.Later Kumarajiva provided metaphor "rice chewed—tasteless and downright disgusting".Both of them felt regretted at the weakening of taste,sometimes even the complete loss of flavor caused by deletion in translation of Buddhist sutras.In early sutra translation,deletion is unavoidable which made many sutra translators felt confused and drove them to study it further and some even managed to give their understanding to this issue.This thesis will discuss the definition,and what causes deletion and the measures adopted by the sutra translators.

  12. Xp22.3 genomic deletions involving the CDKL5 gene in girls with early onset epileptic encephalopathy.

    Science.gov (United States)

    Mei, Davide; Marini, Carla; Novara, Francesca; Bernardina, Bernardo D; Granata, Tiziana; Fontana, Elena; Parrini, Elena; Ferrari, Anna R; Murgia, Alessandra; Zuffardi, Orsetta; Guerrini, Renzo

    2010-04-01

    Mutations of the X-linked gene cyclin-dependent kinase-like 5 (CDKL5) cause an X-linked encephalopathy with early onset intractable epilepsy, including infantile spasms and other seizure types, and a Rett syndrome (RTT)-like phenotype. Very limited information is available on the frequency and phenotypic spectrum associated with CDKL5 deletions/duplications. We investigated the role of CDKL5 deletions/duplications in causing early onset intractable epilepsy of unknown etiology in girls. We studied 49 girls with early onset intractable epilepsy, with or without infantile spasms, and developmental impairment, for whom no etiologic factors were obvious after clinical examination, brain magnetic resonance imaging (MRI) and expanded screening for inborn errors of metabolism. We performed CDKL5 gene mutation analysis in all and multiplex ligation dependent probe amplification assay (MLPA) in those who were mutation negative. Custom Array-comparative genomic hybridization (CGH), breakpoint polymerase chain reaction (PCR) analysis, and X-inactivation studies were performed in patients in whom MLPA uncovered a genomic alteration. We found CDKL5 mutations in 8.2% (4 of 49) of patients and genomic deletions in 8.2% (4 of 49). Overall, abnormalities of the CDKL5 gene accounted for 16.3% (8 of 49) of patients. CDKL5 gene deletions are an under-ascertained cause of early onset intractable epilepsy in girls. Genetic testing of CDKL5, including both mutation and deletion/duplication analysis, should be considered in this clinical subgroup.

  13. Two novel deletions (array CGH findings) in pigment dispersion syndrome.

    Science.gov (United States)

    Mikelsaar, Ruth; Molder, Harras; Bartsch, Oliver; Punab, Margus

    2007-12-01

    We report the first male with pigment dispersion syndrome and a balanced translocation t(10;15)(p11.1;q11.1). Cytogenetic analyses using Giemsa banding and FISH methods, and array CGH were performed. Array CGH analyses did not show altered DNA sequences in the breakpoints of the translocation, but revealed two novel deletions in 2q22.1 and 18q22.1. We suppose that the coexistence of t(10;15) and pigment dispersion syndrome in our patient is a coincidence. The deletion in 2q22.1, where the gene LRP1B has been located, may play a major role in the dysembryogenesis of the eye and cause the disorder.

  14. Deletion of the Snord116/SNORD116 Alters Sleep in Mice and Patients with Prader-Willi Syndrome.

    Science.gov (United States)

    Lassi, Glenda; Priano, Lorenzo; Maggi, Silvia; Garcia-Garcia, Celina; Balzani, Edoardo; El-Assawy, Nadia; Pagani, Marco; Tinarelli, Federico; Giardino, Daniela; Mauro, Alessandro; Peters, Jo; Gozzi, Alessandro; Grugni, Graziano; Tucci, Valter

    2016-03-01

    Sleep-wake disturbances are often reported in Prader-Willi syndrome (PWS), a rare neurodevelopmental syndrome that is associated with paternally-expressed genomic imprinting defects within the human chromosome region 15q11-13. One of the candidate genes, prevalently expressed in the brain, is the small nucleolar ribonucleic acid-116 (SNORD116). Here we conducted a translational study into the sleep abnormalities of PWS, testing the hypothesis that SNORD116 is responsible for sleep defects that characterize the syndrome. We studied sleep in mutant mice that carry a deletion of Snord116 at the orthologous locus (mouse chromosome 7) of the human PWS critical region (PWScr). In particular, we assessed EEG and temperature profiles, across 24-h, in PWScr (m+/p-) heterozygous mutants compared to wild-type littermates. High-resolution magnetic resonance imaging (MRI) was performed to explore morphoanatomical differences according to the genotype. Moreover, we complemented the mouse work by presenting two patients with a diagnosis of PWS and characterized by atypical small deletions of SNORD116. We compared the individual EEG parameters of patients with healthy subjects and with a cohort of obese subjects. By studying the mouse mutant line PWScr(m+/p-), we observed specific rapid eye movement (REM) sleep alterations including abnormal electroencephalograph (EEG) theta waves. Remarkably, we observed identical sleep/EEG defects in the two PWS cases. We report brain morphological abnormalities that are associated with the EEG alterations. In particular, mouse mutants have a bilateral reduction of the gray matter volume in the ventral hippocampus and in the septum areas, which are pivotal structures for maintaining theta rhythms throughout the brain. In PWScr(m+/p-) mice we also observed increased body temperature that is coherent with REM sleep alterations in mice and human patients. Our study indicates that paternally expressed Snord116 is involved in the 24-h regulation of

  15. A case of 18p deletion syndrome after blepharoplasty

    Directory of Open Access Journals (Sweden)

    Xu LJ

    2017-01-01

    Full Text Available Li-juan Xu,1 Lv-xian Wu,2 Qing Yuan,3 Zhi-gang Lv,1 Xue-yan Jiang2 1Department of Opthalmology, 2Department of Pediatrics, 3Department of Clinical Laboratory, Jinhua Central Hospital, Jinhua, Zhejiang, People’s Republic of China Objective: The deletion of the short arm of chromosome 18 is thought to be one of the rare chromosomal aberrations. Here, we report a case to review this disease.Case report: The proband is a five-and-a-half-year-old girl who has had phenotypes manifested mainly by ptosis, broad face, broad neck with low posterior hairline, mental retardation, short stature, and other malformations. Chromosomal analysis for her mother showed a normal karyotype. Her father and younger brother were phenotypically normal.Result: Phenotypical features were quite similar throughout other cases and in accordance with the usual phenotype of del(18p suggested within the same cases and among the del(18p cases described. She underwent blepharoplasty, which improved her appearance.Conclusion: 18p deletion syndrome is diagnosed by gene analysis. Plastic surgeries for improving the appearance might be an option for these patients. Keywords: chromosome, deletion, blepharoplasty

  16. AIRE variations in Addison's disease and autoimmune polyendocrine syndromes (APS): partial gene deletions contribute to APS I.

    Science.gov (United States)

    Bøe Wolff, A S; Oftedal, B; Johansson, S; Bruland, O; Løvås, K; Meager, A; Pedersen, C; Husebye, E S; Knappskog, P M

    2008-03-01

    Autoimmune Addison's disease (AAD) is often associated with other components in autoimmune polyendocrine syndromes (APS). Whereas APS I is caused by mutations in the AIRE gene, the susceptibility genes for AAD and APS II are unclear. In the present study, we investigated whether polymorphisms or copy number variations in the AIRE gene were associated with AAD and APS II. First, nine SNPs in the AIRE gene were analyzed in 311 patients with AAD and APS II and 521 healthy controls, identifying no associated risk. Second, in a subgroup of 25 of these patients, AIRE sequencing revealed three novel polymorphisms. Finally, the AIRE copy number was determined by duplex quantitative PCR in 14 patients with APS I, 161 patients with AAD and APS II and in 39 healthy subjects. In two Scandinavian APS I patients previously reported to be homozygous for common AIRE mutations, we identified large deletions of the AIRE gene covering at least exon 2 to exon 8. We conclude that polymorphisms in the AIRE gene are not associated with AAD and APS II. We further suggest that DNA analysis of the parents of patients found to be homozygous for mutations in AIRE, always should be performed.

  17. Deletion of 11q12.3-11q13.1 in a patient with intellectual disability and childhood facial features resembling Cornelia de Lange syndrome

    DEFF Research Database (Denmark)

    Boyle, Martine Isabel; Jespersgaard, Cathrine; Nazaryan, Lusine

    2015-01-01

    Deletions within 11q12.3-11q13.1 are very rare and to date only two cases have been described in the literature. In this study we describe a 23-year-old male patient with intellectual disability, behavioral problems, dysmorphic features, dysphagia, gastroesophageal reflux and skeletal abnormalities...

  18. LETM1, a novel gene encoding a putative EF-hand Ca(2+)-binding protein, flanks the Wolf-Hirschhorn syndrome (WHS) critical region and is deleted in most WHS patients.

    Science.gov (United States)

    Endele, S; Fuhry, M; Pak, S J; Zabel, B U; Winterpacht, A

    1999-09-01

    Deletions within human chromosome 4p16.3 cause Wolf-Hirschhorn syndrome (WHS), which is characterized by severe mental and developmental defects. It is thought that haploinsufficiency of more than one gene contributes to the complex phenotype. We have cloned and characterized a novel gene (LETM1) that is deleted in nearly all WHS patients. LETM1 encodes a putative member of the EF-hand family of Ca(2+)-binding proteins. The protein contains two EF-hands, a transmembrane domain, a leucine zipper, and several coiled-coil domains. On the basis of its possible Ca(2+)-binding property and involvement in Ca(2+) signaling and/or homeostasis, we propose that haploinsufficiency of LETM1 may contribute to the neuromuscular features of WHS patients. Copyright 1999 Academic Press.

  19. Deletion of Dystrophin In-Frame Exon 5 Leads to a Severe Phenotype: Guidance for Exon Skipping Strategies.

    Directory of Open Access Journals (Sweden)

    Zhi Yon Charles Toh

    Full Text Available Duchenne and Becker muscular dystrophy severity depends upon the nature and location of the DMD gene lesion and generally correlates with the dystrophin open reading frame. However, there are striking exceptions where an in-frame genomic deletion leads to severe pathology or protein-truncating mutations (nonsense or frame-shifting indels manifest as mild disease. Exceptions to the dystrophin reading frame rule are usually resolved after molecular diagnosis on muscle RNA. We report a moderate/severe Becker muscular dystrophy patient with an in-frame genomic deletion of DMD exon 5. This mutation has been reported by others as resulting in Duchenne or Intermediate muscular dystrophy, and the loss of this in-frame exon in one patient led to multiple splicing events, including omission of exon 6, that disrupts the open reading frame and is consistent with a severe phenotype. The patient described has a deletion of dystrophin exon 5 that does not compromise recognition of exon 6, and although the deletion does not disrupt the reading frame, his clinical presentation is more severe than would be expected for classical Becker muscular dystrophy. We suggest that the dystrophin isoform lacking the actin-binding sequence encoded by exon 5 is compromised, reflected by the phenotype resulting from induction of this dystrophin isoform in mouse muscle in vivo. Hence, exon skipping to address DMD-causing mutations within DMD exon 5 may not yield an isoform that confers marked clinical benefit. Additional studies will be required to determine whether multi-exon skipping strategies could yield more functional dystrophin isoforms, since some BMD patients with larger in-frame deletions in this region have been reported with mild phenotypes.

  20. Submicroscopic subtelomeric aberrations in Chinese patients with unexplained developmental delay/mental retardation

    Directory of Open Access Journals (Sweden)

    Wang Liwen

    2010-05-01

    Full Text Available Abstract Background Subtelomeric imbalance is widely accepted as related to developmental delay/mental retardation (DD/MR. Fine mapping of aberrations in gene-enriched subtelomeric regions provides essential clues for localizing critical regions, and provides a strategy for identifying new candidate genes. To date, no large-scale study has been conducted on subtelomeric aberrations in DD/MR patients in mainland China. Methods This study included 451 Chinese children with moderate to severe clinically unexplained DD/MR. The subtelomere-MLPA (multiplex ligation dependent probe amplification and Affymetrix human SNP array 6.0 were used to determine the subtelomeric copy number variations. The exact size and the breakpoint of each identified aberration were well defined. Results The submicroscopic subtelomeric aberrations were identified in 23 patients, with a detection rate of 5.1%. 16 patients had simple deletions, 2 had simple duplications and 5 with both deletions and duplications. The deletions involved 14 different subtelomeric regions (1p, 2p, 4p, 6p, 7p, 7q, 8p, 9p, 10p, 11q, 14q, 15q, 16p and 22q, and duplications involved 7 subtelomeric regions (3q, 4p, 6q, 7p, 8p, 12p and 22q. Of all the subtelomeric aberrations found in Chinese subjects, the most common was 4p16.3 deletion. The sizes of the deletions varied from 0.6 Mb to 12 Mb, with 5-143 genes inside. Duplicated regions were 0.26 Mb to 11 Mb, with 6-202 genes inside. In this study, four deleted subtelomeric regions and one duplicated region were smaller than any other previously reported, specifically the deletions in 11q25, 8p23.3, 7q36.3, 14q32.33, and the duplication in 22q13. Candidate genes inside each region were proposed. Conclusions Submicroscopic subtelomeric aberrations were detected in 5.1% of Chinese children with clinically unexplained DD/MR. Four deleted subtelomeric regions and one duplicated region found in this study were smaller than any previously reported, which

  1. Occurrence of two different intragenic deletions in two male relatives affected with Duchenne muscular dystrophy

    Energy Technology Data Exchange (ETDEWEB)

    Mostacciuolo, M.L.; Miorin, M.; Vitiello, L.; Rampazzo, A.; Fanin, M.; Angelini, C.; Danieli, G.A. [Univ. of Padua (Italy)

    1994-03-01

    The occurrence of 2 different intragenic deletions (exons 10-44 and exon 45, respectively) is reported in 2 male relatives affected with Duchenne muscular dystrophy, both showing the same haplotype for DNA markers not included in the deleted segment. The 2 different deletions seem to have occurred independently in the same X chromosome. This finding, together with other reports, suggests possibly an increased predisposition to mutations within the DMD locus in some families. Therefore, when dealing with prenatal diagnosis, the investigation on fetal DNA cannot be restricted only to the region in which a mutation was previously identified in the family. 14 refs., 1 fig.

  2. A Large PROP1 Gene Deletion in a Turkish Pedigree

    Directory of Open Access Journals (Sweden)

    Suheyla Gorar

    2018-01-01

    Full Text Available Pituitary-specific paired-like homeodomain transcription factor, PROP1, is associated with multiple pituitary hormone deficiency. Alteration of the gene encoding the PROP1 may affect somatotropes, thyrotropes, and lactotropes, as well as gonadotropes and corticotropes. We performed genetic analysis of PROP1 gene in a Turkish pedigree with three siblings who presented with short stature. Parents were first degree cousins. Index case, a boy, had somatotrope, gonadotrope, thyrotrope, and corticotrope deficiency. However, two elder sisters had somatotroph, gonadotroph, and thyrotroph deficiency and no corticotroph deficiency. On pituitary magnetic resonance, partial empty sella was detected with normal bright spot in all siblings. In genetic analysis, we found a gross deletion involving PROP1 coding region. In conclusion, we report three Turkish siblings with a gross deletion in PROP1 gene. Interestingly, although little boy with combined pituitary hormone deficiency has adrenocorticotropic hormone (ACTH deficiency, his elder sisters with the same gross PROP1 deletion have no ACTH deficiency. This finding is in line with the fact that patients with PROP1 mutations may have different phenotype/genotype correlation.

  3. 22q11.2 Deletion syndrome is associated with perioperative outcome in tetralogy of Fallot.

    Science.gov (United States)

    Mercer-Rosa, Laura; Pinto, Nelangi; Yang, Wei; Tanel, Ronn; Goldmuntz, Elizabeth

    2013-10-01

    We sought to investigate the impact of 22q11.2 deletion on perioperative outcome in tetralogy of Fallot. We conducted a retrospective review of patients with tetralogy of Fallot who underwent complete surgical reconstruction at The Children's Hospital of Philadelphia between 1995 and 2006. Inclusion criteria included diagnosis of tetralogy of Fallot and known genotype. Fisher exact and Mann-Whitney tests were used for categoric and continuous variables, respectively. Regression analysis was used to determine whether deletion status predicts outcome. We studied 208 subjects with tetralogy of Fallot, 164 (79%) without and 44 (20%) with 22q11.2 deletion syndrome. There were no differences in sex, race, gestational age, age at diagnosis, admission weight, and duration of mechanical ventilation. Presenting anatomy, survival, complications and reoperations were also comparable between patients with and without 22q11.2 deletion syndrome. Those with 22q11.2 deletion syndrome had more aortopulmonary shunts preceding complete surgical repair (21% vs 7%, P = .02). This association was present after adjustment for presenting anatomy (stenosis, atresia, or absence of pulmonary valve and common atrioventricular canal) and surgical era. In addition, those with 22q11.2 deletion syndrome had longer cardiopulmonary bypass time (84 vs 72 minutes, P = .02) and duration of intensive care (6 vs 4 days, P = .007). Genotype affects early operative outcomes in tetralogy of Fallot resulting, in particular, in longer duration of intensive care. Future studies are required to determine factors contributing to such differences in this susceptible population. Copyright © 2013 The American Association for Thoracic Surgery. Published by Mosby, Inc. All rights reserved.

  4. X-linked ichthyosis: clinical and molecular findings in 35 Italian patients.

    Science.gov (United States)

    Diociaiuti, Andrea; Angioni, Adriano; Pisaneschi, Elisa; Alesi, Viola; Zambruno, Giovanna; Novelli, Antonio; El Hachem, May

    2018-04-19

    Recessive X-linked ichthyosis (XLI), the second most common ichthyosis, is caused by mutations in the STS gene encoding the steroid sulfatase enzyme. A complete deletion of the STS gene is found in 85-90% of cases. Rarely, larger deletions involving contiguous genes are detected in syndromic patients. We report the clinical and molecular genetic findings in a series of 35 consecutive Italian male patients. All patients underwent molecular testing by MLPA or aCGH, followed, in case of negative results, by next generation sequencing analysis. Neuropsychiatric, ophthalmological and pediatric evaluations were also performed. Our survey showed a frequent presence of disease manifestations at birth (42.8%). Fold and palmoplantar surfaces were involved in 18 (51%) and 7 (20%) patients, respectively. Fourteen patients (42%) presented neuropsychiatric symptoms, including attention deficit hyperactivity disorder and motor disabilities. In addition, two patients with mental retardation were shown to be affected by a contiguous gene syndrome. Twenty-seven patients had a complete STS deletion, one a partial deletion and 7 carried missense mutations, two of which previously unreported. In addition, a de novo STS deletion was identified in a sporadic case. The frequent presence of palmoplantar and fold involvement in XLI should be taken into account when considering the differential diagnosis with ichthyosis vulgaris. Our findings also underline the relevance of involving the neuropsychiatrist in the multidisciplinary management of XLI. Finally, we report for the first time a de novo mutation which shows that STS deletion can also occur in oogenesis. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  5. Analysis of APOBEC3A/3B germline deletion polymorphism in breast, cervical and oral cancers from South India and its impact on miRNA regulation.

    Science.gov (United States)

    Revathidevi, Sundaramoorthy; Manikandan, Mayakannan; Rao, Arunagiri Kuha Deva Magendhra; Vinothkumar, Vilvanathan; Arunkumar, Ganesan; Rajkumar, Kottayasamy Seenivasagam; Ramani, Rajendran; Rajaraman, Ramamurthy; Ajay, Chandrasekar; Munirajan, Arasambattu Kannan

    2016-09-01

    Breast cancer and cervical cancer are the leading causes of death in women worldwide as well as in India, whilst oral cancer is the top most common cancer among Asian especially in Indian men in terms of both incidence and mortality rate. Genetic factors determining the predisposition to cancer are being explored to identify the signature genetic variations associated with these cancers. Recently, a germline deletion polymorphism in APOBEC3 gene cluster which completely deletes APOBEC3B coding region has been studied for its association with cancer risk. We screened the germline deletion polymorphism in 409 cancer patients (224 breast cancer, 88 cervical cancer and 97 oral cancer samples), 478 controls and 239 cervical cancer tissue DNAs of South Indian origin. The results suggest that the APOBEC3A/3B deletion polymorphism is not significantly associated with cancer risk in our study population (OR 0.739, 95 % CI, p value 0.91457). Considering the viral restriction property of APOBEC3s, we also screened cervical cancer tissue DNAs for the human papilloma virus infection. We observed a gradual increase in the frequency of HPV16 infection from AA/BB cases (66.86 %) to AA/-- cases (71.43) which signifies the impact of this deletion polymorphism in HPV infection. In addition, we performed in silico analysis to understand the effect of this polymorphism on miRNA regulation of the APOBEC3A/3B fusion transcript. Only 8 APOBEC3B targeting miRNAs were observed to regulate the fusion transcript of which miR-34b-3p and miR-138-5p were found to be frequently downregulated in cancers suggesting miRNA-mediated deregulation of APOBEC3A expression in cancer patients harbouring this particular deletion polymorphism.

  6. 11p15 duplication and 13q34 deletion with Beckwith-Wiedemann syndrome and factor VII deficiency.

    Science.gov (United States)

    Jurkiewicz, Dorota; Kugaudo, Monika; Tańska, Anna; Wawrzkiewicz-Witkowska, Angelika; Tomaszewska, Agnieszka; Kucharczyk, Marzena; Cieślikowska, Agata; Ciara, Elżbieta; Krajewska-Walasek, Małgorzata

    2015-06-01

    Here we report a patient with 11p15.4p15.5 duplication and 13q34 deletion presenting with Beckwith-Wiedemann syndrome (BWS) and moderate deficiency of factor VII (FVII). The duplication was initially diagnosed on methylation-sensitive multiplex ligation-dependent probe amplification. Array comparative genome hybridization confirmed its presence and indicated a 13q34 distal deletion. The patient's clinical symptoms, including developmental delay and facial dysmorphism, were typical of BWS with paternal 11p15 trisomy. Partial 13q monosomy in this patient is associated with moderate deficiency of FVII and may also overlap with a few symptoms of paternal 11p15 trisomy such as developmental delay and some facial features. To our knowledge this is the first report of 11p15.4p15.5 duplication associated with deletion of 13q34 and FVII deficiency. Moreover, this report emphasizes the importance of detailed clinical as well as molecular examinations in patients with BWS features and developmental delay. © 2015 Japan Pediatric Society.

  7. Deletions in the fifth alpha helix of HIV-1 matrix block virus release

    International Nuclear Information System (INIS)

    Sanford, Bridget; Li, Yan; Maly, Connor J.; Madson, Christian J.; Chen, Han; Zhou, You; Belshan, Michael

    2014-01-01

    The matrix (MA) protein of HIV-1 is the N-terminal component of the Gag structural protein and is critical for the early and late stages of viral replication. MA contains five α-helices (α1–α5). Deletions in the N-terminus of α5 as small as three amino acids impaired virus release. Electron microscopy of one deletion mutant (MA∆96-120) showed that its particles were tethered to the surface of cells by membranous stalks. Immunoblots indicated all mutants were processed completely, but mutants with large deletions had alternative processing intermediates. Consistent with the EM data, MA∆96-120 retained membrane association and multimerization capability. Co-expression of this mutant inhibited wild type particle release. Alanine scanning mutation in this region did not affect virus release, although the progeny virions were poorly infectious. Combined, these data demonstrate that structural ablation of the α5 of MA inhibits virus release. - Highlights: • Deletions were identified in the C-terminus of matrix that block virus release. • These deletion mutants still multimerized and associated with membranes. • TEM showed the mutant particles were tethered to the cell surface. • Amino acid mutagenesis of the region did not affect release. • The data suggests that disruption of matrix structure blocks virus release

  8. Deletions in the fifth alpha helix of HIV-1 matrix block virus release

    Energy Technology Data Exchange (ETDEWEB)

    Sanford, Bridget; Li, Yan; Maly, Connor J.; Madson, Christian J. [Department of Medical Microbiology and Immunology, Creighton University, 2500 California Plaza, Omaha, NE 68178 (United States); Chen, Han [Center for Biotechnology, University of Nebraska-Lincoln, Lincoln, NE (United States); Zhou, You [Center for Biotechnology, University of Nebraska-Lincoln, Lincoln, NE (United States); Nebraska Center for Virology, Lincoln, NE (United States); Belshan, Michael, E-mail: michaelbelshan@creighton.edu [Department of Medical Microbiology and Immunology, Creighton University, 2500 California Plaza, Omaha, NE 68178 (United States); Nebraska Center for Virology, Lincoln, NE (United States)

    2014-11-15

    The matrix (MA) protein of HIV-1 is the N-terminal component of the Gag structural protein and is critical for the early and late stages of viral replication. MA contains five α-helices (α1–α5). Deletions in the N-terminus of α5 as small as three amino acids impaired virus release. Electron microscopy of one deletion mutant (MA∆96-120) showed that its particles were tethered to the surface of cells by membranous stalks. Immunoblots indicated all mutants were processed completely, but mutants with large deletions had alternative processing intermediates. Consistent with the EM data, MA∆96-120 retained membrane association and multimerization capability. Co-expression of this mutant inhibited wild type particle release. Alanine scanning mutation in this region did not affect virus release, although the progeny virions were poorly infectious. Combined, these data demonstrate that structural ablation of the α5 of MA inhibits virus release. - Highlights: • Deletions were identified in the C-terminus of matrix that block virus release. • These deletion mutants still multimerized and associated with membranes. • TEM showed the mutant particles were tethered to the cell surface. • Amino acid mutagenesis of the region did not affect release. • The data suggests that disruption of matrix structure blocks virus release.

  9. Hybrid Capture-Based Comprehensive Genomic Profiling Identifies Lung Cancer Patients with Well-Characterized Sensitizing Epidermal Growth Factor Receptor Point Mutations That Were Not Detected by Standard of Care Testing.

    Science.gov (United States)

    Suh, James H; Schrock, Alexa B; Johnson, Adrienne; Lipson, Doron; Gay, Laurie M; Ramkissoon, Shakti; Vergilio, Jo-Anne; Elvin, Julia A; Shakir, Abdur; Ruehlman, Peter; Reckamp, Karen L; Ou, Sai-Hong Ignatius; Ross, Jeffrey S; Stephens, Philip J; Miller, Vincent A; Ali, Siraj M

    2018-03-14

    In our recent study, of cases positive for epidermal growth factor receptor ( EGFR ) exon 19 deletions using comprehensive genomic profiling (CGP), 17/77 (22%) patients with prior standard of care (SOC) EGFR testing results available were previously negative for exon 19 deletion. Our aim was to compare the detection rates of CGP versus SOC testing for well-characterized sensitizing EGFR point mutations (pm) in our 6,832-patient cohort. DNA was extracted from 40 microns of formalin-fixed paraffin-embedded sections from 6,832 consecutive cases of non-small cell lung cancer (NSCLC) of various histologies (2012-2015). CGP was performed using a hybrid capture, adaptor ligation-based next-generation sequencing assay to a mean coverage depth of 576×. Genomic alterations (pm, small indels, copy number changes and rearrangements) involving EGFR were recorded for each case and compared with prior testing results if available. Overall, there were 482 instances of EGFR exon 21 L858R (359) and L861Q (20), exon 18 G719X (73) and exon 20 S768I (30) pm, of which 103 unique cases had prior EGFR testing results that were available for review. Of these 103 cases, CGP identified 22 patients (21%) with sensitizing EGFR pm that were not detected by SOC testing, including 9/75 (12%) patients with L858R, 4/7 (57%) patients with L861Q, 8/20 (40%) patients with G719X, and 4/7 (57%) patients with S768I pm (some patients had multiple EGFR pm). In cases with available clinical data, benefit from small molecule inhibitor therapy was observed. CGP, even when applied to low tumor purity clinical-grade specimens, can detect well-known EGFR pm in NSCLC patients that would otherwise not be detected by SOC testing. Taken together with EGFR exon 19 deletions, over 20% of patients who are positive for EGFR -activating mutations using CGP are previously negative by SOC EGFR mutation testing, suggesting that thousands of such patients per year in the U.S. alone could experience improved clinical

  10. A novel 5-bp deletion in Clarin 1 in a family with Usher syndrome.

    Science.gov (United States)

    Akoury, Elie; El Zir, Elie; Mansour, Ahmad; Mégarbané, André; Majewski, Jacek; Slim, Rima

    2011-11-01

    To identify the genetic defect in a Lebanese family with two sibs diagnosed with Usher Syndrome. Exome capture and sequencing were performed on DNA from one affected member using Agilent in solution bead capture, followed by Illumina sequencing. This analysis revealed the presence of a novel homozygous 5-bp deletion, in Clarin 1 (CLRN1), a known gene responsible for Usher syndrome type III. The deletion is inherited from both parents and segregates with the disease phenotype in the family. The 5-bp deletion, c.301_305delGTCAT, p.Val101SerfsX27, is predicted to result in a frameshift and protein truncation after 27 amino acids. Sequencing all the coding regions of the CLRN1 gene in the proband did not reveal any other mutation or variant. Here we describe a novel deletion in CLRN1. Our data support previously reported intra familial variability in the clinical features of Usher syndrome type I and III.

  11. Deletion affecting band 7q36 not associated with holoprosencephaly

    Energy Technology Data Exchange (ETDEWEB)

    Ebrahim, S.A.D.; Krivchenia, E.; Mohamed, A.N. [Wayne State Univ., Detroit, MI (United States)] [and others

    1994-09-01

    Although the appearance of 7q36 aberrations have been postulated to be responsible for holoprosencephaly (HPE), the presence of a de novo 7q36 deletion in fetus without HPE has not been reported. We report the first case of a fetus with 7q36 deletion but lacking HPE. Ultrasound examination of a 25-year-old G3P1 Caucasian female showed small head circumference with microcephaly at 28 weeks. Decreased amniotic fluid volume, bilateral renal dilatation and abnormal facial features were also noted. Chromosome analysis after cordocentesis showed an abnormal female karyotype with a deletion involving the chromosome band 7q36, 46,XX,del(7)(q36). Chromosome studies on the biological parents were normal. In view of the chromosome finding and after extensive counseling, the couple elected to terminate the pregnancy. The chromosome findings were confirmed by fetal blood chromosome analysis at termination. Post-mortem examination confirmed dysmorphic features including a depressed nasal bridge and large flat ears with no lobules, but no cleft lip or palate was noted. Internal abnormalities included a bicuspid pulmonary valve and abnormally located lungs. The brain weighed 190g (249 {plus_minus} 64g expected) and had symmetric cerebral hemispheres without evidence of HPE or other gross or microscopic malformation, except focal cerebellar cortical dysplasia. In summary, our patient showed a deletion of the same chromosomal band implicated in HPE but lacked HPE. This finding indicates that 7q36 deletion may be seen in the absence of HPE and suggests that other genetic mechanisms may be responsible for HPE in this setting.

  12. The HDAC inhibitor SB939 overcomes resistance to BCR-ABL kinase Inhibitors conferred by the BIM deletion polymorphism in chronic myeloid leukemia.

    Directory of Open Access Journals (Sweden)

    Muhammad Rauzan

    Full Text Available Chronic myeloid leukemia (CML treatment has been improved by tyrosine kinase inhibitors (TKIs such as imatinib mesylate (IM but various factors can cause TKI resistance in patients with CML. One factor which contributes to TKI resistance is a germline intronic deletion polymorphism in the BCL2-like 11 (BIM gene which impairs the expression of pro-apoptotic splice isoforms of BIM. SB939 (pracinostat is a hydroxamic acid based HDAC inhibitor with favorable pharmacokinetic, physicochemical and pharmaceutical properties, and we investigated if this drug could overcome BIM deletion polymorphism-induced TKI resistance. We found that SB939 corrects BIM pre-mRNA splicing in CML cells with the BIM deletion polymorphism, and induces apoptotic cell death in CML cell lines and primary cells with the BIM deletion polymorphism. More importantly, SB939 both decreases the viability of CML cell lines and primary CML progenitors with the BIM deletion and restores TKI-sensitivity. Our results demonstrate that SB939 overcomes BIM deletion polymorphism-induced TKI resistance, and suggest that SB939 may be useful in treating CML patients with BIM deletion-associated TKI resistance.

  13. Investigation of 305 patients with myelodysplastic syndromes and 20q deletion for associated cytogenetic and molecular genetic lesions and their prognostic impact.

    Science.gov (United States)

    Bacher, Ulrike; Haferlach, Torsten; Schnittger, Susanne; Zenger, Melanie; Meggendorfer, Manja; Jeromin, Sabine; Roller, Andreas; Grossmann, Vera; Krauth, Maria-Theresa; Alpermann, Tamara; Kern, Wolfgang; Haferlach, Claudia

    2014-03-01

    In patients with myelodysplastic syndromes (MDS), sole 20q deletion [del(20q)] is a recurrent favourable abnormality. We studied additional molecular and cytogenetic lesions and their prognostic impact in 305 MDS patients with del(20q) (229 males/76 females; 29-90 years). All patients were investigated by cytomorphology and chromosome banding analysis (CBA), subsets by fluorescence in situ hybridization, molecular mutation screening, and array comparative genomic hybridization (aCGH). By aCGH (n = 30), the minimal common deleted region (CDR) was flanked by PTPRT (20q13·11) and EYA2 (20q13·12). 210 (68·9%) patients had 'early MDS' without blast increase, 95 (31·1%) 'advanced' MDS with blast increase (5-19%). Additional chromosomal abnormalities (ACAs) were detected in 88/305 (28·9%) patients. Patients with advanced MDS more frequently had ACAs (P = 0·003) and had a higher mean number of ACAs (P = 0·020) and of molecular mutations (P = 0·060). Spliceosome mutations were frequent (U2AF1: n = 31/155; 20·0%; SRSF2: n = 31/159; 19·5%; SF3B1mut: n = 8/159; 5·0%). ASXL1mut (25/153; 16·3%) were associated with advanced MDS (P = 0·001). Presence of ≥3 ACAs (P = 0·003) and ASXL1mut (P = 0·002) were associated with worse 2-year survival. In conclusion, the cytogenetic subgroup of MDS with del(20q) has a good prognosis but may be further subclassified by additional cytogenetic and molecular lesions. U2AF1mut is overrepresented in MDS with del(20q), and ASXL1mut is prognostically adverse. © 2013 John Wiley & Sons Ltd.

  14. Schizophrenia Spectrum Disorders in a Danish 22q11.2 Deletion Syndrome Cohort Compared to the Total Danish Population-A Nationwide Register Study

    DEFF Research Database (Denmark)

    Vangkilde, Anders; Olsen, Line; Hoeffding, Louise K

    2016-01-01

    OBJECTIVE: Cross-sectional studies have shown associations between 22q11.2 deletion syndrome and schizophrenia. However, large-scale prospective studies have been lacking. We, therefore, conducted the first large-scale population based study on the risk of being diagnosed with schizophrenia...... in persons identified with 22q11.2 deletion syndrome. METHODS: Danish nationwide registers were linked to establish a cohort consisting of all Danish citizens born during 1955-2004 and the cohort was followed from January 1, 1994 until December 31, 2013. Data were analyzed using survival analyses...... and adjusted for calendar year, age, sex, and parental mental health history. RESULTS: A total of 156 individuals with 22q11.2 deletion syndrome were identified, out of which 6 individuals were diagnosed with schizophrenia spectrum disorders following identification with 22q11 deletion syndrome. Identified...

  15. Copy Number Variations Found in Patients with a Corpus Callosum Abnormality and Intellectual Disability.

    Science.gov (United States)

    Heide, Solveig; Keren, Boris; Billette de Villemeur, Thierry; Chantot-Bastaraud, Sandra; Depienne, Christel; Nava, Caroline; Mignot, Cyril; Jacquette, Aurélia; Fonteneau, Eric; Lejeune, Elodie; Mach, Corinne; Marey, Isabelle; Whalen, Sandra; Lacombe, Didier; Naudion, Sophie; Rooryck, Caroline; Toutain, Annick; Caignec, Cédric Le; Haye, Damien; Olivier-Faivre, Laurence; Masurel-Paulet, Alice; Thauvin-Robinet, Christel; Lesne, Fabien; Faudet, Anne; Ville, Dorothée; des Portes, Vincent; Sanlaville, Damien; Siffroi, Jean-Pierre; Moutard, Marie-Laure; Héron, Delphine

    2017-06-01

    To evaluate the role that chromosomal micro-rearrangements play in patients with both corpus callosum abnormality and intellectual disability, we analyzed copy number variations (CNVs) in patients with corpus callosum abnormality/intellectual disability STUDY DESIGN: We screened 149 patients with corpus callosum abnormality/intellectual disability using Illumina SNP arrays. In 20 patients (13%), we have identified at least 1 CNV that likely contributes to corpus callosum abnormality/intellectual disability phenotype. We confirmed that the most common rearrangement in corpus callosum abnormality/intellectual disability is inverted duplication with terminal deletion of the 8p chromosome (3.2%). In addition to the identification of known recurrent CNVs, such as deletions 6qter, 18q21 (including TCF4), 1q43q44, 17p13.3, 14q12, 3q13, 3p26, and 3q26 (including SOX2), our analysis allowed us to refine the 2 known critical regions associated with 8q21.1 deletion and 19p13.1 duplication relevant for corpus callosum abnormality; report a novel 10p12 deletion including ZEB1 recently implicated in corpus callosum abnormality with corneal dystrophy; and) report a novel pathogenic 7q36 duplication encompassing SHH. In addition, 66 variants of unknown significance were identified in 57 patients encompassed candidate genes. Our results confirm the relevance of using microarray analysis as first line test in patients with corpus callosum abnormality/intellectual disability. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Isolation of Persicaria minor sesquiterpene synthase promoter and its deletions for transgenic Arabidopsis thaliana

    Science.gov (United States)

    Omar, Aimi Farehah; Ismail, Ismanizan

    2016-11-01

    Sesquiterpene synthase (SS) catalyzes the formation of sesquiterpenes from farnesyl diphosphate (FDP) via carbocation intermediates. In this study, the promoter region of sesquiterpene synthase was isolated from Persicaria minor to identify possible cis-acting elements in the promoter. The full-length PmSS promoter of P. minor is 1824-bp sequences. The sequence was analyzed and several putative cis-acting regulatory elements were identified. Three cis-acting regulatory elements were selected for deletion analysis which are cis-acting element involved in wound responsiveness (WUN), cis - acting element involved in defense and stress responsiveness (TC) and cis-acting element involved in ABA responsiveness (ABRE). Series of deletions were conducted to assess the promoter activity producing three truncated fragments promoter; Prom 2 1606-bp, Prom 3 1144- bp, and Prom 4 921-bp. The full-length promoter and its deletion series were cloned into the pBGWFS7 vector which contain β-glucuronidase (GUS) gene and green fluorescent protein (GFP) as the reporter gene. All constructs were successfully transformed into Arabidopsis thaliana based on PCR of positive BASTA resistance plants.

  17. Assessment of copy number variations in 120 patients with Poland syndrome.

    Science.gov (United States)

    Vaccari, Carlotta Maria; Tassano, Elisa; Torre, Michele; Gimelli, Stefania; Divizia, Maria Teresa; Romanini, Maria Victoria; Bossi, Simone; Musante, Ilaria; Valle, Maura; Senes, Filippo; Catena, Nunzio; Bedeschi, Maria Francesca; Baban, Anwar; Calevo, Maria Grazia; Acquaviva, Massimo; Lerone, Margherita; Ravazzolo, Roberto; Puliti, Aldamaria

    2016-11-25

    Poland Syndrome (PS) is a rare congenital disorder presenting with agenesis/hypoplasia of the pectoralis major muscle variably associated with thoracic and/or upper limb anomalies. Most cases are sporadic, but familial recurrence, with different inheritance patterns, has been observed. The genetic etiology of PS remains unknown. Karyotyping and array-comparative genomic hybridization (CGH) analyses can identify genomic imbalances that can clarify the genetic etiology of congenital and neurodevelopmental disorders. We previously reported a chromosome 11 deletion in twin girls with pectoralis muscle hypoplasia and skeletal anomalies, and a chromosome six deletion in a patient presenting a complex phenotype that included pectoralis muscle hypoplasia. However, the contribution of genomic imbalances to PS remains largely unknown. To investigate the prevalence of chromosomal imbalances in PS, standard cytogenetic and array-CGH analyses were performed in 120 PS patients. Following the application of stringent filter criteria, 14 rare copy number variations (CNVs) were identified in 14 PS patients in different regions outside known common copy number variations: seven genomic duplications and seven genomic deletions, enclosing the two previously reported PS associated chromosomal deletions. These CNVs ranged from 0.04 to 4.71 Mb in size. Bioinformatic analysis of array-CGH data indicated gene enrichment in pathways involved in cell-cell adhesion, DNA binding and apoptosis processes. The analysis also provided a number of candidate genes possibly causing the developmental defects observed in PS patients, among others REV3L, a gene coding for an error-prone DNA polymerase previously associated with Möbius Syndrome with variable phenotypes including pectoralis muscle agenesis. A number of rare CNVs were identified in PS patients, and these involve genes that represent candidates for further evaluation. Rare inherited CNVs may contribute to, or represent risk factors of PS

  18. Constitutional von Hippel-Lindau (VHL) gene deletions detected in VHL families by fluorescence in situ hybridization.

    Science.gov (United States)

    Pack, S D; Zbar, B; Pak, E; Ault, D O; Humphrey, J S; Pham, T; Hurley, K; Weil, R J; Park, W S; Kuzmin, I; Stolle, C; Glenn, G; Liotta, L A; Lerman, M I; Klausner, R D; Linehan, W M; Zhuang, Z

    1999-11-01

    von Hippel-Lindau (VHL) disease is an autosomal dominantly inherited cancer syndrome predisposing to a variety of tumor types that include retinal hemangioblastomas, hemangioblastomas of the central nervous system, renal cell carcinomas, pancreatic cysts and tumors, pheochromocytomas, endolymphatic sac tumors, and epididymal cystadenomas [W. M. Linehan et al., J. Am. Med. Assoc., 273: 564-570, 1995; E. A. Maher and W. G. Kaelin, Jr., Medicine (Baltimore), 76: 381-391, 1997; W. M. Linehan and R. D. Klausner, In: B. Vogelstein and K. Kinzler (eds.), The Genetic Basis of Human Cancer, pp. 455-473, McGraw-Hill, 1998]. The VHL gene was localized to chromosome 3p25-26 and cloned [F. Latif et al., Science (Washington DC), 260: 1317-1320, 1993]. Germline mutations in the VHL gene have been detected in the majority of VHL kindreds. The reported frequency of detection of VHL germline mutations has varied from 39 to 80% (J. M. Whaley et al., Am. J. Hum. Genet., 55: 1092-1102, 1994; Clinical Research Group for Japan, Hum. Mol. Genet., 4: 2233-2237, 1995; F. Chen et al., Hum. Mutat., 5: 66-75, 1995; E. R. Maher et al., J. Med. Genet., 33: 328-332, 1996; B. Zbar, Cancer Surv., 25: 219-232, 1995). Recently a quantitative Southern blotting procedure was found to improve this frequency (C. Stolle et al., Hum. Mutat., 12: 417-423, 1998). In the present study, we report the use of fluorescence in situ hybridization (FISH) as a method to detect and characterize VHL germline deletions. We reexamined a group of VHL patients shown previously by single-strand conformation and sequencing analysis not to harbor point mutations in the VHL locus. We found constitutional deletions in 29 of 30 VHL patients in this group using cosmid and P1 probes that cover the VHL locus. We then tested six phenotypically normal offspring from four of these VHL families: two were found to carry the deletion and the other four were deletion-free. In addition, germline mosaicism of the VHL gene was identified in

  19. 76 FR 5142 - Procurement List; Additions and Deletion

    Science.gov (United States)

    2011-01-28

    ... and Deletion AGENCY: Committee for Purchase From People Who Are Blind or Severely Disabled. ACTION: Additions to and deletion from the Procurement List. SUMMARY: This action adds services to the Procurement.... Contracting Activity: Department of Transportation, Federal Aviation Administration, Jamaica, NY. Deletion On...

  20. Prader-Willi syndrome and atypical submicroscopic 15q11-q13 deletions with or without imprinting defects.

    Science.gov (United States)

    Hassan, Maaz; Butler, Merlin G

    2016-11-01

    We report a 20 year follow up on a Caucasian female, now 26 years of age, with Prader-Willi syndrome (PWS) harboring an atypical 15q11-q13 submicroscopic deletion of 100-200 kb in size first detected in 1996 involving the imprinting center, SNRPN gene and surrounding region. PWS is a rare complex disorder caused by the loss of paternally expressed genes in the 15q11-q13 region. With high resolution chromosomal microarray and methylation - specific MLPA analysis, we updated the genetic findings on our patient and found a 209,819bp deletion including the SNURF-SNRPN gene complex which includes the imprinting center and the SNORD116 region. We compared with four other similarly reported individuals in the literature with atypical submicroscopic deletions within this region but without imprinting center involvement to better characterize the specific genetic lesions causing PWS clinical findings. Clinically, our patient met the diagnostic criteria of PWS including infantile hypotonia, a poor suck with feeding difficulties, global developmental delays and later food foraging, childhood obesity, small hands and skin picking. Small atypical deletions of comparable sizes were seen in the 15q11-q13 region in all five cases and similar behavioral/physical characteristics were found despite an imprinting defect in our patient. These results further support an overlapping critical deletion region involving the non-coding snoRNA SNORD116 in common in the five individuals playing a key role in contributing to the PWS phenotype. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  1. Encephalopathy and bilateral cataract in a boy with an interstitial deletion of Xp22 comprising the CDKL5 and NHS genes.

    Science.gov (United States)

    Van Esch, Hilde; Jansen, Anna; Bauters, Marijke; Froyen, Guy; Fryns, Jean-Pierre

    2007-02-15

    We describe a male patient with a deletion at Xp22, detected by high resolution X-array CGH. The clinical phenotype present in this infant boy, consists of severe encephalopathy, congenital cataracts and tetralogy of Fallot and can be attributed to the deletion of the genes within the interval. Among these deleted genes are the gene for Nance-Horan syndrome and the cyclin-dependent kinase-like 5 gene (CDKL5), responsible for the early seizure variant of Rett syndrome. This is the first description of a male patient with a deletion of these genes, showing the involvement of CDKL5 in severe epileptic encephalopathy in males. Moreover it illustrates the added value of high resolution array-CGH in molecular diagnosis of mental retardation-multiple congenital anomaly cases. (c) 2007 Wiley-Liss, Inc.

  2. Generating Bona Fide Mammalian Prions with Internal Deletions.

    Science.gov (United States)

    Munoz-Montesino, Carola; Sizun, Christina; Moudjou, Mohammed; Herzog, Laetitia; Reine, Fabienne; Chapuis, Jérôme; Ciric, Danica; Igel-Egalon, Angelique; Laude, Hubert; Béringue, Vincent; Rezaei, Human; Dron, Michel

    2016-08-01

    Mammalian prions are PrP proteins with altered structures causing transmissible fatal neurodegenerative diseases. They are self-perpetuating through formation of beta-sheet-rich assemblies that seed conformational change of cellular PrP. Pathological PrP usually forms an insoluble protease-resistant core exhibiting beta-sheet structures but no more alpha-helical content, loosing the three alpha-helices contained in the correctly folded PrP. The lack of a high-resolution prion structure makes it difficult to understand the dynamics of conversion and to identify elements of the protein involved in this process. To determine whether completeness of residues within the protease-resistant domain is required for prions, we performed serial deletions in the helix H2 C terminus of ovine PrP, since this region has previously shown some tolerance to sequence changes without preventing prion replication. Deletions of either four or five residues essentially preserved the overall PrP structure and mutant PrP expressed in RK13 cells were efficiently converted into bona fide prions upon challenge by three different prion strains. Remarkably, deletions in PrP facilitated the replication of two strains that otherwise do not replicate in this cellular context. Prions with internal deletion were self-propagating and de novo infectious for naive homologous and wild-type PrP-expressing cells. Moreover, they caused transmissible spongiform encephalopathies in mice, with similar biochemical signatures and neuropathologies other than the original strains. Prion convertibility and transfer of strain-specific information are thus preserved despite shortening of an alpha-helix in PrP and removal of residues within prions. These findings provide new insights into sequence/structure/infectivity relationship for prions. Prions are misfolded PrP proteins that convert the normal protein into a replicate of their own abnormal form. They are responsible for invariably fatal neurodegenerative

  3. 78 FR 29119 - Procurement List; Additions and Deletion

    Science.gov (United States)

    2013-05-17

    ... and Deletion AGENCY: Committee for Purchase From People Who Are Blind or Severely Disabled. ACTION: Additions to and Deletion from the Procurement List. SUMMARY: This action adds products and services to the... Activity: Washington Headquarters Services (WHS), Acquisition Directorate, Washington, DC. Deletion On 4/5...

  4. Deletions and de novo mutations of SOX11 are associated with a neurodevelopmental disorder with features of Coffin-Siris syndrome.

    Science.gov (United States)

    Hempel, Annmarie; Pagnamenta, Alistair T; Blyth, Moira; Mansour, Sahar; McConnell, Vivienne; Kou, Ikuyo; Ikegawa, Shiro; Tsurusaki, Yoshinori; Matsumoto, Naomichi; Lo-Castro, Adriana; Plessis, Ghislaine; Albrecht, Beate; Battaglia, Agatino; Taylor, Jenny C; Howard, Malcolm F; Keays, David; Sohal, Aman Singh; Kühl, Susanne J; Kini, Usha; McNeill, Alisdair

    2016-03-01

    SOX11 is a transcription factor proposed to play a role in brain development. The relevance of SOX11 to human developmental disorders was suggested by a recent report of SOX11 mutations in two patients with Coffin-Siris syndrome. Here we further investigate the role of SOX11 variants in neurodevelopmental disorders. We used array based comparative genomic hybridisation and trio exome sequencing to identify children with intellectual disability who have deletions or de novo point mutations disrupting SOX11. The pathogenicity of the SOX11 mutations was assessed using an in vitro gene expression reporter system. Loss-of-function experiments were performed in xenopus by knockdown of Sox11 expression. We identified seven individuals with chromosome 2p25 deletions involving SOX11. Trio exome sequencing identified three de novo SOX11 variants, two missense (p.K50N; p.P120H) and one nonsense (p.C29*). The biological consequences of the missense mutations were assessed using an in vitro gene expression system. These individuals had microcephaly, developmental delay and shared dysmorphic features compatible with mild Coffin-Siris syndrome. To further investigate the function of SOX11, we knocked down the orthologous gene in xenopus. Morphants had significant reduction in head size compared with controls. This suggests that SOX11 loss of function can be associated with microcephaly. We thus propose that SOX11 deletion or mutation can present with a Coffin-Siris phenotype. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  5. Genomic deletions in OPA1 in Danish patients with autosomal dominant optic atrophy

    DEFF Research Database (Denmark)

    Almind, Gitte J; Grønskov, Karen; Milea, Dan

    2011-01-01

    Autosomal dominant optic atrophy (ADOA, Kjer disease, MIM #165500) is the most common form of hereditary optic neuropathy. Mutations in OPA1 located at chromosome 3q28 are the predominant cause for ADOA explaining between 32 and 89% of cases. Although deletions of OPA1 were recently reported...

  6. 19 CFR 142.49 - Deletion of C-4 Code.

    Science.gov (United States)

    2010-04-01

    .... Entry filers may delete C-4 Codes from Line Release by notifying the port director in writing on a Deletion Data Loading Sheet. Such notification shall state the C-4 Code which is to be deleted, the port... TREASURY (CONTINUED) ENTRY PROCESS Line Release § 142.49 Deletion of C-4 Code. (a) By Customs. A port...

  7. Molecular cytogenetic characterization of the first reported case of an inv dup (4p)(p15.1-pter) with a concomitant 4q35.1-qter deletion and normal parents.

    Science.gov (United States)

    Tassano, E; Alpigiani, M G; Salvati, P; Gimelli, S; Lorini, R; Gimelli, G

    2012-12-15

    Inverted duplications associated with terminal deletions are complex anomalies described in an increasing of chromosome ends. We report on the cytogenetic characterization of the first de novo inv dup del(4) with partial 4p duplication and 4q deletion in a girl with clinical signs consistent with "recombinant 4 syndrome". This abnormality was suspected by banding, but high-resolution molecular cytogenetic investigations allowed us to define the breakpoints of the rearrangement. The terminal duplicated region extending from 4p15.1 to the telomere was estimated to be 29.27 Mb, while the size of the terminal deletion was 3.114 Mb in the 4q35.1 region. Until now, 10 patients with duplicated 4p14-p15 and deleted 4q35 chromosome 4 have been described. In all cases the abnormal chromosome 4 was derived from a pericentric inversion inherited from one of the parents. In conclusion, we have identified the first case of inv dup del(4) with normal parents suggesting that, often, terminal duplications or terminal deletions mask complex rearrangements. Copyright © 2012 Elsevier B.V. All rights reserved.

  8. 5 CFR 2502.18 - Deletion of exempted information.

    Science.gov (United States)

    2010-01-01

    ... 5 Administrative Personnel 3 2010-01-01 2010-01-01 false Deletion of exempted information. 2502.18... Charges for Search and Reproduction § 2502.18 Deletion of exempted information. Where requested records... the remainder of the records, they shall be disclosed by the Office with deletions. To each such...

  9. 78 FR 75912 - Procurement List; Addition and Deletion

    Science.gov (United States)

    2013-12-13

    ... and Deletion AGENCY: Committee for Purchase From People Who Are Blind or Severely Disabled. ACTION: Addition to and deletion from the Procurement List. SUMMARY: This action adds a service to the Procurement...: General Services Administration, Fort Worth, TX Deletion On 11/1/2013 (78 FR 65618), the Committee for...

  10. MicroRNA Dysregulation, Gene Networks, and Risk for Schizophrenia in 22q11.2 Deletion Syndrome

    Science.gov (United States)

    Merico, Daniele; Costain, Gregory; Butcher, Nancy J.; Warnica, William; Ogura, Lucas; Alfred, Simon E.; Brzustowicz, Linda M.; Bassett, Anne S.

    2014-01-01

    The role of microRNAs (miRNAs) in the etiology of schizophrenia is increasingly recognized. Microdeletions at chromosome 22q11.2 are recurrent structural variants that impart a high risk for schizophrenia and are found in up to 1% of all patients with schizophrenia. The 22q11.2 deletion region overlaps gene DGCR8, encoding a subunit of the miRNA microprocessor complex. We identified miRNAs overlapped by the 22q11.2 microdeletion and for the first time investigated their predicted target genes, and those implicated by DGCR8, to identify targets that may be involved in the risk for schizophrenia. The 22q11.2 region encompasses seven validated or putative miRNA genes. Employing two standard prediction tools, we generated sets of predicted target genes. Functional enrichment profiles of the 22q11.2 region miRNA target genes suggested a role in neuronal processes and broader developmental pathways. We then constructed a protein interaction network of schizophrenia candidate genes and interaction partners relevant to brain function, independent of the 22q11.2 region miRNA mechanisms. We found that the predicted gene targets of the 22q11.2 deletion miRNAs, and targets of the genome-wide miRNAs predicted to be dysregulated by DGCR8 hemizygosity, were significantly represented in this schizophrenia network. The findings provide new insights into the pathway from 22q11.2 deletion to expression of schizophrenia, and suggest that hemizygosity of the 22q11.2 region may have downstream effects implicating genes elsewhere in the genome that are relevant to the general schizophrenia population. These data also provide further support for the notion that robust genetic findings in schizophrenia may converge on a reasonable number of final pathways. PMID:25484875

  11. Identification of the -α(2.4) Deletion in One Family and in One Hb H Disease Patient in Guangxi, People's Republic of China.

    Science.gov (United States)

    Pang, Wanrong; Sun, Lei; Long, Ju; Weng, Xunjin; Ye, Xuehe; Wang, Junjie; Liao, Yan; Tang, Weijun; Fan, Zuqian; Wu, Suping; Song, Chuanlu; Wei, Xiaoying; Zhang, Chenghong

    2016-06-01

    The 2.4 kb (or -α(2.4)) deletion in the α-globin gene cluster (NG_000006.1) is an α(+)-thalassemia (α(+)-thal) allele. The molecular basis of -α(2.4) is a deletion from 36860 to 39251 of the α-globin gene cluster. It was reported by three research groups in 2005, 2012 and 2014, respectively. In routine thalassemia screening studies by this research group, we found an individual with the -α(2.4)/αα genotype and an Hb H (β4) disease patient whose genotype was - -(SEA)/-α(2.4). Samples from the parents of the carrier of the -α(2.4)/αα genotype were collected to perform pedigree analysis, and the proband's mother's genotype was diagnosed to be - -(SEA)/-α(2.4). The research revealed that the -α(2.4) allele exists in the population of southern Guangxi, People's Republic of China.

  12. CDC73 intragenic deletion in familial primary hyperparathyroidism associated with parathyroid carcinoma.

    Science.gov (United States)

    Korpi-Hyövälti, Eeva; Cranston, Treena; Ryhänen, Eeva; Arola, Johanna; Aittomäki, Kristiina; Sane, Timo; Thakker, Rajesh V; Schalin-Jäntti, Camilla

    2014-09-01

    CDC73 mutations frequently underlie the hyperparathyroidism-jaw tumor syndrome, familial isolated hyperparathyroidism (FIHP), and parathyroid carcinoma. It has also been suggested that CDC73 deletion analysis should be performed in those patients without CDC73 mutations. To investigate for CDC73 deletion in a family with FIHP previously reported not to have CDC73 mutations. Eleven members (six affected with primary hyperparathyroidism and five unaffected) were ascertained from the family, and multiplex ligation-dependent probe amplification was performed to detect CDC73 deletion using leukocyte DNA. A previously unreported deletion of CDC73 involving exons 1-10 was detected in five affected members and two unaffected members who were 26 and 39 years of age. Two affected members had parathyroid carcinomas at the ages of 18 and 32 years, and they had Ki-67 proliferation indices of 5 and 14.5% and did not express parafibromin, encoded by CDC73. Primary hyperparathyroidism in the other affected members was due to adenomas and atypical adenomas, and none had jaw tumors. Two affected members had thoracic aortic aneurysms, which in one member occurred with parathyroid carcinoma and renal cysts. A previously unreported intragenic deletion of exons 1 to 10 of CDC73 was detected in a three-generation family with FIHP, due to adenomas, atypical adenomas, and parathyroid carcinomas. In addition, two affected males had thoracic aortic aneurysms, which may represent another associated clinical feature of this disorder.

  13. Low cost biosensor-based molecular differential diagnosis of α-thalassemia (Southeast Asia deletion).

    Science.gov (United States)

    Wangmaung, Nantawan; Promptmas, Chamras; Chomean, Sirinart; Sanchomphu, Chularat; Ittarat, Wanida

    2013-06-01

    Thalassemias are genetic hematologic diseases which the homozygous form of α-thalassemia can cause either death in utero or shortly after birth. It is necessary to accurately identify high-risk heterozygous couples. We developed a quartz crystal microbalance (QCM) to identify the abnormal gene causing the commonly found α-thalassemia1, [Southeast Asia (SEA) deletion]. This work is an improved method of our previous study by reducing both production cost and analysis time. A silver electrode on the QCM surface was immobilized with a biotinylated probe. The α-globin gene fragment was amplified and hybridized with the probe. Hybridization was indicated by changes of quartz oscillation. Each drying step was improved by using an air pump for 30 min instead of the overnight air dry. The diagnostic potency of the silver QCM was evaluated using 70 suspected samples with microcytic hypochromic erythrocytes. The silver QCM could clearly identify samples with abnormal α-globin genes, either homozygous or heterozygous, from normal samples. Thirteen out of 70 blood samples were identified as carrier of α-thalassemia1 (SEA deletion). Results were consistent with the standard agarose gel electrophoresis. Using silver instead of gold QCM could reduce the production expense 10-fold. An air pump drying the QCM surface could reduce the analysis time from 3 days to 4 h. The silver thalassemic QCM was specific, sensitive, rapid, cheap and field applicable. It could be used as a one-step definite diagnosis of α-thalassemia1 (SEA deletion) with no need for the preliminary screening test.

  14. A Deletion in the Canine POMC Gene Is Associated with Weight and Appetite in Obesity-Prone Labrador Retriever Dogs

    OpenAIRE

    Raffan, Eleanor; Dennis, Rowena?J.; O?Donovan, Conor?J.; Becker, Julia?M.; Scott, Robert?A.; Smith, Stephen?P.; Withers, David?J.; Wood, Claire?J.; Conci, Elena; Clements, Dylan?N.; Summers, Kim?M.; German, Alexander?J.; Mellersh, Cathryn?S.; Arendt, Maja?L.; Iyemere, Valentine?P.

    2016-01-01

    Sequencing of candidate genes for obesity in Labrador retriever dogs identified a 14 bp deletion in pro-opiomelanocortin (POMC) with an allele frequency of 12%. The deletion disrupts the β-MSH and β-endorphin coding sequences and is associated with body weight (per allele effect of 0.33 SD), adiposity, and greater food motivation. Among other dog breeds, the deletion was only found in the closely related flat-coat retriever (FCR), where it is similarly associated with body weight and food mot...

  15. In vivo CRISPR screening identifies Ptpn2 as a cancer immunotherapy target.

    Science.gov (United States)

    Manguso, Robert T; Pope, Hans W; Zimmer, Margaret D; Brown, Flavian D; Yates, Kathleen B; Miller, Brian C; Collins, Natalie B; Bi, Kevin; LaFleur, Martin W; Juneja, Vikram R; Weiss, Sarah A; Lo, Jennifer; Fisher, David E; Miao, Diana; Van Allen, Eliezer; Root, David E; Sharpe, Arlene H; Doench, John G; Haining, W Nicholas

    2017-07-27

    Immunotherapy with PD-1 checkpoint blockade is effective in only a minority of patients with cancer, suggesting that additional treatment strategies are needed. Here we use a pooled in vivo genetic screening approach using CRISPR-Cas9 genome editing in transplantable tumours in mice treated with immunotherapy to discover previously undescribed immunotherapy targets. We tested 2,368 genes expressed by melanoma cells to identify those that synergize with or cause resistance to checkpoint blockade. We recovered the known immune evasion molecules PD-L1 and CD47, and confirmed that defects in interferon-γ signalling caused resistance to immunotherapy. Tumours were sensitized to immunotherapy by deletion of genes involved in several diverse pathways, including NF-κB signalling, antigen presentation and the unfolded protein response. In addition, deletion of the protein tyrosine phosphatase PTPN2 in tumour cells increased the efficacy of immunotherapy by enhancing interferon-γ-mediated effects on antigen presentation and growth suppression. In vivo genetic screens in tumour models can identify new immunotherapy targets in unanticipated pathways.

  16. Multiplex Ligation-dependent Probe Amplification Identification of Deletions and Duplications of the Duchenne Muscular Dystrophy Gene in Taiwanese Subjects

    Directory of Open Access Journals (Sweden)

    Hsiao-Lin Hwa

    2007-05-01

    Conclusion: MLPA was proven to be a powerful tool for the detection of DMD gene deletions and duplications in male patients and female carriers. There was a relatively lower frequency of deletion and a higher frequency of duplication of DMD gene in this population compared to previous reports.

  17. 5 CFR 1631.17 - Deletion of exempted information.

    Science.gov (United States)

    2010-01-01

    ... 5 Administrative Personnel 3 2010-01-01 2010-01-01 false Deletion of exempted information. 1631.17... Deletion of exempted information. Where requested records contain matters which are exempted under 5 U.S.C... disclosed by the Board with deletions. To each such record, the Board shall attach a written justification...

  18. 78 FR 27369 - Procurement List; Additions and Deletion

    Science.gov (United States)

    2013-05-10

    ... and Deletion AGENCY: Committee for Purchase From People Who Are Blind or Severely Disabled. ACTION: Additions to and Deletion from the Procurement List. SUMMARY: This action adds products to the Procurement..., Philadelphia, PA. Deletion On 4/5/2013 (78 FR 20622-20623), the Committee for Purchase From People Who Are...

  19. Deleted in Malignant Brain Tumors 1 is up-regulated in bacterial endocarditis and binds to components of vegetations

    DEFF Research Database (Denmark)

    Müller, Hanna; Renner, Marcus; Helmke, Burkhard M

    2009-01-01

    OBJECTIVE: Bacterial endocarditis is a frequent infectious cardiac disease, especially in patients with congenital or acquired heart defects. It is characterized by bacterial colonization of the heart valves and the appearance of vegetations consisting of fibrin, blood cells, and bacteria....... The glycoprotein Deleted in Malignant Brain Tumors 1 is a scavenger receptor cysteine-rich protein with functions in innate immunity and epithelial differentiation. Because of the aggregating capacity of Deleted in Malignant Brain Tumors 1, we hypothesized that an up-regulation in bacterial endocarditis may...... be linked to the development of vegetations. METHODS: Heart tissue of 19 patients with bacterial endocarditis and 10 controls without bacterial endocarditis was analyzed by immunohistochemistry. The effect of human recombinant Deleted in Malignant Brain Tumors 1 on erythrocyte aggregation was measured using...

  20. Genetic heterogeneity of patients with suspected Silver-Russell syndrome: genome-wide copy number analysis in 82 patients without imprinting defects.

    Science.gov (United States)

    Inoue, Takanobu; Nakamura, Akie; Fuke, Tomoko; Yamazawa, Kazuki; Sano, Shinichiro; Matsubara, Keiko; Mizuno, Seiji; Matsukura, Yoshika; Harashima, Chie; Hasegawa, Tatsuji; Nakajima, Hisakazu; Tsumura, Kumi; Kizaki, Zenro; Oka, Akira; Ogata, Tsutomu; Fukami, Maki; Kagami, Masayo

    2017-01-01

    Silver-Russell syndrome (SRS) is a rare congenital disorder characterized by pre- and postnatal growth failure and dysmorphic features. Recently, pathogenic copy number variations (PCNVs) and imprinting defects other than hypomethylation of the H19 -differentially methylated region (DMR) and maternal uniparental disomy chromosome 7 have been reported in patients with the SRS phenotype. This study aimed to clarify the frequency and clinical features of patients with SRS phenotype caused by PCNVs. We performed array comparative genomic hybridization analysis using a catalog array for 54 patients satisfying the Netchine-Harbison clinical scoring system (NH-CSS) (SRS-compatible) and for 28 patients presenting with three NH-CSS items together with triangular face and/or fifth finger clinodactyly and/or brachydactyly (SRS-like) without abnormal methylation levels of 9 DMRs related to known imprinting disorders. We then investigated the clinical features of patients with PCNVs. Three of the 54 SRS-compatible patients (5.6%) and 2 of the 28 SRS-like patients (7.1%) had PCNVs. We detected 3.5 Mb deletion in 4p16.3, mosaic trisomy 18, and 3.77-4.00 Mb deletion in 19q13.11-12 in SRS-compatible patients, and 1.41-1.97 Mb deletion in 7q11.23 in both SRS-like patients. Congenital heart diseases (CHDs) were identified in two patients and moderate to severe global developmental delay was observed in four patients. Of the patients in our study, 5.6% of SRS-compatible and 7.1% of SRS-like patients had PCNVs. All PCNVs have been previously reported for genetic causes of contiguous deletion syndromes or mosaic trisomy 18. Our study suggests patients with PCNVs, who have a phenotype resembling SRS, show a high tendency towards CHDs and/or apparent developmental delay.

  1. A Comparative Study of Quantum and Classical Deletion

    International Nuclear Information System (INIS)

    Shen Yao; Hao Liang; Long Guilu

    2010-01-01

    Here in this letter, we study the difference between quantum and classical deletion. We point out that the linear mapping deletion operation used in the impossibility proof for quantum systems applies also to classical system. The general classical deletion operation is a combined operation of measurement and transformation, i.e., first read the state and then transfer the state to the standard blank state. Though both quantum information and classical information can be deleted in an open system, quantum information cannot be recovered while classical information can be recovered. (general)

  2. Variability in a three-generation family with Pierre Robin sequence, acampomelic campomelic dysplasia, and intellectual disability due to a novel ∼1 Mb deletion upstream of SOX9, and including KCNJ2 and KCNJ16.

    Science.gov (United States)

    Castori, Marco; Bottillo, Irene; Morlino, Silvia; Barone, Chiara; Cascone, Piero; Grammatico, Paola; Laino, Luigi

    2016-01-01

    Campomelic dysplasia and acampomelic campomelic dysplasia (ACD) are allelic disorders due to heterozygous mutations in or around SOX9. Translocations and deletions involving the SOX9 5' regulatory region are rare causes of these disorders, as well as Pierre Robin sequence (PRS) and 46,XY gonadal dysgenesis. Genotype-phenotype correlations are not straightforward due to the complex epigenetic regulation of SOX9 expression during development. We report a three-generation pedigree with a novel ∼1 Mb deletion upstream of SOX9 and including KCNJ2 and KCNJ16, and ascertained for dominant transmission of PRS. Further characterization of the family identified subtle appendicular anomalies and a variable constellation of axial skeletal features evocative of ACD in several members. Affected males showed learning disability. The identified deletion was smaller than all other chromosome rearrangements associated with ACD. Comparison with other reported translocations and deletions involving this region allowed further refining of genotype-phenotype correlations and an update of the smallest regions of overlap associated with the different phenotypes. Intrafamilial variability in this pedigree suggests a phenotypic continuity between ACD and PRS in patients carrying mutations in the SOX9 5' regulatory region. © 2015 Wiley Periodicals, Inc.

  3. A novel contiguous deletion involving NDP, MAOB and EFHC2 gene ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 96; Issue 6. A novel contiguous deletion involving NDP, MAOBand EFHC2gene in a patient with familial Norrie disease: bilateral blindness and leucocoria without other deficits. BEI JIA LIPING HUANG YAOYU CHEN SIPING LIU CUIHUA CHEN KE XIONG LANLIN SONG YULAI ...

  4. A novel contiguous deletion involving NDP, MAOB and EFHC2 gene ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 96; Issue 6. A novel contiguous deletion involving NDP, MAOBitalic> and EFHC2italic> gene in a patient with familial Norrie disease: bilateral blindness and leucocoria without other deficits. BEI JIA LIPING HUANG YAOYU CHEN SIPING LIU CUIHUA CHEN KE XIONG LANLIN ...

  5. Contribution of insertions and deletions to the variability of hepatitis C virus populations.

    Science.gov (United States)

    Torres-Puente, Manuela; Cuevas, José M; Jiménez-Hernández, Nuria; Bracho, María A; García-Robles, Inmaculada; Carnicer, Fernando; del Olmo, Juan; Ortega, Enrique; Moya, Andrés; González-Candelas, Fernando

    2007-08-01

    Little is known about the potential effects of insertions and deletions (indels) on the evolutionary dynamics of hepatitis C virus (HCV). In fact, the consequences of indels on antiviral treatment response are a field of investigation completely unexplored. Here, an extensive sequencing project was undertaken by cloning and sequencing serum samples from 25 patients infected with HCV subtype 1a and 48 patients with subtype 1b. For 23 patients, samples obtained after treatment with alpha interferon plus ribavirin were also available. Two genome fragments containing the hypervariable regions in the envelope 2 glycoprotein and the PKR-BD domain in NS5A were sequenced, yielding almost 16 000 sequences. Our results show that insertions are quite rare, but they are often present in biologically relevant domains of the HCV genome. Moreover, their frequency distributions between different time samples reflect the quasispecies dynamics of HCV populations. Deletions seem to be subject to negative selection.

  6. Conversion of Deletions during Recombination in Pneumococcal Transformation

    Science.gov (United States)

    Lefevre, J. C.; Mostachfi, P.; Gasc, A. M.; Guillot, E.; Pasta, F.; Sicard, M.

    1989-01-01

    Genetic analysis of 16 deletions obtained in the amiA locus of pneumococcus is described. When present on donor DNA, all deletions increased drastically the frequency of wild-type recombinants in two-point crosses. This effect was maximal for deletions longer than 200 bases. It was reduced for heterologies shorter than 76 bases and did not exist for very short deletions. In three-point crosses in which the deletion was localized between two point mutations, we demonstrated that this excess of wild-type recombinants was the result of a genetic conversion. This conversion extended over several scores of bases outside the deletion. Conversion takes place during the heteroduplex stage of recombination. Therefore, in pneumococcal transformation, long heterologies participated in this heteroduplex configuration. As this conversion did not require an active DNA polymerase A gene it is proposed that the mechanism of conversion is not a DNA repair synthesis but involves breakage and ligation between DNA molecules. Conversion of deletions did not require the Hex system of correction of mismatched bases. It differs also from localized conversion. It appears that it is a process that evolved to correct errors of replication which lead to long heterologies and which are not eliminated by other systems. PMID:2599365

  7. 36 CFR 1275.58 - Deletion of restricted portions.

    Science.gov (United States)

    2010-07-01

    ... 36 Parks, Forests, and Public Property 3 2010-07-01 2010-07-01 false Deletion of restricted... HISTORICAL MATERIALS OF THE NIXON ADMINISTRATION Access by the Public § 1275.58 Deletion of restricted... materials after the deletion of the portions which are restricted under this § 1275.50 or § 1275.52. ...

  8. 75 FR 69638 - Procurement List; Additions and Deletion

    Science.gov (United States)

    2010-11-15

    ... and Deletion AGENCY: Committee for Purchase From People Who Are Blind or Severely Disabled. ACTION: Additions to and deletion from the Procurement List. SUMMARY: This action adds products and a service to the...), DENVER, CO. Deletion On 9/17/2010 (75 FR 56995-56996), the Committee for Purchase From People Who Are...

  9. Genetics Home Reference: proximal 18q deletion syndrome

    Science.gov (United States)

    ... characteristic features. Most cases of proximal 18q deletion syndrome are the result of a new (de novo) deletion and are not inherited from a ... J, Fox PT, Stratton RF, Perry B, Hale DE. Recurrent interstitial deletions of proximal 18q: a new syndrome involving expressive speech delay. Am J Med Genet ...

  10. Analysis of pools of targeted Salmonella deletion mutants identifies novel genes affecting fitness during competitive infection in mice.

    Directory of Open Access Journals (Sweden)

    Carlos A Santiviago

    2009-07-01

    Full Text Available Pools of mutants of minimal complexity but maximal coverage of genes of interest facilitate screening for genes under selection in a particular environment. We constructed individual deletion mutants in 1,023 Salmonella enterica serovar Typhimurium genes, including almost all genes found in Salmonella but not in related genera. All mutations were confirmed simultaneously using a novel amplification strategy to produce labeled RNA from a T7 RNA polymerase promoter, introduced during the construction of each mutant, followed by hybridization of this labeled RNA to a Typhimurium genome tiling array. To demonstrate the ability to identify fitness phenotypes using our pool of mutants, the pool was subjected to selection by intraperitoneal injection into BALB/c mice and subsequent recovery from spleens. Changes in the representation of each mutant were monitored using T7 transcripts hybridized to a novel inexpensive minimal microarray. Among the top 120 statistically significant spleen colonization phenotypes, more than 40 were mutations in genes with no previously known role in this model. Fifteen phenotypes were tested using individual mutants in competitive assays of intraperitoneal infection in mice and eleven were confirmed, including the first two examples of attenuation for sRNA mutants in Salmonella. We refer to the method as Array-based analysis of cistrons under selection (ABACUS.

  11. Molecular analysis of the Duchenne muscular dystrophy gene in Spanish individuals: Deletion detection and familial diagnosis

    Energy Technology Data Exchange (ETDEWEB)

    Patino, A.; Garcia-Delgado, M.; Narbona, J. [Univ. of Navarra, Pamplona (Spain)

    1995-11-06

    Deletion studies were performed in 26 Duchenne muscular dystrophy (DMD) patients through amplification of nine different exons by multiplex polymerase chain reaction (PCR). DNA from paraffin-embedded muscle biopsies was analyzed in 12 of the 26 patients studied. Optimization of this technique is of great utility because it enables analysis of material stored in pathology archives. PCR deletion detection, useful in DMD-affected boys, is problematic in determining the carrier state in female relatives. For this reason, to perform familial linkage diagnosis, we made use of a dinucleotide repeat polymorphism (STRP, or short tandem repeat polymorphism) located in intron 49 of the gene. We designed a new pair of primers that enabled the detection of 22 different alleles in relatives in the 14 DMD families studied. The use of this marker allowed familial diagnosis in 11 of the 14 DMD families and detection of de novo deletions in 3 of the probands. 8 refs., 5 figs., 2 tabs.

  12. Unusual presentation of Kallmannn syndrome with contiguous gene deletion in three siblings of a family

    Directory of Open Access Journals (Sweden)

    Sri Venkat Madhu

    2012-01-01

    Full Text Available We report the case of 3 brothers aged 34, 24, and 22 years, unmarried, who presented to our endocrinology clinic with absence of secondary sexual characters. There was no such history in other siblings, but their maternal uncle had similar complaints. On examination, all 3 had pre-pubertal appearance, voice, and genitalia along with anosmia and bimanual synkinesia. Cryptorchidism was noticed in 2 while third person had small hypoplastic testes. It was also noted that all 3 patients had icthyosis mainly involving trunk, back, and limbs. The hormonal assays were consistent with isolated hypogonadotrophic hypogonadism. IQ testing revealed mental retardation in the 2 patients. Ultrasound showed ectopic right kidney in one patient, atrophic right kidney in the second patient while the third patient had normal kidneys. MRI brain of all the patients showed poorly visualized olfactory tract and bulb. Kallmann syndrome (KS was diagnosed based on hormonal evaluation and MRI results. Of the four types of KS: Synkinesia, renal anomaly, and X-linked pedigree pattern in our patients pointed towards X-linked type 1 KS as the possible cause. But, icthyosis and mental retardation are not usual presentation of type 1 KS. They are usually seen as a result of contiguous gene deletion of KAL1, steroid sulfatase (STS, and mental retardation (MRX gene on X chromosome. Hence, the possible gene defect in our cases is inherited defect in contiguous gene deletion. The contiguous gene deletion as the cause of KS in 3 patients of same family is very rare and worth reporting. Also, the significance of phenotype-genotypic association in Kallmann syndrome is discussed

  13. The diagnosis and molecular analysis of a novel 21.9kb deletion (Qinzhou type deletion) causing α+ thalassemia.

    Science.gov (United States)

    Long, Ju; Yan, Shanhuo; Lao, Kegan; Pang, Wanrong; Ye, Xuehe; Sun, Lei

    2014-04-01

    α-Thalassemia is a common single-gene genetic disease that can cause Hb Bart's hydrops fetalis and Hb H disease in tropical and subtropical regions. When examining conventional thalassemia genes, an only detected --(SEA) genotype sample needs further analysis. In doing so, we found a novel 21.9kb deletion (Qinzhou type deletion). The deletion position of the novel 21.9kb deletion is from 14373bp to 36299bp of the α-globin gene cluster (NG_000006.1); thus, there exists a 21927bp sequence deletion, into which a 29bp sequence is added. After sequence analysis, a group of Gap-PCR primers were synthesized to diagnose this novel thalassemia genotype. Through pedigree analysis, we deduced that the propositus obtained the novel alleles from her mother. The genotype of this propositus is --(SEA)/-α(21.9) and its phenotype conforms to the characteristics of Hb H disease, establishing that the combination between -α(21.9) genotype and α(0) genotype can lead to Hb H disease. By molecular analysis, we established that this case fits the characteristic of an α(+) thalassemia genotype. © 2013.

  14. Genome-wide screening for genes whose deletions confer sensitivity to mutagenic purine base analogs in yeast

    Directory of Open Access Journals (Sweden)

    Kozmin Stanislav G

    2005-06-01

    Full Text Available Abstract Background N-hydroxylated base analogs, such as 6-hydroxylaminopurine (HAP and 2-amino-6-hydroxylaminopurine (AHA, are strong mutagens in various organisms due to their ambiguous base-pairing properties. The systems protecting cells from HAP and related noncanonical purines in Escherichia coli include specialized deoxyribonucleoside triphosphatase RdgB, DNA repair endonuclease V, and a molybdenum cofactor-dependent system. Fewer HAP-detoxification systems have been identified in yeast Saccharomyces cerevisiae and other eukaryotes. Cellular systems protecting from AHA are unknown. In the present study, we performed a genome-wide search for genes whose deletions confer sensitivity to HAP and AHA in yeast. Results We screened the library of yeast deletion mutants for sensitivity to the toxic and mutagenic action of HAP and AHA. We identified novel genes involved in the genetic control of base analogs sensitivity, including genes controlling purine metabolism, cytoskeleton organization, and amino acid metabolism. Conclusion We developed a method for screening the yeast deletion library for sensitivity to the mutagenic and toxic action of base analogs and identified 16 novel genes controlling pathways of protection from HAP. Three of them also protect from AHA.

  15. Genome-Wide Estimates of Transposable Element Insertion and Deletion Rates in Drosophila Melanogaster

    Science.gov (United States)

    Adrion, Jeffrey R.; Song, Michael J.; Schrider, Daniel R.; Hahn, Matthew W.

    2017-01-01

    Abstract Knowing the rate at which transposable elements (TEs) insert and delete is critical for understanding their role in genome evolution. We estimated spontaneous rates of insertion and deletion for all known, active TE superfamilies present in a set of Drosophila melanogaster mutation-accumulation (MA) lines using whole genome sequence data. Our results demonstrate that TE insertions far outpace TE deletions in D. melanogaster. We found a significant effect of background genotype on TE activity, with higher rates of insertions in one MA line. We also found significant rate heterogeneity between the chromosomes, with both insertion and deletion rates elevated on the X relative to the autosomes. Further, we identified significant associations between TE activity and chromatin state, and tested for associations between TE activity and other features of the local genomic environment such as TE content, exon content, GC content, and recombination rate. Our results provide the most detailed assessment of TE mobility in any organism to date, and provide a useful benchmark for both addressing theoretical predictions of TE dynamics and for exploring large-scale patterns of TE movement in D. melanogaster and other species. PMID:28338986

  16. Identification of a basic helix-loop-helix-type transcription regulator gene in Aspergillus oryzae by systematically deleting large chromosomal segments.

    Science.gov (United States)

    Jin, Feng Jie; Takahashi, Tadashi; Machida, Masayuki; Koyama, Yasuji

    2009-09-01

    We previously developed two methods (loop-out and replacement-type recombination) for generating large-scale chromosomal deletions that can be applied to more effective chromosomal engineering in Aspergillus oryzae. In this study, the replacement-type method is used to systematically delete large chromosomal DNA segments to identify essential and nonessential regions in chromosome 7 (2.93 Mb), which is the smallest A. oryzae chromosome and contains a large number of nonsyntenic blocks. We constructed 12 mutants harboring deletions that spanned 16- to 150-kb segments of chromosome 7 and scored phenotypic changes in the resulting mutants. Among the deletion mutants, strains designated Delta5 and Delta7 displayed clear phenotypic changes involving growth and conidiation. In particular, the Delta5 mutant exhibited vigorous growth and conidiation, potentially beneficial characteristics for certain industrial applications. Further deletion analysis allowed identification of the AO090011000215 gene as the gene responsible for the Delta5 mutant phenotype. The AO090011000215 gene was predicted to encode a helix-loop-helix binding protein belonging to the bHLH family of transcription factors. These results illustrate the potential of the approach for identifying novel functional genes.

  17. PTEN genomic deletion predicts prostate cancer recurrence and is associated with low AR expression and transcriptional activity

    Directory of Open Access Journals (Sweden)

    Choucair Khalil

    2012-11-01

    Full Text Available Abstract Background Prostate cancer (PCa, a leading cause of cancer death in North American men, displays a broad range of clinical outcome from relatively indolent to lethal metastatic disease. Several genomic alterations have been identified in PCa which may serve as predictors of progression. PTEN, (10q23.3, is a negative regulator of the phosphatidylinositol 3-kinase (PIK3/AKT survival pathway and a tumor suppressor frequently deleted in PCa. The androgen receptor (AR signalling pathway is known to play an important role in PCa and its blockade constitutes a commonly used treatment modality. In this study, we assessed the deletion status of PTEN along with AR expression levels in 43 primary PCa specimens with clinical follow-up. Methods Fluorescence In Situ Hybridization (FISH was done on formalin fixed paraffin embedded (FFPE PCa samples to examine the deletion status of PTEN. AR expression levels were determined using immunohistochemistry (IHC. Results Using FISH, we found 18 cases of PTEN deletion. Kaplan-Meier analysis showed an association with disease recurrence (P=0.03. Concurrently, IHC staining for AR found significantly lower levels of AR expression within those tumors deleted for PTEN (PPTEN deleted. We confirmed the predictive value of PTEN deletion in disease recurrence (P=0.03. PTEN deletion was also linked to diminished expression of PTEN (PP=0.02. Furthermore, gene set enrichment analysis revealed a diminished expression of genes downstream of AR signalling in PTEN deleted tumors. Conclusions Altogether, our data suggest that PTEN deleted tumors expressing low levels of AR may represent a worse prognostic subset of PCa establishing a challenge for therapeutic management.

  18. Characterization of a complex rearrangement involving duplication and deletion of 9p in an infant with craniofacial dysmorphism and cardiac anomalies

    Directory of Open Access Journals (Sweden)

    Di Bartolo Daniel L

    2012-07-01

    Full Text Available Abstract Partial duplication and partial deletion of the short arm of chromosome 9 have each been reported in the literature as clinically recognizable syndromes. We present clinical, cytogenetic, and molecular findings on a five-week-old female infant with concomitant duplication and terminal deletion of the short arm of chromosome 9. To our knowledge ten such cases have previously been reported. Conventional cytogenetic analysis identified additional material on chromosome 9 at band p23. FISH analysis aided in determining the additional material consisted of an inverted duplication with a terminal deletion of the short arm. Microarray analysis confirmed this interpretation and further characterized the abnormality as a duplication of about 32.7 Mb, from 9p23 to 9p11.2, and a terminal deletion of about 11.5 Mb, from 9p24.3 to 9p23. The infant displayed characteristic features of Duplication 9p Syndrome (hypotonia, bulbous nose, single transverse palmar crease, cranial anomalies, as well as features associated with Deletion 9p Syndrome (flat nasal bridge, long philtrum, cardiac anomalies despite the deletion being distal to the reported critical region for this syndrome. This case suggests that there are genes or regulatory elements that lie outside of the reported critical region responsible for certain phenotypic features associated with Deletion 9p Syndrome. It also underscores the importance of utilizing array technology to precisely define abnormalities involving the short arm of 9p in order to further refine genotype/phenotype associations and to identify additional cases of duplication/deletion.

  19. 29 CFR 1610.20 - Deletion of exempted matters.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 4 2010-07-01 2010-07-01 false Deletion of exempted matters. 1610.20 Section 1610.20 Labor... Production or Disclosure Under 5 U.S.C. 552 § 1610.20 Deletion of exempted matters. Where requested records... the remainder of the records, they shall be disclosed by the Commission with deletions. To each such...

  20. Prenatal diagnosis and molecular cytogenetic characterization of a de novo proximal interstitial deletion of chromosome 4p (4p15.2→p14).

    Science.gov (United States)

    Chen, Chih-Ping; Lee, Meng-Ju; Chern, Schu-Rern; Wu, Peih-Shan; Su, Jun-Wei; Chen, Yu-Ting; Lee, Meng-Shan; Wang, Wayseen

    2013-10-25

    We present prenatal diagnosis of de novo proximal interstitial deletion of chromosome 4p (4p15.2→p14) and molecular cytogenetic characterization of the deletion using uncultured amniocytes. We review the phenotypic abnormalities of previously reported patients with similar proximal interstitial 4p deletions, and we discuss the functions of the genes of RBPJ, CCKAR, STIM2, PCDH7 and ARAP2 that are deleted within this region. © 2013.

  1. Toward a patient-centered ambulatory after-visit summary: Identifying primary care patients' information needs.

    Science.gov (United States)

    Clarke, Martina A; Moore, Joi L; Steege, Linsey M; Koopman, Richelle J; Belden, Jeffery L; Canfield, Shannon M; Kim, Min S

    2018-09-01

    The purpose of this study was to determine the information needs of primary care patients as they review clinic visit notes to inform information that should be contained in an after-visit summary (AVS). We collected data from 15 patients with an acute illness and 14 patients with a chronic disease using semi-structured interviews. The acute patients reviewed seven major sections, and chronic patients reviewed eight major sections of a simulated, but realistic visit note to identify relevant information needs for their AVS. Patients in the acute illness group identified the Plan, Assessment and History of Present Illness the most as important note sections, while patients in the chronic care group identified Significant Lab Data, Plan, and Assessment the most as important note sections. This study was able to identify primary care patients' information needs after clinic visit. Primary care patients have information needs pertaining to diagnosis and treatment, which may be the reason why both patient groups identified Plan and Assessment as important note sections. Future research should also develop and assess an AVS based on the information gathered in this study and evaluate its usefulness among primary care patients. The results of this study can be used to inform the development of an after-visit summary that assists patients to fully understand their treatment plan, which may improve treatment adherence.

  2. De novo unbalanced translocation (4p duplication/8p deletion) in a patient with autism, OCD, and overgrowth syndrome.

    Science.gov (United States)

    Sagar, Angela; Pinto, Dalila; Najjar, Fedra; Guter, Stephen J; Macmillan, Carol; Cook, Edwin H

    2017-06-01

    Chromosomal abnormalities, such as unbalanced translocations and copy number variants (CNVs), are found in autism spectrum disorders (ASDs) [Sanders et al. (2011) Neuron 70: 863-885]. Many chromosomal abnormalities, including sub microscopic genomic deletions and duplications, are missed by G-banded karyotyping or Fragile X screening alone and are picked up by chromosomal microarrays [Shen et al. (2010) Pediatrics 125: e727-735]. Translocations involving chromosomes 4 and 8 are possibly the second most frequent translocation in humans and are often undetected in routine cytogenetics [Giglio et al. (2002) Circulation 102: 432-437]. Deletions of 4p16 have been associated with Wolf-Hirschhorn syndrome while 4p16 duplications have been associated with an overgrowth syndrome and mild to moderate mental retardation [Partington et al. (1997) Journal of Medical Genetics 34: 719-728]. The 8p23.3 region contains the autism candidate gene DLGAP2, which can contribute to autism when disrupted [Marshall et al. (2008) The American Journal of Human Genetics 82: 477-488] . There has been a case report of a family with autism spectrum disorder (ASD), prominent obsessional behavior, and overgrowth in patients with der (8) t (4;8) p (16;23) [Partington et al. (1997)]. This is an independent report of a male patient with autism, obsessive compulsive disorder (OCD), attention-deficit hyperactivity disorder (ADHD), and an overgrowth syndrome, whose de novo unbalanced translocation der (8) t (4;8) p (16.1→ter; 23.1→ter) was initially missed by routine cytogenetics but detected with SNP microarray, allowing higher resolution of translocation breakpoints. © 2017 Wiley Periodicals, Inc.

  3. Telomere healing following DNA polymerase arrest-induced breakages is likely the main mechanism generating chromosome 4p terminal deletions.

    Science.gov (United States)

    Hannes, Femke; Van Houdt, Jeroen; Quarrell, Oliver W; Poot, Martin; Hochstenbach, Ron; Fryns, Jean-Pierre; Vermeesch, Joris R

    2010-12-01

    Constitutional developmental disorders are frequently caused by terminal chromosomal deletions. The mechanisms and/or architectural features that might underlie those chromosome breakages remain largely unexplored. Because telomeres are the vital DNA protein complexes stabilizing linear chromosomes against chromosome degradation, fusion, and incomplete replication, those terminal-deleted chromosomes acquired new telomeres either by telomere healing or by telomere capture. To unravel the mechanisms leading to chromosomal breakage and healing, we sequenced nine chromosome 4p terminal deletion boundaries. A computational analysis of the breakpoint flanking region, including 12 previously published pure terminal breakage sites, was performed in order to identify architectural features that might be involved in this process. All terminal 4p truncations were likely stabilized by telomerase-mediated telomere healing. In the majority of breakpoints multiple genetic elements have a potential to induce secondary structures and an enrichment in replication stalling site motifs were identified. These findings suggest DNA replication stalling-induced chromosome breakage during early development is the first mechanistic step leading toward terminal deletion syndromes. © 2010 Wiley-Liss, Inc.

  4. Identification of the first homozygous 1-bp deletion in GDF9 gene leading to primary ovarian insufficiency by using targeted massively parallel sequencing.

    Science.gov (United States)

    França, M M; Funari, M F A; Nishi, M Y; Narcizo, A M; Domenice, S; Costa, E M F; Lerario, A M; Mendonca, B B

    2018-02-01

    Targeted massively parallel sequencing (TMPS) has been used in genetic diagnosis for Mendelian disorders. In the past few years, the TMPS has identified new and already described genes associated with primary ovarian insufficiency (POI) phenotype. Here, we performed a targeted gene sequencing to find a genetic diagnosis in idiopathic cases of Brazilian POI cohort. A custom SureSelect XT DNA target enrichment panel was designed and the sequencing was performed on Illumina NextSeq sequencer. We identified 1 homozygous 1-bp deletion variant (c.783delC) in the GDF9 gene in 1 patient with POI. The variant was confirmed and segregated using Sanger sequencing. The c.783delC GDF9 variant changed an amino acid creating a premature termination codon (p.Ser262Hisfs*2). This variant was not present in all public databases (ExAC/gnomAD, NHLBI/EVS and 1000Genomes). Moreover, it was absent in 400 alleles from fertile Brazilian women screened by Sanger sequencing. The patient's mother and her unaffected sister carried the c.783delC variant in a heterozygous state, as expected for an autosomal recessive inheritance. Here, the TMPS identified the first homozygous 1-bp deletion variant in GDF9. This finding reveals a novel inheritance pattern of pathogenic variant in GDF9 associated with POI, thus improving the genetic diagnosis of this disorder. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  5. Probabilistic deletion of copies of linearly independent quantum states

    International Nuclear Information System (INIS)

    Feng Jian; Gao Yunfeng; Wang Jisuo; Zhan Mingsheng

    2002-01-01

    We show that each of two copies of the nonorthogonal states randomly selected from a certain set S can be probabilistically deleted by a general unitary-reduction operation if and only if the states are linearly independent. We derive a tight bound on the best possible deleting efficiencies. These results for 2→1 probabilistic deleting are also generalized into the case of N→M deleting (N,M positive integers and N>M)

  6. ATLAS DQ2 Deletion Service

    International Nuclear Information System (INIS)

    Oleynik, Danila; Petrosyan, Artem; Garonne, Vincent; Campana, Simone

    2012-01-01

    The ATLAS Distributed Data Management project DQ2 is responsible for the replication, access and bookkeeping of ATLAS data across more than 100 distributed grid sites. It also enforces data management policies decided on by the collaboration and defined in the ATLAS computing model. The DQ2 Deletion Service is one of the most important DDM services. This distributed service interacts with 3rd party grid middleware and the DQ2 catalogues to serve data deletion requests on the grid. Furthermore, it also takes care of retry strategies, check-pointing transactions, load management and fault tolerance. In this paper special attention is paid to the technical details which are used to achieve the high performance of service, accomplished without overloading either site storage, catalogues or other DQ2 components. Special attention is also paid to the deletion monitoring service that allows operators a detailed view of the working system.

  7. Nucleophosmin (NPM1) gene variants in Egyptian patients with acute myeloid leukemia

    International Nuclear Information System (INIS)

    Ibrahim, G.H.

    2012-01-01

    To the editor Kassem et al. [1] described a novel mutational deletion [del 1178 (A)] in the 30 untranslated region of NPM1 gene detected in a heterozygous form in seven de novo acute myeloid leukemia (AML) patients of their study population. The described nucleotide deletion is an NPM1 gene polymorphism recorded in db SNP database (rs34351976; g28027: Genbank accession number NG 0 16018.1) (http://www.ncbi.nlm.nih.gov/projects/SNP/) and was described previously by Do hner et al. [2] and Chou et al. [3]. This variant accounted for 60-70% of AML patients with normal karyotype [2]. The putative deletion was also identified in healthy volunteers and persisted at complete remission and also at relapse of AML patients [3]. This deletion had no effect on the predicted amino acid sequence and is not in linkage disequilibrium with any previously identified NPM1 mutations [2,3]. Analysis of RNA folding at the region surrounding the rs34351976 in the presence or absence of the deletion using Mfold analysis software (http://www.mfold.rna.albany.edu) revealed no RNA folding change that may alter RNA splicing and subsequently gene expression. Furthermore, splicing motifs analysis using Human Splicing Finder software version 2.4.1 showed that the presence of the deletion does not abolish any recognition site of exonic or intronic enhancers or silencer motifs. In general, it seems that the impact of NMP1 polymorphisms on the molecular pathogenesis of AML is not clear yet and needs further investigation. Kassem et al. [1] describes the molecular aspect of de novo AML in the Egyptian population. The previously known NPM1 mutations mentioned in their study are less frequent compared to the figures recorded worldwide. Moreover, the authors wondered whether the NPM1 variants identified in their patients may confer a better outcome of AML. According to the previously mentioned data, one can speculate that the presence of NPM1 gene polymorphism (rs34351976) should not be mistaken as

  8. Screening for single nucleotide variants, small indels and exon deletions with a next-generation sequencing based gene panel approach for Usher syndrome.

    Science.gov (United States)

    Krawitz, Peter M; Schiska, Daniela; Krüger, Ulrike; Appelt, Sandra; Heinrich, Verena; Parkhomchuk, Dmitri; Timmermann, Bernd; Millan, Jose M; Robinson, Peter N; Mundlos, Stefan; Hecht, Jochen; Gross, Manfred

    2014-09-01

    Usher syndrome is an autosomal recessive disorder characterized both by deafness and blindness. For the three clinical subtypes of Usher syndrome causal mutations in altogether 12 genes and a modifier gene have been identified. Due to the genetic heterogeneity of Usher syndrome, the molecular analysis is predestined for a comprehensive and parallelized analysis of all known genes by next-generation sequencing (NGS) approaches. We describe here the targeted enrichment and deep sequencing for exons of Usher genes and compare the costs and workload of this approach compared to Sanger sequencing. We also present a bioinformatics analysis pipeline that allows us to detect single-nucleotide variants, short insertions and deletions, as well as copy number variations of one or more exons on the same sequence data. Additionally, we present a flexible in silico gene panel for the analysis of sequence variants, in which newly identified genes can easily be included. We applied this approach to a cohort of 44 Usher patients and detected biallelic pathogenic mutations in 35 individuals and monoallelic mutations in eight individuals of our cohort. Thirty-nine of the sequence variants, including two heterozygous deletions comprising several exons of USH2A, have not been reported so far. Our NGS-based approach allowed us to assess single-nucleotide variants, small indels, and whole exon deletions in a single test. The described diagnostic approach is fast and cost-effective with a high molecular diagnostic yield.

  9. APOBEC3A is an oral cancer prognostic biomarker in Taiwanese carriers of an APOBEC deletion polymorphism.

    Science.gov (United States)

    Chen, Ting-Wen; Lee, Chi-Ching; Liu, Hsuan; Wu, Chi-Sheng; Pickering, Curtis R; Huang, Po-Jung; Wang, Jing; Chang, Ian Yi-Feng; Yeh, Yuan-Ming; Chen, Chih-De; Li, Hsin-Pai; Luo, Ji-Dung; Tan, Bertrand Chin-Ming; Chan, Timothy En Haw; Hsueh, Chuen; Chu, Lichieh Julie; Chen, Yi-Ting; Zhang, Bing; Yang, Chia-Yu; Wu, Chih-Ching; Hsu, Chia-Wei; See, Lai-Chu; Tang, Petrus; Yu, Jau-Song; Liao, Wei-Chao; Chiang, Wei-Fan; Rodriguez, Henry; Myers, Jeffrey N; Chang, Kai-Ping; Chang, Yu-Sun

    2017-09-06

    Oral squamous cell carcinoma is a prominent cancer worldwide, particularly in Taiwan. By integrating omics analyses in 50 matched samples, we uncover in Taiwanese patients a predominant mutation signature associated with cytidine deaminase APOBEC, which correlates with the upregulation of APOBEC3A expression in the APOBEC3 gene cluster at 22q13. APOBEC3A expression is significantly higher in tumors carrying APOBEC3B-deletion allele(s). High-level APOBEC3A expression is associated with better overall survival, especially among patients carrying APOBEC3B-deletion alleles, as examined in a second cohort (n = 188; p = 0.004). The frequency of APOBEC3B-deletion alleles is ~50% in 143 genotyped oral squamous cell carcinoma -Taiwan samples (27A3B -/- :89A3B +/- :27A3B +/+ ), compared to the 5.8% found in 314 OSCC-TCGA samples. We thus report a frequent APOBEC mutational profile, which relates to a APOBEC3B-deletion germline polymorphism in Taiwanese oral squamous cell carcinoma that impacts expression of APOBEC3A, and is shown to be of clinical prognostic relevance. Our finding might be recapitulated by genomic studies in other cancer types.Oral squamous cell carcinoma is a prevalent malignancy in Taiwan. Here, the authors show that OSCC in Taiwanese show a frequent deletion polymorphism in the cytidine deaminases gene cluster APOBEC3 resulting in increased expression of A3A, which is shown to be of clinical prognostic relevance.

  10. Two novel types of contiguous gene deletion of the AVPR2 and ARHGAP4 genes in unrelated Japanese kindreds with nephrogenic diabetes insipidus.

    Science.gov (United States)

    Demura, Masashi; Takeda, Yoshiyu; Yoneda, Takashi; Furukawa, Kenji; Usukura, Mikiya; Itoh, Yuji; Mabuchi, Hiroshi

    2002-01-01

    Study of two families containing individuals with nephrogenic diabetes insipidus (NDI) indicated different types of 21.3 kb and 26.3 kb deletions involving the AVPR2 and ARHGAP4 (RhoGAP C1) genes. In the case of the 21.3 kb deletion, the deletion consensus motif (5'-TGAAGG-3') and polypurine runs, known as the arrest site of polymerase alpha, were detected in the vicinity of the deletion junction. Inverted repeats (7/8 matches), believed to potentiate DNA loop formation, flank the deletion breakpoint. We propose this deletion to be the result of slipped mispairing during DNA replication. In the case of the 26.3 kb deletion, the 12,945 bp inverted region with the 10,003 bp internal deletion was accompanied with the 2,509 bp deletion in the 5'-side and the 13,785 bp deletion in the 3'-side. We defined three deletion junctions in this rearrangement (DJ1, DJ2, and DJ3) from the 5'-side. The surrounding sequence of DJ1 (5'-CCC-3') closely resembled that of DJ3 (5'-AGGG-3') (DJ1; 5'-cCCCgaggg-3', DJ3; 5'-ccccAGGG-3'), and DJ1 was located in the 5'-side of DJ3 without any overlapping in sequence. The immunoglobulin class switch (ICS) motif (5'-TGGGG-3') was found around the complementary sequence of DJ3. There was a 10-base palindrome (5'-aGACAtgtct-3') in the alignment of the DJ2 (5'-GACA-3') region. From these findings, we propose a novel mutation process with the rearrangement probably resulting from stem-loop induced non-homologous recombination in an ICS-like fashion. Both patients, despite lacking ARHGAP4, had no morphological, clinical, or laboratory abnormalities except for those usually found in patients with NDI. Copyright 2001 Wiley-Liss, Inc.

  11. Refinement of the critical 2p25.3 deletion region: the role of MYT1L in intellectual disability and obesity.

    Science.gov (United States)

    De Rocker, Nina; Vergult, Sarah; Koolen, David; Jacobs, Eva; Hoischen, Alexander; Zeesman, Susan; Bang, Birgitte; Béna, Frédérique; Bockaert, Nele; Bongers, Ernie M; de Ravel, Thomy; Devriendt, Koenraad; Giglio, Sabrina; Faivre, Laurence; Joss, Shelagh; Maas, Saskia; Marle, Nathalie; Novara, Francesca; Nowaczyk, Malgorzata J M; Peeters, Hilde; Polstra, Abeltje; Roelens, Filip; Rosenberg, Carla; Thevenon, Julien; Tümer, Zeynep; Vanhauwaert, Suzanne; Varvagiannis, Konstantinos; Willaert, Andy; Willemsen, Marjolein; Willems, Marjolaine; Zuffardi, Orsetta; Coucke, Paul; Speleman, Frank; Eichler, Evan E; Kleefstra, Tjitske; Menten, Björn

    2015-06-01

    Submicroscopic deletions of chromosome band 2p25.3 are associated with intellectual disability and/or central obesity. Although MYT1L is believed to be a critical gene responsible for intellectual disability, so far no unequivocal data have confirmed this hypothesis. In this study we evaluated a cohort of 22 patients (15 sporadic patients and two families) with a 2p25.3 aberration to further refine the clinical phenotype and to delineate the role of MYT1L in intellectual disability and obesity. In addition, myt1l spatiotemporal expression in zebrafish embryos was analyzed by quantitative polymerase chain reaction and whole-mount in situ hybridization. Complete MYT1L deletion, intragenic deletion, or duplication was observed in all sporadic patients, in addition to two patients with a de novo point mutation in MYT1L. The familial cases comprise a 6-Mb deletion in a father and his three children and a 5' MYT1L overlapping duplication in a father and his two children. Expression analysis in zebrafish embryos shows specific myt1l expression in the developing brain. Our data strongly strengthen the hypothesis that MYT1L is the causal gene for the observed syndromal intellectual disability. Moreover, because 17 patients present with obesity/overweight, haploinsufficiency of MYT1L might predispose to weight problems with childhood onset.Genet Med 17 6, 460-466.

  12. Intranasal insulin to improve developmental delay in children with 22q13 deletion syndrome: an exploratory clinical trial.

    Science.gov (United States)

    Schmidt, H; Kern, W; Giese, R; Hallschmid, M; Enders, A

    2009-04-01

    The 22q13 deletion syndrome (Phelan-McDermid syndrome) is characterised by a global developmental delay, absent or delayed speech, generalised hypotonia, autistic behaviour and characteristic phenotypic features. Intranasal insulin has been shown to improve declarative memory in healthy adult subjects and in patients with Alzheimer disease. To assess if intranasal insulin is also able to improve the developmental delay in children with 22q13 deletion syndrome. We performed exploratory clinical trials in six children with 22q13 deletion syndrome who received intranasal insulin over a period of 1 year. Short-term (during the first 6 weeks) and long-term effects (after 12 months of treatment) on motor skills, cognitive functions, or autonomous functions, speech and communication, emotional state, social behaviour, behavioural disorders, independence in daily living and education were assessed. The children showed marked short-term improvements in gross and fine motor activities, cognitive functions and educational level. Positive long-term effects were found for fine and gross motor activities, nonverbal communication, cognitive functions and autonomy. Possible side effects were found in one patient who displayed changes in balance, extreme sensitivity to touch and general loss of interest. One patient complained of intermittent nose bleeding. We conclude that long-term administration of intranasal insulin may benefit motor development, cognitive functions and spontaneous activity in children with 22q13 deletion syndrome.

  13. Localization of the endpoints of deletions in the 5' region of the Duchenne gene using a sequence isolated by chromosome jumping

    Energy Technology Data Exchange (ETDEWEB)

    Kenwrick, S J; Smith, T J; England, S; Collins, F; Davies, K E

    1988-02-25

    The authors have used chromosome jumping technology to move from within a large intron sequence in the Duchenne muscular dystrophy (DMD) gene to a region adjacent to exons of the gene. The single copy jump clone, HH1, was used to characterize deletions in patients previously shown to be deleted for DNA markers in the 5' end of the gene. 12 out of 15 such patients have breakpoints which lie between HH1 and the genomic locus J-47. Thus the vast majority of the deletions in these patients have proximal breakpoints in a similar region distal to the 5'end of the gene. HH1 was mapped with respect to the X;1 translocation in a DMD female and was shown to lie at least 80 kb from the starting point of the chromosome jump, HIP25.

  14. 75 FR 56995 - Procurement List Proposed Additions and Deletion

    Science.gov (United States)

    2010-09-17

    ... Additions and Deletion AGENCY: Committee for Purchase From People Who Are Blind or Severely Disabled. ACTION: Proposed Additions to and Deletion From the Procurement List. SUMMARY: The Committee is proposing to add... aggregated by the Defense Logistics Agency Troop Support, Philadelphia, PA. Deletion Regulatory Flexibility...

  15. 76 FR 60810 - Procurement List; Proposed Additions and Deletion

    Science.gov (United States)

    2011-09-30

    ... Additions and Deletion AGENCY: Committee for Purchase From People Who Are Blind or Severely Disabled. ACTION: Proposed Additions to and Deletion from the Procurement List. SUMMARY: The Committee is proposing to add... Activity: Department of Energy, Idaho Operations Office, Idaho Falls, ID. DELETION Regulatory Flexibility...

  16. Are there ethnic differences in deletions in the dystrophin gene?

    Energy Technology Data Exchange (ETDEWEB)

    Banerjee, M.; Verma, I.C. [All India Inst. of Medical Sciences, New Delhi (India)

    1997-01-20

    We studied 160 cases of Duchenne muscular dystrophy (DMD) drawn from all parts of India, using multiplex PCR of 27 exons. Of these, 103 (64.4%) showed intragenic deletions. Most (69.7%) of the deletions involved exons 45-51. The phenotype of cases with deletion of single exons did not differ significantly from those with deletion of multiple exons. The distribution of deletions in studies from different countries was variable, but this was accounted for either by the small number of cases studied, or by fewer exons analyzed. It is concluded that there is likely to be no ethnic difference with respect to deletions in the DMD gene. 38 refs., 2 figs., 3 tabs.

  17. Homozygous deletion of the α- and β1-interferon genes in human leukemia and derived cell lines

    International Nuclear Information System (INIS)

    Diaz, M.O.; Ziemin, S.; Le Beau, M.M.; Pitha, P.; Smith, S.D.; Chilcote, R.R.; Rowley, J.D.

    1988-01-01

    The loss of bands p21-22 from one chromosome 9 homologue as a consequence of a deletion of the short arm [del(9p)], unbalanced translocation, or monosomy 9 is frequently observed in the malignant cells of patients with lymphoid neoplasias, including acute lymphoblastic leukemia and non-Hodgkin lymphoma. The α- and β 1 -interferon genes have been assigned to this chromosome region (9p21-22). The authors now present evidence of the homozygous deletion of the interferon genes in neoplastic hematopoietic cell lines and primary leukemia cells in the presence or absence of chromosomal deletions that are detectable at the level of the light microscope. In these cell lines, the deletion of the interferon genes is accompanied by a deficiency of 5'-methylthioadenosine phosphorylase, an enzyme of purine metabolism. These homozygous deletions may be associated with the loss of a tumor-suppressor gene that is involved in the development of these neoplasias. The relevant genes may be either the interferon genes themselves or a gene that has a tumor-suppressor function and is closely linked to them

  18. RCSD1-ABL1 Translocation Associated with IKZF1 Gene Deletion in B-Cell Acute Lymphoblastic Leukemia

    Directory of Open Access Journals (Sweden)

    Shawana Kamran

    2015-01-01

    Full Text Available The RCSD1 gene has recently been identified as a novel gene fusion partner of the ABL1 gene in cases of B-cell Acute Lymphoblastic Leukemia (B-ALL. The RCSD1 gene is located at 1q23 and ABL1 is located at 9q34, so that the RCSD1-ABL1 fusion typically arises through a rare reciprocal translocation t(1;9(q23;q34. Only a small number of RCSD1-ABL1 positive cases of B-ALL have been described in the literature, and the full spectrum of clinical, morphological, immunophenotypic, and molecular features associated with this genetic abnormality has not been defined. We describe extensive genetic characterization of a case of B-ALL with RCSD1-ABL1 fusion, by using conventional cytogenetic analysis, Fluorescence In Situ Hybridization (FISH studies, and Chromosomal Microarray Analysis (CMA. The use of CMA resulted in detection of an approximately 70 kb deletion at 7p12.2, which caused a disruption of the IKZF1 gene. Deletions and mutations of IKZF1 are recurring abnormalities in B-ALL and are associated with a poor prognosis. Our findings highlight the association of the deletion of IKZF1 gene with the t(1;9(q24;q34 and illustrate the importance of comprehensive cytogenetic and molecular evaluation for accurate prediction of prognosis in patients with B-cell ALL.

  19. The significance of chromosome deletions in atomic-bomb survivors

    International Nuclear Information System (INIS)

    Tanaka, Kimio; Shigeta, Chiharu; Oguma, Nobuo; Kamada, Nanao; Deng, Z.; Niimi, Masanobu; Aisaka, Tadaichi.

    1986-01-01

    In 39 A-bomb survivors 40 years after exposure at ≤ 1,000 m from ground zero, the frequency and features of chromosome deletions in peripheral lymphocytes were examined using a differential staining technique. Simultaneously, in vitro irradiation experiment with Cf-252 was made to infer chromosome aberrations occuring immediately after exposure. Californium-252 with 100 rad induced dicentric and ring chromosomes in 40 % of the cells and acentric fragments in 44 %. Among the A-bomb survivors, chromosome aberrations were observed in 651 (21 %) of the total 3,136 cells. There were 146 cells with deletions (22 % of abnormal cells; 5 % of the total cells), and 10 cells with acentric fragment (0.3 % of the total cells). The figure for deletions was far higher than that reported in the literature. A large number of deletions were seen in chromosomes no.4, no.21, and no.22, and a few deletions in chromosomes no.7 and no.20. Significance of chromosome deletions is discussed. (Namekawa, K.)

  20. Reduced plasma levels of angiotensin-(1-7 and renin activity in preeclamptic patients are associated with the angiotensin I- converting enzyme deletion/deletion genotype

    Directory of Open Access Journals (Sweden)

    E.P. Velloso

    2007-04-01

    Full Text Available The relationship between preeclampsia and the renin-angiotensin system (RAS is poorly understood. Angiotensin I-converting enzyme (ACE is a key RAS component and plays an important role in blood pressure homeostasis by generating angiotensin II (Ang II and inactivating the vasodilator angiotensin-(1-7 (Ang-(1-7. ACE (I/D polymorphism is characterized by the insertion (I or deletion (D of a 287-bp fragment, leading to changes in ACE activity. In the present study, ACE (I/D polymorphism was correlated with plasma Ang-(1-7 levels and several RAS components in both preeclamptic (N = 20 and normotensive pregnant women (N = 20. The percentage of the ACE DD genotype (60% in the preeclamptic group was higher than that for the control group (35%; however, this percentage was not statistically significant (Fisher exact test = 2.86, d.f. = 2, P = 0.260. The highest plasma ACE activity was observed in the ACE DD preeclamptic women (58.1 ± 5.06 vs 27.6 ± 3.25 nmol Hip-His Leu-1 min-1 mL-1 in DD control patients; P = 0.0005. Plasma renin activity was markedly reduced in preeclampsia (0.81 ± 0.2 vs 3.43 ± 0.8 ng Ang I mL plasma-1 h-1 in DD normotensive patients; P = 0.0012. A reduced plasma level of Ang-(1-7 was also observed in preeclamptic women (15.6 ± 1.3 vs 22.7 ± 2.5 pg/mL in the DD control group; P = 0.0146. In contrast, plasma Ang II levels were unchanged in preeclamptic patients. The selective changes in the RAS described in the present study suggest that the ACE DD genotype may be used as a marker for susceptibility to preeclampsia.

  1. Reduced plasma levels of angiotensin-(1-7 and renin activity in preeclamptic patients are associated with the angiotensin I- converting enzyme deletion/deletion genotype

    Directory of Open Access Journals (Sweden)

    E.P. Velloso

    Full Text Available The relationship between preeclampsia and the renin-angiotensin system (RAS is poorly understood. Angiotensin I-converting enzyme (ACE is a key RAS component and plays an important role in blood pressure homeostasis by generating angiotensin II (Ang II and inactivating the vasodilator angiotensin-(1-7 (Ang-(1-7. ACE (I/D polymorphism is characterized by the insertion (I or deletion (D of a 287-bp fragment, leading to changes in ACE activity. In the present study, ACE (I/D polymorphism was correlated with plasma Ang-(1-7 levels and several RAS components in both preeclamptic (N = 20 and normotensive pregnant women (N = 20. The percentage of the ACE DD genotype (60% in the preeclamptic group was higher than that for the control group (35%; however, this percentage was not statistically significant (Fisher exact test = 2.86, d.f. = 2, P = 0.260. The highest plasma ACE activity was observed in the ACE DD preeclamptic women (58.1 ± 5.06 vs 27.6 ± 3.25 nmol Hip-His Leu-1 min-1 mL-1 in DD control patients; P = 0.0005. Plasma renin activity was markedly reduced in preeclampsia (0.81 ± 0.2 vs 3.43 ± 0.8 ng Ang I mL plasma-1 h-1 in DD normotensive patients; P = 0.0012. A reduced plasma level of Ang-(1-7 was also observed in preeclamptic women (15.6 ± 1.3 vs 22.7 ± 2.5 pg/mL in the DD control group; P = 0.0146. In contrast, plasma Ang II levels were unchanged in preeclamptic patients. The selective changes in the RAS described in the present study suggest that the ACE DD genotype may be used as a marker for susceptibility to preeclampsia.

  2. Altered ultrasonic vocalization and impaired learning and memory in Angelman syndrome mouse model with a large maternal deletion from Ube3a to Gabrb3.

    Directory of Open Access Journals (Sweden)

    Yong-Hui Jiang

    2010-08-01

    Full Text Available Angelman syndrome (AS is a neurobehavioral disorder associated with mental retardation, absence of language development, characteristic electroencephalography (EEG abnormalities and epilepsy, happy disposition, movement or balance disorders, and autistic behaviors. The molecular defects underlying AS are heterogeneous, including large maternal deletions of chromosome 15q11-q13 (70%, paternal uniparental disomy (UPD of chromosome 15 (5%, imprinting mutations (rare, and mutations in the E6-AP ubiquitin ligase gene UBE3A (15%. Although patients with UBE3A mutations have a wide spectrum of neurological phenotypes, their features are usually milder than AS patients with deletions of 15q11-q13. Using a chromosomal engineering strategy, we generated mutant mice with a 1.6-Mb chromosomal deletion from Ube3a to Gabrb3, which inactivated the Ube3a and Gabrb3 genes and deleted the Atp10a gene. Homozygous deletion mutant mice died in the perinatal period due to a cleft palate resulting from the null mutation in Gabrb3 gene. Mice with a maternal deletion (m-/p+ were viable and did not have any obvious developmental defects. Expression analysis of the maternal and paternal deletion mice confirmed that the Ube3a gene is maternally expressed in brain, and showed that the Atp10a and Gabrb3 genes are biallelically expressed in all brain sub-regions studied. Maternal (m-/p+, but not paternal (m+/p-, deletion mice had increased spontaneous seizure activity and abnormal EEG. Extensive behavioral analyses revealed significant impairment in motor function, learning and memory tasks, and anxiety-related measures assayed in the light-dark box in maternal deletion but not paternal deletion mice. Ultrasonic vocalization (USV recording in newborns revealed that maternal deletion pups emitted significantly more USVs than wild-type littermates. The increased USV in maternal deletion mice suggests abnormal signaling behavior between mothers and pups that may reflect abnormal

  3. 75 FR 7450 - Procurement List: Proposed Addition and Deletion

    Science.gov (United States)

    2010-02-19

    ... Addition and Deletion AGENCY: Committee for Purchase From People Who Are Blind or Severely Disabled. ACTION: Proposed addition to and deletion from Procurement List. SUMMARY: The Committee is proposing to add to the... W6BA ACA, FT CARSON, COLORADO. Deletion Regulatory Flexibility Act Certification I certify that the...

  4. 77 FR 20795 - Procurement List Proposed Addition and Deletion

    Science.gov (United States)

    2012-04-06

    ... Addition and Deletion AGENCY: Committee for Purchase From People Who Are Blind or Severely Disabled. ACTION: Proposed Addition to and Deletion from the Procurement List. SUMMARY: The Committee is proposing to add a.... Deletion Regulatory Flexibility Act Certification I certify that the following action will not have a...

  5. Detailed clinical and molecular study of 20 females with Xq deletions with special reference to menstruation and fertility.

    Science.gov (United States)

    Mercer, Catherine L; Lachlan, Katherine; Karcanias, Alexandra; Affara, Nabeel; Huang, Shuwen; Jacobs, Patricia A; Thomas, N Simon

    2013-01-01

    Integrity of the long arm of the X chromosome is important for maintaining female fertility and several critical regions for normal ovarian function have been proposed. In order to understand further the importance of specific areas of the X chromosome, we describe a series of 20 previously unreported patients missing part of Xq in whom detailed phenotypic information has been gathered as well as precise chromosome mapping using array Comparative Genomic Hybridization. Features often associated with Turner syndrome were not common in our study and excluding puberty, menarche and menstruation, the phenotypes observed were present in only a minority of women and were not specific to the X chromosome. The most frequently occurring phenotypic features in our patients were abnormalities of menstruation and fertility. Larger terminal deletions were associated with a higher incidence of primary ovarian failure, occurring at a younger age; however patients with similar or even identical deletions had discordant menstrual phenotypes, making accurate genetic counselling difficult. Nevertheless, large deletions are likely to be associated with complete skewing of X inactivation so that the resulting phenotypes are relatively benign given the amount of genetic material missing, even in cases with unbalanced X;autosome translocations. Some degree of ovarian dysfunction is highly likely, especially for terminal deletions extending proximal to Xq27. In conjunction with patient data from the literature, our study suggests that loss of Xq26-Xq28 has the most significant effect on ovarian function. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

  6. Physical mapping of chromosome 8p22 markers and their homozygous deletion in a metastatic prostate cancer

    Energy Technology Data Exchange (ETDEWEB)

    Bova, G.S.; Pin, S.S.; Isaacs, W.B. [Johns Hopkins Univ. School of Medicine, Baltimore, MD (United States)]|[Brady Urological Institute, Baltimore, MD (United States)] [and others

    1996-07-01

    Numerous studies have implicated the short arm of chromosome 8 as the site of one or more tumor suppressor genes inactivated in carcinogenesis of the prostate, colon, lung, and liver. Previously, we identified a homozygous deletion on chromosome 8p22 in a metastatic prostate cancer. To map this homozygous deletion physically, long-range restriction mapping was performed using yeast artificial chromosomes (YACs) spanning approximately 2 Mb of chromosome band 8p22. Subcloned genomic DNA and cDNA probes isolated by hybrid capture from these YACs were mapped in relation to one another, reinforcing map integrity. Mapped single-copy probes from the region were then applied to DNA isolated from a metastatic prostate cancer containing a chromosome 8p22 homozygous deletion and indicated that its deletion spans 730-970 kb. Candidate genes PRLTS (PDGF-receptor {beta}-like tumor suppressor) and CTSB (cathepsin B) are located outside the region of homozygous deletion. Genethon marker D8S549 is located approximately at the center of this region of homozygous deletion. Two new microsatellite polymorphisms, D8S1991 and D8S1992, also located within the region of homozygous deletion on chromosome 8p22, are described. Physical mapping places cosmid CI8-2644 telomeric to MSR (macrophage scavenger receptor), the reverse of a previously published map, altering the interpretation of published deletion studies. This work should prove helpful in the identification of candidate tumor suppressor genes in this region. 47 refs., 5 figs., 1 tab.

  7. Detection of large scale 3' deletions in the PMS2 gene amongst Colon-CFR participants: have we been missing anything?

    Science.gov (United States)

    Clendenning, Mark; Walsh, Michael D; Gelpi, Judith Balmana; Thibodeau, Stephen N; Lindor, Noralane; Potter, John D; Newcomb, Polly; LeMarchand, Loic; Haile, Robert; Gallinger, Steve; Hopper, John L; Jenkins, Mark A; Rosty, Christophe; Young, Joanne P; Buchanan, Daniel D

    2013-09-01

    Current screening practices have been able to identify PMS2 mutations in 78 % of cases of colorectal cancer from the Colorectal Cancer Family Registry (Colon CFR) which showed solitary loss of the PMS2 protein. However the detection of large-scale deletions in the 3' end of the PMS2 gene has not been possible due to technical difficulties associated with pseudogene sequences. Here, we utilised a recently described MLPA/long-range PCR-based approach to screen the remaining 22 % (n = 16) of CRC-affected probands for mutations in the 3' end of the PMS2 gene. No deletions encompassing any or all of exons 12 through 15 were identified; therefore, our results suggest that 3' deletions in PMS2 are not a frequent occurrence in such families.

  8. Velo-Cardio-Facial syndrome and DiGeorge sequence with meningomyelocele and deletions of the 22q11 region

    Energy Technology Data Exchange (ETDEWEB)

    Nickel, R.E.; Pillers, D.M.; Merkens, M.; Magenis, R.E.; Zonana, J. [Oregon Health Sciences Univ., Portland, OR (United States); Driscoll, D.A.; Emanuel, B.S. [Univ. of Pennsylvania Medical Center, Philadelphia, PA (United States)

    1994-10-01

    Approximately 5% of children with neural tube defects (NTDs) have a congenital heart defect and/or cleft lip and palate. The cause of isolated meningomyelocele, congenital heart defects, or cleft lip and palate has been largely thought to be multifactorial. However, chromosomal, teratogenic, and single gene causes of combinations of NTDs with congenital heart defects and/or cleft lip and palate have been reported. We report on 3 patients with meningomyelocele, congenital heart defects, and 22q11 deletions. Two of the children had the clinical diagnosis of velo-cardio-facial syndrome (VCFS); both have bifid uvula. The third child had DiGeorge sequence (DGS). The association of NTDs with 22q11 deletion has not been reported previously. An accurate diagnosis of the 22q11 deletion is critical as this micro-deletion and its associated clinical problems is transmitted as an autosomal dominant trait due to the inheritance of the deletion-bearing chromosome. We recommend that all children with NTDs and congenital heart defects, with or without cleft palate, have cytogenetic and molecular studies performed to detect 22q11 deletions. 31 refs., 3 figs.

  9. Mitochondrial DNA deletion mutations in adult mouse cardiac side population cells

    International Nuclear Information System (INIS)

    Lushaj, Entela B.; Lozonschi, Lucian; Barnes, Maria; Anstadt, Emily; Kohmoto, Takushi

    2012-01-01

    We investigated the presence and potential role of mitochondrial DNA (mtDNA) deletion mutations in adult cardiac stem cells. Cardiac side population (SP) cells were isolated from 12-week-old mice. Standard polymerase chain reaction (PCR) was used to screen for the presence of mtDNA deletion mutations in (a) freshly isolated SP cells and (b) SP cells cultured to passage 10. When present, the abundance of mtDNA deletion mutation was analyzed in single cell colonies. The effect of different levels of deletion mutations on SP cell growth and differentiation was determined. MtDNA deletion mutations were found in both freshly isolated and cultured cells from 12-week-old mice. While there was no significant difference in the number of single cell colonies with mtDNA deletion mutations from any of the groups mentioned above, the abundance of mtDNA deletion mutations was significantly higher in the cultured cells, as determined by quantitative PCR. Within a single clonal cell population, the detectable mtDNA deletion mutations were the same in all cells and unique when compared to deletions of other colonies. We also found that cells harboring high levels of mtDNA deletion mutations (i.e. where deleted mtDNA comprised more than 60% of total mtDNA) had slower proliferation rates and decreased differentiation capacities. Screening cultured adult stem cells for mtDNA deletion mutations as a routine assessment will benefit the biomedical application of adult stem cells.

  10. Deletions of a differentially methylated CpG island at SNRPN define a putative imprinting control region

    Energy Technology Data Exchange (ETDEWEB)

    Sutcliffe, J.S.,; Nakao, M.; Beaudet, A.L. [Baylor College of Medicine, Houston, TX (United States)] [and others

    1994-09-01

    Prader-Willi syndrome (PWS) and Angelman syndrome (AS) are associated with paternal and maternal deficiencies, respectively, of gene expression within human chromosome 15q11-q13, and are caused by deletion, uniparental disomy, or other mutations. Four transcripts designated PAR-5, PAR-7, PAR-1 and PAR-4 were isolated and localized to a region within 300 kb telomeric to the gene encoding small nuclear ribonucleoprotein-associated polypeptide N (SNRPN). Analysis of the transcripts in cultured fibroblasts and lymphoblasts from deletion patients demonstrated that SNRPN, PAR-5 and PAR-1 are expressed exclusively from the paternal chromosome, defining an imprinted domain that spans at least 200 kb. All three imprinted transcripts were absent in cells from three PWS patients (one pair of sibs and one sporadic case) with small deletions that involve a differentially methylated CpG island containing a previously undescribed 5{prime} untranslated exon ({alpha}) of SNRPN. Methylation of the CpG island is specific for the maternal chromosome consistent with paternal expression of the imprinted domain. One deletion, which is benign when maternally transmitted, extends upstream <30 kb from the CpG island, and is associated with altered methylation centromeric to SNRPN, and loss of transcription telomeric to SNRPN, implying the presence of an imprinting control region around the CpG island containing exon {alpha}.

  11. Expansion of the clinical phenotype of the distal 10q26.3 deletion syndrome to include ataxia and hyperemia of the hands and feet.

    Science.gov (United States)

    Lacaria, Melanie; Srour, Myriam; Michaud, Jacques L; Doja, Asif; Miller, Elka; Schwartzentruber, Jeremy; Goldsmith, Claire; Majewski, Jacek; Boycott, Kym M

    2017-06-01

    Distal deletion of the long arm of chromosome 10 is associated with a dysmorphic craniofacial appearance, microcephaly, behavioral issues, developmental delay, intellectual disability, and ocular, urogenital, and limb abnormalities. Herein, we present clinical, molecular, and cytogenetic investigations of four patients, including two siblings, with nearly identical terminal deletions of 10q26.3, all of whom have an atypical presentation of this syndrome. Their prominent features include ataxia, mild-to-moderate intellectual disability, and hyperemia of the hands and feet, and they do not display many of the other features commonly associated with deletions of this region. These results point to a novel gene locus associated with ataxia and highlight the variability of the clinical presentation of patients with deletions of this region. © 2017 Wiley Periodicals, Inc.

  12. Insertion/Deletion Polymorphisms and Serum Angiotensin-converting Enzyme Levels in Iranian Patients with Sarcoidosis

    Science.gov (United States)

    JAVADI, Alireza; SHAMAEI, Masoud; ZAREI, Masoud; REZAEIAN, Lida; KIANI, Arda; ABEDINI, Atefeh

    2016-01-01

    Background: Sarcoidosis is a multisystem inflammatory disease of unknown origin with characterization of small granulomas. Angiotensin-converting enzyme (ACE) is a pathophysiologic marker of sarcoidosis. We present the ACE insertion/deletion (I/D) polymorphism in correlation with serum ACE level in Iranian patients with sarcoidosis. Methods: From Jan 2014 to Jan 2015, 102 Iranian patients who histopathologically diagnosed for sarcoidosis and 192 healthy age and sex-matched controls were recruited. PCR was used for detection of I/D polymorphism in ACE gene. Results: Frequency of II/ID/DD genotype in sarcoidosis disease was 17%, 35.5%, and 47.1%, respectively. The frequency of D allele was 0.65. A significant association between I/D genotypes and mean of sACE level was seen (DD=85.2±22.9, P<0.001). More frequent genotype in sarcoidosis patients was DD (47%), ID genotype (45.9%) was found more in controls. Logistic regression analysis adjusting age and sex showed that ID to II (OR=0.35, 95%CI=0.17–0.73, P=0.005) and DD to II (OR=2.11, 95%CI=0.98–4.54, P=0.05) could be considered as a predictor factor for the disease activity. No significant model for men in sarcoidosis group was seen, while women with II/ID were associated with a reduced risk for the disease. Conclusion: Although more regional studies with appropriate statistical scale must be done to provide a better diagnosis and prognostic tool for this disease, this study demonstrates that ID and DD genotype could be predictive factors for sarcoidosis. PMID:28032065

  13. VIP Gene Deletion in Mice Causes Cardiomyopathy Associated with Upregulation of Heart Failure Genes

    Energy Technology Data Exchange (ETDEWEB)

    Szema, Anthony M.; Hamidi, Sayyed A.; Smith, S. David; Benveniste, Helene; Katare, Rajesh Gopalrao

    2013-05-20

    Vasoactive Intestinal Peptide (VIP), a pulmonary vasodilator and inhibitor of vascular smooth muscle proliferation, is absent in pulmonary arteries of patients with idiopathic pulmonary arterial hypertension (PAH). We previously determined that targeted deletion of the VIP gene in mice leads to PAH with pulmonary vascular remodeling and right ventricular (RV) dilatation. Whether the left ventricle is also affected by VIP gene deletion is unknown. In the current study, we examined if VIP knockout mice (VIP-/-) develop both right (RV) and left ventricular (LV) cardiomyopathy, manifested by LV dilatation and systolic dysfunction, as well as overexpression of genes conducive to heart failure.

  14. P450XXI (steroid 21-hydroxylase) gene deletions are not found in family studies of congenital adrenal hyperplasia

    International Nuclear Information System (INIS)

    Matteson, K.J.; Phillips, J.A. III; Miller, W.L.; Chung, B.C.; Orlando, P.J.; Frisch, H.; Ferrandez, A.; Burr, I.M.

    1987-01-01

    Congenital adrenal hyperplasia (CAH) is a common genetic disorder due to defective 21-hydroxylation of steroid hormones. The human P450XXIA2 gene encodes cytochrome P450c21 [steroid 21-monooxygenase (steroid 21-hydroxylase)], which mediates 21-hydroxylation. The P450XXIA2 gene may be distinguished from the duplicated P450XXIA1 pseudogene by cleavage with the restriction endonuclease Taq I, with the XXIA2 gene characterized by a 3.7-kilobase (kb) fragment and the XXIA1 pseudogene characterized by a 3.2-kb fragment. Restriction endonuclease mapping by several laboratories has suggested that deletion of the P450XXIA2 gene occurs in about 25% of patients with CAH, as their genomic DNA lacks detectable 3.7-kb Taq I fragments. The authors have cloned human P450c21 cDNA and used it to study genomic DNA prepared from 51 persons in 10 families, each of which includes 2 or more persons with CAH. After Taq I digestion, apparent deletions are seen in 7 of the 20 alleles of the probands; using EcoRI, apparent deletions are seen in 9 of the 20 alleles. However, the apparently deleted alleles seen with Taq I do not coincide with those seen with EcoRI. Furthermore, studies with Bgl II, EcoRI, Kpn I, and Xba I yield normal patterns with at least two enzymes in all cases. Since all probands yielded normal patterns with at least two of the five enzymes used, they conclude that the P450XXIA2 gene deletions widely reported in CAH patients probably represent gene conversions, unequal crossovers,or polymorphisms rather than simple gene deletions

  15. Sex-Specific Protection of Osteoarthritis by Deleting Cartilage Acid Protein 1.

    Science.gov (United States)

    Ge, Xianpeng; Ritter, Susan Y; Tsang, Kelly; Shi, Ruirui; Takei, Kohtaro; Aliprantis, Antonios O

    2016-01-01

    Cartilage acidic protein 1 (CRTAC1) was recently identified as an elevated protein in the synovial fluid of patients with osteoarthritis (OA) by a proteomic analysis. This gene is also upregulated in both human and mouse OA by transcriptomic analysis. The objective of this study was to characterize the expression and function of CRTAC1 in OA. Here, we first confirm the increase of CRTAC1 in cartilage biopsies from OA patients undergoing joint replacement by real-time PCR and immunohistochemistry. Furthermore, we report that proinflammatory cytokines interleukin-1beta and tumor necrosis factor alpha upregulate CRTAC1 expression in primary human articular chondrocytes and synovial fibroblasts. Genetic deletion of Crtac1 in mice significantly inhibited cartilage degradation, osteophyte formation and gait abnormalities of post-traumatic OA in female, but not male, animals undergoing the destabilization of medial meniscus (DMM) surgery. Taken together, CRTAC1 is upregulated in the osteoarthritic joint and directly induced in chondrocytes and synovial fibroblasts by pro-inflammatory cytokines. This molecule is necessary for the progression of OA in female mice after DMM surgery and thus represents a potential therapy for this prevalent disease, especially for women who demonstrate higher rates and more severe OA.

  16. Localization of the endpoints of deletions in the 5' region of the Duchenne gene using a sequence isolated by chromosome jumping

    Energy Technology Data Exchange (ETDEWEB)

    Kenwrick, S.J.; Smith, T.J.; England, S.; Collins, F.; Davies, K.E.

    1988-02-25

    The authors have used chromosome jumping technology to move from within a large intron sequence in the Duchenne muscular dystrophy (DMD) gene to a region adjacent to exons of the gene. The single copy jump clone, HH1, was used to characterize deletions in patients previously shown to be deleted for DNA markers in the 5' end of the gene. 12 out of 15 such patients have breakpoints which lie between HH1 and the genomic locus J-47. Thus the vast majority of the deletions in these patients have proximal breakpoints in a similar region distal to the 5'end of the gene. HH1 was mapped with respect to the X;1 translocation in a DMD female and was shown to lie at least 80 kb from the starting point of the chromosome jump, HIP25.

  17. A familial Cri-du-Chat/5p deletion syndrome resulted from rare maternal complex chromosomal rearrangements (CCRs and/or possible chromosome 5p chromothripsis.

    Directory of Open Access Journals (Sweden)

    Heng Gu

    Full Text Available Cri-du-Chat syndrome (MIM 123450 is a chromosomal syndrome characterized by the characteristic features, including cat-like cry and chromosome 5p deletions. We report a family with five individuals showing chromosomal rearrangements involving 5p, resulting from rare maternal complex chromosomal rearrangements (CCRs, diagnosed post- and pre-natally by comprehensive molecular and cytogenetic analyses. Two probands, including a 4½-year-old brother and his 2½-year- old sister, showed no diagnostic cat cry during infancy, but presented with developmental delay, dysmorphic and autistic features. Both patients had an interstitial deletion del(5(p13.3p15.33 spanning ≈ 26.22 Mb. The phenotypically normal mother had de novo CCRs involving 11 breakpoints and three chromosomes: ins(11;5 (q23;p14.1p15.31,ins(21;5(q21;p13.3p14.1,ins(21;5(q21;p15.31p15.33,inv(7(p22q32dn. In addition to these two children, she had three first-trimester miscarriages, two terminations due to the identification of the 5p deletion and one delivery of a phenotypically normal daughter. The unaffected daughter had the maternal ins(11;5 identified prenatally and an identical maternal allele haplotype of 5p. Array CGH did not detect any copy number changes in the mother, and revealed three interstitial deletions within 5p15.33-p13.3, in the unaffected daughter, likely products of the maternal insertions ins(21;5. Chromothripsis has been recently reported as a mechanism drives germline CCRs in pediatric patients with congenital defects. We postulate that the unique CCRs in the phenotypically normal mother could resulted from chromosome 5p chromothripsis, that further resulted in the interstitial 5p deletions in the unaffected daughter. Further high resolution sequencing based analysis is needed to determine whether chromothripsis is also present as a germline structural variation in phenotypically normal individuals in this family.

  18. Detection of mitochondrial DNA deletions in human cells induced by ionizing radiation

    International Nuclear Information System (INIS)

    Liu, Qing-Jie; Feng, Jiang-Bin; Lu, Xue; Li, Yu-Wen; Chen, De-Qing

    2008-01-01

    Full text: Purpose: To screen the novel mitochondrial DNA (mt DNA) deletions induced by ionizing radiation, and analyze the several kinds of mt DNA deletions, known as 3895 bp, 889 bp, 7436 bp or 4934 bp deletions. Methods: Long-range PCR with two pairs of primers, which could amplify the whole human mitochondrial genome, was used to analyze the lymphoblastoid cell line before and after exposed to 10 Gy 60 Co γ-rays. The limited condition PCR was used to certify the possible mt DNA deletion showed by long-range PCR. The PCR products were purified, cloned, sequenced and the sequence result were BLASTed. Regular PCR or nest-PCR were used to analyze the 3895 bp, 889 bp, 7436 bp or 4934 bp deletions before and after radiation exposure. The final PCR products were purified, sequenced and BALSTed on standard human mitochondrial genome sequence database. Results: (1) The predicted bands of mt DNA were observed on the control cell lines, and the possible mt DNA deletions were also detected on the irradiated cell lines. The deletions were certified by the limited condition PCR. The sequence BLAST results of the cloned PCR products showed that two kinds of deletions, 7455 bp deletion (nt 475-7929 in heavy strand) and 9225 bp deletion (nt 7714-369 in heavy strand), which were between two 8 bp direct repeats. Further bioinformatics analysis showed that the two deletions were novel deletions. (2) The 889 bp and 3895 bp deletion were not detected for the cell line samples not exposed to 60 Co γ-rays. The 889 bp and 3895 bp deletions were detected on samples exposed to 10 Gy 60 Co γ-rays. The BALST results showed that the 889 bp and 3895 deletions flanked nt 11688 bp-12576, nt 548 bp-4443, respectively. The 7436 bp deletion levels were not changed much before and after irradiation. (3) The 4934 bp deletions had the same pattern as 7436 bp deletion, but it could induced by radiation. Conclusions: Ionizing radiation could induce the human lymphoblastoid two novel mt DNA

  19. Clonal deleted latent membrane protein 1 variants of Epstein-Barr virus are predominant in European extranodal NK/T lymphomas and disappear during successful treatment.

    Science.gov (United States)

    Halabi, Mohamad Adnan; Jaccard, Arnaud; Moulinas, Rémi; Bahri, Racha; Al Mouhammad, Hazar; Mammari, Nour; Feuillard, Jean; Ranger-Rogez, Sylvie

    2016-08-15

    Extranodal natural killer/T-cell lymphomas (NK/TL), rare in Europe, are Epstein-Barr virus (EBV) associated lymphomas with poor outcomes. Here, we determined the virus type and analyzed the EBV latent membrane protein-1 (LMP1) gene sequence in NK/TL from French patients. Six clones of viral LMP1 were sequenced by Sanger technology in blood from 13 patients before treatment with an l-asparaginase based regimen and, for 8 of them, throughout the treatment. Blood LMP1 sequences from 21 patients without any known malignancy were tested as controls. EBV Type A was identified for 11/13 patients and for all controls. Before treatment, a clonal LMP1 gene containing a 30 bp deletion (del30) was found in 46.1% of NK/TL and only in 4.8% of controls. Treatment was less effective in these patients who died more rapidly than the others. Patients with a deleted strain evolving toward a wild-type strain during treatment reached complete remission. The LMP1 gene was sequenced by highly sensitive next-generation sequencing technology in five NK/TL nasopharyngeal biopsies, two of them originating from the previous patients. Del30 was present in 100% of the biopsies; two viruses at least coexisted in three biopsies. These results suggest that del30 may be associated with poor prognosis NK/TL and that strain evolution could be used as a potential marker to monitor treatment. © 2016 UICC.

  20. ABCA7 frameshift deletion associated with Alzheimer disease in African Americans

    OpenAIRE

    Cukier, Holly N.; Kunkle, Brian W.; Vardarajan, Badri N.; Rolati, Sophie; Hamilton-Nelson, Kara L.; Kohli, Martin A.; Whitehead, Patrice L.; Dombroski, Beth A.; Van Booven, Derek; Lang, Rosalyn; Dykxhoorn, Derek M.; Farrer, Lindsay A.; Cuccaro, Michael L.; Vance, Jeffery M.; Gilbert, John R.

    2016-01-01

    Objective: To identify a causative variant(s) that may contribute to Alzheimer disease (AD) in African Americans (AA) in the ATP-binding cassette, subfamily A (ABC1), member 7 (ABCA7) gene, a known risk factor for late-onset AD. Methods: Custom capture sequencing was performed on ?150 kb encompassing ABCA7 in 40 AA cases and 37 AA controls carrying the AA risk allele (rs115550680). Association testing was performed for an ABCA7 deletion identified in large AA data sets (discovery n = 1,068; r...

  1. Somatic DNA recombination yielding circular DNA and deletion of a genomic region in embryonic brain

    International Nuclear Information System (INIS)

    Maeda, Toyoki; Chijiiwa, Yoshiharu; Tsuji, Hideo; Sakoda, Saburo; Tani, Kenzaburo; Suzuki, Tomokazu

    2004-01-01

    In this study, a mouse genomic region is identified that undergoes DNA rearrangement and yields circular DNA in brain during embryogenesis. External region-directed inverse polymerase chain reaction on circular DNA extracted from late embryonic brain tissue repeatedly detected DNA of this region containing recombination joints. Wide-range genomic PCR and digestion-circularization PCR analysis showed this region underwent recombination accompanied with deletion of intervening sequences, including the circularized regions. This region was mapped by fluorescence in situ hybridization to C1 on mouse chromosome 16, where no gene and no physiological DNA rearrangement had been identified. DNA sequence in the region has segmental homology to an orthologous region on human chromosome 3q.13. These observations demonstrated somatic DNA recombination yielding genomic deletions in brain during embryogenesis

  2. SHANK1 Deletions in Males with Autism Spectrum Disorder.

    Science.gov (United States)

    Sato, Daisuke; Lionel, Anath C; Leblond, Claire S; Prasad, Aparna; Pinto, Dalila; Walker, Susan; O'Connor, Irene; Russell, Carolyn; Drmic, Irene E; Hamdan, Fadi F; Michaud, Jacques L; Endris, Volker; Roeth, Ralph; Delorme, Richard; Huguet, Guillaume; Leboyer, Marion; Rastam, Maria; Gillberg, Christopher; Lathrop, Mark; Stavropoulos, Dimitri J; Anagnostou, Evdokia; Weksberg, Rosanna; Fombonne, Eric; Zwaigenbaum, Lonnie; Fernandez, Bridget A; Roberts, Wendy; Rappold, Gudrun A; Marshall, Christian R; Bourgeron, Thomas; Szatmari, Peter; Scherer, Stephen W

    2012-05-04

    Recent studies have highlighted the involvement of rare (number variations and point mutations in the genetic etiology of autism spectrum disorder (ASD); these variants particularly affect genes involved in the neuronal synaptic complex. The SHANK gene family consists of three members (SHANK1, SHANK2, and SHANK3), which encode scaffolding proteins required for the proper formation and function of neuronal synapses. Although SHANK2 and SHANK3 mutations have been implicated in ASD and intellectual disability, the involvement of SHANK1 is unknown. Here, we assess microarray data from 1,158 Canadian and 456 European individuals with ASD to discover microdeletions at the SHANK1 locus on chromosome 19. We identify a hemizygous SHANK1 deletion that segregates in a four-generation family in which male carriers--but not female carriers--have ASD with higher functioning. A de novo SHANK1 deletion was also detected in an unrelated male individual with ASD with higher functioning, and no equivalent SHANK1 mutations were found in >15,000 controls (p = 0.009). The discovery of apparent reduced penetrance of ASD in females bearing inherited autosomal SHANK1 deletions provides a possible contributory model for the male gender bias in autism. The data are also informative for clinical-genetics interpretations of both inherited and sporadic forms of ASD involving SHANK1. Copyright © 2012 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  3. Intranasal insulin to improve developmental delay in children with 22q13 deletion syndrome: an exploratory clinical trial

    OpenAIRE

    Schmidt, Heinrich; Giese, Renate; Enders, Angelika; Kern, W.; Hallschmid, M.

    2009-01-01

    Background: The 22q13 deletion syndrome (Phelan– McDermid syndrome) is characterised by a global developmental delay, absent or delayed speech, generalised hypotonia, autistic behaviour and characteristic phenotypic features. Intranasal insulin has been shown to improve declarative memory in healthy adult subjects and in patients with Alzheimer disease. Aims: To assess if intranasal insulin is also able to improve the developmental delay in children with 22q13 delet...

  4. Rhabdoid tumor predisposition syndrome caused by SMARCB1 constitutional deletion: prenatal detection of new case of recurrence in siblings due to gonadal mosaicism.

    Science.gov (United States)

    Gigante, Laura; Paganini, Irene; Frontali, Marina; Ciabattoni, Serena; Sangiuolo, Federica Carla; Papi, Laura

    2016-01-01

    Rhabdoid tumors are aggressive malignancies that show loss-of-function mutations of SMARCB1 gene, a member of the SWI/SNF chromatin-remodeling complex controlling gene transcription. One-third of patients affected by rhabdoid tumor harbor a germ-line mutation of SMARCB1 defining a rhabdoid tumor predisposition syndrome. The occurrence of a second somatic mutation determines the development of neoplasia in a two-hit model. Most germ-line mutations occur de novo, and few cases of recurrence in a sibship have been described. Here we report on a new Italian family with recurrence of SMARCB1 germ-line deletion in two siblings due to gonadal mosaicism. The deletion was identified in the 9-month-old proband with malignant rhabdoid tumor of the right kidney and disseminated metastases. Testing of both parents confirmed the de novo origin of the mutation, but recurrence was then detected prenatally in a new pregnancy. This is the sixth family with malignant rhabdoid tumor predisposition syndrome with the recurrence of the same germ-line SMARCB1 mutation in the sibship but not in healthy parents, suggesting that gonadal mosaicism is a less rare event than supposed. The clinical outcome in our patient confirms previous data of poorer outcome in patients with rhabdoid tumor predisposition syndrome.

  5. Ku80-deleted cells are defective at base excision repair

    International Nuclear Information System (INIS)

    Li, Han; Marple, Teresa; Hasty, Paul

    2013-01-01

    Graphical abstract: - Highlights: • Ku80-deleted cells are hypersensitive to ROS and alkylating agents. • Cells deleted for Ku80, but not Ku70 or Lig4, have reduced BER capacity. • OGG1 rescues hypersensitivity to H 2 O 2 and paraquat in Ku80-mutant cells. • Cells deleted for Ku80, but not Lig4, are defective at repairing AP sites. • Cells deleted for Ku80, but not Lig4 or Brca2 exon 27, exhibit increased PAR. - Abstract: Ku80 forms a heterodimer with Ku70, called Ku, that repairs DNA double-strand breaks (DSBs) via the nonhomologous end joining (NHEJ) pathway. As a consequence of deleting NHEJ, Ku80-mutant cells are hypersensitive to agents that cause DNA DSBs like ionizing radiation. Here we show that Ku80 deletion also decreased resistance to ROS and alkylating agents that typically cause base lesions and single-strand breaks (SSBs). This is unusual since base excision repair (BER), not NHEJ, typically repairs these types of lesions. However, we show that deletion of another NHEJ protein, DNA ligase IV (Lig4), did not cause hypersensitivity to these agents. In addition, the ROS and alkylating agents did not induce γ-H2AX foci that are diagnostic of DSBs. Furthermore, deletion of Ku80, but not Lig4 or Ku70, reduced BER capacity. Ku80 deletion also impaired BER at the initial lesion recognition/strand scission step; thus, involvement of a DSB is unlikely. Therefore, our data suggests that Ku80 deletion impairs BER via a mechanism that does not repair DSBs

  6. Ku80-deleted cells are defective at base excision repair

    Energy Technology Data Exchange (ETDEWEB)

    Li, Han [The University of Texas Health Science Center at San Antonio, The Institute of Biotechnology, The Department of Molecular Medicine, 15355 Lambda Drive, San Antonio, TX 78245-3207 (United States); Tumor Suppression Group, Spanish National Cancer Research Centre (CNIO), Madrid 28029 (Spain); Marple, Teresa [The University of Texas Health Science Center at San Antonio, The Institute of Biotechnology, The Department of Molecular Medicine, 15355 Lambda Drive, San Antonio, TX 78245-3207 (United States); Hasty, Paul, E-mail: hastye@uthscsa.edu [The University of Texas Health Science Center at San Antonio, The Institute of Biotechnology, The Department of Molecular Medicine, 15355 Lambda Drive, San Antonio, TX 78245-3207 (United States); Tumor Suppression Group, Spanish National Cancer Research Centre (CNIO), Madrid 28029 (Spain)

    2013-05-15

    Graphical abstract: - Highlights: • Ku80-deleted cells are hypersensitive to ROS and alkylating agents. • Cells deleted for Ku80, but not Ku70 or Lig4, have reduced BER capacity. • OGG1 rescues hypersensitivity to H{sub 2}O{sub 2} and paraquat in Ku80-mutant cells. • Cells deleted for Ku80, but not Lig4, are defective at repairing AP sites. • Cells deleted for Ku80, but not Lig4 or Brca2 exon 27, exhibit increased PAR. - Abstract: Ku80 forms a heterodimer with Ku70, called Ku, that repairs DNA double-strand breaks (DSBs) via the nonhomologous end joining (NHEJ) pathway. As a consequence of deleting NHEJ, Ku80-mutant cells are hypersensitive to agents that cause DNA DSBs like ionizing radiation. Here we show that Ku80 deletion also decreased resistance to ROS and alkylating agents that typically cause base lesions and single-strand breaks (SSBs). This is unusual since base excision repair (BER), not NHEJ, typically repairs these types of lesions. However, we show that deletion of another NHEJ protein, DNA ligase IV (Lig4), did not cause hypersensitivity to these agents. In addition, the ROS and alkylating agents did not induce γ-H2AX foci that are diagnostic of DSBs. Furthermore, deletion of Ku80, but not Lig4 or Ku70, reduced BER capacity. Ku80 deletion also impaired BER at the initial lesion recognition/strand scission step; thus, involvement of a DSB is unlikely. Therefore, our data suggests that Ku80 deletion impairs BER via a mechanism that does not repair DSBs.

  7. Neuronal activity in the isolated mouse spinal cord during spontaneous deletions in fictive locomotion: insights into locomotor central pattern generator organization

    Science.gov (United States)

    Zhong, Guisheng; Shevtsova, Natalia A; Rybak, Ilya A; Harris-Warrick, Ronald M

    2012-01-01

    We explored the organization of the spinal central pattern generator (CPG) for locomotion by analysing the activity of spinal interneurons and motoneurons during spontaneous deletions occurring during fictive locomotion in the isolated neonatal mouse spinal cord, following earlier work on locomotor deletions in the cat. In the isolated mouse spinal cord, most spontaneous deletions were non-resetting, with rhythmic activity resuming after an integer number of cycles. Flexor and extensor deletions showed marked asymmetry: flexor deletions were accompanied by sustained ipsilateral extensor activity, whereas rhythmic flexor bursting was not perturbed during extensor deletions. Rhythmic activity on one side of the cord was not perturbed during non-resetting spontaneous deletions on the other side, and these deletions could occur with no input from the other side of the cord. These results suggest that the locomotor CPG has a two-level organization with rhythm-generating (RG) and pattern-forming (PF) networks, in which only the flexor RG network is intrinsically rhythmic. To further explore the neuronal organization of the CPG, we monitored activity of motoneurons and selected identified interneurons during spontaneous non-resetting deletions. Motoneurons lost rhythmic synaptic drive during ipsilateral deletions. Flexor-related commissural interneurons continued to fire rhythmically during non-resetting ipsilateral flexor deletions. Deletion analysis revealed two classes of rhythmic V2a interneurons. Type I V2a interneurons retained rhythmic synaptic drive and firing during ipsilateral motor deletions, while type II V2a interneurons lost rhythmic synaptic input and fell silent during deletions. This suggests that the type I neurons are components of the RG, whereas the type II neurons are components of the PF network. We propose a computational model of the spinal locomotor CPG that reproduces our experimental results. The results may provide novel insights into the

  8. Microarray-based ultra-high resolution discovery of genomic deletion mutations

    Science.gov (United States)

    2014-01-01

    Background Oligonucleotide microarray-based comparative genomic hybridization (CGH) offers an attractive possible route for the rapid and cost-effective genome-wide discovery of deletion mutations. CGH typically involves comparison of the hybridization intensities of genomic DNA samples with microarray chip representations of entire genomes, and has widespread potential application in experimental research and medical diagnostics. However, the power to detect small deletions is low. Results Here we use a graduated series of Arabidopsis thaliana genomic deletion mutations (of sizes ranging from 4 bp to ~5 kb) to optimize CGH-based genomic deletion detection. We show that the power to detect smaller deletions (4, 28 and 104 bp) depends upon oligonucleotide density (essentially the number of genome-representative oligonucleotides on the microarray chip), and determine the oligonucleotide spacings necessary to guarantee detection of deletions of specified size. Conclusions Our findings will enhance a wide range of research and clinical applications, and in particular will aid in the discovery of genomic deletions in the absence of a priori knowledge of their existence. PMID:24655320

  9. Phenotype and 244k array-CGH characterization of chromosome 13q deletions: an update of the phenotypic map of 13q21.1-qter

    DEFF Research Database (Denmark)

    Kirchhoff, Maria; Bisgaard, Anne-Marie; Stoeva, Radka

    2009-01-01

    Partial deletions of the long arm of chromosome 13 lead to variable phenotypes dependant on the size and position of the deleted region. In order to update the phenotypic map of chromosome 13q21.1-qter deletions, we applied 244k Agilent oligonucleotide-based array-CGH to determine the exact break......-genotype correlation on chromosome 13. In contrast to previous reports of carriers of 13q32 band deletions as the most seriously affected patients, we present two such individuals with long-term survival, 28 and 2.5 years....

  10. 41 CFR 51-2.3 - Notice of proposed addition or deletion.

    Science.gov (United States)

    2010-07-01

    ... addition or deletion. 51-2.3 Section 51-2.3 Public Contracts and Property Management Other Provisions... or deletion. At least 30 days prior to the Committee's consideration of the addition or deletion of a... Register announcing the proposed addition or deletion and providing interested persons an opportunity to...

  11. Gene deletion of cytosolic ATP: citrate lyase leads to altered organic acid production in Aspergillus niger

    DEFF Research Database (Denmark)

    Meijer, Susan Lisette; Nielsen, Michael Lynge; Olsson, Lisbeth

    2009-01-01

    With the availability of the genome sequence of the filamentous fungus Aspergillus niger, the use of targeted genetic modifications has become feasible. This, together with the fact that A. niger is well established industrially, makes this fungus an attractive micro-organism for creating a cell...... factory platform for production of chemicals. Using molecular biology techniques, this study focused on metabolic engineering of A. niger to manipulate its organic acid production in the direction of succinic acid. The gene target for complete gene deletion was cytosolic ATP: citrate lyase (acl), which...... the acl gene. Additionally, the total amount of organic acids produced in the deletion strain was significantly increased. Genome-scale stoichiometric metabolic model predictions can be used for identifying gene targets. Deletion of the acl led to increased succinic acid production by A. niger....

  12. [Phenotypic and genetic analysis of a patient presented with Tietz/Waardenburg type II a syndrome].

    Science.gov (United States)

    Wang, Huanhuan; Tang, Lifang; Zhang, Jingmin; Hu, Qin; Chen, Yingwei; Xiao, Bing

    2015-08-01

    To determine the genetic cause for a patient featuring decreased pigmentation of the skin and iris, hearing loss and multiple congenital anomalies. Routine chromosomal banding was performed to analyze the karyotype of the patient and his parents. Single nucleotide polymorphism array (SNP array) was employed to identify cryptic chromosome aberrations, and quantitative real-time PCR was used to confirm the results. Karyotype analysis has revealed no obvious anomaly for the patient and his parents. SNP array analysis of the patient has demonstrated a 3.9 Mb deletion encompassing 3p13p14.1, which caused loss of entire MITF gene. The deletion was confirmed by quantitative real-time PCR. Clinical features of the patient have included severe bilateral hearing loss, decreased pigmentation of the skin and iris and multiple congenital anomalies. The patient, carrying a 3p13p14.1 deletion, has features of Tietz syndrome/Waardenburg syndrome type IIa. This case may provide additional data for the study of genotype-phenotype correlation of this disease.

  13. Nephrogenic diabetes insipidus in a patient with L1 syndrome: a new report of a contiguous gene deletion syndrome including L1CAM and AVPR2.

    Science.gov (United States)

    Knops, Noël B B; Bos, Krista K; Kerstjens, Mieke; van Dael, Karin; Vos, Yvonne J

    2008-07-15

    We report on an infant boy with congenital hydrocephalus due to L1 syndrome and polyuria due to diabetes insipidus. We initially believed his excessive urine loss was from central diabetes insipidus and that the cerebral malformation caused a secondary insufficient pituitary vasopressin release. However, he failed to respond to treatment with a vasopressin analogue, which pointed to nephrogenic diabetes insipidus (NDI). L1 syndrome and X-linked NDI are distinct clinical disorders caused by mutations in the L1CAM and AVPR2 genes, respectively, located in adjacent positions in Xq28. In this boy we found a deletion of 61,577 basepairs encompassing the entire L1CAM and AVPR2 genes and extending into intron 7 of the ARHGAP4 gene. To our knowledge this is the first description of a patient with a deletion of these three genes. He is the second patient to be described with L1 syndrome and NDI. During follow-up he manifested complications from the hydrocephalus and NDI including global developmental delay and growth failure with low IGF-1 and hypothyroidism. 2008 Wiley-Liss, Inc.

  14. Proximal 21q deletion as a result of a de novo unbalanced t(12;21) translocation in a patient with dysmorphic features, hepatomegaly, thick myocardium and delayed psychomotor development

    DEFF Research Database (Denmark)

    Jespersgaard, Cathrine; Damgaard, Ida N; Cornelius, Nanna

    2016-01-01

    of the region from 32.3 Mb to 37.1 Mb was more crucial than the deletion of other regions. CASE PRESENTATION: In this study we describe a female patient with dysmorphic features, hepatomegaly, thick myocardium and psychomotor delay. Conventional karyotyping was initially interpreted as full monosomy 21...

  15. EPHA4 haploinsufficiency is responsible for the short stature of a patient with 2q35-q36.2 deletion and Waardenburg syndrome.

    Science.gov (United States)

    Li, Chuan; Chen, Rongyu; Fan, Xin; Luo, Jingsi; Qian, Jiale; Wang, Jin; Xie, Bobo; Shen, Yiping; Chen, Shaoke

    2015-04-11

    Waardenburg syndrome type I (WS1), an auditory-pigmentary genetic disorder, is caused by heterozygous loss-of-function mutations in PAX3. Abnormal physical signs such as dystopia canthorum, patchy hypopigmentation and sensorineural hearing loss are common, but short stature is not associated with WS1. We reported a 4-year and 6 month-old boy with a rare combination of WS1 and severe short stature (83.5 cm (-5.8SD)). His facial features include dystopia canthorum, mild synophrys, slightly up-slanted palpebral fissure, posteriorly rotated ears, alae nasi hypoplasia and micrognathia. No heterochromia was noticed. He had a normal intelligence quotient and hearing. Insulin-like growth factor-1 (IGF-1) was 52.7 ng/ml, lower than the normal range (55 ~ 452 ng/ml) and the peak growth hormone level was 7.57 ng/ml at 90 minutes after taking moderate levodopa and pyridostigmine bromide. The patient exhibited a good response to human growth hormone (rhGH) replacement therapy, showing a 9.2 cm/year growth rate and an improvement of 1 standard deviation (SD) of height after one year treatment. CMA test of patient's DNA revealed a 4.46 Mb de novo deletion at 2q35-q36.2 (hg19; chr2:221,234,146-225,697,363). PAX3 haploinsufficiency is known to cause Waardenburg syndrome. Examining overlapping deletions in patients led to the conclusion that EPHA4 is a novel short stature gene. The finding is supported by the splotch-retarded and epha4 knockout mouse models which both showed growth retardation. We believe this rare condition is caused by the haploinsufficiency of both PAX3 and EPH4 genes. We further reported a growth response to recombinant human growth hormone treatment in this patient.

  16. Angiotensin-converting enzyme (ACE) gene insertion/deletion polymorphism is not a risk factor for hypertension in SLE nephritis.

    Science.gov (United States)

    Negi, Vir S; Devaraju, Panneer; Gulati, Reena

    2015-09-01

    SLE is a systemic autoimmune disease with high prevalence of hypertension. Around 40-75 % of SLE patients develop nephritis, a major cause of hypertension and mortality. Angiotensin-converting enzyme (ACE) maintains the blood pressure and blood volume homeostasis. An insertion/deletion (I/D) polymorphism in intron 16 of ACE gene was reported to influence the development of hypertension, nephritis, and cardiovascular diseases in different ethnic populations. Despite compelling evidence for the high prevalence of hypertension in individuals with SLE, underlying factors for its development are not well studied. With this background, we analyzed the influence of ACE insertion/deletion polymorphism on susceptibility to SLE, development of nephritis and hypertension, other clinical features and autoantibody phenotype in South Indian SLE patients. Three hundred patients with SLE and 460 age and sex similar ethnicity matched individuals were included as patients and healthy controls, respectively. The ACE gene insertion/deletion polymorphism was analyzed by PCR. Insertion (I) and deletion (D) alleles were observed to be equally distributed among patients (57 and 43 %) and controls (59 and 41 %), respectively. The mutant (D) allele did not confer significant risk for SLE (II vs. ID: p = 0.4, OR 1.15, 95 % CI 0.8-1.6; II vs. DD: p = 0.34, OR 1.22, 95 % CI 0.8-1.85). There was no association of the ACE genotype or the allele with development of lupus nephritis (II vs. ID: p = 0.19, OR 1.41, 95 % CI 0.84-2.36; II vs. DD: p = 0.41, OR 0.74, 95 % CI 0.38-1.41) or hypertension (II vs. ID: p = 0.85, OR 0.9, 95 % CI 0.43-1.8; II vs. DD: p = 0.66, OR 1.217, 95 % CI 0.5-2.8). The presence of mutant allele (D) was not found to influence any clinical features or autoantibody phenotype. The insertion/deletion polymorphism of the ACE gene is not a genetic risk factor for SLE and does not influence development of hypertension or lupus nephritis in South Indian

  17. Identification and characterization of large DNA deletions affecting oil quality traits in soybean seeds through transcriptome sequencing analysis.

    Science.gov (United States)

    Goettel, Wolfgang; Ramirez, Martha; Upchurch, Robert G; An, Yong-Qiang Charles

    2016-08-01

    Identification and characterization of a 254-kb genomic deletion on a duplicated chromosome segment that resulted in a low level of palmitic acid in soybean seeds using transcriptome sequencing. A large number of soybean genotypes varying in seed oil composition and content have been identified. Understanding the molecular mechanisms underlying these variations is important for breeders to effectively utilize them as a genetic resource. Through design and application of a bioinformatics approach, we identified nine co-regulated gene clusters by comparing seed transcriptomes of nine soybean genotypes varying in oil composition and content. We demonstrated that four gene clusters in the genotypes M23, Jack and N0304-303-3 coincided with large-scale genome rearrangements. The co-regulated gene clusters in M23 and Jack mapped to a previously described 164-kb deletion and a copy number amplification of the Rhg1 locus, respectively. The coordinately down-regulated gene clusters in N0304-303-3 were caused by a 254-kb deletion containing 19 genes including a fatty acyl-ACP thioesterase B gene (FATB1a). This deletion was associated with reduced palmitic acid content in seeds and was the molecular cause of a previously reported nonfunctional FATB1a allele, fap nc . The M23 and N0304-304-3 deletions were located in duplicated genome segments retained from the Glycine-specific whole genome duplication that occurred 13 million years ago. The homoeologous genes in these duplicated regions shared a strong similarity in both their encoded protein sequences and transcript accumulation levels, suggesting that they may have conserved and important functions in seeds. The functional conservation of homoeologous genes may result in genetic redundancy and gene dosage effects for their associated seed traits, explaining why the large deletion did not cause lethal effects or completely eliminate palmitic acid in N0304-303-3.

  18. A novel small deletion in the NHS gene associated with Nance-Horan syndrome.

    Science.gov (United States)

    Li, Huajin; Yang, Lizhu; Sun, Zixi; Yuan, Zhisheng; Wu, Shijing; Sui, Ruifang

    2018-02-05

    Nance-Horan syndrome is a rare X-linked recessive inherited disease with clinical features including severe bilateral congenital cataracts, characteristic facial and dental abnormalities. Data from Chinese Nance-Horan syndrome patients are limited. We assessed the clinical manifestations of a Chinese Nance-Horan syndrome pedigree and identified the genetic defect. Genetic analysis showed that 3 affected males carried a novel small deletion in NHS gene, c.263_266delCGTC (p.Ala89TrpfsTer106), and 2 female carriers were heterozygous for the same variant. All 3 affected males presented with typical Nance-Horan syndrome features. One female carrier displayed lens opacities centered on the posterior Y-suture in both eyes, as well as mild dental abnormalities. We recorded the clinical features of a Chinese Nance-Horan syndrome family and broadened the spectrum of mutations in the NHS gene.

  19. Highly restricted deletion of the SNORD116 region is implicated in Prader-Willi Syndrome.

    Science.gov (United States)

    Bieth, Eric; Eddiry, Sanaa; Gaston, Véronique; Lorenzini, Françoise; Buffet, Alexandre; Conte Auriol, Françoise; Molinas, Catherine; Cailley, Dorothée; Rooryck, Caroline; Arveiler, Benoit; Cavaillé, Jérome; Salles, Jean Pierre; Tauber, Maïthé

    2015-02-01

    The SNORD116 locus lies in the 15q11-13 region of paternally expressed genes implicated in Prader-Willi Syndrome (PWS), a complex disease accompanied by obesity and severe neurobehavioural disturbances. Cases of PWS patients with a deletion encompassing the SNORD116 gene cluster, but preserving the expression of flanking genes, have been described. We report a 23-year-old woman who presented clinical criteria of PWS, including the behavioural and nutritional features, obesity, developmental delay and endocrine dysfunctions with hyperghrelinemia. We found a paternally transmitted highly restricted deletion of the SNORD116 gene cluster, the shortest described to date (118 kb). This deletion was also present in the father. This finding in a human case strongly supports the current hypothesis that lack of the paternal SNORD116 gene cluster has a determinant role in the pathogenesis of PWS. Moreover, targeted analysis of the SNORD116 gene cluster, complementary to SNRPN methylation analysis, should be carried out in subjects with a phenotype suggestive of PWS.

  20. Establishment and antitumor effects of dasatinib and PKI-587 in BD-138T, a patient-derived muscle invasive bladder cancer preclinical platform with concomitant EGFR amplification and PTEN deletion.

    Science.gov (United States)

    Chang, Nakho; Lee, Hye Won; Lim, Joung Eun; Jeong, Da Eun; Song, Hye Jin; Kim, Sudong; Nam, Do-Hyun; Sung, Hyun Hwan; Jeong, Byong Chang; Seo, Seong Il; Jeon, Seong Soo; Lee, Hyun Moo; Choi, Han-Yong; Jeon, Hwang Gyun

    2016-08-09

    Muscle-invasive bladder cancer (MIBC) consists of a heterogeneous group of tumors with a high rate of metastasis and mortality. To facilitate the in-depth investigation and validation of tailored strategies for MIBC treatment, we have developed an integrated approach using advanced high-throughput drug screening and a clinically relevant patient-derived preclinical platform. We isolated patient-derived tumor cells (PDCs) from a rare MIBC case (BD-138T) that harbors concomitant epidermal growth factor receptor (EGFR) amplification and phosphatase and tensin homolog (PTEN) deletion. High-throughput in vitro drug screening demonstrated that dasatinib, a SRC inhibitor, and PKI-587, a dual PI3K/mTOR inhibitor, exhibited targeted anti-proliferative and pro-apoptotic effects against BD-138T PDCs. Using established patient-derived xenograft models that successfully retain the genomic and molecular characteristics of the parental tumor, we confirmed that these anti-tumor responses occurred through the inhibition of SRC and PI3K/AKT/mTOR signaling pathways. Taken together, these experimental results demonstrate that dasatinib and PKI-587 might serve as promising anticancer drug candidates for treating MIBC with combined EGFR gene amplification and PTEN deletion.

  1. A case of an atypically large proximal 15q deletion as cause for Prader-Willi syndrome arising from a de novo unbalanced translocation.

    Science.gov (United States)

    Hickey, Scott E; Thrush, Devon Lamb; Walters-Sen, Lauren; Reshmi, Shalini C; Astbury, Caroline; Gastier-Foster, Julie M; Atkin, Joan

    2013-09-01

    We describe an 11 month old female with Prader-Willi syndrome (PWS) resulting from an atypically large deletion of proximal 15q due to a de novo 3;15 unbalanced translocation. The 10.6 Mb deletion extends from the chromosome 15 short arm and is not situated in a region previously reported as a common distal breakpoint for unbalanced translocations. There was no deletion of the reciprocal chromosome 3q subtelomeric region detected by either chromosomal microarray or FISH. The patient has hypotonia, failure to thrive, and typical dysmorphic facial features for PWS. The patient also has profound global developmental delay consistent with an expanded, more severe, phenotype. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  2. Cortical morphology development in patients with 22q11.2 deletion syndrome at ultra-high risk of psychosis.

    Science.gov (United States)

    Padula, Maria Carmela; Schaer, Marie; Armando, Marco; Sandini, Corrado; Zöller, Daniela; Scariati, Elisa; Schneider, Maude; Eliez, Stephan

    2018-01-17

    Patients with 22q11.2 deletion syndrome (22q11DS) present a high risk of developing psychosis. While clinical and cognitive predictors for the conversion towards a full-blown psychotic disorder are well defined and largely used in practice, neural biomarkers do not yet exist. However, a number of investigations indicated an association between abnormalities in cortical morphology and higher symptoms severities in patients with 22q11DS. Nevertheless, few studies included homogeneous groups of patients differing in their psychotic symptoms profile. In this study, we included 22 patients meeting the criteria for an ultra-high-risk (UHR) psychotic state and 22 age-, gender- and IQ-matched non-UHR patients. Measures of cortical morphology, including cortical thickness, volume, surface area and gyrification, were compared between the two groups using mass-univariate and multivariate comparisons. Furthermore, the development of these measures was tested in the two groups using a mixed-model approach. Our results showed differences in cortical volume and surface area in UHR patients compared with non-UHR. In particular, we found a positive association between surface area and the rate of change of global functioning, suggesting that higher surface area is predictive of improved functioning with age. We also observed accelerated cortical thinning during adolescence in UHR patients with 22q11DS. These results, although preliminary, suggest that alterations in cortical volume and surface area as well as altered development of cortical thickness may be associated to a greater probability to develop psychosis in 22q11DS.

  3. Genetic heterogeneity in patients with Bartter syndrome type 1.

    Science.gov (United States)

    Sun, Mingran; Ning, Jing; Xu, Weihong; Zhang, Han; Zhao, Kaishu; Li, Wenfu; Li, Guiying; Li, Shibo

    2017-02-01

    Bartter syndrome (BS) type 1 is an autosomal recessive kidney disorder caused by loss‑of‑function mutations in the solute carrier family 12 member 1 (SLC12A1) gene. To date, 72 BS type 1 patients harboring SLC12A1 mutations have been documented. Of these 144 alleles studied, 68 different disease‑causing mutations have been detected in 129 alleles, and no mutation was detected in the remaining 15 alleles. The mutation types included missense/nonsense mutations, splicing mutations and small insertions and deletions ranging from 1 to 4 nucleotides. A large deletion encompassing a whole exon in the SLC12A1 gene has not yet been reported. The current study initially identified an undocumented homozygous frameshift mutation (c.1833delT) by Sanger sequencing analysis of a single infant with BS type 1. However, in a subsequent analysis, the mutation was detected only in the father's DNA. Upon further investigation using a next‑generation sequencing approach, a deletion in exons 14 and 15 in both the patient and patient's mother was detected. The deletion was subsequently confirmed by use of a long‑range polymerase chain reaction and was determined to be 3.16 kb in size based on sequencing of the junction fragment. The results of the present study demonstrated that pathogenic variants of SLC12A1 are heterogeneous. Large deletions appear to serve an etiological role in BS type 1, and may be more prevalent than previously thought.

  4. Deletion of amelotin exons 3-6 is associated with amelogenesis imperfecta.

    Science.gov (United States)

    Smith, Claire E L; Murillo, Gina; Brookes, Steven J; Poulter, James A; Silva, Sandra; Kirkham, Jennifer; Inglehearn, Chris F; Mighell, Alan J

    2016-08-15

    Amelogenesis imperfecta (AI) is a heterogeneous group of genetic conditions that result in defective dental enamel formation. Amelotin (AMTN) is a secreted protein thought to act as a promoter of matrix mineralization in the final stage of enamel development, and is strongly expressed, almost exclusively, in maturation stage ameloblasts. Amtn overexpression and Amtn knockout mouse models have defective enamel with no other associated phenotypes, highlighting AMTN as an excellent candidate gene for human AI. However, no AMTN mutations have yet been associated with human AI. Using whole exome sequencing, we identified an 8,678 bp heterozygous genomic deletion encompassing exons 3-6 of AMTN in a Costa Rican family segregating dominant hypomineralised AI. The deletion corresponds to an in-frame deletion of 92 amino acids, shortening the protein from 209 to 117 residues. Exfoliated primary teeth from an affected family member had enamel that was of a lower mineral density compared to control enamel and exhibited structural defects at least some of which appeared to be associated with organic material as evidenced using elemental analysis. This study demonstrates for the first time that AMTN mutations cause non-syndromic human AI and explores the human phenotype, comparing it with that of mice with disrupted Amtn function. © The Author 2016. Published by Oxford University Press.

  5. The -(α)(5.2) Deletion Detected in a Uruguayan Family: First Case Report in the Americas.

    Science.gov (United States)

    Soler, Ana María; Schelotto, Magdalena; de Oliveira Mota, Natalia; Dorta Ferreira, Roberta; Sonati, Maria de Fatima; da Luz, Julio Abayubá

    2016-08-01

    In Uruguay, α-thalassemia (α-thal) mutations were introduced predominantly by Mediterranean European immigrant populations and by slave trade of African populations. A patient with anemia with hypochromia and microcytosis, refractory to iron treatment and with normal hemoglobin (Hb) electrophoresis was analyzed for α-thal mutations by multiplex gap-polymerase chain reaction (gap-PCR), automated sequencing and multiplex ligation-dependent probe amplification (MLPA) analyses. Agarose gel electrophoresis of the multiplex gap-PCR showed a band of unexpected size (approximately 700 bp) in the samples from the proband and mother. Automated sequencing of the amplified fragment showed the presence of the -(α)(5.2) deletion (NG_000006.1: g.32867_38062del5196) [an α-thal-1 deletion of 5196 nucleotides (nts)]. The MLPA analysis of the proband's sample also showed the presence of the -(α)(5.2) deletion in heterozygous state. We report here the presence of the -(α)(5.2) deletion, for the first time in the Americas, in a Uruguayan family with Italian ancestry, detected with a previously described multiplex gap-PCR.

  6. One in Four Individuals of African-American Ancestry Harbors a 5.5kb Deletion at chromosome 11q13.1

    Science.gov (United States)

    Zainabadi, Kayvan; Jain, Anuja V.; Donovan, Frank X.; Elashoff, David; Rao, Nagesh P.; Murty, Vundavalli V.; Chandrasekharappa, Settara C.; Srivatsan, Eri S.

    2014-01-01

    Cloning and sequencing of 5.5kb deletion at chromosome 11q13.1 from the HeLa cells, tumorigenic hybrids and two fibroblast cell lines has revealed homologous recombination between AluSx and AluY resulting in the deletion of intervening sequences. Long-range PCR of the 5.5kb sequence in 494 normal lymphocyte samples showed heterozygous deletion in 28.3% of African- American ancestry samples but only in 4.8% of Caucasian samples (pdeletion occurs in 27% of YRI (Yoruba – West African) population but none in non-African populations. The HapMap analysis further identified strong linkage disequilibrium between 5 single nucleotide polymorphisms and the 5.5kb deletion in the people of African ancestry. Computational analysis of 175kb sequence surrounding the deletion site revealed enhanced flexibility, low thermodynamic stability, high repetitiveness, and stable stem-loop/hairpin secondary structures that are hallmarks of common fragile sites. PMID:24412158

  7. Association of Angiotensin-Converting Enzyme Genotype, Insertion/Deletion Polymorphism and Saphenous Vein Graft Atherosclerosis in Iranian Patients

    Directory of Open Access Journals (Sweden)

    Neda Zeinali

    2015-10-01

    Full Text Available ABSTRACT OBJECTIVE: The aim of this study was to evaluate possible interactions among Angiotensin-I converting enzyme genotype, insertion/deletion polymorphism and atherosclerosis of vein grafts in Iranian patients, and characterize their clinical and demographic profile. METHODS: In this cross-sectional study, patients who underwent coronary artery bypass graft surgery more than five years ago, were included for angiographic analysis. Atherosclerosis was determined by quantitative angiography and adjusted Gensini score. The gene angiotensin converting enzyme I/D polymorphism was detected by polymerase chain reaction. RESULTS: A total of 102 patients participated in this study. Eighty-four patients were male. The frequency distribution of DD, ID and II polymorphism were 23.6%, 62.7% and 13.7% respectively. There were no differences among genotypic groups in age, sex, number of risk factors, number of vein grafts and months since bypass surgery. According to adjusted Gensini score [0.18±0.12 (II vs. 0.11±0.09 (ID and 0.1±0.09 (DD P=0.021] the II genotype was associated with severity of vein graft atherosclerosis. CONCLUSION: Although there are conflicting results about gene angiotensin converting enzyme I/D polymorphism and the degree of venous bypass graft degeneration, this study suggests an association between ACE genotype II and atherosclerosis of saphenous vein grafts, however, large samples considering clinical, demographic and ethnic profile are necessary to confirm these results.

  8. A Deletion in the Canine POMC Gene Is Associated with Weight and Appetite in Obesity-Prone Labrador Retriever Dogs.

    Science.gov (United States)

    Raffan, Eleanor; Dennis, Rowena J; O'Donovan, Conor J; Becker, Julia M; Scott, Robert A; Smith, Stephen P; Withers, David J; Wood, Claire J; Conci, Elena; Clements, Dylan N; Summers, Kim M; German, Alexander J; Mellersh, Cathryn S; Arendt, Maja L; Iyemere, Valentine P; Withers, Elaine; Söder, Josefin; Wernersson, Sara; Andersson, Göran; Lindblad-Toh, Kerstin; Yeo, Giles S H; O'Rahilly, Stephen

    2016-05-10

    Sequencing of candidate genes for obesity in Labrador retriever dogs identified a 14 bp deletion in pro-opiomelanocortin (POMC) with an allele frequency of 12%. The deletion disrupts the β-MSH and β-endorphin coding sequences and is associated with body weight (per allele effect of 0.33 SD), adiposity, and greater food motivation. Among other dog breeds, the deletion was only found in the closely related flat-coat retriever (FCR), where it is similarly associated with body weight and food motivation. The mutation is significantly more common in Labrador retrievers selected to become assistance dogs than pets. In conclusion, the deletion in POMC is a significant modifier of weight and appetite in Labrador retrievers and FCRs and may influence other behavioral traits. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  9. Array based characterization of a terminal deletion involving chromosome subband 15q26.2: an emerging syndrome associated with growth retardation, cardiac defects and developmental delay

    Directory of Open Access Journals (Sweden)

    Björkhem Gudrun

    2008-01-01

    Full Text Available Abstract Background Subtelomeric regions are gene rich and deletions in these chromosomal segments have been demonstrated to account for approximately 2.5% of patients displaying mental retardation with or without association of dysmorphic features. However, cases that report de novo terminal deletions on chromosome arm 15q are rare. Methods In this study we present the first example of a detailed molecular genetic mapping of a de novo deletion in involving 15q26.2-qter, caused by the formation of a dicentric chromosome 15, using metaphase FISH and tiling resolution (32 k genome-wide array-based comparative genomic hybridization (CGH. Results After an initial characterization of the dicentric chromosome by metaphase FISH, array CGH analysis mapped the terminal deletion to encompass a 6.48 megabase (Mb region, ranging from 93.86–100.34 Mb on chromosome 15. Conclusion In conclusion, we present an additional case to the growing family of reported cases with 15q26-deletion, thoroughly characterized at the molecular cytogenetic level. In the deleted regions, four candidate genes responsible for the phenotype of the patient could be delineated: IGFR1, MEF2A, CHSY1, and TM2D3. Further characterization of additional patients harboring similar 15q-aberrations might hopefully in the future lead to the description of a clear cut clinically recognizable syndrome.

  10. Quantitative Genome-Wide Analysis of Yeast Deletion Strain Sensitivities to Oxidative and Chemical Stress

    Directory of Open Access Journals (Sweden)

    Stanley Fields

    2006-03-01

    Full Text Available Understanding the actions of drugs and toxins in a cell is of critical importance to medicine, yet many of the molecular events involved in chemical resistance are relatively uncharacterized. In order to identify the cellular processes and pathways targeted by chemicals, we took advantage of the haploid Saccharomyces cerevisiae deletion strains (Winzeler et al., 1999. Although ~4800 of the strains are viable, the loss of a gene in a pathway affected by a drug can lead to a synthetic lethal effect in which the combination of a deletion and a normally sublethal dose of a chemical results in loss of viability. WE carried out genome-wide screens to determine quantitative sensitivities of the deletion set to four chemicals: hydrogen peroxide, menadione, ibuprofen and mefloquine. Hydrogen peroxide and menadione induce oxidative stress in the cell, whereas ibuprofen and mefloquine are toxic to yeast by unknown mechanisms. Here we report the sensitivities of 659 deletion strains that are sensitive to one or more of these four compounds, including 163 multichemicalsensitive strains, 394 strains specific to hydrogen peroxide and/or menadione, 47 specific to ibuprofen and 55 specific to mefloquine.We correlate these results with data from other large-scale studies to yield novel insights into cellular function.

  11. PAX3 gene deletion detected by microarray analysis in a girl with hearing loss.

    Science.gov (United States)

    Drozniewska, Malgorzata; Haus, Olga

    2014-01-01

    Deletions of the PAX3 gene have been rarely reported in the literature. Mutations of this gene are a common cause of Waardenburg syndrome type 1 and 3. We report a 16 year old female presenting hearing loss and normal intellectual development, without major features of Waardenburg syndrome type 1, and without family history of the syndrome. Her phenotype, however, overlaps with features of craniofacial-deafness-hand syndrome. Microarray analysis showed ~862 kb de novo deletion at 2q36.1 including PAX3. The above findings suggest that the rearrangement found in our patient appeared de novo and with high probability is a cause of her phenotype.

  12. Prognostic impact of IKZF1 deletion in adults with common B-cell acute lymphoblastic leukemia.

    Science.gov (United States)

    Yao, Qiu-Mei; Liu, Kai-Yan; Gale, Robert Peter; Jiang, Bin; Liu, Yan-Rong; Jiang, Qian; Jiang, Hao; Zhang, Xiao-Hui; Zhang, Mei-Jie; Chen, Shan-Shan; Huang, Xiao-Jun; Xu, Lan-Ping; Ruan, Guo-Rui

    2016-04-11

    Interrogate the impact of IKZF1 deletion on therapy-outcomes of adults with common B-cell acute lymphoblastic leukemia. One hundred sixty-five consecutive adults with common B-cell ALL were tested for IKZF1 deletion and for BCR/ABL. Deletions in IKZF1 were detected using multiplex RQ-PCR, multiplex fluorescent PCR, sequence analysis and multiplex ligation-dependent probe amplification (MLPA). BCR/ABL was detected using RQ-PCR. All subjects received chemotherapy and some also received an allotransplant and tyrosine kinase-inhibitors. Multivariate analyses were done to identify associations between IKZF1 deletion and other variables on non-relapse mortality (NRM), cumulative incidence of relapse (CIR), leukemia-free survival (LFS) and survival. Amongst subjects achieving complete remission those with IKZF1 deletion had similar 5-year non-relapse mortality (NRM) (11% [2-20%] vs. 16% [4-28%]; P = 0.736), a higher 5-year cumulative incidence of relapse (CIR) (55% [35-76%] vs. 25% [12-38%]; P = 0.004), and worse 5-year leukemia-free survival (LFS) (33% [16-52%] vs. 59% [42-73%]; P = 0.012) and survival (48% [33-62%] vs. 75% [57-86%]; P = 0.002). In multivariate analyses IKZF1 deletion was associated with an increased relapse (relative risk [RR] =2.7, [1.4-5.2]; P = 0.002), a higher risk of treatment-failure (inverse of LFS; RR = 2.1, [1.2-3.6]; P = 0.007) and a higher risk of death (RR = 2.8, [1.5-5.5]; P = 0.002). The adverse impact of IKZF1 deletion on outcomes was stronger in subjects without vs. with BCR-ABL1 and in subjects receiving chemotherapy-only vs. an allotransplant. IKZF1 deletion was independently-associated with a higher relapse risk and worse LFS and survival in adults with common B-cell ALL after adjusting for other prognostic variables and differences in therapies. These data suggest IKZF1 deletion may be a useful prognostic variable in adults with common B-cell ALL, especially in persons without BCR-ABL1 and those receiving chemotherapy

  13. PP2A: The Achilles Heal in MDS with 5q Deletion

    Directory of Open Access Journals (Sweden)

    David eSallman

    2014-09-01

    Full Text Available Myelodysplastic syndromes (MDS represent a hematologically diverse group of myeloid neoplasms, however, one subtype characterized by an isolated deletion of chromosome 5q (del(5q is pathologically and clinically distinct. Patients with del(5q MDS share biological features that account for the profound hypoplastic anemia and unique sensitivity to treatment with lenalidomide. Ineffective erythropoiesis in del(5q MDS arises from allelic deletion of the ribosomal processing S-14 (RPS14 gene, which leads to MDM2 sequestration with consequent p53 activation and erythroid cell death. Since its approval in 2005, lenalidomide has changed the natural course of the disease. Patients who achieve transfusion independence and/or a cytogenetic response with lenalidomide have a decreased risk of progression to AML and an improved overall survival compared to non-responders. Elucidation of the mechanisms of action of lenalidomide in del(5q MDS has advanced therapeutic strategies for this disease. The selective cytotoxicity of lenalidomide in del(5q clones derives from inhibition of a haplodeficient phosphatase whose catalytic domain is encoded within the common deleted region on chromosome 5q, i.e., protein phosphatase 2A (PP2Acα. PP2A is a highly conserved, dual specificity phosphatase that plays an essential role in regulation of the G2/M checkpoint. Inhibition of PP2Acα results in cell cycle arrest and apoptosis in del(5q cells. Targeted knockdown of PP2Acα using siRNA is sufficient to sensitize non-del(5q clones to lenalidomide. Through its inhibitory effect on PP2A, lenalidomide stabilizes MDM2 to restore p53 degradation in erythroid precursors, with subsequent arrest in G2/M. Unfortunately, the majority of patients with del(5q MDS develop resistance to lenalidomide over time associated with PP2Acα overexpression. Targeted inhibition of PP2A with a more potent inhibitor has emerged as an attractive therapeutic approach for patients with del(5q MDS.

  14. Clinical spectrum and molecular diagnosis of Angelman and Prader-Willi syndrome patients with an imprinting mutation

    Energy Technology Data Exchange (ETDEWEB)

    Saitoh, S.; Cassidy, S.B.; Conroy, J.M. [Univ. of Hospitals of Cleveland, OH (United States)] [and others

    1997-01-20

    Recent studies have identified a new class of Prader-Willi syndrome (PWS) and Angelman syndrome (AS) patients who have biparental inheritance, but neither the typical deletion nor uniparental disomy (UPD) or translocation. However, these patients have uniparental DNA methylation throughout 15q11-q13, and thus appear to have a mutation in the imprinting process for this region. Here we describe detailed clinical findings of five AS imprinting mutation patients (three families) and two PWS imprinting mutation patients (one new family). All these patients have essentially the classical clinical phenotype for the respective syndrome, except that the incidence of microcephaly is lower in imprinting mutation AS patients than in deletion AS patients. Furthermore, imprinting mutation AS and PWS patients do not typically have hypopigmentation, which is commonly found in patients with the usual large deletion. Molecular diagnosis of these cases is initially achieved by DNA methylation analyses of the DN34/ZNF127, PW71 (D15S63), and SNRPN loci. The latter two probes have clear advantages in the simple molecular diagnostic analysis of PWS and AS patients with an imprinting mutation, as has been found for typical deletion or UPD PWS and AS cases. With the recent finding of inherited microdeletions in PWS and AS imprinting mutation families, our studies define a new class of these two syndromes. The clinical and molecular identification of these PWS and AS patients has important genetic counseling consequences. 49 refs., 4 figs., 3 tabs.

  15. Genetics Home Reference: 17q12 deletion syndrome

    Science.gov (United States)

    ... with 17q12 deletion syndrome have delayed development (particularly speech and language delays), intellectual disability, or behavioral or psychiatric disorders. Behavioral and psychiatric conditions that have been reported in people with 17q12 deletion syndrome include autism ...

  16. 47 CFR 76.1601 - Deletion or repositioning of broadcast signals.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 4 2010-10-01 2010-10-01 false Deletion or repositioning of broadcast signals... RADIO SERVICES MULTICHANNEL VIDEO AND CABLE TELEVISION SERVICE Notices § 76.1601 Deletion or... to § 76.1601: No deletion or repositioning of a local commercial television station shall occur...

  17. Peripheral neuropathy predicts nuclear gene defect in patients with mitochondrial ophthalmoplegia.

    Science.gov (United States)

    Horga, Alejandro; Pitceathly, Robert D S; Blake, Julian C; Woodward, Catherine E; Zapater, Pedro; Fratter, Carl; Mudanohwo, Ese E; Plant, Gordon T; Houlden, Henry; Sweeney, Mary G; Hanna, Michael G; Reilly, Mary M

    2014-12-01

    Progressive external ophthalmoplegia is a common clinical feature in mitochondrial disease caused by nuclear DNA defects and single, large-scale mitochondrial DNA deletions and is less frequently associated with point mutations of mitochondrial DNA. Peripheral neuropathy is also a frequent manifestation of mitochondrial disease, although its prevalence and characteristics varies considerably among the different syndromes and genetic aetiologies. Based on clinical observations, we systematically investigated whether the presence of peripheral neuropathy could predict the underlying genetic defect in patients with progressive external ophthalmoplegia. We analysed detailed demographic, clinical and neurophysiological data from 116 patients with genetically-defined mitochondrial disease and progressive external ophthalmoplegia. Seventy-eight patients (67%) had a single mitochondrial DNA deletion, 12 (10%) had a point mutation of mitochondrial DNA and 26 (22%) had mutations in either POLG, C10orf2 or RRM2B, or had multiple mitochondrial DNA deletions in muscle without an identified nuclear gene defect. Seventy-seven patients had neurophysiological studies; of these, 16 patients (21%) had a large-fibre peripheral neuropathy. The prevalence of peripheral neuropathy was significantly lower in patients with a single mitochondrial DNA deletion (2%) as compared to those with a point mutation of mitochondrial DNA or with a nuclear DNA defect (44% and 52%, respectively; Pperipheral neuropathy as the only independent predictor associated with a nuclear DNA defect (P=0.002; odds ratio 8.43, 95% confidence interval 2.24-31.76). Multinomial logistic regression analysis identified peripheral neuropathy, family history and hearing loss as significant predictors of the genotype, and the same three variables showed the highest performance in genotype classification in a decision tree analysis. Of these variables, peripheral neuropathy had the highest specificity (91%), negative

  18. Study the Molecular Association between a Deletion Mutation in CHEK2 gene (5395 bp and Breast Cancer

    Directory of Open Access Journals (Sweden)

    Manijeh Jalilvand

    2015-07-01

    Full Text Available Background & Objectives: Breast cancer is the most common cancer among women and the second most common cause of cancer death. Genetic factors play an important role in the development of breast cancer. Among these genetic factors, CHEk2 (checkpoint kinase 2 gene, as a tumor suppressor gene, plays a critical role in DNA repair. Germline mutations in CEHK2 result in the loss of this feature. One of the mutations in CHEK2 gene is a 5395 bp deletion mutation which has been associated with the increasing risk of Breast Cancer in some populations in the world.  In the present study, we investigated the association between a 5395 bp deletion mutation in CHEK2 gene and the risk of Breast Cancer in the women of an Iranian population. Methods: Pathologic information of 38 cases under the age of 45 and 62 cases over the age of 45 referring to surgery ward of Milad Hospital in Tehran were extracted. 100 healthy controls were included in the study as well. After obtaining informed consent, 5 mL whole blood was taken DNA was successfully isolated. Multiplex PCR was used to investigate the association between a 5395bp deletion mutation in CHEK2 gene and increasing risk of Breast Cancer among patients. Results: The 5395bp deletion mutation in CHEK2 gene was not found in any of the participating groups of patients or heathy controls. Conclusion: The present study revealed that there is no significant relation between increasing the risk of Breast Cancer and bearing large deletion mutation in exon 9 and exon 10 of CHECK2 gene.

  19. Mutational analysis of Greek patients with suspected hereditary neuropathy with liability to pressure palsies (HNPP): a 15-year experience.

    Science.gov (United States)

    Karadima, Georgia; Koutsis, Georgios; Raftopoulou, Maria; Karletidi, Karolina-Maria; Zambelis, Thomas; Karandreas, Nikolaos; Panas, Marios

    2015-06-01

    There has been limited information from population studies regarding the overall frequency of the common 1.5-Mb 17p11.2 deletion and even scarcer data regarding the overall frequency of PMP22 micromutations in patients with a clinical suspicion of hereditary neuropathy with liability to pressure palsies (HNPP). We have analysed 100 consecutive Greek patients referred for HNPP genetic testing over a 15-year period to our Neurogenetics Unit in Athens, a reference centre for all regions of Greece. All patients were screened for the 1.5-Mb deletion and a selected subgroup of deletion-negative patients for PMP22 micromutations. Mutation-positive and mutation-negative patients were compared for various clinical parameters. In total, 54 mutation-positive patients were identified. In index cases, the deletion frequency was 47.8%, and the PMP22 micromutation frequency was 2.2%. Within mutation-positive patients, the common deletion represented 95.7% and PMP22 micromutations 4.3% of cases. Two previously reported PMP22 micromutations (c.364_365delCC and c.79-2A>G) were detected. HNPP index cases had a 2.8-1 male-to-female ratio, similar to mutation-negative patients. A typical phenotype (recurrent or isolated palsies) was present in 82.4% of symptomatic HNPP cases, significantly higher than mutation-negative patients. Sensitivity of proposed electrophysiological diagnostic criteria for HNPP was calculated at 95.7% and specificity at 80.5%. In conclusion, the common HNPP deletion accounts for ∼50% and PMP22 micromutations for ∼2% of cases in a large consecutive cohort of patients with suspected HNPP. The mutational and phenotypic spectrum of HNPP is similar in the Greek population compared with other populations. Proposed electrophysiological diagnostic criteria perform satisfactorily in everyday clinical practice. © 2015 Peripheral Nerve Society.

  20. Deletion of 7q31.1 supports involvement of FOXP2 in language impairment: clinical report and review.

    Science.gov (United States)

    Lennon, P A; Cooper, M L; Peiffer, D A; Gunderson, K L; Patel, A; Peters, Sarika; Cheung, S W; Bacino, C A

    2007-04-15

    We report on a young male with moderate mental retardation, dysmorphic features, and language delay who is deleted for 7q31.1-7q31.31. His full karyotype is 46,XY,der(7)del(7)(q31.1q31.31)ins(10;7)(q24.3;q31.1q31.31)mat. This child had language impairment, including developmental verbal dyspraxia, but did not meet criteria for autism according to standardized ADOS testing. Our patient's deletion, which is the smallest reported deletion including FOXP2, adds to the body of evidence that supports the role of FOXP2 in speech and language impairment, but not in autism. A reported association between autism and deletions of WNT2, a gene also deleted in our patient, is likewise not supported by our case. Previously, fine mapping with microsatellites markers within in a large three-generation family, in which half the members had severe specific language impairment, aided the localization of the SPCH1 locus to 7q31 within markers D7S2459 (107.1 Mb) and D7S643 (120.5 Mb). Additionally, chromosome rearrangement of 7q31 and mutational analyses have supported the growing evidence that FOXP2, a gene within the SPCH1 region, is involved with speech and language development. It is unclear however whether the AUTS1 (autistic spectrum 1) locus, highly linked to 7q31, overlaps with the SPCH1 and FOXP2. Copyright 2007 Wiley-Liss, Inc.