WorldWideScience

Sample records for del gen slc4a1

  1. Evidencia de asociación entre el gen SLC6A4 y efectos epistáticos con variantes en HTR2A en la etiología del autismo en la población antioqueña

    Directory of Open Access Journals (Sweden)

    Ana Victoria Valencia

    2012-12-01

    Full Text Available Introducción. El espectro autista constituye un grupo de trastornos graves del neurodesarrollo, conun fuerte componente genético. Se ha sugerido un papel importante del sistema serotoninérgico en el desarrollo de este grupo de trastornos, con base en los estudios de respuesta a medicamentos y la hiperserotoninemia, característica común en el autismo. Se han implicado múltiples moléculas en el metabolismo y la neurotransmisión de la serotonina; sin embargo, los resultados de los estudios hantenido poca congruencia entre diferentes poblaciones. Objetivos. Evaluar la relación entre el autismo y el polimorfismo de nucleótido simple (SingleNucleotide Polymorphism, SNP en los genes SLC6A4, HTR2A e ITGB3, en una muestra de la población antioqueña. Materiales y métodos. Se genotipificaron 42 núcleos familiares con autismo para 10 variantes enlos genes SLC6A4, ITGB3 y HTR2A. Se evaluó la asociación utilizando la prueba de desequilibrio enla transmisión. Se exploró el impacto de la interacción entre estos genes y el autismo, utilizando la reducción multidimensional. Resultados. Se encontró asociación de las variantes rs4583306 (OR=2,6, p=0,004 y rs2066713(OR=2,2 p=0,03, en el gen SLC6A4, y asociación de combinaciones genotípicas entre los genes SLC6A4 y HTR2A y el riesgo de autismo (p=0,0001. Conclusiones. Se encontró asociación significativa con variantes en el gen transportador de serotoninacon el autismo, al igual que interacción entre variantes en los genes HTR2A con SLC6A4. Estos resultados concuerdan con los de estudios previos en otras poblaciones y son pruebas a favor delpapel del sistema serotoninérgico en la etiología del espectro autista.   doi: http://dx.doi.org/10.7705/biomedica.v32i4.593

  2. SLC3A1 and SLC7A9 mutations in autosomal recessive or dominant canine cystinuria: a new classification system.

    Science.gov (United States)

    Brons, A-K; Henthorn, P S; Raj, K; Fitzgerald, C A; Liu, J; Sewell, A C; Giger, U

    2013-01-01

    Cystinuria, one of the first recognized inborn errors of metabolism, has been reported in many dog breeds. To determine urinary cystine concentrations, inheritance, and mutations in the SLC3A1 and SLC7A9 genes associated with cystinuria in 3 breeds. Mixed and purebred Labrador Retrievers (n = 6), Australian Cattle Dogs (6), Miniature Pinschers (4), and 1 mixed breed dog with cystine urolithiasis, relatives and control dogs. Urinary cystinuria and aminoaciduria was assessed and exons of the SLC3A1 and SLC7A9 genes were sequenced from genomic DNA. In each breed, male and female dogs, independent of neuter status, were found to form calculi. A frameshift mutation in SLC3A1 (c.350delG) resulting in a premature stop codon was identified in autosomal-recessive (AR) cystinuria in Labrador Retrievers and mixed breed dogs. A 6 bp deletion (c.1095_1100del) removing 2 threonines in SLC3A1 was found in autosomal-dominant (AD) cystinuria with a more severe phenotype in homozygous than in heterozygous Australian Cattle Dogs. A missense mutation in SLC7A9 (c.964G>A) was discovered in AD cystinuria in Miniature Pinschers with only heterozygous affected dogs observed to date. Breed-specific DNA tests were developed, but the prevalence of each mutation remains unknown. These studies describe the first AD inheritance and the first putative SLC7A9 mutation to cause cystinuria in dogs and expand our understanding of this phenotypically and genetically heterogeneous disease, leading to a new classification system for canine cystinuria and better therapeutic management and genetic control in these breeds. Copyright © 2013 by the American College of Veterinary Internal Medicine.

  3. SLC26A4 mutations are associated with a specific inner ear malformation.

    Science.gov (United States)

    Fitoz, Suat; Sennaroğlu, Levent; Incesulu, Armağan; Cengiz, Filiz Başak; Koç, Yasemin; Tekin, Mustafa

    2007-03-01

    Inner ear anomalies have been reported in approximately 30% of children with early onset deafness. Identification of causative genetic factors in a large proportion of these patients was not successful. Mutations in the SLC26A4 gene have been detected in individuals with enlarged vestibular aqueduct (EVA) or Mondini dysplasia. We aimed to characterize the inner ear anomalies associated with SLC26A4 mutations. The SLC26A4 gene has been screened for mutations in 16 subjects from 14 unrelated Turkish families with a variety of inner ear anomalies ranging from Michel aplasia to incomplete partition-II and EVA. None of the patients was diagnosed to have a recognizable genetic syndrome. Additional four patients with Pendred syndrome from three families were included. Only one patient with EVA was found to have a heterozygous mutation (c.1586delT) in SLC26A4. All patients with Pendred syndrome had homozygous mutations and were noted to have either EVA or EVA associated with incomplete partition-II on the computed tomography of the temporal bone. SLC26A4 mutations are not associated with a large spectrum of inner ear anomalies. They, instead, result in a specific morphological appearance consistent with EVA or incomplete partition-II.

  4. A 7666-bp genomic deletion is frequent in Chinese Han deaf patients with non-syndromic enlarged vestibular aqueduct but without bi-allelic SLC26A4 mutations.

    Science.gov (United States)

    Pang, Xiuhong; Chai, Yongchuan; He, Longxia; Chen, Penghui; Wang, Xiaowen; Li, Lei; Jia, Huan; Wu, Hao; Yang, Tao

    2015-12-01

    To investigate the genetic cause of the patients with non-syndromic enlarged vestibular aqueduct (EVA) but without bi-allelic SLC26A4 mutations. Presence of a homozygous genomic deletion was detected in a Chinese Han deaf patient (D1467-1) who failed to amplify the first three exons of SLC26A4. The breakpoints of the deletion were fine-mapped and revealed by PCR amplification and sequencing. This deletion was subsequently screened in 22 Chinese Han EVA probands with mono-allelic SLC26A4 mutations. The possible founder effect of the newly identified genomic deletion was evaluated by haplotype analysis. A homozygous c.-2071_307+3801del7666 deletion of SLC26A4 was identified in patient D1467-1. This novel genomic deletion was subsequently identified in 18% (4/22) of the Chinese Han EVA probands with mono-allelic SLC26A4 mutations. Haplotype analysis showed that this genomic deletion is likely a founder mutation in Chinese Hans. Our results suggested that the cryptic c.-2071_307+3801del7666 deletion of SLC26A4 is relatively frequent in Chinese Han non-syndromic EVA patients without bi-allelic SLC26A4 mutations. Screening of this genomic deletion should be incorporated into the routine DNA testing of SLC26A4 in Chinese Hans. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  5. Na(+) dependent acid-base transporters in the choroid plexus; insights from slc4 and slc9 gene deletion studies

    DEFF Research Database (Denmark)

    Christensen, Henriette L; Nguyen, An T; Pedersen, Fredrik D

    2013-01-01

    The choroid plexus epithelium (CPE) is located in the ventricular system of the brain, where it secretes the majority of the cerebrospinal fluid (CSF) that fills the ventricular system and surrounds the central nervous system. The CPE is a highly vascularized single layer of cuboidal cells....... Genetically modified mice targeting slc4a2, slc4a5, slc4a7, slc4a10, and slc9a1 have been generated. Deletion of slc4a5, 7 or 10, or slc9a1 has numerous impacts on CP function and structure in these mice. Removal of the transporters affects brain ventricle size (slc4a5 and slc4a10) and intracellular p...

  6. SLC1 and SLC4 encode partially redundant acyl-coenzyme A 1-acylglycerol-3-phosphate O-acyltransferases of budding yeast

    DEFF Research Database (Denmark)

    Benghezal, Mohammed; Roubaty, Carole; Veepuri, Vijayanath

    2007-01-01

    Phosphatidic acid is the intermediate, from which all glycerophospholipids are synthesized. In yeast, it is generated from lysophosphatidic acid, which is acylated by Slc1p, an sn-2-specific, acyl-coenzyme A-dependent 1-acylglycerol-3-phosphate O-acyltransferase. Deletion of SLC1 is not lethal...

  7. BÚSQUEDA DE LA MUTACIÓN Phe-809 EN EL GEN DEL SUSTRATO DEL RECEPTOR DE INSULINA -1 (IRS-1 EN RATAS DIABÉTICAS eSS

    Directory of Open Access Journals (Sweden)

    Stella Maris Daniele

    2010-01-01

    Full Text Available El gen del sustrato del receptor de insulina IRS-1 juega un rol clave en la transducción de señales de insulina en músculo esquelético. Diversos polimorfismos del gen IRS-1 han sido reportados en estados de insulinorresistencia como obesidad y diabetes tipo 2.Las ratas eSS desarrollan espontáneamente diabetes tipo 2 magra, con insulinoresistencia caracterizada por hiperglucemia e hiperinsulinemia. Durante el segundo año existe disminución progresiva de la insulinemia y agravamiento del síndrome. Nuestro propósito fue buscar la mutación Phe-809 en el gen IRS-1, que implica sustitución del aminoácido Ser por Phe en el codon 809; dicho sitio se halla conservado en la rata. Esta variante fue identificada en pacientes diabéticos tipo 2. El gen del IRS-1 consta de un solo exón.Se analizó un fragmento de 281pb del gen IRS-1, que posee 90% de homología con el mismo fragmento en humanos. Se purificó ADN de leucocitos de un pool de sangre de ratas machos eSS y controles Wistar. Se cuantificó y amplificó por PCR utilizando un par de primers para amplificar ese mismo fragmento en el gen IRS-1 en humanos. Se usó sangre humana como control de amplificación. Se empleó el método de Sanger en la secuenciación del fragmento obtenido por PCR, previa extracción del mismo de un gel de agarosa al 2%. Se observó que la rata eSS y las controles mantuvieron la lectura esperada para ese fragmento, no encontrándose la mutación investigada. Se descarta la mutación Phe-809 como origen de la insulinoresistencia de la rata eSS.

  8. Sobre el significado del descubrimiento del gen FOXP2

    OpenAIRE

    Longa Martínez, Víctor Manuel

    2006-01-01

    El reciente descubrimiento del gen FOXP2 ha ofrecido la primera evidencia clara de la base genética del lenguaje, mostrando una correlación inequívoca desde la perspectiva genética entre una versión mutada de F0XP2 y los trastornos lingüísticos de diferente tipo sufridos por una familia inglesa, conocida como KE. El objetivo central del presente trabajo es discutir diferentes aspectos relacionados con tal descubrimiento; especialmente, la discusión del significado de FOXP2 con ...

  9. Generación de un modelo knock-out del gen SCN1A en Drosophila melanogaster para el estudio del síndrome de Dravet.

    OpenAIRE

    PLANELLS CÁRCEL, ANDRÉS

    2017-01-01

    [ES] El Síndrome de Dravet (SD) es una enfermedad rara infantil que se manifiesta en crisis epilépticas a temprana edad y provoca un deterioro cognitivo y conductual. Esta enfermedad es causada por mutaciones dominantes en el gen SCN1A. Este trabajo se centra en la generación de un modelo knock-out (KO) del gen paralytic en Drosophila melanogaster, homólogo al gen SCN1A en humanos, para su aplicación en el estudio del SD. A la vez se ha estudiado la conducta de cepas sensibles ...

  10. Capacidad transactivadora del gen pttg1 y su implicación en tumorigénesis

    OpenAIRE

    Romero Franco, Ana

    2016-01-01

    Falta palabras clave Objetivos: Los objetivos planteados en esta tesis doctoral son los que se enumeran a continuación: 1) Estudiar la capacidad moduladora que ejerce el gen pttg1 sobre la expresión de genes relacionados con el microambiente del tumor, en células inmortalizadas de ratón NIH3T3. 2) Estudiar la capacidad transactivadora del gen pttg1 en células tumorales humanas y establecer nexos con su posible implicación biológica en el desarrollo del tumor. 3) Estudiar el efecto en el de...

  11. Deletion of Slc26a1 and Slc26a7 Delays Enamel Mineralization in Mice

    Directory of Open Access Journals (Sweden)

    Kaifeng Yin

    2017-05-01

    Full Text Available Amelogenesis features two major developmental stages—secretory and maturation. During maturation stage, hydroxyapatite deposition and matrix turnover require delicate pH regulatory mechanisms mediated by multiple ion transporters. Several members of the Slc26 gene family (Slc26a1, Slc26a3, Slc26a4, Slc26a6, and Slc26a7, which exhibit bicarbonate transport activities, have been suggested by previous studies to be involved in maturation-stage amelogenesis, especially the key process of pH regulation. However, details regarding the functional role of these genes in enamel formation are yet to be clarified, as none of the separate mutant animal lines demonstrates any discernible enamel defects. Continuing with our previous investigation of Slc26a1−/− and Slc26a7−/− animal models, we generated a double-mutant animal line with the absence of both Slc26a1 and Slc26a7. We showed in the present study that the double-mutant enamel density was significantly lower in the regions that represent late maturation-, maturation- and secretory-stage enamel development in wild-type mandibular incisors. However, the “maturation” and “secretory” enamel microstructures in double-mutant animals resembled those observed in wild-type secretory and/or pre-secretory stages. Elemental composition analysis revealed a lack of mineral deposition and an accumulation of carbon and chloride in double-mutant enamel. Deletion of Slc26a1 and Slc26a7 did not affect the stage-specific morphology of the enamel organ. Finally, compensatory expression of pH regulator genes and ion transporters was detected in maturation-stage enamel organs of double-mutant animals when compared to wild-type. Combined with the findings from our previous study, these data indicate the involvement of SLC26A1and SLC26A7 as key ion transporters in the pH regulatory network during enamel maturation.

  12. Divergencia genética en poblaciones peruanas detectada a partir de las frecuencias haplotípicas del mtDNA y del gen nuclear MBL

    Directory of Open Access Journals (Sweden)

    Jesús H. Córdova

    2011-01-01

    Full Text Available Objetivos: Avanzar en el conocimiento del origen de las poblaciones peruanas estudiadas en un contexto filogeográfico. Diseño: Estudio genético poblacional. Instituciones: Laboratorio de Genética Humana, Facultad de Ciencias Biológicas, Universidad Nacional Mayor de San Marcos, e Instituto de Genética y Biología Molecular, Facultad de Medicina, Universidad San Martín de Porras, Lima, Perú. Participantes: Siete poblaciones peruanas. Metodología: Análisis comparativo de los resultados a partir del estudio del mtDNA y el gen nuclear MBL de siete poblaciones peruanas, procesados de manera separada y luego combinados, utilizando el programa PHYLYP 3.65, para obtener valores FST de diferenciación genética y la construcción de árboles de distancias por aplicación del algorritmo UPGMA y el análisis subsecuente de los agrupamientos (clusters generados. Principales medidas de resultados: Árboles genéticos generados. Resultados: De manera separada, los árboles generados para cada marcador genético tuvieron topologías propias y diferentes entre sí. Procesados de manera combinada, el árbol resultante demostró que los mayores valores de diferenciación genética se hallaron en las Islas del Lago Titicaca (Puno, Perú conocidas -Taquile, Amantani y Anapia-, que fue calificada como muy alta, porque mostró valores de FST de 0.3113, 0.2949 y 0.3348 respecto de las poblaciones estudiadas, tanto fuera del Departamento de Puno -como Chachapoyas, Pucallpa y Chiclayo, respectivamente-, así como a la de los Uro del mismo Puno y del mismo Lago Titicaca (0.2837. Fuera de Puno, el par de poblaciones Chachapoyas-Pucallpa fue el menos divergente, al alcanzar entre ellas un valor de FST de 0.0108, calificándosele de pequeña. Conclusiones: El árbol obtenido del procesamiento de los marcadores vía una matriz combinada demostró que las poblaciones que habitan las islas de Taquile, Amantani y Anapia, divergen notablemente de las restantes cuatro

  13. Necesidad de estudio genético para el diagnóstico de algunos casos de acidosis tubular renal distal

    Directory of Open Access Journals (Sweden)

    Manuel Heras Benito

    2016-09-01

    Full Text Available Describimos el caso de una mujer joven, que fue diagnosticada de insuficiencia renal avanzada, con un hallazgo casual de una nefrocalcinosis sin una etiología clara, al haberse encontrado asintomática a lo largo de su vida. El estudio genético por paneles de genes conocidos asociados a enfermedad tubulointersticial permitió descubrir una acidosis tubular renal distal autosómica dominante, asociada a una mutación de novo en el exón 14 del gen SLC4A1, que hubiera sido imposible diagnosticar clínicamente por lo avanzado de la enfermedad renal cuando fue descubierta.

  14. SLC37A1 and SLC37A2 are phosphate-linked, glucose-6-phosphate antiporters.

    Directory of Open Access Journals (Sweden)

    Chi-Jiunn Pan

    Full Text Available Blood glucose homeostasis between meals depends upon production of glucose within the endoplasmic reticulum (ER of the liver and kidney by hydrolysis of glucose-6-phosphate (G6P into glucose and phosphate (P(i. This reaction depends on coupling the G6P transporter (G6PT with glucose-6-phosphatase-α (G6Pase-α. Only one G6PT, also known as SLC37A4, has been characterized, and it acts as a P(i-linked G6P antiporter. The other three SLC37 family members, predicted to be sugar-phosphate:P(i exchangers, have not been characterized functionally. Using reconstituted proteoliposomes, we examine the antiporter activity of the other SLC37 members along with their ability to couple with G6Pase-α. G6PT- and mock-proteoliposomes are used as positive and negative controls, respectively. We show that SLC37A1 and SLC37A2 are ER-associated, P(i-linked antiporters, that can transport G6P. Unlike G6PT, neither is sensitive to chlorogenic acid, a competitive inhibitor of physiological ER G6P transport, and neither couples to G6Pase-α. We conclude that three of the four SLC37 family members are functional sugar-phosphate antiporters. However, only G6PT/SLC37A4 matches the characteristics of the physiological ER G6P transporter, suggesting the other SLC37 proteins have roles independent of blood glucose homeostasis.

  15. Screening of SLC26A4, FOXI1, KCNJ10, and GJB2 in bilateral deafness patients with inner ear malformation.

    Science.gov (United States)

    Chen, Kaitian; Wang, Xianren; Sun, Liang; Jiang, Hongyan

    2012-06-01

    Bilateral nonsyndromic sensorineural hearing loss associated with inner ear malformation is closely related to genetics. SLC26A4 is considered to be the major involved gene. Recently, FOXI1 and KCNJ10 mutations have been linked to enlarged vestibular aqueducts and GJB2 mutations linked to temporal bone malformation. The authors aimed to investigate the mutation spectrums of these genes in Chinese patients with bilateral hearing impairment associated with inner ear malformation. Cross-sectional study. Affiliated hospital of the university. The authors analyzed the GJB2, SLC26A4, FOXI1, and KCNJ10 gene sequences in 43 patients presenting with bilateral hearing impairment associated with inner ear malformation using pyrosequencing and direct DNA sequencing. In total, 74.4% (32/43) of patients carried at least 1 of 14 pathogenic SLC26A4 mutations, including 6 novel mutations and 4 polymorphisms. Patients with enlarged vestibular aqueducts had a higher rate of SLC26A4 mutation than Mondini dysplasia patients. No FOXI1 or KCNJ10 potential pathogenic mutation was present, and GJB2 biallelic pathogenic mutations were uncommon (2.3%; 1/43). No significant correlation was observed between the genotype and phenotype of SLC26A4 mutations. SLC26A4 accounts for 74.4% of inner ear malformations in our cohort, whereas FOXI1, KCNJ10, and GJB2 mutations are not common. Other possible genes or external factors may contribute to this multibranch abnormality.

  16. Regulators of Slc4 bicarbonate transporter activity

    Directory of Open Access Journals (Sweden)

    Ian M. Thornell

    2015-06-01

    Full Text Available The Slc4 family of transporters is comprised of anion exchangers (AE1-4, Na-coupled bicarbonate transporters (NCBTs including electrogenic Na/bicarbonate cotransporters (NBCe1 and NBCe2, electroneutral Na/bicarbonate cotransporters (NBCn1 and NBCn2, and the electroneutral Na-driven Cl-bicarbonate exchanger (NDCBE, as well as a borate transporter (BTR1. These transporters regulate intracellular pH (pHi and contribute to steady-state pHi, but are also involved in other physiological processes including CO2 carriage by red blood cells and solute secretion/reabsorption across epithelia. Acid-base transporters function as either acid extruders or acid loaders, with the Slc4 proteins moving HCO3– either into or out of cells. According to results from both molecular and functional studies, multiple Slc4 proteins and/or associated splice variants with similar expected effects on pHi are often found in the same tissue or cell. Such apparent redundancy is likely to be physiologically important. In addition to regulating pHi, a HCO3– transporter contributes to a cell’s ability to fine tune the intracellular regulation of the cotransported/exchanged ion(s (e.g., Na+ or Cl–. In addition, functionally similar transporters or splice variants with different regulatory profiles will optimize pH physiology and solute transport under various conditions or within subcellular domains. Such optimization will depend on activated signaling pathways and transporter expression profiles. In this review, we will summarize and discuss both classical and more recently identified regulators of the Slc4 proteins. Some of these regulators include traditional second messengers, lipids, binding proteins, autoregulatory domains, and less conventional regulators. The material presented will provide insight into the diversity and physiological significance of multiple members within the Slc4 gene family.

  17. Actividad del Sistema Renina-Angiotensina en relación con sus polimorfismos genéticos

    OpenAIRE

    Morcillo Hidalgo, Luis

    2015-01-01

    La realización del presente estudio sobre sujetos jóvenes y sanos no hipertensos tiene dos objetivos primordiales: El primero es analizar la relación de los polimorfismos de los genes del Sistema Renina-Angiotensina, el M235T del gen del angiotensinógeno, el Inserción/Delección del gen de la ECA y el A1166C del gen del receptor AT1 para la angiotensina II, con los niveles en plasma de angiotensina I, angiotensina II y angiotensina-(1-7), todas sustancias peptídicas activas del sistema E...

  18. NBCe1 (SLC4A4) a potential pH regulator in enamel organ cells during enamel development in the mouse

    NARCIS (Netherlands)

    Jalali, R.; Guo, J.; Zandieh-Doulabi, B.; Bervoets, T.J.M.; Paine, M.L.; Boron, W.F.; Parker, M.D.; Bijvelds, M.J.C.; Medina, J.F.; DenBesten, P.K.; Bronckers, A.L.J.J.

    2014-01-01

    During the formation of dental enamel, maturation-stage ameloblasts express ion-transporting transmembrane proteins. The SLC4 family of ion-transporters regulates intra- and extracellular pH in eukaryotic cells by cotransporting HCO3 − with Na+. Mutation in SLC4A4 (coding for the sodium-bicarbonate

  19. Structure of Bor1 supports an elevator transport mechanism for SLC4 anion exchangers.

    Science.gov (United States)

    Thurtle-Schmidt, Bryan H; Stroud, Robert M

    2016-09-20

    Boron is essential for plant growth because of its incorporation into plant cell walls; however, in excess it is toxic to plants. Boron transport and homeostasis in plants is regulated in part by the borate efflux transporter Bor1, a member of the solute carrier (SLC) 4 transporter family with homology to the human bicarbonate transporter Band 3. Here, we present the 4.1-Å resolution crystal structure of Arabidopsis thaliana Bor1. The structure displays a dimeric architecture in which dimerization is mediated by centralized Gate domains. Comparisons with a structure of Band 3 in an outward-open state reveal that the Core domains of Bor1 have rotated inwards to achieve an occluded state. Further structural comparisons with UapA, a xanthine transporter from the nucleobase-ascorbate transporter family, show that the downward pivoting of the Core domains relative to the Gate domains may access an inward-open state. These results suggest that the SLC4, SLC26, and nucleobase-ascorbate transporter families all share an elevator transport mechanism in which alternating access is provided by Core domains that carry substrates across a membrane.

  20. Exonal deletion of SLC24A4 causes hypomaturation amelogenesis imperfecta.

    Science.gov (United States)

    Seymen, F; Lee, K-E; Tran Le, C G; Yildirim, M; Gencay, K; Lee, Z H; Kim, J-W

    2014-04-01

    Amelogenesis imperfecta is a heterogeneous group of genetic conditions affecting enamel formation. Recently, mutations in solute carrier family 24 member 4 (SLC24A4) have been identified to cause autosomal recessive hypomaturation amelogenesis imperfecta. We recruited a consanguineous family with hypomaturation amelogenesis imperfecta with generalized brown discoloration. Sequencing of the candidate genes identified a 10-kb deletion, including exons 15, 16, and most of the last exon of the SLC24A4 gene. Interestingly, this deletion was caused by homologous recombination between two 354-bp-long homologous sequences located in intron 14 and the 3' UTR. This is the first report of exonal deletion in SLC24A4 providing confirmatory evidence that the function of SLC24A4 in calcium transport has a crucial role in the maturation stage of amelogenesis.

  1. AVPR1a and SLC6A4 Gene Polymorphisms Are Associated with Creative Dance Performance.

    Directory of Open Access Journals (Sweden)

    2005-09-01

    Full Text Available Dancing, which is integrally related to music, likely has its origins close to the birth of Homo sapiens, and throughout our history, dancing has been universally practiced in all societies. We hypothesized that there are differences among individuals in aptitude, propensity, and need for dancing that may partially be based on differences in common genetic polymorphisms. Identifying such differences may lead to an understanding of the neurobiological basis of one of mankind's most universal and appealing behavioral traits-dancing. In the current study, 85 current performing dancers and their parents were genotyped for the serotonin transporter (SLC6A4: promoter region HTTLPR and intron 2 VNTR and the arginine vasopressin receptor 1a (AVPR1a: promoter microsatellites RS1 and RS3. We also genotyped 91 competitive athletes and a group of nondancers/nonathletes (n = 872 subjects from 414 families. Dancers scored higher on the Tellegen Absorption Scale, a questionnaire that correlates positively with spirituality and altered states of consciousness, as well as the Reward Dependence factor in Cloninger's Tridimensional Personality Questionnaire, a measure of need for social contact and openness to communication. Highly significant differences in AVPR1a haplotype frequencies (RS1 and RS3, especially when conditional on both SLC6A4 polymorphisms (HTTLPR and VNTR, were observed between dancers and athletes using the UNPHASED program package (Cocaphase: likelihood ratio test [LRS] = 89.23, p = 0.000044. Similar results were obtained when dancers were compared to nondancers/nonathletes (Cocaphase: LRS = 92.76, p = 0.000024. These results were confirmed using a robust family-based test (Tdtphase: LRS = 46.64, p = 0.010. Association was also observed between Tellegen Absorption Scale scores and AVPR1a (Qtdtphase: global chi-square = 26.53, p = 0.047, SLC6A4 haplotypes (Qtdtphase: chi-square = 2.363, p = 0.018, and AVPR1a conditional on SCL6A4 (Tdtphase: LRS

  2. AVPR1a and SLC6A4 gene polymorphisms are associated with creative dance performance.

    Directory of Open Access Journals (Sweden)

    Rachel Bachner-Melman

    2005-09-01

    Full Text Available Dancing, which is integrally related to music, likely has its origins close to the birth of Homo sapiens, and throughout our history, dancing has been universally practiced in all societies. We hypothesized that there are differences among individuals in aptitude, propensity, and need for dancing that may partially be based on differences in common genetic polymorphisms. Identifying such differences may lead to an understanding of the neurobiological basis of one of mankind's most universal and appealing behavioral traits--dancing. In the current study, 85 current performing dancers and their parents were genotyped for the serotonin transporter (SLC6A4: promoter region HTTLPR and intron 2 VNTR and the arginine vasopressin receptor 1a (AVPR1a: promoter microsatellites RS1 and RS3. We also genotyped 91 competitive athletes and a group of nondancers/nonathletes (n = 872 subjects from 414 families. Dancers scored higher on the Tellegen Absorption Scale, a questionnaire that correlates positively with spirituality and altered states of consciousness, as well as the Reward Dependence factor in Cloninger's Tridimensional Personality Questionnaire, a measure of need for social contact and openness to communication. Highly significant differences in AVPR1a haplotype frequencies (RS1 and RS3, especially when conditional on both SLC6A4 polymorphisms (HTTLPR and VNTR, were observed between dancers and athletes using the UNPHASED program package (Cocaphase: likelihood ratio test [LRS] = 89.23, p = 0.000044. Similar results were obtained when dancers were compared to nondancers/nonathletes (Cocaphase: LRS = 92.76, p = 0.000024. These results were confirmed using a robust family-based test (Tdtphase: LRS = 46.64, p = 0.010. Association was also observed between Tellegen Absorption Scale scores and AVPR1a (Qtdtphase: global chi-square = 26.53, p = 0.047, SLC6A4 haplotypes (Qtdtphase: chi-square = 2.363, p = 0.018, and AVPR1a conditional on SCL6A4 (Tdtphase: LRS

  3. Traffic Generator (TrafficGen) Version 1.4.2: Users Guide

    Science.gov (United States)

    2016-06-01

    the network with Transmission Control Protocol and User Datagram Protocol Internet Protocol traffic. Each node generating network traffic in an...TrafficGen Graphical User Interface (GUI) 3 3.1 Anatomy of the User Interface 3 3.2 Scenario Configuration and MGEN Files 4 4. Working with...for public release; distribution is unlimited. vi List of Figures Fig. 1 TrafficGen user interface

  4. Estudio molecular del gen MLL en 30 pacientes con leucemias agudas Molecular study of MLL gen in 30 patients with acute leukemias

    Directory of Open Access Journals (Sweden)

    Raquel Levón Herrera

    2000-04-01

    Full Text Available Los reordenamientos del gen MLL en la banda cromosómica 11q23 son frecuentes en leucemias agudas (LA en niños y en las LA secundarias desarrolladas después de la terapia con inhibidores de la enzima topoisomerasa II. En menor medida también se aprecia en adultos con LA. La presencia de estos reordenamientos se considera un indicador de mal pronóstico asociado con resultados clínicos desfavorables, por ello es muy importante realizar su determinación en las LA. En este trabajo mostramos los resultados preliminares de la introducción del estudio del gen MLL en nuestro país mediante la técnica de Southern. Analizamos ADN de 30 pacientes con LA, incluidos niños y adultos, que en el momento del estudio se encontraban al debut o en recaída. El estudio molecular se realizó con la sonda FA4, que es un inserto genómico del gen MLL. Sólo uno de los 30 pacientes mostró bandas de reordenamiento con 2 enzimas de restricción diferentes, el resto mostró el gen MLL en configuración germinal. Es interesante destacar que el paciente con el reordenamiento era un niño con leucemia mieloblástica aguda subtipo M5b, lo cual concuerda con la literatura, donde se describe que estos reordenamientos están estrechamente correlacionados con los subtipos mielomonocítico (M4 y monocítico (M5 de leucemia mieloide aguda (LMARearrangements of MLL gen in llq23 chromosomal band are frequents in childhood type of acute leukemia (AL and in secondary AL, developed after therapy with II topoisomerase enzyme. To a lesser extent also is seen in adults with AL. Presence of theses rearrangements is considered to be a worse prognosis indicator, associated with unfavourable clinical results, that is why it is very important to carry our its assessment in AL. In this paper authors present preliminary results from introduction of study on MLL gen in our country through Southern technique. DNA from 30 patients was analized, including children and adults, that at the

  5. Prevalencia de bacterias Gram negativas portadoras del gen blaKPC en hospitales de Colombia

    Directory of Open Access Journals (Sweden)

    Robinson Pacheco

    2014-04-01

    Full Text Available Introducción. Las enzimas carbapenemasas de tipo KPC tienen gran capacidad de diseminación, son causantes de epidemias y se asocian a mayor mortalidad y estancia hospitalaria. En Colombia se han venido reportando cada vez más desde 2007, pero se desconoce la prevalencia hospitalaria. Objetivo. Estimar la prevalencia hospitalaria del gen blaKPC. Materiales y métodos. Se evaluó la presencia del gen blaKPC y su ‘clonalidad’ en aislamientos de enterobacterias y Pseudomonas aeruginosa de pacientes hospitalizados. Resultados. De los 424 aislamientos evaluados durante el periodo de estudio, 273 cumplieron con criterios de elegibilidad, 31,1 % fue positivo para el gen blaKPC y, al ajustar por ‘clonalidad’, la positividad fue de 12,8 %. El gen blaKPC se encontró con mayor frecuencia en Klebsiella pneumoniae seguido de P. aeruginosa y otras enterobacterias. A pesar de que la unidad de cuidados intensivos aportó el mayor número de aislamientos, no se encontró un patrón más prevalente del gen blaKPC en las ellas que en las otras salas. El aparato respiratorio fue el sitio anatómico de origen con la mayor prevalencia. No se presentó estacionalidad en la frecuencia de los aislamientos portadores del gen blaKPC. Conclusión. Este estudio reveló la alta prevalencia del gen blaKPC en diferentes microorganismos aislados en varias instituciones hospitalarias del país. La extraordinaria capacidad de propagación del gen blaKPC, las dificultades del diagnóstico y la limitada disponibilidad de antibióticos plantean la apremiante necesidad de fortalecer los sistemas de vigilancia epidemiológica y ajustar oportunamente las políticas institucionales de uso racional de antibióticos con el fin de contener su diseminación a otras instituciones de salud del país.

  6. Developmental expression of SLC26A4 (Pendrin) during amelogenesis in developing rodent teeth

    Science.gov (United States)

    Bronckers, Antonius LJJ; Guo, Jing; Zandieh-Doulabi, Behrouz; Bervoets, Theodore J; Lyaruu, Donacian M.; Li, Xiangming; Wangemann, Philine; DenBesten, Pamela

    2012-01-01

    Ameloblasts need to regulate pH during formation of enamel crystals, a process that generates protons. Solute carrier family 26A member 4 (SLC26A4, or pendrin) is an anion exchanger for chloride, bicarbonate, iodine and formate. It is expressed in apical membranes of ion-transporting epithelia in kidney, inner ear and thyroid where it regulates luminal pH and fluid transport. We hypothesized that maturation ameloblasts express SLC26A4 to neutralize acidification of enamel fluid in forming enamel. In rodents, secretory and maturation ameloblasts were immunopositive for SLC26A4. Staining was particularly strong in apical membranes of maturation ameloblasts facing forming enamel. RT-PCR confirmed the presence of mRNA transcripts for Slc26a4 in enamel organs. SLC26A4 immunostaining was also found in mineralizing connective tissues including odontoblasts, osteoblasts, osteocytes, osteoclasts, bone lining cells, cellular cementoblasts and cementocytes. However, Slc26a4-null mutant mice had no overt dental phenotype. The presence of SLC26A4 in apical plasma membranes of maturation ameloblasts is consistent with a potential function as pH regulator. SLC26A4 does not appear critical for ameloblast functioning and is likely compensated by other pH regulators. PMID:22243245

  7. Análisis genético del virus peruano de la fiebre amarilla

    Directory of Open Access Journals (Sweden)

    Carlos Yábar V

    2002-01-01

    Full Text Available Objetivo: Determinar las variantes genéticas de aislamientos del virus peruano de la Fiebre Amarilla (FA. Materiales y métodos: la región carboxiterminal del gen de la envoltura (E de cinco aislamientos de FA obtenidas de pacientes provenientes de Ayacucho 1978 (PER1, Junín 1995 (PER2, Cerro de Pasco (PER3, Cusco (1998 y San Martín (1999 fue amplificada por PCR, secuenciada y analizada con programas software de ADN. Resultados: el índice de similaridad de la secuencia de nucleótidos entre los cinco aislamientos reveló valores oscilantes entre 94,3% y 99,3%, mientras que la secuencia de aminoácidos presentó valores entre 97,6% y 99,7% de similaridad. El análisis filogenético demostró una distancia genética entre 0,40 y 6,50 mediante la secuencia de nucleótidos y a través de la secuencia de aminoácidos se observó un rango de 0,30 y 4,29. Sin embargo, las secuencias correspondientes a los sitios de glicosilación y a los epítopes de reconocimiento humoral fueron conservadas entre los cinco aislamientos, con excepción de algunos aislamientos de referencia reportados por otros autores. Conclusiones: los virus de FA peruanos forman un grupo filogenético distinto a otros virus de FA sudamericanos, basados en el análisis genéticos del gen E.

  8. A single base deletion in the SLC45A2 gene in a Bullmastiff with oculocutaneous albinism.

    Science.gov (United States)

    Caduff, M; Bauer, A; Jagannathan, V; Leeb, T

    2017-10-01

    Oculocutaneous albinism type 4 (OCA4) in humans and similar phenotypes in many animal species are caused by variants in the SLC45A2 gene, encoding a putative sugar transporter. In dog, two independent SLC45A2 variants are known that cause oculocutaneous albinism in Doberman Pinschers and several small dog breeds respectively. For the present study, we investigated a Bullmastiff with oculocutaneous albinism. The affected dog was highly inbred and resulted from the mating of a sire to its own grandmother. We obtained whole genome sequence data from the affected dog and searched specifically for variants in candidate genes known to cause albinism. We detected a single base deletion in exon 6 of the SLC45A2 gene (NM_001037947.1:c.1287delC) that has not been reported thus far. This deletion is predicted to result in an early premature stop codon. It was confirmed by Sanger sequencing and perfectly co-segregated with the phenotype in the available family members. We genotyped 174 unrelated dogs from diverse breeds, all of which were homozygous wildtype. We therefore suggest that SLC45A2:c.1287delC causes the observed oculocutaneous albinism in the affected Bullmastiff. © 2017 Stichting International Foundation for Animal Genetics.

  9. Genetic moderation of cocaine subjective effects by variation in the TPH1, TPH2, and SLC6A4 serotonin genes.

    Science.gov (United States)

    Patriquin, Michelle A; Hamon, Sara C; Harding, Mark J; Nielsen, Ellen M; Newton, Thomas F; De La Garza, Richard; Nielsen, David A

    2017-10-01

    This study investigated variants of tryptophan hydroxylase (TPH)1, TPH2, and SLC6A4 in the moderation of the subjective effects of cocaine. Non-treatment-seeking cocaine-dependent individuals (N=66) were intravenously administered saline and cocaine (40 mg) in a randomized order. Participants self-reported subjective effects of cocaine using a visual analog scale starting before administration of saline or cocaine (-15 min) to up to 20 min after infusion. Self-report ratings on the visual analog scale ranged from 0 (no effect) to 100 (greatest effect). Participants were genotyped for the TPH1 rs1799913, TPH2 rs4290270, and SLC6A4 5-HTTLPR variants. Repeated-measures analysis of covariance was used to examine changes in subjective effect scores over time while controlling for population structure. Participants carrying the TPH1 rs1799913 A allele reported greater subjective response to cocaine for 'stimulated' and 'access' relative to the CC genotype group. Those carrying the TPH2 rs4290270 A allele reported higher 'good effect' and lower 'depressed' effect relative to the TT genotype group. Those carrying the SLC6A4 5-HTTLPR S' allele reported greater 'desire' and 'access' compared with the L'L' genotype group. These findings indicate that TPH1, TPH2, and SLC6A4 variants moderate the subjective effects of cocaine in non-treatment-seeking cocaine-dependent participants.

  10. Dicty_cDB: SLC405 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC405 (Link to dictyBase) - - - Contig-U11279-1 | Contig-U16243-1 SLC4...05P (Link to Original site) SLC405F 536 SLC405Z 439 SLC405P 975 - - Show SLC405 Library SL (Link to library) Clone ID SLC4...79-1 | Contig-U16243-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...05Q.Seq.d/ Representative seq. ID SLC405P (Link to Original site) Representative DNA sequence >SLC405 (SLC4...05Q) /CSM/SL/SLC4-A/SLC405Q.Seq.d/ ATAACTAATAAAATGTCATTCAATTCAAGAATTGAAACTATTTCTCGCCACTTAAGCACT

  11. Deletions at SLC18A1 increased the risk of CRC and lower SLC18A1 expression associated with poor CRC outcome.

    Science.gov (United States)

    Zhang, Dandan; Li, Zhenli; Xu, Xiaohong; Zhou, Dan; Tang, Shunli; Yin, Xiaoyang; Xu, Fangying; Li, Hui; Zhou, Yuan; Zhu, Tao; Deng, Hong; Zhang, Shuai; Huang, Qiong; Wang, Jing; Yin, Wei; Zhu, Yimin; Lai, Maode

    2017-10-26

    Copy number variations (CNVs) contribute to the development of colorectal cancer (CRC). We conducted a two-stage association study to identify CNV risk loci for CRC. We performed a gene-based rare CNV study on 694 sporadic CRC and 1641 controls using Illumina Human-OmniExpress-12v1.0 BeadChips, and further replicated in 934 CRC cases and 2680 controls for risk CNVs by using TaqMan Copy Number Assay. Tumor buddings, cancer cells in the center of primary tumor and normal intestinal epithelial cells were captured using laser capture microdissection (LCM) and were assayed using AffymetrixGeneChip® Human Genome U133 Plus 2.0 Array. In addition, The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus data were assessed for the effects of risk CNVs. We found that germline deletions affecting the last six exons of SLC18A1 significantly associated with CRC with a combined P value of 6.4 × 10-5 by a two-stage analysis. Both in TCGA CRC RNA seq dataset and GDS4382, SLC18A1 was significantly down regulated in CRC tissues than in paired normal tissues (N = 32 and 17 pairs, P = 0.004 and 0.009, respectively). In LCM samples, similar observations were obtained that the expression levels of SLC18A1 in the tumor buddings, cancer cells in the center of primary tumor, and stroma of both tumor budding and cancer cells were lower than normal intestinal epithelial and stromal cells (fold change = 0.17-0.62, 0.12-0.57 and 0.37-0.68, respectively). In summary, the germline deletions at SLC18A1 contributed to the development of CRC. The role of SLC18A1 required further exploration. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  12. Developmental expression of solute carrier family 26A member 4 (SLC26A4/pendrin) during amelogenesis in developing rodent teeth.

    Science.gov (United States)

    Bronckers, Antonius L J J; Guo, Jing; Zandieh-Doulabi, Behrouz; Bervoets, Theodore J; Lyaruu, Donacian M; Li, Xiangming; Wangemann, Philine; DenBesten, Pamela

    2011-12-01

    Ameloblasts need to regulate pH during the formation of enamel crystals, a process that generates protons. Solute carrier family 26A member 4 (SLC26A4, or pendrin) is an anion exchanger for chloride, bicarbonate, iodine, and formate. It is expressed in apical membranes of ion-transporting epithelia in kidney, inner ear, and thyroid where it regulates luminal pH and fluid transport. We hypothesized that maturation ameloblasts express SLC26A4 to neutralize acidification of enamel fluid in forming enamel. In rodents, secretory and maturation ameloblasts were immunopositive for SLC26A4. Staining was particularly strong in apical membranes of maturation ameloblasts facing forming enamel. RT-PCR confirmed the presence of mRNA transcripts for Slc26a4 in enamel organs. SLC26A4 immunostaining was also found in mineralizing connective tissues, including odontoblasts, osteoblasts, osteocytes, osteoclasts, bone lining cells, cellular cementoblasts, and cementocytes. However, Slc26a4-null mutant mice had no overt dental phenotype. The presence of SLC26A4 in apical plasma membranes of maturation ameloblasts is consistent with a potential function as a pH regulator. SLC26A4 does not appear to be critical for ameloblast function and is probably compensated by other pH regulators. © 2011 Eur J Oral Sci.

  13. Epigenetic adaptation of the placental serotonin transporter gene (SLC6A4 to gestational diabetes mellitus.

    Directory of Open Access Journals (Sweden)

    Sofia Blazevic

    Full Text Available We tested the hypothesis that gestational diabetes mellitus (GDM alters the DNA methylation pattern of the fetal serotonin transporter gene (SLC6A4, and examined the functional relevance of DNA methylation for regulation of the SLC6A4 expression in the human placenta. The study included 50 mother-infant pairs. Eighteen mothers were diagnosed with GDM and 32 had normal glucose tolerance (NGT. All neonates were of normal birth weight and born at term by planned Cesarean section. DNA and RNA were isolated from samples of tissue collected from the fetal side of the placenta immediately after delivery. DNA methylation was quantified at 7 CpG sites within the SLC6A4 distal promoter region using PCR amplification of bisulfite treated DNA and subsequent DNA sequencing. SLC6A4 mRNA levels were measured by reverse transcription-quantitative PCR (RT-qPCR. Functional SLC6A4 polymorphisms (5HTTLPR, STin2, rs25531 were genotyped using standard PCR-based procedures. Average DNA methylation across the 7 analyzed loci was decreased in the GDM as compared to the NGT group (by 27.1%, p = 0.037 and negatively correlated, before and after adjustment for potential confounder/s, with maternal plasma glucose levels at the 24th to 28th week of gestation (p0.05. The results suggest that DNA methylation of the fetal SLC6A4 gene is sensitive to the maternal metabolic state in pregnancy. They also indicate a predominant role of epigenetic over genetic mechanisms in the regulation of SLC6A4 expression in the human placenta. Longitudinal studies in larger cohorts are needed to verify these results and determine to which degree placental SLC6A4 changes may contribute to long-term outcomes of infants exposed to GDM.

  14. TGF-β signaling directly regulates transcription and functional expression of the electrogenic sodium bicarbonate cotransporter 1, NBCe1 (SLC4A4), via Smad4 in mouse astrocytes.

    Science.gov (United States)

    Khakipoor, Shokoufeh; Ophoven, Christian; Schrödl-Häußel, Magdalena; Feuerstein, Melanie; Heimrich, Bernd; Deitmer, Joachim W; Roussa, Eleni

    2017-08-01

    The electrogenic sodium bicarbonate cotransporter NBCe1 (SLC4A4) expressed in astrocytes regulates intracellular and extracellular pH. Here, we introduce transforming growth factor beta (TGF-β) as a novel regulator of NBCe1 transcription and functional expression. Using hippocampal slices and primary hippocampal and cortical astrocyte cultures, we investigated regulation of NBCe1 and elucidated the underlying signaling pathways by RT-PCR, immunoblotting, immunofluorescence, intracellular H( + ) recording using the H( + ) -sensitive dye 2',7'-bis-(carboxyethyl)-5-(and-6)-carboxyfluorescein, mink lung epithelial cell (MLEC) assay, and chromatin immunoprecipitation. Activation of TGF-β signaling significantly upregulated transcript, protein, and surface expression of NBCe1. These effects were TGF-β receptor-mediated and suppressed following inhibition of JNK and Smad signaling. Moreover, 4-aminopyridine (4AP)-dependent NBCe1 regulation requires TGF-β. TGF-β increased the rate and amplitude of intracellular H + changes upon challenging NBCe1 in wild-type astrocytes but not in cortical astrocytes from Slc4a4-deficient mice. A Smad4 binding sequence was identified in the NBCe1 promoter and Smad4 binding increased after activation of TGF-β signaling. The data show for the first time that NBCe1 is a direct target of TGF-β/Smad4 signaling. Through activation of the canonical pathway TGF-β acts directly on NBCe1 by binding of Smad4 to the NBCe1 promoter and regulating its transcription, followed by increased protein expression and transport activity. © 2017 The Authors GLIA Published by Wiley Periodicals, Inc.

  15. Differential expression of the Slc4 bicarbonate transporter family in murine corneal endothelium and cell culture.

    Science.gov (United States)

    Shei, William; Liu, Jun; Htoon, Hla M; Aung, Tin; Vithana, Eranga N

    2013-01-01

    To characterize the relative expression levels of all the solute carrier 4 (Slc4) transporter family members (Slc4a1-Slc4a11) in murine corneal endothelium using real-time quantitative (qPCR), to identify further important members besides Slc4a11 and Slc4a4, and to explore how close to the baseline levels the gene expressions remain after cells have been subjected to expansion and culture. Descemet's membrane-endothelial layers of 8-10-week-old C57BL6 mice were stripped from corneas and used for both primary cell culture and direct RNA extraction. Total RNA (from uncultured cells as well as cultured cells at passages 2 and 7) was reverse transcribed, and the cDNA was used for real time qPCR using specific primers for all the Slc4 family members. The geNorm method was applied to determine the most stable housekeeping genes and normalization factor, which was calculated from multiple housekeeping genes for more accurate and robust quantification. qPCR analyses revealed that all Slc4 bicarbonate transporter family members were expressed in mouse corneal endothelium. Slc4a11 showed the highest expression, which was approximately three times higher than that of Slc4a4 (3.4±0.3; p=0.004). All Slc4 genes were also expressed in cultured cells, and interestingly, the expression of Slc4a11 in cultured cells was significantly reduced by approximately 20-fold (0.05±0.001; p=0.000001) in early passage and by approximately sevenfold (0.14±0.002; p=0.000002) in late passage cells. Given the known involvement of SLC4A4 and SLC4A11 in corneal dystrophies, we speculate that the other two highly expressed genes in the uncultured corneal endothelium, SLC4A2 and SLC4A7, are worthy of being considered as potential candidate genes for corneal endothelial diseases. Moreover, as cell culture can affect expression levels of Slc4 genes, caution and careful design of experiments are necessary when undertaking studies of Slc4-mediated ion transport in cultured cells.

  16. Dicty_cDB: SLC492 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC492 (Link to dictyBase) - - - Contig-U10734-1 | Contig-U12865-1 SLC4...92P (Link to Original site) SLC492F 645 SLC492Z 550 SLC492P 1195 - - Show SLC492 Library SL (Link to library) Clone ID SLC4...734-1 | Contig-U12865-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC4...92Q.Seq.d/ Representative seq. ID SLC492P (Link to Original site) Representative DNA sequence >SLC492 (SLC4...92Q) /CSM/SL/SLC4-D/SLC492Q.Seq.d/ AAAAAAAAAATATACAAATAATGAATAAATTTTTAGCTTTGTTATTTGTTTTAGCTTTGT

  17. Dicty_cDB: SLC432 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC432 (Link to dictyBase) - - - Contig-U09715-1 | Contig-U16382-1 SLC4...32P (Link to Original site) SLC432F 633 SLC432Z 188 SLC432P 821 - - Show SLC432 Library SL (Link to library) Clone ID SLC4...15-1 | Contig-U16382-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC4...32Q.Seq.d/ Representative seq. ID SLC432P (Link to Original site) Representative DNA sequence >SLC432 (SLC4...32Q) /CSM/SL/SLC4-B/SLC432Q.Seq.d/ ATTAAATTAAATAAAAAATAAAAATGGATGGTGAAGATGTTCAAGCTTTAGTTATTGATA

  18. Dicty_cDB: SLC424 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC424 (Link to dictyBase) - G01086 DDB0231665 Contig-U08784-1 SLC4...24P (Link to Original site) SLC424F 169 SLC424Z 538 SLC424P 707 - - Show SLC424 Library SL (Link to library) Clone ID SLC4...ontig-U08784-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...24Q.Seq.d/ Representative seq. ID SLC424P (Link to Original site) Representative DNA sequence >SLC424 (SLC424Q) /CSM/SL/SLC4...-A/SLC424Q.Seq.d/ GGATATTATAATTTCAAATTAAGTTTTATAAATTTGAAATAATATTGAAAAAAAAAAAAA ATAAAAAA

  19. SLC26A4 Variations Among Graves’ Hyper-Functioning Thyroid Gland

    Directory of Open Access Journals (Sweden)

    Hassen Hadj-Kacem

    2010-01-01

    Full Text Available Deleterious mutations of SLC26A4 cause Pendred syndrome (PS, an autosomal recessive disorder comprising goitre and deafness with enlarged vestibular aqueducts (EVA, and nonsyndromic hearing loss (NSHL. However, the SLC26A4 hyperactivity was recently associated with the emergence of autoimmune thyroid diseases (AITD and asthma among human and mouse model. Here, by direct sequencing, we investigate the sequences of the 20 coding exons (2 to 21 of SLC26A4 and their flanking intron-exon junctions among patients affected with Graves' disease (GD hyperthyroidism. Ten mono-allelic variants were identified, seven of which are intronic and previously unreported. Two, c.898A>C (p.I300L and c.1061T>C (p.F354S, of the three exonic variants are non synonymous. The p.F354S variant is already described to be involved in PS or NSHL inheritances. The exploration by PCR-RFLP of p.I300L and p.F354S variants among 132 GD patients, 105 Hashimoto thyroiditis (HT, 206 Healthy subjects and 102 families with NSHL have shown the presence of both variants. The p.F354S variation was identified both among patients (1~HT and 3 GD and healthy subjects (n=5. Whereas, the p.I300L variant was identified only in GD patients (n=3. Our studies provide evidence of the importance of systematic analysis of SLC26A4 gene sequences on models other than deafness. This approach allows the identification of new variants and the review of the pathogenic effects of certain mono-allelic variants reported responsible for PS and NSHL development.

  20. SLC4A11 Prevents Osmotic Imbalance Leading to Corneal Endothelial Dystrophy, Deafness, and Polyuria*

    Science.gov (United States)

    Gröger, Nicole; Fröhlich, Henning; Maier, Hannes; Olbrich, Andrea; Kostin, Sawa; Braun, Thomas; Boettger, Thomas

    2010-01-01

    Maintenance of ion concentration gradients is essential for the function of many organs, including the kidney, the cornea, and the inner ear. Ion concentrations and fluid content in the cornea are regulated by endothelial cells that separate the collagenous avascular corneal stroma from the anterior eye chamber. Failure to maintain correct ion concentrations leads to swelling and destruction of the cornea. In the inner ear, the stria vascularis is responsible for generating proper ion concentrations in the endolymph, which is essential for hearing. Mutations of SLC4A11 in humans lead to syndromes associated with corneal dystrophy and perceptive deafness. The molecular mechanisms underlying these symptoms are poorly understood, impeding therapeutic interventions. The ion transporter SLC4A11 mediates sodium-dependent transport of borate as well as flux of sodium and hydroxyl ions in vitro. Here, we show that SLC4A11 is expressed in the endothelial cells of the cornea where it prevents severe morphological changes of the cornea caused by increased sodium chloride concentrations in the stroma. In the inner ear, SLC4A11 is located in fibrocytes underlying the stria vascularis. Loss of SLC4A11 leads to morphological changes in the fibrocytes and deafness. We demonstrate that SLC4A11 is essential for the generation of the endocochlear potential but not for regulation of potassium concentrations in the endolymph. In the kidney, SLC4A11 is expressed in the thin descending limb of Henle loop. SLC4A11 is essential for urinary concentration, suggesting that SLC4A11 participates in the countercurrent multiplication that concentrates urine in the kidney medulla. PMID:20185830

  1. Prevention of the disrupted enamel phenotype in Slc4a4-null mice using explant organ culture maintained in a living host kidney capsule.

    Directory of Open Access Journals (Sweden)

    Xin Wen

    Full Text Available Slc4a4-null mice are a model of proximal renal tubular acidosis (pRTA. Slc4a4 encodes the electrogenic sodium base transporter NBCe1 that is involved in transcellular base transport and pH regulation during amelogenesis. Patients with mutations in the SLC4A4 gene and Slc4a4-null mice present with dysplastic enamel, amongst other pathologies. Loss of NBCe1 function leads to local abnormalities in enamel matrix pH regulation. Loss of NBCe1 function also results in systemic acidemic blood pH. Whether local changes in enamel pH and/or a decrease in systemic pH are the cause of the abnormal enamel phenotype is currently unknown. In the present study we addressed this question by explanting fetal wild-type and Slc4a4-null mandibles into healthy host kidney capsules to study enamel formation in the absence of systemic acidemia. Mandibular E11.5 explants from NBCe1-/- mice, maintained in host kidney capsules for 70 days, resulted in teeth with enamel and dentin with morphological and mineralization properties similar to cultured NBCe1+/+ mandibles grown under identical conditions. Ameloblasts express a number of proteins involved in dynamic changes in H+/base transport during amelogenesis. Despite the capacity of ameloblasts to dynamically modulate the local pH of the enamel matrix, at least in the NBCe1-/- mice, the systemic pH also appears to contribute to the enamel phenotype. Extrapolating these data to humans, our findings suggest that in patients with NBCe1 mutations, correction of the systemic metabolic acidosis at a sufficiently early time point may lead to amelioration of enamel abnormalities.

  2. Dicty_cDB: SLC413 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC413 (Link to dictyBase) - - - Contig-U15735-1 SLC413P (Link to Original site) SLC4...13F 686 SLC413Z 466 SLC413P 1152 - - Show SLC413 Library SL (Link to library) Clone ID SLC4...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC413Q.Seq.d/ Representative seq. ID SLC4...13P (Link to Original site) Representative DNA sequence >SLC413 (SLC413Q) /CSM/SL/SLC4-A/SLC4...iknkikkknikqkkkk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC413 (SLC413Q) /CSM/SL/SLC4

  3. Variantes polimórficas Ala513Pro y Gly972Arg del gen IRS-1 no se asocian a la diabetes mellitus tipo 2 en un grupo de la población cubana The Ala513Pro and Gly972ARg polymorphous variants of IRS-1 gen are not associated with type diabetes mellitus in a group of the Cuban population

    Directory of Open Access Journals (Sweden)

    Luis Miguel Pérez

    2011-08-01

    Full Text Available Introducción: la diabetes mellitus tipo 2 es una enfermedad heterogénea y multifactorial, que está determinada por factores genéticos y no genéticos. El sustrato 1 del receptor de la insulina (IRS-1 cumple una función fundamental en la transmisión de la señal insulínica, por tanto sus variantes génicas constituyen blancos importantes en el estudio de la susceptibilidad genética a esta enfermedad en las diferentes poblaciones. Objetivo: explorar el papel de las variantes polimórficas Gly972Arg y Ala513Pro del gen IRS-1 en la susceptibilidad genética de la diabetes mellitus tipo 2 en un grupo de la población cubana. Métodos: se determinó la frecuencia de los polimorfismos Gly972Arg y Ala513Pro del IRS-1 en 499 ciudadanos cubanos, con un índice de masa corporal entre 22-30, con edades comprendidas entre los 40 y 70 años: de ellos 272 (54,5 % diabéticos y 227 (45,5 % no diabéticos. Resultados: la frecuencia del alelo Pro513 fue baja (1,2 % y similar para ambos grupos (1,1 % vs. 1,3 % para el grupo de diabéticos y el grupo control, respectivamente. La frecuencia del polimorfismo Gly972Arg fue de 16,2%, superior a la reportada para la mayoría de las poblaciones estudiadas. No se encontraron diferencias significativas en la frecuencia del alelo Arg972 entre el grupo de diabéticos y el grupo control (15,4 % vs. 17,3 %, ni cambios en los niveles de glucemia e insulinemia asociados a la presencia del alelo polimórfico Arg972. Conclusiones: en este grupo de sujetos de la población cubana, las variantes polimórficas Ala513Pro y Gly972Arg del gen IRS-1 no participan en la etiología de la diabetes mellitus tipo 2.Introduction: the type 2 diabetes mellitus is a heterogeneous and multifactor disease determined by genetic and no-genetic factors. The substrate 1 of insulin receptor (IRS-1 has a fundamental function in transmission of insulin signal, thus its genic variants are significant targets in study of genetic susceptibility to

  4. Dicty_cDB: SLC441 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC441 (Link to dictyBase) - - - Contig-U00414-1 SLC441P (Link to Original site) SLC4...41F 207 SLC441Z 473 SLC441P 680 - - Show SLC441 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC441Q.Seq.d/ Representative seq. ID SLC4...41P (Link to Original site) Representative DNA sequence >SLC441 (SLC441Q) /CSM/SL/SLC4-B/SLC4...Q) /CSM/SL/SLI1-C/SLI162Q.Seq.d/ 896 0.0 SLC441 (SLC441Q) /CSM/SL/SLC4-B/SLC441Q.Seq.d/ 896 0.0 AFK293 (AFK2

  5. Dicty_cDB: SLC404 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC404 (Link to dictyBase) - G22406 DDB0190371 Contig-U03918-1 SLC4...04E (Link to Original site) - - - - - - SLC404E 229 Show SLC404 Library SL (Link to library) Clone ID SLC4...riginal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC404Q.Seq.d/ ...Representative seq. ID SLC404E (Link to Original site) Representative DNA sequence >SLC404 (SLC404Q) /CSM/SL/SLC4-A/SLC4...y vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC404 (SLC404Q) /CSM/SL/SLC4-A/SLC4

  6. Dicty_cDB: SLC494 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC494 (Link to dictyBase) - - - Contig-U16260-1 SLC494Z (Link... to Original site) - - SLC494Z 451 - - - - Show SLC494 Library SL (Link to library) Clone ID SLC494 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC494Q.Seq.d/ Representative seq. ID SLC49...4Z (Link to Original site) Representative DNA sequence >SLC494 (SLC494Q) /CSM/SL/SLC4-D/SLC494Q.Seq.d/ XXXXX...a: 0.00 m3b: 0.00 m_ : 1.00 52.0 %: cytoplasmic 36.0 %: nuclear 8.0 %: cytoskeletal 4.0 %: mitochondrial >> prediction for SLC4

  7. Dicty_cDB: SLC411 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC411 (Link to dictyBase) - - - Contig-U16272-1 SLC411Z (Link... to Original site) - - SLC411Z 486 - - - - Show SLC411 Library SL (Link to library) Clone ID SLC411 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC411Q.Seq.d/ Representative seq. ID SLC41...1Z (Link to Original site) Representative DNA sequence >SLC411 (SLC411Q) /CSM/SL/SLC4-A/SLC411Q.Seq.d/ XXXXX...vacuolar 4.0 %: peroxisomal >> prediction for SLC411 is nuc 5' end seq. ID - 5' e

  8. Estructura y diversidad genética en vacas Holstein de Antioquia usando un polimorfismo del gen bGH

    Directory of Open Access Journals (Sweden)

    Juan Rincon F.

    2013-03-01

    Full Text Available Objetivo. Determinar las frecuencias alélicas y genotípicas del polimorfismo del intrón 3 del gen bGH y estimar algunos parámetros de estructura poblacional en ganado Holstein. Materiales y métodos. El estudio se realizó con 1366 vacas Holstein en 120 hatos de 11 municipios del departamento de Antioquia. Se extrajo DNA por el método de Salting out y la genotipificación se realizó usando la técnica de PCR-RFLPs. La diversidad genética se determinó mediante la comparación de las heterocigosidades, El equilibrio de Hardy-Weinberg (HW y la diferenciación genética entre las poblaciones se realizó usando el software Arlequín 2.0 Las frecuencias alélicas y genotípicas se evaluaron mediante el paquete estadístico SAS®. Resultados. Las frecuencias genotípicas encontradas fueron 0.764 (+/+, 0.223 (+/- y 0.013 (-/- y las frecuencias alélicas 0.876 (+ y 0.124 (-. No se encontraron desviaciones del Equilibrio de Hardy Weinberg en ninguna de las subpoblaciones. La diversidad genética determinada mediante la comparación de las heterocigosidades fue relativamente baja entre poblaciones pero al interior de estas no. El valor de FST de toda la población fue de 0.0068 y significativo (p<0.05, algunos FST pareados también lo fueron, tomando valores desde 0.0 a 0.13. Los estadísticos FIT y FIS no fueron significativos. Conclusiones. El gen bGH es un candidato interesante para evaluar características de importancia económica ya que no parece haber sido sometido a selección directa, presenta una variabilidad media en las poblaciones, observándose diferenciación genética significativa entre distintos municipios, producto de los diferentes sistemas de producción y acceso a las biotecnologías.

  9. Aspectos genéticos y neuroendocrinos en el trastorno del espectro autista

    OpenAIRE

    Oviedo, Norma; Manuel-Apolinar, Leticia; de la Chesnaye, Elsa; Guerra-Araiza, Christian

    2015-01-01

    El autismo, hoy en día definido como trastornos del espectro autista, fue descrito inicialmente en 1943. Se caracteriza por alteraciones en la comunicación, la interacción social y un espectro restringido de intereses del paciente. Generalmente se identifica en etapas tempranas del desarrollo a partir de los 18 meses de edad. Actualmente el autismo se considera un desorden neurológico con un espectro que abarca diferentes grados que se asocian con factores genéticos, no genéticos y del medio ...

  10. Dicty_cDB: SLC402 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC402 (Link to dictyBase) - - - Contig-U16327-1 SLC402E (Link to Original site) SLC4...02F 661 SLC402Z 395 SLC402P 1056 SLC402E 674 Show SLC402 Library SL (Link to library) Clone ID SLC4...inal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC402Q.Seq.d/ Representative seq. ID SLC4...02E (Link to Original site) Representative DNA sequence >SLC402 (SLC402Q) /CSM/SL/SLC4-A/SLC4...lignments: (bits) Value SSC554 (SSC554Q) /CSM/SS/SSC5-C/SSC554Q.Seq.d/ 1128 0.0 SLC402 (SLC4

  11. Dicty_cDB: SLC465 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC465 (Link to dictyBase) - G01923 DDB0190872 Contig-U14177-1 SLC4...65P (Link to Original site) SLC465F 725 SLC465Z 393 SLC465P 1118 - - Show SLC465 Library SL (Link to library) Clone ID SLC4...Contig-U14177-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...65Q.Seq.d/ Representative seq. ID SLC465P (Link to Original site) Representative DNA sequence >SLC465 (SLC465Q) /CSM/SL/SLC4...-C/SLC465Q.Seq.d/ CGTTAACAGATTTTAATATTACTAATATTGTAGAAAATGATTTTAAATAAAGTAGCAAAA TGTTATG

  12. Dicty_cDB: SLC426 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC426 (Link to dictyBase) - G01922 DDB0233225 Contig-U14991-1 SLC4...26E (Link to Original site) SLC426F 335 SLC426Z 320 SLC426P 655 SLC426E 335 Show SLC426 Library SL (Lin...Contig Contig-U14991-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC4...26Q.Seq.d/ Representative seq. ID SLC426E (Link to Original site) Representative DNA sequence >SLC426 (SLC4...26Q) /CSM/SL/SLC4-B/SLC426Q.Seq.d/ AAATAATAAATAGTAAATAATAAATAATAATAAATAATAATAATAATATTTNAAAATGGG

  13. Dicty_cDB: SLC451 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC451 (Link to dictyBase) - - - Contig-U16260-1 SLC451Z (Link... to Original site) - - SLC451Z 389 - - - - Show SLC451 Library SL (Link to library) Clone ID SLC451 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC451Q.Seq.d/ Representative seq. ID SLC45...1Z (Link to Original site) Representative DNA sequence >SLC451 (SLC451Q) /CSM/SL/SLC4-C/SLC451Q.Seq.d/ XXXXX... producing significant alignments: (bits) Value SLC451 (SLC451Q) /CSM/SL/SLC4-C/SLC4

  14. Dicty_cDB: SLC418 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC418 (Link to dictyBase) - G01921 DDB0191271 Contig-U15820-1 SLC4...18E (Link to Original site) SLC418F 604 SLC418Z 554 SLC418P 1158 SLC418E 1076 Show SLC418 Library SL (L...ink to library) Clone ID SLC418 (Link to dictyBase) Atlas ID - NBRP ID G01921 dictyBase ID DDB0191271 Link t...o Contig Contig-U15820-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...18Q.Seq.d/ Representative seq. ID SLC418E (Link to Original site) Representative DNA sequence >SLC418 (SLC4

  15. Dicty_cDB: SLC481 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC481 (Link to dictyBase) - - - Contig-U16358-1 SLC481Z (Link... to Original site) - - SLC481Z 393 - - - - Show SLC481 Library SL (Link to library) Clone ID SLC481 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC481Q.Seq.d/ Representative seq. ID SLC48...1Z (Link to Original site) Representative DNA sequence >SLC481 (SLC481Q) /CSM/SL/SLC4-D/SLC481Q.Seq.d/ XXXXX...SL/SLG8-A/SLG820Q.Seq.d/ 708 0.0 SLC481 (SLC481Q) /CSM/SL/SLC4-D/SLC481Q.Seq.d/ 708 0.0 SLC178 (SLC178Q) /CS

  16. Efecto sedante del midazolam genérico versus innovador en ratas Wistar

    Directory of Open Access Journals (Sweden)

    Radamés Alemón-Medina

    2015-11-01

    Full Text Available Antecedentes: ocho de cada diez pacientes en Terapia Intensiva del Instituto Nacional de Pediatría no obtienen el mismo efecto ansiolítico y sedante con midazolam genérico (PiSA®, que con el innovador (Dormicum, Roche® a pesar de que su biodisponibilidad es de 100%.  Objetivo: determinar diferencias significativas en el efecto sedante del midazolam genérico y del innovador administrados parenteralmente.  Material y métodos: estudio aleatorizado cruzado en 24 ratas Wistar macho distribuidas en 4 grupos (n=6. A cada individuo se le administró una dosis de 0.5 mg/kg de peso vía intraperitoneal. Se determinaron los grados de sedación mediante la escala de Salamone. Se midió la concentración del fármaco en las ampolletas de ambas marcas por cromatografía líquida de alta resolución. Resultados: el efecto sedante del midazolam apareció al mismo tiempo y tuvo la misma duración, ndependientemente de la marca. El efecto tiende a ser más duradero con el innovador pero sin ser estadísticamente significativo (ANOVA, p ≤ 0.05. Asimismo, la mayoría de los animales llegaron al nivel 3 de sedación con ambas marcas.   Conclusión: tanto el midazolam innovador como el genérico tienen el mismo efecto sedante: aparece al mismo tiempo y tiene la misma duración.

  17. Modulation of sodium-bicarbonate co-transporter (SLC4A4/NBCe1) protein and mRNA expression in rat's uteri by sex-steroids and at different phases of the oestrous cycle.

    Science.gov (United States)

    Gholami, Khadijeh; Muniandy, Sekaran; Salleh, Naguib

    2014-02-01

    Oestrogen-induced uterine fluid sodium (Na(+)) and bicarbonate (HCO3(-)) secretion may involve SLC4A4. We hypothesized that uterine SLC4A4 expression changes under different sex-steroid influence, therefore may account for the fluctuation in uterine fluid Na(+) and HCO3(-) content throughout the oestrous cycle. The aim of this study is to investigate the differential effects of sex-steroids and oestrous cycle phases on uterine SLC4A4 expression. Adult female WKY rats were ovariectomised and treated with different doses of 17β-oestradiol (E2) (0.2, 2, 20 and 50 μg/ml/day) or progesterone (P4) (4 mg/ml/day) for three consecutive days and 3 days treatment with 0.2 μg/ml/day E2 followed by another 3 days with P4 to mimic the hormonal changes in early pregnancy. Oestrous cycle phases in intact, non-ovariectomised rats were determined by vaginal smear. The animals were then sacrificed and uteri were removed for protein and mRNA expression analyses by Western blotting and Real Time PCR, respectively. SLC4A4 distribution was observed by immunohistochemistry. Treatment with increasing E2 doses resulted in a dose-dependent increase in SLC4A4 protein expression. High SLC4A4 protein and mRNA expression can be seen at estrus. SLC4A4 is distributed mainly at the apical as well as basolateral membranes of the luminal and glandular epithelia following E2 treatment and at Es. Meanwhile, SLC4A4 expression was reduced following P4 treatment and was low at diestrus. High SLC4A4 expression under estrogen dominance may contribute to the increase in uterine fluid Na(+) and HCO3(-) content, while its low expression under P4 dominance may result in vice versa. Copyright © 2013 Elsevier Ltd. All rights reserved.

  18. Dicty_cDB: SLC489 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC489 (Link to dictyBase) - - - Contig-U16255-1 SLC489P (Link to Original site) SLC4...89F 628 SLC489Z 172 SLC489P 800 - - Show SLC489 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC489Q.Seq.d/ Representative seq. ID SLC4...89P (Link to Original site) Representative DNA sequence >SLC489 (SLC489Q) /CSM/SL/SLC4-D/SLC4...SSD212Q.Seq.d/ 1001 0.0 SLE207 (SLE207Q) /CSM/SL/SLE2-A/SLE207Q.Seq.d/ 1001 0.0 SLC489 (SLC489Q) /CSM/SL/SLC4-D/SLC4

  19. Dicty_cDB: SLC420 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC420 (Link to dictyBase) - G01085 DDB0205634 Contig-U01169-1 | Contig-U15736-1 SLC4...20P (Link to Original site) SLC420F 333 SLC420Z 423 SLC420P 756 - - Show SLC420 Libra...ry SL (Link to library) Clone ID SLC420 (Link to dictyBase) Atlas ID - NBRP ID G01085 dictyBase ID DDB020563...cdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC420Q.Seq.d/ Representative seq. ID SLC420P (Link to Original site) R...epresentative DNA sequence >SLC420 (SLC420Q) /CSM/SL/SLC4-A/SLC420Q.Seq.d/ GCTAGCACACACATAAATAATACATACACACAT

  20. Dicty_cDB: SLC419 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC419 (Link to dictyBase) - - - Contig-U03801-1 SLC419Z (Link... to Original site) - - SLC419Z 335 - - - - Show SLC419 Library SL (Link to library) Clone ID SLC419 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC419Q.Seq.d/ Representative seq. ID SLC41...9Z (Link to Original site) Representative DNA sequence >SLC419 (SLC419Q) /CSM/SL/SLC4-A/SLC419Q.Seq.d/ XXXXX...I6-A/SSI602Q.Seq.d/ 490 e-138 SSD173 (SSD173Q) /CSM/SS/SSD1-D/SSD173Q.Seq.d/ 490 e-138 SLC419 (SLC4

  1. Dicty_cDB: SLC409 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC409 (Link to dictyBase) - - - Contig-U14931-1 SLC409Z (Link... to Original site) - - SLC409Z 483 - - - - Show SLC409 Library SL (Link to library) Clone ID SLC409 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC409Q.Seq.d/ Representative seq. ID SLC40...9Z (Link to Original site) Representative DNA sequence >SLC409 (SLC409Q) /CSM/SL/SLC4-A/SLC409Q.Seq.d/ XXXXX... SLH501 (SLH501Q) /CSM/SL/SLH5-A/SLH501Q.Seq.d/ 858 0.0 SLF191 (SLF191Q) /CSM/SL/SLF1-D/SLF191Q.Seq.d/ 858 0.0 SLC409 (SLC4

  2. Dicty_cDB: SLC443 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC443 (Link to dictyBase) - - - Contig-U16518-1 SLC443P (Link to Original site) SLC4...43F 466 SLC443Z 304 SLC443P 770 - - Show SLC443 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC443Q.Seq.d/ Representative seq. ID SLC4...43P (Link to Original site) Representative DNA sequence >SLC443 (SLC443Q) /CSM/SL/SLC4-B/SLC4...Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC443 (SLC443Q) /CSM/SL/SLC4-B/SLC4

  3. Extremely discrepant mutation spectrum of SLC26A4 between Chinese patients with isolated Mondini deformity and enlarged vestibular aqueduct.

    Science.gov (United States)

    Huang, Shasha; Han, Dongyi; Yuan, Yongyi; Wang, Guojian; Kang, Dongyang; Zhang, Xin; Yan, Xiaofei; Meng, Xiaoxiao; Dong, Min; Dai, Pu

    2011-09-30

    Mutations in SLC26A4 cause Pendred syndrome (hearing loss with goiter) or DFNB4 (non-syndromic hearing loss with inner ear malformation, such as enlarged vestibular aqueduct or Mondini deformity). The relationship between mutations in SLC26A4 and Mondini deformity without enlarged vestibular aqueduct has not been studied in any Chinese deaf population. The purpose of this study was to assess whether mutations in the SLC26A4 gene cause Mondini deformity without an enlarged vestibular aqueduct (isolated Mondini deformity) in a Chinese population. In total, 144 patients with sensorineural hearing loss were included and subjected to high-resolution temporal bone CT. Among them, 28 patients with isolated Mondini dysplasia (MD group), 50 patients with enlarged vestibular aqueduct with Mondini dysplasia (EVA with MD group), 50 patients with enlarged vestibular aqueduct without Mondini dysplasia (EVA group), and 16 patients with other types of inner ear malformations (IEM group) were identified. The coding exons of SLC26A4 were analyzed in all subjects. DNA sequence analysis of SLC26A4 was performed in all 144 patients. In the different groups, the detection rate of the SLC26A4 mutation differed. In the isolated MD group, only one single allelic mutation in SLC26A4 was found in one patient (1/28, 3.6%). In the EVA with MD group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0%) and three patients (3/50, 6.0%), respectively. Also, in the EVA group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0%) and three patients (3/50, 6.0%), respectively. These percentages were identical to those in the EVA plus MD group. Only two patients carried monoallelic mutations of the SLC26A4 gene in the IEM group (2/16, 12.5%). There were significant differences in the frequency of SLC26A4 mutation among the groups (P0.5). Although mutations in the SLC26A4 gene were frequently found in Chinese EVA patients with and

  4. Dicty_cDB: SLC428 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC428 (Link to dictyBase) - - - Contig-U10963-1 SLC428P (Link to Original site) SLC4...28F 573 SLC428Z 307 SLC428P 880 - - Show SLC428 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC428Q.Seq.d/ Representative seq. ID SLC4...28P (Link to Original site) Representative DNA sequence >SLC428 (SLC428Q) /CSM/SL/SLC4-B/SLC4...nces producing significant alignments: (bits) Value SLC428 (SLC428Q) /CSM/SL/SLC4-B/SLC428Q.Seq.d/ 1526 0.0

  5. Dicty_cDB: SLC487 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC487 (Link to dictyBase) - - - Contig-U12865-1 SLC487Z (Link... to Original site) - - SLC487Z 404 - - - - Show SLC487 Library SL (Link to library) Clone ID SLC487 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC487Q.Seq.d/ Representative seq. ID SLC48...7Z (Link to Original site) Representative DNA sequence >SLC487 (SLC487Q) /CSM/SL/SLC4-D/SLC487Q.Seq.d/ XXXXX...1 0.0 SSF377 (SSF377Q) /CSM/SS/SSF3-D/SSF377Q.Seq.d/ 801 0.0 SLC492 (SLC492Q) /CSM/SL/SLC4-D/SLC4

  6. Dicty_cDB: SLC495 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC495 (Link to dictyBase) - - - Contig-U03919-1 SLC495E (Link to Original site) SLC4...95F 337 SLC495Z 295 SLC495P 632 SLC495E 337 Show SLC495 Library SL (Link to library) Clone ID SLC4...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC495Q.Seq.d/ Representative seq. ID SLC4...95E (Link to Original site) Representative DNA sequence >SLC495 (SLC495Q) /CSM/SL/SLC4-D/SLC4...ficant alignments: (bits) Value SLC495 (SLC495Q) /CSM/SL/SLC4-D/SLC495Q.Seq.d/ 446 e-124 VSF494 (VSF494Q) /C

  7. Genetic variants of SLC11A1 are associated with both autoimmune and infectious diseases: systematic review and meta-analysis.

    Science.gov (United States)

    Archer, N S; Nassif, N T; O'Brien, B A

    2015-06-01

    A systematic review and meta-analyses were undertaken to investigate the association of SLC11A1 genetic variants with disease occurrence. Literature searching indentified 109 publications to include in the meta-analyses assessing the association of 11 SLC11A1 variants with autoimmune and infectious disease. The (GT)n promoter alleles 2 and 3 (rs534448891), which alter SLC11A1 expression, were significantly associated with tuberculosis (OR=1.47 (1.30-1.66), OR=0.76 (0.65-0.89), respectively) and infectious disease (OR=1.25 (1.10-1.42), OR=0.83 (0.74-0.93), respectively). However, although no association was observed with autoimmune disease, a modest significant association was observed with type 1 diabetes (allele 2 OR=0.94 (0.89-0.98)). On the basis of a stronger association of (GT)n allele 2 with tuberculosis, compared with the protective effect of allele 3, we hypothesise that allele 2 is likely the disease-causing variant influencing disease susceptibility. Significant associations were observed between the 469+14G/C polymorphism (rs3731865) and autoimmune disease (OR=1.30 (1.04-1.64)) and rheumatoid arthritis (OR=1.60 (1.20-2.13)) and between the -237C/T polymorphism (rs7573065) and inflammatory bowel disease (OR=0.60 (0.43-0.84)). Further, significant associations were identified between the 469+14G/C, 1730G/A and 1729+55del4 polymorphisms (rs3731865, rs17235409 and rs17235416, respectively) and both infectious disease per se and tuberculosis. These findings show a clear association between variants in the SLC11A1 locus and autoimmune and infectious disease susceptibility.

  8. Traducción del modelo genérico del modelo de negocio a Object-Z

    OpenAIRE

    Daniele, Marcela; Martellotto, Paola; Baum, Gabriel Alfredo

    2005-01-01

    Este trabajo muestra el modelo genérico del modelo de negocio [BDMN04], representado gráficamente en términos de UML a través de un diagrama de clases, producto del análisis de los artefactos del Proceso Unificado que componen el modelo de negocio y sus relaciones. Además, se definen un conjunto de reglas que el modelo debe verificar. Esta demostrado que el modelado gráfico es muy útil para visualizar, especificar, construir y documentar los artefactos de un sistema, brindando un lenguaje ...

  9. Extremely discrepant mutation spectrum of SLC26A4 between Chinese patients with isolated Mondini deformity and enlarged vestibular aqueduct

    Directory of Open Access Journals (Sweden)

    Yan Xiaofei

    2011-09-01

    Full Text Available Abstract Background Mutations in SLC26A4 cause Pendred syndrome (hearing loss with goiter or DFNB4 (non-syndromic hearing loss with inner ear malformation, such as enlarged vestibular aqueduct or Mondini deformity. The relationship between mutations in SLC26A4 and Mondini deformity without enlarged vestibular aqueduct has not been studied in any Chinese deaf population. The purpose of this study was to assess whether mutations in the SLC26A4 gene cause Mondini deformity without an enlarged vestibular aqueduct (isolated Mondini deformity in a Chinese population. Methods In total, 144 patients with sensorineural hearing loss were included and subjected to high-resolution temporal bone CT. Among them, 28 patients with isolated Mondini dysplasia (MD group, 50 patients with enlarged vestibular aqueduct with Mondini dysplasia (EVA with MD group, 50 patients with enlarged vestibular aqueduct without Mondini dysplasia (EVA group, and 16 patients with other types of inner ear malformations (IEM group were identified. The coding exons of SLC26A4 were analyzed in all subjects. Results DNA sequence analysis of SLC26A4 was performed in all 144 patients. In the different groups, the detection rate of the SLC26A4 mutation differed. In the isolated MD group, only one single allelic mutation in SLC26A4 was found in one patient (1/28, 3.6%. In the EVA with MD group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0% and three patients (3/50, 6.0%, respectively. Also, in the EVA group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0% and three patients (3/50, 6.0%, respectively. These percentages were identical to those in the EVA plus MD group. Only two patients carried monoallelic mutations of the SLC26A4 gene in the IEM group (2/16, 12.5%. There were significant differences in the frequency of SLC26A4 mutation among the groups (P SLC26A4 mutation in the isolated MD group was

  10. Dicty_cDB: SLC469 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC469 (Link to dictyBase) - - - Contig-U16584-1 SLC469P (Link to Original site) SLC4...69F 676 SLC469Z 397 SLC469P 1073 - - Show SLC469 Library SL (Link to library) Clone ID SLC4...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC469Q.Seq.d/ Representative seq. ID SLC4...69P (Link to Original site) Representative DNA sequence >SLC469 (SLC469Q) /CSM/SL/SLC4-C/SLC4...sfflc sklvvik*ncynyp Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC469 (SLC4

  11. Dicty_cDB: SLC452 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC452 (Link to dictyBase) - - - Contig-U08358-1 SLC452E (Link to Original site) SLC4...52F 537 SLC452Z 347 SLC452P 884 SLC452E 537 Show SLC452 Library SL (Link to library) Clone ID SLC4...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC452Q.Seq.d/ Representative seq. ID SLC4...52E (Link to Original site) Representative DNA sequence >SLC452 (SLC452Q) /CSM/SL/SLC4-C/SLC4...slvtpplffq*skk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC4

  12. Dicty_cDB: SLC435 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC435 (Link to dictyBase) - - - Contig-U16260-1 SLC435E (Link... to Original site) - - - - - - SLC435E 373 Show SLC435 Library SL (Link to library) Clone ID SLC435 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC435Q.Seq.d/ Representative seq. ID SLC43...5E (Link to Original site) Representative DNA sequence >SLC435 (SLC435Q) /CSM/SL/SLC4-B/SLC435Q.Seq.d/ GGAGA...I815Q) /CSM/SL/SLI8-A/SLI815Q.Seq.d/ 694 0.0 SLC435 (SLC435Q) /CSM/SL/SLC4-B/SLC4

  13. Dicty_cDB: SLC431 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC431 (Link to dictyBase) - - - Contig-U15865-1 SLC431Z (Link... to Original site) - - SLC431Z 405 - - - - Show SLC431 Library SL (Link to library) Clone ID SLC431 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC431Q.Seq.d/ Representative seq. ID SLC43...1Z (Link to Original site) Representative DNA sequence >SLC431 (SLC431Q) /CSM/SL/SLC4-B/SLC431Q.Seq.d/ XXXXX...omology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC431 (SLC4

  14. Dicty_cDB: SLC433 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC433 (Link to dictyBase) - - - Contig-U16397-1 SLC433Z (Link... to Original site) - - SLC433Z 613 - - - - Show SLC433 Library SL (Link to library) Clone ID SLC433 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC433Q.Seq.d/ Representative seq. ID SLC43...3Z (Link to Original site) Representative DNA sequence >SLC433 (SLC433Q) /CSM/SL/SLC4-B/SLC433Q.Seq.d/ XXXXX...tyostelium discoideum slug cDNA, clone SLH872. 1134 0.0 1 ( AU034279 ) Dictyostelium discoideum slug cDNA, clone SLC4

  15. Dicty_cDB: SLC403 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC403 (Link to dictyBase) - - - Contig-U16252-1 SLC403Z (Link... to Original site) - - SLC403Z 492 - - - - Show SLC403 Library SL (Link to library) Clone ID SLC403 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC403Q.Seq.d/ Representative seq. ID SLC40...3Z (Link to Original site) Representative DNA sequence >SLC403 (SLC403Q) /CSM/SL/SLC4-A/SLC403Q.Seq.d/ XXXXX...-B/SLE731Q.Seq.d/ 902 0.0 SLC403 (SLC403Q) /CSM/SL/SLC4-A/SLC403Q.Seq.d/ 902 0.0 SLC241 (SLC241Q) /CSM/SL/SL

  16. Dicty_cDB: SLC485 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC485 (Link to dictyBase) - - - Contig-U16358-1 SLC485Z (Link... to Original site) - - SLC485Z 452 - - - - Show SLC485 Library SL (Link to library) Clone ID SLC485 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC485Q.Seq.d/ Representative seq. ID SLC48...5Z (Link to Original site) Representative DNA sequence >SLC485 (SLC485Q) /CSM/SL/SLC4-D/SLC485Q.Seq.d/ XXXXX... 825 0.0 SLG820 (SLG820Q) /CSM/SL/SLG8-A/SLG820Q.Seq.d/ 825 0.0 SLC485 (SLC485Q) /CSM/SL/SLC4-D/SLC4

  17. Dicty_cDB: SLC415 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC415 (Link to dictyBase) - - - Contig-U16521-1 SLC415E (Link... to Original site) - - - - - - SLC415E 210 Show SLC415 Library SL (Link to library) Clone ID SLC415 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC415Q.Seq.d/ Representative seq. ID SLC41...5E (Link to Original site) Representative DNA sequence >SLC415 (SLC415Q) /CSM/SL/SLC4-A/SLC415Q.Seq.d/ CCAAC...lkprdpskfqakkllpsk *iilfsl*k Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC415 (SLC4

  18. Dicty_cDB: SLC440 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC440 (Link to dictyBase) - G22407 DDB0231506 Contig-U13322-1 | Contig-U16512-1 SLC4...40P (Link to Original site) SLC440F 491 SLC440Z 449 SLC440P 940 - - Show SLC440 Libra...ry SL (Link to library) Clone ID SLC440 (Link to dictyBase) Atlas ID - NBRP ID G22407 dictyBase ID DDB023150...cdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC440Q.Seq.d/ Representative seq. ID SLC440P (Link to Original site) R...epresentative DNA sequence >SLC440 (SLC440Q) /CSM/SL/SLC4-B/SLC440Q.Seq.d/ GGAGATTTCACCACCACCAACAGAACAACACCA

  19. Dicty_cDB: SLC442 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC442 (Link to dictyBase) - - - Contig-U16430-1 SLC442Z (Link... to Original site) - - SLC442Z 467 - - - - Show SLC442 Library SL (Link to library) Clone ID SLC442 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC442Q.Seq.d/ Representative seq. ID SLC44...2Z (Link to Original site) Representative DNA sequence >SLC442 (SLC442Q) /CSM/SL/SLC4-B/SLC442Q.Seq.d/ XXXXX... 4.0 %: extracellular, including cell wall 4.0 %: peroxisomal >> prediction for SLC4

  20. Inhibition of SLC1A5 sensitizes colorectal cancer to cetuximab.

    Science.gov (United States)

    Ma, Huanrong; Wu, Zhenzhen; Peng, Jianjun; Li, Yang; Huang, Hongxiang; Liao, Yi; Zhou, Minyu; Sun, Li; Huang, Na; Shi, Min; Bin, Jianping; Liao, Yulin; Rao, Jinjun; Wang, Lin; Liao, Wangjun

    2018-06-15

    Cetuximab resistance is a key barrier in treating metastatic colorectal cancer (mCRC). Targeting of metabolic resources import could resensitize drug-resistant cancer cells to anticancer treatments. Here we showed that the expression of the glutamine transporter solute carrier 1 family member 5 (SLC1A5) in clinical CRC samples of patients resisted to cetuximab was significantly higher than in those of patients responded to cetuximab. Inhibition of SLC1A5 by shRNA-mediated gene silencing or pharmacological inhibitor significantly suppressed the growth of CRC. Moreover, inhibition of SLC1A5 significantly enhanced the inhibitory efficacy of cetuximab on CRC proliferation both in vitro and in vivo. Mechanistically, SLC1A5 inhibition facilitated EGFR degradation through the ubiquitin-proteasome pathway, and decreased the expression of nuclear EGFR, both of which might have contribution to the improved response to cetuximab. This study provides the metabolic molecule SLC1A5 as a potential therapeutic target to increase the efficacy of cetuximab on CRC. © 2018 UICC.

  1. Dicty_cDB: SLC490 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC490 (Link to dictyBase) - - - Contig-U16444-1 SLC490Z (Link... to Original site) - - SLC490Z 427 - - - - Show SLC490 Library SL (Link to library) Clone ID SLC490 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC490Q.Seq.d/ Representative seq. ID SLC49...0Z (Link to Original site) Representative DNA sequence >SLC490 (SLC490Q) /CSM/SL/SLC4-D/SLC490Q.Seq.d/ XXXXX...itochondrial 24.0 %: cytoplasmic 24.0 %: nuclear 4.0 %: cytoskeletal 4.0 %: plasma membrane 4.0 %: peroxisomal >> prediction for SLC4

  2. Dicty_cDB: SLC484 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC484 (Link to dictyBase) - - - Contig-U15497-1 SLC484Z (Link... to Original site) - - SLC484Z 462 - - - - Show SLC484 Library SL (Link to library) Clone ID SLC484 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC484Q.Seq.d/ Representative seq. ID SLC48...4Z (Link to Original site) Representative DNA sequence >SLC484 (SLC484Q) /CSM/SL/SLC4-D/SLC484Q.Seq.d/ XXXXX...mic 32.0 %: mitochondrial 16.0 %: nuclear 4.0 %: peroxisomal 4.0 %: endoplasmic reticulum >> prediction for SLC4

  3. Dicty_cDB: SLC434 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC434 (Link to dictyBase) - - - Contig-U15434-1 SLC434Z (Link... to Original site) - - SLC434Z 438 - - - - Show SLC434 Library SL (Link to library) Clone ID SLC434 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC434Q.Seq.d/ Representative seq. ID SLC43...4Z (Link to Original site) Representative DNA sequence >SLC434 (SLC434Q) /CSM/SL/SLC4-B/SLC434Q.Seq.d/ XXXXX...logy vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC434 (SLC434Q) /CSM/SL/SLC4-B/SLC4

  4. Dicty_cDB: SLC407 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC407 (Link to dictyBase) - - - Contig-U16560-1 SLC407Z (Link... to Original site) - - SLC407Z 365 - - - - Show SLC407 Library SL (Link to library) Clone ID SLC407 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC407Q.Seq.d/ Representative seq. ID SLC40...7Z (Link to Original site) Representative DNA sequence >SLC407 (SLC407Q) /CSM/SL/SLC4-A/SLC407Q.Seq.d/ XXXXX...vvtkf*cqt e** Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC407 (SLC407Q) /CSM/SL/SLC4

  5. Dicty_cDB: SLC474 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC474 (Link to dictyBase) - - - Contig-U01121-1 SLC474Z (Link... to Original site) - - SLC474Z 431 - - - - Show SLC474 Library SL (Link to library) Clone ID SLC474 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC474Q.Seq.d/ Representative seq. ID SLC47...4Z (Link to Original site) Representative DNA sequence >SLC474 (SLC474Q) /CSM/SL/SLC4-D/SLC474Q.Seq.d/ XXXXX... Score E Sequences producing significant alignments: (bits) Value SLC474 (SLC474Q) /CSM/SL/SLC4-D/SLC474Q.Se

  6. Dicty_cDB: SLC425 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC425 (Link to dictyBase) - - - Contig-U16276-1 SLC425Z (Link... to Original site) - - SLC425Z 515 - - - - Show SLC425 Library SL (Link to library) Clone ID SLC425 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC425Q.Seq.d/ Representative seq. ID SLC42...5Z (Link to Original site) Representative DNA sequence >SLC425 (SLC425Q) /CSM/SL/SLC4-B/SLC425Q.Seq.d/ XXXXX...producing significant alignments: (bits) Value SLC425 (SLC425Q) /CSM/SL/SLC4-B/SLC4

  7. Programa nacional de prevención y consejería genética del retinoblastoma mediante detección de mutaciones en el gen RB.

    Directory of Open Access Journals (Sweden)

    H. Frayle

    2001-07-01

    una la doble mutación inactivante del gen Rb, exclusivamente somática en los esporádicos y germinal más somática en los hereditarios. Esta investigacin tuvo como objetivo caracterizar las mutaciones en el gen Rb mediante secuenciación directa y evaluar su utilidad en la consejería genética.

  8. Human Sodium Phosphate Transporter 4 (hNPT4/SLC17A3) as a Common Renal Secretory Pathway for Drugs and Urate*

    Science.gov (United States)

    Jutabha, Promsuk; Anzai, Naohiko; Kitamura, Kenichiro; Taniguchi, Atsuo; Kaneko, Shuji; Yan, Kunimasa; Yamada, Hideomi; Shimada, Hidetaka; Kimura, Toru; Katada, Tomohisa; Fukutomi, Toshiyuki; Tomita, Kimio; Urano, Wako; Yamanaka, Hisashi; Seki, George; Fujita, Toshiro; Moriyama, Yoshinori; Yamada, Akira; Uchida, Shunya; Wempe, Michael F.; Endou, Hitoshi; Sakurai, Hiroyuki

    2010-01-01

    The evolutionary loss of hepatic urate oxidase (uricase) has resulted in humans with elevated serum uric acid (urate). Uricase loss may have been beneficial to early primate survival. However, an elevated serum urate has predisposed man to hyperuricemia, a metabolic disturbance leading to gout, hypertension, and various cardiovascular diseases. Human serum urate levels are largely determined by urate reabsorption and secretion in the kidney. Renal urate reabsorption is controlled via two proximal tubular urate transporters: apical URAT1 (SLC22A12) and basolateral URATv1/GLUT9 (SLC2A9). In contrast, the molecular mechanism(s) for renal urate secretion remain unknown. In this report, we demonstrate that an orphan transporter hNPT4 (human sodium phosphate transporter 4; SLC17A3) was a multispecific organic anion efflux transporter expressed in the kidneys and liver. hNPT4 was localized at the apical side of renal tubules and functioned as a voltage-driven urate transporter. Furthermore, loop diuretics, such as furosemide and bumetanide, substantially interacted with hNPT4. Thus, this protein is likely to act as a common secretion route for both drugs and may play an important role in diuretics-induced hyperuricemia. The in vivo role of hNPT4 was suggested by two hyperuricemia patients with missense mutations in SLC17A3. These mutated versions of hNPT4 exhibited reduced urate efflux when they were expressed in Xenopus oocytes. Our findings will complete a model of urate secretion in the renal tubular cell, where intracellular urate taken up via OAT1 and/or OAT3 from the blood exits from the cell into the lumen via hNPT4. PMID:20810651

  9. Dicty_cDB: SLC473 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC473 (Link to dictyBase) - - - Contig-U16054-1 SLC473F (Link to Original site) SLC4...73F 698 - - - - - - Show SLC473 Library SL (Link to library) Clone ID SLC473 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC473Q.Seq.d/ Representative seq. ID SLC47...3F (Link to Original site) Representative DNA sequence >SLC473 (SLC473Q) /CSM/SL/SLC4-D/SLC473Q.Seq.d/ AGAAA... CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC473 (SLC473Q) /CSM/SL/SLC4

  10. Loss of Slc4a1b chloride/bicarbonate exchanger function protects mechanosensory hair cells from aminoglycoside damage in the zebrafish mutant persephone.

    Directory of Open Access Journals (Sweden)

    Dale W Hailey

    Full Text Available Mechanosensory hair cell death is a leading cause of hearing and balance disorders in the human population. Hair cells are remarkably sensitive to environmental insults such as excessive noise and exposure to some otherwise therapeutic drugs. However, individual responses to damaging agents can vary, in part due to genetic differences. We previously carried out a forward genetic screen using the zebrafish lateral line system to identify mutations that alter the response of larval hair cells to the antibiotic neomycin, one of a class of aminoglycoside compounds that cause hair cell death in humans. The persephone mutation confers resistance to aminoglycosides. 5 dpf homozygous persephone mutants are indistinguishable from wild-type siblings, but differ in their retention of lateral line hair cells upon exposure to neomycin. The mutation in persephone maps to the chloride/bicarbonate exchanger slc4a1b and introduces a single Ser-to-Phe substitution in zSlc4a1b. This mutation prevents delivery of the exchanger to the cell surface and abolishes the ability of the protein to import chloride across the plasma membrane. Loss of function of zSlc4a1b reduces hair cell death caused by exposure to the aminoglycosides neomycin, kanamycin, and gentamicin, and the chemotherapeutic drug cisplatin. Pharmacological block of anion transport with the disulfonic stilbene derivatives DIDS and SITS, or exposure to exogenous bicarbonate, also protects hair cells against damage. Both persephone mutant and DIDS-treated wild-type larvae show reduced uptake of labeled aminoglycosides. persephone mutants also show reduced FM1-43 uptake, indicating a potential impact on mechanotransduction-coupled activity in the mutant. We propose that tight regulation of the ionic environment of sensory hair cells, mediated by zSlc4a1b activity, is critical for their sensitivity to aminoglycoside antibiotics.

  11. Dicty_cDB: SLC444 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC444 (Link to dictyBase) - - - Contig-U16368-1 SLC444Z (Link... to Original site) - - SLC444Z 462 - - - - Show SLC444 Library SL (Link to library) Clone ID SLC444 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC444Q.Seq.d/ Representative seq. ID SLC44...4Z (Link to Original site) Representative DNA sequence >SLC444 (SLC444Q) /CSM/SL/SLC4-B/SLC444Q.Seq.d/ XXXXX...tochondrial 8.0 %: nuclear 4.0 %: cytoskeletal 4.0 %: cytoplasmic >> prediction for SLC444 is mit 5' end seq

  12. The histidine transporter SLC15A4 coordinates mTOR-dependent inflammatory responses and pathogenic antibody production.

    Science.gov (United States)

    Kobayashi, Toshihiko; Shimabukuro-Demoto, Shiho; Yoshida-Sugitani, Reiko; Furuyama-Tanaka, Kaori; Karyu, Hitomi; Sugiura, Yuki; Shimizu, Yukiko; Hosaka, Toshiaki; Goto, Motohito; Kato, Norihiro; Okamura, Tadashi; Suematsu, Makoto; Yokoyama, Shigeyuki; Toyama-Sorimachi, Noriko

    2014-09-18

    SLC15A4 is a lysosome-resident, proton-coupled amino-acid transporter that moves histidine and oligopeptides from inside the lysosome to the cytosol of eukaryotic cells. SLC15A4 is required for Toll-like receptor 7 (TLR7)- and TLR9-mediated type I interferon (IFN-I) productions in plasmacytoid dendritic cells (pDCs) and is involved in the pathogenesis of certain diseases including lupus-like autoimmunity. How SLC15A4 contributes to diseases is largely unknown. Here we have shown that B cell SLC15A4 was crucial for TLR7-triggered IFN-I and autoantibody productions in a mouse lupus model. SLC15A4 loss disturbed the endolysosomal pH regulation and probably the v-ATPase integrity, and these changes were associated with disruption of the mTOR pathway, leading to failure of the IFN regulatory factor 7 (IRF7)-IFN-I regulatory circuit. Importantly, SLC15A4's transporter activity was necessary for the TLR-triggered cytokine production. Our findings revealed that SLC15A4-mediated optimization of the endolysosomal state is integral to a TLR7-triggered, mTOR-dependent IRF7-IFN-I circuit that leads to autoantibody production. Copyright © 2014 Elsevier Inc. All rights reserved.

  13. Dicty_cDB: SLC448 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC448 (Link to dictyBase) - - - Contig-U15118-1 SLC448E (Link... to Original site) - - - - - - SLC448E 245 Show SLC448 Library SL (Link to library) Clone ID SLC448 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC448Q.Seq.d/ Representative seq. ID SLC44...8E (Link to Original site) Representative DNA sequence >SLC448 (SLC448Q) /CSM/SL/SLC4-B/SLC448Q.Seq.d/ GGTAA... %: nuclear 12.0 %: mitochondrial 8.0 %: cytoskeletal 4.0 %: endoplasmic reticulum >> prediction for SLC4

  14. Dicty_cDB: SLC486 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC486 (Link to dictyBase) - - - Contig-U16480-1 SLC486E (Link... to Original site) - - - - - - SLC486E 451 Show SLC486 Library SL (Link to library) Clone ID SLC486 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC486Q.Seq.d/ Representative seq. ID SLC48...6E (Link to Original site) Representative DNA sequence >SLC486 (SLC486Q) /CSM/SL/SLC4-D/SLC486Q.Seq.d/ GTCAT...7Q.Seq.d/ 868 0.0 SLD427 (SLD427Q) /CSM/SL/SLD4-B/SLD427Q.Seq.d/ 868 0.0 SLC486 (SLC486Q) /CSM/SL/SLC4-D/SLC4

  15. Investigation of SLC6A4 gene expression in autism spectrum disorders

    Directory of Open Access Journals (Sweden)

    Elif Funda Şener

    2015-06-01

    Full Text Available Objective: Autism is defined as a complex neurodevelopmental disorder. Genetics plays a major role in the etiology of autism spectrum disorders (ASD. The role of the serotonin in the development of autism has been widely investigated. SLC6A4 gene (SERT or 5-HT has an important role reuptaking of serotonin. Because of this, our study examined the expression level of SLC6A4 gene in autism patients. Methods: Thirty-four patients (26 male, 8 female who diagnosed as autism firstly according to DSM-V criteria in the Department of child psychiatry, Erciyes University Medical Faculty and healthy 23 controls (16 male, 7 female were enrolled in this study. Total RNA was isolated from peripheral blood samples using TRIzol. Quantitative Real-time PCR (qRT-PCR was performed to detect SLC6A4 gene expression. Results: SLC6A4 gene expression was found statistically significant and low in autism group compared with controls (p=0,027. Conclusion: The low gene expression in the patient group implied that there is an abnormality of serotonin reuptake. According to our results, we suggest that much more studies may be planned with the expression and methylation profile of this gene combined with gene polymorphisms especially affecting the expression in larger sample sizes. J Clin Exp Invest 2015; 6 (2: 165-169

  16. Genetic variations in the MCT1 (SLC16A1) gene in the Chinese population of Singapore.

    Science.gov (United States)

    Lean, Choo Bee; Lee, Edmund Jon Deoon

    2009-01-01

    MCT1(SLC16A1) is the first member of the monocarboxylate transporter (MCT) and its family is involved in the transportation of metabolically important monocarboxylates such as lactate, pyruvate, acetate and ketone bodies. This study identifies genetic variations in SLC16A1 in the ethnic Chinese group of the Singaporean population (n=95). The promoter, coding region and exon-intron junctions of the SLC16A1 gene encoding the MCT1 transporter were screened for genetic variation in the study population by DNA sequencing. Seven genetic variations of SLC16A1, including 4 novel ones, were found: 2 in the promoter region, 2 in the coding exons (both nonsynonymous variations), 2 in the 3' untranslated region (3'UTR) and 1 in the intron. Of the two mutations detected in the promoter region, the -363-855T>C is a novel mutation. The 1282G>A (Val(428)Ile) is a novel SNP and was found as heterozygotic in 4 subjects. The 1470T>A (Asp(490)Glu) was found to be a common polymorphism in this study. Lastly, IVS3-17A>C in intron 3 and 2258 (755)A>G in 3'UTR are novel mutations found to be common polymorphisms in the local Chinese population. To our knowledge, this is the first report of a comprehensive analysis on the MCT1 gene in any population.

  17. Dicty_cDB: SLC483 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC483 (Link to dictyBase) - - - Contig-U16486-1 SLC483F (Link to Original site) SLC4...83F 718 - - - - - - Show SLC483 Library SL (Link to library) Clone ID SLC483 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC483Q.Seq.d/ Representative seq. ID SLC48...3F (Link to Original site) Representative DNA sequence >SLC483 (SLC483Q) /CSM/SL/SLC4-D/SLC483Q.Seq.d/ AAAAA...roducing significant alignments: (bits) Value SLC483 (SLC483Q) /CSM/SL/SLC4-D/SLC483Q.Seq.d/ 1423 0.0 SLE651

  18. Dicty_cDB: SLC464 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC464 (Link to dictyBase) - - - Contig-U00917-1 SLC464Z (Link... to Original site) - - SLC464Z 406 - - - - Show SLC464 Library SL (Link to library) Clone ID SLC464 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC464Q.Seq.d/ Representative seq. ID SLC46...4Z (Link to Original site) Representative DNA sequence >SLC464 (SLC464Q) /CSM/SL/SLC4-C/SLC464Q.Seq.d/ XXXXX... Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC464 (SLC4

  19. Hearing loss associated with enlarged vestibular aqueduct and zero or one mutant allele of SLC26A4.

    Science.gov (United States)

    Rose, Jane; Muskett, Julie A; King, Kelly A; Zalewski, Christopher K; Chattaraj, Parna; Butman, John A; Kenna, Margaret A; Chien, Wade W; Brewer, Carmen C; Griffith, Andrew J

    2017-07-01

    To characterize the severity and natural history of hearing loss, and the prevalence of having a cochlear implant in a maturing cohort of individuals with enlarged vestibular aqueduct (EVA) and zero or one mutant allele of SLC26A4. Prospective cohort study of subjects ascertained between 1998 and 2015 at the National Institutes of Health Clinical Center. Study subjects were 127 individuals (median age, 8 years; range, 0-59 years) with EVA in at least one ear. Ears with EVA and zero or one mutant allele of SLC26A4 had mean 0.5/1/2/4-kHz pure-tone averages of 62.6 and 52.9 dB HL, respectively, in contrast to EVA ears with two mutant alleles of SLC26A4 (88.1 dB HL; P zero, one, and two mutant alleles, respectively (P = .00833). This association was not independent (P = .534) but reflected underlying correlations with age at time of first audiogram (P = .003) or severity of hearing loss (P = .000). Ears with EVA and zero or one mutant allele of SLC26A4 have less severe hearing loss, no difference in prevalence of fluctuation, and a lower prevalence of cochlear implantation in comparison to ears with two mutant alleles of SLC26A4. NA Laryngoscope, 127:E238-E243, 2017. © 2016 The American Laryngological, Rhinological and Otological Society, Inc.

  20. Common Genetic Variation and Haplotypes of the Anion Exchanger SLC4A2 in Primary Biliary Cirrhosis

    Science.gov (United States)

    Juran, Brian D.; Atkinson, Elizabeth J.; Larson, Joseph J.; Schlicht, Erik M.; Lazaridis, Konstantinos N.

    2010-01-01

    Objectives Deficiencies of the anion exchanger SLC4A2 are thought to play a pathogenic role in primary biliary cirrhosis (PBC), evidenced by decreased expression and activity in PBC patients and development of disease features in SLC4A2 knockout mice. We hypothesized that genetic variation in SLC4A2 might influence this pathogenic contribution. Thus, we aimed to perform a comprehensive assessment of SLC4A2 genetic variation in PBC using a linkage disequilibrium (LD)-based haplotype-tagging approach. Methods Twelve single nucleotide polymorphisms (SNPs) across SLC4A2 were genotyped in 409 PBC patients and 300 controls and evaluated for association with disease, as well as with prior orthotopic liver transplant and antimitochondrial antibody (AMA) status among the PBC patients, both individually and as inferred haplotypes, using logistic regression. Results All SNPs were in Hardy–Weinberg equilibrium. No associations with disease or liver transplantation were detected, but two variants, rs2303929 and rs3793336, were associated with negativity for antimitochondrial antibodies among the PBC patients. Conclusions The common genetic variation of SLC4A2 does not directly affect the risk of PBC or its clinical outcome. Whether the deficiency of SLC4A2 expression and activity observed earlier in PBC patients is an acquired epiphenomenon of underlying disease or is because of heritable factors in unappreciated regulatory regions remains uncertain. Of note, two SLC4A2 variants appear to influence AMA status among PBC patients. The mechanisms behind this finding are unclear. PMID:19491853

  1. Dicty_cDB: SLC458 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC458 (Link to dictyBase) - - - Contig-U16279-1 SLC458Z (Link... to Original site) - - SLC458Z 508 - - - - Show SLC458 Library SL (Link to library) Clone ID SLC458 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC458Q.Seq.d/ Representative seq. ID SLC45...8Z (Link to Original site) Representative DNA sequence >SLC458 (SLC458Q) /CSM/SL/SLC4-C/SLC458Q.Seq.d/ XXXXX...icant alignments: (bits) Value SLC458 (SLC458Q) /CSM/SL/SLC4-C/SLC458Q.Seq.d/ 743

  2. Risk and protective genetic variants in suicidal behaviour: association with SLC1A2, SLC1A3, 5-HTR1B &NTRK2 polymorphisms.

    LENUS (Irish Health Repository)

    Murphy, Therese M

    2012-02-01

    BACKGROUND: Suicidal behaviour is known to aggregate in families. Patients with psychiatric disorders are at higher risk for suicide attempts (SA), however protective and risk genetic variants for suicide appear to be independent of underlying psychiatric disorders. Here we investigate genetic variants in genes important for neurobiological pathways linked to suicidal behaviour and\\/or associated endophenotypes, for association with SA among patients with co-existing psychiatric illness. Selected gene-gene and gene-environment interactions were also tested. METHODS: DNA was obtained from bloods of 159 patients (76 suicide attempters and 83 non-attempters), who were profiled for DSM-IV Axis I psychiatric diagnosis. Twenty-eight single nucleotide polymorphisms (SNPs) from 18 candidate genes (COMT, 5-HT2A, 5-HT1A, 5-HTR1B, TPH1, MAO-A, TPH2, DBH, CNR1, BDNF, ABCG1, GABRA5, GABRG2, GABRB2, SLC1A2, SLC1A3, NTRK2, CRHR1) were genotyped. Genotyping was performed by KBioscience. Tests of association between genetic variants and SA were conducted using Chi squared and Armitage Trend tests. Binary logistical regression analyses were performed to evaluate the contribution of individual genetic variants to the prediction of SA, and to examine SNPs for potential gene-gene and gene-environment interactions. RESULTS: Our analysis identified 4 SNPs (rs4755404, rs2269272, rs6296 and rs1659400), which showed evidence of association with SA compared to a non-attempter control group. We provide evidence of a 3-locus gene-gene interaction, and a putative gene-environment interaction, whereby genetic variation at the NTRK2 locus may moderate the risk associated with history of childhood abuse. CONCLUSION: Preliminary findings suggest that allelic variability in SLC1A2\\/3, 5-HTR1B and NTRK2 may be relevant to the underlying diathesis for suicidal acts.

  3. Dicty_cDB: SLC429 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC429 (Link to dictyBase) - - - Contig-U09691-1 SLC429Z (Link... to Original site) - - SLC429Z 419 - - - - Show SLC429 Library SL (Link to library) Clone ID SLC429 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC429Q.Seq.d/ Representative seq. ID SLC42...9Z (Link to Original site) Representative DNA sequence >SLC429 (SLC429Q) /CSM/SL/SLC4-B/SLC429Q.Seq.d/ XXXXX... significant alignments: (bits) Value SLC429 (SLC429Q) /CSM/SL/SLC4-B/SLC429Q.Seq.d/ 708 0.0 SLC392 (SLC392Q

  4. Dicty_cDB: SLC470 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC470 (Link to dictyBase) - - - Contig-U15735-1 SLC470Z (Link... to Original site) - - SLC470Z 386 - - - - Show SLC470 Library SL (Link to library) Clone ID SLC470 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC470Q.Seq.d/ Representative seq. ID SLC47...0Z (Link to Original site) Representative DNA sequence >SLC470 (SLC470Q) /CSM/SL/SLC4-C/SLC470Q.Seq.d/ XXXXX...Seq.d/ 533 e-151 SLF229 (SLF229Q) /CSM/SL/SLF2-B/SLF229Q.Seq.d/ 533 e-151 SLC470 (SLC470Q) /CSM/SL/SLC4-C/SLC4

  5. Dicty_cDB: SLC461 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC461 (Link to dictyBase) - - - Contig-U16382-1 SLC461Z (Link... to Original site) - - SLC461Z 386 - - - - Show SLC461 Library SL (Link to library) Clone ID SLC461 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC461Q.Seq.d/ Representative seq. ID SLC46...1Z (Link to Original site) Representative DNA sequence >SLC461 (SLC461Q) /CSM/SL/SLC4-C/SLC461Q.Seq.d/ XXXXX...e-155 2 ( AU034553 ) Dictyostelium discoideum slug cDNA, clone SLC461. 531 e-155 2 ( AU052473 ) Dictyosteliu

  6. Dicty_cDB: SLC437 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC437 (Link to dictyBase) - - - Contig-U16397-1 SLC437Z (Link... to Original site) - - SLC437Z 622 - - - - Show SLC437 Library SL (Link to library) Clone ID SLC437 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC437Q.Seq.d/ Representative seq. ID SLC43...7Z (Link to Original site) Representative DNA sequence >SLC437 (SLC437Q) /CSM/SL/SLC4-B/SLC437Q.Seq.d/ XXXXX...scoideum slug cDNA, clone SLC437. 1158 0.0 1 ( AU033994 ) Dictyostelium discoideum slug cDNA, clone SLB708.

  7. Virus del dengue de serotipo 1 (DENV-1 de Colombia: su contribución a la presentación del dengue en el departamento de Santander

    Directory of Open Access Journals (Sweden)

    Raquel E. Ocazionez-Jiménez

    2013-08-01

    Full Text Available Introducción. Los cuatro serotipos del virus del dengue circularon en el departamento de Santander entre 1998 y 2008. No existe información sobre el papel del serotipo 1 (DENV-1 en la epidemiología de la enfermedad. Objetivo. Analizar la relación entre el cambio de predominancia del (DENV-1 con su diversificación genética, predominancia de los otros serotipos y presentación del dengue grave. Materiales y métodos. La diversificación genética se estudió por análisis filogenético usando la secuencia del gen E de 12 cepas del virus. Para el análisis se utilizaron datos sobre predominancia delos serotipos obtenidos en estudios previos y datos oficiales de incidencia del dengue. Resultados. Los virus seleccionados se agruparon en el genotipo V junto a (DENV-1 de países de Latinoamérica y se evidenció segregación en cuatro linajes. Los cambios en la predominancia del virus coincidieron con el reemplazo de linaje y esto, a su vez, con incremento en la prevalencia de DENV-2y DENV-3, e incremento del dengue grave. Conclusión. La diversificación genética podría contribuir a cambios de predominancia de (DENV-1, y la relación del virus con el DENV-2 y DENV-3 en situaciones que favorecen la presentación de casos graves. Se necesitan más estudios para precisar el papel de los serotipos en la epidemiología del dengue. doi: http://dx.doi.org/10.7705/biomedica.v33i0.717

  8. Dicty_cDB: SLC478 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC478 (Link to dictyBase) - - - Contig-U16419-1 SLC478Z (Link... to Original site) - - SLC478Z 400 - - - - Show SLC478 Library SL (Link to library) Clone ID SLC478 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC478Q.Seq.d/ Representative seq. ID SLC47...8Z (Link to Original site) Representative DNA sequence >SLC478 (SLC478Q) /CSM/SL/SLC4-D/SLC478Q.Seq.d/ XXXXX... %: cytoplasmic 28.0 %: nuclear 24.0 %: mitochondrial 12.0 %: cytoskeletal >> prediction for SLC4

  9. Dicty_cDB: SLC456 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC456 (Link to dictyBase) - - - Contig-U16272-1 SLC456Z (Link... to Original site) - - SLC456Z 483 - - - - Show SLC456 Library SL (Link to library) Clone ID SLC456 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC456Q.Seq.d/ Representative seq. ID SLC45...6Z (Link to Original site) Representative DNA sequence >SLC456 (SLC456Q) /CSM/SL/SLC4-C/SLC456Q.Seq.d/ XXXXX...0 %: vacuolar 4.0 %: peroxisomal >> prediction for SLC456 is nuc 5' end seq. ID -

  10. SLC25A13 gene analysis in citrin deficiency: sixteen novel mutations in East Asian patients, and the mutation distribution in a large pediatric cohort in China.

    Directory of Open Access Journals (Sweden)

    Yuan-Zong Song

    Full Text Available BACKGROUND: The human SLC25A13 gene encodes citrin, the liver-type mitochondrial aspartate/glutamate carrier isoform 2 (AGC2, and SLC25A13 mutations cause citrin deficiency (CD, a disease entity that encompasses different age-dependant clinical phenotypes such as Adult-onset Citrullinemia Type II (CTLN2 and Neonatal Intrahepatic Cholestasis caused by Citrin Deficiency (NICCD. The analyses of SLC25A13 gene and its protein/mRNA products remain reliable tools for the definitive diagnoses of CD patients, and so far, the SLC25A13 mutation spectrum in Chinese CD patients has not been well-characterized yet. METHODS AND RESULTS: By means of direct DNA sequencing, cDNA cloning and SNP analyses, 16 novel pathogenic mutations, including 9 missense, 4 nonsense, 1 splice-site, 1 deletion and 1 large transposal insertion IVS4ins6kb (GenBank accession number KF425758, were identified in CTLN2 or NICCD patients from China, Japan and Malaysia, respectively, making the SLC25A13 variations worldwide reach the total number of 81. A large NICCD cohort of 116 Chinese cases was also established, and the 4 high-frequency mutations contributed a much larger proportion of the mutated alleles in the patients from south China than in those from the north (χ(2 = 14.93, P<0.01, with the latitude of 30°N as the geographic dividing line in mainland China. CONCLUSIONS: This paper further enriched the SLC25A13 variation spectrum worldwide, and formed a substantial contribution to the in-depth understanding of the genotypic feature of Chinese CD patients.

  11. Dicty_cDB: SLC450 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC450 (Link to dictyBase) - - - Contig-U16382-1 SLC450Z (Link... to Original site) - - SLC450Z 416 - - - - Show SLC450 Library SL (Link to library) Clone ID SLC450 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC450Q.Seq.d/ Representative seq. ID SLC45...0Z (Link to Original site) Representative DNA sequence >SLC450 (SLC450Q) /CSM/SL/SLC4-C/SLC450Q.Seq.d/ XXXXX...cant alignments: (bits) Value SLC450 (SLC450Q) /CSM/SL/SLC4-C/SLC450Q.Seq.d/ 678 0.0 VFO858 (VFO858Q) /CSM/V

  12. SLC26A4 gene copy number variations in Chinese patients with non-syndromic enlarged vestibular aqueduct

    Directory of Open Access Journals (Sweden)

    Zhao Jiandong

    2012-05-01

    Full Text Available Abstract Background Many patients with enlarged vestibular aqueduct (EVA have either only one allelic mutant of the SLC26A4 gene or lack any detectable mutation. In this study, multiplex ligation-dependent probe amplification (MLPA was used to screen for copy number variations (CNVs of SLC26A4 and to reveal the pathogenic mechanisms of non-syndromic EVA (NSEVA. Methods Between January 2003 and March 2010, 923 Chinese patients (481 males, 442 females with NSEVA were recruited. Among these, 68 patients (7.4% were found to carry only one mutant allele of SLC26A4 and 39 patients (4.2% lacked any detectable mutation in SLC26A4; these 107 patients without double mutant alleles were assigned to the patient group. Possible copy number variations in SLC26A4 were detected by SALSA MLPA. Results Using GeneMapper, no significant difference was observed between the groups, as compared with the standard probe provided in the assay. The results of the capillary electrophoresis showed no significant difference between the patients and controls. Conclusion Our results suggest that CNVs and the exon deletion in SLC26A4 are not important factors in NSEVA. However, it would be premature to conclude that CNVs have no role in EVA. Genome-wide studies to explore CNVs within non-coding regions of the SLC26A4 gene and neighboring regions are warranted, to elucidate their roles in NSEVA etiology.

  13. Dicty_cDB: SLC455 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC455 (Link to dictyBase) - - - Contig-U16584-1 SLC455Z (Link... to Original site) - - SLC455Z 379 - - - - Show SLC455 Library SL (Link to library) Clone ID SLC455 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC455Q.Seq.d/ Representative seq. ID SLC45...5Z (Link to Original site) Representative DNA sequence >SLC455 (SLC455Q) /CSM/SL/SLC4-C/SLC455Q.Seq.d/ XXXXX...57 ) Dictyostelium discoideum slug cDNA, clone SLC469. 468 e-177 3 ( AU034549 ) Dictyostelium discoideum slug cDNA, clone SLC4

  14. Dicty_cDB: SLC477 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC477 (Link to dictyBase) - - - Contig-U16260-1 SLC477Z (Link... to Original site) - - SLC477Z 326 - - - - Show SLC477 Library SL (Link to library) Clone ID SLC477 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC477Q.Seq.d/ Representative seq. ID SLC47...7Z (Link to Original site) Representative DNA sequence >SLC477 (SLC477Q) /CSM/SL/SLC4-D/SLC477Q.Seq.d/ XXXXX...hfefsnivikskkkkkkkkkkkkkk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC477 (SLC4

  15. Dicty_cDB: SLC436 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC436 (Link to dictyBase) - - - Contig-U16460-1 SLC436Z (Link... to Original site) - - SLC436Z 344 - - - - Show SLC436 Library SL (Link to library) Clone ID SLC436 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC436Q.Seq.d/ Representative seq. ID SLC43...6Z (Link to Original site) Representative DNA sequence >SLC436 (SLC436Q) /CSM/SL/SLC4-B/SLC436Q.Seq.d/ XXXXX.../CSM/SL/SLE2-C/SLE258Q.Seq.d/ 470 e-132 SLC773 (SLC773Q) /CSM/SL/SLC7-D/SLC773Q.Seq.d/ 470 e-132 SLC4

  16. Dicty_cDB: SLC438 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC438 (Link to dictyBase) - - - Contig-U10771-1 SLC438Z (Link... to Original site) - - SLC438Z 549 - - - - Show SLC438 Library SL (Link to library) Clone ID SLC438 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC438Q.Seq.d/ Representative seq. ID SLC43...8Z (Link to Original site) Representative DNA sequence >SLC438 (SLC438Q) /CSM/SL/SLC4-B/SLC438Q.Seq.d/ XXXXX...es producing significant alignments: (bits) Value SSM825 (SSM825Q) /CSM/SS/SSM8-B/SSM825Q.Seq.d/ 948 0.0 SLC438 (SLC4

  17. Dicty_cDB: SLC480 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC480 (Link to dictyBase) - - - Contig-U13538-1 SLC480Z (Link... to Original site) - - SLC480Z 455 - - - - Show SLC480 Library SL (Link to library) Clone ID SLC480 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC480Q.Seq.d/ Representative seq. ID SLC48...0Z (Link to Original site) Representative DNA sequence >SLC480 (SLC480Q) /CSM/SL/SLC4-D/SLC480Q.Seq.d/ XXXXX...ial 8.0 %: peroxisomal >> prediction for SLC480 is nuc 5' end seq. ID - 5' end seq. - Length of 5' end seq. - 3' end seq. ID SLC4

  18. CLONACIÓN Y FILOGENIA MOLECULAR DE UN SEGMENTO DEL GEN CODANTE DE LA ACTINA DE MYRCIARIA DUBIA “CAMU-CAMU”: UN CANDIDATO PARA GEN DE REFERENCIA

    Directory of Open Access Journals (Sweden)

    Juan Carlos Castro Gómez

    2012-12-01

    Full Text Available Myrciaria dubia “camu-camu” es un frutal amazónico caracterizado por su amplia variación de vitamina C. Pero los estudios genético moleculares que puedan explicar esta variación son limitados. Por ello nuestro objetivo fue realizar la clonación y filogenia molecular de un segmento del gen codante de la actina de M. dubia. Las muestras fueron obtenidas de la colección de germoplasma del INIA. Luego, el ARN fue purificado y mediante RT-PCR con cebadores degenerados se amplificó un segmento del gen. En base a la secuencia obtenida se diseñaron cebadores específicos para PCR en tiempo real. Los resultados muestran que se ha aislado, clonado y secuenciado un segmento del gen codante de actina de M. dubia y detectado su expresión en hojas, pulpa y cáscara de M. dubia. Así, con el soporte de herramientas bioinformáticas y uso de técnicas de biología molecular hemos aislado, clonado y secuenciado un segmento del gen codante de la actina de M. dubia. Asimismo, los análisis realizados muestran que el gen se expresa y presenta niveles similares de expresión en hojas, pulpa y cáscara de M. dubia. Sin embargo, es necesario realizar más experimentos a fin de verificar su estabilidad de expresión.

  19. Polimorfismos del gen BoLA-DRB3.2* en ganado criollo colombiano

    Directory of Open Access Journals (Sweden)

    Darwin Hernández H.

    2013-10-01

    Full Text Available Objetivo. Caracterizar el polimorfismo del gen BoLA-DRB3.2* en las razas bovinas criollas y colombianas. Materiales y métodos. En 360 muestras de ADN de ocho razas bovinas criollas (Blanco Orejinegro, Casanareño, Costeño con Cuernos, Chino Santandereano, Caqueteño, Hartón del Valle, Romosinuano y San Martinero, dos razas sintéticas Colombianas (Lucerna y Velásquez y dos razas foráneas (Brahman y Holstein se evaluó el polimorfismo del gen BoLA-DRB3.2 mediante técnicas moleculares (PCR-RFLP; se calculó el número promedio de alelos (NPA, las frecuencias, la heterocigocidad esperada (He y observada (Ho, el equilibrio de Hardy-Weinberg, la estructura genética y los valores de FST y FIS. Resultados. El NPA fue 14.6 ± 3.8 siendo Caqueteño la raza con mayor NPA (25 y el menor el Chino Santandereano (10. Se encontraron 41 alelos BoLA-DRB3.2* los más frecuentes fueron *28, *37, *24, *23, *20, *27, *8, *16, *39 (0.17, 0.11, 0.10, 0.09, 0.09, 0.07, 0.07 y 0.06 respectivamente. Se encontró alta diversidad genética (He = 0.878 con mayor valor en Caqueteño (0.96 y menor en San Martinero (0.81. Todas las razas se encontraron en equilibrio de Hardy-Weinberg, se encontraron valores altamente significativos de diferenciación genética (FST= 0.044 y de coeficiente de endogamia (FIS = 0.249. Conclusiones. El ganado criollo colombiano posee alto polimorfismo del gen BoLA-DRB3.2* representado en los altos valores de NPA y diversidad génetica.

  20. Heterogeneidad clínica y genética en pacientes con retinosis pigmentaria en Pinar del Río. Importancia del asesoramiento genético

    Directory of Open Access Journals (Sweden)

    Nercy Rodríguez Garcia

    2013-12-01

    Full Text Available Introducción: la retinosis pigmentaria (RP es una degeneración progresiva, crónica y de carácter hereditario de la retina, que conduce a discapacidad visual o ceguera sin un tratamiento adecuado. Objetivo: determinar la variabilidad de la expresión clínica en la presentación de la retinosis pigmentaria, así como el tipo de herencia con que se transmite en los enfermos y familias de los individuos ingresados en el servicio provincial de la enfermedad en Pinar del Río, lo que permitirá aplicar una estrategia para el asesoramiento genético individual y familiar. Material y Método: se realizó una investigación descriptiva, retrospectiva y transversal, teniendo como universo y muestra a los 259 pacientes con diagnóstico del padecimiento, registrados en el servicio provincial, de enero a septiembre del año 2012. Resultados: predominó el sexo masculino con 154 pacientes y el grupo de edades entre 40 y 59 años de edad con un 46,71 %. De acuerdo a la clasificación cubana, prevalece el debut precoz, el estadio I, la herencia autosómica recesiva y la forma típica de presentación. Resaltan el síndrome de Usher como entidad asociada y en 99 familias se determinó que la enfermedad sigue un patrón de herencia autosómico recesivo, en 38 de las cuales existe consanguinidad. Las limitaciones de estos enfermos obligan a suministrarles una información adecuada y precisa mediante los servicios de asesoramiento genético. Conclusiones: la gran heterogeneidad clínica y genética de la enfermedad ha generado que la estrategia de asesoramiento genético incluya la personalización del proceso de acuerdo a cada paciente y familia y se le brinde mayor importancia a los grupos de apoyo mutuo.

  1. MBL, P2X7, and SLC11A1 gene polymorphisms in patients with oropharyngeal tularemia.

    Science.gov (United States)

    Somuk, Battal Tahsin; Koc, Sema; Ates, Omer; Göktas, Göksel; Soyalic, Harun; Uysal, Ismail Onder; Gurbuzler, Levent; Sapmaz, Emrah; Sezer, Saime; Eyibilen, Ahmet

    2016-11-01

    A significant association was found of oropharyngeal tularemia with SLC11A1 allele polymorphism (INT4 G/C) and MBL2 C + 4T (P/Q). These results indicate C allele and Q allele might be a risk factor for the development of oropharyngeal tularemia. This study aimed to investigate the relationship of SLC11A1, MBL, and P2X 7 gene polymorphism with oropharyngeal tularemia. The study included totally 120 patients who were diagnosed with oropharyngeal tularemia. Frequencies of polymorphisms in the following genes were analyzed both in the patient and control groups in the study: SLC11A1 (5'(GT) n Allele 2/3, Int4 G/C, 3' UTR, D543N G/A), MBL (MBL2 C + 4T (P/Q), and P2X 7 (-762 C/T and 1513 A/C). Among all polymorphisms that were investigated in this study, SLC11A1 gene showed a significance in the distriburtion of polymorphism allelle frequency at the INT4 region. Frequency of C allele was 54 (28%) in patients with oropharyngeal tularemia, and 31 (13%) in the control group (p = 0.006 and OR = 1.96 (1.21-3.20)). An association was detected between MBL2 C + 4T (P/Q) gene polymorphism and oropharyngeal tularemia (p tularemia in this study (p > 0.05).

  2. Association between a genetic variant in the serotonin transporter gene (SLC6A4 and suicidal behavior in patients with schizophrenia

    Directory of Open Access Journals (Sweden)

    Lindholm Carlström Eva

    2012-05-01

    Full Text Available Abstract Background The serotonin (5-hydroxytryptamin; 5-HT system has a central role in the circuitry of cognition and emotions. Multiple lines of evidence suggest that genetic variation in the serotonin transporter gene (SLC6A4; 5-HTT is associated with schizophrenia and suicidal behavior. In this study, we wanted to elucidate whether SLC6A4 variations is involved in attempted suicide among patients with schizophrenia in a Scandinavian case–control sample. Methods Patients diagnosed with schizophrenia from three Scandinavian samples were assessed for presence or absence of suicide attempts, based on record reviews and interview data. Seven SLC6A4 single nucleotide polymorphisms (SNPs were genotyped in 837 schizophrenia patients and 1,473 control individuals. Association analyses and statistical evaluations were performed with the program UNPHASED (version 3.0.9. Results We observed an allele association between the SNP rs16965628, located in intron one of SLC6A4, and attempted suicide (adjusted p-value 0.01, among patients with schizophrenia. No association was found to a diagnosis of schizophrenia, when patients were compared to healthy control individuals. Conclusion The gene SLC6A4 appears to be involved in suicidal ideation among patients with schizophrenia. Independent replication is needed before more firm conclusions can be drawn.

  3. Análisis de las mutaciones más frecuentes del gen BRCA1 (185delAG y 5382insC en mujeres con cáncer de mama en Bucaramanga, Colombia

    Directory of Open Access Journals (Sweden)

    María Carolina Sanabria

    2009-03-01

    Conclusión. Se requieren más estudios en la región que abarquen la tamización de la totalidad del gen BRCA1, para hacer una mayor contribución al conocimiento de la epidemiología molecular del cáncer de mama en Bucaramanga, Santander, Colombia.

  4. Expression of solute carrier 7A4 (SLC7A4) in the plasma membrane is not sufficient to mediate amino acid transport activity.

    OpenAIRE

    Wolf, Sabine; Janzen, Annette; Vékony, Nicole; Martiné, Ursula; Strand, Dennis; Closs, Ellen I

    2002-01-01

    Member 4 of human solute carrier family 7 (SLC7A4) exhibits significant sequence homology with the SLC7 subfamily of human cationic amino acid transporters (hCATs) [Sperandeo, Borsani, Incerti, Zollo, Rossi, Zuffardi, Castaldo, Taglialatela, Andria and Sebastio (1998) Genomics 49, 230-236]. It is therefore often referred to as hCAT-4 even though no convincing transport activity has been shown for this protein. We expressed SLC7A4 in Xenopus laevis oocytes, but could not detect any transport a...

  5. Dicty_cDB: SLC466 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC466 (Link to dictyBase) - - - Contig-U16381-1 SLC466Z (Link... to Original site) - - SLC466Z 427 - - - - Show SLC466 Library SL (Link to library) Clone ID SLC466 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC466Q.Seq.d/ Representative seq. ID SLC46...6Z (Link to Original site) Representative DNA sequence >SLC466 (SLC466Q) /CSM/SL/SLC4-C/SLC466Q.Seq.d/ XXXXX... AU034556 ) Dictyostelium discoideum slug cDNA, clone SLC466. 176 2e-77 2 ( AU033496 ) Dictyostelium discoid

  6. Enfermedades genéticas del ADN mitocondrial humano

    Directory of Open Access Journals (Sweden)

    Solano Abelardo

    2001-01-01

    Full Text Available Las enfermedades mitocondriales son un grupo de trastornos que están producidos por un fallo en el sistema de fosforilación oxidativa (sistema Oxphos, la ruta final del metabolismo energético mitocondrial, con la consiguiente deficiencia en la biosíntesis del trifosfato de adenosina (ATP, por sus siglas en inglés. Parte de los polipéptidos que componen este sistema están codificados en el ácido desoxirribonucleico (DNA mitocondrial y, en los últimos años, se han descrito mutaciones que se han asociado con síndromes clínicos bien definidos. Las características genéticas del DNA mitocondrial, herencia materna, poliplasmia y segregación mitótica, confieren a estas enfermedades propiedades muy particulares. Las manifestaciones clínicas de estas enfermedades son muy heterogéneas y afectan a distintos órganos y tejidos por lo que su correcto diagnóstico implica la obtención de datos clínicos, morfológicos, bioquímicos y genéticos. El texto completo en inglés de este artículo está disponible en: http://www.insp.mx/salud/index.html

  7. Programa nacional de prevención y consejería genética del retinoblastoma mediante detección de mutaciones en el gen rb.

    OpenAIRE

    Frayle, H.; Guevara, G.

    2011-01-01

    El retinoblastoma es un raro tumor ocular que se diagnostica en los niños, 40% de los casos se consideran hereditarios y 60% esporádicos. El modelo genético propuesto por Knudson involucra
    una la doble mutación inactivante del gen Rb, exclusivamente somática en los esporádicos y germinal más somática en los hereditarios. Esta investigacin tuvo como objetivo caracterizar las mutaciones en el gen Rb mediante secuenciación directa y evaluar su utilidad en la consejería genética....

  8. Na+-taurocholate cotransporting polypeptide (NTCP/SLC10A1) ortholog in the marine skate Leucoraja erinacea is not a physiological bile salt transporter.

    Science.gov (United States)

    Yu, Dongke; Zhang, Han; Lionarons, Daniel A; Boyer, James L; Cai, Shi-Ying

    2017-04-01

    The Na + -dependent taurocholate cotransporting polypeptide (NTCP/SLC10A1) is a hepatocyte-specific solute carrier, which plays an important role in maintaining bile salt homeostasis in mammals. The absence of a hepatic Na + -dependent bile salt transport system in marine skate and rainbow trout raises a question regarding the function of the Slc10a1 gene in these species. Here, we have characterized the Slc10a1 gene in the marine skate, Leucoraja erinacea The transcript of skate Slc10a1 (skSlc10a1) encodes 319 amino acids and shares 46% identity to human NTCP (hNTCP) with similar topology to mammalian NTCP. SkSlc10a1 mRNA was mostly confined to the brain and testes with minimal expression in the liver. An FXR-bile salt reporter assay indicated that skSlc10a1 transported taurocholic acid (TCA) and scymnol sulfate, but not as effectively as hNTCP. An [ 3 H]TCA uptake assay revealed that skSlc10a1 functioned as a Na + -dependent transporter, but with low affinity for TCA ( K m = 92.4 µM) and scymnol sulfate ( K i = 31 µM), compared with hNTCP (TCA, K m = 5.4 µM; Scymnol sulfate, K i = 3.5 µM). In contrast, the bile salt concentration in skate plasma was 2 µM, similar to levels seen in mammals. Interestingly, skSlc10a1 demonstrated transport activity for the neurosteroids dehydroepiandrosterone sulfate and estrone-3-sulfate at physiological concentration, similar to hNTCP. Together, our findings indicate that skSlc10a1 is not a physiological bile salt transporter, providing a molecular explanation for the absence of a hepatic Na + -dependent bile salt uptake system in skate. We speculate that Slc10a1 is a neurosteroid transporter in skate that gained its substrate specificity for bile salts later in vertebrate evolution. Copyright © 2017 the American Physiological Society.

  9. Elevated SLC26A4 gene promoter methylation is associated with the risk of presbycusis in men.

    Science.gov (United States)

    Xu, Jin; Zheng, Jiachen; Shen, Wanjing; Ma, Lili; Zhao, Ming; Wang, Xubo; Tang, Jiyuan; Yan, Jihong; Wu, Zhenhua; Zou, Zuquan; Bu, Shizhong; Xi, Yang

    2017-07-01

    Presbycusis affects approximately one-third of people over the age of 65 and is a worldwide health problem. In the current study, whether the methylation level of solute carrier family 26 member 4 (SLC26A4) predicted an increased risk of presbycusis was investigated. Peripheral blood samples from 102 patients with presbycusis and 104 controls were collected, and the methylation of the CpG sites of SLC26A4 was measured by applying pyrosequencing technology combined with sodium bisulfate DNA conversion chemistry. Within the SLC26A4 promoter region, one CpG site (CpG3) exhibited a significantly (Ppresbycusis (26.5±5.56%) compared with the controls (23.8±3.85%). Significantly different CpG3 methylation levels were observed between the patients with presbycusis and the controls among the male participants (P=0.0004). In addition, a significant decrease in the transcriptional level of SLC26A4 in peripheral blood was observed in the patients with presbycusis compared with the controls. Furthermore, analyses of the receiver operating characteristic (ROC) curves indicated that CpG3 methylation at the SLC26A4 promoter predicted the risk of presbycusis in the male participants (AUC=0.684, 95% CI=0.584‑0.784, P=0.001). The results demonstrated the significance of the CpG site methylation level of SLC26A4, and thus provides a potential marker for the diagnosis of presbycusis.

  10. Association between the SLC6A3 A1343G polymorphism and schizophrenia Associação entre o polimorfismo A1343G do SLC6A3 e esquizofrenia

    Directory of Open Access Journals (Sweden)

    Quirino Cordeiro

    2010-10-01

    Full Text Available Epidemiological studies have demonstrated that the genetic component is an important risk factor for the development of schizophrenia. The genes that codify the different compounds of the dopaminergic system have created interest for molecular investigations in patients with schizophrenia because the antipsychotic drugs, especially those of first generation, act on this cerebral system. Thus the aim of the present study was to investigate the possible association between a new single nucleotide polymorphism (rs6347 located in exon 9 of the protein transporter (SLC6A3 and schizophrenia. The distribution of the alleles and genotypes of the studied polymorphism was investigated in a sample of 235 patients and 834 controls matched by gender and age. There were statistical differences in the allelic (χ2=5.97, 1d.f. , p=0.01, OR=1.33-1.05Estudos epidemiológicos têm demonstrado que o componente genético é um importante fator de risco para a esquizofrenia. Os genes que codificam os diferentes componentes do sistema dopaminérgico passaram a despertar interesse para estudos moleculares em pacientes com esquizofrenia, pois os antipsicóticos, em especial os de primeira geração, exercem sua ação nesse sistema. Assim, o objetivo do presente estudo foi investigar a associação entre um novo polimorfismo de nucleotídeo único (rs6347 localizado no exon 9 do gene do transportador de dopamina (SLC6A3 e esquizofrenia. Um total de 235 pacientes e 834 controles pareados para sexo e idade foi selecionado para a investigação da distribuição dos alelos e genótipos do polimorfismo investigado entre os grupos de pacientes e controles. Houve diferenças estatisticamente significantes nas distribuições alélicas (χ2=5,97, 1d.f. , p=0,01, OR=1,33-1,051,69 e genotípicas (χ2=6,56, 2d.f. , p=0,03 entre pacientes e controles. Assim, o polimorfismo SLC6A3 A1343G mostrou associação com esquizofrenia na amostra estudada.

  11. Characterization of SLC transporters in human skin

    Directory of Open Access Journals (Sweden)

    Marion Alriquet

    2015-03-01

    Full Text Available Most identified drug transporters belong to the ATP-binding Cassette (ABC and Solute Carrier (SLC families. Recent research indicates that some of these transporters play an important role in the absorption, distribution and excretion of drugs, and are involved in clinically relevant drug-drug interactions for systemic drugs. However, very little is known about the role of drug transporters in human skin in the disposition of topically applied drugs and their involvement in drug-drug interactions. The aim of this work was to compare the expression in human skin (vs human hepatocytes and kidney of SLC transporters included in the EMA guidance as the most likely clinical sources of drug interactions. The expression of SLC transporters in human tissues was analyzed by quantitative RT-PCR. Modulation of SLC47A1 and SLC47A2 (MATE1 and MATE2 expression was analyzed after treatment of human skin in organ-culture with rifampicin and UV irradiation. The expression of SLCO2B1 (OATPB, SLCO3A1 (OATPD, SLCO4A1 (OATPE, SLC47A1 and SLC47A2 (MATE1 and MATE2 was detected in human skin, OATPE and MATE1 being the most expressed. OATPE is about 70 times more expressed in human skin than in human hepatocytes. Moreover, the expression of SLC47A1 and SLC47A2 was down-regulated after treatment with rifampicin or after exposure to UV light. The present findings demonstrate that SLCO4A1 (OATPE and SLC47A1 (MATE1 are highly expressed in human skin and suggest the involvement of SLC transporters in the disposition of topically applied drugs.

  12. Identification of IGF1, SLC4A4, WWOX, and SFMBT1 as hypertension susceptibility genes in Han Chinese with a genome-wide gene-based association study.

    Directory of Open Access Journals (Sweden)

    Hsin-Chou Yang

    Full Text Available Hypertension is a complex disorder with high prevalence rates all over the world. We conducted the first genome-wide gene-based association scan for hypertension in a Han Chinese population. By analyzing genome-wide single-nucleotide-polymorphism data of 400 matched pairs of young-onset hypertensive patients and normotensive controls genotyped with the Illumina HumanHap550-Duo BeadChip, 100 susceptibility genes for hypertension were identified and also validated with permutation tests. Seventeen of the 100 genes exhibited differential allelic and expression distributions between patient and control groups. These genes provided a good molecular signature for classifying hypertensive patients and normotensive controls. Among the 17 genes, IGF1, SLC4A4, WWOX, and SFMBT1 were not only identified by our gene-based association scan and gene expression analysis but were also replicated by a gene-based association analysis of the Hong Kong Hypertension Study. Moreover, cis-acting expression quantitative trait loci associated with the differentially expressed genes were found and linked to hypertension. IGF1, which encodes insulin-like growth factor 1, is associated with cardiovascular disorders, metabolic syndrome, decreased body weight/size, and changes of insulin levels in mice. SLC4A4, which encodes the electrogenic sodium bicarbonate cotransporter 1, is associated with decreased body weight/size and abnormal ion homeostasis in mice. WWOX, which encodes the WW domain-containing protein, is related to hypoglycemia and hyperphosphatemia. SFMBT1, which encodes the scm-like with four MBT domains protein 1, is a novel hypertension gene. GRB14, TMEM56 and KIAA1797 exhibited highly significant differential allelic and expressed distributions between hypertensive patients and normotensive controls. GRB14 was also found relevant to blood pressure in a previous genetic association study in East Asian populations. TMEM56 and KIAA1797 may be specific to

  13. SLC22A1-ABCB1 haplotype profiles predict imatinib pharmacokinetics in Asian patients with chronic myeloid leukemia.

    Directory of Open Access Journals (Sweden)

    Onkar Singh

    Full Text Available OBJECTIVE: This study aimed to explore the influence of SLC22A1, PXR, ABCG2, ABCB1 and CYP3A5 3 genetic polymorphisms on imatinib mesylate (IM pharmacokinetics in Asian patients with chronic myeloid leukemia (CML. PATIENTS AND METHODS: Healthy subjects belonging to three Asian populations (Chinese, Malay, Indian; n = 70 each and CML patients (n = 38 were enrolled in a prospective pharmacogenetics study. Imatinib trough (C(0h and clearance (CL were determined in the patients at steady state. Haplowalk method was applied to infer the haplotypes and generalized linear model (GLM to estimate haplotypic effects on IM pharmacokinetics. Association of haplotype copy numbers with IM pharmacokinetics was defined by Mann-Whitney U test. RESULTS: Global haplotype score statistics revealed a SLC22A1 sub-haplotypic region encompassing three polymorphisms (rs3798168, rs628031 and IVS7+850C>T, to be significantly associated with IM clearance (p = 0.013. Haplotype-specific GLM estimated that the haplotypes AGT and CGC were both associated with 22% decrease in clearance compared to CAC [CL (10(-2 L/hr/mg: CAC vs AGT: 4.03 vs 3.16, p = 0.017; CAC vs CGC: 4.03 vs 3.15, p = 0.017]. Patients harboring 2 copies of AGT or CGC haplotypes had 33.4% lower clearance and 50% higher C(0h than patients carrying 0 or 1 copy [CL (10(-2 L/hr/mg: 2.19 vs 3.29, p = 0.026; C(0h (10(-6 1/ml: 4.76 vs 3.17, p = 0.013, respectively]. Further subgroup analysis revealed SLC22A1 and ABCB1 haplotypic combinations to be significantly associated with clearance and C(0h (p = 0.002 and 0.009, respectively. CONCLUSION: This exploratory study suggests that SLC22A1-ABCB1 haplotypes may influence IM pharmacokinetics in Asian CML patients.

  14. Functional Testing of SLC26A4 Variants—Clinical and Molecular Analysis of a Cohort with Enlarged Vestibular Aqueduct from Austria

    Science.gov (United States)

    Bernardinelli, Emanuele; Nofziger, Charity; Patsch, Wolfgang; Rasp, Gerd; Paulmichl, Markus; Dossena, Silvia

    2018-01-01

    The prevalence and spectrum of sequence alterations in the SLC26A4 gene, which codes for the anion exchanger pendrin, are population-specific and account for at least 50% of cases of non-syndromic hearing loss associated with an enlarged vestibular aqueduct. A cohort of nineteen patients from Austria with hearing loss and a radiological alteration of the vestibular aqueduct underwent Sanger sequencing of SLC26A4 and GJB2, coding for connexin 26. The pathogenicity of sequence alterations detected was assessed by determining ion transport and molecular features of the corresponding SLC26A4 protein variants. In this group, four uncharacterized sequence alterations within the SLC26A4 coding region were found. Three of these lead to protein variants with abnormal functional and molecular features, while one should be considered with no pathogenic potential. Pathogenic SLC26A4 sequence alterations were only found in 12% of patients. SLC26A4 sequence alterations commonly found in other Caucasian populations were not detected. This survey represents the first study on the prevalence and spectrum of SLC26A4 sequence alterations in an Austrian cohort and further suggests that genetic testing should always be integrated with functional characterization and determination of the molecular features of protein variants in order to unequivocally identify or exclude a causal link between genotype and phenotype. PMID:29320412

  15. Loci asociados con enfermedades genéticas y calidad de carne en bovinos Charolais Mexicanos

    Directory of Open Access Journals (Sweden)

    Ana María Sifuentes Rincón

    2015-01-01

    Full Text Available Se determinaron las frecuencias alélicas y genotípicas de ocho marcadores localizados en los genes calpaína (CAPN, 4 751 y 316, calpastatina (CASTT1 y tiroglobulina (TG5, asociados a calidad de carne, y en los genes, m iost atina (MSTN, Q204X, arginino succinato sintasa (ASS, monofosfato sintasa (UMPS y miofosforilasa (PYGM, asocia dos a enfermedade s genéticas de ganado bovino. Se muestrearon 493 animales Charolais de registro de dos hatos ubicado s en Sonora (n=157 y tres en Nuevo León (n=336. No se encontraron portadores de los alelos T-ASS y T-UM PS, pero sí portadores del alelo Q204X del gen MSTN en frecuencias de  1 % en las poblaciones de Sonora y de 8.6 a 14.4 % en las de Nuevo León. Además, se identificaron portadores del marcador del gen PYGM, en frecuencias del 6.5 y de 1.0 % para un hato de Sonora y otro de Nuevo León, respectivamente. El análisis de diferenciación génica p areado entre las poblaciones y con los cuatro loci mostró que hay diferencias altamente significativas dentro de pobl aciones del noroeste ( P <0.0001 y entre éstas y las del noreste ( P <0.001, la cual es explicada principalmente por los loci CAPN-316 y TG5. De acuerdo a los resultados obtenidos se recomienda el monitoreo del marcador del gen PYGM y del ale lo Q204X del gen MSTN, así como también implementar estrategias para confirmar la utilidad de los marcadores asociado s a calidad y productividad como herramienta para complementar los progra mas de mejoramiento genético.

  16. Significance of downregulation of renal organic cation transporter (SLC47A1 in cisplatin-induced proximal tubular injury

    Directory of Open Access Journals (Sweden)

    Mizuno T

    2015-07-01

    Full Text Available Tomohiro Mizuno,1–3 Waichi Sato,2,3 Kazuhiro Ishikawa,4 Yuki Terao,1 Kazuo Takahashi,2 Yukihiro Noda,5 Yukio Yuzawa,2 Tadashi Nagamatsu1 1Department of Analytical Pharmacology, Meijo University Faculty of Pharmacy, Nagoya, 2Department of Nephrology, School of Medicine, Fujita Health University, Toyoake, 3Department of Nephrology, Nagoya University School of Medicine, Nagoya, 4Department of Neuropsychopharmacology and Hospital Pharmacy, Nagoya University Graduate School of Medicine, Nagoya, 5Division of Clinical Sciences and Neuropsychopharmacology, Meijo University Faculty of Pharmacy, Nagoya, Japan Background/aim: To elucidate the mechanism responsible for developing acute kidney injury in patients with diabetes mellitus, we also evaluated the issue of whether advanced glycation endproducts (AGEs influence the expressions of multi antimicrobial extrusion protein (MATE1/SLC47A1 in tubular cells. Materials and methods: To detect changing expression of MATE1/SLC47A1 in dose- and time-dependent manners, human proximal tubular epithelial cells were incubated with AGE-aggregated-human serum albumin. As a function assay for MATE1/SLC47A1, human proximal tubular epithelial cells were incubated with cisplatin or carboplatin. Results: On incubation with AGEs, the expressions of MATE1/SLC47A1 were decreased in tubular cells. In addition, the toxicities of cisplatin were increased in tubular cells that had been pretreated with AGEs. However, the toxicities of carboplatin were smaller than that of cisplatin in proximal tubular epithelial cells. Conclusion: The expression of the MATE1/SLC47A1 is decreased by AGEs, which increases the risk for proximal tubular injury. Keywords: advanced glycation endproducts, cisplatin, SLC47A1, diabetes mellitus, acute kidney injury

  17. OCD candidate gene SLC1A1/EAAT3 impacts basal ganglia-mediated activity and stereotypic behavior.

    Science.gov (United States)

    Zike, Isaac D; Chohan, Muhammad O; Kopelman, Jared M; Krasnow, Emily N; Flicker, Daniel; Nautiyal, Katherine M; Bubser, Michael; Kellendonk, Christoph; Jones, Carrie K; Stanwood, Gregg; Tanaka, Kenji Fransis; Moore, Holly; Ahmari, Susanne E; Veenstra-VanderWeele, Jeremy

    2017-05-30

    Obsessive-compulsive disorder (OCD) is a chronic, disabling condition with inadequate treatment options that leave most patients with substantial residual symptoms. Structural, neurochemical, and behavioral findings point to a significant role for basal ganglia circuits and for the glutamate system in OCD. Genetic linkage and association studies in OCD point to SLC1A1 , which encodes the neuronal glutamate/aspartate/cysteine transporter excitatory amino acid transporter 3 (EAAT3)/excitatory amino acid transporter 1 (EAAC1). However, no previous studies have investigated EAAT3 in basal ganglia circuits or in relation to OCD-related behavior. Here, we report a model of Slc1a1 loss based on an excisable STOP cassette that yields successful ablation of EAAT3 expression and function. Using amphetamine as a probe, we found that EAAT3 loss prevents expected increases in ( i ) locomotor activity, ( ii ) stereotypy, and ( iii ) immediate early gene induction in the dorsal striatum following amphetamine administration. Further, Slc1a1 -STOP mice showed diminished grooming in an SKF-38393 challenge experiment, a pharmacologic model of OCD-like grooming behavior. This reduced grooming is accompanied by reduced dopamine D 1 receptor binding in the dorsal striatum of Slc1a1 -STOP mice. Slc1a1 -STOP mice also exhibit reduced extracellular dopamine concentrations in the dorsal striatum both at baseline and following amphetamine challenge. Viral-mediated restoration of Slc1a1 /EAAT3 expression in the midbrain but not in the striatum results in partial rescue of amphetamine-induced locomotion and stereotypy in Slc1a1 -STOP mice, consistent with an impact of EAAT3 loss on presynaptic dopaminergic function. Collectively, these findings indicate that the most consistently associated OCD candidate gene impacts basal ganglia-dependent repetitive behaviors.

  18. Polimorfismos del gen ob en bovinos de raza holstein en la Comarca Lagunera, México

    Directory of Open Access Journals (Sweden)

    Sarai S. Mendoza-Retana

    2017-01-01

    Full Text Available La Comarca Lagunera es la cuenca lechera más importante de México. En la actualidad se están utilizando diversas técnicas que permiten evaluar genéticamente el animal a una edad temprana, permitiendo seleccionar futuros reproductores con características deseables. Entre los genes relacionados con la producción de leche, se encuentran el gen Ob también llamado gen Leptina el cual actúa sobre el sistema nervioso central y tejidos periféricos jugando un papel muy importante en la modulación regulación del apetito, ganancia de peso vivo, incremento del metabolismo energético y el anabolismo muscular. Este trabajo se realizó para determinar el polimorfismo de longitud del fragmento de restricción ACI I de gen leptina en el exón 2 y correlacionarlo con los parámetros de producción y calidad de leche. Se recolectaron 100 muestra de sangre de vacas en producción del establo “Lácteos Florida” de Francisco I. Madero municipio de Coahuila, México con tres esta tus de producción: altas, medias y bajas La extracción de ADN se realizó por el método modificado de Salting - Out. Se realizó PCR del gen leptina originando un fragmento de 272 bp de longitud y se realizó PCR - RFLP con la enzima de restricción ACI I y secue nciación, correlacionando los genotipos TT, CT Y CC con tres estatus de producción de leche: altas, medias, bajas. El análisis estadístico indicó que las vacas portadoras del genotipo homocigoto (TT tienen un efecto significativo (P<0.01 con respecto a l as características de producción y calidad de leche ya que tuvieron un mayor consumo de alimento, ganancia de peso, además de una elevada producción de leche en comparación a los genotipos heterocigoto (CT y homocigoto (CC. Los resultados obtenidos muest ran que l a identificación molecular de polimorfismos del gen Ob puede usarse como herramienta de selección genética en bovinos de raza Holstein.

  19. Variabilidad genética de la respuesta inflamatoria: I. Polimorfismo -511 C/T en el gen IL1β en diferentes subpoblaciones peruanas

    Directory of Open Access Journals (Sweden)

    Óscar Acosta

    2012-07-01

    Full Text Available El polimorfismo -511 citosina/timina (-511 C/T en la región promotora del gen interleuquina 1 beta (IL1β estα implicado en la producciσn diferencial de la citoquina y por tanto puede estar asociado a la respuesta inmuno-inflamatoria en obesidad, dislipidemias, cardiopatías, cáncer, infecciones, y el tratamiento con nutrientes y fármacos. Objetivos: Establecer la distribución de frecuencias de los genotipos y alelos del polimorfismo -511 C/T del gen IL1β en diferentes subpoblaciones peruanas. Diseño: Estudio descriptivo, observacional, transversal. Instituciones: Centro de Investigación de Bioquímica y Nutrición e Instituto de Medicina Tropical D.A. Carrión, Facultad de Medicina, UNMSM y Centro de Genética y Biología Molecular, Facultad de Medicina, USMP, Lima, Perú. Participantes: Pobladores peruanos. Intervenciones: Extracción de ADN genómico a partir de muestras sanguíneas o epitelio bucal según metodología estándar, de 168 individuos de 9 grupos subpoblacionales: 23 mestizos de Lima, 33 amazónicos (20 de Pucallpa y 13 de Amazonas y 112 andinos (12 de Ancash, 10 de Cajamarca, 18 de Huarochirí-Lima, 25 de Puno-Taquile, 25 de Puno-Uros y 22 de Puno-Anapia. Análisis del polimorfismo -511 C/T mediante la técnica de PCR/RFLP, con primers específicos y digestión con la enzima de restricción AvaI, detectándose los fragmentos por electroforesis en geles de agarosa al 2% y tinción con bromuro de etidio. Principales medidas de resultados: Frecuencias genotípicas y alélicas del gen IL1β. Resultados: Se encontró las siguientes frecuencias genotípicas CC=0,024; CT=0,369 y TT=0,607, consistentes con el equilibrio de Hardy-Weinberg; y las frecuencias alélicas fueron alelo C=0,208 y aleloT= 0,792. La frecuencia del alelo T, considerado el mutante, fue muy alta en los Uros de Puno (0.940 y más baja en los mestizos de Lima (0.609. La comparación de las frecuencias genotípicas (TT versus CT+CC y alélicas (T versus C

  20. Molecular Etiology of Hearing Impairment in Inner Mongolia: mutations in SLC26A4 gene and relevant phenotype analysis

    Directory of Open Access Journals (Sweden)

    Wu Bailin

    2008-11-01

    Full Text Available Abstract Background The molecular etiology of hearing impairment in Chinese has not been thoroughly investigated. Study of GJB2 gene revealed that 30.4% of the patients with hearing loss in Inner Mongolia carried GJB2 mutations. The SLC26A4 gene mutations and relevant phenotype are analyzed in this study. Methods One hundred and thirty-five deaf patients were included. The coding exons of SLC26A4 gene were sequence analyzed in 111 patients, not including 22 patients carrying bi-allelic GJB2 mutations or one patient carrying a known GJB2 dominant mutation as well as one patient with mtDNA 1555A>G mutation. All patients with SLC26A4 mutations or variants were subjected to high resolution temporal bone CT scan and those with confirmed enlarged vestibular aqueduct and/or other inner ear malformation were then given further ultrasound scan of thyroid and thyroid hormone assays. Results Twenty-six patients (19.26%, 26/135 were found carrying SLC26A4 mutation. Among them, 17 patients with bi-allelic SLC26A4 mutations were all confirmed to have EVA or other inner ear malformation by CT scan. Nine patients were heterozygous for one SLC26A4 mutation, including 3 confirmed to be EVA or EVA and Mondini dysplasia by CT scan. The most common mutation, IVS7-2A>G, accounted for 58.14% (25/43 of all SLC26A4 mutant alleles. The shape and function of thyroid were confirmed to be normal by thyroid ultrasound scan and thyroid hormone assays in 19 of the 20 patients with EVA or other inner ear malformation except one who had cystoid change in the right side of thyroid. No Pendred syndrome was diagnosed. Conclusion In Inner Mongolia, China, mutations in SLC26A4 gene account for about 12.6% (17/135 of the patients with hearing loss. Together with GJB2 (23/135, SLC26A4 are the two most commonly mutated genes causing deafness in this region. Pendred syndrome is not detected in this deaf population. We established a new strategy that detects SLC26A4 mutations prior to the

  1. Molecular Etiology of Hearing Impairment in Inner Mongolia: mutations in SLC26A4 gene and relevant phenotype analysis

    Science.gov (United States)

    Dai, Pu; Yuan, Yongyi; Huang, Deliang; Zhu, Xiuhui; Yu, Fei; Kang, Dongyang; Yuan, Huijun; Wu, Bailin; Han, Dongyi; Wong, Lee-Jun C

    2008-01-01

    Background The molecular etiology of hearing impairment in Chinese has not been thoroughly investigated. Study of GJB2 gene revealed that 30.4% of the patients with hearing loss in Inner Mongolia carried GJB2 mutations. The SLC26A4 gene mutations and relevant phenotype are analyzed in this study. Methods One hundred and thirty-five deaf patients were included. The coding exons of SLC26A4 gene were sequence analyzed in 111 patients, not including 22 patients carrying bi-allelic GJB2 mutations or one patient carrying a known GJB2 dominant mutation as well as one patient with mtDNA 1555A>G mutation. All patients with SLC26A4 mutations or variants were subjected to high resolution temporal bone CT scan and those with confirmed enlarged vestibular aqueduct and/or other inner ear malformation were then given further ultrasound scan of thyroid and thyroid hormone assays. Results Twenty-six patients (19.26%, 26/135) were found carrying SLC26A4 mutation. Among them, 17 patients with bi-allelic SLC26A4 mutations were all confirmed to have EVA or other inner ear malformation by CT scan. Nine patients were heterozygous for one SLC26A4 mutation, including 3 confirmed to be EVA or EVA and Mondini dysplasia by CT scan. The most common mutation, IVS7-2A>G, accounted for 58.14% (25/43) of all SLC26A4 mutant alleles. The shape and function of thyroid were confirmed to be normal by thyroid ultrasound scan and thyroid hormone assays in 19 of the 20 patients with EVA or other inner ear malformation except one who had cystoid change in the right side of thyroid. No Pendred syndrome was diagnosed. Conclusion In Inner Mongolia, China, mutations in SLC26A4 gene account for about 12.6% (17/135) of the patients with hearing loss. Together with GJB2 (23/135), SLC26A4 are the two most commonly mutated genes causing deafness in this region. Pendred syndrome is not detected in this deaf population. We established a new strategy that detects SLC26A4 mutations prior to the temporal bone CT scan to

  2. Diversity in the glucose transporter-4 gene (SLC2A4 in humans reflects the action of natural selection along the old-world primates evolution.

    Directory of Open Access Journals (Sweden)

    Eduardo Tarazona-Santos

    Full Text Available BACKGROUND: Glucose is an important source of energy for living organisms. In vertebrates it is ingested with the diet and transported into the cells by conserved mechanisms and molecules, such as the trans-membrane Glucose Transporters (GLUTs. Members of this family have tissue specific expression, biochemical properties and physiologic functions that together regulate glucose levels and distribution. GLUT4 -coded by SLC2A4 (17p13 is an insulin-sensitive transporter with a critical role in glucose homeostasis and diabetes pathogenesis, preferentially expressed in the adipose tissue, heart muscle and skeletal muscle. We tested the hypothesis that natural selection acted on SLC2A4. METHODOLOGY/PRINCIPAL FINDINGS: We re-sequenced SLC2A4 and genotyped 104 SNPs along a approximately 1 Mb region flanking this gene in 102 ethnically diverse individuals. Across the studied populations (African, European, Asian and Latin-American, all the eight common SNPs are concentrated in the N-terminal region upstream of exon 7 ( approximately 3700 bp, while the C-terminal region downstream of intron 6 ( approximately 2600 bp harbors only 6 singletons, a pattern that is not compatible with neutrality for this part of the gene. Tests of neutrality based on comparative genomics suggest that: (1 episodes of natural selection (likely a selective sweep predating the coalescent of human lineages, within the last 25 million years, account for the observed reduced diversity downstream of intron 6 and, (2 the target of natural selection may not be in the SLC2A4 coding sequence. CONCLUSIONS: We propose that the contrast in the pattern of genetic variation between the N-terminal and C-terminal regions are signatures of the action of natural selection and thus follow-up studies should investigate the functional importance of different regions of the SLC2A4 gene.

  3. Dicty_cDB: SLC832 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC832 (Link to dictyBase) - - - Contig-U13922-1 SLC832Z (Link... to Original site) - - SLC832Z 638 - - - - Show SLC832 Library SL (Link to library) Clone ID SLC832 (Link to dic..._1( EU565733 |pid:none) Uncultured soil bacterium clone gl... 35 2.4 CP000010_276....1 AP009385_2728( AP009385 |pid:none) Burkholderia multivorans ATCC 1... 33 5.3 A... 20.0 %: nuclear 16.0 %: vesicles of secretory system 12.0 %: mitochondrial 8.0 %: Golgi 8.0 %: endoplasmic reticul

  4. Effects of fasting and refeeding on gene expression of slc15a1a, a gene encoding an oligopeptide transporter (PepT1), in the intestine of Mozambique tilapia.

    Science.gov (United States)

    Orozco, Zenith Gaye A; Soma, Satoshi; Kaneko, Toyoji; Watanabe, Soichi

    2017-01-01

    The tissue distribution of slc15a1a, a gene that encodes an oligopeptide transporter, PepT1, and its response to fasting and refeeding were investigated in the intestinal epithelium of Mozambique tilapia for a better understanding of its role on nutrient absorption. The slc15a1a was predominantly expressed in the absorptive epithelia of the anterior part of the intestine, suggesting that digested oligopeptides are primarily absorbed in the anterior intestine. The response of slc15a1a to fasting was evaluated at 1, 2, 4, 7 and 14days after the last feeding. Fasting revealed a biphasic effect, where short-term fasting significantly upregulated slc15a1a expression and long-term fasting resulted in downregulation. The expression level continued to decrease and fell below the pre-fasted level from day 4 to 14. Proximal (the hepatic loop, HL) and distal parts (the proximal major coil, PMC) of the anterior intestine showed different magnitudes of responses to fasting; slc15a1a expression in the PMC showed greater upregulation and downregulation than that in the HL. Refeeding significantly stimulated slc15a1a expression at day 3, although the expression did not exceed the pre-fasted level. Observed responses of slc15a1a to fasting and refeeding suggest that the expression level of this gene can serve as a sensitive indicator of the changes that may occur in altering nutritional conditions. These findings contribute to a better understanding of the role of PepT1 in nutrition and of the complex mechanisms underlying the absorption of oligopeptides and amino acids in the intestine, and may lead to development of possible means to manipulate the absorption processes for the improvement of growth and other metabolic and physiological conditions in fish. Copyright © 2016. Published by Elsevier Inc.

  5. SLC6A1 Mutation and Ketogenic Diet in Epilepsy With Myoclonic-Atonic Seizures.

    Science.gov (United States)

    Palmer, Samantha; Towne, Meghan C; Pearl, Phillip L; Pelletier, Renee C; Genetti, Casie A; Shi, Jiahai; Beggs, Alan H; Agrawal, Pankaj B; Brownstein, Catherine A

    2016-11-01

    Epilepsy with myoclonic-atonic seizures, also known as myoclonic-astatic epilepsy or Doose syndrome, has been recently linked to variants in the SLC6A1 gene. Epilepsy with myoclonic-atonic seizures is often refractory to antiepileptic drugs, and the ketogenic diet is known for treating medically intractable seizures, although the mechanism of action is largely unknown. We report a novel SLC6A1 variant in a patient with epilepsy with myoclonic-atonic seizures, analyze its effects, and suggest a mechanism of action for the ketogenic diet. We describe a ten-year-old girl with epilepsy with myoclonic-atonic seizures and a de novo SLC6A1 mutation who responded well to the ketogenic diet. She carried a c.491G>A mutation predicted to cause p.Cys164Tyr amino acid change, which was identified using whole exome sequencing and confirmed by Sanger sequencing. High-resolution structural modeling was used to analyze the likely effects of the mutation. The SLC6A1 gene encodes a transporter that removes gamma-aminobutyric acid from the synaptic cleft. Mutations in SLC6A1 are known to disrupt the gamma-aminobutyric acid transporter protein 1, affecting gamma-aminobutyric acid levels and causing seizures. The p.Cys164Tyr variant found in our study has not been previously reported, expanding on the variants linked to epilepsy with myoclonic-atonic seizures. A 10-year-old girl with a novel SLC6A1 mutation and epilepsy with myoclonic-atonic seizures had an excellent clinical response to the ketogenic diet. An effect of the diet on gamma-aminobutyric acid reuptake mediated by gamma-aminobutyric acid transporter protein 1 is suggested. A personalized approach to epilepsy with myoclonic-atonic seizures patients carrying SLC6A1 mutation and a relationship between epilepsy with myoclonic-atonic seizures due to SLC6A1 mutations, GABAergic drugs, and the ketogenic diet warrants further exploration. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. Multicenter cohort association study of SLC2A1 single nucleotide polymorphisms and age-related macular degeneration

    Science.gov (United States)

    Baas, Dominique C.; Ho, Lintje; Tanck, Michael W.T.; Fritsche, Lars G.; Merriam, Joanna E.; van het Slot, Ruben; Koeleman, Bobby P.C.; Gorgels, Theo G.M.F.; van Duijn, Cornelia M.; Uitterlinden, André G.; de Jong, Paulus T.V.M.; Hofman, Albert; ten Brink, Jacoline B.; Vingerling, Johannes R.; Klaver, Caroline C.W.; Dean, Michael; Weber, Bernhard H. F.; Allikmets, Rando; Hageman, Gregory S.

    2012-01-01

    Purpose Age-related macular degeneration (AMD) is a major cause of blindness in older adults and has a genetically complex background. This study examines the potential association between single nucleotide polymorphisms (SNPs) in the glucose transporter 1 (SLC2A1) gene and AMD. SLC2A1 regulates the bioavailability of glucose in the retinal pigment epithelium (RPE), which might influence oxidative stress–mediated AMD pathology. Methods Twenty-two SNPs spanning the SLC2A1 gene were genotyped in 375 cases and 199 controls from an initial discovery cohort (the Amsterdam-Rotterdam-Netherlands study). Replication testing was performed in The Rotterdam Study (the Netherlands) and study populations from Würzburg (Germany), the Age Related Eye Disease Study (AREDS; United States), Columbia University (United States), and Iowa University (United States). Subsequently, a meta-analysis of SNP association was performed. Results In the discovery cohort, significant genotypic association between three SNPs (rs3754219, rs4660687, and rs841853) and AMD was found. Replication in five large independent (Caucasian) cohorts (4,860 cases and 4,004 controls) did not yield consistent association results. The genotype frequencies for these SNPs were significantly different for the controls and/or cases among the six individual populations. Meta-analysis revealed significant heterogeneity of effect between the studies. Conclusions No overall association between SLC2A1 SNPs and AMD was demonstrated. Since the genotype frequencies for the three SLC2A1 SNPs were significantly different for the controls and/or cases between the six cohorts, this study corroborates previous evidence that population dependent genetic risk heterogeneity in AMD exists. PMID:22509097

  7. Prevalencia de bacterias Gram negativas portadoras del gen blaKPC en hospitales de Colombia

    OpenAIRE

    Robinson Pacheco; Lyda Osorio; Adriana M. Correa; Maria Virginia Villegas

    2014-01-01

    Introducción. Las enzimas carbapenemasas de tipo KPC tienen gran capacidad de diseminación, son causantes de epidemias y se asocian a mayor mortalidad y estancia hospitalaria. En Colombia se han venido reportando cada vez más desde 2007, pero se desconoce la prevalencia hospitalaria. Objetivo. Estimar la prevalencia hospitalaria del gen blaKPC. Materiales y métodos. Se evaluó la presencia del gen blaKPC y su ‘clonalidad’ en aislamientos de enterobacterias y Pseudomonas aeruginosa de p...

  8. Functional assessment of allelic variants in the SLC26A4 gene involved in Pendred syndrome and nonsyndromic EVA

    Science.gov (United States)

    Pera, Alejandra; Dossena, Silvia; Rodighiero, Simona; Gandía, Marta; Bottà, Guido; Meyer, Giuliano; Moreno, Felipe; Nofziger, Charity; Hernández-Chico, Concepción; Paulmichl, Markus

    2008-01-01

    Pendred syndrome is an autosomal recessive disorder characterized by sensorineural hearing loss, with malformations of the inner ear, ranging from enlarged vestibular aqueduct (EVA) to Mondini malformation, and deficient iodide organification in the thyroid gland. Nonsyndromic EVA (ns-EVA) is a separate type of sensorineural hearing loss showing normal thyroid function. Both Pendred syndrome and ns-EVA seem to be linked to the malfunction of pendrin (SLC26A4), a membrane transporter able to exchange anions between the cytosol and extracellular fluid. In the past, the pathogenicity of SLC26A4 missense mutations were assumed if the mutations fulfilled two criteria: low incidence of the mutation in the control population and substitution of evolutionary conserved amino acids. Here we show that these criteria are insufficient to make meaningful predictions about the effect of these SLC26A4 variants on the pendrin-induced ion transport. Furthermore, we functionally characterized 10 missense mutations within the SLC26A4 ORF, and consistently found that on the protein level, an addition or omission of a proline or a charged amino acid in the SLC26A4 sequence is detrimental to its function. These types of changes may be adequate for predicting SLC26A4 functionality in the absence of direct functional tests. PMID:19017801

  9. SLC45A2 mutation frequency in Oculocutaneous Albinism Italian patients doesn't differ from other European studies.

    Science.gov (United States)

    Mauri, Lucia; Barone, Luca; Al Oum, Muna; Del Longo, Alessandra; Piozzi, Elena; Manfredini, Emanuela; Stanzial, Franco; Benedicenti, Francesco; Penco, Silvana; Patrosso, Maria Cristina

    2014-01-01

    Oculocutaneous Albinism (OCA) is a heterogeneous group of inherited diseases involving hair, skin and eyes. To date, six forms are recognized on the effects of different melanogenesis genes. OCA4 is caused by mutations in SLC45A2 showing a heterogeneous phenotype ranging from white hair, blue irides and nystagmus to brown/black hair, brown irides and no nystagmus. The high clinic variety often leads to misdiagnosis. Our aim is to contribute to OCA4 diagnosis defining SLC45A2 genetic variants in Italian patients with OCA without any TYR, OCA2 and TYRP1 gene defects. After the clinical diagnosis of OCA, all patients received genetic counseling and genetic test. Automatic sequencing of TYR, OCA2, and TYRP1 genes was performed on DNA of 117 albino patients. Multiplex Ligation-dependent Probe Amplification (MLPA) was carried out on TYR and OCA2 genes to increase the mutation rate. SLC45A2 gene sequencing was then executed in the patients with a single mutation in one of the TYR, OCA2, TYRP1 genes and in the patients, which resulted negative at the screening of these genes. SLC45A2 gene analysis was performed in 41 patients and gene alterations were found in 5 patients. Four previously reported SLC45A2 mutations were found: p.G100S, p.W202C, p.A511E and c.986delC, and three novel variants were identified: p.M265L, p.H94D, and c.1156+1G>A. All the alterations have been detected in the group of patients without mutations in the other OCA genes. Three new variants were identified in OCA4 gene; the analysis allowed the classification of a patient previously misdiagnosed as OA1 because of skin and hair pigmentation presence. The molecular defects in SLC45A2 gene represent the 3.4% in this cohort of Italian patients, similar to other Caucasian populations; our data differ from those previously published by an Italian researcher group, obtained on a smaller cohort of patients. © 2013 Elsevier B.V. All rights reserved.

  10. Célula del SMF modificada genéticamente para sobreexpresar NGAL y su uso como medicamento

    OpenAIRE

    Hotter, Georgina; Jung, Michaela; Solà, Anna M.

    2009-01-01

    Célula del SMF modificada genéticamente para sobreexpresar NGAL y su uso como medicamento. La presente invención se encuadra dentro del campo de la biomedicina. Específicamente, la presente invención se refiere a una célula del Sistema Mononuclear Fagocítico o SMF, preferiblemente un monocito o un macrófago, modificada genéticamente para sobreexpresar la lipocalina asociada a gelatinasa de neutrófilos (NGAL, en sus siglas en inglés), a un método para su obtención y a s...

  11. Extremely discrepant mutation spectrum of SLC26A4 between Chinese patients with isolated Mondini deformity and enlarged vestibular aqueduct

    OpenAIRE

    Huang, Shasha; Han, Dongyi; Yuan, Yongyi; Wang, Guojian; Kang, Dongyang; Zhang, Xin; Yan, Xiaofei; Meng, Xiaoxiao; Dong, Min; Dai, Pu

    2011-01-01

    Abstract Background Mutations in SLC26A4 cause Pendred syndrome (hearing loss with goiter) or DFNB4 (non-syndromic hearing loss with inner ear malformation, such as enlarged vestibular aqueduct or Mondini deformity). The relationship between mutations in SLC26A4 and Mondini deformity without enlarged vestibular aqueduct has not been studied in any Chinese deaf population. The purpose of this study was to assess whether mutations in the SLC26A4 gene cause Mondini deformity without an enlarged ...

  12. The renal urate transporter SLC17A1 locus: confirmation of association with gout.

    Science.gov (United States)

    Hollis-Moffatt, Jade E; Phipps-Green, Amanda J; Chapman, Brett; Jones, Gregory T; van Rij, Andre; Gow, Peter J; Harrison, Andrew A; Highton, John; Jones, Peter B; Montgomery, Grant W; Stamp, Lisa K; Dalbeth, Nicola; Merriman, Tony R

    2012-04-27

    Two major gout-causing genes have been identified, the urate transport genes SLC2A9 and ABCG2. Variation within the SLC17A1 locus, which encodes sodium-dependent phosphate transporter 1, a renal transporter of uric acid, has also been associated with serum urate concentration. However, evidence for association with gout is equivocal. We investigated the association of the SLC17A1 locus with gout in New Zealand sample sets. Five variants (rs1165196, rs1183201, rs9358890, rs3799344, rs12664474) were genotyped across a New Zealand sample set totaling 971 cases and 1,742 controls. Cases were ascertained according to American Rheumatism Association criteria. Two population groups were studied: Caucasian and Polynesian. At rs1183201 (SLC17A1), evidence for association with gout was observed in both the Caucasian (odds ratio (OR) = 0.67, P = 3.0 × 10-6) and Polynesian (OR = 0.74, P = 3.0 × 10-3) groups. Meta-analysis confirmed association of rs1183201 with gout at a genome-wide level of significance (OR = 0.70, P = 3.0 × 10-8). Haplotype analysis suggested the presence of a common protective haplotype. We confirm the SLC17A1 locus as the third associated with gout at a genome-wide level of significance.

  13. Los suelos del Parque Nacional Viñales, Pinar del Río, Cuba. Condiciones genéticas y ambientales.

    Directory of Open Access Journals (Sweden)

    Efrén Jaimez Salgado

    2006-01-01

    Full Text Available Se realiza la cartografía digital y actualización de la clasificación y diagnóstico de suelos del área del «Parque Nacional Viñales», a partir de la implementación de un Sistema de Información de Suelos (sobre plataforma SIG, para el manejo y consulta oportuna de las correspondientes bases de datos por parte de las autoridades del Parque. Los suelos predominantes por excelencia corresponden al grupo Leptosoles (90%. Están seguidos en segundo lugar por el grupo Acrisoles (4,5%, los que se encuentran en asociación genética con el grupo Alisoles, (4,4% tratándose en ambos casos de suelos con muy alto grado de evolución edáfica, cuyo origen y evolución se deriva de la combinación de materiales parentales ricos en cuarzo y silicatos de aluminio, así como la existencia de períodos climáticos antiguos muy húmedos en esta zona montañosa del occidente de Cuba. Se describen los principales procesos degradantes encontrados en los suelos del Parque y algunas de las medidas más importantes a tomar para atenuarlos.

  14. S113R mutation in SLC33A1 leads to neurodegeneration and augmented BMP signaling in a mouse model

    Directory of Open Access Journals (Sweden)

    Pingting Liu

    2017-01-01

    Full Text Available The S113R mutation (c.339T>G (MIM #603690.0001 in SLC33A1 (MIM #603690, an ER membrane acetyl-CoA transporter, has been previously identified in individuals with hereditary spastic paraplegia type 42 (SPG42; MIM #612539. SLC33A1 has also been shown to inhibit the bone morphogenetic protein (BMP signaling pathway in zebrafish. To better understand the function of SLC33A1, we generated and characterized Slc33a1S113R knock-in mice. Homozygous Slc33a1S113R mutant mice were embryonic lethal, whereas heterozygous Slc33a1 mutant mice (Slc33a1wt/mut exhibited behavioral abnormalities and central neurodegeneration, which is consistent with hereditary spastic paraplegia (HSP phenotypes. Importantly, we found an upregulation of BMP signaling in the nervous system and mouse embryonic fibroblasts of Slc33a1wt/mut mice. Using a sciatic nerve crush injury model in vivo and dorsal root ganglion (DRG culture in vitro we showed that injury-induced axonal regeneration in Slc33a1wt/mut mice was accelerated and mediated by upregulated BMP signaling. Exogenous addition of BMP signaling antagonist, noggin, could efficiently alleviate the accelerated injury-induced axonal regrowth. These results indicate that SLC33A1 can negatively regulate BMP signaling in mice, further supporting the notion that upregulation of BMP signaling is a common mechanism of a subset of hereditary spastic paraplegias.

  15. Medicina Genómica Aspectos éticos, legales y sociales del Genoma Humano

    Directory of Open Access Journals (Sweden)

    Rodolfo E. Ávila

    2011-01-01

    Full Text Available La Medicina Genómica es el uso de la inf ormación de los genomas y sus deriv ados (ARN, proteínas y met abolitos que permite guiar la toma de decisiones médicas, es un c omponente clave de la medicina personalizada. La Medicina Genómica permite conocer la cartografía del genoma hum ano y proporciona una valiosa información a tener en cuenta a la hora de detect ar genes implicados en ciert as enfermedades. Esto conlleva a que en la actualidad nos centremos más en la predicción de patologías que en l a prevención, por lo que la tendencia es que en el futuro la Medicina Genómica acabe desbancando a la Medicina P reventiva. El Proyecto Genoma Humano presenta diversas aplicaciones que, al no tener una clara cobert ura legal, traen consigo un nuevo paradigma con problemas éticos, sociales y legales que la comunidad científica trat a de resolver para compaginar los aspectos morales con el progreso en la investigación. El objetivo del presente trabajo es describir brevemente los aspectos éticos, legales y sociales del Genoma Humano.

  16. Avances del mejoramiento genético participativo del frijol en Cuba

    Directory of Open Access Journals (Sweden)

    Rodobaldo Ortiz-P\\u00E9rez

    2006-01-01

    Full Text Available Las actividades de Fitomejoramiento Participativo fueron conducidas con agricultores del municipio de San Antonio de los Baños de la provincia La Habana y campesinos de la comunidad la Palma de la provincia de Pinar del Río durante 2001 al 2004. En la fase de diagnóstico en las áreas de intervención del proyecto, más del 80 % de los agricultores no utilizaban la semilla del sistema formal; por lo tanto, las variedades obtenidas por los programas de mejoramiento no llegaban a la mayoría de los agricultores. Se buscó un mecanismo alternativo para introducir diversidad genética a las localidades mediante las ferias de diversidad, cuyo objetivo principal ha estado dirigido a facilitar el flujo de semilla de los institutos de investigaciones hacia el agricultor y viceversa. Posterior al desarrollo de las ferias de diversidad se continúa con la experimentación campesina en fincas y cooperativas, desarrollándose una amplia red experimental difícil de lograrse sin la participación de los productores. La experimentación campesina, el aumento de la eficiencia en la finca, incluyendo el aumento del rendimiento de sus parcelas, el aumento de la diversidad por el uso de mayor número de variedades, y una mayor proporción de área dedicada a estas variedades; todo lo cual redunda en un mejoramiento de la vida del campesino y su familia

  17. Acceso a recursos genéticos y distribución de beneficios en Colombia: desafíos del régimen normativo

    Directory of Open Access Journals (Sweden)

    Luciana Carla Silvestri

    2016-06-01

    Full Text Available La investigación analiza los retos que presenta el régimen colombiano sobre acceso a recursos genéticos y distribución de beneficios mediante la utilización del método jurídico, con un enfoque descriptivo, comparativo y propositivo. El mecanismo de acceso y distribución de beneficios pretende desacelerar la pérdida de diversidad genética, entre otros fines. El marco legal se encuentra incompleto y no sistematizado. Asimismo, el procedimiento de acceso a recursos genéticos surge burocrático e ineficiente y obstaculiza así la investigación de la biodiversidad del país. Afortunadamente, la reciente simplificación del procedimiento para investigar recursos genéticos con fines no comerciales podría ayudar a resolver el mencionado problema para este tipo de proyectos. Además, la consulta previa articulada para el acceso a recursos genéticos ubicados en territorios de las comunidades indígenas y negras no garantiza la efectiva participación de aquellas. Por último, las medidas de cumplimiento establecidas, que circunscriben el control al acatamiento de la legislación colombiana y la de los países andinos, no satisfacen las disposiciones del Protocolo de Nagoya al respecto.

  18. Dicty_cDB: SLC460 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC460 (Link to dictyBase) - - - - SLC460Z (Link to Original site) - - SLC4...60Z 333 - - - - Show SLC460 Library SL (Link to library) Clone ID SLC460 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...60Q.Seq.d/ Representative seq. ID SLC460Z (Link to Original site) R...epresentative DNA sequence >SLC460 (SLC460Q) /CSM/SL/SLC4-C/SLC460Q.Seq.d/ XXXXXXXXXXAATTATTATTGTGTAATTCCTGT

  19. Dicty_cDB: SLC496 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC496 (Link to dictyBase) - - - - SLC496E (Link to Original site) - - - - - - SLC4...96E 443 Show SLC496 Library SL (Link to library) Clone ID SLC496 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC4...96Q.Seq.d/ Representative seq. ID SLC496E (Link to Original site) R...epresentative DNA sequence >SLC496 (SLC496Q) /CSM/SL/SLC4-D/SLC496Q.Seq.d/ AAGAAATTTGAATCACTCCAAATCATTATCCCA

  20. Dicty_cDB: SLC449 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC449 (Link to dictyBase) - - - - SLC449Z (Link to Original site) - - SLC4...49Z 384 - - - - Show SLC449 Library SL (Link to library) Clone ID SLC449 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...49Q.Seq.d/ Representative seq. ID SLC449Z (Link to Original site) R...epresentative DNA sequence >SLC449 (SLC449Q) /CSM/SL/SLC4-C/SLC449Q.Seq.d/ XXXXXXXXXXGTAAAAAGGAACACCAAGCCACT

  1. Vps35-deficiency impairs SLC4A11 trafficking and promotes corneal dystrophy.

    Directory of Open Access Journals (Sweden)

    Wei Liu

    Full Text Available Vps35 (vacuolar protein sorting 35 is a major component of retromer that selectively promotes endosome-to-Golgi retrieval of transmembrane proteins. Dysfunction of retromer is a risk factor for the pathogenesis of Parkinson's disease (PD and Alzheimer's disease (AD. However, Vps35/retromer's function in the eye or the contribution of Vps35-deficiency to eye degenerative disorders remains to be explored. Here we provide evidence for a critical role of Vps35 in mouse corneal dystrophy. Vps35 is expressed in mouse and human cornea. Mouse cornea from Vps35 heterozygotes (Vps35+/- show features of dystrophy, such as loss of both endothelial and epithelial cell densities, disorganizations of endothelial, stroma, and epithelial cells, excrescences in the Descemet membrane, and corneal edema. Additionally, corneal epithelial cell proliferation was reduced in Vps35-deficient mice. Intriguingly, cell surface targeting of SLC4A11, a membrane transport protein (OH- /H+ /NH3 /H2O of corneal endothelium, whose mutations have been identified in patients with corneal dystrophy, was impaired in Vps35-deficient cells and cornea. Taken together, these results suggest that SLC4A11 appears to be a Vps35/retromer cargo, and Vps35-regulation of SLC4A11 trafficking may underlie Vps35/retromer regulation of corneal dystrophy.

  2. Mutations in the GABA Transporter SLC6A1 Cause Epilepsy with Myoclonic-Atonic Seizures

    Science.gov (United States)

    Carvill, Gemma L.; McMahon, Jacinta M.; Schneider, Amy; Zemel, Matthew; Myers, Candace T.; Saykally, Julia; Nguyen, John; Robbiano, Angela; Zara, Federico; Specchio, Nicola; Mecarelli, Oriano; Smith, Robert L.; Leventer, Richard J.; Møller, Rikke S.; Nikanorova, Marina; Dimova, Petia; Jordanova, Albena; Petrou, Steven; Helbig, Ingo; Striano, Pasquale; Weckhuysen, Sarah; Berkovic, Samuel F.; Scheffer, Ingrid E.; Mefford, Heather C.

    2015-01-01

    GAT-1, encoded by SLC6A1, is one of the major gamma-aminobutyric acid (GABA) transporters in the brain and is responsible for re-uptake of GABA from the synapse. In this study, targeted resequencing of 644 individuals with epileptic encephalopathies led to the identification of six SLC6A1 mutations in seven individuals, all of whom have epilepsy with myoclonic-atonic seizures (MAE). We describe two truncations and four missense alterations, all of which most likely lead to loss of function of GAT-1 and thus reduced GABA re-uptake from the synapse. These individuals share many of the electrophysiological properties of Gat1-deficient mice, including spontaneous spike-wave discharges. Overall, pathogenic mutations occurred in 6/160 individuals with MAE, accounting for ∼4% of unsolved MAE cases. PMID:25865495

  3. Activation of lysosomal P2X4 by ATP transported into lysosomes via VNUT/SLC17A9 using V‐ATPase generated voltage gradient as the driving force

    Science.gov (United States)

    Zhong, Xi Zoë; Cao, Qi; Sun, Xue

    2016-01-01

    Key points SLC17A9 proteins function as a lysosomal ATP transporter responsible for lysosomal ATP accumulation.P2X4 receptors act as lysosomal ion channels activated by luminal ATP.SLC17A9‐mediated ATP transport across the lysosomal membrane is suppressed by Bafilomycin A1, the V‐ATPase inhibitor.SLC17A9 mainly uses voltage gradient but not pH gradient generated by the V‐ATPase as the driving force to transport ATP into the lysosome to activate P2X4. Abstract The lysosome contains abundant ATP which plays important roles in lysosome functions and in cell signalling. Recently, solute carrier family 17 member 9 (SLC17A9, also known as VNUT for vesicular nucleotide transporter) proteins were suggested to function as a lysosomal ATP transporter responsible for lysosomal ATP accumulation, and P2X4 receptors were suggested to be lysosomal ion channels that are activated by luminal ATP. However, the molecular mechanism of SLC17A9 transporting ATP and the regulatory mechanism of lysosomal P2X4 are largely unknown. In this study, we report that SLC17A9‐mediated ATP transport across lysosomal membranes is suppressed by Bafilomycin A1, the V‐ATPase inhibitor. By measuring P2X4 activity, which is indicative of ATP transport across lysosomal membranes, we further demonstrated that SLC17A9 mainly uses voltage gradient but not pH gradient as the driving force to transport ATP into lysosomes. This study provides a molecular mechanism for lysosomal ATP transport mediated by SLC17A9. It also suggests a regulatory mechanism of lysosomal P2X4 by SLC17A9. PMID:27477609

  4. The role of SLC2A1 in early onset and childhood absence epilepsies

    DEFF Research Database (Denmark)

    Muhle, Hiltrud; Helbig, Ingo; Frøslev, Tobias Guldberg

    2013-01-01

    Early Onset Absence Epilepsy constitutes an Idiopathic Generalized Epilepsy with absences starting before the age of four years. Mutations in SLC2A1, encoding the glucose transporter, account for approximately 10% of EOAE cases. The role of SLC2A1 mutations in absence epilepsies with a later onset...

  5. ASCT2 (SLC1A5-Deficient Mice Have Normal B-Cell Development, Proliferation, and Antibody Production

    Directory of Open Access Journals (Sweden)

    Etienne Masle-Farquhar

    2017-05-01

    Full Text Available SLC1A5 (solute carrier family 1, member 5 is a small neutral amino acid exchanger that is upregulated in rapidly proliferating lymphocytes but also in many primary human cancers. Furthermore, cancer cell lines have been shown to require SLC1A5 for their survival in vitro. One of SLC1A5’s primary substrates is the immunomodulatory amino acid glutamine, which plays an important role in multiple key processes, such as energy supply, macromolecular synthesis, nucleotide biosynthesis, redox homeostasis, and resistance against oxidative stress. These processes are also essential to immune cells, including neutrophils, macrophages, B and T lymphocytes. We show here that mice with a stop codon in Slc1a5 have reduced glutamine uptake in activated lymphocytes and primary fibroblasts. B and T cell populations and maturation in resting mice were not affected by absence of SLC1A5. Antibody production in resting and immunized mice and the germinal center response to immunization were also found to be normal. SLC1A5 has been recently described as a novel target for the treatment of a variety of cancers, and our results indicate that inhibition of SLC1A5 in cancer therapy may be tolerated well by the immune system of cancer patients.

  6. Diversidad genética de la región variable de los genes msp1a y msp4 en cepas de Anaplasma marginale de México

    Directory of Open Access Journals (Sweden)

    Rafael Jiménez Ocampo

    2012-01-01

    Full Text Available La anaplasmosis es de difícil control debido a la diversidad genética de la rickettsia. La proteína Msp1a, compuesta de repetidos variables de entre 23 y 31 aminoácidos en su región variable y la proteína Msp4, son dos de las proteínas de superficie más estudiadas en A. marginale y han sido ampliamente usadas como marcadores genéticos en la caracterización de cepas de A. marginale de diferentes orígenes geográficos. En este trabajo se analizaron, la región variable de la proteína Msp1a y la proteína Msp4 de 10 cepas mexicanas. En el caso de Msp1a, se observó un patrón de segregación que contiene los repetidos (alpha, beta, beta, gama en diferentes modalidades a lo largo de aislamientos del Golfo de México, principalmente en zonas de estabilidad enzoótica, mientras que la máxima variabilidad se presentó en Tamaulipas, en aislamientos de un brote de la enfermedad, es decir en zonas de inestabilidad. La diversidad observada no es tan extensa como se esperaba y, misma que se puede explicar por la presión que el sistema inmune del hospedero ejerce contra la rickettsia y los mecanismos de esta última para evadirla. En el caso de la proteína Msp4, la secuencia fue altamente conservada tanto en nucleótidos como en aminoácidos para los aislados en estudio, aunque, se observan diferencias con lo previamente reportado en México para este marcador.

  7. Estudio de bioequivalencia del ibuprofeno genérico 400mg tabletas

    Directory of Open Access Journals (Sweden)

    Ofelia Villalva-Rojas

    2007-10-01

    Full Text Available Objetivo. Determinar la biodisponibilidad de dos formulaciones de ibuprofeno 400mg tabletas, para establecer si el medicamento multifuente (genérico es bioequivalente al de referencia (Motrin® 400mg. Materiales y métodos. Se diseñó un estudio abierto, randomizado, cruzado, dos periodos, con siete días de lavado, con 12 voluntarios sanos de ambos sexos, entre 21 y 48 años, quienes ingirieron una tableta del medicamento genérico o de referencia, según randomización, con 200mL de agua. Luego de ingerir el medicamento se colectó 4mL de sangre por voluntario para la cuantificación plasmática de ibuprofeno. Las muestras de plasma se analizaron por cromatografía líquida acoplada al espectrofotómetro de masas (LC-MS/MS con ionización electrospray ión negativo, aplicando monitoreo de reacción selectiva. La bioequivalencia se determinó con los parámetros farmacocinéticos de área bajo la curva AUC(0-t, AUC(0-∞ y concentración máxima (Cmax. Resultados. Según análisis estadístico, se encontraron: AUCmultifuente(0-t = 86,85 (μg*h/ mL, AUCRef.(0-t= 81,20 (μg*h/mL, AUCmultifuente(0-∞= 88,67 (μg*h/mL, AUCRef.(0-∞= 82,83(μg*h/mL, Cmαxmultifuente = 17,70 ug/mL, CmαxRef. =18,09 μg/mL, con rango de 0,93-1,24 para AUC(0-t, 0,93-1,24 para AUC(0-∞ y 0,81-1,19 para Cmax. Conclusión. Los valores encontrados de ibuprofeno están dentro de los requisitos de la OMS y la FDA, para establecer bioequivalencia (0,80-1,25, demostrándose que el ibuprofeno genérico es bioequivalente al de referencia en velocidad y cantidad de ibuprofeno absorbido en el organismo.

  8. Sequence variation and linkage disequilibrium in the GABA transporter-1 gene (SLC6A1 in five populations: implications for pharmacogenetic research

    Directory of Open Access Journals (Sweden)

    Sughondhabirom Atapol

    2007-10-01

    Full Text Available Abstract Background GABA transporter-1 (GAT-1; genetic locus SLC6A1 is emerging as a novel target for treatment of neuropsychiatric disorders. To understand how population differences might influence strategies for pharmacogenetic studies, we identified patterns of genetic variation and linkage disequilibrium (LD in SLC6A1 in five populations representing three continental groups. Results We resequenced 12.4 kb of SLC6A1, including the promoters, exons and flanking intronic regions in African-American, Thai, Hmong, Finnish, and European-American subjects (total n = 40. LD in SLC6A1 was examined by genotyping 16 SNPs in larger samples. Sixty-three variants were identified through resequencing. Common population-specific variants were found in African-Americans, including a novel 21-bp promoter region variable number tandem repeat (VNTR, but no such variants were found in any of the other populations studied. Low levels of LD and the absence of major LD blocks were characteristic of all five populations. African-Americans had the highest genetic diversity. European-Americans and Finns did not differ in genetic diversity or LD patterns. Although the Hmong had the highest level of LD, our results suggest that a strategy based on the use of tag SNPs would not translate to a major improvement in genotyping efficiency. Conclusion Owing to the low level of LD and presence of recombination hotspots, SLC6A1 may be an example of a problematic gene for association and haplotype tagging-based genetic studies. The 21-bp promoter region VNTR polymorphism is a putatively functional candidate allele for studies focusing on variation in GAT-1 function in the African-American population.

  9. The SLC4A7 variant rs4973768 is associated with breast cancer risk: evidence from a case-control study and a meta-analysis.

    Science.gov (United States)

    Chen, Wei; Zhong, Rong; Ming, Jie; Zou, Li; Zhu, Beibei; Lu, Xuzai; Ke, Juntao; Zhang, Yu; Liu, Li; Miao, Xiaoping; Huang, Tao

    2012-12-01

    Recent genome-wide association study has identified a genetic variant rs4973768, located in 3'-UTR of solute carrier family 4, sodium bicarbonate cotransporter, member 7 (SLC4A7), was associated with increased risk of breast cancer (BC). However, several following replication studies cannot yield consistent results. We thus conducted a hospital-based case-control study including 485 patients and 514 controls, combined a meta-analysis including 108,632 cases and 135,818 controls to explore the relationship between this variant and BC risk. Our case-control study showed that rs4973768 was significantly associated with increased BC risk with the odds ratio (OR) of 1.29 (95 % confidence interval [CI]: 1.04-1.60) under the allelic model. In addition, the meta-analysis also indicated that the variant slightly increased the risk of BC with the pooled OR of the per-allele effect being 1.08 (95 % CI: 1.04-1.11) although with significant heterogeneity between studies. Stratified analyses showed that ethnicity, sample size, and study design may explain part of the heterogeneity. Moreover, the bioinformatics analysis suggested that this variant may influence the transcriptional capacity of SLC4A7. In summary, our results showed that the SLC4A7 variant, rs4973768, is associated with risk of BC although the underlying biologic mechanism warrants further studies.

  10. Pathogenic substitution of IVS15 + 5G > A in SLC26A4 in patients of Okinawa Islands with enlarged vestibular aqueduct syndrome or Pendred syndrome.

    Science.gov (United States)

    Ganaha, Akira; Kaname, Tadashi; Yanagi, Kumiko; Naritomi, Kenji; Tono, Tetsuya; Usami, Shin-ichi; Suzuki, Mikio

    2013-05-24

    Pendred syndrome (PS) and nonsyndromic hearing loss associated with enlarged vestibular aqueduct (EVA) are caused by SLC26A4 mutations. The Okinawa Islands are the southwestern-most islands of the Japanese archipelago. And ancestral differences have been reported between people from Okinawa Island and those from the main islands of Japan. To confirm the ethnic variation of the spectrum of SLC26A4 mutations, we investigated the frequencies of SLC26A4 mutations and clinical manifestations of patients with EVA or PS living in the Okinawa Islands. We examined 22 patients with EVA or PS from 21 unrelated families in Okinawa Islands. The patient's clinical history, findings of physical and otoscopic examinations, hearing test, and computed tomography (CT) scan of the temporal bones were recorded. To detect mutations, all 21 exons and the exon-intron junctions of SLC26A4 were sequenced for all subjects. Quantitative reverse-transcription polymerase chain reaction (qRT-PCR) for SLC26A4 and calculations using the comparative CT (2(-ΔΔCT)) method were used to determine the pathogenicity associated with gene substitutions. SLC26A4 mutations were identified in 21 of the 22 patients. We found a compound heterozygous mutation for IVS15 + 5G > A/H723R in nine patients (41%), a homozygous substitution of IVS15 + 5G > A in six patients (27%), and homozygous mutation for H723R in five patients (23%). The most prevalent types of SLC26A4 alleles were IVS15 + 5G > A and H723R, which both accounted for 15/22 (68%) of the patients. There were no significant correlations between the types of SLC26A4 mutation and clinical manifestations. Based on qRT-PCR results, expression of SLC26A4 was not identified in patients with the homozygous substitution of IVS15 + 5G > A. The substitution of IVS15 + 5G > A in SLC26A4 was the most common mutation in uniquely found in patients with PS and EVA in Okinawa Islands. This suggested that the spectrum of SLC26A4 mutation differed

  11. Positive selection in the SLC11A1 gene in the family Equidae

    DEFF Research Database (Denmark)

    Bayerova, Zuzana; Janova, Eva; Matiasovic, Jan

    2016-01-01

    Immunity-related genes are a suitable model for studying effects of selection at the genomic level. Some of them are highly conserved due to functional constraints and purifying selection, while others are variable and change quickly to cope with the variation of pathogens. The SLC11A1 gene encodes...... a transporter protein mediating antimicrobial activity of macrophages. Little is known about the patterns of selection shaping this gene during evolution. Although it is a typical evolutionarily conserved gene, functionally important polymorphisms associated with various diseases were identified in humans...... and other species. We analyzed the genomic organization, genetic variation, and evolution of the SLC11A1 gene in the family Equidae to identify patterns of selection within this important gene. Nucleotide SLC11A1 sequences were shown to be highly conserved in ten equid species, with more than 97 % sequence...

  12. Substrate specificity of the electrogenic sodium/bicarbonate cotransporter NBCe1-A (SLC4A4, variant A) from humans and rabbits.

    Science.gov (United States)

    Lee, Seong-Ki; Boron, Walter F; Parker, Mark D

    2013-04-01

    In the basolateral membrane of proximal-tubule cells, NBCe1-A (SLC4A4, variant A), operating with an apparent Na(+):HCO(3)(-) stoichiometry of 1:3, contributes to the reclamation of HCO(3)(-) from the glomerular filtrate, thereby preventing whole body acidosis. Others have reported that NBCe1-like activity in human, rabbit, and rat renal preparations is substantially influenced by lithium, sulfite, oxalate, and harmaline. These data were taken as evidence for the presence of distinct Na(+) and CO(3)(2-) binding sites in NBCe1-A, favoring a model of 1 Na(+):1 HCO(3)(-):1 CO(3)(2-). Here, we reexamine these findings by expressing human or rabbit NBCe1-A clones in Xenopus oocytes. In oocytes, NBCe1-A exhibits a 1:2 stoichiometry and could operate in one of five thermodynamically equivalent transport modes: 1) cotransport of Na(+) + 2 HCO(3)(-), 2) cotransport of Na(+) + CO(3)(2-), 3) transport of NaCO(3)(-), 4) exchange of Na(+) + HCO(3)(-) for H(+), or 5) HCO(3)(-)-activated exchange of Na(+) for 2 H(+). In contrast to the behavior of NBCe1-like activity in renal preparations, we find that cloned NBCe1-A is only slightly stimulated by Li(+), not at all influenced by sulfite or oxalate, and only weakly inhibited by harmaline. These negative data do not uniquely support any of the five models above. In addition, we find that NBCe1-A mediates a small amount of Na(+)-independent NO(3)(-) transport and that NBCe1-A is somewhat inhibited by extracellular benzamil. We suggest that the features of NBCe1-like activity in renal preparations are influenced by yet-to-be-identified renal factors. Thus the actual ionic substrates of NBCe1 remain to be identified.

  13. Identification of seven novel mutations including the first two genomic rearrangements in SLC26A3 mutated in congenital chloride diarrhea.

    Science.gov (United States)

    Höglund, P; Sormaala, M; Haila, S; Socha, J; Rajaram, U; Scheurlen, W; Sinaasappel, M; de Jonge, H; Holmberg, C; Yoshikawa, H; Kere, J

    2001-09-01

    Congenital chloride diarrhea (CLD) is an autosomal recessive disorder characterized by defective intestinal electrolyte absorption, resulting in voluminous osmotic diarrhea with high chloride content. A variety of mutations in the solute carrier family 26, member 3 gene (SLC26A3, previously known as CLD or DRA) are responsible for the disease. Since the identification of the SLC26A3 gene and the determination of its genomic structure, altogether three founder and 17 private mutations have been characterized within miscellaneous ethnic groups. We screened for mutations in seven unrelated families with CLD. The diagnoses were confirmed by fecal chloride measurements. The combined PCR-SSCP and sequencing analyses revealed altogether seven novel mutations including two missense mutations (S206P, D468V), two splicing defects (IVS12-1G>C, IVS13-2delA), one nonsense mutation (Q436X), one insertion/deletion mutation (2104-2105delGGins29-bp), and an intragenic deletion of SLC26A3 exons 7 and 8. Two previously identified mutations were also found. This is the first report of rearrangement mutations in SLC26A3. Molecular features predisposing SLC26A3 for the two rearrangements may include repetitive elements and palindromic-like sequences. The increasingly wide diversity of SLC26A3 mutations suggests that mutations in the SLC26A3 gene may not be rare events. Copyright 2001 Wiley-Liss, Inc.

  14. Intronic deletions in the SLC34A3 gene: A cautionary tale for mutation analysis of hereditary hypophosphatemic rickets with hypercalciuria

    Science.gov (United States)

    Ichikawa, Shoji; Tuchman, Shamir; Padgett, Leah R.; Gray, Amie K.; Baluarte, H. Jorge; Econs, Michael J.

    2013-01-01

    Hereditary hypophosphatemic rickets with hypercalciuria (HHRH) is a rare metabolic disorder, characterized by hypophosphatemia, variable degrees of rickets/osteomalacia, and hypercalciuria secondary to increased serum 1,25-dihydroxyvitamin D [1,25(OH)2D] levels. HHRH is caused by mutations in the SLC34A3 gene, which encodes sodium-phosphate co-transporter type IIc. A 6 ½-year-old female presented with a history of nephrolithiasis. Her metabolic evaluation revealed increased 24- hour urine calcium excretion with high serum calcium, low intact parathyroid hormone (PTH) levels, and elevated 1,25(OH)2D level. In addition, the patient had low to low-normal serum phosphorus with high urine phosphorus. The patient had normal stature; without rachitic or boney deformities or a history of fractures. Genetic analysis of SLC34A3 revealed the patient to be a compound heterozygote for a novel single base pair deletion in exon 12 (c.1304delG) and 30-base pair deletion in intron 6 (g.1440–1469del). The single-base pair mutation causes a frameshift, which results in premature stop codon. The intronic deletion is likely caused by misalignment of the 4-basepair homologous repeats and results in the truncation of an already small intron to 63 bp, which would impair proper RNA splicing of the intron. This is the fourth unique intronic deletion identified in patients with HHRH, suggesting the frequent occurrence of sequence misalignments in SLC34A3 and the importance of screening introns in patients with HHRH. PMID:24176905

  15. The Physiopathological Role of the Exchangers Belonging to the SLC37 Family

    Directory of Open Access Journals (Sweden)

    Anna Rita Cappello

    2018-04-01

    Full Text Available The human SLC37 gene family includes four proteins SLC37A1-4, localized in the endoplasmic reticulum (ER membrane. They have been grouped into the SLC37 family due to their sequence homology to the bacterial organophosphate/phosphate (Pi antiporter. SLC37A1-3 are the less characterized isoforms. SLC37A1 and SLC37A2 are Pi-linked glucose-6-phosphate (G6P antiporters, catalyzing both homologous (Pi/Pi and heterologous (G6P/Pi exchanges, whereas SLC37A3 transport properties remain to be clarified. Furthermore, SLC37A1 is highly homologous to the bacterial glycerol 3-phosphate permeases, so it is supposed to transport also glycerol-3-phosphate. The physiological role of SLC37A1-3 is yet to be further investigated. SLC37A1 seems to be required for lipid biosynthesis in cancer cell lines, SLC37A2 has been proposed as a vitamin D and a phospho-progesterone receptor target gene, while mutations in the SLC37A3 gene appear to be associated with congenital hyperinsulinism of infancy. SLC37A4, also known as glucose-6-phosphate translocase (G6PT, transports G6P from the cytoplasm into the ER lumen, working in complex with either glucose-6-phosphatase-α (G6Pase-α or G6Pase-β to hydrolyze intraluminal G6P to Pi and glucose. G6PT and G6Pase-β are ubiquitously expressed, whereas G6Pase-α is specifically expressed in the liver, kidney and intestine. G6PT/G6Pase-α complex activity regulates fasting blood glucose levels, whereas G6PT/G6Pase-β is required for neutrophil functions. G6PT deficiency is responsible for glycogen storage disease type Ib (GSD-Ib, an autosomal recessive disorder associated with both defective metabolic and myeloid phenotypes. Several kinds of mutations have been identified in the SLC37A4 gene, affecting G6PT function. An increased autoimmunity risk for GSD-Ib patients has also been reported, moreover, SLC37A4 seems to be involved in autophagy.

  16. The Physiopathological Role of the Exchangers Belonging to the SLC37 Family

    Science.gov (United States)

    Cappello, Anna Rita; Curcio, Rosita; Lappano, Rosamaria; Maggiolini, Marcello; Dolce, Vincenza

    2018-04-01

    The human SLC37 gene family includes four proteins SLC37A1-4, localized in the endoplasmic reticulum (ER) membrane. They have been grouped into the SLC37 family due to their sequence homology to the bacterial organophosphate/phosphate (Pi) antiporter. SLC37A1-3 are the less characterized isoforms. SLC37A1 and SLC37A2 are Pi-linked glucose-6-phosphate (G6P) antiporters, catalyzing both homologous (Pi/Pi) and heterologous (G6P/Pi) exchanges, whereas SLC37A3 transport properties remain to be clarified. Furthermore, SLC37A1 is highly homologous to the bacterial glycerol 3-phosphate permeases, so it is supposed to transport also glycerol-3-phosphate. The physiological role of SLC37A1-3 is yet to be further investigated. SLC37A1 seems to be required for lipid biosynthesis in cancer cell lines, SLC37A2 has been proposed as a vitamin D and a phospho-progesterone receptor target gene, while mutations in the SLC37A3 gene appear to be associated with congenital hyperinsulinism of infancy. SLC37A4, also known as glucose-6-phosphate translocase (G6PT), transports G6P from the cytoplasm into the ER lumen, working in complex with either glucose-6-phosphatase-α (G6Pase-α) or G6Pase-β to hydrolyze intraluminal G6P to Pi and glucose. G6PT and G6Pase-β are ubiquitously expressed, whereas G6Pase-α is specifically expressed in the liver, kidney and intestine. G6PT/G6Pase-α complex activity regulates fasting blood glucose levels, whereas G6PT/G6Pase-β is required for neutrophil functions. G6PT deficiency is responsible for glycogen storage disease type Ib (GSD-Ib), an autosomal recessive disorder associated with both defective metabolic and myeloid phenotypes. Several kinds of mutations have been identified in the SLC37A4 gene, affecting G6PT function. An increased autoimmunity risk for GSD-Ib patients has also been reported, moreover, SLC37A4 seems to be involved in autophagy.

  17. Distancias genéticas en poblaciones del NOA

    Directory of Open Access Journals (Sweden)

    Acreche, Noemí

    1996-01-01

    Full Text Available La mayor parte de los trabajos realizados en nuestro país sobre polimorfismos hematológicos, abordan la necesaria descripción de las poblaciones. Se pone de relieve la importancia de encarar estudios, en base a la valiosa información publicada, que vinculen los grupos con técnicas que permitan realizar nuevas inferencias sobre sus relaciones. Conocidas en gran medida en cuanto a sus manifestaciones culturales, pueden aportar desde lo genético a la comprensión de los procesos microevolutivos ocurridos en una región. Para el NOA, se ha considerado la presencia de comunidades aborígenes incluídas en cuatro familias lingüísticas. Se tendrán en cuenta estos complejos como representativos de afinidades que se establecen a partir de estrechas relaciones entre las etnias, no sólo por la lengua, sino también por las características de sus sistemas productivos, religiosidad y organización. En base a las frecuencias génicas publicadas correspondientes a los siguientes alelos: I*A, I*B, I*O; M, N, S, s; Dia , Dib; P1, P2; C, c; D, d, E, e; Le, le; Fya, Fyb; Jka, Jkb; K y k se construyeron tablas de frecuencias. Se estimaron los coeficientes de distancias genéticas que fueron analizados y posteriormente incluídos en la construcción de un fenograma de los grupos de estudio, mediante agrupaciones (Sahn Cluster secuenciales, aglomerativas, jerárquicas y anidadas. De acuerdo a la información recopilada de las frecuencias de los 25 alelos estudiados en trece poblaciones de aborígenes del NOA y Paraguay, las distancias genéticas obtenidas reflejan los caracteres lingüístico-culturales.

  18. Genómica del síndrome de Down

    Directory of Open Access Journals (Sweden)

    S Díaz Cuéllar

    2016-09-01

    Full Text Available El síndrome de Down es la cromosomopatía más común del ser humano, con una frecuencia de 1 en 650 recién nacidos vivos. Las manifestaciones clínicas son muy variables y dependen, en gran parte, de la presencia de diversos factores genéticos como mosaicismo, cambios variables en el número de copias o variantes de un solo nucleótido. La identificación de estas variantes se ha convertido en un tema central de investigación ya que es esencial para la comprensión de los mecanismos moleculares subyacentes en esta enfermedad.

  19. Composición genética de una población del suroccidente de Colombia

    Directory of Open Access Journals (Sweden)

    Liliana Córdoba

    2012-01-01

    Full Text Available La población actual del departamento del Cauca es el resultado de la mezcla de tres poblaciones parentales (europea, amerindia y africana. En este estudio se determinó la composición genética de 306 residentes del departamento mediante la utilización de 34 variantes autosómicas, 9 variantes en el cromosoma X, 6 en el ADNmt y 8 en el cromosoma Y. Los análisis de las variantes autosómicas y del cromosoma X revelaron que la población europea y la amerindia han contribuido en mayor proporción al actual acervo genético de la población estudiada. Los resultados de las variantes en el ADNmt y del cromosoma Y sugieren un fuerte sesgo sexual (flujo génico asimétrico en el proceso de mezcla, en el que los cruces interétnicos fueron principalmente entre los colonizadores europeos y las mujeres nativas.

  20. Mutations in the GABA Transporter SLC6A1 Cause Epilepsy with Myoclonic-Atonic Seizures

    DEFF Research Database (Denmark)

    Carvill, Gemma L; McMahon, Jacinta M; Schneider, Amy

    2015-01-01

    GAT-1, encoded by SLC6A1, is one of the major gamma-aminobutyric acid (GABA) transporters in the brain and is responsible for re-uptake of GABA from the synapse. In this study, targeted resequencing of 644 individuals with epileptic encephalopathies led to the identification of six SLC6A1 mutatio...

  1. Association study of serotonin transporter SLC6A4 gene with Chinese Han irritable bowel syndrome.

    Directory of Open Access Journals (Sweden)

    Jing Yuan

    Full Text Available OBJECTIVE: Irritable bowel syndrome (IBS is a common clinical gastrointestinal dysfunction disorders. 5-sertonon (5-hydroxytryptamine, 5-HT is a very important neurotransmitter, which is involved in gastrointestinal motion and sensation. Solute carrier family 6 member 4 (SLC6A4 gene encode serotonin transporter (SERT which function is to rapidly reuptake the most of 5-HT. Therefore, it is needed to explore the association between SLC6A4 gene polymorphisms and IBS. METHODS: 119 patients and 238 healthy controls were administrated to detect the SLC6A4 gene polymorphisms including 5-HT-transporter-gene-linked polymorphic region (5-HTTLPR, variable number of tandem repeats (VNTRs and three selected tag Single Nucleotide Polymorphisms (SNPs rs1042173, rs3794808, rs2020936 by using polymerase chain reaction (PCR and TaqMan® SNP Genotyping. RESULTS: There were significant difference for 5-HTTLPR between IBS and control groups (X2 = 106.168, P<0.0001. In control group, genotypes were mainly L/L (58.4%, however, the genotypes in IBS were S/S (37.8%. The significant difference was shown in D-IBS subjects when compared to the controls (X(2 = 50.850, P<0.0001 for 5-HTTLPR. For STin2 VNTR, rs1042173, rs3794808, and rs2020936 polymorphisms, there were no any significant differences between IBS and control groups. There were no statistical significantly haplotypes for 5-HTTLPR, VNTRs and the three SNPs between IBS and controls. CONCLUSION: The S allele in 5-HTTLPR was a susceptible allele with Chinese Han IBS, but other associations of VNTRs, three selected Tag SNPs and positive haplotype with IBS were not found. It is indicated that much research are needed to study the relationship between other polymorphisms in SLC6A4 gene and IBS.

  2. The Role of Na:K:2Cl Cotransporter 1 (NKCC1/SLC12A2) in Dental Epithelium during Enamel Formation in Mice

    Science.gov (United States)

    Jalali, Rozita; Lodder, Johannes C.; Zandieh-Doulabi, Behrouz; Micha, Dimitra; Melvin, James E.; Catalan, Marcelo A.; Mansvelder, Huibert D.; DenBesten, Pamela; Bronckers, Antonius

    2017-01-01

    Na+:K+:2Cl− cotransporters (NKCCs) belong to the SLC12A family of cation-coupled Cl− transporters. We investigated whether enamel-producing mouse ameloblasts express NKCCs. Transcripts for Nkcc1 were identified in the mouse dental epithelium by RT-qPCR and NKCC1 protein was immunolocalized in outer enamel epithelium and in the papillary layer but not the ameloblast layer. In incisors of Nkcc1-null mice late maturation ameloblasts were disorganized, shorter and the mineral density of the enamel was reduced by 10% compared to wild-type controls. Protein levels of gap junction protein connexin 43, Na+-dependent bicarbonate cotransporter e1 (NBCe1), and the Cl−-dependent bicarbonate exchangers SLC26A3 and SLC26A6 were upregulated in Nkcc1-null enamel organs while the level of NCKX4/SLC24A4, the major K+, Na+ dependent Ca2+ transporter in maturation ameloblasts, was slightly downregulated. Whole-cell voltage clamp studies on rat ameloblast-like HAT-7 cells indicated that bumetanide increased ion-channel activity conducting outward currents. Bumetanide also reduced cell volume of HAT-7 cells. We concluded that non-ameloblast dental epithelium expresses NKCC1 to regulate cell volume in enamel organ and provide ameloblasts with Na+, K+ and Cl− ions required for the transport of mineral- and bicarbonate-ions into enamel. Absence of functional Nkcc1 likely is compensated by other types of ion channels and ion transporters. The increased amount of Cx43 in enamel organ cells in Nkcc1-null mice suggests that these cells display a higher number of gap junctions to increase intercellular communication. PMID:29209227

  3. El polimorfismo (CAGn del gen ATXN2, nuevo marcador de susceptibilidad para diabetes mellitus tipo 2

    Directory of Open Access Journals (Sweden)

    Luis J. Flores-Alvarado

    Full Text Available RESUMEN Objetivo Estimar si hay asociación del repetido (CAGn del gen ATXN2 en población mexicana con diabetes mellitus (DM tipo 2. Métodos Estudio epidemiológico de casos y controles. Se incluyeron personas sanas y personas diabéticas. La detección de la expansión (CAGn se realizó por reacción en cadena de la polimerasa (PCR-punto final. Los productos de PCR se analizaron mediante electroforesis (PAGE al 8% y tinción con nitrato de plata. Resultados La distribución de alelos del trinucleótido (CAGn en la población analizada resultó similar a la reportada en el centro del país. El alelo más frecuente es el de 22 repetidos; sin embargo, hay asociación con los portadores de los repetidos largos dentro del rango normal con diabetes. Conclusiones Los resultados sugieren que el repetido (CAGn del gen de ATXN2 podría ser un factor causal de DM tipo 2.

  4. A deletion mutation in bovine SLC4A2 is associated with osteopetrosis in Red Angus cattle

    Directory of Open Access Journals (Sweden)

    Beever Jonathan E

    2010-05-01

    Full Text Available Abstract Background Osteopetrosis is a skeletal disorder of humans and animals characterized by the formation of overly dense bones, resulting from a deficiency in the number and/or function of bone-resorbing osteoclast cells. In cattle, osteopetrosis can either be induced during gestation by viral infection of the dam, or inherited as a recessive defect. Genetically affected calves are typically aborted late in gestation, display skull deformities and exhibit a marked reduction of osteoclasts. Although mutations in several genes are associated with osteopetrosis in humans and mice, the genetic basis of the cattle disorder was previously unknown. Results We have conducted a whole-genome association analysis to identify the mutation responsible for inherited osteopetrosis in Red Angus cattle. Analysis of >54,000 SNP genotypes for each of seven affected calves and nine control animals localized the defective gene to the telomeric end of bovine chromosome 4 (BTA4. Homozygosity analysis refined the interval to a 3.4-Mb region containing the SLC4A2 gene, encoding an anion exchanger protein necessary for proper osteoclast function. Examination of SLC4A2 from normal and affected animals revealed a ~2.8-kb deletion mutation in affected calves that encompasses exon 2 and nearly half of exon 3, predicted to prevent normal protein function. Analysis of RNA from a proven heterozygous individual confirmed the presence of transcripts lacking exons 2 and 3, in addition to normal transcripts. Genotyping of additional animals demonstrated complete concordance of the homozygous deletion genotype with the osteopetrosis phenotype. Histological examination of affected tissues revealed scarce, morphologically abnormal osteoclasts displaying evidence of apoptosis. Conclusions These results indicate that a deletion mutation within bovine SLC4A2 is associated with osteopetrosis in Red Angus cattle. Loss of SLC4A2 function appears to induce premature cell death, and

  5. Caracterización clínico genética del síndrome Prader Willi

    Directory of Open Access Journals (Sweden)

    Anitery Travieso Tellez

    2014-12-01

    Full Text Available Introducción: el síndrome Prader Willi es un desorden genético causado por la pérdida de genes contenidos en la región 15q11-q13 del cromosoma paterno. Objetivo: describir las características clínicas y genéticas de los pacientes con síndrome Prader Willi. Material y método: se realizó un estudio descriptivo, de corte transversal, con el universo de 15 pacientes con sospecha de síndrome Prader Willi remitidos a consulta provincial de Genética Clínica durante el año 2013. Se consideraron como variables clínicas los criterios diagnósticos según Holms, y como variables genéticas los resultados de los estudios cromosómicos y moleculares. Resultados: predominó el sexo femenino en un 66.7%. Las edades estuvieron entre los tres y los 41 años. Los criterios mayores más frecuentes resultaron la obesidad troncular y el retraso del neurodesarrollo en el 100% de los pacientes. Los criterios menores más identificados fueron los disturbios del sueño y las dificultades del lenguaje con un 66.7% cada uno. En ninguno de los casos se detectaron anomalías cromosómicas por cariotipificación. Tres pacientes (60% presentaron la deleción a nivel de la región 15q11-q13 identificada por la técnica de hibridación in sito con fluorescencia. Conclusiones: la definición del diagnóstico en la provincia resulta demorada. Se requiere de reevaluación según los criterios clínicos en las diferentes etapas de la vida para diagnóstico de certeza. La presencia de hipotonía neonatal y dificultades en la alimentación son elementos asociados al diagnóstico por deleción 15q11-q13.

  6. Polimorfismo del gen de la catecol-O-metiltransferasa (COMT) en gestantes con restricción del crecimiento intrauterino (RCIU)

    OpenAIRE

    Pacheco, José; Huerta, Doris; Acosta, Oscar; Cabrera, Santiago

    2013-01-01

    Objetivos: Establecer la asociación entre el polimorfismo Vall58Met catecol-O-metiltransferasa (COMT) y la RCIU. Diseño: Estudio relacional, observacional, tipo caso-control. Institución: Facultad de Medicina, UNMSM. Participantes: Gestantes sin y con RCIU. Intervenciones: Se obtuvo 81 muestras de sangre para genotipaje del gen COMT; 55 (67,9%) correspondieron a gestantes sin RCIU (controles) y 26 (32,1%) a madres de hijos con RCIU. Las gestantes firmaron consentimiento informado. Principales...

  7. [Analysis the relationship between SLC26A4 mutation and current diagnosis of inner ear malformation in children with sensorineural hearing loss].

    Science.gov (United States)

    Sun, Baochun; Zhou, Chengyong; Dai, Zhiyao

    2014-11-01

    Explore the relationship between the pathogenic mutations of SLC26A4 gene and inner ear malformation, and analyze the feasibility of genetic testing to help current diagnosis in part of children with sensorineural hearing loss. 2094 cases of children were detected by SLC26A4 with the method of DNA sequence. CT phenotypes of those children were classified according to the method proposed by Sennaroglu. We analyzed the relationship between the pathogenic mutations of gene and the CT phenotypes. (1) 685 cases of inner ear malformations were found in 2094 cases of children with sensorineural hearing loss by CT examination (371 cases of cochlea malformation were consisted of the follow types of malformation. Michel deformity was 6 cases, cochlea aplasia was 8 cases, common cavity deformity was 12 cases, incomplete partition type I was 27 cases, cochlea hypoplasia was 30 cases and Mondini malformation was 288 cases); Vestibular aqueduct was 265 cases; Vestibular/semicircular canal/internal auditory canal were 49 cases, normal was 1409 cases. (2) The DNA sequence results revealed that 465 cases carried pathogenic mutations (Bi-allelic mutations) of SLC26A4 gene, among which 135 cases were homozygous, 330 cases were compound heterozygous. (3) Pathogenic mutations of SLC26A4 gene detected 100% (465/465) in the group related to vestibular aqueduct malformation. The results suggest that pathogenic mutation of SLC26A4 gene is closely related to the CT phenotype of vestibular aqueduct malformation. Detecting of pathogenic mutations for hearing loss is binging the possibility to identify children with inner malformations at an early stage. As a consequence, it will improve the current diagnosis and therapeutical option.

  8. Relación de la transición A G en la posición –21 del intrón 10 del gen NCF-2 con la expresión de la proteína p67-phox

    Directory of Open Access Journals (Sweden)

    Pablo Patiño

    2001-04-01

    Full Text Available

    El sistema NADPH oxidasa de las células fagocíticas es esencial
    para la producción de metabolitos reactivos de oxígeno que tienen
    acción microbicida importante. La proteína p67-phox, codificada por
    el gen NCF-2, tiene un papel importante en este sistema (1. Previamente nuestro grupo reportó algunos cambios nucleotídicos en regiones no codificadoras del gen NCF-2. Uno de estos corresponde a la
    transición de una adenina (A por una guanina (G en el intrón 10, 21
    nucleótidos antes del inicio del exón 11, sitio importante para la eliminación de este intrón y unión de los exones 10 y 11 durante el procesamiento del ARNm.
    En este proyecto se pretende determinar si existe alguna modificación
    en la expresión de p67-phox inducida por la transición A -►G en la posición -21 del intrón 10 en el gen NCF-2.

     

     

  9. Análisis de la diversidad genética de 21 aislamientos del hongo Moniliophthora roreri basado en marcadores RAPD

    Directory of Open Access Journals (Sweden)

    Boris Gutarra Castillo

    2013-12-01

    Full Text Available Objetivos: Estudiar la diversidad genética de 21 aislamientos del hongo que afecta al cultivo del cacao, Moniliophthora roreri, en tres zonas cacaoteras del Perú (Tocache, Mariscal Cáceres y Leoncio Prado. Métodos: Se utilizó 14 iniciadores RAPD (random amplified polymorphic DNA polimórficos y una pareja de oligonucleótidos, los que fueron empleados bajo condiciones de amplificación estandarizadas. Con los datos obtenidos se construyó un dendograma utilizando el coeficiente de Jaccard y el algoritmo UPGMA (Unweighted Pair-Group Method using Arithmetic Average. La estructura genética fue estimada en función del análisis molecular de variancia (AMOVA y la diversidad mediante los índices de Shannon y Nei. Resultados: Fueron conseguidas 59 bandas RAPD con un 73% de polimorfismo. El dendograma obtenido a un índice de similitud de 0,70, claramente dividió los individuos en tres grupos. El análisis de la diversidad genética mostró altos valores en las zonas estudiadas de acuerdo con el índice de Shannon (0,3936 y de Nei (0,2622, con mayor riqueza en Leoncio Prado. Estas zonas presentan alta variabilidad, y según el AMOVA realizado: 88% entre accesiones por zona y solo 12% entre zonas. Conclusiones: Existe más de un grupo genético de Moniliophthora roreri en la Amazonía del Perú. Estos grupos, provenientes del Ecuador, pudieron haber ingresado por el intercambio de semillas y/o de forma natural por medio de los ríos en común y estarían originando nuevos grupos genéticos locales.

  10. Obtención del Valor Genético Predicho en Animales Incluyendo el Efecto del Medio Ambiente Permanente Obtención del Valor Genético Predicho en Animales Incluyendo el Efecto del Medio Ambiente Permanente

    Directory of Open Access Journals (Sweden)

    Mauricio Valencia Posadas

    2012-02-01

    Full Text Available The genetic improvement of the animals based in productive records and genealogical information, is a fundamental mechanism to increase the economic income of the commercial farms, through the estimation of the predicted breeding values (VGP’s. The VGP’s allows the identification of animals genetically superior to be used as parents of the next generation. In many parts of the world the best linear unbiased predictor procedure (MPLI is used as an animal model, for its appropriate properties, to obtain the VGP’s. In these models the permanent environment effect is usually included in order to increase the accuracy of the VGP’s. In this work a developed example is presented using supposed data to obtain VGP’s with the MPLI procedure and an animal model where the methodology, interpretation and use of the VGP’s are shown.El mejoramiento genético de los animales, con base en los registros de rendimiento e información genealógica, es un mecanismo fundamental para incrementar los rendimientos económicos de las explotaciones comerciales, a partir de la estimación de valores genéticos predichos (VGP’s. Los VGP permiten identificar a los animales genéticamente superiores de una forma objetiva, para que sean utilizados como padres de la siguiente generación. En muchas partes del mundo se utiliza el procedimiento del mejor predictor lineal insesgado (MPLI con un modelo animal por sus adecuadas propiedades para obtenerlos VGP’s. En dichos modelos se suele incluir el efecto del medio ambiente permanente con el objeto de incrementar la precisión de los VGP’s. En este trabajos e presenta un ejemplo desarrollado utilizando datos supuestos para obtener VGP’s con el procedimiento MPLI y un modelo animal, donde se muestra la metodología, interpretación y uso que tienen los VGP’s.

  11. Historia del nombre genérico Escallonia mutis ex L. Fil. Historia del nombre genérico Escallonia mutis ex L. Fil.

    Directory of Open Access Journals (Sweden)

    Fernández Alonso J. L.

    1991-06-01

    Full Text Available According with the historical context of the Real Expedición Botánica del Nuevo Reino de Granada (1783-1816, the nomenclatural history of the generic name Escallonia Mutis ex L. fiI. (Grossulariaceae is discussed. The extant misinterpretation concerning the name in the manuscript documentation of the Expedition, is brigthened; four species of diferent  families appear associated to this name in the manuscripts. Type specimens of two species, Escallonia myrtilloides L. fiI. and Dichondra evolvulacea (L. fiI. Britton are located or selected. Dentro del contexto histórico de la Real Expedición Botánica del Nuevo Reino de Granada (1783-1816, se realiza el seguimiento del nombre genérico Escallonia Mutis ex L. fiI. (Grossulariaceae. Se aclara la confusión existente acerca de este nombre en la documentación manuscrita de la Expedición (Archivos de Mutis y Linneo, donde se encuentra asociado a descripciones originales de cuatro especies de diferentes familias. Se localiza y selecciona material tipo de dos de ellas: Escallonia myrtilloides L. fil. Y Dichondra evolvulacea (L. IiI. Britton.

  12. Missense mutation in exon 2 of SLC36A1 responsible for champagne dilution in horses.

    Directory of Open Access Journals (Sweden)

    Deborah Cook

    2008-09-01

    Full Text Available Champagne coat color in horses is controlled by a single, autosomal-dominant gene (CH. The phenotype produced by this gene is valued by many horse breeders, but can be difficult to distinguish from the effect produced by the Cream coat color dilution gene (CR. Three sires and their families segregating for CH were tested by genome scanning with microsatellite markers. The CH gene was mapped within a 6 cM region on horse chromosome 14 (LOD = 11.74 for theta = 0.00. Four candidate genes were identified within the region, namely SPARC [Secreted protein, acidic, cysteine-rich (osteonectin], SLC36A1 (Solute Carrier 36 family A1, SLC36A2 (Solute Carrier 36 family A2, and SLC36A3 (Solute Carrier 36 family A3. SLC36A3 was not expressed in skin tissue and therefore not considered further. The other three genes were sequenced in homozygotes for CH and homozygotes for the absence of the dilution allele (ch. SLC36A1 had a nucleotide substitution in exon 2 for horses with the champagne phenotype, which resulted in a transition from a threonine amino acid to an arginine amino acid (T63R. The association of the single nucleotide polymorphism (SNP with the champagne dilution phenotype was complete, as determined by the presence of the nucleotide variant among all 85 horses with the champagne dilution phenotype and its absence among all 97 horses without the champagne phenotype. This is the first description of a phenotype associated with the SLC36A1 gene.

  13. Respuesta del Tumor Venéreo Transmisible Canino a Presentaciones de Vincristina de Patente y Genérica

    OpenAIRE

    Susana Miguel De la Cruz

    2015-01-01

    El objetivo del presente estudio fue comparar la respuesta de perros infectados naturalmente con el Tumor Venéreo Transmisible (TVTc) al tratamiento con vincristina comercial de patente y genérica. Se trabajó con 12 perros infectados naturalmente y con diagnóstico por citología y PCR. Los perros fueron asignados aleatoriamente a un tratamiento semanal con 0.025 mg/kg de vincristina de patente comercial o de tipo genérico, hasta que dos citologías consecutivas resultaran negativas. Se hicieron...

  14. Caracterización de pacientes con enfermedades genéticas del esqueleto en un centro colombiano de remisión

    Directory of Open Access Journals (Sweden)

    Harvy Mauricio Velasco

    2017-06-01

    Resultados. El motivo de consulta más frecuente fue por sospecha de enfermedad genética del esqueleto. Entre los tipos de tratamiento, se consideraron los de soporte, los quirúrgicos, el farmacológico y la ‘ortesis’, y se pudo establecer que los pacientes con enfermedades genéticas del esqueleto obtenían puntajes mayores en la variable de intervención y menores en las de talla alta y baja. Conclusiones. El diagnóstico de la mayoría de los pacientes remitidos respondía a enfermedades genéticas del esqueleto, talla baja y otras enfermedades genéticas monogénicas. Se encontraron diferencias significativas entre la edad de inicio de los síntomas y la de diagnóstico, así como diversos enfoques terapéuticos. Hubo menos intervenciones en los pacientes con talla alta y baja, lo cual podría alertar sobre la necesidad de reevaluar las necesidades terapéuticas de este grupo.

  15. Caracterización clínico genética del síndrome Prader Willi

    OpenAIRE

    Travieso Tellez, Anitery; Menéndez García, Reinaldo; Licourt Otero, Deysi

    2014-01-01

    Introducción: el síndrome Prader Willi es un desorden genético causado por la pérdida de genes contenidos en la región 15q11-q13 del cromosoma paterno. Objetivo: describir las características clínicas y genéticas de los pacientes con síndrome Prader Willi. Material y método: se realizó un estudio descriptivo, de corte transversal, con el universo de 15 pacientes con sospecha de síndrome Prader Willi remitidos a consulta provincial de Genética Clínica durante el año 2013. Se consideraron como ...

  16. El uso de alteraciones genéticas en la estratificación por riesgo del mieloma múltiple

    Directory of Open Access Journals (Sweden)

    Esteban Braggio

    2013-08-01

    Full Text Available Los estudios genéticos han alcanzado un papel central en el estudio del mieloma múltiple (MM, al convertirse en un componente crítico en la estratificación basada en el riesgo de la enfermedad. Se han hecho grandes esfuerzos para identificar cambios genéticos que puedan predecir el resultado clínico e incluirlos en la práctica clínica diaria. La hibridización in situ fluorescente (FISH es todavía la técnica genética más utilizada en la práctica clínica, mayormente debido a su sencilla implementación y su simplicidad para el análisis de datos. El advenimiento de la genómica (hibridización genómica comparativa, secuenciación exónica o genómica completa y del transcriptoma de alta resolución (perfiles de expresión de genes - GEP y secuenciación de ARNm proveen un análisis exhaustivo de los ya definidos factores pronósticos genéticos y son herramientas útiles para la identificación de potenciales nuevos marcadores pronósticos de enfermedad en el clon tumoral de MM. Más aún, GEP ha sido exitosamente implementado en MM como una herramienta de estratificación de riesgo, siendo la de mayor poder de discriminación de resultados. De todas maneras, algunos aspectos técnicos y logísticos complejos (necesidad de una elevada purificación del clon tumoral, costo de los ensayos y complejidad en los análisis de los datos deben ser considerados antes de la incorporación definitiva de estas tecnologías de alto rendimiento dentro de los ensayos clínicos de rutina. Hasta entonces, FISH continúa siendo la herramienta estándar para la detección de anormalidades genéticas y de valoración pronóstico de enfermedad.

  17. The D543N polymorphism of the SLC11A1/NRAMP1 gene is associated with treatment failure in male patients with pulmonary tuberculosis.

    Science.gov (United States)

    Salinas-Delgado, Yvain; Galaviz-Hernández, Carlos; Toral, René García; Ávila Rejón, Carmen A; Reyes-Lopez, Miguel A; Martínez, Antonio Rojas; Martínez-Aguilar, Gerardo; Sosa-Macías, Martha

    2015-09-01

    Polymorphisms in SLC11A1/NRAMP1 have shown an important association with susceptibility to tuberculosis and progression to active disease. However, whether there is an association of these polymorphisms with treatment failure is unknown. The aim of this study was to determine the association of SLC11A1 polymorphisms with treatment failure in Mexican subjects with pulmonary tuberculosis. Thirty-three subjects with treatment failure were paired by age and body mass index with 33 patients who successfully completed treatment and were considered cured. We assessed the polymorphisms of SLC11A1 in the regions of D543N and INT4 via polymerase chain reaction real-time TaqMan® single nucleotide polymorphism (SNP) genotyping. We found that D543N (G/A genotype) was associated with treatment failure in patients with pulmonary tuberculosis [odds ratio (OR) 11.61, 95% confidence interval (CI) 3.66-36.78]. When adjusted by gender, this association remained significant in males (OR 11.09, 95% CI 3.46-35.51). In our male population, the presence of the D543N polymorphism of SLC11A1 is a risk factor for treatment failure. This finding should be confirmed in other populations.

  18. Functional identification of the promoter of SLC4A5, a gene associated with cardiovascular and metabolic phenotypes in the HERITAGE Family Study.

    Science.gov (United States)

    Stütz, Adrian M; Teran-Garcia, Margarita; Rao, D C; Rice, Treva; Bouchard, Claude; Rankinen, Tuomo

    2009-11-01

    The sodium bicarbonate cotransporter gene SLC4A5, associated earlier with cardiovascular phenotypes, was tested for associations in the HERITAGE Family Study, and possible mechanisms were investigated. Twelve tag-single nucleotide polymorphisms (SNPs) covering the SLC4A5 gene were analyzed in 276 Black and 503 White healthy, sedentary subjects. Associations were tested using a variance components-based (QTDT) method with data adjusted for age, sex and body size. In Whites, rs6731545 and rs7571842 were significantly associated with resting and submaximal exercise pulse pressure (PP) (0.0004 HERITAGE Family Study are likely due to neither variation in the promoter nor known coding SNPs of SLC4A5.

  19. Fructose Synthesis and Transport at the Uterine-Placental Interface of Pigs: Cell-Specific Localization of SLC2A5, SLC2A8, and Components of the Polyol Pathway.

    Science.gov (United States)

    Steinhauser, Chelsie B; Landers, McKinsey; Myatt, Louise; Burghardt, Robert C; Vallet, Jeffrey L; Bazer, Fuller W; Johnson, Greg A

    2016-11-01

    The fetal fluids and uterine flushings of pigs contain higher concentrations of fructose than glucose, but fructose is not detected in maternal blood. Fructose can be synthesized from glucose via enzymes of the polyol pathway, aldose reductase (AKR1B1) and sorbitol dehydrogenase (SORD), transported across cell membranes by solute carriers SLC2A5 and SLC2A8, and converted to fructose-1-phosphate by ketohexokinase (KHK). SLC2A8, SLC2A5, AKR1B1, SORD, and KHK mRNAs and proteins were analyzed using quantitative PCR and immunohistochemistry or in situ hybridization in endometria and placentae of cyclic and pregnant gilts, cyclic gilts injected with estrogen, and ovariectomized gilts injected with progesterone. Progesterone up-regulated SLC2A8 protein in uterine luminal (LE) and glandular epithelia during the peri-implantation period, and expression became exclusively placental, chorion and blood vessels, after Day 30. P4 up-regulated SLC2A5 mRNA in uterine LE and glandular epithelia after implantation, and the chorion expressed SLC2A5 between Days 30 and 85. AKR1B1 and SORD proteins localized to uterine LE during the peri-implantation period, but expression switched to chorion by Day 20 and was maintained through Day 85. Uterine expression of AKR1B1 mRNA was down-regulated by estrogen. KHK protein localized to trophectoderm/chorion throughout gestation. These results provide evidence that components for the conversion of glucose to fructose and for fructose transport are present at the uterine-placental interface of pigs. The shift in expression from LE to chorion during pregnancy suggests free-floating conceptuses are supported by fructose synthesized by the uterus, but after implantation, the chorion becomes self-sufficient for fructose synthesis and transport. © 2016 by the Society for the Study of Reproduction, Inc.

  20. Estimación mediante RAPD's de la diversidad genética en Guadua en el departamento del Cauca, Colombia

    Directory of Open Access Journals (Sweden)

    Palacio M. Juan Diego

    2006-06-01

    Full Text Available

    Mediante RAPD's se analizaron 120 muestras foliares de 12 biotipos de Guadua angustifolia Kunth clasificados morfológicamente, procedentes de la cuenca del río Cauca, en el departamento del Cauca, Colombia, para determinar diversidad genética. El ADN se extrajo mediante el protocolo modificado de Dellaporta (1983. Se emplearon los cebadores; OPF-12, OPG-19, OPN-19 y OPP-16 con mayor número de bandas polimórficas. El índice de Shannon (HT = 0.4556 ± 0.1849 señaló diversidad genética total alta y diversidad entre los biotipos y al interior de ellos. El Índice de estructura genética (Gst = 0.5200 e Indice de migración efectiva (Nm = 0.4615 definieron biotipos bien diferenciados. El análisis de similaridad conformó tres grupos a un coeficiente de 0.64. El grupo G1 incluyó los biotipos Curvado, Rayada frecuente, Amarilla Playón, Rayada ancha, Rayada escasa, Convexa, Amarilla, Hembra, Verde irregular y algunos individuos de verde alta. El grupo G2, Verde alta y Macho. El grupo G3, Rayada negra. El estudio molecular agrupó los individuos de forma similar al estudio morfológico, con excepción de los individuos del biotipo Hembra.

    Palabras claves: Guadua angustifolia, caracterización molecular, variación genética.

  1. SLC-2000: A luminosity upgrade for the SLC

    International Nuclear Information System (INIS)

    Breidenbach, M.; Decker, F.-J.; Helm, R.; Napoly, O.; Phinney, N.; Raimondi, P.; Raubenheimer, T.O.; Siemann, R.; Zimmermann, F.; Hertzbach, S.

    1996-01-01

    We discuss a possible upgrade to the Stanford Linear Collider (SLC), whose objective is to increase the SLC luminosity by at least a factor 7, to an average Z production rate of more than 35,000 per week. The centerpiece of the upgrade is the installation of a new superconducting final doublet with a field gradient of 240 T/m, which will be placed at a distance of only 70 cm from the interaction point. In addition, several bending magnets in each final focus will be lengthened and two octupole correctors are added. A complementary upgrade of damping rings and bunch compressors will allow optimum use of the modified final focus and can deliver, or exceed, the targeted luminosity. The proposed upgrade will place the SLC physics program in a very competitive position, and will also enable it to pursue its pioneering role as the first and only linear collider. (author)

  2. mTORC1 Activator SLC38A9 Is Required to Efflux Essential Amino Acids from Lysosomes and Use Protein as a Nutrient.

    Science.gov (United States)

    Wyant, Gregory A; Abu-Remaileh, Monther; Wolfson, Rachel L; Chen, Walter W; Freinkman, Elizaveta; Danai, Laura V; Vander Heiden, Matthew G; Sabatini, David M

    2017-10-19

    The mTORC1 kinase is a master growth regulator that senses many environmental cues, including amino acids. Activation of mTORC1 by arginine requires SLC38A9, a poorly understood lysosomal membrane protein with homology to amino acid transporters. Here, we validate that SLC38A9 is an arginine sensor for the mTORC1 pathway, and we uncover an unexpectedly central role for SLC38A9 in amino acid homeostasis. SLC38A9 mediates the transport, in an arginine-regulated fashion, of many essential amino acids out of lysosomes, including leucine, which mTORC1 senses through the cytosolic Sestrin proteins. SLC38A9 is necessary for leucine generated via lysosomal proteolysis to exit lysosomes and activate mTORC1. Pancreatic cancer cells, which use macropinocytosed protein as a nutrient source, require SLC38A9 to form tumors. Thus, through SLC38A9, arginine serves as a lysosomal messenger that couples mTORC1 activation to the release from lysosomes of the essential amino acids needed to drive cell growth. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Evaluación de la presencia del gen mer A implicado en la detoxificación de mercurio a partir de actinomicetos nativos del humedal de La Conejera

    Directory of Open Access Journals (Sweden)

    Rueda Carolina

    2009-07-01

    Full Text Available Se aislaron diez cepas de actinomicetos nativos del humedal La Conejera a partir de muestras de sedimento y agua, con el fin de determinar la capacidad de resistencia y detoxificación de mercurio, evaluando la presencia del gen mer A involucrado en el proceso. La prueba de resistencia fue realizada mediante un test de sensibilidad tomando concentraciones desde 3,68x10-3 mM hasta 10 mM de HgCl2. Se realizaron curvas de crecimiento de 192 h para las cepas resistentes al mercurio, en un medio suplementado con 0,01 mM y 0,05 mM de HgCl2, realizando una fermentación discontinua y midiendo el crecimiento por la técnica de peso seco. A partir de estos resultados se determinó un tiempo de adaptación de 24 h y una producción máxima de biomasa de 2,72 g·L-1 a la hora 72. Paralelamente, se realizó la secuenciación de los genes de resistencia al mercurio de Streptomyces lividans 1326, por medio del diseño de los oligonucleótidos capaces de amplificar el extremos 3’ del gen mer A, codificador de la enzima mercurio reductasa. Se optimizaron las condiciones de amplificación por PCR para obtener un producto amplificado de 686 pb aproximadamente. Finalmente, se realizó una electroforesis en campo pulsado comprobando la presencia de plásmidos en la cepa KH7 con tamaños aproximados de 50, 90 y 300 Kb, no integrados al cromosoma y posiblemente asociados a la resistencia presentada frente al metal.

  4. Genómica del Trypanosoma cruzi. Nuevas oportunidades para tratar el mal de Chagas

    Directory of Open Access Journals (Sweden)

    Jorge A. Huete-Pérez

    2006-12-01

    Full Text Available LA SECUENCIACIÓN DEL GENOMA HUMANO PUBLICADA EN FEBRERO de 2001 ha sido considerada como el hito científico más importante del siglo XX. La secuenciación, cuatro años más tarde, de tres parásitos tripanosmatidas, entre ellos el Trypanosoma cruzi, podría ser también catalogada como uno de los acontecimientos científicos más importantes para la salud publica del continente americano. Aquí se presenta un panorama general sobre los resultados más significativos del estudio geonómico del T. cruzi, se abordan los trabajos realizados por nuestro laboratorio en la Universidad Centroamericana, finalizando con una discusión sobre las perspectivas del uso de la genómica en Nicaragua.

  5. Drosophila SLC5A11 Mediates Hunger by Regulating K(+) Channel Activity.

    Science.gov (United States)

    Park, Jin-Yong; Dus, Monica; Kim, Seonil; Abu, Farhan; Kanai, Makoto I; Rudy, Bernardo; Suh, Greg S B

    2016-08-08

    Hunger is a powerful drive that stimulates food intake. Yet, the mechanism that determines how the energy deficits that result in hunger are represented in the brain and promote feeding is not well understood. We previously described SLC5A11-a sodium/solute co-transporter-like-(or cupcake) in Drosophila melanogaster, which is required for the fly to select a nutritive sugar over a sweeter nonnutritive sugar after periods of food deprivation. SLC5A11 acts on approximately 12 pairs of ellipsoid body (EB) R4 neurons to trigger the selection of nutritive sugars, but the underlying mechanism is not understood. Here, we report that the excitability of SLC5A11-expressing EB R4 neurons increases dramatically during starvation and that this increase is abolished in the SLC5A11 mutation. Artificial activation of SLC5A11-expresssing neurons is sufficient to promote feeding and hunger-driven behaviors; silencing these neurons has the opposite effect. Notably, SLC5A11 transcript levels in the brain increase significantly when flies are starved and decrease shortly after starved flies are refed. Furthermore, expression of SLC5A11 is sufficient for promoting hunger-driven behaviors and enhancing the excitability of SLC5A11-expressing neurons. SLC5A11 inhibits the function of the Drosophila KCNQ potassium channel in a heterologous expression system. Accordingly, a knockdown of dKCNQ expression in SLC5A11-expressing neurons produces hunger-driven behaviors even in fed flies, mimicking the overexpression of SLC5A11. We propose that starvation increases SLC5A11 expression, which enhances the excitability of SLC5A11-expressing neurons by suppressing dKCNQ channels, thereby conferring the hunger state. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Asociación del polimorfismo del codon 72 del gen p53 con el riesgo de cáncer gástrico en una población de alto riesgo de Costa Rica

    Directory of Open Access Journals (Sweden)

    Warner Alpízar-Alpízar

    2005-09-01

    Full Text Available El cáncer gástrico es la segunda causa de muerte por cáncer en el mundo. Varios factores han sido asociados con el riesgo de llegar a desarrollarlo, entre ellos la predisposición genética. El gen p53 presenta un polimorfismo en el codón 72, el cual ha sido asociado con un mayor riesgo de desarrollar varios tipos de cáncer entre ellos el gástrico. El objetivo de este estudio fue determinar la asociación del polimorfismo localizado en el codón 72 del gen p53 con el riesgo de cáncer gástrico y lesiones gástricas leves en una población de alto riesgo de Costa Rica. El análisis del polimorfismo se llevó a cabo mediante PCR-RFLP, en una muestra de 58 pacientes de cáncer gástrico, 99 personas controles y 41 individuos clasificados como grupos I y II de acuerdo con la clasificación histológica japonesa. No se determinó asociación del polimorfismo del codón 72 de p53 con el riesgo de cáncer gástrico, ni de lesiones gástricas leves en la muestra estudiada. Con base en este estudio y otros que han investigado el polimorfismo del codón 72 del gen p53, no está claro el papel que podría estar jugando dicho polimorfismo en el desarrollo de cáncer gástrico. Mutaciones de novo en el gen p53 producidas durante el desarrollo neoplásico de la enfermedad podrían tener un mayor efecto que polimorfismos de línea germinal de este mismo gen. Existen otros genes polimórficos que también se han asociado con el riesgo de desarrollar cáncer gástrico.Association of the p53 codon 72 polymorphism to gastric cancer risk in a hight risk population of Costa Rica. Gastric cancer is the second most common cancer associated death cause worldwide. Several factors have been associated with higher risk to develop gastric cancer, among them genetic predisposition. The p53 gene has a polymorphism located at codon 72, which has been associated with higher risk of several types of cancer, including gastric cancer. The aim of this study was to determine

  7. Nuevos diseños de sistemas de control híbrido, genético-adaptativo, para la regulación de la eficiencia del bloque termoenergético de las empresas del níquel.

    Directory of Open Access Journals (Sweden)

    Antonio Muñoz

    2006-10-01

    Full Text Available El artículo muestra los resultados de la investigación del sistema de avanzado híbrido (genéticoadaptativo para la generación de vapor, a través de lazos de regulación para la reducción de la dispersión de las variables del régimen operacional del proceso, con la aplicación de nuevas estrategias de control óptimo con algoritmos genéticos del gasto de energía, sobre la desviación del régimen de trabajo de las calderas; todo lo cual contribuye a la reducción de las pérdidas de energía para generar vapor, permitiendo implementar sistemas control híbridos, resultantes de la integración de sistemas de control genético-adaptativos.

  8. Study of the serotonin transporter (SLC6A4 and BDNF genes in French patients with non syndromic mental deficiency

    Directory of Open Access Journals (Sweden)

    Mignon Laurence

    2010-02-01

    Full Text Available Abstract Background Mental deficiency has been linked to abnormalities in cortical neuronal network connectivity and plasticity. These mechanisms are in part under the control of two interacting signalling pathways, the serotonergic and the brain-derived neurotrophic (BDNF pathways. The aim of the current paper is to determine whether particular alleles or genotypes of two crucial genes of these systems, the serotonin transporter gene (SLC6A4 and the brain-derived neurotrophic factor gene (BDNF, are associated with mental deficiency (MD. Methods We analyzed four functional polymorphisms (rs25531, 5-HTTLPR, VNTR, rs3813034 of the SLC6A4 gene and one functional polymorphism (Val66 Met of the BDNF gene in 98 patients with non-syndromic mental deficiency (NS-MD and in an ethnically matched control population of 251 individuals. Results We found no significant differences in allele and genotype frequencies in the five polymorphisms studied in the SLC6A4 and BDNF genes of NS-MD patients versus control patients. While the comparison of the patterns of linkage disequilibrium (D' in the control and NS-MD populations revealed a degree of variability it did not, however, reach significance. No significant differences in frequencies of haplotypes and genotypes for VNTR/rs3813034 and rs25531/5-HTTLPR were observed. Conclusion Altogether, results from the present study do not support a role for any of the five functional polymorphisms of SLC6A4 and BDNF genes in the aetiology of NS-RM. Moreover, they suggest no epistatic interaction in NS-MD between polymorphisms in BDNF and SLC6A4. However, we suggest that further studies on these two pathways in NS-MD remain necessary.

  9. Mejoramiento genético acelerado de angiospermas perennes vía inducción floral por sobre-expresión del gen FT

    Directory of Open Access Journals (Sweden)

    Rafael Urrea López

    2018-05-01

    Full Text Available Los bosques y selvas enfrentan el reto de satisfacer la demanda por recursos de una población en crecimiento, así como la amenaza del rápido cambio climático que exacerba la magnitud y frecuencia de estreses bióticos y abióticos. Para ello, es urgente acelerar el mejoramiento genético de especies forestales. Sin embargo, sus largas etapas juveniles y asincronía floral retrasan peligrosamente este proceso. El presente ensayo explora los adelantos biotecnológicos en inducción floral y su potencial aplicación en especies forestales. Entre los genes identificados y caracterizados que participan en la ruta de señalización de la floración, especial atención se destina al gen FLOWERING LOCUS T, considerado un integrador de rutas de señalización altamente conservado entre las angiospermas, que, al sobre-expresarse por ingeniería genética, es capaz de inducir la floración de forma eficiente. Esta novedosa estrategia biotecnológica se ha utilizado, recientemente, para segregar genes de resistencia a enfermedades, en un menor tiempo, en germoplasma comercial de manzana y ciruela. Permite soslayar barreras naturales que por mucho tiempo han restringido a las especies forestales al mejoramiento por selección, principalmente. Entre sus ventajas está la de poder restringirla al proceso y no al producto, para acelerar las cruzas sexuales sin modificar genéticamente la progenie; se aleja así de la controversia alrededor de la liberación y consumo de organismos genéticamente modificados, y de los costos y trámites obligatorios para los OGM para monitoreo de posibles riesgos. Se proyecta como una tecnología que puede acelerar, significativamente, el mejoramiento de especies forestales.

  10. Frequency of MYO9B polymorphisms in celiac patients and controls Frecuencia de polimorfismos del gen MYO9B en pacientes celiacos y en sujetos controles

    Directory of Open Access Journals (Sweden)

    Tamara Loeff

    2012-12-01

    Full Text Available Introduction: the MYO9B gene contributes to the maintenance of the intestinal barrier and it has been postulated as a risk factor of celiac disease (CD. The objective of this study was to compare the frequency and association rs2305764, rs2305767and rs1457092 MYO09B polymorphisms in pediatric CD patients from Chile and Argentina. Patients and methods: the study was made in 104 CD pediatric patients (Chilean and Argentineans and 104 controls subjects. MYO9B gene polymorphisms were analyzed by Taqman allelic probes. We evaluated the Hardy-Weinberg equilibrium by means of Chi-square and compared the haplotypes distribution using Fisher test. Results: SNPs rs2305767 and rs1457092 were associated with celiac disease (CD; TT genotype in rs2305767 would be a protective factor (p Introducción: el gen miosina IX B (MYO9B participa en el mantenimiento de la barrera intestinal y se postula que puede aportar riesgo para desarrollar enfermedad celiaca (EC. El objetivo de este estudio fue comparar la frecuencia y la asociación de los polimorfismos rs 2305764, rs 2305767 y rs 1457092 del gen MYO9B en pacientes pediátricos con EC procedentes de Chile y Argentina. Pacientes y métodos: el estudio se realizó en 104 pacientes pediátricos con EC (chilenos y argentinos y en 104 sujetos controles. El análisis de los polimorfismos del gen MYO9B se realizó mediante ensayos Taqman de discriminación alélica. Se evalúo equilibrio de Hardy-Weinberg mediante Chi-cuadrado y comparación de haplotipos según prueba de Fisher. Resultados: los polimorfismos de un solo nucleótido (SNPs rs2305767 y rs1457092 mostraron asociación con la EC. El genotipo TT del rs2305767 sería un factor protector (p < 0,0001, OR = 0,19 IC 0,1-0,4 mientras que el genotipo CT sería un factor de riesgo (p < 0,0001, OR = 4,9 IC 2,2-11,3. En el rs1457092, el genotipo CC resultó también un factor protector frente a esta enfermedad (p < 0,0001, OR = 0,07 IC 0,0-0,3. Conclusión: nuestros

  11. Differential SLC1A2 Promoter Methylation in Bipolar Disorder With or Without Addiction

    Directory of Open Access Journals (Sweden)

    Yun-Fang Jia

    2017-07-01

    Full Text Available While downregulation of excitatory amino acid transporter 2 (EAAT2, the main transporter removing glutamate from the synapse, has been recognized in bipolar disorder (BD, the underlying mechanisms of downregulation have not been elucidated. BD is influenced by environmental factors, which may, via epigenetic modulation of gene expression, differentially affect illness presentation. This study thus focused on epigenetic DNA methylation regulation of SLC1A2, encoding for EAAT2, in BD with variable environmental influences of addiction. High resolution melting PCR (HRM-PCR and thymine–adenine (TA cloning with sequence analysis were conducted to examine methylation of the promoter region of the SLC1A2. DNA was isolated from blood samples drawn from BD patients (N = 150 with or without addiction to alcohol, nicotine, or food, defined as binge eating, and matched controls (N = 32. In comparison to controls, the SLC1A2 promoter region was hypermethylated in BD without addiction but was hypomethylated in BD with addiction. After adjusting for age and sex, the association of methylation levels with nicotine addiction (p = 0.0009 and binge eating (p = 0.0002 remained significant. Consistent with HRM-PCR, direct sequencing revealed increased methylation in CpG site 6 in BD, but decreased methylation in three CpG sites (6, 48, 156 in BD with alcohol and nicotine addictions. These results suggest that individual point methylation within the SLC1A2 promoter region may be modified by exogenous addiction and may have a potential for developing clinically valuable epigenetic biomarkers for BD diagnosis and monitoring.

  12. Linking chronic infection and autoimmune diseases: Mycobacterium avium subspecies paratuberculosis, SLC11A1 polymorphisms and type-1 diabetes mellitus.

    Directory of Open Access Journals (Sweden)

    Daniela Paccagnini

    2009-09-01

    Full Text Available The etiology of type 1 diabetes mellitus (T1DM is still unknown; numerous studies are performed to unravel the environmental factors involved in triggering the disease. SLC11A1 is a membrane transporter that is expressed in late endosomes of antigen presenting cells involved in the immunopathogenic events leading to T1DM. Mycobacterium avium subsp. paratuberculosis (MAP has been reported to be a possible trigger in the development of T1DM.Fifty nine T1DM patients and 79 healthy controls were genotyped for 9 polymorphisms of SLC11A1 gene, and screened for the presence of MAP by PCR. Differences in genotype frequency were evaluated for both T1DM patients and controls. We found a polymorphism in the SLC11A1 gene (274C/T associated to type 1 diabetic patients and not to controls. The presence of MAP DNA was also significantly associated with T1DM patients and not with controls.The 274C/T SCL11A1 polymorphism was found to be associated with T1DM as well as the presence of MAP DNA in blood. Since MAP persists within macrophages and it is also processed by dendritic cells, further studies are necessary to evaluate if mutant forms of SLC11A1 alter the processing or presentation of MAP antigens triggering thereby an autoimmune response in T1DM patients.

  13. Function and expression of the proton-coupled amino acid transporter Slc36a1 along the rat gastrointestinal tract

    DEFF Research Database (Denmark)

    Broberg, M. L.; Holm, Rasmus Koldborg; Tønsberg, H

    2012-01-01

    BACKGROUND AND PURPOSE: Intestinal absorption via membrane transporters may determine the pharmacokinetics of drug compounds. The hypothesis is that oral absorption of gaboxadol (4, 5, 6, 7-tetrahydroisoxazolo [5,4-c] pyridine-3-ol) in rats occurs via the proton-coupled amino acid transporter, r....... The intestinal expression of rSlc36a1 mRNA was measured by quantitative real-time PCR (q-RT-PCR). Furthermore, the hPAT1-/rPAT1-mediated transport of gaboxadol or L-proline was studied in hPAT1-expressing X. laevis oocytes, Caco-2 cell monolayers and excised segments of the rat intestine. KEY RESULTS......). The in vitro carrier-mediated uptake rate of L-proline in the excised intestinal segments was highest in the mid jejunum and low in the colon. The in vitro uptake and the in vivo absorption correlated with the expression of rSlc36a1 mRNA along the rat intestine. CONCLUSIONS AND IMPLICATIONS: The results...

  14. Diagnóstico prenatal de mosaicismo 45,X/46,XX con presencia del gen SRY. Presentación de un caso

    OpenAIRE

    Pedro Alí Díaz-Véliz Jiménez; María Antonia Ocaña Gil; Leydi María Sosa Águila; Belkis Vidal Hernández

    2013-01-01

    El cariotipo más frecuente del Síndrome de Turner es 45,X, aunque también puede presentarse como mosaico 45,X/46,XX. En el Centro Provincial de Genética Médica de Cienfuegos se le realizó la amniocentesis a una gestante de 42 años de edad, detectándose un mosaico de Síndrome de Turner (45,X/46,XX). Por ultrasonido se diagnosticó un varón, por lo que se envió una muestra de líquido amniótico al Centro Nacional de Genética Médica para corroborarlo y se indicó realizar estudio del gen SRY, cuyo ...

  15. Variabilidad genética de Aedes aegypti en algunas áreas del Perú usando Single Stranded Conformational Polymorphism (SSCP

    Directory of Open Access Journals (Sweden)

    Nélida Leiva G

    2004-07-01

    Full Text Available Aedes aegypti es el vector responsable de la transmisión del virus del dengue, su distribución geográfica se ha ampliado rápidamente debido principalmente a la intervención de los seres humanos. Objetivo: Analizar la variabilidad genética de este mosquito mediante la comparación del Segundo Espaciador Transcrito Interno (ITS 2 perteneciente al ADN ribosomal (rADN. Materiales y Métodos: Se analizaron muestras de ocho localidades (Jaén, Tingo María, Iquitos, Lambayeque, el distrito de El Rimac, Sullana y Zarumilla y uno de la provincia de Huaquillas (Ecuador. El análisis de la variabilidad se determinó usando la técnica conocida como SSCP (Single Stranded Conformation Polymorphism. Resultados: El estudio muestra que existe variabilidad genética entre las poblaciones analizadas, principalmente entre las muestras localizadas en la costa del Perú (Zarumilla, El Rímac, Sullana y Huaquillas y las muestras del nororiente (Tingo María, Iquitos, Jaén y Lambayeque Conclusión: Se determinaron dos variantes genéticas entre las poblaciones de Aedes aegypti: Costeña y Nororiental, que probablemente provienen de dos ancestros diferentes y cuyo ancestro común sufrió de aislamiento por distancia. Se observó que no existe relación entre las distancias genéticas y las distancias geográficas indicando que la migración de estas poblaciones es el resultado de la intervención de los seres humanos que diseminan al vector y no por la migración activa del mosquito. Se plantea el papel de la Cordillera de los Andes en la migración y separación de las poblaciones de Aedes.

  16. A novel variant in the SLC12A1 gene in two families with antenatal Bartter syndrome.

    Science.gov (United States)

    Breinbjerg, Anders; Siggaard Rittig, Charlotte; Gregersen, Niels; Rittig, Søren; Hvarregaard Christensen, Jane

    2017-01-01

    Bartter syndrome is an autosomal-recessive inherited disease in which patients present with hypokalaemia and metabolic alkalosis. We present two apparently nonrelated cases with antenatal Bartter syndrome type I, due to a novel variant in the SLC12A1 gene encoding the bumetanide-sensitive sodium-(potassium)-chloride cotransporter 2 in the thick ascending limb of the loop of Henle. Blood samples were received from the two cases and 19 of their relatives, and deoxyribonucleic acid was extracted. The coding regions of the SLC12A1 gene were amplified using polymerase chain reaction, followed by bidirectional direct deoxyribonucleic acid sequencing. Each affected child in the two families was homozygous for a novel inherited variant in the SLC12A1gene, c.1614T>A. The variant predicts a change from a tyrosine codon to a stop codon (p.Tyr538Ter). The two cases presented antenatally and at six months of age, respectively. The two cases were homozygous for the same variant in the SLC12A1 gene, but presented clinically at different ages. This could eventually be explained by the presence of other gene variants or environmental factors modifying the phenotypes. The phenotypes of the patients were similar to other patients with antenatal Bartter syndrome. ©2016 Foundation Acta Paediatrica. Published by John Wiley & Sons Ltd.

  17. Peripheral SLC6A4 DNA methylation is associated with in vivo measures of human brain serotonin synthesis and childhood physical aggression.

    Directory of Open Access Journals (Sweden)

    Dongsha Wang

    Full Text Available The main challenge in addressing the role of DNA methylation in human behaviour is the fact that the brain is inaccessible to epigenetic analysis in living humans. Using positron emission tomography (PET measures of brain serotonin (5-HT synthesis, we found in a longitudinal sample that adult males with high childhood-limited aggression (C-LHPA had lower in vivo 5-HT synthesis in the orbitofrontal cortex (OBFC. Here we hypothesized that 5-HT alterations associated with childhood aggression were linked to differential DNA methylation of critical genes in the 5-HT pathway and these changes were also detectable in peripheral white blood cells. Using pyrosequencing, we determined the state of DNA methylation of SLC6A4 promoter in T cells and monocytes isolated from blood of cohort members (N = 25 who underwent a PET scan, and we examined whether methylation status in the blood is associated with in vivo brain 5-HT synthesis. Higher levels of methylation were observed in both T cells and monocytes at specific CpG sites in the C-LHPA group. DNA methylation of SLC6A4 in monocytes appears to be associated more reliably with group membership than T cells. In both cell types the methylation state of these CpGs was associated with lower in vivo measures of brain 5-HT synthesis in the left and right lateral OBFC (N = 20 where lower 5-HT synthesis in C-LHPA group was observed. Furthermore, in vitro methylation of the SLC6A4 promoter in a luciferase reporter construct suppresses its transcriptional activity supporting a functional role of DNA methylation in SLC6A4 promoter regulation. These findings indicate that state of SLC6A4 promoter methylation is altered in peripheral white blood cells of individuals with physical aggression during childhood. This supports the relevance of peripheral DNA methylation for brain function and suggests that peripheral SLC6A4 DNA methylation could be a marker of central 5-HT function.

  18. Polimorfismos del gen pfmdr1 en muestras clínicas de Plasmodium falciparum y su relación con la respuesta terapéutica a antipalúdicos y paludismo grave en Colombia

    Directory of Open Access Journals (Sweden)

    Paula Montoya

    2007-06-01

    Conclusiones. Los polimorfismos 86Tir y 1246Tir en el gen pfmdr1 no son útiles como factores de predicción de falla terapéutica o paludismo grave en los municipios estudiados. Este estudio describe por primera vez la presencia del alelo 86Tir en cuatro muestras clínicas de Suramérica.

  19. Transport by SLC5A8 with subsequent inhibition of histone deacetylase 1 (HDAC1) and HDAC3 underlies the antitumor activity of 3-bromopyruvate.

    Science.gov (United States)

    Thangaraju, Muthusamy; Karunakaran, Senthil K; Itagaki, Shiro; Gopal, Elangovan; Elangovan, Selvakumar; Prasad, Puttur D; Ganapathy, Vadivel

    2009-10-15

    3-bromopyruvate is an alkylating agent with antitumor activity. It is currently believed that blockade of adenosine triphosphate production from glycolysis and mitochondria is the primary mechanism responsible for this antitumor effect. The current studies uncovered a new and novel mechanism for the antitumor activity of 3-bromopyruvate. The transport of 3-bromopyruvate by sodium-coupled monocarboxylate transporter SMCT1 (SLC5A8), a tumor suppressor and a sodium (Na+)-coupled, electrogenic transporter for short-chain monocarboxylates, was studied using a mammalian cell expression and the Xenopus laevis oocyte expression systems. The effect of 3-bromopyruvate on histone deacetylases (HDACs) was monitored using the lysate of the human breast cancer cell line MCF7 and human recombinant HDAC isoforms as the enzyme sources. Cell viability was monitored by fluorescence-activated cell-sorting analysis and colony-formation assay. The acetylation status of histone H4 was evaluated by Western blot analysis. 3-Bromopyruvate is a transportable substrate for SLC5A8, and that transport process is Na+-coupled and electrogenic. MCF7 cells did not express SLC5A8 and were not affected by 3-bromopyruvate. However, when transfected with SLC5A8 or treated with inhibitors of DNA methylation, these cells underwent apoptosis in the presence of 3-bromopyruvate. This cell death was associated with the inhibition of HDAC1/HDAC3. Studies with different isoforms of human recombinant HDACs identified HDAC1 and HDAC3 as the targets for 3-bromopyruvate. 3-Bromopyruvate was transported into cells actively through the tumor suppressor SLC5A8, and the process was energized by an electrochemical Na+ gradient. Ectopic expression of the transporter in MCF7 cells led to apoptosis, and the mechanism involved the inhibition of HDAC1/HDAC3. Copyright (c) 2009 American Cancer Society.

  20. Progressive irreversible hearing loss is caused by stria vascularis degeneration in an Slc26a4-insufficient mouse model of large vestibular aqueduct syndrome.

    Science.gov (United States)

    Ito, T; Nishio, A; Wangemann, P; Griffith, A J

    2015-12-03

    Hearing loss of patients with enlargement of the vestibular aqueduct (EVA) can fluctuate or progress, with overall downward progression. The most common detectable cause of EVA is mutations of SLC26A4. We previously described a transgenic Slc26a4-insufficient mouse model of EVA in which Slc26a4 expression is controlled by doxycycline administration. Mice that received doxycycline from conception until embryonic day 17.5 (DE17.5; doxycycline discontinued at embryonic day 17.5) had fluctuating hearing loss between 1 and 6 months of age with an overall downward progression after 6 months of age. In this study, we characterized the cochlear functional and structural changes underlying irreversible hearing loss in DE17.5 mice at 12 months of age. The endocochlear potential was decreased and inversely correlated with auditory brainstem response thresholds. The stria vascularis was thickened and edematous in ears with less severe hearing loss, and thinned and atrophic in ears with more severe hearing loss. There were pathologic changes in marginal cell morphology and gene expression that were not observed at 3 months. We conclude that strial dysfunction and degeneration are the primary causes of irreversible progressive hearing loss in our Slc26a4-insufficient mouse model of EVA. This model of primary strial atrophy may be used to explore the mechanisms of progressive hearing loss due to strial dysfunction. Published by Elsevier Ltd.

  1. Identification of two novel mutations in the SLC45A2 gene in a Hungarian pedigree affected by unusual OCA type 4.

    Science.gov (United States)

    Tóth, Lola; Fábos, Beáta; Farkas, Katalin; Sulák, Adrienn; Tripolszki, Kornélia; Széll, Márta; Nagy, Nikoletta

    2017-03-15

    Oculocutaneous albinism (OCA) is a clinically and genetically heterogenic group of pigmentation abnormalities. OCA type IV (OCA4, OMIM 606574) develops due to homozygous or compound heterozygous mutations in the solute carrier family 45, member 2 (SLC45A2) gene. This gene encodes a membrane-associated transport protein, which regulates tyrosinase activity and, thus, melanin content by changing melanosomal pH and disrupting the incorporation of copper into tyrosinase. Here we report two Hungarian siblings affected by an unusual OCA4 phenotype. After genomic DNA was isolated from peripheral blood of the patients, the coding regions of the SLC45A2 gene were sequenced. In silico tools were applied to identify the functional impact of the newly detected mutations. Direct sequencing of the SLC45A2 gene revealed two novel, heterozygous mutations, one missense (c.1226G > A, p.Gly409Asp) and one nonsense (c.1459C > T, p.Gln437*), which were present in both patients, suggesting the mutations were compound heterozygous. In silico tools suggest that these variations are disease causing mutations. The newly identified mutations may affect the transmembrane domains of the protein, and could impair transport function, resulting in decreases in both melanosomal pH and tyrosinase activity. Our study provides expands on the mutation spectrum of the SLC45A2 gene and the genetic background of OCA4.

  2. Variabilidad genética del robalo común Centropomus undecimalis (Perciformes: Centropomidae en ambiente marino y ribereño interconectados

    Directory of Open Access Journals (Sweden)

    Ulises Hernández-Vidal

    2014-08-01

    Full Text Available El robalo común Centropomus undecimalis habita en áreas ribereñas y marinas del sur del Golfo de México donde es sujeto a explotación intensiva. Aunque la identificación de las poblaciones de peces representa una valiosa herramienta para el manejo de las poblaciones silvestres, no hay información disponible para identificar genéticamente las poblaciones de peces de esta especie en la región. El objetivo de este estudio fue determinar la relación genética entre C. undecimalis capturado en ambiente marino y dulceacuícola del Golfo de México y río San Pedro. Muestras de tejido muscular de 79 individuos fueron obtenidas en áreas separadas por más de 300km. El genotipo de cada individuo fue determinado usando siete pares de cebadores microsatélites. Cinco cebadores amplificaron eficientemente presentando entre seis y 28 alelos por locus. Altos niveles de heterocigosidad se observaron en las muestras de ambos ambientes. Se observó desviación del equilibrio HW debido a exceso de heterocigotos. Los valores de diferenciación genética indican ausencia de estructuración poblacional F ST (0.0075 y R ST (0.016, p=0.051 y similitud en las frecuencias alélicas definidas por el índice de Nei (0.805. Los datos mostraron elevado flujo genético debido al número de migrantes (Nm=18.7. Estos resultados sugieren que los individuos en estos ambientes provienen de la misma población genética. La información obtenida en este estudio, por lo tanto contribuirá con elementos que pueden ser considerados en el desarrollo de programas de manejo y protección de las poblaciones de peces silvestres.

  3. Mutation analysis of SLC26A4 for Pendred syndrome and nonsyndromic hearing loss by high-resolution melting

    DEFF Research Database (Denmark)

    Chen, Neng; Tranebjærg, Lisbeth; Rendtorff, Nanna Dahl

    2011-01-01

    Pendred syndrome and DFNB4 (autosomal recessive nonsyndromic congenital deafness, locus 4) are associated with autosomal recessive congenital sensorineural hearing loss and mutations in the SLC26A4 gene. Extensive allelic heterogeneity, however, necessitates analysis of all exons and splice sites...

  4. Interaction between the SLC19A1 gene and maternal first trimester fever on offspring neural tube defects.

    Science.gov (United States)

    Pei, Lijun; Zhu, Huiping; Ye, Rongwei; Wu, Jilei; Liu, Jianmeng; Ren, Aiguo; Li, Zhiwen; Zheng, Xiaoying

    2015-01-01

    Many studies have indicated that the reduced folate carrier gene (SLC19A1) is associated with an increased risk of neural tube defects (NTDs). However, the interaction between the SLC19A1 gene variant and maternal fever exposure and NTD risk remains unknown. The aim of this study was to investigate whether the risk for NTDs was influenced by the interactions between the SLC19A1 (rs1051266) variant and maternal first trimester fever. We investigated the potential interaction between maternal first trimester fever and maternal or offspring SLC19A1 polymorphism through a population-based case-control study. One hundred and four nuclear families with NTDs and 100 control families with nonmal newborns were included in the study. SLC19A1 polymorphism was determined using polymerase chain reaction-restricted fragment length polymorphism. Mothers who had the GG/GA genotype and first trimester fever had an elevated risk of NTDs (adjusted odds ratio, 11.73; 95% confidence interval, 3.02-45.58) as compared to absence of maternal first trimester fever and AA genotype after adjusting for maternal education, paternal education, and age, and had a significant interactive coefficient (γ = 3.17) between maternal GG/GA genotype and first trimester fever. However, there was no interaction between offspring's GG/GA genotype and maternal first trimester fever (the interactive coefficient γ = 0.97) after adjusting for confounding factors. Our findings suggested that the risk of NTDs was potentially influenced by a gene-environment interaction between maternal SLC19A1 rs1051266 GG/GA genotype and first trimester fever. Maternal GG/GA genotype may strengthen the effect of maternal fever exposure on NTD risk in this Chinese population. © 2014 Wiley Periodicals, Inc.

  5. Hypoxic Stress Upregulates the Expression of Slc38a1 in Brown Adipocytes via Hypoxia-Inducible Factor-1α.

    Science.gov (United States)

    Horie, Tetsuhiro; Fukasawa, Kazuya; Iezaki, Takashi; Park, Gyujin; Onishi, Yuki; Ozaki, Kakeru; Kanayama, Takashi; Hiraiwa, Manami; Kitaguchi, Yuka; Kaneda, Katsuyuki; Hinoi, Eiichi

    2018-01-01

    The availability of amino acid in the brown adipose tissue (BAT) has been shown to be altered under various conditions; however, little is known about the possible expression and pivotal role of amino acid transporters in BAT under physiological and pathological conditions. The present study comprehensively investigated whether amino acid transporters are regulated by obesogenic conditions in BAT in vivo. Moreover, we investigated the mechanism underlying the regulation of the expression of amino acid transporters by various stressors in brown adipocytes in vitro. The expression of solute carrier family 38 member 1 (Slc38a1; gene encoding sodium-coupled neutral amino acid transporter 1) was preferentially upregulated in the BAT of both genetic and acquired obesity mice in vivo. Moreover, the expression of Slc38a1 was induced by hypoxic stress through hypoxia-inducible factor-1α, which is a master transcription factor of the adaptive response to hypoxic stress, in brown adipocytes in vitro. These results indicate that Slc38a1 is an obesity-associated gene in BAT and a hypoxia-responsive gene in brown adipocytes. © 2017 S. Karger AG, Basel.

  6. Relación del polimorfismo TaqI del gen del receptor de la vitamina D con la lepra lepromatosa en población mexicana Association between the TaqI polymorphism of Vitamin D Receptor gene and lepromatous leprosy in a Mexican population sample

    Directory of Open Access Journals (Sweden)

    Jesús Salvador Velarde Félix

    2009-02-01

    Full Text Available OBJETIVO: Determinar la relación del polimorfismo TaqI del gen del receptor de la vitamina D (RVD con la lepra lepromatosa (LL en individuos originarios de Sinaloa, México. MATERIAL Y MÉTODOS: Se amplificó un fragmento de 740 pb del gen RVD en muestras de ADN de 71 pacientes con LL y 144 controles en el Hospital General de Culiacán durante el periodo 2004-2007. El polimorfismo se identificó mediante la endonucleasa TaqI. RESULTADOS: Se observó un aumento de relevancia estadística del genotipo TT en pacientes con LL en comparación con los controles (p= 0.040; RM= 1.82. CONCLUSIÓN: Se demuestra un nexo entre el genotipo TT y la susceptibilidad a la LL.OBJETIVE: To establish the association of the vitamin D receptor gene TaqI polymorphism with lepromatous leprosy (LL in individuals from Sinaloa, Mexico. MATERIAL AND METHODS: A 740 bp fragment was amplified from the VDR gene in DNA samples of 71 patients with LL and 144 controls in the Hospital General de Culiacán during 2004-2007. Polymorphism was identified through TaqI endonuclease. RESULTS: A significant increase in the genotype TT of the VDR gene was observed in patients when compared to controls (p = 0.040; OR = 1.82. CONCLUSIONS: Our data support the association between the TT genotype and susceptibility to LL in this Mexican population.

  7. Association of polymorphisms in 5-HTT (SLC6A4) and MAOA genes with measures of obesity in young adults of Portuguese origin.

    Science.gov (United States)

    Dias, Helena; Muc, Magdalena; Padez, Cristina; Manco, Licínio

    2016-01-01

    To investigate the association of polymorphisms in SLC6A4 and MAOA genes with overweight (including obesity). Young adults (n = 535) of Portuguese origin were genotyped for the SLC6A4 polymorphisms 5-HTTLPR and STin2 and a MAOA VNTR. BMI and body fat percentage were measured and a questionnaire was used to assess individual's sport practicing habits. In whole study sample, haplotype-based analysis revealed significant association with overweight/obesity for the individual 5-HTTLPR/Stin2 haplotype L10 (p = 0.04). In men, the MAOA 3R genotype was nominally associated with body fat (p = 0.04). In inactive individuals, overweight/obesity was found significantly associated with 5-HTTLPR L-allele (p = 0.01) and nominally associated with STin2 10-allele (p = 0.03). A significant association was also found testing for all haplotype effects (χ(2 )= 8.7; p = 0.03). We found some evidences for the association of SLC6A4 and MAOA genes with measures of obesity. Our results suggest physical inactivity accentuates the influence of SLC6A4 polymorphisms on obesity risk.

  8. Identificación de Yarrowia lipolytica (Ascomycota: Hemiascomycetes como contaminante en la obtención de amplificados del gen 28S rRNA de moluscos

    Directory of Open Access Journals (Sweden)

    Jenny Chirinos

    2011-05-01

    Full Text Available En el presente trabajo se identifica una secuencia de DNA no esperada proveniente de los amplificados del gen 28S rRNA de moluscos terrestres. Las extracciones de DNA se realizaron del tejido del pie de caracoles terrestres por el método del CTAB modificado. Las PCRs fueron llevadas a cabo con primers universales para el gen COI e iniciadores diseñados para moluscos, para el marcador 16S rRNA, 28S rRNA y la región ITS-2. Los tamaños aproximados de las bandas de los amplificados de moluscos fueron de 706 pb para el COI, 330 pb para el 16S rRNA, 900 pb para el ITS-2 y 583 pb para el 28S rRNA; un amplificado del último marcador fue de una longitud inesperada, ~340 pb. Las secuencias de DNA fueron comparadas con la base de datos del GenBank mediante el programa BLASTn y la muestra con la banda de tamaño inesperado resultó en un 100% de identidad y cobertura del 99% con el gen 26S rRNA de la levadura Yarrowia lipolytica. El análisis filogenético con Neighbour-Joining y los valores de divergencia confirmaron la identificación, proporcionando resultados que apoyan la ubicación taxonómica de la especie dentro del clado de los Hemiascomycetes.

  9. Further characterisation of the recently described SLC26A4 c.918+2T>C mutation and reporting of a novel variant predicted to be damaging.

    Science.gov (United States)

    Gonçalves, A C; Santos, R; O'Neill, A; Escada, P; Fialho, G; Caria, H

    2016-06-01

    Pendred syndrome (PS) is the second most common type of autosomal recessive syndromic hearing loss (HL). It is characterised by sensorineural HL and goiter with occasional hypothyroidism. These features are generally accompanied by malformations of the inner ear, as enlarged vestibular aqueduct (EVA). In about 50% of probands, mutations in the SLC26A4 gene are the cause of the disease. Here we report the case of a Portuguese female, aged 47, presenting with severe to profound HL and hypothyroidism. Her mother and sister, both deceased, had suffered from HL and goiter. By MRI and CT, an enlarged vestibular aqueduct and endolymphatic sac were observed. Molecular study of the patient included screening for GJB2 coding mutations and GJB6 common deletions followed by screening of all SLC26A4 exons, as well as intronic regions 8 and 14. Mutation c.918+2T>C was found for the first time in homozygosity in the intronic region 7 of the SLC26A4 gene. Whilst sequencing the control samples, a novel mutation c.821C>G was found in heterozygosity in the exon 7 of SLC26A4 gene and was predicted to be damaging. This study thus led to the finding of two novel SLC26A4 genotypes and provides new insight on the phenotypic features associated with PS. © Copyright by Società Italiana di Otorinolaringologia e Chirurgia Cervico-Facciale, Rome, Italy.

  10. Three cysteine residues of SLC52A1, a receptor for the porcine endogenous retrovirus-A (PERV-A), play a critical role in cell surface expression and infectivity.

    Science.gov (United States)

    Colon-Moran, Winston; Argaw, Takele; Wilson, Carolyn A

    2017-07-01

    Porcine endogenous retrovirus-A (PERV-A), a gammaretrovirus, infects human cells in vitro, thus raising the potential risk of cross-species transmission in xenotransplantation. Two members of the solute carrier family 52 (SLC52A1 and SLC52A2) are PERV-A receptors. Site-directed mutagenesis of the cDNA encoding SLC52A1 identified that only one of two putative glycosylation signals is occupied by glycans. In addition, we showed that glycosylation of SLC52A1 is not necessary for PERV-A receptor function. We also identified that at a minimum, three cysteine residues are sufficient for SLC52A1 cell surface expression. Mutation of cysteine at position 365 and either of the two cysteine residues in the C-terminal tail at positions 442 or 446 reduced SLC52A1 surface expression and PERV-A infection suggesting that these residues may contribute to overall structural stability and receptor function. Understanding interactions between PERV-A and its cellular receptor may provide novel strategies to prevent zoonotic infection in the setting of xenotransplantation. Published by Elsevier Inc.

  11. Polimorfismo R577X del gen ACTN3 en nadadores de velocidad, medio fondo y fondo y su relación con el rendimiento

    OpenAIRE

    Calle Pérez, Laura de la; Díaz Ureña, Germán; Muniesa Ferrero, Carlos Alberto

    2013-01-01

    Son numerosas las investigaciones que ponen de manifiesto una relación entre el genotipo del gen ACTN3 y el rendimiento deportivo, vinculado con la velocidad y la fuerza explosiva. El objetivo de este estudio, fue determinar si existe entre los nadadores, una distribución genotípica del gen ACTN3 diferente a la de la población general, y diferente en función del tipo de prueba que nadan. Participaron en este estudio 75 nadadores españoles, de categoría absoluta, velocistas, medio fondis...

  12. Examining the role of components of Slc11a1 (Nramp1 in the susceptibility of New Zealand sea lions (Phocarctos hookeri to disease.

    Directory of Open Access Journals (Sweden)

    Amy J Osborne

    Full Text Available The New Zealand sea lion (NZSL, Phocarctos hookeri is a Threatened marine mammal with a restricted distribution and a small, declining, population size. The species is susceptible to bacterial pathogens, having suffered three mass mortality events since 1998. Understanding the genetic factors linked to this susceptibility is important in mitigating population decline. The gene solute carrier family 11 member a1 (Slc11a1 plays an important role in mammalian resistance or susceptibility to a wide range of bacterial pathogens. At present, Slc11a1 has not been characterised in many taxa, and despite its known roles in mediating the effects of infectious disease agents, has not been examined as a candidate gene in susceptibility or resistance in any wild population of conservation concern. Here we examine components of Slc11a1 in NZSLs and identify: i a polymorphic nucleotide in the promoter region; ii putative shared transcription factor binding motifs between canids and NZSLs; and iii a conserved polymorphic microsatellite in the first intron of Slc11a1, which together suggest conservation of Slc11a1 gene structure in otariids. At the promoter polymorphism, we demonstrate a shift away from normal allele frequency distributions and an increased likelihood of death from infectious causes with one allelic variant. While this increased likelihood is not statistically significant, lack of significance is potentially due to the complexity of genetic susceptibility to disease in wild populations. Our preliminary data highlight the potential significance of this gene in disease resistance in wild populations; further exploration of Slc11a1 will aid the understanding of susceptibility to infection in mammalian species of conservation significance.

  13. Polimorfismos del gen ApoE en individuos con síndrome de Down y sus progenitores en una población colombiana

    Directory of Open Access Journals (Sweden)

    Lucero Rengifo

    2012-06-01

    Full Text Available Introducción. Los polimorfismos en el gen ApoE se han examinado en el síndrome de Down debido a la relación existente de la isoforma E4 con la demencia de tipo Alzheimer que aparece en los individuos con síndrome de Down. Objetivos. Determinar los polimorfismos en el gen ApoE en individuos con síndrome de Down y sus progenitores, y buscar su asociación. Materiales y métodos. Mediante PCR-RFLP, se analizaron los polimorfismos del gen ApoE en 134 individuos jóvenes con síndrome de Down, 87 madres y 54 padres del eje cafetero, y se compararon con una población control de 525 individuos sanos. Resultados. El alelo APOEε3 y el genotipo ε3/ε3 fueron los más frecuentes en todas las poblaciones. La frecuencia alélica de APOEε2 es muy baja y ε2/ε2 está ausente en las poblaciones con síndrome de Down y sus progenitores. El alelo APOEε4 fue más frecuente en individuos con síndrome de Down que en el resto de poblaciones analizadas. Al comparar las frecuencias alélicas y genotípicas entre las poblaciones con síndrome de Down y los progenitores con la población control, mediante la χ2 de Pearson y los odds ratios por la prueba exacta de Fisher, no se encontraron diferencias estadísticamente significativas. Conclusiones. No se encontró asociación entre los polimorfismos del gen ApoE y el síndrome de Down. Es posible que el tamaño de la muestra o las influencias étnicas hubieran afectado estos resultados. Es necesario hacer otros estudios en poblaciones colombianas y evaluar la asociación con otros genes que se encuentran relacionados con la enfermedad de Alzheimer.   doi: http://dx.doi.org/10.7705/biomedica.v32i2.427

  14. Selección sexual relacionada con el tamaño corporal, parámetros genético-cuantitativos multivariados, y divergencia morfométrica multivariada entre poblaciones de dos especies cactófilas del genéro Drosophila

    OpenAIRE

    Norry, Fabián Marcelo

    1995-01-01

    Los recientes avances conceptuales dentro del campo de la genética cuantitativa, han brindado las herramientas teóricas necesarias para caracterizar la evolución del fenotipo medio en poblaciones naturales. La teoria predice que la micro-evolución adaptativa del fenotipo depende de la forma de selección natural operando sobre los caracteres adaptativos, y particularmente de las varianzas y covarianzas genéticas y fenotípicas entre tales caracteres. Por ello, los estudios empíricos sobre estos...

  15. Inhibitors of GLUT/SLC2A Enhance the Action of BCNU and Temozolomide against High-Grade Gliomas

    Directory of Open Access Journals (Sweden)

    Alberto Azzalin

    2017-04-01

    Full Text Available Glucose transport across glioblastoma membranes plays a crucial role in maintaining the enhanced glycolysis typical of high-grade gliomas and glioblastoma. We tested the ability of two inhibitors of the glucose transporters GLUT/SLC2A superfamily, indinavir (IDV and ritonavir (RTV, and of one inhibitor of the Na/glucose antiporter type 2 (SGLT2/SLC5A2 superfamily, phlorizin (PHZ, in decreasing glucose consumption and cell proliferation of human and murine glioblastoma cells. We found in vitro that RTV, active on at least three different GLUT/SLC2A transporters, was more effective than IDV, a specific inhibitor of GLUT4/SLC2A4, both in decreasing glucose consumption and lactate production and in inhibiting growth of U87MG and Hu197 human glioblastoma cell lines and primary cultures of human glioblastoma. PHZ was inactive on the same cells. Similar results were obtained when cells were grown in adherence or as 3D multicellular tumor spheroids. RTV treatment but not IDV treatment induced AMP-activated protein kinase (AMPKα phosphorylation that paralleled the decrease in glycolytic activity and cell growth. IDV, but not RTV, induced an increase in GLUT1/SLC2A1 whose activity could compensate for the inhibition of GLUT4/SLC2A4 by IDV. RTV and IDV pass poorly the blood brain barrier and are unlikely to reach sufficient liquoral concentrations in vivo to inhibit glioblastoma growth as single agents. Isobologram analysis of the association of RTV or IDV and 1,3-bis(2-chloroethyl-1-nitrosourea (BCNU or 4-methyl-5-oxo-2,3,4,6,8-pentazabicyclo[4.3.0]nona-2,7,9-triene-9-carboxamide (TMZ indicated synergy only with RTV on inhibition of glioblastoma cells. Finally, we tested in vivo the combination of RTV and BCNU on established GL261 tumors. This drug combination increased the overall survival and allowed a five-fold reduction in the dose of BCNU.

  16. Estimación de la varianza genética y ambiental en caracteres métricos del esqueleto humano

    Directory of Open Access Journals (Sweden)

    Varela, Héctor Hugo

    2003-01-01

    Full Text Available En la teoría evolutiva de rasgos cuantitativos el conocimiento de la varianza genética (VG es determinante para hacer inferencias acerca del parentesco. En muchos casos no es posible estimar dicha componente sin la información obtenida a partir de la correlación entre parientes o de experimentos de selección. Por esta razón, en ausencia de datos apropiados es posible lograr una aproximación mediante el análisis de la repetibilidad de caracteres cuantitativos. En este trabajo se estima la proporción de la varianza genética máxima (VGmax o repetibilidad de medidas del cráneo y del esqueleto postcraneal, empleando la información obtenida por la Dra. Silvia Quevedo en el grupo prehistórico de Punta Teatinos (Norte Semiárido de Chile. La VG es igual a la varianza fenotípica (VP menos la varianza ambiental (VE. Esta última se puede particionar en una varianza ambiental especial (VEe y en una varianza ambiental general (VEg. Como la VEe se puede conocer por la medición de caracteres simétricos del lado derecho e izquierdo del individuo, entonces es posible calcular la varianza genética máxima de la siguiente manera, VGmax=VP-VEe. La proporción de la VGmax se obtuvo para siete variables del esqueleto postcraneano en individuos femeninos (n=56, masculinos (n=55, de ambos sexos (n=115 e infantiles (n=66, y para nueve mediciones del cráneo en un único grupo (n=54. Los resultados indican que la proporción media de la VGmax es menor en el cráneo que en el esqueleto postcraneal sugiriendo una distribución diferencial del efecto ambiental desde el punto de vista topográfico. Además, dicha cantidad es mayor en individuos infantiles que en masculinos y femeninos posiblemente por la existencia en aquellos de una mayor influencia del efecto ambiental general confundido con la VGmax.

  17. Identificación de mutaciones puntuales del gen de la 21-hidroxilasa en pacientes afectados con hiperplasia suprarrenal congénita.

    Directory of Open Access Journals (Sweden)

    Dora Fonseca

    2005-06-01

    Full Text Available lntroducción. La hiperplasia suprarrenal congénita es un trastorno autosómico recesivo debido a la inadecuada secreción de cortisol. Mas del 95% de los casos de hiperplasia suprarrenal congénita son causados por defectos del gen de la 21 hidroxilasa, CYP21A2 . Las manifestaciones clínicas incluyen la forma clásica y la forma no clásica. Objetivos. Determinar la frecuencia de las mutaciones puntuales P30L, IVS2-12AIC-G, Del 8pb, I172N, cluster Ex 6, V281L, Q318X, R356W y P453S en pacientes con hiperplasia suprarrenal congénita. Materiales y métodos. Se estudiaron 58 pacientes, de los cuales, 48 fueron clásicos y 10 no clásicos. Mediante PCR alelo-especifica y ACRS (Amplified Creation Restriction Sites, se analizaron 9 mutaciones puntuales del gen CYP21A2 y se determinó la frecuencia en la población analizada. Resultados. Los alelos afectados se identificaron en el 82,8% de los cromosomas. Las mutaciones mas frecuentes fueron: IVS2-12AIC-G (26,7%, Q318X (21,5%, V281L (12,1% e I172N (12,1%. Conclusiones. Las mutaciones mas frecuentes en Colombia son similares a las de otros países del mundo, excepto para Q318X que presentó una mayor frecuencia, pero similar a la de otros países latinoamericanos. Este hallazgo y la existencia de 17,2% de alelos no identificados puede indicar diferencia entre el acervo genético de las poblaciones. En la forma clásica perdedora de sal predominaron las mutaciones Q318X e IVS2-12AIC-G; en la virilizante simple, IVS2-12AIC-G e I172N y en la no clásica , V281L, lo cual esta relacionado con el grado de actividad enzimática. En la forma no clásica, se encontraron alelos severos en el 66,7% de los casos, lo que determina el riesgo de tener hijos afectados con la forma grave virilizante simple o perdedora de sal. Los resultados reportados permiten ofrecer asesoramiento genético y diagnóstico prenatal.

  18. Efecto del Polimorfismo del Intrón 6 del Gen LTF Bovino con Algunas Enfermedades de Alta Incidencia en la Producción Lechera Effect of the Polymorphism in the Intron 6 of the Bovine LTF Gene with Some Diseases of High Incidence in Dairy Production

    Directory of Open Access Journals (Sweden)

    Nancy Rodríguez Colorado

    2012-06-01

    Full Text Available Resumen. El objetivo de la investigación fue determinar la asociación del polimorfismo (C/T del intrón 6 del gen de la bLTF, con la incidencia de algunas enfermedades en ganado lechero. Para ello fueron observadas 482 vacas Holstein, durante al menos una lactancia, determinando la incidencia de algunas de las enfermedades mas importantes en la ganaderia de leche. La genotipificación para el polimorfismo de bLTF, se hizo usando la técnica de PCR-RFLP con DNA extraído de sangre periférica mediante la técnica de salting out. Para estudiar la asociación de los alelos del gen LTF, se utilizó el alelo B como control y se determinó el Odds Ratio (OR. Como resultados se obtiene que las frecuencias de los alelos A y B para el gen bLTF fueron 0,78 y 0,22 respectivamente. Las frecuencias genotípicas fueron 0,60, 0,36 y 0,04 para AA, AB y BB respectivamente. Una asociación altamente significativa (P≤0,001 fue hallada entre la incidencia de mastitis clínica y el polimorfismo del gen LTF. Los individuos portadores del alelo B tuvieron una probabilidad de incidencia de mastitis dos veces superior a los portadores del alelo A (OR=2.115 IC del 95%, 1.392-3.213. En el caso de la mastitis subclínica la probabilidad de incidencia fue de 1,6 veces más en los portadores del alelo B, con un OR=1.637 IC del 95% 1.184-2.264. Para la incidencia de enfermedades metabólicas, reproductivas, respiratorias, parasitarias, cáncer y cojeras, no se halló diferencia significativa (P>0,05 y se encontró asociación del alelo B del polimorfismo del intrón 6 del gen bLTF con la incidencia de mastitis clínica y subclínica.Abstract. The research objective was to determine the association of polymorphism (C/T of intron 6 bLTF gene, with the incidence of some diseases on dairy cattle. A total of 482 Holstein cows located in different herds in the department of Antioquia - Colombia, were used to follow the incidence of disease, for at least a full lactation

  19. Solute carrier protein family 11 member 1 (Slc11a1) activation efficiently inhibits Leishmania donovani survival in host macrophages.

    Science.gov (United States)

    Singh, Nisha; Gedda, Mallikarjuna Rao; Tiwari, Neeraj; Singh, Suya P; Bajpai, Surabhi; Singh, Rakesh K

    2017-09-01

    Visceral leishmaniasis (kala-azar), a life threatening disease caused by L. donovani , is a latent threat to more than 147 million people living in disease endemic South East Asia region of the Indian subcontinent. The therapeutic option to control leishmanial infections are very limited, and at present comprise only two drugs, an antifungal amphotericin B and an antitumor miltefosine, which are also highly vulnerable for parasitic resistance. Therefore, identification and development of alternate control measures is an exigent requirement to control leishmanial infections. In this study, we report that functionally induced expression of solute carrier protein family 11 member 1 ( Slc11a1), a transmembrane divalent cationic transporter recruited on the surface of phagolysosomes after phagocytosis of parasites, effectively inhibits Leishmania donovani growth in host macrophages. Further, the increased Slc11a1 functionality also resulted in increased production of NOx, TNF-α and IL-12 by activated macrophages. The findings of this study signify the importance of interplay between Slc11a1 expression and macrophages activation that can be effectively used to control of Leishmania growth and survival.

  20. Response to crizotinib in a lung adenocarcinoma patient harboring a novel SLC34A2-ROS1 fusion variant

    Science.gov (United States)

    Zhao, Zheng; Song, Zhangjun; Wang, Xuwei; Sun, Haifeng; Yang, Xiaomin; Yuan, Yong; Yu, Pan

    2017-01-01

    ROS1 fusion is a common genetic alteration in non-small-cell lung cancer. Crizotinib, an anaplastic lymphoma kinase inhibitor, shows efficacy in the treatment of lung cancer cases with ROS1 translocation. We report the response to crizotinib of a lung adenocarcinoma patient harboring a novel SLC34A2-ROS1 fusion variant, which was different from the two common SLC34A2-ROS1 fusion types reported in the literature. After crizotinib administration, overall recovery was good in this patient; the primary lesion was successfully treated, the lymph node metastases had disappeared, and the metabolism was normal. PMID:28860822

  1. Mutations in the HFE, TFR2, and SLC40A1 genes in patients with hemochromatosis.

    Science.gov (United States)

    Del-Castillo-Rueda, Alejandro; Moreno-Carralero, María-Isabel; Cuadrado-Grande, Nuria; Alvarez-Sala-Walther, Luis-Antonio; Enríquez-de-Salamanca, Rafael; Méndez, Manuel; Morán-Jiménez, María-Josefa

    2012-10-15

    Hereditary hemochromatosis causes iron overload and is associated with a variety of genetic and phenotypic conditions. Early diagnosis is important so that effective treatment can be administered and the risk of tissue damage avoided. Most patients are homozygous for the c.845G>A (p.C282Y) mutation in the HFE gene; however, rare forms of genetic iron overload must be diagnosed using a specific genetic analysis. We studied the genotype of 5 patients who had hyperferritinemia and an iron overload phenotype, but not classic mutations in the HFE gene. Two patients were undergoing phlebotomy and had no iron overload, 1 with metabolic syndrome and no phlebotomy had mild iron overload, and 2 patients had severe iron overload despite phlebotomy. The patients' first-degree relatives also underwent the analysis. We found 5 not previously published mutations: c.-408_-406delCAA in HFE, c.1118G>A (p.G373D), c.1473G>A (p.E491E) and c.2085G>C (p.S695S) in TFR2; and c.-428_-427GG>TT in SLC40A1. Moreover, we found 3 previously published mutations: c.221C>T (p.R71X) in HFE; c.1127C>A (p.A376D) in TFR2; and c.539T>C (p.I180T) in SLC40A1. Four patients were double heterozygous or compound heterozygous for the mutations mentioned above, and the patient with metabolic syndrome was heterozygous for a mutation in the TFR2 gene. Our findings show that hereditary hemochromatosis is clinically and genetically heterogeneous and that acquired factors may modify or determine the phenotype. Copyright © 2012. Published by Elsevier B.V.

  2. Caracterización del gen mecA de Staphylococcus aureus resistentes a meticilina aislados de tres grupos poblacionales de la ciudad de Medellín

    Directory of Open Access Journals (Sweden)

    Marcela Sanchez

    Full Text Available Introducción: Staphylococcus aureus resistente a la meticilina (SARM es responsable de infecciones intrahospitalarias, las que constituyen una importante causa de morbilidad y mortalidad en nuestro medio, por lo cual la rápida identificación y tipificación molecular de la resistencia como el complejo SSCmec es esencial para entender la epidemiología de la infección. Objetivo: Caracterizar fenotípicamente la resistencia a meticilina y genotípicamente el casete cromosomal SSCmec en cepas de S. aureus aislados de individuos de la ciudad de Medellín mediante PCR múltiple. Materiales y métodos: A 41 aislamientos (hospitalarios y de la comunidad de S. aureus se les estableció la resistencia a cefoxitin mediante la técnica de Kirby-Bauer y la concentración inhibitoria mínima para oxacilina. Mediante PCR convencional se les confirmó la presencia del gen mecA. Para la tipificación del complejo SSCmec se utilizó PCR múltiple para amplificar 6 loci diferentes de este gen. Resultados: A todos los aislamientos se les confirmó resistencia a meticilina y la presencia del gen mecA, de los cuales 17 fueron clasificados como SSC mec I, 1 como SSC mec II, 21 como SSC mecIV; dos aislamientos no fue posible clasificarlos. Conclusiones: Con el uso de esta técnica clasificamos el 95% de los aislamientos del estudio, encontrando una mayor prevalencia de los SSCmec I y IV. La implementación de esta técnica permite una fácil caracterización de los aislamientos SARM y un apropiado manejo de la información de los integrantes de los comités de infecciones hospitalarios, lo cual podría impactar positivamente en el tratamiento a los pacientes y el control de enfermedades infecciosas intrahospitalarias.

  3. The mitochondrial citrate carrier, SLC25A1, drives stemness and therapy resistance in non-small cell lung cancer.

    Science.gov (United States)

    Fernandez, Harvey R; Gadre, Shreyas M; Tan, Mingjun; Graham, Garrett T; Mosaoa, Rami; Ongkeko, Martin S; Kim, Kyu Ah; Riggins, Rebecca B; Parasido, Erika; Petrini, Iacopo; Pacini, Simone; Cheema, Amrita; Varghese, Rency; Ressom, Habtom W; Zhang, Yuwen; Albanese, Christopher; Üren, Aykut; Paige, Mikell; Giaccone, Giuseppe; Avantaggiati, Maria Laura

    2018-04-12

    Therapy resistance represents a clinical challenge for advanced non-small cell lung cancer (NSCLC), which still remains an incurable disease. There is growing evidence that cancer-initiating or cancer stem cells (CSCs) provide a reservoir of slow-growing dormant populations of cells with tumor-initiating and unlimited self-renewal ability that are left behind by conventional therapies reigniting post-therapy relapse and metastatic dissemination. The metabolic pathways required for the expansion of CSCs are incompletely defined, but their understanding will likely open new therapeutic opportunities. We show here that lung CSCs rely upon oxidative phosphorylation for energy production and survival through the activity of the mitochondrial citrate transporter, SLC25A1. We demonstrate that SLC25A1 plays a key role in maintaining the mitochondrial pool of citrate and redox balance in CSCs, whereas its inhibition leads to reactive oxygen species build-up thereby inhibiting the self-renewal capability of CSCs. Moreover, in different patient-derived tumors, resistance to cisplatin or to epidermal growth factor receptor (EGFR) inhibitor treatment is acquired through SLC25A1-mediated implementation of mitochondrial activity and induction of a stemness phenotype. Hence, a newly identified specific SLC25A1 inhibitor is synthetic lethal with cisplatin or with EGFR inhibitor co-treatment and restores antitumor responses to these agents in vitro and in animal models. These data have potential clinical implications in that they unravel a metabolic vulnerability of drug-resistant lung CSCs, identify a novel SLC25A1 inhibitor and, lastly, provide the first line of evidence that drugs, which block SLC25A1 activity, when employed in combination with selected conventional antitumor agents, lead to a therapeutic benefit.

  4. A Study of Single Nucleotide Polymorphisms of the SLC19A1/RFC1 Gene in Subjects with Autism Spectrum Disorder

    Directory of Open Access Journals (Sweden)

    Naila Al Mahmuda

    2016-05-01

    Full Text Available Autism Spectrum Disorder (ASD is a group of neurodevelopmental disorders with complex genetic etiology. Recent studies have indicated that children with ASD may have altered folate or methionine metabolism, suggesting that the folate–methionine cycle may play a key role in the etiology of ASD. SLC19A1, also referred to as reduced folate carrier 1 (RFC1, is a member of the solute carrier group of transporters and is one of the key enzymes in the folate metabolism pathway. Findings from multiple genomic screens suggest the presence of an autism susceptibility locus on chromosome 21q22.3, which includes SLC19A1. Therefore, we performed a case-control study in a Japanese population. In this study, DNA samples obtained from 147 ASD patients at the Kanazawa University Hospital in Japan and 150 unrelated healthy Japanese volunteers were examined by the sequence-specific primer-polymerase chain reaction method pooled with fluorescence correlation spectroscopy. p < 0.05 was considered to represent a statistically significant outcome. Of 13 single nucleotide polymorphisms (SNPs examined, a significant p-value was obtained for AA genotype of one SNP (rs1023159, OR = 0.39, 95% CI = 0.16–0.91, p = 0.0394; Fisher’s exact test. Despite some conflicting results, our findings supported a role for the polymorphism rs1023159 of the SLC19A1 gene, alone or in combination, as a risk factor for ASD. However, the findings were not consistent after multiple testing corrections. In conclusion, although our results supported a role of the SLC19A1 gene in the etiology of ASD, it was not a significant risk factor for the ASD samples analyzed in this study.

  5. Salud pública, genética y ética

    Directory of Open Access Journals (Sweden)

    Kottow Miguel H

    2002-01-01

    Full Text Available La investigación genética ha tenido una enorme expansión en recientes décadas, con repercusiones terapéuticas aún inciertas. El análisis bioético tradicional de las complejas prácticas genéticas ha sido insuficiente por sostenerse en la ética de la investigación y en la bioética de corte principialista. Los problemas éticos más importantes de la genética son de orden colectivo y deben ser abordados por una reflexión ético-social cuyo enfoque es más amplio que la agenda interpersonal del principialismo. Temas como exploraciones genéticas, cuestiones patrimoniales, manipulación génica y asignación de recursos, deben todos ser sometidos a un pensamiento inspirado en los requerimientos de la ciudadanía, en el bien común y en la definición del rol del Estado en fiscalizar actividades genéticas y en proteger a la población. El objetivo del estudio es mostrar cómo el amplio campo de la ética y de la genética tiene una mayor relevancia en el campo social que en el clínico. El objetivo del trabajo es señalar que la bioética principialista ha enfatizado los problemas éticos individuales que nacen con la intervención genética, a costa de marginar sus importantes repercusiones sociales.

  6. Salud pública, genética y ética

    Directory of Open Access Journals (Sweden)

    Miguel H Kottow

    2002-10-01

    Full Text Available La investigación genética ha tenido una enorme expansión en recientes décadas, con repercusiones terapéuticas aún inciertas. El análisis bioético tradicional de las complejas prácticas genéticas ha sido insuficiente por sostenerse en la ética de la investigación y en la bioética de corte principialista. Los problemas éticos más importantes de la genética son de orden colectivo y deben ser abordados por una reflexión ético-social cuyo enfoque es más amplio que la agenda interpersonal del principialismo. Temas como exploraciones genéticas, cuestiones patrimoniales, manipulación génica y asignación de recursos, deben todos ser sometidos a un pensamiento inspirado en los requerimientos de la ciudadanía, en el bien común y en la definición del rol del Estado en fiscalizar actividades genéticas y en proteger a la población. El objetivo del estudio es mostrar cómo el amplio campo de la ética y de la genética tiene una mayor relevancia en el campo social que en el clínico. El objetivo del trabajo es señalar que la bioética principialista ha enfatizado los problemas éticos individuales que nacen con la intervención genética, a costa de marginar sus importantes repercusiones sociales.

  7. [The association of polymorphisms in SLC18A1, TPH1 and RELN genes with risk of paranoid schizophrenia].

    Science.gov (United States)

    Galaktionova, D Iu; Gareeva, A E; Khusnutdinova, E K; Nasedkina, T V

    2014-01-01

    We have developed a biochip for the analysis of polymorphisms in candidate genes for schizophrenia: DISC1, RELN, ZNF804A, PLXNA2, COMT, SLC18A41, CACNA1C, ANK3, TPH1, PLAA and SNAP-25. Using biochip the allele and genotype frequencies in 198 patients with schizophrenia and 192 healthy individuals have been obtained. For SLC18A1 polymorphism rs2270641 A>C, the frequencies of A allele (p = 0.007) and AA genotype (p = 0.002) were lower in patients compared with healthy individuals. A significant association was found between AA genotype (p = 0.036) of the TPH1 polymorphism rs1800532 C>A and schizophrenia. The C allele (p = 0.039) of the RELNpolymorphism rs7341475 C>T were lower in patients with schizophrenia compared with healthy individuals in a tatar population. Genotype AA of the TPH1 polymorphism rs1800532 C>A were more frequent in patients with schizophrenia compared with healthy individuals. Ithas been shown that the C allele (p = 0.0001) and GC (p = = 0.0001) genotype of the PLXNA2 polymorphism rs1327175 G>C are associated with the family history in patients with paranoid schizophrenia. The obtained data suggest that SLC18A1, TPH1 and RELN gene polymorphisms are associated with the risk of paranoid schizophrenia.

  8. Changes in oil content of transgenic soybeans expressing the yeast SLC1 gene.

    Science.gov (United States)

    Rao, Suryadevara S; Hildebrand, David

    2009-10-01

    The wild type (Wt) and mutant form of yeast (sphingolipid compensation) genes, SLC1 and SLC1-1, have been shown to have lysophosphatidic acid acyltransferase (LPAT) activities (Nageic et al. in J Biol Chem 269:22156-22163, 1993). Expression of these LPAT genes was reported to increase oil content in transgenic Arabidopsis and Brassica napus. It is of interest to determine if the TAG content increase would also be seen in soybeans. Therefore, the wild type SLC1 was expressed in soybean somatic embryos under the control of seed specific phaseolin promoter. Some transgenic somatic embryos and in both T2 and T3 transgenic seeds showed higher oil contents. Compared to controls, the average increase in triglyceride values went up by 1.5% in transgenic somatic embryos. A maximum of 3.2% increase in seed oil content was observed in a T3 line. Expression of the yeast Wt LPAT gene did not alter the fatty acid composition of the seed oil.

  9. Recent SLC developments

    International Nuclear Information System (INIS)

    Ross, M.

    1993-04-01

    The SLAC Linear Collider (SLC) is the forerunner of a new generation of high energy accelerators. As such, it incorporates many novel features that must be fully exploited to achieve optimum performance. In this paper we present an overview of the frontiers of collider performance at SLC. Recent developments have centered on polarization, intensity and emittance preservation issues. A polarized source and spin transport system were successfully commissioned in 1992 and operated with high reliability. Practical intensity limits associated with rapid growth ( S ) bunch length instabilities have been observed in the damping rings. Ring RF voltage manipulations are used to suppress the instabilities. Emittance preservation technique development has focused on controlling system-wide instabilities and improving feedback and tuning procedures. Control of instabilities of all time scales, pulse to pulse, fast and slow, is one of the most challenging aspects of the collider. The challenge is met with (1) very high level of control and automation required for general tuning and optimization, (2) real-time transport line optical correction and monitoring, (3) coupled, high level, trajectory and energy feedback, (4) high order multipole optical correction and monitoring, (5) feedback-based linac beam emittance preservation, and (6) interaction region luminosity optimization. The common thread beneath all of these is the SLC control system which must provide a level of control, diagnosis and feedback not required for simpler machines

  10. Frecuencia de algunas enfermedades genéticas en Neuropediatría

    Directory of Open Access Journals (Sweden)

    Tatiana Zaldívar Vaillant

    2012-12-01

    Full Text Available Introducción: las enfermedades neurológicas en Pediatría son diversas y obedecen a un gran número de causas: infecciosas, genéticas, metabólicas y degenerativas, entre otras. El diagnóstico genético, dentro del método clínico en Neurología, está relacionado con el diagnóstico etiológico. Existen muy pocas publicaciones que reflejen la frecuencia de las enfermedades neurogenéticas como grupo etiológico. Objetivo: describir la frecuencia de algunas enfermedades neuropediátricas en la Consulta de Neurogenética del Instituto de Neurología y Neurocirugía. Métodos: se realizó una investigación descriptiva y prospectiva en el periodo 2008-2010. Se clasificó a los pacientes por grupos etarios, y se calculó el porcentaje de frecuencia para la atrofia muscular espinal de la infancia, la distrofia muscular tipo Duchenne/Becker, las lesiones estáticas del sistema nervioso central de causa prenatal genética, y para la clasificación de los grupos según tipo de herencia. Resultados: el universo de estudio estuvo conformado por 161 pacientes, 72,6 % del sexo masculino, para una razón de la variable sexo de 2,5. Los escolares fueron mayoría (37,8 %, y la edad promedio 5 años. La distrofia muscular tipo Duchenne fue la enfermedad más frecuente (24,8 %. El 41,40 % clasificó en la herencia autosómica recesiva. Los resultados coinciden con lo reportado en la literatura. Conclusiones: las enfermedades neuromusculares hereditarias, y las lesiones estáticas del sistema nervioso central de causa prenatal genética, son las más frecuentes de solicitud de asesoramiento genético en un servicio de Neurogenética.

  11. Estudios genéticos en las comunidades indígenas del nororiente colombiano

    Directory of Open Access Journals (Sweden)

    Humberto Ossa

    1994-01-01

    Full Text Available Se presentan las frecuencias génicas de los grupos sanguíneos ABO, Rh, Kell, Duffy, Kidd, Diego y MNSs en las siete comunidades que viven en el nororiente columbiano (wayrl, Barf, Arhuaco, Yuco, Kogi, Arsario y Chimila. Además se presenta el índice de mezcla racial, con excepción de los Arsario, y algunos aspectos iniciales de las distancias genéticas, con excepción de los Arsario y los Chimila, sobre la base de cinco loci informativos. Las frecuencias génicas fueron obtenidas a partir de los genotipos deducidos a través de los arboles familiares. Geográficamente el nororiente colombiano se encuentra conformado por los departamentos de la Guajira, Magdalena, Cesar y Norte de Santander. En la península de la Guajira viven los Wayu; en la Sierra Nevada de Santa Marta habitan los Kogi, los Arhuaco y los Arsario, todos descendientes de los primitivos Taironas. En la Serranía del Perija encontramos los Yuco al norte y los Barf al sur y en el departamento del Magdalena encontramos los Chimila. Estos grupos indígenas fueron estudiados para siete sistemas genéticos polimórficos que comprenden 23 alelos y 18 especificidades serológicas: ABO(tres alelos,Rh (seisalelos, Kell (dos alelos,Duffy (tres alelos, Kidd (tres alelos,Diego (dos alelos y MNSs (cuatro alelos. EI estudio se adelanto utilizando anticuerpos policlonales y monoclonales y las técnicas de tipificación convencionales. Se realizaron quince visitas a las siete comunidades y se recolectaron 473 muestras sanguíneas distribuidas en 63 familias de dos, tres y cuatro generaciones. Se presentan los resultados para frecuencias de fenotipos y genotipos en las poblaciones estudiadas y los resultados del análisis del equilibrio de Hardy-Weinberg.

  12. Caracteres clínico-patológicos y perfil genético en el carcinoma colorrectal

    Directory of Open Access Journals (Sweden)

    Florencia Perazzo

    2013-10-01

    Full Text Available El cáncer colorrectal es el tercer cáncer más frecuente en hombres y el segundo más frecuente en mujeres, con una incidencia mundial aproximada de 1.2 millones de casos nuevos por año. Nuestro objetivo primario fue estudiar la relación existente entre las características clínico-histológicas en individuos con cáncer colorrectal y el estado mutacional de los codones 12 y 13 del gen KRAS (7 mutaciones validadas, con el fin de hallar un marcador histopatológico para los tumores mutados. El objetivo secundario fue determinar cuántos pacientes tenían mutaciones adicionales en los codones 15 y 61 del gen KRAS y 600 del gen BRAF que podrían modificar el fenotipo tumoral. Fueron seleccionados 60 individuos con cáncer colorrectal (30 wild-type y 30 con mutaciones validadas en los codones 12 y 13 del gen KRAS. Se amplificaron y secuenciaron del gen KRAS los exones 2 y 3, y del gen BRAF el exón 15. La información recolectada se examinó mediante un análisis descriptivo, análisis univariado y/o análisis multivariado, según correspondiese. En conclusión, no se encontró relación entre las características clínico-histológicas de los tumores de individuos con diagnóstico de cáncer colorrectal y el estado mutacional de los codones 12 y 13 del gen KRAS. No hallamos un marcador histopatológico para los tumores mutados. En pacientes con adenocarcinomas colorrectales avanzados y KRAS wild-type resulta de interés considerar el estudio del codón 600 del gen BRAF.

  13. Positive selection in the SLC11A1 gene in the family Equidae.

    Science.gov (United States)

    Bayerova, Zuzana; Janova, Eva; Matiasovic, Jan; Orlando, Ludovic; Horin, Petr

    2016-05-01

    Immunity-related genes are a suitable model for studying effects of selection at the genomic level. Some of them are highly conserved due to functional constraints and purifying selection, while others are variable and change quickly to cope with the variation of pathogens. The SLC11A1 gene encodes a transporter protein mediating antimicrobial activity of macrophages. Little is known about the patterns of selection shaping this gene during evolution. Although it is a typical evolutionarily conserved gene, functionally important polymorphisms associated with various diseases were identified in humans and other species. We analyzed the genomic organization, genetic variation, and evolution of the SLC11A1 gene in the family Equidae to identify patterns of selection within this important gene. Nucleotide SLC11A1 sequences were shown to be highly conserved in ten equid species, with more than 97 % sequence identity across the family. Single nucleotide polymorphisms (SNPs) were found in the coding and noncoding regions of the gene. Seven codon sites were identified to be under strong purifying selection. Codons located in three regions, including the glycosylated extracellular loop, were shown to be under diversifying selection. A 3-bp indel resulting in a deletion of the amino acid 321 in the predicted protein was observed in all horses, while it has been maintained in all other equid species. This codon comprised in an N-glycosylation site was found to be under positive selection. Interspecific variation in the presence of predicted N-glycosylation sites was observed.

  14. The role of SLC2A1 mutations in myoclonic astatic epilepsy and absence epilepsy, and the estimated frequency of GLUT1 deficiency syndrome

    DEFF Research Database (Denmark)

    Larsen, Jan; Johannesen, Katrine Marie; Ek, Jakob

    2015-01-01

    The first mutations identified in SLC2A1, encoding the glucose transporter type 1 (GLUT1) protein of the blood-brain barrier, were associated with severe epileptic encephalopathy. Recently, dominant SLC2A1 mutations were found in rare autosomal dominant families with various forms of epilepsy inc...

  15. Aproximación a la filogenia de Spodoptera (Lepidoptera: Noctuidae con el uso de un fragmento del gen de la citocromo oxidasa I (COI

    Directory of Open Access Journals (Sweden)

    Clara Inés Saldamando

    2012-09-01

    Full Text Available En este trabajo se secuenció un fragmento de 451pb del gen mitocondrial de la citocromo oxidasa I (COI en 62 secuencias del género Spodoptera y una secuencia de Bombix mori (grupo externo. Los resultados mostraron gran diferenciación genética (distancia K2 entre los haplotipos de Spodoptera frugiperda de Colombia y Estados Unidos, según los estimadores de diversidad haplotípica, diversidad y polimorfismo nucleotídicos calculados. Un árbol de ML agrupó las especies con valores de bootstrap entre 73-99% en las ramas internas. No obstante algunas ramas presentaron bajos valores de bootstrap. Este árbol formó un grupo constituido por las especies del hemisferio oriental (S. littoralis y S. litura y también agrupó las especies localizadas en el hemisferio occidental (S. androgea, S. dolichos, S. eridania, S. exigua, S. frugiperda, S. latifascia, S. ornithogalli y S. pulchella. Esto demuestra que el árbol agrupó las especies con base en su origen geográfico. Contrariamente, el árbol no agrupó a S. frugiperda con S. ornithogalli, demostrando que a pesar de que ambas coexisten en el cultivo de algodón, no comparten un ancestro común reciente. En Colombia, estas especies forman parte del “complejo Spodoptera” del algodón, y nuestros resultados demuestran que la secuenciación de este gen permite diferenciarlas sin necesidad del uso de claves taxonómicas de sus estadios larvales. Este trabajo es una aproximación a la filogenia de este género, por lo cual la inclusión de más genes (mitocondriales y nucleares son necesarios para futuros trabajos.

  16. La expresión del promotor del gen ahybadh4 en plantas transgénicas de Arabidopsis thaliana es específica en la raíz

    OpenAIRE

    Onofre, J; Legaria, J.P.; Avonce, Nelson; Iturriaga, G.

    2003-01-01

    La glicina betaína es uno de los solutos compatibles con el metabolismo más eficiente. En las plantas, la biosíntesis de la glicina betaína se lleva a cabo en dos pasos enzimáticos. Primero se oxida el sustrato colina a betaína aldehído por medio de la colina monooxigenasa (CMO); el segundo paso es catalizado por una betaína aldehído deshidrogenasa (BADH) que convierte la betaína aldehído a glicina betaína. Estudios previos mostraron que la transcripción del gen ahybadh17, que codifica para l...

  17. Molecular Properties of Drugs Interacting with SLC22 Transporters OAT1, OAT3, OCT1, and OCT2: A Machine-Learning Approach.

    Science.gov (United States)

    Liu, Henry C; Goldenberg, Anne; Chen, Yuchen; Lun, Christina; Wu, Wei; Bush, Kevin T; Balac, Natasha; Rodriguez, Paul; Abagyan, Ruben; Nigam, Sanjay K

    2016-10-01

    Statistical analysis was performed on physicochemical descriptors of ∼250 drugs known to interact with one or more SLC22 "drug" transporters (i.e., SLC22A6 or OAT1, SLC22A8 or OAT3, SLC22A1 or OCT1, and SLC22A2 or OCT2), followed by application of machine-learning methods and wet laboratory testing of novel predictions. In addition to molecular charge, organic anion transporters (OATs) were found to prefer interacting with planar structures, whereas organic cation transporters (OCTs) interact with more three-dimensional structures (i.e., greater SP3 character). Moreover, compared with OAT1 ligands, OAT3 ligands possess more acyclic tetravalent bonds and have a more zwitterionic/cationic character. In contrast, OCT1 and OCT2 ligands were not clearly distinquishable form one another by the methods employed. Multiple pharmacophore models were generated on the basis of the drugs and, consistent with the machine-learning analyses, one unique pharmacophore created from ligands of OAT3 possessed cationic properties similar to OCT ligands; this was confirmed by quantitative atomic property field analysis. Virtual screening with this pharmacophore, followed by transport assays, identified several cationic drugs that selectively interact with OAT3 but not OAT1. Although the present analysis may be somewhat limited by the need to rely largely on inhibition data for modeling, wet laboratory/in vitro transport studies, as well as analysis of drug/metabolite handling in Oat and Oct knockout animals, support the general validity of the approach-which can also be applied to other SLC and ATP binding cassette drug transporters. This may make it possible to predict the molecular properties of a drug or metabolite necessary for interaction with the transporter(s), thereby enabling better prediction of drug-drug interactions and drug-metabolite interactions. Furthermore, understanding the overlapping specificities of OATs and OCTs in the context of dynamic transporter tissue

  18. Performance of a commercial assay for the diagnosis of influenza A (H1N1 infection in comparison to the Centers for Disease Control and Prevention protocol of real time RT-PCR

    Directory of Open Access Journals (Sweden)

    María G Barbás

    2012-03-01

    Full Text Available At the time of influenza A (H1N1 emergency, the WHO responded with remarkable speed by releasing guidelines and a protocol for a real-time RT-PCR assay (rRT-PCR. The aim of the present study was to evalúate the performance of the "Real Time Ready Influenza A/H1N1 Detection Set" (June 2009-Roche kit in comparison to the CDC reference rRT-PCR protocol. The overall sensitivity of the Roche assay for detection of the Inf A gene in the presence or absence of the H1 gene was 74.5 %. The sensitivity for detecting samples that were only positive for the Inf A gene (absence of the H1 gene was 53.3 % whereas the sensitivity for H1N1-positive samples (presence of the Inf A gene and any other swine gene was 76.4 %. The specificity of the assay was 97.1 %. A new version of the kit (November 2009 is now available, and a recent evaluation of its performance showed good sensitivity to detect pandemic H1N1 compared to other molecular assays.Durante la pandemia de influenza A (H1N1, la OMS recomendó algoritmos y protocolos de detección del virus mediante RT-PCR en tiempo real. El objetivo del presente estudio fue evaluar el desempeño del equipo que comercializa la empresa Roche, Real Time Ready Influenza A/H1N1 Detection Set (junio de 2009, en comparación con el protocolo de RT-PCR en tiempo real de los CDC. La sensibilidad global del ensayo de Roche para la detección del gen Inf A en presencia o ausencia del gen H1 fue 74,5 %. La sensibilidad para la detección de muestras positivas solo para el gen Inf A (ausencia del gen H1 fue 53,3 % y la sensibilidad para la detección de muestras positivas para H1N1 (presencia del gen Inf A y cualquier otro gen porcino fue 76,4 %. La especificidad fue 97,1 %. Existe una nueva versión del equipo (noviembre 2009 que, según se ha descrito, presenta buena sensibilidad en comparación con otros ensayos moleculares para detectar H1N1 pandémica.

  19. KONSUMSI MIKRONUTRIEN DAN EKSPRESI GEN eNOS3 ALEL INTRO 4a4b PADA PENDERITA HIPERTENSI ETNIK MINANGKABAU

    Directory of Open Access Journals (Sweden)

    Delmi Sulastri

    2011-05-01

    Full Text Available AbstrakGen eNOS3 varian intron 4a4b merupakan salah satu gen yang berhubungan dengan kejadian hipertensi esensial. Kemampuan Gen eNOS3 varian ini untuk mensintesis enzim nitric oxide synthase (NOS berkurang sehingga sintesis Nitric oxide (NO menurun. Senyawa NO adalah suatu senyawa vasoaktif yang menyebabkan vasodilatasi pembuluh darah.Penelitian pada subjek hipertensi dan normotensi berusia 30-65 tahun bertujuan untuk melihat pengaruh mikronutrien terhadap ekspresi gen eNOS3 alel intron 4a4b. 130 subjek, diwawancara pola makannya lalu dilakukan analisis asupan mikronutrien, gen eNOS3, serta kadar NO plasma. Data yang diperoleh dianalisis menggunakan uji T dan chi-square.Kadar NO plasma penderita hipertensi adalah 26.91 + 15.40 μM/L dan normotensi 25.79 + 15.04 μM/L. 55.5% subjek hipertensi memiliki gen eNOS3 varian intron 4b dan 69% subjek normotensi mempunyai varian intron 4a4b. Kadar NO plasma rendah, (66.7% ditemukan pada subjek hipertensi dengan varian intron 4b. Tidak terdapat hubungan bermakna asupan mikronutrien dengan kadar NO plasma pada subjek hipertensi.Hasil ini tidak mendukung pengaruh konsumsi mikronutrien terhadap kadar NO plasma pada penderita hipertensi dengan gen eNOS3 varian intron 4a4b.Kata Kunci : hipertensi esensial, gen eNOS3, kadar NO plasmaAbstracteNOS 3 gene intron 4a4b allel is one of the important genes which is related to hypertesion essensial. This gene expresses the nitric oxide synthase (NOS enzyme which regulates the synthesis of Nitric oxide (NO in human body. NO causes vasodilatation, which decreases peripheral resistant and blood pressure.A research has been done based on cross sectional study on hypertension patients and those with normal blood pressure in the range of 30-65 years old. The main of this research is to evaluate the influence of micronutrient consumption on eNOS3 gene intron 4a4b allel expression in hypertension subjects in Minangkabau ethnicity. 130 subjects interviewed about micronutrient

  20. Additive composite ABCG2, SLC2A9 and SLC22A12 scores of high-risk alleles with alcohol use modulate gout risk.

    Science.gov (United States)

    Tu, Hung-Pin; Chung, Chia-Min; Min-Shan Ko, Albert; Lee, Su-Shin; Lai, Han-Ming; Lee, Chien-Hung; Huang, Chung-Ming; Liu, Chiu-Shong; Ko, Ying-Chin

    2016-09-01

    The aim of the present study was to evaluate the contribution of urate transporter genes and alcohol use to the risk of gout/tophi. Eight variants of ABCG2, SLC2A9, SLC22A12, SLC22A11 and SLC17A3 were genotyped in male individuals in a case-control study with 157 gout (33% tophi), 106 asymptomatic hyperuricaemia and 295 control subjects from Taiwan. The multilocus profiles of the genetic risk scores for urate gene variants were used to evaluate the risk of asymptomatic hyperuricaemia, gout and tophi. ABCG2 Q141K (T), SLC2A9 rs1014290 (A) and SLC22A12 rs475688 (C) under an additive model and alcohol use independently predicted the risk of gout (respective odds ratio for each factor=2.48, 2.03, 1.95 and 2.48). The additive composite Q141K, rs1014290 and rs475688 scores of high-risk alleles were associated with gout risk (Pgout and tophi risk (P for interaction=0.0452, 0.0033). The synergistic effect of genetic urate score 5-6 and alcohol use indicates that these combined factors correlate with gout and tophi occurrence.

  1. Alternative transcription of sodium/bicarbonate transporter SLC4A7 gene enhanced by single nucleotide polymorphisms.

    Science.gov (United States)

    Park, Hae Jeong; Lee, Soojung; Ju, Eunji; Jones, Jayre A; Choi, Inyeong

    2017-03-01

    Genome-wide association studies have identified the single nucleotide polymorphism (SNP) rs3278 in the human SLC4A7 gene as one of the marker loci for addiction vulnerability. This marker is located in an intron of the gene, and its genomic role has been unknown. In this study, we examined rs3278 and three adjacent SNPs prevalent in alcoholics for their effects on an alternative promoter that would lead to the production of the NH 2 -terminally truncated protein NBCn1ΔN450, missing the first 450 amino acids. Analysis of the transcription start site database and a promoter prediction algorithm identified a cluster of three promoters in intron 7 and two short CpG-rich sites in intron 6. The promoter closest to rs3278 showed strong transcription activity in luciferase reporter gene assays. Major-to-minor allele substitution at rs3278 resulted in increased transcription activity. Equivalent substitutions at adjacent rs3772723 (intron 7) and rs13077400 (exon 8) had negligible effect; however, the substitution at nonsynonymous rs3755652 (exon 8) increased the activity by more than twofold. The concomitant substitution at rs3278/rs3755652 produced an additive effect. The rs3755652 had more profound effects on the promoter than the upstream regulatory CpG sites. The amino acid change E326K caused by rs3755652 had negligible effect on transporter function. In HEK 293 cells, NBCn1ΔN450 was expressed in plasma membranes, but at significantly lower levels than the nontruncated NBCn1-E. The pH change mediated by NBCn1ΔN450 was also low. We conclude that rs3278 and rs3755652 stimulate an alternative transcription of the SLC4A7 gene, increasing the production of a defective transporter. Copyright © 2017 the American Physiological Society.

  2. SLC30A9 mutation affecting intracellular zinc homeostasis causes a novel cerebro-renal syndrome.

    Science.gov (United States)

    Perez, Yonatan; Shorer, Zamir; Liani-Leibson, Keren; Chabosseau, Pauline; Kadir, Rotem; Volodarsky, Michael; Halperin, Daniel; Barber-Zucker, Shiran; Shalev, Hanna; Schreiber, Ruth; Gradstein, Libe; Gurevich, Evgenia; Zarivach, Raz; Rutter, Guy A; Landau, Daniel; Birk, Ohad S

    2017-04-01

    A novel autosomal recessive cerebro-renal syndrome was identified in consanguineous Bedouin kindred: neurological deterioration was evident as of early age, progressing into severe intellectual disability, profound ataxia, camptocormia and oculomotor apraxia. Brain MRI was normal. Four of the six affected individuals also had early-onset nephropathy with features of tubulo-interstitial nephritis, hypertension and tendency for hyperkalemia, though none had rapid deterioration of renal function. Genome wide linkage analysis identified an ∼18 Mb disease-associated locus on chromosome 4 (maximal logarithm of odds score 4.4 at D4S2971; θ = 0). Whole exome sequencing identified a single mutation in SLC30A9 within this locus, segregating as expected within the kindred and not found in a homozygous state in 300 Bedouin controls. We showed that SLC30A9 (solute carrier family 30 member 9; also known as ZnT-9) is ubiquitously expressed with high levels in cerebellum, skeletal muscle, thymus and kidney. Confocal analysis of SH-SY5Y cells overexpressing SLC30A9 fused to enhanced green fluorescent protein demonstrated vesicular cytosolic localization associated with the endoplasmic reticulum, not co-localizing with endosomal or Golgi markers. SLC30A9 encodes a putative zinc transporter (by similarity) previously associated with Wnt signalling. However, using dual-luciferase reporter assay in SH-SY5Y cells we showed that Wnt signalling was not affected by the mutation. Based on protein modelling, the identified mutation is expected to affect SLC30A9's highly conserved cation efflux domain, putatively disrupting its transmembrane helix structure. Cytosolic Zn2+ measurements in HEK293 cells overexpressing wild-type and mutant SLC30A9 showed lower zinc concentration within mutant rather than wild-type SLC30A9 cells. This suggests that SLC30A9 has zinc transport properties affecting intracellular zinc homeostasis, and that the molecular mechanism of the disease is through

  3. Factores genéticos en casos graves de gripe (H1N1 2009

    Directory of Open Access Journals (Sweden)

    Francesc Calafell i Majó

    2011-01-01

    Full Text Available La pandemia de gripe (H1N1 2009 generó una serie de cuestiones, entre las cuales estuvo que entre un 25 y un 30% de los casos graves de gripe no presentaron ningún factor de riesgo obvio. Hipotetizamos que un elemento que puede contribuir a la respuesta son factores de riesgo gené ticos del huésped involucrados en la mala progresió n de la enfermedad. Varios indicios nos llevaron a esta hipótesis: estudios de agregación familiar en islandeses y mormones de Utah muestran una cierta heredabilidad de la mortalidad por gripe; se conocen casi 300 genes humanos necesarios para la replicació n del virus de la gripe; y los pacientes más graves de gripe (H1N12009 mostraron una desregulació n del sistema inmune adaptativo. Estamos abordando este problema mediante un diseñ o caso-control (casos hospitalizados de gripe (H1N12009 confirmados contra casos ambulatorios, tambié n confirmados para (H1N12009, en el que se genotiparán más de un milló n de polimorfismos de cambios de nucleó tido (SNPs y de variació n de número de copia (CNVs en casos y controles.

  4. Lessons from the SLC for future LC control systems

    International Nuclear Information System (INIS)

    Humphrey, R.

    1992-01-01

    The SLC control system is the dynamic result of a number of forces. The most obvious force is the functional requirements of the SLC itself, but other forces are history, budget, people, available technology, etc. The plan of this paper is to describe the critical functional requirements of the SLC which caused significant development of the control system. I have tried to focus on functional requirements as a driver, and I will describe some solutions which we have implemented to satisfy those requirements. The important functional requirements drivers for the control system discussed in this paper are: (1) Repetition rate, (2) Sensitivity to orbit distortion, (3) Stability/Automation, (4) Accelerator Development. (author)

  5. Manipulación genética y el estudio del parásito protozoario Leishmania.

    Directory of Open Access Journals (Sweden)

    Tania M. Cortázar

    2004-12-01

    Full Text Available Durante los últimos 15 años se ha dado paso al entendimiento de muchos aspectos de la genómica funcional de Leishmania gracias a los avances en la metodología de transfección de ADN dentro de la célula de este protozoario, la eliminación y la complementación de genes por medio de recombinación homóloga y las estrategias para la selección de células transfectadas. Estos acercamientos tienen el potencial de brindar información sobre la expresión génica y la función de las proteínas en el contexto del parásito intacto. Dado que el genoma de Leishmania muestra una carencia acentuada de los factores conocidos de iniciación de la transcripción y que la expresión génica está regulada casi completamente a nivel postranscripcional (a través del empalme de los ARNm y los mecanismos que involucran el procesamiento diferencial de la región no traducida 3' del ARNm (3?UTR, la transfección génica representa una herramienta útil para la identificación y el análisis funcional de los genes de interés así como de los mecanismos que dirigen su regulación. El desarrollo de los sistemas de manipulación genética también ha abierto nuevos horizontes para la identificación de genes esenciales involucrados en la virulencia, la supervivencia intracelular y la resistencia a drogas de Leishmania, así como para la validación de proteínas específicas del parásito como nuevos blancos quimio e inmunoterapéuticos. En esta revisión presentamos los avances más recientes en el campo de la manipulación genética en Leishmania, los cuales permiten análisis estructurales, funcionales y de fenotipo, por medio de la eliminación y complementación génica a través de la transfección transitoria o permanente de genes en este parásito.

  6. Asociación entre el polimorfismo genético de la apolipoproteína E (ApoE y la enfermedad de Parkinson

    Directory of Open Access Journals (Sweden)

    Victoria Marca

    2013-07-01

    Full Text Available Introducción: En nuestro país, con el incremento en la esperanza de vida, existe una tendencia creciente de enfermedades neurodegenerativas, por lo que se hace necesario realizar estudios sobre factores de riesgo genético en personas afectadas con la enfermedad de Parkinson (EP, entre ellos el gen de la apolipoproteína E (ApoE, ya que esta asociación es desconocida en nuestra población. Objetivo: Determinar la asociación del polimorfismo en el gen ApoE con la EP. Diseño: Estudio asociativo, observacional tipo casos y controles. Lugar: Instituto Nacional de Ciencias Neurológicas, Lima, Perú. Participantes: Personas de ambos sexos, 163 pacientes con la EP y 176 controles. Intervenciones: Extracción de ADN genómico según metodología estándar. Análisis del gen APOE mediante técnica PCR-RFLP. Principales medidas de resultados: Frecuencias genotípicas y alélicas del gen ApoE en los casos y controles, medidas de asociación y de riesgo. Resultados: No se encontró diferencias significativas entre el grupo control y los pacientes según genotipo de ApoE. La frecuencia del alelo ε4 fue similar en pacientes y en controles. El odds ratio para el alelo ε4 de la ApoE fue 1,0852 (IC 95%: 0,5812 a 2,0266. La edad de inicio de la EP no tuvo relaciσn con los genotipos ApoE. Conclusiones: El alelo ε4 de la ApoE no podrνa ser considerado un factor de riesgo para la EP, y los genotipos de la ApoE no se asociaron con la edad de inicio en esta muestra evaluada.

  7. Veinte años del Régimen Andino de Acceso a Recursos Genéticos

    Directory of Open Access Journals (Sweden)

    Mónica Ribadeneira Sarmiento

    2017-05-01

    Full Text Available El artículo buscar contribuir al conocimiento del régimen legal andino de acceso a recursos genéticos, cuyo instrumento central es la Decisión Andina 391, promulgada en 1996. Se analiza la norma y se presentan sus más evidentes virtudes y limitaciones. Se incluye información sobre la evolución nacional de la decisión en cada uno de los países andinos. El artículo contiene un apartado referido al futuro de la norma en el actual escenario de reingeniería del Sistema Andino de Integración (SAI. Se han consultado documentos, fuentes oficiales, artículos de expertos y entrevistas. El artículo se estructura de la siguiente manera: los orígenes de la norma; el análisis y contenido de la norma andina; el proceso de reglamentación en los países andinos; las virtudes y limitaciones; la coyuntura y el futuro, y, por último, las conclusiones.

  8. A common SLC26A4-linked haplotype underlying non-syndromic hearing loss with enlargement of the vestibular aqueduct

    DEFF Research Database (Denmark)

    Chattaraj, Parna; Munjal, Tina; Honda, Keiji

    2017-01-01

    BACKGROUND: Enlargement of the vestibular aqueduct (EVA) is the most common radiological abnormality in children with sensorineural hearing loss. Mutations in coding regions and splice sites of the SLC26A4 gene are often detected in Caucasians with EVA. Approximately one-fourth of patients with E...

  9. Estructura genética del copépodo Acartia lilljeborgii en la costa del estado de Yucatán, México

    OpenAIRE

    Jorge Tello-Cetina; Lucia Gómez-Victoria; Roberto Zamora-Bustillos; Gerardo Rivera-Muñoz; Sara Solis-Pereira; Herbert Loria-Sunza

    2013-01-01

    Se determinó la estructura genética poblacional y sus implicancias dentro de la cadena trófica del copépodo Acartia lilljeborgii en la costa de Yucatán, mediante el uso de isoenzimas y su posterior determinación por electroforesis. Nueve sistemas se expresaron con un máximo de 30 loci. El polimorfismo y heterocigosis de las poblaciones estudiadas, al ser comparados con otras especies de copépodos, resultaron ser bajos y de los cuatro loci que presentaron variación, solo los loci EST2 y PGM1 s...

  10. Genetic polymorphisms and haplotypes of the organic cation transporter 1 gene (SLC22A1 in the Xhosa population of South Africa

    Directory of Open Access Journals (Sweden)

    Clifford Jacobs

    2014-06-01

    Full Text Available Human organic cation transporter 1 is primarily expressed in hepatocytes and mediates the electrogenic transport of various endogenous and exogenous compounds, including clinically important drugs. Genetic polymorphisms in the gene coding for human organic cation transporter 1, SLC22A1, are increasingly being recognized as a possible mechanism explaining the variable response to clinical drugs, which are substrates for this transporter. The genotypic and allelic distributions of 19 nonsynonymous and one intronic SLC22A1 single nucleotide polymorphisms were determined in 148 healthy Xhosa participants from South Africa, using a SNAPshot® multiplex assay. In addition, haplotype structure for SLC22A1 was inferred from the genotypic data. The minor allele frequencies for S14F (rs34447885, P341L (rs2282143, V519F (rs78899680, and the intronic variant rs622342 were 1.7%, 8.4%, 3.0%, and 21.6%, respectively. None of the participants carried the variant allele for R61C (rs12208357, C88R (rs55918055, S189L (rs34104736, G220V (rs36103319, P283L (rs4646277, R287G (rs4646278, G401S (rs34130495, M440I (rs35956182, or G465R (rs34059508. In addition, no variant alleles were observed for A306T (COSM164365, A413V (rs144322387, M420V (rs142448543, I421F (rs139512541, C436F (rs139512541, V501E (rs143175763, or I542V (rs137928512 in the population. Eight haplotypes were inferred from the genotypic data. This study reports important genetic data that could be useful for future pharmacogenetic studies of drug transporters in the indigenous Sub-Saharan African populations.

  11. A 40-bp VNTR polymorphism in the 3'-untranslated region of DAT1/SLC6A3 is associated with ADHD but not with alcoholism.

    Science.gov (United States)

    Šerý, Omar; Paclt, Ivo; Drtílková, Ivana; Theiner, Pavel; Kopečková, Marta; Zvolský, Petr; Balcar, Vladimir J

    2015-06-11

    ADHD and alcoholism are psychiatric diseases with pathophysiology related to dopamine system. DAT1 belongs to the SLC6 family of transporters and is involved in the regulation of extracellular dopamine levels. A 40 bp variable number tandem repeat (VNTR) polymorphism in the 3'-untranslated region of DAT1/SLC6A3 gene was previously reported to be associated with various phenotypes involving disturbed regulation of dopaminergic neurotransmission. A total of 1312 subjects were included and genotyped for 40 bp VNTR polymorphism of DAT1/SLC6A3 gene in this study (441 alcoholics, 400 non-alcoholic controls, 218 ADHD children and 253 non ADHD children). Using miRBase software, we have performed a computer analysis of VNTR part of DAT1 gene for presence of miRNA binding sites. We have found significant relationships between ADHD and the 40 bp VNTR polymorphisms of DAT1/SLC6A3 gene (P VNTR polymorphism of DAT1/SLC6A3 gene has been detected. We have found an association between 40 bp VNTR polymorphism of DAT1/SLC6A3 gene and ADHD in the Czech population; in a broad agreement with studies in other population samples. Furthermore, we detected rare genotypes 8/10, 7/10 and 10/11 present in ADHD boys only and identified miRNAs that should be looked at as potential novel targets in the research on ADHD.

  12. Polimorfismo VAL158MET del gen Catecol-O-Metiltransferasa y características clínicas en primeros episodios de psicosis

    OpenAIRE

    Pelayo Terán, José María

    2011-01-01

    RESUMEN: La esquizofrenia está considerada un síndrome clínico heterogéneo con una etiopatogenia de origen multifactorial, en el que se incluyen factores ambientales, caracteriales y genéticos. A pesar de que más del 50% de la variabilidad de la enfermedad se puede deber a uno o varios factores genéticos, sólo un número limitado de variantes de riesgo genético y con un efecto muy débil han podido ser identificados. Muchos de ellos no han podido reproducirse tanto por la diversidad de las mues...

  13. Association of SLC11A1 gene polymorphism with caprine ...

    Indian Academy of Sciences (India)

    Navya

    2017-01-16

    Jan 16, 2017 ... RESEARCH ARTICLE. Evaluation of the ..... Nramp2 (Slc11a2) expressed at the plasma membrane. Blood, 102 ... Received 21 November 2016, in final revised form 11 January 2017; accepted 12 January 2017. Unedited ...

  14. Frecuencia de las mutaciones más comunes del gen CFTR en pacientes peruanos con fibrosis quística mediante la técnica ARMS-PCR

    OpenAIRE

    Aquino, Ruth; Protzel, Ana; Rivera, Juan; Abarca, Hugo; Dueñas, Milagros; Nestarez, Cecilia; Purizaga, Nestor; Diringer, Benoit

    2017-01-01

    Objetivos. Determinar la frecuencia de las diez mutaciones más comúnmente reportadas en América Latina del gen CFTR mediante Sistema de Mutación Refractario a la amplificación por PCR (ARMS-PCR) en los pacientes con fibrosis quística (FQ) de dos instituciones hospitalarias de referencia en el Perú durante el año 2014. Materiales y métodos. Se evaluó la frecuencia de las diez comúnmente reportadas más comúnmente reportadas del gen CFTR en los pacientes del Hospital Nacional Edgardo Rebagliati ...

  15. Partial deletion of the sulfate transporter SLC13A1 is associated with an osteochondrodysplasia in the Miniature Poodle breed.

    Directory of Open Access Journals (Sweden)

    Mark W Neff

    Full Text Available A crippling dwarfism was first described in the Miniature Poodle in Great Britain in 1956. Here, we resolve the genetic basis of this recessively inherited disorder. A case-control analysis (8:8 of genotype data from 173 k SNPs revealed a single associated locus on CFA14 (P(raw <10(-8. All affected dogs were homozygous for an ancestral haplotype consistent with a founder effect and an identical-by-descent mutation. Systematic failure of nine, nearly contiguous SNPs, was observed solely in affected dogs, suggesting a deletion was the causal mutation. A 130-kb deletion was confirmed both by fluorescence in situ hybridization (FISH analysis and by cloning the physical breakpoints. The mutation was perfectly associated in all cases and obligate heterozygotes. The deletion ablated all but the first exon of SLC13A1, a sodium/sulfate symporter responsible for regulating serum levels of inorganic sulfate. Our results corroborate earlier findings from an Slc13a1 mouse knockout, which resulted in hyposulfatemia and syndromic defects. Interestingly, the metabolic disorder in Miniature Poodles appears to share more clinical signs with a spectrum of human disorders caused by SLC26A2 than with the mouse Slc13a1 model. SLC26A2 is the primary sodium-independent sulfate transporter in cartilage and bone and is important for the sulfation of proteoglycans such as aggregan. We propose that disruption of SLC13A1 in the dog similarly causes undersulfation of proteoglycans in the extracellular matrix (ECM, which impacts the conversion of cartilage to bone. A co-dominant DNA test of the deletion was developed to enable breeders to avoid producing affected dogs and to selectively eliminate the mutation from the gene pool.

  16. The Human SLC25A33 and SLC25A36 Genes of Solute Carrier Family 25 Encode Two Mitochondrial Pyrimidine Nucleotide Transporters*

    Science.gov (United States)

    Di Noia, Maria Antonietta; Todisco, Simona; Cirigliano, Angela; Rinaldi, Teresa; Agrimi, Gennaro; Iacobazzi, Vito; Palmieri, Ferdinando

    2014-01-01

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport inorganic anions, amino acids, carboxylates, nucleotides, and coenzymes across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. Here two members of this family, SLC25A33 and SLC25A36, have been thoroughly characterized biochemically. These proteins were overexpressed in bacteria and reconstituted in phospholipid vesicles. Their transport properties and kinetic parameters demonstrate that SLC25A33 transports uracil, thymine, and cytosine (deoxy)nucleoside di- and triphosphates by an antiport mechanism and SLC25A36 cytosine and uracil (deoxy)nucleoside mono-, di-, and triphosphates by uniport and antiport. Both carriers also transported guanine but not adenine (deoxy)nucleotides. Transport catalyzed by both carriers was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. In confirmation of their identity (i) SLC25A33 and SLC25A36 were found to be targeted to mitochondria and (ii) the phenotypes of Saccharomyces cerevisiae cells lacking RIM2, the gene encoding the well characterized yeast mitochondrial pyrimidine nucleotide carrier, were overcome by expressing SLC25A33 or SLC25A36 in these cells. The main physiological role of SLC25A33 and SLC25A36 is to import/export pyrimidine nucleotides into and from mitochondria, i.e. to accomplish transport steps essential for mitochondrial DNA and RNA synthesis and breakdown. PMID:25320081

  17. Estradiol-induced regulation of GLUT4 in 3T3-L1 cells: involvement of ESR1 and AKT activation.

    Science.gov (United States)

    Campello, Raquel S; Fátima, Luciana A; Barreto-Andrade, João Nilton; Lucas, Thais F; Mori, Rosana C; Porto, Catarina S; Machado, Ubiratan F

    2017-10-01

    Impaired insulin-stimulated glucose uptake involves reduced expression of the GLUT4 (solute carrier family 2 facilitated glucose transporter member 4, SLC2A4 gene). 17β-estradiol (E 2 ) modulates SLC2A4 /GLUT4 expression, but the involved mechanisms are unclear. Although E 2 exerts biological effects by binding to estrogen receptors 1/2 (ESR1/2), which are nuclear transcriptional factors; extranuclear effects have also been proposed. We hypothesize that E 2 regulates GLUT4 through an extranuclear ESR1 mechanism. Thus, we investigated the effects of E 2 upon (1) subcellular distribution of ESRs and the proto-oncogene tyrosine-protein kinases (SRC) involvement; (2) serine/threonine-protein kinase (AKT) activation; (3) Slc2a4 /GLUT4 expression and (4) GLUT4 subcellular distribution and glucose uptake in 3T3-L1 adipocytes. Differentiated 3T3-L1 adipocytes were cultivated or not with E 2 for 24 h, and additionally treated or not with ESR1-selective agonist (PPT), ESR1-selective antagonist (MPP) or selective SRC inhibitor (PP2). Subcellular distribution of ESR1, ESR2 and GLUT4 was analyzed by immunocytochemistry; Slc2a4 mRNA and GLUT4 were quantified by qPCR and Western blotting, respectively; plasma membrane GLUT4 translocation and glucose uptake were analyzed under insulin stimulus for 20 min or not. E 2 induced (1) translocation of ESR1, but not of ESR2, from nucleus to plasma membrane and AKT phosphorylation, effects mimicked by PPT and blocked by MPP and PP2; (2) increased Slc2a4 /GLUT4 expression and (3) increased insulin-stimulated GLUT4 translocation and glucose uptake. In conclusion, E 2 treatment promoted a SRC-mediated nucleus-plasma membrane shuttle of ESR1, and increased AKT phosphorylation, Slc2a4 /GLUT4 expression and plasma membrane GLUT4 translocation; consequently, improving insulin-stimulated glucose uptake. These results unravel mechanisms through which estrogen improves insulin sensitivity. © 2017 Society for Endocrinology.

  18. Feedback systems in the SLC

    International Nuclear Information System (INIS)

    Thompson, K.A.; Jobe, R.K.; Johnson, R.; Phinney, N.

    1987-02-01

    Two classes of computer-controlled feedback have been implemented to stabilize parameters in subsystems of the SLC: (1) ''slow'' (time scales ∼ minutes) feedback, and (2) ''fast'', i.e., pulse-to-pulse, feedback. The slow loops run in a single FEEDBACK process in the SLC host VAX, which acquires signals and sets control parameters via communication with the database and the network of normal SLC microprocessors. Slow loops exist to stabilize beam energy and energy spread, beam position and angle, and timing of kicker magnets, and to compensate for changes in the phase length of the rf drive line. The fast loops run in dedicated microprocessors, and may sample and/or feedback on particular parameters as often as every pulse of the SLC beam. The first implementations of fast feedback are to control transverse beam blow-up and to stabilize the energy and energy spread of bunches going into the SLC arcs. The overall architecture of the feedback software and the operator interface for controlling loops are discussed

  19. SLC2A9 is a high-capacity urate transporter in humans.

    Directory of Open Access Journals (Sweden)

    Mark J Caulfield

    2008-10-01

    ] 0.9 to 1.05, p > 0.33 by meta-analysis of an SLC2A9 variant in six case-control studies including 11,897 participants. In a separate meta-analysis of four population studies including 11,629 participants we found no association of SLC2A9 with systolic (effect size -0.12 mm Hg, 95% CI -0.68 to 0.43, p = 0.664 or diastolic blood pressure (effect size -0.03 mm Hg, 95% CI -0.39 to 0.31, p = 0.82.This study provides evidence that SLC2A9 splice variants act as high-capacity urate transporters and is one of the first functional characterisations of findings from genome-wide association scans. We did not find an association of the SLC2A9 gene with blood pressure in this study. Our findings suggest potential pathogenic mechanisms that could offer a new drug target for gout.

  20. Two novel mutations in the SLC40A1 and HFE genes implicated in iron overload in a Spanish man.

    Science.gov (United States)

    Del-Castillo-Rueda, Alejandro; Moreno-Carralero, María-Isabel; Alvarez-Sala-Walther, Luis-Antonio; Cuadrado-Grande, Nuria; Enríquez-de-Salamanca, Rafael; Méndez, Manuel; Morán-Jiménez, María-Josefa

    2011-03-01

    The most common form of hemochromatosis is caused by mutations in the HFE gene. Rare forms of the disease are caused by mutations in other genes. We present a patient with hyperferritinemia and iron overload, and facial flushing. Magnetic resonance imaging was performed to measure hepatic iron overload, and a molecular study of the genes involved in iron metabolism was undertaken. The iron overload was similar to that observed in HFE hemochromatosis, and the patient was double heterozygous for two novel mutations, c.-20G>A and c.718A>G (p.K240E), in the HFE and ferroportin (FPN1 or SLC40A1) genes, respectively. Hyperferritinemia and facial flushing improved after phlebotomy. Two of the patient's children were also studied, and the daughter was heterozygous for the mutation in the SLC40A1 gene, although she did not have hyperferritinemia. The patient presented a mild iron overload phenotype probably because of the two novel mutations in the HFE and SLC40A1 genes. © 2011 John Wiley & Sons A/S.

  1. The human SLC25A33 and SLC25A36 genes of solute carrier family 25 encode two mitochondrial pyrimidine nucleotide transporters.

    Science.gov (United States)

    Di Noia, Maria Antonietta; Todisco, Simona; Cirigliano, Angela; Rinaldi, Teresa; Agrimi, Gennaro; Iacobazzi, Vito; Palmieri, Ferdinando

    2014-11-28

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport inorganic anions, amino acids, carboxylates, nucleotides, and coenzymes across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. Here two members of this family, SLC25A33 and SLC25A36, have been thoroughly characterized biochemically. These proteins were overexpressed in bacteria and reconstituted in phospholipid vesicles. Their transport properties and kinetic parameters demonstrate that SLC25A33 transports uracil, thymine, and cytosine (deoxy)nucleoside di- and triphosphates by an antiport mechanism and SLC25A36 cytosine and uracil (deoxy)nucleoside mono-, di-, and triphosphates by uniport and antiport. Both carriers also transported guanine but not adenine (deoxy)nucleotides. Transport catalyzed by both carriers was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. In confirmation of their identity (i) SLC25A33 and SLC25A36 were found to be targeted to mitochondria and (ii) the phenotypes of Saccharomyces cerevisiae cells lacking RIM2, the gene encoding the well characterized yeast mitochondrial pyrimidine nucleotide carrier, were overcome by expressing SLC25A33 or SLC25A36 in these cells. The main physiological role of SLC25A33 and SLC25A36 is to import/export pyrimidine nucleotides into and from mitochondria, i.e. to accomplish transport steps essential for mitochondrial DNA and RNA synthesis and breakdown. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  2. SLC39A8 Deficiency: A Disorder of Manganese Transport and Glycosylation.

    Science.gov (United States)

    Park, Julien H; Hogrebe, Max; Grüneberg, Marianne; DuChesne, Ingrid; von der Heiden, Ava L; Reunert, Janine; Schlingmann, Karl P; Boycott, Kym M; Beaulieu, Chandree L; Mhanni, Aziz A; Innes, A Micheil; Hörtnagel, Konstanze; Biskup, Saskia; Gleixner, Eva M; Kurlemann, Gerhard; Fiedler, Barbara; Omran, Heymut; Rutsch, Frank; Wada, Yoshinao; Tsiakas, Konstantinos; Santer, René; Nebert, Daniel W; Rust, Stephan; Marquardt, Thorsten

    2015-12-03

    SLC39A8 is a membrane transporter responsible for manganese uptake into the cell. Via whole-exome sequencing, we studied a child that presented with cranial asymmetry, severe infantile spasms with hypsarrhythmia, and dysproportionate dwarfism. Analysis of transferrin glycosylation revealed severe dysglycosylation corresponding to a type II congenital disorder of glycosylation (CDG) and the blood manganese levels were below the detection limit. The variants c.112G>C (p.Gly38Arg) and c.1019T>A (p.Ile340Asn) were identified in SLC39A8. A second individual with the variants c.97G>A (p.Val33Met) and c.1004G>C (p.Ser335Thr) on the paternal allele and c.610G>T (p.Gly204Cys) on the maternal allele was identified among a group of unresolved case subjects with CDG. These data demonstrate that variants in SLC39A8 impair the function of manganese-dependent enzymes, most notably β-1,4-galactosyltransferase, a Golgi enzyme essential for biosynthesis of the carbohydrate part of glycoproteins. Impaired galactosylation leads to a severe disorder with deformed skull, severe seizures, short limbs, profound psychomotor retardation, and hearing loss. Oral galactose supplementation is a treatment option and results in complete normalization of glycosylation. SLC39A8 deficiency links a trace element deficiency with inherited glycosylation disorders. Copyright © 2015 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  3. Estructura genética del caballo de pura raza árabe español y su influencia en razas derivadas: aplicación de nuevas metodologías en el cálculo del tamaño efectivo

    OpenAIRE

    Cervantes Navarro, Isabel

    2008-01-01

    Durante el desarrollo del estudio se ha analizado la estructura genética del caballo de Pura Raza Árabe y de sus razas derivadas y se ha puesto a punto una nueva metodología de estimación del tamaño efectivo, aplicándose en poblaciones simuladas y reales. Se observó una reducida variabilidad genética en el caballo de Pura Raza Árabe Español, ocasionada por el desequilibrio en la utilización de los reproductores y el cuello de botella acaecido durante la Guerra Civil. Este hecho está compensán...

  4. Sodium/bicarbonate cotransporter NBCn1/slc4a7 increases cytotoxicity in magnesium depletion in primary cultures of hippocampal neurons

    Science.gov (United States)

    Cooper, Deborah S.; Yang, Han Soo; He, Peijian; Kim, Eunjin; Rajbhandari, Ira; Yun, Chris C.; Choi, Inyeong

    2009-01-01

    Growing evidence suggests that pharmacological inhibition of Na/H exchange and Na/HCO3 transport provides protection against damage or injury in cardiac ischemia. In this study, we examined the contribution of the sodium/bicarbonate cotransporter NBCn1 (slc4a7) to cytotoxicity in cultured hippocampal neurons of rats. In neurons exposed to extracellular pH (pHo) ranging from 6.2 to 8.3, NBCn1 protein expression increased by fivefold at pH < 6.5 compared to the expression at pHo 7.4. At pHo 6.5, the intracellular pH of neurons was ~1 unit lower than that at pH 7.4. Immunochemistry showed a marked increase in NBCn1 immunofluorescence in plasma membranes and cytosol of the soma as well as in dendrites, at pHo 6.5. NBCn1 expression also increased by 40% in a prolonged Mg2+-free incubation at normal pHo. Knockdown of NBCn1 in neurons had negligible effect on cell viability. The effect of NBCn1 knockdown on cytotoxicity was then determined by exposing neurons to 0.5 mM glutamate for 10 min and measuring lactate dehydrogenase (LDH) release from neurons. Compared to normal incubation (pHo 7.2 for 6 h) after glutamate exposure, acidic incubation (pHo 6.3 for 6 h) reduced cytotoxicity by 75% for control neurons and 78% for NBCn1-knockdown neurons. Thus, both controls and knockdown neurons showed acidic protection from cytotoxicity. However, in Mg2+-free incubation after glutamate exposure, NBCn1 knockdown progressively attenuated cytotoxicity. This attenuation was unaffected by acidic preincubation before glutamate exposure. We conclude that NBCn1 has a dynamic upregulation in low pHo and Mg2+ depletion. NBCn1 is not required for acidic protection, but increases cytotoxicity in Mg2+-free conditions. PMID:19170751

  5. No Association of BDNF, COMT, MAOA, SLC6A3, and SLC6A4 Genes and Depressive Symptoms in a Sample of Healthy Colombian Subjects.

    Science.gov (United States)

    González-Giraldo, Yeimy; Camargo, Andrés; López-León, Sandra; Forero, Diego A

    2015-01-01

    Background. Major depressive disorder (MDD) is the second cause of years lived with disability around the world. A large number of studies have been carried out to identify genetic risk factors for MDD and related endophenotypes, mainly in populations of European and Asian descent, with conflicting results. The main aim of the current study was to analyze the possible association of five candidate genes and depressive symptoms in a Colombian sample of healthy subjects. Methods and Materials. The Spanish adaptation of the Hospital Anxiety and Depression Scale (HADS) was applied to one hundred eighty-eight healthy Colombian subjects. Five functional polymorphisms were genotyped using PCR-based assays: BDNF-Val66Met (rs6265), COMT-Val158Met (rs4680), SLC6A4-HTTLPR (rs4795541), MAOA-uVNTR, and SLC6A3-VNTR (rs28363170). Result. We did not find significant associations with scores of depressive symptoms, derived from the HADS, for any of the five candidate genes (nominal p values >0.05). In addition, we did not find evidence of significant gene-gene interactions. Conclusion. This work is one of the first studies of candidate genes for depressive symptoms in a Latin American sample. Study of additional genetic and epigenetic variants, taking into account other pathophysiological theories, will help to identify novel candidates for MDD in populations around the world.

  6. Polimorfismo del gen de la banda 3 eritrocítica en grupos étnicos de Costa Rica

    Directory of Open Access Journals (Sweden)

    M Chaves-Villalobos

    2004-09-01

    Full Text Available Banda 3 (AE1 es una de las proteínas más abundantes de la membrana del eritrocito humano. Ésta funciona como un intercambiador aniónico cloruro / bicarbonato y es el punto de anclaje de varias proteínas del citoesqueleto del eritrocito. Se han descrito varias mutaciones y muchas variantes polimórficas se han asociado a esferocitosis hereditaria. La identificación de un marcador genético en el extremo 5’ del gene AE1 podría asociarse a varios defectos moleculares del eritrocito. Este marcador genético es un fragmento de restricción de longitud polimórfica "RFLP" producido por la endonucleasa de restricción Pst I. Se analizaron para este polimorfismo un total de 216 individuos de siete poblaciones: una hispanomestiza (Valle Central, dos afrodescendientes (Limón y Guanacaste y cuatro amerindias (bribri, cabecar, maleku y guaymí. El alelo más frecuente en la población hispanomestiza fue el 2, mientras en los grupos afrodescendientes y amerindios se encontró el 1. No se observaron diferencias significativas con respecto al equilibrio de Hardy-Weinberg en seis de las poblaciones, sin embargo, el grupo Guaymí si presenta diferencias significativas con respecto al equilibrio de Hardy-Weinberg.Polymorphism of the erythrocyte band 3 gene (EPB3 in ethnic groups of Costa Rica. Band 3 (AE1 is one of the most abundant proteins in the membrane of the human erythrocyte. This protein works as an anionic CI - and HCO3- exchanger and it also functions as an anchor for several proteins of the erythrocyte's cytoesqueleton. Several mutations have been described and many polymorphic variants have been associated to hereditary spherocytosis. The identification of a genetic marker at position 5' of the AE1 gene could be associated to several molecular defects of the erythrocyte. This genetic marker is a restriction fragment length polymorphism (RFLP produced by restriction enzime Pst I. For this polymorphism a total of 216 individuals belonging to

  7. Actualización en marcadores genéticos ultrasonográficos del 1º trimestre del embarazo

    Directory of Open Access Journals (Sweden)

    Felicia Amaralis Trull Martínez

    2010-01-01

    Full Text Available Se aborda el tema de los marcadores ultrasonográficos del 1º trimestre del embarazo, brindando una actualización del tema. Se hace énfasis en los marcadores predictivos de las anomalías congénitas más frecuentes y se concluyó con importantes aspectos a tener en cuenta para una correcta interpretación de estos hallazgos.

  8. Indirubin, a component of Ban-Lan-Gen, activates CYP3A4 gene transcription through the human pregnane X receptor.

    Science.gov (United States)

    Kumagai, Takeshi; Aratsu, Yusuke; Sugawara, Ryosuke; Sasaki, Takamitsu; Miyairi, Shinichi; Nagata, Kiyoshi

    2016-04-01

    Ban-Lan-Gen is the common name for the dried roots of indigo plants, including Polygonum tinctorium, Isatis indigotica, Isatis tinctoria, and Strobilanthes cusia. Ban-Lan-Gen is frequently used as an anti-inflammatory and an anti-viral for the treatment of hepatitis, influenza, and various types of inflammation. One of the cytochrome P450 (CYP) enzymes, CYP3A4, is responsible for the metabolism of a wide variety of xenobiotics, including an estimated 60% of all clinically used drugs. In this study, we investigated the effect of Ban-Lan-Gen on the transcriptional activation of the CYP3A4 gene. Ban-Lan-Gen extract increased CYP3A4 gene reporter activity in a dose-dependent manner. Indirubin, one of the biologically active ingredients in the Ban-Lan-Gen, also dose-dependently increased CYP3A4 gene reporter activity. Expression of short hairpin RNA for the human pregnane X receptor (hPXR-shRNA) inhibited CYP3A4 gene reporter activity, and overexpression of human PXR increased indirubin- and rifampicin-induced CYP3A4 gene reporter activity. Furthermore, indirubin induced CYP3A4 mRNA expression in HepG2 cells. Taken together, these results indicate that indirubin, a component of Ban-Lan-Gen, activated CYP3A4 gene transcription through the activation of the human PXR. Copyright © 2016. Published by Elsevier Ltd.

  9. A partial gene deletion of SLC45A2 causes oculocutaneous albinism in Doberman pinscher dogs.

    Directory of Open Access Journals (Sweden)

    Paige A Winkler

    Full Text Available The first white Doberman pinscher (WDP dog was registered by the American Kennel Club in 1976. The novelty of the white coat color resulted in extensive line breeding of this dog and her offspring. The WDP phenotype closely resembles human oculocutaneous albinism (OCA and clinicians noticed a seemingly high prevalence of pigmented masses on these dogs. This study had three specific aims: (1 produce a detailed description of the ocular phenotype of WDPs, (2 objectively determine if an increased prevalence of ocular and cutaneous melanocytic tumors was present in WDPs, and (3 determine if a genetic mutation in any of the genes known to cause human OCA is causal for the WDP phenotype. WDPs have a consistent ocular phenotype of photophobia, hypopigmented adnexal structures, blue irides with a tan periphery and hypopigmented retinal pigment epithelium and choroid. WDPs have a higher prevalence of cutaneous melanocytic neoplasms compared with control standard color Doberman pinschers (SDPs; cutaneous tumors were noted in 12/20 WDP (5 years of age: 8/8 and 1/20 SDPs (p<0.00001. Using exclusion analysis, four OCA causative genes were investigated for their association with WDP phenotype; TYR, OCA2, TYRP1 and SLC45A2. SLC45A2 was found to be linked to the phenotype and gene sequencing revealed a 4,081 base pair deletion resulting in loss of the terminus of exon seven of SLC45A2 (chr4∶77,062,968-77,067,051. This mutation is highly likely to be the cause of the WDP phenotype and is supported by a lack of detectable SLC45A2 transcript levels by reverse transcriptase PCR. The WDP provides a valuable model for studying OCA4 visual disturbances and melanocytic neoplasms in a large animal model.

  10. Transport via SLC5A8 with Subsequent Inhibition of Histone Deacetylases HDAC1 and HDAC3 Underlies the Antitumor Activity of 3-Bromopyruvate

    Science.gov (United States)

    Thangaraju, Muthusamy; Karunakaran, Senthil K.; Itagaki, Shiro; Gopal, Elangovan; Elangovan, Selvakumar; Prasad, Puttur D.; Ganapathy, Vadivel

    2009-01-01

    Background 3-Bromopyruvate is an alkylating agent with antitumor activity. It is currently believed that blockade of ATP production from glycolysis and mitochondria is the primary mechanism responsible for this antitumor effect. The present studies have uncovered a new and novel mechanism for the antitumor activity of 3-bromopyruvate. Methods Transport of 3-bromopyruvate via SLC5A8, a tumor suppressor and a Na+-coupled electrogenic transporter for short-chain monocarboxylates, was studied using a mammalian cell expression and the Xenopus laevis oocyte expression systems. The effect of 3-bromopyruvate on histone deacetylases (HDACs) was monitored using the lysate of the human breast cancer cell line MCF7 and human recombinant HDAC isoforms as the enzyme sources. Cell viability was monitored by FACS analysis and colony formation assay. Acetylation status of histone H4 was evaluated by Western blot. Results 3-Bromopyruvate is a transportable substrate for SLC5A8, with the transport process being Na+-coupled and electrogenic. MCF7 cells do not express SLC5A8 and are not affected by 3-bromopyruvate. However, when transfected with SLC5A8 or treated with inhibitors of DNA methylation, these cells undergo apoptosis in the presence of 3-bromopyruvate. This cell death is associated with inhibition of HDAC1/HDAC3. Studies with different isoforms of human recombinant HDACs identify HDAC1 and HDAC3 as the targets for 3-bromopyruvate. Conclusions 3-Bromopyruvate is transported into cells actively via the tumor suppressor SLC5A8 and the process is energized by an electrochemical Na+ gradient. Ectopic expression of the transporter in MCF7 cells leads to apoptosis, and the mechanism involves inhibition of HDAC1/HDAC3. PMID:19637353

  11. Crystal Structure of a Eukaryotic GEN1 Resolving Enzyme Bound to DNA

    Directory of Open Access Journals (Sweden)

    Yijin Liu

    2015-12-01

    Full Text Available We present the crystal structure of the junction-resolving enzyme GEN1 bound to DNA at 2.5 Å resolution. The structure of the GEN1 protein reveals it to have an elaborated FEN-XPG family fold that is modified for its role in four-way junction resolution. The functional unit in the crystal is a monomer of active GEN1 bound to the product of resolution cleavage, with an extensive DNA binding interface for both helical arms. Within the crystal lattice, a GEN1 dimer interface juxtaposes two products, whereby they can be reconnected into a four-way junction, the structure of which agrees with that determined in solution. The reconnection requires some opening of the DNA structure at the center, in agreement with permanganate probing and 2-aminopurine fluorescence. The structure shows that a relaxation of the DNA structure accompanies cleavage, suggesting how second-strand cleavage is accelerated to ensure productive resolution of the junction.

  12. Diversidad genómica de aislamientos del virus del papiloma humano de los tipos 16, 18, 31 y 35, en una población mexicana

    OpenAIRE

    CALLEJA M., ITZEL E.; KALANTARI, MINA; HUH, JOHN; ORTIZ L., ROCÍO; ROJAS M., AUGUSTO; GONZÁLEZ G., JUAN F.; W., ANNA-LISE; HAGMAR, BJÓRN; WILEY, DOROTHY J.; VILLARREAL, LUIS; BERNARD, HANS-ULRICH; BARRERA S., HUGO A.

    2004-01-01

    Analizamos secuencias genÛmicas de variantes mexi- canas del HPV-16, 18, 31 y 35. Entre 112 muestras HPV-16 se detectaron catorce variantes E y 98 AA. Entre 15 muestras HPV-18, trece E y dos africanas. Se construyeron árboles filogenÈticos con las varian- tes del HPV-31 y 35. En 46 asilados HPV-31 se detectaron 35 cambios nucleotÌdicos. En 27 muestras HPV-35 se detectaron once mutaciones. La alta prevalencia de las variantes carcinogÈnicas AA del HPV- 16 y la extensiva diversidad de las varia...

  13. Cathepsin D Specifically Cleaves the Chemokines Macrophage Inflammatory Protein-1α, Macrophage Inflammatory Protein-1β, and SLC That Are Expressed in Human Breast Cancer

    Science.gov (United States)

    Wolf, Marlene; Clark-Lewis, Ian; Buri, Caroline; Langen, Hanno; Lis, Maddalena; Mazzucchelli, Luca

    2003-01-01

    Cathepsin D (Cath-D) expression in human primary breast cancer has been associated with a poor prognosis. In search of a better understanding of the Cath-D substrates possibly involved in cancer invasiveness and metastasis, we investigated the potential interactions between this protease and chemokines. Here we report that purified Cath-D, as well as culture supernatants from the human breast carcinoma cell lines MCF-7 and T47D, selectively degrade macrophage inflammatory protein (MIP)-1α (CCL3), MIP-1β (CCL4), and SLC (CCL21). Proteolysis was totally blocked by the protease inhibitor pepstatin A, and specificity of Cath-D cleavage was demonstrated using a large chemokine panel. Whereas MIP-1α and MIP-1β degradation was rapid and complete, cleavage of SLC was slow and not complete. Mass spectrometry analysis showed that Cath-D cleaves the Leu58 to Trp59 bond of SLC producing two functionally inactive fragments. Analysis of Cath-D proteolysis of a series of monocyte chemoattractant protein-3/MIP-1β hybrids indicated that processing of MIP-1β might start by cleaving off amino acids located in the C-terminal domain. In situ hybridization studies revealed MIP-1α, MIP-1β, and Cath-D gene expression mainly in the stromal compartment of breast cancers whereas SLC transcripts were found in endothelial cells of capillaries and venules within the neoplastic tissues. Cath-D production in the breast carcinoma cell lines MCF-7 and T47D, as assessed by enzyme-linked immunosorbent assay of culture supernatants and cell lysates, was not affected by stimulation with chemokines such as interleukin-8 (CXCL8), SDF-1 (CXCL12), and SLC. These data suggest that inactivation of chemokines by Cath-D possibly influences regulatory mechanisms in the tumoral extracellular microenvironment that in turn may affect the generation of the antitumoral immune response, the migration of cancer cells, or both processes. PMID:12651610

  14. Plasma Membrane Na+-Coupled Citrate Transporter (SLC13A5 and Neonatal Epileptic Encephalopathy

    Directory of Open Access Journals (Sweden)

    Yangzom D. Bhutia

    2017-02-01

    Full Text Available SLC13A5 is a Na+-coupled transporter for citrate that is expressed in the plasma membrane of specific cell types in the liver, testis, and brain. It is an electrogenic transporter with a Na+:citrate3− stoichiometry of 4:1. In humans, the Michaelis constant for SLC13A5 to transport citrate is ~600 μM, which is physiologically relevant given that the normal concentration of citrate in plasma is in the range of 150–200 μM. Li+ stimulates the transport function of human SLC13A5 at concentrations that are in the therapeutic range in patients on lithium therapy. Human SLC13A5 differs from rodent Slc13a5 in two important aspects: the affinity of the human transporter for citrate is ~30-fold less than that of the rodent transporter, thus making human SLC13A5 a low-affinity/high-capacity transporter and the rodent Slc13a5 a high-affinity/low-capacity transporter. In the liver, SLC13A5 is expressed exclusively in the sinusoidal membrane of the hepatocytes, where it plays a role in the uptake of circulating citrate from the sinusoidal blood for metabolic use. In the testis, the transporter is expressed only in spermatozoa, which is also only in the mid piece where mitochondria are located; the likely function of the transporter in spermatozoa is to mediate the uptake of citrate present at high levels in the seminal fluid for subsequent metabolism in the sperm mitochondria to generate biological energy, thereby supporting sperm motility. In the brain, the transporter is expressed mostly in neurons. As astrocytes secrete citrate into extracellular medium, the potential function of SLC13A5 in neurons is to mediate the uptake of circulating citrate and astrocyte-released citrate for subsequent metabolism. Slc13a5-knockout mice have been generated; these mice do not have any overt phenotype but are resistant to experimentally induced metabolic syndrome. Recently however, loss-of-function mutations in human SLC13A5 have been found to cause severe epilepsy

  15. Sodium-coupled neutral amino acid (System N/A) transporters of the SLC38 gene family.

    Science.gov (United States)

    Mackenzie, Bryan; Erickson, Jeffrey D

    2004-02-01

    The sodium-coupled neutral amino acid transporters (SNAT) of the SLC38 gene family resemble the classically-described System A and System N transport activities in terms of their functional properties and patterns of regulation. Transport of small, aliphatic amino acids by System A subtypes (SNAT1, SNAT2, and SNAT4) is rheogenic and pH sensitive. The System N subtypes SNAT3 and SNAT5 also countertransport H(+), which may be key to their operation in reverse, and have narrower substrate profiles than do the System A subtypes. Glutamine emerges as a favored substrate throughout the family, except for SNAT4. The SLC38 transporters undoubtedly play many physiological roles including the transfer of glutamine from astrocyte to neuron in the CNS, ammonia detoxification and gluconeogenesis in the liver, and the renal response to acidosis. Probing their regulation has revealed additional roles, and recent work has considered SLC38 transporters as therapeutic targets in neoplasia.

  16. Association between SLC19A1 Gene Polymorphism and High Dose Methotrexate Toxicity in Childhood Acute Lymphoblastic Leukaemia and Non Hodgkin Malignant Lymphoma: Introducing a Haplotype based Approach

    Science.gov (United States)

    Kotnik, Barbara Faganel; Jazbec, Janez; Grabar, Petra Bohanec; Rodriguez-Antona, Cristina

    2017-01-01

    Abstract Background We investigated the clinical relevance of SLC 19A1 genetic variability for high dose methotrexate (HD-MTX) related toxicities in children and adolescents with acute lymphoblastic leukaemia (ALL) and non Hodgkin malignant lymphoma (NHML). Patients and methods Eighty-eight children and adolescents with ALL/NHML were investigated for the influence of SLC 19A1 single nucleotide polymorphisms (SNPs) and haplotypes on HD-MTX induced toxicities. Results Patients with rs2838958 TT genotype had higher probability for mucositis development as compared to carriers of at least one rs2838958 C allele (OR 0.226 (0.071–0.725), p < 0.009). Haplotype TGTTCCG (H4) statistically significantly reduced the risk for the occurrence of adverse events during treatment with HD-MTX (OR 0.143 (0.023–0.852), p = 0.030). Conclusions SLC 19A1 SNP and haplotype analysis could provide additional information in a personalized HD-MTX therapy for children with ALL/NHML in order to achieve better treatment outcome. However further studies are needed to validate the results. PMID:29333125

  17. Diversidad genética de Dioscorea trifida “sachapapa” de cinco cuencas hidrográficas de la amazonía peruana

    Directory of Open Access Journals (Sweden)

    Jhonatan Pérez Arévalo

    2013-12-01

    Full Text Available Dioscorea trifida “sachapapa” es una de las especies promisorias amazónicas que podemos considerarla huérfana de la ciencia, por las escasas investigaciones que hay sobre esta especie. El objetivo de esta investigación fue determinar la diversidad genética intra e interpoblacional de D. trifida de cinco cuencas hidrográficas de la amazonía peruana. Las hojas fueron colectadas de una colección de germoplasma y purificó el ADN con métodos estándares. El polimorfismo genético se evaluó con la técnica RAPD y los parámetros de genética poblacional fueron estimados con el programa POPGENE. Los análisis espectrofotométrico (A260/A280=1,7±0,1 y electroforético (bandas de ADN íntegras mostraron que el ADN purificado fue de alta calidad. Asimismo, la cantidad obtenida fue apropiada para estudios de diversidad genética (rendimiento promedio = 582±248 mg ADN/mg hojas. La diversidad genética intrapoblacional más alta se encontró en la cuenca del Itaya (h = 0,24±0,11 y la más baja en la cuenca del Marañón (h = 0,10±0,04. Adicionalmente, la diversidad genética interpoblacional más alta se registró entre las poblaciones de Itaya vs Ucayali (GST = 1,00, mientras que la más baja entre las poblaciones de Nanay vs Tapiche (GST = 0,07. En conclusión, D. trifida muestra variación en su diversidad genética intra e interpoblacional en las cinco cuencas hidrográficas de la amazonía peruana, siendo la cuenca del Itaya la que presenta mayor diversidad genética intrapoblacional y las poblaciones de Itaya vs Ucayali las que presentan mayor diversidad genética interpoblacional, que en parte se atribuyen al flujo de genes diferencial entre las poblaciones analizadas.

  18. Loss-of-function mutations in SLC30A8 protect against type 2 diabetes.

    Science.gov (United States)

    Flannick, Jason; Thorleifsson, Gudmar; Beer, Nicola L; Jacobs, Suzanne B R; Grarup, Niels; Burtt, Noël P; Mahajan, Anubha; Fuchsberger, Christian; Atzmon, Gil; Benediktsson, Rafn; Blangero, John; Bowden, Don W; Brandslund, Ivan; Brosnan, Julia; Burslem, Frank; Chambers, John; Cho, Yoon Shin; Christensen, Cramer; Douglas, Desirée A; Duggirala, Ravindranath; Dymek, Zachary; Farjoun, Yossi; Fennell, Timothy; Fontanillas, Pierre; Forsén, Tom; Gabriel, Stacey; Glaser, Benjamin; Gudbjartsson, Daniel F; Hanis, Craig; Hansen, Torben; Hreidarsson, Astradur B; Hveem, Kristian; Ingelsson, Erik; Isomaa, Bo; Johansson, Stefan; Jørgensen, Torben; Jørgensen, Marit Eika; Kathiresan, Sekar; Kong, Augustine; Kooner, Jaspal; Kravic, Jasmina; Laakso, Markku; Lee, Jong-Young; Lind, Lars; Lindgren, Cecilia M; Linneberg, Allan; Masson, Gisli; Meitinger, Thomas; Mohlke, Karen L; Molven, Anders; Morris, Andrew P; Potluri, Shobha; Rauramaa, Rainer; Ribel-Madsen, Rasmus; Richard, Ann-Marie; Rolph, Tim; Salomaa, Veikko; Segrè, Ayellet V; Skärstrand, Hanna; Steinthorsdottir, Valgerdur; Stringham, Heather M; Sulem, Patrick; Tai, E Shyong; Teo, Yik Ying; Teslovich, Tanya; Thorsteinsdottir, Unnur; Trimmer, Jeff K; Tuomi, Tiinamaija; Tuomilehto, Jaakko; Vaziri-Sani, Fariba; Voight, Benjamin F; Wilson, James G; Boehnke, Michael; McCarthy, Mark I; Njølstad, Pål R; Pedersen, Oluf; Groop, Leif; Cox, David R; Stefansson, Kari; Altshuler, David

    2014-04-01

    Loss-of-function mutations protective against human disease provide in vivo validation of therapeutic targets, but none have yet been described for type 2 diabetes (T2D). Through sequencing or genotyping of ~150,000 individuals across 5 ancestry groups, we identified 12 rare protein-truncating variants in SLC30A8, which encodes an islet zinc transporter (ZnT8) and harbors a common variant (p.Trp325Arg) associated with T2D risk and glucose and proinsulin levels. Collectively, carriers of protein-truncating variants had 65% reduced T2D risk (P = 1.7 × 10(-6)), and non-diabetic Icelandic carriers of a frameshift variant (p.Lys34Serfs*50) demonstrated reduced glucose levels (-0.17 s.d., P = 4.6 × 10(-4)). The two most common protein-truncating variants (p.Arg138* and p.Lys34Serfs*50) individually associate with T2D protection and encode unstable ZnT8 proteins. Previous functional study of SLC30A8 suggested that reduced zinc transport increases T2D risk, and phenotypic heterogeneity was observed in mouse Slc30a8 knockouts. In contrast, loss-of-function mutations in humans provide strong evidence that SLC30A8 haploinsufficiency protects against T2D, suggesting ZnT8 inhibition as a therapeutic strategy in T2D prevention.

  19. Identificación de un polimorfismo del gen Est9 relacionado con resistencia a piretroides en Rhipicephalus (Boophilus microplus

    Directory of Open Access Journals (Sweden)

    Edgar Diaz R.

    2013-10-01

    Full Text Available Objetivo. Mediante procedimientos de PCR-RFLP, detectar un polimorfismo en el gen Est9 de garrapatas Rhipicephalus (Boophilus microplus resistentes a piretroides en Ibagué, Colombia, determinando el grado de asociación entre los fenotipos y los genotipos resultantes. Materiales y métodos. El ADN de 30 teleoginas R. (Boophilus microplus fenotípicamente susceptibles, resistentes o medianamente resistentes a piretroides en una prueba de Drummond modificada, fue amplificado por PCR con cebadores específicos para obtener un fragmento de 372 pb del gen Est9, que fue sometido a digestión con la enzima EcoRI para estudiar los RFLPs generados y poder diferenciar los respectivos genotipos. El grado de asociación entre los fenotipos y los genotipos resultantes se determinó mediante la prueba exacta de Fisher. Resultados. Luego de digerir el fragmento con la endonucleasa, se generaron dos segmentos en teleoginas con algún nivel de resistencia, mientras en las teleoginas susceptibles no hubo división del fragmento de 372 pb, demostrándose así la presencia de una mutación puntual y los genotipos homocigoto natural, homocigoto mutante y heterocigoto. Las diferencias altamente significativas (p<0.01 entre teleoginas susceptibles y aquellas con algún nivel de resistencia, mostraron una relación directa entre el genotipo y el fenotipo con un nivel de confianza de p=0.0009852. Conclusiones. Se comprobó, por primera vez en Colombia, la presencia de una mutación puntual en el gen Est9 de garrapatas R. (Boophilus microplus resistentes a piretroides, sugiriendo la necesidad de realizar estudios para detectar alteraciones moleculares en otros genes relacionados con quimioresistencia.

  20. Genome dynamics, genetic complexity and macroevolution Dinámica del genoma, complejidad genética y macroevolución

    Directory of Open Access Journals (Sweden)

    MILTON GALLARDO

    2003-12-01

    duplicaciones génicas. Esta idea, desarrollada por Ohno (1968 permanece vigente en el estudio de varios organismos cuyos genomas se han secuenciado. El maíz, la levadura y los humanos contienen más paralogones que lo esperado por azar, apoyando así la idea que las familias génicas no se formaron de novo, sino por duplicaciones a gran escala del ADN. La hibridización de linajes emerge como un mecanismo eficiente y diseminado que crea novedades evolutivas por reclutamiento de genes redundantes hacia nuevos roles. La transferencia génica lateral indica una composición quimérica de los genomas de procariontes. Esta peculiar forma de herencia oscurece los límites de los linajes filogenéticos y sugiere anastomización y dicotomización en la forma del árbol de la vida. Las mutaciones adaptativas también han ensanchado el marco genético del pensamiento evolutivo al incorporar un nuevo mecanismo de formación de genes. Además, la biología del desarrollo ha entregado evidencias sólidas de la organización modular onto- y epigenética del organismo. Los cambios rápidos y drásticos generados por los genes del desarrollo han falseado la noción que la adaptación se logra exclusivamente por el reemplazo gradual de alelos, y que el cambio macroevolutivo es microevolución expandida. Con todo, la genómica comparada parece estar gestando una ampliación o un remodelamiento del marco genético en que comprendemos la filogenia y la evolución de la complejidad morfológica

  1. Association between a genetic variant in the serotonin transporter gene (SLC6A4) and suicidal behavior in patients with schizophrenia

    DEFF Research Database (Denmark)

    Lindholm Carlstrom, Eva; Saetre, Peter; Rosengren, Anders

    2012-01-01

    ABSTRACT: BACKGROUND: The serotonin (5-hydroxytryptamin; 5-HT) system has a central role in the circuitry of cognition and emotions. Multiple lines of evidence suggest that genetic variation in the serotonin transporter gene (SLC6A4; 5-HTT) is associated with schizophrenia and suicidal behavior. ...

  2. Criminología biológica: Una mirada desde la genética forense/Biological criminology: a view from the forensic genetics

    Directory of Open Access Journals (Sweden)

    Rosa Elizabeth Carrera Palao

    2017-01-01

    Full Text Available El presente artículo tiene como objeto establecer el estado del arte en neurobiología en torno a la predisposición genética que determina la conducta agresiva, en el ámbito de las neurociencias, y etiopatogenia de la anatomía patológica en los trastornos de personalidad antisocial, que caracteriza la conducta violenta del comportamiento delictivo, de interés a la criminología biológica. Aplicando el método de búsqueda selectiva no sistemática de información relevante de investigaciones científicas reportadas en genética de la conducta y epigenética. Se reportan contribuciones genéticas implicadas en la conducta agresiva, violenta, antisocial, y la interacción de factores genéticos con los ambientales. Se desconoce con exactitud los mecanismos como factores genéticos contribuyen a estas conductas. El maltrato o abuso físico, sexual o psicológico, y respuesta al estrés, son factores ambientales, que tienen efecto sobre la expresión de genes específicos y, consecuentemente, en la conducta agresiva. Los principales hallazgos son: menor tamaño craneal y volumen encefálico, asimetría del lóbulo frontal, descenso de actividad de la corteza prefrontal con disminución del flujo sanguíneo, alteración de memoria, atención y concentración, menor volumen del hipocampo y amígdala, incremento de concentración de dopamina, adrenalina, noradrenalina y cortisol; niveles alterados de serotonina en corteza prefrontal, niveles altos de testosterona, niveles bajos de colesterol, efectos de drogas, dietas, cobre, zinc, traumatismos, contaminación ambiental y toxinas. La neurogenética ha reportado dos genes que codifican enzimas principales del metabolismo de serotonina en el cerebro (triptófano-hidroxilasa y MAO-A y el receptor 5-HT1A, forman parte del complejo grupo de genes que modulan la conducta agresiva.

  3. Estructura poblacional y demografía genética en poblaciones de trucha común (Salmo trutta) del Pirineo catalán

    OpenAIRE

    Fernández Cebrián, Raquel

    2012-01-01

    El sistema de 9 loci microsatélites desarrollado en este trabajo resulta muy eficiente para el análisis de la estructura poblacional y la demografía genética de las poblaciones de trucha común (Salmo trutta) en las cuencas del Pirineo. La complejidad de los procesos evolutivos ocurridos durante las glaciaciones del cuaternario en el Pirineo y la diferente escala espacial y temporal en que estos han tenido lugar impiden establecer un patrón general que relacione la estructura poblacional y la ...

  4. Variation in the SLC23A1 gene does not influence cardiometabolic outcomes to the extent expected given its association with l-ascorbic acid 1 2 3 4

    OpenAIRE

    Wade, Kaitlin H; Forouhi, Nita G; Cook, Derek G; Johnson, Paul; McConnachie, Alex; Morris, Richard W; Rodriguez, Santiago; Ye, Zheng; Ebrahim, Shah; Padmanabhan, Sandosh; Watt, Graham; Bruckdorfer, K Richard; Wareham, Nick J; Whincup, Peter H; Chanock, Stephen

    2014-01-01

    Background: Observational studies showed that circulating l-ascorbic acid (vitamin C) is inversely associated with cardiometabolic traits. However, these studies were susceptible to confounding and reverse causation.\\ud \\ud Objectives:We assessed the relation between l-ascorbic acid and 10 cardiometabolic traits by using a single nucleotide polymorphism in the solute carrier family 23 member 1 (SLC23A1) gene (rs33972313) associated with circulating l-ascorbic acid concentrations. The observed...

  5. Traducción independiente de la estructura 5´cap del ARN genómico del virus dengue

    Directory of Open Access Journals (Sweden)

    Mariela Pérez Dominguez

    Full Text Available Objetivos. Analizar la participación de la caperuza metil-guanosín-trifosfato (5´cap y de la región inicial del ARN genómico del virus dengue serotipo 2 (DENV-2 genotipo Americano en la traducción, utilizando un sistema libre de células obtenido de placenta humana. Materiales y métodos. Se preparó el plásmido recombinante pTZ18R-D2 conteniendo el ADN que codifica la 5´UTR y los primeros 201 nucleótidos de la cápside viral. Este plásmido se utilizó para transcribir el ARN correspondiente (ARN-D2, sin la 5´cap. El ARN-D2 fue traducido en un sistema constituido por la fracción posmitocondrial (S-30 de placenta humana y se evaluó la incorporación de [ 14C] aminoácidos en presencia del ARN-D2 y en su ausencia (control. Se diseñaron siete oligonucleótidos antisentido (OAs1-7 dirigidos contra secuencias de las estructuras SLA, SLB y cHP del ARN-D2 y se analizó el efecto de los mismos sobre la traducción ARN-D2. Resultados. El ARN-D2 produjo un incremento significativo (p<0,001 en la incorporación de [14C] aminoácidos, con estimulación del 75% de la actividad traduccional respecto al control. El análisis de los productos de traducción mostró un pico de incorporación correspondiente a péptidos con peso molecular aparente cercano al esperado (7,746 kDa. El OAs5, complementario a una secuencia de la estructura SLB del ARN-D2, inhibió completamente la traducción. Conclusiones. El ARN-D2 fue traducido de manera específica y eficiente, bajo condiciones semejantes a las intracelulares en humanos, por un mecanismo alternativo independiente de la 5´cap, que involucraría a la estructura SLB. Este mecanismo podría considerarse como blanco en el desarrollo de terapias antisentido para inhibir la reproducción del virus.

  6. Relación del polimorfismo C-514T del gen de la lipasa hepática con indicadores nutricionales y lipoproteínas en una muestra poblacional peruana: una perspectiva nutrigenética

    Directory of Open Access Journals (Sweden)

    Doris Huerta

    2008-12-01

    Full Text Available Introducción: Las enfermedades cardiovasculares son una de las principales causas de muerte en todo el mundo. El promotor del gen de la lipasa hepática presenta un polimorfismo funcional C-514T que se relaciona con la actividad de la enzima, la variación de los niveles de lipoproteínas y un posible riesgo para desarrollar enfermedades cardiovasculares. Objetivos: Establecer la relación del polimorfismo C-514T del promotor del gen de la lipasa hepática con indicadores nutricionales y los niveles de lipoproteínas plasmáticas en una muestra de peruanos saludables. Diseño: Estudio descriptivo, transversal, asociativo. Lugar: Centro de Investigación de Bioquímica y Nutrición Alberto Guzmán Barrón, Facultad de Medicina, Universidad Nacional Mayor de San Marcos. Participantes: Noventiuna personas sanas de ambos sexos, cuyas edades fluctuaban entre 18 y 58 años, voluntarios con consentimiento informado. Intervenciones: Extracción del ADN genómico a partir de muestras sanguíneas según metodología estándar. Toma de medidas antropométricas, estableciéndose los indicadores nutricionales, determinación del perfil lipídico por el método enzimático. Análisis del polimorfismo C-514T mediante la técnica de PCR/RFLP, con primers específicos y digestión con la enzima de restricción NlaIII, detectándose los fragmentos de RFLP por electroforesis en gel de poliacrilamida (PAGE y tinción con nitrato de plata. Principales medidas de resultados: Frecuencias genotípicas y alélicas del gen de la lipasa hepática y relación con parámetros lipídicos y nutricionales. Resultados: Se encontró las frecuencias genotípicas CC=0,143; CT=0,593 y TT = 0,264, siendo la distribución consistente con el equilibrio de Hardy-Weinberg (X2 =3,8024, g.l.=1, p = 0,086. Las frecuencias alélicas fueron alelo C = 0,4395 y el alelo T = 0,5605. Los niveles de colesterol, HDLc, LDLc, TG y los promedios de pliegue subcutáneo, el IMC y el porcentaje de

  7. The Effect of Turmeric (Curcuma longa Extract on the Functionality of the Solute Carrier Protein 22 A4 (SLC22A4 and Interleukin-10 (IL-10 Variants Associated with Inflammatory Bowel Disease

    Directory of Open Access Journals (Sweden)

    Mark J. McCann

    2014-10-01

    Full Text Available Inflammatory bowel disease (IBD is a chronic relapsing disease. Genetic predisposition to the disease reduces an individual’s capacity to respond appropriately to environmental challenges in the intestine leading to inappropriate inflammation. IBD patients often modify their diet to mitigate or reduce the severity of inflammation. Turmeric (Curcuma longa L., Zingiberaceae has historically been used in Chinese, Hindu, and Ayurvedic medicine over several centuries to treat inflammatory disorders. To understand how turmeric may influence the consequences of a genetic predisposition to inappropriate inflammation, we used HEK293 cells to examine the in vitro capacity of turmeric extract and fractions to affect the functionality of two gene variants, solute carrier protein 22 A4 (SLC22A4, rs1050152 and interleukin-10 (IL-10, rs1800896 associated with IBD. We found that a turmeric extract and several chromatographically separated fractions beneficially affected the variants of SLC22A4 and IL-10 associated with IBD, by reducing inappropriate epithelial cell transport (SLC22A4, 503F and increasing anti-inflammatory cytokine gene promoter activity (IL-10, −1082A. The effect of turmeric on the IL-10 variant was strongly associated with the curcumin content of the extract and its fractions.

  8. The effect of turmeric (Curcuma longa) extract on the functionality of the solute carrier protein 22 A4 (SLC22A4) and interleukin-10 (IL-10) variants associated with inflammatory bowel disease.

    Science.gov (United States)

    McCann, Mark J; Johnston, Sarah; Reilly, Kerri; Men, Xuejing; Burgess, Elaine J; Perry, Nigel B; Roy, Nicole C

    2014-10-13

    Inflammatory bowel disease (IBD) is a chronic relapsing disease. Genetic predisposition to the disease reduces an individual's capacity to respond appropriately to environmental challenges in the intestine leading to inappropriate inflammation. IBD patients often modify their diet to mitigate or reduce the severity of inflammation. Turmeric (Curcuma longa L., Zingiberaceae) has historically been used in Chinese, Hindu, and Ayurvedic medicine over several centuries to treat inflammatory disorders. To understand how turmeric may influence the consequences of a genetic predisposition to inappropriate inflammation, we used HEK293 cells to examine the in vitro capacity of turmeric extract and fractions to affect the functionality of two gene variants, solute carrier protein 22 A4 (SLC22A4, rs1050152) and interleukin-10 (IL-10, rs1800896) associated with IBD. We found that a turmeric extract and several chromatographically separated fractions beneficially affected the variants of SLC22A4 and IL-10 associated with IBD, by reducing inappropriate epithelial cell transport (SLC22A4, 503F) and increasing anti-inflammatory cytokine gene promoter activity (IL-10, -1082A). The effect of turmeric on the IL-10 variant was strongly associated with the curcumin content of the extract and its fractions.

  9. Satisfacción de las víctimas de violencia de género con la actuación policial en España. Validación del Sistema VioGen

    Directory of Open Access Journals (Sweden)

    José Luis González

    2015-01-01

    Full Text Available En la lucha contra la violencia de género en España las policías juegan un papel importante en la prevención, protección y seguridad de las víctimas y la información que ellas aportan sirve para mejorar las actuaciones policiales. En este estudio se trata de conocer la satisfacción de las mujeres víctimas de violencia de género con respecto a las medidas policiales de protección que reciben, especialmente desde su incorporación al Sistema de Seguimiento Integral del Ministerio del Interior (Sistema VioGen. Para ello se actualizó a una versión online un cuestionario de satisfacción utilizado en dos estudios piloto anteriores, recopilándose 1.128 respuestas válidas cumplimentadas por víctimas de violencia de género. La tendencia de respuesta fue consistente en el sentido de que el 80% de las mujeres manifestaron estar muy satisfechas con la actuación policial, con independencia del Cuerpo que las atendía, y facilitaron algunas sugerencias de mejora. Estos resultados sirven como validación del Sistema VioGen

  10. La ruta de señalización del acido salicílico juega un papel importante en la resistencia en tomate a Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) mediada por el gen Mi-1

    OpenAIRE

    Muñiz, Mariano; Rodriguez, C.I.; Kaloshian, I.; Nombela, Gloria

    2009-01-01

    Es bien conocido que la resistencia en tomate a Bemisia tabaci (Gennadius), a Macrosiphum euphorbiae (Thomas) y a tres especies de nematodos formadores de nódulos (Meloidogyne spp.) está mediada por el gen Mi-1. Asimismo, está documentado que el ácido salicílico interviene en los mecanismos de resistencia frente a nematodos formadores de nódulos y áfidos. Recientemente se ha descrito que, en Arabidopsis, el biotipo B de B. tabaci induce defensas activadas por este ácido e inhibe las del ácido...

  11. Análisis de PCR-RFLP del gen de leptina y su asociación con características de la leche en ganado nativo (Bos indicus de Irán

    Directory of Open Access Journals (Sweden)

    Mojtaba Rezaei

    2015-01-01

    Full Text Available Se utilizó una muestra ganadera experimental para la caracterización de los genes y las frecuencias genotípicas y evaluar la asociación entre los polimorfismos de longitud del fragmento de restricción BsaAI en el gen de leptina y las características lácteas. Se recolectaron muestras de sangre de 390 vacas proporcionadas por el censo ganadero de la provincia de Guilán en Irán. La extracción de ADN genómico se basó en el método modificado de precipitación salina. El fragmento de 522 bp que comprende la región parcial del exón 3 e intrón 2 del locus del gen de leptina se amplificó mediante PCR-RFLP e iniciadores específicos. La digestión del fragmento amplificado con la enzima de restricción BsaAI reveló dos alelos de A y B con frecuencias de 0.447 y 0.553, y tres genotipos de AA, AB, BB con frecuencias de 0.185, 0.526 y 0.289 en la población estudiada, respectivamente. El resultado del contenido de polimorfismo fue 0.372 y para heterocigosis 0.526. Los resultados demostraron que la población estudiada estaba en equilibrio Hardy-Weinberg. El análisis estadístico indicó que el polimorfismo LEP- BsaAI tiene un efecto significativo en la producción de leche, porcentaje de grasa y proteína de la leche ( P <0.01. Animales portadores del genotipo heterocigoto (AB produjeron 1.17 y 0.7 kg/d más leche que los animales homocigotos AA y BB, respectivamente. Los animales con el genotipo AA tuvieron mayor grasa (0.28 % y porcentaje de proteína (0.17 % que el genotipo AB. Tales resultados pueden utilizarse como criterios para facilitar la selección genética en los programas de cría animal.

  12. Two Variants in SLC24A5 Are Associated with “Tiger-Eye” Iris Pigmentation in Puerto Rican Paso Fino Horses

    Directory of Open Access Journals (Sweden)

    Maura Mack

    2017-08-01

    Full Text Available A unique eye color, called tiger-eye, segregates in the Puerto Rican Paso Fino (PRPF horse breed and is characterized by a bright yellow, amber, or orange iris. Pedigree analysis identified a simple autosomal recessive mode of inheritance for this trait. A genome-wide association study (GWAS with 24 individuals identified a locus on ECA 1 reaching genome-wide significance (Pcorrected = 1.32 × 10−5. This ECA1 locus harbors the candidate gene, Solute Carrier Family 24 (Sodium/Potassium/Calcium Exchanger, Member 5 (SLC24A5, with known roles in pigmentation in humans, mice, and zebrafish. Humans with compound heterozygous mutations in SLC24A5 have oculocutaneous albinism (OCA type 6 (OCA6, which is characterized by dilute skin, hair, and eye pigmentation, as well as ocular anomalies. Twenty tiger-eye horses were homozygous for a nonsynonymous mutation in exon 2 (p.Phe91Tyr of SLC24A5 (called here Tiger-eye 1, which is predicted to be deleterious to protein function. Additionally, eight of the remaining 12 tiger-eye horses heterozygous for the p.Phe91Tyr variant were also heterozygous for a 628 bp deletion encompassing all of exon 7 of SLC24A5 (c.875-340_1081+82del, which we will call here the Tiger-eye 2 allele. None of the 122 brown-eyed horses were homozygous for either tiger-eye-associated allele or were compound heterozygotes. Further, neither variant was detected in 196 horses from four related breeds not known to have the tiger-eye phenotype. Here, we propose that two mutations in SLC24A5 affect iris pigmentation in tiger-eye PRPF horses. Further, unlike OCA6 in humans, the Tiger-eye 1 mutation in its homozygous state or as a compound heterozygote (Tiger-eye 1/Tiger-eye 2 does not appear to cause ocular anomalies or a change in coat color in the PRPF horse.

  13. Anticipation in a family with primary familial brain calcification caused by an SLC20A2 variant.

    Science.gov (United States)

    Konno, Takuya; Blackburn, Patrick R; Rozen, Todd D; van Gerpen, Jay A; Ross, Owen A; Atwal, Paldeep S; Wszolek, Zbigniew K

    2018-04-11

    To describe a family with primary familial brain calcification (PFBC) due to SLC20A2 variant showing possible genetic anticipation. We conducted historical, genealogical, clinical, and radiologic studies of a family with PFBC. Clinical evaluations including neurological examination and head computed tomography (CT) scans of a proband and her father were performed. They provided additional information regarding other family members. To identify a causative gene variant, we performed whole-exome sequencing for the proband followed by segregation analysis in other affected members using direct sequencing. In this family, nine affected members were identified over four generations. The proband suffered from chronic daily headache including thunderclap headache. We identified an SLC20A2 (c.509delT, p.(Leu170*)) variant in three affected members over three generations. Interestingly, the age of onset became younger as the disease passed through successive generations, suggestive of genetic anticipation. For clinical purpose, it is important to consider thunderclap headache and genetic anticipation in PFBC caused by SLC20A2 variants. Further investigation is required to validate our observation. Copyright © 2018 Polish Neurological Society. Published by Elsevier Urban & Partner Sp. z o.o. All rights reserved.

  14. Association of serotonin transporter (SLC6A4 & receptor (5HTR1A, 5HTR2A polymorphisms with response to treatment with escitalopram in patients with major depressive disorder : A preliminary study

    Directory of Open Access Journals (Sweden)

    Aniruddha Basu

    2015-01-01

    Full Text Available Background & objectives: Genetic factors have potential of predicting response to antidepressants in patients with major depressive disorder (MDD. In this study, an attempt was made to find an association between response to escitalopram in patients with MDD, and serotonin transporter (SLC6A4 and receptor (5HTR1A, 5HTR2A polymorphisms. Methods: Fifty five patients diagnosed as suffering from MDD, were selected for the study. The patients were treated with escitalopram over a period of 6-8 wk. Severity of depression, response to treatment and side effects were assessed using standardised instruments. Genetic variations from HTR1A (rs6295, HTR2A (rs6311 and rs6313 and SLC6A4 (44 base-pair insertion/deletion at 5-HTTLPR were genotyped. The genetic data of the responders and non-responders were compared to assess the role of genetic variants in therapeutic outcome. Results: Thirty six (65.5% patients responded to treatment, and 19 (34.5% had complete remission. No association was observed for genotype and allelic frequencies of single nucleotide polymorphisms (SNPs among remitter/non-remitter and responder/non-responder groups, and six most common side-effects, except memory loss which was significantly associated with rs6311 ( p0 =0.03. Interpretation & conclusions: No significant association was found between the SNPs analysed and response to escitalopram in patients with MDD though a significant association was seen between the side effect of memory loss and rs6311. Studies with larger sample are required to find out genetic basis of antidepressant response in Indian patients.

  15. Revalidacion de Bombax Ceiba L. como especie típica del genero Bombax L. y descripcion de Pseudobombax gen. nov

    Directory of Open Access Journals (Sweden)

    Dugand Armando

    1943-04-01

    Full Text Available En este trabajo se determina por razones históricas que Bombax Ceiba L. es la especie típica del genero Bombax L. y se tipifica dicha especie a su vez sobre Bombax quinatum Jacq. Refútase así la recomendación de B. malabaricum DC. como lectotipo de Bombax. Se propone una nueva definición, sensu maxime strictissimo, de Bombax L. y de B. Ceiba L. fundada en B. quinatum Jacq.; se mencionan los sinónimos conocidos y los ejemplares botánicos examinados. Esta tipificación causa una completa alteración del concepto genérico de Bombax por cuanto B. quinatum ha sido considerado generalmente como representativo de un género intermedio (Bombacopsis Pittier cuya definición sistemática resulta ahora justamente aplicable al genera linneano. Por consiguiente es necesario hacer un ajuste nomenclatural y se propone una nueva denominación genérica (Pseudobombax Dugand que abarca, por lo pronto, tres especies: septenatum Jacq. (como tipo , ellipticum HBK. y Palmeri S. Wats., antes considerados como verdaderos Bombax. La preparación de este estudio fue realizada en su mayor parte compilando numerosos datos históricos en las bibliotecas del Arnold Arboretum y del Gray Herbarium, merced a las prerrogativas que me fueron generosamente concedidas por la Universidad de Harvard al designarme Research Fellow del Arnold Arboretum durante la visita que hice recientemente a varias instituciones botanicas de los Estados Unidos como invitado del Comité de Relaciones Artísticas e Intelectuales Inter-Americanas.

  16. Tetralogía de Fallot asociada a duplicación distal del brazo largo del cromosoma 11

    Directory of Open Access Journals (Sweden)

    Elodia Torres

    2015-04-01

    Full Text Available La tetralogía de Fallot es una cardiopatía frecuente y puede representar hasta el 11 al 13% de todas las cardiopatías congénitas clínicas, se presenta en 1 de cada 8.500 nacidos vivos. En la mayoría de los casos, se asocia a una microdeleción del cromosoma 22 y con menor frecuencia al síndrome de Down. El síndrome de la dup 11q es una anomalía cromosómica causada por la duplicación de la porción distal del extremo del brazo largo del cromosoma 11, ocasionando una trisomía parcial del mismo, producto de un desbalance cromosómico, con disfunción de los genes involucrados en este material genético adicional que ocasiona anormalidades tanto físicas como mentales en un recién nacido. Se presenta el caso de un niño de 3 meses de vida que es derivado a la consulta genética por fenotipo sindromático, Tetralogía de Fallot y retraso del crecimiento. El estudio citogenético se realizó en sangre periférica, los cromosomas fueron procesados con técnicas de tinción convencional, bandas de alta resolución y centroméricas, observándose una duplicación 11q. Cariotipo: 46, XY, dup11 (q23àqter. Se enfatiza la importancia del estudio cromosómico en recién nacidos con malformaciones congénitas mayores para el diagnóstico de certeza y posterior asesoramiento genético a los progenitores.

  17. Evaluación del potencial de mejoramiento genético en el crecimiento en altura de Acacia mangium Willd.

    Directory of Open Access Journals (Sweden)

    Iván Javier Pastrana-Vargas

    2012-04-01

    Full Text Available En el periodo 2009-2010, en Ayapel, Planeta Rica y Tierralta, departamento de Córdoba (Colombia se evaluó el desempeño en crecimiento en altura total de 90 familias de polinización abierta de Acacia mangium. En estos municipios el clima se clasifica, de acuerdo con Holdridge, como bosque seco tropical (Bs-T, excepto Tierralta que es bosque húmedo tropical (Bh-T. Durante el primer año de crecimiento, las plantas en cada familia fueron evaluadas en ensayos de progenie mediante un diseño experimental de bloques completos al azar, con seis bloques en cada una de las tres localidades. La parcela o unidad experimental consistió en seis plantas de polinización abierta por familia, distribuidas aleatoriamente en tres parejas espacialmente separadas dentro de cada bloque. La predicción de parámetros genéticos individuales y de familias se efectuó por medio del procedimiento BLUP y los componentes de varianza por medio del procedimiento REML utilizando el software SELEGEN. Las estimaciones de heredabilidad variaron entre <1 y 13%, y entre 6 y 68%, para heredabilidad individual en sentido estricto (h²a y heredabilidad media de familias (h²mp, respectivamente. El ranking genético en altura de las 15 mejores familias indica que las de mayor crecimiento fueron también las más estables y de mayor adaptabilidad a los ambientes. Los resultados sugieren un alto potencial de mejoramiento al nivel de familia en crecimiento y productividad de plantaciones de A. mangium en el departamento de Córdoba, Colombia. Son necesarios nuevos estudios a fin de lograr una mejor selección genética.

  18. Family-Based Association Study Between SLC2A1, HK1, and LEPR Polymorphisms With Myelomeningocele in Chile

    Science.gov (United States)

    Suazo, José; Castillo, Silvia; Martin, Luz Maria; Rojas, Francisca; Santos, José Luis; Rotter, Karin; Solar, Margarita; Tapia, Eva

    2013-01-01

    Obese/diabetic mothers present a higher risk to develop offspring with myelomeningocele (MM), evidence supporting the role of energy homeostasis-related genes in neural tube defects. Using polymerase chain reaction–restriction fragment length polymorphism, we have genotyped SLC2A1, HK1, and LEPR single-nucleotide polymorphisms in 105 Chilean patients with MM and their parents in order to evaluate allele–phenotype associations by means of allele/haplotype transmission test (TDT) and parent-of-origin effects. We detected an undertransmission for the SLC2A1 haplotype T-A (rs710218-rs2229682; P = .040), which was not significant when only lower MM (90% of the cases) was analyzed. In addition, the leptin receptor rs1137100 G allele showed a significant increase in the risk of MM for maternal-derived alleles in the whole sample (2.43-fold; P = .038) and in lower MM (3.20-fold; P = .014). Our results support the role of genes involved in energy homeostasis in the risk of developing MM, thus sustaining the hypothesis of diverse pathways and genetic mechanisms acting in the expression of such birth defect. PMID:23427181

  19. Trastornos generalizados del desarrollo: Aspectos clínicos y genéticos Pervasive developmental disorders: Clinical and genetics aspects

    Directory of Open Access Journals (Sweden)

    Víctor Ruggieri

    2007-01-01

    Full Text Available Los Trastornos Generalizados del Desarrollo se expresan con compromiso en la socialización, trastorno en el desarrollo del lenguaje (verbal y no verbal e intereses restringidos con conductas repetitivas. La frecuencia estimada en la población general es de 27.5/10.000. En nuestro trabajo analizamos los aspectos clínicos y genéticos de los TGD: Autismo, Síndrome de Asperger, TGD no Especificado, Síndrome de Rett y Trastorno desintegrativo de la niñez. Desde el punto de vista clínico jerarquizamos los aspectos conductuales para su reconocimiento. En los aspectos genéticos puntualizamos diversas entidades con las que se asocian consistentemente estos trastornos, denominados cuadros sindrómicos, (aproximadamente el 20% de los casos y las bases genéticas actualmente propuestas para el 80% restante o formas no sindrómicas. El reconocimiento temprano de estos trastornos del desarrollo y el diagnóstico de una entidad específica asociada permiten un temprano y adecuado abordaje terapéutico, un correcto asesoramiento genético y un control evolutivo específico previendo posibles complicaciones relacionadas a la entidad de base. Finalmente, si bien las bases genéticas del autismo no están identificadas se han propuesto diversos genes candidatos ubicados en los cromosomas: 15q, 2q, 17q, 7q, 12q, y los relacionados al X, entre otros, los que son analizados en este trabajo y permitirán en un futuro cercano comprender mejor estos trastornos.Pervasive developmental disorders (PDD encompass a heterogeneous group of children with deficits of verbal and non-verbal language, social communication, and with a restricted repertoire of activities or repetitive behaviours. The frequency in general population is considered 27.5/10,000. In this study, we analyzed the clinical and genetic aspects of Autism, Asperger Syndrome, PDD Not Otherwise Specified, Rett Syndrome and Childhood Disintegrative Disorder. We analyzed clinical, behavioural and

  20. Manipulación genética de seres humanos

    Directory of Open Access Journals (Sweden)

    Manuel Santos Alcántara

    2006-08-01

    Full Text Available El gran avance que ha tenido la Genética en los últimos años y, particularmente, aquello relacionado con el desciframiento del genoma humano, ha traído a la discusión pública la posibilidad concreta de manipular genéticamente a los seres humanos. El mejoramiento o perfeccionamiento genético de los seres humanos, denominado eugenesia, actualmente se ha convertido técnicamente en una realidad, motivando una profunda reflexión de tipo ético. La pregunta básica es la siguiente: aquello que es técnicamente posible de realizar ¿es ético hacerlo? ¿Tienen derecho los padres a acceder a la tecnología genética para mejorar las características de sus hijos? En este artículo se revisan las bases científicas del mejoramiento genético de los seres humanos, y se plantean los cuestionamientos éticos más relevantes derivados de esta manipulación.

  1. Caracterización clínica, bioquímica y de neuroimagen de la enfermedad de Parkinson asociada a mutaciones del gen LRRK2 y de su fase prodrómica

    OpenAIRE

    Vilas Rolán, Dolores

    2016-01-01

    La presente memoria se basa en cuatro trabajos que pertenecen a una misma línea de estudio: el estudio de la enfermedad de Parkinson asociada a mutaciones del gen LRRK2 (EP-LRRK2) . En primer lugar, se ha estudiado la EP-LRRK2 desde un punto de vista clínico, centrándonos en los síntomas no motores. En segundo lugar se ha realizado un estudio a través de la sonografía transcraneal en portadores de la mutación G2019S del gen LRRK2 , tanto pacientes con enfermedad de Parkinson como portadores a...

  2. Variantes del ADNmt en isleños del lago Titicaca: máxima frecuencia del haplotipo B1 y evidencia de efecto fundador

    Directory of Open Access Journals (Sweden)

    José Sandoval

    2013-06-01

    Full Text Available Los polimorfismos del ADN mitocondrial son herramientas en el estudio comparativo de poblaciones modernas y antiguas. Entre los más usados están los haplotipos mitocondriales basados en RFLP (polimorfismo de longitud de fragmentos de restricción y un sistema de inserción /deleción. El presente estudio establece la frecuencia de estos haplotipos y compara un total de 144 individuos representativos de las islas Taquile y Amantaní (lengua quechua y de las islas de Los Uros y Anapia (lengua aymara del lago Titicaca, Perú. Nuestros resultados revelan la predominancia del haplotipo B1: 100% en Taquile (n=57; 88,6% en Amantaní (n=35; 75% en Los Uros (n=28 y 87,5% en Anapia (n=24, siendo las frecuencias más altas registradas en el mundo. Otros haplotipos se observan en menor proporción: 17,9% de A2 y 7,1% de D1 en Los Uros; 11,4% de la variante C1 en Amantaní; 4,2% de cada haplotipo C1, C2 y D1 en Anapia. La alta frecuencia de B1 indica que las poblaciones de Taquile, Amantaní y Anapia provienen de un grupo fundador reducido. Aunque hay afinidad entre las poblaciones aymaras de Anapia y Los Uros; la proporción de algunos alelos en los últimos, sugiere la persistencia de un acervo genético uru en contraposición a la idea de su extinción.

  3. Population genetic structure revealed by a school of the freshwatermigratory fish, Brycon hilarii Estructura genética poblacional revelada por un cardumen del pez migratorio de agua dulce, Brycon hilarii

    Directory of Open Access Journals (Sweden)

    Alexandra Sanches

    2012-07-01

    Full Text Available It is believed that different genetic populations of migratory fishes can co-exist in a single hydrographic system. Although different populations may occupy and explore the river together, they segregate during the spawning season and consequently the population genetic structuring is maintained. Genetic variation of a Brycon hilarii spawning school and samples from different collection sites in the Miranda River basin were surveyed using seven microsatellites. Population structuring was revealed by a significant differentiation of the spawning school related to the supposed local populations. The genetic differentiation detected may be supported by behavior during the reproductive season that promotes the maintenance of the genetic integrity of different populations. These data may contribute toward the understanding of the behavior and biology of these fish as well as fishery management and species conservation programs.Se ha documentado que diferentes poblaciones genéticas de peces migratorios pueden coexistir en un único sistema hidrográfico. Diferentes poblaciones pueden ocupar y explorar el río juntas, pero se segregan durante la temporada de desove y consecuentemente la estructuración genética poblacional se mantiene. La diversidad genética de un cardumen reproductivo de Brycon hilarii y muestras de diferentes sitios en la cuenca del Río Miranda fueron analizadas mediante siete microsatélites. La estructura poblacional fue revelada por una diferenciación genética significativa del cardumen reproductivo con las muestras de las poblaciones locales. La diferenciación genética detectada puede ser resultado de un probable comportamiento durante la temporada reproductiva, que promueve el mantenimiento de la integridad genética de las diferentes poblaciones. Estos datos pueden contribuir a la comprensión del comportamiento y biología de estos peces, así como amparar programas de gestión de la pesca y conservación de las

  4. Inorganic phosphorus (Pi) in CSF is a biomarker for SLC20A2-associated idiopathic basal ganglia calcification (IBGC1).

    Science.gov (United States)

    Hozumi, Isao; Kurita, Hisaka; Ozawa, Kazuhiro; Furuta, Nobuyuki; Inden, Masatoshi; Sekine, Shin-Ichiro; Yamada, Megumi; Hayashi, Yuichi; Kimura, Akio; Inuzuka, Takashi; Seishima, Mitsuru

    2018-05-15

    Idiopathic basal ganglia calcification (IBGC), also called Fahr's disease or recently primary familial brain calcification (PFBC), is characterized by abnormal deposits of minerals including calcium mainly and phosphate in the brain. Mutations in SLC20A2 (IBGC1 (merged with former IBGC2 and IBGC3)), which encodes PiT-2, a phosphate transporter, is the major cause of IBGC. Recently, Slc20a2-KO mice have been showed to have elevated levels of inorganic phosphorus (Pi) in cerebrospinal fluid (CSF); however, CSF Pi levels in patients with IBGC have not been fully examined. We investigated the cases of 29 patients with IBGC including six patients with SLC20A2 mutation and three patients with PDGFB mutation, and 13 controls. The levels of sodium (Na), potassium (K), chloride (Cl), calcium (Ca), and Pi in sera and CSF were determined by potentiometry and colorimetry. Moreover, clinical manifestations were investigated in the IBGC patients with high Pi levels in CSF. The study revealed that the average level of Pi in the CSF of the total group of patients with IBGC is significantly higher than that of the control group, and the levels of Pi in CSF of the IBGC patients with SLC20A2 mutations are significantly higher than those of the IBGC patients with PDGFB mutations, the other IBGC patients and controls. Results of this study suggest that the levels of CSF Pi will be a good biomarker for IBGC1. Copyright © 2018 Elsevier B.V. All rights reserved.

  5. A calorimeter software trigger for the Mark II detector at SLC [Stanford Linear Collider

    International Nuclear Information System (INIS)

    Briggs, D.; Glanzman, T.; Grosse-Wiesmann, P.; Tinsman, J.; Holmgren, S.; Schaad, M.W.

    1989-04-01

    A new FASTBUS-based calorimeter software trigger for the upgraded Mark II at the Stanford Linear Collider (SLC) is presented. The trigger requirements for SLC and a short description of the hardware used for this purpose are given, followed by a detailed description of the software. Some preliminary results are presented. 9 refs., 4 figs

  6. Contribuciones de Sir Roland Fisher a la Estadística Genética

    Directory of Open Access Journals (Sweden)

    Jaime Cuadros

    2004-11-01

    Full Text Available Sir Ronald Fisher (18901962 fue profesor de genética y muchas de sus innovaciones estadísticas encontraron expresión en el desarrollo de metodología en estadística genética. Sin embargo, mientras sus contribuciones en estadística matemática son fácilmente identificadas, en genética de poblaciones compartió su supremacía con Sewall Wright (1889 1988 y J. S. S. Haldane (1892 1965. Este documento muestra algunas de las mejores contribuciones de Fisher a las bases de la estadística genética, y sus interacciones con Wright y Haldane, los cuales contribuyeron al desarrollo del tema. Con la tecnología moderna, tanto la metodología la estadística como la información genética están cambiando. No obstante, muchos de los trabajos de Fisher permanecen relevantes, y pueden aun servir como una base para investigaciones futuras en el análisis estadístico de datos de DNA. El trabajo de este autor refleja su visión del papel de Ia estadística en Ia inferencia científica expresada en 1949

  7. Polimorfismos genéticos de aislamientos del género Malassezia obtenidos en Colombia de pacientes con lesión dermatológica y sin ella.

    Directory of Open Access Journals (Sweden)

    Adriana M. Celis

    2005-12-01

    Full Text Available Introducción. Las especies del género Malassezia se consideran levaduras oportunistas emergentes de gran importancia. Han sido asociadas a diferentes patologías dermatológicas y sistémicas de las cuales se aislan una o más especies de este género. El papel de estas levaduras en las enfermedades dermatológicas no se ha aclarado completamente, ya que la Malassezia spp. pertenece a la flora normal de la piel. Objetivo. Buscar marcadores genéticos en los aislamientos de Malassezia spp. que permitan correlacionar las lesiones dermatológicas con las especies aisladas. Materiales y métodos. Se obtuvieron 103 aislamientos de Malassezia spp. a partir de muestras de pacientes con pitiriasis versicolor, dermatitis seborreica, dermatitis seborreica en pacientes positivos para VIH, dermatitis atópica, y de individuos sanos. Para los controles se usaron ocho cepas del Centraalbureau voor Schimmelcultures (CBS, Holanda. El perfil genético se realizó utilizando la técnica de ADN polimórfico amplificado aleatorio (RAPD con tres iniciadores (OPA2, OPA4, OPA13. Los datos obtenidos se analizaron con los programas Diversity Database y SYN-TAX-PC. Resultados. Se observó heterogeneidad genética intraespecífica en Malassezia furfur, Malassezia globosa, Malassezia restricta, Malassezia slooffiae y Malassezia obtusa, mientras que Malassezia sympodialis mostró mayor homogeneidad. Conclusión. No se determinó ningún patrón genético específico mediante la técnica de RAPD para las especies de Malassezia que se pudiera relacionar con la entidad dermatológica implicada.

  8. Estimación de parámetros genéticos para características productivas y reproductivas en los sistemas doble propósito del trópico bajo colombiano

    Directory of Open Access Journals (Sweden)

    A. P. Galeano

    2010-01-01

    Full Text Available Con el objetivo de estimar los componentes de varianza, las heredabilidades, repetibilidades y correlaciones genéticas y fenotípicas para la producción de leche por lactancia (PL, el peso al destete (PD, el intervalo entre partos (IEP y el Índice de Vaca (IV, de las hembras bovinas manejadas en los sistemas de producción de doble propósito del trópico bajo colombiano, se analizaron los registros productivos y reproductivos de 1.687 vacas registradas en la Asociación Colombiana de Criadores de Ganado en Doble Propósito (Asodoble, durante el periodo comprendido entre 1998 y 2007. Se empleó un modelo animal mixto que incluyó los efectos fijos del grupo contemporáneo (finca-sexo-época-año, la composición racial, y la duración de la lactancia como covariable; así como los efectos genéticos aleatorios del animal, el medio ambiente permanente y el residual. Las heredabilidades estimadas para IEP (0,04 y PD (0,11 fueron bajas, y moderadas para PL (0,35 e IV (0,24, respectivamente. La repetibilidad estimada para IEP fue baja (0,08, y para PL (0,41 e IV (0,31 moderada; en el caso de PD este valor fue igual a la heredabilidad (0,11. Las correlaciones genéticas y fenotípicas obtenidas entre PL y PD con respecto a IEP fueron positivas, y se determinó una asociación genética negativa entre PL y PD. Los resultados demostraron que el IV es un buen indicador, desde el punto de vista genético, de la eficiencia productiva y reproductiva de los animales manejados en estos sistemas productivos.

  9. SLC and SLD: Experimental experience with a linear collider

    International Nuclear Information System (INIS)

    Breidenbach, M.

    1993-08-01

    The SLAC Linear Collider (SLC) is the prototype e + e - linear collider. This talk will consist of an introduction to SLC, a description of the strategy for luminosity, a description of the systems for the transport and measurement of the polarized electrons, and a description of the present performance of the SLC and planned upgrades. The detector, SLD, and the status of the polarization asymmetry measurement A LR will be described

  10. Implicaciones del estudio de inestabilidad del ciclo celular en la biología del cáncer.

    OpenAIRE

    Luis Tume-Farfán

    2014-01-01

    Todas las células poseen mecanismos para mantener la integridad genómica que es vital para la supervivencia celular y la proliferación. Las células se dividen a tasas normale s durante su tiempo de vida, cuando esta tasa sobrepasa los límites normales ocurren alteraciones a nivel genético que afectan el control del ciclo celular por lo tanto estas células crecen y se dividen sin control y ya no responden a señalización extrace lular que indica la detención del ciclo y la apoptosis, estos meca...

  11. Polimorfismo inserción/deleción del gen de la enzima convertidora de angiontensina y enfermedad coronaria en la población de Montería, Córdoba

    Directory of Open Access Journals (Sweden)

    Manolo I Jaramillo

    2013-09-01

    Full Text Available Antecedentes y objetivo: el polimorfismo inserción/deleción del gen de la enzima convertidora de angiotensina, ha sido identificado como un potente factor de riesgo de enfermedad coronaria. Para la población de Montería se desconocen las frecuencias con las que se expresan los alelos de este gen y el carácter de su interacción con condiciones de riesgo cardiovascular. El objetivo de este trabajo fue determinar, para dicha población, la asociación de este polimorfismo y el riesgo de sufrir enfermedad coronaria. Método: se llevó a cabo un estudio retrospectivo con 70 casos y 70 controles; como casos se consideraron pacientes con padecimientos coronarios confirmados por electrocardiograma, remitidos a la Organización Cardiodiagnóstico de Córdoba, y como controles individuos voluntarios sin antecedentes cardiovasculares y sin relación filial. El ADN requerido se extrajo a partir de sangre periférica. La caracterización del polimorfismo se hizo mediante reacción en cadena de la polimerasa. Resultados: la distribución de genotipos de la enzima convertidora de angiotensina en pacientes casos no fue significativamente diferente a la estimada en pacientes controles (X2=3.687, p=0,1583. El genotipo más frecuente en la población fue ID (40,72%. En el grupo casos, el genotipo II fue más frecuente que el genotipo DD comparado con el grupo control (p<0,05. El modelo de regresión logística múltiple ajustado, indicó no significancia del genotipo DD como factor de riesgo coronario (razón de disparidad = 0,51 IC95% = 0,25 – 1,06. Conclusión: el polimorfismo I/D del gen de la enzima convertidora de angiotensina no mostró ser un factor de riesgo significativo para enfermedad coronaria en la población de Montería.

  12. Upregulation of the Creatine Transporter Slc6A8 by Klotho

    Directory of Open Access Journals (Sweden)

    Ahmad Almilaji

    2014-11-01

    Full Text Available Background/Aims: The transmembrane Klotho protein contributes to inhibition of 1,25(OH2D3 formation. The extracellular domain of Klotho protein could function as an enzyme with e.g. β-glucuronidase activity, be cleaved off and be released into blood and cerebrospinal fluid. Klotho regulates several cellular transporters. Klotho protein deficiency accelerates the appearance of age related disorders including neurodegeneration and muscle wasting and eventually leads to premature death. The main site of Klotho protein expression is the kidney. Klotho protein is also appreciably expressed in other tissues including chorioid plexus. The present study explored the effect of Klotho protein on the creatine transporter CreaT (Slc6A8, which participates in the maintenance of neuronal function and survival. Methods: To this end cRNA encoding Slc6A8 was injected into Xenopus oocytes with and without additional injection of cRNA encoding Klotho protein. Creatine transporter CreaT (Slc6A8 activity was estimated from creatine induced current determined by two-electrode voltage-clamp. Results: Coexpression of Klotho protein significantly increased creatine-induced current in Slc6A8 expressing Xenopus oocytes. Coexpression of Klotho protein delayed the decline of creatine induced current following inhibition of carrier insertion into the cell membrane by brefeldin A (5 µM. The increase of creatine induced current by coexpression of Klotho protein in Slc6A8 expressing Xenopus oocytes was reversed by β-glucuronidase inhibitor (DSAL. Similarly, treatment of Slc6A8 expressing Xenopus oocytes with recombinant human alpha Klotho protein significantly increased creatine induced current. Conclusion: Klotho protein up-regulates the activity of creatine transporter CreaT (Slc6A8 by stabilizing the carrier protein in the cell membrane, an effect requiring β-glucuronidase activity of Klotho protein.

  13. Las competencias genéricas del estudiante y la influencia en su nivel de emprendimiento en la Facultad de Ciencias Empresariales de la Universidad Alas Peruanas – Filial Tacna

    OpenAIRE

    Eyzaguirre Mazuelos, Néstor Guido

    2014-01-01

    La presente tesis tuvo como objetivo principal determinar la influencia de las competencias genéricas del estudiante sobre su nivel de emprendimiento en la Facultad de Ciencias Empresariales de la Universidad Alas Peruanas – Filial Tacna, en el año 2013; para lo cual, se trabajó con una muestra de 150 estudiantes de las 03 Escuelas Profesionales; se encontró que existe una relación directa y significativa entre los indicadores de las competencias genéricas del estudiante y los indicadores de ...

  14. Justicia en salud y genética

    Directory of Open Access Journals (Sweden)

    Maria Graciela De Ortuzar

    2014-06-01

    Full Text Available Las expectativas puestas en el conocimiento genético exceden el ámbito de la medicina tradiciona, debido a que la intervención directa en la lotería natural demandaría el replanteamiento de conceptos centrales de justicia en salud: necesidades médicas, enfermedad, normalidad, e igualdad de oportunidades en el acceso a la salud. El punto en debate es sí el replanteo de dichos conceptos conlleva un cambio radical en las teorías de justicia (libertariana y/o liberal, mostrando su obsolescencia, o sí simplemente se requiere ampliar dichos conceptos claves por fallas estructurales en las mismas teorías. Como hipótesis general considero que los supuestos cuestionamientos, lejos de socavar las bases de las teorías de justicia, sólo ponen en evidencia sus viejos problemas estructurales. Por razones expositivas, dividiré la presentación tres partes. En la Primera parte, analizo la teoría libertariana, estudiando las contradicciones del modelo a través del impacto de la información genética en el seguro privado de salud. En la Segunda Parte, desarrollo la propuesta alternativa liberal rawlsianadanielsiana del modelo de seguro público, evaluando las implicaciones de la genética a partir de la crítica de su concepto biológico de enfermedad y su restricción al acceso a la salud por necesidades naturales. En la Tercera parte presento un modelo integral de necesidades y capacidades básicas, comprendiendo la prevención, el tratamiento y el mejoramiento moralmente permisible (genético y no genético.Mi aporte principal consiste en la elaboración de este modelo normativo integral de necesidades y capacidades para la regulación conjunta de la información y terapia genética con los restantes problemas de salud.

  15. SLC6A1 gene involvement in susceptibility to attention-deficit/hyperactivity disorder: A case-control study and gene-environment interaction.

    Science.gov (United States)

    Yuan, Fang-Fen; Gu, Xue; Huang, Xin; Zhong, Yan; Wu, Jing

    2017-07-03

    Attention-deficit/hyperactivity disorder (ADHD) is an early onset childhood neurodevelopmental disorder with an estimated heritability of approximately 76%. We conducted a case-control study to explore the role of the SLC6A1 gene in ADHD. The genotypes of eight variants were determined using Sequenom MassARRAY technology. The participants in the study were 302 children with ADHD and 411 controls. ADHD symptoms were assessed using the Conners Parent Symptom Questionnaire. In our study, rs2944366 was consistently shown to be associated with the ADHD risk in the dominant model (odds ratio [OR]=0.554, 95% confidence interval [CI]=0.404-0.760), and nominally associated with Hyperactive index score (P=0.027). In addition, rs1170695 has been found to be associated with the ADHD risk in the addictive model (OR=1.457, 95%CI=1.173-1.809), while rs9990174 was associated with the Hyperactive index score (P=0.010). Intriguingly, gene-environmental interactions analysis consistently revealed the potential interactions of rs1170695 with blood lead (P mul =0.044) to modify the ADHD risk. Expression quantitative trait loci analysis suggested that these positive single nucleotide polymorphisms (SNPs) may mediate SLC6A1 gene expression. Therefore, our results suggest that selected SLC6A1 gene variants may have a significant effect on the ADHD risk. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Is tumor necrosis factor - 376a promoter polymorphism associated with susceptibility to multiple sclerosis? ¿El polimorfismo-376A del promotor del gen del factor de necrosis tumoral se asocia con una mayor susceptibilidad a padecer esclerosis múltiple?

    Directory of Open Access Journals (Sweden)

    Marcelo A. Kauffman

    2007-10-01

    Full Text Available A single nucleotide polymorphism (SNP at position -376 of the tumor necrosis factor á gene (TNFA has been associated with susceptibility to multiple sclerosis (MS in Spain. However, no association was found in populations from the USA and The Netherlands. Here we investigate the association between the TNFA - 376A SNP and MS susceptibility in Argentinean patients with MS. The A/G genotype was found in 4.4% of patients (n=90 and in 4.8% of healthy individuals (n=84; p=0.92; odds ratio=0.93; confidence interval: 0.23- 3.84. Thus, no significant differences in genotype and allele frequencies were found between healthy individuals and patients with MS in Argentina.Un polimorfismo de nucleótido único (SNP, por sus iniciales en inglés en la posición -376 del gen codificante del factor de necrosis tumoral á (TNFA ha sido asociado en España con un mayor riesgo a padecer esclerosis múltiple (EM. Sin embargo, esta asociación no fue encontrada en estudios hechos en poblaciones provenientes de los EE.UU. y Holanda. Aquí investigamos la asociación entre el SNP TNFA -376A y el desarrollo de EM en una población de pacientes argentinos con EM. El genotipo A/G fue encontrado en 4.4% de los pacientes (n=90 y en 4.8% de los controles sanos (n=84; p=0.92; odds ratio=0.93; intervalo de confianza: 0.23-3.84. En consecuencia, no encontramos diferencias en las frecuencias alélicas y genotípicas entre los sujetos enfermos y los controles sanos en Argentina.

  17. Aspectos genéticos da escoliose idiopática do adolescente Aspectos genéticos de la escoliosis idiopática del adolescente Genetic aspects of the adolescent idiopathic scoliosis

    Directory of Open Access Journals (Sweden)

    Marcelo Wajchenberg

    2012-09-01

    Full Text Available A escoliose idiopática do adolescente é uma doença frequente e sua etiologia permanece obscura. Várias hipóteses foram formuladas, entre elas a possibilidade da transmissão genética. Estudos na literatura procuraram analisar a prevalência da doença em determinadas populações, as possíveis formas de transmissão, a localização dos genes responsáveis e as variações de determinados genes (polimorfismos que podem influenciar o desenvolvimento da deformidade. O objetivo deste artigo é revisar e atualizar os conceitos sobre a influência genética na etiologia da escoliose idiopática do adolescente.La escoliosis idiopática del adolescente es una enfermedad frecuente y su etiología continúa siendo obscura. Varias hipótesis fueron elaboradas, entre ellas, la posibilidad de la transmisión genética. Los estudios en la literatura procuraron analizar la prevalencia de la enfermedad en determinadas poblaciones, las posibles formas de transmisión, la localización de los genes responsables y las variaciones de genes específicos (polimorfismos que pueden influenciar en el desarrollo de la deformidad. El objetivo de este artículo es revisar y actualizar los conceptos sobre la influencia genética en la etiología de la escoliosis idiopática del adolescente.The adolescent idiopathic scoliosis is a common disease and its etiology remains unclear. Several hypotheses have been devised, including the possibility of genetic transmission. Studies in the literature have examined the prevalence of the disease in certain populations, the possible modes of transmission, the location of genes and variations of certain genes (polymorphisms that may influence the development of the deformity. This article intends to review and update the concepts of genetic influence in the etiology of adolescent idiopathic scoliosis.

  18. Tròpics de Shakespeare : orígens i originalitat del Hamlet català

    OpenAIRE

    Buffery, Helena

    2009-01-01

    Hamlet és una de les obres que més ha inspirat autors, actors, directors i dramaturgs catalans. De fet, es podria dir, com en altres cultures europees, que és l'obra que determina tota traducció i representació posterior de Shakespeare, i que marca els orígens de la seva influència en la tradició cultural europea. Aquest article presenta la història retòrica del Hamlet català mitjançant les traduccions, les adaptacions i altres formes de reescritura de l'obra, a més de la seva representació t...

  19. Flat beams in the SLC

    International Nuclear Information System (INIS)

    Adolphsen, C.; Barklow, T.; Burke, D.; Decker, F.J.; Emma, P.; Hildreth, M.; Himel, T.; Krejcik, P.; Limberg, T.; Minty, M.

    1993-01-01

    The Stanford Linear Collider was designed to operate with round beams; horizontal and vertical emittance made equal in the damping rings. The main motivation was to facilitate the optical matching through beam lines with strong coupling elements like the solenoid spin rotator magnets and the SLC arcs. Tests in 1992 showed that open-quote flat close-quote beams with a vertical to horizontal emittance ratio of around 1/10 can be successfully delivered to the end of the linac. Techniques developed to measure and control the coupling of the SLC arcs allow These beams to be transported to the Interaction Point (IP). Before flat beams could be used for collisions with polarized electrons, a new method of rotating the electron spin orientation with vertical arc orbit bumps had to be developed. Early in the 1993 run, the SLC was switched to open-quote flat close-quote beam operation. Within a short time the peak luminosity of the previous running cycle was reached and then surpassed. The average daily luminosity is now a factor of about two higher than the best achieved last year. In the following the authors present an overview of the problems encountered and their solutions for different parts of the SLC

  20. Enfermedades genéticas del ADN mitocondrial humano Genetic diseases of the mitochondrial DNA

    Directory of Open Access Journals (Sweden)

    Abelardo Solano

    2001-04-01

    Full Text Available Las enfermedades mitocondriales son un grupo de trastornos que están producidos por un fallo en el sistema de fosforilación oxidativa (sistema Oxphos, la ruta final del metabolismo energético mitocondrial, con la consiguiente deficiencia en la biosíntesis del trifosfato de adenosina (ATP, por sus siglas en inglés. Parte de los polipéptidos que componen este sistema están codificados en el ácido desoxirribonucleico (DNA mitocondrial y, en los últimos años, se han descrito mutaciones que se han asociado con síndromes clínicos bien definidos. Las características genéticas del DNA mitocondrial, herencia materna, poliplasmia y segregación mitótica, confieren a estas enfermedades propiedades muy particulares. Las manifestaciones clínicas de estas enfermedades son muy heterogéneas y afectan a distintos órganos y tejidos por lo que su correcto diagnóstico implica la obtención de datos clínicos, morfológicos, bioquímicos y genéticos. El texto completo en inglés de este artículo está disponible en: http://www.insp.mx/salud/index.htmlMitochondrial diseases are a group of disorders produced by defects in the oxidative phosphorylation system (Oxphos system, the final pathway of the mitochondrial energetic metabolism, resulting in a deficiency of the biosynthesis of ATP. Part of the polypeptide subunits involved in the Oxphos system are codified by the mitochondrial DNA. In the last years, mutations in this genetic system have been described and associated to well defined clinical syndromes. The clinical features of these disorders are very heterogeneous affecting, in most cases, to different organs and tissues and their correct diagnosis require precise clinical, morphological, biochemical and genetic data. The peculiar genetic characteristics of the mitochondrial DNA (maternal inheritance, polyplasmia and mitotic segregation give to these disorders very distinctive properties. The English version of this paper is available at

  1. Susceptibilidad genética y riesgo de cáncer gástrico en una población del Cauca.

    Directory of Open Access Journals (Sweden)

    María M. Torres

    2004-06-01

    Full Text Available El cáncer gástrico es la principal causa de mortalidad por cáncer en Colombia. El riesgo de desarrollar cáncer gástrico se ha asociado con factores ambientales y con la infección por Helicobacter pylori. Las enzimas glutatión-S-transferasas están involucradas en la desintoxicación de varios carcinógenos ambientales. Las deleciones homocigóticas de glutatión-S-transferasa M1 (GSTM1-0 y glutatión-S-transferasa T1 (GSTT1-0 se han asociado con algunos tipos de cáncer. Los niveles del factor de necrosis tumoral (FNT ? están aumentados en pacientes infectados por H. pylori. Una transición G/A en la posición -308 del promotor del FNT-? se ha visto relacionada en algunos estudios con un incremento en la expresión del gen, y está asociada con la susceptibilidad a cáncer gástrico. Se investigó la asociación de estos polimorfismos con cáncer gástrico y la interacción con otros factores de riesgo (estilo de vida. Se obtuvieron muestras de sangre de 46 pacientes con cáncer gástrico y 96 controles. Se empleó el modelo de regresión logística para obtener la razón de posibilidades (OR y sus intervalos de confianza del 95% y, así, establecer la asociación entre los polimorfismos enzimáticos y el cáncer gástrico, y entre otros factores independientes y esta enfermedad. Las frecuencias de los polimorfismos de deleción en pacientes y controles fueron: para la GSTM1, 65,2% y 37,5%, y para la GSTT1, 17,4% y 14,6%, respectivamente. La frecuencia del polimorfismo G/A del FNT ? en las personas infectadas con H. pylori fue de 18% en la población con cáncer gástrico y de 7% en el grupo control. Nuestros resultados sugieren que el polimorfismo de deleción de GSTM1 puede estar asociado con un riesgo aumentado de cáncer gástrico (OR 5,5; IC95%, 1,7-17,2. Igualmente, nuestros datos muestran que otros factores de riesgo como la infección por H. pylori y el consumo de cigarrillo y alcohol están asociados con este tipo de cáncer (OR

  2. Impact of genetic polymorphisms of SLC2A2, SLC2A5, and KHK on metabolic phenotypes in hypertensive individuals.

    Directory of Open Access Journals (Sweden)

    MyPhuong T Le

    Full Text Available In the past few decades, consumption of added sugars has increased dramatically. Studies have linked high sugar intake with increased risk for a number of diseases. Importantly, fructose, a component of sugar, has been linked with the development of features of metabolic syndrome. This study determined if single nucleotide polymorphisms in genes involved in fructose transport (solute carrier family 2 facilitated glucose transporter, member 2 (SLC2A2 and solute carrier family 2 facilitated glucose/fructose transporter, member 5 (SLC2A5 and metabolism (ketohexokinase (KHK affect inter-individual variability in metabolic phenotypes, such as increased serum uric acid levels.The influence of SLC2A2, SLC2A5, and KHK SNPs on metabolic phenotypes was tested in 237 European Americans and 167 African Americans from the Pharmacogenomic Evaluation and Antihypertensive Responses (PEAR study. Using baseline untreated fasting data, associations were considered significant if p≤0.005. These SNPs were then evaluated for potential replication (p≤0.05 using data from the Genetic Epidemiology of Responses to Antihypertensives (GERA studies.SLC2A5 rs5438 was associated with an increase in serum uric acid in European American males. However, we were unable to replicate the association in GERA. The minor allele of SLC2A2 rs8192675 showed an association with lower high-density lipoproteins in European Americans (A/A: 51.0 mg/dL, A/G: 47.0 mg/dL, G/G: 41.5 mg/dL, p = 0.0034 in PEAR. The association between rs8192675 and lower high-density lipoproteins was replicated in the combined European American GERA study samples (A/A: 47.6 mg/dL, A/G: 48.6 mg/dL, G/G: 41.9 mg/dL, p = 0.0315.The association between SLC2A2 rs8192675 and high-density lipoproteins suggests the polymorphism may play a role in influencing high-density lipoproteins and thus metabolic risk of cardiovascular disease.

  3. Variantes alélicas de CYP2D6: *4, *6 y *10 en una muestra de residentes del estado Aragua, Venezuela

    Directory of Open Access Journals (Sweden)

    Carlos Flores-Angulo

    Full Text Available El objetivo del estudio fue determinar la frecuencia de las variantes del gen CYP2D6: *4, *6 y *10 y predecir el fenotipo metabolizador en una muestra de 145 individuos no consanguíneos, aparentemente sanos, residentes del estado Aragua, Venezuela. Los genotipos fueron determinados mediante ensayos de reacción en cadena de la polimerasa seguidos de digestión con endonucleasas de restricción. La predicción del fenotipo metabolizador se realizó con base al sistema Activity score. Las frecuencias de CYP2D6 *4, *6 y *10 fueron de 14,5%, 0,3% y 1%, respectivamente; un porcentaje significativo de individuos fueron categorizados como metabolizador rápido heterocigoto/metabolizador intermedio (23,5% y metabolizador lento (4,1%. Esta información tiene impacto clínico potencial, porque CYP2D6 interviene en el metabolismo de fármacos de prescripción frecuente como: carvedilol, captopril, cloroquina, codeína, fluoxetina, fluvastatina, haloperidol, idarrubicina, indinavir, imatinib, loperamida, nifedipina, ondansetrón y tamoxifeno

  4. Epidemiología genómica y paraparesia espástica tropical asociada a la infección por el virus linfotrópico humano de células T tipo 1 Genome epidemiology and tropical spastic paraparesis associated with human T-cell lymphotropic virus type 1

    Directory of Open Access Journals (Sweden)

    Mercedes Salcedo-Cifuentes

    2011-11-01

    Full Text Available OBJETIVO: Caracterizar el ambiente genómico de las secuencias adyacentes al virus linfotrópico humano de células T tipo 1 (HTLV-1 en pacientes con paraparesia espástica tropical y mielopatía asociada a la infección con HTLV-1 (PET/MAH de diferentes regiones de Colombia y del Japón. MÉTODOS: Se enfrentaron 71 clones recombinantes con secuencias del genoma humano adyacentes al 5'-LTR de pacientes con PET/MAH, a las bases de datos del Genome Browser y del Gen-Bank. Se identificaron y analizaron estadísticamente 16 variables genómicas estructurales y composicionales mediante el programa informático R, versión 2.8.1, en una ventana de 0,5 Mb. RESULTADOS: El 43,0% de los provirus se localizaron en los cromosomas del grupo C; 74% de las secuencias se ubicaron en regiones teloméricas y subteloméricas (P OBJECTIVE: Characterize the genomic environment of the sequences adjacent to human T-cell lymphotropic virus type 1 (HTLV-1 in patients with HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP in different regions of Colombia and Japan. METHODS: A total of 71 recombinant clones with human genome sequences adjacent to 5' LTR in patients with HAM/TSP were compared to the Genome Browser and GenBank databases. Sixteen structural and compositional genome variables were identified, and statistical analysis was conducted in the R computer program, version 2.8.1, in a 0.5 Mb window. RESULTS: A total of 43.0% of the proviruses were located in the group C chromosomes; 74% of the sequences were located in the telomeric and subtelomeric regions (P < 0.05. A cluster analysis was used to establish the hierarchical relations between the genome characteristics included in the study. The analysis of principal components identified the components that defined the preferred genome environments for proviral integration in cases of HAM/TSP. CONCLUSIONS: HTLV-1 was integrated more often in chromatin regions rich in CpG islands with a high density

  5. Cystinuria Associated with Different SLC7A9 Gene Variants in the Cat.

    Directory of Open Access Journals (Sweden)

    Keijiro Mizukami

    Full Text Available Cystinuria is a classical inborn error of metabolism characterized by a selective proximal renal tubular defect affecting cystine, ornithine, lysine, and arginine (COLA reabsorption, which can lead to uroliths and urinary obstruction. In humans, dogs and mice, cystinuria is caused by variants in one of two genes, SLC3A1 and SLC7A9, which encode the rBAT and bo,+AT subunits of the bo,+ basic amino acid transporter system, respectively. In this study, exons and flanking regions of the SLC3A1 and SLC7A9 genes were sequenced from genomic DNA of cats (Felis catus with COLAuria and cystine calculi. Relative to the Felis catus-6.2 reference genome sequence, DNA sequences from these affected cats revealed 3 unique homozygous SLC7A9 missense variants: one in exon 5 (p.Asp236Asn from a non-purpose-bred medium-haired cat, one in exon 7 (p.Val294Glu in a Maine Coon and a Sphinx cat, and one in exon 10 (p.Thr392Met from a non-purpose-bred long-haired cat. A genotyping assay subsequently identified another cystinuric domestic medium-haired cat that was homozygous for the variant originally identified in the purebred cats. These missense variants result in deleterious amino acid substitutions of highly conserved residues in the bo,+AT protein. A limited population survey supported that the variants found were likely causative. The remaining 2 sequenced domestic short-haired cats had a heterozygous variant at a splice donor site in intron 10 and a homozygous single nucleotide variant at a branchpoint in intron 11 of SLC7A9, respectively. This study identifies the first SLC7A9 variants causing feline cystinuria and reveals that, as in humans and dogs, this disease is genetically heterogeneous in cats.

  6. Divergência genética entre genótipos de frangos tipo caipira

    Directory of Open Access Journals (Sweden)

    R. C. Veloso

    2015-10-01

    Full Text Available RESUMOObjetivou-se com este trabalho verificar a divergência genética entre sete genótipos de frangos tipo caipira da linhagem Redbro utilizando as características de desempenho por meio de técnicas de análise multivariada. Foram utilizados 840 pintos de um dia, machos, distribuídos em delineamento inteiramente ao acaso, dos seguintes genótipos: Caboclo, Carijó, Colorpak, Gigante Negro, Pesadão Vermelho, Pescoço Pelado e Tricolor. Após a consistência dos dados, foram avaliadas as seguintes variáveis: ganho em peso médio diário, consumo de ração médio diário e conversão alimentar, para os períodos: 1 a 28, 1 a 56, 1 a 70 e 1 a 84 dias de idade; peso corporal ao nascimento, aos 28, 56, 70 e aos 84 dias de idade. O desempenho dos genótipos foi avaliado por meio da análise de variância multivariada e da função discriminante linear de Fisher, usando os testes do maior autovalor de Roy e da união-interseção de Roy para as comparações múltiplas. O estudo da divergência genética foi feito por meio da análise por variáveis canônicas e pelo método de otimização de Tocher. Os genótipos Caboclo e Gigante Negro apresentaram médias canônicas diferentes dos demais genótipos. As duas primeiras variáveis canônicas explicaram 97,41% da variação entre os genótipos. A divergência genética entre os genótipos avaliados permitiu a formação de quatro grupos com os seguintes genótipos: grupo 1 - Colorpak; grupo 2 - Pesadão Vermelho e Pescoço Pelado; grupo 3 - Carijó e Tricolor; e grupo 4 - Caboclo e Gigante Negro.

  7. Transhumanistas y Bioconservadores en torno al dopaje genético

    Directory of Open Access Journals (Sweden)

    Raúl Francisco Sebastián Solanes

    2013-04-01

    Full Text Available En el presente texto proponemos una reflexión sobre uso de tecnologías genéticas que  aumentan el rendimiento deportivo como futuro campo de investigación de una Neuroética social. Este problema, que se ha dado en llamar “dopaje genético”, congrega a su alrededor un debate entre los partidarios del Bioconservadurismo y del Transhumanismo. Expondremos la concepción de dos importantes representantes del Transhumanismo (J. Savulescu y C. Tamburrini y de dos conocidos partidarios del Bioconservadurismo (M. Sandel y R. L. Simon, a fin de subrayar la importancia de este debate y las futuras implicaciones en la mejora del rendimiento físico, cognitivo y educacional a las que se deberá hacer frente desde el nivel socio-cultural de la Neuroética.

  8. Marcadores ancestrales culturales y genéticos: investigación de apellidos mapuche

    Directory of Open Access Journals (Sweden)

    Corach, Daniel

    2007-01-01

    Full Text Available Las comunidades aborígenes que habitan las regiones andinas se caracterizan por haber conservado elementos lingüísticos originarios en sus apellidos. Estos han sufrido procesos de “occidentalización”, manteniendo, no obstante, rasgos etnia-específicos. Tal situación permite disponer de un criterio simple para identificar con cierto grado de certeza la ancestralidad de un individuo. Con el objeto de evaluar el grado de correlación entre este marcador cultural y marcadores genéticos hemos llevado a cabo una investigación con individuos varones no relacionados provenientes de las provincias de Río Negro y Chubut (N=136. Los donantes se seleccionaron de acuerdo a la presencia de elementos lingüísticos Mapuche en sus apellidos e individuos con apellidos europeos. Se emplearon tres criterios de clasificación: apellidos, presencia del haplogrupo Q-M3 y presencia de Haplogrupos mitocondriales amerindios (ABCD. Los grupos clasificados de acuerdo con estos criterios fueron analizados mediante 15 STRs autosómicos y 9 Y-STRs. En ambas provincias más del 95% de los individuos portadores de apellidos Mapuche exhibían hgs matri y/o patrilineales amerindios. Por otro lado, en Río Negro y Chubut sólo 18 y 17%, respectivamente, no exhibieron ni apellidos ni marcadores genéticos asociables con ancestros amerindios; en éstos los hgmt más representados fueron H (6.5%, U5 (4.3% y K (2.8%, seguidos por T (1.4%, V (0.7%, X (0.7% y M (0.7%. También fue detectado el hg Africano en baja frecuencia (1.4%. Nuestros resultados confirman una correlación estrecha entre apellidos Mapuche y polimorfismos genéticos étnia-específicos.

  9. Distribución de tres polimorfismos del gen TSLP en población afrodescendiente de San Basilio de Palenque, Colombia

    Directory of Open Access Journals (Sweden)

    Luis Fang

    2013-06-01

    Full Text Available Introducción. La linfopoyetina tímica del estroma (Thymic Stromal Lymphopoietin, TSLP se ha vinculado como un gen de propensión al desarrollo de enfermedades alérgicas. Se sabe que la población de Cartagena es una mezcla triétnica, en la cual el componente de herencia africana se asoció con el riesgo de asma y altos niveles séricos de IgE total. Este componente provino de esclavos africanos que lograron organizarse en “palenques”, uno de ellos es San Basilio de Palenque, en la Costa Caribe colombiana. Objetivo. Determinar la distribución de los polimorfismos de nucleótido simple (Single Nucleotide Polymorphism, SNP rs1837253, rs17551370 y rs2289276 del gen TSLP en individuos afrodescendientes de San Basilio de Palenque. Materiales y métodos. Mediante PCR en tiempo real y sondas TaqMan SNP Genotyping™ segenotipificaron estos SNP en 80 individuos afrodescendientes entre los 5 y 18 años de edad. Resultados. El alelo de menor frecuencia para el polimorfismo rs1837253 fue el alelo T (41,9 %, para el rs17551370, el alelo A (14,3 %, y para el rs2289276, el alelo T (22,5 %. La distribución de los polimorfismos rs17551370 y rs2289276 se mantuvo en equilibrio genético de Hardy-Weinberg. Las frecuencias alélicas de cada SNP no mostraron diferencias significativas con las reportadas para poblaciones africanas. Conclusiones. Los tres polimorfismos analizados en el gen TSLP estuvieron presentes en la muestra de población de San Basilio de Palenque y su distribución es similar a la reportada para poblaciones africanas y para poblaciones americanas de ancestro africano. doi: http://dx.doi.org/10.7705/biomedica.v33i2.655

  10. A Novel Role of Human Holliday Junction Resolvase GEN1 in the Maintenance of Centrosome Integrity

    DEFF Research Database (Denmark)

    Gao, M.; Danielsen, Jannie Michaela Rendtlew; Wei, L.-Z.

    2012-01-01

    but not catalytic activity of GEN1 is required for preventing centrosome hyper-amplification, formation of multiple mitotic spindles, and multi-nucleation. Our findings provide novel insight into the biological functions of GEN1 by uncovering an important role of GEN1 in the regulation of centrosome integrity....

  11. Mejoramiento genético y taza de autofecundación del Camu Camu arbustivo en la Amazonía Peruana

    Directory of Open Access Journals (Sweden)

    Carlos Oliva Cruz

    2008-06-01

    Full Text Available El camu camu (Myrciaria dubia (H.B.K. MC VAUGH es una frutera silvestre conocida mundialmente como un excepcional productor de vitamina C. Su mejoramiento se encuentra en fase inicial. Este trabajo tuvo por objetivos estudiar el sistema reproductivo (taza de autofecundación, el efecto del origen del polen (autofecundación o polinización abierta en la producción de ácido ascórbico y porcentaje de germinación, la repetibilidad de caracteres productivos y sus implicaciones en el programa de mejoramiento. El sistema reproductivo del camu camu es mixto con variables tazas de autofecundación. No fue confirmada la existencia de efecto del origen del polen para el carácter de producción de ácido ascórbico. La repetibilidad individual de la producción fue de moderada magnitud (0.41; la repetibilidad del promedio de 5 cosechas de fruta fue de 0.77, propiciando exactitud selectiva de 0.88. Genotipos superiores pueden ser seleccionados con precisión y, por lo tanto, cinco a seis cosechas por planta es un número adecuado. La selección y clonación de los diez mejores individuos deberá propiciar una ganancia genética del 237.5 %, elevando la productividad media anual de frutas por planta de 7.75 para 26.17 kg/año.

  12. Wire breakage in SLC wire profile monitors

    International Nuclear Information System (INIS)

    Field, C.; McCormick, D.; Raimondi, P.; Ross, M.

    1998-05-01

    Wire scanning beam profile monitors are used at the Stanford Linear Collider (SLC) for emittance preservation control and beam optics optimization. Twenty such scanners have proven most useful for this purpose and have performed a total of 1.5 million scans in the 4 to 6 years since their installation. Most of the essential scanners are equipped with 20 to 40 microm tungsten wires. SLC bunch intensities and sizes often exceed 2 x 10 7 particles/microm 2 (3C/m 2 ). The authors believe that this has caused a number of tungsten wire failures that appear at the ends of the wire, near the wire support points, after a few hundred scans are accumulated. Carbon fibers, also widely used at SLAC, have been substituted in several scanners and have performed well. In this paper, the authors present theories for the wire failure mechanism and techniques learned in reducing the failures

  13. Genome-wide association analysis identifies a mutation in the thiamine transporter 2 (SLC19A3 gene associated with Alaskan Husky encephalopathy.

    Directory of Open Access Journals (Sweden)

    Karen M Vernau

    Full Text Available Alaskan Husky Encephalopathy (AHE has been previously proposed as a mitochondrial encephalopathy based on neuropathological similarities with human Leigh Syndrome (LS. We studied 11 Alaskan Husky dogs with AHE, but found no abnormalities in respiratory chain enzyme activities in muscle and liver, or mutations in mitochondrial or nuclear genes that cause LS in people. A genome wide association study was performed using eight of the affected dogs and 20 related but unaffected control AHs using the Illumina canine HD array. SLC19A3 was identified as a positional candidate gene. This gene controls the uptake of thiamine in the CNS via expression of the thiamine transporter protein THTR2. Dogs have two copies of this gene located within the candidate interval (SLC19A3.2 - 43.36-43.38 Mb and SLC19A3.1 - 43.411-43.419 Mb on chromosome 25. Expression analysis in a normal dog revealed that one of the paralogs, SLC19A3.1, was expressed in the brain and spinal cord while the other was not. Subsequent exon sequencing of SLC19A3.1 revealed a 4bp insertion and SNP in the second exon that is predicted to result in a functional protein truncation of 279 amino acids (c.624 insTTGC, c.625 C>A. All dogs with AHE were homozygous for this mutation, 15/41 healthy AH control dogs were heterozygous carriers while 26/41 normal healthy AH dogs were wild type. Furthermore, this mutation was not detected in another 187 dogs of different breeds. These results suggest that this mutation in SLC19A3.1, encoding a thiamine transporter protein, plays a critical role in the pathogenesis of AHE.

  14. Making electron beams for the SLC linac

    International Nuclear Information System (INIS)

    Clendenin, J.E.; Ecklund, S.D.; James, M.B.; Miller, R.H.; Sheppard, J.C.; Sodja, J.; Truher, J.B.; Minten, A.

    1984-01-01

    A source of high-intensity, single-bunch electron beams has been developed at SLAC for the SLC. The properties of these beams have been studied extensively utilizing the first 100-m of the SLAC linac and the computer-based control system being developed for the SLC. The source is described and the properties of the beams are summarized. 9 references, 2 figures, 1 table

  15. Significado biológico de la expresión del gen "h-MAM" en cáncer de mama humano

    OpenAIRE

    Núñez Villar, María José

    2002-01-01

    El gen de la mamoglobina codifica para una proteína de 10 Kda, que en tejidos humanos adultos tan solo ha sido detectada en la mama. Nuestro objetivo ha sido la detección del gen h-MAN en muestras tumorales y la correlación de dicha expresión con parámetros biológicos de primera generación (variedad histológica, grado histológico y nuclear, e invasción ganglionar), segunda generación (receptores de estrógenos y progesterona) y tercera generación (p53, Ki67 y c-erbB-2), así como con la ploidía...

  16. Toxicidad del irinotecán en pacientes con cáncer colorrectal y variabilidad del gen UGT1A

    OpenAIRE

    Gayoso Rey, Mónica

    2012-01-01

    El cáncer colorrectal (CCR) ocupa el segundo lugar como causa de mortalidad por cáncer en la mayoría de los países desarrollados. El irinotecán es uno de los fármacos más empleados en la quimioterapia. Sin embargo, existe una variabilidad interindividual en la aparición de efectos adversos. Se han publicado diversos estudios que intentan correlacionar determinados polimorfismos genéticos con la toxicidad, mostrando discrepancias. Pocos de estos trabajos se han centrado en la población español...

  17. Measurement of electron beam polarization at the SLC

    International Nuclear Information System (INIS)

    Steiner, H.; California Univ., Berkeley

    1988-01-01

    One of the unique features of the SLC is its capability to accelerate longitudinally polarized electrons. The SLC polarization group has been performed to implement the polarization program at the SLC. Technically the polarization project consists of three main parts: (1) a polarized source, (2) spin-rotating superconducting solenoid magnets to be used to manipulate the direction of the electron spin, and (3) the polarimeters needed to monitor and measure the electron beam polarization. It is this last topic that will concern us here. Two types of polarimeters will be used - Compton and Moeller. (orig./HSI)

  18. Intención de compra de medicamentos genéricos por parte de los usuarios de Asturias

    Directory of Open Access Journals (Sweden)

    González Hernando Santiago

    2003-01-01

    Full Text Available Fundamento: Conocer las percepciones de los consumidores acerca del riesgo asociado al uso de medicamentos genéricos y los factores que más influyen en la intención de solicitar un genérico al médico (prescriptor y/o al farmacéutico, a fin de determinar posibles barreras o frenos a la aceptación de los mismos y obtener información que apoye la toma de decisiones de los gestores sanitarios. Métodos: Estudio sobre utilización de medicamentos centrado en la disposición de los pacientes a solicitar una EFG. En esta investigación transversal cuantitativa se entrevistó personalmente a 542 individuos, a la salida de un centro de salud o de un establecimiento de farmacia en Asturias. En el cuestionario se incluía una escala de medición del riesgo percibido en la compra de un medicamento con 15 atributos agrupados en cinco dimensiones. Asimismo se recogió información sobre la intención de consumir medicamentos genéricos y sobre las características demográficas y socioeconómicas de los entrevistados. Para el análisis de los resultados se aplicaron un análisis factorial confirmatorio, regresión múltiple y análisis univariable. El tratamiento de los datos se efectuó con los programas estadísticos EQS y SPSS. Resultados: Percepción media del riesgo (escalas de 1 a 7: funcional: 2,75; físico: 2,68; financiero: 2,19; psicológico: 1,99; social: 1,42. Factores influyentes sobre la intención de solicitar genéricos al médico: riesgo psicológico (p=0,000. Sobre la solicitud al farmacéutico: riesgo psicológico (p=0,000 y riesgo social (p=0,020. Conclusiones: Los agentes interesados en el desarrollo en el mercado de las EFG deben mantener sus esfuerzos de comunicación hacia la equiparación de los aspectos funcionales y financieros entre especialidades del fabricante y especialidades genéricas, pero no deben dejar de lado aspectos psicológicos y sociales del comportamiento de compra del consumidor.

  19. Características clínicas y genéticas del Síndrome de Usher

    OpenAIRE

    Dyce Gordon, Elisa; Mapolón Arcendor, Yolanda; Palma López, Maritza; Santana Alvarez, Jorge

    2000-01-01

    Con el objetivo de describir las características clínicas y genéticas del síndrome de Usher, se realizó un estudio descriptivo transversal en el Centro de Retinosis Pigmentaria de Camagüey, desde octubre de 1991 hasta Mayo de 1998, con siete pacientes con síndrome Usher. A través de entrevistas y confección de encuestas, incluyendo el árbol genealógico se recopilaron los datos necesarios; los cuales fueron procesados realizándose estadística descriptiva. El síndrome de Usher tipo II fue el má...

  20. La biotecnología como herramienta para la propagación, conservación y el mejoramiento genético del guayabo

    Directory of Open Access Journals (Sweden)

    Juliette Valdés-Infante Herrero

    2012-07-01

    Full Text Available Título en ingles: Biotechnology as a tool for propagation, con­servation and genetic breeding in guava Resumen: Las técnicas biotecnológicas contribuyen positiva y significativamente en los programas de propagación, conservación y mejoramiento de las especies vegetales. Dentro de éstas, el cultivo de tejidos, el desarrollo de mapas de ligamientos genéticos y de QTLs y la detección de genes de interés han demostrado ser de gran utilidad para los mencionados propósitos. En este sentido, se estandarizó una técnica para la multiplicación in vitro de la forma silvestre de guayabo en tres fases de cultivo: establecimiento, multiplicación de propágulos y enraizamiento. La misma constituye una vía de utilidad para la propagación, la conservación de germoplasma y el mejoramiento genético en la especie. Además, se estandarizó un método de conservación a corto-mediano plazo. Por otra parte, se construyó un mapa de ligamiento genético para la especie empleando marcadores AFLP y SSR. Los 11 grupos del mapa de ligamiento genético y los 50 QTLs relacionados con caracteres vegetativos y de calidad interna y externa del fruto, constituyen el punto de partida para el clonaje de genes de interés agrícola y la implementación futura de la selección asistida por marcadores en el guayabo. De igual forma, las 176 secuencias candidatas a genes de resistencia (RGL y del desarrollo de la planta (MADS-box y HOMEO-box detectadas pueden ser de gran utilidad en la saturación del mapa de ligamiento referido, el estudio de la variabilidad presente en el cultivo, así como en la solución de problemas relacionados con el rendimiento, la producción y la resistencia a estrés biótico y abiótico. Palabras clave: in vitro; mapa de ligamiento; QTLs; RGL; genes del desarrollo;  guayabo Abstract: Biotechnologies contribute positively and signifi­cantly in the propagation, conservation and breeding programs of many plant species. From them, tissue

  1. Epigenetic regulation of the glucose transporter gene Slc2a1 by β-hydroxybutyrate underlies preferential glucose supply to the brain of fasted mice.

    Science.gov (United States)

    Tanegashima, Kosuke; Sato-Miyata, Yukiko; Funakoshi, Masabumi; Nishito, Yasumasa; Aigaki, Toshiro; Hara, Takahiko

    2017-01-01

    We carried out liquid chromatography-tandem mass spectrometry analysis of metabolites in mice. Those metabolome data showed that hepatic glucose content is reduced, but that brain glucose content is unaffected, during fasting, consistent with the priority given to brain glucose consumption during fasting. The molecular mechanisms for this preferential glucose supply to the brain are not fully understood. We also showed that the fasting-induced production of the ketone body β-hydroxybutyrate (β-OHB) enhances expression of the glucose transporter gene Slc2a1 (Glut1) via histone modification. Upon β-OHB treatment, Slc2a1 expression was up-regulated, with a concomitant increase in H3K9 acetylation at the critical cis-regulatory region of the Slc2a1 gene in brain microvascular endothelial cells and NB2a neuronal cells, shown by quantitative PCR analysis and chromatin immunoprecipitation assay. CRISPR/Cas9-mediated disruption of the Hdac2 gene increased Slc2a1 expression, suggesting that it is one of the responsible histone deacetylases (HDACs). These results confirm that β-OHB is a HDAC inhibitor and show that β-OHB plays an important role in fasting-induced epigenetic activation of a glucose transporter gene in the brain. © 2016 Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd.

  2. Efecto del tipo de lactancia durante el primer año de vida sobre el estado de hierro y el desarrollo físico y psicológico del niño

    OpenAIRE

    Bedmar Carretero, Cristina

    2012-01-01

    El objetivo de este estudio fue valorar el desarrollo del niño durante el primer año de vida en función del tipo de lactancia realizada durante el primer semestre y de la dosis de hierro administrada durante el segundo semestre. El 75,5% realizan lactancia materna exclusiva al nacer y el 16,5% la mantienen hasta los 6 meses. El 39,5%tienen alguna mutación en el gen HFE. La prevalencia de déficit de hierroy anemia ferropénicaes del 4,5% y 2,5% a los 6 meses y del 9,2% y 1,2% a los 12 meses.La ...

  3. Evaluación de la diversidad genética del género Capsicum sp. presente en los Departamentos de Vaupés, Guainía y Putumayo por medio de Isoenzimas

    Directory of Open Access Journals (Sweden)

    Lorena Quintero Barrera

    2000-01-01

    Full Text Available El género Capsicumcomprende 25 especies de las cuales cinco han sido domesticadas y dadoorigen a numerosos cultivares. Sin embargo, la alta selección a la que está siendo sometido elgénero podría llevarla a su erosión genética, por ello se requiere la introducción de nuevogermoplasma que suministre una fuente de diversidad genética, para el mejoramiento de loscultivares comerciales. Dicha fuente se debe encontrar en aquellas zonas donde las especiessilvestres, cercanas y/o relacionadas se distribuyen, ya que estas áreas funcionan como reser-vorio de genes y es allí donde se encuentran variedades con acervos genéticos amplios; fuentesgenéticas para resistencia a enfermedades, alta productividad y calidad nutricional. Teniendoen cuenta lo anterior la región amazónica colombiana tiene un valor potencial en la exploraciónde germoplasma importante para el género Capsicum, por ser considerada como el lugar deorigen del complejo silvestre annuum-chinense-frutescens. Así mismo se requiere de unaevaluación urgente de la diversidad genética de la región amazónica, antes de que se agotela disponibilidad de material vivo debido al proceso de deforestación. Con el propósito devalorar la diversidad genética presente del género Capsicum, en la Amazonía colombiana seutilizó la técnica de electroforésis de isoenzimas para los materiales de Ají colectados enhuertos y chagras indígenas de los departamentos de Vaupés, Guainía y Putumayo. Para laevaluación se utilizaron cinco isoenzimas polimórficas: alfabetaEST (alfabeta esterasa, GOT(glutamato oxaloacetato transaminasa, PRX (peroxidasa, 6PGDH (6-fosfoglucona-todehidrogenasa y ME (enzima málica. Con los resultados de presencia-ausencia de bandasse construyeron fenogramas con el índice de similaridad de Dice o Nei (1945 por mediodel programa estadístico NTSYS (Numerical Taxonomy and Multivariate Analisys System. Deacuerdo a los resultados se pudo establecer la alta variabilidad

  4. Reduced Slc6a15 in Nucleus Accumbens D2-Neurons Underlies Stress Susceptibility.

    Science.gov (United States)

    Chandra, Ramesh; Francis, T Chase; Nam, Hyungwoo; Riggs, Lace M; Engeln, Michel; Rudzinskas, Sarah; Konkalmatt, Prasad; Russo, Scott J; Turecki, Gustavo; Iniguez, Sergio D; Lobo, Mary Kay

    2017-07-05

    Previous research demonstrates that Slc6a15, a neutral amino acid transporter, is associated with depression susceptibility. However, no study examined Slc6a15 in the ventral striatum [nucleus accumbens (NAc)] in depression. Given our previous characterization of Slc6a15 as a striatal dopamine receptor 2 (D2)-neuron-enriched gene, we examined the role of Slc6a15 in NAc D2-neurons in mediating susceptibility to stress in male mice. First, we showed that Slc6a15 mRNA was reduced in NAc of mice susceptible to chronic social defeat stress (CSDS), a paradigm that produces behavioral and molecular adaptations that resemble clinical depression. Consistent with our preclinical data, we observed Slc6a15 mRNA reduction in NAc of individuals with major depressive disorder (MDD). The Slc6a15 reduction in NAc occurred selectively in D2-neurons. Next, we used Cre-inducible viruses combined with D2-Cre mice to reduce or overexpress Slc6a15 in NAc D2-neurons. Slc6a15 reduction in D2-neurons caused enhanced susceptibility to a subthreshold social defeat stress (SSDS) as observed by reduced social interaction, while a reduction in social interaction following CSDS was not observed when Slc6a15 expression in D2-neurons was restored. Finally, since both D2-medium spiny neurons (MSNs) and D2-expressing choline acetyltransferase (ChAT) interneurons express Slc6a15, we examined Slc6a15 protein in these interneurons after CSDS. Slc6a15 protein was unaltered in ChAT interneurons. Consistent with this, reducing Slc5a15 selectively in NAc D2-MSNs, using A2A-Cre mice that express Cre selectively in D2-MSNs, caused enhanced susceptibility to SSDS. Collectively, our data demonstrate that reduced Slc6a15 in NAc occurs in MDD individuals and that Slc6a15 reduction in NAc D2-neurons underlies stress susceptibility. SIGNIFICANCE STATEMENT Our study demonstrates a role for reduced Slc6a15, a neutral amino acid transporter, in nucleus accumbens (NAc) in depression and stress susceptibility. The

  5. GEN1 from a thermophilic fungus is functionally closely similar to non-eukaryotic junction-resolving enzymes.

    Science.gov (United States)

    Freeman, Alasdair D J; Liu, Yijin; Déclais, Anne-Cécile; Gartner, Anton; Lilley, David M J

    2014-12-12

    Processing of Holliday junctions is essential in recombination. We have identified the gene for the junction-resolving enzyme GEN1 from the thermophilic fungus Chaetomium thermophilum and expressed the N-terminal 487-amino-acid section. The protein is a nuclease that is highly selective for four-way DNA junctions, cleaving 1nt 3' to the point of strand exchange on two strands symmetrically disposed about a diagonal axis. CtGEN1 binds to DNA junctions as a discrete homodimer with nanomolar affinity. Analysis of the kinetics of cruciform cleavage shows that cleavage of the second strand occurs an order of magnitude faster than the first cleavage so as to generate a productive resolution event. All these properties are closely similar to those described for bacterial, phage and mitochondrial junction-resolving enzymes. CtGEN1 is also similar in properties to the human enzyme but lacks the problems with aggregation that currently prevent detailed analysis of the latter protein. CtGEN1 is thus an excellent enzyme with which to engage in biophysical and structural analysis of eukaryotic GEN1. Copyright © 2014. Published by Elsevier Ltd.

  6. STANFORD: Highly polarized SLC electron beams

    International Nuclear Information System (INIS)

    Anon.

    1993-01-01

    Full text: Using specialized photocathodes made with 'strained' gallium arsenide, physicists at the Stanford Linear Accelerator Center (SLAC) have generated electron beams with polarizations in excess of 60 percent a year ahead of schedule. Together with recent luminosity increases, this breakthrough will have a major impact on the physics output of the Stanford Linear Collider (SLC). Beam polarization was almost tripled using photocathodes in which a gallium arsenide layer was grown epitaxially over a substrate of gallium arsenide phosphide. The mismatch between these two layers deforms the crystal structure and removes a degeneracy in the valence band structure, permitting selective optical pumping of one unique spin state. Whereas conventional gallium arsenide photocathodes are limited to 50 percent polarization because of this degeneracy (and realistic cathodes fall substantially below this theoretical limit), such strained crystal lattices have the potential to yield polarizations close to 100 percent. Polarization enhancement with strained lattices was first demonstrated in 1991 by a SLAC/Wisconsin/ Berkeley group (May 1991, page 6) with a 71 percent polarization in a laboratory experiment. More recently this group has achieved polarization in excess of 90 percent, reported last November at the Nagoya Spin Symposium. (In a complementary development, a Japanese KEK/ Nagoya/KEK obtains polarized beams using a 'superlattice' - May 1991, page 4.) The 1993 SLC run, the strained gallium arsenide photocathode technique's debut in an operating particle accelerator, has proved to be a resounding, unqualified success - as have physics experiments on the Z particles produced by the highly polarized beam. A conservative approach was called for, due to concerns about possible charge saturation effects. A relatively thick (0.3 micron) gallium arsenide layer was used for the photocathode in the SLC polarized electron source. With a titanium

  7. Desarrollo del maquinado en 4 ejes en la empresa R&R Precisión

    Directory of Open Access Journals (Sweden)

    Carmen Elenea Madriz Quirós

    2009-01-01

    Full Text Available A continuación se presenta el resumen del proyecto de investigación denominado Transferencia de Tecnología de Maquinado en 4 ejes, el cual fue realizado con el aporte principal del Fondo de Proyectos Concursables del (CONICIT, Consejo Nacional de Investigaciones Científicas y Tecnológicas del (ITCR Instituto Tecnológico de Costa Rica y una inversión de contrapartida de la empresa R & R Precisión, ubicada en Santo Domingo de Heredia, empresa donde se realizó la transferencia de tecnología. El proyecto inició con una capacitación en Estados Unidos sobre el maquinado en 4 y 5 ejes, mediante un distribuidor autorizado del software Master Cam. Luego se realizó las inversiones en la versión 9 del software, el driver del 4º eje y las herramientas necesarias para el maquinado. Se continuó con el estudio del software, para lo cual se adquirió una versión académica con fondos del ITCR y luego se inició un período de instalación del software en la empresa, las prácticas de diseño y posteriormente, de maquinado de piezas en 4 ejes. Como uno de los grandes resultados del proyecto, la empresa R & R Precisión logró el dominio de la tecnología de maquinado en 4 ejes, adquiriendo nuevos contratos de nuevos clientes, así como nuevos contratos de su cartera actual de clientes. Como otro resultado importante, se recomendó a la empresa la búsqueda de piezas de repuestos industriales genéricos que se puedan fabricar por volumen, así como también la penetración en nuevos mercados en Centroamérica, principalmente. El Salvador y Guatemala.

  8. Saber o no saber… Derecho e información genética

    Directory of Open Access Journals (Sweden)

    José Ignacio Solar Cayón

    2013-12-01

    Full Text Available El extraordinario desarrollo de las técnicas genéticas, con su formidable capacidad de afectación a la autonomía personal y de invasión de los derechos individuales, está teniendo un impacto profundo en el pensamiento jurídico, obligándonos a revisar algunos de los presupuestos en que se funda nuestra concepción de los derechos fundamentales. Así, el reconocimiento del derecho del individuo a no conocer sus datos genéticos parece desafiar nociones esenciales como las de autonomía y racionalidad del sujeto de derechos, vinculadas en el proyecto ilustrado de emancipación del individuo a la idea de pleno acceso al conocimiento. Sin embargo, la propia idea de “ignorancia” no resulta ajena al discurso de fundamentación de los derechos fundamentales, como prueba el papel esencial que el “velo de la ignorancia” desempeña en la revisión de la tradición liberal efectuada por John Rawls. A partir de la teoría de éste y de John Stuart Mill se indaga en los fundamentos filosóficos del derecho a no saber los datos genéticos y en sus límites, ante la existencia de posibles derechos de terceros a acceder a esa información. Asimismo, se pone de manifiesto el papel que en este nuevo contexto juega el Derecho como instancia administradora del conocimiento y de la ignorancia, ante la amenaza de un determinismo genético que parece poner en cuestión en última instancia la idea misma de libertad individual.

  9. Genética del Autismo: Caenorhabditis elegans como modelo experimental en el estudio de la función sináptica neuronal

    OpenAIRE

    Calahorro, Fernando

    2011-01-01

    Los trastornos del espectro autista son de etiología desconocida. Los datos epidemiológicos en los que se compara la incidencia de estas enfermedades en gemelos monocigóticos y dicigóticos demuestran que tienen un origen predominantemente genético. Diversos resultados experimentales recientes indican que en un número significativo de casos, estos trastornos se originan por alteraciones en la sinapsis neuronal, que durante el desarrollo del sistema nervioso podrían constituir la raíz de las an...

  10. Diagnóstico genético del polimorfismo en citocromo P450 mediante ensayo de PCR múltiplex (Práctica en laboratorio virtual Cibertorio)

    OpenAIRE

    Herráez, Angel

    2017-01-01

    Guión de trabajo para el laboratorio virtual «Cibertorio» en Biomodel.UAH.es Se habla de diversidad genética de los individuos como el resultado de que, en diversas regiones del genoma, unas personas tenemos secuencias de nucleótidos que nos diferencian de otras; esto se denomina polimorfismo genético. Cuando estas regiones polimórficas corresponden a zonas codificantes de un producto, existen consecuencias funcionales. La superfamilia enzimática citocromo P450 juega un papel crucial ...

  11. The SLC control system - status and development

    International Nuclear Information System (INIS)

    Phinney, N.; Shoaee, H.

    1987-03-01

    The SLC control system is installed and operational in the full SLC through the Linac, Damping Rings, Positron Source, Arcs and Final Focus. The system now includes a host VAX 11/785, a development VAX 11/780, 4 VAX workstations, a distributed network of 70 microprocessors, and about 270 Camac crates with more than 4000 modules. The micros are used for control and monitoring of the hardware, for pulse-to-pulse feedback, and for consoles (COWs). High level model-driven host software provides a variety of tools for beam setup, optimization, diagnosis, and stabilization. This paper will summarize the current status and projects under development

  12. The SLC polarized electron source

    International Nuclear Information System (INIS)

    Clendenin, J.E.

    1990-10-01

    A polarized electron source consisting of a 3-electrode photocathode gun and a flashlamp-pumped dye laser has been designed and built for the SLC and is currently undergoing commissioning. The source is described, and the operating configuration is discussed. The present status of the source and future plans are briefly indicated. 7 refs., 4 figs

  13. Language disorder with mild intellectual disability in a child affected by a novel mutation of SLC6A8 gene.

    Science.gov (United States)

    Battini, R; Chilosi, A M; Casarano, M; Moro, F; Comparini, A; Alessandrì, M G; Leuzzi, V; Tosetti, M; Cioni, G

    2011-02-01

    We describe the clinical and molecular features of a child harboring a novel mutation in SLC6A8 gene in association with a milder phenotype than other creatine transporter (CT1) deficient patients (OMIM 300352) [1-7]. The mutation c.757 G>C p.G253R in exon 4 of SLC6A8 was hemizygous in the child, aged 6 years and 6 months, who showed mild intellectual disability with severe speech and language delay. His carrier mother had borderline intellectual functioning. Although the neurochemical and biochemical parameters were fully consistent with those reported in the literature for subjects with CT1 deficit, in our patient within a general cognitive disability, a discrepancy between nonverbal and verbal skills was observed, confirming the peculiar vulnerability of language development under brain Cr depletion. Copyright © 2010 Elsevier Inc. All rights reserved.

  14. Estrategia de verificación de calidad de las cepas de Escherichia coli conservadas en la Colección del Centro de Ingeniería Genética y Biotecnología

    OpenAIRE

    Iveldris Domínguez-Vázquez; Evelyn Olano-Ruiz; Angela Estela Sosa-Espinosa

    2010-01-01

    La colección de microorganismos de interés biotecnológico del Centro de Ingeniería Genética y Biotecnología incluye diferentes cepas de bacterias y levaduras utilizables en la manipulación de genes mediante el empleo de la ingeniería genética y para la producción de proteínas recombinantes por métodos biotecnológicos. La colección de hospederos de Escherichia coli centraliza todas las cepas que se utilizan en los proyectos de investigación-desarrollo de la institución. Este microorganismo con...

  15. Slc3a2 Mediates Branched-Chain Amino-Acid-Dependent Maintenance of Regulatory T Cells

    Directory of Open Access Journals (Sweden)

    Kayo Ikeda

    2017-11-01

    Full Text Available Summary: Foxp3+ regulatory T (Treg cells, which suppress immune responses, are highly proliferative in vivo. However, it remains unclear how the active replication of Treg cells is maintained in vivo. Here, we show that branched-chain amino acids (BCAAs, including isoleucine, are required for maintenance of the proliferative state of Treg cells via the amino acid transporter Slc3a2-dependent metabolic reprogramming. Mice fed BCAA-reduced diets showed decreased numbers of Foxp3+ Treg cells with defective in vivo proliferative capacity. Mice lacking Slc3a2 specifically in Foxp3+ Treg cells showed impaired in vivo replication and decreased numbers of Treg cells. Slc3a2-deficient Treg cells showed impaired isoleucine-induced activation of the mTORC1 pathway and an altered metabolic state. Slc3a2 mutant mice did not show an isoleucine-induced increase of Treg cells in vivo and exhibited multi-organ inflammation. Taken together, these findings demonstrate that BCAA controls Treg cell maintenance via Slc3a2-dependent metabolic regulation. : Treg cells regulate excess immune responses and are highly proliferative in vivo. Ikeda et al. find that branched-chain amino acids (BCAAs are essentially required to maintain expansion and the suppressive capacity of Treg cells via Slc3a2 and mTORC1. Keywords: Treg cells, amino acids, immunometabolism, immune regulation, transporter

  16. SLC25 Family Member Genetic Interactions Identify a Role for HEM25 in Yeast Electron Transport Chain Stability.

    Science.gov (United States)

    Dufay, J Noelia; Fernández-Murray, J Pedro; McMaster, Christopher R

    2017-06-07

    The SLC25 family member SLC25A38 (Hem25 in yeast) was recently identified as a mitochondrial glycine transporter that provides substrate to initiate heme/hemoglobin synthesis. Mutations in the human SLC25A38 gene cause congenital sideroblastic anemia. The full extent to which SLC25 family members coregulate heme synthesis with other mitochondrial functions is not clear. In this study, we surveyed 29 nonessential SLC25 family members in Saccharomyces cerevisiae for their ability to support growth in the presence and absence of HEM25 Six SLC25 family members were identified that were required for growth or for heme synthesis in cells lacking Hem25 function. Importantly, we determined that loss of function of the SLC25 family member Flx1, which imports FAD into mitochondria, together with loss of function of Hem25, resulted in inability to grow on media that required yeast cells to supply energy using mitochondrial respiration. We report that specific components of complexes of the electron transport chain are decreased in the absence of Flx1 and Hem25 function. In addition, we show that mitochondria from flx1 Δ hem25 Δ cells contain uncharacterized Cox2-containing high molecular weight aggregates. The functions of Flx1 and Hem25 provide a facile explanation for the decrease in heme level, and in specific electron transport chain complex components. Copyright © 2017 Dufay et al.

  17. SLC25 Family Member Genetic Interactions Identify a Role for HEM25 in Yeast Electron Transport Chain Stability

    Directory of Open Access Journals (Sweden)

    J. Noelia Dufay

    2017-06-01

    Full Text Available The SLC25 family member SLC25A38 (Hem25 in yeast was recently identified as a mitochondrial glycine transporter that provides substrate to initiate heme/hemoglobin synthesis. Mutations in the human SLC25A38 gene cause congenital sideroblastic anemia. The full extent to which SLC25 family members coregulate heme synthesis with other mitochondrial functions is not clear. In this study, we surveyed 29 nonessential SLC25 family members in Saccharomyces cerevisiae for their ability to support growth in the presence and absence of HEM25. Six SLC25 family members were identified that were required for growth or for heme synthesis in cells lacking Hem25 function. Importantly, we determined that loss of function of the SLC25 family member Flx1, which imports FAD into mitochondria, together with loss of function of Hem25, resulted in inability to grow on media that required yeast cells to supply energy using mitochondrial respiration. We report that specific components of complexes of the electron transport chain are decreased in the absence of Flx1 and Hem25 function. In addition, we show that mitochondria from flx1Δ hem25Δ cells contain uncharacterized Cox2-containing high molecular weight aggregates. The functions of Flx1 and Hem25 provide a facile explanation for the decrease in heme level, and in specific electron transport chain complex components.

  18. [Polymorphism in the Serotonin Transporter Gene (SLC6A4) and Emotional Bipolar Disorder in Two Regional Mental Health Centers from the Eje Cafetero (Colombia)].

    Science.gov (United States)

    Ramos, Lucero Rengifo; Arias, Duverney Gaviria; Salazar, Liliana Salazar; Vélez, Juan Pablo; Pardo, Stella Lozano

    2012-03-01

    The indel polymorphisms in the promoting region and the 2(nd) intron polymorphisms in the serotonin transporter gene (SLC6A4) have been associated to bipolar disorder 1 (BD1) in several population studies. The objective was to analyze the genotypic and allelic frequencies in both gene regions in a study of cases and controls with individuals from Risaralda and Quindío (Colombia) so as to establish possible associations to BD1, and compare results with previous and similar studies. 133 patients and 120 controls were studied. L and S indel polymorphisms in the promoting region were analyzed by PCR, together with VNTR STin2.10 and STin 2.12 VNTRs polymorphisms in the 2(nd) intron of the SL-C6A4 gene Genotypic and allelic frequencies for the S and L polymorphisms were similar both in cases and controls. However, the LL genotype was significantly increased both in BD1 population (OR=1.89; CI95%=1.1-3.68), and when discriminated by gender. This particular genotype in general population is OR=2.22; IC95%=1.04-5.66 for women, and OR=1.62; IC 95%=0.71-4.39 for men. No significant genotypic and allelic differences were found for VNTR STin2.10 and STin 2.12. polymorphisms. No association was found between polymorphisms of 5-HTTLPR polymorphisms and the 2(nd) intron of the serotonin transporting gene in general patients with BD1, nor when compared by gender. Our results are similar to those reported for Caucasian populations and differ from those of Asian and Brazilian populations. Copyright © 2012 Asociación Colombiana de Psiquiatría. Publicado por Elsevier España. All rights reserved.

  19. Reporte de familias con neurofibromatosis y otras enfermedades genéticas

    OpenAIRE

    Orraca Castillo, Miladys; Licourt Otero, Deysi; Sánchez Álvarez de La Campa, Ana Isabel

    2011-01-01

    La neurofibromatosis tipo 1, es una enfermedad genética que primariamente afecta el desarrollo y crecimiento celular del sistema nervioso, clínicamente se caracteriza por máculas café con leche, neurofibromas, pecas en regiones no expuestas al sol, nódulos de Lisch, lesiones óseas y glioma óptico. En el presente trabajo se describen dos familias, en las cuales algunos individuos padecen esta enfermedad y otros miembros de la misma familia muestran una diferente enfermedad genética. La coexist...

  20. LATENCIA DEL HERPESVIRUS BOVINO-1: EL PAPEL DE LOS TRANSCRITOS RELACIONADOS CON LATENCIA (RL

    Directory of Open Access Journals (Sweden)

    JULIÁN, RUIZ

    2008-01-01

    Full Text Available El herpesvirus bovino-1 es un virus de distribución mundial causante de graves pérdidas económicas debidas principalmente a la disminución de la eficiencia y en los indicadores de salud y productividad de cualquier hato ganadero infectado. Luego de la infección inicial del tracto respiratorio de los animales, el virus establece un estado de latencia viral en las neuronas sensoriales del ganglio trigémino y en los centros germinales de las tonsilas faríngeas. Periódicamente, el virus es reactivado y excretado en secreciones a través de las cuales puede infectar a otros animales susceptibles. Durante dicho estado de latencia hay disminución dramática de la expresión de genes virales, llevando solo a la expresión de dos transcritos: El RNA codificado por el gen relacionado con latencia (RL y el ORF-E viral. Múltiples estudios demuestran como el RL y el ORF-E están involucrados en la regulación del complejo ciclo de latencia y reactivación de la infección. La presente revisión de literatura se enfocará en describir y analizar los distintos estudios que han llevado a dilucidar el papel jugado por el gen RL y el ORF-E, sus transcritos y sus productos proteicos en el establecimiento, mantenimiento y reactivación de la latencia del HVB-1.

  1. Drug Clearance from Cerebrospinal Fluid Mediated by Organic Anion Transporters 1 (Slc22a6) and 3 (Slc22a8) at Arachnoid Membrane of Rats.

    Science.gov (United States)

    Zhang, Zhengyu; Tachikawa, Masanori; Uchida, Yasuo; Terasaki, Tetsuya

    2018-03-05

    Although arachnoid mater epithelial cells form the blood-arachnoid barrier (BAB), acting as a blood-CSF interface, it has been generally considered that the BAB is impermeable to water-soluble substances and plays a largely passive role. Here, we aimed to clarify the function of transporters at the BAB in regulating CSF clearance of water-soluble organic anion drugs based on quantitative targeted absolute proteomics (QTAP) and in vivo analyses. Protein expression levels of 61 molecules, including 19 ATP-binding-cassette (ABC) transporters and 32 solute-carrier (SLC) transporters, were measured in plasma membrane fraction of rat leptomeninges using QTAP. Thirty-three proteins were detected; others were under the quantification limits. Expression levels of multidrug resistance protein 1 (Mdr1a/P-gp/Abcb1a) and breast cancer resistance protein (Bcrp/Abcg2) were 16.6 and 3.27 fmol/μg protein (51.9- and 9.82-fold greater than in choroid plexus, respectively). Among those organic anion transporters detected only at leptomeninges, not choroid plexus, organic anion transporter 1 (oat1/Slc22a6) showed the greatest expression (2.73 fmol/μg protein). On the other hand, the protein expression level of oat3 at leptomeninges was 6.65 fmol/μg protein, and the difference from choroid plexus was within two-fold. To investigate oat1's role, we injected para-aminohippuric acid (PAH) with or without oat1 inhibitors into cisterna magna (to minimize the contribution of choroid plexus function) of rats. A bulk flow marker, FITC-inulin, was not taken up from CSF up to 15 min, whereas uptake clearance of PAH was 26.5 μL/min. PAH uptake was completely blocked by 3 mM cephalothin (inhibits both oat1 and oat3), while 17% of PAH uptake was inhibited by 0.2 mM cephalothin (selectively inhibits oat3). These results indicate that oat1 and oat3 at the BAB provide a distinct clearance pathway of organic anion drugs from CSF independently of choroid plexus.

  2. Manipulación genética de seres humanos

    OpenAIRE

    Manuel Santos Alcántara

    2006-01-01

    El gran avance que ha tenido la Genética en los últimos años y, particularmente, aquello relacionado con el desciframiento del genoma humano, ha traído a la discusión pública la posibilidad concreta de manipular genéticamente a los seres humanos. El mejoramiento o perfeccionamiento genético de los seres humanos, denominado eugenesia, actualmente se ha convertido técnicamente en una realidad, motivando una profunda reflexión de tipo ético. La pregunta básica es la siguiente: aquello que es téc...

  3. Expression of RFC/SLC19A1 is associated with tumor type in bladder cancer patients.

    Directory of Open Access Journals (Sweden)

    Alyaa M Abdel-Haleem

    Full Text Available Urinary bladder cancer (UBC ranks ninth in worldwide cancer. In Egypt, the pattern of bladder cancer is unique in that both the transitional and squamous cell types prevail. Despite much research on the topic, it is still difficult to predict tumor progression, optimal therapy and clinical outcome. The reduced folate carrier (RFC/SLC19A1 is the major transport system for folates in mammalian cells and tissues. RFC is also the primary means of cellular uptake for antifolate cancer chemotherapeutic drugs, however, membrane transport of antifolates by RFC is considered as limiting to antitumor activity. The purpose of this study was to compare the mRNA expression level of RFC/SLC19A1 in urothelial and non-urothelial variants of bladder carcinomas. Quantification of RFC mRNA in the mucosa of 41 untreated bladder cancer patients was performed using RT-qPCR. RFC mRNA steady-state levels were ∼9-fold higher (N = 39; P<0.0001 in bladder tumor specimens relative to normal bladder mRNA. RFC upregulation was strongly correlated with tumor type (urothelial vs. non-urothelial; p<0.05 where median RFC mRNA expression was significantly (p<0.05 higher in the urothelial (∼14-fold compared to the non-urothelial (∼4-fold variant. This may account for the variation in response to antifolate-containing regimens used in the treatment of either type. RFC mRNA levels were not associated with tumor grade (I, II and III or stage (muscle-invasive vs. non-muscle invasive implying that RFC cannot be used for prognostic purposes in bladder carcinomas and its increased expression is an early event in human bladder tumors pathogenesis. Further, RFC can be considered as a potential marker for predicting response to antifolate chemotherapy in urothelial carcinomas.

  4. Estimación de parámetros genéticos para características productivas y reproductivas en los sistemas doble propósito del trópico bajo colombiano

    Directory of Open Access Journals (Sweden)

    A. P. Galeano

    2010-06-01

    Full Text Available Con el objetivo de estimar los componentes de varianza, las heredabilidades, repetibilidadesy correlaciones genéticas y fenotípicas para la producción de leche por lactancia(PL, el peso al destete (PD, el intervalo entre partos (IEP y el Índice de Vaca (IV,de las hembras bovinas manejadas en los sistemas de producción de doble propósitodel trópico bajo colombiano, se analizaron los registros productivos y reproductivosde 1.687 vacas registradas en la Asociación Colombiana de Criadores de Ganado enDoble Propósito (Asodoble, durante el periodo comprendido entre 1998 y 2007. Seempleó un modelo animal mixto que incluyó los efectos fijos del grupo contemporáneo(finca-sexo-época-año, la composición racial, y la duración de la lactancia comocovariable; así como los efectos genéticos aleatorios del animal, el medio ambientepermanente y el residual. Las heredabilidades estimadas para IEP (0,04 y PD (0,11fueron bajas, y moderadas para PL (0,35 e IV (0,24, respectivamente. La repetibilidadestimada para IEP fue baja (0,08, y para PL (0,41 e IV (0,31 moderada; en el casode PD este valor fue igual a la heredabilidad (0,11. Las correlaciones genéticas y fenotípicasobtenidas entre PL y PD con respecto a IEP fueron positivas, y se determinóuna asociación genética negativa entre PL y PD. Los resultados demostraron que el IVes un buen indicador, desde el punto de vista genético, de la eficiencia productiva yreproductiva de los animales manejados en estos sistemas productivos.

  5. Association of the TPO gene in Colombian families with type 1 diabetes Asociación del gen TPO en familias colombianas con la diabetes tipo 1

    Directory of Open Access Journals (Sweden)

    Federico Uribe Londoño

    2009-11-01

    transmission disequilibrium test (TDT.

    It was found that 86% of the patients presented at least one of the three auto-antibodies tested. Both parents and probands were found in HWE for both SNPs. In addition, the two markers were found in tight LD (p < 0.0001. A haplotype associated with susceptibility to the disease was identified (p = 0.0116.

    Autoimmunity was found in a proportion similar to that previously reported. It was found that a haplotype at TPO gene is associated with the disease. Such haplotype is characterized by alleles G and A at rs4927611 and rs732609 SNPs, respectively. Our results suggest a possible causative participation of the TPO gene in T1D. In order to verify them, a sample of equivalent size is currently being collected, from the same population in Colombia.

    Hemos encontrado ligamiento y asociación de la diabetes mellitus tipo 1 (T1D con 2p25. En esta región se halla el gen TPO. Nuestro objetivo fue estudiar la asociación de dicho gen con la susceptibilidad a la T1D en un grupo de familias colombianas, todas ellas originarias de Antioquia, una población especial en el noroccidente del país. Se analizaron cien tríos familiares con T1D. Estas familias ya habían sido estudiadas para anticuerpos contra la ácido-glutámico-descarboxilasa (GAD y el locus marcador D2S319

  6. Association of the solute carrier family 11 member 1 gene polymorphisms with susceptibility to leprosy in a Brazilian sample

    Directory of Open Access Journals (Sweden)

    Maria José Franco Brochado

    2016-02-01

    Full Text Available Natural resistance-associated macrophage protein 1/solute carrier family 11 member 1 gene (Nramp1/Slc11a1 is a gene that controls the susceptibility of inbred mice to intracellular pathogens. Polymorphisms in the human Slc11a1/Nramp1 gene have been associated with host susceptibility to leprosy. This study has evaluated nine polymorphisms of the Slc11a1/Nramp1 gene [(GTn, 274C/T, 469+14G/C, 577-18G/A, 823C/T, 1029 C/T, 1465-85G/A, 1703G/A, and 1729+55del4] in 86 leprosy patients (67 and 19 patients had the multibacillary and the paucibacillary clinical forms of the disease, respectively, and 239 healthy controls matched by age, gender, and ethnicity. The frequency of allele 2 of the (GTn polymorphism was higher in leprosy patients [p = 0.04, odds ratio (OR = 1.49], whereas the frequency of allele 3 was higher in the control group (p = 0.03; OR = 0.66. Patients carrying the 274T allele (p = 0.04; OR = 1.49 and TT homozygosis (p = 0.02; OR = 2.46, such as the 469+14C allele (p = 0.03; OR = 1.53 of the 274C/T and 469+14G/C polymorphisms, respectively, were more frequent in the leprosy group. The leprosy and control groups had similar frequency of the 577-18G/A, 823C/T, 1029C/T, 1465-85G/A, 1703G/A, and 1729+55del4 polymorphisms. The 274C/T polymorphism in exon 3 and the 469+14G/C polymorphism in intron 4 were associated with susceptibility to leprosy, while the allele 2 and 3 of the (GTn polymorphism in the promoter region were associated with susceptibility and protection to leprosy, respectively.

  7. Exploración de la variabilidad genética del maracuyá (Passiflora edulis f. flavicarpa Degener como base para un programa de fitomejoramiento en Colombia

    Directory of Open Access Journals (Sweden)

    John Ocampo

    2013-12-01

    Full Text Available El maracuyá es uno de los principales frutales del Neotrópico y en Colombia existen cerca de 6000 ha cultivadas con esta fruta, con una producción de 90,000 t/año. No obstante este potencial, los cultivos presentan graves problemas fitosanitarios y degeneración genética, lo que se manifiesta por una reducción de la vida útil de la plantación. El objetivo de esta investigación fue evaluar el grado de variabilidad genética del maracuyá cultivado en Colombia como base para un programa de fitomejoramiento. Las recolecciones se realizaron en los departamentos de Antioquia, Caldas, Cauca, Huila, Tolima y Valle del Cauca mediante una selección masal participativa con los productores. En cada cultivo, se seleccionaron diez frutos al azar (calidad extra de las plantas más sobresalientes por productividad y sanidad, en las cuales se registró la incidencia de insectos plaga y enfermedades. Los frutos fueron caracterizados con 11 variables fisicoquímicas y analizados mediante la descomposición de la varianza (univariado y el análisis de clasificación (neighbour joining. Los resultados mostraron que los trips (Neohydatothrips spp. y la virosis (SMV son los problemas fitosanitarios que más afectan el cultivo en los sitios del estudio. El análisis univariado del fruto mostró un porcentaje de variabilidad promedio total de 14.31% (CV, destacándose los pesos de la cáscara (20.53% y de la semilla (20.47%. Tomando en cuenta los parámetros de calidad (°Brix y %pulpa + semilla se identificaron ocho accesiones élite provenientes de Caldas, Valle del Cauca y Antioquia. El análisis de clasificación mostró una alta variabilidad, con poca estructuración por origen geográfico. Estos resultados permitirán iniciar un proceso de mejoramiento genético a partir de genotipos superiores de las accesiones élite identificadas.

  8. Diversidad genética de poblaciones de ajo (Allium sativum L. cultivadas en Guatemala, definida por marcadores de ADN

    Directory of Open Access Journals (Sweden)

    Fredy Uber Rosales-Longo

    2007-01-01

    Full Text Available Diversidad genética de las poblaciones de ajo (Allium sativum L. cultivadas en Gua temala, definida por mar cado res de ADN. En Guatemala es escasa la in for ma ción sobre la diversidad genética de ajo. Los objetivos del estudio fueron: incidir en el mejoramiento de Allium sativum, so bre la base del conocimiento de su variabilidad genética, así mismo, establecer una colección in vi tro de la co lec ción de las poblaciones cultivadas en Guatemala. Los experimentos fueron realizados entre octubre de 2005 y marzo de 2006. La determinación de las variaciones de ADN se realizaron me dian te la téc ni ca de AFLP™. La información se analiza por medio de análisis de componentes principales, análisis de coordenadas principales y análisis de conglomerados. Mediante la inspección de los pro duc tos de AFLP™ y análi sis estadísticos, se detectó una alta variabilidad genética entre los materiales vegetales colectados. Las muestras clasificadas co mo del ti po “Chi leno”, correspondieron a los tipos “Criollo”. Nueve bien diferenciados grupos genéticos se conformaron en un dendrograma y se con fir mó que la diversidad genética descubierta es una función del lugar don de se cul ti van las po bla cio nes de ajo. Se identificó una mayor diversidad genética entre las mues tras de ajo del ti po “Crio llo” que las que se tienen en tre los ma te ria les del ti po “Chileno”, como producto de la mayor dispersión espacial de los primeros. Los materiales genéticos de ajo se encuentran actualmente preservados en un Banco de Germoplasma in vi tro en la Uni dad de Bio tec no lo gía del IC TA.

  9. Action Potential Shortening and Impairment of Cardiac Function by Ablation of Slc26a6.

    Science.gov (United States)

    Sirish, Padmini; Ledford, Hannah A; Timofeyev, Valeriy; Thai, Phung N; Ren, Lu; Kim, Hyo Jeong; Park, Seojin; Lee, Jeong Han; Dai, Gu; Moshref, Maryam; Sihn, Choong-Ryoul; Chen, Wei Chun; Timofeyeva, Maria Valeryevna; Jian, Zhong; Shimkunas, Rafael; Izu, Leighton T; Chiamvimonvat, Nipavan; Chen-Izu, Ye; Yamoah, Ebenezer N; Zhang, Xiao-Dong

    2017-10-01

    Intracellular pH (pH i ) is critical to cardiac excitation and contraction; uncompensated changes in pH i impair cardiac function and trigger arrhythmia. Several ion transporters participate in cardiac pH i regulation. Our previous studies identified several isoforms of a solute carrier Slc26a6 to be highly expressed in cardiomyocytes. We show that Slc26a6 mediates electrogenic Cl - /HCO 3 - exchange activities in cardiomyocytes, suggesting the potential role of Slc26a6 in regulation of not only pH i , but also cardiac excitability. To test the mechanistic role of Slc26a6 in the heart, we took advantage of Slc26a6 knockout ( Slc26a6 -/ - ) mice using both in vivo and in vitro analyses. Consistent with our prediction of its electrogenic activities, ablation of Slc26a6 results in action potential shortening. There are reduced Ca 2+ transient and sarcoplasmic reticulum Ca 2+ load, together with decreased sarcomere shortening in Slc26a6 -/ - cardiomyocytes. These abnormalities translate into reduced fractional shortening and cardiac contractility at the in vivo level. Additionally, pH i is elevated in Slc26a6 -/ - cardiomyocytes with slower recovery kinetics from intracellular alkalization, consistent with the Cl - /HCO 3 - exchange activities of Slc26a6. Moreover, Slc26a6 -/ - mice show evidence of sinus bradycardia and fragmented QRS complex, supporting the critical role of Slc26a6 in cardiac conduction system. Our study provides mechanistic insights into Slc26a6, a unique cardiac electrogenic Cl - /HCO 3 - transporter in ventricular myocytes, linking the critical roles of Slc26a6 in regulation of pH i , excitability, and contractility. pH i is a critical regulator of other membrane and contractile proteins. Future studies are needed to investigate possible changes in these proteins in Slc26a6 -/ - mice. © 2017 American Heart Association, Inc.

  10. Adding PCs to SLC Control System

    International Nuclear Information System (INIS)

    Lahey, T.; Levitt, S.; MacKenzie, R.; Spencer, N.; Underwood, K.

    1993-05-01

    The SLAC Controls Department has interfaced IBM-Compatible PCs to the SLC Control System, for use by the Final Focus Test Beam (FFTB) experimenters, who are building new accelerator equipment and developing and testing it at their home institutions. They will bring the equipment to SLAC and integrate it into the control system using a new software package. The machine physicists and operators will use the existing SLC control system applications and database device types to control and monitor the equipment. The PCs support a limited control environment: they run DOS and exchange messages with the existing control system via TCP/IP over ethernet, using the new SLC Area Message Service. This mechanism will also allow SLC to implement other commercial device controllers that can communicate over ethernet and run the same software interface code

  11. Expresión fenotípica de una sordera familiar con deleción del gen POU3F4

    Directory of Open Access Journals (Sweden)

    Ibis Menéndez

    1999-12-01

    Full Text Available Se presenta una familia cubana con 5 miembros afectados por una hipoacusia bilateral, congénita, severa, mixta con componente neurosensorial predominante y sin alteraciones morfológicas de oído interno. El patrón de transmisión era compatible con la herencia recesiva ligada al cromosoma X. Los estudios moleculares detectaron una deleción en la región Xq21.1 que implica el gen POU3F4, responsable de la sordera de tipo DFN3. Se hacen comentarios sobre la evidente variabilidad clínica de las sorderas tipo DFN3.A Cuban five-member family affected by a severe congenital bilateral mixed deafness with predominant sensorineural component and without morphological changes in the internal hearing is presented in this study. The transmission pattern was compatible with X-linked recessive heritage. The molecular studies detected a deletion of Xq 21 region involving POU3F4 gene which is responsible for DFN3-type deafness. Comments are made on the obvious clinical variability of DFN3-type deafness.

  12. Estructura poblacional y variabilidad genética de Rhodnius prolixus (Hemiptera: Reduviidae procedente de diferentes áreas geográficas de Colombia

    Directory of Open Access Journals (Sweden)

    Diana Carolina López

    2007-01-01

    Resultados. R. prolixus presenta variabilidad genética moderada (Fst 0,057-0,15, entre las poblaciones domiciliadas se encontraron tasas de migración (Nm>1 que revelan flujo genético. Se encontró diferenciación genética de moderada-alta entre la población silvestre de Casanare y las poblaciones domésticas del centro del país (Tolima y Cundinamarca. Conclusión. Las poblaciones domiciliadas de R. prolixus son homogéneas debido a que existe flujo genético entre éstas; lo cual es favorable para el control químico, mientras que la población silvestre agrupa aparte de las domiciliadas. Se evidencia la necesidad de estudiar la estructura genética de los focos silvestres, sus posibles rutas de dispersión y el riesgo epidemiológico que representan.

  13. Identification and functional characterization of a solute carrier family 15, member 4 gene in Litopenaeus vannamei.

    Science.gov (United States)

    Chen, Yong-Gui; Yuan, Kai; Zhang, Ze-Zhi; Yuan, Feng-Hua; Weng, Shao-Ping; Yue, Hai-Tao; He, Jian-Guo; Chen, Yi-Hong

    2016-04-01

    Innate immunity in shrimp is important in resisting bacterial infection. The NF-κB pathway is pivotal in such an immune response. This study cloned and functionally characterized the solute carrier family (SLC) 15 member A 4 (LvSLC15A4) gene in Litopenaeus vannamei. The open reading frame of LvSLC15A4 is 1, 902 bp long and encodes a putative 633-amino acid protein, which is localized in the plasma membrane and intracellular vesicular compartments. Results of the reporter gene assay showed that LvSLC15A4 upregulated NF-κB target genes, including the immediate-early gene 1 of white spot syndrome virus, as well as several antimicrobial peptide genes, such as pen4, CecA, AttA, and Mtk in S2 cells. Moreover, knocked-down expression of LvSLC15A4 reduced pen4 expression in L. vannamei. LvSLC15A4 down-regulation also increased the cumulative mortality of Vibrio parahemolyticus-infected L. vannamei. Furthermore, LvSLC15A4 expression was induced by unfolded protein response (UPR) in L. vannamei hematocytes. These results suggest that LvSLC15A4 participates in L. vannamei innate immunity via the NF-κB pathway and thus may be related to UPR. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. Consideraciones genéticas sobre las dislipidemias y la aterosclerosis

    OpenAIRE

    Julio César Fernández Travieso

    2008-01-01

    La interacción entre factores genéticos y ambientales explican muchos aspectos de la aterosclerosis y las variaciones genéticas constituyen marcadores de riesgo de la enfermedad coronaria (EC), la cual ocupa el primer lugar entre las causas de morbilidad y mortalidad a nivel mundial. La predisposición familiar a padecer EC, junto al avance vertiginoso en técnicas de análisis de ADN y la disponibilidad de secuencias del genoma humano, han orientado la investigación de alteraciones genéticas re...

  15. Transcript levels of members of the SLC2 and SLC5 families of glucose transport proteins in eel swimbladder tissue: the influence of silvering and the influence of a nematode infection.

    Science.gov (United States)

    Schneebauer, Gabriel; Mauracher, David; Fiechtner, Birgit; Pelster, Bernd

    2018-04-01

    The rate of glucose metabolism has been shown to be correlated to glucose uptake in swimbladder gas gland cells. Therefore, it is assumed that in the European eel silvering, i.e., the preparation of the eel for the spawning migration to the Sargasso Sea, coincides with an enhanced capacity for glucose uptake. To test this hypothesis expression of all known glucose transport proteins has been assessed at the transcript level in yellow and in silver eels, and we also included Anguillicola crassus infected swimbladders. Glucose uptake by rete mirabile endothelial cells could be crucial for the countercurrent exchange capacity of the rete. Therefore, this tissue was also included in our analysis. The results revealed expression of ten different members of the slc2 family of glucose transporters, of four slc5 family members, and of kiaa1919 in gas gland tissue. Glucose transporters of the slc2 family were expressed at very high level, and slc2a1b made up about 80% of all slc2 family members, irrespective of the developmental state or the infection status of the eel. Overall, the slc5 family contributed to only about 8% of all detected glucose transport transcripts in gas gland tissue, and the slc2 family to more than 85%. In rete capillaries, the contribution of sodium-dependent glucose transporters was significantly higher, leaving only 66% for the slc2 family of glucose transporters. Neither silvering nor the infection status had a significant effect on the expression of glucose transporters in swimbladder gas gland tissue, suggesting that glucose metabolism of eel gas gland cells may not be related to transcriptional changes of glucose transport proteins.

  16. Effect of GenF20 Plus on serum IGF-1 levels in healthy adults: a randomized controlled study

    Directory of Open Access Journals (Sweden)

    Sonawane N

    2015-03-01

    Full Text Available Navneet Sonawane,1 Vinayak Kale,2 Suhas Erande,3 Jayesh Chaudhary1 1Vedic Lifesciences Pvt Ltd, Mumbai, India; 2Lokmanya Hospital, Pune, India; 3Akshay Hospital, Pune, India Background: Aging is related to a reduction of growth hormones, resulting in physiological derailment and affects overall wellbeing. GenF20 Plus is a dietary supplement postulated to naturally stimulate the secretion of human growth hormone (HGH through the anterior pituitary. This study sought to evaluate the effect of GenF20 Plus in enhancing the levels of insulin-like growth factor-1 (IGF-1, which is a marker of HGH levels. Methods: Seventy subjects aged 35–65 years visiting outpatient departments at five study centers across India, presenting with at least two of the following age-related complaints: decreased memory, decreased libido, low energy levels, or poor quality of sleep were randomly assigned to either GenF20 Plus (n=35 or placebo (n=35 for a period of 12 weeks (84 days. Randomization was carried out using computerized software. The primary outcome measure was serum IGF-1 levels. Changes in waist circumference, body mass index, body fat percentage, lean muscle mass, and scores for memory, libido, energy levels, and quality of sleep were also assessed. Trial registration: CTRI/2011/06/001784. Results: Sixty-one subjects completed the study as per protocol and were analyzed. The mean increase (mean ± standard deviation in IGF-1 levels at day 84 in the GenF20 Plus group was 13.46±36.12 ng/mL and in the placebo group was 6.35±36.56 ng/mL, which was not statistically significantly different (P>0.05 when compared across the groups. In the ≥40 years subgroup, the mean increase in IGF-1 in the GenF20 Plus group (14.59±40.08 ng/mL was not statistically significantly different when compared to the placebo group (3.17±16.09 ng/mL using analysis of variance (ANOVA; P>0.05. However, when this change was analyzed using analysis of covariance (ANCOVA considering

  17. Downregulation of SLC7A7 Triggers an Inflammatory Phenotype in Human Macrophages and Airway Epithelial Cells

    Directory of Open Access Journals (Sweden)

    Bianca Maria Rotoli

    2018-03-01

    Full Text Available Lysinuric protein intolerance (LPI is a recessively inherited aminoaciduria caused by mutations of SLC7A7, the gene encoding y+LAT1 light chain of system y+L for cationic amino acid transport. The pathogenesis of LPI is still unknown. In this study, we have utilized a gene silencing approach in macrophages and airway epithelial cells to investigate whether complications affecting lung and immune system are directly ascribable to the lack of SLC7A7 or, rather, mediated by an abnormal accumulation of arginine in mutated cells. When SLC7A7/y+LAT1 was silenced in human THP-1 macrophages and A549 airway epithelial cells by means of short interference RNA (siRNA, a significant induction of the expression and release of the inflammatory mediators IL1β and TNFα was observed, no matter the intracellular arginine availability. This effect was mainly regulated at transcriptional level through the activation of NFκB signaling pathway. Moreover, since respiratory epithelial cells are the important sources of chemokines in response to pro-inflammatory stimuli, the effect of IL1β has been addressed on SLC7A7 silenced A549 cells. Results obtained indicated that the downregulation of SLC7A7/y+LAT1 markedly strengthened the stimulatory effect of the cytokine on CCL5/RANTES expression and release without affecting the levels of CXCL8/IL8. Consistently, also the conditioned medium of silenced THP-1 macrophages activated airway epithelial cells in terms of CCL5/RANTES expression due to the presence of elevated amount of proinflammatory cytokines. In conclusion, our results point to a novel thus far unknown function of SLC7A7/y+LAT1, that, under physiological conditions, besides transporting arginine, may act as a brake to restrain inflammation.

  18. Neurosteroid Transport in the Brain: Role of ABC and SLC Transporters

    Directory of Open Access Journals (Sweden)

    Markus Grube

    2018-04-01

    Full Text Available Neurosteroids, comprising pregnane, androstane, and sulfated steroids can alter neuronal excitability through interaction with ligand-gated ion channels and other receptors and have therefore a therapeutic potential in several brain disorders. They can be formed in brain cells or are synthesized by an endocrine gland and reach the brain by penetrating the blood–brain barrier (BBB. Especially sulfated steroids such as pregnenolone sulfate (PregS and dehydroepiandrosterone sulfate (DHEAS depend on transporter proteins to cross membranes. In this review, we discuss the involvement of ATP-binding cassette (ABC- and solute carrier (SLC-type membrane proteins in the transport of these compounds at the BBB and in the choroid plexus (CP, but also in the secretion from neurons and glial cells. Among the ABC transporters, especially BCRP (ABCG2 and several MRP/ABCC subfamily members (MRP1, MRP4, MRP8 are expressed in the brain and known to efflux conjugated steroids. Furthermore, several SLC transporters have been shown to mediate cellular uptake of steroid sulfates. These include members of the OATP/SLCO subfamily, namely OATP1A2 and OATP2B1, as well as OAT3 (SLC22A3, which have been reported to be expressed at the BBB, in the CP and in part in neurons. Furthermore, a role of the organic solute transporter OSTα-OSTβ (SLC51A/B in brain DHEAS/PregS homeostasis has been proposed. This transporter was reported to be localized especially in steroidogenic cells of the cerebellum and hippocampus. To date, the impact of transporters on neurosteroid homeostasis is still poorly understood. Further insights are desirable also with regard to the therapeutic potential of these compounds.

  19. Beam-based alignment technique for the SLC [Stanford Linear Collider] linac

    International Nuclear Information System (INIS)

    Adolphsen, C.E.; Lavine, T.L.; Atwood, W.B.

    1989-03-01

    Misalignment of quadrupole magnets and beam position monitors (BPMs) in the linac of the SLAC Linear Collider (SLC) cause the electron and positron beams to be steered off-center in the disk-loaded waveguide accelerator structures. Off-center beams produce wakefields which limit the SLC performance at high beam intensities by causing emittance growth. Here, we present a general method for simultaneously determining quadrupole magnet and BPM offsets using beam trajectory measurements. Results from the application of the method to the SLC linac are described. The alignment precision achieved is approximately 100 μm, which is significantly better than that obtained using optical surveying techniques. 2 refs., 4 figs

  20. Medicamentos genéricos y de marca-Calidad e intercambiabilidad

    Directory of Open Access Journals (Sweden)

    Rua F.

    2012-03-01

    Full Text Available El interés por los medicamentos genéricos procede de la necesidad de los sistemas sanitarios de reducir la factura sanitaria sin merma de los objetivos de salud. Su expansión y uso requieren la aceptación de la población y de los profesionales. También requieren que se despejen algunas dudas sobre su verdadera equivalencia respecto a los medicamentos originales. Desde su introducción en el mercado farmacéutico existe el debate de si son correctamente investigados y de alta calidad. No son infrecuentes los conceptos equivocados entre los profesionales sobre los genéricos, en especial, el supuesto hecho de que pueden llegar a contener hasta un 20% menos de concentración en principio activo. Estas creencias erróneas sugieren una situación de desventaja en la eficacia y la tolerabilidad de los medicamentos genéricos comparados con sus equivalentes de marca, disminuyendo la credibilidad de los mismos. Así, en una encuesta realizada en 2008 los farmacéuticos opinaron que los genéricos y las marcas son diferentes en eficacia (26%, equivalencia (28% y, sobre todo, en la calidad del excipiente (46%, aumentando la percepción de que los genéricos son diferentes en función del laboratorio que los fabrica (52,8%. En este artículo, con el fin de ampliar los conocimientos sobre medicamentos genéricos, solucionar dudas y proporcionar información, objetiva, clara y rigurosa, se revisan los posibles prejuicios sobre genéricos y se exponen las evidencias que existen en torno a los mismos, como los requisitos de bioequivalencia de los productos genéricos, analizando si ésta corrobora adecuadamente la equivalencia terapéutica y de intercambio.

  1. Mutations in SLC33A1 cause a lethal autosomal-recessive disorder with congenital cataracts, hearing loss, and low serum copper and ceruloplasmin

    DEFF Research Database (Denmark)

    Huppke, Peter; Brendel, Cornelia; Kalscheuer, Vera

    2012-01-01

    or compound heterozygous mutations for all affected subjects in SLC33A1 encoding a highly conserved acetylCoA transporter (AT-1) required for acetylation of multiple gangliosides and glycoproteins. The mutations were found to cause reduced or absent AT-1 expression and abnormal intracellular localization...

  2. Identificación de la secuencia del gen de la subunidad catalítica de la telomerasa en Plasmodium falciparum.

    Directory of Open Access Journals (Sweden)

    Claudia Consuelo Rubiano

    2005-03-01

    Full Text Available lntroducción. La enzima telomerasa participa en la regulación de la longitud de los telómeros al sintetizar nuevas repeticiones teloméricas que compensan las pérdidas en cada ronda de replicación del ADN. Por esta razón, el bloqueo de su actividad se plantea como un posible blanco de acción para detener el crecimiento de células con altas tasas de crecimiento. Tal es el caso de Plasmodium falciparum, parásito causante de la forma más grave de paludismo humano, en el cual se sabe que hay actividad de telomerasa pero no se tiene información sobre la enzima misma. Metodología. Para hacer un acercamiento al estudio de la telomerasa en P. falciparum, se realizó un alineamiento múltiple de las secuencias de la subunidad catalítica de la telomerasa disponibles en bases de datos y se obtuvo una secuencia consenso, la cual se comparó con las secuencias generadas en el proyecto de genoma de P. falciparum. Se encontró una secuencia que podría corresponder a parte del gen de la telomerasa de P. falciparum. Para comprobarlo, se diseñaron iniciadores que se utilizaron en ensayos de amplificación sobre el ADN y el ARN del parásito. Resultados. Se amplificaron fragmentos de ADN correspondientes a motivos conservados en las telomerasas y se detectó la presencia del ARNm mediante trascripción reversa y PCR sobre el ADNc generado. De esta manera, al combinar la utilización de herramientas de bioinformática y su posterior comprobación mediante técnicas de biología molecular, se obtuvo la secuencia del gen de la subunidad catalítica de la telomerasa en P. falciparum y se comprobó su presencia y trascripción en el parásito

  3. Daño genético y exposición a plaguicidas en trabajadores agrícolas del Valle de San Quintín, Baja California, México

    Directory of Open Access Journals (Sweden)

    Erika Zúñiga Violante

    2012-12-01

    Full Text Available Diferentes estudios muestran la capacidad de los plaguicidas para inducir daño genético (DG con diversos efectos en la salud. En el presente trabajo se estudia la genotoxicidad en residentes del valle agrícola de San Quintín, Baja California, México (VSQ. El objetivo fue determinar si la exposición laboral y ambiental a plaguicidas en la región del VSQ es un factor de DG y explorar si las mujeres son más vulnerables a dicho efecto. Se aplicó un cuestionario a 88 residentes del VSQ para determinar los factores de inclusión y exclusión del estudio, 40 aceptaron participar, 25 expuestos ocupacionalmente a plaguicidas y 15 ambientalmente expuestos, con similar número de hombres y mujeres. Todos los participantes firmaron un consentimiento informado. Se utilizó la técnica de micronúcleos (MN por bloqueo de la citocinesis en sangre periférica para evaluar el DG con la frecuencia de MN y Puentes de Cromatina en 1000 células binucleadas (CBN; se exploró la correlación del DG con el tiempo de exposición ocupacional a plaguicidas. Los hombres ambientalmente expuestos tuvieron menos DG que las mujeres con medias de MN de 8,1 (±1,83 y 13,1 (±1,7 respectivamente; en cambio, la exposición laboral afectó a los dos sexos: los hombres tuvieron una media de MN igual a 15,9 (±2,9 y en las mujeres fue 18,1 (±1,7. Se concluye que la exposición laboral a plaguicidas es un factor de DG, las mujeres mostraron mayor vulnerabilidad al DG. El tiempo de exposición laboral se relaciona directamente con el aumento del número de MN.

  4. Detección de interacciones genéticas asociadas a enfermedades complejas. Aplicación al cáncer de vejiga

    OpenAIRE

    Urrea Gales, Víctor

    2009-01-01

    El proyecto en el que he participado se engloba dentro del Estudio Español de Cáncer de Vejiga/EPICURO, que comenzó en 1997 con el propósito de avanzar en el conocimiento de este cáncer respecto a las causas genéticas y ambientales, prevención, prognosis y tratamiento, y que aglutina esfuerzos de distintos grupos de nvestigación. El proyecto está coordinado por Núria Malats, jefa del Grupo de Epidemiología Genética y Molecular del CNIO (Centro Nacional de Investigaciones Oncológicas)...

  5. Una variante del gen CAPN10 y los factores ambientales muestran asociación con el exceso de peso en jóvenes colombianos

    Directory of Open Access Journals (Sweden)

    Ana C. Orozco

    2014-12-01

    Full Text Available Introducción. La obesidad resulta de la interacción entre factores de riesgo genéticos y ambientales. Objetivo. Evaluar el efecto de tres variantes genéticas y factores ambientales en el exceso de peso en jóvenes de 10 a 18 años de Medellín, Colombia. Materiales y métodos. Se hizo un estudio transversal en 424 jóvenes divididos en tres grupos: 100 obesos, 112 jóvenes con sobrepeso, y, pareados con ellos, 212 jóvenes con peso adecuado, que conformaron el grupo de control. Se evaluó la asociación entre tres polimorfismos genéticos (UCP3-rs1800849, FTO-rs17817449 y CAPN10-rs3842570 y el exceso de peso, así como su interacción con antecedentes familiares de enfermedad, el tiempo dedicado a ver televisión y a jugar videojuegos y el consumo de alimentos. Resultados. Los antecedentes familiares de obesidad, la dedicación de más de dos horas al día a ver televisión y jugar videojuegos, la falta de lactancia materna, el bajo consumo de cereales, legumbres, frutas y verduras y el gran consumo de comidas rápidas fueron más frecuentes entre los obesos que en los controles. Se observó una asociación significativa entre el genotipo I/I (SNP19 del CAPN10 y el exceso de peso, incluso en los jóvenes que llevaban una vida activa. Además, se encontró una asociación significativa entre los genotipos C/C del UCP3 y G/G y T/T del FTO y el exceso de peso, pero solo en los jóvenes sedentarios. Conclusiones. En esta población, la alimentación inadecuada y el sedentarismo aumentaron el riesgo de exceso de peso. El genotipo I/I de SNP19 del CAPN10 se asoció significativamente con el exceso de peso. Algunas variantes del FTO y el UCP3 mostraron tener efecto solo en jóvenes sedentarios.

  6. A Missense Mutation in SLC45A2 Is Associated with Albinism in Several Small Long Haired Dog Breeds.

    Science.gov (United States)

    Wijesena, Hiruni R; Schmutz, Sheila M

    2015-01-01

    Homozygosity for a large deletion in the solute carrier family 45, member 2 (SLC45A2) gene causes oculocutaneous albinism (OCA) in the Doberman Pinscher breed. An albino Lhasa Apso did not have this g.27141_31223del (CanFam2) deletion in her SLC45A2 sequence. Therefore, SLC45A2 was investigated in this female Lhasa Apso to search for other possible variants that caused her albinism. The albino Lhasa Apso was homozygous for a nonsynonymous substitution in the seventh exon, a c.1478G>A base change that resulted in a glycine to aspartic acid substitution (p.G493D). This mutation was not found in a wolf, a coyote, or any of the 15 other Lhasa Apso dogs or 32 other dogs of breeds related to the Lhasa Apso. However, an albino Pekingese, 2 albino Pomeranians, and an albino mixed breed dog that was small and long haired were also homozygous for the 493D allele. The colored puppies of the albino Lhasa Apso and the colored dam of the 2 albino Pomeranians were heterozygous for this allele. However, an albino Pug was homozygous for the 493G allele and therefore although we suggest the 493D allele causes albinism when homozygous in several small, long haired dog breeds, it does not explain all albinism in dogs. A variant effect prediction for the albino Lhasa Apso confirms that p.G493D is a deleterious substitution, and a topology prediction for SLC45A2 suggests that the 11th transmembrane domain where the 493rd amino acid was located, has an altered structure. © The American Genetic Association 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  7. Aproximación genómica al diagnóstico genético de las distrofias hereditarias de retina y búsqueda de nuevos genes relacionados

    OpenAIRE

    González del Pozo, María

    2014-01-01

    Diagnosticar genéticamente a las familias afectas de alguna de las distrofias hereditarias de retina (DHR) es, desde el punto de vista del genetista, una tarea ardua y complicada, si atendemos a la gran cantidad de genes y mutaciones reportados hasta la fecha. La gran heterogeneidad clínica y genética que caracteriza a este conjunto de enfermedades, es sin duda el mayor impedimento para su resolución genética. En este escenario, el empleo de herramientas cada vez más poderosas es indispensabl...

  8. Estrategia de genotipado del gen FMR1: Método de diagnóstico alternativo para el Síndrome X Frágil y otras enfermedades por expansión de trinucleotidos

    Directory of Open Access Journals (Sweden)

    Saúl Lindo-Samanamud

    2013-10-01

    Full Text Available Objetivos: Diseñar una estrategia alternativa por PCR para el genotipado de secuencias ricas en citosinas, basada en modificación nucleotídica. Material y métodos: Se modificó el gen FMR1 nativo de ocho individuos clínicamente no afectados por el Síndrome X frágil, cambiando las citosinas por uracilos, empleando bisulfito de sodio. El ADN modificado fue purificado y cuantificado por espectrofotometría. Las estructuras alternativas y potenciales islas CpG que adopta el microsatélite inestable fueron simuladas con los programas MFOLD y CpGplot. Se generaron cebadores específicos que hibriden tanto con el microsatélite modificado (Primer T y con una secuencia modificada de las islas CpG (Primer M, utilizando el programa MethPrimer. Finalmente, ambas secuencias fueron amplificadas por PCR y los amplicones fueron separados por electroforesis en gel de poliacrilamida (PAGE por sus siglas en inglés al 6% y visualizados con tinción de nitrato de plata. Resultados: La modificación del ADN fue evidenciada por espectrofotometría al uracilo. Las estructuras observadas en la simulación fueron las horquillas encontrándose dos potenciales islas CpG. La amplificación con los cebadores T, confirmó el diseño in silico desarrollado para abordar la estructura en horquillas. La amplificación con los cebadores M permitió detectar metilación de la primera isla CpG del gen FMR1.Conclusión: Se propone un diseño alternativo para amplificación de secuencias de microsatélite que contengan citosinas metiladas y no metiladas. Se requieren estudios posteriores con muestras de ADN que contengan microsatélites muy expandidos para validar su aplicación para diagnóstico molecular.

  9. Prenatal exposure to maternal depressed mood and the MTHFR C677T variant affect SLC6A4 methylation in infants at birth.

    Directory of Open Access Journals (Sweden)

    Angela M Devlin

    2010-08-01

    Full Text Available Prenatal and early postnatal exposure to maternal depression may "program" childhood behavior via epigenetic processes such as DNA methylation. Methylenetetrahydro-folate reductase (MTHFR is an important enzyme in the generation of methyl groups for DNA methylation. The common MTHFR C677T variant is associated with depression in men and non-pregnant women, and with global changes in DNA methylation. This study investigated the effect of maternal MTHFR C677T genotype on antenatal maternal mood, and their impact on the gene-specific methylation in pregnant women and their newborn infants. The methylation status of SLC6A4, which encodes the transmembrane serotonin transporter, and BDNF, which encodes brain derived neurotrophic factor, were assessed because of their potential role in behaviour.Depressed mood was assessed by the Edinburgh Postnatal Depression Scale (EPDS and the Hamilton Rating Scale for Depression (HAM-D in women (n = 82, all taking folate during the 2(nd and 3(rd trimesters of pregnancy. The methylation status of SLC6A4 and BDNF were assessed in 3rd trimester maternal peripheral leukocytes and in umbilical cord leukocytes collected from their infants at birth. Women with the MTHFR 677TT genotype had greater 2(nd trimester depressed mood (p<0.05. Increased 2(nd trimester maternal depressed mood (EPDS scores was associated with decreased maternal and infant SLC6A4 promoter methylation (p<0.05, but had no effect on BDNF promoter methylation.These findings show that the MTHFR C677T variant is associated with greater depressed mood during pregnancy. We further showed that prenatal exposure to maternal depressed mood affects gene-specific DNA methylation patterns. These findings support the concept that alterations in epigenetic processes may contribute to developmental programming of behaviour by maternal depression.

  10. Serotonin Transporter Gene ("SLC6A4") Methylation Associates with Neonatal Intensive Care Unit Stay and 3-month-old Temperament in Preterm Infants

    Science.gov (United States)

    Montirosso, Rosario; Provenzi, Livio; Fumagalli, Monica; Sirgiovanni, Ida; Giorda, Roberto; Pozzoli, Uberto; Beri, Silvana; Menozzi, Giorgia; Tronick, Ed; Morandi, Francesco; Mosca, Fabio; Borgatti, Renato

    2016-01-01

    Preterm birth and Neonatal Intensive Care Unit (NICU) stay are early adverse stressful experiences, which may result in an altered temperamental profile. The serotonin transporter gene ("SLC6A4"), which has been linked to infant temperament, is susceptible to epigenetic regulation associated with early stressful experience. This study…

  11. Análisis de la biodiversidad genética del algodón peruano usando marcadores moleculares: Avances en el 2004

    OpenAIRE

    Olórtegui, José; Espinoza, Marco; Espinoza, José; Montoya, Ysabel

    2005-01-01

    Tres mini preparaciones de extracción de ADN de algodón fueron comparadas en términos de calidad y rendimiento. El método de extracción de ADN usando CTAB fue el más eficiente (30 ug) en comparación con un kit comercial de extracción (20 ug) a partir de 100 mg de hojas cotiledonarias. La óptima calidad del ADN fue evaluada con las enzimas de restricción EcoRI y MseI. El ADN preparado será usado para iniciar el análisis de la biodiversidad genética del algodón peruano, usando marcadores mole...

  12. Optimización de la resolución electroforética de la banda 2.1 y de las bandas 4.1a y 4.1b del citoesqueleto de memebrana del eritrocito humano

    Directory of Open Access Journals (Sweden)

    Enrioue Salcedo

    1993-09-01

    Full Text Available Durante años de trabajo en el modelo Plasmodium falciparum-eritrocito humano hemos observado una insuficiente separación de la banda 2.1 (ankirina, 215Kd con respecto a la banda 2 (B-espectrina, 225Kd cuyas masas moleculares se diferencian en 10Kd (lo que representa menos del 5% de la masa de las proteínas. En el sistema discontinuo de Laemmli, éstas comigran (1. Similar problema se encuentra entre las bandas 4.la(80Kd y 4.1 b(78Kd; cuya diferencia representa el 2,5% de la masa molecular de éstas.

  13. Els orígens de la tuberculosi

    OpenAIRE

    Bueno i Torrens, David, 1965-

    2014-01-01

    La tuberculosi és una de les primeres malalties infeccioses de la història de la humanitat. Es dedueix del registre fòssil, per les empremtes que deixa en els ossos d"algunes de les persones que l"han patit. Tradicionalment s"ha assumit que la tuberculosi ve del bestiar boví, que la va transmetre per primer cop a les persones durant el neolític. Però l"anàlisi genètica dels bacteris causants d"aquesta malaltia en diversos indrets del món i de bacteris fòssils trobats en mòmies precolombines h...

  14. Origen de la mutación G736A del gen Parkin en la población de Peque (noroccidente de Antioquia

    Directory of Open Access Journals (Sweden)

    William H. Arias P.

    2012-01-01

    Full Text Available En una gran familia de la población de Peque (Antioquia se hallaron individuos afectados por la enfermedad de Parkinson juvenil, debido a la mutación G736A localizada en el exón 6 del gen PARK2. Dada la composición triétnica de nuestras poblaciones mestizas, y dado que esta mutación fue reportada en España, nuestro objetivo fue buscar su origen. Para ello, tipificamos con marcadores moleculares del cromosoma Y a 132 individuos no relacionados de la población general y a 31 de la familia, además con registros de apellidos en dos periodos diferentes. La mutación solo se encontró en la familia en la que se dio un solo haplotipo europeo (haplogrupo P de apellido Valle, y un solo haplotipo nativo (Q1a3a de apellido Salas, portadores de la mutación G736A. La mutación G736A ingresó con fundadores europeos (P de apellido Valle, aumentó su frecuencia debido a un efecto fundador, al crecimiento interno y a cruces endogámicos en la familia y no en la población total, y se expandió en un contexto amerindio (Q1a3a de apellido Salas.

  15. High levels of the type III inorganic phosphate transporter PiT1 (SLC20A1) can confer faster cell adhesion

    OpenAIRE

    Kongsfelt, Iben Boutrup; Byskov, Kristina; Pedersen, Lasse Ebdrup; Pedersen, Lene

    2014-01-01

    The inorganic phosphate transporter PiT1 (SLC20A1) is ubiquitously expressed in mammalian cells. We recently showed that overexpression of human PiT1 was sufficient to increase proliferation of two strict density-inhibited cell lines, murine fibroblastic NIH3T3 and pre-osteoblastic MC3T3-E1 cells, and allowed the cultures to grow to higher cell densities. In addition, upon transformation NIH3T3 cells showed increased ability to form colonies in soft agar. The cellular regulation of PiT1 expre...

  16. Diversidad genética, entre y dentro de los mayores grupos humanos

    Directory of Open Access Journals (Sweden)

    Barbujani, G.

    2003-01-01

    Full Text Available Varios estudios están de acuerdo cuando reportan que cerca del 85% de la diversidad del ADN autosomal y de los loci de las proteínas se debe a diferencias entre individuos dentro de la misma población, mientras que las diferencias entre los grupos de diferentes continentes son responsables de solamente 10% de la variación genética total. Estos resultados están en conflicto con nociones populares de razas humanas claramente distintas y relativamente homogéneas, y nos hacen cuestionar la utilidad de clasificaciones étnicas en diagnósticos médicos, en el campo forense y en genética farmacológica. Nuevos datos obtenidos de inserciones polimórficas de Alu y del cromosoma Y confirman los resultados previos, aunque indican una diversidad mayor en algunos (pero no todos los loci del cromosoma Y. Estos datos nos permiten investigar dos preguntas: (1 si las diferencias continentales, aunque pequeñas, son suficientemente grandes como para asignar a individuos a sus continentes basados en sus genotipos; (2 si los genotipos observados se agrupan en grupos de población o continentales cuando el origen de la muestra se ignora. Usando varios métodos estadísticos, veremos que los errores de clasificación son por lo menos de un 30% para los polimorfismos autosomales bi-alélicos, y de un 27% para el cromosoma Y. Cuatro series de datos genéticos de todo el mundo sugieren la existencia de grupos de genotipos diferentes, pero que éstos cuatro grupos no coinciden el uno con el otro. Adicionalmente, estudios de bloques de ADN del genoma humano indican que la mayor parte de dichos bloques es compartida entre los continentes, con solamente un pequeño porcentaje siendo específico a ciertos continentes. Estos resultados no indican que haya una base clara para subdividir a los humanos en grupos biológicamente definidos. Este puede no ser un problema en áreas aplicadas de genéticas, dado que los métodos rápidos para obtener genotipos individuales

  17. Determining mutations in G6PC and SLC37A4 genes in a sample of Brazilian patients with glycogen storage disease types Ia and Ib

    Directory of Open Access Journals (Sweden)

    Marcelo Paschoalete Carlin

    2013-01-01

    Full Text Available Glycogen storage disease (GSD comprises a group of autosomal recessive disorders characterized by deficiency of the enzymes that regulate the synthesis or degradation of glycogen. Types Ia and Ib are the most prevalent; while the former is caused by deficiency of glucose-6-phosphatase (G6Pase, the latter is associated with impaired glucose-6-phosphate transporter, where the catalytic unit of G6Pase is located. Over 85 mutations have been reported since the cloning of G6PC and SLC37A4 genes. In this study, twelve unrelated patients with clinical symptoms suggestive of GSDIa and Ib were investigated by using genetic sequencing of G6PC and SLC37A4 genes, being three confirmed as having GSD Ia, and two with GSD Ib. In seven of these patients no mutations were detected in any of the genes. Five changes were detected in G6PC, including three known point mutations (p.G68R, p.R83C and p.Q347X and two neutral mutations (c.432G > A and c.1176T > C. Four changes were found in SLC37A4: a known point mutation (p.G149E, a novel frameshift insertion (c.1338_1339insT, and two neutral mutations (c.1287G > A and c.1076-28C > T. The frequency of mutations in our population was similar to that observed in the literature, in which the mutation p.R83C is also the most frequent one. Analysis of both genes should be considered in the investigation of this condition. An alternative explanation to the negative results in this molecular study is the possibility of a misdiagnosis. Even with a careful evaluation based on laboratory and clinical findings, overlap with other types of GSD is possible, and further molecular studies should be indicated.

  18. Acceso a medicamentos y situación del mercado farmacéutico en Ecuador

    Directory of Open Access Journals (Sweden)

    Esteban Ortiz-Prado

    Full Text Available Resulta fundamental, en el área de la salud pública, conocer la estructura y dinámica del mercado farmacéutico ecuatoriano, su segmentación entre el sector público y privado, así como su relación con la demanda y oferta de medicamentos tanto genéricos como de marca. Para esto, se realizó un estudio descriptivo observacional con la información obtenida de las bases de datos científicos, institucionales, técnico-administrativas y económicas disponibles. Además, se revisó la información científica referente al mercado farmacéutico ecuatoriano y regional a través de los buscadores PubMed y Ovid. Los medicamentos de marca dispensados en el país corresponden 69,6% a marcas y los genéricos a 30,4%. En Ecuador, del total de medicamentos registrados, 1 829 (13,6% son considerados de venta libre y 11 622 (86,4% son de venta bajo prescripción médica. De las ventas, 93,15% corresponden a medicamentos de marca y solo 6,85% a genéricos. El 90% de las farmacias se hallan en la zona urbana y solo 10% a nivel rural. El incremento de precios en los últimos cinco años fue de 12,5% para los medicamentos de marca y de 0,86% para genéricos. La dispensación y consumo de medicamentos de marca es 2,3 veces mayor que la de genéricos. La mayoría de las farmacias se localizan en la zona urbana, demostrando que existe una relación entre el poder adquisitivo y el acceso a los medicamentos. A pesar de que la autoridad reguladora estipula que 13% de medicamentos son de venta libre, aproximadamente 60% de la población accede a medicamentos sin prescripción médica.

  19. SLC kicker magnet limitations

    International Nuclear Information System (INIS)

    Cassel, R.; Donaldson, A.; Mattison, T.; Bowden, G.; Weaver, J.; Bulos, F.; Fiander, D.

    1991-01-01

    The SLC Damping Ring kicker magnets requires a fast magnetic field rise time of 58 nsec, a peak field of 800 gauss, a pulse amplitude stability of 0.01%, and a reasonable operational lifetime. The original kicker magnets designed by SLAC and at Fermi were not able to fulfill the SLC kicker requirements. Extensive studies were conducted to determine the limitation in the magnets, response of the ferrite in kicker magnet, and the modifications needed to improve the kicker magnet performance. The paper details the SLAC and Fermi kicker magnets limitation of performance

  20. Filling Landsat ETM+ SLC-off gaps using a segmentation model approach

    Science.gov (United States)

    Maxwell, Susan

    2004-01-01

    The purpose of this article is to present a methodology for filling Landsat Scan Line Corrector (SLC)-off gaps with same-scene spectral data guided by a segmentation model. Failure of the SLC on the Landsat 7 Enhanced Thematic Mapper Plus (ETM+) instrument resulted in a loss of approximately 25 percent of the spectral data. The missing data span across most of the image with scan gaps varying in size from two pixels near the center of the image to 14 pixels along the east and west edges. Even with the scan gaps, the radiometric and geometric qualities of the remaining portions of the image still meet design specifications and therefore contain useful information (see http:// landsat7.usgs.gov for additional information). The U.S. Geological Survey EROS Data Center (EDC) is evaluating several techniques to fill the gaps in SLC-off data to enhance the usability of the imagery (Howard and Lacasse 2004) (PE&RS, August 2004). The method presented here uses a segmentation model approach that allows for same-scene spectral data to be used to fill the gaps. The segment model is generated from a complete satellite image with no missing spectral data (e.g., Landsat 5, Landsat 7 SLCon, SPOT). The model is overlaid on the Landsat SLC-off image, and the missing data within the gaps are then estimated using SLC-off spectral data that intersect the segment boundary. A major advantage of this approach is that the gaps are filled using spectral data derived from the same SLC-off satellite image.

  1. Mutations in OTOF, CLDN14 & SLC26A4 genes as major causes of hearing impairment in Dhadkai village, Jammu & Kashmir, India

    Directory of Open Access Journals (Sweden)

    Nishtha Pandey

    2017-01-01

    Interpretation & conclusions: This study suggested considerable genetic heterogeneity in the causation of hearing loss in Dhadkai. Recessive mutations were observed in at least three genes causing hearing loss: OTOF (p.R708X, SLC26A4 (p.Y556X and CLDN14 (p.V85D. Mutation p.R708X appeared to be the major cause of hearing impairment in Dhadkai.

  2. Inhibition of intestinal bile acid transporter Slc10a2 improves triglyceride metabolism and normalizes elevated plasma glucose levels in mice.

    Directory of Open Access Journals (Sweden)

    Thomas Lundåsen

    Full Text Available Interruption of the enterohepatic circulation of bile acids increases cholesterol catabolism, thereby stimulating hepatic cholesterol synthesis from acetate. We hypothesized that such treatment should lower the hepatic acetate pool which may alter triglyceride and glucose metabolism. We explored this using mice deficient of the ileal sodium-dependent BA transporter (Slc10a2 and ob/ob mice treated with a specific inhibitor of Slc10a2. Plasma TG levels were reduced in Slc10a2-deficient mice, and when challenged with a sucrose-rich diet, they displayed a reduced response in hepatic TG production as observed from the mRNA levels of several key enzymes in fatty acid synthesis. This effect was paralleled by a diminished induction of mature sterol regulatory element-binding protein 1c (Srebp1c. Unexpectedly, the SR-diet induced intestinal fibroblast growth factor (FGF 15 mRNA and normalized bile acid synthesis in Slc10a2-/- mice. Pharmacologic inhibition of Slc10a2 in diabetic ob/ob mice reduced serum glucose, insulin and TGs, as well as hepatic mRNA levels of Srebp1c and its target genes. These responses are contrary to those reported following treatment of mice with a bile acid binding resin. Moreover, when key metabolic signal transduction pathways in the liver were investigated, those of Mek1/2-Erk1/2 and Akt were blunted after treatment of ob/ob mice with the Slc10a2 inhibitor. It is concluded that abrogation of Slc10a2 reduces hepatic Srebp1c activity and serum TGs, and in the diabetic ob/ob model it also reduces glucose and insulin levels. Hence, targeting of Slc10a2 may be a promising strategy to treat hypertriglyceridemia and diabetes.

  3. Polimorfismo genético relacionado con la probabilidad de desarrollar asma ocupacional en trabajadores expuestos a isocianatos

    Directory of Open Access Journals (Sweden)

    Gaetano Pepe Betancourt

    2014-03-01

    Full Text Available Introducción: El desarrollo tecnológico ha traído como consecuencia el uso de sustancias químicas potencialmente perjudiciales para la salud de los trabajadores. Particularmente el uso de isocianatos ha resultado en una mayor morbilidad de patología respiratoria, especialmente el asma. Considerando que no todos los trabajadores expuestos desarrollan la enfermedad se ha propuesto un modelo de interacción gen-medioambiental, el cual trata de explicar la predisposición genética que tienen algunos individuos a desarrollar asma ocupacional y otros no. Objetivo: Conocer la evidencia científica relacionada con el polimorfismo genético y la susceptibilidad que tienen los trabajadores expuestos a isocianatos a desarrollar asma ocupacional. Metodología: Se realizó una revisión sistemática mediante una búsqueda bibliográfica utilizando las bases de datos PubMedline, así como en los repositorios Dialnet y ELSEVIER. Se extrajeron los artículos relacionados al objetivo de esta revisión, no se aplicaron filtros de temporalidad, utilizándose los siguientes descriptores: MeSH Major Topic, MeSH Terms. El periodo de búsqueda fue desde el 20 de noviembre de 2013 y finalizó el 15 de diciembre de 2013. El nivel de evidencia se estableció de acuerdo a los criterios GRADE. Resultados: Se analizaron a texto completo 42 artículos, la evidencia científica se sustentó en 11 estudios de casos-controles. Dada la complejidad del polimorfismo genético asociado con la expresión fenotípica de la enfermedad, como limitación de los estudios, los autores coinciden que el tamaño muestral no es suficientemente grande, sin embargo después de ajustar los factores de confusión los artículos encontrados tuvieron un nivel de evidencia B de GRADE. Conclusión: La genética tiene una influencia significativa en el asma ocupacional inducida por isocianatos. El peso de la susceptibilidad genética y de la interacción gen-medioambiente aún no se han

  4. Thiamine responsive megaloblastic anemia: a novel SLC19A2 compound heterozygous mutation in two siblings.

    Science.gov (United States)

    Mozzillo, Enza; Melis, Daniela; Falco, Mariateresa; Fattorusso, Valentina; Taurisano, Roberta; Flanagan, Sarah E; Ellard, Sian; Franzese, Adriana

    2013-08-01

    Thiamine responsive megaloblastic anemia (TRMA) is an autosomal recessive disease caused by loss of function mutations in the SLC19A2 gene. TRMA is characterized by anemia, deafness, and diabetes. In some cases, optic atrophy or more rarely retinitis pigmentosa is noted. We now report two sisters, the eldest of which presented to a different hospital during childhood with sensorineural deafness, which was treated with a hearing prosthesis, insulin requiring diabetes, retinitis pigmentosa, optic atrophy, and macrocytic anemia. These features initially suggested a clinical diagnosis of Wolfram syndrome (WS). Therapy with thiamine was initiated which resulted in the resolution of the anemia. The younger sister, who was affected with sensorineural deafness, was referred to our hospital for non-autoimmune diabetes. She was found to have macrocytosis and ocular abnormalities. Because a diagnosis of TRMA was suspected, therapy with insulin and thiamine was started. Sequencing analysis of the SLC19A2 gene identified a compound heterozygous mutation p.Y81X/p.L457X (c.242insA/c.1370delT) in both sisters. Non-autoimmune diabetes associated with deafness and macrocytosis, without anemia, suggests a diagnosis of TRMA. Patients clinically diagnosed with WS with anemia and/or macrocytosis should be reevaluated for TRMA. © 2012 John Wiley & Sons A/S.

  5. CYP1A1, CYP2E1 Y RIESGO A CÁNCER GÁSTRICO EN UNA POBLACIÓN COLOMBIANA DE ALTA INCIDENCIA

    Directory of Open Access Journals (Sweden)

    Eduardo Castaño

    2009-09-01

    Full Text Available El objetivo fue probar la hipótesis de que en casos y controles, de una población colombiana con alta incidencia de cáncer gástrico, muestran diferencias significativas entre las frecuencias de los polimorfismos genéticos CYP1A1-m2 y CYP2E1-c2; y a la vez, probar si hay diferencias entre el hábito del tabaquismo, el consumo de licor y el estrato socioeconómico; así como también sus posibles interacciones. Ochenta y siete pacientes afectados por cáncer gástrico e igual número de controles, del mismo grupo poblacional, genéticamente aislado, pertenecientes a la comunidad “paisa” del departamento de Caldas, fueron genotipíficados por medio de PCR-RFLPs para los polimorfismos CYP1A1-m2 y CYP2E1-c2. Además, se tuvo en cuenta las variables socioeconómicas y el estilo de vida, con respecto al tabaquismo y al consumo de alcohol. Los resultados encontrados sugieren que los portadores del polimorfismo CYP2E1-c2, asociado con mayor actividad metabólica, tienen mayor riesgo a desarrollar cáncer gástrico (OR=3.6, CI95% 1.6-8.1/p=0,002. En contraste, la frecuencia del polimorfismo CYP1A1*2A (MspI, también asociado con mayor actividad enzimática, mostró similar frecuencia entre los dos grupos. El tabaquismo y el estrato socioeconómico bajo, también mostraron diferencias significativas. En conclusión, se evidencia interacción significativa entre gen-ambiente, particularmente entre el tabaquismo y los alelos bioactiavantes CYP2E1- c2 y CYP1A1-m2, que pueden alterar la susceptibilidad a cáncer de estómago en esta región Andina del noroeste de Sur América.

  6. Seguimiento longitudinal de la masa ósea en mujeres postmenopáusicas en función de los polimorfismo BSMI y APAI del gen del receptor de la vitamina D (VDR)

    OpenAIRE

    Pedrera Canal, María

    2015-01-01

    La Osteoporosis es una condición poligénica que está determinada por la influencia de diversos genes, cada uno de los cuales tiene un efecto modesto sobre la masa ósea. El objetivo del presente trabajo de tesis doctoral fue determinar como los polimorfismos del gen receptor de la vitamina D (BsmI y ApaI) están asociados con la densidad mineral ósea (DMO), los valores de DMO en mujeres osteoporóticas y la respuesta al tratamiento en mujeres osteoporóticas postmenopáusicas españolas. Un total d...

  7. Salud pública, genética y ética Public health, genetics and ethics

    Directory of Open Access Journals (Sweden)

    Miguel H Kottow

    2002-10-01

    Full Text Available La investigación genética ha tenido una enorme expansión en recientes décadas, con repercusiones terapéuticas aún inciertas. El análisis bioético tradicional de las complejas prácticas genéticas ha sido insuficiente por sostenerse en la ética de la investigación y en la bioética de corte principialista. Los problemas éticos más importantes de la genética son de orden colectivo y deben ser abordados por una reflexión ético-social cuyo enfoque es más amplio que la agenda interpersonal del principialismo. Temas como exploraciones genéticas, cuestiones patrimoniales, manipulación génica y asignación de recursos, deben todos ser sometidos a un pensamiento inspirado en los requerimientos de la ciudadanía, en el bien común y en la definición del rol del Estado en fiscalizar actividades genéticas y en proteger a la población. El objetivo del estudio es mostrar cómo el amplio campo de la ética y de la genética tiene una mayor relevancia en el campo social que en el clínico. El objetivo del trabajo es señalar que la bioética principialista ha enfatizado los problemas éticos individuales que nacen con la intervención genética, a costa de marginar sus importantes repercusiones sociales.Genetics research has shown enormous developments in recent decades, although as yet with only limited clinical application. Bioethical analysis has been unable to deal with the vast problems of genetics because emphasis has been put on the principlism applied to both clinical and research bioethics. Genetics nevertheless poses its most complex moral dilemmas at the public level, where a social brand of ethics ought to supersede the essentially interpersonal perspective of principlism. A more social understanding of ethics in genetics is required to unravel issues such as research and clinical explorations, ownership and patents, genetic manipulation, and allocation of resources. All these issues require reflection based on the

  8. La importancia del mundo virtual en la enseñanza y aprendizaje “AVA para el contenido de Genética”.

    Directory of Open Access Journals (Sweden)

    Alexander Afanador Castañeda

    2011-02-01

    Full Text Available El presente escrito describe la importancia y la necesidad de incorporar las TIC en los procesos de enseñanza y aprendizaje de las ciencias, además la utilización de ambientes virtuales de aprendizajes como alternativa innovadora y eficaz para la adquisición y comunicación del conocimiento científico, y hace referencia a la necesidad de incorporar la evaluación formativa en medios virtuales. Por último se presenta un ambiente virtual de aprendizaje como estrategia didáctica teniendo en cuenta la resolución de problemas para la apropiación del contenido conceptual en Genética con su respectivo guión pedagógico.

  9. Profil Ekspresi mRNA Gen Murine Double Minute2, Kruppel-Like Factor4, dan c-Myc pada Fibrosarkoma

    Directory of Open Access Journals (Sweden)

    - Humaryanto

    2017-02-01

    Full Text Available Abstrak Fibrosarkoma hanya terjadi 1–3% dari seluruh keganasan jaringan lunak. Hingga saat ini etiologi fibrosarkoma belum diketahui dengan pasti. Beberapa faktor dapat menjadi penyebab patogenesis fibrosarkoma antara lain radiasi, terpapar zat kimia tertentu, serta infeksi human herpes virus 8 (HHV8 dan Epstein-Barr virus (EBV. Penelitian terkini menunjukkan bahwa banyak sarkoma terkait dengan mutasi genetik. Penelitian ini bertujuan melihat profil ekspresi mRNA gen Krüppel-like Factor4, Murine Double Minute2, dan c-Myc pada fibrosarkoma menggunakan teknik real time PCR kuantitatif (quantitative real time PCR, qRT-PCR. Analisis data menggunakan metode kuantititatif relatif 2-ΔΔCt. Penelitian ini menggunakan 10 sampel kasus fibrosarkoma yang ditemukan di Kota Jambi dari tahun 2011–2015. Hasil ΔCt (+SD MDM2, KLF-4, dan c-Myc disusun dari nilai yang terkecil hingga tertinggi adalah 1,85±2,14; 2,06±3,86; 2,9±2,66 secara berurutan. Dibanding dengan level ekspresi dengan GAPDH sebagai housekeeping gene, gen MDM2 dan KLF-4 relatif menurun dua kali lipat, sedangkan gen c-Myc relatif menurun lebih dari tiga kali lipat. Simpulan, penelitian ini menunjukkan bahwa pada kasus fibrosarkoma, gen c-Myc disupresi lebih kuat dibanding dengan gen MDM2 dan KLF-4. Abstract Fibrosarcoma is a rare soft tissue sarcoma, reported only 1–3% of all soft tissue sarcomas. Like any other soft-tissue sarcomas the definitive caused has not yet understood. Recognized causes include exposure to ionizing radiation, various physical and chemical factors, infection with human herpes virus (HHV8 and Epstein-Barr virus (EBV. Current research indicates many sarcomas are associated with genetic mutations. In this study, we investigated profile of mRNA gene expression KLF4, MDM2, and c-Myc of RNA in fibrosarcoma cases. The genes expression was examined using quantitative real time PCR (qRT-PCR and we analyzed the relative gene expression using the 2-ΔΔCt method. Ten

  10. SLC energy spectrum monitor using synchrotron radiation

    International Nuclear Information System (INIS)

    Seeman, J.; Brunk, W.; Early, R.; Ross, M.; Tillmann, E.; Walz, D.

    1986-01-01

    The SLAC linac is being upgraded for the use in the SLAC Linear Collider (SLC). The improved linac must accelerate electron and positron bunches from 1.2 GeV to 50 GeV while producing output energy spectra of about 0.2%. The energy spectra must be maintained during operation to provide for good beam transmission and to minimize chromatic effects in the SLC ARCs and Final Focus. The energy spectra of these beams are determined by the bunch length and intensity, the RF phase and waveform and the intra-bunch longitudinal wakefields. A non-destructive energy spectrum monitor has been designed using a vertical wiggler magnet located downstream of the horizontal beam splitter at the end of the SLC linac. It produces synchrotron radiation which is viewed in an off-axis x-ray position sensitive detector. The expected resolution is 0.08 %. The design considerations of this monitor are presented. A pair of these monitors is under construction with an installation data set for late summer 1986

  11. SLC energy spectrum monitor using synchrotron radiation

    International Nuclear Information System (INIS)

    Seeman, J.; Brunk, W.; Early, R.; Ross, M.; Tillmann, E.; Walz, D.

    1986-04-01

    The SLAC Linac is being upgraded for the use in the SLAC Linear Collider (SLC). The improved Linac must accelerate electron and positron bunches from 1.2 GeV to 50 GeV while producing output energy spectra of about 0.2%. The energy spectra must be maintained during operation to provide for good beam transmission and to minimize chromatic effects in the SLC ARCs and Final Focus. the energy spectra of these beams are determined by the bunch length and intensity, the RF phase and waveform and the intra-bunch longitudinal wakefields. A non-destructive energy spectrum monitor has been designed using a vertical wiggler magnet located downstream of the horizontal beam splitter at the end of the SLC Linac. It produces synchrotron radiation which is viewed in an off-axis x-ray position sensitive detector. The expected resolution is 0.08%. The design considerations of this monitor are presented in this paper. A pair of these monitors is under construction with an installation date set for late summer 1986. 5 refs., 6 figs

  12. DiffSLC: A graph centrality method to detect essential proteins of a protein-protein interaction network.

    Science.gov (United States)

    Mistry, Divya; Wise, Roger P; Dickerson, Julie A

    2017-01-01

    Identification of central genes and proteins in biomolecular networks provides credible candidates for pathway analysis, functional analysis, and essentiality prediction. The DiffSLC centrality measure predicts central and essential genes and proteins using a protein-protein interaction network. Network centrality measures prioritize nodes and edges based on their importance to the network topology. These measures helped identify critical genes and proteins in biomolecular networks. The proposed centrality measure, DiffSLC, combines the number of interactions of a protein and the gene coexpression values of genes from which those proteins were translated, as a weighting factor to bias the identification of essential proteins in a protein interaction network. Potentially essential proteins with low node degree are promoted through eigenvector centrality. Thus, the gene coexpression values are used in conjunction with the eigenvector of the network's adjacency matrix and edge clustering coefficient to improve essentiality prediction. The outcome of this prediction is shown using three variations: (1) inclusion or exclusion of gene co-expression data, (2) impact of different coexpression measures, and (3) impact of different gene expression data sets. For a total of seven networks, DiffSLC is compared to other centrality measures using Saccharomyces cerevisiae protein interaction networks and gene expression data. Comparisons are also performed for the top ranked proteins against the known essential genes from the Saccharomyces Gene Deletion Project, which show that DiffSLC detects more essential proteins and has a higher area under the ROC curve than other compared methods. This makes DiffSLC a stronger alternative to other centrality methods for detecting essential genes using a protein-protein interaction network that obeys centrality-lethality principle. DiffSLC is implemented using the igraph package in R, and networkx package in Python. The python package can be

  13. Clinical and ethical implications of genetic counselling in familial adenomatous polyposis Implicaciones clínicas y éticas del consejo genético en la poliposis adenomatosa familiar

    Directory of Open Access Journals (Sweden)

    A. Fernández-Suárez

    2005-09-01

    écnicas de secuenciación que detectan mutaciones en la línea germinal del gen APC (adenomatous poliposis coli. El abordaje del diagnóstico genético en familias con PAF seguidas previamente en la consulta de digestivo, ha permitido poner de manifiesto tanto las ventajas como los inconvenientes de esta forma de acercarnos a la enfermedad y a los pacientes. La revelación de los resultados de la prueba genética comporta importantes problemas en la práctica clínica, que afectan tanto al ámbito sanitario, como al ético y legal, además de las implicaciones familiares, laborales y sociales que el conocimiento del status genético puede tener para el paciente. El análisis genético es poco frecuente en la práctica clínica habitual, lo que conlleva errores tanto en la interpretación de los resultados obtenidos como durante el proceso del consejo genético. Son necesarias unidades multidisciplinares especializadas en el manejo de pacientes con PAF, en las cuales se realice un análisis y un consejo genético adecuado, permitiendo así una atención personalizada. La creación de registros de PAF y la protocolización de este proceso sanitario debería optimizar el manejo de estos pacientes y sus familias.

  14. Errata: “Teoría y experimento en Genética Mendeliana"

    Directory of Open Access Journals (Sweden)

    Editor Theoria

    2009-11-01

    Full Text Available Por un error de imprenta, no aparecieron publicadas en color las figuras del artículo de Mario Casa-nueva y Diego Méndez “Teoría y experimento en Genética Mendeliana: una exposición en imágenes”, publicado en Theoria, 2008, Vol. 23/3, Nº 63, 285-306. Dado que la impresión en color era necesaria para la comprensión del artículo, las reproducimos aquí con nuestras disculpas a los autores y lectores. Due to a mistake in the printing process, the following figures were not reproduced in colour in Mario Casanueva and Diego Méndez's article “Teoría y experimento en Genética Mendeliana: una exposi-ción en imágenes”, published in Theoria, 2008, Vol. 23/3, Nº 63, 285-306. Given that the im-ages in colour were necessary to understand the article, the reader will find here a correct printing, to-gether with our apologies.

  15. Complex analysis of urate transporters SLC2A9, SLC22A12 and functional characterization of non-synonymous allelic variants of GLUT9 in the Czech population: no evidence of effect on hyperuricemia and gout.

    Science.gov (United States)

    Hurba, Olha; Mancikova, Andrea; Krylov, Vladimir; Pavlikova, Marketa; Pavelka, Karel; Stibůrková, Blanka

    2014-01-01

    Using European descent Czech populations, we performed a study of SLC2A9 and SLC22A12 genes previously identified as being associated with serum uric acid concentrations and gout. This is the first study of the impact of non-synonymous allelic variants on the function of GLUT9 except for patients suffering from renal hypouricemia type 2. The cohort consisted of 250 individuals (150 controls, 54 nonspecific hyperuricemics and 46 primary gout and/or hyperuricemia subjects). We analyzed 13 exons of SLC2A9 (GLUT9 variant 1 and GLUT9 variant 2) and 10 exons of SLC22A12 by PCR amplification and sequenced directly. Allelic variants were prepared and their urate uptake and subcellular localization were studied by Xenopus oocytes expression system. The functional studies were analyzed using the non-parametric Wilcoxon and Kruskall-Wallis tests; the association study used the Fisher exact test and linear regression approach. We identified a total of 52 sequence variants (12 unpublished). Eight non-synonymous allelic variants were found only in SLC2A9: rs6820230, rs2276961, rs144196049, rs112404957, rs73225891, rs16890979, rs3733591 and rs2280205. None of these variants showed any significant difference in the expression of GLUT9 and in urate transport. In the association study, eight variants showed a possible association with hyperuricemia. However, seven of these were in introns and the one exon located variant, rs7932775, did not show a statistically significant association with serum uric acid concentration. Our results did not confirm any effect of SLC22A12 and SLC2A9 variants on serum uric acid concentration. Our complex approach using association analysis together with functional and immunohistochemical characterization of non-synonymous allelic variants did not show any influence on expression, subcellular localization and urate uptake of GLUT9.

  16. Inicio de replicación y estabilidad genómica en Saccharomyces cerevisiae

    OpenAIRE

    Ayuda Durán, Pilar

    2014-01-01

    [ES]La levadura de gemación Saccharomyces cerevisiae constituye un buen sistema modelo para el estudio de los mecanismos que dirigen la replicación del material genético y controlan su estabilidad en organismos eucariotas. Utilizando este modelo se ha estudiado el efecto de la desregulación de actividad CDK durante la fase G1 del ciclo celular de esta levadura, a causa de la carencia de sus reguladores específicos (las proteínas Cdh1, Sic1 y el dominio N-terminal de la proteína Cdc6). L...

  17. Physics at the SLC [SLAC Linear Collider

    International Nuclear Information System (INIS)

    Swartz, M.L.

    1990-11-01

    The SLAC Linear Collider (SLC) was constructed in the years 1983--1987 for two principal reasons: to develop the accelerator physics and technology that are necessary for the construction of future linear electron-positron colliders; and to produce electron-positron collisions at the Z 0 pole and to study the physics of the weak neutral current. To date, the SLC program has been quite successful at achieving the first goal. The machine has produced and collided high energy electron and positron beams of three-micron transverse size. The problems of operating an open geometry detector in an environment that is more akin to those found in fixed-target experiments than in storage rings have largely been solved. As a physics producing venture, the SLC has been less successful than was originally hoped but more successful than is commonly believed. Some of the results that have been produced by the Mark II experiment with a very modest data sample are competitive with those that have been produced with much larger samples by the four LEP collaborations. At the current, time, SLAC is engaged in an ambitious program to upgrade the SLC luminosity and to exploit one of its unique features, a spin polarized electron beam. These lectures are therefore organized into three sections: a brief description of the SLC; a review of the physics results that have been achieved with the Mark II detector; a description of the SLC's future: the realization and use of a polarized electron beam

  18. Alta conectividad genética y expansión poblacional de Scomber japonicus en en la parte norte del Sistema de Corriente de Humboldt reveladas por secuencias de la región control mitocondrial

    Directory of Open Access Journals (Sweden)

    Sergio Paolo Barahona Padilla

    2017-07-01

    Full Text Available La caballa, Scomber japonicus soporta una pesquería importante en el Pacífico Sudeste, sin embargo, su genética de poblaciones se desconoce actualmente. En el presente estudio se examinó la estructura genética, el flujo génico y la demografía histórica de esta especie en la parte norte del Sistema de la Corriente de Humboldt. Las muestras fueron colectadas en los veranos del 2013 y 2014 en tres puntos de desembarco de pesca (Paita, Ventanilla e Ilo cubriendo 12 grados de latitud frente a la costa peruana. Se secuenció un segmento de 532 pb de la región control mitocondrial en 72 individuos, el cual permitió detectar un total de 29 sitios polimórficos, 35 haplotipos, niveles moderados altos de diversidad haplotípica (0.793 – 0.969 y muy bajos niveles de diversidad nucleotídica (0.004 – 0.008. El análisis de flujo génico mostró altos niveles de conectividad entre las poblaciones en las áreas de muestreo. El análisis de varianza molecular (ФST = 0.00868, P = 0.1837, las comparaciones ФST a pares de poblaciones y las pruebas de diferenciación genética confirmaron la carencia de estructuración genética entre las tres localidades. Estos análisis sugieren que los sitios de muestreo analizados pueden ser considerados como un solo grupo genético. El comportamiento migratorio, el alto potencial de dispersión de los estadios tempranos de desarrollo y la ausencia de barreras oceanográficas pueden explicar su homogeneidad genética a lo largo del mar peruano. También se examinó la demografía histórica. Las pruebas de neutralidad, la distribución mismatch y el Bayesian Skyline Plot sugirieron un escenario de expansión poblacional que tuvo lugar durante el Pleistoceno Superior. Este estudio provee información nueva con respecto a la genética de poblaciones de la caballa en el Pacífico Sudeste.

  19. Polarized source performance in 1992 for SLC--SLD

    International Nuclear Information System (INIS)

    Schultz, D.; Alley, R.; Clendenin, J.; Frisch, J.; Garden, C.; Hoyt, E.; Klaisner, L.; Kulikov, A.; Prescott, C.; Saez, P.; Tang, H.; Turner, J.; Wicks, M.; Woods, M.; Yeremian, D.; Zolotorev, M.

    1993-02-01

    In its initial operation, the SLC Polarized Electron Source successfully met the SLC goals for 1992 for intensity and efficiency. However, the stability of the beam at the source was marginal, and the polarization was only ∼28%. The SLC goal to provide > 10,000 Z events for the SLD from polarized electrons was met

  20. Kicker thyratron experience from SLC

    International Nuclear Information System (INIS)

    Donaldson, A.R.; Cassel, R.L.; Mattison, T.S.; Reginato, L.L.

    1991-05-01

    The SLAC Linear Collider has five fast kickers for the damping ring injectors, extractors, and the electron extractor for the positron target that use multi-gap Deuterium-filled thyratrons. The thyratrons operate with 30 to 70 kV anode voltages and 1 to 5 kA currents, to deliver pulses to kicker magnets with ∼ 30 ns rise times, up to ∼ 150 ns pulse widths, at 120 Hz. Operating and lifetime experience with several types of thyratrons and support electronics are discussed. Floating driver and power supply electronics were replaced by a ferrite choke isolator to allow grounding of the cathode support electronics with a commensurate increase in operating reliability. The construction of a 100 ns Blumlein enabled detailed measurements of the switching times for all SLC thyratrons under similar conditions. In the final focus area, the kickers dump the SLC beams after the e + e - collisions. These thyratrons function with 15 kV anode voltages and up to 2 kA currents to produce 1/2 sine pulses with ∼ 300 ns rise times, ∼ 550 ns FWHM, at 120 Hz. Operating experience with these thyratrons will also be presented. 7 refs., 1 fig., 3 tabs

  1. La fábrica de la empatía. Del determinismo genético al origen social de la moral

    Directory of Open Access Journals (Sweden)

    Hernández Castro, David

    2016-06-01

    Full Text Available Preston and De Waal have adopted a theoretical idea known as the “Perception-Action Model” (PAM, which suggests that empathy and morality have genetic and evolutionary roots. In this paper, the author proposes a critical reading of PAM and an alternative interpretation, “the empathy factory”, which reconsiders the “Perception-Action Hypothesis” and the discovery of mirror neurons in the light of Judith Butler’s concept of performativity and the social construction of emotions. The conclusion is that the origin of the moral impulse does not lie in genetic determinism but in social relationships, language and affective communication.Preston y De Waal han adoptado una idea teórica, el Mecanismo de Percepción-Acción (MPA, que sugiere que la empatía y la moral tienen raíces genéticas y evolutivas. En este artículo analizamos críticamente el MPA y proponemos una interpretación alternativa, la fábrica de la empatía, que reconsidera la “Hipótesis de la Percepción-Acción” y el descubrimiento de las neuronas espejo bajo la luz del concepto de performatividad de Judith Butler y la construcción social de las emociones. Frente al determinismo genético, nuestra investigación apunta a las relaciones sociales y el lenguaje.

  2. Genome-wide association analysis confirms and extends the association of SLC2A9 with serum uric acid levels to Mexican Americans

    Directory of Open Access Journals (Sweden)

    Venkata Saroja eVoruganti

    2013-12-01

    Full Text Available Increased serum uric acid (SUA is a risk factor for gout and renal and cardiovascular disease. The purpose of this study was to identify genetic factors that affect the variation in SUA in 632 Mexican Americans participants of the San Antonio Family Heart Study (SAFHS. A genome-wide association analysis was performed using the Illumina Human Hap 550K single nucleotide polymorphism (SNP microarray. We used a linear regression-based association test under an additive model of allelic effect, while accounting for non-independence among family members via a kinship variance component. All analyses were performed in the software package SOLAR. SNPs rs6832439, rs13131257 and rs737267 in solute carrier protein 2 family, member 9 (SLC2A9 were associated with SUA at genome-wide significance (p <1.3×10-7. The minor alleles of these SNPs had frequencies of 36.2%, 36.2%, and 38.2 %, respectively, and were associated with decreasing SUA levels. All of these SNPs were located in introns 3-7 of SLC2A9, the location of the previously reported associations in European populations. When analyzed for association with cardiovascular-renal disease risk factors, conditional on SLC2A9 SNPs strongly associated with SUA, significant associations were found for SLC2A9 SNPs with BMI, body weight and waist circumference (p < 1.4 x 10-3 and suggestive associations with albumin-creatinine ratio and total antioxidant status. The SLC2A9 gene encodes an urate transporter that has considerable influence on variation in SUA. In addition to the primary association locus, suggestive evidence (p<1.9×10-6 for joint linkage/association was found at a previously-reported urate quantitative trait locus (Logarithm of odds score = 3.6 on 3p26.3. In summary, our GWAS extends and confirms the association of SLC2A9 with SUA for the first time in a Mexican American cohort and also shows for the first time its association with cardiovascular-renal disease risk factors.

  3. Genetic diversity and conservation of the Resplendent Quetzal Pharomachrus mocinno in Mesoamerica Diversidad genética y conservación del quetzal Pharomachrus mocinno en Mesoamérica

    Directory of Open Access Journals (Sweden)

    Sofía Solórzano

    2009-04-01

    Full Text Available In this study, we analyzed the genetic variation of quetzals (Pharomachrus mocinno throughout their geographic distribution to determine conservation targets. This species is found in patchy isolated cloud forests from Mexico to Panama. A multidimensional scaling and UPGMA analysis of a 286 RAPD fragment set resolved 3 genetic groups: cluster 1 (Mexican localities, cluster 2 (Guatemala, Nicaragua and El Salvador and cluster 3 (Panama. The mean genetic diversity estimated by the Shannon index was 0.38, 0.22 and 0.32, for clusters 1, 2, and 3, respectively. The genetic differentiation among clusters was statistically significant. The highest percentage of genetic variation (70.86% was found within populations using an AMOVA analysis. Our results suggest that within the quetzal species, there are 3 genetic groups that should be considered as independent conservation targets and included in a global Mesoamerican conservation program.En este estudio, analizamos la variación genética del quetzal (Pharomachrus mocinno a lo largo de su distribución geográfica con la finalidad de determinar prioridades de conservación. Esta especie se encuentra desde México hasta Panamá en bosques de niebla fragmentados y aislados. Un análisis escalar multidimensional y un UPGMA de un conjunto de 286 fragmentos de RAPD resolvieron 3 grupos genéticos: grupo 1, localidades mexicanas; grupo 2, Guatemala, Nicaragua y El Salvador, y grupo 3, Panamá. La media de la diversidad genética estimada con el índice de Shannon fue de 0.38, 0.22 y 0.32, para los grupos 1, 2 y 3, respectivamente. La diferenciación genética entre grupos fue estadísticamente significativa. El análisis de AMOVA detectó que el porcentaje más alto de variación genética (70.86% está dentro de las poblaciones. Nuestros resultados sugieren que dentro de la especie de quetzal, existen 3 grupos genéticos que deben ser considerados como prioridades de conservación independientes y ser

  4. Variantes moleculares en el gen L1 del virus del papiloma humano tipo 16, y regiones de la proteína L1 probablemente involucradas en la interacción virus-célula epitelial

    Directory of Open Access Journals (Sweden)

    María Mercedes Bravo

    2004-03-01

    Full Text Available

    La infección con virus del papiloma humano de alto riesgo es considerada como el principal factor de riesgo en el desarrollo del cáncer de cuello uterino. Entre los HPV de alto riesgo, el tipo 16 es el más frecuente tanto en mujeres con citología normal, como en mujeres con lesiones premalignas y en cáncer invasivo. Se ha demostrado la existencia de variaciones en la secuencia del genoma de HPV16, estos polimorfismos se han agrupado en cinco ramas filogenéticas denominadas según su distribución geográfica: Europeas (E, Asiaticas-Americanas (AA, Asiáticas (As, Africanas (Af y Norteamericanas (NA; determinadas por sustituciones nucleotídicas en los genes E6, L1 y L2 y la región larga de control.

    Varios estudios han sugerido que las variantes no Europeas son más agresivas que las Europeas, esto puede ser el reflejo de una interacción diferente con el huésped y por tanto implicar diferencias en el resultado final de la infección (mayor persistencia o mayor oncogenicidad.

    Particularmente se ha demostrado que las variaciones en la secuencia de aminoácidos de la proteína L1, la proteína principal de la cápside viral, pueden modificar las epítopes neutralizantes del virus afectando la efectividad de la respuesta inmune, también estas variaciones pueden afectar la capacidad de ensamble de las cápsides y la afinidad por receptores a nivel epitelial.

    El propósito de este estudio fue identificar las variaciones moleculares del gen L1 de HPV16 en aislamientos provenientes de cepillados cervicales de mujeres colombianas con citología normal y con cáncer de cuello uterino, con el fin de analizar si existen variaciones que alteren las regiones

  5. Detección de alteraciones numéricas en el gen dys y su asociación con rasgos clínicos

    Directory of Open Access Journals (Sweden)

    Alejandra Mampel

    2011-04-01

    Full Text Available La distrofia muscular de Duchenne/Becker (DMD/B es una miopatía hereditaria grave y progresiva. Se relaciona con alteraciones en el gen DYS, ubicado en el cromosoma X, que codifica para la proteína distrofina. Distintas manifestaciones pueden observarse según el impacto de la alteración genética sobre la proteína. Los registros internacionales de mutaciones refieren una elevada frecuencia (65-70% de deleciones/duplicaciones de uno o más exones del gen DYS. En este trabajo presentamos el estudio de alteraciones numéricas en los 79 exones del gen DYS. El estudio fue realizado en 59 individuos pertenecientes a 31 familias no relacionadas. La metodología utilizada fue Multiplex Ligation Dependent Probe Amplification (MLPA. En los 31 casos independientes se estableció además el score clínico, se realizó el test de Raven y se determinaron los valores de creatininfosfoquinasa (CPK en sangre. Nuestros datos revelan una frecuencia de alteraciones numéricas en el gen DYS del 61.3%, provocando un corrimiento del marco de lectura en el 100% de los casos. Se observó una región con mayor tendencia a presentar alteraciones que involucran un solo exón. La tasa de mutación de novo identificada fue del 35.2%. Se halló, a su vez, una asociación significativa entre afectados con alteraciones numéricas y valores del test de Raven de bajo rendimiento. Estos resultados aportan datos a los conocimientos regionales sobre las alteraciones genéticas y su impacto fenotípico en la enfermedad de Duchenne/Becker.

  6. Estimación de las frecuencias alélicas y genotípicas de los genes CAPN1 Y CAST asociados a la calidad de la carne en bovinos de la Cuenca del Papaloapan

    Directory of Open Access Journals (Sweden)

    C.M. Desgarennes-Alcalá

    2017-01-01

    Full Text Available El ganado de doble propósito es aquel utiliz ado para producir carne y leche. G eneralmente es el producto del cruce de razas de origen Cebú x europeas y/o Criollo. Este grupo genético se ha adaptado a las condiciones climáticas de temperatura, humedad, baja calidad de pastos y clases de parásitos que prevalecen en las regiones tropicales. En este trabajo, se realizó un escrutinio molecular para observar la frecuencia de dos polimorfismos d el gen de la μ - calpaína (CAPN1 - 316, CAPN1 - 530 y uno del gen de la calpastatina ( CAST, asociados a la suavidad de la carne en ganado bovino de doble propósito de la Cuenca del Papaloapan. Las pruebas se basaron en Reacción en Cadena de la Polimerasa (PCR y Polimorfismos de la Longitud de Fragmentos de Restricción (RFLPs con las enzimas de restricción Btg I, Ava II y Rsa I para los alelos C - G, A - G y C - G, respectivamente (n=331. Para CAPN1 - 316 las frecuencias genotípicas obtenidas fueron de 0.03 (AA, 0.8 6 (GG y 0.11 (GA y las frecuencias alélicas fueron 0.86 (G y 0.14 (A. Para el marcador CAPN1 - 530 las frecuencias genotípicas fueron de 0.02 (CC, 0.85 (GG y 0.13 (GC, con una frecuencia alélica de 0.85 para G y 0.15 para C. Las frecuencias genotípica s para el marcador CAST fueron de 0.32 (CC, 0.28 (GG y 0.4 (GC, con una frecuencia alélica de 0.68 para el alelo G y 0.32 para el alelo C. La pobl a ción en estudio no se encontró en equilibrio Hardy Weinberg y los valores de χ 2 P con dos grados de liberta d fueron de 0.964, 0.985 y 0.9803 para CAPN1 - 316, CAPN1 - 530 y CAST, respectivamente. De acuerdo con el porcentaje de la genotipificación de los marcadores en los genes CAPN1 y CAST se concluye que la población analizada tiene bajos índices de marc a dores pa ra la suavidad o terneza de la carne, probablemente por las cruzas no dirigidas que se realizan habitualmente, de esta forma se propone, mejorar la calidad de la carne en base a programas de mejoramiento gen

  7. Distribution and expression of SLC45A2 in the skin of sheep with different coat colors.

    Science.gov (United States)

    Wang, Haidong; Xue, Linli; Li, Yanan; Zhao, Bingling; Chen, Tianzhi; Liu, Ying; Chang, Lucheng; Wang, Juan

    2016-01-01

    To investigate whether the membrane-associated transporter protein SLC45A2 is differentially expressed in the skin of sheep with different coat colors and to determine its correlation with coat color establishment in sheep. The expression of SLC45A2 in sheep skin samples with different coat colors was qualitatively and quantitatively analyzed by PCR amplification, RT-PCR, immunohistochemical staining and Western blotting. A 193-bp SLC45A2 CDS sequence was successfully amplified from sheep skin samples with diverse coat colors. RT-PCR analysis revealed that SLC45A2 mRNA was expressed in all sheep skin samples tested, with relative expression levels of 512.74 ± 121.51 in black skin, 143.38 ± 119.31 and 1.36 ± 0.09 in black dots and white dots of piebald skin, respectively, and 1.02 ± 0.23 in white skin (p coat colors. These patterns were quantified by optical density (OD) analysis, which yielded relative expression levels of 0.23 ± 0.11 in black skin, 0.19 ± 0.09 and 0.10 ± 0.03 in black dots and white dots of piebald skin, respectively, and 0.08 ± 0.01 in white skin (p coat colors, though at significantly different levels. SLC45A2 may participate in the establishment of coat color by regulating the synthesis and trafficking of melanin.

  8. Aplicabilidad de estrategias genéricas de diseño pasivo en edificaciones bajo la influencia del cambio climático en Concepción y Santiago, Chile

    Directory of Open Access Journals (Sweden)

    Carlos Rubio-Bellido

    2015-12-01

    Full Text Available Las estrategias de diseño pasivo en arquitectura y el comportamiento energético de la edificación normalmente se cuantifican en base a archivos climáticos que, por lo general, no consideran las predicciones del clima. Este artículo profundiza en la generación de datos climáticos futuros y su influencia en el confort higrotérmico, así como en las estrategias de diseño arquitectónico genéricas de adaptación desde el punto de vista pasivo. Con ese fin, se han generado determinados escenarios climáticos para Concepción y Santiago, dos de las conurbaciones urbanas más pobladas de Chile, para los años 2020, 2050 y 2080. Las predicciones se han realizado para el escenario más extendido de emisiones de Gases de Efecto Invernadero GEIA 2 “medium-high”, según el Intergovernmental Panel on Climate Change IPCC. Los niveles de confort se han examinado desde una perspectiva adaptativa, considerando estrategias de diseño genéricas, ambos modelos recogidos en la ASHRAE. Al analizar los pronósticos climáticos con los modelos de confort, se obtienen resultados para una mejor comprensión del grado de adaptación del usuario y la arquitectura al posible clima futuro. Esta investigación genera estrategias genéricas para optimizar el diseño de construcciones en Chile.

  9. Interaksi Ekstrak Sambiloto (Andrographis paniculata (Burm.F.Ness dengan Glibenklamid terhadap Ekspresi Gen CYP3A4 pada Kultur Sel HepG2

    Directory of Open Access Journals (Sweden)

    Andzar Fikranus Shofa

    2017-12-01

    Full Text Available Diabetes melitus (DM merupakan salah satu penyakit metabolik kronis yang ditandai dengan hiperglikemia. Berbagai terapi dilakukan untuk mengatasi hiperglikemia, baik dengan menggunakan obat antidiabetes oral maupun tanaman herbal berkhasiat antidiabetes. Sambiloto (Andrographis paniculata (Burm.F.Nees merupakan salah satu herbal antidiabetes yang banyak dikonsumsi masyarakat Indonesia. Andrografolida merupakan zat aktif yang terdapat dalam sambiloto yang berperan sebagai agen antidiabetes. Namun, dalam banyak kasus kombinasi antara herbal dan obat sintesis menyebabkan interaksi jika digunakan pada waktu bersamaan. Penelitian ini bertujuan untuk memperoleh data interaksi ekstrak etanol herba sambiloto dengan glibenklamid terhadap ekspresi gen CYP3A4 pada kultur sel HepG2. Hasil penelitian ini menunjukkan bahwa terjadi penurunan ekspresi gen CYP3A4 pada pengujian sampel tunggal maupun kombinasi antara ekstrak etanol herba sambiloto dan glibenklamid dengan bertambahnya konsentrasi. Pada konsentrasi 50 dan 100 μg/mL sambiloto, glibenklamid, dan kombinasinya menyebabkan penurunan ekspresi gen CYP3A4 sekitar 0,82, 0,70; 0,89, 0,53; 0,84, 0,72. Berdasarkan hasil tersebut dapat disimpulkan terjadi penurunan ekspresi gen CYP3A4 dengan bertambahnya konsentrasi sampel.

  10. The gene expression of the neuronal protein, SLC38A9, changes in mouse brain after in vivo starvation and high-fat diet.

    Directory of Open Access Journals (Sweden)

    Sofie V Hellsten

    Full Text Available SLC38A9 is characterized as a lysosomal component of the amino acid sensing Ragulator-RAG GTPase complex, controlling the mechanistic target of rapamycin complex 1 (mTORC1. Here, immunohistochemistry was used to map SLC38A9 in mouse brain and staining was detected throughout the brain, in cortex, hypothalamus, thalamus, hippocampus, brainstem and cerebellum. More specifically, immunostaining was found in areas known to be involved in amino acid sensing and signaling pathways e.g. piriform cortex and hypothalamus. SLC38A9 immunoreactivity co-localized with both GABAergic and glutamatergic neurons, but not with astrocytes. SLC38A9 play a key role in the mTORC1 pathway, and therefore we performed in vivo starvation and high-fat diet studies, to measure gene expression alterations in specific brain tissues and in larger brain regions. Following starvation, Slc38a9 was upregulated in brainstem and cortex, and in anterior parts of the brain (Bregma 3.2 to -2.1mm. After high-fat diet, Slc38a9 was specifically upregulated in hypothalamus, while overall downregulation was noticed throughout the brain (Bregma 3.2 to -8.6mm.

  11. Caracterización de la región cromosómica 15q11-q13 del genoma humano. Variabilidad genómica en el autismo e identificación de ncRNAs

    OpenAIRE

    Cerrato Rivera, Celia

    2007-01-01

    La tesis doctoral con título "Caracterización de la región cromosómica 15q11-13 del genoma humano. Variabilidad genómica en el autismo e identificación de ncRNAs" se basa en el estudio de la región cromosómica 15q11-q13, centrándonos en los aspectos de la variabilidad genómica y su significado funcional. En la primera parte del estudio buscamos reordenamientos de 15q11-q13 en pacientes con autismo, mediante la genotipación de marcadores microsatélites cubriendo dicha región, y definimos una d...

  12. Detección de mutaciones de los genes hMLH1 y hMSH2 del sistema de reparación de malos apareamientos del ADN en familias colombianas sospechosas de cancer colorrectal no polipósico hereditario (síndrome de Lynch.

    Directory of Open Access Journals (Sweden)

    Andrea Gómez

    2005-09-01

    Full Text Available Introducción. El cáncer colorrectal es la segunda causa de morbilidad y mortalidad por cáncer en los países desarrollados. En Colombia es la quinta causa de muerte entre los diferentes cánceres. Cerca del 75% de éstos corresponde a cánceres esporádicos, alrededor del 25% son familiares, y son claramente hereditarios el 5%. De éstos, el más importantes es el cáncer colorrectal no polipósico hereditario o síndrome de Lynch. Objetivo. Analizar los dos genes más importantes involucrados en el síndrome de Lynch, el hMLH1 y el hMSH2. Materiales y métodos. En 17 familias colombianas que cumplían con los criterios de Ámsterdam II o las pautas de Bethesda, se analizaron por SSCP los 35 exones de estos dos genes y las variantes electroforéticas se secuenciaron. Resultados. Se detectaron 8 mutaciones de línea germinal en las familias analizadas, 7 en el gen hMLH1 y 1 en hMSH2, y se encontró una tasa de detección de mutaciones del 47%. Seis de las 8 mutaciones encontradas en este estudio han sido previamente reportadas en la literatura. Un cambio de una base en el sitio donador de empalme en el exón 9 del gen hMLH1 (G>A (dos familias, un cambio A>G en el codón 755 del exón 17, y un cambio G>A en el exón 18. Se detectaron dos nuevas mutaciones, una en el exón 17, un cambio C>T en el codón 640, y una deleción de TG en el codón 184 del exón 3 del gen hMSH2. También se detectó en dos familias un polimorfismo del intrón 13 del hMLH1. Conclusión. Este es el primer estudio realizado en Colombia que detecta mutaciones en el síndrome de Lynch y pretende establecer un programa integral de manejo y prevención.

  13. The Columbus Knee System: 4-Year Results of a New Deep Flexion Design Compared to the NexGen Full Flex Implant

    Directory of Open Access Journals (Sweden)

    D. Goebel

    2012-01-01

    Full Text Available The Columbus knee system is designed as a standard knee implant to allow high flexion without additional bone resection. Between August, 2004 and March, 2010 we performed 109 total knee arthroplasties of the Columbus knee system in 101 consecutive patients suffering from primary arthrosis of the knee. Mean age was 72.4 years in women and 70.3 years in men. Mean followup was 47.3 months. The 4-year results of a group of patients who received the NexGen Full Flex implant operated by the same surgeon were used for comparison. Mean total knee score was Columbus: 175.6 and NexGen Flex: 183.4; =0.037. Mean operation time was 53 min for Columbus and 66 min for NexGen Flex; 0.05. Radiological assessment showed no signs of loosening for both groups. Therefore, the Columbus knee system can be recommended for flexion angles up to 140∘.

  14. La genética comunitaria en los programas de diagnóstico prenatal Community genetics in prenatal diagnosis programs

    Directory of Open Access Journals (Sweden)

    Yanet Hernández Triguero

    2013-06-01

    Full Text Available Introducción: la creación de centros para el desarrollo de la Genética comunitaria, en todos los municipios del país, ha hecho posible el incremento de la cobertura de atención de los servicios de genética médica en la atención primaria. Objetivo: evaluar los resultados obtenidos en el funcionamiento prenatal del Programa Cubano de Diagnóstico, Manejo y Prevención de Enfermedades Genéticas y Defectos Congénitos. Material y métodos: se realizó un estudio descriptivo, retrospectivo y de corte longitudinal que incluyó el total de gestantes captadas desde el 1ro. de enero de 2007 hasta el 31 de diciembre de 2011, en el municipio La Palma. Resultados: de 2016 gestantes, el 51.7% fueron clasificadas como riesgo genético incrementado. En este grupo, la adolescencia (29.4% y la edad materna avanzada (15.8% fueron los principales factores de riesgo genético encontrados. Se realizaron 1720 exámenes de ecografía, entre las 11 y 13.6 semanas, examen que logra una cobertura del 94.8%. Se detectaron 47 portadoras de hemoglobina AS o AC. Se determinó el valor de la alfafetoproteína en suero materno, el 7.1 % mostró cifras elevadas y la amenaza de aborto constituyó la primera causa de esta alteración. Se diagnosticaron prenatalmente, por ecografía del segundo trimestre, 20 gestantes que presentaron fetos con defectos congénitos, lográndose una cobertura de 99,5%. Conclusiones: el enfoque comunitario de la genética y el trabajo coordinado con la atención primaria de salud permiten confeccionar estrategias dirigidas al control y disminución de los riesgos de defectos congénitos y enfermedades comunes en la población.Introduction: the creation of centers to the development of community genetics all over the municipalities of the country has made possible an increased coverage of medical genetics services in Primary Health Care. Objective: to assess the results obtained in the establishment of Cuban Prenatal Diagnosis, Management and

  15. Dos aspectos a considerar en la adopción de embriones en el Estado de Querétaro: el derecho del menor a conocer su origen genético y la prohibición implícita de los diagnósticos genéticos preimplantacional y prenatal

    Directory of Open Access Journals (Sweden)

    Miguel Ángel León Ortiz

    2017-01-01

    Full Text Available La donación de embriones supernumerarios en la implementación de procedimientos de reproducción asistida de naturaleza heteróloga, es una constante en las normativas vigentes en esta materia. En México, el Estado de Querétaro regula de forma particular este acto jurídico, importante en las relaciones sostenidas en el derecho de familia actual, poniendo al alcance de parejas infértiles la posibilidad de acudir a la adopción de embriones supernumerarios. En este trabajo, se analizan dos aspectos esenciales: el derecho del menor a conocer su origen genético y la prohibición implícita de los diagnósticos genéticos preimplantacional y prenatal, de donde resultan efectos jurídicos diversos.

  16. Determination of Unbound Partition Coefficient and in Vitro-in Vivo Extrapolation for SLC13A Transporter-Mediated Uptake.

    Science.gov (United States)

    Riccardi, Keith; Li, Zhenhong; Brown, Janice A; Gorgoglione, Matthew F; Niosi, Mark; Gosset, James; Huard, Kim; Erion, Derek M; Di, Li

    2016-10-01

    Unbound partition coefficient (Kpuu) is important to an understanding of the asymmetric free drug distribution of a compound between cells and medium in vitro, as well as between tissue and plasma in vivo, especially for transporter-mediated processes. Kpuu was determined for a set of compounds from the SLC13A family that are inhibitors and substrates of transporters in hepatocytes and transporter-transfected cell lines. Enantioselectivity was observed, with (R)-enantiomers achieving much higher Kpuu (>4) than the (S)-enantiomers (<1) in human hepatocytes and SLC13A5-transfected human embryonic 293 cells. The intracellular free drug concentration correlated directly with in vitro pharmacological activity rather than the nominal concentration in the assay because of the high Kpuu mediated by SLC13A5 transporter uptake. Delivery of the diacid PF-06649298 directly or via hydrolysis of the ethyl ester prodrug PF-06757303 resulted in quite different Kpuu values in human hepatocytes (Kpuu of 3 for diacid versus 59 for prodrug), which was successfully modeled on the basis of passive diffusion, active uptake, and conversion rate from ester to diacid using a compartmental model. Kpuu values changed with drug concentrations; lower values were observed at higher concentrations possibly owing to a saturation of transporters. Michaelis-Menten constant (Km) of SLC13A5 was estimated to be 24 μM for PF-06649298 in human hepatocytes. In vitro Kpuu obtained from rat suspension hepatocytes supplemented with 4% fatty acid free bovine serum albumin showed good correlation with in vivo Kpuu of liver-to-plasma, illustrating the potential of this approach to predict in vivo Kpuu from in vitro systems. Copyright © 2016 by The American Society for Pharmacology and Experimental Therapeutics.

  17. Congenital Chloride-Losing Diarrhea in a Mexican child with the novel homozygous SLC26A3 mutation G393W

    Directory of Open Access Journals (Sweden)

    Fabian R. Reimold

    2015-06-01

    Full Text Available Congenital chloride diarrhea is an autosomal recessive disease caused by mutations in the intestinal lumenal membrane Cl-/HCO3- exchanger, SLC26A3.We report here the novel SLC26A3 mutation G393W in a Mexican child, the first such report in a patient from Central America. SLC26A3 G393W expression in Xenopus oocytes exhibits a mild hypomorphic phenotype, with normal surface expression and moderately reduced anion transport function. However, expression of HA-SLC26A3 in HEK-293 cells reveals intracellular retention and greatly decreased steady-state levels of the mutant polypeptide, in contrast to peripheral membrane expression of the wildtype protein. Whereas wildtype HA-SLC26A3 is apically localized in polarized monolayers of filter-grown MDCK cells and Caco2 cells, mutant HA-SLC26A3 G393W exhibits decreased total polypeptide abundance, with reduced or absent surface expression and sparse punctate (or absent intracellular distribution. The WT protein is similarly localized in LLCPK1 cells, but the mutant fails to accumulate to detectable levels. We conclude that the chloride-losing diarrhea phenotype associated with homozygous expression of SLC26A3 G393W likely reflects lack of apical surface expression in enterocytes, secondary to combined abnormalities in polypeptide trafficking and stability. Future progress in development of general or target-specific folding chaperonins and correctors may hold promise for pharmacological rescue of this and similar genetic defects in membrane protein targeting.

  18. Disruption of Slc52a3 gene causes neonatal lethality with riboflavin deficiency in mice

    OpenAIRE

    Yoshimatsu, Hiroki; Yonezawa, Atsushi; Yamanishi, Kaori; Yao, Yoshiaki; Sugano, Kumiko; Nakagawa, Shunsaku; Imai, Satoshi; Omura, Tomohiro; Nakagawa, Takayuki; Yano, Ikuko; Masuda, Satohiro; Inui, Ken-ichi; Matsubara, Kazuo

    2016-01-01

    Homeostasis of riboflavin should be maintained by transporters. Previous in vitro studies have elucidated basic information about riboflavin transporter RFVT3 encoded by SLC52A3 gene. However, the contribution of RFVT3 to the maintenance of riboflavin homeostasis and the significance in vivo remain unclear. Here, we investigated the physiological role of RFVT3 using Slc52a3 knockout (Slc52a3−/−) mice. Most Slc52a3−/− mice died with hyperlipidemia and hypoglycemia within 48 hr after birth. The...

  19. FRECUENCIAS ALELICAS Y GENOTIPICAS DEL GEN KAPPA CASEINA EN BOVINOS DE DOBLE PROPOSITO

    Directory of Open Access Journals (Sweden)

    Nohémi Gabriela Cortes López

    2012-01-01

    Full Text Available En este trabajo, las frecuencias alélicas (A y B del gen CAS se determinaron como criterio de selección en la calidad de la leche en el ganado bovino de doble propósito. Se tomaron muestras sanguíneas de 200 hembras bovinas y se colocaron en tubos que contenían EDTA. Se amplifico el marcador MB002 a partir de material genético extraído. Los RFLP se realizaron con la enzima de restricción Hinf I para el diagnóstico de los alelos A y B en CASκ. Las frecuencias genotípicas obtenidas correspondían a 0.34, 0.01 y 0.65 para los alelos AA, BB y AB, respectivamente. Las frecuencias alélicas fueron de 0.67 y 0.33 para los alelos A y B, respectivamente. Además, se registró una heterocigosidad promedio de 0.6481. La población es estudio no se encuentra en equilibrio Hardy Weinberg, el valor ji cuadrada fue de 2 = 14.8 con 2 grados de libertad (P < 0.005. Basado en la frecuencia alélica de CAS  B (0.34 observada en este estudio, el ganado de doble propósito puede ser una opción viable para aumentar la calidad de la leche si se utilizan sementales con el genotipo BB para el cruce. De esta manera, los alelos B asociados a la calidad de la leche pueden mejorarse en pocas generaciones.

  20. Aplicación de la biotecnología en los recursos genéticos forestales

    Directory of Open Access Journals (Sweden)

    R. Martínez

    2003-01-01

    Full Text Available A medida que aumenta la población y sus demandas de productos forestales, las tierras disponibles para la producción disminuyen, por lo que se necesitan esfuerzos coordinados para conseguir la sostenibilidad de la producción forestal. Aunque los sistemas tradicionales de silvicultura y mejoramiento genético continúan siendo importantes en las actividades forestales actuales, los programas convencionales de mejoramiento genético se ven limitados por el largo ciclo de desarrollo de los árboles forestales y la dificultad para distinguir siempre entre la expresión genotípica y los efectos ambientales. La biotecnología ofrece nuevas técnicas que complementan a las metodologías tradicionales del mejoramiento genético forestal. Los avances importantes de la técnica de cultivo de tejidos vegetales y la biología molecular que han tenido lugar en las dos últimas décadas se encuentran en la base del desarrollo de campos como la crioconservación y la regeneración masiva de plantas (expresión de la totipotencia celular, los marcadores de ADN, la genómica de árboles y la transformación genética. En el ámbito de los recursos genéticos, los marcadores de ADN permiten caracterizar la naturaleza, amplitud y distribución de la variabilidad genética de especies vegetales, y por tanto, facilitan la toma de decisiones sobre qué y cómo preservar. La crioconservación y la regeneración de plantas in vitro se están utilizando para conservar y micropropagar material vegetal específico, a fin de llevar a cabo la conservación ex situ y permitir el desarrollo de la silvicultura clonal. En este trabajo se realiza una revisión de las aplicaciones de estos campos a las especies forestales. En este contexto se aporta información sobre la actividad de la biotecnología forestal en las diferentes áreas de investigación.

  1. Status of the SLC

    International Nuclear Information System (INIS)

    Moffeit, K.C.

    1987-01-01

    The status and research possibilities of the Stanford Linear Collider (SLC) are reviewed. The physics program concentrates on production of Z 0 's and their decay. The SLC systems include a new injector and booster, two damping rings to provide the small beam emittance, a new positron source, the existing LINAC structure upgraded for higher energy and better beam control, beam transport arcs, a final focus section, and experimental halls are detectors. Energy spectrometers with an accuracy of ± 50 MeV/c 2 for pulse-to-pulse center of mass energy measurement are to be installed. Longitudinal polarized electrons are expected, and will allow more precise tests of the standard model

  2. Review of SLC performance

    International Nuclear Information System (INIS)

    Phinney, N.

    1992-08-01

    The SLAC Linear Collider (SLC) has begun a new era of operation with the SLD detector. During 1991 there was a first engineering run for the SLD in parallel with machine improvements to increase luminosity and reliability. For the 1992 run, a polarized electron source was added and more than 10,000 Zs with an average of 23% polarization have been logged by the SLD. This paper will discuss the performance of the SLC in 1991 and 1992 and the technical advances that have produced higher luminosity. Emphasis will be placed on issues relevant to future linear colliders such as producing and maintaining high-current, low-emittance beams and focusing the beams to the micron scale for collisions

  3. Lessons learned from the SLC

    Energy Technology Data Exchange (ETDEWEB)

    Phinney, N. [Stanford Univ., CA (United States). Stanford Linear Accelerator Center

    1998-07-01

    The SLAC Linear Collider (SLC) is the first example of an entirely new type of lepton collider. Many years of effort were required to develop the understanding and techniques needed to approach design luminosity. This paper discusses some of the key issues and problems encountered in producing a working linear collider. These include the polarized source, techniques for emittance preservation, extensive feedback systems, and refinements in beam optimization in the final focus. The SLC experience has been invaluable for testing concepts and developing designs for a future linear collider.

  4. Lessons learned from the SLC

    International Nuclear Information System (INIS)

    Phinney, N.

    1998-01-01

    The SLAC Linear Collider (SLC) is the first example of an entirely new type of lepton collider. Many years of effort were required to develop the understanding and techniques needed to approach design luminosity. This paper discusses some of the key issues and problems encountered in producing a working linear collider. These include the polarized source, techniques for emittance preservation, extensive feedback systems, and refinements in beam optimization in the final focus. The SLC experience has been invaluable for testing concepts and developing designs for a future linear collider

  5. A genetic-demographic approach reveals a gender-specific association of SLC6A3/DAT1 40 bp-VNTR with life-expectancy.

    Science.gov (United States)

    Hadi, Fazal; Dato, Serena; Carpi, Francesco M; Prontera, Paolo; Crucianelli, Francesca; Renda, Federica; Passarino, Giuseppe; Napolioni, Valerio

    2015-06-01

    Several recent lines of evidence are proving an important role for dopamine in the aging process and in the determination of life span. Components of the dopaminergic system may represent good candidates for longevity studies. Herein, we tested the possible association of the functional SLC6A3/DAT1 40-bp VNTR with life-expectancy in a healthy population of Central Italy (N = 993) by applying a genetic-demographic approach that takes into account the demographic information and different survival rates between sexes for modeling the survival of specific allele carriers in the population. Male carriers of S*/S* genotype showed a lower survival chance across most of the lifespan respect to the survival of DAT1*L-carriers (P = 0.021). The same analyses gave non-significant results in females. Several studies already reported significant sex differences in dopamine metabolism and its related biological pathways. Thus, we can hypothesize that the SLC6A3/DAT1 40 bp-VNTR may affect life expectancy in a sex-specific way. Moreover, it is conceivable that DAT1 S*/S* carriers, who are prone to assume "risk" type behaviors, may be dropped out of the "healthy" population by a sort of "demographic selection".

  6. Lack of Association between SLC30A8 Variants and Type 2 Diabetes in Mexican American Families

    Directory of Open Access Journals (Sweden)

    Hemant Kulkarni

    2016-01-01

    Full Text Available SLC30A8 encodes zinc transporter 8 which is involved in packaging and release of insulin. Evidence for the association of SLC30A8 variants with type 2 diabetes (T2D is inconclusive. We interrogated single nucleotide polymorphisms (SNPs around SLC30A8 for association with T2D in high-risk, pedigreed individuals from extended Mexican American families. This study of 118 SNPs within 50 kb of the SLC30A8 locus tested the association with eight T2D-related traits at four levels: (i each SNP using measured genotype approach (MGA; (ii interaction of SNPs with age and sex; (iii combinations of SNPs using Bayesian Quantitative Trait Nucleotide (BQTN analyses; and (iv entire gene locus using the gene burden test. Only one SNP (rs7817754 was significantly associated with incident T2D but a summary statistic based on all T2D-related traits identified 11 novel SNPs. Three SNPs and one SNP were weakly but interactively associated with age and sex, respectively. BQTN analyses could not demonstrate any informative combination of SNPs over MGA. Lastly, gene burden test results showed that at best the SLC30A8 locus could account for only 1-2% of the variability in T2D-related traits. Our results indicate a lack of association of the SLC30A8 SNPs with T2D in Mexican American families.

  7. Overexpression of monocarboxylate transporter-1 (Slc16a1) in mouse pancreatic ß-cells leads to relative hyperinsulinism during exercise

    DEFF Research Database (Denmark)

    Pullen, Timothy J; Sylow, Lykke; Sun, Gao

    2012-01-01

    Exercise-induced hyperinsulinism (EIHI) is an autosomal dominant disorder characterized by inappropriate insulin secretion in response to vigorous physical exercise or pyruvate injection. Activating mutations in the monocarboxylate transporter-1 (MCT1, SLC16A1) promoter have been linked to EIHI....... Expression of this pyruvate transporter is specifically repressed (disallowed) in pancreatic ß-cells, despite nearly universal expression across other tissues. It has been impossible to determine, however, whether EIHI mutations cause MCT1 expression in patient ß-cells. The hypothesis that MCT1 expression...... in ß-cells is sufficient to cause EIHI by allowing entry of pyruvate and triggering insulin secretion thus remains unproven. Therefore, we generated a transgenic mouse capable of doxycycline-induced, ß-cell-specific overexpression of MCT1 to test this model directly. MCT1 expression caused isolated...

  8. Variabilidad genética de Plasmodium falciparum en pacientes con malaria grave y malaria no complicada en Iquitos - Perú

    Directory of Open Access Journals (Sweden)

    Gisely Hijar G

    2002-07-01

    Full Text Available Objetivo: Determinar la diversidad genética del gen que codifica la proteína rica en glutamato (GLURP de Plasmodium falciparum en pacientes con malaria complicada y no complicada circulante en un área del departamento de Loreto, distrito de Maynas. Materiales y métodos: La diversidad genética fue analizada usando reacción en cadena de la polimerasa (PCR en 30 muestras sanguíneas de pacientes con malaria no complicada (MNC y 46 con malaria grave complicada (MGC. Resultados: Ocho genotipos fueron detectados en pacientes con MNC (Genotipo I,II,III, IV,V, VI,VII y VIII y cuatro genotipos en los pacientes con MGC (Genotipo V,VI,VII,VIII. Asimismo, en 50% de las muestras con MNC fueron detectadas infecciones múltiples, a diferencia de las muestras de MGC en donde no se detectó infecciones múltiples. Conclusión: Existe una diversidad genética en esta región del gen GLURP de P. falciparum, para esa época (marzo 1998 - abril 1999 y esa área del país. En tal sentido, nuestros resultados podrían servir de base para llevar a cabo estudios epidemiológicos posteriores, ya que permitiría conocer la distribución de las cepas circulantes en nuestro país.

  9. Complex analysis of urate transporters SLC2A9, SLC22A12 and functional characterization of non-synonymous allelic variants of GLUT9 in the Czech population: no evidence of effect on hyperuricemia and gout.

    Directory of Open Access Journals (Sweden)

    Olha Hurba

    Full Text Available OBJECTIVE: Using European descent Czech populations, we performed a study of SLC2A9 and SLC22A12 genes previously identified as being associated with serum uric acid concentrations and gout. This is the first study of the impact of non-synonymous allelic variants on the function of GLUT9 except for patients suffering from renal hypouricemia type 2. METHODS: The cohort consisted of 250 individuals (150 controls, 54 nonspecific hyperuricemics and 46 primary gout and/or hyperuricemia subjects. We analyzed 13 exons of SLC2A9 (GLUT9 variant 1 and GLUT9 variant 2 and 10 exons of SLC22A12 by PCR amplification and sequenced directly. Allelic variants were prepared and their urate uptake and subcellular localization were studied by Xenopus oocytes expression system. The functional studies were analyzed using the non-parametric Wilcoxon and Kruskall-Wallis tests; the association study used the Fisher exact test and linear regression approach. RESULTS: We identified a total of 52 sequence variants (12 unpublished. Eight non-synonymous allelic variants were found only in SLC2A9: rs6820230, rs2276961, rs144196049, rs112404957, rs73225891, rs16890979, rs3733591 and rs2280205. None of these variants showed any significant difference in the expression of GLUT9 and in urate transport. In the association study, eight variants showed a possible association with hyperuricemia. However, seven of these were in introns and the one exon located variant, rs7932775, did not show a statistically significant association with serum uric acid concentration. CONCLUSION: Our results did not confirm any effect of SLC22A12 and SLC2A9 variants on serum uric acid concentration. Our complex approach using association analysis together with functional and immunohistochemical characterization of non-synonymous allelic variants did not show any influence on expression, subcellular localization and urate uptake of GLUT9.

  10. Variabilidad genética en Prosopis ferox (Mimosaceae

    Directory of Open Access Journals (Sweden)

    Alicia D. Burghardt

    2004-01-01

    Full Text Available Prosopis ferox (Mimosaceae es una especie arbustiva o arbórea espinosa que se distribuye desde el Sur de Bolivia hasta el noroeste de la Argentina. En la provincia de Jujuy se encuentra a grandes alturas (entre los 2400 y los 3700 m s.m.. Existe una gran variabilidad morfológica, especialmente en cuanto a las dimensiones del fruto y la cantidad de semillas por fruto, ambas características importantes debido al uso de esta planta como forraje. Con el objeto de verificar si existe además variabilidad genética, se realizó un estudio electroforético de proteínas seminales de árboles procedentes de distintas localidades de la provincia de Jujuy. Los patrones polipeptídicos obtenidos por SDS-PAGE presentaron en total 26 bandas. Cada población se caracterizó por sus patrones de presencia-ausencia de bandas, habiéndose encontrado variabilidad intrapoblacional (polimorfismo en algunas de ellas, siendo otras genéticamente homogéneas. Los índices polimórficos en poblaciones de P. ferox son comparables a los obtenidos previamente en P. ruscifolia. La variabilidad genética interpoblacional hallada por medio del estudio electroforético de las proteínas seminales hace suponer la existencia de ecotipos

  11. Predicción científica y prescripción en mejora genética vegetal en cuanto Ciencia Aplicada de Diseño: El caso de la mejora de frutales del género Prunus

    Directory of Open Access Journals (Sweden)

    Pedro Martínez-Gómez

    2017-01-01

    Full Text Available La mejora genética vegetal tiene una doble índole científica: Ciencia Empírica de la Naturaleza y Ciencia Aplicada de Diseño. En este contexto el presente trabajo pretende indagar en la predicción científica como rasgo esencial de esta disciplina en cuanto Ciencia Aplicada de Diseño con especial referencia la mejora de frutales de hueso (del género Prunus. En mejora genética vegetal podemos hablar de tres niveles de conocimiento asociados a la biología molecular (nivel micro, la constitución genética de un individuo (nivel meso y al fenotipo o aspecto global de la nueva variedad (nivel macro, que afectan tanto a los tipos de predicción como a las metodologías a aplicar. La predicción constituye el objetivo principal de la mejora genética como Ciencia de Diseño. Es clave tener un conocimiento del futuro posible para poder hacer un nuevo diseño que estará completo al cabo de algunos años, más de 12 años en el caso de los frutales de hueso que es el objeto de este trabajo. Asimismo, es necesario tener en cuenta en el desarrollo de esta predicción científica aplicada a la mejora de Prunus diversas variables internas (la naturaleza genética del material vegetal de partida, las metodologías disponibles, etc. y externas (la aceptación social, los factores medioambientales, los estreses bióticos y abióticos, etc. a la hora de llevar a cabo esta predicción. El grado de conocimiento de estas variables determinará la calidad de la predicción en el diseño de nuevas variedades de Prunus.

  12. The dopamine transporter protein gene (SLC6A3): Primary linage mapping and linkage studies in Tourette syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Gelernter, J.; Kruger, S.D.; Pakstis, A.J. [Yale Univ., New Haven, CT (United States)]|[West Haven Veterans Affairs Medical Center, CT (United States)] [and others

    1995-12-10

    The dopamine transporter, the molecule responsible for presynaptic reuptake of dopamine and a major site of action of psychostimulant drugs, including cocaine, is encoded by locus SLC6A3 (alias DAT1). The protein`s actions and DAT`s specific localization to dopaminergic neurons make it a candidate gene for several psychiatric illnesses. SLC6A3 has been mapped to distal chromosome 5p, using physical methods. Genetic linkage methods were used to place SLC6A3 in the genetic linkage map. Four extended pedigrees (one of which overlaps with CEPH) were typed. Linkage with Tourette syndrome (TS) was also examined. SLC6A3 showed close linkage with several markers previously mapped to distal chromosome 5p, including D5S11 (Z{sub max} = 16.0, {theta}{sub M} = {theta}{sub F} = 0.03, results from four families) and D5S678 (Z{sub max} = 7.84, {theta}{sub M} = {theta}{sub F} = 0, results from two families). Observed crossovers established that SLC6A3 is a distal marker close to D5S10 and D5S678, but these three distal markers could not be ordered. Linkage between TS and SLC6A3 could be excluded independently in two branches of a large kindred segregating TS; the lod score in a third family was also negative, but not significant. Cumulative results show a lod score of -6.2 at {theta} = 0 and of -3.9 at {theta} = 0.05 (dominant model, narrow disease definition). SLC6A3 thus maps to distal chromosome 5p by linkage analysis, in agreement with previous physical mapping data. A mutation at SLC6A3 is not causative for TS in the two large families that generated significant negative lod scores (if the parameters of our analyses were correct) and is unlikely to be causative in the family that generated a negative lod score that did not reach significance. These results do not exclude a role for the dopamine transporter in influencing risk for TS in combination with other loci. 23 refs., 1 fig., 2 tabs.

  13. Parámetros y valores genéticos para características de composición corporal, área de ojo del lomo y grasa dorsal medidos mediante ultrasonido en la raza Brahman

    Directory of Open Access Journals (Sweden)

    A. Jiménez

    2010-12-01

    Full Text Available El ganado Brahman en Colombia es el de mayor participación como raza pura paraproducción de carne, y tiene gran influencia en el ganado comercial. Hasta el momento,Asocebu ha realizado evaluaciones genéticas para características de crecimiento,pero aún no se han realizado para características de la canal. El objetivo de este trabajofue determinar parámetros genéticos (heredabilidades y correlaciones, y valores genéticos(DEP para área de ojo del lomo (AOL, grasa dorsal (GD, profundidad delmúsculo glúteo medio (PMGM y grasa del anca (GA. Fueron medidos por medio deultrasonido un total de 934 animales puros, hijos de 164 toros que se encontraban enun rango de edad de 15 a 18 meses. Para los análisis se crearon grupos contemporáneosteniendo en cuenta la época, el sexo y el manejo alimenticio. Se realizó un análisis univariadousando un modelo reproductor, teniendo en cuenta el grupo contemporáneo(animales del mismo sexo, de la misma época y en el mismo manejo alimenticio, laedad fue tomada como covariable y la finca fue incluida en el modelo. Las heredabilidadesfueron 0,37 ± 0,11; 0,29 ± 0,10; 0,26 ± 0,10 y 0,11 ± 0,09 para AOL, GD,PMGM y GA respectivamente. Las DEP para AOL variaron de -2,84 a 3,43; para GDde -0,372 a 0,235; para PMGM de -0,187 a 0,235, y para GD de -0,176 a 0,298. Lascorrelaciones genéticas fueron positivas y altas indicando que la selección por musculaturano afecta el grado de acabado. Este trabajo mostró que en ganado Brahman puroexiste variación genética para las características medidas por ultrasonido relacionadascon la canal, lo cual permitirá tenerlas en cuenta en el programa de mejoramientogenético de la raza Brahman en Colombia.

  14. SL(C) 5 migration at CERN

    International Nuclear Information System (INIS)

    Schwickerath, Ulrich; Silva, Ricardo

    2010-01-01

    Most LCG sites are currently running on SL(C)4. However, this operating system is already rather old, and it is becoming difficult to get the required hardware drivers, to get the best out of recent hardware. A possible way out is the migration to SL(C)5 based systems where possible, in combination with virtualization methods. The former is typically possible for nodes where the software to run the services is available and tested, while the latter offers a possibility to make use of the new hardware platforms whilst maintaining operating system compatibility. Since autumn 2008, CERN has offered public interactive and batch worker nodes for evaluation to the experiments. For the Grid environment, access is granted by a dedicated CEs. The status of the evaluation, feedback received from the experiments and the status of the migration will be reviewed, and the status of virtualization of services at CERN will be reported. Beyond this, the migration to a new operating system also offers an excellent opportunity to upgrade the fabric infrastructure used to manage the servers.

  15. Análisis de la diversidad genética de una población de caballos Criollo Argentino mediante polimorfismos de nucleótido simple de los genes IL12B y TNF-α

    Directory of Open Access Journals (Sweden)

    Claudia Corbi Botto

    2016-12-01

    Full Text Available La caracterización de una población es el primer paso en el camino hacia su conservación y utilización. La raza Criollo Argentino es una de las referentes de la especie equina en Argentina y, por lo tanto, un patrimonio ganadero local que representa un recurso único en cuanto a la identidad y al sistema productivo del país. El objetivo de este trabajo fue analizar una población de caballos Criollo Argentino del norte de Argentina por medio de la caracterización de la variabilidad genética de cuatro marcadores moleculares del tipo single nucleotide polymorphism (SNP localizados en los genes que codifican para las citoquinas IL-12B y TNF-α. Se recolectaron muestras de 50 caballos Criollo Argentino y se extrajo ADN genómico que se utilizó para tipificar mediante PCR-Pirosecuenciación®, tres SNPs en el promotor del gen TNF-α y uno localizado en el exón 5 del gen IL-12B. Se estimaron frecuencias génicas y genotípicas, equilibrio de Hardy-Weinberg y diversidad genética. En IL-12B se detectaron dos alelos, mientras que en TNF-α se observaron 4 haplotipos, entre ellos uno no descripto hasta el momento en equinos. Los resultados muestran que la heterocigosis esperada fue superior en TNF-α (He=0,764 y la población se encuentra en equilibrio para el locus IL-12B (p-valor ≥0,05. Se destaca la importancia del caballo Criollo Argentino como acervo génico para el estudio de características genéticas y enfermedades de la especie equina.

  16. ANALISIS SEKUEN GEN GLUTATION PEROKSIDASE (GPX1 SEBAGAI DETEKSI STRES OKSIDATIF AKIBAT INFEKSI MYCOBACTERIUM TUBERCULOSIS

    Directory of Open Access Journals (Sweden)

    Ari Yuniastuti

    2013-02-01

    Full Text Available Glutation merupakan antioksidan yang berperan dalam fungsi imun, dan diekspresikan secara genetik oleh urutan gen yang membentuk protein enzim Glutation Peroxidase (GPx1. Bila ekspresi gen berubah maka terjadi perubahan fungsi glutation dan kerentanan terhadap stress oksidatif. Metode yang digunakan adalah Kasus-kontrol. Sampel yang digunakan adalah sampel darah. Kelompok kasus adalah sampel darah pasien tuberkulosis paru sedangkan kelompok kontrol adalah sampel darah orang sehat. Pemeriksaan gen Glutation peroxidase (GPx1 menggunakan metode Polymerase Chain Reaction (PCR untuk melihat pita DNA pada pasien tuberkulosis par serta elektroforesis produk PCR-RFLP gen GPx1 kelompok sampel tuberkulosis. Hasil penelitian menunjukkan bahwa tidak terdapat hubungan yang bermakna antara polimorfisme gen GPx1 (p=0,365 pasein tuberkulois dengan individu sehat, sehingga tidak dapat digunakan sebagai alat deteksi kerentanan terhadap stress oksidatif pada pasien tuberkulosis. Perlu penelitian lanjutan yang menggunakan sampel lebih besar dan populasi etnik yang berbeda.

  17. Hypothesis: SLC12A3 Polymorphism modifies thiazide hypersensitivity of antenatal Bartter syndrome to thiazide resistance.

    Science.gov (United States)

    Mammen, Cherry; Rupps, Rosemarie; Trnka, Peter; Boerkoel, Cornelius F

    2012-02-01

    We report a 5-year-old boy with thiazide-resistant Bartter syndrome. This is highly unusual since thiazide hypersensitivity is a common diagnostic finding in Bartter syndrome patients. Subsequent molecular testing identified compound heterozygosity for two novel mutations in KCNJ1, (c.556A > G and c.683G > A) which is associated with Bartter syndrome, and a paternally inherited polymorphism in SLC12A3 (c.791G > C). Mutations in SLC12A3 cause the thiazide-resistant tubulopathy Gitelman syndrome. Based on published studies of this polymorphism in SLC12A3 and the features of the proband's father, we postulate that this polymorphism modifies the phenotype of Bartter syndrome in the proband to thiazide resistance. Copyright © 2011 Elsevier Masson SAS. All rights reserved.

  18. Genetic variants in the regulatory region of SLC10A1 are not associated with the risk of hepatitis B virus infection and clearance.

    Science.gov (United States)

    Chen, Xueqin; Wang, Ying; Chen, Xiaohua; Cheng, Kailiang; Li, Jiaoyuan; Lou, Jiao; Ke, Juntao; Yang, Yang; Gong, Yajie; Zhu, Ying; Wang, Li; Zhong, Rong

    2016-10-01

    The Na/taurocholate cotransporter NTCP (encoded by SLC10A1) was identified as a cellular entry receptor for the human hepatitis B virus (HBV), advancing our understanding of the molecular mechanism of HBV infection. An alternative hypothesis was put forward that regulatory variants in SLC10A1 might play an important role in HBV susceptibility by potentially influencing expression levels of NTCP. The three regulatory SNPs (rs8011311, rs7154439, rs111409076) were genotyped in 1023 HBV-persistent carriers, 735 subjects with HBV natural clearance and 732 HBV marker-negative subjects in a Han Chinese population. Real-time reverse transcription PCR analysis and luciferase assays have been performed to dissect the potential functionality. In logistic regression analysis, when subjects with HBV natural clearance were compared with HBV marker-negative subjects, no significant associations with the risk of HBV infection were observed for any of the three SNPs after adjusting for age, sex, smoking status and alcohol consumption (P>0.05). Similar negative results were also found for the three SNPs when HBV-persistent carriers were compared with HBV marker-negative subjects. Likewise, no significant associations with the risk of HBV clearance were observed when HBV-persistent carriers were compared with subjects with HBV natural clearance (P>0.05). Quantitative RT/PCR showed no significant difference in NTCP expression levels in normal liver tissue amongst individuals with different rs111409076 genotypes (P=0.317 for the general linear model). Moreover, no evident effect of the SLC10A1 rs111409076 AACA/- polymorphism on transcriptional activity was found by luciferase assay in either HepG2 (P=0.161) or Hep3b (P=0.129) cell lines. The present study indicated that the common variants in the regulatory region of SLC10A1 may not influence the expression of NTCP at the level of transcriptional regulation, and ultimately may not be associated with HBV susceptibility in this Chinese

  19. Una mirada al albinismo óculo-cutáneo: reporte de mutaciones en el gen TYR en cinco individuos colombianos

    Directory of Open Access Journals (Sweden)

    Diana Sanabria

    2012-06-01

    Full Text Available Introducción. El albinismo óculo-cutáneo es un trastorno hereditario autosómico recesivo relacionado con la pigmentación. Sus manifestaciones clínicas incluyen hipopigmentación en piel, cabello y ojos, hipoplasia en la fóvea y disminución de la agudeza visual. A nivel mundial, hasta el momento, se han reportado, aproximadamente, 230 mutaciones en el gen TYR que causan albinismo óculo-cutáneo de tipo 1. Este gen codifica para la tirosinasa, enzima principal de la biosíntesis de melanina. Objetivos. Identificar las mutaciones en el gen TYR responsables del albinismo óculo-cutáneo de tipo 1 en cinco individuos colombianos; cuatro de ellos pertenecen a una misma familia y el otro individuo es un caso aislado no relacionado con la familia. Asimismo, se pretende evaluar un sistema oftálmico que permite corregir problemas de refracción, y disminuir el nistagmo y la fotofobia en uno de los casos. Materiales y métodos. Se hizo la secuenciación de los cinco exones del gen TYR en los cinco individuos de estudio y se buscaron portadores en la familia. Se llevó a cabo la evaluación clínica oftalmológica y la implementación del sistema correctivo en uno de los pacientes. Resultados. Se encontraron las mutaciones G47D y 1379delTT en la familia, y en el caso aislado, las mutaciones G47D y D42N. Con la implementación del sistema óculo-visual se logró incrementar la agudeza visual y disminuir el nistagmo.Conclusiones. Por ser el primer estudio en albinismo de este carácter en el país, estos resultados marcan una pauta para estudios posteriores de tamización molecular de albinismo en población colombiana.   doi: http://dx.doi.org/10.7705/biomedica.v32i2.638

  20. Identificación de un gen codificante de polifenol oxidasa (PPO en Theobroma cacao L. (cacao de Ecuador

    Directory of Open Access Journals (Sweden)

    Jaime Morante-Carriel

    2017-12-01

    Full Text Available En Ecuador, las plantaciones de cacao presentan bajos promedios de producción debido a la diversidad de patógenos, especialmente a la infección por Moniliophthora roreri (monilia. Se cree que existe una relación entre el ataque del hongo y el aumento de los niveles de expresión de genes codificantes de polifenol oxidasas (PPOs como mecanismo de defensa ante patógenos y herbívoros en diferentes plantas. Para la identificación de genes que codifican para PPOs, se seleccionaron hojas de cacao Nacional, provenientes de plantas resistentes y susceptibles a monilia, ubicadas en la Finca Experimental La Represa, propiedad de la Universidad Técnica Estatal de Quevedo. Se afinó un protocolo de extracción de ARN total de alta calidad para hojas de cacao recalcitrantes. Después de su retrotranscripción a ADNc, se realizaron ensayos de amplificación por PCR con diferentes primers, diseñados a partir de secuencias conservadas de PPOs. Los productos de amplificación permitieron la identificación de un gen de 961 pb, similar a un gen que codifica para la PPO predictiva de Theobroma cacao depositada en NCBI (XP_017978715.1 La identificación de este gen, es fundamental para evaluar a futuro los niveles de expresión y cuantificación en diferentes estados de desarrollo del fruto. Dicha cuantificación permitirá proponer herramientas de control para monilia y construir las bases para el mejoramiento genético del cacao Nacional.

  1. The image of God (Gen. 1:26-27) in the Pentateuch : a biblical-theological approach / Daniel Simango

    OpenAIRE

    Simango, Daniel

    2006-01-01

    This dissertation focuses on how the theme of the image of God (Gen 1 :26-27) is seen and developed in the Pentateuch. The image of God in man (Gen 1 :26-27) has been interpreted in various ways. Predominant opinions have changed over time from the Early Jewish interpretation to the present period. Today there is a wider range of opinion regarding the image of God than ever. This dissertation follows a biblical-theological approach from a Reformed tradition of Genesis 1 :26-...

  2. Correlation plot facility in the SLC control system

    International Nuclear Information System (INIS)

    Hendrickson, L.; Phinney, N.; Sanchez-Chopitea, L.

    1991-05-01

    The Correlation Plot facility is a powerful interactive tool for data acquisition and analysis throughout the SLC. A generalized interface allows the user to perform a wide variety of machine physics experiments without the need for specialized software. It has been used extensively during SLC commissioning and operation. The user may step one or two independent parameters such as magnet or feedback setpoints while measuring or calculating up to 160 others. Measured variables include all analog signals available to the control system as well as a variety of derived parameters such as beam size or emittance. Various fitting algorithms and display options are provided for data analysis. A software-callable interface is also provided. Applications based on this facility are used to phase klystrons, measure emittance and dispersion, minimize beam size at the interaction point and maintain beam collisions. 4 refs., 3 figs

  3. Doping Genético e Eugenia: Diálogos além do esporte

    Directory of Open Access Journals (Sweden)

    Tiago Vieira Bomtempo

    2016-01-01

    Full Text Available La ingeniería genética trajo posibilidades antes inimaginables, en la que no hace mucho tiempo era visto sólo en las películas. De la terapia génica, dirigida hacia una corrección o cura de una enfermedad, pasa a la posibilidad del mejoramiento genético, actualmente vislumbrado en el mundo del deporte con el doping genético. ¿Pero, el doping genético no estaría violando el derecho al patrimonio genético no modificado? Aunque la intervención genética no se transmita a los descendentes, habría un mejoramiento genético, que afectaría el genoma del atleta y lo diferenciaría de los demás atletas y otros individuos, hiriendo el principio de igualdad en detrimento de la autonomía privada, pudiéndose estar hablando inicialmente de una relación de dominación, aunque sea en razón al rendimiento físico en el deporte. En este sentido, estas innovaciones que atraviesan el campo de la ingeniería genética, infunden una preocupación acerca de la manipulación genética en las generaciones futuras, punto de discusión no sólo biomédica, sino también bioético y biojurídico. Así, surge una preocupación si estos nuevos avances pueden afectar a la dignidad humana delante de una posible eugenesia, debido a la proyección de personas y la consecuente discriminación por determinada identidad genética. Junto a esto, el objetivo de este artículo es investigar si el dopaje genético ofendería el derecho al patrimonio genético no modificado y los derechos de las generaciones futuras, dando lugar a una nueva forma de eugenesia, al no permitir el ejercicio igualitario de las libertades fundamentales. Por lo tanto, se hace necesaria una investigación basada en los autores de la bioética y el bioderecho, así como también los textos legales nacionales e internacionales que involucran el tema. Es indispensable la discusión de estas cuestiones, sobre todo con la proximidad de los Juegos Olímpicos de Verano en Brasil en este año 2016

  4. Informe técnico final. Caracterización genética poblacional para el manejo y la conservación de recursos marinos de importancia para la acuicultura y la pesquería.

    OpenAIRE

    Vergara, A.M.

    2005-01-01

    conocimiento de la variabilidad genética de un recurso permite estimar el estado de conservación genética del recurso a lo largo de su distribución geográfica, permitiendo tomar decisiones adecuadas para correctos planes de manejo, repoblamiento y/o cultivo del recurso.

  5. Stanford: SLC back in action

    Energy Technology Data Exchange (ETDEWEB)

    Anon.

    1990-05-15

    During January, Stanford's SLC Linear Collider began producing Z particles again after the major disruptions in October due to the Loma Prieta earthquake. What's more, the pulse repetition rate climbed smoothly from 60 to 120 Hz as part of the ongoing collider improvement programme. Although the SLC luminosity has not quite returned to its best pre-quake levels, the collider managed to produce enough Z particles to permit Mark II physicists to test their newly installed Vertex Detection System (VDS)

  6. SLC52A2 [p.P141T] and SLC52A3 [p.N21S] causing Brown-Vialetto-Van Laere Syndrome in an Indian patient: First genetically proven case with mutations in two riboflavin transporters.

    Science.gov (United States)

    Udhayabanu, Tamilarasan; Subramanian, Veedamali S; Teafatiller, Trevor; Gowda, Vykuntaraju K; Raghavan, Varun S; Varalakshmi, Perumal; Said, Hamid M; Ashokkumar, Balasubramaniem

    2016-11-01

    Brown-Vialetto-Van Laere Syndrome (BVVLS), a rare neurological disorder characterized by bulbar palsies and sensorineural deafness, is mainly associated with defective riboflavin transporters encoded by the SLC52A2 and SLC52A3 genes. Here we present a 16-year-old BVVLS patient belonging to a five generation consanguineous family from Indian ethnicity with two homozygous missense mutations viz., c.421C>A [p.P141T] in SLC52A2 and c.62A>G [p.N21S] in SLC52A3. Functional characterization based on 3 H-riboflavin uptake assay and live-cell confocal imaging revealed that the effect of mutation c.421C>A [p.P141T] identified in SLC52A2 had a slight reduction in riboflavin uptake; on the other hand, the c.62A>G [p.N21S] identified in SLC52A3 showed a drastic reduction in riboflavin uptake, which appeared to be due to impaired trafficking and membrane targeting of the hRFVT-3 protein. This is the first report presenting mutations in both riboflavin transporters hRFVT-2 and hRFVT-3 in the same BVVLS patient. Also, c.62A>G [p.N21S] in SLC52A3 appears to contribute more to the disease phenotype in this patient than c.421C>A [p.P141T] in SLC52A2. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Variants in SLC18A3, vesicular acetylcholine transporter, cause congenital myasthenic syndrome

    NARCIS (Netherlands)

    O'Grady, Gina L.; Verschuuren, Corien; Yuen, Michaela; Webster, Richard; Menezes, Manoj; Fock, Johanna M.; Pride, Natalie; Best, Heather A.; Damm, Tatiana Benavides; Turner, Christian; Lek, Monkol; Engel, Andrew G.; North, Kathryn N.; Clarke, Nigel F.; MacArthur, Daniel G.; Kamsteeg, Erik-Jan; Cooper, Sandra T.

    2016-01-01

    Objective: To describe the clinical and genetic characteristics of presynaptic congenital myasthenic syndrome secondary to biallelic variants in SLC18A3. Methods: Individuals from 2 families were identified with biallelic variants in SLC18A3, the gene encoding the vesicular acetylcholine transporter

  8. Ideas Previas Acerca de “Evolución y Su Relación con la Genética” en Estudiantes de Grado Noveno del Colegio Nicolás Esquerra

    Directory of Open Access Journals (Sweden)

    Sergio Alejandro Peláez Plazas

    2015-12-01

    Full Text Available Como primera experiencia didáctica, en este trabajo se muestran las ideas previas que construyen 10  estudiantes de noveno grado del colegio Nacional Nicolás Esguerra acerca del proceso de evolución, las cuales se encuentran relacionadas con algunos conceptos que aborda la genética. Los datos fueron recogidos por medio de una encuesta de pregunta abierta y un dibujo en base al método cualitativo, con el fin de conocer la comprensión que los estudiantes tienen acerca de la evolución y  los conceptos mencionados en sus explicaciones, entre los cuales se encontraron: adaptación, ADN y código genético,  relacionando en estos el tiempo como factor de cambio. Estas ideas se organizaron en tres categorías  (Comprensión de Procesos evolutivos basados en variabilidad y selección natural e Ideas relacionadas al catastrofismo como factor promotor de especiación. Entre estas, la mayoría de los alumnos hace alusión a cambios en el ciclo de vida y desarrollo, y no como un proceso a nivel histórico y constante en las poblaciones. En cuanto a la comprensión del ADN, el gen y su relación con las especies, no hay claridad con respecto a la expresión de caracteres desde  la información que se expresa en las proteínas. Por consiguiente, se infiere que las ideas encontradas están poco articuladas  ya que ellos no las logran conectar de forma apropiada en sus respuestas.

  9. Overview of materials R and D for fusion and Gen-4

    Energy Technology Data Exchange (ETDEWEB)

    Kohyama, A. [Kyoto Univ., lnstitute of Advanced Energy (Japan); Tavassoli, F.; Carre, F.; Billot, P. [CEA Saclay, 91 - Gif sur Yvette (France); Zinide, S. [Oak Ridge National Laboratory, Materials Science and Technology Div., AK TN (United States)

    2007-07-01

    Full text of publication follows: In view of the growing need for energy, the risk of exhaustion of fossil fuel and the problem of global warming, the nuclear energy is receiving added attention as a realistic and viable advanced solution. International collaborations on Generation IV (Gen-IV) fission reactors and on ITER and DEMO fusion reactors are developing. This is particularly the case in the sector of materials, where they hold the key to success of these systems. The international community has recognized and planned its materials R and D work for Fusion and Gen-IV reactors with the following considerations: 1- The time allotted to materials R and D is short and may not allow development of totally new materials. 2- Activities required, to cover existing materials variations and service conditions necessary for reactor design, are very time consuming. 3- The work to be done must build upon the existing knowledge of materials and avoid duplications. Although ITER for fusion and Generation four International Forum (GIF) for Gen-IV are important international collaborative programs, they are insufficient to meet all the national energy policies of the participating countries. This paper provides an overview of the materials R and D carried out for fusion and Gen-IV reactors at international and national levels. Materials programs discussed include both cross-cutting and reactor specific actions, where major tasks can be defined as: + Cross-cutting materials tasks: - materials for high temperature service; - materials with neutron damage tolerance; - materials behavior analysis and modeling; - high temperature design methodology. + Reactor specific materials tasks: - very high temperature alloys; - carbon, high temperature ceramics and their composites; - materials compatibilities. Starting with a brief introduction of materials R and D strategies, ITER and Broader Approach (BA), overall activities for fusion and GIF for Gen-IV will be reviewed. Domestic

  10. Expansión clónica y caracterización genómica del proceso de integración del virus linfotrópico humano tipo I en la leucemia/linfoma de células T en adultos

    Directory of Open Access Journals (Sweden)

    Mercedes Salcedo-Cifuentes

    2009-06-01

    Conclusiones. Los resultados permiten postular que la integración del virus linfotrópico humano tipo I se dirigiría hacia un ambiente genómico caracterizado por elevado contenido de C:G, genes de replicación temprana que regularían el ciclo celular y la transducción de señales.

  11. Identification of novel mutations in HFE, HFE2, TfR2, and SLC40A1 genes in Chinese patients affected by hereditary hemochromatosis.

    Science.gov (United States)

    Wang, Yongwei; Du, Yali; Liu, Gang; Guo, Shanshan; Hou, Bo; Jiang, Xianyong; Han, Bing; Chang, Yanzhong; Nie, Guangjun

    2017-04-01

    Hereditary hemochromatosis (HH) is a group of inherited iron-overload disorders associated with pathogenic defects in the genes encoding hemochromatosis (HFE), hemojuvelin (HJV/HFE2), hepcidin (HAMP), transferrin receptor 2 (TfR2), and ferroportin (FPN1/SLC40A1) proteins, and the clinical features are well described. However, there have been only a few detailed reports of HH in Chinese populations. Thus, there is insufficient patient information for population-based analyses in Chinese populations or comparative studies among different ethical groups. In the current work, we describe eight Chinese cases of hereditary hemochromatosis. Gene sequencing results revealed eight mutations (five novel mutations) in HFE, HFE2, TfR2, and SLC40A1 genes in these Chinese HH patients. In addition, we used Polymorphism Phenotyping v2 (Polyphen), Sorting Intolerant From Tolerant (SIFT), and a sequence alignment program to predict the molecular consequences of missense mutations.

  12. Stanford: SLC back in action

    International Nuclear Information System (INIS)

    Anon.

    1990-01-01

    During January, Stanford's SLC Linear Collider began producing Z particles again after the major disruptions in October due to the Loma Prieta earthquake. What's more, the pulse repetition rate climbed smoothly from 60 to 120 Hz as part of the ongoing collider improvement programme. Although the SLC luminosity has not quite returned to its best pre-quake levels, the collider managed to produce enough Z particles to permit Mark II physicists to test their newly installed Vertex Detection System (VDS)

  13. Performance of the SLC polarized electron source with high polarization

    International Nuclear Information System (INIS)

    Clendenin, J.E.; Alley, R.K.; Aoyagi, H.

    1993-04-01

    For the 1992 operating cycle of the SLAC Linear Collider (SLC), the polarized electron source (PES) during its maiden run successfully met the pulse intensity and overall efficiency requirements of the SLC. However, the polarization of the bulk GaAs cathode was low (∼27%) and the pulse-to-pulse stability was marginal. We have shown that adequate charge for the SLC can be extracted from a strained layer cathode having P e ∼80% even though the quantum efficiency (QE) is - beam stability. The performance of the PES during the 1993 SLC operating cycle with these and other improvements is discussed

  14. Hipercalcemia hipocalciúrica debida a una mutación de novo del gen del receptor sensor de calcio Hypocalciuric hypercalcemia due to de novo mutation of the calcium sensing receptor

    Directory of Open Access Journals (Sweden)

    Marcelo Sarli

    2004-08-01

    Full Text Available El objetivo de este trabajo es presentar el inusual caso clínico de una paciente de 34 años que consultó para establecer diagnóstico de certeza y conducta terapéutica ante una hipercalcemia asintomática, detectada en un examen bioquímico de rutina. La elevación de la calcemia en ausencia de inhibición de la secreción de parathormona orientó hacia una patología paratiroidea. La persistencia de la hipercalcemia concomitante con hipocalciuria y coincidente con una relación clearance de calcio/clearance de creatinina inferior a 0.01, hicieron sospechar el diagnóstico de hipercalcemia hipocalciúrica familiar. La falta de antecedentes familiares llevó a realizar un estudio molecular de la paciente y su grupo familiar. Los resultados de los estudios nos permitieron concluir que la paciente es portadora de una mutación de novo (inactivante del gen del receptor sensor del calcio. Se incluyen los datos del estudio molecular y una breve revisión bibliográfica del tema.The aim of this paper is to refer the unusual case of a 34 years old woman who consulted because of asymptomatic hypercalcemia, detected in a biochemical routine examination. The elevated values of serum calcium without blunted parathyroid hormone secretion suggested a parathyroid pathology. The concomitance of hypocalciuria with hypercalcemia and a calcium clearance/creatinine clearance ratio less than 0.01 reverted the diagnosis of familial hypocalciuric hypercalcemia, the first option. The absence of familial background led to the molecular study of the patient and her family. The latter confirmed the diagnosis of a de novo inactivating mutation of the calcium sensing receptor. Details on the molecular study and a brief review of this subject are included.

  15. Aceptación de los fármacos genéricos en equipos de atención primaria: efecto de una intervención educativa y de los precios de referencia

    Directory of Open Access Journals (Sweden)

    Vallès J.A.

    2002-01-01

    Full Text Available Objetivo: Analizar la aceptación de los pacientes de la sustitución de marcas de fantasía por genéricos en el marco de la prescripción crónica. Métodos: Estudio prospectivo, multicéntrico, de utilización de medicamentos. De los 31 centros incluidos en el estudio, ocho fueron aleatorizados al grupo intervención y 23 al grupo control. Durante un año los pacientes del grupo intervención que acudieron a recoger las recetas de la medicación crónica fueron informados de forma verbal y escrita sobre las ventajas e inconvenientes de los fármacos genéricos y los de marca de fantasía. Se registraron los pacientes que recibían fármacos susceptibles de ser prescritos como genéricos, los motivos de no aceptación del cambio y las variables relacionadas (edad, sexo, nivel de estudios, centro, médico de cabecera, tipo de fármaco y número total de fármacos crónicos. Cada 2 meses se obtuvo el porcentaje de genéricos prescritos respecto al total de prescripción. Resultados: Fueron informados 4.620 pacientes de los que el 98,9% aceptó el cambio. El centro de atención primaria, el tipo de fármaco, la influencia médica y la satisfacción del paciente con el fármaco se asociaron significativamente con el grado de aceptación de los genéricos. En el grupo intervenido, el porcentaje de envases genéricos respecto al total de envases prescritos alcanzó un 5,9 frente a un 2,8% de los controles no incentivados. Tras finalizar la intervención y antes de la aplicación de los precios de referencia, los porcentajes fueron del 6,7 y el 3,9%, mientras que justo tras su aplicación, los porcentajes fueron del 8,6 y el 6,3%, respectivamente. Conclusiones: Una intervención educativa directa sobre el paciente es efectiva para cambiar de marca de fantasía a genérico. La motivación y el conocimiento sobre los medicamentos genéricos por parte del médico de cabecera son factores influyentes sobre su uso. La aplicación de los precios de

  16. Lack of SLC2A1 (glucose transporter 1) mutations in 30 Italian patients with alternating hemiplegia of childhood.

    Science.gov (United States)

    De Grandis, Elisa; Stagnaro, Michela; Biancheri, Roberta; Giannotta, Melania; Gobbi, Giuseppe; Traverso, Monica; Veneselli, Edvige; Zara, Federico

    2013-07-01

    Alternating hemiplegia of childhood is a rare, predominantly sporadic disorder. Diagnosis is clinical, and little is known about genetics. Glucose transporter 1 deficiency syndrome shares with alternating hemiplegia of childhood paroxysmal and nonparoxysmal symptoms. The aim of the study was to investigate glucose transporter 1 mutations in 30 Italian patients. Genetic material was analyzed by DNA amplification and glucose transporter 1 region sequencing. Mutational analysis findings of the SLC2A1 gene were negative in all patients. The pattern of movement disorders was reviewed. Interictal dystonia and multiple paroxysmal events were typical of alternating hemiplegia of childhood. In conclusion, alternating hemiplegia of childhood is a heterogeneous clinical condition, and although glucose transporter 1 deficiency can represent an undiagnosed cause of this disorder, mutational analysis is not routinely recommended. Alternatively, a careful clinical analysis and the 3-O-methyl-D-glucose uptake test can allow prompt identification of a subgroup of patients with alternating hemiplegia of childhood treatable with a ketogenic diet.

  17. Estudios entomológicos del Aedes aegypti relacionados con la epidemiología del dengue

    Directory of Open Access Journals (Sweden)

    Clara B. Ocampo

    2004-03-01

    Full Text Available

    La fiebre de dengue (FD y el dengue hemorrágico (DH son enfermedades producidas por la transmisión del virus de dengue (serotipos 1 – 4 a través de los mosquitos Aedes aegypti y A. albopictus. Ambos vectores están altamente adaptados a vivir en ambientes urbanos especialmente en las áreas tropicales.

    El virus de dengue es el arbovirus más importante que afecta a los humanos (1-3, pero hasta el momento no existe una vacuna y su prevención se basa principalmente en el control de sus vectores. En Colombia, el principal vector es A. aegypti, el cual se encuentra en la mayoría del territorio Nacional por debajo de los 1.800 metros, sin embargo, ya se observa la presencia de A. albopictus en unas localidades de frontera amenazando con su desplazamiento en todas las áreas del país (4, 5.

    Adicionalmente, existe la presencia de todos los serotipos de dengue, lo que nos ubica como un territorio hiperendémico de dengue. Los programas de control se basan en el control de criaderos, aplicación de insecticidas y educación ambiental, pero esto no ha sido suficiente para controlar el incremento de la enfermedad en el país.

    Son múltiples los factores asociados con la capacidad de un vector de transmitir un patógeno. Entre ellos se encuentran su densidad, el comportamiento y las características intrínsecas, que permiten el desarrollo y transmisión del patógeno, lo que se conoce como competencia vectorial.

    La capacidad adaptativa del A. aegypti y del A. albopictus para reproducirse en cualquier recipiente con agua en los ambientes urbanos y su comportamiento de

  18. Consideraciones alrededor del Libro del Almismo, el Libro del Pensar.

    Directory of Open Access Journals (Sweden)

    MartaLucía Tamayo Fernandez

    1999-12-01

    Full Text Available

    La doctora MarthaLucía Tamayo comparte muchas inquietudes alrededor del Libro del Almismo, el Libro del Pensar; de dónde salió ese nombre; de juntar en medicina y en genética a tres escritores como lo son Jorge Luis Borges, Macedonio Fernández y Julio Cortázar. Su conferencia dice así:

    El término almismo fue ideado por Macedonio Fernández porque defendía mucho el ensimismamiento y el pensamiento hacia el interior, mirar hacia adentro; cada uno somos un “sí mismo” que nos hace diferentes aunque al mismo tiempo podemos ser iguales. Todos tenemos esa parte interior que la medicina debe trabajar y que no puede olvidar.

    “El Libro del Almismo, el libro del pensar” nos lleva a replantear y a repensar un poco la medicina que queremos, una medicina vuelta a pensar.

    Quiero contarles la historia de cómo se llegó a este libro y por qué y para qué se sigue trabajando en estos temas: Después de mi internado y de un trabajo un poco triste de rural, volví al Instituto de Genética y a la Universidad Javeriana en donde encontré al doctor Bernal y un espacio que estaba buscando para esa medicina diferente que quería, con un grupo de personas que me permitía no sólo ver la medicina sino ver muchas otras cosas más; había espacio para la literatura, para Mafalda, para hablar de niños, de locos, había incluso tiempo para hablar de medicina dentro del golf, de carros antiguos y de todo eso fui aprendiendo.

    Eso era lo que estaba buscando. Una medicina que diera espacios diferentes, que fuera más humanizada. Rápidamente me ubiqué y me quedé! No me arrepiento en lo absoluto de haberme quedado porque fue, ha sido y sigue siendo, una experiencia enriquecedora, de muchas vivencias importantes. Sabía exactamente dónde estaba y sabía que había que seguir rápido y había que trabajar muchos aspectos de esa medicina que estábamos buscando y de esa genética especial.

    Rápidamente empezamos a trabajar

  19. Aislamientos de Staphylococcus aureus sensibles a meticilina relacionados genéticamente con el clon USA300, ¿origen de los aislamientos SARM de genotipo comunitario en Colombia?

    Directory of Open Access Journals (Sweden)

    Javier Antonio Escobar-Pérez

    2014-04-01

    Full Text Available Introducción. USA300 es un linaje genético que se encuentra en aislamientos de Staphylococcus aureus sensibles (SASM y resistentes a meticilina (SARM. Actualmente, en Colombia las infecciones por SARM en hospitales y en la comunidad son causadas principalmente por un clon con genotipo comunitario (SARM-GC relacionado genéticamente con el clon USA300. El origen de esta variante es aún desconocido. Objetivo. Identificar y caracterizar aislamientos de S. aureus resistentes y sensibles a meticilina con el fin de aportar información para establecer un posible origen de los aislamientos SARM-GC en Colombia. Materiales y métodos. Se realizó una caracterización de aislamientos SASM relacionados con el clon USA300 detectados a partir de un análisis de 184 aislamientos de S. aureus (90 SARM y 94 SASM causantes de infecciones. La relación genética de los aislamientos se determinó por electroforesis en gel de campo pulsado (PFGE, tipificación de secuencias multilocus (MLST y tipificación del gen de la proteína A (spa. Resultados. De los 184 aislamientos, 27 (14,7 % presentaron características moleculares y relación genética con el clon USA300, y de ellos, 18 fueron SARM y nueve fueron SASM. Todos los aislamientos SARM relacionados con este clon albergaban un casete estafilocócico cromosómico mec (SCCmec IVc (3.1.2. En ningún aislamiento SASM se detectaron secuencias remanentes de SCCmec o una duplicación del sitio attB que evidenciaran la pérdida del casete. Conclusión. El origen de los aislamientos SARM-GC en Colombia probablemente se encuentre en la diseminación de clones SASM relacionados con el clon USA300 que adquirieron el SCCmec IVc posteriormente.

  20. Genetic analysis of the GLUT10 glucose transporter (SLC2A10 polymorphisms in Caucasian American type 2 diabetes

    Directory of Open Access Journals (Sweden)

    Mychaleckyj Josyf C

    2005-12-01

    Full Text Available Abstract Background GLUT10 (gene symbol SLC2A10 is a facilitative glucose transporter within the type 2 diabetes (T2DM-linked region on chromosome 20q12-13.1. Therefore, we evaluated GLUT10 as a positional candidate gene for T2DM in Caucasian Americans. Methods Twenty SNPs including 4 coding, 10 intronic and 6 5' and 3' to the coding sequence were genotyped across a 100 kb region containing the SLC2A10 gene in DNAs from 300 T2DM cases and 310 controls using the Sequenom MassArray Genotyping System. Allelic association was evaluated, and linkage disequilibrium (LD and haplotype structure of SLC2A10 were also determined to assess whether any specific haplotypes were associated with T2DM. Results Of these variants, fifteen had heterozygosities greater than 0.80 and were analyzed further for association with T2DM. No evidence of significant association was observed for any variant with T2DM (all P ≥ 0.05, including Ala206Thr (rs2235491 which was previously reported to be associated with fasting insulin. Linkage disequilibrium analysis suggests that the SLC2A10 gene is contained in a single haplotype block of 14 kb. Haplotype association analysis with T2DM did not reveal any significant differences between haplotype frequencies in T2DM cases and controls. Conclusion From our findings, we can conclude that sequence variants in or near GLUT10 are unlikely to contribute significantly to T2DM in Caucasian Americans.

Some links on this page may take you to non-federal websites. Their policies may differ from this site.