Directory of Open Access Journals (Sweden)
Li Kelvin
2012-11-01
Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus
An iterative method for selecting degenerate multiplex PCR primers.
Souvenir, Richard; Buhler, Jeremy; Stormo, Gary; Zhang, Weixiong
2007-01-01
Single-nucleotide polymorphism (SNP) genotyping is an important molecular genetics process, which can produce results that will be useful in the medical field. Because of inherent complexities in DNA manipulation and analysis, many different methods have been proposed for a standard assay. One of the proposed techniques for performing SNP genotyping requires amplifying regions of DNA surrounding a large number of SNP loci. To automate a portion of this particular method, it is necessary to select a set of primers for the experiment. Selecting these primers can be formulated as the Multiple Degenerate Primer Design (MDPD) problem. The Multiple, Iterative Primer Selector (MIPS) is an iterative beam-search algorithm for MDPD. Theoretical and experimental analyses show that this algorithm performs well compared with the limits of degenerate primer design. Furthermore, MIPS outperforms an existing algorithm that was designed for a related degenerate primer selection problem.
MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling
Directory of Open Access Journals (Sweden)
Kitchen James L
2012-11-01
Full Text Available Abstract Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.
MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.
Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G
2012-11-05
Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.
Directory of Open Access Journals (Sweden)
Andrés Alvarado
Full Text Available Transmissible plasmids are responsible for the spread of genetic determinants, such as antibiotic resistance or virulence traits, causing a large ecological and epidemiological impact. Transmissible plasmids, either conjugative or mobilizable, have in common the presence of a relaxase gene. Relaxases were previously classified in six protein families according to their phylogeny. Degenerate primers hybridizing to coding sequences of conserved amino acid motifs were designed to amplify related relaxase genes from γ-Proteobacterial plasmids. Specificity and sensitivity of a selected set of 19 primer pairs were first tested using a collection of 33 reference relaxases, representing the diversity of γ-Proteobacterial plasmids. The validated set was then applied to the analysis of two plasmid collections obtained from clinical isolates. The relaxase screening method, which we call "Degenerate Primer MOB Typing" or DPMT, detected not only most known Inc/Rep groups, but also a plethora of plasmids not previously assigned to any Inc group or Rep-type.
MethPrimer: designing primers for methylation PCRs.
Li, Long-Cheng; Dahiya, Rajvir
2002-11-01
DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.
Directory of Open Access Journals (Sweden)
Christopher A Gulvik
Full Text Available Development and use of primer sets to amplify nucleic acid sequences of interest is fundamental to studies spanning many life science disciplines. As such, the validation of primer sets is essential. Several computer programs have been created to aid in the initial selection of primer sequences that may or may not require multiple nucleotide combinations (i.e., degeneracies. Conversely, validation of primer specificity has remained largely unchanged for several decades, and there are currently few available programs that allows for an evaluation of primers containing degenerate nucleotide bases. To alleviate this gap, we developed the program De-MetaST that performs an in silico amplification using user defined nucleotide sequence dataset(s and primer sequences that may contain degenerate bases. The program returns an output file that contains the in silico amplicons. When De-MetaST is paired with NCBI's BLAST (De-MetaST-BLAST, the program also returns the top 10 nr NCBI database hits for each recovered in silico amplicon. While the original motivation for development of this search tool was degenerate primer validation using the wealth of nucleotide sequences available in environmental metagenome and metatranscriptome databases, this search tool has potential utility in many data mining applications.
Garcillán-Barcia, M Pilar; Ruiz del Castillo, Belén; Alvarado, Andrés; de la Cruz, Fernando; Martínez-Martínez, Luis
2015-01-01
Degenerate Primer MOB Typing is a PCR-based protocol for the classification of γ-proteobacterial transmissible plasmids in five phylogenetic relaxase MOB families. It was applied to a multiresistant E. coli collection, previously characterized by PCR-based replicon-typing, in order to compare both methods. Plasmids from 32 clinical isolates of multiresistant E. coli (19 extended spectrum beta-lactamase producers and 13 non producers) and their transconjugants were analyzed. A total of 95 relaxases were detected, at least one per isolate, underscoring the high potential of these strains for antibiotic-resistance transmission. MOBP12 and MOBF12 plasmids were the most abundant. Most MOB subfamilies detected were present in both subsets of the collection, indicating a shared mobilome among multiresistant E. coli. The plasmid profile obtained by both methods was compared, which provided useful data upon which decisions related to the implementation of detection methods in the clinic could be based. The phylogenetic depth at which replicon and MOB-typing classify plasmids is different. While replicon-typing aims at plasmid replication regions with non-degenerate primers, MOB-typing classifies plasmids into relaxase subfamilies using degenerate primers. As a result, MOB-typing provides a deeper phylogenetic depth than replicon-typing and new plasmid groups are uncovered. Significantly, MOB typing identified 17 plasmids and an integrative and conjugative element, which were not detected by replicon-typing. Four of these backbones were different from previously reported elements. Copyright © 2014 Elsevier Inc. All rights reserved.
Digiaro, Michele; Elbeaino, Toufic; Martelli, Giovanni Paolo
2007-04-01
Based on the nucleotide sequence homology of RNA-1 and RNA-2 of nepoviruses isolated from grapevines, three sets of degenerate primers, one for each of the three subgroups of the genus (A, B and C), were designed and proved effective for RT-PCR detection of subgroups in infected grapevines and herbaceous hosts. Primers designed specifically for detecting subgroup A species amplified a fragment of 255 bp from samples infected by Grapevine fanleaf virus (GFLV), Arabis mosaic virus (ArMV), Tobacco ringspot virus (TRSV) and Grapevine deformation virus (GDefV), but not from samples infected by other nepovirus species. Similarly, primers for detection of subgroup B nepoviruses amplified a 390 bp product from samples infected by Grapevine chrome mosaic virus (GCMV), Tomato black ring virus (TBRV), Grapevine Anatolian ringspot virus (GARSV) and Artichoke Italian latent virus (AILV). The third set of primers amplified a 640 bp fragment, only from samples infected by subgroup C nepoviruses, i.e Tomato ringspot virus (ToRSV) Grapevine Bulgarian latent virus (GBLV), and Grapevine Tunisian ringspot virus (GTRSV). These primers were able to detect simultaneously all viral species belonging to the same subgroup and to discriminate species of different subgroups. Multiplex-PCR detection of subgroup A and B nepoviruses was obtained using a specific primer (sense for subgroup A and antisense for subgroup B) for each of the species of the same subgroup in combination with the degenerate subgroup-specific primers. In this way it was possible to detect four different viral species in single samples containing mixtures of viruses of the same subgroup. In particular, for viruses of subgroup A (TRSV, GFLV, ArMV and GDefV) amplicons of 190, 259, 301 and 371 bp were obtained, whereas amplicons of 190, 278, 425 and 485 bp, respectively, were obtained from samples infected with viruses of subgroup B (GCMV, AILV, GARSV and TBRV).
Primer3_masker: integrating masking of template sequence with primer design software.
Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido
2018-06-01
Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.
CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.
Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei
2015-07-01
The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.
UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes
Directory of Open Access Journals (Sweden)
Nomin Batnyam
2012-01-01
Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.
Shen, K A; Meyers, B C; Islam-Faridi, M N; Chin, D B; Stelly, D M; Michelmore, R W
1998-08-01
The recent cloning of genes for resistance against diverse pathogens from a variety of plants has revealed that many share conserved sequence motifs. This provides the possibility of isolating numerous additional resistance genes by polymerase chain reaction (PCR) with degenerate oligonucleotide primers. We amplified resistance gene candidates (RGCs) from lettuce with multiple combinations of primers with low degeneracy designed from motifs in the nucleotide binding sites (NBSs) of RPS2 of Arabidopsis thaliana and N of tobacco. Genomic DNA, cDNA, and bacterial artificial chromosome (BAC) clones were successfully used as templates. Four families of sequences were identified that had the same similarity to each other as to resistance genes from other species. The relationship of the amplified products to resistance genes was evaluated by several sequence and genetic criteria. The amplified products contained open reading frames with additional sequences characteristic of NBSs. Hybridization of RGCs to genomic DNA and to BAC clones revealed large numbers of related sequences. Genetic analysis demonstrated the existence of clustered multigene families for each of the four RGC sequences. This parallels classical genetic data on clustering of disease resistance genes. Two of the four families mapped to known clusters of resistance genes; these two families were therefore studied in greater detail. Additional evidence that these RGCs could be resistance genes was gained by the identification of leucine-rich repeat (LRR) regions in sequences adjoining the NBS similar to those in RPM1 and RPS2 of A. thaliana. Fluorescent in situ hybridization confirmed the clustered genomic distribution of these sequences. The use of PCR with degenerate oligonucleotide primers is therefore an efficient method to identify numerous RGCs in plants.
Grushetskaia, Z E; Lemesh, V A; Khotyleva, L V
2010-01-01
Cellulose synthase catalytic subunit genes, CesA, have been discovered in several higher plant species, and it has been shown that the CesA gene family has multiple members. HVR2 fragment of these genes determine the class specificity of the CESA protein and its participation in the primary or secondary cell wall synthesis. The aim of this study was development of specific and degenerated primers to flax CesA gene fragments leading to obtaining the class specific HVR2 region of the gene. Two pairs of specific primers to the certain fragments of CesA-1 and CesA-6 genes and one pair of degenerated primers to HVR2 region of all flax CesA genes were developed basing on comparison of six CesA EST sequences of flax and full cDNA sequences of Arabidopsis, poplar, maize and cotton plants, obtained from GenBank. After amplification of flax cDNA, the bands of expected size were detected (201 and 300 b.p. for the CesA-1 and CesA-6, and 600 b.p. for the HVR2 region of CesA respectively). The developed markers can be used for cloning and sequencing of flax CesA genes, identifying their number in flax genome, tissue and stage specificity.
Bioinformatic tools for PCR Primer design
African Journals Online (AJOL)
ES
reaction (PCR), oligo hybridization and DNA sequencing. Proper primer design is actually one of the most important factors/steps in successful DNA sequencing. Various bioinformatics programs are available for selection of primer pairs from a template sequence. The plethora programs for PCR primer design reflects the.
VizPrimer: a web server for visualized PCR primer design based on known gene structure.
Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang
2011-12-15
The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.
PHUSER (Primer Help for USER): a novel tool for USER fusion primer design
DEFF Research Database (Denmark)
Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads
2011-01-01
containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (Tm), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers...
MPprimer: a program for reliable multiplex PCR primer design
Directory of Open Access Journals (Sweden)
Wang Xiaolei
2010-03-01
Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.
Bioinformatic tools and guideline for PCR primer design | Abd ...
African Journals Online (AJOL)
Bioinformatics has become an essential tool not only for basic research but also for applied research in biotechnology and biomedical sciences. Optimal primer sequence and appropriate primer concentration are essential for maximal specificity and efficiency of PCR. A poorly designed primer can result in little or no ...
Designing for transportation management and operations : a primer.
2013-02-01
This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...
Real-time PCR (qPCR) primer design using free online software.
Thornton, Brenda; Basu, Chhandak
2011-01-01
Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.
Automated design of degenerate codon libraries.
Mena, Marco A; Daugherty, Patrick S
2005-12-01
Degenerate codon libraries are frequently used in protein engineering and evolution studies but are often limited to targeting a small number of positions to adequately limit the search space. To mitigate this, codon degeneracy can be limited using heuristics or previous knowledge of the targeted positions. To automate design of libraries given a set of amino acid sequences, an algorithm (LibDesign) was developed that generates a set of possible degenerate codon libraries, their resulting size, and their score relative to a user-defined scoring function. A gene library of a specified size can then be constructed that is representative of the given amino acid distribution or that includes specific sequences or combinations thereof. LibDesign provides a new tool for automated design of high-quality protein libraries that more effectively harness existing sequence-structure information derived from multiple sequence alignment or computational protein design data.
UniPrime2: a web service providing easier Universal Primer design.
Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C
2009-07-01
The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.
GST-PRIME: an algorithm for genome-wide primer design.
Leister, Dario; Varotto, Claudio
2007-01-01
The profiling of mRNA expression based on DNA arrays has become a powerful tool to study genome-wide transcription of genes in a number of organisms. GST-PRIME is a software package created to facilitate large-scale primer design for the amplification of probes to be immobilized on arrays for transcriptome analyses, even though it can be also applied in low-throughput approaches. GST-PRIME allows highly efficient, direct amplification of gene-sequence tags (GSTs) from genomic DNA (gDNA), starting from annotated genome or transcript sequences. GST-PRIME provides a customer-friendly platform for automatic primer design, and despite the relative simplicity of the algorithm, experimental tests in the model plant species Arabidopsis thaliana confirmed the reliability of the software. This chapter describes the algorithm used for primer design, its input and output files, and the installation of the standalone package and its use.
Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas
2016-01-01
Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic
Primer sets for cloning the human repertoire of T cell Receptor Variable regions.
Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele
2008-08-29
Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.
PRIMEGENSw3: a web-based tool for high-throughput primer and probe design.
Kushwaha, Garima; Srivastava, Gyan Prakash; Xu, Dong
2015-01-01
Highly specific and efficient primer and probe design has been a major hurdle in many high-throughput techniques. Successful implementation of any PCR or probe hybridization technique depends on the quality of primers and probes used in terms of their specificity and cross-hybridization. Here we describe PRIMEGENSw3, a set of web-based utilities for high-throughput primer and probe design. These utilities allow users to select genomic regions and to design primer/probe for selected regions in an interactive, user-friendly, and automatic fashion. The system runs the PRIMEGENS algorithm in the back-end on the high-performance server with the stored genomic database or user-provided custom database for cross-hybridization check. Cross-hybridization is checked not only using BLAST but also by checking mismatch positions and energy calculation of potential hybridization hits. The results can be visualized online and also can be downloaded. The average success rate of primer design using PRIMEGENSw3 is ~90 %. The web server also supports primer design for methylated sequences, which is used in epigenetic studies. Stand-alone version of the software is also available for download at the website.
Scrimer: designing primers from transcriptome data
Czech Academy of Sciences Publication Activity Database
Mořkovský, Libor; Pačes, Jan; Rídl, Jakub; Reifová, R.
2015-01-01
Roč. 15, č. 6 (2015), s. 1415-1420 ISSN 1755-098X R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 ; RVO:68378050 Keywords : next-generation sequencing * primer design * SNaPshot * SNP genotyping * transcriptome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.298, year: 2015
Shimomura, Yumi; Morimoto, Sho; Hoshino, Yuko Takada; Uchida, Yoshitaka; Akiyama, Hiroko; Hayatsu, Masahito
2012-01-01
Ammonia monooxygenase subunit A gene (amoA) is frequently used as a functional gene marker for diversity analysis of ammonia-oxidizing bacteria (AOB). To select a suitable amoA primer for real-time PCR and PCR-denaturing gradient gel electrophoresis (DGGE), three reverse primers (degenerate primer amoA-2R; non-degenerate primers amoA-2R-GG and amoA-2IR) were examined. No significant differences were observed among the three primers in terms of quantitative values of amoA from environmental samples using real-time PCR. We found that PCR-DGGE analysis with the amoA-2IR primer gave the best results in this studied soil. These results indicate that amoA-2IR is a suitable primer for community analysis of AOB in the environment. PMID:22075625
Disclosing bias in bisulfite assay: MethPrimers underestimate high DNA methylation.
Directory of Open Access Journals (Sweden)
Andrea Fuso
Full Text Available Discordant results obtained in bisulfite assays using MethPrimers (PCR primers designed using MethPrimer software or assuming that non-CpGs cytosines are non methylated versus primers insensitive to cytosine methylation lead us to hypothesize a technical bias. We therefore used the two kinds of primers to study different experimental models and methylation statuses. We demonstrated that MethPrimers negatively select hypermethylated DNA sequences in the PCR step of the bisulfite assay, resulting in CpG methylation underestimation and non-CpG methylation masking, failing to evidence differential methylation statuses. We also describe the characteristics of "Methylation-Insensitive Primers" (MIPs, having degenerated bases (G/A to cope with the uncertain C/U conversion. As CpG and non-CpG DNA methylation patterns are largely variable depending on the species, developmental stage, tissue and cell type, a variable extent of the bias is expected. The more the methylome is methylated, the greater is the extent of the bias, with a prevalent effect of non-CpG methylation. These findings suggest a revision of several DNA methylation patterns so far documented and also point out the necessity of applying unbiased analyses to the increasing number of epigenomic studies.
Suin, Vanessa; Nazé, Florence; Francart, Aurélie; Lamoral, Sophie; De Craeye, Stéphane; Kalai, Michael; Van Gucht, Steven
2014-01-01
A generic two-step lyssavirus real-time reverse transcriptase polymerase chain reaction (qRT-PCR), based on a nested PCR strategy, was validated for the detection of different lyssavirus species. Primers with 17 to 30% of degenerate bases were used in both consecutive steps. The assay could accurately detect RABV, LBV, MOKV, DUVV, EBLV-1, EBLV-2, and ABLV. In silico sequence alignment showed a functional match with the remaining lyssavirus species. The diagnostic specificity was 100% and the sensitivity proved to be superior to that of the fluorescent antigen test. The limit of detection was ≤ 1 50% tissue culture infectious dose. The related vesicular stomatitis virus was not recognized, confirming the selectivity for lyssaviruses. The assay was applied to follow the evolution of rabies virus infection in the brain of mice from 0 to 10 days after intranasal inoculation. The obtained RNA curve corresponded well with the curves obtained by a one-step monospecific RABV-qRT-PCR, the fluorescent antigen test, and virus titration. Despite the presence of degenerate bases, the assay proved to be highly sensitive, specific, and reproducible.
Desingu, P A; Singh, S D; Dhama, K; Kumar, O R Vinodh; Singh, R; Singh, R K
2015-02-01
A rapid and accurate method of detection and differentiation of virulent and avirulent Newcastle disease virus (NDV) pathotypes was developed. The NDV detection was carried out for different domestic avian field isolates and pigeon paramyxo virus-1 (25 field isolates and 9 vaccine strains) by using APMV-I "fusion" (F) gene Class II specific external primer A and B (535bp), internal primer C and D (238bp) based reverses transcriptase PCR (RT-PCR). The internal degenerative reverse primer D is specific for F gene cleavage position of virulent strain of NDV. The nested RT-PCR products of avirulent strains showed two bands (535bp and 424bp) while virulent strains showed four bands (535bp, 424bp, 349bp and 238bp) on agar gel electrophoresis. This is the first report regarding development and use of degenerate primer based nested RT-PCR for accurate detection and differentiation of NDV pathotypes by demonstrating multiple PCR band patterns. Being a rapid, simple, and economical test, the developed method could serve as a valuable alternate diagnostic tool for characterizing NDV isolates and carrying out molecular epidemiological surveillance studies for this important pathogen of poultry. Copyright © 2014 Elsevier B.V. All rights reserved.
Camilo, Cesar M; Lima, Gustavo M A; Maluf, Fernando V; Guido, Rafael V C; Polikarpov, Igor
2016-01-01
Following burgeoning genomic and transcriptomic sequencing data, biochemical and molecular biology groups worldwide are implementing high-throughput cloning and mutagenesis facilities in order to obtain a large number of soluble proteins for structural and functional characterization. Since manual primer design can be a time-consuming and error-generating step, particularly when working with hundreds of targets, the automation of primer design process becomes highly desirable. HTP-OligoDesigner was created to provide the scientific community with a simple and intuitive online primer design tool for both laboratory-scale and high-throughput projects of sequence-independent gene cloning and site-directed mutagenesis and a Tm calculator for quick queries.
A tool for design of primers for microRNA-specific quantitative RT-qPCR. BMC Bioinformatics
DEFF Research Database (Denmark)
Busk, Peter Kamp
2014-01-01
of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed......Background MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come...... at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. Results I have developed the software miRprimer for automatic...
Design of a Percussion and Electric Primer Gun Firing Power Supply
2014-07-01
solenoid failure. As new instrumentation techniques such as high-speed video and laser interferometry have been introduced into our gun testing...to drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks to...drive the solenoid or ignite the primer. This report details the design and construction of the power supplies. 15. SUBJECT TERMS power supply
Primer sets for cloning the human repertoire of T cell Receptor Variable regions
Directory of Open Access Journals (Sweden)
Santoro Claudio
2008-08-01
Full Text Available Abstract Background Amplification and cloning of naïve T cell Receptor (TR repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Results Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT®, the ImMunoGeneTics information system®. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. Conclusion This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.
Directory of Open Access Journals (Sweden)
Vanessa Suin
2014-01-01
Full Text Available A generic two-step lyssavirus real-time reverse transcriptase polymerase chain reaction (qRT-PCR, based on a nested PCR strategy, was validated for the detection of different lyssavirus species. Primers with 17 to 30% of degenerate bases were used in both consecutive steps. The assay could accurately detect RABV, LBV, MOKV, DUVV, EBLV-1, EBLV-2, and ABLV. In silico sequence alignment showed a functional match with the remaining lyssavirus species. The diagnostic specificity was 100% and the sensitivity proved to be superior to that of the fluorescent antigen test. The limit of detection was ≤1 50% tissue culture infectious dose. The related vesicular stomatitis virus was not recognized, confirming the selectivity for lyssaviruses. The assay was applied to follow the evolution of rabies virus infection in the brain of mice from 0 to 10 days after intranasal inoculation. The obtained RNA curve corresponded well with the curves obtained by a one-step monospecific RABV-qRT-PCR, the fluorescent antigen test, and virus titration. Despite the presence of degenerate bases, the assay proved to be highly sensitive, specific, and reproducible.
Design of the Advanced Virgo non-degenerate recycling cavities
International Nuclear Information System (INIS)
Granata, M; Barsuglia, M; Flaminio, R; Freise, A; Hild, S; Marque, J
2010-01-01
Advanced Virgo is the project to upgrade the interferometric gravitational wave detector Virgo, and it foresees the implementation of power and signal non-degenerate recycling cavities. Such cavities suppress the build-up of high order modes of the resonating sidebands, with some advantage for the commissioning of the detector and the build-up of the gravitational signal. Here we present the baseline design of the Advanced Virgo non-degenerate recycling cavities, giving some preliminary results of simulations about the tolerances of this design to astigmatism, mirror figure errors and thermal lensing.
Universal primers that amplify RNA from all three flavivirus subgroups
Directory of Open Access Journals (Sweden)
Barnard Ross T
2008-01-01
Full Text Available Abstract Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5 coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers.
FullSSR: Microsatellite Finder and Primer Designer
Directory of Open Access Journals (Sweden)
Sebastián Metz
2016-01-01
Full Text Available Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user.
Directory of Open Access Journals (Sweden)
Wang Zhen
2011-11-01
Full Text Available Abstract Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs. These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures.
DEFF Research Database (Denmark)
Huang, Yili; Zeng, Yanhua; Lu, Hang
2016-01-01
Seq sequencing of the 16S rRNA, pufM, and bchY genes was carried out to assess the diversity of local phototrophic communities. In addition, we designed new degenerate primers of aerobic cyclase gene acsF, which serves as a convenient marker for both phototrophic Gemmatimonadetes and phototrophic Proteobacteria...... a diverse community of phototrophic Gemmatimonadetes forming 30 operational taxonomic units. These species represented 10.5 and 17.3% of the acsF reads in the upper semiaerobic sediment and anoxic sediment, whereas their abundance in the water column was ... fundamental biological processes on Earth. Recently, the presence of photosynthetic reaction centers has been reported from a rarely studied bacterial phylum, Gemmatimonadetes, but almost nothing is known about the diversity and environmental distribution of these organisms. The newly designed acsF primers...
Directory of Open Access Journals (Sweden)
Laura Audrey Hug
2013-11-01
Full Text Available Reductive dehalogenases are the critical enzymes for anaerobic organohalide respiration, a microbial metabolic process that has been harnessed for bioremediation efforts to resolve chlorinated solvent contamination in groundwater and is implicated in the global halogen cycle. Reductive dehalogenase sequence diversity is informative for the dechlorination potential of the site or enrichment culture. A suite of degenerate PCR primers targeting a comprehensive curated set of reductive dehalogenase genes was designed and applied to twelve DNA samples extracted from contaminated and pristine sites, as well as six enrichment cultures capable of reducing chlorinated compounds to non-toxic end-products. The amplified gene products from four environmental sites and two enrichment cultures were sequenced using Illumina HiSeq, and the reductive dehalogenase complement of each sample determined. The results indicate that the diversity of the reductive dehalogenase gene family is much deeper than is currently accounted for: one-third of the translated proteins have less than 70% pairwise amino acid identity to database sequences. Approximately 60% of the sequenced reductive dehalogenase genes were broadly distributed, being identified in four or more samples, and often in previously sequenced genomes as well. In contrast, 17% of the sequenced reductive dehalogenases were unique, present in only a single sample and bearing less than 90% pairwise amino acid identity to any previously identified proteins. Many of the broadly distributed reductive dehalogenases are uncharacterized in terms of their substrate specificity, making these intriguing targets for further biochemical experimentation. Finally, comparison of samples from a contaminated site and an enrichment culture derived from the same site eight years prior allowed examination of the effect of the enrichment process.
Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.
Yofe, Ido; Schuldiner, Maya
2014-02-01
The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.
Directory of Open Access Journals (Sweden)
Cheng-Hong Yang
Full Text Available BACKGROUND: Complete mitochondrial (mt genome sequencing is becoming increasingly common for phylogenetic reconstruction and as a model for genome evolution. For long template sequencing, i.e., like the entire mtDNA, it is essential to design primers for Polymerase Chain Reaction (PCR amplicons which are partly overlapping each other. The presented chromosome walking strategy provides the overlapping design to solve the problem for unreliable sequencing data at the 5' end and provides the effective sequencing. However, current algorithms and tools are mostly focused on the primer design for a local region in the genomic sequence. Accordingly, it is still challenging to provide the primer sets for the entire mtDNA. METHODOLOGY/PRINCIPAL FINDINGS: The purpose of this study is to develop an integrated primer design algorithm for entire mt genome in general, and for the common primer sets for closely-related species in particular. We introduce ClustalW to generate the multiple sequence alignment needed to find the conserved sequences in closely-related species. These conserved sequences are suitable for designing the common primers for the entire mtDNA. Using a heuristic algorithm particle swarm optimization (PSO, all the designed primers were computationally validated to fit the common primer design constraints, such as the melting temperature, primer length and GC content, PCR product length, secondary structure, specificity, and terminal limitation. The overlap requirement for PCR amplicons in the entire mtDNA is satisfied by defining the overlapping region with the sliding window technology. Finally, primer sets were designed within the overlapping region. The primer sets for the entire mtDNA sequences were successfully demonstrated in the example of two closely-related fish species. The pseudo code for the primer design algorithm is provided. CONCLUSIONS/SIGNIFICANCE: In conclusion, it can be said that our proposed sliding window-based PSO
A web-based adaptive tutor to teach PCR primer design
van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.
2012-01-01
When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used
A Web-based Adaptive Tutor to Teach PCR Primer Design
Seters, van J.R.; Wellink, J.; Tramper, J.; Goedhart, M.J.; Ossevoort, M.A.
2012-01-01
When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used
Specific primer design of mitochondrial 12S rRNA for species identification in raw meats
Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.
2018-01-01
Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.
A Web-Based Adaptive Tutor to Teach PCR Primer Design
van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.
2012-01-01
When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used part of the Taxonomy of Educational Objectives (the…
indCAPS: A tool for designing screening primers for CRISPR/Cas9 mutagenesis events.
Hodgens, Charles; Nimchuk, Zachary L; Kieber, Joseph J
2017-01-01
Genetic manipulation of organisms using CRISPR/Cas9 technology generally produces small insertions/deletions (indels) that can be difficult to detect. Here, we describe a technique to easily and rapidly identify such indels. Sequence-identified mutations that alter a restriction enzyme recognition site can be readily distinguished from wild-type alleles using a cleaved amplified polymorphic sequence (CAPS) technique. If a restriction site is created or altered by the mutation such that only one allele contains the restriction site, a polymerase chain reaction (PCR) followed by a restriction digest can be used to distinguish the two alleles. However, in the case of most CRISPR-induced alleles, no such restriction sites are present in the target sequences. In this case, a derived CAPS (dCAPS) approach can be used in which mismatches are purposefully introduced in the oligonucleotide primers to create a restriction site in one, but not both, of the amplified templates. Web-based tools exist to aid dCAPS primer design, but when supplied sequences that include indels, the current tools often fail to suggest appropriate primers. Here, we report the development of a Python-based, species-agnostic web tool, called indCAPS, suitable for the design of PCR primers used in dCAPS assays that is compatible with indels. This tool should have wide utility for screening editing events following CRISPR/Cas9 mutagenesis as well as for identifying specific editing events in a pool of CRISPR-mediated mutagenesis events. This tool was field-tested in a CRISPR mutagenesis experiment targeting a cytokinin receptor (AHK3) in Arabidopsis thaliana. The tool suggested primers that successfully distinguished between wild-type and edited alleles of a target locus and facilitated the isolation of two novel ahk3 null alleles. Users can access indCAPS and design PCR primers to employ dCAPS to identify CRISPR/Cas9 alleles at http://indcaps.kieber.cloudapps.unc.edu/.
Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory
Elkins, Kelly M.
2011-01-01
The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…
Integrating PCR Theory and Bioinformatics into a Research-oriented Primer Design Exercise
Robertson, Amber L.; Phillips, Allison R.
2008-01-01
Polymerase chain reaction (PCR) is a conceptually difficult technique that embodies many fundamental biological processes. Traditionally, students have struggled to analyze PCR results due to an incomplete understanding of the biological concepts (theory) of DNA replication and strand complementarity. Here we describe the design of a novel research-oriented exercise that prepares students to design DNA primers for PCR. Our exercise design includes broad and specific learning goals and assessm...
Primer design for a prokaryotic differential display RT-PCR.
Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H
1997-05-01
We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.
Bioinformatic tools for PCR Primer design
African Journals Online (AJOL)
ES
Bioinformatics is an emerging scientific discipline that uses information ... complex biological questions. ... and computer programs for various purposes of primer ..... polymerase chain reaction: Human Immunodeficiency Virus 1 model studies.
Tools for Ultraspecific Probe/Primer Design
National Research Council Canada - National Science Library
Fofanov, Yurly
2006-01-01
.... Our approach will deliver DNA probes and PCR primers that have an unprecedentedly low probability of false positives or confusion by environmental background, and which resist evasion by threat agent engineering...
Sequence diversity in haloalkane dehalogenases, as revealed by PCR using family-specific primers
Czech Academy of Sciences Publication Activity Database
Kotík, Michael; Faměrová, Veronika
2012-01-01
Roč. 88, č. 2 (2012), s. 212-217 ISSN 0167-7012 R&D Projects: GA ČR GAP504/10/0137; GA ČR GAP207/10/0135 Institutional research plan: CEZ:AV0Z50200510 Keywords : Dehalogenation * Consensus sequence * Degenerate PCR primer Subject RIV: EE - Microbiology, Virology Impact factor: 2.161, year: 2012
Directory of Open Access Journals (Sweden)
Zuiter Afnan
2012-08-01
Full Text Available Abstract Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.
Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou
2016-11-01
It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.
Directory of Open Access Journals (Sweden)
Dunn Sade N
2008-06-01
Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.
Identification of degenerate nuclei and development of a SCAR marker for Flammulina velutipes.
Directory of Open Access Journals (Sweden)
Sun Young Kim
Full Text Available Flammulina velutipes is one of the major edible mushrooms in the world. Recently, abnormalities that have a negative impact on crop production have been reported in this mushroom. These symptoms include slow vegetative growth, a compact mycelial mat, and few or even no fruiting bodies. The morphologies and fruiting capabilities of monokaryons of wild-type and degenerate strains that arose through arthrospore formation were investigated through test crossing. Only one monokaryotic group of the degenerate strains and its hybrid strains showed abnormal phenotypes. Because the monokaryotic arthrospore has the same nucleus as the parent strain, these results indicated that only one aberrant nucleus of the two nuclei in the degenerate strain was responsible for the degeneracy. A sequence-characterized amplified region marker that is linked to the degenerate monokaryon was identified based on a polymorphic sequence that was generated using random primers. Comparative analyses revealed the presence of a degenerate-specific genomic region in a telomere, which arose via the transfer of a genomic fragment harboring a putative helicase gene. Our findings have narrowed down the potential molecular targets responsible for this phenotype for future studies and have provided a marker for the detection of degenerate strains.
Simple sequence repeat marker loci discovery using SSR primer.
Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David
2004-06-12
Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/
KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz
International Nuclear Information System (INIS)
Bowman, Stephen M.
2008-01-01
The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of
Engqvist, Martin K M; Nielsen, Jens
2015-08-21
The Ambiguous Nucleotide Tool (ANT) is a desktop application that generates and evaluates degenerate codons. Degenerate codons are used to represent DNA positions that have multiple possible nucleotide alternatives. This is useful for protein engineering and directed evolution, where primers specified with degenerate codons are used as a basis for generating libraries of protein sequences. ANT is intuitive and can be used in a graphical user interface or by interacting with the code through a defined application programming interface. ANT comes with full support for nonstandard, user-defined, or expanded genetic codes (translation tables), which is important because synthetic biology is being applied to an ever widening range of natural and engineered organisms. The Python source code for ANT is freely distributed so that it may be used without restriction, modified, and incorporated in other software or custom data pipelines.
Intervertebral disc degeneration in dogs
Bergknut, N.
2011-01-01
Back pain is common in both dogs and humans, and is often associated with intervertebral disc (IVD) degeneration. The IVDs are essential structures of the spine and degeneration can ultimately result in diseases such as IVD herniation or spinal instability. In order to design new treatments halting
Intervertebral disc degeneration in dogs
Bergknut, Niklas
Back pain is common in both dogs and humans, and is often associated with intervertebral disc (IVD) degeneration. The IVDs are essential structures of the spine and degeneration can ultimately result in diseases such as IVD herniation or spinal instability. In order to design new treatments halting
Meglécz, Emese; Costedoat, Caroline; Dubut, Vincent; Gilles, André; Malausa, Thibaut; Pech, Nicolas; Martin, Jean-François
2010-02-01
QDD is an open access program providing a user-friendly tool for microsatellite detection and primer design from large sets of DNA sequences. The program is designed to deal with all steps of treatment of raw sequences obtained from pyrosequencing of enriched DNA libraries, but it is also applicable to data obtained through other sequencing methods, using FASTA files as input. The following tasks are completed by QDD: tag sorting, adapter/vector removal, elimination of redundant sequences, detection of possible genomic multicopies (duplicated loci or transposable elements), stringent selection of target microsatellites and customizable primer design. It can treat up to one million sequences of a few hundred base pairs in the tag-sorting step, and up to 50,000 sequences in a single input file for the steps involving estimation of sequence similarity. QDD is freely available under the GPL licence for Windows and Linux from the following web site: http://www.univ-provence.fr/gsite/Local/egee/dir/meglecz/QDD.html. Supplementary data are available at Bioinformatics online.
Directory of Open Access Journals (Sweden)
Ni Luh Putu Indi Dharmayanti
2016-07-01
Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.
Directory of Open Access Journals (Sweden)
Fernando L. Mantelatto
Full Text Available Abstract We designed 14 new primers for amplification of the COI barcode region of decapod crustacean species. We tested, with high level of success, the generation of ~ 640 ± 49 base-pair sequences in selected groups of decapods (hermit crabs, squat lobsters, marine and freshwater crabs and shrimps, encompassing representatives of 27 genera of 15 families, 11 of Pleocyemata (Anomura, Brachyura, and Caridea and 4 of Dendrobranchiata. Based on the results we expect the applicability of these primers for several studies with different taxa within Decapoda.
Couillerot, O; Poirier, M-A; Prigent-Combaret, C; Mavingui, P; Caballero-Mellado, J; Moënne-Loccoz, Y
2010-08-01
To assess the applicability of sequence characterized amplified region (SCAR) markers obtained from BOX, ERIC and RAPD fragments to design primers for real-time PCR quantification of the phytostimulatory maize inoculants Azospirillum brasilense UAP-154 and CFN-535 in the rhizosphere. Primers were designed based on strain-specific SCAR markers and were screened for successful amplification of target strain and absence of cross-reaction with other Azospirillum strains. The specificity of primers thus selected was verified under real-time PCR conditions using genomic DNA from strain collection and DNA from rhizosphere samples. The detection limit was 60 fg DNA with pure cultures and 4 x 10(3) (for UAP-154) and 4 x 10(4) CFU g(-1) (for CFN-535) in the maize rhizosphere. Inoculant quantification was effective from 10(4) to 10(8) CFU g(-1) soil. BOX-based SCAR markers were useful to find primers for strain-specific real-time PCR quantification of each A. brasilense inoculant in the maize rhizosphere. Effective root colonization is a prerequisite for successful Azospirillum phytostimulation, but cultivation-independent monitoring methods were lacking. The real-time PCR methods developed here will help understand the effect of environmental conditions on root colonization and phytostimulation by A. brasilense UAP-154 and CFN-535.
KENO V.a Primer: A Primer for Criticality Calculations with SCALE/KENO V.a Using CSPAN for Input
International Nuclear Information System (INIS)
Busch, R.D.
2003-01-01
The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory (ORNL) is widely used and accepted around the world for criticality safety analyses. The well-known KENO V.a three-dimensional Monte Carlo criticality computer code is the primary criticality safety analysis tool in SCALE. The KENO V.a primer is designed to help a new user understand and use the SCALE/KENO V.a Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO V.a in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO V.a that are useful in criticality analyses. The primer is based on SCALE 4.4a, which includes the Criticality Safety Processor for Analysis (CSPAN) input processor for Windows personal computers (PCs). A second edition of the primer, which uses the new KENO Visual Editor, is currently under development at ORNL and is planned for publication in late 2003. Each example in this first edition of the primer uses CSPAN to provide the framework for data input. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO V.a input and allows the user to quickly run a simple criticality problem with SCALE/KENO V.a. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO V.a features which are covered in detail in the example problems in that section. Upon completion of the primer, a new user should be comfortable using CSPAN to set up criticality problems in SCALE/KENO V.a
Multiplexing Short Primers for Viral Family PCR
Energy Technology Data Exchange (ETDEWEB)
Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W
2008-06-26
We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.
RUCS: Rapid identification of PCR primers for unique core sequences
DEFF Research Database (Denmark)
Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik
2017-01-01
Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...
A database of PCR primers for the chloroplast genomes of higher plants
Heinze, Berthold
2007-01-01
Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny) or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species). The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata). Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution. PMID:17326828
A database of PCR primers for the chloroplast genomes of higher plants
Directory of Open Access Journals (Sweden)
Heinze Berthold
2007-02-01
Full Text Available Abstract Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species. The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata. Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution.
Shinohara, Ayano; Taira, Yohsuke; Sakihara, Michino; Sawase, Takashi
2018-01-01
Objective The objective of this study was to evaluate the effects of combinations of silane primers and adhesive agents on the bond strength of a composite block for a computer-aided design and manufacturing system. Material and Methods Three silane primers [Clearfil Ceramic Primer (CP), Super-Bond PZ Primer (PZ), and GC Ceramic Primer II (GP)] were used in conjunction with five adhesive agents [G-Premio Bond (P-Bond), Repair Adhe Adhesive (R-Adhesive), Super-Bond D-Liner Dual (SB-Dual), Super-Bond C&B (SB-Self), and SB-Dual without tributylborane derivative (SB-Light)]. The surface of a composite block (Gradia Block) was ground with silicon carbide paper. After treatment with a silane primer, a adhesive agent was applied to each testing specimen. The specimens were then bonded with a light-curing resin composite. After 24 h, the shear bond strength values were determined and compared using a post hoc test (α=0.05, n=8/group). We also prepared control specimens without primer (No primer) and/or without adhesive agent (No adhesive). Results PZ/SB-Dual and GP/SB-Dual presented the highest bond strength, followed by GP/P-Bond, CP/SB-Dual, CP/R-Adhesive, No primer/SB-Dual, GP/R-Adhesive, CP/P-Bond, No primer/R-Adhesive, PZ/R-Adhesive, CP/SB-Self, PZ/P-Bond, PZ/SB-Self, and GP/SB-Self in descending order of bond strength. No primer/P-Bond, No primer/SB-Self, and all specimens in the SB-Light and No adhesive groups presented the lowest bond strengths. Conclusion A dual-curing adhesive agent (SB-Dual) containing a tributylborane derivative in combination with a silane primer (GP or PZ) presents a greater bond strength between the composite block and the repairing resin composite than the comparators used in the study.
International Nuclear Information System (INIS)
Flude, J.W.; Nicholas, J.R.
1991-04-01
This Predictive Maintenance Primer provides utility plant personnel with a single-source reference to predictive maintenance analysis methods and technologies used successfully by utilities and other industries. It is intended to be a ready reference to personnel considering starting, expanding or improving a predictive maintenance program. This Primer includes a discussion of various analysis methods and how they overlap and interrelate. Additionally, eighteen predictive maintenance technologies are discussed in sufficient detail for the user to evaluate the potential of each technology for specific applications. This document is designed to allow inclusion of additional technologies in the future. To gather the information necessary to create this initial Primer the Nuclear Maintenance Applications Center (NMAC) collected experience data from eighteen utilities plus other industry and government sources. NMAC also contacted equipment manufacturers for information pertaining to equipment utilization, maintenance, and technical specifications. The Primer includes a discussion of six methods used by analysts to study predictive maintenance data. These are: trend analysis; pattern recognition; correlation; test against limits or ranges; relative comparison data; and statistical process analysis. Following the analysis methods discussions are detailed descriptions for eighteen technologies analysts have found useful for predictive maintenance programs at power plants and other industrial facilities. Each technology subchapter has a description of the operating principles involved in the technology, a listing of plant equipment where the technology can be applied, and a general description of the monitoring equipment. Additionally, these descriptions include a discussion of results obtained from actual equipment users and preferred analysis techniques to be used on data obtained from the technology. 5 refs., 30 figs
Hu, Hui; Jung, Kwonil; Wang, Qiuhong; Saif, Linda J; Vlasova, Anastasia N
2018-06-01
Coronaviruses (CoVs) are critical human and animal pathogens because of their potential to cause severe epidemics of respiratory or enteric diseases. In pigs, the newly emerged porcine deltacoronavirus (PDCoV) and re-emerged porcine epidemic diarrhea virus (PEDV) reported in the US and Asia, as well as the discovery of novel CoVs in wild bats or birds, has necessitated development of improved detection and control measures for these CoVs. Because the previous pancoronavirus (panCoV) RT-PCR established in our laboratory in 2007-2011 did not detect deltacoronaviruses (δ-CoVs) in swine fecal and serum samples, our goal was to develop a new panCoV RT-PCR assay to detect known human and animal CoVs, including δ-CoVs. In this study, we designed a new primer set to amplify a 668 bp-region within the RNA-dependent RNA polymerase (RdRP) gene that encodes the most conserved protein domain of α-, β-, γ-, and δ-CoVs. We established a one-step panCoV RT-PCR assay and standardized the assay conditions. The newly established panCoV RT-PCR assay was demonstrated to have a high sensitivity and specificity. Using a panel of 60 swine biological samples (feces, intestinal contents, and sera) characterized by PEDV, PDCoV and transmissible gastroenteritis virus-specific RT-PCR assays, we demonstrated that sensitivity and specificity of the newly established panCoV RT-PCR assay were 100%. 400 avian fecal (RNA) samples were further tested simultaneously for CoV by the new panCoV RT-PCR and a one-step RT-PCR assay with the δ-CoV nucleocapsid-specific universal primers. Four of 400 avian samples were positive for CoV, three of which were positive for δ-CoV by the conventional RT-PCR. PanCoV RT-PCR fragments for 3 of the 4 CoVs were sequenced. Phylogenetic analysis revealed the presence of one γ-CoV and two δ-CoV in the sequenced samples. The newly designed panCoV RT-PCR assay should be useful for the detection of currently known CoVs in animal biological samples. Copyright © 2018
Mohan, S.B.; Schmid, M.C.; Jetten, M.S.M.; Cole, J.
2004-01-01
Degenerate primers to detect nrfA were designed by aligning six nrfA sequences including Escherichia coli K-12, Sufurospirillum deleyianum and Wolinella succinogenes. These primers amplified a 490 by fragment of nrfA. The ability of these primers to detect nrfA was tested with chromosomal DNA
Yetter, Carol J.
2009-01-01
This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…
Burns, Cara C; Kilpatrick, David R; Iber, Jane C; Chen, Qi; Kew, Olen M
2016-01-01
Virologic surveillance is essential to the success of the World Health Organization initiative to eradicate poliomyelitis. Molecular methods have been used to detect polioviruses in tissue culture isolates derived from stool samples obtained through surveillance for acute flaccid paralysis. This chapter describes the use of realtime PCR assays to identify and serotype polioviruses. In particular, a degenerate, inosine-containing, panpoliovirus (panPV) PCR primer set is used to distinguish polioviruses from NPEVs. The high degree of nucleotide sequence diversity among polioviruses presents a challenge to the systematic design of nucleic acid-based reagents. To accommodate the wide variability and rapid evolution of poliovirus genomes, degenerate codon positions on the template were matched to mixed-base or deoxyinosine residues on both the primers and the TaqMan™ probes. Additional assays distinguish between Sabin vaccine strains and non-Sabin strains. This chapter also describes the use of generic poliovirus specific primers, along with degenerate and inosine-containing primers, for routine VP1 sequencing of poliovirus isolates. These primers, along with nondegenerate serotype-specific Sabin primers, can also be used to sequence individual polioviruses in mixtures.
Criticality calculations with MCNP trademark: A primer
International Nuclear Information System (INIS)
Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.
1994-01-01
With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand
Polyacid macromolecule primers
Sugama, Toshifumi.
1989-12-26
Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.
Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples.
Zuntini, Alexandre R; Fonseca, Luiz Henrique M; Lohmann, Lúcia G
2013-09-01
New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. • Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. • The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.
GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.
Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart
2011-01-01
The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.
Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples
Directory of Open Access Journals (Sweden)
Alexandre R. Zuntini
2013-08-01
Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.
Beneath sci-fi sound: primer, science fiction sound design, and American independent cinema
Johnston, Nessa
2012-01-01
Primer is a very low budget science-fiction film that deals with the subject of time travel; however, it looks and sounds quite distinctively different from other films associated with the genre. While Hollywood blockbuster sci-fi relies on “sound spectacle” as a key attraction, in contrast Primer sounds “lo-fi” and screen-centred, mixed to two channel stereo rather than the now industry-standard 5.1 surround sound. Although this is partly a consequence of the economics of its production, the...
Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.
Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela
2014-08-01
Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.
Sánchez-Seco, María-Paz; Echevarría, José-Manuel; Hernández, Lourdes; Estévez, Domingo; Navarro-Marí, José-María; Tenorio, Antonio
2003-09-01
Phleboviruses are a large and widespread group of viruses that are transmitted by arthropods. Toscana virus is one of the principal agents that causes meningitis in humans during the summer in Italy and, possibly, in other Mediterranean countries. Rift Valley Fever virus can cause serious illness in both animals and humans, leading to high morbidity and mortality, and is considered to be a potential agent for epizootics and human epidemics. Since information on this group of viruses is still scant, reliable laboratory tools for diagnosis and epidemiological surveillance must be developed, in order to ascertain their real impact on Public Health. Sequence data obtained from Spanish isolates of Toscana virus and other phleboviruses confirmed that natural genome variability may hamper the diagnosis of these agents by molecular methods, so this must be borne in mind when developing reliable assays. In view of the above, a novel and useful protocol has been developed for the detection and specific identification of every member of the phlebovirus genus present in a sample, including Toscana virus, based on a generic RT-nested-PCR, followed by sequencing of the amplified fragment. A change in this method also allowed specific direct detection and identification of wild isolates of Toscana virus of different geographical origin, using newly designed primers. Testing clinical samples with these assays confirmed the role of Toscana virus as an agent that causes acute aseptic meningitis in the central region of Spain. Copyright 2003 Wiley-Liss, Inc.
Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok
2018-03-01
We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.
Low-copy nuclear primers and ycf1 primers in Cactaceae.
Franck, Alan R; Cochrane, Bruce J; Garey, James R
2012-10-01
To increase the number of variable regions available for phylogenetic study in the Cactaceae, primers were developed for a portion of the plastid ycf1 gene and intron-spanning regions of two low-copy nuclear genes (isi1, nhx1). • Primers were tested on several families within Caryophyllales, focusing on the Cactaceae. Gel electrophoresis indicated positive amplification in most samples. Sequences of these three regions (isi1, nhx1, ycf1) from Harrisia exhibited variation similar to or greater than two plastid regions (atpB-rbcL intergenic spacer and rpl16 intron). • The isi, nhx, and ycf1 primers amplify phylogenetically useful information applicable to the Cactaceae and other families in the Caryophyllales.
[Design of primers to DNA of lactic acid bacteria].
Lashchevskiĭ, V V; Kovalenko, N K
2003-01-01
Primers LP1-LP2 to the gene 16S rRNA have been developed, which permit to differentiate lactic acid bacteria: Lactobacillus plantarum, L. delbrueckii subsp. bulgaricus and Streptococcus salivarius subsp. thermophilus. The strain-specific and species-specific differentiations are possible under different annealing temperature. Additional fragments, which are synthesized outside the framework of gene 16S rRNA reading, provide for the strain-specific type of differentiation, and the fragment F864 read in the gene 16S rRNA permits identifying L. plantarum.
Energy Technology Data Exchange (ETDEWEB)
Dan Arthur; Bruce Langhus; Jon Seekins
2005-05-25
During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of
Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G
2017-02-01
To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.
Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.
Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis
2018-03-01
Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.
Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen
2015-09-01
Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.
Directory of Open Access Journals (Sweden)
Wang Xiaowei
2008-12-01
Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.
Wang, Yong
2009-10-09
Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.
Ferchichi, M; Valcheva, R; Prévost, H; Onno, B; Dousset, X
2008-06-01
Species-specific primers targeting the 16S-23S ribosomal DNA (rDNA) intergenic spacer region (ISR) were designed to rapidly discriminate between Lactobacillus mindensis, Lactobacillus panis, Lactobacillus paralimentarius, Lactobacillus pontis and Lactobacillus frumenti species recently isolated from French sourdough. The 16S-23S ISRs were amplified using primers 16S/p2 and 23S/p7, which anneal to positions 1388-1406 of the 16S rRNA gene and to positions 207-189 of the 23S rRNA gene respectively, Escherichia coli numbering (GenBank accession number V00331). Clone libraries of the resulting amplicons were constructed using a pCR2.1 TA cloning kit and sequenced. Species-specific primers were designed based on the sequences obtained and were used to amplify the 16S-23S ISR in the Lactobacillus species considered. For all of them, two PCR amplicons, designated as small ISR (S-ISR) and large ISR (L-ISR), were obtained. The L-ISR is composed of the corresponding S-ISR, interrupted by a sequence containing tRNA(Ile) and tRNA(Ala) genes. Based on these sequences, species-specific primers were designed and proved to identify accurately the species considered among 30 reference Lactobacillus species tested. Designed species-specific primers enable a rapid and accurate identification of L. mindensis, L. paralimentarius, L. panis, L. pontis and L. frumenti species among other lactobacilli. The proposed method provides a powerful and convenient means of rapidly identifying some sourdough lactobacilli, which could be of help in large starter culture surveys.
Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.
Françoso, E; Arias, M C
2013-09-01
Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.
Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.
2012-01-01
DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820
Gamper, H.A.; Leuchtmann, A.
2007-01-01
Taxon-specific polymerase chain reaction (PCR) primers enable detection of arbuscular mycorrhizal fungi (AMF, Glomeromycota) in plant roots where the fungi lack discriminative morphological and biochemical characters. We designed and validated pairs of new PCR primers targeted to the flanking
Targeted reduction of highly abundant transcripts using pseudo-random primers.
Arnaud, Ophélie; Kato, Sachi; Poulain, Stéphane; Plessy, Charles
2016-04-01
Transcriptome studies based on quantitative sequencing can estimate levels of gene expression by measuring target RNA abundance in sequencing libraries. Sequencing costs are proportional to the total number of sequenced reads, and in order to cover rare RNAs, considerable quantities of abundant and identical reads are needed. This major limitation can be addressed by depleting a proportion of the most abundant sequences from the library. However, such depletion strategies involve either extra handling of the input RNA sample or use of a large number of reverse transcription primers, termed not-so-random (NSR) primers, which are costly to synthesize. Taking advantage of the high tolerance of reverse transcriptase to mis-prime, we found that it is possible to use as few as 40 pseudo-random (PS) reverse transcription primers to decrease the rate of undesirable abundant sequences within a library without affecting the overall transcriptome diversity. PS primers are simple to design and can be used to deplete several undesirable RNAs simultaneously, thus creating a flexible tool for enriching transcriptome libraries for rare transcript sequences.
... macula in the back of the eye. The macula is important for clear central vision, allowing an individual to see fine details. There are two types of macular degeneration, dry and wet. Dry macular degeneration is more ...
30 CFR 56.6304 - Primer protection.
2010-07-01
... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives...
Comparison of shear bond strength of orthodontic brackets using various zirconia primers.
Lee, Ji-Yeon; Kim, Jin-Seok; Hwang, Chung-Ju
2015-07-01
The aim of this study was to compare the shear bond strength (SBS) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer, and subjected to thermocycling. We designed 10 experimental groups following the surface treatment and thermocycling. The surface was treated with one of the following method: no-primer (NP), Porcelain Conditioner (PC), Z-PRIME Plus (ZP), Monobond Plus (MP) and Zirconia Liner Premium (ZL) (n=20). Then each group was subdivided to non-thermocycled and thermocycled groups (NPT, PC, ZPT, MPT, ZLT) (n=10). Orthodontic brackets were bonded to the specimens using Transbond™ XT Paste and light cured for 15 s at 1,100 mW/cm(2). The SBS was measured at a 1 mm/min crosshead speed. The failure mode was assessed by examination with a stereomicroscope and the amount of bonding resin remaining on the zirconia surface was scored using the modified adhesive remnant index (ARI). The SBS of all experimental groups decreased after thermocycling. Before thermocycling, the SBS was ZL, ZP ≥ MP ≥ PC > NP but after thermocycling, the SBS was ZLT ≥ MPT ≥ ZPT > PCT = NPT (p > 0.05). For the ARI score, both of the groups lacking primer (NP and NPT) displayed adhesive failure modes, but the groups with zirconia primers (ZP, ZPT, MP, MPT, ZL, and ZLT) were associated with mixed failure modes. Surface treatment with a zirconia primer increases the SBS relative to no-primer or silane primer application between orthodontic brackets and zirconia prostheses.
MR imaging of central nervous system white matter tract degeneration (Wallerian degeneration)
International Nuclear Information System (INIS)
Kuhn, M.J.; Johnson, K.A.; Davis, K.R.
1987-01-01
Wallerian degeneration is readily demonstrated by MR imaging. Twenty-one patients with MR signal abnormalities in various central nervous system (CNS) white matter tracts were evaluated with regard to (1) nature of signal abnormality, (2) MR anatomy of the involved tract, and (3) primary pathology (e.g., infarct, tumor, hemorrhage). Most examples of wallerian degeneration result in a thin, continuous band of long T1, long T2 signal abnormality conforming to the known anatomic pathway of a CNS axonal tract. Old, large cortical infarcts have the greatest propensity to show subsequent white-matter tract degeneration. Corticospinal tract degeneration is the type most readily visualized, often seen extending completely from the cerebral cortex through the medulla
Directory of Open Access Journals (Sweden)
Amanda eMartino
2012-01-01
Full Text Available A degenerate PCR-based method of whole-genome amplification, designed to work fluidly with 454 sequencing technology, was developed and tested for use on deep marine subsurface DNA samples. The method, which we have called Random Amplification Metagenomic PCR (RAMP, involves the use of specific primers from Roche 454 amplicon sequencing, modified by the addition of a degenerate region at the 3’ end. It utilizes a PCR reaction, which resulted in no amplification from blanks, even after 50 cycles of PCR. After efforts to optimize experimental conditions, the method was tested with DNA extracted from cultured E. coli cells, and genome coverage was estimated after sequencing on three different occasions. Coverage did not vary greatly with the different experimental conditions tested, and was around 62% with a sequencing effort equivalent to a theoretical genome coverage of 14.10X. The GC content of the sequenced amplification product was within 2% of the predicted values for this strain of E. coli. The method was also applied to DNA extracted from marine subsurface samples from ODP Leg 201 site 1229 (Peru Margin, and results of a taxonomic analysis revealed microbial communities dominated by Proteobacteria, Chloroflexi, Firmicutes, Euryarchaeota, and Crenarchaeota, among others. These results were similar to those obtained previously for those samples; however, variations in the proportions of taxa show that community analysis can be sensitive to both the amplification technique used and the method of assigning sequences to taxonomic groups. Overall, we find that RAMP represents a valid methodology for amplifying metagenomes from low biomass samples.
Bioinspired Catecholic Primers for Rigid and Ductile Dental Resin Composites.
Shin, Eeseul; Ju, Sung Won; An, Larry; Ahn, Eungjin; Ahn, Jin-Soo; Kim, Byeong-Su; Ahn, B Kollbe
2018-01-17
In the construction of dental restorative polymer composite materials, surface priming on mineral fillers is essential to improve the mechanical performance of the composites. Here we present bioinspired catechol-functionalized primers for a tougher dental resin composite containing glass fillers. The catecholic primers with different polymerizable end groups were designed and then coated on glass surfaces using a simple drop-casting or dip-coating process. The surface binding ability and possible cross-linking (coupling or chemical bridging between the glass substrate and the dental resin) of the catecholic bifunctional primers were evaluated using atomic force microscopy, contact angle measurements, and the knife shear bonding test and compared to a state-of-the-art silane-based coupling agent. Various mechanical tests including shrinkage and compression tests of the dental resin composites were also conducted. Compression tests of the composites containing the catecholic primed fillers exhibited enhanced mechanical properties, owing to the bidentate hydrogen bonding of catechol moieties to the oxide mineral surface. Furthermore, the superior biocompatibility of the primed surface was confirmed via cell attachment assay, thus providing applicability of catecholic primers for practical dental and biomedical applications.
What Is Age-Related Macular Degeneration?
... Eye Health / Eye Health A-Z Age-Related Macular Degeneration Sections What Is Macular Degeneration? How is AMD ... What Does Macular Degeneration Look Like? What Is Macular Degeneration? Leer en Español: ¿Qué es la degeneración macular ...
2006-01-01
The author develops a deformation theory for degenerations of complex curves; specifically, he treats deformations which induce splittings of the singular fiber of a degeneration. He constructs a deformation of the degeneration in such a way that a subdivisor is "barked" (peeled) off from the singular fiber. These "barking deformations" are related to deformations of surface singularities (in particular, cyclic quotient singularities) as well as the mapping class groups of Riemann surfaces (complex curves) via monodromies. Important applications, such as the classification of atomic degenerations, are also explained.
Directory of Open Access Journals (Sweden)
Christopher Ryan Penton
2013-09-01
Full Text Available Targeting sequencing to genes involved in key environmental processes, i.e. ecofunctional genes, provides an opportunity to sample nature’s gene guilds to greater depth and help link community structure to process-level outcomes. Vastly different approaches have been implemented for sequence processing and, ultimately, for taxonomic placement of these gene reads. The overall quality of next generation sequence analysis of functional genes is dependent on multiple steps and assumptions of unknown diversity. To illustrate current issues surrounding amplicon read processing we provide examples for three ecofunctional gene groups. A combination of in-silico, environmental and cultured strain sequences was used to test new primers targeting the dioxin and dibenzofuran degrading genes dxnA1, dbfA1, and carAa. The majority of obtained environmental sequences were classified into novel sequence clusters, illustrating the discovery value of the approach. For the nitrite reductase step in denitrification, the well-known nirK primers exhibited deficiencies in reference database coverage, illustrating the need to refine primer-binding sites and/or to design multiple primers, while nirS primers exhibited bias against five phyla. Amino acid-based OTU clustering of these two N-cycle genes from soil samples yielded only 114 unique nirK and 45 unique nirS genus-level groupings, likely a reflection of constricted primer coverage. Finally, supervised and non-supervised OTU analysis methods were compared using the nifH gene of nitrogen fixation, with generally similar outcomes, but the clustering (non-supervised method yielded higher diversity estimates and stronger site-based differences. High throughput amplicon sequencing can provide inexpensive and rapid access to nature’s related sequences by circumventing the culturing barrier, but each unique gene requires individual considerations in terms of primer design and sequence processing and classification.
Degenerate pressure driven modified nucleus-acoustic waves in degenerate plasmas
Mamun, A. A.
2018-02-01
The existence of degenerate pressure driven modified nucleus-acoustic (DPDMNA) waves propagating in a cold degenerate quantum plasma (DQP) system [containing cold inertialess degenerate electron species (DES), cold inertial non-degenerate light nucleus species (LNS), and stationary heavy nucleus species (HNS)] is predicted for the first time. The DPDMNA waves (in which the mass density of the cold LNS provides the inertia and the cold inertialess DES gives rise to the restoring force) are new since they completely disappear if the degenerate pressure of the cold DES is neglected. It is found that the phase speed (Vp) of the DPDMNA waves decreases with the rise of the charge number density of the stationary HNS for both non-relativistic and ultra-relativistic DES, and that the ultra-relativistic DES does not have any effect on Vp when β = 1, where β = Λc/Λe with Λ e = ne 0 - 1 / 3 being the average inter-electron distance in the DQP system and Λc being the constant (˜10-10 cm) for the DES. However, the ultra-relativistic DES does have quite a significant effect on Vp for β ≫ 1 and β ≪ 1, and the ultra-relativistic effect significantly enhances (reduces) Vp for β ≫ 1 (β ≪ 1). The DPDMNA waves and their dispersion properties are expected to be useful in understanding the basic features of the electrostatic perturbation mode in space and laboratory DQP systems.
Li, Bing-Bing; Cheng, Yuan-Yuan; Fan, Yang-Yang; Liu, Dong-Feng; Fang, Cai-Yun; Wu, Chao; Li, Wen-Wei; Yang, Zong-Chuang; Yu, Han-Qing
2018-05-12
Shewanella species have a diverse respiratory ability and wide distribution in environments and play an important role in bioremediation and the biogeochemical cycles of elements. Primers with more accuracy and broader coverage are required with consideration of the increasing number of Shewanella species and evaluation of their roles in various environments. In this work, a new primer set of 640F/815R was developed to quantify the abundance of Shewanella species in natural and engineered environments. In silico tools for primer evaluation, quantitative polymerase chain reaction (qPCR) and clone library results showed that 640F/815R had a higher specificity and coverage than the previous primers in quantitative analysis of Shewanella. Another newly developed primer pair of 211F/815cR was also adopted to analyze the Shewanella diversity and demonstrated to be the best candidate in terms of specificity and coverage. We detected more Shewanella-related species in freshwater environments and found them to be substantially different from those in marine environments. Abundance and diversity of Shewanella species in wastewater treatment plants were largely affected by the process and operating conditions. Overall, this study suggests that investigations of abundance and diversity of Shewanella in various environments are of great importance to evaluate their ecophysiology and potential ecological roles. Copyright © 2018 Elsevier B.V. All rights reserved.
Automated imaging dark adaptometer for investigating hereditary retinal degenerations
Azevedo, Dario F. G.; Cideciyan, Artur V.; Regunath, Gopalakrishnan; Jacobson, Samuel G.
1995-05-01
We designed and built an automated imaging dark adaptometer (AIDA) to increase accuracy, reliability, versatility and speed of dark adaptation testing in patients with hereditary retinal degenerations. AIDA increases test accuracy by imaging the ocular fundus for precise positioning of bleaching and stimulus lights. It improves test reliability by permitting continuous monitoring of patient fixation. Software control of stimulus presentation provides broad testing versatility without sacrificing speed. AIDA promises to facilitate the measurement of dark adaptation in studies of the pathophysiology of retinal degenerations and in future treatment trials of these diseases.
Structure of Hepatitis C Virus Polymerase in Complex with Primer-Template RNA
Energy Technology Data Exchange (ETDEWEB)
Mosley, Ralph T.; Edwards, Thomas E.; Murakami, Eisuke; Lam, Angela M.; Grice, Rena L.; Du, Jinfa; Sofia, Michael J.; Furman, Philip A.; Otto, Michael J. (Pharmasset); (Emerald)
2012-08-01
The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory {beta}-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesis at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory {beta}-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus.
The UVM primer a step-by-step introduction to the universal verification methodology
Salemi, Ray
2013-01-01
The UVM Primer uses simple, runnable code examples, accessible analogies, and an easy-to-read style to introduce you to the foundation of the Universal Verification Methodology. You will learn the basics of object-oriented programming with SystemVerilog and build upon that foundation to learn how to design testbenches using the UVM. Use the UVM Primer to brush up on your UVM knowledge before a job interview to be able to confidently answer questions such as "What is a uvm_agent?" , "How do you use uvm_sequences?", and "When do you use the UVM's factory." The UVM Primer's downloadable code examples give you hands-on experience with real UVM code. Ray Salemi uses online videos (on www.uvmprimer.com) to walk through the code from each chapter and build your confidence. Read The UVM Primer today and start down the path to the UVM.
Serber, Robert
2018-01-01
Unabridged declassified value reproduction of The Los Alamos Primer by Robert Serber, in full color with all censor markings. This is the booklet given to new workers at Los Alamos during World War II, to catch them up on how to build a practical fission bomb. The Primer was driven by Robert Oppenheimer asking his protégé Robert Serber to summarize all knowledge and possible solutions known as of April 1943 in a series of lectures. Serber did such an excellent job that the notes from the series was turned into The Los Alamos Primer. Serber was known as an expert that bridged theory and reality, and so was also chosen to be one of the first Americans to enter Hiroshima and Nagasaki to assess the atomic damage in 1945.
Peripheral retinal degenerations and the risk of retinal detachment.
Lewis, Hilel
2003-07-01
To review the degenerative diseases of the peripheral retina in relationship with the risk to develop a rhegmatogenous retinal detachment and to present recommendations for use in eyes at increased risk of developing a retinal detachment. Focused literature review and author's clinical experience. Retinal degenerations are common lesions involving the peripheral retina, and most of them are clinically insignificant. Lattice degeneration, degenerative retinoschisis, cystic retinal tufts, and, rarely, zonular traction tufts, can result in a rhegmatogenous retinal detachment. Therefore, these lesions have been considered for prophylactic therapy; however, adequate studies have not been performed to date. Well-designed, prospective, randomized clinical studies are necessary to determine the benefit-risk ratio of prophylactic treatment. In the meantime, the evidence available suggests that most of the peripheral retinal degenerations should not be treated except in rare, high-risk situations.
DEFF Research Database (Denmark)
Lund, Anders Henrik; Duch, M; Lovmand, J
1997-01-01
, but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology....
Software-Supported USER Cloning Strategies for Site-Directed Mutagenesis and DNA Assembly
DEFF Research Database (Denmark)
Genee, Hans Jasper; Bonde, Mads Tvillinggaard; Bagger, Frederik Otzen
2015-01-01
USER cloning is a fast and versatile method for engineering of plasmid DNA. We have developed a user friendly Web server tool that automates the design of optimal PCR primers for several distinct USER cloning-based applications. Our Web server, named AMUSER (Automated DNA Modifications with USER...... cloning), facilitates DNA assembly and introduction of virtually any type of site-directed mutagenesis by designing optimal PCR primers for the desired genetic changes. To demonstrate the utility, we designed primers for a simultaneous two-position site-directed mutagenesis of green fluorescent protein...... (GFP) to yellow fluorescent protein (YFP), which in a single step reaction resulted in a 94% cloning efficiency. AMUSER also supports degenerate nucleotide primers, single insert combinatorial assembly, and flexible parameters for PCR amplification. AMUSER is freely available online at ....
Designing of primers for detection of salmonella typhimirium and enteritidis by heminested PCR
International Nuclear Information System (INIS)
Ben salem, Issam
2007-01-01
Salmonella are the main responsible agent for the frequent food borne gastrointestinal diseases. In Tunisia, this pathogen is considered one of the most important causes of toxiinfections and its detection using classical methods is laborious and requires a large amount of time for revelation. To solve this problem, we developed a rapid molecular technique for the detection of the invA virulence gene sequence which is found in the majority of Salmonella spp. This technique is a hemi nested PCR amplification using specific primers designed and by bioinformatics tools. The detection method consisted of pre-enrichment of the sample in buffered peptone water (BPW), followed by a total DNA extraction step prior to single tube hemi nested PCR amplification. This method was found highly specific and sensitive to detect low levels of salmonella typhimurium and salmonella enteritidis (1cfu/ 25g) in naturally contaminated spicy sausage (merguez) samples. These results can benefit the public health agencies concerning microbiological and quality aspects of the commercial and traditional merguez meat production in Tunisia. (Author)
Nanotechnology: A Policy Primer
2013-06-24
savings in the United States of 24 million barrels of oil.4 • Universal access to clean water. Nanotechnology water desalination and filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...COVERED 00-00-2013 to 00-00-2013 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT
Primer on CDM programme of activities
Energy Technology Data Exchange (ETDEWEB)
Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)
2009-07-01
As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)
Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers
DEFF Research Database (Denmark)
Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.
2011-01-01
BACKGROUND: MicroRNAs are important regulators of gene expression at the post-transcriptional level and play an important role in many biological processes. Due to the important biological role it is of great interest to quantitatively determine their expression level in different biological...... be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...... samples than a similar method based on locked nucleic acids-spiked primers, which is in agreement with the observation that locked nucleic acid interferes with efficient amplification of short templates. The higher amplification efficiency of DNA primers translates into higher sensitivity and precision...
Energy Technology Data Exchange (ETDEWEB)
Ni, Chun Chun
2009-11-16
Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.
Bender, Kelly S; Rice, Melissa R; Fugate, William H; Coates, John D; Achenbach, Laurie A
2004-09-01
Natural attenuation of the environmental contaminant perchlorate is a cost-effective alternative to current removal methods. The success of natural perchlorate remediation is dependent on the presence and activity of dissimilatory (per)chlorate-reducing bacteria (DPRB) within a target site. To detect DPRB in the environment, two degenerate primer sets targeting the chlorite dismutase (cld) gene were developed and optimized. A nested PCR approach was used in conjunction with these primer sets to increase the sensitivity of the molecular detection method. Screening of environmental samples indicated that all products amplified by this method were cld gene sequences. These sequences were obtained from pristine sites as well as contaminated sites from which DPRB were isolated. More than one cld phylotype was also identified from some samples, indicating the presence of more than one DPRB strain at those sites. The use of these primer sets represents a direct and sensitive molecular method for the qualitative detection of (per)chlorate-reducing bacteria in the environment, thus offering another tool for monitoring natural attenuation. Sequences of cld genes isolated in the course of this project were also generated from various DPRB and provided the first opportunity for a phylogenetic treatment of this metabolic gene. Comparisons of the cld and 16S ribosomal DNA (rDNA) gene trees indicated that the cld gene does not track 16S rDNA phylogeny, further implicating the possible role of horizontal transfer in the evolution of (per)chlorate respiration.
Degenerate nonlinear diffusion equations
Favini, Angelo
2012-01-01
The aim of these notes is to include in a uniform presentation style several topics related to the theory of degenerate nonlinear diffusion equations, treated in the mathematical framework of evolution equations with multivalued m-accretive operators in Hilbert spaces. The problems concern nonlinear parabolic equations involving two cases of degeneracy. More precisely, one case is due to the vanishing of the time derivative coefficient and the other is provided by the vanishing of the diffusion coefficient on subsets of positive measure of the domain. From the mathematical point of view the results presented in these notes can be considered as general results in the theory of degenerate nonlinear diffusion equations. However, this work does not seek to present an exhaustive study of degenerate diffusion equations, but rather to emphasize some rigorous and efficient techniques for approaching various problems involving degenerate nonlinear diffusion equations, such as well-posedness, periodic solutions, asympt...
On Degenerate Partial Differential Equations
Chen, Gui-Qiang G.
2010-01-01
Some of recent developments, including recent results, ideas, techniques, and approaches, in the study of degenerate partial differential equations are surveyed and analyzed. Several examples of nonlinear degenerate, even mixed, partial differential equations, are presented, which arise naturally in some longstanding, fundamental problems in fluid mechanics and differential geometry. The solution to these fundamental problems greatly requires a deep understanding of nonlinear degenerate parti...
PIPEMicroDB: microsatellite database and primer generation tool for pigeonpea genome.
Sarika; Arora, Vasu; Iquebal, M A; Rai, Anil; Kumar, Dinesh
2013-01-01
Molecular markers play a significant role for crop improvement in desirable characteristics, such as high yield, resistance to disease and others that will benefit the crop in long term. Pigeonpea (Cajanus cajan L.) is the recently sequenced legume by global consortium led by ICRISAT (Hyderabad, India) and been analysed for gene prediction, synteny maps, markers, etc. We present PIgeonPEa Microsatellite DataBase (PIPEMicroDB) with an automated primer designing tool for pigeonpea genome, based on chromosome wise as well as location wise search of primers. Total of 123 387 Short Tandem Repeats (STRs) were extracted from pigeonpea genome, available in public domain using MIcroSAtellite tool (MISA). The database is an online relational database based on 'three-tier architecture' that catalogues information of microsatellites in MySQL and user-friendly interface is developed using PHP. Search for STRs may be customized by limiting their location on chromosome as well as number of markers in that range. This is a novel approach and is not been implemented in any of the existing marker database. This database has been further appended with Primer3 for primer designing of selected markers with left and right flankings of size up to 500 bp. This will enable researchers to select markers of choice at desired interval over the chromosome. Furthermore, one can use individual STRs of a targeted region over chromosome to narrow down location of gene of interest or linked Quantitative Trait Loci (QTLs). Although it is an in silico approach, markers' search based on characteristics and location of STRs is expected to be beneficial for researchers. Database URL: http://cabindb.iasri.res.in/pigeonpea/
Indian hedgehog contributes to human cartilage endplate degeneration.
Wang, Shaowei; Yang, Kun; Chen, Shuai; Wang, Jiying; Du, Guoqing; Fan, Shunwu; Wei, Lei
2015-08-01
To determine the role of Indian hedgehog (Ihh) signaling in human cartilage endplate (CEP) degeneration. CEP-degenerated tissues from patients with Modic I or II changes (n = 9 and 45, respectively) and normal tissues from vertebral burst fracture patients (n = 17) were collected. Specimens were either cut into slices for organ culture ex vivo or digested to isolate chondrocytes for cell culture in vitro. Ihh expression and the effect of Ihh on cartilage degeneration were determined by investigating degeneration markers in this study. Ihh expression and cartilage degeneration markers significantly increased in the Modic I and II groups. The expression of cartilage degeneration markers was positively correlated with degeneration severity. Gain-of-function for Ihh promoted expression of cartilage degeneration markers in vitro, while loss-of-function for Ihh inhibited their expression both in vitro and ex vivo. These findings demonstrated that Ihh promotes CEP degeneration. Blocking Ihh pathway has potential clinical usage for attenuating CEP degeneration.
Optimization Of ISSR Markers For DNA Fingerprinting In Stevia Rebaudiana Bertoni
International Nuclear Information System (INIS)
Lyena Watty Zuraine Ahmad; Lyena Watty Zuraine Ahmad; Azhar Mohamad; Mohamad Osman; Zarina Zainuddin; Fatin Izzati Mohd Khari
2014-01-01
ISSR or inter-simple sequence repeat is PCR based markers which required no prior DNA sequence knowledge of the studied organism. It has been proved to overcome limitations in other genetic marker techniques. In this study, 100 ISSR primers which comprised of 80 specific primers and 20 degenerate primers were used. All of the primers were tested on gradient temperatures from 45-55 degree Celsius. For positive amplification, 62 specific primers (77.5 %) and 18 degenerate primers (90.0 %) were recorded as working primers. The most efficient temperature for 25 primers was 55 degree Celsius. Marker derived from ISSR profiling is a powerful approach for identification and molecular classification of Stevia rebaudiana bertoni. (author)
High-speed measurement of firearm primer blast waves
Courtney, Michael; Daviscourt, Joshua; Eng, Jonathan; Courtney, Amy
2012-01-01
This article describes a method and results for direct high-speed measurements of firearm primer blast waves employing a high-speed pressure transducer located at the muzzle to record the blast pressure wave produced by primer ignition. Key findings are: 1) Most of the lead styphnate based primer models tested show 5.2-11.3% standard deviation in the magnitudes of their peak pressure. 2) In contrast, lead-free diazodinitrophenol (DDNP) based primers had standard deviations of the peak blast p...
Sahly, I; Bar Nachum, S; Suss-Toby, E; Rom, A; Peretz, A; Kleiman, J; Byk, T; Selinger, Z; Minke, B
1992-01-01
Light accelerates degeneration of photoreceptor cells of the retinal degeneration B (rdgB) mutant of Drosophila. During early stages of degeneration, light stimuli evoke spikes from photoreceptors of the mutant fly; no spikes can be recorded from photoreceptors of the wild-type fly. Production of spike potentials from mutant photoreceptors was blocked by diltiazem, verapamil hydrochloride, and cadmium. Little, if any, effect of the (-)-cis isomer or (+)-cis isomer of diltiazem on the light response was seen. Further, the (+)-cis isomer was approximately 50 times more effective than the (-)-cis isomer in blocking the Ca2+ spikes, indicating that diltiazem action on the rdgB eye is mediated by means of blocking voltage-sensitive Ca2+ channels, rather than by blocking the light-sensitive channels. Application of the Ca(2+)-channel blockers (+)-cis-diltiazem and verapamil hydrochloride to the eyes of rdgB flies over a 7-day period largely inhibited light-dependent degeneration of the photoreceptor cells. Pulse labeling with [32P]phosphate showed much greater incorporation into eye proteins of [32P]phosphate in rdgB flies than in wild-type flies. Retarding the light-induced photoreceptor degeneration in the mutant by Ca(2+)-channel blockers, thus, suggests that toxic increase in intracellular Ca2+ by means of voltage-gated Ca2+ channels, possibly secondary to excessive phosphorylation, leads to photoreceptor degeneration in the rdgB mutant. Images PMID:1309615
Hexavalent Chromium IV-Free Primer Development
Alldredge, Michael J.; Buck, Amy L.
2015-01-01
Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.
International Nuclear Information System (INIS)
Oldendorf, W.; Oldendorf, W. Jr.
1991-01-01
Designed for studies, radiologists, and clinicians at all levels of training, this book provides a basic introduction to the principles, physics, and instrumentation of magnetic resonance imaging. The fundamental concepts that are essential for the optimal clinical use of MRI are thoroughly explained in easily accessible terms. To facilitate the reader's comprehension, the material is presented nonmathematically, using no equations and a minimum of symbols and abbreviations. MRI Primer presents a clear account of the phenomenon of nuclear magnetic resonance and the use of gradient magnetic fields to create clinically useful images of cross-sectional slices. Close attention is given to the magnetization vector as a means of expressing nuclear behavior, the role of T 1 and T 2 weighing in imaging, the use of contrast agents, and the pulse sequences most often used in clinical practice, as well as to the relative capabilities and limitations of MRI and CT. The basic hardware components of an MRI scanner are described in detail. Sample MRI scans illustrate how MRI characterizes tissue. An appendix provides a brief introduction to quantum processes in MRI
Genetic and Clinical Features of Progranulin-Associated Frontotemporal Lobar Degeneration
Chen-Plotkin, A.S.; Martinez-Lage, M.; Sleiman, P.M.A.; Hu, W.; Greene, R.; Wood, E.M.; Bing, S.X.; Grossman, M.; Schellenberg, G.D.; Hatanpaa, K.J.; Weiner, M.F.; White, C.L.; Brooks, W.S.; Halliday, G.M.; Kril, J.J.; Gearing, M.; Beach, T.G.; Graff-Radford, N.R.; Dickson, D.W.; Rademakers, R.; Boeve, B.F.; Pickering-Brown, S.M.; Snowden, J.; van Swieten, J.C.; Heutink, P.; Seelaar, H.; Murrell, J.R.; Ghetti, B.; Spina, S.; Grafman, J.; Kaye, J.A.; Woltjer, R.L.; Mesulam, M.; Bigio, E.; Llado, A.; Miller, B.L.; Alzualde, A.; Moreno, F.; Rohrer, J.D.; Mackenzie, I.R.A.; Feldman, H.H.; Hamilton, R.L.; Cruts, M.; Engelborghs, S.; de Deyn, P.P.; Van Broeckhoven, C.; Bird, T.D.; Cairns, N.J.; Goate, A.; Frosch, M.P.; Riederer, P.F.; Bogdanovic, N.; Lee, V.M.Y.; Trojanowski, J.Q.; Van Deerlin, V.M.
2011-01-01
Objective: To assess the relative frequency of unique mutations and their associated characteristics in 97 individuals with mutations in progranulin (GRN), an important cause of frontotemporal lobar degeneration (FTLD). Participants and Design: A 46-site International Frontotemporal Lobar
International Nuclear Information System (INIS)
Ravi, M.S.; Panchasara, Chirag; Vijay, R.; Suchetha Kumari, N.; Sanjeev, Ganesh
2013-01-01
To evaluate the in vitro genotoxicity and cytotoxicity of two visible light-cured adhesives. The materials tested were 1. orthodontic adhesive with primer (Transbond XT3M) and 2. Orthodontic adhesive without primer (Heliosit, Ivoclar Vivadent AG), Cured sterile individual masses were exposed to 2 kGy electron beam radiation, both irradiated and non irradiated materials were immersed in Phosphate buffer saline and left at 370℃ for 24 hr. Then a volume of 200 μL of the extract medium was mixed with human peripheral blood lymphocyte tested for comet assay by single cell DNA Damage assay and Apoptosis by DNA diffusion agar assay. Evaluation of cytotoxicity was carried out by Hemolysis assay method. Haemolytic activity of orthodontic adhesive without primer (53.34±3.12) was slightly more than that of orthodontic adhesive with primer (52.9±.88). In case of Apoptosis, adhesive with primer (188.92±55.05) and adhesives without primer (186.75±101.83) showed increased diffusion of DNA compared to normal lymphocyte (111.22±8.78). However the level of DNA diffusion was not significantly different between the two adhesives. Both adhesives were cytotoxic and induced apoptosis. Adhesives without primer were found to be slightly toxic than that of adhesive with primer. Both the adhesives had no significant effect on the percentage of DNA tail and olive tail moment of DNA exposed to electron beam radiation. (author)
Primer on spontaneous heating and pyrophoricity
Energy Technology Data Exchange (ETDEWEB)
1994-12-01
This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.
30 CFR 57.6304 - Primer protection.
2010-07-01
... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a...
Martino, Amanda J.; Rhodes, Matthew E.; Biddle, Jennifer F.; Brandt, Leah D.; Tomsho, Lynn P.; House, Christopher H.
2011-01-01
A degenerate polymerase chain reaction (PCR)-based method of whole-genome amplification, designed to work fluidly with 454 sequencing technology, was developed and tested for use on deep marine subsurface DNA samples. While optimized here for use with Roche 454 technology, the general framework presented may be applicable to other next generation sequencing systems as well (e.g., Illumina, Ion Torrent). The method, which we have called random amplification metagenomic PCR (RAMP), involves the use of specific primers from Roche 454 amplicon sequencing, modified by the addition of a degenerate region at the 3′ end. It utilizes a PCR reaction, which resulted in no amplification from blanks, even after 50 cycles of PCR. After efforts to optimize experimental conditions, the method was tested with DNA extracted from cultured E. coli cells, and genome coverage was estimated after sequencing on three different occasions. Coverage did not vary greatly with the different experimental conditions tested, and was around 62% with a sequencing effort equivalent to a theoretical genome coverage of 14.10×. The GC content of the sequenced amplification product was within 2% of the predicted values for this strain of E. coli. The method was also applied to DNA extracted from marine subsurface samples from ODP Leg 201 site 1229 (Peru Margin), and results of a taxonomic analysis revealed microbial communities dominated by Proteobacteria, Chloroflexi, Firmicutes, Euryarchaeota, and Crenarchaeota, among others. These results were similar to those obtained previously for those samples; however, variations in the proportions of taxa identified illustrates well the generally accepted view that community analysis is sensitive to both the amplification technique used and the method of assigning sequences to taxonomic groups. Overall, we find that RAMP represents a valid methodology for amplifying metagenomes from low-biomass samples. PMID:22319519
... See More About Research The NINDS supports and conducts research on disorders of the brain and nervous system such as striatonigral degeneration. This research ... Publications Definition Striatonigral ...
[Lattice degeneration of the retina].
Boĭko, E V; Suetov, A A; Mal'tsev, D S
2014-01-01
Lattice degeneration of the retina is a clinically important type of peripheral retinal dystrophies due to its participation in the pathogenesis of rhegmatogenous retinal detachment. In spite of extensive epidemiological, morphological, and clinical data, the question on causes of this particular type of retinal dystrophies currently remains debatable. Existing hypotheses on pathogenesis of retinal structural changes in lattice degeneration explain it to a certain extent. In clinical ophthalmology it is necessary to pay close attention to this kind of degenerations and distinguish between cases requiring preventive treatment and those requiring monitoring.
Screening for Residual Disease in Pediatric Burkitt Lymphoma Using Consensus Primer Pools
Directory of Open Access Journals (Sweden)
Melissa Agsalda
2009-01-01
Full Text Available Assessing molecular persistent or minimal residual disease (PD/MRD in childhood Burkitt lymphoma (BL is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs. Because BL is characterized by rearranged immunoglobulin heavy chain (IgVH genes, IgVH primer pools from IgVH1–IgVH7 regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgVH primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgVH primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.
Screening for residual disease in pediatric burkitt lymphoma using consensus primer pools.
Agsalda, Melissa; Kusao, Ian; Troelstrup, David; Shiramizu, Bruce
2009-01-01
Assessing molecular persistent or minimal residual disease (PD/MRD) in childhood Burkitt lymphoma (BL) is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs). Because BL is characterized by rearranged immunoglobulin heavy chain (IgV(H)) genes, IgV(H) primer pools from IgV(H1)-IgV(H7) regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgV(H) primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgV(H) primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.
Directory of Open Access Journals (Sweden)
Luk Ketut Budi Maitriani
2015-10-01
Full Text Available ABSTRAK : Penelitian ini bertujuan untuk memperoleh sepasang primer terbaik hasil desain secara in silico menggunakan program Clone Manager Suite 6 (University of Groningen. Primer ini didesain untuk digunakan dalam mengamplifikasi fragmen gen inhA isolat klinis Multidrug Resistance Tuberculosis (MDR-TB mencakup kodon 94 (nukleotida 280-282. Kodon 94 gen inhA merupakan posisi yang sering mengalami mutasi dan mengakibatkan koresisten terhadap isoniazid dan ethionamid. Desain primer menggunakan sekuen gen inhA Mycobacterium tuberculosis yang diperoleh dari situs www.ncbi.nlm.nih.gov (GenBank : AF106077. Hasil desain diperoleh sepasang primer terbaik dan diuji secara in vitro menggunakan metode Polymerase Chain Reaction (PCR. Template DNA yang digunakan adalah isolat klinis MDR-TB. Proses amplifikasi diawali dengan denaturasi awal pada 95°C selama 15 menit dan diikuti oleh 45 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 56°C selama 1 menit 20 detik dan elongasi pada 72°C selama 2 menit serta diakhiri dengan elongasi akhir pada 72°C selama 10 menit. Produk PCR dideteksi menggunakan elektroforesis gel agarosa 1,5%. Kesimpulan penelitian adalah diperoleh sepasang primer terbaik berdasarkan kriteria pada program Clone Manager Suite 6 (University of Groningen, meliputi: panjang primer, %GC, Tm (melting temperature, interaksi primer (dimers dan hairpins, stabilitas primer, repeats, runs dan false priming. Primer tersebut meliputi, primer forward (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3’ dan primer reverse (pR-inhA 5’ CGACCGTCATCCA-GTTGTA 3’ dengan ukuran produk 460 pb. ABSTRACT: The aim of this study was to obtain the best pair of primer as result in silico design using Clone Manager Suite 6 program (University of Groningen. The primer was designed for amplifying inhA gene fragment of Multidrug Resistance Tuberculosis (MDR-TB clinical isolates include codon 94 (nucleotide 280-282. Codon 94 of inhA gene is
Rust transformation/rust compatible primers
Emeric, Dario A.; Miller, Christopher E.
1993-01-01
Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.
... FARA) National Ataxia Foundation (NAF) National Multiple Sclerosis Society See all related organizations Publications Degeneración cerebelosa Order NINDS Publications Definition Cerebellar degeneration is a process in which neurons ( ...
Liu, Weipeng; Zhu, Minjun; Liu, Hongxing; Wei, Jitao; Zhou, Xiaoming; Xing, Da
2016-07-15
Searching for a strategy to enhance the efficiency of nucleic acid amplification and achieve exquisite discrimination of nucleic acids at the single-base level for biological detection has become an exciting research direction in recent years. Here, we have developed a simple and universal primer design strategy which produces a fascinating effect on isothermal strand displacement amplification (iSDA). We refer to the resultant primer as "invading stacking primer (IS-Primer)" which is based on contiguous stacking hybridization and toehold-mediated exchange reaction and function by merely changing the hybridization location of the primer. Using the IS-Primer, the sensitivity in detecting the target miR-21 is improved approximately five fold compared with the traditional iSDA reaction. It was further demonstrated that the IS-Primer acts as an invading strand to initiate branch migration which can increase the efficiency of the untwisting of the hairpin probe. This effect is equivalent to reducing the free energy of the stem, and the technique shows superior selectivity for single-base mismatches. By demonstrating the enhanced effect of the IS-Primer in the iSDA reaction, this work may provide a potentially new avenue for developing more sensitive and selective nucleic acids assays. Copyright © 2016 Elsevier B.V. All rights reserved.
Genomic composition factors affect codon usage in porcine genome ...
African Journals Online (AJOL)
... be explored for designing degenerate primers, necessitate selecting appropriate hosts expression systems to manipulate the expression of target genes in vivo or in vitro and improve the accuracy of gene prediction from genomic sequences thus maximizing the effectiveness of genetic manipulations in synthetic biology.
Second order degenerate elliptic equations
International Nuclear Information System (INIS)
Duong Minh Duc.
1988-08-01
Using an improved Sobolev inequality we study a class of elliptic operators which is degenerate inside the domain and strongly degenerate near the boundary of the domain. Our results are applicable to the L 2 -boundary value problem and the mixed boundary problem. (author). 18 refs
Primer for criticality calculations with DANTSYS
International Nuclear Information System (INIS)
Busch, R.D.
1996-01-01
With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his or her facility. Typically, two types of codes are available: deterministic codes such as ANISN or DANTSYS that solve an approximate model exactly and Monte Carlo Codes such as KENO or MCNP that solve an exact model approximately. Often, the analyst feels that the deterministic codes are too simple and will not provide the necessary information, so most modeling uses Monte Carlo methods. This sometimes means that hours of effort are expended to produce results available in minutes from deterministic codes. A substantial amount of reliable information on nuclear systems can be obtained using deterministic methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico in cooperation with the Radiation Transport Group at Los Alamos National Laboratory has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. (DANTSYS is the name of a suite of codes that users more commonly know as ONEDANT, TWODANT, TWOHEX, and THREEDANT.) It assumes a college education in a technical field, but there is no assumption of familiarity with neutronics codes in general or with DANTSYS in particular. The primer is designed to teach by example, with each example illustrating two or three DANTSYS features useful in criticality analyses
Directory of Open Access Journals (Sweden)
Diana Sari
2015-05-01
Full Text Available AbstrakDismenore primer merupakan nyeri menstruasi yang dijumpai tanpa kelainan yang nyata pada alat-alat genital. Lebih dari 50% wanita mengalami dismenore primer dan 15% diantaranya mengalami nyeri yang hebat.Tujuan penelitian ini adalah untuk menentukan hubungan tingkat stres dengan derajat dismenore primer. Penelitian dilakukan pada mahasiswi pendidikan dokter Fakultas Kedokteran Universitas Andalas angkatan 2009 dan 2010. Desain penelitian ini menggunakan cross sectional study dengan jumlah subjek 165 orang. Pengumpulan data dari responden dilakukan dengan wawancara terpimpin (pengisian kuesioner. Analisa statistik yang digunakan adalah uji chi-square dan uji koefisien korelasi sederhana. Uji chi-square menunjukan ada hubungan yang bermakna antara stres dengan kejadian dismenore primer dan uji statistik koefisien korelasi sederhana menunjukkan ada hubungan yang bermakna dengan korelasi agak lemah antara tingkat stres dengan derajat dismenore primer.Kata kunci: stres, dismenore primer, mahasiswi fakultas kedokteran AbstractPrimary dysmenorrhoea is menstrual pain founded without real abnormalities in genital organs. More than 50% woman experiance it and 15% had severe pain. The objective of this study was to determine relationship between stress and primary dysmenorrhoea. Research was executed to education medical female students medical faculty of Andalas University class of 2009 and 2010. This research use cross sectional study design with 165 subjects. Data was collected by guided interview. Statistic analysis use chi-square test and simple correlation test. Chi-square test show there is significant relationship between stress and primary dysmenorrhoea and simple coefficient test show there is weak correlation between stress levels and degree of primary dysmenorrhoea.Keywords: stress, primary dysmenorrhoea, female student of medical faculty
Medium Caliber Lead-Free Electric Primer. Version 2
2012-09-01
2008). Safe Drinking Water Act of 1986 lists lead compounds as carcinogens (27 CCR 27001 – Dec. 2008). EPA began a Phase I assessment to determine...primer cups was our standard method, wet loading using solvents (hexane and iso -propanol) was investigated to reduce risk of accidental ignition...LOADING OPERATION (Single Die) Wet primer mix charge with solvent (Hexane/ Iso -Propanol) and stir to mix to a uniform slurry Insert primer cup in
A mouse model for degeneration of the spiral ligament.
Kada, Shinpei; Nakagawa, Takayuki; Ito, Juichi
2009-06-01
Previous studies have indicated the importance of the spiral ligament (SL) in the pathogenesis of sensorineural hearing loss. The aim of this study was to establish a mouse model for SL degeneration as the basis for the development of new strategies for SL regeneration. We injected 3-nitropropionic acid (3-NP), an inhibitor of succinate dehydrogenase, at various concentrations into the posterior semicircular canal of adult C57BL/6 mice. Saline-injected animals were used as controls. Auditory function was monitored by measurements of auditory brain stem responses (ABRs). On postoperative day 14, cochlear specimens were obtained after the measurement of the endocochlear potential (EP). Animals that were injected with 5 or 10 mM 3-NP showed a massive elevation of ABR thresholds along with extensive degeneration of the cochleae. Cochleae injected with 1 mM 3-NP exhibited selective degeneration of the SL fibrocytes but alterations in EP levels and ABR thresholds were not of sufficient magnitude to allow for testing functional recovery after therapeutic interventions. Animals injected with 3 mM 3-NP showed a reduction of around 50% in the EP along with a significant loss of SL fibrocytes, although degeneration of spiral ganglion neurons and hair cells was still present in certain regions. These findings indicate that cochleae injected with 3 mM 3-NP may be useful in investigations designed to test the feasibility of new therapeutic manipulations for functional SL regeneration.
Effect of oligonucleotide primers in determining viral variability within hosts
Directory of Open Access Journals (Sweden)
Moya Andrés
2004-12-01
Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.
Effect of oligonucleotide primers in determining viral variability within hosts.
Bracho, Maria Alma; García-Robles, Inmaculada; Jiménez, Nuria; Torres-Puente, Manuela; Moya, Andrés; González-Candelas, Fernando
2004-12-09
Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR) based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV) populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient). Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.
Directory of Open Access Journals (Sweden)
Lenka Maršálková
2014-07-01
Full Text Available The aim of this work was to use TaqMan Real-Time PCR for quantitative authentication of chicken and turkey meat. To meet this purpose, a specific pair of primers and TaqMan probe was used. The test was aimed at identifying the reaction cycle of turkey and chicken meat using by two sets of primers. With first set of primer designed for chicken we obtained the following results: Cp = 16.18 for 100% chicken DNA Cp = 29, 18 100% turkey DNA It was also amplified DNA of pig that exceeded the detection threshold fluorescence intensities in the 31.07 cycle (Cp = 31.07. Using primers designed for turkey we obtained the following results Cp = 31.16 for 100% CHDNA, Cp =16.18 100% TDNA. It was also amplified the 100% DNA of rabbit in 31.63 cycle (Cp = 31.63 and deer in cycle 32 (Cp = 32. The DNA of all other animal species was amplificated after more than 35 cycles (Cp >35. It follows that the second detection primer pair is specific enough to unrelated species of animals by 30 cycles of the reaction. Species authentication based on DNA analysis from this perspective overcomes all the shortcomings of proteins. At present, DNA analysis use different types of PCR. Is the most progressive Real-time PCR, which is suitable for the specific use of detection (primers and TaqMan probe. The TaqMan Real-time PCR is within the sensitivity and specificity, clearly one of the best methods for identifying the species of chicken and turkey meat. The specificity of this method, however, depends primarily on the specificity of the primers and TaqMan probe. The 30 cycle reaction was chosen by us as the threshold for specificity using primers for authentication chicken and turkey meat.
International Nuclear Information System (INIS)
Kolstad, Frode; Myhr, Gunnar; Kvistad, Kjell Arne; Nygaard, Oystein P.; Leivseth, Gunnar
2005-01-01
Study design: Descriptive study comparing MRI classifications with measurements from radiographs. Objectives: 1.Define the relationship between MRI classified cervical disc degeneration and objectively measured disc height. 2.Assess the level of inter- and intra-observer errors using MRI in defining cervical disc degeneration. Summary of background data: Cervical spine degeneration has been defined radiologically by loss of disc height, decreased disc and bone marrow signal intensity and disc protrusion/herniation on MRI. The intra- and inter-observer error using MRI in defining cervical degeneration influences data interpretation. Few previous studies have addressed this source of error. The relation and time sequence between cervical disc degeneration classified by MRI and cervical disc height decrease measured from radiographs is unclear. Methods: The MRI classification of degeneration was based on nucleus signal, prolaps identification and bone marrow signal. Two neuro-radiologists evaluated the MR-images independently in a blinded fashion. The radiographic disc height measurements were done by a new computer-assisted method compensating for image distortion and permitting comparison with normal level-, age- and gender-appropriate disc height. Results/conclusions: 1.Progressing disc degeneration classified from MRI is on average significantly associated with a decrease of disc height as measured from radiographs. Within each MRI defined category of degeneration measured disc heights, however, scatter in a wide range. 2.The inter-observer agreement between two neuro-radiologists in both defining degeneration and disc height by MRI was only moderate. Studies addressing questions related to cervical disc degeneration should take this into consideration
Energy Technology Data Exchange (ETDEWEB)
Kolstad, Frode [National Centre of Spinal Disorders, Norwegian University of Science and Technology, University Hospital of Trondheim, 7006 Trondheim (Norway)]. E-mail: frode.kolstad@medisin.ntnu.no; Myhr, Gunnar [Department of Radiology, University Hospital of Trondheim, 7006 Trondheim (Norway); Kvistad, Kjell Arne [Department of Radiology, University Hospital of Trondheim, 7006 Trondheim (Norway); Nygaard, Oystein P. [National Centre of Spinal Disorders, Norwegian University of Science and Technology, University Hospital of Trondheim, 7006 Trondheim (Norway); Leivseth, Gunnar [Department of Neuromedicine, Faculty of Medicine, Norwegian University of Science and Technology, University Hospital of Trondheim, 7006 Trondheim (Norway)
2005-09-01
Study design: Descriptive study comparing MRI classifications with measurements from radiographs. Objectives: 1.Define the relationship between MRI classified cervical disc degeneration and objectively measured disc height. 2.Assess the level of inter- and intra-observer errors using MRI in defining cervical disc degeneration. Summary of background data: Cervical spine degeneration has been defined radiologically by loss of disc height, decreased disc and bone marrow signal intensity and disc protrusion/herniation on MRI. The intra- and inter-observer error using MRI in defining cervical degeneration influences data interpretation. Few previous studies have addressed this source of error. The relation and time sequence between cervical disc degeneration classified by MRI and cervical disc height decrease measured from radiographs is unclear. Methods: The MRI classification of degeneration was based on nucleus signal, prolaps identification and bone marrow signal. Two neuro-radiologists evaluated the MR-images independently in a blinded fashion. The radiographic disc height measurements were done by a new computer-assisted method compensating for image distortion and permitting comparison with normal level-, age- and gender-appropriate disc height. Results/conclusions: 1.Progressing disc degeneration classified from MRI is on average significantly associated with a decrease of disc height as measured from radiographs. Within each MRI defined category of degeneration measured disc heights, however, scatter in a wide range. 2.The inter-observer agreement between two neuro-radiologists in both defining degeneration and disc height by MRI was only moderate. Studies addressing questions related to cervical disc degeneration should take this into consideration.
Mating type gene analysis in apparently asexual Cercospora species is suggestive of cryptic sex
Groenewald, M.; Groenewald, J.Z.; Harrington, T.C.; Abeln, E.C.A.; Crous, P.W.
2006-01-01
The genus Cercospora consists of numerous important, apparently asexual plant pathogens. We designed degenerate primers from homologous sequences in related species to amplify part of the C. apii, C. apiicola, C. beticola, C. zeae-maydis and C. zeina mating type genes. Chromosome walking was used to
Value for money assessment for public-private partnerships : a primer.
2015-01-01
This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion : primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of : primers.
Psychosocial Intervention for Age-Related Macular Degeneration: A Pilot Project
Wahl, Hans-Werner; Kammerer, Annette; Holz, Frank; Miller, Daniel; Becker, Stefanie; Kaspar, Roman; Himmelsbach, Ines
2006-01-01
This study evaluated an emotion-focused and a problem-focused intervention designed for patients with age-related macular degeneration. It found a limited decrease in depression in the emotion-focused group and an increase in active problem orientation and in adaptation to vision loss in the problem-focused group.
The macula is the part of the retina that distinguishes fine details at the center of the field of vision. Macular degeneration results from a partial breakdown of the insulating layer between the retina and the choroid layer of ...
Motor axon excitability during Wallerian degeneration
DEFF Research Database (Denmark)
Moldovan, Mihai; Alvarez, Susana; Krarup, Christian
2008-01-01
Axonal loss and degeneration are major factors in determining long-term outcome in patients with peripheral nerve disorders or injury. Following loss of axonal continuity, the isolated nerve stump distal to the lesion undergoes Wallerian degeneration in several phases. In the initial 'latent' phase......, action potential propagation and structural integrity of the distal segment are maintained. The aim of this study was to investigate in vivo the changes in membrane function of motor axons during the 'latent' phase of Wallerian degeneration. Multiple indices of axonal excitability of the tibial nerve...
Total absorption by degenerate critical coupling
Energy Technology Data Exchange (ETDEWEB)
Piper, Jessica R., E-mail: jrylan@stanford.edu; Liu, Victor; Fan, Shanhui, E-mail: shanhui@stanford.edu [Ginzton Laboratory, Department of Electrical Engineering, Stanford University, Stanford, California 94305 (United States)
2014-06-23
We consider a mirror-symmetric resonator with two ports. We show that, when excited from a single port, complete absorption can be achieved through critical coupling to degenerate resonances with opposite symmetry. Moreover, any time two resonances with opposite symmetry are degenerate in frequency and absorption is always significantly enhanced. In contrast, when two resonances with the same symmetry are nearly degenerate, there is no absorption enhancement. We numerically demonstrate these effects using a graphene monolayer on top of a photonic crystal slab, illuminated from a single side in the near-infrared.
Many-Body Green Function of Degenerate Systems
International Nuclear Information System (INIS)
Brouder, Christian; Panati, Gianluca; Stoltz, Gabriel
2009-01-01
A rigorous nonperturbative adiabatic approximation of the evolution operator in the many-body physics of degenerate systems is derived. This approximation is used to solve the long-standing problem of the choice of the initial states of H 0 leading to eigenstates of H 0 +V for degenerate systems. These initial states are eigenstates of P 0 VP 0 , where P 0 is the projection onto a degenerate eigenspace of H 0 . This result is used to give the proper definition of the Green function, the statistical Green function and the nonequilibrium Green function of degenerate systems. The convergence of these Green functions is established.
Codon optimizing for increased membrane protein production
DEFF Research Database (Denmark)
Mirzadeh, K.; Toddo, S.; Nørholm, Morten
2016-01-01
. As demonstrated with two membrane-embedded transporters in Escherichia coli, the method was more effective than optimizing the entire coding sequence. The method we present is PCR based and requires three simple steps: (1) the design of two PCR primers, one of which is degenerate; (2) the amplification...
Economics : pricing, demand, and economic efficiency : a primer.
2008-11-01
The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...
Antoniou, Grigoris; Harmelen, Frank van
2004-01-01
The development of the Semantic Web, with machine-readable content, has the potential to revolutionize the World Wide Web and its use. A Semantic Web Primer provides an introduction and guide to this still emerging field, describing its key ideas, languages, and technologies. Suitable for use as a
Su, Lei; Zhang, Qianqian; Gong, Jun
2017-07-01
Peritrich ciliates are highly diverse and can be important bacterial grazers in aquatic ecosystems. Morphological identifications of peritrich species and assemblages in the environment are time-consuming and expertise-demanding. In this study, two peritrich-specific PCR primers were newly designed to amplify a fragment including the internal transcribed spacer (ITS) region of ribosomal rDNA from environmental samples. The primers showed high specificity in silico, and in tests with peritrich isolates and environmental DNA. Application of these primers in clone library construction and sequencing yielded exclusively sequences of peritrichs for water and sediment samples. We also found the ITS1, ITS2, ITS, D1 region of 28S rDNA, and ITS+D1 region co-varied with, and generally more variable than, the V9 region of 18S rDNA in peritrichs. The newly designed specific primers thus provide additional tools to study the molecular diversity, community composition, and phylogeography of these ecologically important protists in different systems.
Degenerated differential pair with controllable transconductance
Mensink, Clemens; Mensink, Clemens H.J.; Nauta, Bram
1998-01-01
A differential pair with input transistors and provided with a variable degeneration resistor. The degeneration resistor comprises a series arrangement of two branches of coupled resistors which are shunted in mutually corresponding points by respective control transistors whose gates are
Mastan, Shaik G.
2011-05-10
Jatropha curcas L., a multipurpose shrub, has acquired significant economic importance for its seed oil which can be converted to biodiesel an emerging alternative to petro-diesel. In addition to the commercial value, it is also having medicinal and even high nutritional value to use as animal fodder which is limited due to the toxicity. Development of molecular marker will enable to differentiate non-toxic from toxic variety of J. curcas in a mixed population and also for quality control since the toxic components of J. curcas has deleterious effect on animals. In the present study, the efforts were made to generate the specific SCAR marker for toxic and/or non-toxic J. curcas from RAPD markers. Among the markers specific for toxic and non-toxic varieties, four were selected, purified, cloned, sequenced, and designed primers out of which one set of primers NT-JC/SCAR I/OPQ15-F and R could able to discriminate the non-toxic with toxic Jatropha by giving expected 430 bp size amplification in non-toxic variety. Furthermore, novel multiplex PCR was designed using the nrDNA ITS primers to overcome the false negatives. Present work also demonstrates utility of the conserved regions of nrDNA coding genes in ruling out the artifacts in PCR-like false negatives frequently occur in SCAR due to various reasons. The specific SCAR markers generated in the present investigation will help to distinguish non-toxic from toxic varieties of J. curcas or vice versa, and isolated marker along with designed multiplex protocol has applications in quality control for selective cultivation of non-toxic variety and will also assist in breeding and molecular mapping studies. © 2011 Springer Science+Business Media, LLC.
Energy Technology Data Exchange (ETDEWEB)
Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.
2013-06-28
Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource
International Nuclear Information System (INIS)
Jothikumar, N.; Hill, Vincent R.
2013-01-01
Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource
Lopes, Denilce Meneses; de Oliveira Campos, Lúcio Antônio; Salomão, Tânia Maria Fernandes; Tavares, Mara Garcia
2010-04-01
Due to their high degree of polymorphism, microsatellites are considered useful tools for studying population genetics. Nevertheless, studies of genetic diversity in stingless bees by means of these primers have revealed a low level of polymorphism, possibly the consequence of the heterologous primers used, since in most cases these were not specifically designed for the species under consideration. Herein we compared the number of polymorphic loci and alleles per locus, as well as observed heterozygosity in Melipona rufiventris and M. mondury populations, using specific and heterologous primers. The use of specific primers placed in evidence the greater frequency of polymorphic loci and alleles per locus, besides an expressive increase in observed heterozygosity in M. rufiventris and M. mondury, thereby reinforcing the idea that populational studies should be undertaken by preferably using species-specific microsatellite primers.
Xiao, Jing; Zhao, Jin; Liu, Mengjun; Liu, Ping; Dai, Li; Zhao, Zhihui
2015-01-01
Chinese jujube (Ziziphus jujuba), an economically important species in the Rhamnaceae family, is a popular fruit tree in Asia. Here, we surveyed and characterized simple sequence repeats (SSRs) in the jujube genome. A total of 436,676 SSR loci were identified, with an average distance of 0.93 Kb between the loci. A large proportion of the SSRs included mononucleotide, dinucleotide and trinucleotide repeat motifs, which accounted for 64.87%, 24.40%, and 8.74% of all repeats, respectively. Among the mononucleotide repeats, A/T was the most common, whereas AT/TA was the most common dinucleotide repeat. A total of 30,565 primer pairs were successfully designed and screened using a series of criteria. Moreover, 725 of 1,000 randomly selected primer pairs were effective among 6 cultivars, and 511 of these primer pairs were polymorphic. Sequencing the amplicons of two SSRs across three jujube cultivars revealed variations in the repeats. The transferability of jujube SSR primers proved that 35/64 SSRs could be transferred across family boundary. Using jujube SSR primers, clustering analysis results from 15 species were highly consistent with the Angiosperm Phylogeny Group (APGIII) System. The genome-wide characterization of SSRs in Chinese jujube is very valuable for whole-genome characterization and marker-assisted selection in jujube breeding. In addition, the transferability of jujube SSR primers could provide a solid foundation for their further utilization. PMID:26000739
Directory of Open Access Journals (Sweden)
Hamidreza Monavari
2013-12-01
Results: Performance of our home made primers for detecting pertussis using Real Time PCR in comparison with those by commercial kit was acceptable based on diagnostic classical guidance (WHO and the (CDC. Conclusions: Real time PCR test with new primers in comparison with culture techniques is more suitable, high sensitivity and can provide more informative values for pertussis detection.
3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.
Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong
2008-09-01
We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.
Directory of Open Access Journals (Sweden)
Miao Chen
Full Text Available Retinal photoreceptors die during retinal synaptogenesis in a portion of retinal degeneration. Whether cone bipolar cells establish regular retinal mosaics and mature morphologies, and resist degeneration are not completely understood. To explore these issues, we backcrossed a transgenic mouse expressing enhanced green fluorescent protein (EGFP in one subset of cone bipolar cells (type 7 into rd1 mice, a classic mouse model of retinal degeneration, to examine the development and survival of cone bipolar cells in a background of retinal degeneration. Our data revealed that both the development and degeneration of cone bipolar cells are independent of the normal activity of cone photoreceptors. We found that type 7 cone bipolar cells achieved a uniform tiling of the retinal surface and developed normal dendritic and axonal arbors without the influence of cone photoreceptor innervation. On the other hand, degeneration of type 7 cone bipolar cells, contrary to our belief of central-to-peripheral progression, was spatially uniform across the retina independent of the spatiotemporal pattern of cone degeneration. The results have important implications for the design of more effective therapies to restore vision in retinal degeneration.
Formation of Degenerate Band Gaps in Layered Systems
Directory of Open Access Journals (Sweden)
Alexey P. Vinogradov
2012-06-01
Full Text Available In the review, peculiarities of spectra of one-dimensional photonic crystals made of anisotropic and/or magnetooptic materials are considered. The attention is focused on band gaps of a special type—the so called degenerate band gaps which are degenerate with respect to polarization. Mechanisms of formation and properties of these band gaps are analyzed. Peculiarities of spectra of photonic crystals that arise due to the linkage between band gaps are discussed. Particularly, it is shown that formation of a frozen mode is caused by linkage between Brillouin and degenerate band gaps. Also, existence of the optical Borrmann effect at the boundaries of degenerate band gaps and optical Tamm states at the frequencies of degenerate band gaps are analyzed.
Quick spacecraft charging primer
International Nuclear Information System (INIS)
Larsen, Brian Arthur
2014-01-01
This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.
Laenderyggens degeneration og radiologi
DEFF Research Database (Denmark)
Jacobsen, Steffen; Gosvig, Kasper Kjaerulf; Sonne-Holm, Stig
2006-01-01
Low back pain (LBP) is one of the most common conditions, and at the same time one of the most complex nosological entities. The lifetime prevalence is approximately 80%, and radiological features of lumbar degeneration are almost universal in adults. The individual risk factors for LBP and signi...... is cyclic: exacerbations relieved by asymptomatic periods. New imaging modalities, including the combination of MR imaging and multiplanar 3-D CT scans, have broadened our awareness of possible pain-generating degenerative processes of the lumbar spine other than disc degeneration....
Primer: Fracture mechanics in the nuclear power industry
International Nuclear Information System (INIS)
Wessel, E.T.; Server, W.L.; Kennedy, E.L.
1990-01-01
This Primer is intended to familiarize utility engineers with the fracture mechanics technology and to provide the basis for a working knowledge of the subject. It is directed towards all the engineering disciplines that are involved either directly or indirectly with the structural reliability of electrical power generation equipment and systems. These engineering disciplines include such areas as: design and stress analysis, metallurgy and materials, nondestructive inspection and quality control, structural analysis and reliability engineering, chemical engineering and water chemistry control, and architectural engineering. This Primer does not provide a comprehensive, in-depth treatment of all the detailed aspects involved in fracture mechanics. It does, however, provide sufficient information and a common vocabulary that should enable engineers to: read and converse intelligently about the subject, understand and utilize ASME Codes and Regulatory Guides involving fracture mechanics, absorb technical information presented and discussed at various technical meetings, and begin to apply this technology towards actual engineering problems encountered in the course of their work. Example problems are provided to further enhance an understanding of fracture mechanics. Also, Appendix A describes fracture mechanics computer codes available through EPRI to analyze rotors, reactor pressure vessels and piping
Lattice degeneration of the retina and retinal detachment.
Semes, L P
1992-01-01
Lattice retinal degeneration is considered the most significant peripheral retinal disorder potentially predisposing to retinal breaks and retinal detachment. Lattice degeneration affects the vitreous and inner retinal layers with secondary changes as deep as the retinal pigment epithelium and perhaps the choriocapillaris. Variations in clinical appearance are the rule; geographically, lattice lesions favor the vertical meridians between the equator and the ora serrata. Lattice degeneration begins early in life and has been reported in sequential generations of the same family. Along with its customary bilateral occurrence, lattice shares other characteristics of a dystrophy. The association between the vitreous and retina in lattice lesions may be responsible for the majority of lattice-induced retinal detachments. The tumultuous event of posterior vitreous separation in the presence of abnormally strong vitreoretinal adherence is the trigger for a retinal tear that, in turn, may lead to retinal detachment. Although retinal holes in young patients with lattice degeneration may play a role in the evolution of retinal detachment, the clinical course of lattice degeneration seems to be one of dormancy rather than of progressive change. This discussion outlines the pathophysiology of lattice retinal degeneration and the relationship of pathophysiology to clinical presentation. The epidemiology of lattice degeneration is summarized, as are the possible precursors to retinal detachment. A clinical characterization of the natural history of lattice degeneration is offered, and interventions for complications are described. To conclude, management strategies from a primary-care standpoint are reviewed.
Climate Change, Health, and Communication: A Primer.
Chadwick, Amy E
2016-01-01
Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.
Degenerate conformal theories on higher-genus surfaces
International Nuclear Information System (INIS)
Gerasimov, A.A.
1989-01-01
Two-dimensional degenerate field theories on higher-genus surfaces are investigated. Objects are built on the space of moduli, whose linear combinations are hypothetically conformal blocks in degenerate theories
Directory of Open Access Journals (Sweden)
Joseph-Alexander Verreet
2011-01-01
Full Text Available Early detection of infection is very important for efficient management of Mycosphaerella graminicola leaf blotch. To monitor and quantify the occurrence of this fungus during the growing season, a diagnostic method based on real-time PCR was developed. Standard and real-time PCR assays were developed using SYBR Green chemistry to quantify M. graminicola in vitro or in wheat samples. Microsatellite dinucleotide specific-primers were designed based on microsatellite repeats of sequences present in the genome of M. graminicola. Specificity was checked by analyzing DNA of 55 M. graminicola isolates obtained from different geographical origins. The method appears to be highly specific for detecting M. graminicola; no fluorescent signals were observed from 14 other closely related taxa. Primer (CT 7 G amplified a specific amplicon of 570 bp from all M. graminicola isolates. The primers did not amplify DNA extracted from 14 other fungal species. The approximate melting temperature (Tm of the (CT 7 G primer was 84.2 °C. The detection limit of the real-time PCR assay with the primer sets (CT 7 G is 10 fg/25 µL, as compared to 10 pg/25 µL using conventional PCR technology. From symptomless leaves, a PCR fragment could be generated two days after inoculation. Both conventional and real-time PCR could successfully detect the fungus from artificially inoculated wheat leaves. However, real-time PCR appeared much more sensitive than conventional PCR. The developed quantitative real-time PCR method proved to be rapid, sensitive, specific, cost-effective and reliable for the identification and quantification of M. graminicola in wheat.
Marketing Information Products and Services : A Primer for ...
International Development Research Centre (IDRC) Digital Library (Canada)
Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Couverture du livre Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Directeur(s) : Abhinandan K. Jain, Ashok Jambhekar, T.P.Rama Rao et S. Sreenivas Rao. Maison(s) ...
Directory of Open Access Journals (Sweden)
Denilce Meneses Lopes
2010-01-01
Full Text Available Due to their high degree of polymorphism, microsatellites are considered useful tools for studying population genetics. Nevertheless, studies of genetic diversity in stingless bees by means of these primers have revealed a low level of polymorphism, possibly the consequence of the heterologous primers used, since in most cases these were not specifically designed for the species under consideration. Herein we compared the number of polymorphic loci and alleles per locus, as well as observed heterozygosity in Melipona rufiventris and M. mondury populations, using specific and heterologous primers. The use of specific primers placed in evidence the greater frequency of polymorphic loci and alleles per locus, besides an expressive increase in observed heterozygosity in M. rufiventris and M. mondury, thereby reinforcing the idea that populational studies should be undertaken by preferably using species-specific microsatellite primers.
An environmentally acceptable primer for galvanized steel: Formulation and evaluation by SVET
Energy Technology Data Exchange (ETDEWEB)
Simoes, A.M.P., E-mail: alda.simoes@ist.utl.p [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Carbonari, R.O.; Di Sarli, A.R.; Amo, B. del [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Romagnoli, R., E-mail: estelectro@cidepint.gov.a [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal)
2011-01-15
Research highlights: {yields} Chromates can be replaced successfully by aluminium phosphosilicate in paint systems. {yields} The solvents of the primer are eco-friendly ones. {yields} The primer adheres on galvanized steel and allows top-coating. {yields} The binder of the primer is compatible with other binders for top-coating. - Abstract: The object of this paper was to formulate a two-pack wash primer employing aluminium phosphosilicate as active anticorrosive pigment instead of basic zinc chromate. The anticorrosive action of the primer was evaluated by the polarization technique and the scanning vibrating electrode technique (SVET). The exposed surface was then examined by scanning electron microscopy (SEM) and the surface composition determined by energy dispersive X-ray (EDX) analysis. The primer was finally integrated in a complete paint scheme whose anticorrosive performance was evaluated by the salt spray chamber and electrochemical impedance spectroscopy. The adhesion of the primer plus a painting system was also evaluated by standard ASTM D 3359-90 test method. The wash primer pigmented with zinc chromate was used as reference. Results indicated that basic zinc chromate could be replaced by the more eco-friendly wash-primer containing aluminium phosphosilicate.
Microsatellite primers for fungus-growing ants
DEFF Research Database (Denmark)
Villesen, Palle; Gertsch, P J; Boomsma, JJ
2002-01-01
We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....
Microsatellite Primers for Fungus-Growing Ants
DEFF Research Database (Denmark)
Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)
2002-01-01
We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....
WASP: a Web-based Allele-Specific PCR assay designing tool for detecting SNPs and mutations
Directory of Open Access Journals (Sweden)
Assawamakin Anunchai
2007-08-01
Full Text Available Abstract Background Allele-specific (AS Polymerase Chain Reaction is a convenient and inexpensive method for genotyping Single Nucleotide Polymorphisms (SNPs and mutations. It is applied in many recent studies including population genetics, molecular genetics and pharmacogenomics. Using known AS primer design tools to create primers leads to cumbersome process to inexperience users since information about SNP/mutation must be acquired from public databases prior to the design. Furthermore, most of these tools do not offer the mismatch enhancement to designed primers. The available web applications do not provide user-friendly graphical input interface and intuitive visualization of their primer results. Results This work presents a web-based AS primer design application called WASP. This tool can efficiently design AS primers for human SNPs as well as mutations. To assist scientists with collecting necessary information about target polymorphisms, this tool provides a local SNP database containing over 10 million SNPs of various populations from public domain databases, namely NCBI dbSNP, HapMap and JSNP respectively. This database is tightly integrated with the tool so that users can perform the design for existing SNPs without going off the site. To guarantee specificity of AS primers, the proposed system incorporates a primer specificity enhancement technique widely used in experiment protocol. In particular, WASP makes use of different destabilizing effects by introducing one deliberate 'mismatch' at the penultimate (second to last of the 3'-end base of AS primers to improve the resulting AS primers. Furthermore, WASP offers graphical user interface through scalable vector graphic (SVG draw that allow users to select SNPs and graphically visualize designed primers and their conditions. Conclusion WASP offers a tool for designing AS primers for both SNPs and mutations. By integrating the database for known SNPs (using gene ID or rs number
Hafler, Brian P.; Klein, Zoe A.; Zhou, Z. Jimmy; Strittmatter, Stephen M.
2014-01-01
Prior investigations have shown that patients with neuronal ceroid lipofuscinosis (NCL) develop neurodegeneration characterized by vision loss, motor dysfunction, seizures, and often early death. Neuropathological analysis of patients with NCL shows accumulation of intracellular autofluorescent storage material, lipopigment, throughout neurons in the central nervous system including in the retina. A recent study of a sibling pair with adult onset NCL and retinal degeneration showed linkage to the region of the progranulin (GRN) locus and a homozygous mutation was demonstrated in GRN. In particular, the sibling pair with a mutation in GRN developed retinal degeneration and optic atrophy. This locus for this form of adult onset neuronal ceroid lipofuscinosis was designated neuronal ceroid lipofuscinosis-11 (CLN11). Based on these clinical observations, we wished to determine whether Grn-null mice develop accumulation of autofluorescent particles and retinal degeneration. Retinas of both wild-type and Progranulin deficient mice were examined by immunostaining and autofluorescence. Accumulation of autofluorescent material was present in Progranulin deficient mice at 12 months. Degeneration of multiple classes of neurons including photoreceptors and retinal ganglion cells was noted in mice at 12 and 18 months. Our data shows that Grn−/− mice develop degenerative pathology similar to features of human CLN11. PMID:25234724
Gonzalez-Martinez, Alejandro; Rodriguez-Sanchez, Alejandro; Rodelas, Belén; Abbas, Ben A; Martinez-Toledo, Maria Victoria; van Loosdrecht, Mark C M; Osorio, F; Gonzalez-Lopez, Jesus
2015-01-01
Identification of anaerobic ammonium oxidizing (anammox) bacteria by molecular tools aimed at the evaluation of bacterial diversity in autotrophic nitrogen removal systems is limited by the difficulty to design universal primers for the Bacteria domain able to amplify the anammox 16S rRNA genes. A metagenomic analysis (pyrosequencing) of total bacterial diversity including anammox population in five autotrophic nitrogen removal technologies, two bench-scale models (MBR and Low Temperature CANON) and three full-scale bioreactors (anammox, CANON, and DEMON), was successfully carried out by optimization of primer selection and PCR conditions (annealing temperature). The universal primer 530F was identified as the best candidate for total bacteria and anammox bacteria diversity coverage. Salt-adjusted optimum annealing temperature of primer 530F was calculated (47°C) and hence a range of annealing temperatures of 44-49°C was tested. Pyrosequencing data showed that annealing temperature of 45°C yielded the best results in terms of species richness and diversity for all bioreactors analyzed.
Degenerate r-Stirling Numbers and r-Bell Polynomials
Kim, T.; Yao, Y.; Kim, D. S.; Jang, G.-W.
2018-01-01
The purpose of this paper is to exploit umbral calculus in order to derive some properties, recurrence relations, and identities related to the degenerate r-Stirling numbers of the second kind and the degenerate r-Bell polynomials. Especially, we will express the degenerate r-Bell polynomials as linear combinations of many well-known families of special polynomials.
Briaire, Jeroen J; Frijns, Johan H M
2006-04-01
Cochlear implant research endeavors to optimize the spatial selectivity, threshold and dynamic range with the objective of improving the speech perception performance of the implant user. One of the ways to achieve some of these goals is by electrode design. New cochlear implant electrode designs strive to bring the electrode contacts into close proximity to the nerve fibers in the modiolus: this is done by placing the contacts on the medial side of the array and positioning the implant against the medial wall of scala tympani. The question remains whether this is the optimal position for a cochlea with intact neural fibers and, if so, whether it is also true for a cochlea with degenerated neural fibers. In this study a computational model of the implanted human cochlea is used to investigate the optimal position of the array with respect to threshold, dynamic range and spatial selectivity for a cochlea with intact nerve fibers and for degenerated nerve fibers. In addition, the model is used to evaluate the predictive value of eCAP measurements for obtaining peri-operative information on the neural status. The model predicts improved threshold, dynamic range and spatial selectivity for the peri-modiolar position at the basal end of the cochlea, with minimal influence of neural degeneration. At the apical end of the array (1.5 cochlear turns), the dynamic range and the spatial selectivity are limited due to the occurrence of cross-turn stimulation, with the exception of the condition without neural degeneration and with the electrode array along the lateral wall of scala tympani. The eCAP simulations indicate that a large P(0) peak occurs before the N(1)P(1) complex when the fibers are not degenerated. The absence of this peak might be used as an indicator for neural degeneration.
A primer on pseudorandom generators
Goldreich, Oded
2010-01-01
A fresh look at the question of randomness was taken in the theory of computing: A distribution is pseudorandom if it cannot be distinguished from the uniform distribution by any efficient procedure. This paradigm, originally associating efficient procedures with polynomial-time algorithms, has been applied with respect to a variety of natural classes of distinguishing procedures. The resulting theory of pseudorandomness is relevant to science at large and is closely related to central areas of computer science, such as algorithmic design, complexity theory, and cryptography. This primer surveys the theory of pseudorandomness, starting with the general paradigm, and discussing various incarnations while emphasizing the case of general-purpose pseudorandom generators (withstanding any polynomial-time distinguisher). Additional topics include the "derandomization" of arbitrary probabilistic polynomial-time algorithms, pseudorandom generators withstanding space-bounded distinguishers, and several natural notions...
[Peripheral retinal degenerations--treatment recommendations].
Joussen, A M; Kirchhof, B
2004-10-01
This report reviews the clinical appearance of degenerative diseases of the peripheral retina in relationship to the risk of developing a rhegmatogenous retinal detachment. We present recommendations for preventive treatment in eyes at increased risk of developing retinal detachment. Retinal degenerations are common lesions involving the peripheral retina but most of them are clinically insignificant. Lattice degeneration, degenerative retinoschisis, cystic retinal tufts, and very rarely zonular traction tufts can result in rhegmatogenous retinal detachment. Therefore, these lesions have been considered for prophylactic treatment; however, adequate studies have not been performed to date. Most of the peripheral retinal degenerations may not require treatment except in rare, high-risk situations. According to current knowledge there is no higher incidence of secondary pucker or other side effects after laser coagulation. Therefore, generous laser indication is recommended if risk factors apply.
A physicists guide to The Los Alamos Primer
International Nuclear Information System (INIS)
Reed, B Cameron
2016-01-01
In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer , which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons. (invited comment)
Directory of Open Access Journals (Sweden)
Joseph-Alexander Verreet
2012-03-01
Full Text Available The goals of this investigation were to identify and evaluate the use of polymorphic microsatellite marker (PMM analysis for molecular typing of seventeen plant pathogenic fungi. Primers for di-, tri-, and tetranucleotide loci were designed directly from the recently published genomic sequence of Mycospherlla graminicola and Fusarium graminearum. A total of 20 new microsatellite primers as easy-to-score markers were developed. Microsatellite primer PCR (MP-PCR yielded highly reproducible and complex genomic fingerprints, with several bands ranging in size from 200 to 3000 bp. Of the 20 primers tested, only (TAGG4, (TCC5 and (CA7T produced a high number of polymorphic bands from either F. graminearum or F. culmorum. (ATG5 led to successful amplifications in M. graminicola isolates collected from Germany. Percentage of polymorphic bands among Fusarium species ranged from 9 to 100%. Cluster analysis of banding patterns of the isolates corresponded well to the established species delineations based on morphology and other methods of phylogenetic analysis. The current research demonstrates that the newly designed microsatellite primers are reliable, sensitive and technically simple tools for assaying genetic variability in plant pathogenic fungi.
SINGLE-DEGENERATE TYPE Ia SUPERNOVAE ARE PREFERENTIALLY OVERLUMINOUS
International Nuclear Information System (INIS)
Fisher, Robert; Jumper, Kevin
2015-01-01
Recent observational and theoretical progress has favored merging and helium-accreting sub-Chandrasekhar mass white dwarfs (WDs) in the double-degenerate and the double-detonation channels, respectively, as the most promising progenitors of normal Type Ia supernovae (SNe Ia). Thus the fate of rapidly accreting Chandrasekhar mass WDs in the single-degenerate channel remains more mysterious then ever. In this paper, we clarify the nature of ignition in Chandrasekhar-mass single-degenerate SNe Ia by analytically deriving the existence of a characteristic length scale which establishes a transition from central ignitions to buoyancy-driven ignitions. Using this criterion, combined with data from three-dimensional simulations of convection and ignition, we demonstrate that the overwhelming majority of ignition events within Chandrasekhar-mass WDs in the single-degenerate channel are buoyancy-driven, and consequently lack a vigorous deflagration phase. We thus infer that single-degenerate SNe Ia are generally expected to lead to overluminous 1991T-like SNe Ia events. We establish that the rates predicted from both the population of supersoft X-ray sources (SSSs) and binary population synthesis models of the single-degenerate channel are broadly consistent with the observed rates of overluminous SNe Ia, and suggest that the population of SSSs are the dominant stellar progenitors of SNe 1991T-like events. We further demonstrate that the single-degenerate channel contribution to the normal and failed 2002cx-like rates is not likely to exceed 1% of the total SNe Ia rate. We conclude with a range of observational tests of overluminous SNe Ia which will either support or strongly constrain the single-degenerate scenario
[Lattice degeneration of the peripheral retina: ultrastructural study].
Bec, P; Malecaze, F; Arne, J L; Mathis, A
1985-01-01
The ultrastructural study of a case of snail track degeneration shows the presence of lipid inclusions in both the glial and the macrophage cells in every layer of the retina, and the existence of intraretinal fibers different from collagen fibers appearing to be glial filaments similar to those found in astrocytic gliomes and to the Rosenthal fibers observed in senile nervous cells. Other features were thinning of the retina and absence of blood vessels in the retina. There are no abnormalities of the vitreo-retinal juncture. All the lesions are in agreement with those observed by Daicker [Ophthalmologica, Basel 165: 360-365, 1972; Klin. Mbl. Augenheilk. 172: 581-583, 1978] with some differences, however. They are different from those found in lattice degeneration. They show that snail track degeneration is a specific form of peripheral retinal degeneration which is quite different from lattice degeneration and must not be considered similar.
Chinchilla-Brenes, Sonia; Sánchez-Oller, Sylvia
2001-01-01
Proyecto de Investigación El problema de la deserción estudiantil es un fenómeno mundial que involucra principalmente a alumnos de primer ingreso a los centros educativos y de manera particular a las instituciones de educación superior las cuales reportan índices de deserción de alrededor del 30% en el primer año. Ante esta situación se hace necesaria la atención de la población de primer ingreso con programas específicos que acompañen a los y las estudiantes en este proceso de ajuste al m...
Human disc degeneration is associated with increased MMP 7 expression.
Le Maitre, C L; Freemont, A J; Hoyland, J A
2006-01-01
During intervertebral disc (IVD) degeneration, normal matrix synthesis decreases and degradation of disc matrix increases. A number of proteases that are increased during disc degeneration are thought to be involved in its pathogenesis. Matrix metalloproteinase 7 (MMP 7) (Matrilysin, PUMP-1) is known to cleave the major matrix molecules found within the IVD, i.e., the proteoglycan aggrecan and collagen type II. To date, however, it is not known how its expression changes with degeneration or its exact location. We investigated the localization of MMP 7 in human, histologically graded, nondegenerate, degenerated and prolapsed discs to ascertain whether MMP 7 is up-regulated during disc degeneration. Samples of human IVD tissue were fixed in neutral buffered formalin, embedded in paraffin, and sections stained with hematoxylin and eosin to score the degree of morphological degeneration. Immunohistochemistry was performed to localize MMP 7 in 41 human IVDs with varying degrees of degeneration. We found that the chondrocyte-like cells of the nucleus pulposus and inner annulus fibrosus were MMP 7 immunopositive; little immunopositivity was observed in the outer annulus. Nondegenerate discs showed few immunopositive cells. A significant increase in the proportion of MMP 7 immunopositive cells was seen in the nucleus pulposus of discs classified as showing intermediate levels of degeneration and a further increase was seen in discs with severe degeneration. Prolapsed discs showed more MMP 7 immunopositive cells compared to nondegenerated discs, but fewer than those seen in cases of severe degeneration.
Do we need primer for orthodontic bonding? A randomized controlled trial.
Nandhra, Sarabjit Singh; Littlewood, Simon J; Houghton, Nadine; Luther, Friedy; Prabhu, Jagadish; Munyombwe, Theresa; Wood, Simon R
2015-04-01
To evaluate the clinical performance of APC™II Victory Series™ (3M Unitek) brackets in direct orthodontic bonding with and without the use of primer. A single-operator, two-centre prospective, non-inferiority randomized controlled clinical trial. The Orthodontic departments at the Leeds Dental Institute and St Luke's Hospital, Bradford, UK. Ethical approval was granted by Leeds (East) Research Ethics Committee on 18th of December 2009 (Reference 09/H1306/102). The protocol was not published prior to trial commencement. Ninety-two patients requiring orthodontic treatment with fixed appliances were randomly allocated to the control (bonded with primer) or test groups (bonded without primer). Patients were randomly allocated to either the control or experimental group. This was performed by preparing opaque numbered sealed envelopes in advance using a random numbers table generated by a computer by an independent third party . Once the envelopes were opened, blinding of the operator and the patient was no longer possible due to the nature of the intervention. Patients were approached for inclusion in the trial if they qualified for NHS orthodontic treatment requiring fixed appliances and had no previous orthodontic treatment. Number of bracket failures, time to bond-up appliances, and the adhesive remnant index (ARI) when bracket failure occurred, over a 12-month period Failure rate with primer was 11.1 per cent and without primer was 15.8 per cent. Bonding without primer was shown statistically to be non-inferior to bonding with primer odds ratio 0.95-2.25 (P = 0.08). Mean difference in bond-up time per bracket was 0.068 minutes (4 seconds), which was not statistically significant (P = 0.402). There was a statistically significant difference in the Adhesive Remnant Index - ARI 0 with primer 49.4 per cent, no primer 76.5 per cent, (P failure rate of 2% to be clinically significant. When bonding with APC™II Victory Series™ brackets without primer was shown
Notochord Cells in Intervertebral Disc Development and Degeneration
McCann, Matthew R.; Séguin, Cheryle A.
2016-01-01
The intervertebral disc is a complex structure responsible for flexibility, multi-axial motion, and load transmission throughout the spine. Importantly, degeneration of the intervertebral disc is thought to be an initiating factor for back pain. Due to a lack of understanding of the pathways that govern disc degeneration, there are currently no disease-modifying treatments to delay or prevent degenerative disc disease. This review presents an overview of our current understanding of the developmental processes that regulate intervertebral disc formation, with particular emphasis on the role of the notochord and notochord-derived cells in disc homeostasis and how their loss can result in degeneration. We then describe the role of small animal models in understanding the development of the disc and their use to interrogate disc degeneration and associated pathologies. Finally, we highlight essential development pathways that are associated with disc degeneration and/or implicated in the reparative response of the tissue that might serve as targets for future therapeutic approaches. PMID:27252900
Notochord Cells in Intervertebral Disc Development and Degeneration
Directory of Open Access Journals (Sweden)
Matthew R. McCann
2016-01-01
Full Text Available The intervertebral disc is a complex structure responsible for flexibility, multi-axial motion, and load transmission throughout the spine. Importantly, degeneration of the intervertebral disc is thought to be an initiating factor for back pain. Due to a lack of understanding of the pathways that govern disc degeneration, there are currently no disease-modifying treatments to delay or prevent degenerative disc disease. This review presents an overview of our current understanding of the developmental processes that regulate intervertebral disc formation, with particular emphasis on the role of the notochord and notochord-derived cells in disc homeostasis and how their loss can result in degeneration. We then describe the role of small animal models in understanding the development of the disc and their use to interrogate disc degeneration and associated pathologies. Finally, we highlight essential development pathways that are associated with disc degeneration and/or implicated in the reparative response of the tissue that might serve as targets for future therapeutic approaches.
Mechanisms of Distal Axonal Degeneration in Peripheral Neuropathies
Cashman, Christopher R.; Höke, Ahmet
2015-01-01
Peripheral neuropathy is a common complication of a variety of diseases and treatments, including diabetes, cancer chemotherapy, and infectious causes (HIV, hepatitis C, and Campylobacter jejuni). Despite the fundamental difference between these insults, peripheral neuropathy develops as a combination of just six primary mechanisms: altered metabolism, covalent modification, altered organelle function and reactive oxygen species formation, altered intracellular and inflammatory signaling, slowed axonal transport, and altered ion channel dynamics and expression. All of these pathways converge to lead to axon dysfunction and symptoms of neuropathy. The detailed mechanisms of axon degeneration itself have begun to be elucidated with studies of animal models with altered degeneration kinetics, including the slowed Wallerian degeneration (Wlds) and Sarmknockout animal models. These studies have shown axonal degeneration to occur througha programmed pathway of injury signaling and cytoskeletal degradation. Insights into the common disease insults that converge on the axonal degeneration pathway promise to facilitate the development of therapeutics that may be effective against other mechanisms of neurodegeneration. PMID:25617478
Primer on consumer marketing research : procedures, methods, and tools
1994-03-01
The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...
Computed tomography of Wallerian degeneration
International Nuclear Information System (INIS)
Uchino, Akira; Maeda, Fumihiko
1986-01-01
CT findings of wallerian degeneration of the pyramidal tract at the midbrain (atrophy of cerebral peduncle following cerebrovascular accident) were studied in 34 patients (44 CT scans) with old cerebrovascular accidents. Severe atrophy of cerebral peduncle was noted when the ipsilateral motor cortex was involved. However, when the posterior limb of the internal capsule was involved, atrophy of the ipsilateral cerebral peduncle was mild. In this series, the shortest interval between cerebrovascular accident and wallerian degeneration was 8 month. (author)
Atmel AVR Microcontroller Primer Programming and Interfacing, Second Edition
Barrett, Steven F
2012-01-01
This textbook provides practicing scientists and engineers a primer on the Atmel AVR microcontroller. In this second edition we highlight the popular ATmega164 microcontroller and other pin-for-pin controllers in the family with a complement of flash memory up to 128 kbytes. The second edition also adds a chapter on embedded system design fundamentals and provides extended examples on two different autonomous robots. Our approach is to provide the fundamental skills to quickly get up and operating with this internationally popular microcontroller. We cover the main subsystems aboard the ATmega
Arbitrary electron acoustic waves in degenerate dense plasmas
Rahman, Ata-ur; Mushtaq, A.; Qamar, A.; Neelam, S.
2017-05-01
A theoretical investigation is carried out of the nonlinear dynamics of electron-acoustic waves in a collisionless and unmagnetized plasma whose constituents are non-degenerate cold electrons, ultra-relativistic degenerate electrons, and stationary ions. A dispersion relation is derived for linear EAWs. An energy integral equation involving the Sagdeev potential is derived, and basic properties of the large amplitude solitary structures are investigated in such a degenerate dense plasma. It is shown that only negative large amplitude EA solitary waves can exist in such a plasma system. The present analysis may be important to understand the collective interactions in degenerate dense plasmas, occurring in dense astrophysical environments as well as in laser-solid density plasma interaction experiments.
Optimization of ISSR-PCR reaction system and selection of primers in Bryum argenteum
Directory of Open Access Journals (Sweden)
Ma Xiaoying
2017-02-01
Full Text Available In order to determine optimum ISSR-PCR reaction system for moss Bryum argenteum,the concentrations of template DNA primers,dNTPs,Mg2+ and Taq DNA polymerase were optimized in four levels by PCR orthogonal experimental method. The appropriate primers were screened from 100 primers by temperature gradient PCR,and the optimal anneal temperature of the screened primers were determined. The results showed that the optimized 20 μL ISSR-PCR reaction system was as follows:template DNA 20 ng/20 μL,primers 0.45 μmol/L,Mg2+2.65 mmol/L,Taq DNA polymerase 0.4 U/20 μL,dNTPs 0.45 mmol/L. Using this system,50 primers with clear bands,repeatability well and polymorphism highly were selected from 100 primers. The establishment of this system,the screened primers and the annealing temperature could provide a theoretical basis for further research on the genetic diversity of bryophytes using ISSR molecular markers.
Energy Technology Data Exchange (ETDEWEB)
Micheli, Fiorenza de [Centro de Estudios Cientificos, Arturo Prat 514, Valdivia (Chile); Instituto de Fisica, Pontificia Universidad Catolica de Valparaiso, Casilla 4059, Valparaiso (Chile); Zanelli, Jorge [Centro de Estudios Cientificos, Arturo Prat 514, Valdivia (Chile); Universidad Andres Bello, Av. Republica 440, Santiago (Chile)
2012-10-15
A degenerate dynamical system is characterized by a symplectic structure whose rank is not constant throughout phase space. Its phase space is divided into causally disconnected, nonoverlapping regions in each of which the rank of the symplectic matrix is constant, and there are no classical orbits connecting two different regions. Here the question of whether this classical disconnectedness survives quantization is addressed. Our conclusion is that in irreducible degenerate systems-in which the degeneracy cannot be eliminated by redefining variables in the action-the disconnectedness is maintained in the quantum theory: there is no quantum tunnelling across degeneracy surfaces. This shows that the degeneracy surfaces are boundaries separating distinct physical systems, not only classically, but in the quantum realm as well. The relevance of this feature for gravitation and Chern-Simons theories in higher dimensions cannot be overstated.
Directory of Open Access Journals (Sweden)
Alejandro Gonzalez-Martinez
2015-01-01
Full Text Available Identification of anaerobic ammonium oxidizing (anammox bacteria by molecular tools aimed at the evaluation of bacterial diversity in autotrophic nitrogen removal systems is limited by the difficulty to design universal primers for the Bacteria domain able to amplify the anammox 16S rRNA genes. A metagenomic analysis (pyrosequencing of total bacterial diversity including anammox population in five autotrophic nitrogen removal technologies, two bench-scale models (MBR and Low Temperature CANON and three full-scale bioreactors (anammox, CANON, and DEMON, was successfully carried out by optimization of primer selection and PCR conditions (annealing temperature. The universal primer 530F was identified as the best candidate for total bacteria and anammox bacteria diversity coverage. Salt-adjusted optimum annealing temperature of primer 530F was calculated (47°C and hence a range of annealing temperatures of 44–49°C was tested. Pyrosequencing data showed that annealing temperature of 45°C yielded the best results in terms of species richness and diversity for all bioreactors analyzed.
Risk factors of age-related macular degeneration in Argentina
Directory of Open Access Journals (Sweden)
María Eugenia Nano
2013-04-01
Full Text Available PURPOSES: To assess the risk factors of age-related macular degeneration in Argentina using a case-control study. METHODS: Surveys were used for subjects' antioxidant intake, age/gender, race, body mass index, hypertension, diabetes (and type of treatment, smoking, sunlight exposure, red meat consumption, fish consumption, presence of age-related macular degeneration and family history of age-related macular degeneration. Main effects models for logistic regression and ordinal logistic regression were used to analyze the results. RESULTS: There were 175 cases and 175 controls with a mean age of 75.4 years and 75.5 years, respectively, of whom 236 (67.4% were female. Of the cases with age-related macular degeneration, 159 (45.4% had age-related macular degeneration in their left eyes, 154 (44.0% in their right eyes, and 138 (39.4% in both eyes. Of the cases with age-related macular degeneration in their left eyes, 47.8% had the dry type, 40.3% had the wet type, and the type was unknown for 11.9%. The comparable figures for right eyes were: 51.9%, 34.4%, and 13.7%, respectively. The main effects model was dominated by higher sunlight exposure (OR [odds ratio]: 3.3 and a family history of age-related macular degeneration (OR: 4.3. Other factors included hypertension (OR: 2.1, smoking (OR: 2.2, and being of the Mestizo race, which lowered the risk of age-related macular degeneration (OR: 0.40. Red meat/fish consumption, body mass index, and iris color did not have an effect. Higher age was associated with progression to more severe age-related macular degeneration. CONCLUSION: Sunlight exposure, family history of age-related macular degeneration, and an older age were the significant risk factors. There may be other variables, as the risk was not explained very well by the existing factors. A larger sample may produce different and better results.
Magnetic resonance imaging of intervertebral disc degeneration
International Nuclear Information System (INIS)
Maeda, Hiroshi; Noguchi, Masao; Kira, Hideaki; Fujiki, Hiroshi; Shimokawa, Isao; Hinoue, Kaichi.
1993-01-01
The aim of this study was to correlate the degree of lumbar intervertebral disc degeneration with findings of magnetic resonance imaging (MRI). Seventeen autopsied (from 7 patients) and 21 surgical (from 20 patients) intervertebral discs were used as specimens for histopathological examination. In addition, 21 intervertebral discs were examined on T2-weighted images. Histopathological findings from both autopsied and surgical specimens were well correlated with MRI findings. In particular, T2-weighted images reflected increased collagen fibers and rupture within the fibrous ring accurately. However, when severely degenerated intervertebral discs and hernia protruding the posterior longitudinal ligament existed, histological findings were not concordant well with T2-weighted images. Morphological appearances of autopsy specimens, divided into four on T2-weighted images, were well consistent with histological degeneration. This morphological classification, as shown on T2-weighted images, could also be used in the evaluation of intervertebral disc degeneration. (N.K.)
Magnetic resonance imaging of intervertebral disc degeneration
Energy Technology Data Exchange (ETDEWEB)
Maeda, Hiroshi; Noguchi, Masao (Kitakyushu City Yahata Hospital, Fukuoka (Japan)); Kira, Hideaki; Fujiki, Hiroshi; Shimokawa, Isao; Hinoue, Kaichi
1993-02-01
The aim of this study was to correlate the degree of lumbar intervertebral disc degeneration with findings of magnetic resonance imaging (MRI). Seventeen autopsied (from 7 patients) and 21 surgical (from 20 patients) intervertebral discs were used as specimens for histopathological examination. In addition, 21 intervertebral discs were examined on T2-weighted images. Histopathological findings from both autopsied and surgical specimens were well correlated with MRI findings. In particular, T2-weighted images reflected increased collagen fibers and rupture within the fibrous ring accurately. However, when severely degenerated intervertebral discs and hernia protruding the posterior longitudinal ligament existed, histological findings were not concordant well with T2-weighted images. Morphological appearances of autopsy specimens, divided into four on T2-weighted images, were well consistent with histological degeneration. This morphological classification, as shown on T2-weighted images, could also be used in the evaluation of intervertebral disc degeneration. (N.K.).
Risk of retinal detachment in patients with lattice degeneration.
Sasaki, K; Ideta, H; Yonemoto, J; Tanaka, S; Hirose, A; Oka, C
1998-01-01
To determine the risk of retinal detachment in patients with lattice degeneration of the retina, we statistically analyzed the incidence of retinal detachment in these patients. The data of hospital patients with retinal detachment associated with lattice degeneration in Kumamoto Prefecture, Japan, in 1990 were collected. The prevalence of lattice degeneration in Kumamoto was reported to be 9.5% in 1980. Based on population data from the 1990 census, the cumulative incidence of retinal detachment associated with lattice degeneration was calculated in this study. Among 1,840,000 residents in Kumamoto, there were 110 patients with retinal detachment associated with lattice degeneration; 72 with detachment resulting from tractional tears (tears), and 38 with detachment from atrophic holes. The cumulative incidence of retinal detachment from atrophic holes was 1.5% at the age of 40 years; from tears it was 3.6% at the age of 80 years. The cumulative incidence of detachment from both atrophic holes and tears was 5.3% at the age of 80 years. The results of this study are useful for clarifying the natural course of lattice degeneration.
Death Receptor 6 Promotes Wallerian Degeneration in Peripheral Axons.
Gamage, Kanchana K; Cheng, Irene; Park, Rachel E; Karim, Mardeen S; Edamura, Kazusa; Hughes, Christopher; Spano, Anthony J; Erisir, Alev; Deppmann, Christopher D
2017-03-20
Axon degeneration during development is required to sculpt a functional nervous system and is also a hallmark of pathological insult, such as injury [1, 2]. Despite similar morphological characteristics, very little overlap in molecular mechanisms has been reported between pathological and developmental degeneration [3-5]. In the peripheral nervous system (PNS), developmental axon pruning relies on receptor-mediated extrinsic degeneration mechanisms to determine which axons are maintained or degenerated [5-7]. Receptors have not been implicated in Wallerian axon degeneration; instead, axon autonomous, intrinsic mechanisms are thought to be the primary driver for this type of axon disintegration [8-10]. Here we survey the role of neuronally expressed, paralogous tumor necrosis factor receptor super family (TNFRSF) members in Wallerian degeneration. We find that an orphan receptor, death receptor 6 (DR6), is required to drive axon degeneration after axotomy in sympathetic and sensory neurons cultured in microfluidic devices. We sought to validate these in vitro findings in vivo using a transected sciatic nerve model. Consistent with the in vitro findings, DR6 -/- animals displayed preserved axons up to 4 weeks after injury. In contrast to phenotypes observed in Wld s and Sarm1 -/- mice, preserved axons in DR6 -/- animals display profound myelin remodeling. This indicates that deterioration of axons and myelin after axotomy are mechanistically distinct processes. Finally, we find that JNK signaling after injury requires DR6, suggesting a link between this novel extrinsic pathway and the axon autonomous, intrinsic pathways that have become established for Wallerian degeneration. Copyright © 2017 Elsevier Ltd. All rights reserved.
Pelloux, H; Weiss, J; Simon, J; Muet, F; Fricker-Hidalgo, H; Goullier-Fleuret, A; Ambroise-Thomas, P
1996-04-15
A new PCR system including a pair of primers, a probe and an internal control were designed from the B1 gene of Toxoplasma gondii. The system described allowed the detection of less than 10 tachyzoites of the RH strain of T. gondii. Among 21 amniotic fluid samples, this system diagnosed the cases of congenital toxoplasmosis which were simultaneously diagnosed using mice inoculation, in vitro culture, and serology from both amniotic fluid and fetal blood. These results show that these new primers allow for a highly sensitive detection of T. gondii DNA.
Degeneration in dysplastic hips. A computer tomography study
DEFF Research Database (Denmark)
Jacobsen, Steffen; Rømer, Lone; Søballe, Kjeld
2005-01-01
BACKGROUND: Hip dysplasia is considered pre-osteoarthritic, causing degeneration in young individuals. OBJECTIVE: To determine the pattern of degenerative change in moderate to severely dysplastic hips in young patients. DESIGN AND PATIENTS: One hundred and ninety-three consecutively......-referred younger patients with hip pain believed to be caused by hip dysplasia constituted the study cohort. The average age was 35.5 years (range, 15-61 years). They were examined by close-cut transverse pelvic and knee computed tomography and antero-posterior radiographs (CT). We identified 197 hips...
The prognosis of retinal detachment due to lattice degeneration.
Benson, W E; Morse, P H
1978-09-01
In a series of 553 consecutive retinal detachments, 29% (120) were due to lattice degeneration. Forty-five percent of these were due to atrophic holes in the lattice degeneration and 55% were due to tears caused by traction posterior to or at the end of a patch of lattice. In phakic patients, retinal detachments due to atrophic holes were most common in young myopes. Detachments due to traction tears were seen in older, less myopic patients. The incidence of massive periretinal proliferation was less (5%) in detachments due to lattice degeneration than in detachments not due to lattice degeneration (6.5%).
Laboratory and gas-fired furnace performance tests of epoxy primers for intumescent coatings
DEFF Research Database (Denmark)
Nørgaard, Kristian Petersen; Dam-Johansen, Kim; Catala, Pere
2014-01-01
, either to ensure adhesion of the intumescent coating to the steel or to provide corrosion resistance. It is essential to document the performance of the intumescent coating together with the primer to ensure the overall quality of coating system. In the present work, two epoxy primers were used...... to a gas-fired furnace following the ISO834 fire curve (a so-called cellulosic fire), one of the primers selected performed well and the other poorly. From tests in the electrically heated oven, it was found that both primers were sensitive to the film thickness employed and the presence of oxygen....... At oxygen-rich conditions, higher primer thicknesses gave weaker performance. In addition, a color change from red to black was observed in nitrogen, while the color remained red in the oxygen-nitrogen mixture. In summary, the results suggest that an adequate choice of primer, primer thickness...
Mutations in ABCR (ABCA4) in patients with Stargardt macular degeneration or cone-rod degeneration.
Briggs, C E; Rucinski, D; Rosenfeld, P J; Hirose, T; Berson, E L; Dryja, T P
2001-09-01
To determine the spectrum of ABCR mutations associated with Stargardt macular degeneration and cone-rod degeneration (CRD). One hundred eighteen unrelated patients with recessive Stargardt macular degeneration and eight with recessive CRD were screened for mutations in ABCR (ABCA4) by single-strand conformation polymorphism analysis. Variants were characterized by direct genomic sequencing. Segregation analysis was performed on the families of 20 patients in whom at least two or more likely pathogenic sequence changes were identified. The authors found 77 sequence changes likely to be pathogenic: 21 null mutations (15 novel), 55 missense changes (26 novel), and one deletion of a consensus glycosylation site (also novel). Fifty-two patients with Stargardt macular degeneration (44% of those screened) and five with CRD each had two of these sequence changes or were homozygous for one of them. Segregation analyses in the families of 19 of these patients were informative and revealed that the index cases and all available affected siblings were compound heterozygotes or homozygotes. The authors found one instance of an apparently de novo mutation, Ile824Thr, in a patient. Thirty-seven (31%) of the 118 patients with Stargardt disease and one with CRD had only one likely pathogenic sequence change. Twenty-nine patients with Stargardt disease (25%) and two with CRD had no identified sequence changes. This report of 42 novel mutations brings the growing number of identified likely pathogenic sequence changes in ABCR to approximately 250.
Disk degeneration in 14 year old children
International Nuclear Information System (INIS)
Erkintalo, M.; Salminen, J.J.; Paajanen, H.; Terho, P.; Kormano, M.
1989-01-01
This paper reports low back symptoms of 1,500 school children (14 years old) evaluated with a questionnaire and with a standardized clinical examination. Forty children who complained of recurrent and/or persistent low back pain and 40 matching symptomless controls were randomly chosen to undergo MR imaging of the lumbar spine. Premature disk degeneration was seen in 25.5% of asymptomatic children and in 40% of those with low back pain. The difference was statistically not significant. Disk degeneration is a surprisingly frequent MR finding in symptomless children. Premature disk degeneration may be the cause of low back pain in some children but is not always symptomatic in childhood
Progression of Fatty Muscle Degeneration in Atraumatic Rotator Cuff Tears.
Hebert-Davies, Jonah; Teefey, Sharlene A; Steger-May, Karen; Chamberlain, Aaron M; Middleton, William; Robinson, Kathryn; Yamaguchi, Ken; Keener, Jay D
2017-05-17
The purpose of this prospective study was to examine the progression of fatty muscle degeneration over time in asymptomatic shoulders with degenerative rotator cuff tears. Subjects with an asymptomatic rotator cuff tear in 1 shoulder and pain due to rotator cuff disease in the contralateral shoulder were enrolled in a prospective cohort. Subjects were followed annually with shoulder ultrasonography, which evaluated tear size, location, and fatty muscle degeneration. Tears that were either full-thickness at enrollment or progressed to a full-thickness defect during follow-up were examined. A minimum follow-up of 2 years was necessary for eligibility. One hundred and fifty-six shoulders with full-thickness rotator cuff tears were potentially eligible. Seventy shoulders had measurable fatty muscle degeneration of at least 1 rotator cuff muscle at some time point. Patients with fatty muscle degeneration in the shoulder were older than those without degeneration (mean, 65.8 years [95% confidence interval (CI), 64.0 to 67.6 years] compared with 61.0 years [95% CI, 59.1 to 62.9 years]; p tears at baseline was larger in shoulders with degeneration than in shoulders that did not develop degeneration (13 and 10 mm wide, respectively, and 13 and 10 mm long; p Tears with fatty muscle degeneration were more likely to have enlarged during follow-up than were tears that never developed muscle degeneration (79% compared with 58%; odds ratio, 2.64 [95% CI, 1.29 to 5.39]; p muscle degeneration occurred more frequently in shoulders with tears that had enlarged (43%; 45 of 105) than in shoulders with tears that had not enlarged (20%; 10 of 51; p tears with enlargement and progression of muscle degeneration were more likely to extend into the anterior supraspinatus than were those without progression (53% and 17%, respectively; p tear size (p = 0.56). The median time from tear enlargement to progression of fatty muscle degeneration was 1.0 year (range, -2.0 to 6.9 years) for the
Directory of Open Access Journals (Sweden)
Puntipar Sonthiphand
Full Text Available Anaerobic ammonia oxidizing (anammox bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library
[Clinical features and prognosis of retinal lattice degeneration].
Guo, X R
1990-07-01
110 cases (110 eyes) of retinal lattice degeneration were clinically observed and followed up for 3-8 years. Most lesions were located in the superotemporal quadrant, band-shaped, and parallel to the ora serrata. 80.9% of the lesions presented various degrees of pigmentation, 67.1% yellowish white spots, and 83.6% white lines. 32.9% of the eyes developed retinal holes. Most lattice degenerations were accompanied by vitreous degeneration and vitreoretinal traction. The disease progressed only slowly, though in a few cases it tended to expand.
Oxygen-induced retinopathy in mice with retinal photoreceptor cell degeneration.
Zhang, Qian; Zhang, Zuo-Ming
2014-04-25
It is reported that retinal neovascularization seems to rarely co-exist with retinitis pigmentosa in patients and in some mouse models; however, it is not widely acknowledged as a universal phenomenon in all strains of all animal species. We aimed to further explore this phenomenon with an oxygen-induced retinopathy model in mice with retinal photoreceptor cell degeneration. Oxygen-induced retinopathy of colored and albino mice with rapid retinal degeneration were compared to homologous wild-type mice. The retinas were analyzed using high-molecular-weight FITC-dextran stained flat-mount preparation, hematoxylin and eosin (H&E) stained cross-sections, an immunohistochemical test for vascular endothelial growth factor (VEGF) distribution and Western blotting for VEGF expression after exposure to hyperoxia between postnatal days 17 (P17) and 21. Leakage and areas of non-perfusion of the retinal blood vessels were alleviated in the retinal degeneration mice. The number of preretinal vascular endothelial cell nuclei in the retinal degeneration mice was smaller than that in the homologous wild-type mice after exposure to hyperoxia (Poxygen-induced retinopathy was positively correlated with the VEGF expression level. However, the VEGF expression level was lower in the retinal degeneration mice. Proliferative retinopathy occurred in mice with rapid retinal degeneration, but retinal photoreceptor cell degeneration could partially restrain the retinal neovascularization in this rapid retinal degeneration mouse model. Copyright © 2014 Elsevier Inc. All rights reserved.
The ability of T2/B4 primers to detect Leishmania infantum among ...
African Journals Online (AJOL)
SERVER
2008-04-03
Apr 3, 2008 ... Reverse Primer (5`-CCT CTC TTT TTT CNC TGT GC-3`). (Schönian et al., 1996),. B. Forward Primer (RV1) (5`-GTG GGG GAG GGG CGT TCT-3`) and Reverse Primer (RV2) (5`-ATT TTA CAC CAA CCC CCA GTT-. 3`) (Lachaud et al., 2002; Reale et al., 1999),. C. Forward Primer (T2) (5`-CGG CTT CGC ...
Hamiltonization of theories with degenerate coordinates
International Nuclear Information System (INIS)
Gitman, D.M.; Tyutin, I.V.
2002-01-01
We consider a class of Lagrangian theories where part of the coordinates does not have any time derivatives in the Lagrange function (we call such coordinates degenerate). We advocate that it is reasonable to reconsider the conventional definition of singularity based on the usual Hessian and, moreover, to simplify the conventional hamiltonization procedure. In particular, in such a procedure, it is not necessary to complete the degenerate coordinates with the corresponding conjugate momenta
Hamiltonization of theories with degenerate coordinates
Energy Technology Data Exchange (ETDEWEB)
Gitman, D.M. E-mail: gitman@fma.if.usp.br; Tyutin, I.V. E-mail: tyutin@lpi.ru
2002-05-27
We consider a class of Lagrangian theories where part of the coordinates does not have any time derivatives in the Lagrange function (we call such coordinates degenerate). We advocate that it is reasonable to reconsider the conventional definition of singularity based on the usual Hessian and, moreover, to simplify the conventional hamiltonization procedure. In particular, in such a procedure, it is not necessary to complete the degenerate coordinates with the corresponding conjugate momenta.
Posterior lattice degeneration characterized by spectral domain optical coherence tomography.
Manjunath, Varsha; Taha, Mohammed; Fujimoto, James G; Duker, Jay S
2011-03-01
The purpose of this study was to use high-resolution spectral domain optical coherence tomography in the characterization of retinal and vitreal morphological changes overlying posterior lattice degeneration. A cross-sectional retrospective analysis was performed on 13 eyes of 13 nonconsecutive subjects with posterior lattice degeneration seen at the New England Eye Center, Tufts Medical Center between October 2009 and January 2010. Spectral domain optical coherence tomography images taken through the region of lattice degeneration were qualitatively analyzed. Four characteristic changes of the retina and vitreous were seen in the 13 eyes with lattice degeneration: 1) anterior/posterior U-shaped vitreous traction; 2) retinal breaks; 3) focal retinal thinning; and 4) vitreous membrane formation. The morphologic appearance of vitreous traction and retinal breaks were found to be consistent with previous histologic reports. It is possible to image posterior lattice degeneration in many eyes using spectral domain optical coherence tomography and to visualize the spectrum of retinal and vitreous changes throughout the area of lattice degeneration.
Macular degeneration - age-related
... AMD occurs when the blood vessels under the macula become thin and brittle. Small yellow deposits, called drusen, form. Almost all people with macular degeneration start with the dry form. Wet AMD occurs ...
Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R
2013-06-06
Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.
The prevalence of sacroiliac joint degeneration in asymptomatic adults.
Eno, Jonathan-James T; Boone, Christopher R; Bellino, Michael J; Bishop, Julius A
2015-06-03
Degenerative changes of the sacroiliac joint have been implicated as a cause of lower back pain in adults. The purpose of this study was to determine the prevalence of sacroiliac joint degeneration in asymptomatic patients. Five hundred consecutive pelvic computed tomography (CT) scans, made at a tertiary-care medical center, of patients with no history of pain in the lower back or pelvic girdle were retrospectively reviewed and analyzed for degenerative changes of the sacroiliac joint. After exclusion criteria were applied, 373 CT scans (746 sacroiliac joints) were evaluated for degenerative changes. Regression analysis was used to determine the association between age and the degree of sacroiliac joint degeneration. The prevalence of sacroiliac joint degeneration was 65.1%, with substantial degeneration occurring in 30.5% of asymptomatic subjects. The prevalence steadily increased with age, with 91% of subjects in the ninth decade of life displaying degenerative changes. Radiographic evidence of sacroiliac joint degeneration is highly prevalent in the asymptomatic population and is associated with age. Caution must be exercised when attributing lower back or pelvic girdle pain to sacroiliac joint degeneration seen on imaging. Prognostic Level IV. See Instructions for Authors for a complete description of levels of evidence. Copyright © 2015 by The Journal of Bone and Joint Surgery, Incorporated.
DEFF Research Database (Denmark)
Holz, Frank G; Dugel, Pravin U.; Weissgerber, Georges
2016-01-01
Purpose To assess the safety and efficacy of different doses of RTH258 applied as single intravitreal administration compared with ranibizumab 0.5 mg in patients with neovascular age-related macular degeneration (AMD). Design Six-month, phase 1/2, prospective, multicenter, double-masked, randomized...
[Pharmacological therapy of age-related macular degeneration based on etiopathogenesis].
Fischer, Tamás
2015-11-15
It is of great therapeutic significance that disordered function of the vascular endothelium which supply the affected ocular structures plays a major role in the pathogenesis and development of age-related macular degeneration. Chronic inflammation is closely linked to diseases associated with endothelial dysfunction, and age-related macular degeneration is accompanied by a general inflammatory response. According to current concept, age-related macular degeneration is a local manifestation of systemic vascular disease. This recognition could have therapeutic implications because restoration of endothelial dysfunction can restabilize the condition of chronic vascular disease including age-related macular degeneration as well. Restoration of endothelial dysfunction by pharmaacological or non pharmacological interventions may prevent the development or improve endothelial dysfunction, which result in prevention or improvement of age related macular degeneration as well. Medicines including inhibitors of the renin-angiotensin system (converting enzyme inhibitors, angiotensin-receptor blockers and renin inhibitors), statins, acetylsalicylic acid, trimetazidin, third generation beta-blockers, peroxisome proliferator-activated receptor gamma agonists, folate, vitamin D, melatonin, advanced glycation end-product crosslink breaker alagebrium, endothelin-receptor antagonist bosentan, coenzyme Q10; "causal" antioxidant vitamins, N-acetyl-cysteine, resveratrol, L-arginine, serotonin receptor agonists, tumor necrosis factor-alpha blockers, specific inhibitor of the complement alternative pathway, curcumin and doxycyclin all have beneficial effects on endothelial dysfunction. Restoration of endothelial dysfunction can restabilize chronic vascular disease including age-related macular degeneration as well. Considering that the human vascular system is consubstantial, medicines listed above should be given to patients (1) who have no macular degeneration but have risk factors
Laenderyggens degeneration og radiologi
DEFF Research Database (Denmark)
Jacobsen, Steffen; Gosvig, Kasper Kjaerulf; Sonne-Holm, Stig
2006-01-01
Low back pain (LBP) is one of the most common conditions, and at the same time one of the most complex nosological entities. The lifetime prevalence is approximately 80%, and radiological features of lumbar degeneration are almost universal in adults. The individual risk factors for LBP and signi......Low back pain (LBP) is one of the most common conditions, and at the same time one of the most complex nosological entities. The lifetime prevalence is approximately 80%, and radiological features of lumbar degeneration are almost universal in adults. The individual risk factors for LBP...... and significant relationships between radiological findings and subjective symptoms have both been notoriously difficult to identify. The lack of consensus on clinical criteria and radiological definitions has hampered the undertaking of properly executed epidemiological studies. The natural history of LBP...
MRI and MR tractography in bilateral hypertrophic olivary degeneration.
Sen, Debraj; Gulati, Yoginder S; Malik, Virender; Mohimen, Aneesh; Sibi, Eranki; Reddy, Deepak Chandra
2014-10-01
Hypertrophic olivary degeneration is a trans-synaptic neuronal degeneration associated with hypertrophy of the inferior olivary nucleus due to a lesion in the triangle of Guillain-Mollaret. Familiarity with this entity on magnetic resonance imaging (MRI) is essential to avoid other erroneous ominous diagnoses. We present a case of bilateral hypertrophic olivary degeneration and discuss the etiopathogenesis and MRI findings in this entity. The contributory role of MR tractography in the diagnosis is also highlighted.
MRI and MR tractography in bilateral hypertrophic olivary degeneration
International Nuclear Information System (INIS)
Sen, Debraj; Gulati, Yoginder S.; Malik, Virender; Mohimen, Aneesh; Sibi, Eranki; Reddy, Deepak Chandra
2014-01-01
Hypertrophic olivary degeneration is a trans-synaptic neuronal degeneration associated with hypertrophy of the inferior olivary nucleus due to a lesion in the triangle of Guillain-Mollaret. Familiarity with this entity on magnetic resonance imaging (MRI) is essential to avoid other erroneous ominous diagnoses. We present a case of bilateral hypertrophic olivary degeneration and discuss the etiopathogenesis and MRI findings in this entity. The contributory role of MR tractography in the diagnosis is also highlighted
Culture independent PCR: an alternative enzyme discovery strategy
DEFF Research Database (Denmark)
Jacobsen, Jonas; Lydolph, Magnus; Lange, Lene
2005-01-01
Degenerate primers were designed for use in a culture-independent PCR screening of DNA from composite fungal communities, inhabiting residues of corn stovers and leaves. According to similarity searches and alignments amplified clone sequences affiliated with glycosyl hydrolase family 7 and glyco...... the value of culture-independent PCR in microbial diversity studies and could add to development of a new enzyme screening technology....
Rapid glutamate receptor 2 trafficking during retinal degeneration
Directory of Open Access Journals (Sweden)
Lin Yanhua
2012-02-01
Full Text Available Abstract Background Retinal degenerations, such as age-related macular degeneration (AMD and retinitis pigmentosa (RP, are characterized by photoreceptor loss and anomalous remodeling of the surviving retina that corrupts visual processing and poses a barrier to late-stage therapeutic interventions in particular. However, the molecular events associated with retinal remodeling remain largely unknown. Given our prior evidence of ionotropic glutamate receptor (iGluR reprogramming in retinal degenerations, we hypothesized that the edited glutamate receptor 2 (GluR2 subunit and its trafficking may be modulated in retinal degenerations. Results Adult albino Balb/C mice were exposed to intense light for 24 h to induce light-induced retinal degeneration (LIRD. We found that prior to the onset of photoreceptor loss, protein levels of GluR2 and related trafficking proteins, including glutamate receptor-interacting protein 1 (GRIP1 and postsynaptic density protein 95 (PSD-95, were rapidly increased. LIRD triggered neuritogenesis in photoreceptor survival regions, where GluR2 and its trafficking proteins were expressed in the anomalous dendrites. Immunoprecipitation analysis showed interaction between KIF3A and GRIP1 as well as PSD-95, suggesting that KIF3A may mediate transport of GluR2 and its trafficking proteins to the novel dendrites. However, in areas of photoreceptor loss, GluR2 along with its trafficking proteins nearly vanished in retracted retinal neurites. Conclusions All together, LIRD rapidly triggers GluR2 plasticity, which is a potential mechanism behind functionally phenotypic revisions of retinal neurons and neuritogenesis during retinal degenerations.
Intramuscular degeneration process in Duchenne muscular dystrophy
International Nuclear Information System (INIS)
Hasegawa, Takeshi; Matsumra, Kiichiro; Hashimoto, Takahiro; Ikehira, Hiroo; Fukuda, Hiroshi; Tateno, Yukio.
1992-01-01
Intramuscular degeneration process of Duchenne dystrophy skeletal muscles was investigated by longitudinal skeletal muscle imaging with high-field-strength NMR-CT of 1.5 Tesla. Thigh muscles in 10 cases ranging in age from 4 to 19 years were examined by T 1 -weighted longitudinal images (TR=215∼505 ms, TE=19∼20 ms). The following results were obtained. Skeletal muscle degeneration was depicted as high signal intensity area reflecting its high fat contents. These high signal intensity areas had a longitudinally streaky appearance in parallel direction with myofibers. These findings were more prominent toward myotendon junction than muscle bellies. Skeletal muscle degeneration progressed rapidly between 7 to 10 years of age, and reached a plateau after that. (author)
New treatment strategies for canine intervertebral disc degeneration
Smolders, L.A.
2013-01-01
Degeneration of the intervertebral disc (IVD) is a common problem in dogs and humans. IVD degeneration can lead to herniation of the IVD with subsequent compression of neural structures and various clinical signs, including back pain. Current treatment of IVD disease is conservative or surgical.
Acquired Nonpigmented Vitreous Cyst Associated With Lattice Degeneration.
Lu, Jing; Mai, Guiying; Liu, Ruyuan; Luo, Yan; Lu, Lin
2017-10-01
A 63-year-old male presented with a round-shaped floater and visual obscuration in the right eye. Clinical evaluation showed a nonpigmented vitreous cyst connected to a lattice degeneration by a stalk. Immunostaining of the vitreous cyst obtained from vitrectomy showed its origin of retinal neuroepithelium. The cyst was formed by continuous vitreous traction, which might tear up the disrupted retina at the area of lattice degeneration. This report added the lattice degeneration to the list of causes for the acquired vitreous cyst. [Ophthalmic Surg Lasers Imaging Retina. 2017;48:856-858.]. Copyright 2017, SLACK Incorporated.
DNA Extraction and Primer Selection
DEFF Research Database (Denmark)
Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads
Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...
International Nuclear Information System (INIS)
Moriyasu, K.
1981-01-01
A basic primer for QCD is presented using a semiclassical approach to the colour Maxwell equations. The non-Abelian nature of colour symmetry and the violation of superposition by colour fields is compared with QED. A simple discussion of asymptotic freedom is also presented. (author)
Hogg, Ruth E; Woodside, Jayne V; McGrath, Alanna; Young, Ian S; Vioque, Jesus L; Chakravarthy, Usha; de Jong, Paulus T; Rahu, Mati; Seland, Johan; Soubrane, Gisele; Tomazzoli, Laura; Topouzis, Fotis; Fletcher, Astrid E
2017-01-01
PURPOSE: To examine associations between adherence to a Mediterranean diet and prevalence of age-related macular degeneration (AMD) in countries ranging from Southern to Northern Europe. DESIGN: Cross-sectional, population-based epidemiologic study. PARTICIPANTS: Of 5060 randomly sampled people aged
Determination of source terms in a degenerate parabolic equation
International Nuclear Information System (INIS)
Cannarsa, P; Tort, J; Yamamoto, M
2010-01-01
In this paper, we prove Lipschitz stability results for inverse source problems relative to parabolic equations. We use the method introduced by Imanuvilov and Yamamoto in 1998 based on Carleman estimates. What is new here is that we study a class of one-dimensional degenerate parabolic equations. In our model, the diffusion coefficient vanishes at one extreme point of the domain. Instead of the classical Carleman estimates obtained by Fursikov and Imanuvilov for non degenerate equations, we use and extend some recent Carleman estimates for degenerate equations obtained by Cannarsa, Martinez and Vancostenoble. Finally, we obtain Lipschitz stability results in inverse source problems for our class of degenerate parabolic equations both in the case of a boundary observation and in the case of a locally distributed observation
Diversity of internal structures in inhibited epoxy primers
Directory of Open Access Journals (Sweden)
Anthony E. Hughes
2015-10-01
Full Text Available Computed tomography is making a significant impact in the field of materials science in recent years. In this paper the authors report on advances made in three areas of characterization and also identified where further research needs to be focused. First we report on a new approach to data analysis called “Data Constrained Modelling (DCM” in which compositional tomography can be undertaken rather than adsorption or phase contrast tomography. This is achieved by collecting X-ray CT data at different energies and then combining the datasets to reconstruct 3D compositional tomography. Second, on the application of this approach to inhibited primers typical of those used in the aerospace industry. Aerospace primers are effectively composite materials containing inorganic phases which are bound together with a polymer. Understanding the materials science of these systems requires information over several orders of magnitude in length-scale. In this paper we report on how DCM can be used to extend our understanding at the smaller length scales at the limits of resolution of the technique. The third and final advance is in extending the approach to include 4-dimensional studies. In this case we examine the primer before and after leaching. This process causes changes in the primer which can be both detected and quantified using the above approach.
MRI and MR tractography in bilateral hypertrophic olivary degeneration
Directory of Open Access Journals (Sweden)
Debraj Sen
2014-01-01
Full Text Available Hypertrophic olivary degeneration is a trans-synaptic neuronal degeneration associated with hypertrophy of the inferior olivary nucleus due to a lesion in the triangle of Guillain-Mollaret. Familiarity with this entity on magnetic resonance imaging (MRI is essential to avoid other erroneous ominous diagnoses. We present a case of bilateral hypertrophic olivary degeneration and discuss the etiopathogenesis and MRI findings in this entity. The contributory role of MR tractography in the diagnosis is also highlighted.
Preparation and Characterization of Acrylic Primer for Concrete Substrate Application
Directory of Open Access Journals (Sweden)
El-Sayed Negim
2016-01-01
Full Text Available This study dealt with the properties of acrylic primer for concrete substrate using acrylic syrup, made from a methyl methacrylate monomer solution of terpolymers. Terpolymer systems consisting of methyl methacrylate (MMA, 2-ethylhexyl acrylate (2-EHA, and methacrylic acid (MAA with different chemical composition ratios of MMA and 2-EHA were synthesized through bulk polymerization using azobisisobutyronitrile (AIBN as initiator. The terpolymer composition is characterized by FTIR, 1H NMR, DSC, TGA, and SEM. The glass transition temperature and the thermal stability increased with increasing amounts of MMA in the terpolymer backbone. The effect of chemical composition of terpolymers on physicomechanical properties of primer films was investigated. However, increasing the amount of MMA in terpolymer backbone increased tensile and contact angle of primer films while elongation at break, water absorption, and bond strength are decreased. In particular, the primer syrup containing 65% 2-EHA has good bonding strength with concrete substrate around 1.1 MPa.
Implementing Clinical Research Using Factorial Designs: A Primer.
Baker, Timothy B; Smith, Stevens S; Bolt, Daniel M; Loh, Wei-Yin; Mermelstein, Robin; Fiore, Michael C; Piper, Megan E; Collins, Linda M
2017-07-01
Factorial experiments have rarely been used in the development or evaluation of clinical interventions. However, factorial designs offer advantages over randomized controlled trial designs, the latter being much more frequently used in such research. Factorial designs are highly efficient (permitting evaluation of multiple intervention components with good statistical power) and present the opportunity to detect interactions amongst intervention components. Such advantages have led methodologists to advocate for the greater use of factorial designs in research on clinical interventions (Collins, Dziak, & Li, 2009). However, researchers considering the use of such designs in clinical research face a series of choices that have consequential implications for the interpretability and value of the experimental results. These choices include: whether to use a factorial design, selection of the number and type of factors to include, how to address the compatibility of the different factors included, whether and how to avoid confounds between the type and number of interventions a participant receives, and how to interpret interactions. The use of factorial designs in clinical intervention research poses choices that differ from those typically considered in randomized clinical trial designs. However, the great information yield of the former encourages clinical researchers' increased and careful execution of such designs. Copyright © 2017. Published by Elsevier Ltd.
Directory of Open Access Journals (Sweden)
Tai-Chi Lin
2015-11-01
Full Text Available Nanoparticles combined with cells, drugs, and specially designed genes provide improved therapeutic efficacy in studies and clinical setting, demonstrating a new era of treatment strategy, especially in retinal diseases. Nanotechnology-based drugs can provide an essential platform for sustaining, releasing and a specific targeting design to treat retinal diseases. Poly-lactic-co-glycolic acid is the most widely used biocompatible and biodegradable polymer approved by the Food and Drug Administration. Many studies have attempted to develop special devices for delivering small-molecule drugs, proteins, and other macromolecules consistently and slowly. In this article, we first review current progress in the treatment of age-related macular degeneration. Then, we discuss the function of vascular endothelial growth factor (VEGF and the pharmacological effects of anti-VEGF-A antibodies and soluble or modified VEGF receptors. Lastly, we summarize the combination of antiangiogenic therapy and nanomedicines, and review current potential targeting therapy in age-related macular degeneration.
Bond strength of compomers to dentin using acidic primers.
Tate, W H; You, C; Powers, J M
1999-10-01
To determine the in vitro bond strengths of seven compomer/bonding agent restorative systems to human dentin. Seven compomer/bonding agents were bonded to human dentin, stored in water at 37 degrees C for 24 hours, and debonded in tension. Bonding conditions were with and without phosphoric acid etching, with and without the use of combined primer/bonding agents, and under moist and wet bond interfaces. Without phosphoric acid etching, F2000/F2000 Compomer Primer/Adhesive and F2000/Single Bond Dental Adhesive System were less sensitive to dentin wetness. With moist dentin, bond strengths of Dyract/Prime & Bond 2.1, Dyract AP/Prime & Bond 2.1, Hytac/OSB light-curing, one-component bonding agent, F2000/Single Bond, and Freedom/STAE single component light-cured dentin/enamel adhesive system, were improved with phosphoric acid etching. Also, with moist dentin, the bond strength of F2000/F2000 Compomer Primer/Adhesive in the 3M Clicker dispensing system was higher without phosphoric acid etching, whereas bonds of Compoglass/Syntac Single-component were not affected by phosphoric acid etching. Bonding did not occur without primer/bonding agent, regardless of surface condition or use of phosphoric acid etching.
Progress toward the maintenance and repair of degenerating retinal circuitry.
Vugler, Anthony A
2010-01-01
Retinal diseases such as age-related macular degeneration and retinitis pigmentosa remain major causes of severe vision loss in humans. Clinical trials for treatment of retinal degenerations are underway and advancements in our understanding of retinal biology in health/disease have implications for novel therapies. A review of retinal biology is used to inform a discussion of current strategies to maintain/repair neural circuitry in age-related macular degeneration, retinitis pigmentosa, and Type 2 Leber congenital amaurosis. In age-related macular degeneration/retinitis pigmentosa, a progressive loss of rods/cones results in corruption of bipolar cell circuitry, although retinal output neurons/photoreceptive melanopsin cells survive. Visual function can be stabilized/enhanced after treatment in age-related macular degeneration, but in advanced degenerations, reorganization of retinal circuitry may preclude attempts to restore cone function. In Type 2 Leber congenital amaurosis, useful vision can be restored by gene therapy where central cones survive. Remarkable progress has been made in restoring vision to rodents using light-responsive ion channels inserted into bipolar cells/retinal ganglion cells. Advances in genetic, cellular, and prosthetic therapies show varying degrees of promise for treating retinal degenerations. While functional benefits can be obtained after early therapeutic interventions, efforts should be made to minimize circuitry changes as soon as possible after rod/cone loss. Advances in retinal anatomy/physiology and genetic technologies should allow refinement of future reparative strategies.
MCNPTM criticality primer and training experiences
International Nuclear Information System (INIS)
Briesmeister, J.; Forster, R.A.; Busch, R.
1995-01-01
With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, the analyst may have little experience with the specific codes available at his or her facility. Usually, the codes are quite complex, black boxes capable of analyzing numerous problems with a myriad of input options. Documentation for these codes is designed to cover all the possible configurations and types of analyses but does not give much detail on any particular type of analysis. For criticality calculations, the user of a code is primarily interested in the value of the effective multiplication factor for a system (k eff ). Most codes will provide this, and truckloads of other information that may be less pertinent to criticality calculations. Based on discussions with code users in the nuclear criticality safety community, it was decided that a simple document discussing the ins and outs of criticality calculations with specific codes would be quite useful. The Transport Methods Group, XTM, at Los Alamos National Laboratory (LANL) decided to develop a primer for criticality calculations with their Monte Carlo code, MCNP. This was a joint task between LANL with a knowledge and understanding of the nuances and capabilities of MCNP and the University of New Mexico with a knowledge and understanding of nuclear criticality safety calculations and educating first time users of neutronics calculations. The initial problem was that the MCNP manual just contained too much information. Almost everything one needs to know about MCNP can be found in the manual; the problem is that there is more information than a user requires to do a simple k eff calculation. The basic concept of the primer was to distill the manual to create a document whose only focus was criticality calculations using MCNP
Directory of Open Access Journals (Sweden)
Shrinivas Ashtekar
2016-01-01
Full Text Available Objective: To compare and evaluate the shear bond strength (SBS of lingual brackets, manufactured by three different processes, that is, laser sintering, milling, and casting, bonded with two different adhesive primers. Materials and Methods: One hundred and twenty premolars were selected, and three types of lingual brackets were used, namely, STB (milling, 7th Generation (casting, and lingualmatrix (laser sintering. Forty brackets per system were used half of which were sandblasted while the other half were used as available. Further, these were subdivided and bonded with Transbond XT primer and adhesive and 3M ESPE Primer and Transbond XT adhesive. Customization of STB and 7th Generation was done by Torque Angulation Reference Guide, Lingualmatrix had bases customized by Computer-aided design/computer-aided manufacturing. SBS was tested with universal testing machine and evaluated for adhesive remnant index (ARI. Results: Statistical analysis showed that surface treatment, use of different primers, method of customization influenced the SBS, and ARI suggested that the fracture occurred between composite and bracket interface. Conclusion: Lingualmatrix bracket showed greater SBS as compared to STB and 7th Generation, sandblasting increased SBS. 3M ESPE primer group showed increased SBS as that bonded with Transbond XT primer. The fracture was between the composite bracket interface.
Courtney, Elya; Courtney, Amy; Summer, Peter David; Courtney, Michael
2014-01-01
Results are presented for lead free primers based on diazodinitrophenol (DDNP)compared with tests on lead styphnate based primers. First, barrel friction measurements in 5.56 mm NATO are presented. Second, shot to shot variations in blast waves are presented as determined by detonating primers in a 7.62x51mm rifle chamber with a firing pin, but without any powder or bullet loaded and measuring the blast wave at the muzzle with a high speed pressure transducer. Third, variations in primer blas...
[Current concepts in pathogenesis of age-related macular degeneration].
Kubicka-Trząska, Agnieszka; Karska-Basta, Izabella; Romanowska-Dixon, Bożena
2014-01-01
Age-related macular degeneration is the leading cause of central blindness in elderly population of the western world. The pathogenesis of this disease, likely multifactorial, is not well known, although a number of theories have been put forward, including oxidative stress, genetic interactions, hemodynamic imbalance, immune and inflammatory processes. The understanding of age-related macular degeneration pathogenesis will give rise to new approaches in prevention and treatment of the early and late stages of both atrophic and neovascular age-related macular degeneration.
MR findings of degenerating parenchymal neurocysticercosis
International Nuclear Information System (INIS)
Lee, Yul; Chung, Eun A; Yang, Ik; Park, Hae Jung; Chung, Soo Young
1996-01-01
To evaluate MR imaging findings of degenerating parenchymal neurocysticercosis and to determine the characteristics which distinguish it from other brain diseases. MR imagings of 19 patients (56 lesions) of degenerating parenchymal neurocysticercosis were retrospectively evaluated, focusing on the size and location of lesions signal intensity patterns of cyst fluid and wall, the extent of the surrounding edema and features of contrast enhancement. Degenerating parenchymal neurocysticercosis was located in gray or subcortical while matter in 89.3% of 56 lesions (50/56) ; most of these (98.2%) were smaller than 2 cm in diameter. Cyst fluid signal was hyperintense relative to CSF on T1 and proton density weighted images (92.9%). A hypointense signal rim of the cyst wall was noted in the lesions on proton density (92.9%) and T2 weighted (98.2%) images, Surrounding edema was mostly mild. Peripheral rim enhancement was noted in all lesions, and this was frequently irregular and lobulated (67.9%) with a focal defect in the enhancing rim(41.1%). Findings which could be helpful in distinguishing degenerating parencymal neurocysticercosis from other brain diseases are as follows : small, superficial lesions ; hyperintense signal of the cyst fluid on T1 and proton density weighted images ; hypointense signal of the cyst wall on proton density and T2 weighted images ; relatively mild extent of surrounding edema, and peripheral rim enhancement which is frequently irregular and lobulated with a focal defect in the enhancing rim
Microsatellite Primers in the Lichen Symbiotic Alga Trebouxia decolorans (Trebouxiophyceae
Directory of Open Access Journals (Sweden)
Francesco Dal Grande
2013-03-01
Full Text Available Premise of the study: Polymorphic microsatellite markers were developed for the symbiotic green alga Trebouxia decolorans to study fine-scale population structure and clonal diversity. Methods and Results: Using Illumina pyrosequencing, 20 microsatellite primer sets were developed for T. decolorans. The primer sets were tested on 43 individuals sampled from four subpopulations in Germany. The primers amplified di-, tri-, and tetranucleotide repeats with three to 15 alleles per locus, and the unbiased haploid diversity per locus ranged from 0.636 to 0.821. Conclusions: The identified microsatellite markers will be useful to study the genetic diversity, dispersal, and reproductive mode of this common lichen photobiont.
40 CFR 63.745 - Standards: Primer and topcoat application operations.
2010-07-01
... CATEGORIES (CONTINUED) National Emission Standards for Aerospace Manufacturing and Rework Facilities § 63.745.../L (4.5 lb/gal) of primer (less water), as applied, for general aviation rework facilities; or 650 g... (4.5 lb/gal) of primer (less water and exempt solvents), as applied, for general aviation rework...
Maroju, Pranay Amruth; Yadav, Sonu; Kolipakam, Vishnupriya; Singh, Shweta; Qureshi, Qamar; Jhala, Yadvendradev
2016-02-09
Non-invasive sampling has opened avenues for the genetic study of elusive species, which has contributed significantly to their conservation. Where field based identity of non-invasive sample is ambiguous (e.g. carnivore scats), it is essential to establish identity of the species through molecular approaches. A cost effective procedure to ascertain species identity is to use species specific primers (SSP) for PCR amplification and subsequent resolution through agarose gel electrophoresis. However, SSPs if ill designed can often cross amplify non-target sympatric species. Herein we report the problem of cross amplification with currently published SSPs, which have been used in several recent scientific articles on tigers (Panthera tigris) and leopards (Panthera pardus) in India. Since these papers form pioneering research on which future work will be based, an early rectification is required so as to not propagate this error further. We conclusively show cross amplification of three of the four SSPs, in sympatric non-target species like tiger SSP amplifying leopard and striped hyena (Hyaena hyaena), and leopard SSP amplifying tiger, lion (Panthera leo persica) and clouded leopard (Neofelis nebulosa), with the same product size. We develop and test a non-cross-amplifying leopard specific primer pair within the mitochondrial cytochrome b region. We also standardize a duplex PCR method to screen tiger and leopard samples simultaneously in one PCR reaction to reduce cost and time. These findings suggest the importance of an often overlooked preliminary protocol of conclusive identification of species from non-invasive samples. The cross amplification of published primers in conspecifics suggests the need to revisit inferences drawn by earlier work.
CT of sarcomatous degeneration in neurofibromatosis
International Nuclear Information System (INIS)
Coleman, B.G.; Arger, P.H.; Dalinka, M.K.; Obringer, A.C.; Raney, B.R.; Meadows, A.T.
1983-01-01
Neurofibromatosis is a relatively common disorder that often involves many organ systems. One of the least understood aspects of this malady is a well documented potential for sarcomatous degeneration of neurofibromas. The inability to identify patients at risk and the lack of noninvasive screening methods for symptomatic patients often leads to late diagnosis. In six of seven subsequently proven neurofibrosarcomas, CT demonstrated low-density areas that histopathologically appeared to be due to necrosis, hemorrhage, and/or cystic degeneration. The density differences within these sarcomas were enhanced by the intravenous adminstration of iodinated contrast agents
LONGITUDINAL STRUCTURAL CHANGES IN LATE-ONSET RETINAL DEGENERATION.
Cukras, Catherine; Flamendorf, Jason; Wong, Wai T; Ayyagari, Radha; Cunningham, Denise; Sieving, Paul A
2016-12-01
To characterize longitudinal structural changes in early stages of late-onset retinal degeneration to investigate pathogenic mechanisms. Two affected siblings, both with a S163R missense mutation in the causative gene C1QTNF5, were followed for 8+ years. Color fundus photos, fundus autofluorescence images, near-infrared reflectance fundus images, and spectral domain optical coherence tomography scans were acquired during follow-up. Both patients, aged 45 and 50 years, had good visual acuities (>20/20) in the context of prolonged dark adaptation. Baseline color fundus photography demonstrated yellow-white, punctate lesions in the temporal macula that correlated with a reticular pattern on fundus autofluorescence and near-infrared reflectance imaging. Baseline spectral domain optical coherence tomography imaging revealed subretinal deposits that resemble reticular pseudodrusen described in age-related macular degeneration. During follow-up, these affected areas developed confluent thickening of the retinal pigment epithelial layer and disruption of the ellipsoid zone of photoreceptors before progressing to overt retinal pigment epithelium and outer retinal atrophy. Structural changes in early stages of late-onset retinal degeneration, revealed by multimodal imaging, resemble those of reticular pseudodrusen observed in age-related macular degeneration and other retinal diseases. Longitudinal follow-up of these lesions helps elucidate their progression to frank atrophy and may lend insight into the pathogenic mechanisms underlying diverse retinal degenerations.
MR imaging of patellar cartilage degeneration at 0.02 T
International Nuclear Information System (INIS)
Koskinen, S.K.; Komu, M.; Aho, H.J.; Kormano, M.; Turku University Hospital
1991-01-01
MR imaging with a 0.02 T resistive magnet was used to establish the correlation between the histologic grading of patellar cartilage degeneration and fat water separation images or T1- and T2-relaxation times. We examined 23 cadaveric patellae. There was a positive correlation between histologically graded cartilage degeneration and T1-relaxation time. Patellar cartilage was well differentiated from surrounding structures on chemical shift water proton images, and an evaluation of cartilage degeneration was possible. No correlation was found between cartilage degeneration damage and T2-relaxation time. Chemical shift imaging at 0.02 T is easy to perform and gives further information of cartilage disorders. (orig.)
Relationship of Tear Size and Location to Fatty Degeneration of the Rotator Cuff
Kim, H. Mike; Dahiya, Nirvikar; Teefey, Sharlene A.; Keener, Jay D.; Galatz, Leesa M.; Yamaguchi, Ken
2010-01-01
Background: Fatty degeneration of the rotator cuff muscles may have detrimental effects on both anatomical and functional outcomes following shoulder surgery. The purpose of this study was to investigate the relationship between tear geometry and muscle fatty degeneration in shoulders with a deficient rotator cuff. Methods: Ultrasonograms of both shoulders of 262 patients were reviewed to assess the type of rotator cuff tear and fatty degeneration in the supraspinatus and infraspinatus muscles. The 251 shoulders with a full-thickness tear underwent further evaluation for tear size and location. The relationship of tear size and location to fatty degeneration of the supraspinatus and infraspinatus muscles was investigated with use of statistical comparisons and regression models. Results: Fatty degeneration was found almost exclusively in shoulders with a full-thickness rotator cuff tear. Of the 251 shoulders with a full-thickness tear, eighty-seven (34.7%) had fatty degeneration in either the supraspinatus or infraspinatus, or both. Eighty-two (32.7%) of the 251 full-thickness tears had a distance of 0 mm between the biceps tendon and anterior margin of the tear. Ninety percent of the full-thickness tears with fatty degeneration in both muscles had a distance of 0 mm posterior from the biceps, whereas only 9% of those without fatty degeneration had a distance of 0 mm. Tears with fatty degeneration had significantly greater width and length than those without fatty degeneration (p Tears with fatty degeneration had a significantly shorter distance posterior from the biceps than those without fatty degeneration (p tear width and length were found to be the most important predictors for infraspinatus fatty degeneration. Conclusions: Fatty degeneration of the rotator cuff muscles is closely associated with tear size and location. The finding of this study suggests that the integrity of the anterior supraspinatus tendon is important to the development of fatty
Ethanol Exposure Causes Muscle Degeneration in Zebrafish
Directory of Open Access Journals (Sweden)
Elizabeth C. Coffey
2018-03-01
Full Text Available Alcoholic myopathies are characterized by neuromusculoskeletal symptoms such as compromised movement and weakness. Although these symptoms have been attributed to neurological damage, EtOH may also target skeletal muscle. EtOH exposure during zebrafish primary muscle development or adulthood results in smaller muscle fibers. However, the effects of EtOH exposure on skeletal muscle during the growth period that follows primary muscle development are not well understood. We determined the effects of EtOH exposure on muscle during this phase of development. Strikingly, muscle fibers at this stage are acutely sensitive to EtOH treatment: EtOH induces muscle degeneration. The severity of EtOH-induced muscle damage varies but muscle becomes more refractory to EtOH as muscle develops. NF-kB induction in muscle indicates that EtOH triggers a pro-inflammatory response. EtOH-induced muscle damage is p53-independent. Uptake of Evans blue dye shows that EtOH treatment causes sarcolemmal instability before muscle fiber detachment. Dystrophin-null sapje mutant zebrafish also exhibit sarcolemmal instability. We tested whether Trichostatin A (TSA, which reduces muscle degeneration in sapje mutants, would affect EtOH-treated zebrafish. We found that TSA and EtOH are a lethal combination. EtOH does, however, exacerbate muscle degeneration in sapje mutants. EtOH also disrupts adhesion of muscle fibers to their extracellular matrix at the myotendinous junction: some detached muscle fibers retain beta-Dystroglycan indicating failure of muscle end attachments. Overexpression of Paxillin, which reduces muscle degeneration in zebrafish deficient for beta-Dystroglycan, is not sufficient to rescue degeneration. Taken together, our results suggest that EtOH exposure has pleiotropic deleterious effects on skeletal muscle.
Rockne, Karl J; Strand, Stuart E
2003-09-01
Type II alpha proteobacteria methanotrophs are capable of a wide range of cometabolic transformations of chlorinated solvents and polycyclic aromatic hydrocarbons (PAHs), and this activity has been exploited in many terrestrial bioremediation systems. However, at present, all known obligately marine methanotrophic isolates are Type I gamma proteobacteria which do not have this activity to the extent of Type II methanotrophs. In previous work in our laboratory, determining the presence of Type II alpha proteobacteria methanotrophs in marine enrichment cultures that co-metabolized PAHs required a more sensitive assay. 16S rDNA PCR primers were designed based on oligonucleotide probes for serine pathway methanotrophs and serine pathway methylotrophs with an approximate amplification fragment size of 870 base pairs. Comparison of the primers using double primer BLAST searches in established nucleotide databases showed potential amplification with all Methylocystis and Methylosinus spp., as well as potential amplification with Methylocella palustrus. DNA from Methylosinus trichosporium OB3b, a Type II methanotroph, amplified with the primers with a fragment size of approximately 850 base pairs, whereas DNA extracted from Methylomonas methanica, a Type I methanotroph, did not. The primers were used to amplify DNA extracted from two marine methanotrophic enrichment cultures: a low nitrogen/low copper enrichment to select for Type II methanotrophs and a high nitrogen/high copper enrichment to select for Type I methanotrophs. Although DNA from both cultures amplified with the PCR primers, amplification was stronger in cultures that were specifically enriched for Type II methanotrophs, suggesting the presence of higher numbers of Type II methanotrophs. These results provide further evidence for the existence of Type II marine methanotrophs, suggesting the possibility of exploiting cometabolic activity in marine systems.
Gonzalez-Martinez, A.; Rodriguez-Sanchez, A.; Rodelas, B.; Abbas, B.A.; Martinez-Toledo, M.V.; Van Loosdrecht, M.C.M.; Osorio, F.; Gonzalez-Lopez, J.
2015-01-01
Identification of anaerobic ammonium oxidizing (anammox) bacteria by molecular tools aimed at the evaluation of bacterial diversity in autotrophic nitrogen removal systems is limited by the difficulty to design universal primers for the Bacteria domain able to amplify the anammox 16S
Surentheran, T; Harwood, C A; Spink, P J; Sinclair, A L; Leigh, I M; Proby, C M; McGregor, J M; Breuer, J
1998-01-01
AIM: To develop a unified diagnostic approach for the detection of human papillomavirus (HPV) DNA in skin and mucosal biopsies from both immunocompetent and immunosuppressed individuals using a degenerate polymerase chain reaction (PCR) method. METHODS: The sensitivity and specificity of three published degenerate primer sets (HVP2/B5 and F14/B15; MY09/MY11; CP62/69 outer and CP65/68 nested primer pairs) were evaluated in PCR reactions with serial dilutions of 12 representative cloned HPV typ...
Prevalence of age-related macular degeneration in elderly Caucasians
DEFF Research Database (Denmark)
Erke, Maja G; Bertelsen, Geir; Peto, Tunde
2012-01-01
To describe the sex- and age-specific prevalence of drusen, geographic atrophy, and neovascular age-related macular degeneration (AMD).......To describe the sex- and age-specific prevalence of drusen, geographic atrophy, and neovascular age-related macular degeneration (AMD)....
Cheng, Yu-Huei
2014-12-01
Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.
The Fluid Reading Primer: Animated Decoding Support for Emergent Readers.
Zellweger, Polle T.; Mackinlay, Jock D.
A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…
[Myopia: frequency of lattice degeneration and axial length].
Martín Sánchez, M D; Roldán Pallarés, M
2001-05-01
To evaluate the relationship between lattice retinal degeneration and axial length of the eye in different grades of myopia. A sample of 200 eyes from 124 myopic patients was collected by chance. The average age was 34.8 years (20-50 years) and the myopia was between 0.5 and 20 diopters (D). The eyes were grouped according to the degree of refraction defect, the mean axial length of each group (Scan A) and the frequency of lattice retinal degeneration and the relationship between these variables was studied. The possible influence of age on our results was also considered. For the statistical analysis, the SAS 6.07 program with the variance analysis for quantitative variables, and chi(2) test for qualitative variables with a 5% significance were used. A multivariable linear regression model was also adjusted. The highest frequency of lattice retinal degeneration occurred in those myopia patients having more than 15 D, and also in the group of myopia patients between 3 and 6 D, but this did not show statistical significance when compared with the other myopic groups. If the axial length is assessed, a greater frequency of lattice retinal degeneration is also found when the axial length is 25-27 mm and 29-30 mm, which correspond, respectively, to myopias between 3-10 D and more than 15 D. When the multivariable linear regression model was adjusted, the axial length showed the existence of lattice retinal degeneration (beta 0.41 mm; p=0.08) adjusted by the number of diopters (beta 0.38 mm; plattice retinal degeneration was found for myopias with axial eye length between 29-30 mm (more than 15 D), and 25-27 mm (between 3-10 D).
Cesare Lombroso: an anthropologist between evolution and degeneration.
Mazzarello, Paolo
2011-01-01
Cesare Lombroso (1835-1909) was a prominent Italian medical doctor and intellectual in the second half of the nineteenth century. He became world famous for his theory that criminality, madness and genius were all sides of the same psychobiological condition: an expression of degeneration, a sort of regression along the phylogenetic scale, and an arrest at an early stage of evolution. Degeneration affected criminals especially, in particular the "born delinquent" whose development had stopped at an early stage, making them the most "atavistic" types of human being. Lombroso also advocated the theory that genius was closely linked with madness. A man of genius was a degenerate, an example of retrograde evolution in whom madness was a form of "biological compensation" for excessive intellectual development. To confirm this theory, in August 1897, Lombroso, while attending the Twelfth International Medical Congress in Moscow, decided to meet the great Russian writer Lev Tolstoy in order to directly verify, in him, his theory of degeneration in the genius. Lombroso's anthropological ideas fuelled a heated debate on the biological determinism of human behaviour.
Therapeutic Approaches to Histone Reprogramming in Retinal Degeneration.
Berner, Andre K; Kleinman, Mark E
2016-01-01
Recent data have revealed epigenetic derangements and subsequent chromatin remodeling as a potent biologic switch for chronic inflammation and cell survival which are important therapeutic targets in the pathogenesis of several retinal degenerations. Histone deacetylases (HDACs) are a major component of this system and serve as a unique control of the chromatin remodeling process. With a multitude of targeted HDAC inhibitors now available, their use in both basic science and clinical studies has widened substantially. In the field of ocular biology, there are data to suggest that HDAC inhibition may suppress neovascularization and may be a possible treatment for retinitis pigmentosa and dry age-related macular degeneration (AMD). However, the effects of these inhibitors on cell survival and chemokine expression in the chorioretinal tissues remain very unclear. Here, we review the multifaceted biology of HDAC activity and pharmacologic inhibition while offering further insight into the importance of this epigenetic pathway in retinal degenerations. Our laboratory investigations aim to open translational avenues to advance dry AMD therapeutics while exploring the role of acetylation on inflammatory gene expression in the aging and degenerating retina.
Hypersensitivity to DNA-damaging agents in primary degenerations of excitable tissue
International Nuclear Information System (INIS)
Robbins, J.H.
1983-01-01
Defects in DNA-repair mechanisms render xeroderma pigmentosum cells hypersensitive to killing by the uv-type of DNA-damaging agent. Some xeroderma pigmentosum patients develop a primary neuronal degeneration, and cell lines from patients with the earliest onset of neurodegeneration are the most sensitive to killing by uv radiation. These findings led to the neuronal DNA integrity theory which holds that when the integrity of neuronal DNA is destroyed by the accumulation of unrepaired DNA damaged spontaneously or by endogenous metabolites, the neurons will undergo a primary degeneration. Cells from patients with Cockayne syndrome, a demyelinating disorder with a primary retinal degeneration, are also hypersensitive to the uv-type of DNA-damaging agent. Cells from patients with the primary neuronal degeneration of ataxia telangiectasia are hypersensitive to the x-ray-type of DNA-damaging agent. Cells from other patients with primary degeneration of excitable tissue also have hypersensitivity to the x-ray-type of DNA-damaging agent. These disorders include (1) primary neuronal degenerations which are either genetic (e.g., Huntington disease, familial dysautonomia, Friedreich ataxia) or sporadic (e.g., Alzheimer disease, Parkinson disease), (2) primary muscle degenerations (e.g., Duchenne muscular dystrophy), and (3) a primary retinal degeneration (Usher syndrome). Death of excitable tissue in vivo in these radiosensitive diseases may result from unrepaired DNA. This hypersensitivity provides the basis for developing suitable presymptomatic and prenatal tests for these diseases, for elucidating their pathogenesis, and for developing future therapies. 119 references, 3 figures, 3 tables
Defense Primer: DOD Contractors
2017-02-10
functions, from intelligence analysis or software development to landscaping or food service. Why does DOD use individual contractors? Going back to...that provide professional services, from research to management support. The bulk of contractors—more than 70%—provide products, and these include...10 U.S.C. Part IV: Service, Supply, and Procurement. CRS Products CRS In Focus IF10548, Defense Primer: U.S. Defense Industrial Base, by Daniel
Assessment of fungal diversity in deep-sea sediments by multiple primer approach
Digital Repository Service at National Institute of Oceanography (India)
Singh, P.; Raghukumar, C.; Verma, P.; Shouche, Y.
products were gel-purified and ligated with pGEM-T easy vector (Promega, USA) and transformed into E. coli cells (Invitrogen, Carlsbad, CA), following the manufacturer’s instructions. Transformants were grown overnight at 37°C on Luria Bertani agar... using culture-independent approach by targeting universal 18S as well as fungal specific and universal ITS (internal transcribed spacers) regions of rRNA genes from three locations in the CIB. It is known that some of the primer pairs designed...
Freshwater Wetlands: A Citizen's Primer.
Catskill Center for Conservation and Development, Inc., Hobart, NY.
The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…
Relationship between full-thickness macular hole and retinal break/lattice degeneration.
Zhang, Jinglin; Li, Yonghao; Zhao, Xiujuan; Cai, Yu; Yu, Xiling; Lu, Lin
2015-12-01
The purpose is to investigate the relationship between full-thickness macular hole (MH) and retinal break (RB) and/or lattice degeneration. Patients diagnosed as full-thickness MH and referred to Dr. Lin Lu from January 2009 to December 2013 were evaluated. All patients underwent general ophthalmologic examinations, fundus examination and optical coherence tomography (OCT). The RB and/or lattice degeneration were recorded. Totally 183 eyes of 167 patients were included. The sex ratio of men to women was 1:2.88. A total of 17 eyes were pseudophakic and 166 eyes were phakic. RB and/or lattice degeneration were found in 62 eyes (33.88%). The prevalence of RB and/or lattice degeneration was similar between men and women (P = 0.344 > 0.05). There was no statistical difference between the pseudophakic eyes and phakic eyes (P = 0.138 > 0.05). All of the RB and/or lattice degeneration were located near or anterior to the equator. The inferior quadrants and the vertical meridian were affected more often than the superior quadrants and the horizontal meridian. We identified a high incidence of RB/lattice degeneration in cases of full-thickness MH. Carefully examination of the peripheral retina and prophylactic treatment of RB and/or lattice degeneration are critical.
Quantitative Microbial Risk Assessment Tutorial - Primer
This document provides a Quantitative Microbial Risk Assessment (QMRA) primer that organizes QMRA tutorials. The tutorials describe functionality of a QMRA infrastructure, guide the user through software use and assessment options, provide step-by-step instructions for implementi...
Directory of Open Access Journals (Sweden)
Gardner Shea N
2011-06-01
Full Text Available Abstract Background We developed an extendable open-source Loop-mediated isothermal AMPlification (LAMP signature design program called LAVA (LAMP Assay Versatile Analysis. LAVA was created in response to limitations of existing LAMP signature programs. Results LAVA identifies combinations of six primer regions for basic LAMP signatures, or combinations of eight primer regions for LAMP signatures with loop primers, which can be used as LAMP signatures. The identified primers are conserved among target organism sequences. Primer combinations are optimized based on lengths, melting temperatures, and spacing among primer sites. We compare LAMP signature candidates for Staphylococcus aureus created both by LAVA and by PrimerExplorer. We also include signatures from a sample run targeting all strains of Mycobacterium tuberculosis. Conclusions We have designed and demonstrated new software for identifying signature candidates appropriate for LAMP assays. The software is available for download at http://lava-dna.googlecode.com/.
Saulsberry, Regor L.; McDougle, Stephen H.; Garcia,Roberto; Johnson, Kenneth L.; Sipes, William; Rickman, Steven; Hosangadi, Ashvin
2011-01-01
An assessment of four spacecraft pyrovalve anomalies that occurred during ground testing was conducted by the NASA Engineering & Safety Center (NESC) in 2008. In all four cases, a common aluminum (Al) primer chamber assembly (PCA) was used with dual NASA Standard Initiators (NSIs) and the nearly simultaneous (separated by less than 80 microseconds) firing of both initiators failed to ignite the booster charge. The results of the assessment and associated test program were reported in AIAA Paper AIAA-2008-4798, NESC Independent Assessment of Pyrovalve Ground Test Anomalies. As a result of the four Al PCA anomalies, and the test results and findings of the NESC assessment, the Mars Science Laboratory (MSL) project team decided to make changes to the PCA. The material for the PCA body was changed from aluminum (Al) to stainless steel (SS) to avoid melting, distortion, and potential leakage of the NSI flow passages when the device functioned. The flow passages, which were interconnected in a Y-shaped configuration (Y-PCA) in the original design, were changed to a V-shaped configuration (V-PCA). The V-shape was used to more efficiently transfer energy from the NSIs to the booster. Development and qualification testing of the new design clearly demonstrated faster booster ignition times compared to the legacy AL Y-PCA design. However, the final NESC assessment report recommended that the SS V-PCA be experimentally characterized and quantitatively compared to the Al Y-PCA design. This data was deemed important for properly evaluating the design options for future NASA projects. This test program has successfully quantified the improvement of the SS V-PCA over the Al Y-PCA. A phase B of the project was also conducted and evaluated the effect of firing command skew and enlargement of flame channels to further assist spacecraft applications.
An Unusual Case of Extensive Lattice Degeneration and Retinal Detachment
Mathew, David J.; Sarma, Saurabh Kumar; Basaiawmoit, Jennifer V.
2016-01-01
Lattice degeneration of the retina is not infrequently encountered on a dilated retinal examination and many of them do not need any intervention. We report a case of atypical lattice degeneration variant with peripheral retinal detachment. An asymptomatic 35-year-old lady with minimal refractive error was found to have extensive lattice degeneration, peripheral retinal detachment and fibrotic changes peripherally with elevation of retinal vessels on dilated retinal examination. There were al...
Retinal Cell Degeneration in Animal Models
Directory of Open Access Journals (Sweden)
Masayuki Niwa
2016-01-01
Full Text Available The aim of this review is to provide an overview of various retinal cell degeneration models in animal induced by chemicals (N-methyl-d-aspartate- and CoCl2-induced, autoimmune (experimental autoimmune encephalomyelitis, mechanical stress (optic nerve crush-induced, light-induced and ischemia (transient retinal ischemia-induced. The target regions, pathology and proposed mechanism of each model are described in a comparative fashion. Animal models of retinal cell degeneration provide insight into the underlying mechanisms of the disease, and will facilitate the development of novel effective therapeutic drugs to treat retinal cell damage.
Sensory reception of the primer pheromone ethyl oleate
Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang
2012-05-01
Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.
Directory of Open Access Journals (Sweden)
Elif Çepni
2012-01-01
Full Text Available In this study, Pseudomonas syringe pathovars isolated from olive, tomato and bean were identified by species-specific PCR and their genetic diversity was assessed by repetitive extragenic palindromic (REP-PCR. Reverse universal primers for REP-PCR were designed by using the bases of A, T, G or C at the positions of 1, 4 and 11 to identify additional polymorphism in the banding patterns. Binding of the primers to different annealing sites in the genome revealed additional fingerprint patterns in eight isolates of P. savastanoi pv. savastanoi and two isolates of P. syringae pv. tomato. The use of four different bases in the primer sequences did not affect the PCR reproducibility and was very efficient in revealing intra-pathovar diversity, particularly in P. savastanoi pv. savastanoi. At the pathovar level, the primer BOX1AR yielded shared fragments, in addition to five bands that discriminated among the pathovars P. syringae pv. phaseolicola, P. savastanoi pv. savastanoi and P. syringae pv. tomato. REP-PCR with a modified primer containing C produced identical bands among the isolates in a pathovar but separated three pathovars more distinctly than four other primers. Although REP-and BOX-PCRs have been successfully used in the molecular identification of Pseudomonas isolates from Turkish flora, a PCR based on inter-enterobacterial repetitive intergenic concensus (ERIC sequences failed to produce clear banding patterns in this study.
Families and degenerations of conformal field theories
Energy Technology Data Exchange (ETDEWEB)
Roggenkamp, D.
2004-09-01
In this work, moduli spaces of conformal field theories are investigated. In the first part, moduli spaces corresponding to current-current deformation of conformal field theories are constructed explicitly. For WZW models, they are described in detail, and sigma model realizations of the deformed WZW models are presented. The second part is devoted to the study of boundaries of moduli spaces of conformal field theories. For this purpose a notion of convergence of families of conformal field theories is introduced, which admits certain degenerated conformal field theories to occur as limits. To such a degeneration of conformal field theories, a degeneration of metric spaces together with additional geometric structures can be associated, which give rise to a geometric interpretation. Boundaries of moduli spaces of toroidal conformal field theories, orbifolds thereof and WZW models are analyzed. Furthermore, also the limit of the discrete family of Virasoro minimal models is investigated. (orig.)
The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers
Danford, M. D.; Mendrek, M. J.; Walsh, D. W.
1995-01-01
The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.
DEFF Research Database (Denmark)
Fredslund, Jakob; Schauser, Leif; Madsen, Lene Heegaard
2005-01-01
Using a comparative approach, the web program PriFi (http://cgi-www.daimi.au.dk/cgi-chili/PriFi/main) designs pairs of primers useful for PCR amplification of genomic DNA in species where prior sequence information is not available. The program works with an alignment of DNA sequences from phylog...
Identification of E. coli O157:H7 by Using Specific Primers for rfbE and stx2b Genes
Directory of Open Access Journals (Sweden)
Mostafa Bakhshi
2017-07-01
Sorbitol-MacConkey agar was used to verification of growth ability of selected colonies during PCR. Results: By appearance of the bonds belong to rfbE and stx2B genes on agarose gel, the ability of designed primers in gene detection in samples of E .coli O157:H7 was verified. Colonies which selected during PCR have growth potency on sorbitol-MacConkey agar medium. Conclusion: It was revealed that we can prepare a fast, precise and relative comfortable method for detection of E. coli O157:H7 strain by using PCR technique and specific primers than other available methods.
A dam for retrograde axonal degeneration in multiple sclerosis?
Balk, L.J.; Twisk, J.W.R.; Steenwijk, M.D.; Daams, M.; Tewarie, P.; Killestein, J.; Uitdehaag, B.M.J.; Polman, C.H.; Petzold, A.F.S.
2014-01-01
Objective: Trans-synaptic axonal degeneration is a mechanism by which neurodegeneration can spread from a sick to a healthy neuron in the central nervous system. This study investigated to what extent trans-synaptic axonal degeneration takes place within the visual pathway in multiple sclerosis
Cystic adventitial degeneration: ectopic ganglia from adjacent joint capsules.
Ortmann, J; Widmer, M K; Gretener, S; Do, D D; Willenberg, T; Daliri, A; Baumgartner, I
2009-11-01
Cystic adventitial degeneration is a rare non-atherosclerotic cause of peripheral arterial occlusive disease, mainly seen in young men without other evidence of vascular disease. Diagnosis will be established by clinical findings and by ultrasound or angiography and can be treated by excision or enucleation of the affected arterial segment or by percutaneous ultrasound-guided aspiration. However, the etiology of adventitial cysts remains unknown. We report a case of cystic adventitial degeneration showing a connection between the joint capsule and the adventitial cyst, supporting the theory that cystic adventitial degeneration may represent ectopic ganglia from adjacent joint capsules.
Ecological transition predictably associated with gene degeneration.
Wessinger, Carolyn A; Rausher, Mark D
2015-02-01
Gene degeneration or loss can significantly contribute to phenotypic diversification, but may generate genetic constraints on future evolutionary trajectories, potentially restricting phenotypic reversal. Such constraints may manifest as directional evolutionary trends when parallel phenotypic shifts consistently involve gene degeneration or loss. Here, we demonstrate that widespread parallel evolution in Penstemon from blue to red flowers predictably involves the functional inactivation and degeneration of the enzyme flavonoid 3',5'-hydroxylase (F3'5'H), an anthocyanin pathway enzyme required for the production of blue floral pigments. Other types of genetic mutations do not consistently accompany this phenotypic shift. This pattern may be driven by the relatively large mutational target size of degenerative mutations to this locus and the apparent lack of associated pleiotropic effects. The consistent degeneration of F3'5'H may provide a mechanistic explanation for the observed asymmetry in the direction of flower color evolution in Penstemon: Blue to red transitions are common, but reverse transitions have not been observed. Although phenotypic shifts in this system are likely driven by natural selection, internal constraints may generate predictable genetic outcomes and may restrict future evolutionary trajectories. © The Author 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Bradley, Ian M; Pinto, Ameet J; Guest, Jeremy S
2016-10-01
The use of high-throughput sequencing technologies with the 16S rRNA gene for characterization of bacterial and archaeal communities has become routine. However, the adoption of sequencing methods for eukaryotes has been slow, despite their significance to natural and engineered systems. There are large variations among the target genes used for amplicon sequencing, and for the 18S rRNA gene, there is no consensus on which hypervariable region provides the most suitable representation of diversity. Additionally, it is unclear how much PCR/sequencing bias affects the depiction of community structure using current primers. The present study amplified the V4 and V8-V9 regions from seven microalgal mock communities as well as eukaryotic communities from freshwater, coastal, and wastewater samples to examine the effect of PCR/sequencing bias on community structure and membership. We found that degeneracies on the 3' end of the current V4-specific primers impact read length and mean relative abundance. Furthermore, the PCR/sequencing error is markedly higher for GC-rich members than for communities with balanced GC content. Importantly, the V4 region failed to reliably capture 2 of the 12 mock community members, and the V8-V9 hypervariable region more accurately represents mean relative abundance and alpha and beta diversity. Overall, the V4 and V8-V9 regions show similar community representations over freshwater, coastal, and wastewater environments, but specific samples show markedly different communities. These results indicate that multiple primer sets may be advantageous for gaining a more complete understanding of community structure and highlight the importance of including mock communities composed of species of interest. The quantification of error associated with community representation by amplicon sequencing is a critical challenge that is often ignored. When target genes are amplified using currently available primers, differential amplification efficiencies
Walraevens, Joris; Liu, Baoge; Meersschaert, Joke; Demaerel, Philippe; Delye, Hans; Depreitere, Bart; Vander Sloten, Jos; Goffin, Jan
2009-03-01
Degeneration of intervertebral discs and facet joints is one of the most frequently encountered spinal disorders. In order to describe and quantify degeneration and evaluate a possible relationship between degeneration and biomechanical parameters, e.g., the intervertebral range of motion and intradiscal pressure, a scoring system for degeneration is mandatory. However, few scoring systems for the assessment of degeneration of the cervical spine exist. Therefore, two separate objective scoring systems to qualitatively and quantitatively assess the degree of cervical intervertebral disc and facet joint degeneration were developed and validated. The scoring system for cervical disc degeneration consists of three variables which are individually scored on neutral lateral radiographs: "height loss" (0-4 points), "anterior osteophytes" (0-3 points) and "endplate sclerosis" (0-2 points). The scoring system for facet joint degeneration consists of four variables which are individually scored on neutral computed tomography scans: "hypertrophy" (0-2 points), "osteophytes" (0-1 point), "irregularity" on the articular surface (0-1 point) and "joint space narrowing" (0-1 point). Each variable contributes with varying importance to the overall degeneration score (max 9 points for the scoring system of cervical disc degeneration and max 5 points for facet joint degeneration). Degeneration of 20 discs and facet joints of 20 patients was blindly assessed by four raters: two neurosurgeons (one senior and one junior) and two radiologists (one senior and one junior), firstly based on first subjective impression and secondly using the scoring systems. Measurement errors and inter- and intra-rater agreement were determined. The measurement error of the scoring system for cervical disc degeneration was 11.1 versus 17.9% of the subjective impression results. This scoring system showed excellent intra-rater agreement (ICC = 0.86, 0.75-0.93) and excellent inter-rater agreement (ICC = 0
DEFF Research Database (Denmark)
Devert, Anthony; Fabre, Nicolas; Floris, Maina Huguette Joséphine
2015-01-01
) targeted by RNA silencing. The dsRNA is subsequently cleaved by the ribonuclease DICER-like into secondary small interfering RNAs (siRNAs) that reinforce and/or maintain the silenced state of the target RNA. Models of RNA silencing propose that RDRs could use primer-independent and primer......Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA......-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer...
Nonspecific amplification of human DNA by Streptococcus pneumoniae LytA primer
Directory of Open Access Journals (Sweden)
Helen Hencida Thangamony
2018-01-01
Full Text Available Background: Determination of various analytical parameters is essential for the validation of primers used for in-house nucleic acid amplification tests. While standardising a high-resolution melt analysis (HRMA for detection of Streptococcus pneumoniae in acute pyogenic meningitis, we encountered non-specific amplification of certain base pair sequences of human DNA by Centers for Disease Control & Prevention, USA recommended S. pneumoniae LytA primer. Materials and Methods: HRMA was standardised using DNA extracted from an ATCC strain of S. pneumoniae using SP LytA F373 primer and Type-it HRMTM polymerase chain reaction kit in Rotor-Gene Q Thermal Cycler according to the manufacturer's instructions. Specificity of the primers was determined in dry and wet laboratory experiments against diverse related and unrelated microbial pathogens by HRMA and on DNA extracted from unspiked clinical samples negative for SP DNA. Sensitivity was determined by calculating lower limit of detection threshold in experiments with spiked samples. The amplicon from spiked experiments was sequenced and analysed through Gene Bank. Results: Our dry/wet laboratory experiments showed two separate curves and different Tm values indicating certain non-specific amplification by the primer. Basic Local Alignment Search Tool (BLAST analysis of the amplicon obtained in the spiked experiment showed sequences of human chromosome 20 associated with Homo sapiens protein tyrosine phosphatase, receptor type T gene. The problem was resolved by stopping the reaction at 30th Ct cycle and observing the Tm values. Conclusion: Since HRMA is done without a specific probe, one should be aware of non-specific amplifications while using primers for HRMA of human clinical samples.
Ekstrom, Claus Thorn
2011-01-01
Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i
Wang, Yong; Qian, Pei-Yuan
2009-01-01
Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions
Self-reported optometric practise patterns in age-related macular degeneration.
Ly, Angelica; Nivison-Smith, Lisa; Zangerl, Barbara; Assaad, Nagi; Kalloniatis, Michael
2017-11-01
The use of advanced imaging in clinical practice is emerging and the use of this technology by optometrists in assessing patients with age-related macular degeneration is of interest. Therefore, this study explored contemporary, self-reported patterns of practice regarding age-related macular degeneration diagnosis and management using a cross-sectional survey of optometrists in Australia and New Zealand. Practising optometrists were surveyed on four key areas, namely, demographics, clinical skills and experience, assessment and management of age-related macular degeneration. Questions pertaining to self-rated competency, knowledge and attitudes used a five-point Likert scale. Completed responses were received from 127 and 87 practising optometrists in Australia and New Zealand, respectively. Advanced imaging showed greater variation in service delivery than traditional techniques (such as slitlamp funduscopy) and trended toward optical coherence tomography, which was routinely performed in age-related macular degeneration by 49 per cent of respondents. Optical coherence tomography was also associated with higher self-rated competency, knowledge and perceived relevance to practice than other modalities. Most respondents (93 per cent) indicated that they regularly applied patient symptoms, case history, visual function results and signs from traditional testing, when queried about their management of patients with age-related macular degeneration. Over half (63 per cent) also considered advanced imaging, while 31 per cent additionally considered all of these as well as the disease stage and clinical guidelines. Contrary to the evidence base, 68 and 34 per cent rated nutritional supplements as highly relevant or relevant in early age-related macular degeneration and normal aging changes, respectively. These results highlight the emergence of multimodal and advanced imaging (especially optical coherence tomography) in the assessment of age-related macular degeneration
THE QUALITY IMPROVEMENT OF PRIMER PACKAGING PROCESS USING SIX SIGMA METHODOLOGY
Directory of Open Access Journals (Sweden)
Prima Ditahardiyani
2008-01-01
Full Text Available The implementation of Six Sigma has become a common theme in many organizations. This paper presents the Six Sigma methodology and its implementation in a primer packaging process of Cranberry drink. DMAIC (Define, Measure, Analyze, Improve and Control approach is used to analyze and to improve the primer packaging process, which have high variability and defects output. After the improvement, the results showed that there was an increasing sigma level. However, it is not significantly and has not achieved the world standard quality, yet. Therefore, the implementation of Six Sigma in primer packaging process of Cranberry drink still has a room for doing a further research.
Electromagnetic solitons in degenerate relativistic electron–positron plasma
International Nuclear Information System (INIS)
Berezhiani, V I; Shatashvili, N L; Tsintsadze, N L
2015-01-01
The existence of soliton-like electromagnetic (EM) distributions in a fully degenerate electron–positron plasma is studied applying relativistic hydrodynamic and Maxwell equations. For a circularly polarized wave it is found that the soliton solutions exist both in relativistic as well as nonrelativistic degenerate plasmas. Plasma density in the region of soliton pulse localization is reduced considerably. The possibility of plasma cavitation is also shown. (invited comment)
Galkiewicz, Julia P; Kellogg, Christina A
2008-12-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.
Galkiewicz, Julia P.; Kellogg, Christina A.
2008-01-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.
Elkins, Kelly M.; Kadunc, Raelynn E.
2012-01-01
In this laboratory experiment, real-time polymerase chain reaction (real-time PCR) was conducted using published human TPOX single-locus DNA primers for validation and various student-designed short tandem repeat (STR) primers for Combined DNA Index System (CODIS) loci. SYBR Green was used to detect the amplification of the expected amplicons. The…
Localized thermonuclear runaways and volcanoes on degenerate dwarf stars
Energy Technology Data Exchange (ETDEWEB)
Shara, M.M.
1982-10-15
Practically all studies to date of thermonuclear runaways on degenerate dwarf stars in binary systems have considered only spherically symmetric eruptions. We emphasize that even slightly non-spherically symmetric accretion leads to transverse temperature gradients in the dwarfs' accreted envelopes. Over a rather broad range of parameter space, thermalization time scales in accreted envelopes are much longer than thermonuclear runaway time scales. Thus localized thermonuclear runaways (i.e., runaways much smaller than the host degenerate star) rather than spherically symmetric global eruptions are likely to occur on many degenerate dwarfs. Localized runaways are more likely to occur on more massive and/or hotter dwarfs.
Molecular passportization of clones of karelian birch using PCRwith semi-specific primers
Directory of Open Access Journals (Sweden)
Tatyana V Matveeva
2008-09-01
Full Text Available Using 4 clones of Karelian birch (Betula pendula Roth var caretica Merckl. from the collection of the karelian birch of the laboratory of genetics of Research Institute of Forest Genetics and Breeding, Voronezh, one normal tree of Betula pendula Roth, and one tree of B. pubescens Ehrh., collected from the nature, we have analyzed the possibility of application of PCR with semi-specific primers for molecular typing. We found primers with high percentage of polymorphic markers. These primers could be recommended for molecular typing of birch.
Grassmann, Felix; Fauser, Sascha; Weber, Bernhard H F
2015-09-01
Age-related macular degeneration (AMD) is a progressive disease of the central retina and the main cause of legal blindness in industrialized countries. Risk to develop the disease is conferred by both individual as well as genetic factors with the latter being increasingly deciphered over the last decade. Therapeutically, striking advances have been made for the treatment of the neovascular form of late stage AMD while for the late stage atrophic form of the disease, which accounts for almost half of the visually impaired, there is currently no effective therapy on the market. This review highlights our current knowledge on the genetic architecture of early and late stage AMD and explores its potential for the discovery of novel, target-guided treatment options. We reflect on current clinical and experimental therapies for all forms of AMD and specifically note a persisting lack of efficacy for treatment in atrophic AMD. We further explore the current insight in AMD-associated genes and pathways and critically question whether this knowledge is suited to design novel treatment options. Specifically, we point out that known genetic factors associated with AMD govern the risk to develop disease and thus may not play a role in its severity or progression. Treatments based on such knowledge appear appropriate rather for prevention than treatment of manifest disease. As a consequence, future research in AMD needs to be greatly focused on approaches relevant to the patients and their medical needs. Copyright © 2015 Elsevier B.V. All rights reserved.
Galkiewicz, Julia P.; Kellogg, Christina A.
2008-01-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299
El primer virreinato americano
Directory of Open Access Journals (Sweden)
Cassá, Roberto
2006-12-01
Full Text Available This article explores the government of viceroy Christopher Columbus in the American territories. We return to the first Spanish settlement in Santo Domingo and the contradictions inherent to this expansionist proyect. The contradictions were part of the
logic of the absolutist state and Columbus’ reaction against the controls imposed by the monarchs. Secondly, we look into the dificulties that the Admiral encountered to develop a mercantilist model. In this context, we examine the rationale behind the first government of the Indies and the features that defined the new West Indian society.
El artículo trata sobre el gobierno de Cristóbal Colón en tierras americanas. Retomamos el tema del primer emplazamiento español en Santo Domingo y las contradicciones que tuvo aquel proyecto debido a la lógica del estado absolutista, a la ambición desmedida del descubridor y a su reacción ante los controles que desde un principio impusieron los monarcas. En un segundo momento analizamos las dificultades que encontró el Almirante para desarrollar un modelo mercantilista acorde a sus ideas y a los acuerdos a que llegó con la Corona. En ese contexto analizamos la lógica del primer gobierno colombinista en las Indias y los rasgos que definieron la nueva sociedad antillana.
Schmidt-Erfurth, Ursula; Eldem, Bora; Guymer, Robyn; Korobelnik, Jean-Franc̦ois; Schlingemann, Reinier O.; Axer-Siegel, Ruth; Wiedemann, Peter; Simader, Christian; Gekkieva, Margarita; Weichselberger, Andreas
2011-01-01
Objective: To demonstrate noninferiority of a quarterly treatment regimen to a monthly regimen of ranibizumab in patients with subfoveal choroidal neovascularization (CNV) secondary to age-related macular degeneration (AMD). Design: A 12-month, multicenter, randomized, double-masked,
[Depression in Patients with Age-Related Macular Degeneration].
Narváez, Yamile Reveiz; Gómez-Restrepo, Carlos
2012-09-01
Age-related macular degeneration is a cause for disability in the elderly since it greatly affects their quality of life and increases depression likelihood. This article discusses the negative effect depression has on patients with age-related macular degeneration and summarizes the interventions available for decreasing their depression index. Copyright © 2012 Asociación Colombiana de Psiquiatría. Publicado por Elsevier España. All rights reserved.
Age-Related Macular Degeneration.
Mehta, Sonia
2015-09-01
Age-related macular degeneration (AMD) is the leading cause of vision loss in the elderly. AMD is diagnosed based on characteristic retinal findings in individuals older than 50. Early detection and treatment are critical in increasing the likelihood of retaining good and functional vision. Copyright © 2015 Elsevier Inc. All rights reserved.
Structure of stable degeneration of K3 surfaces into pairs of rational elliptic surfaces
Kimura, Yusuke
2018-01-01
F-theory/heterotic duality is formulated in the stable degeneration limit of a K3 fibration on the F-theory side. In this note, we analyze the structure of the stable degeneration limit. We discuss whether stable degeneration exists for pairs of rational elliptic surfaces. We demonstrate that, when two rational elliptic surfaces have an identical complex structure, stable degeneration always exists. We provide an equation that systematically describes the stable degeneration of a K3 surface i...
Sediment transport primer: estimating bed-material transport in gravel-bed rivers
Peter Wilcock; John Pitlick; Yantao Cui
2009-01-01
This primer accompanies the release of BAGS, software developed to calculate sediment transport rate in gravel-bed rivers. BAGS and other programs facilitate calculation and can reduce some errors, but cannot ensure that calculations are accurate or relevant. This primer was written to help the software user define relevant and tractable problems, select appropriate...
Degeneration of Bethe subalgebras in the Yangian of gl_n
Ilin, Aleksei; Rybnikov, Leonid
2018-04-01
We study degenerations of Bethe subalgebras B( C) in the Yangian Y(gl_n), where C is a regular diagonal matrix. We show that closure of the parameter space of the family of Bethe subalgebras, which parameterizes all possible degenerations, is the Deligne-Mumford moduli space of stable rational curves \\overline{M_{0,n+2}}. All subalgebras corresponding to the points of \\overline{M_{0,n+2}} are free and maximal commutative. We describe explicitly the "simplest" degenerations and show that every degeneration is the composition of the simplest ones. The Deligne-Mumford space \\overline{M_{0,n+2}} generalizes to other root systems as some De Concini-Procesi resolution of some toric variety. We state a conjecture generalizing our results to Bethe subalgebras in the Yangian of arbitrary simple Lie algebra in terms of this De Concini-Procesi resolution.
Genetics of lattice degeneration of the retina.
Murakami, F; Ohba, N
1982-01-01
First-degree relatives of proband patients with lattice degeneration of the retina revealed a significantly higher prevalence of the disease than the prevalence in the general population: the former had the disease about three times as frequently as the latter. The observed data were analyzed in terms of their accordance with recognized genetic models. The inheritance pattern did not fit well to a monogenic mode of inheritance, and it was hypothesized that a polygenic or multifactorial mode of inheritance is the most likely for lattice degeneration of the retina.
Caetano-Anollés, G; Gresshoff, P M
1996-06-01
DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.
Wang, Chaojen; Lin, Yisheng; Lin, Yinghong; Chung, Wenhsin
2013-01-01
Previous investigations demonstrated that Fusarium oxysporum (Fo), which is not pathogenic to cucumbers, could serve as a biological control agent for managing Fusarium wilt of cucumber caused by Fo f. sp. cucumerinum (Foc) in Taiwan. However, thus far it has not been possible to separate the populations of pathogenic Fo from the nonpathogenic isolates that have biological control potential through their morphological characteristics. Although these two populations can be distinguished from one another using a bioassay, the work is laborious and time-consuming. In this study, a fragment of the intergenic spacer (IGS) region of ribosomal DNA from an Fo biological control agent, Fo366, was PCR-amplified with published general primers, FIGS11/FIGS12 and sequenced. A new primer, NPIGS-R, which was designed based on the IGS sequence, was paired with the FIGS11 primer. These primers were then evaluated for their specificity to amplify DNA from nonpathogenic Fo isolates that have biological control potential. The results showed that the modified primer pair, FIGS11/NPIGS-R, amplified a 500-bp DNA fragment from five of seven nonpathogenic Fo isolates. These five Fo isolates delayed symptom development of cucumber Fusarium wilt in greenhouse bioassay tests. Seventy-seven Fo isolates were obtained from the soil and plant tissues and then subjected to amplification using the modified primer pair; six samples showed positive amplification. These six isolates did not cause symptoms on cucumber seedlings when grown in peat moss infested with the isolates and delayed disease development when the same plants were subsequently inoculated with a virulent isolate of Foc. Therefore, the modified primer pair may prove useful for the identification of Fo isolates that are nonpathogenic to cucumber which can potentially act as biocontrol agents for Fusarium wilt of cucumber. PMID:23762289
Zhang, Hongtao; Setubal, Joao Carlos; Zhan, Xiaobei; Zheng, Zhiyong; Yu, Lijun; Wu, Jianrong; Chen, Dingqiang
2011-06-01
Agrobacterium sp. ATCC 31749 (formerly named Alcaligenes faecalis var. myxogenes) is a non-pathogenic aerobic soil bacterium used in large scale biotechnological production of curdlan. However, little is known about its genomic information. DNA partial sequence of electron transport chains (ETCs) protein genes were obtained in order to understand the components of ETC and genomic-specificity in Agrobacterium sp. ATCC 31749. Degenerate primers were designed according to ETC conserved sequences in other reported species. DNA partial sequences of ETC genes in Agrobacterium sp. ATCC 31749 were cloned by the PCR method using degenerate primers. Based on comparative genomic analysis, nine electron transport elements were ascertained, including NADH ubiquinone oxidoreductase, succinate dehydrogenase complex II, complex III, cytochrome c, ubiquinone biosynthesis protein ubiB, cytochrome d terminal oxidase, cytochrome bo terminal oxidase, cytochrome cbb (3)-type terminal oxidase and cytochrome caa (3)-type terminal oxidase. Similarity and phylogenetic analyses of these genes revealed that among fully sequenced Agrobacterium species, Agrobacterium sp. ATCC 31749 is closest to Agrobacterium tumefaciens C58. Based on these results a comprehensive ETC model for Agrobacterium sp. ATCC 31749 is proposed.
Microsatellite Primers in the Foundation Tree Species Pinus edulis and P. monophylla (Pinaceae
Directory of Open Access Journals (Sweden)
Andrew L. Krohn
2013-07-01
Full Text Available Premise of the study: Microsatellite primers were developed in the foundational tree species Pinus edulis to investigate population differentiation of P. edulis and hybridization among closely related species. Methods and Results: Using a hybridization protocol, primer sets for 11 microsatellite loci were developed using megagametophyte tissue from P. edulis and scored for polymorphism in three populations of P. edulis and a single P. monophylla population. The primers amplified simple and compound di-, tri-, and pentanucleotide repeats with two to 18 alleles per locus. Conclusions: These results demonstrate the utility of the described primers for studies of population differentiation within and among P. edulis populations as well as across putative hybrid zones where P. edulis may coexist with sister species.
In vivo effect of a self-etching primer on dentin.
Milia, E; Lallai, M R; García-Godoy, F
1999-08-01
To determine the ultrastructural aspects of the dentin collagen area in the cavity preparation floor produced in vivo after phosphoric acid acid-etching or after using Clearfil Liner Bond 2 self-etching primer (LB2 Primer). Twenty-four non-carious third molars scheduled for extraction from young adult patients (16-30 years old) were used. Conventional Class I cavities (+/- 2 mm deep) were prepared on the occlusal surfaces of all teeth using a cylindrical diamond bur on a high-speed handpiece with copious water spray. To avoid dehydration of the dentin, the smear layer-covered dentin was briefly air-dried for 2 seconds. Cavities were assigned at random to the following groups: Group A: Dentin etched for 15 seconds with 34% phosphoric acid, rinsed for 20 seconds and then briefly air-dried for 2 seconds with oil-free compressed air leaving the surfaces slightly moist. Group B: LB2 Primer was applied to the cavity surfaces for 30 seconds and then briefly air-dried to remove the solvent. Group C: The untreated dentin smear layer was used as a control. In all three groups, the cavities were filled incrementally with a resin-based composite (APX), light curing every increment for 40 seconds. After 30 minutes, the teeth were extracted atraumatically and the samples immediately prepared for evaluation with the transmission electron microscope. The use of a self-etching primer did not produce significant morphological changes in the moist dentin substrate. Adverse morphological conditions where observed when there was an excess water on the dentin surface. Phosphoric acid altered the collagen more severely than the self-etching primer.
Hafeez, Mian A; Shivaramaiah, Srichaitanya; Dorsey, Kristi Moore; Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Cobean, Julie; Barta, John R
2015-05-01
Species-specific PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus were generated that allow for the specific identification of the most common Eimeria species infecting turkeys (i.e., Eimeria adenoeides, Eimeria meleagrimitis, Eimeria gallopavonis, Eimeria meleagridis, Eimeria dispersa, and Eimeria innocua). PCR reaction chemistries were optimized with respect to divalent cation (MgCl2) and dNTP concentrations, as well as PCR cycling conditions (particularly anneal temperature for primers). Genomic DNA samples from single oocyst-derived lines of six Eimeria species were tested to establish specificity and sensitivity of these newly designed primer pairs. A mixed 60-ng total DNA sample containing 10 ng of each of the six Eimeria species was used as DNA template to demonstrate specific amplification of the correct product using each of the species-specific primer pairs. Ten nanograms of each of the five non-target Eimeria species was pooled to provide a non-target, control DNA sample suitable to test the specificity of each primer pair. The amplifications of the COI region with species-specific primer pairs from pooled samples yielded products of expected sizes (209 to 1,012 bp) and no amplification of non-target Eimeria sp. DNA was detected using the non-target, control DNA samples. These primer pairs specific for Eimeria spp. of turkeys did not amplify any of the seven Eimeria species infecting chickens. The newly developed PCR primers can be used as a diagnostic tool capable of specifically identifying six turkey Eimeria species; additionally, sequencing of the PCR amplification products yields sequence-based genotyping data suitable for identification and molecular phylogenetics.
Ozkok, Ahmet; Sigford, Douglas K; Tezel, Tongalp H
2016-11-01
To test define characteristic fundus autofluorescence patterns of different exudative age-related macular degeneration subtypes. Cross-sectional study. Fifty-two patients with choroidal neovascularization because of three different neovascular age-related macular degeneration subtypes were included in the study. Macular and peripheral fundus autofluorescence patterns of study subjects were compared in a masked fashion. Fundus autofluorescence patterns of all three neovascular age-related macular degeneration subtypes revealed similar patterns. However, peripapillary hypo-autofluorescence was more common among patients with polypoidal choroidal vasculopathy (88.2%) compared with patients with retinal angiomatous proliferation (12.5%) and patients without retinal angiomatous proliferation and polypoidal choroidal vasculopathy (21.1%) (P autofluorescence defects in neovascular age-related macular degeneration maybe suggestive of polypoidal choroidal vasculopathy as a variant of neovascular age-related macular degeneration.
Characteristics of the population employed in primer sector in Turkey
Directory of Open Access Journals (Sweden)
Bayar Rüya
2006-01-01
Full Text Available Activities related to the production of raw material like agriculture husbandry, forestry, fishery are called as primer activities. Especially people living in rural areas earn their livings on primer activities, mainly agriculture. Rural planning is inevitable for providing rural development which has an important place in all development of a country. And achievement of this planning depends on putting forth the characteristics of the population living in rural areas with its different aspects. Therefore, the requirements will be introduced more clearly and the increase in the welfare levels of the people living in rural areas will have been achieved. To achieve the rural development and progress, in addition to the features like the size of agricultural products, products that are cultivated, activities like husbandry, forestry, hunting, etc. and the qualities of the enterprises in which these activities are carried out, policies applied, capital, market and technology, the characteristics of the population employed in this sector is also of importance. Considering these points, what is aimed in this study is to put forth the characteristics of the population employed in primer sector in Turkey. According to the census results of the year 2000 in Turkey 38% of the population is employed, and 48% of this work is in primer sector.
Sequential changes in MR imaging of human wallerian degeneration
Energy Technology Data Exchange (ETDEWEB)
Orita, Tetsuji; Tsurutani, Tohru; Izumihara, Akifumi; Kajiwara, Koji (Shuto General Hospital, Yamaguchi (Japan)); Matsunaga, Tokio
1994-05-01
MRI of wallerian degeneration of the pyramidal tract in the brainstem was repeatedly performed on the same coronal slice in 10 patients, who had infarction or hemorrhage of the basal ganglia and had the exact onset of hemiparesis. The processes of wallerian degeneration were divided into four stages by proton-density weighted images. In stage 1, the axon began to degenerate and was destroyed. It occurred during the first 0.7 month and resulted in no signal intensity abnormality. In stage 2, axon debris disappeared from degenerating tracts. Myelin structure was preserved and myelin lipid remained intact. The lipid water ratio in the tissue became large and the tissue was more hydrophobic. From 0.7 to 2.0 months, low signal intensity was observed. In stage 3, subsequent myelin lipid breakdown began and the lipid/water ratio in the tissue tended to be small. There was no abnormal signal intensity. In stage 4, lipid began to be removed from the tissue. The lipid/water ratio became smaller and the tissue became hydrophilic. Gliosis was more prominent. High signal intensity was observed. (author).
Sequential changes in MR imaging of human wallerian degeneration
International Nuclear Information System (INIS)
Orita, Tetsuji; Tsurutani, Tohru; Izumihara, Akifumi; Kajiwara, Koji; Matsunaga, Tokio.
1994-01-01
MRI of wallerian degeneration of the pyramidal tract in the brainstem was repeatedly performed on the same coronal slice in 10 patients, who had infarction or hemorrhage of the basal ganglia and had the exact onset of hemiparesis. The processes of wallerian degeneration were divided into four stages by proton-density weighted images. In stage 1, the axon began to degenerate and was destroyed. It occurred during the first 0.7 month and resulted in no signal intensity abnormality. In stage 2, axon debris disappeared from degenerating tracts. Myelin structure was preserved and myelin lipid remained intact. The lipid water ratio in the tissue became large and the tissue was more hydrophobic. From 0.7 to 2.0 months, low signal intensity was observed. In stage 3, subsequent myelin lipid breakdown began and the lipid/water ratio in the tissue tended to be small. There was no abnormal signal intensity. In stage 4, lipid began to be removed from the tissue. The lipid/water ratio became smaller and the tissue became hydrophilic. Gliosis was more prominent. High signal intensity was observed. (author)
Quantization with maximally degenerate Poisson brackets: the harmonic oscillator!
International Nuclear Information System (INIS)
Nutku, Yavuz
2003-01-01
Nambu's construction of multi-linear brackets for super-integrable systems can be thought of as degenerate Poisson brackets with a maximal set of Casimirs in their kernel. By introducing privileged coordinates in phase space these degenerate Poisson brackets are brought to the form of Heisenberg's equations. We propose a definition for constructing quantum operators for classical functions, which enables us to turn the maximally degenerate Poisson brackets into operators. They pose a set of eigenvalue problems for a new state vector. The requirement of the single-valuedness of this eigenfunction leads to quantization. The example of the harmonic oscillator is used to illustrate this general procedure for quantizing a class of maximally super-integrable systems
Natural history of seminiferous tubule degeneration in Klinefelter syndrome
DEFF Research Database (Denmark)
Aksglaede, Lise; Wikström, Anne M; Rajpert-De Meyts, Ewa
2006-01-01
Klinefelter syndrome (47,XXY) is characterized by small, firm testis, gynaecomastia, azoospermia and hypergonadotropic hypogonadism. Degeneration of the seminiferous tubules in 47,XXY males is a well-described phenomenon. It begins in the fetus, progresses through infancy and accelerates dramatic......Klinefelter syndrome (47,XXY) is characterized by small, firm testis, gynaecomastia, azoospermia and hypergonadotropic hypogonadism. Degeneration of the seminiferous tubules in 47,XXY males is a well-described phenomenon. It begins in the fetus, progresses through infancy and accelerates...... summarize current knowledge on the development of the classical endocrinological and histological features of 47,XXY males from fetus to adulthood and review the literature concerning the degeneration of the seminiferous tubules in this syndrome....
Menopause 101: A Primer for the Perimenopausal
... Abstracts Media Award Recipients Media Policy Media Requests Menopause 101: A primer for the perimenopausal The information ... about 2 years earlier. Common Body Changes at Menopause Each woman’s experience of menopause is different. Many ...
Directory of Open Access Journals (Sweden)
Martin Beránek
2012-01-01
Full Text Available Dideoxynucleotide DNA sequencing is one of the principal procedures in molecular biology. Loss of an initial part of nucleotides behind the 3' end of the sequencing primer limits the readability of sequenced amplicons. We present a method which extends the readability by using sequencing primers modified by polyadenylated tails attached to their 5' ends. Performing a polymerase chain reaction, we amplified eight amplicons of six human genes (AMELX, APOE, HFE, MBL2, SERPINA1 and TGFB1 ranging from 106 bp to 680 bp. Polyadenylation of the sequencing primers minimized the loss of bases in all amplicons. Complete sequences of shorter products (AMELX 106 bp, SERPINA1 121 bp, HFE 208 bp, APOE 244 bp, MBL2 317 bp were obtained. In addition, in the case of TGFB1 products (366 bp, 432 bp, and 680 bp, respectively, the lengths of sequencing readings were significantly longer if adenylated primers were used. Thus, single strand dideoxynucleotide sequencing with adenylated primers enables complete or near complete readability of short PCR amplicons.
Ma, Hongwei; Thapa, Arjun; Morris, Lynsie; Redmond, T. Michael; Baehr, Wolfgang; Ding, Xi-Qin
2014-01-01
Photoreceptors degenerate in a wide array of hereditary retinal diseases and age-related macular degeneration. There is currently no treatment available for retinal degenerations. While outnumbered roughly 20:1 by rods in the human retina, it is the cones that mediate color vision and visual acuity, and their survival is critical for vision. In this communication, we investigate whether thyroid hormone (TH) signaling affects cone viability in retinal degeneration mouse models. TH signaling is...
Genus-Specific Primers for Study of Fusarium Communities in Field Samples
Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna
2015-01-01
Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387
Association of suprascapular neuropathy with rotator cuff tendon tears and fatty degeneration.
Shi, Lewis L; Boykin, Robert E; Lin, Albert; Warner, Jon J P
2014-03-01
The mutual influence of suprascapular neuropathy (SSN) and rotator cuff tendon tears on muscle pathology is unclear. Debate continues as to how retracted cuff tears can lead to SSN and whether SSN or tendon retraction causes muscle fatty degeneration. A cohort of 87 patients suspected of having SSN was identified from a prospectively collected registry. All underwent electromyography/nerve conduction velocity study (EMG/NCV) and magnetic resonance imaging (MRI) of their shoulders. EMG/NCVs were performed and interpreted by electrodiagnosticians, and MRI cuff tendon quality and muscle fatty degeneration were interpreted by two surgeons. Out of 87 patients, 32 patients had SSN on EMG/NCV, and 55 patients had normal suprascapular nerve. MRI showed that 59 of 87 supraspinatus had no fatty degeneration or mild fatty streaks (Goutallier grades 0 and 1), and 28 patients had significant fatty degeneration (grades 2-4); infraspinatus fatty degeneration was similar. Review of supraspinatus tendon showed 41 patients with intact tendons or partial tears, and 46 with full tears. Infraspinatus tendons pathology was similar. Tendon pathology and fatty degeneration were related (P-valuetears were associated with SSN (P = .01), but SSN was not related to fatty degeneration of either supraspinatus or infraspinatus (P-values .65, .54). The exact association and etiology of SSN in patients with rotator cuff pathology remain unclear. SSN is correlated to tendon tear size, but it does not have significant influence on fatty degeneration of either supraspinatus or infraspinatus. Copyright © 2014 Journal of Shoulder and Elbow Surgery Board of Trustees. Published by Mosby, Inc. All rights reserved.
Genetic association of apolipoprotein E with age-related macular degeneration
M. Kliffen (Mike); C.M. van Duijn (Cornelia); M. Cruts (Marc); D.E. Grobbee (Diederick); P.T.V.M. de Jong (Paulus); C.C.W. Klaver (Caroline); C. van Broeckhoven (Christine); A. Hofman (Albert)
1998-01-01
textabstractAge-related macular degeneration (AMD) is the most common geriatric eye disorder leading to blindness and is characterized by degeneration of the neuroepithelium in the macular area of the eye. Apolipoprotein E (apoE), the major apolipoprotein of the CNS and an
A simple RT-PCR-based strategy for screening connexin identity
Directory of Open Access Journals (Sweden)
M. Urban
1999-08-01
Full Text Available Vertebrate gap junctions are aggregates of transmembrane channels which are composed of connexin (Cx proteins encoded by at least fourteen distinct genes in mammals. Since the same Cx type can be expressed in different tissues and more than one Cx type can be expressed by the same cell, the thorough identification of which connexin is in which cell type and how connexin expression changes after experimental manipulation has become quite laborious. Here we describe an efficient, rapid and simple method by which connexin type(s can be identified in mammalian tissue and cultured cells using endonuclease cleavage of RT-PCR products generated from "multi primers" (sense primer, degenerate oligonucleotide corresponding to a region of the first extracellular domain; antisense primer, degenerate oligonucleotide complementary to the second extracellular domain that amplify the cytoplasmic loop regions of all known connexins except Cx36. In addition, we provide sequence information on RT-PCR primers used in our laboratory to screen individual connexins and predictions of extension of the "multi primer" method to several human connexins.
Schraermeyer, U; Thumann, G; Luther, T; Kociok, N; Armhold, S; Kruttwig, K; Andressen, C; Addicks, K; Bartz-Schmidt, K U
2001-01-01
The Royal College of Surgeons (RCS) rat is an animal model for retinal degeneration such as the age-related macular degeneration. The RCS rat undergoes a progressive retinal degeneration during the early postnatal period. A potential treatment to prevent this retinal degeneration is the transplantation into the subretinal space of cells that would replace functions of the degenerating retinal pigment epithelium (RPE) cells or may form neurotrophic factors. In this study we have investigated the potential of subretinally transplanted embryonic stem cells to prevent the genetically determined photoreceptor cell degeneration in the RCS rat. Embryonic stem cells from the inner cell mass of the mouse blastocyst were allowed to differentiate to neural precursor cells in vitro and were then transplanted into the subretinal space of 20-day-old RCS rats. Transplanted and sham-operated rats were sacrificed 2 months following cell transplantation. The eyes were enucleated and photoreceptor degeneration was quantified by analyzing and determining the thickness of the outer nuclear layer by light and electron microscopy. In the eyes transplanted with embryonic cells up to 8 rows of photoreceptor cell nuclei were observed, whereas in nontreated control eyes the outer nuclear layer had degenerated completely. Transplantation of embryonic stem cells appears to delay photoreceptor cell degeneration in RCS rats.
Galkiewicz, J.P.; Kellogg, C.A.
2008-01-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.
Aag-initiated base excision repair drives alkylation-induced retinal degeneration in mice.
Meira, Lisiane B; Moroski-Erkul, Catherine A; Green, Stephanie L; Calvo, Jennifer A; Bronson, Roderick T; Shah, Dharini; Samson, Leona D
2009-01-20
Vision loss affects >3 million Americans and many more people worldwide. Although predisposing genes have been identified their link to known environmental factors is unclear. In wild-type animals DNA alkylating agents induce photoreceptor apoptosis and severe retinal degeneration. Alkylation-induced retinal degeneration is totally suppressed in the absence of the DNA repair protein alkyladenine DNA glycosylase (Aag) in both differentiating and postmitotic retinas. Moreover, transgenic expression of Aag activity restores the alkylation sensitivity of photoreceptors in Aag null animals. Aag heterozygotes display an intermediate level of retinal degeneration, demonstrating haploinsufficiency and underscoring that Aag expression confers a dominant retinal degeneration phenotype.
Some Remarks on Space-Time Decompositions, and Degenerate Metrics, in General Relativity
Bengtsson, Ingemar
Space-time decomposition of the Hilbert-Palatini action, written in a form which admits degenerate metrics, is considered. Simple numerology shows why D = 3 and 4 are singled out as admitting a simple phase space. The canonical structure of the degenerate sector turns out to be awkward. However, the real degenerate metrics obtained as solutions are the same as those that occur in Ashtekar's formulation of complex general relativity. An exact solution of Ashtekar's equations, with degenerate metric, shows that the manifestly four-dimensional form of the action, and its 3 + 1 form, are not quite equivalent.
Cryer, CW
2014-01-01
Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula
Majid, Shahn
2002-05-01
Here is a self-contained introduction to quantum groups as algebraic objects. Based on the author's lecture notes for the Part III pure mathematics course at Cambridge University, the book is suitable as a primary text for graduate courses in quantum groups or supplementary reading for modern courses in advanced algebra. The material assumes knowledge of basic and linear algebra. Some familiarity with semisimple Lie algebras would also be helpful. The volume is a primer for mathematicians but it will also be useful for mathematical physicists.
Yan, Jian; Peng, Xifeng; Cai, Yulian; Cong, Wendong
2018-06-01
The present anti-angiogenic therapies for neovascular age-related macular degeneration require effective drug delivery systems for transfer drug molecules. Ranibizumab is an active humanized monoclonal antibody that counteracts active forms of vascular endothelial growth factor A in the neovascular age-related macular degeneration therapy. The development of ranibizumab-related therapies, we have designed the effective drug career with engineered magnetic nanoparticles (Fe 3 O 4 ) as a facile platform of ranibizumab delivery for the treatment of neovascular age-related macular degeneration. Ranibizumab conjugated iron oxide (Fe 3 O 4 )/PEGylated poly lactide-co-glycolide (PEG-PLGA) was successfully designed and the synthesized materials are analyzed different analytical techniques. The microscopic techniques (Scanning Electron Microscopy (SEM) & Transmission Electron Microscopy (TEM)) are clearly displayed that spherical nanoparticles into the PEG-PLGA matrix and presence of elements and chemical interactions confirmed by the results of energy dispersive X-ray analysis (EDX) and Fourier trans-form infrared (FTIR) spectroscopic methods. The in vitro anti-angiogenic evaluation of Fe 3 O 4 /PEG-PLGA polymer nanomaterial efficiently inhibits the tube formation in the Matrigel-based assay method by using human umbilical vein endothelial cells. Ranibizumab treated Fe 3 O 4 /PEG-PLGA polymer nanomaterials not disturbed cell proliferation and the results could not display the any significant differences in human endothelial cells. The present investigated results describe that Fe 3 O 4 /PEG-PLGA polymer nanomaterials can be highly favorable and novel formulation for the treatment of neovascular age-related macular degeneration. Copyright © 2018 Elsevier B.V. All rights reserved.
Genetics Home Reference: Stargardt macular degeneration
... recognizing faces. In most people with Stargardt macular degeneration , a fatty yellow pigment (lipofuscin) builds up in cells underlying the macula. Over time, the abnormal accumulation of this substance ...
K-causality and degenerate spacetimes
Dowker, H. F.; Garcia, R. S.; Surya, S.
2000-11-01
The causal relation K+ was introduced by Sorkin and Woolgar to extend the standard causal analysis of C2 spacetimes to those that are only C0. Most of their results also hold true in the case of metrics with degeneracies which are C0 but vanish at isolated points. In this paper we seek to examine K+ explicitly in the case of topology-changing `Morse histories' which contain degeneracies. We first demonstrate some interesting features of this relation in globally Lorentzian spacetimes. In particular, we show that K+ is robust and the Hawking and Sachs characterization of causal continuity translates into a natural condition in terms of K+. We then examine K+ in topology-changing Morse spacetimes with the degenerate points excised and then for the Morse histories in which the degenerate points are reinstated. We find further characterizations of causal continuity in these cases.
Late complications following cryotherapy of lattice degeneration.
Benson, W E; Morse, P H; Nantawan, P
1977-10-01
We observed 341 patients who had received cryotherapy for lattice degeneration in order to identify possible late complications. Sequelae such as retinal tears posterior to an operculum or flap tears within treated areas showed that treatment did not necessarily prevent subsequent vitreous traction. Moreover, the newly created flap tears may extend beyond the treated area and can cause retinal detachment. Even scleral buckling did not necesserily prevent further traction. Therefore, we concluded that when cryotherapy is used to treat lattice degeneration, an adequate margin of surrounding retina should be treated and the treatment should extend to the ora serrata.
Degenerate Fermi gas in a combined harmonic-lattice potential
International Nuclear Information System (INIS)
Blakie, P. B.; Bezett, A.; Buonsante, P.
2007-01-01
In this paper we derive an analytic approximation to the density of states for atoms in a combined optical lattice and harmonic trap potential as used in current experiments with quantum degenerate gases. We compare this analytic density of states to numerical solutions and demonstrate its validity regime. Our work explicitly considers the role of higher bands and when they are important in quantitative analysis of this system. Applying our density of states to a degenerate Fermi gas, we consider how adiabatic loading from a harmonic trap into the combined harmonic-lattice potential affects the degeneracy temperature. Our results suggest that occupation of excited bands during loading should lead to more favorable conditions for realizing degenerate Fermi gases in optical lattices
Disc degeneration: current surgical options
Directory of Open Access Journals (Sweden)
C Schizas
2010-10-01
Full Text Available Chronic low back pain attributed to lumbar disc degeneration poses a serious challenge to physicians. Surgery may be indicated in selected cases following failure of appropriate conservative treatment. For decades, the only surgical option has been spinal fusion, but its results have been inconsistent. Some prospective trials show superiority over usual conservative measures while others fail to demonstrate its advantages. In an effort to improve results of fusion and to decrease the incidence of adjacent segment degeneration, total disc replacement techniques have been introduced and studied extensively. Short-term results have shown superiority over some fusion techniques. Mid-term results however tend to show that this approach yields results equivalent to those of spinal fusion. Nucleus replacement has gained some popularity initially, but evidence on its efficacy is scarce. Dynamic stabilisation, a technique involving less rigid implants than in spinal fusion and performed without the need for bone grafting, represents another surgical option. Evidence again is lacking on its superiority over other surgical strategies and conservative measures. Insertion of interspinous devices posteriorly, aiming at redistributing loads and relieving pain, has been used as an adjunct to disc removal surgery for disc herniation. To date however, there is no clear evidence on their efficacy. Minimally invasive intradiscal thermocoagulation techniques have also been tried, but evidence of their effectiveness is questioned. Surgery using novel biological solutions may be the future of discogenic pain treatment. Collaboration between clinicians and basic scientists in this multidisciplinary field will undoubtedly shape the future of treating symptomatic disc degeneration.
Wallerian degeneration: the innate-immune response to traumatic nerve injury
Directory of Open Access Journals (Sweden)
Rotshenker Shlomo
2011-08-01
Full Text Available Abstract Traumatic injury to peripheral nerves results in the loss of neural functions. Recovery by regeneration depends on the cellular and molecular events of Wallerian degeneration that injury induces distal to the lesion site, the domain through which severed axons regenerate back to their target tissues. Innate-immunity is central to Wallerian degeneration since innate-immune cells, functions and molecules that are produced by immune and non-immune cells are involved. The innate-immune response helps to turn the peripheral nerve tissue into an environment that supports regeneration by removing inhibitory myelin and by upregulating neurotrophic properties. The characteristics of an efficient innate-immune response are rapid onset and conclusion, and the orchestrated interplay between Schwann cells, fibroblasts, macrophages, endothelial cells, and molecules they produce. Wallerian degeneration serves as a prelude for successful repair when these requirements are met. In contrast, functional recovery is poor when injury fails to produce the efficient innate-immune response of Wallerian degeneration.
An Unusual Case of Extensive Lattice Degeneration and Retinal Detachment.
Mathew, David J; Sarma, Saurabh Kumar; Basaiawmoit, Jennifer V
2016-07-01
Lattice degeneration of the retina is not infrequently encountered on a dilated retinal examination and many of them do not need any intervention. We report a case of atypical lattice degeneration variant with peripheral retinal detachment. An asymptomatic 35-year-old lady with minimal refractive error was found to have extensive lattice degeneration, peripheral retinal detachment and fibrotic changes peripherally with elevation of retinal vessels on dilated retinal examination. There were also areas of white without pressure, chorioretinal scarring and retinal breaks. All the changes were limited to beyond the equator but were found to span 360 degrees. She was treated with barrage laser all around to prevent extension of the retinal detachment posteriorly. She remained stable till her latest follow-up two years after the barrage laser. This case is reported for its rarity with a discussion of the probable differential diagnoses. To the best of our knowledge, this is the first report of such findings in lattice degeneration.
Prunier, Rachel; Latimer, Andrew
2010-01-01
Microsatellite primers were developed in the South African sclerophyllous shrub Protea punctata to investigate the degree of population differentiation within and between P. punctata and closely related species. • 10 primer pairs were identified from three individuals of Protea punctata. The primers amplified di- and tri-nucleotide repeats. Across all P. punctata samples, the loci have 8-49 alleles. All primers also amplified in Protea section Exsertae (P. aurea, P. aurea subsp. potbergensis, P. mundii, P. venusta, P. lacticolor, and P. subvestita). The loci had 14-69 alleles across the subgenus. • These results show the broad utility of microsatellite loci for future studies of population genetics in the white proteas and their potential utility across the entire genus.
Degree of tendon degeneration and stage of rotator cuff disease.
Jo, Chris Hyunchul; Shin, Won Hyoung; Park, Ji Wan; Shin, Ji Sun; Kim, Ji Eun
2017-07-01
While tendon degeneration has been known to be an important cause of rotator cuff disease, few studies have objectively proven the association of tendon degeneration and rotator cuff disease. The purpose of this study was to investigate changes of tendon degeneration with respect to the stage of rotator cuff disease. A total of 48 patients were included in the study: 12 with tendinopathy, 12 with a partial-thickness tear (pRCT), 12 with a full-thickness tear (fRCT), and 12 as the control. A full-thickness supraspinatus tendon sample was harvested en bloc from the middle portion between the lateral edge and the musculotendinous junction of the tendon using a biopsy punch with a diameter of 3 mm. Harvested samples were evaluated using a semi-quantitative grading scale with 7 parameters after haematoxylin and eosin staining. There was no significant difference in age, gender, symptom duration, and Kellgren-Lawrence grade between the groups except for the global fatty degeneration index. All of the seven parameters were significantly different between the groups and could be categorized as follows: early responders (fibre structure and arrangement), gradual responder (rounding of the nuclei), after-tear responders (cellularity, vascularity, and stainability), and late responder (hyalinization). The total degeneration scores were not significantly different between the control (6.08 ± 1.16) and tendinopathy (6.67 ± 1.83) (n.s.). However, the score of pRCT group (10.42 ± 1.31) was greater than that of tendinopathy (P rotator cuff disease progresses from tendinopathy to pRCT, and then to fRCT. The degree of degeneration of tendinopathy was not different from that of normal but aged tendons, and significant tendon degeneration began from the stage of pRCT. The clinical relevance of the study is that strategies and goals of the treatment for rotator cuff disease should be specific to its stage, in order to prevent disease progression for tendinopathy and pRCT, as
Profitability primer: a guide to profitability analysis in the electric power industry
International Nuclear Information System (INIS)
Woo, C.K.; Lloyd-Zannetti, D.; Martin, J.; Price, S.
1996-06-01
As the electric power industry is opened to forces of competition, increased attention must be focused to develop products and services that deliver good value to customers and to identify customer segments that are profitable to serve. This primer introduces the concept of profitability analysis and its application to the electric power industry. The primer recognizes that some segments of the business will remain monopolistic and subject to regulations, while other segments will become competitive. The primer also recognizes that customer profitability is critically dependent on a host of related issues such as how internal costs are allocated to various functions and how revenues are collected and allocated
Joachim, N.; Colijn, J.M.; Kifley, A.; Lee, K.E.; Buitendijk, G.H.; Klein, B.E.; Myers, C.E.; Meuer, S.M.; Tan, A.G.; Holliday, E.G.; Attia, J.; Liew, G.; Iyengar, S.K.; Jong, p de; Hofman, A.; Vingerling, J.R.; Mitchell, P.; Klaver, C.C.W.; Klein, R.; Wang, J.J.
2017-01-01
PURPOSE: To assess the 5-year progression from unilateral to bilateral age-related macular degeneration (AMD) and associated risk factors. DESIGN: Pooled data analyses of three prospective population-based cohorts, the Blue Mountains Eye Study, Beaver Dam Eye Study and Rotterdam Study. METHODS:
Joachim, Nichole; Colijn, Johanna Maria; Kifley, Annette; Lee, Kristine E; Buitendijk, Gabriëlle H S; Klein, Barbara E K; Myers, Chelsea E; Meuer, Stacy M; Tan, Ava G; Holliday, Elizabeth G; Attia, John; Liew, Gerald; Iyengar, Sudha K; de Jong, Paulus T V M; Hofman, Albert; Vingerling, Johannes R; Mitchell, Paul; Klaver, Caroline C W; Klein, Ronald; Wang, Jie Jin
2017-01-01
PURPOSE: To assess the 5-year progression from unilateral to bilateral age-related macular degeneration (AMD) and associated risk factors. DESIGN: Pooled data analyses of three prospective population-based cohorts, the Blue Mountains Eye Study, Beaver Dam Eye Study and Rotterdam Study. METHODS:
Relativistic many-body XMCD theory including core degenerate effects
Fujikawa, Takashi
2009-11-01
A many-body relativistic theory to analyze X-ray Magnetic Circular Dichroism (XMCD) spectra has been developed on the basis of relativistic quantum electrodynamic (QED) Keldysh Green's function approach. This theoretical framework enables us to handle relativistic many-body effects in terms of correlated nonrelativistic Green's function and relativistic correction operator Q, which naturally incorporates radiation field screening and other optical field effects in addition to electron-electron interactions. The former can describe the intensity ratio of L2/L3 which deviates from the statistical weight (branching ratio) 1/2. In addition to these effects, we consider the degenerate or nearly degenerate effects of core levels from which photoelectrons are excited. In XPS spectra, for example in Rh 3d sub level excitations, their peak shapes are quite different: This interesting behavior is explained by core-hole moving after the core excitation. We discuss similar problems in X-ray absorption spectra in particular excitation from deep 2p sub levels which are degenerate in each sub levels and nearly degenerate to each other in light elements: The hole left behind is not frozen there. We derive practical multiple scattering formulas which incorporate all those effects.
Identification of Age-Related Macular Degeneration Using OCT Images
Arabi, Punal M., Dr; Krishna, Nanditha; Ashwini, V.; Prathibha, H. M.
2018-02-01
Age-related Macular Degeneration is the most leading retinal disease in the recent years. Macular degeneration occurs when the central portion of the retina, called macula deteriorates. As the deterioration occurs with the age, it is commonly referred as Age-related Macular Degeneration. This disease can be visualized by several imaging modalities such as Fundus imaging technique, Optical Coherence Tomography (OCT) technique and many other. Optical Coherence Tomography is the widely used technique for screening the Age-related Macular Degeneration disease, because it has an ability to detect the very minute changes in the retina. The Healthy and AMD affected OCT images are classified by extracting the Retinal Pigmented Epithelium (RPE) layer of the images using the image processing technique. The extracted layer is sampled, the no. of white pixels in each of the sample is counted and the mean value of the no. of pixels is calculated. The average mean value is calculated for both the Healthy and the AMD affected images and a threshold value is fixed and a decision rule is framed to classify the images of interest. The proposed method showed an accuracy of 75%.
Temas de Física para Ingeniería: Primer principio de la termodinámica
Beléndez Vázquez, Augusto
1992-01-01
Acústica, fluidos y termodinámica: "Primer principio de la termodinámica". Objetivos y caracteres generales de la termodinámica. Conceptos fundamentales de la termodinámica. Capacidad calorífica, calor específico y calor latente. Trabajo. Primer principio de la termodinámica: energía interna. Algunas aplicaciones del primer principio.
Ataxias and Cerebellar or Spinocerebellar Degeneration
... and conducts a broad range of basic and clinical research on cerebellar and spinocerebellar degeneration, including work aimed at finding the cause(s) of ataxias and ways to ... Publications Definition Ataxia ...
The effects of wallerian degeneration of the optic radiations demonstrated by MRI
Energy Technology Data Exchange (ETDEWEB)
Savoiardo, M.; Grisoli, M.; Forester, M.; D' Incerti, L.; Farina, L. (Dept. of Neuroradiology, Ist. Nazionale Neurologico C. Besta, Milan (Italy)); Pareyson, D. (Dept. of Neurology, Ist. Nazionale Neurologico C. Besta, Milan (Italy))
1992-08-01
The effects of wallerian degeneration can be demonstrated by MRI as abnormal signal along the course of the degenerate fibres; they have previously been reported in the corticospinal tract. We report two cases of wallerian degeneration of the right optic radiations due to lesions of the right lateral geniculate body. The anatomy and the MRI visibility of the normal optic radiations are briefly discussed. (orig.).
The effects of wallerian degeneration of the optic radiations demonstrated by MRI
International Nuclear Information System (INIS)
Savoiardo, M.; Grisoli, M.; Forester, M.; D'Incerti, L.; Farina, L.; Pareyson, D.
1992-01-01
The effects of wallerian degeneration can be demonstrated by MRI as abnormal signal along the course of the degenerate fibres; they have previously been reported in the corticospinal tract. We report two cases of wallerian degeneration of the right optic radiations due to lesions of the right lateral geniculate body. The anatomy and the MRI visibility of the normal optic radiations are briefly discussed. (orig.)
A primer on motor vehicle air pollution.
1973-01-01
This primer presents a brief state-of-the art review of motor vehicle air pollution. Its purpose is to aid highway personnel in understanding the nature of this environmental problem on our highways and to present possible solutions for its abatement...
Risk assessment model for development of advanced age-related macular degeneration.
Klein, Michael L; Francis, Peter J; Ferris, Frederick L; Hamon, Sara C; Clemons, Traci E
2011-12-01
To design a risk assessment model for development of advanced age-related macular degeneration (AMD) incorporating phenotypic, demographic, environmental, and genetic risk factors. We evaluated longitudinal data from 2846 participants in the Age-Related Eye Disease Study. At baseline, these individuals had all levels of AMD, ranging from none to unilateral advanced AMD (neovascular or geographic atrophy). Follow-up averaged 9.3 years. We performed a Cox proportional hazards analysis with demographic, environmental, phenotypic, and genetic covariates and constructed a risk assessment model for development of advanced AMD. Performance of the model was evaluated using the C statistic and the Brier score and externally validated in participants in the Complications of Age-Related Macular Degeneration Prevention Trial. The final model included the following independent variables: age, smoking history, family history of AMD (first-degree member), phenotype based on a modified Age-Related Eye Disease Study simple scale score, and genetic variants CFH Y402H and ARMS2 A69S. The model did well on performance measures, with very good discrimination (C statistic = 0.872) and excellent calibration and overall performance (Brier score at 5 years = 0.08). Successful external validation was performed, and a risk assessment tool was designed for use with or without the genetic component. We constructed a risk assessment model for development of advanced AMD. The model performed well on measures of discrimination, calibration, and overall performance and was successfully externally validated. This risk assessment tool is available for online use.
Spin-dependent Hall effect in degenerate semiconductors: a theoretical study
Energy Technology Data Exchange (ETDEWEB)
Idrish Miah, M [Nanoscale Science and Technology Centre, Griffith University, Nathan, Brisbane, QLD 4111 (Australia)], E-mail: m.miah@griffith.edu.au
2008-10-15
The spin-dependent Hall (SDH) effect in degenerate semiconductors is investigated theoretically. Starting from a two-component drift-diffusion equation, an expression for SDH voltage (V{sub SDH}) is derived, and drift and diffusive contributions to V{sub SDH} are studied. For the possible enhancement of the diffusive part, degenerate and nondegenerate cases are examined. We find that due to an increase in the diffusion coefficient V{sub SDH} increases in a degenerate semiconductor, consistent with the experimental observations. The expression for V{sub SDH} is reduced in three limiting cases, namely diffusive, drift-diffusion crossover and drift, and is analysed. The results agree with those obtained in recent theoretical investigations.
Spin-dependent Hall effect in degenerate semiconductors: a theoretical study
International Nuclear Information System (INIS)
Idrish Miah, M
2008-01-01
The spin-dependent Hall (SDH) effect in degenerate semiconductors is investigated theoretically. Starting from a two-component drift-diffusion equation, an expression for SDH voltage (V SDH ) is derived, and drift and diffusive contributions to V SDH are studied. For the possible enhancement of the diffusive part, degenerate and nondegenerate cases are examined. We find that due to an increase in the diffusion coefficient V SDH increases in a degenerate semiconductor, consistent with the experimental observations. The expression for V SDH is reduced in three limiting cases, namely diffusive, drift-diffusion crossover and drift, and is analysed. The results agree with those obtained in recent theoretical investigations.
Holz, Frank G.; Amoaku, Winfried; Donate, Juan; Guymer, Robyn H.; Kellner, Ulrich; Schlingemann, Reinier O.; Weichselberger, Andreas; Staurenghi, Giovanni
2011-01-01
Objective: To evaluate the safety and efficacy of individualized ranibizumab treatment in patients with neovascular age-related macular degeneration. Design: Twelve-month, phase III, multicenter, open-label, single-arm study. Participants: A total of 513 ranibizumab-naive SUSTAIN patients.
Directory of Open Access Journals (Sweden)
Delio Eulalio Martins
Full Text Available CONTEXT AND OBJECTIVE: There is controversy regarding which imaging method is best for identifying early degenerative alterations in intervertebral discs. No correlations between such methods and histological finds are presented in the literature. The aim of this study was to correlate the thickness of intervertebral discs measured on simple radiographs with the degree of degeneration seen on magnetic resonance images and the histological findings relating to nerve ends inside the discs. DESIGN AND SETTING: Cross-sectional correlation study on the lumbar spines of human cadavers, at Universidade Federal de São Paulo (Unifesp, São Paulo, Brazil. METHODS: Ten lumbar spinal columns were extracted from human cadavers and subjected to magnetic resonance imaging and simple radiography. They were classified according to the degree of disc degeneration seen on magnetic resonance, and the thickness of the discs was measured on radiographs. The intervertebral discs were then extracted, embedded in paraffin and analyzed immunohistochemically with protein S100, and the nerve fibers were counted and classified. RESULTS: No correlation was observed between the thickness of the intervertebral discs and the degree of degeneration seen on magnetic resonance images. Only the uppermost lumbar discs (L1/L2 and L2/L3 presented a correlation between their thickness and type I and IV nerve endings. CONCLUSION: Reduced disc thickness is unrelated to increased presence of nerve ends in intervertebral discs, or to the degree of disc degeneration.
Toh, Wei Seong; Gomoll, Andreas H.; Olsen, Bjørn Reino; Spector, Myron
2014-01-01
Objective: The objective of the present study was to investigate the presence and distribution of 2 basement membrane (BM) molecules, laminin and collagen type IV, in healthy and degenerative cartilage tissues. Design: Normal and degenerated tissues were obtained from goats and humans, including articular knee cartilage, the intervertebral disc, and meniscus. Normal tissue was also obtained from patella-tibial enthesis in goats. Immunohistochemical analysis was performed using anti-laminin and anti–collagen type IV antibodies. Human and goat skin were used as positive controls. The percentage of cells displaying the pericellular presence of the protein was graded semiquantitatively. Results: When present, laminin and collagen type IV were exclusively found in the pericellular matrix, and in a discrete layer on the articulating surface of normal articular cartilage. In normal articular (hyaline) cartilage in the human and goat, the proteins were found co-localized pericellularly. In contrast, in human osteoarthritic articular cartilage, collagen type IV but not laminin was found in the pericellular region. Nonpathological fibrocartilaginous tissues from the goat, including the menisci and the enthesis, were also positive for both laminin and collagen type IV pericellularly. In degenerated fibrocartilage, including intervertebral disc, as in degenerated hyaline cartilage only collagen type IV was found pericellularly around chondrocytes but with less intense staining than in non-degenerated tissue. In calcified cartilage, some cells were positive for laminin but not type IV collagen. Conclusions: We report differences in expression of the BM molecules, laminin and collagen type IV, in normal and degenerative cartilaginous tissues from adult humans and goats. In degenerative tissues laminin is depleted from the pericellular matrix before collagen type IV. The findings may inform future studies of the processes underlying cartilage degeneration and the functional
Supra-annular valve strategy for an early degenerated transcatheter balloon-expandable heart valve.
Kamioka, Norihiko; Caughron, Hope; Corrigan, Frank; Block, Peter; Babaliaros, Vasilis
2018-01-23
Currently, there are no recommendations regarding the selection of valve type for a transcatheter heart valve (THV)-in-THV procedure. A supra-annular valve design may be superior in that it results in a larger effective orifice area and may have a lower chance of valve thrombosis after THV-in-THV. In this report, we describe the use of a supra-annular valve strategy for an early degenerated THV. © 2018 Wiley Periodicals, Inc.
Joachim, Nichole; Colijn, Johanna Maria; Kifley, Annette; Lee, Kristine E.; Buitendijk, Gabriëlle H. S.; Klein, Barbara E. K.; Myers, Chelsea E.; Meuer, Stacy M.; Tan, Ava G.; Holliday, Elizabeth G.; Attia, John; Liew, Gerald; Iyengar, Sudha K.; de Jong, Paulus T. V. M.; Hofman, Albert; Vingerling, Johannes R.; Mitchell, Paul; Klaver, Caroline C. W.; Klein, Ronald; Wang, Jie Jin
2017-01-01
Purpose To assess the 5-year progression from unilateral to bilateral age-related macular degeneration (AMD) and associated risk factors. Design Pooled data analyses of three prospective population-based cohorts, the Blue Mountains Eye Study, Beaver Dam Eye Study and Rotterdam Study. Methods Retinal
Forest Interpreter's Primer on Fire Management.
Zelker, Thomas M.
Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…
Evaluation of genetic diversity in open pollinated guava by iPBS primers
International Nuclear Information System (INIS)
Mehmood, A.; Jaskani, M.J.; Ahmad, S.; Ahmad, R.
2013-01-01
DNA markers are important tools for assessing genetic diversity and relationships among species, cultivars and breeding materials. Many horticultural species are lacking genomic information. DNA markers that do not require prior knowledge of DNA sequences are therefore appealing for horticultural research. A retrotransposon-based DNA marker system, iPBS (inter primer binding sites) developed from conserved primer binding sites within retrotransposons, was used to study the genetic variation and relationships in ornamental guava. PCR from 6 iPBS primers (dominant markers) produced a total of 113 bands (52.38-100% polymorphic) ranging from 150 bp to 3000 bp, and the mean PIC value for each primer ranging from 0.1245 to 0.3698. Molecular information generated from both iPBS was separately scored in a matrix for phylogenetic dendrogram construction. The phylogenetic dendrogram based on iPBS markers reflected morphologic classifications of the accessions that were studied. The iPBS PCR-based genome fingerprinting technology in this study is low-cost and provides another effective alternative in differentiation of accessions in guava (Psidium guajava Linn.) and related species or genera. (author)
Extended Hellmann-Feynman theorem for degenerate eigenstates
Zhang, G. P.; George, Thomas F.
2004-04-01
In a previous paper, we reported a failure of the traditional Hellmann-Feynman theorem (HFT) for degenerate eigenstates. This has generated enormous interest among different groups. In four independent papers by Fernandez, by Balawender, Hola, and March, by Vatsya, and by Alon and Cederbaum, an elegant method to solve the problem was devised. The main idea is that one has to construct and diagonalize the force matrix for the degenerate case, and only the eigenforces are well defined. We believe this is an important extension to HFT. Using our previous example for an energy level of fivefold degeneracy, we find that those eigenforces correctly reflect the symmetry of the molecule.
Kinematic control of robot with degenerate wrist
Barker, L. K.; Moore, M. C.
1984-01-01
Kinematic resolved rate equations allow an operator with visual feedback to dynamically control a robot hand. When the robot wrist is degenerate, the computed joint angle rates exceed operational limits, and unwanted hand movements can result. The generalized matrix inverse solution can also produce unwanted responses. A method is introduced to control the robot hand in the region of the degenerate robot wrist. The method uses a coordinated movement of the first and third joints of the robot wrist to locate the second wrist joint axis for movement of the robot hand in the commanded direction. The method does not entail infinite joint angle rates.
Prevalence of lattice degeneration and its relation to axial length in severe myopia.
Celorio, J M; Pruett, R C
1991-01-15
We studied 436 eyes of 218 patients with myopia of -6.00 diopters or more in both eyes. Of 218 patients, 72 (33.0%) had lattice degeneration of the retina. Among these 72 patients, lattice lesions were uniocular in 39 (54.2%) and binocular in 33 (45.8%). Of 105 males, 33 (31.4%) had lattice degeneration; of 113 females, 39 (34.5%) had lattice degeneration. Contrary to previously published data, we found an inverse relationship between axial length and the prevalence of lattice degeneration in severely myopic eyes. The greatest prevalence of lattice degeneration (63 of 154 eyes, 40.9%) was found in eyes with an axial length of 26.0 to 26.9 mm (-6.00 to -8.70 diopters), and the least prevalence of lattice degeneration (five of 71 eyes, 7.0%) was found in eyes with an axial length of 32.0 mm (-24.00 diopters) or greater. This may explain the observation that retinal detachment after cataract surgery has been noted more commonly among patients with moderate than severe myopia.
Posterior Lattice Degeneration Characterized by Spectral Domain Optical Tomography
Manjunath, Varsha; Taha, Mohammed; Fujimoto, James G.; Duker, Jay S.
2011-01-01
PURPOSE: To utilize high-resolution spectral domain optical coherence tomography (SD-OCT) in the characterization of retinal and vitreal morphological changes overlying posterior lattice degeneration. METHODS: A cross-sectional, retrospective analysis was performed on 13 eyes of 13 nonconsecutive subjects with posterior lattice degeneration seen at the New England Eye Center, Tufts Medical Center between October 2009 and January 2010. SD-OCT images taken through the region of latti...
A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets
Energy Technology Data Exchange (ETDEWEB)
Warwick, William M.
2002-06-03
This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.
Waldenberg, Christian; Hebelka, Hanna; Brisby, Helena; Lagerstrand, Kerstin Magdalena
2018-05-01
Magnetic resonance imaging (MRI) is the best diagnostic imaging method for low back pain. However, the technique is currently not utilized in its full capacity, often failing to depict painful intervertebral discs (IVDs), potentially due to the rough degeneration classification system used clinically today. MR image histograms, which reflect the IVD heterogeneity, may offer sensitive imaging biomarkers for IVD degeneration classification. This study investigates the feasibility of using histogram analysis as means of objective and continuous grading of IVD degeneration. Forty-nine IVDs in ten low back pain patients (six males, 25-69 years) were examined with MRI (T2-weighted images and T2-maps). Each IVD was semi-automatically segmented on three mid-sagittal slices. Histogram features of the IVD were extracted from the defined regions of interest and correlated to Pfirrmann grade. Both T2-weighted images and T2-maps displayed similar histogram features. Histograms of well-hydrated IVDs displayed two separate peaks, representing annulus fibrosus and nucleus pulposus. Degenerated IVDs displayed decreased peak separation, where the separation was shown to correlate strongly with Pfirrmann grade (P histogram appearances. Histogram features correlated well with IVD degeneration, suggesting that IVD histogram analysis is a suitable tool for objective and continuous IVD degeneration classification. As histogram analysis revealed IVD heterogeneity, it may be a clinical tool for characterization of regional IVD degeneration effects. To elucidate the usefulness of histogram analysis in patient management, IVD histogram features between asymptomatic and symptomatic individuals needs to be compared.
International Nuclear Information System (INIS)
Nguyen, H.; Bredy, R.; Camp, H.A.; DePaola, B.D.; Awata, T.
2004-01-01
Resolution plays a vital role in spectroscopic studies. In the usual recoil-ion momentum spectroscopy (RIMS), Q-value resolution is relied upon to distinguish between different collision channels: The better the Q-value resolution, the better one is able to resolve energetically similar channels. Although traditional COLTRIMS greatly improves Q-value resolution by cooling the target and thus greatly reducing the initial target momentum spread, the resolution of the technique is still limited by target temperature. However, with the recent development in RIMS, namely, magneto-optical trap recoil ion momentum spectroscopy (MOTRIMS) superior recoil ion momentum resolution as well as charge transfer measurements with laser excited targets have become possible. Through MOTRIMS, methods for the measurements of target excited state fraction and kinematically complete relative charge transfer cross sections have been developed, even for some systems having energetically degenerate or nearly degenerate channels. In the present work, the systems of interest having energy degeneracies or near degeneracies are Rb + , K + , and Li + colliding with trapped Rb(5l), where l=s and p
Relationship between facet tropism and facet joint degeneration in the sub-axial cervical spine
Directory of Open Access Journals (Sweden)
Xin Rong
2017-02-01
Full Text Available Abstract Background Facet tropism is the angular asymmetry between the left and right facet joint orientation. Although debatable, facet tropism was suggested to be associated with disc degeneration, facet degeneration and degenerative spondylolisthesis in the lumbar spine. The purpose of this study was to explore the relationship between facet tropism and facet degeneration in the sub-axial cervical spine. Methods A total of 200 patients with cervical spondylosis were retrospectively analyzed. Facet degeneration was categorized into 4 grade: grade I, normal; grade II, degenerative changes including joint space narrowing, cyst formation, small osteophytes (3 mm without fusion of the joint; grade IV, bony fusion of the facet joints. Facet orientations and facet tropisms with respect to the transverse, sagittal and coronal plane were calculated from the reconstructed cervical spine, which was based on the axial CT scan images. The paired facet joints were then categorized into three types: symmetric, moderated tropism and severe tropism. Univariate and multivariate analysis were performed to evaluate the relationship between any demographic and anatomical factor and facet degeneration. Results The mean age of enrolled patients was 46.23 years old (ranging from 30 to 64 years old. There were 114 males and 86 females. The degrees of facet degeneration varied according to cervical levels and ages. Degenerated facet joints were most common at C2-C3 level and more common in patients above 50 years old. The facet orientations were also different from level to level. By univariate analysis, genders, ages, cervical levels, facet orientations and facet tropisms were all significantly different between the normal facets and degenerated facets. However, results from multivariate logistic regression suggested only age and facet tropism with respect to the sagittal plane were related to facet degeneration. Conclusion Facet degeneration were more common at
A primer on industrial ecosystems : a strategy for sustainable industrial development
Energy Technology Data Exchange (ETDEWEB)
Cote, R P [Dalhousie Univ., Halifax, NS (Canada). Eco-Efficiency Centre; [Dalhousie Univ., Halifax, NS (Canada). Faculty of Management, School for Resource and Environmental Studies
2003-07-01
Industrial ecology incorporates ecological theories, functions and limits into the design of industrial production systems, processes and products. The main objective is to enhance environmental and economic performance through collaboration in managing environmental resource issues such as energy, water and materials. Industrial ecology recognizes the connectedness and synergies of materials, products and infrastructure. As such, it considers the life cycle of products, the design of buildings, infrastructure and industrial parks. By working together, businesses gain a collective benefit which is greater than the total of the individual benefits each company could achieve on its own. Industrial ecology also considers the reuse, recovery and recycling of resources. The benefits include: efficiency of resource use; cost reduction for industrial infrastructure; sustainable development support; and, new opportunities in economic development, technology development, manufacturing, and business management. This primer also presents guidelines for win-win projects in industrial ecology. refs., figs.
Wilkinson, Charles P
2014-09-05
. We last searched the electronic databases on 19 February 2014. Textbooks regarding retinal detachment and the reference lists of relevant reports were reviewed for additional study reports. We contacted experts in the field for details of other published and unpublished studies. This review was designed to include randomized controlled trials in which one treatment for asymptomatic retinal breaks and lattice degeneration was compared with another treatment or no treatment. Initially, one author assessed the search results and collected relevant studies. Since no studies met the inclusion criteria, no studies were assessed for risk of bias. No data were extracted and no meta-analysis could be performed. No trials were found that met the inclusion criteria for this review. No conclusions could be reached about the effectiveness of surgical interventions to prevent retinal detachment in eyes with asymptomatic retinal breaks or lattice degeneration, or both. Current recommendations for treatment, based upon a consensus of expert opinion, should be assessed in a randomized controlled trial.
Urocortin 2 treatment is protective in excitotoxic retinal degeneration.
Szabadfi, K; Kiss, P; Reglodi, D; Fekete, E M; Tamas, A; Danyadi, B; Atlasz, T; Gabriel, R
2014-03-01
Urocortin 2 (Ucn 2) is a corticotrop releasing factor paralog peptide with many physiological functions and it has widespread distribution. There are some data on the cytoprotective effects of Ucn 2, but less is known about its neuro- and retinoprotective actions. We have previously shown that Ucn 2 is protective in ischemia-induced retinal degeneration. The aim of the present study was to examine the protective potential of Ucn 2 in monosodium-glutamate (MSG)-induced retinal degeneration by routine histology and to investigate cell-type specific effects by immunohistochemistry. Rat pups received MSG applied on postnatal days 1, 5 and 9 and Ucn 2 was injected intravitreally into one eye. Retinas were processed for histology and immunocytochemistry after 3 weeks. Immunolabeling was determined for glial fibrillary acidic protein, vesicular glutamate transporter 1, protein kinase Cα, calbindin, parvalbumin and calretinin. Retinal tissue from animals treated with MSG showed severe degeneration compared to normal retinas, but intravitreal Ucn 2 treatment resulted in a retained retinal structure both at histological and neurochemical levels: distinct inner retinal layers and rescued inner retinal cells (different types of amacrine and rod bipolar cells) could be observed. These findings support the neuroprotective function of Ucn 2 in MSG-induced retinal degeneration.
Washington, Ilyas; Saad, Leonide
2016-01-01
One of the earliest events preceding several forms of retinal degeneration is the formation and accumulation of vitamin A dimers in the retinal pigment epithelium (RPE) and underlying Bruch's membrane (BM). Such degenerations include Stargardt disease, Best disease, forms of retinitis pigmentosa, and age-related macular degeneration (AMD). Since their discovery in the 1990's, dimers of vitamin A, have been postulated as chemical triggers driving retinal senescence and degeneration. There is evidence to suggest that the rate at which vitamin A dimerizes and the eye's response to the dimerization products may dictate the retina's lifespan. Here, we present outstanding questions, finding the answers to which may help to elucidate the role of vitamin A dimerization in retinal degeneration.
Inteligencia emocional y autoconcepto en los estudiantes de primer ciclo
Castillo Canales, Braulio
2017-01-01
En nuestra investigación se tuvo como problema: ¿Qué relación existe entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II? Además el objetivo fue: Determinar la relación entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II. El tipo de estudio fue básica...
Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer
Energy Technology Data Exchange (ETDEWEB)
Lucas, D.S.
2004-10-03
This paper covers the basics of the implementation of the control volume method in the context of the Homogeneous Equilibrium Model (HEM)(T/H) code using the conservation equations of mass, momentum, and energy. This primer uses the advection equation as a template. The discussion will cover the basic equations of the control volume portion of the course in the primer, which includes the advection equation, numerical methods, along with the implementation of the various equations via FORTRAN into computer programs and the final result for a three equation HEM code and its validation.
Móvil remisión de V. cinta del primer móvil.
2011-01-01
[ES] Definición del término Móvil remisión de V. cinta del primer móvil. en el diccionario Dicter. [EN] Definition of the word Móvil remisión de V. cinta del primer móvil. in the dictionary Dicter.
Degenerate four wave mixing in large mode area hybrid photonic crystal fibers
DEFF Research Database (Denmark)
Petersen, Sidsel Rübner; Alkeskjold, Thomas Tanggaard; Lægsgaard, Jesper
2013-01-01
Spontaneous degenerate four wave mixing (FWM) is investigated in large mode area hybrid photonic crystal fibers, in which photonic bandgap guidance and index guidance is combined. Calculations show the parametric gain is maximum on the edge of a photonic bandgap, for a large range of pump...... wavelengths. The FWM products are observed on the edges of a transmission band experimentally, in good agreement with the numerical results. Thereby the bandedges can be used to control the spectral positions of FWM products through a proper fiber design. The parametric gain control combined with a large mode...... area fiber design potentially allows for power scaling of light at wavelengths not easily accessible with e.g. rare earth ions....
Leopold, Luna Bergere; Langbein, Walter Basil
1960-01-01
When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to
Energy Technology Data Exchange (ETDEWEB)
Zhang, Xuan; Zhang, Xiaofeng; Yan, Yue; Zhong, Yanli; Li, Lei; Zhang, Guanli [Beijing Institute of Aeronautical Materials (BIAM), Haidian District, Beijing, 100095 (China)
2015-04-01
A silicone-based primer layer was developed to improve the adhesion and thermal stability of amorphous transparent indium zinc oxide (IZO) films on polycarbonate (PC). The IZO films deposited by direct current magnetron sputtering at room temperature on primer-treated and untreated PCs were evaluated ex situ in terms of surface morphology, adhesion, optical, and electrical properties during annealing at 120 C in air. Nano-scratch tests indicated the adhesion of IZO films on primer-treated substrates was superior to that on untreated PCs. This superior adhesion can be attributed to the strong Si-O-Si inorganic bonds abundant in the primer layer and better matches of the primer layer in the terms of thermal expansion to the IZO. Moreover, the electrical resistivity of IZO films prepared on primer-treated PCs remained stable during the annealing treatment, whereas those of IZO films on untreated PCs presented a continuously increasing trend, which was attributed to the decrease in carrier concentration that resulted from oxygen adsorption. (copyright 2015 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)
Deficiency of adaptive immunity does not interfere with Wallerian degeneration.
Directory of Open Access Journals (Sweden)
Christopher R Cashman
Full Text Available Following injury, distal axons undergo the process of Wallerian degeneration, and then cell debris is cleared to create a permissive environment for axon regeneration. The innate and adaptive immune systems are believed to be critical for facilitating the clearance of myelin and axonal debris during this process. However, immunodeficient animal models are regularly used in transplantation studies investigating cell therapies to modulate the degenerative/regenerative response. Given the importance of the immune system in preparing a permissive environment for regeneration by clearing debris, animals lacking, in part or in full, a functional immune system may have an impaired ability to regenerate due to poor myelin clearance, and may, thus, be poor hosts to study modulators of regeneration and degeneration. To study this hypothesis, three different mouse models with impaired adaptive immunity were compared to wild type animals in their ability to degenerate axons and clear myelin debris one week following sciatic nerve transection. Immunofluorescent staining for axons and quantitation of axon density with nerve histomorphometry of the distal stump showed no consistent discrepancy between immunodeficient and wild type animals, suggesting axons tended to degenerate equally between the two groups. Debris clearance was assessed by macrophage density and relative myelin basic protein expression within the denervated nerve stump, and no consistent impairment of debris clearance was found. These data suggested deficiency of the adaptive immune system does not have a substantial effect on axon degeneration one week following axonal injury.
Rastogi, Neelesh; Smith, R Theodore
2016-01-01
Age-related macular degeneration is the leading cause of adult blindness in the developed world. Thus, major endeavors to understand the risk factors and pathogenesis of this disease have been undertaken. Reticular macular disease is a proposed subtype of age-related macular degeneration correlating histologically with subretinal drusenoid deposits located between the retinal pigment epithelium and the inner segment ellipsoid zone. Reticular lesions are more prevalent in females and in older age groups and are associated with a higher mortality rate. Risk factors for developing age-related macular degeneration include hypertension, smoking, and angina. Several genes related to increased risk for age-related macular degeneration and reticular macular disease are also associated with cardiovascular disease. Better understanding of the clinical and genetic risk factors for age-related macular degeneration and reticular macular disease has led to the hypothesis that these eye diseases are systemic. A systemic origin may help to explain why reticular disease is diagnosed more frequently in females as males suffer cardiovascular mortality at an earlier age, before the age of diagnosis of reticular macular disease and age-related macular degeneration. Copyright © 2015 Elsevier Inc. All rights reserved.
Family-specific vs. universal PCR primers for the study of mitochondrial DNA in plants
Directory of Open Access Journals (Sweden)
Aleksić Jelena M.
2016-01-01
Full Text Available Mitochondrial genomes (mtDNAs or mitogenomes of seed plants are characterized by a notoriously unstable organization on account of which available so-called universal or consensus primers may fail to fulfil their foreseen function - amplification of various mtDNA regions in a broad range of plant taxa. Thus, the primers developed for groups assumed to have similar organization of their mitogenomes, such as families, may facilitate a broader usage of more variable non-coding portions of these genomes in group members. Using in silico PCR method and six available complete mitogenomes of Fabaceae, it has been demonstrated that only three out of 36 published universal primer and three Medicago sativa-specific primer pairs that amplify various mtDNA regions are suitable for six representatives of the Fabaceae family upon minor modifications, and develop 21 Fabaceae-specific primer pairs for amplification of all 14 cis-splicing introns in genes of NADH subunits (nad genes which represent the most commonly used non-coding mtDNA regions in various studies in plants. Using the same method and six available complete mitogenomes of representatives of related families Cucurbitaceae, Euphorbiaceae and Rosaceae and a model plant, Arabidopsis thaliana, it has further been demonstrated that applicability of newly developed primer pairs for amplification of nad introns in more or less related taxa was dependent not only on species evolutionary distances but also on their genome sizes. A reported set of 24 primer pairs is a valuable resource which may facilitate a broader usage of mtDNA variability in future studies at both intra- and inter-specific levels in Fabaceae, which is the third largest family of flowering plants rarely studied at the mtDNA level, and in other more or less related taxa. [Projekat Ministarstva nauke Republike Srbije, br. 173005
Energy Technology Data Exchange (ETDEWEB)
Ata-ur-Rahman,; Qamar, A. [Institute of Physics and Electronics, University of Peshawar, Peshawar 25000 (Pakistan); National Centre for Physics, QAU Campus, Shahdrah Valley Road, Islamabad 44000 (Pakistan); Masood, W. [National Centre for Physics, QAU Campus, Shahdrah Valley Road, Islamabad 44000 (Pakistan); COMSATS, Institute of Information Technology, Park Road, Chak Shahzad, Islamabad 44000 (Pakistan); Eliasson, B. [Physics Department, University of Strathclyde, Glasgow G4 0NG, Scotland (United Kingdom)
2013-09-15
In this paper, small but finite amplitude electrostatic solitary waves in a relativistic degenerate magnetoplasma, consisting of relativistically degenerate electrons and non-degenerate cold ions, are investigated. The Zakharov-Kuznetsov equation is derived employing the reductive perturbation technique and its solitary wave solution is analyzed. It is shown that only compressive electrostatic solitary structures can propagate in such a degenerate plasma system. The effects of plasma number density, ion cyclotron frequency, and direction cosines on the profiles of ion acoustic solitary waves are investigated and discussed at length. The relevance of the present investigation vis-a-vis pulsating white dwarfs is also pointed out.
D'Alessandro, Oriana; Selmi, Gonzalo J.; Deyá, Cecilia; Di Sarli, Alejandro; Romagnoli, Roberto
2018-02-01
Tannins are polyphenols synthesized by plants and useful for the coating industry as corrosion inhibitors. In addition, lanthanum salts have a great inhibitory effect on steel corrosion. The aim of this study was to obtain lanthanum "tannate" with adequate solubility to be incorporated as the corrosion inhibitor in a wash-primer. The "tannate" was obtained from commercial "Quebracho" tannin and 0.1 M La(NO3)3. The soluble tannin was determined by the Folin-Denis reagent, while the concentration of Lanthanum was obtained by a gravimetric procedure. The protective action of "tannate" on SAE 1010 steel was evaluated by linear polarization curves and corrosion potential measurements. Lanthanum "tannate" was incorporated in a wash-primer formulation and tested by corrosion potential and ionic resistance measurements. The corrosion rate was also determined by the polarization resistance technique. Besides, the primer was incorporated in an alkyd paint system and its anticorrosion performance assessed in the salt spray cabinet and by electrochemical impedance spectroscopy. Results showed that lanthanum "tannate" primer inhibits the development of deleterious iron oxyhydroxides on the steel substrate and incorporated into a paint system had a similar behavior to the primer formulated with zinc tetroxychromate.
The use of a fluoropolymer containing primer to enhance adhesion of rotolined fluoropolymer coatings
Energy Technology Data Exchange (ETDEWEB)
Lech, L.M. [DuPont, Parkersburg, WV (United States)
1999-11-01
Fluoropolymers such as PFA and ETFE are often used in rotolining applications. A common source of failure for rotolined coatings is delamination from the metal substrate. Extensive thermal cycling of the coated part, permeation of the contained liquid to the substrate, or a combination of both thermal cycling and permeation causes this. Rotolined coatings are typically applied directly to the metal part. It has been found that applying an aqueous fluoropolymer based primer to the metal substrate prior to applying the rotolined resin increases the time before delamination is observed. The primer is applied by conventional spray techniques and can either be force dried at low temperature or air-dried under ambient conditions. The primer consists primarily of a fluoropolymer such as ETFE or PFA and a bonding agent such as polyamide-imide, polyphenylene sulfide, or polyether sulfone. After the primer is applied to the metal part, the fluoropolymer in the primer melt blends with the fluoropolymer rotolining resin during the rotolining process. The bonding agent enhances the adhesion of the entire coating system to the metal part. This extends the lifetime of the rotolined coatings.
Is Preexisting Cervical Disk Degeneration a Prognostic Factor in Whiplash-associated Disorders?
Chung, Nam-Su; Jeon, Chang-Hoon; Lee, Yu-Sang; Park, Jang-Ho; Lee, Han-Dong
2017-11-01
This is a retrospective control study. We aimed to determine whether preexisting cervical disk degeneration is a prognostic factor in Whiplash-associated disorder (WAD). WAD is a common injury of traffic accident and has a broad range of prognoses. Although numerous studies have investigated prognostic factors in WAD, few have evaluated the effect of preexisting disk degeneration. This study involved 45 consecutive patients with grade I or II WAD having advanced disk degeneration (at least 1 disk of Miyazaki grade≥III on magnetic resonance imaging) and a control cohort of 52 patients with no or mild disk degeneration (all disks having Miyazaki grades≤II). Clinical assessment included pain severity (assessed by the visual analog scale), neck pain-related disability (assessed by the neck disability index), and physical and mental health condition [assessed by the short-form 36 (SF-36) physical composite score and SF-36 mental composite score, respectively]. Changes in each parameter were evaluated at baseline and at 3-month, 6-month, and 1-year follow-ups and compared between the 2 groups. There were no differences between the 2 groups regarding demographics and baseline outcome parameters (all P>0.05). There were also no differences in improvement in visual analog scale for neck pain, neck disability index, SF-36 physical composite score, or SF-36 mental composite score between the 2 groups (all P>0.05) for each visit. The number of claim closures was significantly lower among patients with advanced degeneration than among controls at 6-month and 1-year follow-ups (P=0.004 and 0.006, respectively). In the present study, the clinical presentation and prognosis of WAD were not affected by preexisting disk degeneration. However, claim closure was delayed in patients with preexisting disk degeneration. These results suggest that misunderstanding of disk degeneration on magnetic resonance imaging may create persistent illness and lead to continued compensation in WAD.
HUMAN CAPSULE EPITHELIAL-CELL DEGENERATION A LM, SEM AND TEM INVESTIGATION
JONGEBLOED, WL; KALICHARAN, D; WORST, JGF
1993-01-01
The degeneration of the capsule epithelium of cataractous lenses has been studied with LM, SEM on TEM with emphases on TEM. The observed degeneration of the epithelial cells can be described as follows: The cell nucleus becomes picnotic and desintegrates as result of change of the chromatin.
Phonon emission in a degenerate semiconductor at low lattice temperatures
International Nuclear Information System (INIS)
Midday, S.; Nag, S.; Bhattacharya, D.P.
2015-01-01
The characteristics of phonon growth in a degenerate semiconductor at low lattice temperatures have been studied for inelastic interaction of non-equilibrium electrons with the intravalley acoustic phonons. The energy of the phonon and the full form of the phonon distribution are taken into account. The results reveal significant changes in the growth characteristics compared to the same for a non-degenerate material
New approaches and potential treatments for dry age-related macular degeneration
Directory of Open Access Journals (Sweden)
Francisco Max Damico
2012-02-01
Full Text Available Emerging treatments for dry age-related macular degeneration (AMD and geographi c atrophy focus on two strategies that target components involved in physiopathological pathways: prevention of photoreceptors and retinal pigment epithelium loss (neuroprotection induction, oxidative damage prevention, and visual cycle modification and suppression of inflammation. Neuroprotective drugs, such as ciliary neurotrophic factor, brimonidine tartrate, tandospirone, and anti-amyloid β antibodies, aim to prevent apoptosis of retinal cells. Oxidative stress and depletion of essential micronutrients are targeted by the Age-Related Eye Disease Study (AREDS formulation. Visual cycle modulators reduce the activity of the photoreceptors and retinal accumulation of toxic fluorophores and lipofuscin. Eyes with dry age-related macular degeneration present chronic inflammation and potential treatments include corticosteroid and complement inhibition. We review the current concepts and rationale of dry age-related macular degeneration treatment that will most likely include a combination of drugs targeting different pathways involved in the development and progression of age-related macular degeneration.
Natural history of seminiferous tubule degeneration in Klinefelter syndrome
DEFF Research Database (Denmark)
Aksglaede, Lise; Wikström, Anne M; Rajpert-De Meyts, Ewa
2006-01-01
Klinefelter syndrome (47,XXY) is characterized by small, firm testis, gynaecomastia, azoospermia and hypergonadotropic hypogonadism. Degeneration of the seminiferous tubules in 47,XXY males is a well-described phenomenon. It begins in the fetus, progresses through infancy and accelerates dramatic......Klinefelter syndrome (47,XXY) is characterized by small, firm testis, gynaecomastia, azoospermia and hypergonadotropic hypogonadism. Degeneration of the seminiferous tubules in 47,XXY males is a well-described phenomenon. It begins in the fetus, progresses through infancy and accelerates...
ITS primers for the identification of marketable Boletus.
Mello, Antonietta; Ghignone, Stefano; Vizzini, Alfredo; Sechi, Clizia; Ruiu, Pino; Bonfante, Paola
2006-02-10
Boletus species belonging to the section Boletus are the most frequently eaten fungi among those harvested in natural conditions in Europe. This section groups 10 taxa which are hardly distinguishable on the basis of their morphology. Some of them have been shown to induce allergic IgE-mediated symptoms either through inhalation, ingestion or contact. Since questions relating to the presence of allergens in any of the species most in demand (B. edulis, B. aereus, B. pinophilus, B. aestivalis, all classified as B. edulis s.l.) remain open, together with the absence of tools which distinguish the species, we sequenced the ITS region of 28 Boletus samples and then we designed specific primers. These allowed the effective separation of the taxa. In addition, the phylogenetic tree obtained from the sequences alignment revealed that B. violaceofuscus, a spectacular Chinese fungus considered belonging to the section Boletus and often sold intermixed with B. edulis s.l. specimens, clusters outside the section Boletus.
Xu, B Y; Ji, B C; Guo, W T; Mu, W B; Cao, L
2017-06-01
Objective: To evaluate the influence of patellofemoral joint degeneration and pre-operative pain location on the outcome of medial Oxford unicompartmental knee arthroplasty (UKA). Methods: A total of 58 patients (58 knees) with medial Oxford UKA had been performed for medial osteoarthritis from March 2013 to July 2014 in Department of Orthopaedic Surgery at First Teaching Hospital of Xinjiang Medical University were retrospective reviewed. There were 24 males and 34 females, the age from 43 to 87 years with the mean age was 68.5 years. The mean body mass index was 25.2 kg/m(2) ranging from 19.7 to 31.5 kg/m(2). Patients were divided into anterior-medial pain group (35 knees), anterior knee pain group (17 knees) and general knee pain group (6 knees) according to pre-operative pain location. Pre-operative radiological statuses of the patellefemoral joint were defined by Ahlback system and divided into patellofemoral joint degeneration group (16 knees) and normal group (42 knees). Patients were also divided into medial patellofemoral degeneration group (20 knees), lateral patellofemoral degeneration group (12 knees) and normal group (26 knees) according to Altman scoring system. Outerbridge system was used intraoperatively and the patients were divided into patellofemoral joint degeneration group (21 knees) and normal group (37 knees). Pre- and post-operative outcomes were evaluated with Oxford Knee Score (OKS), Western Ontario and MacMaster (WOMAC) and patellofemoral score system of Lonner. T test and ANOVA were used to analyze the data. Results: The average duration of follow-up was 33 months (from 26 to 42 months). There were no patients had complications of infection, deep vein thrombosis, dislocation or loosing at the last follow-up. Compared to pre-operation, OKS (18.9±3.5 vs . 38.9±4.7, 19.3±4.2 vs . 39.6±4.6, 18.1±3.2 vs . 38.1±3.7)( t =5.64 to 7.08, all P patellofemoral joint degeneration group and normal group, the outcomes were the same according to
Leonhardt, U.
2001-01-01
Laboratory-based optical analogs of astronomical objects such as black holes rely on the creation of light with an extremely low or even vanishing group velocity (slow light). These brief notes represent a pedagogical attempt towards elucidating this extraordinary form of light. This paper is a contribution to the book Artificial Black Holes edited by Mario Novello, Matt Visser and Grigori Volovik. The paper is intended as a primer, an introduction to the subject for non-experts, not as a det...
International Nuclear Information System (INIS)
Ahn, Tae-Joon; Lee, Sang-Ho; Choi, Gun; Ahn, Yong; Liu, Wei-Chiang; Kim, Ho-Jin; Lee, Ho-Yeon
2009-01-01
Magnetic resonance (MR) imaging with axial loading can simulate the physiological standing state and disclose spinal stenosis undetected or underestimated in the conventional position. Intervertebral disk degeneration may be an important factor in spinal stenosis. This study investigated whether intervertebral disk degeneration increases spinal stenosis during axial loading. MR imaging with and without axial loading was obtained in 51 patients with neurogenic intermittent claudication and/or sciatica and reviewed retrospectively. The grade of disk degeneration was rated in four disk spaces from L2-3 to L5-S1. The dural sac cross-sectional area (DCSA) was measured on MR images taken in both conventional and axial loading positions, and the change in the DCSA was calculated. The effect of disk degeneration on the DCSA was statistically analyzed. Significant decreases in the DCSA occurred with grade 4 disk degeneration (mean±standard deviation, 20.1±14.1 mm 2 ), followed by grade 3 (18.3±15.1 mm 2 ) and grade 2 (8.9±13.1 mm 2 ). DCSA decreased considerably with increased severity of disk degeneration with axial loading, except for grade 5 disk degeneration. More accurate diagnosis of stenosis can be achieved using MR imaging with axial loading, especially if grade 2 to 4 disk degeneration is present. (author)
Three Studies Point to Same Risk Gene for Age-Related Macular Degeneration
... point to same risk gene for age-related macular degeneration NIH-funded research helps unravel the biology of ... rare, but powerful risk factor for age-related macular degeneration (AMD), a common cause of vision loss in ...
Quantitative OCT and MRI biomarkers for the differentiation of cartilage degeneration
International Nuclear Information System (INIS)
Nebelung, Sven; Brill, Nicolai; Tingart, Markus; Jahr, Holger; Pufe, Thomas; Kuhl, Christiane; Truhn, Daniel
2016-01-01
To evaluate the usefulness of quantitative parameters obtained by optical coherence tomography (OCT) and magnetic resonance imaging (MRI) in the comprehensive assessment of human articular cartilage degeneration. Human osteochondral samples of variable degeneration (n = 45) were obtained from total knee replacements and assessed by MRI sequences measuring T1, T1ρ, T2 and T2* relaxivity and by OCT-based quantification of irregularity (OII, optical irregularity index), homogeneity (OHI, optical homogeneity index) and attenuation (OAI, optical attenuation index). Samples were also assessed macroscopically (Outerbridge classification) and histologically (Mankin classification) as grade-0 (Mankin scores 0-4)/grade-I (scores 5-8)/grade-II (scores 9-10)/grade-III (score 11-14). After data normalisation, differences between Mankin grades and correlations between imaging parameters were assessed using ANOVA and Tukey's post-hoc test and Spearman's correlation coefficients, respectively. Sensitivities and specificities in the detection of Mankin grade-0 were calculated. Significant degeneration-related increases were found for T2 and OII and decreases for OAI, while T1, T1ρ, T2* or OHI did not reveal significant changes in relation to degeneration. A number of significant correlations between imaging parameters and histological (sub)scores were found, in particular for T2 and OII. Sensitivities and specificities in the detection of Mankin grade-0 were highest for OHI/T1 and OII/T1ρ, respectively. Quantitative OCT and MRI techniques seem to complement each other in the comprehensive assessment of cartilage degeneration. Sufficiently large structural and compositional changes in the extracellular matrix may thus be parameterized and quantified, while the detection of early degeneration remains challenging. (orig.)
Quantitative OCT and MRI biomarkers for the differentiation of cartilage degeneration
Energy Technology Data Exchange (ETDEWEB)
Nebelung, Sven [Aachen University Hospital, Department of Orthopaedics, Aachen (Germany); Institute of Anatomy and Cell Biology, RWTH, Aachen (Germany); Brill, Nicolai [Fraunhofer Institute for Production Technology, Aachen (Germany); Tingart, Markus; Jahr, Holger [Aachen University Hospital, Department of Orthopaedics, Aachen (Germany); Pufe, Thomas [Institute of Anatomy and Cell Biology, RWTH, Aachen (Germany); Kuhl, Christiane; Truhn, Daniel [Aachen University Hospital, Department of Diagnostic and Interventional Radiology, Aachen (Germany)
2016-04-15
To evaluate the usefulness of quantitative parameters obtained by optical coherence tomography (OCT) and magnetic resonance imaging (MRI) in the comprehensive assessment of human articular cartilage degeneration. Human osteochondral samples of variable degeneration (n = 45) were obtained from total knee replacements and assessed by MRI sequences measuring T1, T1ρ, T2 and T2* relaxivity and by OCT-based quantification of irregularity (OII, optical irregularity index), homogeneity (OHI, optical homogeneity index) and attenuation (OAI, optical attenuation index). Samples were also assessed macroscopically (Outerbridge classification) and histologically (Mankin classification) as grade-0 (Mankin scores 0-4)/grade-I (scores 5-8)/grade-II (scores 9-10)/grade-III (score 11-14). After data normalisation, differences between Mankin grades and correlations between imaging parameters were assessed using ANOVA and Tukey's post-hoc test and Spearman's correlation coefficients, respectively. Sensitivities and specificities in the detection of Mankin grade-0 were calculated. Significant degeneration-related increases were found for T2 and OII and decreases for OAI, while T1, T1ρ, T2* or OHI did not reveal significant changes in relation to degeneration. A number of significant correlations between imaging parameters and histological (sub)scores were found, in particular for T2 and OII. Sensitivities and specificities in the detection of Mankin grade-0 were highest for OHI/T1 and OII/T1ρ, respectively. Quantitative OCT and MRI techniques seem to complement each other in the comprehensive assessment of cartilage degeneration. Sufficiently large structural and compositional changes in the extracellular matrix may thus be parameterized and quantified, while the detection of early degeneration remains challenging. (orig.)
Muen, Wisam J; Hewick, Simon A
2011-01-01
Objectives To evaluate the quality of referrals to a neovascular age-related macular degeneration clinic from optometrists using the standard Rapid Access Referral Form (RARF) from the Royal College of Ophthalmologists. Design A prospective study. Prospective data were gathered from all optometry referrals using the RARF, between the periods of December 2006 to August 2009. These were assessed for accuracy of history, clinical signs and final diagnosis as compared to a macula expert. Setting ...
The study of a Mg-rich epoxy primer for protection of AZ91D magnesium alloy
Energy Technology Data Exchange (ETDEWEB)
Lu Xiangyu [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China); Zuo Yu, E-mail: zuoy@mail.buct.edu.c [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China); Zhao Xuhui; Tang Yuming; Feng Xingguo [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China)
2011-01-15
Research highlights: {yields} A Mg-rich epoxy primer was prepared by adding pure magnesium particles in epoxy coating. Cross scratch testing results showed that in 3% NaCl solution the Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. {yields} The open circuit potential of AZ91D alloy in NaCl solution decreased after coated with Mg-rich coating, suggesting that cathodic protection effect of the Mg-rich coating on AZ91D alloy was present. {yields} EIS studies showed that during the immersion tests of AZ91D alloy with Mg-rich coating the magnesium particles in coating dissolved with the charge-transfer resistance R{sub ct} at the magnesium particle/coating interface decreased and the double-layer capacitance Q{sub dl} increased. While the coating resistance remained stable for a long time and corrosion of the AZ91D alloy substrate was obviously delayed. - Abstract: A Mg-rich epoxy primer was prepared by adding pure magnesium particles to an epoxy coating. The coating properties were studied with electrochemical impedance spectroscopy (EIS), scanning electronic microscopy (SEM) and X-ray diffraction (XRD). The Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. The open circuit potential measurements showed cathodic protection effect of the Mg-rich primer on AZ91D alloy. Cross scratch testing showed that the Mg-rich primer provided better protection for the substrate than original epoxy coating. The precipitation of Mg(OH){sub 2} in the coating also provided some degree of barrier protection.
The study of a Mg-rich epoxy primer for protection of AZ91D magnesium alloy
International Nuclear Information System (INIS)
Lu Xiangyu; Zuo Yu; Zhao Xuhui; Tang Yuming; Feng Xingguo
2011-01-01
Research highlights: → A Mg-rich epoxy primer was prepared by adding pure magnesium particles in epoxy coating. Cross scratch testing results showed that in 3% NaCl solution the Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. → The open circuit potential of AZ91D alloy in NaCl solution decreased after coated with Mg-rich coating, suggesting that cathodic protection effect of the Mg-rich coating on AZ91D alloy was present. → EIS studies showed that during the immersion tests of AZ91D alloy with Mg-rich coating the magnesium particles in coating dissolved with the charge-transfer resistance R ct at the magnesium particle/coating interface decreased and the double-layer capacitance Q dl increased. While the coating resistance remained stable for a long time and corrosion of the AZ91D alloy substrate was obviously delayed. - Abstract: A Mg-rich epoxy primer was prepared by adding pure magnesium particles to an epoxy coating. The coating properties were studied with electrochemical impedance spectroscopy (EIS), scanning electronic microscopy (SEM) and X-ray diffraction (XRD). The Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. The open circuit potential measurements showed cathodic protection effect of the Mg-rich primer on AZ91D alloy. Cross scratch testing showed that the Mg-rich primer provided better protection for the substrate than original epoxy coating. The precipitation of Mg(OH) 2 in the coating also provided some degree of barrier protection.
Liu, Xiaojing; Locasale, Jason W
2017-04-01
Metabolomics generates a profile of small molecules that are derived from cellular metabolism and can directly reflect the outcome of complex networks of biochemical reactions, thus providing insights into multiple aspects of cellular physiology. Technological advances have enabled rapid and increasingly expansive data acquisition with samples as small as single cells; however, substantial challenges in the field remain. In this primer we provide an overview of metabolomics, especially mass spectrometry (MS)-based metabolomics, which uses liquid chromatography (LC) for separation, and discuss its utilities and limitations. We identify and discuss several areas at the frontier of metabolomics. Our goal is to give the reader a sense of what might be accomplished when conducting a metabolomics experiment, now and in the near future. Copyright © 2017 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Catherine Lenox
2015-05-01
Full Text Available A 5-month-old castrated male Sphynx kitten presented with left hindlimb lameness shortly after adoption. Prior to adoption, the breeder had fed the kitten an exclusively raw chicken diet. Radiographs revealed generalized osteopenia and a left tibia–fibula fracture. Ophthalmic examination revealed corneal vascularization and opacity in the right eye, and lesions suggestive of feline central retinal degeneration in the left eye. The patient’s diagnoses included metabolic bone disease and feline central retinal degeneration, which can result from taurine deficiency. The kitten’s nutritional diseases were managed with a complete and balanced canned diet designed for kitten growth and with taurine supplementation.
Experimental model of intervertebral disc degeneration by needle puncture in Wistar rats
International Nuclear Information System (INIS)
Issy, A.C.; Castania, V.; Castania, M.; Salmon, C.E.G.; Nogueira-Barbosa, M.H.; Bel, E. Del; Defino, H.L.A.
2013-01-01
Animal models of intervertebral disc degeneration play an important role in clarifying the physiopathological mechanisms and testing novel therapeutic strategies. The objective of the present study is to describe a simple animal model of disc degeneration involving Wistar rats to be used for research studies. Disc degeneration was confirmed and classified by radiography, magnetic resonance and histological evaluation. Adult male Wistar rats were anesthetized and submitted to percutaneous disc puncture with a 20-gauge needle on levels 6-7 and 8-9 of the coccygeal vertebrae. The needle was inserted into the discs guided by fluoroscopy and its tip was positioned crossing the nucleus pulposus up to the contralateral annulus fibrosus, rotated 360° twice, and held for 30 s. To grade the severity of intervertebral disc degeneration, we measured the intervertebral disc height from radiographic images 7 and 30 days after the injury, and the signal intensity T2-weighted magnetic resonance imaging. Histological analysis was performed with hematoxylin-eosin and collagen fiber orientation using picrosirius red staining and polarized light microscopy. Imaging and histological score analyses revealed significant disc degeneration both 7 and 30 days after the lesion, without deaths or systemic complications. Interobserver histological evaluation showed significant agreement. There was a significant positive correlation between histological score and intervertebral disc height 7 and 30 days after the lesion. We conclude that the tail disc puncture method using Wistar rats is a simple, cost-effective and reproducible model for inducing disc degeneration
Experimental model of intervertebral disc degeneration by needle puncture in Wistar rats
Energy Technology Data Exchange (ETDEWEB)
Issy, A.C.; Castania, V.; Castania, M. [Departamento de Morfologia, Fisiologia e Patologia Básica, Faculdade de Odontologia de Ribeirão Preto, Universidade de São Paulo, Ribeirão Preto, SP (Brazil); Salmon, C.E.G. [Departamento de Física, Faculdade de Filosofia, Ciências e Letras de Ribeirão Preto, Universidade de São Paulo, Ribeirão Preto, SP (Brazil); Nogueira-Barbosa, M.H. [Divisão de Radiologia, Departamento de Clínica Médica, Faculdade de Medicina de Ribeirão Preto, Universidade de São Paulo, Ribeirão Preto, SP (Brazil); Bel, E. Del [Departamento de Morfologia, Fisiologia e Patologia Básica, Faculdade de Odontologia de Ribeirão Preto, Universidade de São Paulo, Ribeirão Preto, SP (Brazil); Defino, H.L.A. [Departamento de Biomecânica, Medicina e Reabilitação do Sistema Locomotor, Faculdade de Medicina de Ribeirão Preto, Universidade de São Paulo, Ribeirão Preto, SP (Brazil)
2013-03-15
Animal models of intervertebral disc degeneration play an important role in clarifying the physiopathological mechanisms and testing novel therapeutic strategies. The objective of the present study is to describe a simple animal model of disc degeneration involving Wistar rats to be used for research studies. Disc degeneration was confirmed and classified by radiography, magnetic resonance and histological evaluation. Adult male Wistar rats were anesthetized and submitted to percutaneous disc puncture with a 20-gauge needle on levels 6-7 and 8-9 of the coccygeal vertebrae. The needle was inserted into the discs guided by fluoroscopy and its tip was positioned crossing the nucleus pulposus up to the contralateral annulus fibrosus, rotated 360° twice, and held for 30 s. To grade the severity of intervertebral disc degeneration, we measured the intervertebral disc height from radiographic images 7 and 30 days after the injury, and the signal intensity T2-weighted magnetic resonance imaging. Histological analysis was performed with hematoxylin-eosin and collagen fiber orientation using picrosirius red staining and polarized light microscopy. Imaging and histological score analyses revealed significant disc degeneration both 7 and 30 days after the lesion, without deaths or systemic complications. Interobserver histological evaluation showed significant agreement. There was a significant positive correlation between histological score and intervertebral disc height 7 and 30 days after the lesion. We conclude that the tail disc puncture method using Wistar rats is a simple, cost-effective and reproducible model for inducing disc degeneration.
Directory of Open Access Journals (Sweden)
Bryant L
2017-12-01
Full Text Available Laura Bryant,1 Olga Lozynska,1 Albert M Maguire,1–3 Tomas S Aleman,1–3 Jean Bennett1–3 1Center for Advanced Retinal and Ocular Therapeutics (CAROT, FM Kirby Center for Molecular Ophthalmology, Scheie Eye Institute, Perelman School of Medicine, University of Pennsylvania, Philadelphia, PA, USA; 2Department of Ophthalmology, The Children’s Hospital of Philadelphia, Philadelphia, PA, USA; 3Department of Ophthalmology, Scheie Eye Institute, Perelman School of Medicine, University of Pennsylvania, Philadelphia, PA, USA Background: Accurate clinical diagnosis and prognosis of retinal degeneration can be aided by the identification of the disease-causing genetic variant. It can confirm the clinical diagnosis as well as inform the clinician of the risk for potential involvement of other organs such as kidneys. It also aids in genetic counseling for affected individuals who want to have a child. Finally, knowledge of disease-causing variants informs laboratory investigators involved in translational research. With the advent of next-generation sequencing, identifying pathogenic mutations is becoming easier, especially the identification of novel pathogenic variants.Methods: We used whole exome sequencing on a cohort of 69 patients with various forms of retinal degeneration and in whom screens for previously identified disease-causing variants had been inconclusive. All potential pathogenic variants were verified by Sanger sequencing and, when possible, segregation analysis of immediate relatives. Potential variants were identified by using a semi-masked approach in which rare variants in candidate genes were identified without knowledge of the clinical diagnosis (beyond “retinal degeneration” or inheritance pattern. After the initial list of genes was prioritized, genetic diagnosis and inheritance pattern were taken into account.Results: We identified the likely pathogenic variants in 64% of the subjects. Seven percent had a single
Directory of Open Access Journals (Sweden)
David L Nordstrom
2012-06-01
Full Text Available The aim of this paper is to introduce novice researchers to surveys as a method of data collection. It starts with the definition of a survey, its major purposes and types as well as changes in the goals surveys have helped to achieve over time. Advantages and disadvantages of surveys over population censuses and medical examinations are discussed. Approaches to questionnaire construction are introduced along with properties that questionnaires are evaluated for. Modes of administration, sample size issues, and data analysis approaches are also introduced. The primer is illustrated with examples of surveys conducted in different countries with various public health purposes.
Designer proton-channel transgenic algae for photobiological hydrogen production
Lee, James Weifu [Knoxville, TN
2011-04-26
A designer proton-channel transgenic alga for photobiological hydrogen production that is specifically designed for production of molecular hydrogen (H.sub.2) through photosynthetic water splitting. The designer transgenic alga includes proton-conductive channels that are expressed to produce such uncoupler proteins in an amount sufficient to increase the algal H.sub.2 productivity. In one embodiment the designer proton-channel transgene is a nucleic acid construct (300) including a PCR forward primer (302), an externally inducible promoter (304), a transit targeting sequence (306), a designer proton-channel encoding sequence (308), a transcription and translation terminator (310), and a PCR reverse primer (312). In various embodiments, the designer proton-channel transgenic algae are used with a gas-separation system (500) and a gas-products-separation and utilization system (600) for photobiological H.sub.2 production.
Glial degeneration with oxidative damage drives neuronal demise in MPSII disease.
Zalfa, Cristina; Verpelli, Chiara; D'Avanzo, Francesca; Tomanin, Rosella; Vicidomini, Cinzia; Cajola, Laura; Manara, Renzo; Sala, Carlo; Scarpa, Maurizio; Vescovi, Angelo Luigi; De Filippis, Lidia
2016-08-11
Mucopolysaccharidosis type II (MPSII) is a lysosomal storage disorder due to the deficit of the iduronate 2-sulfatase (IDS) enzyme, causing progressive neurodegeneration in patients. Neural stem cells (NSCs) derived from the IDS-ko mouse can recapitulate MPSII pathogenesis in vitro. In differentiating IDS-ko NSCs and in the aging IDS-ko mouse brain, glial degeneration precedes neuronal degeneration. Here we show that pure IDS-ko NSC-derived astrocytes are selectively able to drive neuronal degeneration when cocultured with healthy neurons. This phenotype suggests concurrent oxidative damage with metabolic dysfunction. Similar patterns were observed in murine IDS-ko animals and in human MPSII brains. Most importantly, the mutant phenotype of IDS-ko astrocytes was reversed by low oxygen conditions and treatment with vitamin E, which also reversed the toxic effect on cocultured neurons. Moreover, at very early stages of disease we detected in vivo the development of a neuroinflammatory background that precedes astroglial degeneration, thus suggesting a novel model of MPSII pathogenesis, with neuroinflammation preceding glial degeneration, which is finally followed by neuronal death. This hypothesis is also consistent with the progression of white matter abnormalities in MPSII patients. Our study represents a novel breakthrough in the elucidation of MPSII brain pathogenesis and suggests the antioxidant molecules as potential therapeutic tools to delay MPSII onset and progression.
Qualification and Flight Test of Non-Chrome Primers for C-130 Aircraft
2011-08-17
system Significant hexavalent chrome reduction in finish system Potential exposure level of spray applied chromated conversion coating not as...Lockheed Martin Aeronautics Company Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft Scott Jones Lockheed Martin...00-2011 to 00-00-2011 4. TITLE AND SUBTITLE Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft 5a. CONTRACT NUMBER 5b. GRANT
Rivas, R; Velázquez, E; Valverde, A; Mateos, P F; Martínez-Molina, E
2001-04-01
Polymerase chain reation (PCR) fingerprints are used to characterize and recognize bacteria and are generally obtained using universal primers that generate an array of DNA amplicons, which can be separated by electrophoresis. Universal primers 8F and 1491 R have been used to amplify specifically 16S rDNA. We have used these primers at an annealing temperature of 50 degrees C. Agarose gel electrophoresis of PCR products revealed several bands. The band pattern of each bacterial species was different and the strains belonging to the same species shared an identical pattern. The patterns obtained did not show variations with plasmid DNA content or the growth stage of the bacteria. The peculiarity of the randomly amplified polymorphic DNA (RAPD) described in this work lies in the use of two large primers (proximately 20 nt) to obtain the pattern, since normally a only smaller primer is used, and in the new application for the primers used to amplify 16S rDNA. This new procedure, called two primers (TP)-RAPD fingerprinting, is thus rapid, sensitive, reliable, highly reproducible and suitable for experiments with a large number of microorganisms, and can be applied to bacterial taxonomy, ecological studies and for the detection of new bacterial species.
Molecular pharmacodynamics of emixustat in protection against retinal degeneration.
Zhang, Jianye; Kiser, Philip D; Badiee, Mohsen; Palczewska, Grazyna; Dong, Zhiqian; Golczak, Marcin; Tochtrop, Gregory P; Palczewski, Krzysztof
2015-07-01
Emixustat is a visual cycle modulator that has entered clinical trials as a treatment for age-related macular degeneration (AMD). This molecule has been proposed to inhibit the visual cycle isomerase RPE65, thereby slowing regeneration of 11-cis-retinal and reducing production of retinaldehyde condensation byproducts that may be involved in AMD pathology. Previously, we reported that all-trans-retinal (atRAL) is directly cytotoxic and that certain primary amine compounds that transiently sequester atRAL via Schiff base formation ameliorate retinal degeneration. Here, we have shown that emixustat stereoselectively inhibits RPE65 by direct active site binding. However, we detected the presence of emixustat-atRAL Schiff base conjugates, indicating that emixustat also acts as a retinal scavenger, which may contribute to its therapeutic effects. Using agents that lack either RPE65 inhibitory activity or the capacity to sequester atRAL, we assessed the relative importance of these 2 modes of action in protection against retinal phototoxicity in mice. The atRAL sequestrant QEA-B-001-NH2 conferred protection against phototoxicity without inhibiting RPE65, whereas an emixustat derivative incapable of atRAL sequestration was minimally protective, despite direct inhibition of RPE65. These data indicate that atRAL sequestration is an essential mechanism underlying the protective effects of emixustat and related compounds against retinal phototoxicity. Moreover, atRAL sequestration should be considered in the design of next-generation visual cycle modulators.
Magnetization transfer and spin lock MR imaging of patellar cartilage degeneration at 0.1 T
International Nuclear Information System (INIS)
Koskinen, S.K.; Ylae-Outinen, H.; Komu, M.E.S.; Aho, H.J.
1997-01-01
Purpose: To investigate magnetization transfer (MT) parameters and rotating frame relaxation time T1ρ in patellar cartilage at different levels of degeneration. Material and Methods: Thirty cadaveric patellae were examined at 0.1 T using the time-dependent saturation-transfer MT technique and the spin lock (SL) technique. In an SL experiment, nuclear spins are locked with a radiofrequency (RF) field, and the locked nuclear magnetization relaxes along the magnetic component of the locking RF field. The specimens were divided into three groups according to the level of cartilage degeneration. MT parameters and T1ρ were measured. Results: The MT effect was greater in degenerated cartilage than in normal cartilage. T1ρ was longer in advanced cartilage degeneration than in intermediate cartilage degeneration. Conculsion: The results suggest that more studies are needed to fully establish the value of SL imaging in cartilage degeneration. (orig.)
Single primer amplification reaction methods reveal exotic and ...
Indian Academy of Sciences (India)
Unknown
mulberry varieties using three different PCR based single primer amplification ..... the results of a multi- variate analysis using Mahalanobis D2 statistic in case of .... Rajan M V, Chaturvedi H K and Sarkar A 1997 Multivariate analysis as an aid ...
Wang, Shifeng; Wang, Rui; Zhang, Pengfei; Dai, Xiang; Gong, Dawei
2017-08-01
One of the motivations of OptoBot Lab is to train primer students into qualified engineers or researchers. The series training programs have been designed by supervisors and implemented with tutoring for students to test and practice their knowledge from textbooks. An environment perception experiment using a 32 layers laser scanner is described in this paper. The training program design and laboratory operation is introduced. The four parts of the experiments which are preparation, sensor calibration, 3D space reconstruction, and object recognition, are the participating students' main tasks for different teams. This entire program is one of the series training programs that play significant role in establishing solid research skill foundation for opto-electronic students.
Smielewska-Loś, E
2003-01-01
Tissues from 4 aborted polar foxes (3 samples of brain and 4 samples of liver) were selected for Toxoplasma gondii PCR assay. Positive results of serological tests of mothers and immunofluorescence test (IFT) of fetal organ smears were the criteria of sample selection. Five sets of primers designed from B1 gene and ITS1 sequences of T. gondii were used for detection of the parasite in fetal fox tissues. All used primer sets successfully amplified T. gondii DNA in PCR from organs which were positive by IFT. Single tube nested PCR also showed positive result from a sample negative by IFT, but this product was not confirmed. The studies showed usefullness of PCR for routine diagnosis of toxoplasmosis in carnivores.
Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders
Energy Technology Data Exchange (ETDEWEB)
Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.
2000-09-27
This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.
Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders
Energy Technology Data Exchange (ETDEWEB)
A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson
1998-12-10
This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.
Summary of the primer on tumor immunology and the biological therapy of cancer
Directory of Open Access Journals (Sweden)
Margolin Kim
2009-01-01
Full Text Available Abstract The International Society for Biological Therapy of Cancer (iSBTc is one of the "premier destinations for interaction and innovation in the cancer biologics community". It provides a primer course each year during the annual meeting to address the most important areas of tumor immunology and immunotherapy. The course has been given by prominent investigators in the area of interest, covering the core principles of cancer immunology and immunotherapy. The target audience for this program includes investigators from academic, regulatory, and biopharmaceutical venues. The program goal is to enable the attendees to learn the current status and the most recent advances in biologic therapies, and to leverage this knowledge towards the improvement of cancer therapy. The 2008 immunologic primer course was held on October 30 at the 23rd Annual meeting of iSBTc in San Diego, CA. Nine internationally renowned investigators gave excellent presentations on different topics. The topics covered in this primer included: (1 cytokines in cancer immunology; (2 anti-angiogenic therapy; (3 end stage: immune killing of tumors; (4 blocking T cell checkpoints; (5 approach to identification and therapeutic exploitation of tumor antigens; (6 T regulatory cells; (7 adoptive T cell therapy; (8 immune monitoring of cancer immunotherapy; and (9 immune adjuvants. We summarized the topics in this primer for public education. The related topic slides and schedule can be accessed online http://www.isbtc.org/meetings/am08/primer08.
Relationship between retinal lattice degeneration and open angle glaucoma.
Rahimi, Mansour
2005-01-01
Patients with retinal disorders may develop glaucoma of both a primary and secondary type. Pigment may contribute to trabecular obstruction in some patients with open-angle glaucoma. Lattice degeneration of the retina in its typical form is a sharply demarcated, circumferentially oriented, degenerative process with significant alterations of retinal pigmentation. The association between myopia, open angle glaucoma and pigment dispersion is striking. Therefore, it could be postulated that there is significant prevalence of open angle glaucoma in patients with retinal lattice degeneration, especially in combination with myopia.
Maximum principles for boundary-degenerate linear parabolic differential operators
Feehan, Paul M. N.
2013-01-01
We develop weak and strong maximum principles for boundary-degenerate, linear, parabolic, second-order partial differential operators, $Lu := -u_t-\\tr(aD^2u)-\\langle b, Du\\rangle + cu$, with \\emph{partial} Dirichlet boundary conditions. The coefficient, $a(t,x)$, is assumed to vanish along a non-empty open subset, $\\mydirac_0!\\sQ$, called the \\emph{degenerate boundary portion}, of the parabolic boundary, $\\mydirac!\\sQ$, of the domain $\\sQ\\subset\\RR^{d+1}$, while $a(t,x)$ may be non-zero at po...
Axon degeneration: make the Schwann cell great again
Directory of Open Access Journals (Sweden)
Keit Men Wong
2017-01-01
Full Text Available Axonal degeneration is a pivotal feature of many neurodegenerative conditions and substantially accounts for neurological morbidity. A widely used experimental model to study the mechanisms of axonal degeneration is Wallerian degeneration (WD, which occurs after acute axonal injury. In the peripheral nervous system (PNS, WD is characterized by swift dismantling and clearance of injured axons with their myelin sheaths. This is a prerequisite for successful axonal regeneration. In the central nervous system (CNS, WD is much slower, which significantly contributes to failed axonal regeneration. Although it is well-documented that Schwann cells (SCs have a critical role in the regenerative potential of the PNS, to date we have only scarce knowledge as to how SCs 'sense' axonal injury and immediately respond to it. In this regard, it remains unknown as to whether SCs play the role of a passive bystander or an active director during the execution of the highly orchestrated disintegration program of axons. Older reports, together with more recent studies, suggest that SCs mount dynamic injury responses minutes after axonal injury, long before axonal breakdown occurs. The swift SC response to axonal injury could play either a pro-degenerative role, or alternatively a supportive role, to the integrity of distressed axons that have not yet committed to degenerate. Indeed, supporting the latter concept, recent findings in a chronic PNS neurodegeneration model indicate that deactivation of a key molecule promoting SC injury responses exacerbates axonal loss. If this holds true in a broader spectrum of conditions, it may provide the grounds for the development of new glia-centric therapeutic approaches to counteract axonal loss.
Verteporfin plus ranibizumab for choroidal neovascularization in age-related macular degeneration
DEFF Research Database (Denmark)
Larsen, Michael; Schmidt-Erfurth, Ursula; Lanzetta, Paolo
2012-01-01
To compare the efficacy and safety of same-day verteporfin photodynamic therapy (PDT) and intravitreal ranibizumab combination treatment versus ranibizumab monotherapy in neovascular age-related macular degeneration.......To compare the efficacy and safety of same-day verteporfin photodynamic therapy (PDT) and intravitreal ranibizumab combination treatment versus ranibizumab monotherapy in neovascular age-related macular degeneration....
Primer Part 1-The building blocks of epilepsy genetics.
Helbig, Ingo; Heinzen, Erin L; Mefford, Heather C
2016-06-01
This is the first of a two-part primer on the genetics of the epilepsies within the Genetic Literacy Series of the Genetics Commission of the International League Against Epilepsy. In Part 1, we cover the foundations of epilepsy genetics including genetic epidemiology and the range of genetic variants that can affect the risk for developing epilepsy. We discuss various epidemiologic study designs that have been applied to the genetics of the epilepsies including population studies, which provide compelling evidence for a strong genetic contribution in many epilepsies. We discuss genetic risk factors varying in size, frequency, inheritance pattern, effect size, and phenotypic specificity, and provide examples of how genetic risk factors within the various categories increase the risk for epilepsy. We end by highlighting trends in epilepsy genetics including the increasing use of massive parallel sequencing technologies. Wiley Periodicals, Inc. © 2016 International League Against Epilepsy.
Zaman, D. M. S.; Amina, M.; Dip, P. R.; Mamun, A. A.
2017-11-01
The basic properties of planar and non-planar (spherical and cylindrical) nucleus-acoustic (NA) shock structures (SSs) in a strongly coupled self-gravitating degenerate quantum plasma system (containing strongly coupled non-relativistically degenerate heavy nuclear species, weakly coupled non-relativistically degenerate light nuclear species, and inertialess non-/ultra-relativistically degenerate electrons) have been investigated. The generalized quantum hydrodynamic model and the reductive perturbation method have been used to derive the modified Burgers equation. It is shown that the strong correlation among heavy nuclear species acts as the source of dissipation and is responsible for the formation of the NA SSs with positive (negative) electrostatic (self-gravitational) potential. It is also observed that the effects of non-/ultra-relativistically degenerate electron pressure, dynamics of non-relativistically degenerate light nuclear species, spherical geometry, etc., significantly modify the basic features of the NA SSs. The applications of our results in astrophysical compact objects like white dwarfs and neutron stars are briefly discussed.
Transsynaptic neuronal degeneration of optic nerves associated with bilateral occipital lesions
Directory of Open Access Journals (Sweden)
Sachdev Mahipal
1990-01-01
Full Text Available A case is reported of a 9-year old male who presented with abnormal behaviour and progressive diminution of vision. Pupils were middilated in both eyes but the pupillary reflexes were preserved. Fundus examination revealed a bilateral optic atrophy and radiological investigations showed a bilateral occipital calcification. We hereby document a case of retrograde transsynaptic neuronal degeneration of the visual system secondary to bilateral occipital lesions. Transsynapptic neuronal degeneration of optic nerves consequent to occipital lobe lesions is a rare phenomenon. Experimentally occipital lobe ablation in non-human primates has been shown to result in optic atrophy. Herein, we document a case of retrograde transsynaptic neuronal degeneration of the visual system secondary to bilateral occipital lesions.
Klein, Ronald; Myers, Chelsea E.; Buitendijk, Gabriëlle H. S.; Rochtchina, Elena; Gao, Xiaoyi; de Jong, Paulus T. V. M.; Sivakumaran, Theru A.; Burlutsky, George; McKean-Cowdin, Roberta; Hofman, Albert; Iyengar, Sudha K.; Lee, Kristine E.; Stricker, Bruno H.; Vingerling, Johannes R.; Mitchell, Paul; Klein, Barbara E. K.; Klaver, Caroline C. W.; Wang, Jie Jin
2014-01-01
To describe associations of serum lipid levels and lipid pathway genes to the incidence of age-related macular degeneration (AMD). Meta-analysis. setting: Three population-based cohorts. population: A total of 6950 participants from the Beaver Dam Eye Study (BDES), Blue Mountains Eye Study (BMES),
Matrix units and Schur elements for the degenerate cyclotomic Hecke algebras
Zhao, Deke
2011-01-01
The paper uses the cellular basis of the (semi-simple) degenerate cyclotomic Hecke algebras to investigate these algebras exhaustively. As a consequence, we describe explicitly the "Young's seminormal form" and a orthogonal bases for Specht modules and determine explicitly the closed formula for the natural bilinear form on Specht modules and Schur elements for the degenerate cyclotomic Hekce algebras.
Exploring Nonconvex, Crossed and Degenerate Polygons
Contreras, Jose N.
2004-01-01
An exploration of nonconvex, crossed, and degenerate polygons (NCCDPs) are described with the help of examples with pedagogical tips and recommendations that are found useful when teaching the mathematical process of extending geometric patterns to NCCDPs. The study concludes that investigating such extensions with interactive geometry software…
Geometry of non-degenerate Susskind fermions
International Nuclear Information System (INIS)
Mitra, P.
1983-01-01
The Dirac-Kaehler equation on the lattice is known to describe the degenerate ''flavours'' appering in Susskind's approach to lattice fermions. We study the modification that has to be made in this equation in order to lift the degeneracy and give the flavours arbitrary different masses. (orig.)
Degenerated human intervertebral discs contain autoantibodies against extracellular matrix proteins
Directory of Open Access Journals (Sweden)
S Capossela
2014-04-01
Full Text Available Degeneration of intervertebral discs (IVDs is associated with back pain and elevated levels of inflammatory cells. It has been hypothesised that discogenic pain is a direct result of vascular and neural ingrowth along annulus fissures, which may expose the avascular nucleus pulposus (NP to the systemic circulation and induce an autoimmune reaction. In this study, we confirmed our previous observation of antibodies in human degenerated and post-traumatic IVDs cultured in vitro. We hypothesised that the presence of antibodies was due to an autoimmune reaction against specific proteins of the disc. Furthermore we identified antigens which possibly trigger an autoimmune response in degenerative disc diseases. We demonstrated that degenerated and post-traumatic IVDs contain IgG antibodies against typical extracellular proteins of the disc, particularly proteins of the NP. We identified IgGs against collagen type II and aggrecan, confirming an autoimmune reaction against the normally immune privileged NP. We also found specific IgGs against collagens types I and V, but not against collagen type III. In conclusion, this study confirmed the association between disc degeneration and autoimmunity, and may open the avenue for future studies on developing prognostic, diagnostic and therapy-monitoring markers for degenerative disc diseases.
A primer of multivariate statistics
Harris, Richard J
2014-01-01
Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why
Veysi, Mehdi; Othman, Mohamed A. K.; Figotin, Alexander; Capolino, Filippo
2018-05-01
We propose a class of lasers based on a fourth-order exceptional point of degeneracy (EPD) referred to as the degenerate band edge (DBE). EPDs have been found in parity-time-symmetric photonic structures that require loss and/or gain; here we show that the DBE is a different kind of EPD since it occurs in periodic structures that are lossless and gainless. Because of this property, a small level of gain is sufficient to induce single-frequency lasing based on a synchronous operation of four degenerate Floquet-Bloch eigenwaves. This lasing scheme constitutes a light-matter interaction mechanism that leads also to a unique scaling law of the laser threshold with the inverse of the fifth power of the laser-cavity length. The DBE laser has the lowest lasing threshold in comparison to a regular band edge laser and to a conventional laser in cavities with the same loaded quality (Q ) factor and length. In particular, even without mirror reflectors the DBE laser exhibits a lasing threshold which is an order of magnitude lower than that of a uniform cavity laser of the same length and with very high mirror reflectivity. Importantly, this novel DBE lasing regime enforces mode selectivity and coherent single-frequency operation even for pumping rates well beyond the lasing threshold, in contrast to the multifrequency nature of conventional uniform cavity lasers.
International Nuclear Information System (INIS)
Zhan Fangfang; Zhou Xiaoming; Xing Da
2013-01-01
Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs–TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: ► A novel method for detection of rotavirus has been developed. ► In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. ► To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. ► The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2′-bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs–TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection. In this study, rotavirus in fecal specimens was successfully detected within 1.5 h. Experimental
Observable consequences of partially degenerate leptogenesis
Ellis, Jonathan Richard; Yanagida, T; Ellis, John; Raidal, Martti
2002-01-01
In the context of the seesaw mechanism, it is natural that the large solar and atmospheric neutrino mixing angles originate separately from large 2 by 2 mixings in the neutrino and charged-lepton sectors, respectively, and large mixing in the neutrino couplings is in turn more plausible if two of the heavy singlet neutrinos are nearly degenerate. We study the phenomenology of this scenario, calculating leptogenesis by solving numerically the set of coupled Boltzmann equations for out-of-equilibrium heavy singlet neutrino decays in the minimal supersymmetric seesaw model. The near-degenerate neutrinos may weigh < 10^8 GeV, avoiding the cosmological gravitino problem. This scenario predicts that Br(mu to e gamma) should be strongly suppressed, because of the small singlet neutrino masses, whilst Br(tau to mu gamma) may be large enough to be observable in B-factory or LHC experiments. If the light neutrino masses are hierarchical, we predict that the neutrinoless double-beta decay parameter m_{ee} is approxim...
A Primer on Basic Effect Size Concepts.
Elmore, Patricia B.; Rotou, Ourania
The increased interest in reporting effect sizes means that it is necessary to consider what should be included in a primer on effect sizes. A review of papers on effect sizes and commonly repeated statistical analyses suggests that it is important to discuss effect sizes relative to bivariate correlation, t-tests, analysis of variance/covariance,…
Atomic rate coefficients in a degenerate plasma
Aslanyan, Valentin; Tallents, Greg
2015-11-01
The electrons in a dense, degenerate plasma follow Fermi-Dirac statistics, which deviate significantly in this regime from the usual Maxwell-Boltzmann approach used by many models. We present methods to calculate the atomic rate coefficients for the Fermi-Dirac distribution and present a comparison of the ionization fraction of carbon calculated using both models. We have found that for densities close to solid, although the discrepancy is small for LTE conditions, there is a large divergence from the ionization fraction by using classical rate coefficients in the presence of strong photoionizing radiation. We have found that using these modified rates and the degenerate heat capacity may affect the time evolution of a plasma subject to extreme ultraviolet and x-ray radiation such as produced in free electron laser irradiation of solid targets.
Transneuronal degeneration in patients with temporal lobe epilepsy: evaluation by MR imaging
Energy Technology Data Exchange (ETDEWEB)
Kodama, Fumiko; Ogawa, Toshihide; Sugihara, Shuji; Kamba, Masayuki; Kinoshita, Toshibumi [Department of Radiology, Faculty of Medicine' ' Tottori University, 36-1 Nishi-cho, 683-8504, Yonago, Tottori (Japan); Kohaya, Norimasa; Kondo, Shinji [Department of Neurosurgery, Faculty of Medicine' ' Tottori University, 36-1 Nishi-cho, 683-8504, Yonago, Tottori (Japan)
2003-09-01
The aim of this study was to assess the MR imaging findings of transneuronal degeneration of limbic system in the patients with temporal lobe epilepsy, and to detect the influence of surgery on the anatomy of the limbic system. Axial and coronal T1- and T2-weighted MR images were retrospectively analyzed in 34 patients with temporal lobe epilepsy, focusing on transneuronal degeneration. In 17 of the 34 patients, MR images were also analyzed after selective amygdalo-hippocampectomy. Atrophy of the fornix, mamillary body, mamillothalamic tract (MTT), and thalamus ipsilateral to the epileptic focus was demonstrated on MR images in 14.7, 17.6, 8.8, and 11.8% of the 34 patients, respectively. Focal hyperintensity of the thalamus was found on T2-weighted images in 8.8% of the 34 patients. In 17 patients who were evaluated before and after surgery, transneuronal degeneration was seen more frequently after surgery: fornix (11.8 vs 29.4%), mamillary body (11.8 vs 52.9%), MTT (5.9 vs 11.8%), and thalamus (11.8 vs 11.8%). Transneuronal degeneration of the limbic system is clearly demonstrated by MR imaging in patients with temporal lobe epilepsy, and surgical intervention induces transneuronal degeneration more frequently. (orig.)
[Vitreomacular adhesion in HD-OCT images in the age-related macular degeneration].
Latalska, Małgorzata; Swiech-Zubilewicz, Anna; Mackiewicz, Jerzy
2013-01-01
The aim of this study was to evaluate an incidence of the vitreomacular adhesion in patients with age-related macular degeneration. We examined 472 eyes in 241 patients (136 W/ 105 M) in age of 54-92 years (mean 62.6 years +/- 8.5) with dry or wet age-related macular degeneration using Cirrus HD-OCT (Zeiss) macular cube 512x128 program or 5-line pro-gram. Vitreomacular adhesion was observed in 139 eyes with dry age-related macular degeneration (29.4%, p=0.000*), in 101 eyes with drusen (21.4%, p=0.000*), in 38 eyes with retinal pigment epithelium alterations (8%, p=0.202), in 278 eyes with wet age-related macular degeneration (58.9%, p=0.001*), in 21 eyes with pigment epithelial detachment (4.4%, p=0.303), in 161 eyes with choroidal neovascularzation (34. 1%, p=0.031*/ and in 96 eyes with scar (20.4%, p=0.040*). Probably, vitreomacular adhesion alone is not able to induce age-related macular degeneration, but it may be associated with choroidal neovascularization development, it can contribute to exudate formation and choroidal neovascularization, it may induces or sustains a chronic low-grade inflammation in the macula region.
Transneuronal degeneration in patients with temporal lobe epilepsy: evaluation by MR imaging
International Nuclear Information System (INIS)
Kodama, Fumiko; Ogawa, Toshihide; Sugihara, Shuji; Kamba, Masayuki; Kinoshita, Toshibumi; Kohaya, Norimasa; Kondo, Shinji
2003-01-01
The aim of this study was to assess the MR imaging findings of transneuronal degeneration of limbic system in the patients with temporal lobe epilepsy, and to detect the influence of surgery on the anatomy of the limbic system. Axial and coronal T1- and T2-weighted MR images were retrospectively analyzed in 34 patients with temporal lobe epilepsy, focusing on transneuronal degeneration. In 17 of the 34 patients, MR images were also analyzed after selective amygdalo-hippocampectomy. Atrophy of the fornix, mamillary body, mamillothalamic tract (MTT), and thalamus ipsilateral to the epileptic focus was demonstrated on MR images in 14.7, 17.6, 8.8, and 11.8% of the 34 patients, respectively. Focal hyperintensity of the thalamus was found on T2-weighted images in 8.8% of the 34 patients. In 17 patients who were evaluated before and after surgery, transneuronal degeneration was seen more frequently after surgery: fornix (11.8 vs 29.4%), mamillary body (11.8 vs 52.9%), MTT (5.9 vs 11.8%), and thalamus (11.8 vs 11.8%). Transneuronal degeneration of the limbic system is clearly demonstrated by MR imaging in patients with temporal lobe epilepsy, and surgical intervention induces transneuronal degeneration more frequently. (orig.)
Degenerated uterine leiomyomas mimicking malignant bilateral ovarian surface epithelial tumors
Energy Technology Data Exchange (ETDEWEB)
Hwang, Yi Boem Ha; Lee, Hae Kyung; Lee, Min Hee; Choi, Seo Youn; Chung, Soo Ho [Bucheon Hospital, Soonchunhyang University College of Medicine, Bucheon (Korea, Republic of)
2017-07-15
Uterine leiomyomas are the most common benign uterine neoplasms. Undegenerated uterine leiomyomas are easily recognizable by the typical imaging findings on radiologic studies. However, degenerated fibroids can have unusual and variable appearances. The atypical appearances due to degenerative changes may cause confusion in diagnosis of leiomyomas. In this article, we report a case of a patient with extensive cystic and myxoid degeneration of uterine leiomyoma, mimicking malignant bilateral ovarian surface epithelial tumors.
The brain basis of musicophilia: evidence from frontotemporal lobar degeneration
Phillip David Fletcher; Laura eDowney; Pirada eWitoonpanich; Jason eWarren
2013-01-01
Musicophilia, or abnormal craving for music, is a poorly understood phenomenon that has been associated in particular with focal degeneration of the temporal lobes. Here we addressed the brain basis of musicophilia using voxel-based morphometry (VBM) on MR volumetric brain images in a retrospectively ascertained cohort of patients meeting clinical consensus criteria for frontotemporal lobar degeneration: of 37 cases ascertained, 12 had musicophilia and 25 did not exhibit the phenomenon. The s...
Directory of Open Access Journals (Sweden)
Zhiyuan Wu
2014-01-01
Full Text Available A multiplex snapback primer system was developed for the simultaneous detection of JAK2 V617F and MPL W515L/K mutations in Philadelphia chromosome- (Ph- negative myeloproliferative neoplasms (MPNs. The multiplex system comprises two snapback versus limiting primer sets for JAK2 and MPL mutation enrichment and detection, respectively. Linear-After exponential (LATE PCR strategy was employed for the primer design to maximize the amplification efficiency of the system. Low ionic strength buffer and rapid PCR protocol allowed for selective amplification of the mutant alleles. Amplification products were analyzed by melting curve analysis for mutation identification. The multiplex system archived 0.1% mutation load sensitivity and <5% coefficient of variation inter-/intra-assay reproducibility. 120 clinical samples were tested by the multiplex snapback primer assay, and verified with amplification refractory system (ARMS, quantitative PCR (qPCR and Sanger sequencing method. The multiplex system, with a favored versatility, provided the molecular diagnosis of Ph-negative MPNs with a suitable implement and simplified the genetic test process.
Zhang, Yunqing; Zhang, Xinju; Xu, Xiao; Kang, Zhihua; Li, Shibao; Zhang, Chen; Su, Bing
2014-01-01
A multiplex snapback primer system was developed for the simultaneous detection of JAK2 V617F and MPL W515L/K mutations in Philadelphia chromosome- (Ph-) negative myeloproliferative neoplasms (MPNs). The multiplex system comprises two snapback versus limiting primer sets for JAK2 and MPL mutation enrichment and detection, respectively. Linear-After exponential (LATE) PCR strategy was employed for the primer design to maximize the amplification efficiency of the system. Low ionic strength buffer and rapid PCR protocol allowed for selective amplification of the mutant alleles. Amplification products were analyzed by melting curve analysis for mutation identification. The multiplex system archived 0.1% mutation load sensitivity and <5% coefficient of variation inter-/intra-assay reproducibility. 120 clinical samples were tested by the multiplex snapback primer assay, and verified with amplification refractory system (ARMS), quantitative PCR (qPCR) and Sanger sequencing method. The multiplex system, with a favored versatility, provided the molecular diagnosis of Ph-negative MPNs with a suitable implement and simplified the genetic test process. PMID:24729973
Tolman, Jennifer; Hill, Robert D.; Kleinschmidt, Julia J.; Gregg, Charles H.
2005-01-01
Purpose: In this study we examined psychosocial adaptation to vision loss and its relationship to depressive symptomatology in legally blind older adults with age-related macular degeneration (ARMD). Design and Methods: The 144 study participants were outpatients of a large regional vision clinic that specializes in the diagnosis and treatment of…
Laenderyggens degeneration og radiologi
DEFF Research Database (Denmark)
Jacobsen, Steffen; Gosvig, Kasper Kjaerulf; Sonne-Holm, Stig
2006-01-01
and significant relationships between radiological findings and subjective symptoms have both been notoriously difficult to identify. The lack of consensus on clinical criteria and radiological definitions has hampered the undertaking of properly executed epidemiological studies. The natural history of LBP...... is cyclic: exacerbations relieved by asymptomatic periods. New imaging modalities, including the combination of MR imaging and multiplanar 3-D CT scans, have broadened our awareness of possible pain-generating degenerative processes of the lumbar spine other than disc degeneration....
The Universal Primer - An open source solution for archiving, organizing and streaming live lectures
DEFF Research Database (Denmark)
Christoffersen, Marc Juul; Panton, Hans Christian Hansen; Krajowski-Kukiel, Maciej
2011-01-01
. The goal of the Universal Primer is to address these problems, and allow anyone, anywhere, to teach or learn anything that can be reasonably taught or learned through a computer. The Universal Primer is 1: A fully open source solution for streaming live lectures. And 2: A Wikipedia-like website...
Beauchaine, Theodore P.
2009-01-01
Taxometric procedures provide an empirical means of determining which psychiatric disorders are typologically distinct from normal behavioral functioning. Although most disorders reflect extremes along continuously distributed behavioral traits, identifying those that are discrete has important implications for accurate diagnosis, effective treatment, early identification of risk, and improved understanding of etiology. This article provides (a) brief descriptions of the conceptual bases of several taxometric procedures, (b) example analyses using simulated data, and (c) strategies for avoiding common pitfalls that are often observed in taxometrics research. To date, most taxometrics studies have appeared in the adult psychopathology literature. It is hoped that this primer will encourage interested readers to extend taxometrics research to child and adolescent populations. PMID:18088222
Magnesium-Based Sacrificial Anode Cathodic Protection Coatings (Mg-Rich Primers for Aluminum Alloys
Directory of Open Access Journals (Sweden)
Michael D. Blanton
2012-09-01
Full Text Available Magnesium is electrochemically the most active metal employed in common structural alloys of iron and aluminum. Mg is widely used as a sacrificial anode to provide cathodic protection of underground and undersea metallic structures, ships, submarines, bridges, decks, aircraft and ground transportation systems. Following the same principle of utilizing Mg characteristics in engineering advantages in a decade-long successful R&D effort, Mg powder is now employed in organic coatings (termed as Mg-rich primers as a sacrificial anode pigment to protect aerospace grade aluminum alloys against corrosion. Mg-rich primers have performed very well on aluminum alloys when compared against the current chromate standard, but the carcinogenic chromate-based coatings/pretreatments are being widely used by the Department of Defense (DoD to protect its infrastructure and fleets against corrosion damage. Factors such as reactivity of Mg particles in the coating matrix during exposure to aggressive corrosion environments, interaction of atmospheric gases with Mg particles and the impact of Mg dissolution, increases in pH and hydrogen gas liberation at coating-metal interface, and primer adhesion need to be considered for further development of Mg-rich primer technology.
Directory of Open Access Journals (Sweden)
Mayya Nurbayanti Shobary
2016-03-01
Full Text Available Abstract - The development of Interactive animation application mixing three colors and introduction of geometric shapes for early childhood, aims to increase learning tool for parents and teachers to attract the attention of children to learn about colors and shapes using interactive animation application. Application built using the concept of PAUD Al-Muslimun in educating early childhood in knowing the result of mixing three primary colors and geometric shapes. The development of application take an example of how theachers in educating early childhood that began with the introduction of color and shapes, and practice how to mix the primary three colors, by showing interisting picture related to colors and shapes are introduced. Data collection methods used for this study is the direct observation of the teaching and learning activities from the perspective of teachers, children and parents to get an idea of the optimal design of an application built on. The development of Interactive animation application mixing three primary colors and introduction of geometric shapes for early childhood for early childhood through the five steps, analyzing, designing, implemeting, testing, and revision errors or shortfall. In this application there are learning processes knowing the primary color and introduction of geometric shapes with support interactive buttons, interesting picture and audio to enhance the absorption of early childhood to the contents of the material, learning and display concerned and to help parents or teachers role in educating children once more creative . Keywords: Applications, Animation, Interactive, Early Childhood Abstrak - Pembangunan aplikasi animasi interaktif pencampuran tiga warna primer dan pengenalan bentuk geometri untuk anak usia dini, bertujuan untuk menambah sarana pembelajaran untuk orang tua dan guru dalam menarik perhatian anak untuk belajar mengenal warna dan bentuk dengan menggunakan aplikasi animasi interaktif
Dysli, Chantal; Dysli, Muriel; Zinkernagel, Martin S; Enzmann, Volker
2016-12-01
Fluorescence lifetime imaging ophthalmoscopy (FLIO) was used to investigate retinal autofluorescence lifetimes in mouse models of pharmacologically induced retinal degeneration over time. Sodium iodate (NaIO 3 , 35 mg/kg intravenously) was used to induce retinal pigment epithelium (RPE) degeneration with subsequent loss of photoreceptors (PR) whereas N-methyl-N-nitrosourea (MNU, 45 mg/kg intraperitoneally) was employed for degeneration of the photoreceptor cell layer alone. All mice were measured at day 3, 7, 14, and 28 after the respective injection of NaIO 3 , MNU or NaCl (control). Fluorescence lifetime imaging was performed using a fluorescence lifetime imaging ophthalmoscope (Heidelberg Engineering, Heidelberg, Germany). Fluorescence was excited at 473 nm and fluorescence lifetimes were measured in a short and a long spectral channel (498-560 nm and 560-720 nm). Corresponding optical coherence tomography (OCT) images were consecutively acquired and histology was performed at the end of the experiments. Segmentation of OCT images and histology verified the cell type-specific degeneration process over time. Retinal autofluorescence lifetimes increased from day 3 to day 28 in mice after NaIO 3 treatment. Finally, at day 28, fluorescence lifetimes were prolonged by 8% in the short and 61% in the long spectral channel compared to control animals (p = 0.21 and p = 0.004, respectively). In mice after MNU treatment, the mean retinal autofluorescence lifetimes were already decreased at day 3 and retinal lifetimes were finally shortened by 27% in the short and 51% in the long spectral channel at day 28 (p = 0.0028). In conclusion, degeneration of the RPE with subsequent photoreceptor degeneration by NaIO 3 lead to longer mean fluorescence lifetimes of the retina compared to control mice, whereas during specific degeneration of the photoreceptor layer induced by MNU shorter lifetimes were measured. Therefore, short retinal fluorescence lifetimes may originate
Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.
Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong
2014-08-01
The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. Copyright © 2014 Elsevier Ltd. All rights reserved.
Transgenic Mice Over-Expressing RBP4 Have RBP4-Dependent and Light-Independent Retinal Degeneration.
Du, Mei; Phelps, Eric; Balangue, Michael J; Dockins, Aaron; Moiseyev, Gennadiy; Shin, Younghwa; Kane, Shelley; Otalora, Laura; Ma, Jian-Xing; Farjo, Rafal; Farjo, Krysten M
2017-08-01
Transgenic mice overexpressing serum retinol-binding protein (RBP4-Tg) develop progressive retinal degeneration, characterized by microglia activation, yet the precise mechanisms underlying retinal degeneration are unclear. Previous studies showed RBP4-Tg mice have normal ocular retinoid levels, suggesting that degeneration is independent of the retinoid visual cycle or light exposure. The present study addresses whether retinal degeneration is light-dependent and RBP4-dependent by testing the effects of dark-rearing and pharmacological lowering of serum RBP4 levels, respectively. RBP4-Tg mice reared on normal mouse chow in normal cyclic light conditions were directly compared to RBP4-Tg mice exposed to chow supplemented with the RBP4-lowering compound A1120 or dark-rearing conditions. Quantitative retinal histological analysis was conducted to assess retinal degeneration, and electroretinography (ERG) and optokinetic tracking (OKT) tests were performed to assess retinal and visual function. Ocular retinoids and bis-retinoid A2E were quantified. Dark-rearing RBP4-Tg mice effectively reduced ocular bis-retinoid A2E levels, but had no significant effect on retinal degeneration or dysfunction in RBP4-Tg mice, demonstrating that retinal degeneration is light-independent. A1120 treatment lowered serum RBP4 levels similar to wild-type mice, and prevented structural retinal degeneration. However, A1120 treatment did not prevent retinal dysfunction in RBP4-Tg mice. Moreover, RBP4-Tg mice on A1120 diet had significant worsening of OKT response and loss of cone photoreceptors compared to RBP4-Tg mice on normal chow. This may be related to the very significant reduction in retinyl ester levels in the retina of mice on A1120-supplemented diet. Retinal degeneration in RBP4-Tg mice is RBP4-dependent and light-independent.
Molecular Basis for DNA Double-Strand Break Annealing and Primer Extension by an NHEJ DNA Polymerase
Directory of Open Access Journals (Sweden)
Nigel C. Brissett
2013-11-01
Full Text Available Nonhomologous end-joining (NHEJ is one of the major DNA double-strand break (DSB repair pathways. The mechanisms by which breaks are competently brought together and extended during NHEJ is poorly understood. As polymerases extend DNA in a 5′-3′ direction by nucleotide addition to a primer, it is unclear how NHEJ polymerases fill in break termini containing 3′ overhangs that lack a primer strand. Here, we describe, at the molecular level, how prokaryotic NHEJ polymerases configure a primer-template substrate by annealing the 3′ overhanging strands from opposing breaks, forming a gapped intermediate that can be extended in trans. We identify structural elements that facilitate docking of the 3′ ends in the active sites of adjacent polymerases and reveal how the termini act as primers for extension of the annealed break, thus explaining how such DSBs are extended in trans. This study clarifies how polymerases couple break-synapsis to catalysis, providing a molecular mechanism to explain how primer extension is achieved on DNA breaks.
DEFF Research Database (Denmark)
Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus
2005-01-01
A novel single-base extension (SBE) assay using cleavable and noncleavable SBE primers in the same reaction mix is described. The cleavable SBE primers consisted of deoxyribonucleotides and one ribonucleotide (hereafter denoted chimeric primers), whereas the noncleavable SBE primers consisted....... A ribonuclease mix was developed to specifically cleave the chimeric primers, irrespective of the base of the ribonucleotide, whereas standard primers without a ribonucleotide were unaffected by the ribonuclease treatment. The SBE products were analyzed in linear mode using a matrix-assisted laser desorption...... containing 9 chimeric primers and 8 standard primers....
Cystic degeneration of liver malignancies. Study by US and CT
Energy Technology Data Exchange (ETDEWEB)
Kumada, Takashi; Nakano, Satoshi; Kitamura, Kimio; Watahiki, Hajime; Takeda, Isao
1983-03-01
CT and US were carried out on 81 patients with hepatocellular carcinoma, 20 patients with cholangiocellular carcinoma and 94 patients with metastatic liver cancer. 1) Cystic degeneration was observed in one with hepatocellular carcinoma (1.2%), one with cholangiocellular carcinoma (5.0%) and 12 with metastatic liver cancer (12.8%) by US, but this change was observed in only 5 by CT (1,0,4, respectively). Metastatic liver cancer showed the highest incidence among these tumors. 2) The characteristics of cystic degeneration of the liver tumors were thickened wall and irregularity of the inner surface of the wall. 3) Judging from macroscopic and histopathological findings, liquefactive necrosis in the tumors was shown as ''echoluent'' area. We concluded that cystic degeneration was one of the important findings in metastatic liver cancer and that careful observation by US and CT avoided the confusion with other hepatic cystic diseases.
Yamagishi, Yuya; Tessier-Lavigne, Marc
2015-01-01
Calcium is a key regulator of axon degeneration caused by trauma and disease, but its specific spatial and temporal dynamics in injured axons remain unclear. To clarify the function of calcium in axon degeneration, we observed calcium dynamics in single injured neurons in live zebrafish larvae and tested the temporal requirement for calcium in zebrafish neurons and cultured mouse DRG neurons. Using laser axotomy to induce Wallerian degeneration (WD) in zebrafish peripheral sensory axons, we monitored calcium dynamics from injury to fragmentation, revealing two stereotyped phases of axonal calcium influx. First, axotomy triggered a transient local calcium wave originating at the injury site. This initial calcium wave only disrupted mitochondria near the injury site and was not altered by expression of the protective WD slow (WldS) protein. Inducing multiple waves with additional axotomies did not change the kinetics of degeneration. In contrast, a second phase of calcium influx occurring minutes before fragmentation spread as a wave throughout the axon, entered mitochondria, and was abolished by WldS expression. In live zebrafish, chelating calcium after the first wave, but before the second wave, delayed the progress of fragmentation. In cultured DRG neurons, chelating calcium early in the process of WD did not alter degeneration, but chelating calcium late in WD delayed fragmentation. We propose that a terminal calcium wave is a key instructive component of the axon degeneration program. SIGNIFICANCE STATEMENT Axon degeneration resulting from trauma or neurodegenerative disease can cause devastating deficits in neural function. Understanding the molecular and cellular events that execute axon degeneration is essential for developing treatments to address these conditions. Calcium is known to contribute to axon degeneration, but its temporal requirements in this process have been unclear. Live calcium imaging in severed zebrafish neurons and temporally controlled
DEFF Research Database (Denmark)
Fredslund, Jakob; Schauser, Leif; Madsen, Lene Heegaard
2005-01-01
Using a comparative approach, the web program PriFi (http://cgi-www.daimi.au.dk/cgi-chili/PriFi/main) designs pairs of primers useful for PCR amplification of genomic DNA in species where prior sequence information is not available. The program works with an alignment of DNA sequences from...... of a procedure for developing general markers serving as common anchor loci across species. To accommodate users with special preferences, configuration settings and criteria can be customized....
Directory of Open Access Journals (Sweden)
Andrea Scribante
2013-01-01
Full Text Available Objective. The aim of this study was to compare the shear bond strength (SBS and adhesive remnant index (ARI scores of no-primer adhesives tested with two different bracket bases. Materials and Methods. 120 bovine permanent mandibular incisors were divided into 6 groups of 20 specimens. Two brackets (ODP with different bracket bases (anchor pylons and 80-gauge mesh were bonded to the teeth using a conventional adhesive (Transbond XT and two different no-primer adhesive (Ortho Cem; Heliosit systems. Groups were tested using an instron universal testing machine. SBS values were recorded. ARI scores were measured. SEM microphotographs were taken to evaluate the pattern of bracket bases. Statistical analysis was performed. ANOVA and Tukey tests were carried out for SBS values, whereas a chi-squared test was applied for ARI scores. Results. Highest bond strength values were reported with Transbond XT (with both pad designs, Ortho Cem bonded on anchor pylons and Heliosit on 80-gauge mesh. A higher frequency of ARI score of “3” was reported for Transbond XT groups. Other groups showed a higher frequency of ARI score “2” and “1.” Conclusion. Transbond XT showed the highest shear bond strength values with both pad designs.
The astrobiology primer: an outline of general knowledge--version 1, 2006.
Billings, L; Cameron, V; Claire, M; Dick, G J; Domagal-Goldman, S D; Javaux, E J; Johnson, O J; Laws, C; Race, M S; Rask, J; Rummel, J D; Schelble, R T; Vance, S
2006-10-01
The Astrobiology Primer has been created as a reference tool for those who are interested in the interdisciplinary field of astrobiology. The field incorporates many diverse research endeavors, but it is our hope that this slim volume will present the reader with all he or she needs to know to become involved and to understand, at least at a fundamental level, the state of the art. Each section includes a brief overview of a topic and a short list of readable and important literature for those interested in deeper knowledge. Because of the great diversity of material, each section was written by a different author with a different expertise. Contributors, authors, and editors are listed at the beginning, along with a list of those chapters and sections for which they were responsible. We are deeply indebted to the NASA Astrobiology Institute (NAI), in particular to Estelle Dodson, David Morrison, Ed Goolish, Krisstina Wilmoth, and Rose Grymes for their continued enthusiasm and support. The Primer came about in large part because of NAI support for graduate student research, collaboration, and inclusion as well as direct funding. We have entitled the Primer version 1 in hope that it will be only the first in a series, whose future volumes will be produced every 3-5 years. This way we can insure that the Primer keeps up with the current state of research. We hope that it will be a great resource for anyone trying to stay abreast of an ever-changing field.
Digoxin-induced retinal degeneration depends on rhodopsin.
Landfried, Britta; Samardzija, Marijana; Barben, Maya; Schori, Christian; Klee, Katrin; Storti, Federica; Grimm, Christian
2017-03-16
Na,K-ATPases are energy consuming ion pumps that are required for maintaining ion homeostasis in most cells. In the retina, Na,K-ATPases are especially important to sustain the dark current in photoreceptor cells needed for rapid hyperpolarization of rods and cones in light. Cardiac glycosides like digoxin inhibit the activity of Na,K-ATPases by targeting their catalytic alpha subunits. This leads to a disturbed ion balance, which can affect cellular function and survival. Here we show that the treatment of wild-type mice with digoxin leads to severe retinal degeneration and loss of vision. Digoxin induced cell death specifically in photoreceptor cells with no or only minor effects in other retinal cell types. Photoreceptor-specific cytotoxicity depended on the presence of bleachable rhodopsin. Photoreceptors of Rpe65 knockouts, which have no measurable rhodopsin and photoreceptors of Rpe65 R91W mice that have treatment. Similarly, cones in the all-cone retina of Nrl knockout mice were also not affected. Digoxin induced expression of several genes involved in stress signaling and inflammation. It also activated proteins such as ERK1/2, AKT, STAT1, STAT3 and CASP1 during a period of up to 10 days after treatment. Activation of signaling genes and proteins, as well as the dependency on bleachable rhodopsin resembles mechanisms of light-induced photoreceptor degeneration. Digoxin-mediated photoreceptor cell death may thus be used as an inducible model system to study molecular mechanisms of retinal degeneration.
Age-related macular degeneration
DEFF Research Database (Denmark)
la Cour, Morten; Kiilgaard, Jens Folke; Nissen, Mogens Holst
2002-01-01
Age-related macular degeneration (AMD) is a common macular disease affecting elderly people in the Western world. It is characterised by the appearance of drusen in the macula, accompanied by choroidal neovascularisation (CNV) or geographic atrophy. The disease is more common in Caucasian....... Smoking is probably also a risk factor. Preventive strategies using macular laser photocoagulation are under investigation, but their efficacy in preventing visual loss is as yet unproven. There is no treatment with proven efficacy for geographic atrophy. Optimal treatment for exudative AMD requires...
Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V
2015-12-01
The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.
Cartilage Degeneration and Alignment in Severe Varus Knee Osteoarthritis.
Nakagawa, Yasuaki; Mukai, Shogo; Yabumoto, Hiromitsu; Tarumi, Eri; Nakamura, Takashi
2015-10-01
The aim of this study was to examine the relationship between cartilage, ligament, and meniscus degeneration and radiographic alignment in severe varus knee osteoarthritis in order to understand the development of varus knee osteoarthritis. Fifty-three patients (71 knees) with primary varus knee osteoarthritis and who underwent total knee arthroplasty were selected for this study. There were 6 men and 47 women, with 40 right knees and 31 left knees studied; their mean age at operation was 73.5 years. The ligament, meniscus, degeneration of joint cartilage, and radiographic alignments were examined visually. The tibial plateau-tibial shaft angle was larger if the condition of the cartilage in the lateral femoral condyle was worse. The femorotibial angle and tibial plateau-tibial shaft angle were larger if the conditions of the lateral meniscus or the cartilage in the lateral tibial plateau were worse. Based on the results of this study, progression of varus knee osteoarthritis may occur in the following manner: medial knee osteoarthritis starts in the central portion of the medial tibial plateau, and accompanied by medial meniscal extrusion and anterior cruciate ligament rupture, cartilage degeneration expands from the anterior to the posterior in the medial tibial plateau. Bone attrition occurs in the medial tibial plateau, and the femoro-tibial angle and tibial plateau-tibial shaft angle increase. Therefore, the lateral intercondylar eminence injures the cartilage of the lateral femoral condyle in the longitudinal fissure type. Thereafter, the cartilage degeneration expands in the whole of the knee joints.
Promotion primer. Foerderfibel
Energy Technology Data Exchange (ETDEWEB)
1981-01-01
This revised edition of the promotion primer is to serve as a topical orientation aid for industrial firms, unions, boards and other bodies interested where the actions of governmental R and D and innovation policy are compiled and clearly arranged. It is important for the success of governmental aids that the institutions concerned are informed about all possibilities of the promotion, financing and advisory programme. Beyond the presentation of the research promotion sectors, the fiscal measures and the contractual as well as the joint research this revised edition focussess on the fields of consultative services for innovation and information. For many firms the access to qualified information and guidance is of particular importance. That is why this brochure points out the ways towards governmental research promotion. The BMFT has provided a remarkable contribution to research promotion by establishing information and consultative services for trade and industry.
Protective effects of cannabidiol on lesion-induced intervertebral disc degeneration.
Directory of Open Access Journals (Sweden)
João W Silveira
Full Text Available Disc degeneration is a multifactorial process that involves hypoxia, inflammation, neoinnervation, accelerated catabolism, and reduction in water and glycosaminoglycan content. Cannabidiol is the main non-psychotropic component of the Cannabis sativa with protective and anti-inflammatory properties. However, possible therapeutic effects of cannabidiol on intervertebral disc degeneration have not been investigated yet. The present study investigated the effects of cannabidiol intradiscal injection in the coccygeal intervertebral disc degeneration induced by the needle puncture model using magnetic resonance imaging (MRI and histological analyses. Disc injury was induced in the tail of male Wistar rats via a single needle puncture. The discs selected for injury were punctured percutaneously using a 21-gauge needle. MRI and histological evaluation were employed to assess the results. The effects of intradiscal injection of cannabidiol (30, 60 or 120 nmol injected immediately after lesion were analyzed acutely (2 days by MRI. The experimental group that received cannabidiol 120 nmol was resubmitted to MRI examination and then to histological analyses 15 days after lesion/cannabidiol injection. The needle puncture produced a significant disc injury detected both by MRI and histological analyses. Cannabidiol significantly attenuated the effects of disc injury induced by the needle puncture. Considering that cannabidiol presents an extremely safe profile and is currently being used clinically, these results suggest that this compound could be useful in the treatment of intervertebral disc degeneration.
Gold nanoparticle-assisted primer walking for closing the human chromosomal gap
DEFF Research Database (Denmark)
Li, H; Shi, B; Li, X
2013-01-01
The finished sequence of the human genome still contains 260 euchromatic gaps. All the PCR-based genome walking techniques used to close gaps have common limitations, such as low efficiency and low specificity. We herein describe a strategy to solve this problem by employing gold nanoparticles (Au......NPs) to improve the efficiency in primer walking amplification. We used this strategy to close a gap in human chromosome 5 containing a DNA stretch composed of the 12SAT repeat. The obtained gap sequence is highly conserved among several mammalian genomes. The demonstrated AuNP-assisted primer walking strategy...
Assessment of Intervertebral Disc Degeneration With Magnetic Resonance Single-Voxel Spectroscopy
Zuo, Jin; Saadat, Ehsan; Romero, Adan; Loo, Kimberly; Li, Xiaojuan; Link, Thomas M.; Kurhanewicz, John; Majumdar, Sharmila
2014-01-01
This study examined the feasibility of using short-echo water-suppressed point-resolved spectroscopy (PRESS) on a clinical 3T magnetic resonance (MR) scanner for evaluating biochemical changes in degenerated bovine and cadaveric human inter-vertebral discs. In bovine discs (N = 17), degeneration was induced with papain injections. Degeneration of human cadaveric discs (N = 27) was assessed using the Pfirrmann grading on T2-weighted images. Chemicals in the carbohydrate region (Carb), the choline head group (Cho), the N-acetyl region (N-acetyl), and the lipid and lactate region (Lac+Lip) were quantified using 1H PRESS, and were compared between specimens with different degrees of degeneration. The correlation between the spectroscopic findings and glycosaminoglycan (GAG) quantification using biochemical assays was determined. Significant differences were found between the ratios (N-acetyl/Cho, N-acetyl/Lac+Lip) acquired before and after papain injection in bovine discs. For human cadaveric discs, significant differences in the ratios (N-acetyl/Carb, N-acetyl/Lac+Lip) were found between discs having high and low Pfirrmann scores. Significant correlations were found between N-acetyl/Lac+Lip and GAG content in bovine discs (R = 0.77, P = 0.0007) and cadaveric discs (R = 0.83, P < 0.0001). Significant correlation between N-acetyl/Cho and GAG content was also found in cadaver discs (R = 0.64, P = 0.0039). This study demonstrates for the first time that short-echo PRESS on a clinical 3T MR scanner can be used to noninvasively and can reproducibly quantify metabolic changes associated with degeneration of intervertebral discs. PMID:19780173
Gilbert, Hamish T J; Hodson, Nathan; Baird, Pauline; Richardson, Stephen M; Hoyland, Judith A
2016-11-17
The aetiology of intervertebral disc (IVD) degeneration remains poorly understood. Painful IVD degeneration is associated with an acidic intradiscal pH but the response of NP cells to this aberrant microenvironmental factor remains to be fully characterised. The aim here was to address the hypothesis that acidic pH, similar to that found in degenerate IVDs, leads to the altered cell/functional phenotype observed during IVD degeneration, and to investigate the involvement of acid-sensing ion channel (ASIC) -3 in the response. Human NP cells were treated with a range of pH, from that of a non-degenerate (pH 7.4 and 7.1) through to mildly degenerate (pH 6.8) and severely degenerate IVD (pH 6.5 and 6.2). Increasing acidity of pH caused a decrease in cell proliferation and viability, a shift towards matrix catabolism and increased expression of proinflammatory cytokines and pain-related factors. Acidic pH resulted in an increase in ASIC-3 expression. Importantly, inhibition of ASIC-3 prevented the acidic pH induced proinflammatory and pain-related phenotype in NP cells. Acidic pH causes a catabolic and degenerate phenotype in NP cells which is inhibited by blocking ASIC-3 activity, suggesting that this may be a useful therapeutic target for treatment of IVD degeneration.
Energy Technology Data Exchange (ETDEWEB)
Zhan Fangfang; Zhou Xiaoming [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China); Xing Da, E-mail: xingda@scnu.edu.cn [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China)
2013-01-25
Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs-TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: Black-Right-Pointing-Pointer A novel method for detection of rotavirus has been developed. Black-Right-Pointing-Pointer In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. Black-Right-Pointing-Pointer To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. Black-Right-Pointing-Pointer The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2 Prime -bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs-TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection
Global Carleman estimates for degenerate parabolic operators with applications
Cannarsa, P; Vancostenoble, J
2016-01-01
Degenerate parabolic operators have received increasing attention in recent years because they are associated with both important theoretical analysis, such as stochastic diffusion processes, and interesting applications to engineering, physics, biology, and economics. This manuscript has been conceived to introduce the reader to global Carleman estimates for a class of parabolic operators which may degenerate at the boundary of the space domain, in the normal direction to the boundary. Such a kind of degeneracy is relevant to study the invariance of a domain with respect to a given stochastic diffusion flow, and appears naturally in climatology models.
Association of HTRA1 rs11200638 with age-related macular degeneration (AMD) in Brazilian patients.
Lana, Tamires Prates; da Silva Costa, Sueli Matilde; Ananina, Galina; Hirata, Fábio Endo; Rim, Priscila Hae Hyun; Medina, Flávio MacCord; de Vasconcellos, José Paulo Cabral; de Melo, Mônica Barbosa
2018-01-01
Age-related macular degeneration is a multifactorial disease that can lead to vision impairment in older individuals. Although the etiology of age-related macular degeneration remains unknown, risk factors include age, ethnicity, smoking, hypertension, obesity, and genetic factors. Two main loci have been identified through genome-wide association studies, on chromosomes 1 and 10. Among the variants located at the 10q26 region, rs11200638, located at the HTRA1 gene promoter, has been associated with age-related macular degeneration in several populations and is considered the main polymorphism. We conducted a replication case-control study to analyze the frequency and participation of rs11200638 in the etiology of age-related macular degeneration in a sample of patients and controls from the State of São Paulo, Brazil, through polymerase chain reaction and enzymatic digestion. The frequency of the A allele was 57.60% in patients with age-related macular degeneration and 36.45% in controls (p value age-related macular degeneration group compared to the control group (p = 1.21 e-07 and 0.0357, respectively). No statistically significant results were observed after stratification in dry versus wet types or advanced versus non-advanced forms. To our knowledge, this is the first time the association between rs11200638 and overall age-related macular degeneration has been reported in South America.
Serum levels of lipid metabolites in age-related macular degeneration
Orban, Tivadar; Johnson, William M.; Dong, Zhiqian; Maeda, Tadao; Maeda, Akiko; Sakai, Tsutomu; Tsuneoka, Hiroshi; Mieyal, John J.; Palczewski, Krzysztof
2015-01-01
Age-related macular degeneration (AMD) is a neurodegenerative disease that causes adult-onset blindness. There are 2 forms of this progressive disease: wet and dry. Currently there is no cure for AMD, but several treatment options have started to emerge making early detection critical for therapeutic success. Analysis of the eyes of Abca4−/−Rdh8−/− mice that display light-induced retinal degeneration indicates that 11-cis-retinal and docosahexaenoic acid (DHA) levels were significantly decrea...
Microcurrent stimulation in the treatment of dry and wet macular degeneration
Directory of Open Access Journals (Sweden)
Chaikin L
2015-12-01
Full Text Available Laurie Chaikin,1 Kellen Kashiwa,2 Michael Bennet,2 George Papastergiou,3 Walter Gregory4 1Private practice, Alameda, CA, USA; 2Retina Institute of Hawaii, Honolulu, HI, USA; 3California Retinal Associates, San Diego, CA, USA; 4Clinical Trials Research Unit, Faculty of Medicine and Health, University of Leeds, Leeds, UK Purpose: To determine the safety and efficacy of the application of transcutaneous (transpalpebral microcurrent stimulation to slow progression of dry and wet macular degeneration or improve vision in dry and wet macular degeneration. Methods: Seventeen patients aged between 67 and 95 years with an average age of 83 years were selected to participate in the study over a period of 3 months in two eye care centers. There were 25 eyes with dry age-related macular degeneration (DAMD and six eyes with wet age-related macular degeneration (WAMD. Frequency-specific microcurrent stimulation was applied in a transpalpebral manner, using two programmable dual channel microcurrent units delivering pulsed microcurrent at 150 µA for 35 minutes once a week. The frequency pairs selected were based on targeting tissues, which are typically affected by the disease combined with frequencies that target disease processes. Early Treatment Diabetic Retinopathy Study or Snellen visual acuity (VA was measured before and after each treatment session. All treatment was administered in a clinical setting. Results: Significant increases were seen in VA in DAMD (P=0.012, Wilcoxon one-sample test, but in WAMD, improvements did not reach statistical significance (P=0.059. In DAMD eyes, twice as many patients showed increase in VA (52% compared to those showing deterioration (26%, with improvements being often sizeable, whereas deteriorations were usually very slight. In WAMD eyes, five of six (83% patients showed an increase and none showed deterioration. Conclusion: The substantial changes observed over this period, combined with continued improvement for
Brownfields Technology Primer: Selecting and Using Phytoremediation for Site Cleanup
This primer explains the phytoremediation process, discusses the potential advantages and considerations in selecting phytoremediation to clean up brownfields sites, and provides information on additional resources about phytoremediation.
A Primer on Autonomous Aerial Vehicle Design.
Coppejans, Hugo H G; Myburgh, Herman C
2015-12-02
There is a large amount of research currently being done on autonomous micro-aerial vehicles (MAV), such as quadrotor helicopters or quadcopters. The ability to create a working autonomous MAV depends mainly on integrating a simultaneous localization and mapping (SLAM) solution with the rest of the system. This paper provides an introduction for creating an autonomous MAV for enclosed environments, aimed at students and professionals alike. The standard autonomous system and MAV automation are discussed, while we focus on the core concepts of SLAM systems and trajectory planning algorithms. The advantages and disadvantages of using remote processing are evaluated, and recommendations are made regarding the viability of on-board processing. Recommendations are made regarding best practices to serve as a guideline for aspirant MAV designers.
Yu, Tiantian; Liang, Qianyong; Niu, Mingyang; Wang, Fengping
2017-08-01
The archaeal phylum Bathyarchaeota, which is composed of a large number of diverse lineages, is widespread and abundant in marine sediments. Environmental factors that control the distribution, abundance and evolution of this largely diversified archaeal phylum are currently unclear. In this study, a new pair of specific primers that target the major marine subgroups of bathyarchaeotal 16S rRNA genes was designed and evaluated to investigate the distribution and abundance of Bathyarchaeota in marine sediments. The abundance of Bathyarchaeota along two sediment cores from the deep-sea sediments of South China Sea (SCS, each from the Dongsha and Shenhu area) was determined. A strong correlation was found between the bathyarchaeotal abundance and the content of total organic carbon (TOC), suggesting an important role of Bathyarchaeota in organic matter remineralisation in the sediments of SCS. Furthermore, diversity analysis revealed that subgroups Bathy-2, Bathy-8 and Bathy-10 were dominant bathyarchaeotal members of the deep-sea sediments in the SCS. Bathy-8 was found predominantly within the reducing and deeper sediment layers, while Bathy-10 occurred preferentially in the oxidizing and shallower sediment layers. Our study lays a foundation for the further understanding of the ecological functions and niche differentiation of the important but not well-understood sedimentary archaeal group. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.
Clinical Features Indicating Nigrostriatal Dopaminergic Degeneration in Drug-Induced Parkinsonism
Directory of Open Access Journals (Sweden)
Seung Ha Lee
2017-01-01
Full Text Available Objective Patients with drug-induced parkinsonism (DIP may have nigrostriatal dopaminergic degeneration. We studied the clinical features that may indicate nigrostriatal dopaminergic degeneration in patients with DIP. Methods Forty-one DIP patients were classified into normal and abnormal [18F] FP-CIT scan groups. Differences in 32 clinical features and drug withdrawal effects were studied. Results Twenty-eight patients had normal (Group I and 13 patients had abnormal (Group II scans. Eight patients of Group I, but none of Group II, had taken calcium channel blockers (p = 0.040. Three patients of Group I and six of Group II had hyposmia (p = 0.018. After drug withdrawal, Group I showed greater improvement in Unified Parkinson’s Disease Rating Scale total motor scores and subscores for bradykinesia and tremors than Group II. Only hyposmia was an independent factor associated with abnormal scans, but it had suboptimal sensitivity. Conclusion None of the clinical features were practical indicators of nigrostriatal dopaminergic degeneration in patients with DIP.
Sheu, Sen-Je; Hwang, Wen-zhe; Chen, Hsin-Chih; Chiang, Yu-Cheng; Tsen, Hau-Yang
2009-01-01
PCR primers specific for the detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum were designed based on the elongation factor Tu gene (tuf). The specificity of these four primer sets were confirmed by PCR with 88 bacterial strains of Lactobacillus, Enterococcus, Bifidobacterium, and other bacterial species. Results indicated that these primer sets generated predicted PCR products of 397, 230, 202, and 161 bp for L. acidophilus, L. delbrueckii, L. casei group, and B. longum, respectively. Bacterial species other than the target organisms tested did not generate false-positive results. When these four primer sets were combined for the simultaneous detection of the lactic acid bacteria (LAB) in fermented milk products including yogurt, the LAB species listed on the labels of these products could be identified without the preenrichment step. The identification limit for each LAB strain with this multiplex PCR method was N X 10(3) CFU/ml in milk samples. The results of our multiplex PCR method were confirmed by PCR assay using primers based on the 16S rDNA or the 16S-23S intergenic spacer region and by biochemical tests using the API 50 CHL kit. When this multiplex PCR method was used with the determination of counts of total viable LAB and bifidobacteria, the quality of commercial fermented milk products could be assured.
Dorn-In, Samart; Bassitta, Rupert; Schwaiger, Karin; Bauer, Johann; Hölzel, Christina S
2015-06-01
Universal primers targeting the bacterial 16S-rRNA-gene allow quantification of the total bacterial load in variable sample types by qPCR. However, many universal primer pairs also amplify DNA of plants or even of archaea and other eukaryotic cells. By using these primers, the total bacterial load might be misevaluated, whenever samples contain high amounts of non-target DNA. Thus, this study aimed to provide primer pairs which are suitable for quantification and identification of bacterial DNA in samples such as feed, spices and sample material from digesters. For 42 primers, mismatches to the sequence of chloroplasts and mitochondria of plants were evaluated. Six primer pairs were further analyzed with regard to the question whether they anneal to DNA of archaea, animal tissue and fungi. Subsequently they were tested with sample matrix such as plants, feed, feces, soil and environmental samples. To this purpose, the target DNA in the samples was quantified by qPCR. The PCR products of plant and feed samples were further processed for the Single Strand Conformation Polymorphism method followed by sequence analysis. The sequencing results revealed that primer pair 335F/769R amplified only bacterial DNA in samples such as plants and animal feed, in which the DNA of plants prevailed. Copyright © 2015 Elsevier B.V. All rights reserved.
Degenerate parabolic stochastic partial differential equations
Czech Academy of Sciences Publication Activity Database
span class="emphasis">Hofmanová, Martinaspan>
2013-01-01
Roč. 123, č. 12 (2013), s. 4294-4336 ISSN 0304-4149 R&D Projects: GA ČR GAP201/10/0752 Institutional support: RVO:67985556 Keywords : kinetic solutions * degenerate stochastic parabolic equations Subject RIV: BA - General Mathematics Impact factor: 1.046, year: 2013 http://library.utia.cas.cz/separaty/2013/SI/hofmanova-0397241.pdf
Machalińska, Anna
2013-01-01
Age-related macular degeneration is the leading cause of irreversible visual impairment and disability among the elderly in developed countries. There is compelling evidence that atherosclerosis and age-related macular degeneration share a similar pathogenic process. The association between atherosclerosis and age-related macular degeneration has been inferred from histological, biochemical and epidemiological studies. Many published data indicate that drusen are similar in molecular composition to plaques in atherosclerosis. Furthermore, a great body of evidence has emerged over the past decade that implicates the chronic inflammatory processes in the pathogenesis and progression of both disorders. We speculate that vascular atherosclerosis and age-related macular degeneration may represent different manifestations of the same disease induced by a pathologic tissue response to the damage caused by oxidative stress and local ischemia. In this review, we characterise in detail a strong association between age-related macular degeneration and atherosclerosis development, and we postulate the hypothesis that age-related macular degeneration is a local manifestation of a systemic disease. This provides a new approach for understanding the aspects of pathogenesis and might improve the prevention and treatment of both diseases which both result from ageing of the human body.
Sultana, S.; Schlickeiser, R.
2018-05-01
Fully nonlinear features of heavy ion-acoustic solitary waves (HIASWs) have been investigated in an astrophysical degenerate relativistic quantum plasma (ADRQP) containing relativistically degenerate electrons and non-relativistically degenerate light ion species, and non-degenerate heavy ion species. The pseudo-energy balance equation is derived from the fluid dynamical equations by adopting the well-known Sagdeev-potential approach, and the properties of arbitrary amplitude HIASWs are examined. The small amplitude limit for the propagation of HIASWs is also recovered. The basic features (width, amplitude, polarity, critical Mach number, speed, etc.) of HIASWs are found to be significantly modified by the relativistic effect of the electron species, and also by the variation of the number density of electron, light ion, and heavy ion species. The basic properties of HIASWs, that may propagated in some realistic astrophysical plasma systems (e.g., in white dwarfs), are briefly discussed.