WorldWideScience

Sample records for degenerate primers designed

  1. Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing

    Directory of Open Access Journals (Sweden)

    Li Kelvin

    2012-11-01

    Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus

  2. An iterative method for selecting degenerate multiplex PCR primers.

    Science.gov (United States)

    Souvenir, Richard; Buhler, Jeremy; Stormo, Gary; Zhang, Weixiong

    2007-01-01

    Single-nucleotide polymorphism (SNP) genotyping is an important molecular genetics process, which can produce results that will be useful in the medical field. Because of inherent complexities in DNA manipulation and analysis, many different methods have been proposed for a standard assay. One of the proposed techniques for performing SNP genotyping requires amplifying regions of DNA surrounding a large number of SNP loci. To automate a portion of this particular method, it is necessary to select a set of primers for the experiment. Selecting these primers can be formulated as the Multiple Degenerate Primer Design (MDPD) problem. The Multiple, Iterative Primer Selector (MIPS) is an iterative beam-search algorithm for MDPD. Theoretical and experimental analyses show that this algorithm performs well compared with the limits of degenerate primer design. Furthermore, MIPS outperforms an existing algorithm that was designed for a related degenerate primer selection problem.

  3. MethPrimer: designing primers for methylation PCRs.

    Science.gov (United States)

    Li, Long-Cheng; Dahiya, Rajvir

    2002-11-01

    DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.

  4. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)

    ES

    reaction (PCR), oligo hybridization and DNA sequencing. Proper primer design is actually one of the most important factors/steps in successful DNA sequencing. Various bioinformatics programs are available for selection of primer pairs from a template sequence. The plethora programs for PCR primer design reflects the.

  5. MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling

    Directory of Open Access Journals (Sweden)

    Kitchen James L

    2012-11-01

    Full Text Available Abstract Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  6. MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.

    Science.gov (United States)

    Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G

    2012-11-05

    Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  7. A degenerate primer MOB typing (DPMT method to classify gamma-proteobacterial plasmids in clinical and environmental settings.

    Directory of Open Access Journals (Sweden)

    Andrés Alvarado

    Full Text Available Transmissible plasmids are responsible for the spread of genetic determinants, such as antibiotic resistance or virulence traits, causing a large ecological and epidemiological impact. Transmissible plasmids, either conjugative or mobilizable, have in common the presence of a relaxase gene. Relaxases were previously classified in six protein families according to their phylogeny. Degenerate primers hybridizing to coding sequences of conserved amino acid motifs were designed to amplify related relaxase genes from γ-Proteobacterial plasmids. Specificity and sensitivity of a selected set of 19 primer pairs were first tested using a collection of 33 reference relaxases, representing the diversity of γ-Proteobacterial plasmids. The validated set was then applied to the analysis of two plasmid collections obtained from clinical isolates. The relaxase screening method, which we call "Degenerate Primer MOB Typing" or DPMT, detected not only most known Inc/Rep groups, but also a plethora of plasmids not previously assigned to any Inc group or Rep-type.

  8. Degenerate primer MOB typing of multiresistant clinical isolates of E. coli uncovers new plasmid backbones.

    Science.gov (United States)

    Garcillán-Barcia, M Pilar; Ruiz del Castillo, Belén; Alvarado, Andrés; de la Cruz, Fernando; Martínez-Martínez, Luis

    2015-01-01

    Degenerate Primer MOB Typing is a PCR-based protocol for the classification of γ-proteobacterial transmissible plasmids in five phylogenetic relaxase MOB families. It was applied to a multiresistant E. coli collection, previously characterized by PCR-based replicon-typing, in order to compare both methods. Plasmids from 32 clinical isolates of multiresistant E. coli (19 extended spectrum beta-lactamase producers and 13 non producers) and their transconjugants were analyzed. A total of 95 relaxases were detected, at least one per isolate, underscoring the high potential of these strains for antibiotic-resistance transmission. MOBP12 and MOBF12 plasmids were the most abundant. Most MOB subfamilies detected were present in both subsets of the collection, indicating a shared mobilome among multiresistant E. coli. The plasmid profile obtained by both methods was compared, which provided useful data upon which decisions related to the implementation of detection methods in the clinic could be based. The phylogenetic depth at which replicon and MOB-typing classify plasmids is different. While replicon-typing aims at plasmid replication regions with non-degenerate primers, MOB-typing classifies plasmids into relaxase subfamilies using degenerate primers. As a result, MOB-typing provides a deeper phylogenetic depth than replicon-typing and new plasmid groups are uncovered. Significantly, MOB typing identified 17 plasmids and an integrative and conjugative element, which were not detected by replicon-typing. Four of these backbones were different from previously reported elements. Copyright © 2014 Elsevier Inc. All rights reserved.

  9. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

    Directory of Open Access Journals (Sweden)

    Nomin Batnyam

    2012-01-01

    Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.

  10. Scrimer: designing primers from transcriptome data

    Czech Academy of Sciences Publication Activity Database

    Mořkovský, Libor; Pačes, Jan; Rídl, Jakub; Reifová, R.

    2015-01-01

    Roč. 15, č. 6 (2015), s. 1415-1420 ISSN 1755-098X R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 ; RVO:68378050 Keywords : next-generation sequencing * primer design * SNaPshot * SNP genotyping * transcriptome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.298, year: 2015

  11. PHUSER (Primer Help for USER): a novel tool for USER fusion primer design

    DEFF Research Database (Denmark)

    Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads

    2011-01-01

    containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (Tm), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers...

  12. Resistance gene candidates identified by PCR with degenerate oligonucleotide primers map to clusters of resistance genes in lettuce.

    Science.gov (United States)

    Shen, K A; Meyers, B C; Islam-Faridi, M N; Chin, D B; Stelly, D M; Michelmore, R W

    1998-08-01

    The recent cloning of genes for resistance against diverse pathogens from a variety of plants has revealed that many share conserved sequence motifs. This provides the possibility of isolating numerous additional resistance genes by polymerase chain reaction (PCR) with degenerate oligonucleotide primers. We amplified resistance gene candidates (RGCs) from lettuce with multiple combinations of primers with low degeneracy designed from motifs in the nucleotide binding sites (NBSs) of RPS2 of Arabidopsis thaliana and N of tobacco. Genomic DNA, cDNA, and bacterial artificial chromosome (BAC) clones were successfully used as templates. Four families of sequences were identified that had the same similarity to each other as to resistance genes from other species. The relationship of the amplified products to resistance genes was evaluated by several sequence and genetic criteria. The amplified products contained open reading frames with additional sequences characteristic of NBSs. Hybridization of RGCs to genomic DNA and to BAC clones revealed large numbers of related sequences. Genetic analysis demonstrated the existence of clustered multigene families for each of the four RGC sequences. This parallels classical genetic data on clustering of disease resistance genes. Two of the four families mapped to known clusters of resistance genes; these two families were therefore studied in greater detail. Additional evidence that these RGCs could be resistance genes was gained by the identification of leucine-rich repeat (LRR) regions in sequences adjoining the NBS similar to those in RPM1 and RPS2 of A. thaliana. Fluorescent in situ hybridization confirmed the clustered genomic distribution of these sequences. The use of PCR with degenerate oligonucleotide primers is therefore an efficient method to identify numerous RGCs in plants.

  13. Primer3_masker: integrating masking of template sequence with primer design software.

    Science.gov (United States)

    Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido

    2018-06-01

    Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.

  14. Development of a one-step RT-PCR assay for detection of pancoronaviruses (α-, β-, γ-, and δ-coronaviruses) using newly designed degenerate primers for porcine and avian `fecal samples.

    Science.gov (United States)

    Hu, Hui; Jung, Kwonil; Wang, Qiuhong; Saif, Linda J; Vlasova, Anastasia N

    2018-06-01

    Coronaviruses (CoVs) are critical human and animal pathogens because of their potential to cause severe epidemics of respiratory or enteric diseases. In pigs, the newly emerged porcine deltacoronavirus (PDCoV) and re-emerged porcine epidemic diarrhea virus (PEDV) reported in the US and Asia, as well as the discovery of novel CoVs in wild bats or birds, has necessitated development of improved detection and control measures for these CoVs. Because the previous pancoronavirus (panCoV) RT-PCR established in our laboratory in 2007-2011 did not detect deltacoronaviruses (δ-CoVs) in swine fecal and serum samples, our goal was to develop a new panCoV RT-PCR assay to detect known human and animal CoVs, including δ-CoVs. In this study, we designed a new primer set to amplify a 668 bp-region within the RNA-dependent RNA polymerase (RdRP) gene that encodes the most conserved protein domain of α-, β-, γ-, and δ-CoVs. We established a one-step panCoV RT-PCR assay and standardized the assay conditions. The newly established panCoV RT-PCR assay was demonstrated to have a high sensitivity and specificity. Using a panel of 60 swine biological samples (feces, intestinal contents, and sera) characterized by PEDV, PDCoV and transmissible gastroenteritis virus-specific RT-PCR assays, we demonstrated that sensitivity and specificity of the newly established panCoV RT-PCR assay were 100%. 400 avian fecal (RNA) samples were further tested simultaneously for CoV by the new panCoV RT-PCR and a one-step RT-PCR assay with the δ-CoV nucleocapsid-specific universal primers. Four of 400 avian samples were positive for CoV, three of which were positive for δ-CoV by the conventional RT-PCR. PanCoV RT-PCR fragments for 3 of the 4 CoVs were sequenced. Phylogenetic analysis revealed the presence of one γ-CoV and two δ-CoV in the sequenced samples. The newly designed panCoV RT-PCR assay should be useful for the detection of currently known CoVs in animal biological samples. Copyright © 2018

  15. CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

    Science.gov (United States)

    Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

    2015-07-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.

  16. Development of degenerate and species-specific primers for the differential and simultaneous RT-PCR detection of grapevine-infecting nepoviruses of subgroups A, B and C.

    Science.gov (United States)

    Digiaro, Michele; Elbeaino, Toufic; Martelli, Giovanni Paolo

    2007-04-01

    Based on the nucleotide sequence homology of RNA-1 and RNA-2 of nepoviruses isolated from grapevines, three sets of degenerate primers, one for each of the three subgroups of the genus (A, B and C), were designed and proved effective for RT-PCR detection of subgroups in infected grapevines and herbaceous hosts. Primers designed specifically for detecting subgroup A species amplified a fragment of 255 bp from samples infected by Grapevine fanleaf virus (GFLV), Arabis mosaic virus (ArMV), Tobacco ringspot virus (TRSV) and Grapevine deformation virus (GDefV), but not from samples infected by other nepovirus species. Similarly, primers for detection of subgroup B nepoviruses amplified a 390 bp product from samples infected by Grapevine chrome mosaic virus (GCMV), Tomato black ring virus (TBRV), Grapevine Anatolian ringspot virus (GARSV) and Artichoke Italian latent virus (AILV). The third set of primers amplified a 640 bp fragment, only from samples infected by subgroup C nepoviruses, i.e Tomato ringspot virus (ToRSV) Grapevine Bulgarian latent virus (GBLV), and Grapevine Tunisian ringspot virus (GTRSV). These primers were able to detect simultaneously all viral species belonging to the same subgroup and to discriminate species of different subgroups. Multiplex-PCR detection of subgroup A and B nepoviruses was obtained using a specific primer (sense for subgroup A and antisense for subgroup B) for each of the species of the same subgroup in combination with the degenerate subgroup-specific primers. In this way it was possible to detect four different viral species in single samples containing mixtures of viruses of the same subgroup. In particular, for viruses of subgroup A (TRSV, GFLV, ArMV and GDefV) amplicons of 190, 259, 301 and 371 bp were obtained, whereas amplicons of 190, 278, 425 and 485 bp, respectively, were obtained from samples infected with viruses of subgroup B (GCMV, AILV, GARSV and TBRV).

  17. VizPrimer: a web server for visualized PCR primer design based on known gene structure.

    Science.gov (United States)

    Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

    2011-12-15

    The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.

  18. Bioinformatic tools and guideline for PCR primer design | Abd ...

    African Journals Online (AJOL)

    Bioinformatics has become an essential tool not only for basic research but also for applied research in biotechnology and biomedical sciences. Optimal primer sequence and appropriate primer concentration are essential for maximal specificity and efficiency of PCR. A poorly designed primer can result in little or no ...

  19. Automated design of degenerate codon libraries.

    Science.gov (United States)

    Mena, Marco A; Daugherty, Patrick S

    2005-12-01

    Degenerate codon libraries are frequently used in protein engineering and evolution studies but are often limited to targeting a small number of positions to adequately limit the search space. To mitigate this, codon degeneracy can be limited using heuristics or previous knowledge of the targeted positions. To automate design of libraries given a set of amino acid sequences, an algorithm (LibDesign) was developed that generates a set of possible degenerate codon libraries, their resulting size, and their score relative to a user-defined scoring function. A gene library of a specified size can then be constructed that is representative of the given amino acid distribution or that includes specific sequences or combinations thereof. LibDesign provides a new tool for automated design of high-quality protein libraries that more effectively harness existing sequence-structure information derived from multiple sequence alignment or computational protein design data.

  20. MPprimer: a program for reliable multiplex PCR primer design

    Directory of Open Access Journals (Sweden)

    Wang Xiaolei

    2010-03-01

    Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

  1. Designing for transportation management and operations : a primer.

    Science.gov (United States)

    2013-02-01

    This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...

  2. Tools for Ultraspecific Probe/Primer Design

    National Research Council Canada - National Science Library

    Fofanov, Yurly

    2006-01-01

    .... Our approach will deliver DNA probes and PCR primers that have an unprecedentedly low probability of false positives or confusion by environmental background, and which resist evasion by threat agent engineering...

  3. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)

    ES

    Bioinformatics is an emerging scientific discipline that uses information ... complex biological questions. ... and computer programs for various purposes of primer ..... polymerase chain reaction: Human Immunodeficiency Virus 1 model studies.

  4. [Development of specific and degenerated primers to CesA genes encoding flax (Linum usitatissimum L.) cellulose synthase].

    Science.gov (United States)

    Grushetskaia, Z E; Lemesh, V A; Khotyleva, L V

    2010-01-01

    Cellulose synthase catalytic subunit genes, CesA, have been discovered in several higher plant species, and it has been shown that the CesA gene family has multiple members. HVR2 fragment of these genes determine the class specificity of the CESA protein and its participation in the primary or secondary cell wall synthesis. The aim of this study was development of specific and degenerated primers to flax CesA gene fragments leading to obtaining the class specific HVR2 region of the gene. Two pairs of specific primers to the certain fragments of CesA-1 and CesA-6 genes and one pair of degenerated primers to HVR2 region of all flax CesA genes were developed basing on comparison of six CesA EST sequences of flax and full cDNA sequences of Arabidopsis, poplar, maize and cotton plants, obtained from GenBank. After amplification of flax cDNA, the bands of expected size were detected (201 and 300 b.p. for the CesA-1 and CesA-6, and 600 b.p. for the HVR2 region of CesA respectively). The developed markers can be used for cloning and sequencing of flax CesA genes, identifying their number in flax genome, tissue and stage specificity.

  5. Diversity of reductive dehalogenase genes from environmental samples and enrichment cultures identified with degenerate primer PCR screens.

    Directory of Open Access Journals (Sweden)

    Laura Audrey Hug

    2013-11-01

    Full Text Available Reductive dehalogenases are the critical enzymes for anaerobic organohalide respiration, a microbial metabolic process that has been harnessed for bioremediation efforts to resolve chlorinated solvent contamination in groundwater and is implicated in the global halogen cycle. Reductive dehalogenase sequence diversity is informative for the dechlorination potential of the site or enrichment culture. A suite of degenerate PCR primers targeting a comprehensive curated set of reductive dehalogenase genes was designed and applied to twelve DNA samples extracted from contaminated and pristine sites, as well as six enrichment cultures capable of reducing chlorinated compounds to non-toxic end-products. The amplified gene products from four environmental sites and two enrichment cultures were sequenced using Illumina HiSeq, and the reductive dehalogenase complement of each sample determined. The results indicate that the diversity of the reductive dehalogenase gene family is much deeper than is currently accounted for: one-third of the translated proteins have less than 70% pairwise amino acid identity to database sequences. Approximately 60% of the sequenced reductive dehalogenase genes were broadly distributed, being identified in four or more samples, and often in previously sequenced genomes as well. In contrast, 17% of the sequenced reductive dehalogenases were unique, present in only a single sample and bearing less than 90% pairwise amino acid identity to any previously identified proteins. Many of the broadly distributed reductive dehalogenases are uncharacterized in terms of their substrate specificity, making these intriguing targets for further biochemical experimentation. Finally, comparison of samples from a contaminated site and an enrichment culture derived from the same site eight years prior allowed examination of the effect of the enrichment process.

  6. De-MetaST-BLAST: a tool for the validation of degenerate primer sets and data mining of publicly available metagenomes.

    Directory of Open Access Journals (Sweden)

    Christopher A Gulvik

    Full Text Available Development and use of primer sets to amplify nucleic acid sequences of interest is fundamental to studies spanning many life science disciplines. As such, the validation of primer sets is essential. Several computer programs have been created to aid in the initial selection of primer sequences that may or may not require multiple nucleotide combinations (i.e., degeneracies. Conversely, validation of primer specificity has remained largely unchanged for several decades, and there are currently few available programs that allows for an evaluation of primers containing degenerate nucleotide bases. To alleviate this gap, we developed the program De-MetaST that performs an in silico amplification using user defined nucleotide sequence dataset(s and primer sequences that may contain degenerate bases. The program returns an output file that contains the in silico amplicons. When De-MetaST is paired with NCBI's BLAST (De-MetaST-BLAST, the program also returns the top 10 nr NCBI database hits for each recovered in silico amplicon. While the original motivation for development of this search tool was degenerate primer validation using the wealth of nucleotide sequences available in environmental metagenome and metatranscriptome databases, this search tool has potential utility in many data mining applications.

  7. A Primer on Autonomous Aerial Vehicle Design.

    Science.gov (United States)

    Coppejans, Hugo H G; Myburgh, Herman C

    2015-12-02

    There is a large amount of research currently being done on autonomous micro-aerial vehicles (MAV), such as quadrotor helicopters or quadcopters. The ability to create a working autonomous MAV depends mainly on integrating a simultaneous localization and mapping (SLAM) solution with the rest of the system. This paper provides an introduction for creating an autonomous MAV for enclosed environments, aimed at students and professionals alike. The standard autonomous system and MAV automation are discussed, while we focus on the core concepts of SLAM systems and trajectory planning algorithms. The advantages and disadvantages of using remote processing are evaluated, and recommendations are made regarding the viability of on-board processing. Recommendations are made regarding best practices to serve as a guideline for aspirant MAV designers.

  8. A Primer on Autonomous Aerial Vehicle Design

    Directory of Open Access Journals (Sweden)

    Hugo H. G. Coppejans

    2015-12-01

    Full Text Available There is a large amount of research currently being done on autonomous micro-aerial vehicles (MAV, such as quadrotor helicopters or quadcopters. The ability to create a working autonomous MAV depends mainly on integrating a simultaneous localization and mapping (SLAM solution with the rest of the system. This paper provides an introduction for creating an autonomous MAV for enclosed environments, aimed at students and professionals alike. The standard autonomous system and MAV automation are discussed, while we focus on the core concepts of SLAM systems and trajectory planning algorithms. The advantages and disadvantages of using remote processing are evaluated, and recommendations are made regarding the viability of on-board processing. Recommendations are made regarding best practices to serve as a guideline for aspirant MAV designers.

  9. Design of the Advanced Virgo non-degenerate recycling cavities

    International Nuclear Information System (INIS)

    Granata, M; Barsuglia, M; Flaminio, R; Freise, A; Hild, S; Marque, J

    2010-01-01

    Advanced Virgo is the project to upgrade the interferometric gravitational wave detector Virgo, and it foresees the implementation of power and signal non-degenerate recycling cavities. Such cavities suppress the build-up of high order modes of the resonating sidebands, with some advantage for the commissioning of the detector and the build-up of the gravitational signal. Here we present the baseline design of the Advanced Virgo non-degenerate recycling cavities, giving some preliminary results of simulations about the tolerances of this design to astigmatism, mirror figure errors and thermal lensing.

  10. FullSSR: Microsatellite Finder and Primer Designer

    Directory of Open Access Journals (Sweden)

    Sebastián Metz

    2016-01-01

    Full Text Available Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user.

  11. A rapid method of accurate detection and differentiation of Newcastle disease virus pathotypes by demonstrating multiple bands in degenerate primer based nested RT-PCR.

    Science.gov (United States)

    Desingu, P A; Singh, S D; Dhama, K; Kumar, O R Vinodh; Singh, R; Singh, R K

    2015-02-01

    A rapid and accurate method of detection and differentiation of virulent and avirulent Newcastle disease virus (NDV) pathotypes was developed. The NDV detection was carried out for different domestic avian field isolates and pigeon paramyxo virus-1 (25 field isolates and 9 vaccine strains) by using APMV-I "fusion" (F) gene Class II specific external primer A and B (535bp), internal primer C and D (238bp) based reverses transcriptase PCR (RT-PCR). The internal degenerative reverse primer D is specific for F gene cleavage position of virulent strain of NDV. The nested RT-PCR products of avirulent strains showed two bands (535bp and 424bp) while virulent strains showed four bands (535bp, 424bp, 349bp and 238bp) on agar gel electrophoresis. This is the first report regarding development and use of degenerate primer based nested RT-PCR for accurate detection and differentiation of NDV pathotypes by demonstrating multiple PCR band patterns. Being a rapid, simple, and economical test, the developed method could serve as a valuable alternate diagnostic tool for characterizing NDV isolates and carrying out molecular epidemiological surveillance studies for this important pathogen of poultry. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Primer design for a prokaryotic differential display RT-PCR.

    Science.gov (United States)

    Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

    1997-05-01

    We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.

  13. Design of a Percussion and Electric Primer Gun Firing Power Supply

    Science.gov (United States)

    2014-07-01

    solenoid failure. As new instrumentation techniques such as high-speed video and laser interferometry have been introduced into our gun testing...to drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks to...drive the solenoid or ignite the primer. This report details the design and construction of the power supplies. 15. SUBJECT TERMS power supply

  14. Detection and identification of Toscana and other phleboviruses by RT-nested-PCR assays with degenerated primers.

    Science.gov (United States)

    Sánchez-Seco, María-Paz; Echevarría, José-Manuel; Hernández, Lourdes; Estévez, Domingo; Navarro-Marí, José-María; Tenorio, Antonio

    2003-09-01

    Phleboviruses are a large and widespread group of viruses that are transmitted by arthropods. Toscana virus is one of the principal agents that causes meningitis in humans during the summer in Italy and, possibly, in other Mediterranean countries. Rift Valley Fever virus can cause serious illness in both animals and humans, leading to high morbidity and mortality, and is considered to be a potential agent for epizootics and human epidemics. Since information on this group of viruses is still scant, reliable laboratory tools for diagnosis and epidemiological surveillance must be developed, in order to ascertain their real impact on Public Health. Sequence data obtained from Spanish isolates of Toscana virus and other phleboviruses confirmed that natural genome variability may hamper the diagnosis of these agents by molecular methods, so this must be borne in mind when developing reliable assays. In view of the above, a novel and useful protocol has been developed for the detection and specific identification of every member of the phlebovirus genus present in a sample, including Toscana virus, based on a generic RT-nested-PCR, followed by sequencing of the amplified fragment. A change in this method also allowed specific direct detection and identification of wild isolates of Toscana virus of different geographical origin, using newly designed primers. Testing clinical samples with these assays confirmed the role of Toscana virus as an agent that causes acute aseptic meningitis in the central region of Spain. Copyright 2003 Wiley-Liss, Inc.

  15. Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

    Science.gov (United States)

    Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

    2018-01-01

    Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

  16. A tool for design of primers for microRNA-specific quantitative RT-qPCR. BMC Bioinformatics

    DEFF Research Database (Denmark)

    Busk, Peter Kamp

    2014-01-01

    of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed......Background MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come...... at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. Results I have developed the software miRprimer for automatic...

  17. PRIMEGENSw3: a web-based tool for high-throughput primer and probe design.

    Science.gov (United States)

    Kushwaha, Garima; Srivastava, Gyan Prakash; Xu, Dong

    2015-01-01

    Highly specific and efficient primer and probe design has been a major hurdle in many high-throughput techniques. Successful implementation of any PCR or probe hybridization technique depends on the quality of primers and probes used in terms of their specificity and cross-hybridization. Here we describe PRIMEGENSw3, a set of web-based utilities for high-throughput primer and probe design. These utilities allow users to select genomic regions and to design primer/probe for selected regions in an interactive, user-friendly, and automatic fashion. The system runs the PRIMEGENS algorithm in the back-end on the high-performance server with the stored genomic database or user-provided custom database for cross-hybridization check. Cross-hybridization is checked not only using BLAST but also by checking mismatch positions and energy calculation of potential hybridization hits. The results can be visualized online and also can be downloaded. The average success rate of primer design using PRIMEGENSw3 is ~90 %. The web server also supports primer design for methylated sequences, which is used in epigenetic studies. Stand-alone version of the software is also available for download at the website.

  18. [Design of primers to DNA of lactic acid bacteria].

    Science.gov (United States)

    Lashchevskiĭ, V V; Kovalenko, N K

    2003-01-01

    Primers LP1-LP2 to the gene 16S rRNA have been developed, which permit to differentiate lactic acid bacteria: Lactobacillus plantarum, L. delbrueckii subsp. bulgaricus and Streptococcus salivarius subsp. thermophilus. The strain-specific and species-specific differentiations are possible under different annealing temperature. Additional fragments, which are synthesized outside the framework of gene 16S rRNA reading, provide for the strain-specific type of differentiation, and the fragment F864 read in the gene 16S rRNA permits identifying L. plantarum.

  19. A Two-Step Lyssavirus Real-Time Polymerase Chain Reaction Using Degenerate Primers with Superior Sensitivity to the Fluorescent Antigen Test

    Directory of Open Access Journals (Sweden)

    Vanessa Suin

    2014-01-01

    Full Text Available A generic two-step lyssavirus real-time reverse transcriptase polymerase chain reaction (qRT-PCR, based on a nested PCR strategy, was validated for the detection of different lyssavirus species. Primers with 17 to 30% of degenerate bases were used in both consecutive steps. The assay could accurately detect RABV, LBV, MOKV, DUVV, EBLV-1, EBLV-2, and ABLV. In silico sequence alignment showed a functional match with the remaining lyssavirus species. The diagnostic specificity was 100% and the sensitivity proved to be superior to that of the fluorescent antigen test. The limit of detection was ≤1 50% tissue culture infectious dose. The related vesicular stomatitis virus was not recognized, confirming the selectivity for lyssaviruses. The assay was applied to follow the evolution of rabies virus infection in the brain of mice from 0 to 10 days after intranasal inoculation. The obtained RNA curve corresponded well with the curves obtained by a one-step monospecific RABV-qRT-PCR, the fluorescent antigen test, and virus titration. Despite the presence of degenerate bases, the assay proved to be highly sensitive, specific, and reproducible.

  20. A two-step lyssavirus real-time polymerase chain reaction using degenerate primers with superior sensitivity to the fluorescent antigen test.

    Science.gov (United States)

    Suin, Vanessa; Nazé, Florence; Francart, Aurélie; Lamoral, Sophie; De Craeye, Stéphane; Kalai, Michael; Van Gucht, Steven

    2014-01-01

    A generic two-step lyssavirus real-time reverse transcriptase polymerase chain reaction (qRT-PCR), based on a nested PCR strategy, was validated for the detection of different lyssavirus species. Primers with 17 to 30% of degenerate bases were used in both consecutive steps. The assay could accurately detect RABV, LBV, MOKV, DUVV, EBLV-1, EBLV-2, and ABLV. In silico sequence alignment showed a functional match with the remaining lyssavirus species. The diagnostic specificity was 100% and the sensitivity proved to be superior to that of the fluorescent antigen test. The limit of detection was ≤ 1 50% tissue culture infectious dose. The related vesicular stomatitis virus was not recognized, confirming the selectivity for lyssaviruses. The assay was applied to follow the evolution of rabies virus infection in the brain of mice from 0 to 10 days after intranasal inoculation. The obtained RNA curve corresponded well with the curves obtained by a one-step monospecific RABV-qRT-PCR, the fluorescent antigen test, and virus titration. Despite the presence of degenerate bases, the assay proved to be highly sensitive, specific, and reproducible.

  1. MSP-HTPrimer: a high-throughput primer design tool to improve assay design for DNA methylation analysis in epigenetics.

    Science.gov (United States)

    Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas

    2016-01-01

    Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic

  2. UniPrime2: a web service providing easier Universal Primer design.

    Science.gov (United States)

    Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C

    2009-07-01

    The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.

  3. Real-time PCR (qPCR) primer design using free online software.

    Science.gov (United States)

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.

  4. GST-PRIME: an algorithm for genome-wide primer design.

    Science.gov (United States)

    Leister, Dario; Varotto, Claudio

    2007-01-01

    The profiling of mRNA expression based on DNA arrays has become a powerful tool to study genome-wide transcription of genes in a number of organisms. GST-PRIME is a software package created to facilitate large-scale primer design for the amplification of probes to be immobilized on arrays for transcriptome analyses, even though it can be also applied in low-throughput approaches. GST-PRIME allows highly efficient, direct amplification of gene-sequence tags (GSTs) from genomic DNA (gDNA), starting from annotated genome or transcript sequences. GST-PRIME provides a customer-friendly platform for automatic primer design, and despite the relative simplicity of the algorithm, experimental tests in the model plant species Arabidopsis thaliana confirmed the reliability of the software. This chapter describes the algorithm used for primer design, its input and output files, and the installation of the standalone package and its use.

  5. Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

    Directory of Open Access Journals (Sweden)

    Zuiter Afnan

    2012-08-01

    Full Text Available Abstract Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.

  6. Implementing Clinical Research Using Factorial Designs: A Primer.

    Science.gov (United States)

    Baker, Timothy B; Smith, Stevens S; Bolt, Daniel M; Loh, Wei-Yin; Mermelstein, Robin; Fiore, Michael C; Piper, Megan E; Collins, Linda M

    2017-07-01

    Factorial experiments have rarely been used in the development or evaluation of clinical interventions. However, factorial designs offer advantages over randomized controlled trial designs, the latter being much more frequently used in such research. Factorial designs are highly efficient (permitting evaluation of multiple intervention components with good statistical power) and present the opportunity to detect interactions amongst intervention components. Such advantages have led methodologists to advocate for the greater use of factorial designs in research on clinical interventions (Collins, Dziak, & Li, 2009). However, researchers considering the use of such designs in clinical research face a series of choices that have consequential implications for the interpretability and value of the experimental results. These choices include: whether to use a factorial design, selection of the number and type of factors to include, how to address the compatibility of the different factors included, whether and how to avoid confounds between the type and number of interventions a participant receives, and how to interpret interactions. The use of factorial designs in clinical intervention research poses choices that differ from those typically considered in randomized clinical trial designs. However, the great information yield of the former encourages clinical researchers' increased and careful execution of such designs. Copyright © 2017. Published by Elsevier Ltd.

  7. HTP-OligoDesigner: An Online Primer Design Tool for High-Throughput Gene Cloning and Site-Directed Mutagenesis.

    Science.gov (United States)

    Camilo, Cesar M; Lima, Gustavo M A; Maluf, Fernando V; Guido, Rafael V C; Polikarpov, Igor

    2016-01-01

    Following burgeoning genomic and transcriptomic sequencing data, biochemical and molecular biology groups worldwide are implementing high-throughput cloning and mutagenesis facilities in order to obtain a large number of soluble proteins for structural and functional characterization. Since manual primer design can be a time-consuming and error-generating step, particularly when working with hundreds of targets, the automation of primer design process becomes highly desirable. HTP-OligoDesigner was created to provide the scientific community with a simple and intuitive online primer design tool for both laboratory-scale and high-throughput projects of sequence-independent gene cloning and site-directed mutagenesis and a Tm calculator for quick queries.

  8. A Web-Based Adaptive Tutor to Teach PCR Primer Design

    Science.gov (United States)

    van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.

    2012-01-01

    When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used part of the Taxonomy of Educational Objectives (the…

  9. A web-based adaptive tutor to teach PCR primer design

    NARCIS (Netherlands)

    van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.

    2012-01-01

    When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used

  10. A Web-based Adaptive Tutor to Teach PCR Primer Design

    NARCIS (Netherlands)

    Seters, van J.R.; Wellink, J.; Tramper, J.; Goedhart, M.J.; Ossevoort, M.A.

    2012-01-01

    When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used

  11. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    Science.gov (United States)

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  12. Integrating PCR Theory and Bioinformatics into a Research-oriented Primer Design Exercise

    OpenAIRE

    Robertson, Amber L.; Phillips, Allison R.

    2008-01-01

    Polymerase chain reaction (PCR) is a conceptually difficult technique that embodies many fundamental biological processes. Traditionally, students have struggled to analyze PCR results due to an incomplete understanding of the biological concepts (theory) of DNA replication and strand complementarity. Here we describe the design of a novel research-oriented exercise that prepares students to design DNA primers for PCR. Our exercise design includes broad and specific learning goals and assessm...

  13. indCAPS: A tool for designing screening primers for CRISPR/Cas9 mutagenesis events.

    Science.gov (United States)

    Hodgens, Charles; Nimchuk, Zachary L; Kieber, Joseph J

    2017-01-01

    Genetic manipulation of organisms using CRISPR/Cas9 technology generally produces small insertions/deletions (indels) that can be difficult to detect. Here, we describe a technique to easily and rapidly identify such indels. Sequence-identified mutations that alter a restriction enzyme recognition site can be readily distinguished from wild-type alleles using a cleaved amplified polymorphic sequence (CAPS) technique. If a restriction site is created or altered by the mutation such that only one allele contains the restriction site, a polymerase chain reaction (PCR) followed by a restriction digest can be used to distinguish the two alleles. However, in the case of most CRISPR-induced alleles, no such restriction sites are present in the target sequences. In this case, a derived CAPS (dCAPS) approach can be used in which mismatches are purposefully introduced in the oligonucleotide primers to create a restriction site in one, but not both, of the amplified templates. Web-based tools exist to aid dCAPS primer design, but when supplied sequences that include indels, the current tools often fail to suggest appropriate primers. Here, we report the development of a Python-based, species-agnostic web tool, called indCAPS, suitable for the design of PCR primers used in dCAPS assays that is compatible with indels. This tool should have wide utility for screening editing events following CRISPR/Cas9 mutagenesis as well as for identifying specific editing events in a pool of CRISPR-mediated mutagenesis events. This tool was field-tested in a CRISPR mutagenesis experiment targeting a cytokinin receptor (AHK3) in Arabidopsis thaliana. The tool suggested primers that successfully distinguished between wild-type and edited alleles of a target locus and facilitated the isolation of two novel ahk3 null alleles. Users can access indCAPS and design PCR primers to employ dCAPS to identify CRISPR/Cas9 alleles at http://indcaps.kieber.cloudapps.unc.edu/.

  14. Conserved PCR primer set designing for closely-related species to complete mitochondrial genome sequencing using a sliding window-based PSO algorithm.

    Directory of Open Access Journals (Sweden)

    Cheng-Hong Yang

    Full Text Available BACKGROUND: Complete mitochondrial (mt genome sequencing is becoming increasingly common for phylogenetic reconstruction and as a model for genome evolution. For long template sequencing, i.e., like the entire mtDNA, it is essential to design primers for Polymerase Chain Reaction (PCR amplicons which are partly overlapping each other. The presented chromosome walking strategy provides the overlapping design to solve the problem for unreliable sequencing data at the 5' end and provides the effective sequencing. However, current algorithms and tools are mostly focused on the primer design for a local region in the genomic sequence. Accordingly, it is still challenging to provide the primer sets for the entire mtDNA. METHODOLOGY/PRINCIPAL FINDINGS: The purpose of this study is to develop an integrated primer design algorithm for entire mt genome in general, and for the common primer sets for closely-related species in particular. We introduce ClustalW to generate the multiple sequence alignment needed to find the conserved sequences in closely-related species. These conserved sequences are suitable for designing the common primers for the entire mtDNA. Using a heuristic algorithm particle swarm optimization (PSO, all the designed primers were computationally validated to fit the common primer design constraints, such as the melting temperature, primer length and GC content, PCR product length, secondary structure, specificity, and terminal limitation. The overlap requirement for PCR amplicons in the entire mtDNA is satisfied by defining the overlapping region with the sliding window technology. Finally, primer sets were designed within the overlapping region. The primer sets for the entire mtDNA sequences were successfully demonstrated in the example of two closely-related fish species. The pseudo code for the primer design algorithm is provided. CONCLUSIONS/SIGNIFICANCE: In conclusion, it can be said that our proposed sliding window-based PSO

  15. New primers for amplification of cytochrome c oxidase subunit I barcode region designed for species of Decapoda (Crustacea

    Directory of Open Access Journals (Sweden)

    Fernando L. Mantelatto

    Full Text Available Abstract We designed 14 new primers for amplification of the COI barcode region of decapod crustacean species. We tested, with high level of success, the generation of ~ 640 ± 49 base-pair sequences in selected groups of decapods (hermit crabs, squat lobsters, marine and freshwater crabs and shrimps, encompassing representatives of 27 genera of 15 families, 11 of Pleocyemata (Anomura, Brachyura, and Caridea and 4 of Dendrobranchiata. Based on the results we expect the applicability of these primers for several studies with different taxa within Decapoda.

  16. Employment of Near Full-Length Ribosome Gene TA-Cloning and Primer-Blast to Detect Multiple Species in a Natural Complex Microbial Community Using Species-Specific Primers Designed with Their Genome Sequences.

    Science.gov (United States)

    Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou

    2016-11-01

    It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.

  17. Designing of primers for detection of salmonella typhimirium and enteritidis by heminested PCR

    International Nuclear Information System (INIS)

    Ben salem, Issam

    2007-01-01

    Salmonella are the main responsible agent for the frequent food borne gastrointestinal diseases. In Tunisia, this pathogen is considered one of the most important causes of toxiinfections and its detection using classical methods is laborious and requires a large amount of time for revelation. To solve this problem, we developed a rapid molecular technique for the detection of the invA virulence gene sequence which is found in the majority of Salmonella spp. This technique is a hemi nested PCR amplification using specific primers designed and by bioinformatics tools. The detection method consisted of pre-enrichment of the sample in buffered peptone water (BPW), followed by a total DNA extraction step prior to single tube hemi nested PCR amplification. This method was found highly specific and sensitive to detect low levels of salmonella typhimurium and salmonella enteritidis (1cfu/ 25g) in naturally contaminated spicy sausage (merguez) samples. These results can benefit the public health agencies concerning microbiological and quality aspects of the commercial and traditional merguez meat production in Tunisia. (Author)

  18. Applying Instructional Design Theories to Bioinformatics Education in Microarray Analysis and Primer Design Workshops

    Science.gov (United States)

    Shachak, Aviv; Ophir, Ron; Rubin, Eitan

    2005-01-01

    The need to support bioinformatics training has been widely recognized by scientists, industry, and government institutions. However, the discussion of instructional methods for teaching bioinformatics is only beginning. Here we report on a systematic attempt to design two bioinformatics workshops for graduate biology students on the basis of…

  19. Bridging the Gap: A Manual Primer into Design Computing in the Context of Basic Design Education

    Science.gov (United States)

    Uysal, V. Safak; Topaloglu, Fulden

    2017-01-01

    Design education is in need of a wider restructuring to accommodate new developments and paradigmatic shifts brought forth by the information age, all of which capitalise a move towards complexity theory, systems science and digital technologies. The intention of this article is to approach one particular aspect of this need: that is, how basic…

  20. Beneath sci-fi sound: primer, science fiction sound design, and American independent cinema

    OpenAIRE

    Johnston, Nessa

    2012-01-01

    Primer is a very low budget science-fiction film that deals with the subject of time travel; however, it looks and sounds quite distinctively different from other films associated with the genre. While Hollywood blockbuster sci-fi relies on “sound spectacle” as a key attraction, in contrast Primer sounds “lo-fi” and screen-centred, mixed to two channel stereo rather than the now industry-standard 5.1 surround sound. Although this is partly a consequence of the economics of its production, the...

  1. Universal primers that amplify RNA from all three flavivirus subgroups

    Directory of Open Access Journals (Sweden)

    Barnard Ross T

    2008-01-01

    Full Text Available Abstract Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5 coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers.

  2. QDD: a user-friendly program to select microsatellite markers and design primers from large sequencing projects.

    Science.gov (United States)

    Meglécz, Emese; Costedoat, Caroline; Dubut, Vincent; Gilles, André; Malausa, Thibaut; Pech, Nicolas; Martin, Jean-François

    2010-02-01

    QDD is an open access program providing a user-friendly tool for microsatellite detection and primer design from large sets of DNA sequences. The program is designed to deal with all steps of treatment of raw sequences obtained from pyrosequencing of enriched DNA libraries, but it is also applicable to data obtained through other sequencing methods, using FASTA files as input. The following tasks are completed by QDD: tag sorting, adapter/vector removal, elimination of redundant sequences, detection of possible genomic multicopies (duplicated loci or transposable elements), stringent selection of target microsatellites and customizable primer design. It can treat up to one million sequences of a few hundred base pairs in the tag-sorting step, and up to 50,000 sequences in a single input file for the steps involving estimation of sequence similarity. QDD is freely available under the GPL licence for Windows and Linux from the following web site: http://www.univ-provence.fr/gsite/Local/egee/dir/meglecz/QDD.html. Supplementary data are available at Bioinformatics online.

  3. The genetics of age-related macular degeneration (AMD)--Novel targets for designing treatment options?

    Science.gov (United States)

    Grassmann, Felix; Fauser, Sascha; Weber, Bernhard H F

    2015-09-01

    Age-related macular degeneration (AMD) is a progressive disease of the central retina and the main cause of legal blindness in industrialized countries. Risk to develop the disease is conferred by both individual as well as genetic factors with the latter being increasingly deciphered over the last decade. Therapeutically, striking advances have been made for the treatment of the neovascular form of late stage AMD while for the late stage atrophic form of the disease, which accounts for almost half of the visually impaired, there is currently no effective therapy on the market. This review highlights our current knowledge on the genetic architecture of early and late stage AMD and explores its potential for the discovery of novel, target-guided treatment options. We reflect on current clinical and experimental therapies for all forms of AMD and specifically note a persisting lack of efficacy for treatment in atrophic AMD. We further explore the current insight in AMD-associated genes and pathways and critically question whether this knowledge is suited to design novel treatment options. Specifically, we point out that known genetic factors associated with AMD govern the risk to develop disease and thus may not play a role in its severity or progression. Treatments based on such knowledge appear appropriate rather for prevention than treatment of manifest disease. As a consequence, future research in AMD needs to be greatly focused on approaches relevant to the patients and their medical needs. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. Effects of three silane primers and five adhesive agents on the bond strength of composite material for a computer-aided design and manufacturing system.

    Science.gov (United States)

    Shinohara, Ayano; Taira, Yohsuke; Sakihara, Michino; Sawase, Takashi

    2018-01-01

    Objective The objective of this study was to evaluate the effects of combinations of silane primers and adhesive agents on the bond strength of a composite block for a computer-aided design and manufacturing system. Material and Methods Three silane primers [Clearfil Ceramic Primer (CP), Super-Bond PZ Primer (PZ), and GC Ceramic Primer II (GP)] were used in conjunction with five adhesive agents [G-Premio Bond (P-Bond), Repair Adhe Adhesive (R-Adhesive), Super-Bond D-Liner Dual (SB-Dual), Super-Bond C&B (SB-Self), and SB-Dual without tributylborane derivative (SB-Light)]. The surface of a composite block (Gradia Block) was ground with silicon carbide paper. After treatment with a silane primer, a adhesive agent was applied to each testing specimen. The specimens were then bonded with a light-curing resin composite. After 24 h, the shear bond strength values were determined and compared using a post hoc test (α=0.05, n=8/group). We also prepared control specimens without primer (No primer) and/or without adhesive agent (No adhesive). Results PZ/SB-Dual and GP/SB-Dual presented the highest bond strength, followed by GP/P-Bond, CP/SB-Dual, CP/R-Adhesive, No primer/SB-Dual, GP/R-Adhesive, CP/P-Bond, No primer/R-Adhesive, PZ/R-Adhesive, CP/SB-Self, PZ/P-Bond, PZ/SB-Self, and GP/SB-Self in descending order of bond strength. No primer/P-Bond, No primer/SB-Self, and all specimens in the SB-Light and No adhesive groups presented the lowest bond strengths. Conclusion A dual-curing adhesive agent (SB-Dual) containing a tributylborane derivative in combination with a silane primer (GP or PZ) presents a greater bond strength between the composite block and the repairing resin composite than the comparators used in the study.

  5. MRI Primer

    International Nuclear Information System (INIS)

    Oldendorf, W.; Oldendorf, W. Jr.

    1991-01-01

    Designed for studies, radiologists, and clinicians at all levels of training, this book provides a basic introduction to the principles, physics, and instrumentation of magnetic resonance imaging. The fundamental concepts that are essential for the optimal clinical use of MRI are thoroughly explained in easily accessible terms. To facilitate the reader's comprehension, the material is presented nonmathematically, using no equations and a minimum of symbols and abbreviations. MRI Primer presents a clear account of the phenomenon of nuclear magnetic resonance and the use of gradient magnetic fields to create clinically useful images of cross-sectional slices. Close attention is given to the magnetization vector as a means of expressing nuclear behavior, the role of T 1 and T 2 weighing in imaging, the use of contrast agents, and the pulse sequences most often used in clinical practice, as well as to the relative capabilities and limitations of MRI and CT. The basic hardware components of an MRI scanner are described in detail. Sample MRI scans illustrate how MRI characterizes tissue. An appendix provides a brief introduction to quantum processes in MRI

  6. Academic Primer Series: Five Key Papers about Study Designs in Medical Education.

    Science.gov (United States)

    Gottlieb, Michael; Chan, Teresa M; Fredette, Jenna; Messman, Anne; Robinson, Daniel W; Cooney, Robert; Boysen-Osborn, Megan; Sherbino, Jonathan

    2017-06-01

    A proper understanding of study design is essential to creating successful studies. This is also important when reading or peer reviewing publications. In this article, we aimed to identify and summarize key papers that would be helpful for faculty members interested in learning more about study design in medical education research. The online discussions of the 2016-2017 Academic Life in Emergency Medicine Faculty Incubator program included a robust and vigorous discussion about education study design, which highlighted a number of papers on that topic. We augmented this list of papers with further suggestions by expert mentors. Via this process, we created a list of 29 papers in total on the topic of medical education study design. After gathering these papers, our authorship group engaged in a modified Delphi approach to build consensus on the papers that were most valuable for the understanding of proper study design in medical education. We selected the top five most highly rated papers on the topic domain of study design as determined by our study group. We subsequently summarized these papers with respect to their relevance to junior faculty members and to faculty developers. This article summarizes five key papers addressing study design in medical education with discussions and applications for junior faculty members and faculty developers. These papers provide a basis upon which junior faculty members might build for developing and analyzing studies.

  7. Protein folding and non-conventional drug design: a primer for nuclear structure physicists

    International Nuclear Information System (INIS)

    Broglia, R.A.; Tiana, G.; Provasi, D.

    2004-01-01

    Some of the paradigms emerging from the study of the phenomena of phase transitions in finite many-body systems, like e.g. the atomic nucleus can be used at profit to solve the protein folding problem within the framework of simple (although not oversimplified) models. From this solution a paradigm emerges for the design of non-conventional drugs, which inhibit enzymatic action without inducing resistance (mutations). The application of these concepts to the design of an inhibitor to the HIV-protease central in the life cycle of the HIV virus is discussed

  8. Disclosing bias in bisulfite assay: MethPrimers underestimate high DNA methylation.

    Directory of Open Access Journals (Sweden)

    Andrea Fuso

    Full Text Available Discordant results obtained in bisulfite assays using MethPrimers (PCR primers designed using MethPrimer software or assuming that non-CpGs cytosines are non methylated versus primers insensitive to cytosine methylation lead us to hypothesize a technical bias. We therefore used the two kinds of primers to study different experimental models and methylation statuses. We demonstrated that MethPrimers negatively select hypermethylated DNA sequences in the PCR step of the bisulfite assay, resulting in CpG methylation underestimation and non-CpG methylation masking, failing to evidence differential methylation statuses. We also describe the characteristics of "Methylation-Insensitive Primers" (MIPs, having degenerated bases (G/A to cope with the uncertain C/U conversion. As CpG and non-CpG DNA methylation patterns are largely variable depending on the species, developmental stage, tissue and cell type, a variable extent of the bias is expected. The more the methylome is methylated, the greater is the extent of the bias, with a prevalent effect of non-CpG methylation. These findings suggest a revision of several DNA methylation patterns so far documented and also point out the necessity of applying unbiased analyses to the increasing number of epigenomic studies.

  9. Understanding the internet, website design and intranet development: a primer for radiologists

    Energy Technology Data Exchange (ETDEWEB)

    Perriss, R.W. [Department of Radiology, John Radcliffe Hospital, Headington, Oxford (United Kingdom); Graham, R.N.J. [Department of Radiology, John Radcliffe Hospital, Headington, Oxford (United Kingdom); Scarsbrook, A.F. [Department of Radiology, John Radcliffe Hospital, Headington, Oxford (United Kingdom)]. E-mail: andyscarsbrook1@aol.com

    2006-05-15

    The internet has become an essential part of daily life for almost all radiologists and yet few fully understand how this works or how best to harness the technology within the workplace. This article will explore the basics of computer networking which has allowed the internet to become a valuable resource. In addition, the process of designing and implementing a website or intranet site for the benefit of radiology departmental administration and education will be discussed. The options of how to develop a website, what to include, and how to achieve this using easy to use, freely available and low-cost software will also be explored.

  10. Understanding the internet, website design and intranet development: a primer for radiologists

    International Nuclear Information System (INIS)

    Perriss, R.W.; Graham, R.N.J.; Scarsbrook, A.F.

    2006-01-01

    The internet has become an essential part of daily life for almost all radiologists and yet few fully understand how this works or how best to harness the technology within the workplace. This article will explore the basics of computer networking which has allowed the internet to become a valuable resource. In addition, the process of designing and implementing a website or intranet site for the benefit of radiology departmental administration and education will be discussed. The options of how to develop a website, what to include, and how to achieve this using easy to use, freely available and low-cost software will also be explored

  11. Striatonigral Degeneration

    Science.gov (United States)

    ... See More About Research The NINDS supports and conducts research on disorders of the brain and nervous system such as striatonigral degeneration. This research ... Publications Definition Striatonigral ...

  12. Assessment of SCAR markers to design real-time PCR primers for rhizosphere quantification of Azospirillum brasilense phytostimulatory inoculants of maize.

    Science.gov (United States)

    Couillerot, O; Poirier, M-A; Prigent-Combaret, C; Mavingui, P; Caballero-Mellado, J; Moënne-Loccoz, Y

    2010-08-01

    To assess the applicability of sequence characterized amplified region (SCAR) markers obtained from BOX, ERIC and RAPD fragments to design primers for real-time PCR quantification of the phytostimulatory maize inoculants Azospirillum brasilense UAP-154 and CFN-535 in the rhizosphere. Primers were designed based on strain-specific SCAR markers and were screened for successful amplification of target strain and absence of cross-reaction with other Azospirillum strains. The specificity of primers thus selected was verified under real-time PCR conditions using genomic DNA from strain collection and DNA from rhizosphere samples. The detection limit was 60 fg DNA with pure cultures and 4 x 10(3) (for UAP-154) and 4 x 10(4) CFU g(-1) (for CFN-535) in the maize rhizosphere. Inoculant quantification was effective from 10(4) to 10(8) CFU g(-1) soil. BOX-based SCAR markers were useful to find primers for strain-specific real-time PCR quantification of each A. brasilense inoculant in the maize rhizosphere. Effective root colonization is a prerequisite for successful Azospirillum phytostimulation, but cultivation-independent monitoring methods were lacking. The real-time PCR methods developed here will help understand the effect of environmental conditions on root colonization and phytostimulation by A. brasilense UAP-154 and CFN-535.

  13. Estimates of abundance and diversity of Shewanella genus in natural and engineered aqueous environments with newly designed primers.

    Science.gov (United States)

    Li, Bing-Bing; Cheng, Yuan-Yuan; Fan, Yang-Yang; Liu, Dong-Feng; Fang, Cai-Yun; Wu, Chao; Li, Wen-Wei; Yang, Zong-Chuang; Yu, Han-Qing

    2018-05-12

    Shewanella species have a diverse respiratory ability and wide distribution in environments and play an important role in bioremediation and the biogeochemical cycles of elements. Primers with more accuracy and broader coverage are required with consideration of the increasing number of Shewanella species and evaluation of their roles in various environments. In this work, a new primer set of 640F/815R was developed to quantify the abundance of Shewanella species in natural and engineered environments. In silico tools for primer evaluation, quantitative polymerase chain reaction (qPCR) and clone library results showed that 640F/815R had a higher specificity and coverage than the previous primers in quantitative analysis of Shewanella. Another newly developed primer pair of 211F/815cR was also adopted to analyze the Shewanella diversity and demonstrated to be the best candidate in terms of specificity and coverage. We detected more Shewanella-related species in freshwater environments and found them to be substantially different from those in marine environments. Abundance and diversity of Shewanella species in wastewater treatment plants were largely affected by the process and operating conditions. Overall, this study suggests that investigations of abundance and diversity of Shewanella in various environments are of great importance to evaluate their ecophysiology and potential ecological roles. Copyright © 2018 Elsevier B.V. All rights reserved.

  14. Cerebellar Degeneration

    Science.gov (United States)

    ... FARA) National Ataxia Foundation (NAF) National Multiple Sclerosis Society See all related organizations Publications Degeneración cerebelosa Order NINDS Publications Definition Cerebellar degeneration is a process in which neurons ( ...

  15. Macular degeneration

    Science.gov (United States)

    The macula is the part of the retina that distinguishes fine details at the center of the field of vision. Macular degeneration results from a partial breakdown of the insulating layer between the retina and the choroid layer of ...

  16. Innovative Comparison of Transient Ignition Temperature at the Booster Interface, New Stainless Steel Pyrovalve Primer Chamber Assembly "V" (PCA) Design Versus the Current Aluminum "Y" PCA Design

    Science.gov (United States)

    Saulsberry, Regor L.; McDougle, Stephen H.; Garcia,Roberto; Johnson, Kenneth L.; Sipes, William; Rickman, Steven; Hosangadi, Ashvin

    2011-01-01

    An assessment of four spacecraft pyrovalve anomalies that occurred during ground testing was conducted by the NASA Engineering & Safety Center (NESC) in 2008. In all four cases, a common aluminum (Al) primer chamber assembly (PCA) was used with dual NASA Standard Initiators (NSIs) and the nearly simultaneous (separated by less than 80 microseconds) firing of both initiators failed to ignite the booster charge. The results of the assessment and associated test program were reported in AIAA Paper AIAA-2008-4798, NESC Independent Assessment of Pyrovalve Ground Test Anomalies. As a result of the four Al PCA anomalies, and the test results and findings of the NESC assessment, the Mars Science Laboratory (MSL) project team decided to make changes to the PCA. The material for the PCA body was changed from aluminum (Al) to stainless steel (SS) to avoid melting, distortion, and potential leakage of the NSI flow passages when the device functioned. The flow passages, which were interconnected in a Y-shaped configuration (Y-PCA) in the original design, were changed to a V-shaped configuration (V-PCA). The V-shape was used to more efficiently transfer energy from the NSIs to the booster. Development and qualification testing of the new design clearly demonstrated faster booster ignition times compared to the legacy AL Y-PCA design. However, the final NESC assessment report recommended that the SS V-PCA be experimentally characterized and quantitatively compared to the Al Y-PCA design. This data was deemed important for properly evaluating the design options for future NASA projects. This test program has successfully quantified the improvement of the SS V-PCA over the Al Y-PCA. A phase B of the project was also conducted and evaluated the effect of firing command skew and enlargement of flame channels to further assist spacecraft applications.

  17. Functional Self-Assembling Peptide Nanofiber Hydrogels Designed for Nerve Degeneration.

    Science.gov (United States)

    Sun, Yuqiao; Li, Wen; Wu, Xiaoli; Zhang, Na; Zhang, Yongnu; Ouyang, Songying; Song, Xiyong; Fang, Xinyu; Seeram, Ramakrishna; Xue, Wei; He, Liumin; Wu, Wutian

    2016-01-27

    Self-assembling peptide (SAP) RADA16-I (Ac-(RADA)4-CONH2) has been suffering from a main drawback associated with low pH, which damages cells and host tissues upon direct exposure. In this study, we presented a strategy to prepare nanofiber hydrogels from two designer SAPs at neutral pH. RADA16-I was appended with functional motifs containing cell adhesion peptide RGD and neurite outgrowth peptide IKVAV. The two SAPs were specially designed to have opposite net charges at neutral pH, the combination of which created a nanofiber hydrogel (-IKVAV/-RGD) characterized by significantly higher G' than G″ in a viscoelasticity examination. Circular dichroism, Fourier transform infrared spectroscopy, and Raman measurements were performed to investigate the secondary structure of the designer SAPs, indicating that both the hydrophobic/hydrophilic properties and electrostatic interactions of the functional motifs play an important role in the self-assembling behavior of the designer SAPs. The neural progenitor cells (NPCs)/stem cells (NSCs) fully embedded in the 3D-IKVAV/-RGD nanofiber hydrogel survived, whereas those embedded within the RADA 16-I hydrogel hardly survived. Moreover, the -IKVAV/-RGD nanofiber hydrogel supported NPC/NSC neuron and astrocyte differentiation in a 3D environment without adding extra growth factors. Studies of three nerve injury models, including sciatic nerve defect, intracerebral hemorrhage, and spinal cord transection, indicated that the designer -IKVAV/-RGD nanofiber hydrogel provided a more permissive environment for nerve regeneration than the RADA 16-I hydrogel. Therefore, we reported a new mechanism that might be beneficial for the synthesis of SAPs for in vitro 3D cell culture and nerve regeneration.

  18. Coal Bed Methane Primer

    Energy Technology Data Exchange (ETDEWEB)

    Dan Arthur; Bruce Langhus; Jon Seekins

    2005-05-25

    During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

  19. Predictive maintenance primer

    International Nuclear Information System (INIS)

    Flude, J.W.; Nicholas, J.R.

    1991-04-01

    This Predictive Maintenance Primer provides utility plant personnel with a single-source reference to predictive maintenance analysis methods and technologies used successfully by utilities and other industries. It is intended to be a ready reference to personnel considering starting, expanding or improving a predictive maintenance program. This Primer includes a discussion of various analysis methods and how they overlap and interrelate. Additionally, eighteen predictive maintenance technologies are discussed in sufficient detail for the user to evaluate the potential of each technology for specific applications. This document is designed to allow inclusion of additional technologies in the future. To gather the information necessary to create this initial Primer the Nuclear Maintenance Applications Center (NMAC) collected experience data from eighteen utilities plus other industry and government sources. NMAC also contacted equipment manufacturers for information pertaining to equipment utilization, maintenance, and technical specifications. The Primer includes a discussion of six methods used by analysts to study predictive maintenance data. These are: trend analysis; pattern recognition; correlation; test against limits or ranges; relative comparison data; and statistical process analysis. Following the analysis methods discussions are detailed descriptions for eighteen technologies analysts have found useful for predictive maintenance programs at power plants and other industrial facilities. Each technology subchapter has a description of the operating principles involved in the technology, a listing of plant equipment where the technology can be applied, and a general description of the monitoring equipment. Additionally, these descriptions include a discussion of results obtained from actual equipment users and preferred analysis techniques to be used on data obtained from the technology. 5 refs., 30 figs

  20. Intervertebral disc degeneration in dogs

    NARCIS (Netherlands)

    Bergknut, N.

    2011-01-01

    Back pain is common in both dogs and humans, and is often associated with intervertebral disc (IVD) degeneration. The IVDs are essential structures of the spine and degeneration can ultimately result in diseases such as IVD herniation or spinal instability. In order to design new treatments halting

  1. Intervertebral disc degeneration in dogs

    NARCIS (Netherlands)

    Bergknut, Niklas

    Back pain is common in both dogs and humans, and is often associated with intervertebral disc (IVD) degeneration. The IVDs are essential structures of the spine and degeneration can ultimately result in diseases such as IVD herniation or spinal instability. In order to design new treatments halting

  2. EZCA primer

    International Nuclear Information System (INIS)

    Karonis, N.T.

    1995-01-01

    This document provides a quick introduction to EZCA, a library that was designed to provide an easy to use interface to Channel Access (CA). As such, this document is not a user's manual, where a more detailed explanation of EZCA can be found. In short, this document is designed to get users to a state where they can be writing EZCA code as quickly as possible. It is not a document that answers all EZCA questions

  3. Primer sets for cloning the human repertoire of T cell Receptor Variable regions

    Directory of Open Access Journals (Sweden)

    Santoro Claudio

    2008-08-01

    Full Text Available Abstract Background Amplification and cloning of naïve T cell Receptor (TR repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Results Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT®, the ImMunoGeneTics information system®. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. Conclusion This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

  4. Primer sets for cloning the human repertoire of T cell Receptor Variable regions.

    Science.gov (United States)

    Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele

    2008-08-29

    Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

  5. VGRAF primer

    Energy Technology Data Exchange (ETDEWEB)

    Padilla, G.C.; Thompson, S.L.

    1980-10-01

    VGRAF is a powerful FORTRAN program which is designed to produce professional-quality color slides, viewgraphs, posters, and data plots for presentations or reports. The program is easy to use and requires no a priori knowledge of a programming language and little or no previous programming experience. This report describes a subset of the VGRAF commands which will enable the user to make very simple plots. For enhanced plotting, the user is referred to SAND79-2147.

  6. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

    KAUST Repository

    Wang, Yong

    2009-10-09

    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.

  7. A Hearing Aid Primer 1

    Science.gov (United States)

    Yetter, Carol J.

    2009-01-01

    This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

  8. Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

    Science.gov (United States)

    Yofe, Ido; Schuldiner, Maya

    2014-02-01

    The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.

  9. Polyacid macromolecule primers

    Science.gov (United States)

    Sugama, Toshifumi.

    1989-12-26

    Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.

  10. Design of primers for pertussis diagnosis by Real Time PCR and determination of its sensitivity and specificity in comparison with commercial kits.

    Directory of Open Access Journals (Sweden)

    Hamidreza Monavari

    2013-12-01

    Results: Performance of our home made primers for detecting pertussis using Real Time PCR in comparison with those by commercial kit was acceptable based on diagnostic classical guidance (WHO and the (CDC. Conclusions: Real time PCR test with new primers in comparison with culture techniques is more suitable, high sensitivity and can provide more informative values for pertussis detection.

  11. Novel acsF Gene Primers Revealed a Diverse Phototrophic Bacterial Population, Including Gemmatimonadetes, in Lake Taihu (China)

    DEFF Research Database (Denmark)

    Huang, Yili; Zeng, Yanhua; Lu, Hang

    2016-01-01

    Seq sequencing of the 16S rRNA, pufM, and bchY genes was carried out to assess the diversity of local phototrophic communities. In addition, we designed new degenerate primers of aerobic cyclase gene acsF, which serves as a convenient marker for both phototrophic Gemmatimonadetes and phototrophic Proteobacteria...... a diverse community of phototrophic Gemmatimonadetes forming 30 operational taxonomic units. These species represented 10.5 and 17.3% of the acsF reads in the upper semiaerobic sediment and anoxic sediment, whereas their abundance in the water column was ... fundamental biological processes on Earth. Recently, the presence of photosynthetic reaction centers has been reported from a rarely studied bacterial phylum, Gemmatimonadetes, but almost nothing is known about the diversity and environmental distribution of these organisms. The newly designed acsF primers...

  12. A versatile method to design stem-loop primer-based quantitative PCR assays for detecting small regulatory RNA molecules.

    Directory of Open Access Journals (Sweden)

    Zsolt Czimmerer

    Full Text Available Short regulatory RNA-s have been identified as key regulators of gene expression in eukaryotes. They have been involved in the regulation of both physiological and pathological processes such as embryonal development, immunoregulation and cancer. One of their relevant characteristics is their high stability, which makes them excellent candidates for use as biomarkers. Their number is constantly increasing as next generation sequencing methods reveal more and more details of their synthesis. These novel findings aim for new detection methods for the individual short regulatory RNA-s in order to be able to confirm the primary data and characterize newly identified subtypes in different biological conditions. We have developed a flexible method to design RT-qPCR assays that are very sensitive and robust. The newly designed assays were tested extensively in samples from plant, mouse and even human formalin fixed paraffin embedded tissues. Moreover, we have shown that these assays are able to quantify endogenously generated shRNA molecules. The assay design method is freely available for anyone who wishes to use a robust and flexible system for the quantitative analysis of matured regulatory RNA-s.

  13. A one-step reaction for the rapid identification of Lactobacillus mindensis, Lactobacillus panis, Lactobacillus paralimentarius, Lactobacillus pontis and Lactobacillus frumenti using oligonucleotide primers designed from the 16S-23S rRNA intergenic sequences.

    Science.gov (United States)

    Ferchichi, M; Valcheva, R; Prévost, H; Onno, B; Dousset, X

    2008-06-01

    Species-specific primers targeting the 16S-23S ribosomal DNA (rDNA) intergenic spacer region (ISR) were designed to rapidly discriminate between Lactobacillus mindensis, Lactobacillus panis, Lactobacillus paralimentarius, Lactobacillus pontis and Lactobacillus frumenti species recently isolated from French sourdough. The 16S-23S ISRs were amplified using primers 16S/p2 and 23S/p7, which anneal to positions 1388-1406 of the 16S rRNA gene and to positions 207-189 of the 23S rRNA gene respectively, Escherichia coli numbering (GenBank accession number V00331). Clone libraries of the resulting amplicons were constructed using a pCR2.1 TA cloning kit and sequenced. Species-specific primers were designed based on the sequences obtained and were used to amplify the 16S-23S ISR in the Lactobacillus species considered. For all of them, two PCR amplicons, designated as small ISR (S-ISR) and large ISR (L-ISR), were obtained. The L-ISR is composed of the corresponding S-ISR, interrupted by a sequence containing tRNA(Ile) and tRNA(Ala) genes. Based on these sequences, species-specific primers were designed and proved to identify accurately the species considered among 30 reference Lactobacillus species tested. Designed species-specific primers enable a rapid and accurate identification of L. mindensis, L. paralimentarius, L. panis, L. pontis and L. frumenti species among other lactobacilli. The proposed method provides a powerful and convenient means of rapidly identifying some sourdough lactobacilli, which could be of help in large starter culture surveys.

  14. Analysis and meta-analysis of single-case designs with a standardized mean difference statistic: a primer and applications.

    Science.gov (United States)

    Shadish, William R; Hedges, Larry V; Pustejovsky, James E

    2014-04-01

    This article presents a d-statistic for single-case designs that is in the same metric as the d-statistic used in between-subjects designs such as randomized experiments and offers some reasons why such a statistic would be useful in SCD research. The d has a formal statistical development, is accompanied by appropriate power analyses, and can be estimated using user-friendly SPSS macros. We discuss both advantages and disadvantages of d compared to other approaches such as previous d-statistics, overlap statistics, and multilevel modeling. It requires at least three cases for computation and assumes normally distributed outcomes and stationarity, assumptions that are discussed in some detail. We also show how to test these assumptions. The core of the article then demonstrates in depth how to compute d for one study, including estimation of the autocorrelation and the ratio of between case variance to total variance (between case plus within case variance), how to compute power using a macro, and how to use the d to conduct a meta-analysis of studies using single-case designs in the free program R, including syntax in an appendix. This syntax includes how to read data, compute fixed and random effect average effect sizes, prepare a forest plot and a cumulative meta-analysis, estimate various influence statistics to identify studies contributing to heterogeneity and effect size, and do various kinds of publication bias analyses. This d may prove useful for both the analysis and meta-analysis of data from SCDs. Copyright © 2013 Society for the Study of School Psychology. Published by Elsevier Ltd. All rights reserved.

  15. Fusion primer and nested integrated PCR (FPNI-PCR: a new high-efficiency strategy for rapid chromosome walking or flanking sequence cloning

    Directory of Open Access Journals (Sweden)

    Wang Zhen

    2011-11-01

    Full Text Available Abstract Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs. These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures.

  16. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

    KAUST Repository

    Wang, Yong; Qian, Pei-Yuan

    2009-01-01

    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions

  17. Bayesian methodology for the design and interpretation of clinical trials in critical care medicine: a primer for clinicians.

    Science.gov (United States)

    Kalil, Andre C; Sun, Junfeng

    2014-10-01

    To review Bayesian methodology and its utility to clinical decision making and research in the critical care field. Clinical, epidemiological, and biostatistical studies on Bayesian methods in PubMed and Embase from their inception to December 2013. Bayesian methods have been extensively used by a wide range of scientific fields, including astronomy, engineering, chemistry, genetics, physics, geology, paleontology, climatology, cryptography, linguistics, ecology, and computational sciences. The application of medical knowledge in clinical research is analogous to the application of medical knowledge in clinical practice. Bedside physicians have to make most diagnostic and treatment decisions on critically ill patients every day without clear-cut evidence-based medicine (more subjective than objective evidence). Similarly, clinical researchers have to make most decisions about trial design with limited available data. Bayesian methodology allows both subjective and objective aspects of knowledge to be formally measured and transparently incorporated into the design, execution, and interpretation of clinical trials. In addition, various degrees of knowledge and several hypotheses can be tested at the same time in a single clinical trial without the risk of multiplicity. Notably, the Bayesian technology is naturally suited for the interpretation of clinical trial findings for the individualized care of critically ill patients and for the optimization of public health policies. We propose that the application of the versatile Bayesian methodology in conjunction with the conventional statistical methods is not only ripe for actual use in critical care clinical research but it is also a necessary step to maximize the performance of clinical trials and its translation to the practice of critical care medicine.

  18. Comparison among amoA Primers Suited for Quantification and Diversity Analyses of Ammonia-Oxidizing Bacteria in Soil

    Science.gov (United States)

    Shimomura, Yumi; Morimoto, Sho; Hoshino, Yuko Takada; Uchida, Yoshitaka; Akiyama, Hiroko; Hayatsu, Masahito

    2012-01-01

    Ammonia monooxygenase subunit A gene (amoA) is frequently used as a functional gene marker for diversity analysis of ammonia-oxidizing bacteria (AOB). To select a suitable amoA primer for real-time PCR and PCR-denaturing gradient gel electrophoresis (DGGE), three reverse primers (degenerate primer amoA-2R; non-degenerate primers amoA-2R-GG and amoA-2IR) were examined. No significant differences were observed among the three primers in terms of quantitative values of amoA from environmental samples using real-time PCR. We found that PCR-DGGE analysis with the amoA-2IR primer gave the best results in this studied soil. These results indicate that amoA-2IR is a suitable primer for community analysis of AOB in the environment. PMID:22075625

  19. High occurrence of Bathyarchaeota (MCG) in the deep-sea sediments of South China Sea quantified using newly designed PCR primers.

    Science.gov (United States)

    Yu, Tiantian; Liang, Qianyong; Niu, Mingyang; Wang, Fengping

    2017-08-01

    The archaeal phylum Bathyarchaeota, which is composed of a large number of diverse lineages, is widespread and abundant in marine sediments. Environmental factors that control the distribution, abundance and evolution of this largely diversified archaeal phylum are currently unclear. In this study, a new pair of specific primers that target the major marine subgroups of bathyarchaeotal 16S rRNA genes was designed and evaluated to investigate the distribution and abundance of Bathyarchaeota in marine sediments. The abundance of Bathyarchaeota along two sediment cores from the deep-sea sediments of South China Sea (SCS, each from the Dongsha and Shenhu area) was determined. A strong correlation was found between the bathyarchaeotal abundance and the content of total organic carbon (TOC), suggesting an important role of Bathyarchaeota in organic matter remineralisation in the sediments of SCS. Furthermore, diversity analysis revealed that subgroups Bathy-2, Bathy-8 and Bathy-10 were dominant bathyarchaeotal members of the deep-sea sediments in the SCS. Bathy-8 was found predominantly within the reducing and deeper sediment layers, while Bathy-10 occurred preferentially in the oxidizing and shallower sediment layers. Our study lays a foundation for the further understanding of the ecological functions and niche differentiation of the important but not well-understood sedimentary archaeal group. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  20. Quick spacecraft charging primer

    International Nuclear Information System (INIS)

    Larsen, Brian Arthur

    2014-01-01

    This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.

  1. Nanotechnology: A Policy Primer

    Science.gov (United States)

    2013-06-24

    savings in the United States of 24 million barrels of oil.4 • Universal access to clean water. Nanotechnology water desalination and filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...COVERED 00-00-2013 to 00-00-2013 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT

  2. Macular degeneration (image)

    Science.gov (United States)

    ... macula in the back of the eye. The macula is important for clear central vision, allowing an individual to see fine details. There are two types of macular degeneration, dry and wet. Dry macular degeneration is more ...

  3. Multiplexing Short Primers for Viral Family PCR

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

    2008-06-26

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  4. Chromosome copy analysis by single-cell comparative genomic hybridization technique based on primer extension preamplification and degenerate oligonucleotide primed-PCR%引物延伸预扩增结合简并引物PCR在单细胞比较基因组杂交分析染色体异常中的应用

    Institute of Scientific and Technical Information of China (English)

    谭珂; 狄玉芬; 程德华; 徐芳; 卢光绣; 谭跃球

    2010-01-01

    Objective To establish a single-cell whole genome amplification (WGA) technique, in combination with comparative genomic hybridization (CGH), for analyzing chromosomal copy number changes, and to explore its clinical application in preimplantation genetic diagnosis (PGD). Methods Twelve single cell samples with known karyotypes, including 5 chorionic villus samples, 4 human embryonic stem cell (hESC) samples and 3 peripheral lymphocyte samples, and 4 single blastomere samples carrying chromosomal abnormalities detected by PGD, were collected for whole genome amplification by combining primer extension preamplification (PEP) with degenerate oligonucleotide primed-PCR (DOP-PCR)amplification. The amplified products labeled by red fluorescence were mixed with control DNA labeled by green fluorescence, and then the mixture was analyzed by CGH. As a comparison, 10 single cell samples were amplified by DOP-PCR only and then CGH analysis was performed. Results The amplification using PEP-DOP-PCR was more stable than traditional DOP-PCR. The products of PEP-DOP-PCR range from 100 bp to 1000 bp, with the mean size being about 400 bp. The CGH results were consistent with analyses by other methods. However, only 6 out of 10 single cell samples were successfully amplified by DOP-PCR,and CGH analysis showed a high background and 2 samples showed inconsistent results from other methods. Conclusion PEP-DOP-PCR can effectively amplify the whole genome DNA of single cell.Combined with CGH, this WGA method can successfully detect single-cell chromosomal copy number changes, while DOP-PCR was easy to fail to amplify and amplify inhomogeneousty, and CGH analysis using this PCR product usually showed high background. These results suggest that PEP-DOP-CGH is a promising method for preimplantation genetic diagnosis.%目的 建立一种可信的单细胞全基因组扩增(whole genome amplification.WGA)技术,结合比较基因组杂交(comparative genomic hybridization,CGH)分析单细

  5. The Los Alamos primer

    CERN Document Server

    Serber, Robert

    2018-01-01

    Unabridged declassified value reproduction of The Los Alamos Primer by Robert Serber, in full color with all censor markings. This is the booklet given to new workers at Los Alamos during World War II, to catch them up on how to build a practical fission bomb. The Primer was driven by Robert Oppenheimer asking his protégé Robert Serber to summarize all knowledge and possible solutions known as of April 1943 in a series of lectures. Serber did such an excellent job that the notes from the series was turned into The Los Alamos Primer. Serber was known as an expert that bridged theory and reality, and so was also chosen to be one of the first Americans to enter Hiroshima and Nagasaki to assess the atomic damage in 1945.

  6. China Energy Primer

    Energy Technology Data Exchange (ETDEWEB)

    Ni, Chun Chun

    2009-11-16

    Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

  7. Designing primers and evaluation of the efficiency of propidium monoazide - Quantitative polymerase chain reaction for counting the viable cells of Lactobacillus gasseri and Lactobacillus salivarius.

    Science.gov (United States)

    Lai, Chieh-Hsien; Wu, Sih-Rong; Pang, Jen-Chieh; Ramireddy, Latha; Chiang, Yu-Cheng; Lin, Chien-Ku; Tsen, Hau-Yang

    2017-07-01

    The purpose of this study is to evaluate the efficiency of using propidium monoazide (PMA) real-time quantitative polymerase chain reaction (qPCR) to count the viable cells of Lactobacillus gasseri and Lactobacillus salivarius in probiotic products. Based on the internal transcription spacer and 23S rRNA genes, two primer sets specific for these two Lactobacillus species were designed. For a probiotic product, the total deMan Rogosa Sharpe plate count was 8.65±0.69 log CFU/g, while for qPCR, the cell counts of L. gasseri and L. salivarius were 8.39±0.14 log CFU/g and 8.57±0.24 log CFU/g, respectively. Under the same conditions, for its heat-killed product, qPCR counts for L. gasseri and L. salivarius were 6.70±0.16 log cells/g and 7.67±0.20 log cells/g, while PMA-qPCR counts were 5.33±0.18 log cells/g and 5.05±0.23 log cells/g, respectively. For cell dilutions with a viable cell count of 8.5 log CFU/mL for L. gasseri and L. salivarius, after heat killing, the PMA-qPCR count for both Lactobacillus species was near 5.5 log cells/mL. When the PMA-qPCR counts of these cell dilutions were compared before and after heat killing, although some DNA might be lost during the heat killing, significant qPCR signals from dead cells, i.e., about 4-5 log cells/mL, could not be reduced by PMA treatment. Increasing PMA concentrations from 100 μM to 200 μM or light exposure time from 5 minutes to 15 minutes had no or, if any, only minor effect on the reduction of qPCR signals from their dead cells. Thus, to differentiate viable lactic acid bacterial cells from dead cells using the PMA-qPCR method, the efficiency of PMA to reduce the qPCR signals from dead cells should be notable. Copyright © 2016. Published by Elsevier B.V.

  8. Designing primers and evaluation of the efficiency of propidium monoazide – Quantitative polymerase chain reaction for counting the viable cells of Lactobacillus gasseri and Lactobacillus salivarius

    Directory of Open Access Journals (Sweden)

    Chieh-Hsien Lai

    2017-07-01

    Full Text Available The purpose of this study is to evaluate the efficiency of using propidium monoazide (PMA real-time quantitative polymerase chain reaction (qPCR to count the viable cells of Lactobacillus gasseri and Lactobacillus salivarius in probiotic products. Based on the internal transcription spacer and 23S rRNA genes, two primer sets specific for these two Lactobacillus species were designed. For a probiotic product, the total deMan Rogosa Sharpe plate count was 8.65±0.69 log CFU/g, while for qPCR, the cell counts of L. gasseri and L. salivarius were 8.39±0.14 log CFU/g and 8.57±0.24 log CFU/g, respectively. Under the same conditions, for its heat-killed product, qPCR counts for L. gasseri and L. salivarius were 6.70±0.16 log cells/g and 7.67±0.20 log cells/g, while PMA-qPCR counts were 5.33±0.18 log cells/g and 5.05±0.23 log cells/g, respectively. For cell dilutions with a viable cell count of 8.5 log CFU/mL for L. gasseri and L. salivarius, after heat killing, the PMA-qPCR count for both Lactobacillus species was near 5.5 log cells/mL. When the PMA-qPCR counts of these cell dilutions were compared before and after heat killing, although some DNA might be lost during the heat killing, significant qPCR signals from dead cells, i.e., about 4–5 log cells/mL, could not be reduced by PMA treatment. Increasing PMA concentrations from 100 μM to 200 μM or light exposure time from 5 minutes to 15 minutes had no or, if any, only minor effect on the reduction of qPCR signals from their dead cells. Thus, to differentiate viable lactic acid bacterial cells from dead cells using the PMA-qPCR method, the efficiency of PMA to reduce the qPCR signals from dead cells should be notable.

  9. Semantic Web Primer

    NARCIS (Netherlands)

    Antoniou, Grigoris; Harmelen, Frank van

    2004-01-01

    The development of the Semantic Web, with machine-readable content, has the potential to revolutionize the World Wide Web and its use. A Semantic Web Primer provides an introduction and guide to this still emerging field, describing its key ideas, languages, and technologies. Suitable for use as a

  10. Design and Evaluation of Illumina MiSeq-Compatible, 18S rRNA Gene-Specific Primers for Improved Characterization of Mixed Phototrophic Communities.

    Science.gov (United States)

    Bradley, Ian M; Pinto, Ameet J; Guest, Jeremy S

    2016-10-01

    The use of high-throughput sequencing technologies with the 16S rRNA gene for characterization of bacterial and archaeal communities has become routine. However, the adoption of sequencing methods for eukaryotes has been slow, despite their significance to natural and engineered systems. There are large variations among the target genes used for amplicon sequencing, and for the 18S rRNA gene, there is no consensus on which hypervariable region provides the most suitable representation of diversity. Additionally, it is unclear how much PCR/sequencing bias affects the depiction of community structure using current primers. The present study amplified the V4 and V8-V9 regions from seven microalgal mock communities as well as eukaryotic communities from freshwater, coastal, and wastewater samples to examine the effect of PCR/sequencing bias on community structure and membership. We found that degeneracies on the 3' end of the current V4-specific primers impact read length and mean relative abundance. Furthermore, the PCR/sequencing error is markedly higher for GC-rich members than for communities with balanced GC content. Importantly, the V4 region failed to reliably capture 2 of the 12 mock community members, and the V8-V9 hypervariable region more accurately represents mean relative abundance and alpha and beta diversity. Overall, the V4 and V8-V9 regions show similar community representations over freshwater, coastal, and wastewater environments, but specific samples show markedly different communities. These results indicate that multiple primer sets may be advantageous for gaining a more complete understanding of community structure and highlight the importance of including mock communities composed of species of interest. The quantification of error associated with community representation by amplicon sequencing is a critical challenge that is often ignored. When target genes are amplified using currently available primers, differential amplification efficiencies

  11. iCFD: Interpreted Computational Fluid Dynamics - Degeneration of CFD to one-dimensional advection-dispersion models using statistical experimental design - The secondary clarifier.

    Science.gov (United States)

    Guyonvarch, Estelle; Ramin, Elham; Kulahci, Murat; Plósz, Benedek Gy

    2015-10-15

    The present study aims at using statistically designed computational fluid dynamics (CFD) simulations as numerical experiments for the identification of one-dimensional (1-D) advection-dispersion models - computationally light tools, used e.g., as sub-models in systems analysis. The objective is to develop a new 1-D framework, referred to as interpreted CFD (iCFD) models, in which statistical meta-models are used to calculate the pseudo-dispersion coefficient (D) as a function of design and flow boundary conditions. The method - presented in a straightforward and transparent way - is illustrated using the example of a circular secondary settling tank (SST). First, the significant design and flow factors are screened out by applying the statistical method of two-level fractional factorial design of experiments. Second, based on the number of significant factors identified through the factor screening study and system understanding, 50 different sets of design and flow conditions are selected using Latin Hypercube Sampling (LHS). The boundary condition sets are imposed on a 2-D axi-symmetrical CFD simulation model of the SST. In the framework, to degenerate the 2-D model structure, CFD model outputs are approximated by the 1-D model through the calibration of three different model structures for D. Correlation equations for the D parameter then are identified as a function of the selected design and flow boundary conditions (meta-models), and their accuracy is evaluated against D values estimated in each numerical experiment. The evaluation and validation of the iCFD model structure is carried out using scenario simulation results obtained with parameters sampled from the corners of the LHS experimental region. For the studied SST, additional iCFD model development was carried out in terms of (i) assessing different density current sub-models; (ii) implementation of a combined flocculation, hindered, transient and compression settling velocity function; and (iii

  12. Defense Primer: DOD Contractors

    Science.gov (United States)

    2017-02-10

    functions, from intelligence analysis or software development to landscaping or food service. Why does DOD use individual contractors? Going back to...that provide professional services, from research to management support. The bulk of contractors—more than 70%—provide products, and these include...10 U.S.C. Part IV: Service, Supply, and Procurement. CRS Products CRS In Focus IF10548, Defense Primer: U.S. Defense Industrial Base, by Daniel

  13. Development of SCAR marker specific to non-toxic Jatropha curcas L. and designing a novel multiplexing PCR along with nrDNA ITS primers to circumvent the false negative detection

    KAUST Repository

    Mastan, Shaik G.

    2011-05-10

    Jatropha curcas L., a multipurpose shrub, has acquired significant economic importance for its seed oil which can be converted to biodiesel an emerging alternative to petro-diesel. In addition to the commercial value, it is also having medicinal and even high nutritional value to use as animal fodder which is limited due to the toxicity. Development of molecular marker will enable to differentiate non-toxic from toxic variety of J. curcas in a mixed population and also for quality control since the toxic components of J. curcas has deleterious effect on animals. In the present study, the efforts were made to generate the specific SCAR marker for toxic and/or non-toxic J. curcas from RAPD markers. Among the markers specific for toxic and non-toxic varieties, four were selected, purified, cloned, sequenced, and designed primers out of which one set of primers NT-JC/SCAR I/OPQ15-F and R could able to discriminate the non-toxic with toxic Jatropha by giving expected 430 bp size amplification in non-toxic variety. Furthermore, novel multiplex PCR was designed using the nrDNA ITS primers to overcome the false negatives. Present work also demonstrates utility of the conserved regions of nrDNA coding genes in ruling out the artifacts in PCR-like false negatives frequently occur in SCAR due to various reasons. The specific SCAR markers generated in the present investigation will help to distinguish non-toxic from toxic varieties of J. curcas or vice versa, and isolated marker along with designed multiplex protocol has applications in quality control for selective cultivation of non-toxic variety and will also assist in breeding and molecular mapping studies. © 2011 Springer Science+Business Media, LLC.

  14. A Quantum Groups Primer

    Science.gov (United States)

    Majid, Shahn

    2002-05-01

    Here is a self-contained introduction to quantum groups as algebraic objects. Based on the author's lecture notes for the Part III pure mathematics course at Cambridge University, the book is suitable as a primary text for graduate courses in quantum groups or supplementary reading for modern courses in advanced algebra. The material assumes knowledge of basic and linear algebra. Some familiarity with semisimple Lie algebras would also be helpful. The volume is a primer for mathematicians but it will also be useful for mathematical physicists.

  15. The R primer

    CERN Document Server

    Ekstrom, Claus Thorn

    2011-01-01

    Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i

  16. Primer on Health Surveys

    Directory of Open Access Journals (Sweden)

    David L Nordstrom

    2012-06-01

    Full Text Available The aim of this paper is to introduce novice researchers to surveys as a method of data collection. It starts with the definition of a survey, its major purposes and types as well as changes in the goals surveys have helped to achieve over time. Advantages and disadvantages of surveys over population censuses and medical examinations are discussed. Approaches to questionnaire construction are introduced along with properties that questionnaires are evaluated for. Modes of administration, sample size issues, and data analysis approaches are also introduced. The primer is illustrated with examples of surveys conducted in different countries with various public health purposes.

  17. Math primer for engineers

    CERN Document Server

    Cryer, CW

    2014-01-01

    Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula

  18. RUCS: Rapid identification of PCR primers for unique core sequences

    DEFF Research Database (Denmark)

    Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik

    2017-01-01

    Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...

  19. A primer on pseudorandom generators

    CERN Document Server

    Goldreich, Oded

    2010-01-01

    A fresh look at the question of randomness was taken in the theory of computing: A distribution is pseudorandom if it cannot be distinguished from the uniform distribution by any efficient procedure. This paradigm, originally associating efficient procedures with polynomial-time algorithms, has been applied with respect to a variety of natural classes of distinguishing procedures. The resulting theory of pseudorandomness is relevant to science at large and is closely related to central areas of computer science, such as algorithmic design, complexity theory, and cryptography. This primer surveys the theory of pseudorandomness, starting with the general paradigm, and discussing various incarnations while emphasizing the case of general-purpose pseudorandom generators (withstanding any polynomial-time distinguisher). Additional topics include the "derandomization" of arbitrary probabilistic polynomial-time algorithms, pseudorandom generators withstanding space-bounded distinguishers, and several natural notions...

  20. El primer virreinato americano

    Directory of Open Access Journals (Sweden)

    Cassá, Roberto

    2006-12-01

    Full Text Available This article explores the government of viceroy Christopher Columbus in the American territories. We return to the first Spanish settlement in Santo Domingo and the contradictions inherent to this expansionist proyect. The contradictions were part of the logic of the absolutist state and Columbus’ reaction against the controls imposed by the monarchs. Secondly, we look into the dificulties that the Admiral encountered to develop a mercantilist model. In this context, we examine the rationale behind the first government of the Indies and the features that defined the new West Indian society.

    El artículo trata sobre el gobierno de Cristóbal Colón en tierras americanas. Retomamos el tema del primer emplazamiento español en Santo Domingo y las contradicciones que tuvo aquel proyecto debido a la lógica del estado absolutista, a la ambición desmedida del descubridor y a su reacción ante los controles que desde un principio impusieron los monarcas. En un segundo momento analizamos las dificultades que encontró el Almirante para desarrollar un modelo mercantilista acorde a sus ideas y a los acuerdos a que llegó con la Corona. En ese contexto analizamos la lógica del primer gobierno colombinista en las Indias y los rasgos que definieron la nueva sociedad antillana.

  1. First large-scale DNA barcoding assessment of reptiles in the biodiversity hotspot of Madagascar, based on newly designed COI primers.

    Science.gov (United States)

    Nagy, Zoltán T; Sonet, Gontran; Glaw, Frank; Vences, Miguel

    2012-01-01

    DNA barcoding of non-avian reptiles based on the cytochrome oxidase subunit I (COI) gene is still in a very early stage, mainly due to technical problems. Using a newly developed set of reptile-specific primers for COI we present the first comprehensive study targeting the entire reptile fauna of the fourth-largest island in the world, the biodiversity hotspot of Madagascar. Representatives of the majority of Madagascan non-avian reptile species (including Squamata and Testudines) were sampled and successfully DNA barcoded. The new primer pair achieved a constantly high success rate (72.7-100%) for most squamates. More than 250 species of reptiles (out of the 393 described ones; representing around 64% of the known diversity of species) were barcoded. The average interspecific genetic distance within families ranged from a low of 13.4% in the Boidae to a high of 29.8% in the Gekkonidae. Using the average genetic divergence between sister species as a threshold, 41-48 new candidate (undescribed) species were identified. Simulations were used to evaluate the performance of DNA barcoding as a function of completeness of taxon sampling and fragment length. Compared with available multi-gene phylogenies, DNA barcoding correctly assigned most samples to species, genus and family with high confidence and the analysis of fewer taxa resulted in an increased number of well supported lineages. Shorter marker-lengths generally decreased the number of well supported nodes, but even mini-barcodes of 100 bp correctly assigned many samples to genus and family. The new protocols might help to promote DNA barcoding of reptiles and the established library of reference DNA barcodes will facilitate the molecular identification of Madagascan reptiles. Our results might be useful to easily recognize undescribed diversity (i.e. novel taxa), to resolve taxonomic problems, and to monitor the international pet trade without specialized expert knowledge.

  2. First Large-Scale DNA Barcoding Assessment of Reptiles in the Biodiversity Hotspot of Madagascar, Based on Newly Designed COI Primers

    Science.gov (United States)

    Nagy, Zoltán T.; Sonet, Gontran; Glaw, Frank; Vences, Miguel

    2012-01-01

    Background DNA barcoding of non-avian reptiles based on the cytochrome oxidase subunit I (COI) gene is still in a very early stage, mainly due to technical problems. Using a newly developed set of reptile-specific primers for COI we present the first comprehensive study targeting the entire reptile fauna of the fourth-largest island in the world, the biodiversity hotspot of Madagascar. Methodology/Principal Findings Representatives of the majority of Madagascan non-avian reptile species (including Squamata and Testudines) were sampled and successfully DNA barcoded. The new primer pair achieved a constantly high success rate (72.7–100%) for most squamates. More than 250 species of reptiles (out of the 393 described ones; representing around 64% of the known diversity of species) were barcoded. The average interspecific genetic distance within families ranged from a low of 13.4% in the Boidae to a high of 29.8% in the Gekkonidae. Using the average genetic divergence between sister species as a threshold, 41–48 new candidate (undescribed) species were identified. Simulations were used to evaluate the performance of DNA barcoding as a function of completeness of taxon sampling and fragment length. Compared with available multi-gene phylogenies, DNA barcoding correctly assigned most samples to species, genus and family with high confidence and the analysis of fewer taxa resulted in an increased number of well supported lineages. Shorter marker-lengths generally decreased the number of well supported nodes, but even mini-barcodes of 100 bp correctly assigned many samples to genus and family. Conclusions/Significance The new protocols might help to promote DNA barcoding of reptiles and the established library of reference DNA barcodes will facilitate the molecular identification of Madagascan reptiles. Our results might be useful to easily recognize undescribed diversity (i.e. novel taxa), to resolve taxonomic problems, and to monitor the international pet trade

  3. Degenerate nonlinear diffusion equations

    CERN Document Server

    Favini, Angelo

    2012-01-01

    The aim of these notes is to include in a uniform presentation style several topics related to the theory of degenerate nonlinear diffusion equations, treated in the mathematical framework of evolution equations with multivalued m-accretive operators in Hilbert spaces. The problems concern nonlinear parabolic equations involving two cases of degeneracy. More precisely, one case is due to the vanishing of the time derivative coefficient and the other is provided by the vanishing of the diffusion coefficient on subsets of positive measure of the domain. From the mathematical point of view the results presented in these notes can be considered as general results in the theory of degenerate nonlinear diffusion equations. However, this work does not seek to present an exhaustive study of degenerate diffusion equations, but rather to emphasize some rigorous and efficient techniques for approaching various problems involving degenerate nonlinear diffusion equations, such as well-posedness, periodic solutions, asympt...

  4. A primer on water

    Science.gov (United States)

    Leopold, Luna Bergere; Langbein, Walter Basil

    1960-01-01

    When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to

  5. Promotion primer. Foerderfibel

    Energy Technology Data Exchange (ETDEWEB)

    1981-01-01

    This revised edition of the promotion primer is to serve as a topical orientation aid for industrial firms, unions, boards and other bodies interested where the actions of governmental R and D and innovation policy are compiled and clearly arranged. It is important for the success of governmental aids that the institutions concerned are informed about all possibilities of the promotion, financing and advisory programme. Beyond the presentation of the research promotion sectors, the fiscal measures and the contractual as well as the joint research this revised edition focussess on the fields of consultative services for innovation and information. For many firms the access to qualified information and guidance is of particular importance. That is why this brochure points out the ways towards governmental research promotion. The BMFT has provided a remarkable contribution to research promotion by establishing information and consultative services for trade and industry.

  6. Metabolomics: A Primer.

    Science.gov (United States)

    Liu, Xiaojing; Locasale, Jason W

    2017-04-01

    Metabolomics generates a profile of small molecules that are derived from cellular metabolism and can directly reflect the outcome of complex networks of biochemical reactions, thus providing insights into multiple aspects of cellular physiology. Technological advances have enabled rapid and increasingly expansive data acquisition with samples as small as single cells; however, substantial challenges in the field remain. In this primer we provide an overview of metabolomics, especially mass spectrometry (MS)-based metabolomics, which uses liquid chromatography (LC) for separation, and discuss its utilities and limitations. We identify and discuss several areas at the frontier of metabolomics. Our goal is to give the reader a sense of what might be accomplished when conducting a metabolomics experiment, now and in the near future. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. A Brief Taxometrics Primer

    Science.gov (United States)

    Beauchaine, Theodore P.

    2009-01-01

    Taxometric procedures provide an empirical means of determining which psychiatric disorders are typologically distinct from normal behavioral functioning. Although most disorders reflect extremes along continuously distributed behavioral traits, identifying those that are discrete has important implications for accurate diagnosis, effective treatment, early identification of risk, and improved understanding of etiology. This article provides (a) brief descriptions of the conceptual bases of several taxometric procedures, (b) example analyses using simulated data, and (c) strategies for avoiding common pitfalls that are often observed in taxometrics research. To date, most taxometrics studies have appeared in the adult psychopathology literature. It is hoped that this primer will encourage interested readers to extend taxometrics research to child and adolescent populations. PMID:18088222

  8. Criticality calculations with MCNP trademark: A primer

    International Nuclear Information System (INIS)

    Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.

    1994-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand

  9. Laenderyggens degeneration og radiologi

    DEFF Research Database (Denmark)

    Jacobsen, Steffen; Gosvig, Kasper Kjaerulf; Sonne-Holm, Stig

    2006-01-01

    Low back pain (LBP) is one of the most common conditions, and at the same time one of the most complex nosological entities. The lifetime prevalence is approximately 80%, and radiological features of lumbar degeneration are almost universal in adults. The individual risk factors for LBP and signi...... is cyclic: exacerbations relieved by asymptomatic periods. New imaging modalities, including the combination of MR imaging and multiplanar 3-D CT scans, have broadened our awareness of possible pain-generating degenerative processes of the lumbar spine other than disc degeneration....

  10. Radiation protection primer

    International Nuclear Information System (INIS)

    Aigner, R.; Melzer, E.; Seissler, H.

    1986-01-01

    This 'radiation protection primer' does not pretend to give absolute, final answers to the many questions that have been arising after the Chernobyl accident. What it is intended to supply, as a schematic overview of problems resulting from nuclear accidents, and a likewise systematic outline of possible solutions and sensible reactions to such an event. The book takes up questions such as: What has happened to the soil. Will future harvests be 'clean' again. What does radioactivity to our drinking water and other waters. What are the effects of a radioactive fallout on food. What may we eat or drink. What happens to the human body after intake of radioactive air, or - even only slightly - contaminated food or water. What can we do to protect our health, and the health of our children. Is there anything else we can do in order to avoid such a disaster in future, except from shutting-off all reactors. The book itself presents some answers and advice, along with a list of terms and explanations, and addresses to apply to for further advice and information. (orig./HP) [de

  11. Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples.

    Science.gov (United States)

    Zuntini, Alexandre R; Fonseca, Luiz Henrique M; Lohmann, Lúcia G

    2013-09-01

    New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. • Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. • The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  12. Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples

    Directory of Open Access Journals (Sweden)

    Alexandre R. Zuntini

    2013-08-01

    Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  13. On Degenerate Partial Differential Equations

    OpenAIRE

    Chen, Gui-Qiang G.

    2010-01-01

    Some of recent developments, including recent results, ideas, techniques, and approaches, in the study of degenerate partial differential equations are surveyed and analyzed. Several examples of nonlinear degenerate, even mixed, partial differential equations, are presented, which arise naturally in some longstanding, fundamental problems in fluid mechanics and differential geometry. The solution to these fundamental problems greatly requires a deep understanding of nonlinear degenerate parti...

  14. Simple sequence repeat marker loci discovery using SSR primer.

    Science.gov (United States)

    Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David

    2004-06-12

    Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/

  15. Laenderyggens degeneration og radiologi

    DEFF Research Database (Denmark)

    Jacobsen, Steffen; Gosvig, Kasper Kjaerulf; Sonne-Holm, Stig

    2006-01-01

    Low back pain (LBP) is one of the most common conditions, and at the same time one of the most complex nosological entities. The lifetime prevalence is approximately 80%, and radiological features of lumbar degeneration are almost universal in adults. The individual risk factors for LBP and signi......Low back pain (LBP) is one of the most common conditions, and at the same time one of the most complex nosological entities. The lifetime prevalence is approximately 80%, and radiological features of lumbar degeneration are almost universal in adults. The individual risk factors for LBP...... and significant relationships between radiological findings and subjective symptoms have both been notoriously difficult to identify. The lack of consensus on clinical criteria and radiological definitions has hampered the undertaking of properly executed epidemiological studies. The natural history of LBP...

  16. Quantum degenerate systems

    Energy Technology Data Exchange (ETDEWEB)

    Micheli, Fiorenza de [Centro de Estudios Cientificos, Arturo Prat 514, Valdivia (Chile); Instituto de Fisica, Pontificia Universidad Catolica de Valparaiso, Casilla 4059, Valparaiso (Chile); Zanelli, Jorge [Centro de Estudios Cientificos, Arturo Prat 514, Valdivia (Chile); Universidad Andres Bello, Av. Republica 440, Santiago (Chile)

    2012-10-15

    A degenerate dynamical system is characterized by a symplectic structure whose rank is not constant throughout phase space. Its phase space is divided into causally disconnected, nonoverlapping regions in each of which the rank of the symplectic matrix is constant, and there are no classical orbits connecting two different regions. Here the question of whether this classical disconnectedness survives quantization is addressed. Our conclusion is that in irreducible degenerate systems-in which the degeneracy cannot be eliminated by redefining variables in the action-the disconnectedness is maintained in the quantum theory: there is no quantum tunnelling across degeneracy surfaces. This shows that the degeneracy surfaces are boundaries separating distinct physical systems, not only classically, but in the quantum realm as well. The relevance of this feature for gravitation and Chern-Simons theories in higher dimensions cannot be overstated.

  17. Laenderyggens degeneration og radiologi

    DEFF Research Database (Denmark)

    Jacobsen, Steffen; Gosvig, Kasper Kjaerulf; Sonne-Holm, Stig

    2006-01-01

    and significant relationships between radiological findings and subjective symptoms have both been notoriously difficult to identify. The lack of consensus on clinical criteria and radiological definitions has hampered the undertaking of properly executed epidemiological studies. The natural history of LBP...... is cyclic: exacerbations relieved by asymptomatic periods. New imaging modalities, including the combination of MR imaging and multiplanar 3-D CT scans, have broadened our awareness of possible pain-generating degenerative processes of the lumbar spine other than disc degeneration....

  18. Primer to Design Safe School Projects in Case of Terrorist Attacks and School Shootings. Buildings and Infrastructure Protection Series. FEMA-428/BIPS-07/January 2012. Edition 2

    Science.gov (United States)

    Chipley, Michael; Lyon, Wesley; Smilowitz, Robert; Williams, Pax; Arnold, Christopher; Blewett, William; Hazen, Lee; Krimgold, Fred

    2012-01-01

    This publication, part of the new Building and Infrastructure Protection Series (BIPS) published by the Department of Homeland Security (DHS) Science and Technology Directorate (S&T) Infrastructure Protection and Disaster Management Division (IDD), serves to advance high performance and integrated design for buildings and infrastructure. This…

  19. A LAN Primer.

    Science.gov (United States)

    Hazari, Sunil I.

    1991-01-01

    Local area networks (LANs) are systems of computers and peripherals connected together for the purposes of electronic mail and the convenience of sharing information and expensive resources. In planning the design of such a system, the components to consider are hardware, software, transmission media, topology, operating systems, and protocols.…

  20. A Cobit primer.

    Energy Technology Data Exchange (ETDEWEB)

    Campbell, Philip LaRoche

    2005-06-01

    COBIT is a set of documents that provides guidance for computer security. This report introduces COBIT by answering the following questions, after first defining acronyms and presenting definitions: 1. Why is COBIT valuable? 2. What is COBIT?, and 3. What documents are related to COBIT? (The answer to the last question constitutes the bulk of this report.) This report also provides more detailed review of three documents. The first two documents--COBIT Security Baseline{trademark} and COBIT Quickstart{trademark}--are initial documents, designed to get people started. The third document-Control Practices-is a ''final'' document, so to speak, designed to take people all the way down into the details. Control Practices is the detail.

  1. A primer of statistical methods for correlating parameters and properties of electrospun poly(L-lactide) scaffolds for tissue engineering--PART 1: design of experiments.

    Science.gov (United States)

    Seyedmahmoud, Rasoul; Rainer, Alberto; Mozetic, Pamela; Maria Giannitelli, Sara; Trombetta, Marcella; Traversa, Enrico; Licoccia, Silvia; Rinaldi, Antonio

    2015-01-01

    Tissue engineering scaffolds produced by electrospinning are of enormous interest, but still lack a true understanding about the fundamental connection between the outstanding functional properties, the architecture, the mechanical properties, and the process parameters. Fragmentary results from several parametric studies only render some partial insights that are hard to compare and generally miss the role of parameters interactions. To bridge this gap, this article (Part-1 of 2) features a case study on poly-L-lactide scaffolds to demonstrate how statistical methods such as design of experiments can quantitatively identify the correlations existing between key scaffold properties and control parameters, in a systematic, consistent, and comprehensive manner disentangling main effects from interactions. The morphological properties (i.e., fiber distribution and porosity) and mechanical properties (Young's modulus) are "charted" as a function of molecular weight (MW) and other electrospinning process parameters (the Xs), considering the single effect as well as interactions between Xs. For the first time, the major role of the MW emerges clearly in controlling all scaffold properties. The correlation between mechanical and morphological properties is also addressed. © 2014 Wiley Periodicals, Inc.

  2. A primer of statistical methods for correlating parameters and properties of electrospun poly(l -lactide) scaffolds for tissue engineering-PART 1: Design of experiments

    KAUST Repository

    Seyedmahmoud, Rasoul

    2014-03-20

    Tissue engineering scaffolds produced by electrospinning are of enormous interest, but still lack a true understanding about the fundamental connection between the outstanding functional properties, the architecture, the mechanical properties, and the process parameters. Fragmentary results from several parametric studies only render some partial insights that are hard to compare and generally miss the role of parameters interactions. To bridge this gap, this article (Part-1 of 2) features a case study on poly-l-lactide scaffolds to demonstrate how statistical methods such as design of experiments can quantitatively identify the correlations existing between key scaffold properties and control parameters, in a systematic, consistent, and comprehensive manner disentangling main effects from interactions. The morphological properties (i.e., fiber distribution and porosity) and mechanical properties (Young\\'s modulus) are "charted" as a function of molecular weight (MW) and other electrospinning process parameters (the Xs), considering the single effect as well as interactions between Xs. For the first time, the major role of the MW emerges clearly in controlling all scaffold properties. The correlation between mechanical and morphological properties is also addressed.

  3. Blockchain: A Graph Primer

    OpenAIRE

    Akcora, Cuneyt Gurcan; Gel, Yulia R.; Kantarcioglu, Murat

    2017-01-01

    Bitcoin and its underlying technology Blockchain have become popular in recent years. Designed to facilitate a secure distributed platform without central authorities, Blockchain is heralded as a paradigm that will be as powerful as Big Data, Cloud Computing and Machine learning. Blockchain incorporates novel ideas from various fields such as public key encryption and distributed systems. As such, a reader often comes across resources that explain the Blockchain technology from a certain pers...

  4. Freshwater Wetlands: A Citizen's Primer.

    Science.gov (United States)

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…

  5. DNA Extraction and Primer Selection

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

    Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

  6. A classical primer for QCD

    International Nuclear Information System (INIS)

    Moriyasu, K.

    1981-01-01

    A basic primer for QCD is presented using a semiclassical approach to the colour Maxwell equations. The non-Abelian nature of colour symmetry and the violation of superposition by colour fields is compared with QED. A simple discussion of asymptotic freedom is also presented. (author)

  7. Design, synthesis, and evaluation of nonretinoid retinol binding protein 4 antagonists for the potential treatment of atrophic age-related macular degeneration and Stargardt disease.

    Science.gov (United States)

    Cioffi, Christopher L; Dobri, Nicoleta; Freeman, Emily E; Conlon, Michael P; Chen, Ping; Stafford, Douglas G; Schwarz, Daniel M C; Golden, Kathy C; Zhu, Lei; Kitchen, Douglas B; Barnes, Keith D; Racz, Boglarka; Qin, Qiong; Michelotti, Enrique; Cywin, Charles L; Martin, William H; Pearson, Paul G; Johnson, Graham; Petrukhin, Konstantin

    2014-09-25

    Accumulation of lipofuscin in the retina is associated with pathogenesis of atrophic age-related macular degeneration and Stargardt disease. Lipofuscin bisretinoids (exemplified by N-retinylidene-N-retinylethanolamine) seem to mediate lipofuscin toxicity. Synthesis of lipofuscin bisretinoids depends on the influx of retinol from serum to the retina. Compounds antagonizing the retinol-dependent interaction of retinol-binding protein 4 (RBP4) with transthyretin in the serum would reduce serum RBP4 and retinol and inhibit bisretinoid formation. We recently showed that A1120 (3), a potent carboxylic acid based RBP4 antagonist, can significantly reduce lipofuscin bisretinoid formation in the retinas of Abca4(-/-) mice. As part of the NIH Blueprint Neurotherapeutics Network project we undertook the in vitro exploration to identify novel conformationally flexible and constrained RBP4 antagonists with improved potency and metabolic stability. We also demonstrate that upon acute and chronic dosing in rats, 43, a potent cyclopentyl fused pyrrolidine antagonist, reduced circulating plasma RBP4 protein levels by approximately 60%.

  8. Primer on hardware prefetching

    CERN Document Server

    Falsafi, Babak

    2014-01-01

    Since the 1970's, microprocessor-based digital platforms have been riding Moore's law, allowing for doubling of density for the same area roughly every two years. However, whereas microprocessor fabrication has focused on increasing instruction execution rate, memory fabrication technologies have focused primarily on an increase in capacity with negligible increase in speed. This divergent trend in performance between the processors and memory has led to a phenomenon referred to as the "Memory Wall."To overcome the memory wall, designers have resorted to a hierarchy of cache memory levels, whi

  9. Sequence diversity in haloalkane dehalogenases, as revealed by PCR using family-specific primers

    Czech Academy of Sciences Publication Activity Database

    Kotík, Michael; Faměrová, Veronika

    2012-01-01

    Roč. 88, č. 2 (2012), s. 212-217 ISSN 0167-7012 R&D Projects: GA ČR GAP504/10/0137; GA ČR GAP207/10/0135 Institutional research plan: CEZ:AV0Z50200510 Keywords : Dehalogenation * Consensus sequence * Degenerate PCR primer Subject RIV: EE - Microbiology, Virology Impact factor: 2.161, year: 2012

  10. Degenerate band edge laser

    Science.gov (United States)

    Veysi, Mehdi; Othman, Mohamed A. K.; Figotin, Alexander; Capolino, Filippo

    2018-05-01

    We propose a class of lasers based on a fourth-order exceptional point of degeneracy (EPD) referred to as the degenerate band edge (DBE). EPDs have been found in parity-time-symmetric photonic structures that require loss and/or gain; here we show that the DBE is a different kind of EPD since it occurs in periodic structures that are lossless and gainless. Because of this property, a small level of gain is sufficient to induce single-frequency lasing based on a synchronous operation of four degenerate Floquet-Bloch eigenwaves. This lasing scheme constitutes a light-matter interaction mechanism that leads also to a unique scaling law of the laser threshold with the inverse of the fifth power of the laser-cavity length. The DBE laser has the lowest lasing threshold in comparison to a regular band edge laser and to a conventional laser in cavities with the same loaded quality (Q ) factor and length. In particular, even without mirror reflectors the DBE laser exhibits a lasing threshold which is an order of magnitude lower than that of a uniform cavity laser of the same length and with very high mirror reflectivity. Importantly, this novel DBE lasing regime enforces mode selectivity and coherent single-frequency operation even for pumping rates well beyond the lasing threshold, in contrast to the multifrequency nature of conventional uniform cavity lasers.

  11. A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

    Directory of Open Access Journals (Sweden)

    Dunn Sade N

    2008-06-01

    Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

  12. Active noise control primer

    CERN Document Server

    Snyder, Scott D

    2000-01-01

    Active noise control - the reduction of noise by generating an acoustic signal that actively interferes with the noise - has become an active area of basic research and engineering applications. The aim of this book is to present all of the basic knowledge one needs for assessing how useful active noise control will be for a given problem and then to provide some guidance for designing, setting up, and tuning an active noise-control system. Written for students who have no prior knowledge of acoustics, signal processing, or noise control but who do have a reasonable grasp of basic physics and mathematics, the book is short and descriptive. It leaves for more advanced texts or research monographs all mathematical details and proofs concerning vibrations, signal processing and the like. The book can thus be used in independent study, in a classroom with laboratories, or in conjunction with a kit for experiment or demonstration. Topics covered include: basic acoustics; human perception and sound; sound intensity...

  13. 30 CFR 56.6304 - Primer protection.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives...

  14. Second order degenerate elliptic equations

    International Nuclear Information System (INIS)

    Duong Minh Duc.

    1988-08-01

    Using an improved Sobolev inequality we study a class of elliptic operators which is degenerate inside the domain and strongly degenerate near the boundary of the domain. Our results are applicable to the L 2 -boundary value problem and the mixed boundary problem. (author). 18 refs

  15. Complexity management in engineering design a primer

    CERN Document Server

    Maurer, Maik

    2017-01-01

    The treatise supports understanding the phenomena of complexity in engineering, distinguishes complexity from other challenges and presents an overview of definitions and applied approaches. The historical background of complexity management is explained by highlighting the important epochs, their key actors and their discoveries, findings and developments. Knowing about the appearance of early system awareness in ancient Greece, the creation of mechanical philosophy in the 17th century and the discovery of classic physics enables the reader to better comprehend modern system sciences and management approaches. A classification of complexity management approaches by research fields indicates current focus areas and starting points for future discussions. In a comprehensive map, the classification points out mutual overlaps between engineering disciplines in terms of similar complexity management approaches. Finally, the treatise introduces a generic complexity management framework, which is based on structura...

  16. Double Degenerate Stars

    International Nuclear Information System (INIS)

    Xin-Lian, Luo; Hua, Bai; Lei, Zhao

    2008-01-01

    Regardless of the formation mechanism, an exotic object, the double degenerate star (DDS), is introduced and investigated, which is composed of baryonic matter and some unknown fermion dark matter. Different from the simple white dwarfs (WDs), there is additional gravitational force provided by the unknown fermion component inside DDSs, which may strongly affect the structure and the stability of such kind of objects. Many possible and strange observational phenomena connecting with them are concisely discussed. Similar to the normal WD, this object can also experience thermonuclear explosion as type Ia supernova explosion when DDS's mass exceeds the maximum mass that can be supported by electron degeneracy pressure. However, since the total mass of baryonic matter can be much lower than that of WD at Chandrasekhar mass limit, the peak luminosity should be much dimmer than what we expect before, which may throw a slight shadow on the standard candle of SN Ia in the research of cosmology. (general)

  17. A Primer to Slow Light

    OpenAIRE

    Leonhardt, U.

    2001-01-01

    Laboratory-based optical analogs of astronomical objects such as black holes rely on the creation of light with an extremely low or even vanishing group velocity (slow light). These brief notes represent a pedagogical attempt towards elucidating this extraordinary form of light. This paper is a contribution to the book Artificial Black Holes edited by Mario Novello, Matt Visser and Grigori Volovik. The paper is intended as a primer, an introduction to the subject for non-experts, not as a det...

  18. A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

    Directory of Open Access Journals (Sweden)

    Wang Xiaowei

    2008-12-01

    Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

  19. Taxon-specific PCR primers to detect two inconspicuous arbuscular mycorrhizal fungi from temperate agricultural grassland

    NARCIS (Netherlands)

    Gamper, H.A.; Leuchtmann, A.

    2007-01-01

    Taxon-specific polymerase chain reaction (PCR) primers enable detection of arbuscular mycorrhizal fungi (AMF, Glomeromycota) in plant roots where the fungi lack discriminative morphological and biochemical characters. We designed and validated pairs of new PCR primers targeted to the flanking

  20. Primer on CDM programme of activities

    Energy Technology Data Exchange (ETDEWEB)

    Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)

    2009-07-01

    As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)

  1. KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

    International Nuclear Information System (INIS)

    Bowman, Stephen M.

    2008-01-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

  2. [Lattice degeneration of the retina].

    Science.gov (United States)

    Boĭko, E V; Suetov, A A; Mal'tsev, D S

    2014-01-01

    Lattice degeneration of the retina is a clinically important type of peripheral retinal dystrophies due to its participation in the pathogenesis of rhegmatogenous retinal detachment. In spite of extensive epidemiological, morphological, and clinical data, the question on causes of this particular type of retinal dystrophies currently remains debatable. Existing hypotheses on pathogenesis of retinal structural changes in lattice degeneration explain it to a certain extent. In clinical ophthalmology it is necessary to pay close attention to this kind of degenerations and distinguish between cases requiring preventive treatment and those requiring monitoring.

  3. Quantitative Experimental Determination of Primer-Dimer Formation Risk by Free-Solution Conjugate Electrophoresis

    Science.gov (United States)

    Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.

    2012-01-01

    DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820

  4. Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

    Science.gov (United States)

    Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

    2018-03-01

    Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

  5. A database of PCR primers for the chloroplast genomes of higher plants

    Science.gov (United States)

    Heinze, Berthold

    2007-01-01

    Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny) or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species). The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata). Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution. PMID:17326828

  6. A database of PCR primers for the chloroplast genomes of higher plants

    Directory of Open Access Journals (Sweden)

    Heinze Berthold

    2007-02-01

    Full Text Available Abstract Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species. The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata. Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution.

  7. iCFD: Interpreted Computational Fluid Dynamics – Degeneration of CFD to one-dimensional advection-dispersion models using statistical experimental design – The secondary clarifier

    DEFF Research Database (Denmark)

    Guyonvarch, Estelle; Ramin, Elham; Kulahci, Murat

    2015-01-01

    using the example of a circular secondary settling tank (SST). First, the significant design and flow factors are screened out by applying the statistical method of two-level fractional factorial design of experiments. Second, based on the number of significant factors identified through the factor...... of (i) assessing different density current sub-models; (ii) implementation of a combined flocculation, hindered, transient and compression settling velocity function; and (iii) assessment of modelling the onset of transient and compression settling. Furthermore, the optimal level of model discretization...

  8. Macular degeneration - age-related

    Science.gov (United States)

    ... AMD occurs when the blood vessels under the macula become thin and brittle. Small yellow deposits, called drusen, form. Almost all people with macular degeneration start with the dry form. Wet AMD occurs ...

  9. A primer of multivariate statistics

    CERN Document Server

    Harris, Richard J

    2014-01-01

    Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why

  10. Computed tomography of Wallerian degeneration

    International Nuclear Information System (INIS)

    Uchino, Akira; Maeda, Fumihiko

    1986-01-01

    CT findings of wallerian degeneration of the pyramidal tract at the midbrain (atrophy of cerebral peduncle following cerebrovascular accident) were studied in 34 patients (44 CT scans) with old cerebrovascular accidents. Severe atrophy of cerebral peduncle was noted when the ipsilateral motor cortex was involved. However, when the posterior limb of the internal capsule was involved, atrophy of the ipsilateral cerebral peduncle was mild. In this series, the shortest interval between cerebrovascular accident and wallerian degeneration was 8 month. (author)

  11. What Is Age-Related Macular Degeneration?

    Science.gov (United States)

    ... Eye Health / Eye Health A-Z Age-Related Macular Degeneration Sections What Is Macular Degeneration? How is AMD ... What Does Macular Degeneration Look Like? What Is Macular Degeneration? Leer en Español: ¿Qué es la degeneración macular ...

  12. Primer for criticality calculations with DANTSYS

    International Nuclear Information System (INIS)

    Busch, R.D.

    1996-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his or her facility. Typically, two types of codes are available: deterministic codes such as ANISN or DANTSYS that solve an approximate model exactly and Monte Carlo Codes such as KENO or MCNP that solve an exact model approximately. Often, the analyst feels that the deterministic codes are too simple and will not provide the necessary information, so most modeling uses Monte Carlo methods. This sometimes means that hours of effort are expended to produce results available in minutes from deterministic codes. A substantial amount of reliable information on nuclear systems can be obtained using deterministic methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico in cooperation with the Radiation Transport Group at Los Alamos National Laboratory has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. (DANTSYS is the name of a suite of codes that users more commonly know as ONEDANT, TWODANT, TWOHEX, and THREEDANT.) It assumes a college education in a technical field, but there is no assumption of familiarity with neutronics codes in general or with DANTSYS in particular. The primer is designed to teach by example, with each example illustrating two or three DANTSYS features useful in criticality analyses

  13. GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.

    Science.gov (United States)

    Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

    2011-01-01

    The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.

  14. Identification of degenerate nuclei and development of a SCAR marker for Flammulina velutipes.

    Directory of Open Access Journals (Sweden)

    Sun Young Kim

    Full Text Available Flammulina velutipes is one of the major edible mushrooms in the world. Recently, abnormalities that have a negative impact on crop production have been reported in this mushroom. These symptoms include slow vegetative growth, a compact mycelial mat, and few or even no fruiting bodies. The morphologies and fruiting capabilities of monokaryons of wild-type and degenerate strains that arose through arthrospore formation were investigated through test crossing. Only one monokaryotic group of the degenerate strains and its hybrid strains showed abnormal phenotypes. Because the monokaryotic arthrospore has the same nucleus as the parent strain, these results indicated that only one aberrant nucleus of the two nuclei in the degenerate strain was responsible for the degeneracy. A sequence-characterized amplified region marker that is linked to the degenerate monokaryon was identified based on a polymorphic sequence that was generated using random primers. Comparative analyses revealed the presence of a degenerate-specific genomic region in a telomere, which arose via the transfer of a genomic fragment harboring a putative helicase gene. Our findings have narrowed down the potential molecular targets responsible for this phenotype for future studies and have provided a marker for the detection of degenerate strains.

  15. ANT: Software for Generating and Evaluating Degenerate Codons for Natural and Expanded Genetic Codes.

    Science.gov (United States)

    Engqvist, Martin K M; Nielsen, Jens

    2015-08-21

    The Ambiguous Nucleotide Tool (ANT) is a desktop application that generates and evaluates degenerate codons. Degenerate codons are used to represent DNA positions that have multiple possible nucleotide alternatives. This is useful for protein engineering and directed evolution, where primers specified with degenerate codons are used as a basis for generating libraries of protein sequences. ANT is intuitive and can be used in a graphical user interface or by interacting with the code through a defined application programming interface. ANT comes with full support for nonstandard, user-defined, or expanded genetic codes (translation tables), which is important because synthetic biology is being applied to an ever widening range of natural and engineered organisms. The Python source code for ANT is freely distributed so that it may be used without restriction, modified, and incorporated in other software or custom data pipelines.

  16. A Primer on Observational Measurement.

    Science.gov (United States)

    Girard, Jeffrey M; Cohn, Jeffrey F

    2016-08-01

    Observational measurement plays an integral role in a variety of scientific endeavors within biology, psychology, sociology, education, medicine, and marketing. The current article provides an interdisciplinary primer on observational measurement; in particular, it highlights recent advances in observational methodology and the challenges that accompany such growth. First, we detail the various types of instrument that can be used to standardize measurements across observers. Second, we argue for the importance of validity in observational measurement and provide several approaches to validation based on contemporary validity theory. Third, we outline the challenges currently faced by observational researchers pertaining to measurement drift, observer reactivity, reliability analysis, and time/expense. Fourth, we describe recent advances in computer-assisted measurement, fully automated measurement, and statistical data analysis. Finally, we identify several key directions for future observational research to explore.

  17. A primer on quantum fluids

    CERN Document Server

    Barenghi, Carlo

    2016-01-01

    The aim of this primer is to cover the essential theoretical information, quickly and concisely, in order to enable senior undergraduate and beginning graduate students to tackle projects in topical research areas of quantum fluids, for example, solitons, vortices and collective modes. The selection of the material, both regarding the content and level of presentation, draws on the authors analysis of the success of relevant research projects with newcomers to the field, as well as of the students feedback from many taught and self-study courses on the subject matter. Starting with a brief historical overview, this text covers particle statistics, weakly interacting condensates and their dynamics and finally superfluid helium and quantum turbulence. At the end of each chapter (apart from the first) there will be some exercises. Detailed solutions can be made available to instructors upon request to the authors. .

  18. Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.

    Science.gov (United States)

    Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela

    2014-08-01

    Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.

  19. MCNPTM criticality primer and training experiences

    International Nuclear Information System (INIS)

    Briesmeister, J.; Forster, R.A.; Busch, R.

    1995-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, the analyst may have little experience with the specific codes available at his or her facility. Usually, the codes are quite complex, black boxes capable of analyzing numerous problems with a myriad of input options. Documentation for these codes is designed to cover all the possible configurations and types of analyses but does not give much detail on any particular type of analysis. For criticality calculations, the user of a code is primarily interested in the value of the effective multiplication factor for a system (k eff ). Most codes will provide this, and truckloads of other information that may be less pertinent to criticality calculations. Based on discussions with code users in the nuclear criticality safety community, it was decided that a simple document discussing the ins and outs of criticality calculations with specific codes would be quite useful. The Transport Methods Group, XTM, at Los Alamos National Laboratory (LANL) decided to develop a primer for criticality calculations with their Monte Carlo code, MCNP. This was a joint task between LANL with a knowledge and understanding of the nuances and capabilities of MCNP and the University of New Mexico with a knowledge and understanding of nuclear criticality safety calculations and educating first time users of neutronics calculations. The initial problem was that the MCNP manual just contained too much information. Almost everything one needs to know about MCNP can be found in the manual; the problem is that there is more information than a user requires to do a simple k eff calculation. The basic concept of the primer was to distill the manual to create a document whose only focus was criticality calculations using MCNP

  20. Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia (DEVELOPMENt OF PRIMERS FOR REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION TO DETECT AVIAN INFLUENZA VIRUS IN INDONESIA

    Directory of Open Access Journals (Sweden)

    Ni Luh Putu Indi Dharmayanti

    2016-07-01

    Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.

  1. 30 CFR 57.6304 - Primer protection.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a...

  2. Bioinspired Catecholic Primers for Rigid and Ductile Dental Resin Composites.

    Science.gov (United States)

    Shin, Eeseul; Ju, Sung Won; An, Larry; Ahn, Eungjin; Ahn, Jin-Soo; Kim, Byeong-Su; Ahn, B Kollbe

    2018-01-17

    In the construction of dental restorative polymer composite materials, surface priming on mineral fillers is essential to improve the mechanical performance of the composites. Here we present bioinspired catechol-functionalized primers for a tougher dental resin composite containing glass fillers. The catecholic primers with different polymerizable end groups were designed and then coated on glass surfaces using a simple drop-casting or dip-coating process. The surface binding ability and possible cross-linking (coupling or chemical bridging between the glass substrate and the dental resin) of the catecholic bifunctional primers were evaluated using atomic force microscopy, contact angle measurements, and the knife shear bonding test and compared to a state-of-the-art silane-based coupling agent. Various mechanical tests including shrinkage and compression tests of the dental resin composites were also conducted. Compression tests of the composites containing the catecholic primed fillers exhibited enhanced mechanical properties, owing to the bidentate hydrogen bonding of catechol moieties to the oxide mineral surface. Furthermore, the superior biocompatibility of the primed surface was confirmed via cell attachment assay, thus providing applicability of catecholic primers for practical dental and biomedical applications.

  3. Gene Isolation Using Degenerate Primers Targeting Protein Motif: A Laboratory Exercise

    Science.gov (United States)

    Yeo, Brandon Pei Hui; Foong, Lian Chee; Tam, Sheh May; Lee, Vivian; Hwang, Siaw San

    2018-01-01

    Structures and functions of protein motifs are widely included in many biology-based course syllabi. However, little emphasis is placed to link this knowledge to applications in biotechnology to enhance the learning experience. Here, the conserved motifs of nucleotide binding site-leucine rich repeats (NBS-LRR) proteins, successfully used for the…

  4. KULTUR PRIMER FIBROBLAS: PENELITIAN PENDAHULUAN

    Directory of Open Access Journals (Sweden)

    Yuli Kurniawati

    2015-05-01

    Full Text Available AbstrakKultur sel fibroblas banyak digunakan untuk penelitian proses penyembuhan luka dan penuaankulit. Metode ini digunakan untuk melihat perkembangan sel, proliferasi kinetik seluler, sertabiosintesis komponen matriks ekstraseluler. Penelitian pendahuluan ini dilakukan untuk optimasiteknik laboratorium serta berbagai kendala yang didapatkan saat kultur fibroblas. Kultur primerfibroblas dibagi menjadi 2 jenis sampel yaitu sampel yang berasal dari embrio mencit usia 7,5–9,5 hari, dan kulit pasien keloid. Sampel dari embrio mencit dilakukan kultur primer denganmetode dissociated fibroblast. Sampel jaringan keloid dan kulit normal dikultur dengan metodeskin explant. Fibroblas yang berasal dari kultur primer embrio mencit tumbuh baik sehinggadapat dilakukan subkultur dan disimpan di dalam nitrogen cair suhu -198°C. Fibroblas yangberasal dari sampel keloid pertama tumbuh sesuai pola pertumbuhan fibroblas, namun padasampel kedua terdapat kontaminasi Paecilomyces sp. yang merupakan salah satu jenis jamurkontaminan. Sel fibroblas mudah untuk dikultur karena memiliki kemampuan tumbuh danmelekat yang tinggi serta regenerasi cepat, namun penelitian lebih lanjut untuk optimasi teknikkultur dan pencegahan kontaminasi masih dibutuhkan sehingga sel dapat tumbuh baik.AbstractFibroblast cell culture method has been used for wound healing and skin aging studies. Thismethod was used for cell development imaging study, celullar kinetic proliferation andextracelullar matrix component biosynthesis. This preeliminary study was done for laboratoricaltechnic optimation as well as problems appeared in fibroblast culture. Fibroblasts primary culturewas divided into 2 type of samples, from 7.5-9.5-day-mice embryo and keloid-patient skin.Primary culture with dissociated fibroblast method was done for mice embryo sample. Keloidtissue sample and normal skin were cultured with skin explant method. Fibroblasts that weretaken from mice embryo primary culture grew well

  5. The design and implementation of a study to investigate the effectiveness of community vs hospital eye service follow-up for patients with neovascular age-related macular degeneration with quiescent disease.

    Science.gov (United States)

    Taylor, J; Scott, L J; Rogers, C A; Muldrew, A; O'Reilly, D; Wordsworth, S; Mills, N; Hogg, R; Violato, M; Harding, S P; Peto, T; Townsend, D; Chakravarthy, U; Reeves, B C

    2016-01-01

    IntroductionStandard treatment for neovascular age-related macular degeneration (nAMD) is intravitreal injections of anti-VEGF drugs. Following multiple injections, nAMD lesions often become quiescent but there is a high risk of reactivation, and regular review by hospital ophthalmologists is the norm. The present trial examines the feasibility of community optometrists making lesion reactivation decisions.MethodsThe Effectiveness of Community vs Hospital Eye Service (ECHoES) trial is a virtual trial; lesion reactivation decisions were made about vignettes that comprised clinical data, colour fundus photographs, and optical coherence tomograms displayed on a web-based platform. Participants were either hospital ophthalmologists or community optometrists. All participants were provided with webinar training on the disease, its management, and assessment of the retinal imaging outputs. In a balanced design, 96 participants each assessed 42 vignettes; a total of 288 vignettes were assessed seven times by each professional group.The primary outcome is a participant's judgement of lesion reactivation compared with a reference standard. Secondary outcomes are the frequency of sight threatening errors; judgements about specific lesion components; participant-rated confidence in their decisions about the primary outcome; cost effectiveness of follow-up by optometrists rather than ophthalmologists.DiscussionThis trial addresses an important question for the NHS, namely whether, with appropriate training, community optometrists can make retreatment decisions for patients with nAMD to the same standard as hospital ophthalmologists. The trial employed a novel approach as participation was entirely through a web-based application; the trial required very few resources compared with those that would have been needed for a conventional randomised controlled clinical trial.

  6. Age-Related Macular Degeneration.

    Science.gov (United States)

    Mehta, Sonia

    2015-09-01

    Age-related macular degeneration (AMD) is the leading cause of vision loss in the elderly. AMD is diagnosed based on characteristic retinal findings in individuals older than 50. Early detection and treatment are critical in increasing the likelihood of retaining good and functional vision. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. Degenerated differential pair with controllable transconductance

    NARCIS (Netherlands)

    Mensink, Clemens; Mensink, Clemens H.J.; Nauta, Bram

    1998-01-01

    A differential pair with input transistors and provided with a variable degeneration resistor. The degeneration resistor comprises a series arrangement of two branches of coupled resistors which are shunted in mutually corresponding points by respective control transistors whose gates are

  8. Thinking in systems a primer

    CERN Document Server

    Meadows, Donella H

    2008-01-01

    In the years following her role as the lead author of the international bestseller, "Limits to Growth"-the first book to show the consequences of unchecked growth on a finite planet- Donella Meadows remained a pioneer of environmental and social analysis until her untimely death in 2001. Meadows' newly released manuscript, "Thinking in Systems", is a concise and crucial book offering insight for problem solving on scales ranging from the personal to the global. Edited by the Sustainability Institute's Diana Wright, this essential primer brings systems thinking out of the realm of computers and equations and into the tangible world, showing readers how to develop the systems-thinking skills that thought leaders across the globe consider critical for 21st-century life. Some of the biggest problems facing the world-war, hunger, poverty, and environmental degradation-are essentially system failures. They cannot be solved by fixing one piece in isolation from the others, because even seemingly minor details have e...

  9. Primer on spontaneous heating and pyrophoricity

    Energy Technology Data Exchange (ETDEWEB)

    1994-12-01

    This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

  10. Automated imaging dark adaptometer for investigating hereditary retinal degenerations

    Science.gov (United States)

    Azevedo, Dario F. G.; Cideciyan, Artur V.; Regunath, Gopalakrishnan; Jacobson, Samuel G.

    1995-05-01

    We designed and built an automated imaging dark adaptometer (AIDA) to increase accuracy, reliability, versatility and speed of dark adaptation testing in patients with hereditary retinal degenerations. AIDA increases test accuracy by imaging the ocular fundus for precise positioning of bleaching and stimulus lights. It improves test reliability by permitting continuous monitoring of patient fixation. Software control of stimulus presentation provides broad testing versatility without sacrificing speed. AIDA promises to facilitate the measurement of dark adaptation in studies of the pathophysiology of retinal degenerations and in future treatment trials of these diseases.

  11. A practical primer on geostatistics

    Science.gov (United States)

    Olea, Ricardo A.

    2009-01-01

    has significant methodological implications.Historical Remarks—As a discipline, geostatistics was firmly established in the 1960s by the French engineer Georges Matheron, who was interested in the appraisal of ore reserves in mining. Geostatistics did not develop overnight. Like other disciplines, it has built on previous results, many of which were formulated with different objectives in various fields.Pioneers—Seminal ideas conceptually related to what today we call geostatistics or spatial statistics are found in the work of several pioneers, including: 1940s: A.N. Kolmogorov in turbulent flow and N. Wiener in stochastic processing; 1950s: D. Krige in mining; 1960s: B. Mathern in forestry and L.S. Gandin in meteorologyCalculations—Serious applications of geostatistics require the use of digital computers. Although for most geostatistical techniques rudimentary implementation from scratch is fairly straightforward, coding programs from scratch is recommended only as part of a practice that may help users to gain a better grasp of the formulations.Software—For professional work, the reader should employ software packages that have been thoroughly tested to handle any sampling scheme, that run as efficiently as possible, and that offer graphic capabilities for the analysis and display of results. This primer employs primarily the package Stanford Geomodeling Software (SGeMS) - recently developed at the Energy Resources Engineering Department at Stanford University - as a way to show how to obtain results practically. This applied side of the primer should not be interpreted as the notes being a manual for the use of SGeMS. The main objective of the primer is to help the reader gain an understanding of the fundamental concepts and tools in geostatistics.Organization of the Primer—The chapters of greatest importance are those covering kriging and simulation. All other materials are peripheral and are included for better comprehension of these main

  12. Hexavalent Chromium IV-Free Primer Development

    Science.gov (United States)

    Alldredge, Michael J.; Buck, Amy L.

    2015-01-01

    Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.

  13. Quantitative Microbial Risk Assessment Tutorial - Primer

    Science.gov (United States)

    This document provides a Quantitative Microbial Risk Assessment (QMRA) primer that organizes QMRA tutorials. The tutorials describe functionality of a QMRA infrastructure, guide the user through software use and assessment options, provide step-by-step instructions for implementi...

  14. Menopause 101: A Primer for the Perimenopausal

    Science.gov (United States)

    ... Abstracts Media Award Recipients Media Policy Media Requests Menopause 101: A primer for the perimenopausal The information ... about 2 years earlier. Common Body Changes at Menopause Each woman’s experience of menopause is different. Many ...

  15. Peripheral retinal degenerations and the risk of retinal detachment.

    Science.gov (United States)

    Lewis, Hilel

    2003-07-01

    To review the degenerative diseases of the peripheral retina in relationship with the risk to develop a rhegmatogenous retinal detachment and to present recommendations for use in eyes at increased risk of developing a retinal detachment. Focused literature review and author's clinical experience. Retinal degenerations are common lesions involving the peripheral retina, and most of them are clinically insignificant. Lattice degeneration, degenerative retinoschisis, cystic retinal tufts, and, rarely, zonular traction tufts, can result in a rhegmatogenous retinal detachment. Therefore, these lesions have been considered for prophylactic therapy; however, adequate studies have not been performed to date. Well-designed, prospective, randomized clinical studies are necessary to determine the benefit-risk ratio of prophylactic treatment. In the meantime, the evidence available suggests that most of the peripheral retinal degenerations should not be treated except in rare, high-risk situations.

  16. Light and inherited retinal degeneration

    OpenAIRE

    Paskowitz, D M; LaVail, M M; Duncan, J L

    2006-01-01

    Light deprivation has long been considered a potential treatment for patients with inherited retinal degenerative diseases, but no therapeutic benefit has been demonstrated to date. In the few clinical studies that have addressed this issue, the underlying mutations were unknown. Our rapidly expanding knowledge of the genes and mechanisms involved in retinal degeneration have made it possible to reconsider the potential value of light restriction in specific genetic contexts. This review summ...

  17. Canadian municipal carbon trading primer

    International Nuclear Information System (INIS)

    Seskus, A.

    2002-01-01

    The trading of greenhouse gas (GHG) emissions is being suggested as an effective economic way to meet Canada's Kyoto target. Emissions trading is a market-based instrument that can help achieve environmental improvements while using the market to absorb the economical and effective measures to achieve emissions reductions. Placing a value on emissions means that in order to minimize costs, companies will be motivated to apply the lowest-cost emission reductions possible for regulatory approval. The two main types of emissions trading that exist in Canada are the trading of emissions that lead to the formation of smog or acid rain, and the trading of greenhouse gas emissions that lead to climate change. Since carbon dioxide is the most prevalent GHG, making up approximately 75 per cent of Canadian GHG emissions, the trading of units of GHGs is often referred to as carbon trading. The impact that emissions trading will have on municipal operations was the focus of this primer. The trading of GHG involves buying and selling of allowances of GHGs between contracting parties, usually between one party that is short of GHG credits and another that has excess credits. The 3 common approaches to emissions trading include allowance trading (cap and trade), credit trading (baseline and credit), and a hybrid system which combines both credit and allowance trading systems. The issues that impact municipalities include the debate regarding who owns the credits from landfills, particularly if power is generated using landfill gas and the power is sold as green power. Other viable questions were also addressed, including who can claim emission reduction credits if a city implements energy efficiency projects, or fuel substitution programs. Also, will municipalities be allowed to trade internationally, for example, with municipalities in the United States, and how should they spend their money earned from selling credits. This report also presents highlights from 3 emissions

  18. KENO V.a Primer: A Primer for Criticality Calculations with SCALE/KENO V.a Using CSPAN for Input

    International Nuclear Information System (INIS)

    Busch, R.D.

    2003-01-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory (ORNL) is widely used and accepted around the world for criticality safety analyses. The well-known KENO V.a three-dimensional Monte Carlo criticality computer code is the primary criticality safety analysis tool in SCALE. The KENO V.a primer is designed to help a new user understand and use the SCALE/KENO V.a Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO V.a in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO V.a that are useful in criticality analyses. The primer is based on SCALE 4.4a, which includes the Criticality Safety Processor for Analysis (CSPAN) input processor for Windows personal computers (PCs). A second edition of the primer, which uses the new KENO Visual Editor, is currently under development at ORNL and is planned for publication in late 2003. Each example in this first edition of the primer uses CSPAN to provide the framework for data input. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO V.a input and allows the user to quickly run a simple criticality problem with SCALE/KENO V.a. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO V.a features which are covered in detail in the example problems in that section. Upon completion of the primer, a new user should be comfortable using CSPAN to set up criticality problems in SCALE/KENO V.a

  19. The UVM primer a step-by-step introduction to the universal verification methodology

    CERN Document Server

    Salemi, Ray

    2013-01-01

    The UVM Primer uses simple, runnable code examples, accessible analogies, and an easy-to-read style to introduce you to the foundation of the Universal Verification Methodology. You will learn the basics of object-oriented programming with SystemVerilog and build upon that foundation to learn how to design testbenches using the UVM. Use the UVM Primer to brush up on your UVM knowledge before a job interview to be able to confidently answer questions such as "What is a uvm_agent?" , "How do you use uvm_sequences?", and "When do you use the UVM's factory." The UVM Primer's downloadable code examples give you hands-on experience with real UVM code. Ray Salemi uses online videos (on www.uvmprimer.com) to walk through the code from each chapter and build your confidence. Read The UVM Primer today and start down the path to the UVM.

  20. Effect of oligonucleotide primers in determining viral variability within hosts

    Directory of Open Access Journals (Sweden)

    Moya Andrés

    2004-12-01

    Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  1. Effect of oligonucleotide primers in determining viral variability within hosts.

    Science.gov (United States)

    Bracho, Maria Alma; García-Robles, Inmaculada; Jiménez, Nuria; Torres-Puente, Manuela; Moya, Andrés; González-Candelas, Fernando

    2004-12-09

    Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR) based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV) populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient). Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  2. Evaluation of highly conserved hsp65-specific nested PCR primers for diagnosing Mycobacterium tuberculosis.

    Science.gov (United States)

    Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G

    2017-02-01

    To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.

  3. Novel degenerate PCR method for whole genome amplification applied to Peru Margin (ODP Leg 201 subsurface samples

    Directory of Open Access Journals (Sweden)

    Amanda eMartino

    2012-01-01

    Full Text Available A degenerate PCR-based method of whole-genome amplification, designed to work fluidly with 454 sequencing technology, was developed and tested for use on deep marine subsurface DNA samples. The method, which we have called Random Amplification Metagenomic PCR (RAMP, involves the use of specific primers from Roche 454 amplicon sequencing, modified by the addition of a degenerate region at the 3’ end. It utilizes a PCR reaction, which resulted in no amplification from blanks, even after 50 cycles of PCR. After efforts to optimize experimental conditions, the method was tested with DNA extracted from cultured E. coli cells, and genome coverage was estimated after sequencing on three different occasions. Coverage did not vary greatly with the different experimental conditions tested, and was around 62% with a sequencing effort equivalent to a theoretical genome coverage of 14.10X. The GC content of the sequenced amplification product was within 2% of the predicted values for this strain of E. coli. The method was also applied to DNA extracted from marine subsurface samples from ODP Leg 201 site 1229 (Peru Margin, and results of a taxonomic analysis revealed microbial communities dominated by Proteobacteria, Chloroflexi, Firmicutes, Euryarchaeota, and Crenarchaeota, among others. These results were similar to those obtained previously for those samples; however, variations in the proportions of taxa show that community analysis can be sensitive to both the amplification technique used and the method of assigning sequences to taxonomic groups. Overall, we find that RAMP represents a valid methodology for amplifying metagenomes from low biomass samples.

  4. Novel Degenerate PCR Method for Whole-Genome Amplification Applied to Peru Margin (ODP Leg 201) Subsurface Samples

    Science.gov (United States)

    Martino, Amanda J.; Rhodes, Matthew E.; Biddle, Jennifer F.; Brandt, Leah D.; Tomsho, Lynn P.; House, Christopher H.

    2011-01-01

    A degenerate polymerase chain reaction (PCR)-based method of whole-genome amplification, designed to work fluidly with 454 sequencing technology, was developed and tested for use on deep marine subsurface DNA samples. While optimized here for use with Roche 454 technology, the general framework presented may be applicable to other next generation sequencing systems as well (e.g., Illumina, Ion Torrent). The method, which we have called random amplification metagenomic PCR (RAMP), involves the use of specific primers from Roche 454 amplicon sequencing, modified by the addition of a degenerate region at the 3′ end. It utilizes a PCR reaction, which resulted in no amplification from blanks, even after 50 cycles of PCR. After efforts to optimize experimental conditions, the method was tested with DNA extracted from cultured E. coli cells, and genome coverage was estimated after sequencing on three different occasions. Coverage did not vary greatly with the different experimental conditions tested, and was around 62% with a sequencing effort equivalent to a theoretical genome coverage of 14.10×. The GC content of the sequenced amplification product was within 2% of the predicted values for this strain of E. coli. The method was also applied to DNA extracted from marine subsurface samples from ODP Leg 201 site 1229 (Peru Margin), and results of a taxonomic analysis revealed microbial communities dominated by Proteobacteria, Chloroflexi, Firmicutes, Euryarchaeota, and Crenarchaeota, among others. These results were similar to those obtained previously for those samples; however, variations in the proportions of taxa identified illustrates well the generally accepted view that community analysis is sensitive to both the amplification technique used and the method of assigning sequences to taxonomic groups. Overall, we find that RAMP represents a valid methodology for amplifying metagenomes from low-biomass samples. PMID:22319519

  5. Primer on laser scattering diagnostics

    International Nuclear Information System (INIS)

    Jahoda, F.C.

    1978-07-01

    The theory of laser scattering is presented in abbreviated format, with emphasis on physical interpretation, followed by sections on laser sources, practical considerations in designing experiments, and current developments in extending the techniques to multispace and multitime point measurements

  6. Genetic and Clinical Features of Progranulin-Associated Frontotemporal Lobar Degeneration

    NARCIS (Netherlands)

    Chen-Plotkin, A.S.; Martinez-Lage, M.; Sleiman, P.M.A.; Hu, W.; Greene, R.; Wood, E.M.; Bing, S.X.; Grossman, M.; Schellenberg, G.D.; Hatanpaa, K.J.; Weiner, M.F.; White, C.L.; Brooks, W.S.; Halliday, G.M.; Kril, J.J.; Gearing, M.; Beach, T.G.; Graff-Radford, N.R.; Dickson, D.W.; Rademakers, R.; Boeve, B.F.; Pickering-Brown, S.M.; Snowden, J.; van Swieten, J.C.; Heutink, P.; Seelaar, H.; Murrell, J.R.; Ghetti, B.; Spina, S.; Grafman, J.; Kaye, J.A.; Woltjer, R.L.; Mesulam, M.; Bigio, E.; Llado, A.; Miller, B.L.; Alzualde, A.; Moreno, F.; Rohrer, J.D.; Mackenzie, I.R.A.; Feldman, H.H.; Hamilton, R.L.; Cruts, M.; Engelborghs, S.; de Deyn, P.P.; Van Broeckhoven, C.; Bird, T.D.; Cairns, N.J.; Goate, A.; Frosch, M.P.; Riederer, P.F.; Bogdanovic, N.; Lee, V.M.Y.; Trojanowski, J.Q.; Van Deerlin, V.M.

    2011-01-01

    Objective: To assess the relative frequency of unique mutations and their associated characteristics in 97 individuals with mutations in progranulin (GRN), an important cause of frontotemporal lobar degeneration (FTLD). Participants and Design: A 46-site International Frontotemporal Lobar

  7. Disc degeneration: current surgical options

    Directory of Open Access Journals (Sweden)

    C Schizas

    2010-10-01

    Full Text Available Chronic low back pain attributed to lumbar disc degeneration poses a serious challenge to physicians. Surgery may be indicated in selected cases following failure of appropriate conservative treatment. For decades, the only surgical option has been spinal fusion, but its results have been inconsistent. Some prospective trials show superiority over usual conservative measures while others fail to demonstrate its advantages. In an effort to improve results of fusion and to decrease the incidence of adjacent segment degeneration, total disc replacement techniques have been introduced and studied extensively. Short-term results have shown superiority over some fusion techniques. Mid-term results however tend to show that this approach yields results equivalent to those of spinal fusion. Nucleus replacement has gained some popularity initially, but evidence on its efficacy is scarce. Dynamic stabilisation, a technique involving less rigid implants than in spinal fusion and performed without the need for bone grafting, represents another surgical option. Evidence again is lacking on its superiority over other surgical strategies and conservative measures. Insertion of interspinous devices posteriorly, aiming at redistributing loads and relieving pain, has been used as an adjunct to disc removal surgery for disc herniation. To date however, there is no clear evidence on their efficacy. Minimally invasive intradiscal thermocoagulation techniques have also been tried, but evidence of their effectiveness is questioned. Surgery using novel biological solutions may be the future of discogenic pain treatment. Collaboration between clinicians and basic scientists in this multidisciplinary field will undoubtedly shape the future of treating symptomatic disc degeneration.

  8. Lattice degeneration of the retina.

    Science.gov (United States)

    Byer, N E

    1979-01-01

    Lattice degeneration of the retina is the most important of all clinically distinct entities that effect the peripheral fundus and are related to retinal detachment. The purpose of this review is to survey the extensive literature, to evaluate the many diverse opinions on this subject, and to correlate and summarize all the known facts regarding this disease entity. The disease is fully defined and described, both clinically and histologically. Some aspects of the disease are still poorly understood, and some remain controversial, especially in the area of management. For this reason, the indications for treatment are discussed under eight subsections, with a view toward providing practical guidelines for recommendations in management.

  9. Age-related macular degeneration

    DEFF Research Database (Denmark)

    la Cour, Morten; Kiilgaard, Jens Folke; Nissen, Mogens Holst

    2002-01-01

    Age-related macular degeneration (AMD) is a common macular disease affecting elderly people in the Western world. It is characterised by the appearance of drusen in the macula, accompanied by choroidal neovascularisation (CNV) or geographic atrophy. The disease is more common in Caucasian....... Smoking is probably also a risk factor. Preventive strategies using macular laser photocoagulation are under investigation, but their efficacy in preventing visual loss is as yet unproven. There is no treatment with proven efficacy for geographic atrophy. Optimal treatment for exudative AMD requires...

  10. Climate Change, Health, and Communication: A Primer.

    Science.gov (United States)

    Chadwick, Amy E

    2016-01-01

    Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.

  11. Microsatellite Primers for Fungus-Growing Ants

    DEFF Research Database (Denmark)

    Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  12. Microsatellite primers for fungus-growing ants

    DEFF Research Database (Denmark)

    Villesen, Palle; Gertsch, P J; Boomsma, JJ

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  13. Comparison of shear bond strength of orthodontic brackets using various zirconia primers.

    Science.gov (United States)

    Lee, Ji-Yeon; Kim, Jin-Seok; Hwang, Chung-Ju

    2015-07-01

    The aim of this study was to compare the shear bond strength (SBS) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer, and subjected to thermocycling. We designed 10 experimental groups following the surface treatment and thermocycling. The surface was treated with one of the following method: no-primer (NP), Porcelain Conditioner (PC), Z-PRIME Plus (ZP), Monobond Plus (MP) and Zirconia Liner Premium (ZL) (n=20). Then each group was subdivided to non-thermocycled and thermocycled groups (NPT, PC, ZPT, MPT, ZLT) (n=10). Orthodontic brackets were bonded to the specimens using Transbond™ XT Paste and light cured for 15 s at 1,100 mW/cm(2). The SBS was measured at a 1 mm/min crosshead speed. The failure mode was assessed by examination with a stereomicroscope and the amount of bonding resin remaining on the zirconia surface was scored using the modified adhesive remnant index (ARI). The SBS of all experimental groups decreased after thermocycling. Before thermocycling, the SBS was ZL, ZP ≥ MP ≥ PC > NP but after thermocycling, the SBS was ZLT ≥ MPT ≥ ZPT > PCT = NPT (p > 0.05). For the ARI score, both of the groups lacking primer (NP and NPT) displayed adhesive failure modes, but the groups with zirconia primers (ZP, ZPT, MP, MPT, ZL, and ZLT) were associated with mixed failure modes. Surface treatment with a zirconia primer increases the SBS relative to no-primer or silane primer application between orthodontic brackets and zirconia prostheses.

  14. Atmel AVR Microcontroller Primer Programming and Interfacing, Second Edition

    CERN Document Server

    Barrett, Steven F

    2012-01-01

    This textbook provides practicing scientists and engineers a primer on the Atmel AVR microcontroller. In this second edition we highlight the popular ATmega164 microcontroller and other pin-for-pin controllers in the family with a complement of flash memory up to 128 kbytes. The second edition also adds a chapter on embedded system design fundamentals and provides extended examples on two different autonomous robots. Our approach is to provide the fundamental skills to quickly get up and operating with this internationally popular microcontroller. We cover the main subsystems aboard the ATmega

  15. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Science.gov (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  16. A mouse model for degeneration of the spiral ligament.

    Science.gov (United States)

    Kada, Shinpei; Nakagawa, Takayuki; Ito, Juichi

    2009-06-01

    Previous studies have indicated the importance of the spiral ligament (SL) in the pathogenesis of sensorineural hearing loss. The aim of this study was to establish a mouse model for SL degeneration as the basis for the development of new strategies for SL regeneration. We injected 3-nitropropionic acid (3-NP), an inhibitor of succinate dehydrogenase, at various concentrations into the posterior semicircular canal of adult C57BL/6 mice. Saline-injected animals were used as controls. Auditory function was monitored by measurements of auditory brain stem responses (ABRs). On postoperative day 14, cochlear specimens were obtained after the measurement of the endocochlear potential (EP). Animals that were injected with 5 or 10 mM 3-NP showed a massive elevation of ABR thresholds along with extensive degeneration of the cochleae. Cochleae injected with 1 mM 3-NP exhibited selective degeneration of the SL fibrocytes but alterations in EP levels and ABR thresholds were not of sufficient magnitude to allow for testing functional recovery after therapeutic interventions. Animals injected with 3 mM 3-NP showed a reduction of around 50% in the EP along with a significant loss of SL fibrocytes, although degeneration of spiral ganglion neurons and hair cells was still present in certain regions. These findings indicate that cochleae injected with 3 mM 3-NP may be useful in investigations designed to test the feasibility of new therapeutic manipulations for functional SL regeneration.

  17. A primer on motor vehicle air pollution.

    Science.gov (United States)

    1973-01-01

    This primer presents a brief state-of-the art review of motor vehicle air pollution. Its purpose is to aid highway personnel in understanding the nature of this environmental problem on our highways and to present possible solutions for its abatement...

  18. A Primer on Basic Effect Size Concepts.

    Science.gov (United States)

    Elmore, Patricia B.; Rotou, Ourania

    The increased interest in reporting effect sizes means that it is necessary to consider what should be included in a primer on effect sizes. A review of papers on effect sizes and commonly repeated statistical analyses suggests that it is important to discuss effect sizes relative to bivariate correlation, t-tests, analysis of variance/covariance,…

  19. Forest Interpreter's Primer on Fire Management.

    Science.gov (United States)

    Zelker, Thomas M.

    Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…

  20. Java to C: A Primer

    DEFF Research Database (Denmark)

    McDowell, Charlie; Villadsen, Jørgen

    This book is designed to be used as a quick introduction to C for programmers already familiar with Java. It is not a replacement for a reference book on C but is instead a supplement. For the programmer already familiar with Java, the typical book on C requires the reader to wade through many...... details of already-familiar material. In this book, we quickly present the main concepts needed to begin writing serious programs in C, highlighting the differences between C and Java....

  1. Degeneration and height of cervical discs classified from MRI compared with precise height measurements from radiographs

    Energy Technology Data Exchange (ETDEWEB)

    Kolstad, Frode [National Centre of Spinal Disorders, Norwegian University of Science and Technology, University Hospital of Trondheim, 7006 Trondheim (Norway)]. E-mail: frode.kolstad@medisin.ntnu.no; Myhr, Gunnar [Department of Radiology, University Hospital of Trondheim, 7006 Trondheim (Norway); Kvistad, Kjell Arne [Department of Radiology, University Hospital of Trondheim, 7006 Trondheim (Norway); Nygaard, Oystein P. [National Centre of Spinal Disorders, Norwegian University of Science and Technology, University Hospital of Trondheim, 7006 Trondheim (Norway); Leivseth, Gunnar [Department of Neuromedicine, Faculty of Medicine, Norwegian University of Science and Technology, University Hospital of Trondheim, 7006 Trondheim (Norway)

    2005-09-01

    Study design: Descriptive study comparing MRI classifications with measurements from radiographs. Objectives: 1.Define the relationship between MRI classified cervical disc degeneration and objectively measured disc height. 2.Assess the level of inter- and intra-observer errors using MRI in defining cervical disc degeneration. Summary of background data: Cervical spine degeneration has been defined radiologically by loss of disc height, decreased disc and bone marrow signal intensity and disc protrusion/herniation on MRI. The intra- and inter-observer error using MRI in defining cervical degeneration influences data interpretation. Few previous studies have addressed this source of error. The relation and time sequence between cervical disc degeneration classified by MRI and cervical disc height decrease measured from radiographs is unclear. Methods: The MRI classification of degeneration was based on nucleus signal, prolaps identification and bone marrow signal. Two neuro-radiologists evaluated the MR-images independently in a blinded fashion. The radiographic disc height measurements were done by a new computer-assisted method compensating for image distortion and permitting comparison with normal level-, age- and gender-appropriate disc height. Results/conclusions: 1.Progressing disc degeneration classified from MRI is on average significantly associated with a decrease of disc height as measured from radiographs. Within each MRI defined category of degeneration measured disc heights, however, scatter in a wide range. 2.The inter-observer agreement between two neuro-radiologists in both defining degeneration and disc height by MRI was only moderate. Studies addressing questions related to cervical disc degeneration should take this into consideration.

  2. Degeneration and height of cervical discs classified from MRI compared with precise height measurements from radiographs

    International Nuclear Information System (INIS)

    Kolstad, Frode; Myhr, Gunnar; Kvistad, Kjell Arne; Nygaard, Oystein P.; Leivseth, Gunnar

    2005-01-01

    Study design: Descriptive study comparing MRI classifications with measurements from radiographs. Objectives: 1.Define the relationship between MRI classified cervical disc degeneration and objectively measured disc height. 2.Assess the level of inter- and intra-observer errors using MRI in defining cervical disc degeneration. Summary of background data: Cervical spine degeneration has been defined radiologically by loss of disc height, decreased disc and bone marrow signal intensity and disc protrusion/herniation on MRI. The intra- and inter-observer error using MRI in defining cervical degeneration influences data interpretation. Few previous studies have addressed this source of error. The relation and time sequence between cervical disc degeneration classified by MRI and cervical disc height decrease measured from radiographs is unclear. Methods: The MRI classification of degeneration was based on nucleus signal, prolaps identification and bone marrow signal. Two neuro-radiologists evaluated the MR-images independently in a blinded fashion. The radiographic disc height measurements were done by a new computer-assisted method compensating for image distortion and permitting comparison with normal level-, age- and gender-appropriate disc height. Results/conclusions: 1.Progressing disc degeneration classified from MRI is on average significantly associated with a decrease of disc height as measured from radiographs. Within each MRI defined category of degeneration measured disc heights, however, scatter in a wide range. 2.The inter-observer agreement between two neuro-radiologists in both defining degeneration and disc height by MRI was only moderate. Studies addressing questions related to cervical disc degeneration should take this into consideration

  3. Rust transformation/rust compatible primers

    Science.gov (United States)

    Emeric, Dario A.; Miller, Christopher E.

    1993-01-01

    Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

  4. Genetics of Frontotemporal Lobar Degeneration

    Directory of Open Access Journals (Sweden)

    Daniela eGalimberti

    2012-04-01

    Full Text Available Frontotemporal Lobar Degeneration (FTLD is the most frequent neurodegenerative disorder with a presenile onset. It presents with a spectrum of clinical manifestations, ranging from behavioural and executive impairment to language disorders and motor dysfunction. Familial aggregation is frequently reported in FTLD, and about 10% of cases have an autosomal dominant transmission. Microtubule Associated Protein Tau gene (MAPT mutations have been the first ones identified and are generally associated with early onset behavioural variant Frontotemporal Dementia (bvFTD phenotype. More recently, progranulin gene (GRN mutations were recognized in association with familial form of FTLD. In addition, other genes are linked to rare cases of familial FTLD. Lastly, a number of genetic risk factors for sporadic forms have also been identified.

  5. Frontotemporal Degeneration in a Child.

    Science.gov (United States)

    Terrill, Tyler; Pascual, Juan M

    2017-07-01

    There is a predilection for the frontal and temporal lobes in certain cases of dementia in the adult, leading to the syndrome of frontotemporal dementia. However, this syndrome has seemed to elude the developing brain until now. We describe an example of apparently selective neurodegeneration of the frontal and temporal regions during development associated with some of the clinical, magnetic resonance imaging, and fludeoxyglucose positron emission tomography (FDG PET) scan features of canonical frontotemporal dementia in the adult. This patient does not have any of the common frontotemporal dementia-causing mutations or known progressive brain disorders of children. This patient illustrates that symptomatic, selective, and progressive vulnerability of the frontal and temporal lobes is not restricted to adulthood, expanding the phenotype of frontotemporal degeneration. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Naturalness of nearly degenerate neutrinos

    International Nuclear Information System (INIS)

    Casas, J.A.; Espinosa, J.R.; Ibarra, A.; Navarro, I.

    1999-01-01

    If neutrinos are to play a relevant cosmological role, they must be essentially degenerate. We study whether radiative corrections can or cannot be responsible for the small mass splittings, in agreement with all the available experimental data. We perform an exhaustive exploration of the bimaximal mixing scenario, finding that (i) the vacuum oscillations solution to the solar neutrino problem is always excluded; (ii) if the mass matrix is produced by a see-saw mechanism, there are large regions of the parameter space consistent with the large angle MSW solution, providing a natural origin for the Δm sol 2 atm 2 hierarchy; (iii) the bimaximal structure becomes then stable under radiative corrections. We also provide analytical expressions for the mass splittings and mixing angles and present a particularly simple see-saw ansatz consistent with all observations

  7. Eigenstate Thermalization for Degenerate Observables

    Science.gov (United States)

    Anza, Fabio; Gogolin, Christian; Huber, Marcus

    2018-04-01

    Under unitary time evolution, expectation values of physically reasonable observables often evolve towards the predictions of equilibrium statistical mechanics. The eigenstate thermalization hypothesis (ETH) states that this is also true already for individual energy eigenstates. Here we aim at elucidating the emergence of the ETH for observables that can realistically be measured due to their high degeneracy, such as local, extensive, or macroscopic observables. We bisect this problem into two parts, a condition on the relative overlaps and one on the relative phases between the eigenbases of the observable and Hamiltonian. We show that the relative overlaps are unbiased for highly degenerate observables and demonstrate that unless relative phases conspire to cumulative effects, this makes such observables verify the ETH. Through this we elucidate potential pathways towards proofs of thermalization.

  8. Functional genes to assess nitrogen cycling and aromatic hydrocarbon degradation: primers and processing matter

    Directory of Open Access Journals (Sweden)

    Christopher Ryan Penton

    2013-09-01

    Full Text Available Targeting sequencing to genes involved in key environmental processes, i.e. ecofunctional genes, provides an opportunity to sample nature’s gene guilds to greater depth and help link community structure to process-level outcomes. Vastly different approaches have been implemented for sequence processing and, ultimately, for taxonomic placement of these gene reads. The overall quality of next generation sequence analysis of functional genes is dependent on multiple steps and assumptions of unknown diversity. To illustrate current issues surrounding amplicon read processing we provide examples for three ecofunctional gene groups. A combination of in-silico, environmental and cultured strain sequences was used to test new primers targeting the dioxin and dibenzofuran degrading genes dxnA1, dbfA1, and carAa. The majority of obtained environmental sequences were classified into novel sequence clusters, illustrating the discovery value of the approach. For the nitrite reductase step in denitrification, the well-known nirK primers exhibited deficiencies in reference database coverage, illustrating the need to refine primer-binding sites and/or to design multiple primers, while nirS primers exhibited bias against five phyla. Amino acid-based OTU clustering of these two N-cycle genes from soil samples yielded only 114 unique nirK and 45 unique nirS genus-level groupings, likely a reflection of constricted primer coverage. Finally, supervised and non-supervised OTU analysis methods were compared using the nifH gene of nitrogen fixation, with generally similar outcomes, but the clustering (non-supervised method yielded higher diversity estimates and stronger site-based differences. High throughput amplicon sequencing can provide inexpensive and rapid access to nature’s related sequences by circumventing the culturing barrier, but each unique gene requires individual considerations in terms of primer design and sequence processing and classification.

  9. Economics : pricing, demand, and economic efficiency : a primer.

    Science.gov (United States)

    2008-11-01

    The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...

  10. Primer on consumer marketing research : procedures, methods, and tools

    Science.gov (United States)

    1994-03-01

    The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...

  11. Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.

    Science.gov (United States)

    Françoso, E; Arias, M C

    2013-09-01

    Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.

  12. Frontotemporal lobar degeneration: current perspectives

    Directory of Open Access Journals (Sweden)

    Riedl L

    2014-02-01

    Full Text Available Lina Riedl,1 Ian R Mackenzie,2 Hans Förstl,1 Alexander Kurz,1 Janine Diehl-Schmid1 1Center for Cognitive Disorders, Department of Psychiatry and Psychotherapy, Klinikum rechts der Isar, Technische Universität München, Munich, Germany; 2Department of Pathology and Laboratory Medicine, University of British Columbia, Vancouver, Canada Abstract: The term frontotemporal lobar degeneration (FTLD refers to a group of progressive brain diseases, which preferentially involve the frontal and temporal lobes. Depending on the primary site of atrophy, the clinical manifestation is dominated by behavior alterations or impairment of language. The onset of symptoms usually occurs before the age of 60 years, and the mean survival from diagnosis varies between 3 and 10 years. The prevalence is estimated at 15 per 100,000 in the population aged between 45 and 65 years, which is similar to the prevalence of Alzheimer's disease in this age group. There are two major clinical subtypes, behavioral-variant frontotemporal dementia and primary progressive aphasia. The neuropathology underlying the clinical syndromes is also heterogeneous. A common feature is the accumulation of certain neuronal proteins. Of these, the microtubule-associated protein tau (MAPT, the transactive response DNA-binding protein, and the fused in sarcoma protein are most important. Approximately 10% to 30% of FTLD shows an autosomal dominant pattern of inheritance, with mutations in the genes for MAPT, progranulin (GRN, and in the chromosome 9 open reading frame 72 (C9orf72 accounting for more than 80% of familial cases. Although significant advances have been made in recent years regarding diagnostic criteria, clinical assessment instruments, neuropsychological tests, cerebrospinal fluid biomarkers, and brain imaging techniques, the clinical diagnosis remains a challenge. To date, there is no specific pharmacological treatment for FTLD. Some evidence has been provided for serotonin reuptake

  13. Motor axon excitability during Wallerian degeneration

    DEFF Research Database (Denmark)

    Moldovan, Mihai; Alvarez, Susana; Krarup, Christian

    2008-01-01

    Axonal loss and degeneration are major factors in determining long-term outcome in patients with peripheral nerve disorders or injury. Following loss of axonal continuity, the isolated nerve stump distal to the lesion undergoes Wallerian degeneration in several phases. In the initial 'latent' phase......, action potential propagation and structural integrity of the distal segment are maintained. The aim of this study was to investigate in vivo the changes in membrane function of motor axons during the 'latent' phase of Wallerian degeneration. Multiple indices of axonal excitability of the tibial nerve...

  14. Disk degeneration in 14 year old children

    International Nuclear Information System (INIS)

    Erkintalo, M.; Salminen, J.J.; Paajanen, H.; Terho, P.; Kormano, M.

    1989-01-01

    This paper reports low back symptoms of 1,500 school children (14 years old) evaluated with a questionnaire and with a standardized clinical examination. Forty children who complained of recurrent and/or persistent low back pain and 40 matching symptomless controls were randomly chosen to undergo MR imaging of the lumbar spine. Premature disk degeneration was seen in 25.5% of asymptomatic children and in 40% of those with low back pain. The difference was statistically not significant. Disk degeneration is a surprisingly frequent MR finding in symptomless children. Premature disk degeneration may be the cause of low back pain in some children but is not always symptomatic in childhood

  15. Total absorption by degenerate critical coupling

    Energy Technology Data Exchange (ETDEWEB)

    Piper, Jessica R., E-mail: jrylan@stanford.edu; Liu, Victor; Fan, Shanhui, E-mail: shanhui@stanford.edu [Ginzton Laboratory, Department of Electrical Engineering, Stanford University, Stanford, California 94305 (United States)

    2014-06-23

    We consider a mirror-symmetric resonator with two ports. We show that, when excited from a single port, complete absorption can be achieved through critical coupling to degenerate resonances with opposite symmetry. Moreover, any time two resonances with opposite symmetry are degenerate in frequency and absorption is always significantly enhanced. In contrast, when two resonances with the same symmetry are nearly degenerate, there is no absorption enhancement. We numerically demonstrate these effects using a graphene monolayer on top of a photonic crystal slab, illuminated from a single side in the near-infrared.

  16. Genetics of frontotemporal lobar degeneration

    Directory of Open Access Journals (Sweden)

    Aswathy P

    2010-10-01

    Full Text Available Frontotemporal lobar degeneration (FTLD is a highly heterogenous group of progressive neurodegenerative disorders characterized by atrophy of prefrontal and anterior temporal cortices. Recently, the research in the field of FTLD has gained increased attention due to the clinical, neuropathological, and genetic heterogeneity and has increased our understanding of the disease pathogenesis. FTLD is a genetically complex disorder. It has a strong genetic basis and 50% of patients show a positive family history for FTLD. Linkage studies have revealed seven chromosomal loci and a number of genes including MAPT, PGRN, VCP, and CHMB-2B are associated with the disease. Neuropathologically, FTLD is classified into tauopathies and ubiquitinopathies. The vast majority of FTLD cases are characterized by pathological accumulation of tau or TDP-43 positive inclusions, each as an outcome of mutations in MAPT or PGRN, respectively. Identification of novel proteins involved in the pathophysiology of the disease, such as progranulin and TDP-43, may prove to be excellent biomarkers of disease progression and thereby lead to the development of better therapeutic options through pharmacogenomics. However, much more dissections into the causative pathways are needed to get a full picture of the etiology. Over the past decade, advances in research on the genetics of FTLD have revealed many pathogenic mutations leading to different clinical manifestations of the disease. This review discusses the current concepts and recent advances in our understanding of the genetics of FTLD.

  17. Degeneration of biogenic superparamagnetic magnetite.

    Science.gov (United States)

    Li, Y-L; Pfiffner, S M; Dyar, M D; Vali, H; Konhauser, K; Cole, D R; Rondinone, A J; Phelps, T J

    2009-01-01

    Magnetite crystals precipitated as a consequence of Fe(III) reduction by Shewanella algae BrY after 265 h incubation and 5-year anaerobic storage were investigated with transmission electron microscopy, Mössbauer spectroscopy and X-ray diffraction. The magnetite crystals were typically superparamagnetic with an approximate size of 13 nm. The lattice constants of the 265 h and 5-year crystals are 8.4164A and 8.3774A, respectively. The Mössbauer spectra indicated that the 265 h magnetite had excess Fe(II) in its crystal-chemistry (Fe(3+) (1.990)Fe(2+) (1.015)O(4)) but the 5-year magnetite was Fe(II)-deficient in stoichiometry (Fe(3+) (2.388)Fe(2+) (0.419)O(4)). Such crystal-chemical changes may be indicative of the degeneration of superparamagnetic magnetite through the aqueous oxidization of Fe(II) anaerobically, and the concomitant oxidation of the organic phases (fatty acid methyl esters) that were present during the initial formation of the magnetite. The observation of a corona structure on the aged magnetite corroborates the anaerobic oxidation of Fe(II) on the outer layers of magnetite crystals. These results suggest that there may be a possible link between the enzymatic activity of the bacteria and the stability of Fe(II)-excess magnetite, which may help explain why stable nano-magnetite grains are seldom preserved in natural environments.

  18. Degeneration of Biogenic Superparamagnetic Magnetite

    Energy Technology Data Exchange (ETDEWEB)

    Li, Dr. Yi-Liang [University of Tennessee, Knoxville (UTK); Pfiffner, Susan M. [University of Tennessee, Knoxville (UTK); Dyar, Dr. M Darby [Mount Holyoke College; Vali, Dr. Hojatolah [McGill University, Montreal, Quebec; Konhauser, Dr, Kurt [University of Alberta; Cole, David R [ORNL; Rondinone, Adam Justin [ORNL; Phelps, Tommy Joe [ORNL

    2009-01-01

    ABSTRACT. Magnetite crystals precipitated as a consequence of Fe(III) reduction by Shewanella algae BrY after 265 hours incubation and 5-year storage were investigated with transmission electron microscopy, M ssbauer spectroscopy and X-ray diffraction. The magnetite crystals were typically superparamagnetic with an approximate size of 13 nm. The lattice constants of the 265 hour and 5-year crystals are 8.4164 and 8.3774 , respectively. The M ssbauer spectra indicated that the 265 hour magnetite had excess Fe(II) in its crystal-chemistry (Fe3+1.9901Fe2+ 1.0149O4) but the 5-year magnetite was Fe(II)-deficient in stoichiometry (Fe3+2.3875Fe2+0.4188O4). Such crystal-hemical changes may be indicative of the degeneration of superparamagnetic magnetite through the aqueous oxidization of Fe(II) anaerobically, and the concomitant oxidation of the organic phases(fatty acid methyl esters) that were present during the initial formation of the magnetite. The observation of a corona structure on the aged magnetite corroborates the oxidation of Fe(II) on the outer layers of magnetite crystals. These results suggest that there may be a possible link between the enzymatic activity of the bacteria and the stability of Fe(II)-excess magnetite, which may help explain why stable nano-magnetite grains are seldom preserved in natural environments.

  19. Genus-specific PCR Primers Targeting Intracellular Parasite Euduboscquella (Dinoflagellata: Syndinea)

    Science.gov (United States)

    Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

    2018-03-01

    We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

  20. Primer: Fracture mechanics in the nuclear power industry

    International Nuclear Information System (INIS)

    Wessel, E.T.; Server, W.L.; Kennedy, E.L.

    1990-01-01

    This Primer is intended to familiarize utility engineers with the fracture mechanics technology and to provide the basis for a working knowledge of the subject. It is directed towards all the engineering disciplines that are involved either directly or indirectly with the structural reliability of electrical power generation equipment and systems. These engineering disciplines include such areas as: design and stress analysis, metallurgy and materials, nondestructive inspection and quality control, structural analysis and reliability engineering, chemical engineering and water chemistry control, and architectural engineering. This Primer does not provide a comprehensive, in-depth treatment of all the detailed aspects involved in fracture mechanics. It does, however, provide sufficient information and a common vocabulary that should enable engineers to: read and converse intelligently about the subject, understand and utilize ASME Codes and Regulatory Guides involving fracture mechanics, absorb technical information presented and discussed at various technical meetings, and begin to apply this technology towards actual engineering problems encountered in the course of their work. Example problems are provided to further enhance an understanding of fracture mechanics. Also, Appendix A describes fracture mechanics computer codes available through EPRI to analyze rotors, reactor pressure vessels and piping

  1. Magnetic resonance imaging of intervertebral disc degeneration

    International Nuclear Information System (INIS)

    Maeda, Hiroshi; Noguchi, Masao; Kira, Hideaki; Fujiki, Hiroshi; Shimokawa, Isao; Hinoue, Kaichi.

    1993-01-01

    The aim of this study was to correlate the degree of lumbar intervertebral disc degeneration with findings of magnetic resonance imaging (MRI). Seventeen autopsied (from 7 patients) and 21 surgical (from 20 patients) intervertebral discs were used as specimens for histopathological examination. In addition, 21 intervertebral discs were examined on T2-weighted images. Histopathological findings from both autopsied and surgical specimens were well correlated with MRI findings. In particular, T2-weighted images reflected increased collagen fibers and rupture within the fibrous ring accurately. However, when severely degenerated intervertebral discs and hernia protruding the posterior longitudinal ligament existed, histological findings were not concordant well with T2-weighted images. Morphological appearances of autopsy specimens, divided into four on T2-weighted images, were well consistent with histological degeneration. This morphological classification, as shown on T2-weighted images, could also be used in the evaluation of intervertebral disc degeneration. (N.K.)

  2. Magnetic resonance imaging of intervertebral disc degeneration

    Energy Technology Data Exchange (ETDEWEB)

    Maeda, Hiroshi; Noguchi, Masao (Kitakyushu City Yahata Hospital, Fukuoka (Japan)); Kira, Hideaki; Fujiki, Hiroshi; Shimokawa, Isao; Hinoue, Kaichi

    1993-02-01

    The aim of this study was to correlate the degree of lumbar intervertebral disc degeneration with findings of magnetic resonance imaging (MRI). Seventeen autopsied (from 7 patients) and 21 surgical (from 20 patients) intervertebral discs were used as specimens for histopathological examination. In addition, 21 intervertebral discs were examined on T2-weighted images. Histopathological findings from both autopsied and surgical specimens were well correlated with MRI findings. In particular, T2-weighted images reflected increased collagen fibers and rupture within the fibrous ring accurately. However, when severely degenerated intervertebral discs and hernia protruding the posterior longitudinal ligament existed, histological findings were not concordant well with T2-weighted images. Morphological appearances of autopsy specimens, divided into four on T2-weighted images, were well consistent with histological degeneration. This morphological classification, as shown on T2-weighted images, could also be used in the evaluation of intervertebral disc degeneration. (N.K.).

  3. Genetics Home Reference: Stargardt macular degeneration

    Science.gov (United States)

    ... recognizing faces. In most people with Stargardt macular degeneration , a fatty yellow pigment (lipofuscin) builds up in cells underlying the macula. Over time, the abnormal accumulation of this substance ...

  4. Ataxias and Cerebellar or Spinocerebellar Degeneration

    Science.gov (United States)

    ... and conducts a broad range of basic and clinical research on cerebellar and spinocerebellar degeneration, including work aimed at finding the cause(s) of ataxias and ways to ... Publications Definition Ataxia ...

  5. Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

    DEFF Research Database (Denmark)

    Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.

    2011-01-01

    BACKGROUND: MicroRNAs are important regulators of gene expression at the post-transcriptional level and play an important role in many biological processes. Due to the important biological role it is of great interest to quantitatively determine their expression level in different biological...... be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...... samples than a similar method based on locked nucleic acids-spiked primers, which is in agreement with the observation that locked nucleic acid interferes with efficient amplification of short templates. The higher amplification efficiency of DNA primers translates into higher sensitivity and precision...

  6. Hamiltonization of theories with degenerate coordinates

    International Nuclear Information System (INIS)

    Gitman, D.M.; Tyutin, I.V.

    2002-01-01

    We consider a class of Lagrangian theories where part of the coordinates does not have any time derivatives in the Lagrange function (we call such coordinates degenerate). We advocate that it is reasonable to reconsider the conventional definition of singularity based on the usual Hessian and, moreover, to simplify the conventional hamiltonization procedure. In particular, in such a procedure, it is not necessary to complete the degenerate coordinates with the corresponding conjugate momenta

  7. Hamiltonization of theories with degenerate coordinates

    Energy Technology Data Exchange (ETDEWEB)

    Gitman, D.M. E-mail: gitman@fma.if.usp.br; Tyutin, I.V. E-mail: tyutin@lpi.ru

    2002-05-27

    We consider a class of Lagrangian theories where part of the coordinates does not have any time derivatives in the Lagrange function (we call such coordinates degenerate). We advocate that it is reasonable to reconsider the conventional definition of singularity based on the usual Hessian and, moreover, to simplify the conventional hamiltonization procedure. In particular, in such a procedure, it is not necessary to complete the degenerate coordinates with the corresponding conjugate momenta.

  8. Splitting deformations of degenerations of complex curves towards the classification of atoms of degenerations

    CERN Document Server

    2006-01-01

    The author develops a deformation theory for degenerations of complex curves; specifically, he treats deformations which induce splittings of the singular fiber of a degeneration. He constructs a deformation of the degeneration in such a way that a subdivisor is "barked" (peeled) off from the singular fiber. These "barking deformations" are related to deformations of surface singularities (in particular, cyclic quotient singularities) as well as the mapping class groups of Riemann surfaces (complex curves) via monodromies. Important applications, such as the classification of atomic degenerations, are also explained.

  9. Low-copy nuclear primers and ycf1 primers in Cactaceae.

    Science.gov (United States)

    Franck, Alan R; Cochrane, Bruce J; Garey, James R

    2012-10-01

    To increase the number of variable regions available for phylogenetic study in the Cactaceae, primers were developed for a portion of the plastid ycf1 gene and intron-spanning regions of two low-copy nuclear genes (isi1, nhx1). • Primers were tested on several families within Caryophyllales, focusing on the Cactaceae. Gel electrophoresis indicated positive amplification in most samples. Sequences of these three regions (isi1, nhx1, ycf1) from Harrisia exhibited variation similar to or greater than two plastid regions (atpB-rbcL intergenic spacer and rpl16 intron). • The isi, nhx, and ycf1 primers amplify phylogenetically useful information applicable to the Cactaceae and other families in the Caryophyllales.

  10. Age related macular degeneration and visual disability.

    Science.gov (United States)

    Christoforidis, John B; Tecce, Nicola; Dell'Omo, Roberto; Mastropasqua, Rodolfo; Verolino, Marco; Costagliola, Ciro

    2011-02-01

    Age-related macular degeneration (AMD) is the leading cause of central blindness or low vision among the elderly in industrialized countries. AMD is caused by a combination of genetic and environmental factors. Among modifiable environmental risk factors, cigarette smoking has been associated with both the dry and wet forms of AMD and may increase the likelihood of worsening pre-existing AMD. Despite advances, the treatment of AMD has limitations and affected patients are often referred for low vision rehabilitation to help them cope with their remaining eyesight. The characteristic visual impairment for both forms of AMD is loss of central vision (central scotoma). This loss results in severe difficulties with reading that may be only partly compensated by magnifying glasses or screen-projection devices. The loss of central vision associated with the disease has a profound impact on patient quality of life. With progressive central visual loss, patients lose their ability to perform the more complex activities of daily living. Common vision aids include low vision filters, magnifiers, telescopes and electronic aids. Low vision rehabilitation (LVR) is a new subspecialty emerging from the traditional fields of ophthalmology, optometry, occupational therapy, and sociology, with an ever-increasing impact on the usual concepts of research, education, and services for visually impaired patients. Relatively few ophthalmologists practise LVR and fewer still routinely use prismatic image relocation (IR) in AMD patients. IR is a method of stabilizing oculomotor functions with the purpose of promoting better function of preferred retinal loci (PRLs). The aim of vision rehabilitation therapy consists in the achievement of techniques designed to improve PRL usage. The use of PRLs to compensate for diseased foveae has offered hope to these patients in regaining some function. However, in a recently published meta-analysis, prism spectacles were found to be unlikely to be of

  11. Age-related macular degeneration.

    Science.gov (United States)

    Cheung, Lily K; Eaton, Angie

    2013-08-01

    Age-related macular degeneration (AMD) is the leading cause of blindness in the elderly, and the prevalence of the disease increases exponentially with every decade after age 50 years. It is a multifactorial disease involving a complex interplay of genetic, environmental, metabolic, and functional factors. Besides smoking, hypertension, obesity, and certain dietary habits, a growing body of evidence indicates that inflammation and the immune system may play a key role in the development of the disease. AMD may progress from the early form to the intermediate form and then to the advanced form, where two subtypes exist: the nonneovascular (dry) type and the neovascular (wet) type. The results from the Age-Related Eye Disease Study have shown that for the nonneovascular type of AMD, supplementation with high-dose antioxidants (vitamin C, vitamin E, and β-carotene) and zinc is recommended for those with the intermediate form of AMD in one or both eyes or with advanced AMD or vision loss due to AMD in one eye. As for the neovascular type of the advanced AMD, the current standard of therapy is intravitreal injections of vascular endothelial growth factor inhibitors. In addition, lifestyle and dietary modifications including improved physical activity, reduced daily sodium intake, and reduced intake of solid fats, added sugars, cholesterol, and refined grain foods are recommended. To date, no study has demonstrated that AMD can be cured or effectively prevented. Clearly, more research is needed to fully understand the pathophysiology as well as to develop prevention and treatment strategies for this devastating disease. © 2013 Pharmacotherapy Publications, Inc.

  12. Indian hedgehog contributes to human cartilage endplate degeneration.

    Science.gov (United States)

    Wang, Shaowei; Yang, Kun; Chen, Shuai; Wang, Jiying; Du, Guoqing; Fan, Shunwu; Wei, Lei

    2015-08-01

    To determine the role of Indian hedgehog (Ihh) signaling in human cartilage endplate (CEP) degeneration. CEP-degenerated tissues from patients with Modic I or II changes (n = 9 and 45, respectively) and normal tissues from vertebral burst fracture patients (n = 17) were collected. Specimens were either cut into slices for organ culture ex vivo or digested to isolate chondrocytes for cell culture in vitro. Ihh expression and the effect of Ihh on cartilage degeneration were determined by investigating degeneration markers in this study. Ihh expression and cartilage degeneration markers significantly increased in the Modic I and II groups. The expression of cartilage degeneration markers was positively correlated with degeneration severity. Gain-of-function for Ihh promoted expression of cartilage degeneration markers in vitro, while loss-of-function for Ihh inhibited their expression both in vitro and ex vivo. These findings demonstrated that Ihh promotes CEP degeneration. Blocking Ihh pathway has potential clinical usage for attenuating CEP degeneration.

  13. Bayesian models a statistical primer for ecologists

    CERN Document Server

    Hobbs, N Thompson

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods-in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach. Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probabili

  14. Signals and systems primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2006-01-01

    Signals and Systems Primer with MATLAB® equally emphasizes the fundamentals of both analog and digital signals and systems. To ensure insight into the basic concepts and methods, the text presents a variety of examples that illustrate a wide range of applications, from microelectromechanical to worldwide communication systems. It also provides MATLAB functions and procedures for practice and verification of these concepts.Taking a pedagogical approach, the author builds a solid foundation in signal processing as well as analog and digital systems. The book first introduces orthogonal signals,

  15. Efficacy and Safety of Monthly versus Quarterly Ranibizumab Treatment in Neovascular Age-related Macular Degeneration: The EXCITE Study

    NARCIS (Netherlands)

    Schmidt-Erfurth, Ursula; Eldem, Bora; Guymer, Robyn; Korobelnik, Jean-Franc̦ois; Schlingemann, Reinier O.; Axer-Siegel, Ruth; Wiedemann, Peter; Simader, Christian; Gekkieva, Margarita; Weichselberger, Andreas

    2011-01-01

    Objective: To demonstrate noninferiority of a quarterly treatment regimen to a monthly regimen of ranibizumab in patients with subfoveal choroidal neovascularization (CNV) secondary to age-related macular degeneration (AMD). Design: A 12-month, multicenter, randomized, double-masked,

  16. Primer Part 1-The building blocks of epilepsy genetics.

    Science.gov (United States)

    Helbig, Ingo; Heinzen, Erin L; Mefford, Heather C

    2016-06-01

    This is the first of a two-part primer on the genetics of the epilepsies within the Genetic Literacy Series of the Genetics Commission of the International League Against Epilepsy. In Part 1, we cover the foundations of epilepsy genetics including genetic epidemiology and the range of genetic variants that can affect the risk for developing epilepsy. We discuss various epidemiologic study designs that have been applied to the genetics of the epilepsies including population studies, which provide compelling evidence for a strong genetic contribution in many epilepsies. We discuss genetic risk factors varying in size, frequency, inheritance pattern, effect size, and phenotypic specificity, and provide examples of how genetic risk factors within the various categories increase the risk for epilepsy. We end by highlighting trends in epilepsy genetics including the increasing use of massive parallel sequencing technologies. Wiley Periodicals, Inc. © 2016 International League Against Epilepsy.

  17. ITS primers for the identification of marketable Boletus.

    Science.gov (United States)

    Mello, Antonietta; Ghignone, Stefano; Vizzini, Alfredo; Sechi, Clizia; Ruiu, Pino; Bonfante, Paola

    2006-02-10

    Boletus species belonging to the section Boletus are the most frequently eaten fungi among those harvested in natural conditions in Europe. This section groups 10 taxa which are hardly distinguishable on the basis of their morphology. Some of them have been shown to induce allergic IgE-mediated symptoms either through inhalation, ingestion or contact. Since questions relating to the presence of allergens in any of the species most in demand (B. edulis, B. aereus, B. pinophilus, B. aestivalis, all classified as B. edulis s.l.) remain open, together with the absence of tools which distinguish the species, we sequenced the ITS region of 28 Boletus samples and then we designed specific primers. These allowed the effective separation of the taxa. In addition, the phylogenetic tree obtained from the sequences alignment revealed that B. violaceofuscus, a spectacular Chinese fungus considered belonging to the section Boletus and often sold intermixed with B. edulis s.l. specimens, clusters outside the section Boletus.

  18. Randomized trial of the ForeseeHome monitoring device for early detection of neovascular age-related macular degeneration. The HOme Monitoring of the Eye (HOME) study design - HOME Study report number 1.

    Science.gov (United States)

    Chew, Emily Y; Clemons, Traci E; Bressler, Susan B; Elman, Michael J; Danis, Ronald P; Domalpally, Amitha; Heier, Jeffrey S; Kim, Judy E; Garfinkel, Richard A

    2014-03-01

    To evaluate the effects of a home-monitoring device with tele-monitoring compared with standard care in detection of progression to choroidal neovascularization (CNV) associated with age-related macular degeneration (AMD), the leading cause of blindness in the US. Participants, aged 55 to 90 years, at high risk of developing CNV associated with AMD were recruited to the HOme Monitoring of Eye (HOME) Study, an unmasked, multi-center, randomized trial of the ForeseeHome (FH) device plus standard care vs. standard care alone. The FH device utilizes preferential hyperacuity perimetry and tele-monitoring to detect changes in vision function associated with development of CNV, potentially prior to symptom and visual acuity loss. After establishing baseline measurements, subsequent changes on follow-up are detected by the device, causing the monitoring center to alert the clinical center to recall participants for an exam. Standard care consists of instructions for self-monitoring visual changes with subsequent self-report to the clinical center. The primary objective of this study is to determine whether home monitoring plus standard care in comparison with standard care alone, results in earlier detection of incident CNV with better present visual acuity. The primary outcome is the decline in visual acuity at CNV diagnosis from baseline. Detection of CNV prior to substantial vision loss is critical as vision outcome following anti-angiogenic therapy is dependent on the visual acuity at initiation of treatment. HOME Study is the first large scale study to test the use of home tele-monitoring system in the management of AMD patients. Published by Elsevier Inc.

  19. Determination of the species specificity of the primers for the detection of chicken and turkey meat by realtime PCR method

    Directory of Open Access Journals (Sweden)

    Lenka Maršálková

    2014-07-01

    Full Text Available The aim of this work was to use TaqMan Real-Time PCR for quantitative authentication of chicken and turkey meat. To meet this purpose, a specific pair of primers and TaqMan probe was used. The test was aimed at identifying the reaction cycle of turkey and chicken meat using by two sets of primers. With first set of primer designed for chicken we obtained the following results: Cp = 16.18 for 100% chicken DNA Cp = 29, 18 100% turkey DNA It was also amplified DNA of pig that exceeded the detection threshold fluorescence intensities in the 31.07 cycle (Cp = 31.07. Using primers designed for turkey we obtained the following results Cp = 31.16 for 100% CHDNA, Cp =16.18 100% TDNA. It was also amplified the 100% DNA of rabbit in 31.63 cycle (Cp = 31.63 and deer in cycle 32 (Cp = 32. The DNA of all other animal species was amplificated after more than 35 cycles (Cp >35. It follows that the second detection primer pair is specific enough to unrelated species of animals by 30 cycles of the reaction. Species authentication based on DNA analysis from this perspective overcomes all the shortcomings of proteins. At present, DNA analysis use different types of PCR. Is the most progressive Real-time PCR, which is suitable for the specific use of detection (primers and TaqMan probe. The TaqMan Real-time PCR is within the sensitivity and specificity, clearly one of the best methods for identifying the species of chicken and turkey meat. The specificity of this method, however, depends primarily on the specificity of the primers and TaqMan probe. The 30 cycle reaction was chosen by us as the threshold for specificity using primers for authentication chicken and turkey meat.

  20. Hubungan Stres dengan Kejadian Dismenore Primer pada Mahasiswi Pendidikan Dokter Fakultas Kedokteran Universitas Andalas

    Directory of Open Access Journals (Sweden)

    Diana Sari

    2015-05-01

    Full Text Available AbstrakDismenore primer merupakan nyeri menstruasi yang dijumpai tanpa kelainan yang nyata pada alat-alat genital. Lebih dari 50% wanita mengalami dismenore primer dan 15% diantaranya mengalami nyeri yang hebat.Tujuan penelitian ini adalah untuk menentukan hubungan tingkat stres dengan derajat dismenore primer. Penelitian dilakukan pada mahasiswi pendidikan dokter Fakultas Kedokteran Universitas Andalas angkatan 2009 dan 2010. Desain penelitian ini menggunakan cross sectional study dengan jumlah subjek 165 orang. Pengumpulan data dari responden dilakukan dengan wawancara terpimpin (pengisian kuesioner. Analisa statistik yang digunakan adalah uji chi-square dan uji koefisien korelasi sederhana. Uji chi-square menunjukan ada hubungan yang bermakna antara stres dengan kejadian dismenore primer dan uji statistik koefisien korelasi sederhana menunjukkan ada hubungan yang bermakna dengan korelasi agak lemah antara tingkat stres dengan derajat dismenore primer.Kata kunci: stres, dismenore primer, mahasiswi fakultas kedokteran AbstractPrimary dysmenorrhoea is menstrual pain founded without real abnormalities in genital organs. More than 50% woman experiance it and 15% had severe pain. The objective of this study was to determine relationship between stress and primary dysmenorrhoea. Research was executed to education medical female students medical faculty of Andalas University class of 2009 and 2010. This research use cross sectional study design with 165 subjects. Data was collected by guided interview. Statistic analysis use chi-square test and simple correlation test. Chi-square test show there is significant relationship between stress and primary dysmenorrhoea and simple coefficient test show there is weak correlation between stress levels and degree of primary dysmenorrhoea.Keywords: stress, primary dysmenorrhoea, female student of medical faculty

  1. Bayesian models: A statistical primer for ecologists

    Science.gov (United States)

    Hobbs, N. Thompson; Hooten, Mevin B.

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods—in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach.Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probability and develops a step-by-step sequence of connected ideas, including basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and inference from single and multiple models. This unique book places less emphasis on computer coding, favoring instead a concise presentation of the mathematical statistics needed to understand how and why Bayesian analysis works. It also explains how to write out properly formulated hierarchical Bayesian models and use them in computing, research papers, and proposals.This primer enables ecologists to understand the statistical principles behind Bayesian modeling and apply them to research, teaching, policy, and management.Presents the mathematical and statistical foundations of Bayesian modeling in language accessible to non-statisticiansCovers basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and moreDeemphasizes computer coding in favor of basic principlesExplains how to write out properly factored statistical expressions representing Bayesian models

  2. Medium Caliber Lead-Free Electric Primer. Version 2

    Science.gov (United States)

    2012-09-01

    2008). Safe Drinking Water Act of 1986 lists lead compounds as carcinogens (27 CCR 27001 – Dec. 2008). EPA began a Phase I assessment to determine...primer cups was our standard method, wet loading using solvents (hexane and iso -propanol) was investigated to reduce risk of accidental ignition...LOADING OPERATION (Single Die) Wet primer mix charge with solvent (Hexane/ Iso -Propanol) and stir to mix to a uniform slurry Insert primer cup in

  3. Development and degeneration of cone bipolar cells are independent of cone photoreceptors in a mouse model of retinitis pigmentosa.

    Directory of Open Access Journals (Sweden)

    Miao Chen

    Full Text Available Retinal photoreceptors die during retinal synaptogenesis in a portion of retinal degeneration. Whether cone bipolar cells establish regular retinal mosaics and mature morphologies, and resist degeneration are not completely understood. To explore these issues, we backcrossed a transgenic mouse expressing enhanced green fluorescent protein (EGFP in one subset of cone bipolar cells (type 7 into rd1 mice, a classic mouse model of retinal degeneration, to examine the development and survival of cone bipolar cells in a background of retinal degeneration. Our data revealed that both the development and degeneration of cone bipolar cells are independent of the normal activity of cone photoreceptors. We found that type 7 cone bipolar cells achieved a uniform tiling of the retinal surface and developed normal dendritic and axonal arbors without the influence of cone photoreceptor innervation. On the other hand, degeneration of type 7 cone bipolar cells, contrary to our belief of central-to-peripheral progression, was spatially uniform across the retina independent of the spatiotemporal pattern of cone degeneration. The results have important implications for the design of more effective therapies to restore vision in retinal degeneration.

  4. High-speed measurement of firearm primer blast waves

    OpenAIRE

    Courtney, Michael; Daviscourt, Joshua; Eng, Jonathan; Courtney, Amy

    2012-01-01

    This article describes a method and results for direct high-speed measurements of firearm primer blast waves employing a high-speed pressure transducer located at the muzzle to record the blast pressure wave produced by primer ignition. Key findings are: 1) Most of the lead styphnate based primer models tested show 5.2-11.3% standard deviation in the magnitudes of their peak pressure. 2) In contrast, lead-free diazodinitrophenol (DDNP) based primers had standard deviations of the peak blast p...

  5. Brownfields Technology Primer: Selecting and Using Phytoremediation for Site Cleanup

    Science.gov (United States)

    This primer explains the phytoremediation process, discusses the potential advantages and considerations in selecting phytoremediation to clean up brownfields sites, and provides information on additional resources about phytoremediation.

  6. DESAIN PRIMER UNTUK AMPLIFIKASI FRAGMEN GEN inhA ISOLAT 134 MULTIDRUG RESISTANCE TUBERCULOSIS (MDR-TB DENGAN METODE POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Luk Ketut Budi Maitriani

    2015-10-01

    Full Text Available ABSTRAK    : Penelitian ini bertujuan untuk memperoleh sepasang primer terbaik hasil desain secara in silico menggunakan program Clone Manager Suite 6 (University of Groningen. Primer ini didesain untuk digunakan dalam mengamplifikasi fragmen gen inhA isolat klinis Multidrug Resistance Tuberculosis (MDR-TB mencakup kodon 94 (nukleotida 280-282. Kodon 94 gen inhA merupakan posisi yang sering mengalami mutasi dan mengakibatkan koresisten terhadap isoniazid dan ethionamid. Desain primer menggunakan sekuen gen inhA Mycobacterium tuberculosis yang diperoleh dari situs www.ncbi.nlm.nih.gov (GenBank : AF106077. Hasil desain diperoleh sepasang primer terbaik dan diuji secara in vitro menggunakan metode Polymerase Chain Reaction (PCR. Template DNA yang digunakan adalah isolat klinis MDR-TB. Proses amplifikasi diawali dengan denaturasi awal pada 95°C selama 15 menit dan diikuti oleh 45 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 56°C selama 1 menit 20 detik dan elongasi pada 72°C selama 2 menit serta diakhiri dengan elongasi akhir pada 72°C selama 10 menit. Produk PCR dideteksi menggunakan elektroforesis gel agarosa 1,5%. Kesimpulan penelitian adalah diperoleh sepasang primer terbaik berdasarkan kriteria pada program Clone Manager Suite 6 (University of Groningen, meliputi: panjang primer, %GC, Tm (melting temperature, interaksi primer (dimers dan hairpins, stabilitas primer, repeats, runs dan false priming. Primer tersebut meliputi, primer forward (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3’ dan primer reverse (pR-inhA 5’ CGACCGTCATCCA-GTTGTA 3’ dengan ukuran produk 460 pb.   ABSTRACT: The aim of this study was to obtain the best pair of primer as result in silico design using Clone Manager Suite 6 program (University of Groningen. The primer was designed for amplifying inhA gene fragment of Multidrug Resistance Tuberculosis (MDR-TB clinical isolates include codon 94 (nucleotide 280-282. Codon 94 of inhA gene is

  7. Families and degenerations of conformal field theories

    Energy Technology Data Exchange (ETDEWEB)

    Roggenkamp, D.

    2004-09-01

    In this work, moduli spaces of conformal field theories are investigated. In the first part, moduli spaces corresponding to current-current deformation of conformal field theories are constructed explicitly. For WZW models, they are described in detail, and sigma model realizations of the deformed WZW models are presented. The second part is devoted to the study of boundaries of moduli spaces of conformal field theories. For this purpose a notion of convergence of families of conformal field theories is introduced, which admits certain degenerated conformal field theories to occur as limits. To such a degeneration of conformal field theories, a degeneration of metric spaces together with additional geometric structures can be associated, which give rise to a geometric interpretation. Boundaries of moduli spaces of toroidal conformal field theories, orbifolds thereof and WZW models are analyzed. Furthermore, also the limit of the discrete family of Virasoro minimal models is investigated. (orig.)

  8. Intramuscular degeneration process in Duchenne muscular dystrophy

    International Nuclear Information System (INIS)

    Hasegawa, Takeshi; Matsumra, Kiichiro; Hashimoto, Takahiro; Ikehira, Hiroo; Fukuda, Hiroshi; Tateno, Yukio.

    1992-01-01

    Intramuscular degeneration process of Duchenne dystrophy skeletal muscles was investigated by longitudinal skeletal muscle imaging with high-field-strength NMR-CT of 1.5 Tesla. Thigh muscles in 10 cases ranging in age from 4 to 19 years were examined by T 1 -weighted longitudinal images (TR=215∼505 ms, TE=19∼20 ms). The following results were obtained. Skeletal muscle degeneration was depicted as high signal intensity area reflecting its high fat contents. These high signal intensity areas had a longitudinally streaky appearance in parallel direction with myofibers. These findings were more prominent toward myotendon junction than muscle bellies. Skeletal muscle degeneration progressed rapidly between 7 to 10 years of age, and reached a plateau after that. (author)

  9. [Peripheral retinal degenerations--treatment recommendations].

    Science.gov (United States)

    Joussen, A M; Kirchhof, B

    2004-10-01

    This report reviews the clinical appearance of degenerative diseases of the peripheral retina in relationship to the risk of developing a rhegmatogenous retinal detachment. We present recommendations for preventive treatment in eyes at increased risk of developing retinal detachment. Retinal degenerations are common lesions involving the peripheral retina but most of them are clinically insignificant. Lattice degeneration, degenerative retinoschisis, cystic retinal tufts, and very rarely zonular traction tufts can result in rhegmatogenous retinal detachment. Therefore, these lesions have been considered for prophylactic treatment; however, adequate studies have not been performed to date. Most of the peripheral retinal degenerations may not require treatment except in rare, high-risk situations. According to current knowledge there is no higher incidence of secondary pucker or other side effects after laser coagulation. Therefore, generous laser indication is recommended if risk factors apply.

  10. Degeneration in dysplastic hips. A computer tomography study

    DEFF Research Database (Denmark)

    Jacobsen, Steffen; Rømer, Lone; Søballe, Kjeld

    2005-01-01

    BACKGROUND: Hip dysplasia is considered pre-osteoarthritic, causing degeneration in young individuals. OBJECTIVE: To determine the pattern of degenerative change in moderate to severely dysplastic hips in young patients. DESIGN AND PATIENTS: One hundred and ninety-three consecutively......-referred younger patients with hip pain believed to be caused by hip dysplasia constituted the study cohort. The average age was 35.5 years (range, 15-61 years). They were examined by close-cut transverse pelvic and knee computed tomography and antero-posterior radiographs (CT). We identified 197 hips...

  11. Metabolic primers for detection of (Per)chlorate-reducing bacteria in the environment and phylogenetic analysis of cld gene sequences.

    Science.gov (United States)

    Bender, Kelly S; Rice, Melissa R; Fugate, William H; Coates, John D; Achenbach, Laurie A

    2004-09-01

    Natural attenuation of the environmental contaminant perchlorate is a cost-effective alternative to current removal methods. The success of natural perchlorate remediation is dependent on the presence and activity of dissimilatory (per)chlorate-reducing bacteria (DPRB) within a target site. To detect DPRB in the environment, two degenerate primer sets targeting the chlorite dismutase (cld) gene were developed and optimized. A nested PCR approach was used in conjunction with these primer sets to increase the sensitivity of the molecular detection method. Screening of environmental samples indicated that all products amplified by this method were cld gene sequences. These sequences were obtained from pristine sites as well as contaminated sites from which DPRB were isolated. More than one cld phylotype was also identified from some samples, indicating the presence of more than one DPRB strain at those sites. The use of these primer sets represents a direct and sensitive molecular method for the qualitative detection of (per)chlorate-reducing bacteria in the environment, thus offering another tool for monitoring natural attenuation. Sequences of cld genes isolated in the course of this project were also generated from various DPRB and provided the first opportunity for a phylogenetic treatment of this metabolic gene. Comparisons of the cld and 16S ribosomal DNA (rDNA) gene trees indicated that the cld gene does not track 16S rDNA phylogeny, further implicating the possible role of horizontal transfer in the evolution of (per)chlorate respiration.

  12. Great Lakes rivermouths: a primer for managers

    Science.gov (United States)

    Pebbles, Victoria; Larson, James; Seelbach, Paul; Pebbles, Victoria; Larson, James; Seelbach, Paul

    2013-01-01

    Between the North American Great Lakes and their tributaries are the places where the confluence of river and lake waters creates a distinct ecosystem: the rivermouth ecosystem. Human development has often centered around these rivermouths, in part, because they provide a rich array of ecosystem services. Not surprisingly, centuries of intense human activity have led to substantial pressures on, and alterations to, these ecosystems, often diminishing or degrading their ecological functions and associated ecological services. Many Great Lakes rivermouths are the focus of intense restoration efforts. For example, 36 of the active Great Lakes Areas of Concern (AOCs) are rivermouths or areas that include one or more rivermouths. Historically, research of rivermouth ecosystems has been piecemeal, focused on the Great Lakes proper or on the upper reaches of tributaries, with little direct study of the rivermouth itself. Researchers have been divided among disciplines, agencies and institutions; and they often work independently and use disparate venues to communicate their work. Management has also been fragmented with a focus on smaller, localized, sub-habitat units and socio-political or economic elements, rather than system-level consideration. This Primer presents the case for a more holistic approach to rivermouth science and management that can enable restoration of ecosystem services with multiple benefits to humans and the Great Lakes ecosystem. A conceptual model is presented with supporting text that describes the structures and processes common to all rivermouths, substantiating the case for treating these ecosystems as an identifiable class.1 Ecological services provided by rivermouths and changes in how humans value those services over time are illustrated through case studies of two Great Lakes rivermouths—the St. Louis River and the Maumee River. Specific ecosystem services are identified in italics throughout this Primer and follow definitions described

  13. Retinal Cell Degeneration in Animal Models

    Directory of Open Access Journals (Sweden)

    Masayuki Niwa

    2016-01-01

    Full Text Available The aim of this review is to provide an overview of various retinal cell degeneration models in animal induced by chemicals (N-methyl-d-aspartate- and CoCl2-induced, autoimmune (experimental autoimmune encephalomyelitis, mechanical stress (optic nerve crush-induced, light-induced and ischemia (transient retinal ischemia-induced. The target regions, pathology and proposed mechanism of each model are described in a comparative fashion. Animal models of retinal cell degeneration provide insight into the underlying mechanisms of the disease, and will facilitate the development of novel effective therapeutic drugs to treat retinal cell damage.

  14. Kinematic control of robot with degenerate wrist

    Science.gov (United States)

    Barker, L. K.; Moore, M. C.

    1984-01-01

    Kinematic resolved rate equations allow an operator with visual feedback to dynamically control a robot hand. When the robot wrist is degenerate, the computed joint angle rates exceed operational limits, and unwanted hand movements can result. The generalized matrix inverse solution can also produce unwanted responses. A method is introduced to control the robot hand in the region of the degenerate robot wrist. The method uses a coordinated movement of the first and third joints of the robot wrist to locate the second wrist joint axis for movement of the robot hand in the commanded direction. The method does not entail infinite joint angle rates.

  15. Late complications following cryotherapy of lattice degeneration.

    Science.gov (United States)

    Benson, W E; Morse, P H; Nantawan, P

    1977-10-01

    We observed 341 patients who had received cryotherapy for lattice degeneration in order to identify possible late complications. Sequelae such as retinal tears posterior to an operculum or flap tears within treated areas showed that treatment did not necessarily prevent subsequent vitreous traction. Moreover, the newly created flap tears may extend beyond the treated area and can cause retinal detachment. Even scleral buckling did not necesserily prevent further traction. Therefore, we concluded that when cryotherapy is used to treat lattice degeneration, an adequate margin of surrounding retina should be treated and the treatment should extend to the ora serrata.

  16. Genetics of lattice degeneration of the retina.

    Science.gov (United States)

    Murakami, F; Ohba, N

    1982-01-01

    First-degree relatives of proband patients with lattice degeneration of the retina revealed a significantly higher prevalence of the disease than the prevalence in the general population: the former had the disease about three times as frequently as the latter. The observed data were analyzed in terms of their accordance with recognized genetic models. The inheritance pattern did not fit well to a monogenic mode of inheritance, and it was hypothesized that a polygenic or multifactorial mode of inheritance is the most likely for lattice degeneration of the retina.

  17. CT of sarcomatous degeneration in neurofibromatosis

    International Nuclear Information System (INIS)

    Coleman, B.G.; Arger, P.H.; Dalinka, M.K.; Obringer, A.C.; Raney, B.R.; Meadows, A.T.

    1983-01-01

    Neurofibromatosis is a relatively common disorder that often involves many organ systems. One of the least understood aspects of this malady is a well documented potential for sarcomatous degeneration of neurofibromas. The inability to identify patients at risk and the lack of noninvasive screening methods for symptomatic patients often leads to late diagnosis. In six of seven subsequently proven neurofibrosarcomas, CT demonstrated low-density areas that histopathologically appeared to be due to necrosis, hemorrhage, and/or cystic degeneration. The density differences within these sarcomas were enhanced by the intravenous adminstration of iodinated contrast agents

  18. Genome-Wide Characterization of Simple Sequence Repeat (SSR) Loci in Chinese Jujube and Jujube SSR Primer Transferability

    Science.gov (United States)

    Xiao, Jing; Zhao, Jin; Liu, Mengjun; Liu, Ping; Dai, Li; Zhao, Zhihui

    2015-01-01

    Chinese jujube (Ziziphus jujuba), an economically important species in the Rhamnaceae family, is a popular fruit tree in Asia. Here, we surveyed and characterized simple sequence repeats (SSRs) in the jujube genome. A total of 436,676 SSR loci were identified, with an average distance of 0.93 Kb between the loci. A large proportion of the SSRs included mononucleotide, dinucleotide and trinucleotide repeat motifs, which accounted for 64.87%, 24.40%, and 8.74% of all repeats, respectively. Among the mononucleotide repeats, A/T was the most common, whereas AT/TA was the most common dinucleotide repeat. A total of 30,565 primer pairs were successfully designed and screened using a series of criteria. Moreover, 725 of 1,000 randomly selected primer pairs were effective among 6 cultivars, and 511 of these primer pairs were polymorphic. Sequencing the amplicons of two SSRs across three jujube cultivars revealed variations in the repeats. The transferability of jujube SSR primers proved that 35/64 SSRs could be transferred across family boundary. Using jujube SSR primers, clustering analysis results from 15 species were highly consistent with the Angiosperm Phylogeny Group (APGIII) System. The genome-wide characterization of SSRs in Chinese jujube is very valuable for whole-genome characterization and marker-assisted selection in jujube breeding. In addition, the transferability of jujube SSR primers could provide a solid foundation for their further utilization. PMID:26000739

  19. Comparative study on the use of specific and heterologous microsatellite primers in the stingless bees Melipona rufiventris and M. mondury (Hymenoptera, Apidae

    Directory of Open Access Journals (Sweden)

    Denilce Meneses Lopes

    2010-01-01

    Full Text Available Due to their high degree of polymorphism, microsatellites are considered useful tools for studying population genetics. Nevertheless, studies of genetic diversity in stingless bees by means of these primers have revealed a low level of polymorphism, possibly the consequence of the heterologous primers used, since in most cases these were not specifically designed for the species under consideration. Herein we compared the number of polymorphic loci and alleles per locus, as well as observed heterozygosity in Melipona rufiventris and M. mondury populations, using specific and heterologous primers. The use of specific primers placed in evidence the greater frequency of polymorphic loci and alleles per locus, besides an expressive increase in observed heterozygosity in M. rufiventris and M. mondury, thereby reinforcing the idea that populational studies should be undertaken by preferably using species-specific microsatellite primers.

  20. Comparative study on the use of specific and heterologous microsatellite primers in the stingless bees Melipona rufiventris and M. mondury (Hymenoptera, Apidae).

    Science.gov (United States)

    Lopes, Denilce Meneses; de Oliveira Campos, Lúcio Antônio; Salomão, Tânia Maria Fernandes; Tavares, Mara Garcia

    2010-04-01

    Due to their high degree of polymorphism, microsatellites are considered useful tools for studying population genetics. Nevertheless, studies of genetic diversity in stingless bees by means of these primers have revealed a low level of polymorphism, possibly the consequence of the heterologous primers used, since in most cases these were not specifically designed for the species under consideration. Herein we compared the number of polymorphic loci and alleles per locus, as well as observed heterozygosity in Melipona rufiventris and M. mondury populations, using specific and heterologous primers. The use of specific primers placed in evidence the greater frequency of polymorphic loci and alleles per locus, besides an expressive increase in observed heterozygosity in M. rufiventris and M. mondury, thereby reinforcing the idea that populational studies should be undertaken by preferably using species-specific microsatellite primers.

  1. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2015-01-01

    This primer offers readers an introduction to the central concepts that form our modern understanding of complex and emergent behavior, together with detailed coverage of accompanying mathematical methods. All calculations are presented step by step and are easy to follow. This new fourth edition has been fully reorganized and includes new chapters, figures and exercises. The core aspects of modern complex system sciences are presented in the first chapters, covering network theory, dynamical systems, bifurcation and catastrophe theory, chaos and adaptive processes, together with the principle of self-organization in reaction-diffusion systems and social animals. Modern information theoretical principles are treated in further chapters, together with the concept of self-organized criticality, gene regulation networks, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase transitions and the cognitive system approach to the brain. Technical course prerequisites are the standard ...

  2. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2007-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  3. Complex and Adaptive Dynamical Systems A Primer

    CERN Document Server

    Gros, Claudius

    2011-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  4. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2013-01-01

    Complex system theory is rapidly developing and gaining importance, providing tools and concepts central to our modern understanding of emergent phenomena. This primer offers an introduction to this area together with detailed coverage of the mathematics involved. All calculations are presented step by step and are straightforward to follow. This new third edition comes with new material, figures and exercises. Network theory, dynamical systems and information theory, the core of modern complex system sciences, are developed in the first three chapters, covering basic concepts and phenomena like small-world networks, bifurcation theory and information entropy. Further chapters use a modular approach to address the most important concepts in complex system sciences, with the emergence and self-organization playing a central role. Prominent examples are self-organized criticality in adaptive systems, life at the edge of chaos, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase...

  5. Intrageneric Primer Design: Bringing Bioinformatics Tools to the Class

    Science.gov (United States)

    Lima, Andre O. S.; Garces, Sergio P. S.

    2006-01-01

    Bioinformatics is one of the fastest growing scientific areas over the last decade. It focuses on the use of informatics tools for the organization and analysis of biological data. An example of their importance is the availability nowadays of dozens of software programs for genomic and proteomic studies. Thus, there is a growing field (private…

  6. Invading stacking primer: A trigger for high-efficiency isothermal amplification reaction with superior selectivity for detecting microRNA variants.

    Science.gov (United States)

    Liu, Weipeng; Zhu, Minjun; Liu, Hongxing; Wei, Jitao; Zhou, Xiaoming; Xing, Da

    2016-07-15

    Searching for a strategy to enhance the efficiency of nucleic acid amplification and achieve exquisite discrimination of nucleic acids at the single-base level for biological detection has become an exciting research direction in recent years. Here, we have developed a simple and universal primer design strategy which produces a fascinating effect on isothermal strand displacement amplification (iSDA). We refer to the resultant primer as "invading stacking primer (IS-Primer)" which is based on contiguous stacking hybridization and toehold-mediated exchange reaction and function by merely changing the hybridization location of the primer. Using the IS-Primer, the sensitivity in detecting the target miR-21 is improved approximately five fold compared with the traditional iSDA reaction. It was further demonstrated that the IS-Primer acts as an invading strand to initiate branch migration which can increase the efficiency of the untwisting of the hairpin probe. This effect is equivalent to reducing the free energy of the stem, and the technique shows superior selectivity for single-base mismatches. By demonstrating the enhanced effect of the IS-Primer in the iSDA reaction, this work may provide a potentially new avenue for developing more sensitive and selective nucleic acids assays. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. The Fluid Reading Primer: Animated Decoding Support for Emergent Readers.

    Science.gov (United States)

    Zellweger, Polle T.; Mackinlay, Jock D.

    A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…

  8. Marketing Information Products and Services : A Primer for ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Couverture du livre Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Directeur(s) : Abhinandan K. Jain, Ashok Jambhekar, T.P.Rama Rao et S. Sreenivas Rao. Maison(s) ...

  9. Screening for residual disease in pediatric burkitt lymphoma using consensus primer pools.

    Science.gov (United States)

    Agsalda, Melissa; Kusao, Ian; Troelstrup, David; Shiramizu, Bruce

    2009-01-01

    Assessing molecular persistent or minimal residual disease (PD/MRD) in childhood Burkitt lymphoma (BL) is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs). Because BL is characterized by rearranged immunoglobulin heavy chain (IgV(H)) genes, IgV(H) primer pools from IgV(H1)-IgV(H7) regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgV(H) primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgV(H) primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

  10. Targeted reduction of highly abundant transcripts using pseudo-random primers.

    Science.gov (United States)

    Arnaud, Ophélie; Kato, Sachi; Poulain, Stéphane; Plessy, Charles

    2016-04-01

    Transcriptome studies based on quantitative sequencing can estimate levels of gene expression by measuring target RNA abundance in sequencing libraries. Sequencing costs are proportional to the total number of sequenced reads, and in order to cover rare RNAs, considerable quantities of abundant and identical reads are needed. This major limitation can be addressed by depleting a proportion of the most abundant sequences from the library. However, such depletion strategies involve either extra handling of the input RNA sample or use of a large number of reverse transcription primers, termed not-so-random (NSR) primers, which are costly to synthesize. Taking advantage of the high tolerance of reverse transcriptase to mis-prime, we found that it is possible to use as few as 40 pseudo-random (PS) reverse transcription primers to decrease the rate of undesirable abundant sequences within a library without affecting the overall transcriptome diversity. PS primers are simple to design and can be used to deplete several undesirable RNAs simultaneously, thus creating a flexible tool for enriching transcriptome libraries for rare transcript sequences.

  11. Screening for Residual Disease in Pediatric Burkitt Lymphoma Using Consensus Primer Pools

    Directory of Open Access Journals (Sweden)

    Melissa Agsalda

    2009-01-01

    Full Text Available Assessing molecular persistent or minimal residual disease (PD/MRD in childhood Burkitt lymphoma (BL is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs. Because BL is characterized by rearranged immunoglobulin heavy chain (IgVH genes, IgVH primer pools from IgVH1–IgVH7 regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgVH primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgVH primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

  12. Driving and Age-Related Macular Degeneration

    OpenAIRE

    Owsley, Cynthia; McGwin, Gerald

    2008-01-01

    This article reviews the research literature on driving and age-related macular degeneration, which is motivated by the link between driving and the quality of life of older adults and their increased collision rate. It addresses the risk of crashes, driving performance, driving difficulty, self-regulation, and interventions to enhance, safety, and considers directions for future research.

  13. Specific heats of degenerate ideal gases

    OpenAIRE

    Caruso, Francisco; Oguri, Vitor; Silveira, Felipe

    2017-01-01

    From arguments based on Heisenberg's uncertainty principle and Pauli's exclusion principle, the molar specific heats of degenerate ideal gases at low temperatures are estimated, giving rise to values consistent with the Nerst-Planck Principle (third law of Thermodynamics). The Bose-Einstein condensation phenomenon based on the behavior of specific heat of massive and non-relativistic boson gases is also presented.

  14. Ecological transition predictably associated with gene degeneration.

    Science.gov (United States)

    Wessinger, Carolyn A; Rausher, Mark D

    2015-02-01

    Gene degeneration or loss can significantly contribute to phenotypic diversification, but may generate genetic constraints on future evolutionary trajectories, potentially restricting phenotypic reversal. Such constraints may manifest as directional evolutionary trends when parallel phenotypic shifts consistently involve gene degeneration or loss. Here, we demonstrate that widespread parallel evolution in Penstemon from blue to red flowers predictably involves the functional inactivation and degeneration of the enzyme flavonoid 3',5'-hydroxylase (F3'5'H), an anthocyanin pathway enzyme required for the production of blue floral pigments. Other types of genetic mutations do not consistently accompany this phenotypic shift. This pattern may be driven by the relatively large mutational target size of degenerative mutations to this locus and the apparent lack of associated pleiotropic effects. The consistent degeneration of F3'5'H may provide a mechanistic explanation for the observed asymmetry in the direction of flower color evolution in Penstemon: Blue to red transitions are common, but reverse transitions have not been observed. Although phenotypic shifts in this system are likely driven by natural selection, internal constraints may generate predictable genetic outcomes and may restrict future evolutionary trajectories. © The Author 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  15. Geometry of non-degenerate Susskind fermions

    International Nuclear Information System (INIS)

    Mitra, P.

    1983-01-01

    The Dirac-Kaehler equation on the lattice is known to describe the degenerate ''flavours'' appering in Susskind's approach to lattice fermions. We study the modification that has to be made in this equation in order to lift the degeneracy and give the flavours arbitrary different masses. (orig.)

  16. Exploring Nonconvex, Crossed and Degenerate Polygons

    Science.gov (United States)

    Contreras, Jose N.

    2004-01-01

    An exploration of nonconvex, crossed, and degenerate polygons (NCCDPs) are described with the help of examples with pedagogical tips and recommendations that are found useful when teaching the mathematical process of extending geometric patterns to NCCDPs. The study concludes that investigating such extensions with interactive geometry software…

  17. Degenerate parabolic stochastic partial differential equations

    Czech Academy of Sciences Publication Activity Database

    span class="emphasis">Hofmanová, Martinaspan>

    2013-01-01

    Roč. 123, č. 12 (2013), s. 4294-4336 ISSN 0304-4149 R&D Projects: GA ČR GAP201/10/0752 Institutional support: RVO:67985556 Keywords : kinetic solutions * degenerate stochastic parabolic equations Subject RIV: BA - General Mathematics Impact factor: 1.046, year: 2013 http://library.utia.cas.cz/separaty/2013/SI/hofmanova-0397241.pdf

  18. MR findings of degenerating parenchymal neurocysticercosis

    International Nuclear Information System (INIS)

    Lee, Yul; Chung, Eun A; Yang, Ik; Park, Hae Jung; Chung, Soo Young

    1996-01-01

    To evaluate MR imaging findings of degenerating parenchymal neurocysticercosis and to determine the characteristics which distinguish it from other brain diseases. MR imagings of 19 patients (56 lesions) of degenerating parenchymal neurocysticercosis were retrospectively evaluated, focusing on the size and location of lesions signal intensity patterns of cyst fluid and wall, the extent of the surrounding edema and features of contrast enhancement. Degenerating parenchymal neurocysticercosis was located in gray or subcortical while matter in 89.3% of 56 lesions (50/56) ; most of these (98.2%) were smaller than 2 cm in diameter. Cyst fluid signal was hyperintense relative to CSF on T1 and proton density weighted images (92.9%). A hypointense signal rim of the cyst wall was noted in the lesions on proton density (92.9%) and T2 weighted (98.2%) images, Surrounding edema was mostly mild. Peripheral rim enhancement was noted in all lesions, and this was frequently irregular and lobulated (67.9%) with a focal defect in the enhancing rim(41.1%). Findings which could be helpful in distinguishing degenerating parencymal neurocysticercosis from other brain diseases are as follows : small, superficial lesions ; hyperintense signal of the cyst fluid on T1 and proton density weighted images ; hypointense signal of the cyst wall on proton density and T2 weighted images ; relatively mild extent of surrounding edema, and peripheral rim enhancement which is frequently irregular and lobulated with a focal defect in the enhancing rim

  19. Degenerate conformal theories on higher-genus surfaces

    International Nuclear Information System (INIS)

    Gerasimov, A.A.

    1989-01-01

    Two-dimensional degenerate field theories on higher-genus surfaces are investigated. Objects are built on the space of moduli, whose linear combinations are hypothetically conformal blocks in degenerate theories

  20. MR imaging of central nervous system white matter tract degeneration (Wallerian degeneration)

    International Nuclear Information System (INIS)

    Kuhn, M.J.; Johnson, K.A.; Davis, K.R.

    1987-01-01

    Wallerian degeneration is readily demonstrated by MR imaging. Twenty-one patients with MR signal abnormalities in various central nervous system (CNS) white matter tracts were evaluated with regard to (1) nature of signal abnormality, (2) MR anatomy of the involved tract, and (3) primary pathology (e.g., infarct, tumor, hemorrhage). Most examples of wallerian degeneration result in a thin, continuous band of long T1, long T2 signal abnormality conforming to the known anatomic pathway of a CNS axonal tract. Old, large cortical infarcts have the greatest propensity to show subsequent white-matter tract degeneration. Corticospinal tract degeneration is the type most readily visualized, often seen extending completely from the cerebral cortex through the medulla

  1. Ethanol Exposure Causes Muscle Degeneration in Zebrafish

    Directory of Open Access Journals (Sweden)

    Elizabeth C. Coffey

    2018-03-01

    Full Text Available Alcoholic myopathies are characterized by neuromusculoskeletal symptoms such as compromised movement and weakness. Although these symptoms have been attributed to neurological damage, EtOH may also target skeletal muscle. EtOH exposure during zebrafish primary muscle development or adulthood results in smaller muscle fibers. However, the effects of EtOH exposure on skeletal muscle during the growth period that follows primary muscle development are not well understood. We determined the effects of EtOH exposure on muscle during this phase of development. Strikingly, muscle fibers at this stage are acutely sensitive to EtOH treatment: EtOH induces muscle degeneration. The severity of EtOH-induced muscle damage varies but muscle becomes more refractory to EtOH as muscle develops. NF-kB induction in muscle indicates that EtOH triggers a pro-inflammatory response. EtOH-induced muscle damage is p53-independent. Uptake of Evans blue dye shows that EtOH treatment causes sarcolemmal instability before muscle fiber detachment. Dystrophin-null sapje mutant zebrafish also exhibit sarcolemmal instability. We tested whether Trichostatin A (TSA, which reduces muscle degeneration in sapje mutants, would affect EtOH-treated zebrafish. We found that TSA and EtOH are a lethal combination. EtOH does, however, exacerbate muscle degeneration in sapje mutants. EtOH also disrupts adhesion of muscle fibers to their extracellular matrix at the myotendinous junction: some detached muscle fibers retain beta-Dystroglycan indicating failure of muscle end attachments. Overexpression of Paxillin, which reduces muscle degeneration in zebrafish deficient for beta-Dystroglycan, is not sufficient to rescue degeneration. Taken together, our results suggest that EtOH exposure has pleiotropic deleterious effects on skeletal muscle.

  2. Calcium channel blockers inhibit retinal degeneration in the retinal-degeneration-B mutant of Drosophila.

    Science.gov (United States)

    Sahly, I; Bar Nachum, S; Suss-Toby, E; Rom, A; Peretz, A; Kleiman, J; Byk, T; Selinger, Z; Minke, B

    1992-01-01

    Light accelerates degeneration of photoreceptor cells of the retinal degeneration B (rdgB) mutant of Drosophila. During early stages of degeneration, light stimuli evoke spikes from photoreceptors of the mutant fly; no spikes can be recorded from photoreceptors of the wild-type fly. Production of spike potentials from mutant photoreceptors was blocked by diltiazem, verapamil hydrochloride, and cadmium. Little, if any, effect of the (-)-cis isomer or (+)-cis isomer of diltiazem on the light response was seen. Further, the (+)-cis isomer was approximately 50 times more effective than the (-)-cis isomer in blocking the Ca2+ spikes, indicating that diltiazem action on the rdgB eye is mediated by means of blocking voltage-sensitive Ca2+ channels, rather than by blocking the light-sensitive channels. Application of the Ca(2+)-channel blockers (+)-cis-diltiazem and verapamil hydrochloride to the eyes of rdgB flies over a 7-day period largely inhibited light-dependent degeneration of the photoreceptor cells. Pulse labeling with [32P]phosphate showed much greater incorporation into eye proteins of [32P]phosphate in rdgB flies than in wild-type flies. Retarding the light-induced photoreceptor degeneration in the mutant by Ca(2+)-channel blockers, thus, suggests that toxic increase in intracellular Ca2+ by means of voltage-gated Ca2+ channels, possibly secondary to excessive phosphorylation, leads to photoreceptor degeneration in the rdgB mutant. Images PMID:1309615

  3. Degenerate r-Stirling Numbers and r-Bell Polynomials

    Science.gov (United States)

    Kim, T.; Yao, Y.; Kim, D. S.; Jang, G.-W.

    2018-01-01

    The purpose of this paper is to exploit umbral calculus in order to derive some properties, recurrence relations, and identities related to the degenerate r-Stirling numbers of the second kind and the degenerate r-Bell polynomials. Especially, we will express the degenerate r-Bell polynomials as linear combinations of many well-known families of special polynomials.

  4. Relativistic Astrophysics and Cosmology: A Primer

    International Nuclear Information System (INIS)

    Abramowicz, Marek A

    2007-01-01

    'Relativistic Astrophysics and Cosmology: A Primer' by Peter Hoyng, was published last year by Springer. The book is based on lectures given by the author at University of Utrecht to advanced undergraduates. This is a short and scholarly book. In about 300 pages, the author has covered the most interesting and important applications of Albert Einstein's general relativity in present-day astrophysics and cosmology: black holes, neutron stars, gravitational waves, and the cosmic microwave background. The book stresses theory, but also discusses several experimental and observational topics, such as the Gravity Probe B mission, interferometer detectors of gravitational waves and the power spectrum of the cosmic microwave background. The coverage is not uniform. Some topics are discussed in depth, others are only briefly mentioned. The book obviously reflects the author's own research interests and his preferences for specific mathematical methods, and the choice of the original artwork that illustrates the book (and appears on its cover) is a very personal one. I consider this personal touch an advantage, even if I do not always agree with the author's choices. For example, I employ Killing vectors as a very useful mathematical tool not only in my research on black holes, but also in my classes. I find that my students prefer it when discussions of particle, photon and fluid motion in the Schwarzschild and Kerr spacetimes are based explicitly and directly on the Killing vectors rather than on coordinate calculations. The latter approach is, of course, the traditional one, and is used in Peter Hoyng's book. Reading the book is a stimulating experience, because the reader can almost feel the author's presence. The author's opinions, his mathematical taste, his research pleasures, and his pedagogical passion are apparent everywhere. Lecturers contemplating a new course on relativistic astrophysics could adopt Hoyng's book as the text. Their students will be in the author

  5. Value for money assessment for public-private partnerships : a primer.

    Science.gov (United States)

    2015-01-01

    This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion : primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of : primers.

  6. Detection of Mycosphaerella graminicola in Wheat Leaves by a Microsatellite Dinucleotide Specific-Primer

    Directory of Open Access Journals (Sweden)

    Joseph-Alexander Verreet

    2011-01-01

    Full Text Available Early detection of infection is very important for efficient management of Mycosphaerella graminicola leaf blotch. To monitor and quantify the occurrence of this fungus during the growing season, a diagnostic method based on real-time PCR was developed. Standard and real-time PCR assays were developed using SYBR Green chemistry to quantify M. graminicola in vitro or in wheat samples. Microsatellite dinucleotide specific-primers were designed based on microsatellite repeats of sequences present in the genome of M. graminicola. Specificity was checked by analyzing DNA of 55 M. graminicola isolates obtained from different geographical origins. The method appears to be highly specific for detecting M. graminicola; no fluorescent signals were observed from 14 other closely related taxa. Primer (CT 7 G amplified a specific amplicon of 570 bp from all M. graminicola isolates. The primers did not amplify DNA extracted from 14 other fungal species. The approximate melting temperature (Tm of the (CT 7 G primer was 84.2 °C. The detection limit of the real-time PCR assay with the primer sets (CT 7 G is 10 fg/25 µL, as compared to 10 pg/25 µL using conventional PCR technology. From symptomless leaves, a PCR fragment could be generated two days after inoculation. Both conventional and real-time PCR could successfully detect the fungus from artificially inoculated wheat leaves. However, real-time PCR appeared much more sensitive than conventional PCR. The developed quantitative real-time PCR method proved to be rapid, sensitive, specific, cost-effective and reliable for the identification and quantification of M. graminicola in wheat.

  7. Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J

    1997-01-01

    , but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology....

  8. Primer on electricity futures and other derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area.

  9. A primer on systematic reviews in toxicology.

    Science.gov (United States)

    Hoffmann, Sebastian; de Vries, Rob B M; Stephens, Martin L; Beck, Nancy B; Dirven, Hubert A A M; Fowle, John R; Goodman, Julie E; Hartung, Thomas; Kimber, Ian; Lalu, Manoj M; Thayer, Kristina; Whaley, Paul; Wikoff, Daniele; Tsaioun, Katya

    2017-07-01

    Systematic reviews, pioneered in the clinical field, provide a transparent, methodologically rigorous and reproducible means of summarizing the available evidence on a precisely framed research question. Having matured to a well-established approach in many research fields, systematic reviews are receiving increasing attention as a potential tool for answering toxicological questions. In the larger framework of evidence-based toxicology, the advantages and obstacles of, as well as the approaches for, adapting and adopting systematic reviews to toxicology are still being explored. To provide the toxicology community with a starting point for conducting or understanding systematic reviews, we herein summarized available guidance documents from various fields of application. We have elaborated on the systematic review process by breaking it down into ten steps, starting with planning the project, framing the question, and writing and publishing the protocol, and concluding with interpretation and reporting. In addition, we have identified the specific methodological challenges of toxicological questions and have summarized how these can be addressed. Ultimately, this primer is intended to stimulate scientific discussions of the identified issues to fuel the development of toxicology-specific methodology and to encourage the application of systematic review methodology to toxicological issues.

  10. Primer on electricity futures and other derivatives

    International Nuclear Information System (INIS)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area

  11. Psychosocial Intervention for Age-Related Macular Degeneration: A Pilot Project

    Science.gov (United States)

    Wahl, Hans-Werner; Kammerer, Annette; Holz, Frank; Miller, Daniel; Becker, Stefanie; Kaspar, Roman; Himmelsbach, Ines

    2006-01-01

    This study evaluated an emotion-focused and a problem-focused intervention designed for patients with age-related macular degeneration. It found a limited decrease in depression in the emotion-focused group and an increase in active problem orientation and in adaptation to vision loss in the problem-focused group.

  12. Mediterranean Diet Score and Its Association with Age-Related Macular Degeneration : The European Eye Study

    NARCIS (Netherlands)

    Hogg, Ruth E; Woodside, Jayne V; McGrath, Alanna; Young, Ian S; Vioque, Jesus L; Chakravarthy, Usha; de Jong, Paulus T; Rahu, Mati; Seland, Johan; Soubrane, Gisele; Tomazzoli, Laura; Topouzis, Fotis; Fletcher, Astrid E

    2017-01-01

    PURPOSE: To examine associations between adherence to a Mediterranean diet and prevalence of age-related macular degeneration (AMD) in countries ranging from Southern to Northern Europe. DESIGN: Cross-sectional, population-based epidemiologic study. PARTICIPANTS: Of 5060 randomly sampled people aged

  13. Single-Chain Antibody Fragment VEGF Inhibitor RTH258 for Neovascular Age-Related Macular Degeneration

    DEFF Research Database (Denmark)

    Holz, Frank G; Dugel, Pravin U.; Weissgerber, Georges

    2016-01-01

    Purpose To assess the safety and efficacy of different doses of RTH258 applied as single intravitreal administration compared with ranibizumab 0.5 mg in patients with neovascular age-related macular degeneration (AMD). Design Six-month, phase 1/2, prospective, multicenter, double-masked, randomized...

  14. A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

    International Nuclear Information System (INIS)

    Jothikumar, N.; Hill, Vincent R.

    2013-01-01

    Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

  15. A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

    Energy Technology Data Exchange (ETDEWEB)

    Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.

    2013-06-28

    Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

  16. Microsatellite Primers in the Lichen Symbiotic Alga Trebouxia decolorans (Trebouxiophyceae

    Directory of Open Access Journals (Sweden)

    Francesco Dal Grande

    2013-03-01

    Full Text Available Premise of the study: Polymorphic microsatellite markers were developed for the symbiotic green alga Trebouxia decolorans to study fine-scale population structure and clonal diversity. Methods and Results: Using Illumina pyrosequencing, 20 microsatellite primer sets were developed for T. decolorans. The primer sets were tested on 43 individuals sampled from four subpopulations in Germany. The primers amplified di-, tri-, and tetranucleotide repeats with three to 15 alleles per locus, and the unbiased haploid diversity per locus ranged from 0.636 to 0.821. Conclusions: The identified microsatellite markers will be useful to study the genetic diversity, dispersal, and reproductive mode of this common lichen photobiont.

  17. A physicists guide to The Los Alamos Primer

    International Nuclear Information System (INIS)

    Reed, B Cameron

    2016-01-01

    In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer , which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons. (invited comment)

  18. Atomic rate coefficients in a degenerate plasma

    Science.gov (United States)

    Aslanyan, Valentin; Tallents, Greg

    2015-11-01

    The electrons in a dense, degenerate plasma follow Fermi-Dirac statistics, which deviate significantly in this regime from the usual Maxwell-Boltzmann approach used by many models. We present methods to calculate the atomic rate coefficients for the Fermi-Dirac distribution and present a comparison of the ionization fraction of carbon calculated using both models. We have found that for densities close to solid, although the discrepancy is small for LTE conditions, there is a large divergence from the ionization fraction by using classical rate coefficients in the presence of strong photoionizing radiation. We have found that using these modified rates and the degenerate heat capacity may affect the time evolution of a plasma subject to extreme ultraviolet and x-ray radiation such as produced in free electron laser irradiation of solid targets.

  19. K-causality and degenerate spacetimes

    Science.gov (United States)

    Dowker, H. F.; Garcia, R. S.; Surya, S.

    2000-11-01

    The causal relation K+ was introduced by Sorkin and Woolgar to extend the standard causal analysis of C2 spacetimes to those that are only C0. Most of their results also hold true in the case of metrics with degeneracies which are C0 but vanish at isolated points. In this paper we seek to examine K+ explicitly in the case of topology-changing `Morse histories' which contain degeneracies. We first demonstrate some interesting features of this relation in globally Lorentzian spacetimes. In particular, we show that K+ is robust and the Hawking and Sachs characterization of causal continuity translates into a natural condition in terms of K+. We then examine K+ in topology-changing Morse spacetimes with the degenerate points excised and then for the Morse histories in which the degenerate points are reinstated. We find further characterizations of causal continuity in these cases.

  20. The consequences of neural degeneration regarding optimal cochlear implant position in scala tympani: a model approach.

    Science.gov (United States)

    Briaire, Jeroen J; Frijns, Johan H M

    2006-04-01

    Cochlear implant research endeavors to optimize the spatial selectivity, threshold and dynamic range with the objective of improving the speech perception performance of the implant user. One of the ways to achieve some of these goals is by electrode design. New cochlear implant electrode designs strive to bring the electrode contacts into close proximity to the nerve fibers in the modiolus: this is done by placing the contacts on the medial side of the array and positioning the implant against the medial wall of scala tympani. The question remains whether this is the optimal position for a cochlea with intact neural fibers and, if so, whether it is also true for a cochlea with degenerated neural fibers. In this study a computational model of the implanted human cochlea is used to investigate the optimal position of the array with respect to threshold, dynamic range and spatial selectivity for a cochlea with intact nerve fibers and for degenerated nerve fibers. In addition, the model is used to evaluate the predictive value of eCAP measurements for obtaining peri-operative information on the neural status. The model predicts improved threshold, dynamic range and spatial selectivity for the peri-modiolar position at the basal end of the cochlea, with minimal influence of neural degeneration. At the apical end of the array (1.5 cochlear turns), the dynamic range and the spatial selectivity are limited due to the occurrence of cross-turn stimulation, with the exception of the condition without neural degeneration and with the electrode array along the lateral wall of scala tympani. The eCAP simulations indicate that a large P(0) peak occurs before the N(1)P(1) complex when the fibers are not degenerated. The absence of this peak might be used as an indicator for neural degeneration.

  1. Degenerate RFID Channel Modeling for Positioning Applications

    Directory of Open Access Journals (Sweden)

    A. Povalac

    2012-12-01

    Full Text Available This paper introduces the theory of channel modeling for positioning applications in UHF RFID. It explains basic parameters for channel characterization from both the narrowband and wideband point of view. More details are given about ranging and direction finding. Finally, several positioning scenarios are analyzed with developed channel models. All the described models use a degenerate channel, i.e. combined signal propagation from the transmitter to the tag and from the tag to the receiver.

  2. Degenerate odd Poisson bracket on Grassmann variables

    International Nuclear Information System (INIS)

    Soroka, V.A.

    2000-01-01

    A linear degenerate odd Poisson bracket (antibracket) realized solely on Grassmann variables is proposed. It is revealed that this bracket has at once three Grassmann-odd nilpotent Δ-like differential operators of the first, second and third orders with respect to the Grassmann derivatives. It is shown that these Δ-like operators, together with the Grassmann-odd nilpotent Casimir function of this bracket, form a finite-dimensional Lie superalgebra

  3. Immunology of age-related macular degeneration

    Science.gov (United States)

    Ambati, Jayakrishna; Atkinson, John P.; Gelfand, Bradley D.

    2014-01-01

    Age-related macular degeneration (AMD) is a leading cause of blindness in aged individuals. Recent advances have highlighted the essential role of immune processes in the development, progression and treatment of AMD. In this Review we discuss recent discoveries related to the immunological aspects of AMD pathogenesis. We outline the diverse immune cell types, inflammatory activators and pathways that are involved. Finally, we discuss the future of inflammation-directed therapeutics to treat AMD in the growing aged population. PMID:23702979

  4. Molecular pharmacodynamics of emixustat in protection against retinal degeneration.

    Science.gov (United States)

    Zhang, Jianye; Kiser, Philip D; Badiee, Mohsen; Palczewska, Grazyna; Dong, Zhiqian; Golczak, Marcin; Tochtrop, Gregory P; Palczewski, Krzysztof

    2015-07-01

    Emixustat is a visual cycle modulator that has entered clinical trials as a treatment for age-related macular degeneration (AMD). This molecule has been proposed to inhibit the visual cycle isomerase RPE65, thereby slowing regeneration of 11-cis-retinal and reducing production of retinaldehyde condensation byproducts that may be involved in AMD pathology. Previously, we reported that all-trans-retinal (atRAL) is directly cytotoxic and that certain primary amine compounds that transiently sequester atRAL via Schiff base formation ameliorate retinal degeneration. Here, we have shown that emixustat stereoselectively inhibits RPE65 by direct active site binding. However, we detected the presence of emixustat-atRAL Schiff base conjugates, indicating that emixustat also acts as a retinal scavenger, which may contribute to its therapeutic effects. Using agents that lack either RPE65 inhibitory activity or the capacity to sequester atRAL, we assessed the relative importance of these 2 modes of action in protection against retinal phototoxicity in mice. The atRAL sequestrant QEA-B-001-NH2 conferred protection against phototoxicity without inhibiting RPE65, whereas an emixustat derivative incapable of atRAL sequestration was minimally protective, despite direct inhibition of RPE65. These data indicate that atRAL sequestration is an essential mechanism underlying the protective effects of emixustat and related compounds against retinal phototoxicity. Moreover, atRAL sequestration should be considered in the design of next-generation visual cycle modulators.

  5. Degenerate pressure driven modified nucleus-acoustic waves in degenerate plasmas

    Science.gov (United States)

    Mamun, A. A.

    2018-02-01

    The existence of degenerate pressure driven modified nucleus-acoustic (DPDMNA) waves propagating in a cold degenerate quantum plasma (DQP) system [containing cold inertialess degenerate electron species (DES), cold inertial non-degenerate light nucleus species (LNS), and stationary heavy nucleus species (HNS)] is predicted for the first time. The DPDMNA waves (in which the mass density of the cold LNS provides the inertia and the cold inertialess DES gives rise to the restoring force) are new since they completely disappear if the degenerate pressure of the cold DES is neglected. It is found that the phase speed (Vp) of the DPDMNA waves decreases with the rise of the charge number density of the stationary HNS for both non-relativistic and ultra-relativistic DES, and that the ultra-relativistic DES does not have any effect on Vp when β = 1, where β = Λc/Λe with Λ e = ne 0 - 1 / 3 being the average inter-electron distance in the DQP system and Λc being the constant (˜10-10 cm) for the DES. However, the ultra-relativistic DES does have quite a significant effect on Vp for β ≫ 1 and β ≪ 1, and the ultra-relativistic effect significantly enhances (reduces) Vp for β ≫ 1 (β ≪ 1). The DPDMNA waves and their dispersion properties are expected to be useful in understanding the basic features of the electrostatic perturbation mode in space and laboratory DQP systems.

  6. Preparation and Characterization of Acrylic Primer for Concrete Substrate Application

    Directory of Open Access Journals (Sweden)

    El-Sayed Negim

    2016-01-01

    Full Text Available This study dealt with the properties of acrylic primer for concrete substrate using acrylic syrup, made from a methyl methacrylate monomer solution of terpolymers. Terpolymer systems consisting of methyl methacrylate (MMA, 2-ethylhexyl acrylate (2-EHA, and methacrylic acid (MAA with different chemical composition ratios of MMA and 2-EHA were synthesized through bulk polymerization using azobisisobutyronitrile (AIBN as initiator. The terpolymer composition is characterized by FTIR, 1H NMR, DSC, TGA, and SEM. The glass transition temperature and the thermal stability increased with increasing amounts of MMA in the terpolymer backbone. The effect of chemical composition of terpolymers on physicomechanical properties of primer films was investigated. However, increasing the amount of MMA in terpolymer backbone increased tensile and contact angle of primer films while elongation at break, water absorption, and bond strength are decreased. In particular, the primer syrup containing 65% 2-EHA has good bonding strength with concrete substrate around 1.1 MPa.

  7. An Undergraduate Laboratory Experiment for Upper-Level Forensic Science, Biochemistry, or Molecular Biology Courses: Human DNA Amplification Using STR Single Locus Primers by Real-Time PCR with SYBR Green Detection

    Science.gov (United States)

    Elkins, Kelly M.; Kadunc, Raelynn E.

    2012-01-01

    In this laboratory experiment, real-time polymerase chain reaction (real-time PCR) was conducted using published human TPOX single-locus DNA primers for validation and various student-designed short tandem repeat (STR) primers for Combined DNA Index System (CODIS) loci. SYBR Green was used to detect the amplification of the expected amplicons. The…

  8. Structure of Hepatitis C Virus Polymerase in Complex with Primer-Template RNA

    Energy Technology Data Exchange (ETDEWEB)

    Mosley, Ralph T.; Edwards, Thomas E.; Murakami, Eisuke; Lam, Angela M.; Grice, Rena L.; Du, Jinfa; Sofia, Michael J.; Furman, Philip A.; Otto, Michael J. (Pharmasset); (Emerald)

    2012-08-01

    The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory {beta}-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesis at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory {beta}-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus.

  9. A new set of primers for the detection of Toxoplasma gondii in amniotic fluid using polymerase chain reaction.

    Science.gov (United States)

    Pelloux, H; Weiss, J; Simon, J; Muet, F; Fricker-Hidalgo, H; Goullier-Fleuret, A; Ambroise-Thomas, P

    1996-04-15

    A new PCR system including a pair of primers, a probe and an internal control were designed from the B1 gene of Toxoplasma gondii. The system described allowed the detection of less than 10 tachyzoites of the RH strain of T. gondii. Among 21 amniotic fluid samples, this system diagnosed the cases of congenital toxoplasmosis which were simultaneously diagnosed using mice inoculation, in vitro culture, and serology from both amniotic fluid and fetal blood. These results show that these new primers allow for a highly sensitive detection of T. gondii DNA.

  10. 3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.

    Science.gov (United States)

    Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong

    2008-09-01

    We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.

  11. A Primer on Alberta’s Oil sands Royalties

    Directory of Open Access Journals (Sweden)

    Sarah Dobson

    2015-12-01

    Full Text Available Fulfilling its campaign promise, the new NDP government announced a review of Alberta’s royalty framework in June 2015. The province receives royalty revenue from three main sources – natural gas, crude oil, and oil sands. Since the 2009-10 fiscal year the largest contributor to Alberta’s royalty revenues has been the oil sands. If you want a sense of how important oil sands royalties have been for Alberta’s finances, consider this: In the 2014–15 fiscal year, the government collected just over $5 billion from oil sands royalties. These royalties covered over 10 per cent of the province’s operational expenses of $48.6 billion in the same fiscal year. Over the last six fiscal years the oil sands have contributed an average of 10 per cent of revenues to provincial coffers. This makes oil sands royalties the fourth largest contributor behind personal income taxes (23 per cent, federal transfers (13 per cent and corporate income taxes (11 per cent. But how many Albertans really understand how the royalty system works? What do we mean when we say “royalty”? How does the Alberta Government calculate royalties on oil sands producers? If the system is going to change, it’s important that Albertans understand how the current system works. That is what this paper is designed to do. For Albertans to properly judge the impact of new policy, they need a solid understanding of the current policy environment. We all know that oil prices have dropped and oil sands producers are losing profitability. As such, changes to the royalty system could have a deep and profound impact on the sector. Here are some of the issues this primer will study: • Pre-payout projects vs. post-payout projects, in other words, the classification of projects for royalty purposes based on whether the cumulative costs of a project exceed its cumulative revenues • Monthly payment of royalties vs. annual payment • Understanding the unit price of bitumen and how that

  12. 454-Pyrosequencing analysis of bacterial communities from autotrophic nitrogen removal bioreactors utilizing universal primers : Effect of annealing temperature

    NARCIS (Netherlands)

    Gonzalez-Martinez, A.; Rodriguez-Sanchez, A.; Rodelas, B.; Abbas, B.A.; Martinez-Toledo, M.V.; Van Loosdrecht, M.C.M.; Osorio, F.; Gonzalez-Lopez, J.

    2015-01-01

    Identification of anaerobic ammonium oxidizing (anammox) bacteria by molecular tools aimed at the evaluation of bacterial diversity in autotrophic nitrogen removal systems is limited by the difficulty to design universal primers for the Bacteria domain able to amplify the anammox 16S

  13. PriFi - Using a Multiple Alignment of Related Sequences to Find Primers for  Amplification of Homologs

    DEFF Research Database (Denmark)

    Fredslund, Jakob; Schauser, Leif; Madsen, Lene Heegaard

    2005-01-01

    Using a comparative approach, the web program PriFi (http://cgi-www.daimi.au.dk/cgi-chili/PriFi/main) designs pairs of primers useful for PCR amplification of genomic DNA in species where prior sequence information is not available. The program works with an alignment of DNA sequences from phylog...

  14. PIPEMicroDB: microsatellite database and primer generation tool for pigeonpea genome.

    Science.gov (United States)

    Sarika; Arora, Vasu; Iquebal, M A; Rai, Anil; Kumar, Dinesh

    2013-01-01

    Molecular markers play a significant role for crop improvement in desirable characteristics, such as high yield, resistance to disease and others that will benefit the crop in long term. Pigeonpea (Cajanus cajan L.) is the recently sequenced legume by global consortium led by ICRISAT (Hyderabad, India) and been analysed for gene prediction, synteny maps, markers, etc. We present PIgeonPEa Microsatellite DataBase (PIPEMicroDB) with an automated primer designing tool for pigeonpea genome, based on chromosome wise as well as location wise search of primers. Total of 123 387 Short Tandem Repeats (STRs) were extracted from pigeonpea genome, available in public domain using MIcroSAtellite tool (MISA). The database is an online relational database based on 'three-tier architecture' that catalogues information of microsatellites in MySQL and user-friendly interface is developed using PHP. Search for STRs may be customized by limiting their location on chromosome as well as number of markers in that range. This is a novel approach and is not been implemented in any of the existing marker database. This database has been further appended with Primer3 for primer designing of selected markers with left and right flankings of size up to 500 bp. This will enable researchers to select markers of choice at desired interval over the chromosome. Furthermore, one can use individual STRs of a targeted region over chromosome to narrow down location of gene of interest or linked Quantitative Trait Loci (QTLs). Although it is an in silico approach, markers' search based on characteristics and location of STRs is expected to be beneficial for researchers. Database URL: http://cabindb.iasri.res.in/pigeonpea/

  15. Human disc degeneration is associated with increased MMP 7 expression.

    Science.gov (United States)

    Le Maitre, C L; Freemont, A J; Hoyland, J A

    2006-01-01

    During intervertebral disc (IVD) degeneration, normal matrix synthesis decreases and degradation of disc matrix increases. A number of proteases that are increased during disc degeneration are thought to be involved in its pathogenesis. Matrix metalloproteinase 7 (MMP 7) (Matrilysin, PUMP-1) is known to cleave the major matrix molecules found within the IVD, i.e., the proteoglycan aggrecan and collagen type II. To date, however, it is not known how its expression changes with degeneration or its exact location. We investigated the localization of MMP 7 in human, histologically graded, nondegenerate, degenerated and prolapsed discs to ascertain whether MMP 7 is up-regulated during disc degeneration. Samples of human IVD tissue were fixed in neutral buffered formalin, embedded in paraffin, and sections stained with hematoxylin and eosin to score the degree of morphological degeneration. Immunohistochemistry was performed to localize MMP 7 in 41 human IVDs with varying degrees of degeneration. We found that the chondrocyte-like cells of the nucleus pulposus and inner annulus fibrosus were MMP 7 immunopositive; little immunopositivity was observed in the outer annulus. Nondegenerate discs showed few immunopositive cells. A significant increase in the proportion of MMP 7 immunopositive cells was seen in the nucleus pulposus of discs classified as showing intermediate levels of degeneration and a further increase was seen in discs with severe degeneration. Prolapsed discs showed more MMP 7 immunopositive cells compared to nondegenerated discs, but fewer than those seen in cases of severe degeneration.

  16. A randomised, double-masked phase III/IV study of the efficacy and safety of Avastin® (Bevacizumab intravitreal injections compared to standard therapy in subjects with choroidal neovascularisation secondary to age-related macular degeneration: clinical trial design

    Directory of Open Access Journals (Sweden)

    Bunce Catey

    2008-10-01

    Full Text Available Abstract Background The management of neovascular age-related macular degeneration (nAMD has been transformed by the introduction of agents delivered by intravitreal injection which block the action of vascular endothelial growth factor-A (anti-VEGF agents. One such agent in widespread use is bevacizumab which was initially developed for use in oncology. Most of the evidence supporting the use of bevacizumab for nAMD has come from interventional case series and this clinical trial was initiated because of the increasing and widespread use of this agent in the treatment of nAMD (an off-label indication despite a lack of definitive unbiased safety and efficacy data. Methods and design The Avastin® (bevacizumab for choroidal neovascularisation (ABC trial is a double-masked randomised controlled trial comparing intravitreal bevacizumab injections to standard therapy in the treatment of nAMD. Patients are randomised to intravitreal bevacizumab or standard therapy available at the time of trial initiation (verteporfin photodynamic therapy, intravitreal pegaptanib or sham treatment. Ranibizumab treatment was not included in the control arm as it had not been licensed for use at the start of recruitment for this trial. The primary outcome is the proportion of patients gaining ≥ 15 letters of visual acuity at 1 year and secondary outcomes include the proportion of patients with stable vision and mean visual acuity change. Discussion The ABC Trial is the first double-masked randomised control trial to investigate the efficacy and safety of intravitreal bevacizumab in the treatment of nAMD. This trial fully recruited in November 2007 and results should be available in early 2009. Important design issues for this clinical trial include (a defining the control group (b use of gain in vision as primary efficacy end-point and (c use of pro re nata treatment using intravitreal bevacizumab rather than continuous therapy. Trial registration Current controlled

  17. Intacs for early pellucid marginal degeneration.

    Science.gov (United States)

    Kymionis, George D; Aslanides, Ioannis M; Siganos, Charalambos S; Pallikaris, Ioannis G

    2004-01-01

    A 42-year-old man had Intacs (Addition Technology Inc.) implantation for early pellucid marginal degeneration (PMD). Two Intacs segments (0.45 mm thickness) were inserted uneventfully in the fashion typically used for low myopia correction (nasal-temporal). Eleven months after the procedure, the uncorrected visual acuity was 20/200, compared with counting fingers preoperatively, while the best spectacle-corrected visual acuity improved to 20/25 from 20/50. Corneal topographic pattern also improved. Although the results are encouraging, concern still exists regarding the long-term effect of this approach for the management of patients with PMD.

  18. Genome instability: Linking ageing and brain degeneration.

    Science.gov (United States)

    Barzilai, Ari; Schumacher, Björn; Shiloh, Yosef

    2017-01-01

    Ageing is a multifactorial process affected by cumulative physiological changes resulting from stochastic processes combined with genetic factors, which together alter metabolic homeostasis. Genetic variation in maintenance of genome stability is emerging as an important determinant of ageing pace. Genome instability is also closely associated with a broad spectrum of conditions involving brain degeneration. Similarities and differences can be found between ageing-associated decline of brain functionality and the detrimental effect of genome instability on brain functionality and development. This review discusses these similarities and differences and highlights cell classes whose role in these processes might have been underestimated-glia and microglia. Copyright © 2016. Published by Elsevier B.V.

  19. Degenerate stars. XII - Recognition of hot nondegenerates

    Science.gov (United States)

    Greenstein, J. L.

    1980-12-01

    Fifty-one newly observed degenerate stars and 14 nondegenerates include 13 faint red stars, most of which do not show any lines except DF, Gr 554. Hot subdwarfs and an X-ray source are discussed along with the problem of low-resolution spectroscopic classification of dense hot stars. The multichannel spectrum of the carbon-rich magnetic star LP 790-29 is examined by fitting the undisturbed parts of the spectrum to a black body of 7625 K by the least squares method; the Swan bands absorb 600 A of the spectrum assuming that the blocked radiation is redistributed in the observed region.

  20. Aneutronic fusion in a degenerate plasma

    International Nuclear Information System (INIS)

    Son, S.; Fisch, N.J.

    2004-01-01

    In a Fermi-degenerate plasma, the electronic stopping of a slow ion is smaller than that given by the classical formula, because some transitions between the electron states are forbidden. The bremsstrahlung losses are then smaller, so that the nuclear burning of an aneutronic fuel is more efficient. Consequently, there occurs a parameter regime in which self-burning is possible. Practical obstacles in this regime that must be overcome before net energy can be realized include the compression of the fuel to an ultra dense state and the creation of a hot spot

  1. Aneutronic Fusion in a Degenerate Plasma

    International Nuclear Information System (INIS)

    Son, S.; Fisch, N.J.

    2004-01-01

    In a Fermi-degenerate plasma, the electronic stopping of a slow ion is smaller than that given by the classical formula, because some transitions between the electron states are forbidden. The bremsstrahlung losses are then smaller, so that the nuclear burning of an aneutronic fuel is more efficient. Consequently, there occurs a parameter regime in which self-burning is possible. Practical obstacles in this regime that must be overcome before net energy can be realized include the compression of the fuel to an ultra dense state and the creation of a hot spot

  2. MRI and MR tractography in bilateral hypertrophic olivary degeneration

    Directory of Open Access Journals (Sweden)

    Debraj Sen

    2014-01-01

    Full Text Available Hypertrophic olivary degeneration is a trans-synaptic neuronal degeneration associated with hypertrophy of the inferior olivary nucleus due to a lesion in the triangle of Guillain-Mollaret. Familiarity with this entity on magnetic resonance imaging (MRI is essential to avoid other erroneous ominous diagnoses. We present a case of bilateral hypertrophic olivary degeneration and discuss the etiopathogenesis and MRI findings in this entity. The contributory role of MR tractography in the diagnosis is also highlighted.

  3. MRI and MR tractography in bilateral hypertrophic olivary degeneration.

    Science.gov (United States)

    Sen, Debraj; Gulati, Yoginder S; Malik, Virender; Mohimen, Aneesh; Sibi, Eranki; Reddy, Deepak Chandra

    2014-10-01

    Hypertrophic olivary degeneration is a trans-synaptic neuronal degeneration associated with hypertrophy of the inferior olivary nucleus due to a lesion in the triangle of Guillain-Mollaret. Familiarity with this entity on magnetic resonance imaging (MRI) is essential to avoid other erroneous ominous diagnoses. We present a case of bilateral hypertrophic olivary degeneration and discuss the etiopathogenesis and MRI findings in this entity. The contributory role of MR tractography in the diagnosis is also highlighted.

  4. An Unusual Case of Extensive Lattice Degeneration and Retinal Detachment

    OpenAIRE

    Mathew, David J.; Sarma, Saurabh Kumar; Basaiawmoit, Jennifer V.

    2016-01-01

    Lattice degeneration of the retina is not infrequently encountered on a dilated retinal examination and many of them do not need any intervention. We report a case of atypical lattice degeneration variant with peripheral retinal detachment. An asymptomatic 35-year-old lady with minimal refractive error was found to have extensive lattice degeneration, peripheral retinal detachment and fibrotic changes peripherally with elevation of retinal vessels on dilated retinal examination. There were al...

  5. MRI and MR tractography in bilateral hypertrophic olivary degeneration

    International Nuclear Information System (INIS)

    Sen, Debraj; Gulati, Yoginder S.; Malik, Virender; Mohimen, Aneesh; Sibi, Eranki; Reddy, Deepak Chandra

    2014-01-01

    Hypertrophic olivary degeneration is a trans-synaptic neuronal degeneration associated with hypertrophy of the inferior olivary nucleus due to a lesion in the triangle of Guillain-Mollaret. Familiarity with this entity on magnetic resonance imaging (MRI) is essential to avoid other erroneous ominous diagnoses. We present a case of bilateral hypertrophic olivary degeneration and discuss the etiopathogenesis and MRI findings in this entity. The contributory role of MR tractography in the diagnosis is also highlighted

  6. Mutations in ABCR (ABCA4) in patients with Stargardt macular degeneration or cone-rod degeneration.

    Science.gov (United States)

    Briggs, C E; Rucinski, D; Rosenfeld, P J; Hirose, T; Berson, E L; Dryja, T P

    2001-09-01

    To determine the spectrum of ABCR mutations associated with Stargardt macular degeneration and cone-rod degeneration (CRD). One hundred eighteen unrelated patients with recessive Stargardt macular degeneration and eight with recessive CRD were screened for mutations in ABCR (ABCA4) by single-strand conformation polymorphism analysis. Variants were characterized by direct genomic sequencing. Segregation analysis was performed on the families of 20 patients in whom at least two or more likely pathogenic sequence changes were identified. The authors found 77 sequence changes likely to be pathogenic: 21 null mutations (15 novel), 55 missense changes (26 novel), and one deletion of a consensus glycosylation site (also novel). Fifty-two patients with Stargardt macular degeneration (44% of those screened) and five with CRD each had two of these sequence changes or were homozygous for one of them. Segregation analyses in the families of 19 of these patients were informative and revealed that the index cases and all available affected siblings were compound heterozygotes or homozygotes. The authors found one instance of an apparently de novo mutation, Ile824Thr, in a patient. Thirty-seven (31%) of the 118 patients with Stargardt disease and one with CRD had only one likely pathogenic sequence change. Twenty-nine patients with Stargardt disease (25%) and two with CRD had no identified sequence changes. This report of 42 novel mutations brings the growing number of identified likely pathogenic sequence changes in ABCR to approximately 250.

  7. Many-Body Green Function of Degenerate Systems

    International Nuclear Information System (INIS)

    Brouder, Christian; Panati, Gianluca; Stoltz, Gabriel

    2009-01-01

    A rigorous nonperturbative adiabatic approximation of the evolution operator in the many-body physics of degenerate systems is derived. This approximation is used to solve the long-standing problem of the choice of the initial states of H 0 leading to eigenstates of H 0 +V for degenerate systems. These initial states are eigenstates of P 0 VP 0 , where P 0 is the projection onto a degenerate eigenspace of H 0 . This result is used to give the proper definition of the Green function, the statistical Green function and the nonequilibrium Green function of degenerate systems. The convergence of these Green functions is established.

  8. The prognosis of retinal detachment due to lattice degeneration.

    Science.gov (United States)

    Benson, W E; Morse, P H

    1978-09-01

    In a series of 553 consecutive retinal detachments, 29% (120) were due to lattice degeneration. Forty-five percent of these were due to atrophic holes in the lattice degeneration and 55% were due to tears caused by traction posterior to or at the end of a patch of lattice. In phakic patients, retinal detachments due to atrophic holes were most common in young myopes. Detachments due to traction tears were seen in older, less myopic patients. The incidence of massive periretinal proliferation was less (5%) in detachments due to lattice degeneration than in detachments not due to lattice degeneration (6.5%).

  9. Amplification of marine methanotrophic enrichment DNA with 16S rDNA PCR primers for type II alpha proteobacteria methanotrophs.

    Science.gov (United States)

    Rockne, Karl J; Strand, Stuart E

    2003-09-01

    Type II alpha proteobacteria methanotrophs are capable of a wide range of cometabolic transformations of chlorinated solvents and polycyclic aromatic hydrocarbons (PAHs), and this activity has been exploited in many terrestrial bioremediation systems. However, at present, all known obligately marine methanotrophic isolates are Type I gamma proteobacteria which do not have this activity to the extent of Type II methanotrophs. In previous work in our laboratory, determining the presence of Type II alpha proteobacteria methanotrophs in marine enrichment cultures that co-metabolized PAHs required a more sensitive assay. 16S rDNA PCR primers were designed based on oligonucleotide probes for serine pathway methanotrophs and serine pathway methylotrophs with an approximate amplification fragment size of 870 base pairs. Comparison of the primers using double primer BLAST searches in established nucleotide databases showed potential amplification with all Methylocystis and Methylosinus spp., as well as potential amplification with Methylocella palustrus. DNA from Methylosinus trichosporium OB3b, a Type II methanotroph, amplified with the primers with a fragment size of approximately 850 base pairs, whereas DNA extracted from Methylomonas methanica, a Type I methanotroph, did not. The primers were used to amplify DNA extracted from two marine methanotrophic enrichment cultures: a low nitrogen/low copper enrichment to select for Type II methanotrophs and a high nitrogen/high copper enrichment to select for Type I methanotrophs. Although DNA from both cultures amplified with the PCR primers, amplification was stronger in cultures that were specifically enriched for Type II methanotrophs, suggesting the presence of higher numbers of Type II methanotrophs. These results provide further evidence for the existence of Type II marine methanotrophs, suggesting the possibility of exploiting cometabolic activity in marine systems.

  10. Getting superstring amplitudes by degenerating Riemann surfaces

    International Nuclear Information System (INIS)

    Matone, Marco; Volpato, Roberto

    2010-01-01

    We explicitly show how the chiral superstring amplitudes can be obtained through factorisation of the higher genus chiral measure induced by suitable degenerations of Riemann surfaces. This powerful tool also allows to derive, at any genera, consistency relations involving the amplitudes and the measure. A key point concerns the choice of the local coordinate at the node on degenerate Riemann surfaces that greatly simplifies the computations. As a first application, starting from recent ansaetze for the chiral measure up to genus five, we compute the chiral two-point function for massless Neveu-Schwarz states at genus two, three and four. For genus higher than three, these computations include some new corrections to the conjectural formulae appeared so far in the literature. After GSO projection, the two-point function vanishes at genus two and three, as expected from space-time supersymmetry arguments, but not at genus four. This suggests that the ansatz for the superstring measure should be corrected for genus higher than four.

  11. Metabolic anatomy of paraneoplastic cerebellar degeneration

    International Nuclear Information System (INIS)

    Anderson, N.E.; Posner, J.B.; Sidtis, J.J.; Moeller, J.R.; Strother, S.C.; Dhawan, V.; Rottenberg, D.A.

    1988-01-01

    Eleven patients with acquired cerebellar degeneration (10 of whom had paraneoplastic cerebellar degeneration [PCD]) were evaluated using neuropsychological tests and 18 F-fluorodeoxyglucose/positron emission tomography to (1) quantify motor, cognitive, and metabolic abnormalities; (2) determine if characteristic alterations in the regional cerebral metabolic rate for glucose (rCMRGlc) are associated with PCD; and (3) correlate behavioral and metabolic measures of disease severity. Eighteen volunteer subjects served as normal controls. Although some PCD neuropsychological test scores were abnormal, these results could not, in general, be dissociated from the effects of dysarthria and ataxia. rCMRGlc was reduced in patients with PCD (versus normal control subjects) in all regions except the brainstem. Analysis of patient and control rCMRGlc data using a mathematical model of regional metabolic interactions revealed two metabolic pattern descriptors, SSF1 and SSF2, which distinguished patients with PCD from normal control subjects; SSF2, which described a metabolic coupling between cerebellum, cuneus, and posterior temporal, lateral frontal, and paracentral cortex, correlated with quantitative indices of cerebellar dysfunction. Our inability to document substantial intellectual impairment in 7 of 10 patients with PCD contrasts with the 50% incidence of dementia in PCD reported by previous investigators. Widespread reductions in PCD rCMRGlc may result from the loss of cerebellar efferents to thalamus and forebrain structures, a reverse cerebellar diaschisis

  12. Progranulin in frontotemporal lobar degeneration and neuroinflammation

    Directory of Open Access Journals (Sweden)

    Hutton Michael L

    2007-02-01

    Full Text Available Abstract Progranulin (PGRN is a pleiotropic protein that has gained the attention of the neuroscience community with recent discoveries of mutations in the gene for PGRN that cause frontotemporal lobar degeneration (FTLD. Pathogenic mutations in PGRN result in null alleles, and the disease is likely the result of haploinsufficiency. Little is known about the normal function of PGRN in the central nervous system apart from a role in brain development. It is expressed by microglia and neurons. In the periphery, PGRN is involved in wound repair and inflammation. High PGRN expression has been associated with more aggressive growth of various tumors. The properties of full length PGRN are distinct from those of proteolytically derived peptides, referred to as granulins (GRNs. While PGRN has trophic properties, GRNs are more akin to inflammatory mediators such as cytokines. Loss of the neurotrophic properties of PGRN may play a role in selective neuronal degeneration in FTLD, but neuroinflammation may also be important. Gene expression studies suggest that PGRN is up-regulated in a variety of neuroinflammatory conditions, and increased PGRN expression by microglia may play a pivotal role in the response to brain injury, neuroinflammation and neurodegeneration.

  13. Observable consequences of partially degenerate leptogenesis

    CERN Document Server

    Ellis, Jonathan Richard; Yanagida, T; Ellis, John; Raidal, Martti

    2002-01-01

    In the context of the seesaw mechanism, it is natural that the large solar and atmospheric neutrino mixing angles originate separately from large 2 by 2 mixings in the neutrino and charged-lepton sectors, respectively, and large mixing in the neutrino couplings is in turn more plausible if two of the heavy singlet neutrinos are nearly degenerate. We study the phenomenology of this scenario, calculating leptogenesis by solving numerically the set of coupled Boltzmann equations for out-of-equilibrium heavy singlet neutrino decays in the minimal supersymmetric seesaw model. The near-degenerate neutrinos may weigh < 10^8 GeV, avoiding the cosmological gravitino problem. This scenario predicts that Br(mu to e gamma) should be strongly suppressed, because of the small singlet neutrino masses, whilst Br(tau to mu gamma) may be large enough to be observable in B-factory or LHC experiments. If the light neutrino masses are hierarchical, we predict that the neutrinoless double-beta decay parameter m_{ee} is approxim...

  14. MR imaging findings of hypertrophic olivary degeneration

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Do Joong; Jeon, Pyung; Kim, Dong Ik [Yonsei Univ. College of Medicine, Seoul (Korea, Republic of)

    1997-06-01

    To describe the magnetic resonance (MR) imaging findings of hypertrophic olivary degeneration (HOD) MR images of seven patients with HOD were retrospectively reviewed. Two were women and five were men, and they were aged between 48 and 65 (mean 58) years. Imaging examinations were performed with a 1.5-T unit, and the findings were used to evaluate the size and signal intensity of olivary lesions. The time interval from hemorrhagic ictus to MR imaging was between two and 30 months. Follow-up examinations were performed in two patients. All four patients with hemorrhages involving the central tegmental tract in the pons or midbrain showed ipsilateral HOD. Among these four, bilateral HOD was seen in one patient with hemorrhage involving the bilateral central tegmental tract, and in another with tegmental hemorrhage extending to the ipsilateral superior cerebellar peduncle. One patient with cerebellar hemorrhage involving the dentate nucleus had contralateral HOD. Two patients with multiple hemorrhages involving both the pons and cerebellum showed bilateral HOD. Axial MR images showed mild enlargement of the involved olivary mucleus, with high signal intensity on both proton density and T2 weighted images. There was no apparent enhancement on postcontrast T1-weighted images. MR imaging can clearly distinguish secondary olivary degeneration from underlying pathology involving the central tegmental tract in the pons or midbrain and cerebellum. These olivary abnormalities should not, however, be mistaken for primary medullary lesions.

  15. Vitreous in lattice degeneration of retina.

    Science.gov (United States)

    Foos, R Y; Simons, K B

    1984-05-01

    A localized pocket of missing vitreous invariably overlies lattice degeneration of the retina. Subjects with lattice also have a higher rate of rhegmatogenous retinal detachment, which is usually a complication of retinal tears. The latter are in turn a result of alterations in the central vitreous--that is, synchysis senilis leading to posterior vitreous detachment. In order to determine if there is either an association or a deleterious interaction between the local and central lesions of the vitreous in eyes with lattice, a comparison was made in autopsy eyes with and without lattice the degree of synchysis and rate of vitreous detachment. Results show no association between the local and central vitreous lesions, indicating that a higher rate of vitreous detachment is not the basis for the higher rate of retinal detachment in eyes with lattice. Also, there was no suggestion of deleterious interaction between the local and central vitreous lesions, either through vitreodonesis as a basis for precocious vitreous detachment, or through a greater degree of synchysis as a basis for interconnection of local and central lacunae (which could extend the localized retinal detachment in eyes with holes in lattice degeneration).

  16. MR imaging findings of hypertrophic olivary degeneration

    International Nuclear Information System (INIS)

    Kim, Do Joong; Jeon, Pyung; Kim, Dong Ik

    1997-01-01

    To describe the magnetic resonance (MR) imaging findings of hypertrophic olivary degeneration (HOD) MR images of seven patients with HOD were retrospectively reviewed. Two were women and five were men, and they were aged between 48 and 65 (mean 58) years. Imaging examinations were performed with a 1.5-T unit, and the findings were used to evaluate the size and signal intensity of olivary lesions. The time interval from hemorrhagic ictus to MR imaging was between two and 30 months. Follow-up examinations were performed in two patients. All four patients with hemorrhages involving the central tegmental tract in the pons or midbrain showed ipsilateral HOD. Among these four, bilateral HOD was seen in one patient with hemorrhage involving the bilateral central tegmental tract, and in another with tegmental hemorrhage extending to the ipsilateral superior cerebellar peduncle. One patient with cerebellar hemorrhage involving the dentate nucleus had contralateral HOD. Two patients with multiple hemorrhages involving both the pons and cerebellum showed bilateral HOD. Axial MR images showed mild enlargement of the involved olivary mucleus, with high signal intensity on both proton density and T2 weighted images. There was no apparent enhancement on postcontrast T1-weighted images. MR imaging can clearly distinguish secondary olivary degeneration from underlying pathology involving the central tegmental tract in the pons or midbrain and cerebellum. These olivary abnormalities should not, however, be mistaken for primary medullary lesions

  17. Hyaline cartilage degenerates after autologous osteochondral transplantation.

    Science.gov (United States)

    Tibesku, C O; Szuwart, T; Kleffner, T O; Schlegel, P M; Jahn, U R; Van Aken, H; Fuchs, S

    2004-11-01

    Autologous osteochondral grafting is a well-established clinical procedure to treat focal cartilage defects in patients, although basic research on this topic remains sparse. The aim of the current study was to evaluate (1) histological changes of transplanted hyaline cartilage of osteochondral grafts and (2) the tissue that connects the transplanted cartilage with the adjacent cartilage in a sheep model. Both knee joints of four sheep were opened surgically and osteochondral grafts were harvested and simultaneously transplanted to the contralateral femoral condyle. The animals were sacrificed after three months and the received knee joints were evaluated histologically. Histological evaluation showed a complete ingrowth of the osseous part of the osteochondral grafts. A healing or ingrowth at the level of the cartilage could not be observed. Histological evaluation of the transplanted grafts according to Mankin revealed significantly more and more severe signs of degeneration than the adjacent cartilage, such as cloning of chondrocytes and irregularities of the articular surface. We found no connecting tissue between the transplanted and the adjacent cartilage and histological signs of degeneration of the transplanted hyaline cartilage. In the light of these findings, long-term results of autologous osteochondral grafts in human beings have to be followed critically.

  18. Schrodinger's scat: a critical review of the currently available tiger (Panthera Tigris) and leopard (Panthera pardus) specific primers in India, and a novel leopard specific primer.

    Science.gov (United States)

    Maroju, Pranay Amruth; Yadav, Sonu; Kolipakam, Vishnupriya; Singh, Shweta; Qureshi, Qamar; Jhala, Yadvendradev

    2016-02-09

    Non-invasive sampling has opened avenues for the genetic study of elusive species, which has contributed significantly to their conservation. Where field based identity of non-invasive sample is ambiguous (e.g. carnivore scats), it is essential to establish identity of the species through molecular approaches. A cost effective procedure to ascertain species identity is to use species specific primers (SSP) for PCR amplification and subsequent resolution through agarose gel electrophoresis. However, SSPs if ill designed can often cross amplify non-target sympatric species. Herein we report the problem of cross amplification with currently published SSPs, which have been used in several recent scientific articles on tigers (Panthera tigris) and leopards (Panthera pardus) in India. Since these papers form pioneering research on which future work will be based, an early rectification is required so as to not propagate this error further. We conclusively show cross amplification of three of the four SSPs, in sympatric non-target species like tiger SSP amplifying leopard and striped hyena (Hyaena hyaena), and leopard SSP amplifying tiger, lion (Panthera leo persica) and clouded leopard (Neofelis nebulosa), with the same product size. We develop and test a non-cross-amplifying leopard specific primer pair within the mitochondrial cytochrome b region. We also standardize a duplex PCR method to screen tiger and leopard samples simultaneously in one PCR reaction to reduce cost and time. These findings suggest the importance of an often overlooked preliminary protocol of conclusive identification of species from non-invasive samples. The cross amplification of published primers in conspecifics suggests the need to revisit inferences drawn by earlier work.

  19. Progressive Retinal Degeneration and Accumulation of Autofluorescent Lipopigments in Progranulin Deficient Mice

    Science.gov (United States)

    Hafler, Brian P.; Klein, Zoe A.; Zhou, Z. Jimmy; Strittmatter, Stephen M.

    2014-01-01

    Prior investigations have shown that patients with neuronal ceroid lipofuscinosis (NCL) develop neurodegeneration characterized by vision loss, motor dysfunction, seizures, and often early death. Neuropathological analysis of patients with NCL shows accumulation of intracellular autofluorescent storage material, lipopigment, throughout neurons in the central nervous system including in the retina. A recent study of a sibling pair with adult onset NCL and retinal degeneration showed linkage to the region of the progranulin (GRN) locus and a homozygous mutation was demonstrated in GRN. In particular, the sibling pair with a mutation in GRN developed retinal degeneration and optic atrophy. This locus for this form of adult onset neuronal ceroid lipofuscinosis was designated neuronal ceroid lipofuscinosis-11 (CLN11). Based on these clinical observations, we wished to determine whether Grn-null mice develop accumulation of autofluorescent particles and retinal degeneration. Retinas of both wild-type and Progranulin deficient mice were examined by immunostaining and autofluorescence. Accumulation of autofluorescent material was present in Progranulin deficient mice at 12 months. Degeneration of multiple classes of neurons including photoreceptors and retinal ganglion cells was noted in mice at 12 and 18 months. Our data shows that Grn−/− mice develop degenerative pathology similar to features of human CLN11. PMID:25234724

  20. Correlations between radiographic, magnetic resonance and histological examinations on the degeneration of human lumbar intervertebral discs

    Directory of Open Access Journals (Sweden)

    Delio Eulalio Martins

    Full Text Available CONTEXT AND OBJECTIVE: There is controversy regarding which imaging method is best for identifying early degenerative alterations in intervertebral discs. No correlations between such methods and histological finds are presented in the literature. The aim of this study was to correlate the thickness of intervertebral discs measured on simple radiographs with the degree of degeneration seen on magnetic resonance images and the histological findings relating to nerve ends inside the discs. DESIGN AND SETTING: Cross-sectional correlation study on the lumbar spines of human cadavers, at Universidade Federal de São Paulo (Unifesp, São Paulo, Brazil. METHODS: Ten lumbar spinal columns were extracted from human cadavers and subjected to magnetic resonance imaging and simple radiography. They were classified according to the degree of disc degeneration seen on magnetic resonance, and the thickness of the discs was measured on radiographs. The intervertebral discs were then extracted, embedded in paraffin and analyzed immunohistochemically with protein S100, and the nerve fibers were counted and classified. RESULTS: No correlation was observed between the thickness of the intervertebral discs and the degree of degeneration seen on magnetic resonance images. Only the uppermost lumbar discs (L1/L2 and L2/L3 presented a correlation between their thickness and type I and IV nerve endings. CONCLUSION: Reduced disc thickness is unrelated to increased presence of nerve ends in intervertebral discs, or to the degree of disc degeneration.

  1. Inteligencia emocional y autoconcepto en los estudiantes de primer ciclo

    OpenAIRE

    Castillo Canales, Braulio

    2017-01-01

    En nuestra investigación se tuvo como problema: ¿Qué relación existe entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II? Además el objetivo fue: Determinar la relación entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II. El tipo de estudio fue básica...

  2. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    Energy Technology Data Exchange (ETDEWEB)

    Lucas, D.S.

    2004-10-03

    This paper covers the basics of the implementation of the control volume method in the context of the Homogeneous Equilibrium Model (HEM)(T/H) code using the conservation equations of mass, momentum, and energy. This primer uses the advection equation as a template. The discussion will cover the basic equations of the control volume portion of the course in the primer, which includes the advection equation, numerical methods, along with the implementation of the various equations via FORTRAN into computer programs and the final result for a three equation HEM code and its validation.

  3. Investment Primer for Green Revolving Funds

    Science.gov (United States)

    Weisbord, Dano

    2012-01-01

    Developing return-oriented green revolving funds (GRFs) is a rapidly growing trend at colleges and universities. A green revolving fund (GRF) is a special account designated for investment in on-campus projects that improve energy efficiency or decrease material use. GRFs invest in a variety of cost-saving initiatives, resulting in significant…

  4. A dam for retrograde axonal degeneration in multiple sclerosis?

    NARCIS (Netherlands)

    Balk, L.J.; Twisk, J.W.R.; Steenwijk, M.D.; Daams, M.; Tewarie, P.; Killestein, J.; Uitdehaag, B.M.J.; Polman, C.H.; Petzold, A.F.S.

    2014-01-01

    Objective: Trans-synaptic axonal degeneration is a mechanism by which neurodegeneration can spread from a sick to a healthy neuron in the central nervous system. This study investigated to what extent trans-synaptic axonal degeneration takes place within the visual pathway in multiple sclerosis

  5. New treatment strategies for canine intervertebral disc degeneration

    NARCIS (Netherlands)

    Smolders, L.A.

    2013-01-01

    Degeneration of the intervertebral disc (IVD) is a common problem in dogs and humans. IVD degeneration can lead to herniation of the IVD with subsequent compression of neural structures and various clinical signs, including back pain. Current treatment of IVD disease is conservative or surgical.

  6. Lattice degeneration of the retina and retinal detachment.

    Science.gov (United States)

    Semes, L P

    1992-01-01

    Lattice retinal degeneration is considered the most significant peripheral retinal disorder potentially predisposing to retinal breaks and retinal detachment. Lattice degeneration affects the vitreous and inner retinal layers with secondary changes as deep as the retinal pigment epithelium and perhaps the choriocapillaris. Variations in clinical appearance are the rule; geographically, lattice lesions favor the vertical meridians between the equator and the ora serrata. Lattice degeneration begins early in life and has been reported in sequential generations of the same family. Along with its customary bilateral occurrence, lattice shares other characteristics of a dystrophy. The association between the vitreous and retina in lattice lesions may be responsible for the majority of lattice-induced retinal detachments. The tumultuous event of posterior vitreous separation in the presence of abnormally strong vitreoretinal adherence is the trigger for a retinal tear that, in turn, may lead to retinal detachment. Although retinal holes in young patients with lattice degeneration may play a role in the evolution of retinal detachment, the clinical course of lattice degeneration seems to be one of dormancy rather than of progressive change. This discussion outlines the pathophysiology of lattice retinal degeneration and the relationship of pathophysiology to clinical presentation. The epidemiology of lattice degeneration is summarized, as are the possible precursors to retinal detachment. A clinical characterization of the natural history of lattice degeneration is offered, and interventions for complications are described. To conclude, management strategies from a primary-care standpoint are reviewed.

  7. Prevalence of age-related macular degeneration in elderly Caucasians

    DEFF Research Database (Denmark)

    Erke, Maja G; Bertelsen, Geir; Peto, Tunde

    2012-01-01

    To describe the sex- and age-specific prevalence of drusen, geographic atrophy, and neovascular age-related macular degeneration (AMD).......To describe the sex- and age-specific prevalence of drusen, geographic atrophy, and neovascular age-related macular degeneration (AMD)....

  8. Variation in extragenic repetitive DNA sequences in Pseudomonas syringae and potential use of modified REP primers in the identification of closely related isolates

    Directory of Open Access Journals (Sweden)

    Elif Çepni

    2012-01-01

    Full Text Available In this study, Pseudomonas syringe pathovars isolated from olive, tomato and bean were identified by species-specific PCR and their genetic diversity was assessed by repetitive extragenic palindromic (REP-PCR. Reverse universal primers for REP-PCR were designed by using the bases of A, T, G or C at the positions of 1, 4 and 11 to identify additional polymorphism in the banding patterns. Binding of the primers to different annealing sites in the genome revealed additional fingerprint patterns in eight isolates of P. savastanoi pv. savastanoi and two isolates of P. syringae pv. tomato. The use of four different bases in the primer sequences did not affect the PCR reproducibility and was very efficient in revealing intra-pathovar diversity, particularly in P. savastanoi pv. savastanoi. At the pathovar level, the primer BOX1AR yielded shared fragments, in addition to five bands that discriminated among the pathovars P. syringae pv. phaseolicola, P. savastanoi pv. savastanoi and P. syringae pv. tomato. REP-PCR with a modified primer containing C produced identical bands among the isolates in a pathovar but separated three pathovars more distinctly than four other primers. Although REP-and BOX-PCRs have been successfully used in the molecular identification of Pseudomonas isolates from Turkish flora, a PCR based on inter-enterobacterial repetitive intergenic concensus (ERIC sequences failed to produce clear banding patterns in this study.

  9. Evaluation of the shear bond strength of lingual brackets manufactured by three different processes using two different adhesive primers: An in vitro study

    Directory of Open Access Journals (Sweden)

    Shrinivas Ashtekar

    2016-01-01

    Full Text Available Objective: To compare and evaluate the shear bond strength (SBS of lingual brackets, manufactured by three different processes, that is, laser sintering, milling, and casting, bonded with two different adhesive primers. Materials and Methods: One hundred and twenty premolars were selected, and three types of lingual brackets were used, namely, STB (milling, 7th Generation (casting, and lingualmatrix (laser sintering. Forty brackets per system were used half of which were sandblasted while the other half were used as available. Further, these were subdivided and bonded with Transbond XT primer and adhesive and 3M ESPE Primer and Transbond XT adhesive. Customization of STB and 7th Generation was done by Torque Angulation Reference Guide, Lingualmatrix had bases customized by Computer-aided design/computer-aided manufacturing. SBS was tested with universal testing machine and evaluated for adhesive remnant index (ARI. Results: Statistical analysis showed that surface treatment, use of different primers, method of customization influenced the SBS, and ARI suggested that the fracture occurred between composite and bracket interface. Conclusion: Lingualmatrix bracket showed greater SBS as compared to STB and 7th Generation, sandblasting increased SBS. 3M ESPE primer group showed increased SBS as that bonded with Transbond XT primer. The fracture was between the composite bracket interface.

  10. Nanotechnology-based drug delivery treatments and specific targeting therapy for age-related macular degeneration

    Directory of Open Access Journals (Sweden)

    Tai-Chi Lin

    2015-11-01

    Full Text Available Nanoparticles combined with cells, drugs, and specially designed genes provide improved therapeutic efficacy in studies and clinical setting, demonstrating a new era of treatment strategy, especially in retinal diseases. Nanotechnology-based drugs can provide an essential platform for sustaining, releasing and a specific targeting design to treat retinal diseases. Poly-lactic-co-glycolic acid is the most widely used biocompatible and biodegradable polymer approved by the Food and Drug Administration. Many studies have attempted to develop special devices for delivering small-molecule drugs, proteins, and other macromolecules consistently and slowly. In this article, we first review current progress in the treatment of age-related macular degeneration. Then, we discuss the function of vascular endothelial growth factor (VEGF and the pharmacological effects of anti-VEGF-A antibodies and soluble or modified VEGF receptors. Lastly, we summarize the combination of antiangiogenic therapy and nanomedicines, and review current potential targeting therapy in age-related macular degeneration.

  11. Simultaneous identification and DNA barcoding of six Eimeria species infecting turkeys using PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus.

    Science.gov (United States)

    Hafeez, Mian A; Shivaramaiah, Srichaitanya; Dorsey, Kristi Moore; Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Cobean, Julie; Barta, John R

    2015-05-01

    Species-specific PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus were generated that allow for the specific identification of the most common Eimeria species infecting turkeys (i.e., Eimeria adenoeides, Eimeria meleagrimitis, Eimeria gallopavonis, Eimeria meleagridis, Eimeria dispersa, and Eimeria innocua). PCR reaction chemistries were optimized with respect to divalent cation (MgCl2) and dNTP concentrations, as well as PCR cycling conditions (particularly anneal temperature for primers). Genomic DNA samples from single oocyst-derived lines of six Eimeria species were tested to establish specificity and sensitivity of these newly designed primer pairs. A mixed 60-ng total DNA sample containing 10 ng of each of the six Eimeria species was used as DNA template to demonstrate specific amplification of the correct product using each of the species-specific primer pairs. Ten nanograms of each of the five non-target Eimeria species was pooled to provide a non-target, control DNA sample suitable to test the specificity of each primer pair. The amplifications of the COI region with species-specific primer pairs from pooled samples yielded products of expected sizes (209 to 1,012 bp) and no amplification of non-target Eimeria sp. DNA was detected using the non-target, control DNA samples. These primer pairs specific for Eimeria spp. of turkeys did not amplify any of the seven Eimeria species infecting chickens. The newly developed PCR primers can be used as a diagnostic tool capable of specifically identifying six turkey Eimeria species; additionally, sequencing of the PCR amplification products yields sequence-based genotyping data suitable for identification and molecular phylogenetics.

  12. Negative electroretinograms in pericentral pigmentary retinal degeneration.

    Science.gov (United States)

    Hotta, Kazuki; Kondo, Mineo; Nakamura, Makoto; Hotta, Junko; Terasaki, Hiroko; Miyake, Yozo; Hida, Tetsuo

    2006-01-01

    The clinical presentation and electrophysiological findings are described of three consecutive cases with pericentral pigmentary retinal degeneration. The responses to bright flashes after dark adaptation showed negative waveform shape in all cases. Rod responses were strongly reduced compared with cone responses. Cone electroretinograms elicited by long-duration stimuli showed greater loss of the on-response than the off-response. The ratio of the on-response amplitude to off-response amplitude of these patients (0.52 +/- 0.12; mean +/- SD, n = 6) was significantly smaller than that of normal subject (0.83 +/- 0.21; mean +/- SD, n = 8) (Mann-Whitney U-test, P retinal function, especially in transmission between photoreceptors and depolarizing bipolar cells.

  13. Tidal effects in twin-degenerate binaries

    International Nuclear Information System (INIS)

    Campbell, C.G.

    1984-01-01

    The tidal velocity field is calculated for an initially non-rotating low mass white dwarf secondary in a twin-degenerate binary. These motions are used to find the tidal torque on the secondary, to first order in the orbital frequency, and an expression is derived for the synchronization time. For a lobe-filling secondary the synchronization time has a weak dependence on the mass and luminosity of the star, and for the binary G61-29 is found to be of the same order as the estimated lifetime of the system. It is emphasized, however, that tidal excitation of non-radial oscillatory modes in the secondary may significantly shorten the synchronization time. (author)

  14. A COMPUTATIONAL MODEL OF MOTOR NEURON DEGENERATION

    Science.gov (United States)

    Le Masson, Gwendal; Przedborski, Serge; Abbott, L.F.

    2014-01-01

    SUMMARY To explore the link between bioenergetics and motor neuron degeneration, we used a computational model in which detailed morphology and ion conductance are paired with intracellular ATP production and consumption. We found that reduced ATP availability increases the metabolic cost of a single action potential and disrupts K+/Na+ homeostasis, resulting in a chronic depolarization. The magnitude of the ATP shortage at which this ionic instability occurs depends on the morphology and intrinsic conductance characteristic of the neuron. If ATP shortage is confined to the distal part of the axon, the ensuing local ionic instability eventually spreads to the whole neuron and involves fasciculation-like spiking events. A shortage of ATP also causes a rise in intracellular calcium. Our modeling work supports the notion that mitochondrial dysfunction can account for salient features of the paralytic disorder amyotrophic lateral sclerosis, including motor neuron hyperexcitability, fasciculation, and differential vulnerability of motor neuron subpopulations. PMID:25088365

  15. A computational model of motor neuron degeneration.

    Science.gov (United States)

    Le Masson, Gwendal; Przedborski, Serge; Abbott, L F

    2014-08-20

    To explore the link between bioenergetics and motor neuron degeneration, we used a computational model in which detailed morphology and ion conductance are paired with intracellular ATP production and consumption. We found that reduced ATP availability increases the metabolic cost of a single action potential and disrupts K+/Na+ homeostasis, resulting in a chronic depolarization. The magnitude of the ATP shortage at which this ionic instability occurs depends on the morphology and intrinsic conductance characteristic of the neuron. If ATP shortage is confined to the distal part of the axon, the ensuing local ionic instability eventually spreads to the whole neuron and involves fasciculation-like spiking events. A shortage of ATP also causes a rise in intracellular calcium. Our modeling work supports the notion that mitochondrial dysfunction can account for salient features of the paralytic disorder amyotrophic lateral sclerosis, including motor neuron hyperexcitability, fasciculation, and differential vulnerability of motor neuron subpopulations. Copyright © 2014 Elsevier Inc. All rights reserved.

  16. Degenerate R-S perturbation theory

    Science.gov (United States)

    Hirschfelder, J. O.; Certain, P. R.

    1973-01-01

    A concise, systematic procedure is given for determining the Rayleigh-Schrodinger energies and wave functions of degenerate states to arbitrarily high orders even when the degeneracies of the various states are resolved in arbitrary orders. The procedure is expressed in terms of an iterative cycle in which the energy through the (2n+1)st order is expressed in terms of the partially determined wave function through the n-th order. Both a direct and an operator derivation are given. The two approaches are equivalent and can be transcribed into each other. The direct approach deals with the wave functions (without the use of formal operators) and has the advantage that it resembles the usual treatment of nondegenerate perturbations and maintains close contact with the basic physics. In the operator approach, the wave functions are expressed in terms of infinite order operators which are determined by the successive resolution of the space of the zeroth order functions.

  17. Nearly degenerate neutrinos, supersymmetry and radiative corrections

    International Nuclear Information System (INIS)

    Casas, J.A.; Espinosa, J.R.; Ibarra, A.; Navarro, I.

    2000-01-01

    If neutrinos are to play a relevant cosmological role, they must be essentially degenerate with a mass matrix of the bimaximal mixing type. We study this scenario in the MSSM framework, finding that if neutrino masses are produced by a see-saw mechanism, the radiative corrections give rise to mass splittings and mixing angles that can accommodate the atmospheric and the (large angle MSW) solar neutrino oscillations. This provides a natural origin for the Δm 2 sol 2 atm hierarchy. On the other hand, the vacuum oscillation solution to the solar neutrino problem is always excluded. We discuss also in the SUSY scenario other possible effects of radiative corrections involving the new neutrino Yukawa couplings, including implications for triviality limits on the Majorana mass, the infrared fixed point value of the top Yukawa coupling, and gauge coupling and bottom-tau unification

  18. Prevention of age-related macular degeneration.

    Science.gov (United States)

    Wong, Ian Yat Hin; Koo, Simon Chi Yan; Chan, Clement Wai Nang

    2011-02-01

    Age-related macular degeneration (AMD) is one of the leading causes of blindness in the developed world. Although effective treatment modalities such as anti-VEGF treatment have been developed for neovascular AMD, there is still no effective treatment for geographical atrophy, and therefore the most cost-effective management of AMD is to start with prevention. This review looks at current evidence on preventive measures targeted at AMD. Modalities reviewed include (1) nutritional supplements such as the Age-Related Eye Disease Study (AREDS) formula, lutein and zeaxanthin, omega-3 fatty acid, and berry extracts, (2) lifestyle modifications, including smoking and body-mass-index, and (3) filtering sunlight, i.e. sunglasses and blue-blocking intraocular lenses. In summary, the only proven effective preventive measures are stopping smoking and the AREDS formula.

  19. Progression of Fatty Muscle Degeneration in Atraumatic Rotator Cuff Tears.

    Science.gov (United States)

    Hebert-Davies, Jonah; Teefey, Sharlene A; Steger-May, Karen; Chamberlain, Aaron M; Middleton, William; Robinson, Kathryn; Yamaguchi, Ken; Keener, Jay D

    2017-05-17

    The purpose of this prospective study was to examine the progression of fatty muscle degeneration over time in asymptomatic shoulders with degenerative rotator cuff tears. Subjects with an asymptomatic rotator cuff tear in 1 shoulder and pain due to rotator cuff disease in the contralateral shoulder were enrolled in a prospective cohort. Subjects were followed annually with shoulder ultrasonography, which evaluated tear size, location, and fatty muscle degeneration. Tears that were either full-thickness at enrollment or progressed to a full-thickness defect during follow-up were examined. A minimum follow-up of 2 years was necessary for eligibility. One hundred and fifty-six shoulders with full-thickness rotator cuff tears were potentially eligible. Seventy shoulders had measurable fatty muscle degeneration of at least 1 rotator cuff muscle at some time point. Patients with fatty muscle degeneration in the shoulder were older than those without degeneration (mean, 65.8 years [95% confidence interval (CI), 64.0 to 67.6 years] compared with 61.0 years [95% CI, 59.1 to 62.9 years]; p tears at baseline was larger in shoulders with degeneration than in shoulders that did not develop degeneration (13 and 10 mm wide, respectively, and 13 and 10 mm long; p Tears with fatty muscle degeneration were more likely to have enlarged during follow-up than were tears that never developed muscle degeneration (79% compared with 58%; odds ratio, 2.64 [95% CI, 1.29 to 5.39]; p muscle degeneration occurred more frequently in shoulders with tears that had enlarged (43%; 45 of 105) than in shoulders with tears that had not enlarged (20%; 10 of 51; p tears with enlargement and progression of muscle degeneration were more likely to extend into the anterior supraspinatus than were those without progression (53% and 17%, respectively; p tear size (p = 0.56). The median time from tear enlargement to progression of fatty muscle degeneration was 1.0 year (range, -2.0 to 6.9 years) for the

  20. Assessment of fungal diversity in deep-sea sediments by multiple primer approach

    Digital Repository Service at National Institute of Oceanography (India)

    Singh, P.; Raghukumar, C.; Verma, P.; Shouche, Y.

    products were gel-purified and ligated with pGEM-T easy vector (Promega, USA) and transformed into E. coli cells (Invitrogen, Carlsbad, CA), following the manufacturer’s instructions. Transformants were grown overnight at 37°C on Luria Bertani agar... using culture-independent approach by targeting universal 18S as well as fungal specific and universal ITS (internal transcribed spacers) regions of rRNA genes from three locations in the CIB. It is known that some of the primer pairs designed...

  1. Formation of Degenerate Band Gaps in Layered Systems

    Directory of Open Access Journals (Sweden)

    Alexey P. Vinogradov

    2012-06-01

    Full Text Available In the review, peculiarities of spectra of one-dimensional photonic crystals made of anisotropic and/or magnetooptic materials are considered. The attention is focused on band gaps of a special type—the so called degenerate band gaps which are degenerate with respect to polarization. Mechanisms of formation and properties of these band gaps are analyzed. Peculiarities of spectra of photonic crystals that arise due to the linkage between band gaps are discussed. Particularly, it is shown that formation of a frozen mode is caused by linkage between Brillouin and degenerate band gaps. Also, existence of the optical Borrmann effect at the boundaries of degenerate band gaps and optical Tamm states at the frequencies of degenerate band gaps are analyzed.

  2. [Lattice degeneration of the peripheral retina: ultrastructural study].

    Science.gov (United States)

    Bec, P; Malecaze, F; Arne, J L; Mathis, A

    1985-01-01

    The ultrastructural study of a case of snail track degeneration shows the presence of lipid inclusions in both the glial and the macrophage cells in every layer of the retina, and the existence of intraretinal fibers different from collagen fibers appearing to be glial filaments similar to those found in astrocytic gliomes and to the Rosenthal fibers observed in senile nervous cells. Other features were thinning of the retina and absence of blood vessels in the retina. There are no abnormalities of the vitreo-retinal juncture. All the lesions are in agreement with those observed by Daicker [Ophthalmologica, Basel 165: 360-365, 1972; Klin. Mbl. Augenheilk. 172: 581-583, 1978] with some differences, however. They are different from those found in lattice degeneration. They show that snail track degeneration is a specific form of peripheral retinal degeneration which is quite different from lattice degeneration and must not be considered similar.

  3. Quality of optometry referrals to neovascular age-related macular degeneration clinic: a prospective study

    OpenAIRE

    Muen, Wisam J; Hewick, Simon A

    2011-01-01

    Objectives To evaluate the quality of referrals to a neovascular age-related macular degeneration clinic from optometrists using the standard Rapid Access Referral Form (RARF) from the Royal College of Ophthalmologists. Design A prospective study. Prospective data were gathered from all optometry referrals using the RARF, between the periods of December 2006 to August 2009. These were assessed for accuracy of history, clinical signs and final diagnosis as compared to a macula expert. Setting ...

  4. Supra-annular valve strategy for an early degenerated transcatheter balloon-expandable heart valve.

    Science.gov (United States)

    Kamioka, Norihiko; Caughron, Hope; Corrigan, Frank; Block, Peter; Babaliaros, Vasilis

    2018-01-23

    Currently, there are no recommendations regarding the selection of valve type for a transcatheter heart valve (THV)-in-THV procedure. A supra-annular valve design may be superior in that it results in a larger effective orifice area and may have a lower chance of valve thrombosis after THV-in-THV. In this report, we describe the use of a supra-annular valve strategy for an early degenerated THV. © 2018 Wiley Periodicals, Inc.

  5. Distribution of Basement Membrane Molecules, Laminin and Collagen Type IV, in Normal and Degenerated Cartilage Tissues

    Science.gov (United States)

    Toh, Wei Seong; Gomoll, Andreas H.; Olsen, Bjørn Reino; Spector, Myron

    2014-01-01

    Objective: The objective of the present study was to investigate the presence and distribution of 2 basement membrane (BM) molecules, laminin and collagen type IV, in healthy and degenerative cartilage tissues. Design: Normal and degenerated tissues were obtained from goats and humans, including articular knee cartilage, the intervertebral disc, and meniscus. Normal tissue was also obtained from patella-tibial enthesis in goats. Immunohistochemical analysis was performed using anti-laminin and anti–collagen type IV antibodies. Human and goat skin were used as positive controls. The percentage of cells displaying the pericellular presence of the protein was graded semiquantitatively. Results: When present, laminin and collagen type IV were exclusively found in the pericellular matrix, and in a discrete layer on the articulating surface of normal articular cartilage. In normal articular (hyaline) cartilage in the human and goat, the proteins were found co-localized pericellularly. In contrast, in human osteoarthritic articular cartilage, collagen type IV but not laminin was found in the pericellular region. Nonpathological fibrocartilaginous tissues from the goat, including the menisci and the enthesis, were also positive for both laminin and collagen type IV pericellularly. In degenerated fibrocartilage, including intervertebral disc, as in degenerated hyaline cartilage only collagen type IV was found pericellularly around chondrocytes but with less intense staining than in non-degenerated tissue. In calcified cartilage, some cells were positive for laminin but not type IV collagen. Conclusions: We report differences in expression of the BM molecules, laminin and collagen type IV, in normal and degenerative cartilaginous tissues from adult humans and goats. In degenerative tissues laminin is depleted from the pericellular matrix before collagen type IV. The findings may inform future studies of the processes underlying cartilage degeneration and the functional

  6. 454-Pyrosequencing Analysis of Bacterial Communities from Autotrophic Nitrogen Removal Bioreactors Utilizing Universal Primers: Effect of Annealing Temperature.

    Science.gov (United States)

    Gonzalez-Martinez, Alejandro; Rodriguez-Sanchez, Alejandro; Rodelas, Belén; Abbas, Ben A; Martinez-Toledo, Maria Victoria; van Loosdrecht, Mark C M; Osorio, F; Gonzalez-Lopez, Jesus

    2015-01-01

    Identification of anaerobic ammonium oxidizing (anammox) bacteria by molecular tools aimed at the evaluation of bacterial diversity in autotrophic nitrogen removal systems is limited by the difficulty to design universal primers for the Bacteria domain able to amplify the anammox 16S rRNA genes. A metagenomic analysis (pyrosequencing) of total bacterial diversity including anammox population in five autotrophic nitrogen removal technologies, two bench-scale models (MBR and Low Temperature CANON) and three full-scale bioreactors (anammox, CANON, and DEMON), was successfully carried out by optimization of primer selection and PCR conditions (annealing temperature). The universal primer 530F was identified as the best candidate for total bacteria and anammox bacteria diversity coverage. Salt-adjusted optimum annealing temperature of primer 530F was calculated (47°C) and hence a range of annealing temperatures of 44-49°C was tested. Pyrosequencing data showed that annealing temperature of 45°C yielded the best results in terms of species richness and diversity for all bioreactors analyzed.

  7. 454-Pyrosequencing Analysis of Bacterial Communities from Autotrophic Nitrogen Removal Bioreactors Utilizing Universal Primers: Effect of Annealing Temperature

    Directory of Open Access Journals (Sweden)

    Alejandro Gonzalez-Martinez

    2015-01-01

    Full Text Available Identification of anaerobic ammonium oxidizing (anammox bacteria by molecular tools aimed at the evaluation of bacterial diversity in autotrophic nitrogen removal systems is limited by the difficulty to design universal primers for the Bacteria domain able to amplify the anammox 16S rRNA genes. A metagenomic analysis (pyrosequencing of total bacterial diversity including anammox population in five autotrophic nitrogen removal technologies, two bench-scale models (MBR and Low Temperature CANON and three full-scale bioreactors (anammox, CANON, and DEMON, was successfully carried out by optimization of primer selection and PCR conditions (annealing temperature. The universal primer 530F was identified as the best candidate for total bacteria and anammox bacteria diversity coverage. Salt-adjusted optimum annealing temperature of primer 530F was calculated (47°C and hence a range of annealing temperatures of 44–49°C was tested. Pyrosequencing data showed that annealing temperature of 45°C yielded the best results in terms of species richness and diversity for all bioreactors analyzed.

  8. Primers As Socializing Agents in American and Finnish Schools.

    Science.gov (United States)

    Hyona, Jukka; And Others

    1995-01-01

    Content analysis of 12 Finnish and 18 American primers for grades 3 through 6 published primarily during the 1980s examined story type, plot setting, protagonist's characteristics, dramatic tasks, portrayals of family structure and parental responsibility, and extrafamilial peer and adult relationships. Results suggest that a nation's cultural…

  9. Bond strength of compomers to dentin using acidic primers.

    Science.gov (United States)

    Tate, W H; You, C; Powers, J M

    1999-10-01

    To determine the in vitro bond strengths of seven compomer/bonding agent restorative systems to human dentin. Seven compomer/bonding agents were bonded to human dentin, stored in water at 37 degrees C for 24 hours, and debonded in tension. Bonding conditions were with and without phosphoric acid etching, with and without the use of combined primer/bonding agents, and under moist and wet bond interfaces. Without phosphoric acid etching, F2000/F2000 Compomer Primer/Adhesive and F2000/Single Bond Dental Adhesive System were less sensitive to dentin wetness. With moist dentin, bond strengths of Dyract/Prime & Bond 2.1, Dyract AP/Prime & Bond 2.1, Hytac/OSB light-curing, one-component bonding agent, F2000/Single Bond, and Freedom/STAE single component light-cured dentin/enamel adhesive system, were improved with phosphoric acid etching. Also, with moist dentin, the bond strength of F2000/F2000 Compomer Primer/Adhesive in the 3M Clicker dispensing system was higher without phosphoric acid etching, whereas bonds of Compoglass/Syntac Single-component were not affected by phosphoric acid etching. Bonding did not occur without primer/bonding agent, regardless of surface condition or use of phosphoric acid etching.

  10. Single primer amplification reaction methods reveal exotic and ...

    Indian Academy of Sciences (India)

    Unknown

    mulberry varieties using three different PCR based single primer amplification ..... the results of a multi- variate analysis using Mahalanobis D2 statistic in case of .... Rajan M V, Chaturvedi H K and Sarkar A 1997 Multivariate analysis as an aid ...

  11. Diversity of internal structures in inhibited epoxy primers

    Directory of Open Access Journals (Sweden)

    Anthony E. Hughes

    2015-10-01

    Full Text Available Computed tomography is making a significant impact in the field of materials science in recent years. In this paper the authors report on advances made in three areas of characterization and also identified where further research needs to be focused. First we report on a new approach to data analysis called “Data Constrained Modelling (DCM” in which compositional tomography can be undertaken rather than adsorption or phase contrast tomography. This is achieved by collecting X-ray CT data at different energies and then combining the datasets to reconstruct 3D compositional tomography. Second, on the application of this approach to inhibited primers typical of those used in the aerospace industry. Aerospace primers are effectively composite materials containing inorganic phases which are bound together with a polymer. Understanding the materials science of these systems requires information over several orders of magnitude in length-scale. In this paper we report on how DCM can be used to extend our understanding at the smaller length scales at the limits of resolution of the technique. The third and final advance is in extending the approach to include 4-dimensional studies. In this case we examine the primer before and after leaching. This process causes changes in the primer which can be both detected and quantified using the above approach.

  12. Development of specific primers for genus Fusarium and F. solani ...

    African Journals Online (AJOL)

    Yomi

    2012-01-05

    Jan 5, 2012 ... reproductive parts of plants. They are ... plant species in most parts of the world. .... 20 µl 2.5X master mix (Eppendorf) and 1 µl of each forward and ... List of primers developed for rapid detection of Fusarium sp. and F. solani.

  13. Development of a microsatellite primer set to investigate the genetic ...

    Indian Academy of Sciences (India)

    Development of a microsatellite primer set to investigate the genetic population structure of Armadillidium nasatum (Crustacea, Oniscidea). Séverine Masson, Cédric Faivre, Isabelle Giraud, Catherine Souty-Grosset, Richard Cordaux, Carine Delaunay,. Didier Bouchon and Nicolas Bech. J. Genet. 93, 545-549. Table 1.

  14. Blood Donation and Transfusion: A Primer for Health Educators.

    Science.gov (United States)

    Felts, W. Michael; Glascoff, Mary A.

    1991-01-01

    Presents a primer for health educators about blood donation and transfusion, examining the nature of human blood, the background of blood transfusion, blood donation criteria, risks related to homologous blood transfusion, directed blood donation, potential alternatives to homologous transfusion, and resources for education on the subject. (SM)

  15. A Primer on Concepts and Applications of Proteomics in Neuroscience

    DEFF Research Database (Denmark)

    Hosp, Fabian; Mann, Matthias

    2017-01-01

    The enormous complexity of the central nervous system has impeded its systemic exploration for decades but powerful "omic" technologies are now pushing forward the frontiers of neuroscience research at an increasing pace. This Primer reviews the most recent progress in mass spectrometry (MS...

  16. Note: Primer Amysat 001; Fragment size is 211bp

    Indian Academy of Sciences (India)

    Renuka

    Bhandara : Lanes 1–14 represent different strains of Bhandara Ecorace. Note: Primer Amysat 001; Fragment size is 211bp. Fig. 1. SSR profiles generated from genomic DNA of 16 strains from different individuals of (A.L, D. TV, D. BV, Modal, Sukinda, Raily, Bhandara) ecoraces of tasar silk worm, Antheraea mylitta using the.

  17. Characteristics of the population employed in primer sector in Turkey

    Directory of Open Access Journals (Sweden)

    Bayar Rüya

    2006-01-01

    Full Text Available Activities related to the production of raw material like agriculture husbandry, forestry, fishery are called as primer activities. Especially people living in rural areas earn their livings on primer activities, mainly agriculture. Rural planning is inevitable for providing rural development which has an important place in all development of a country. And achievement of this planning depends on putting forth the characteristics of the population living in rural areas with its different aspects. Therefore, the requirements will be introduced more clearly and the increase in the welfare levels of the people living in rural areas will have been achieved. To achieve the rural development and progress, in addition to the features like the size of agricultural products, products that are cultivated, activities like husbandry, forestry, hunting, etc. and the qualities of the enterprises in which these activities are carried out, policies applied, capital, market and technology, the characteristics of the population employed in this sector is also of importance. Considering these points, what is aimed in this study is to put forth the characteristics of the population employed in primer sector in Turkey. According to the census results of the year 2000 in Turkey 38% of the population is employed, and 48% of this work is in primer sector.

  18. Controlling Air Pollution; A Primer on Stationary Source Control Techniques.

    Science.gov (United States)

    Corman, Rena

    This companion document to "Air Pollution Primer" is written for the nonexpert in air pollution; however, it does assume a familiarity with air pollution problems. This work is oriented toward providing the reader with knowledge about current and proposed air quality legislation and knowledge about available technology to meet these standards for…

  19. Transplantation of retinal pigment epithelial cells - a possible future treatment for age-related macular degeneration

    DEFF Research Database (Denmark)

    Wiencke, Anne Katrine

    2001-01-01

    ophthalmology, age-related macular degeneration, transplantation, retinal pigment epithelial cells, treatment......ophthalmology, age-related macular degeneration, transplantation, retinal pigment epithelial cells, treatment...

  20. Transplantation of retinal pigment epithelial cells - a possible future treatment for age-related macular degeneration

    DEFF Research Database (Denmark)

    Wiencke, Anne Katrine

    2001-01-01

    ophthalmology, age-related macular degeneration, retinal pigment epithelial cells, transplantation, treatment......ophthalmology, age-related macular degeneration, retinal pigment epithelial cells, transplantation, treatment...

  1. Progress toward the maintenance and repair of degenerating retinal circuitry.

    Science.gov (United States)

    Vugler, Anthony A

    2010-01-01

    Retinal diseases such as age-related macular degeneration and retinitis pigmentosa remain major causes of severe vision loss in humans. Clinical trials for treatment of retinal degenerations are underway and advancements in our understanding of retinal biology in health/disease have implications for novel therapies. A review of retinal biology is used to inform a discussion of current strategies to maintain/repair neural circuitry in age-related macular degeneration, retinitis pigmentosa, and Type 2 Leber congenital amaurosis. In age-related macular degeneration/retinitis pigmentosa, a progressive loss of rods/cones results in corruption of bipolar cell circuitry, although retinal output neurons/photoreceptive melanopsin cells survive. Visual function can be stabilized/enhanced after treatment in age-related macular degeneration, but in advanced degenerations, reorganization of retinal circuitry may preclude attempts to restore cone function. In Type 2 Leber congenital amaurosis, useful vision can be restored by gene therapy where central cones survive. Remarkable progress has been made in restoring vision to rodents using light-responsive ion channels inserted into bipolar cells/retinal ganglion cells. Advances in genetic, cellular, and prosthetic therapies show varying degrees of promise for treating retinal degenerations. While functional benefits can be obtained after early therapeutic interventions, efforts should be made to minimize circuitry changes as soon as possible after rod/cone loss. Advances in retinal anatomy/physiology and genetic technologies should allow refinement of future reparative strategies.

  2. Psychosocial Adaptation to Visual Impairment and Its Relationship to Depressive Affect in Older Adults with Age-Related Macular Degeneration

    Science.gov (United States)

    Tolman, Jennifer; Hill, Robert D.; Kleinschmidt, Julia J.; Gregg, Charles H.

    2005-01-01

    Purpose: In this study we examined psychosocial adaptation to vision loss and its relationship to depressive symptomatology in legally blind older adults with age-related macular degeneration (ARMD). Design and Methods: The 144 study participants were outpatients of a large regional vision clinic that specializes in the diagnosis and treatment of…

  3. Five-year progression of unilateral age-related macular degeneration to bilateral involvement: the Three Continent AMD Consortium report

    NARCIS (Netherlands)

    Joachim, N.; Colijn, J.M.; Kifley, A.; Lee, K.E.; Buitendijk, G.H.; Klein, B.E.; Myers, C.E.; Meuer, S.M.; Tan, A.G.; Holliday, E.G.; Attia, J.; Liew, G.; Iyengar, S.K.; Jong, p de; Hofman, A.; Vingerling, J.R.; Mitchell, P.; Klaver, C.C.W.; Klein, R.; Wang, J.J.

    2017-01-01

    PURPOSE: To assess the 5-year progression from unilateral to bilateral age-related macular degeneration (AMD) and associated risk factors. DESIGN: Pooled data analyses of three prospective population-based cohorts, the Blue Mountains Eye Study, Beaver Dam Eye Study and Rotterdam Study. METHODS:

  4. Five-year progression of unilateral age-related macular degeneration to bilateral involvement: the Three Continent AMD Consortium report

    NARCIS (Netherlands)

    Joachim, Nichole; Colijn, Johanna Maria; Kifley, Annette; Lee, Kristine E.; Buitendijk, Gabriëlle H. S.; Klein, Barbara E. K.; Myers, Chelsea E.; Meuer, Stacy M.; Tan, Ava G.; Holliday, Elizabeth G.; Attia, John; Liew, Gerald; Iyengar, Sudha K.; de Jong, Paulus T. V. M.; Hofman, Albert; Vingerling, Johannes R.; Mitchell, Paul; Klaver, Caroline C. W.; Klein, Ronald; Wang, Jie Jin

    2017-01-01

    Purpose To assess the 5-year progression from unilateral to bilateral age-related macular degeneration (AMD) and associated risk factors. Design Pooled data analyses of three prospective population-based cohorts, the Blue Mountains Eye Study, Beaver Dam Eye Study and Rotterdam Study. Methods Retinal

  5. Five-year progression of unilateral age-related macular degeneration to bilateral involvement : the Three Continent AMD Consortium report

    NARCIS (Netherlands)

    Joachim, Nichole; Colijn, Johanna Maria; Kifley, Annette; Lee, Kristine E; Buitendijk, Gabriëlle H S; Klein, Barbara E K; Myers, Chelsea E; Meuer, Stacy M; Tan, Ava G; Holliday, Elizabeth G; Attia, John; Liew, Gerald; Iyengar, Sudha K; de Jong, Paulus T V M; Hofman, Albert; Vingerling, Johannes R; Mitchell, Paul; Klaver, Caroline C W; Klein, Ronald; Wang, Jie Jin

    2017-01-01

    PURPOSE: To assess the 5-year progression from unilateral to bilateral age-related macular degeneration (AMD) and associated risk factors. DESIGN: Pooled data analyses of three prospective population-based cohorts, the Blue Mountains Eye Study, Beaver Dam Eye Study and Rotterdam Study. METHODS:

  6. Safety and Efficacy of a Flexible Dosing Regimen of Ranibizumab in Neovascular Age-Related Macular Degeneration: The SUSTAIN Study

    NARCIS (Netherlands)

    Holz, Frank G.; Amoaku, Winfried; Donate, Juan; Guymer, Robyn H.; Kellner, Ulrich; Schlingemann, Reinier O.; Weichselberger, Andreas; Staurenghi, Giovanni

    2011-01-01

    Objective: To evaluate the safety and efficacy of individualized ranibizumab treatment in patients with neovascular age-related macular degeneration. Design: Twelve-month, phase III, multicenter, open-label, single-arm study. Participants: A total of 513 ranibizumab-naive SUSTAIN patients.

  7. Hormonal emergency contraception: a clinical primer.

    Science.gov (United States)

    Ziebarth, Angela; Hansen, Keith A

    2007-03-01

    Unintended and teenage pregnancies are major public health concerns in the United States. Emergency contraception is used to prevent pregnancy after failure of a contraceptive method or after unprotected intercourse. Expanded use of emergency contraception has the potential to reduce unintended pregnancy and induced abortions, while reducing state and federal healthcare expenditures. The recent approval of Plan B as an over-the-counter medication for individuals over 18 years of age should improve access to this medication. However, there are still widespread misconceptions about the mechanisms and implications of emergency contraception. Expanded access to emergency contraception is associated with increased use, but not associated with decreased efficacy, increased sexual risk-taking behavior, or less consistent use of traditional birth control methods. This review is designed to provide clinicians with information regarding the use of emergency contraception for reproductive age patients. It includes a brief description of methods of use, mechanisms of action, and side effect profiles of the most commonly used methods of emergency contraception, levonorgestrel and the Yuzpe method.

  8. Cardiology office computer use: primer, pointers, pitfalls.

    Science.gov (United States)

    Shepard, R B; Blum, R I

    1986-10-01

    An office computer is a utility, like an automobile, with benefits and costs that are both direct and hidden and potential for disaster. For the cardiologist or cardiovascular surgeon, the increasing power and decreasing costs of computer hardware and the availability of software make use of an office computer system an increasingly attractive possibility. Management of office business functions is common; handling and scientific analysis of practice medical information are less common. The cardiologist can also access national medical information systems for literature searches and for interactive further education. Selection and testing of programs and the entire computer system before purchase of computer hardware will reduce the chances of disappointment or serious problems. Personnel pretraining and planning for office information flow and medical information security are necessary. Some cardiologists design their own office systems, buy hardware and software as needed, write programs for themselves and carry out the implementation themselves. For most cardiologists, the better course will be to take advantage of the professional experience of expert advisors. This article provides a starting point from which the practicing cardiologist can approach considering, specifying or implementing an office computer system for business functions and for scientific analysis of practice results.

  9. Localized thermonuclear runaways and volcanoes on degenerate dwarf stars

    Energy Technology Data Exchange (ETDEWEB)

    Shara, M.M.

    1982-10-15

    Practically all studies to date of thermonuclear runaways on degenerate dwarf stars in binary systems have considered only spherically symmetric eruptions. We emphasize that even slightly non-spherically symmetric accretion leads to transverse temperature gradients in the dwarfs' accreted envelopes. Over a rather broad range of parameter space, thermalization time scales in accreted envelopes are much longer than thermonuclear runaway time scales. Thus localized thermonuclear runaways (i.e., runaways much smaller than the host degenerate star) rather than spherically symmetric global eruptions are likely to occur on many degenerate dwarfs. Localized runaways are more likely to occur on more massive and/or hotter dwarfs.

  10. Cystic adventitial degeneration: ectopic ganglia from adjacent joint capsules.

    Science.gov (United States)

    Ortmann, J; Widmer, M K; Gretener, S; Do, D D; Willenberg, T; Daliri, A; Baumgartner, I

    2009-11-01

    Cystic adventitial degeneration is a rare non-atherosclerotic cause of peripheral arterial occlusive disease, mainly seen in young men without other evidence of vascular disease. Diagnosis will be established by clinical findings and by ultrasound or angiography and can be treated by excision or enucleation of the affected arterial segment or by percutaneous ultrasound-guided aspiration. However, the etiology of adventitial cysts remains unknown. We report a case of cystic adventitial degeneration showing a connection between the joint capsule and the adventitial cyst, supporting the theory that cystic adventitial degeneration may represent ectopic ganglia from adjacent joint capsules.

  11. Acquired Nonpigmented Vitreous Cyst Associated With Lattice Degeneration.

    Science.gov (United States)

    Lu, Jing; Mai, Guiying; Liu, Ruyuan; Luo, Yan; Lu, Lin

    2017-10-01

    A 63-year-old male presented with a round-shaped floater and visual obscuration in the right eye. Clinical evaluation showed a nonpigmented vitreous cyst connected to a lattice degeneration by a stalk. Immunostaining of the vitreous cyst obtained from vitrectomy showed its origin of retinal neuroepithelium. The cyst was formed by continuous vitreous traction, which might tear up the disrupted retina at the area of lattice degeneration. This report added the lattice degeneration to the list of causes for the acquired vitreous cyst. [Ophthalmic Surg Lasers Imaging Retina. 2017;48:856-858.]. Copyright 2017, SLACK Incorporated.

  12. [Clinical features and prognosis of retinal lattice degeneration].

    Science.gov (United States)

    Guo, X R

    1990-07-01

    110 cases (110 eyes) of retinal lattice degeneration were clinically observed and followed up for 3-8 years. Most lesions were located in the superotemporal quadrant, band-shaped, and parallel to the ora serrata. 80.9% of the lesions presented various degrees of pigmentation, 67.1% yellowish white spots, and 83.6% white lines. 32.9% of the eyes developed retinal holes. Most lattice degenerations were accompanied by vitreous degeneration and vitreoretinal traction. The disease progressed only slowly, though in a few cases it tended to expand.

  13. [Current concepts in pathogenesis of age-related macular degeneration].

    Science.gov (United States)

    Kubicka-Trząska, Agnieszka; Karska-Basta, Izabella; Romanowska-Dixon, Bożena

    2014-01-01

    Age-related macular degeneration is the leading cause of central blindness in elderly population of the western world. The pathogenesis of this disease, likely multifactorial, is not well known, although a number of theories have been put forward, including oxidative stress, genetic interactions, hemodynamic imbalance, immune and inflammatory processes. The understanding of age-related macular degeneration pathogenesis will give rise to new approaches in prevention and treatment of the early and late stages of both atrophic and neovascular age-related macular degeneration.

  14. The ability of T2/B4 primers to detect Leishmania infantum among ...

    African Journals Online (AJOL)

    SERVER

    2008-04-03

    Apr 3, 2008 ... Reverse Primer (5`-CCT CTC TTT TTT CNC TGT GC-3`). (Schönian et al., 1996),. B. Forward Primer (RV1) (5`-GTG GGG GAG GGG CGT TCT-3`) and Reverse Primer (RV2) (5`-ATT TTA CAC CAA CCC CCA GTT-. 3`) (Lachaud et al., 2002; Reale et al., 1999),. C. Forward Primer (T2) (5`-CGG CTT CGC ...

  15. PriFi - Using a Multiple Alignment of Related Sequences to Find Primers for  Amplification of Homologs

    DEFF Research Database (Denmark)

    Fredslund, Jakob; Schauser, Leif; Madsen, Lene Heegaard

    2005-01-01

    Using a comparative approach, the web program PriFi (http://cgi-www.daimi.au.dk/cgi-chili/PriFi/main) designs pairs of primers useful for PCR amplification of genomic DNA in species where prior sequence information is not available. The program works with an alignment of DNA sequences from...... of a procedure for developing general markers serving as common anchor loci across species. To accommodate users with special preferences, configuration settings and criteria can be customized....

  16. Characterization of Novel Di-, Tri-, and Tetranucleotide Microsatellite Primers Suitable for Genotyping Various Plant Pathogenic Fungi with Special Emphasis on Fusaria and Mycospherella graminicola

    Directory of Open Access Journals (Sweden)

    Joseph-Alexander Verreet

    2012-03-01

    Full Text Available The goals of this investigation were to identify and evaluate the use of polymorphic microsatellite marker (PMM analysis for molecular typing of seventeen plant pathogenic fungi. Primers for di-, tri-, and tetranucleotide loci were designed directly from the recently published genomic sequence of Mycospherlla graminicola and Fusarium graminearum. A total of 20 new microsatellite primers as easy-to-score markers were developed. Microsatellite primer PCR (MP-PCR yielded highly reproducible and complex genomic fingerprints, with several bands ranging in size from 200 to 3000 bp. Of the 20 primers tested, only (TAGG4, (TCC5 and (CA7T produced a high number of polymorphic bands from either F. graminearum or F. culmorum. (ATG5 led to successful amplifications in M. graminicola isolates collected from Germany. Percentage of polymorphic bands among Fusarium species ranged from 9 to 100%. Cluster analysis of banding patterns of the isolates corresponded well to the established species delineations based on morphology and other methods of phylogenetic analysis. The current research demonstrates that the newly designed microsatellite primers are reliable, sensitive and technically simple tools for assaying genetic variability in plant pathogenic fungi.

  17. Cross-kingdom amplification using bacteria-specific primers: complications for studies of coral microbial ecology.

    Science.gov (United States)

    Galkiewicz, Julia P; Kellogg, Christina A

    2008-12-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

  18. Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

    OpenAIRE

    Galkiewicz, Julia P.; Kellogg, Christina A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

  19. Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

    Science.gov (United States)

    Galkiewicz, Julia P.; Kellogg, Christina A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299

  20. A Gemini snapshot survey for double degenerates

    Science.gov (United States)

    Kilic, Mukremin; Brown, Warren R.; Gianninas, A.; Curd, Brandon; Bell, Keaton J.; Allende Prieto, Carlos

    2017-11-01

    We present the results from a Gemini snapshot radial-velocity survey of 44 low-mass white-dwarf candidates selected from the Sloan Digital Sky Survey (SDSS) spectroscopy. To find sub-hour orbital period binary systems, our time-series spectroscopy had cadences of 2-8 min over a period of 20-30 min. Through follow-up observations at Gemini and the MMT, we identify four double-degenerate binary systems with periods ranging from 53 min to 7 h. The shortest period system, SDSS J123549.88+154319.3, was recently identified as a sub-hour period detached binary by Breedt and collaborators. Here, we refine the orbital and physical parameters of this system. High-speed and time-domain survey photometry observations do not reveal eclipses or other photometric effects in any of our targets. We compare the period distribution of these four systems with the orbital period distribution of known double white dwarfs; the median period decreases from 0.64 to 0.24 d for M = 0.3-0.5 M⊙ to M < 0.3 M⊙ white dwarfs. However, we do not find a statistically significant correlation between the orbital period and white-dwarf mass.

  1. Correlations in a partially degenerate electron plasma

    Energy Technology Data Exchange (ETDEWEB)

    Chihara, Junzo [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment

    1998-03-01

    The density-functional theory proves that an ion-electron mixture can be treated as a one-component liquid interacting only via a pairwise interaction in the evaluation of the ion-ion radial distribution function (RDF), and provides a set of integral equations: one is an integral equation for the ion-ion RDF and another for an effective ion-ion interaction, which depends on the ion-ion RDF. This formulation gives a set of integral equation to calculate plasma structures with combined use of the electron-electron correlations in a partially degenerate electron plasma. Therefore, it is important for this purpose to determine the electron-electron correlations at a arbitrary temperature. Here, they are calculated by the quantal version of the hypernetted chain (HNC) equation. On the basis of the jellium-vacancy model, the ionic and electronic structures of rubidium are calculated for the range from liquid metal to plasma states by increasing the temperature at the fixed density using the electron-correlation results. (author)

  2. Radiation therapy: age-related macular degeneration.

    Science.gov (United States)

    Mendez, Carlos A Medina; Ehlers, Justis P

    2013-01-01

    Age-related macular degeneration (AMD) is the leading cause of severe irreversible vision loss in patients over the age of 50 years in the developed world. Neovascular AMD (NVAMD) is responsible for 90% of the cases with severe visual loss. In the last decade, the treatment paradigm for NVAMD has been transformed by the advent of anti-vascular endothelial growth factor therapy. Despite the excellent results of anti-vascular endothelial growth factor therapy, frequent injections remain a necessity for most patients. The burden of these frequent visits as well as the cumulative risks of indefinite intravitreal injections demand continued pursuit of more enduring therapy that provides similar functional results. Radiotherapy has been studied for two decades as a potential therapy for NVAMD. Because of its antiangiogenic properties, radiation therapy remains a promising potential adjunctive resource for the treatment of choroidal neovascularization secondary to NVAMD. This review considers the past, present and future of radiation as a treatment or combination treatment of NVAMD. Copyright © 2013 S. Karger AG, Basel.

  3. On degenerate metrics, dark matter and unification

    Science.gov (United States)

    Searight, Trevor P.

    2017-12-01

    A five-dimensional theory of relativity is presented which suggests that gravitation and electromagnetism may be unified using a degenerate metric. There are four fields (in the four-dimensional sense): a tensor field, two vector fields, and a scalar field, and they are unified with a combination of a gauge-like invariance and a reflection symmetry which means that both vector fields are photons. The gauge-like invariance implies that the fifth dimension is not directly observable; it also implies that charge is a constant of motion. The scalar field is analogous to the Brans-Dicke scalar field, and the theory tends towards the Einstein-Maxwell theory in the limit as the coupling constant tends to infinity. As there is some scope for fields to vary in the fifth dimension, it is possible for the photons to have wave behaviour in the fifth dimension. The wave behaviour has two effects: it gives mass to the photons, and it prevents them from interacting directly with normal matter. These massive photons still act as a source of gravity, however, and therefore they are candidates for dark matter.

  4. Animal models of age related macular degeneration

    Science.gov (United States)

    Pennesi, Mark E.; Neuringer, Martha; Courtney, Robert J.

    2013-01-01

    Age related macular degeneration (AMD) is the leading cause of vision loss of those over the age of 65 in the industrialized world. The prevalence and need to develop effective treatments for AMD has lead to the development of multiple animal models. AMD is a complex and heterogeneous disease that involves the interaction of both genetic and environmental factors with the unique anatomy of the human macula. Models in mice, rats, rabbits, pigs and non-human primates have recreated many of the histological features of AMD and provided much insight into the underlying pathological mechanisms of this disease. In spite of the large number of models developed, no one model yet recapitulates all of the features of human AMD. However, these models have helped reveal the roles of chronic oxidative damage, inflammation and immune dysregulation, and lipid metabolism in the development of AMD. Models for induced choroidal neovascularization have served as the backbone for testing new therapies. This article will review the diversity of animal models that exist for AMD as well as their strengths and limitations. PMID:22705444

  5. Radiotherapy in age-related macula degeneration

    International Nuclear Information System (INIS)

    Gripp, Stephan; Stammen, Johannes; Petersen, Claudia; Hartmann, Axel; Willers, Reinhart; Althaus, Christoph

    2002-01-01

    Purpose: To ascertain the benefit from radiotherapy in age-related macula degeneration in a single-arm longitudinal study. Methods and Materials: From 1997 to 1998, 39 patients with occult and 33 patients with classic choroidal neovascularization (CNV) were irradiated with 16 Gy. Fluorescein angiography and measurements of visual acuity were performed before and 3, 6, and 12 months after irradiation. Results: Complete follow-up data for 1 year were available from 69 patients. The mean patient age was 72 years (range 49-92). Vision decreased in 43, was stable in 18, and improved in 8 cases. The mean vision deteriorated significantly (p=0.02, Wilcoxon test), particularly within the first 3 months. Patients with occult CNV did significantly better than did those with classic CNV (p=0.03). The proportion of patients retaining vision ≥0.2 fell from 65% to 42% (p <0.01), for classic and occult CNV from 50% to 23%, and for occult CNV from 77% to 56% (p<0.02), respectively. CNV size increased in 30 patients and was stable in 38. Neither age (p=0.17) nor gender (p=0.21, chi-square test) influenced prognosis. Four patients reported transitional complaints. Conclusion: Low-dose fractionated radiotherapy with 16 Gy is well tolerated. However, vision and reading ability were not preserved in most patients

  6. Coulomb Logarithm in Nonideal and Degenerate Plasmas

    Science.gov (United States)

    Filippov, A. V.; Starostin, A. N.; Gryaznov, V. K.

    2018-03-01

    Various methods for determining the Coulomb logarithm in the kinetic theory of transport and various variants of the choice of the plasma screening constant, taking into account and disregarding the contribution of the ion component and the boundary value of the electron wavevector are considered. The correlation of ions is taken into account using the Ornstein-Zernike integral equation in the hypernetted-chain approximation. It is found that the effect of ion correlation in a nondegenerate plasma is weak, while in a degenerate plasma, this effect must be taken into account when screening is determined by the electron component alone. The calculated values of the electrical conductivity of a hydrogen plasma are compared with the values determined experimentally in the megabar pressure range. It is shown that the values of the Coulomb logarithm can indeed be smaller than unity. Special experiments are proposed for a more exact determination of the Coulomb logarithm in a magnetic field for extremely high pressures, for which electron scattering by ions prevails.

  7. Double Degenerates among DA white dwarfs

    International Nuclear Information System (INIS)

    Bragaglia, A.; Greggio, L.; Renzini, A.; D'odorico, S.

    1990-01-01

    The results of a spectroscopic survey of catalog white dwarfs in search of radial velocity variations indicative of a binary motion are reported. In a sample of 54 DA white dwarfs, one Double Degenerate (DD) system with a period of 1.15 days (the shortest period DD system yet discovered) is found. Two other excellent and two good DD candidates, and two white dwarf + red dwarf pairs were also found. If all the candidates should be confirmed, this would indicate a frequency of about 13 percent of interacting binaries in an unbiased sample of evolved stars, with a DD frequency of about 10 percent. These results suggest fairly large values for the common-envelope parameter alpha, implying that a source of energy other than orbital may be required to eject the envelope during common-envelope events. Finally, in combination with previous evidence our result implies that DDs with WD components of the DA variety are unlikely to be the precursors of Type I supernovae, but DDs with non-DA components remain very attractive candidates. 20 refs

  8. CERKL knockdown causes retinal degeneration in zebrafish.

    Directory of Open Access Journals (Sweden)

    Marina Riera

    Full Text Available The human CERKL gene is responsible for common and severe forms of retinal dystrophies. Despite intense in vitro studies at the molecular and cellular level and in vivo analyses of the retina of murine knockout models, CERKL function remains unknown. In this study, we aimed to approach the developmental and functional features of cerkl in Danio rerio within an Evo-Devo framework. We show that gene expression increases from early developmental stages until the formation of the retina in the optic cup. Unlike the high mRNA-CERKL isoform multiplicity shown in mammals, the moderate transcriptional complexity in fish facilitates phenotypic studies derived from gene silencing. Moreover, of relevance to pathogenicity, teleost CERKL shares the two main human protein isoforms. Morpholino injection has been used to generate a cerkl knockdown zebrafish model. The morphant phenotype results in abnormal eye development with lamination defects, failure to develop photoreceptor outer segments, increased apoptosis of retinal cells and small eyes. Our data support that zebrafish Cerkl does not interfere with proliferation and neural differentiation during early developmental stages but is relevant for survival and protection of the retinal tissue. Overall, we propose that this zebrafish model is a powerful tool to unveil CERKL contribution to human retinal degeneration.

  9. Magnonic triply-degenerate nodal points

    Science.gov (United States)

    Owerre, S. A.

    2017-12-01

    We generalize the concept of triply-degenerate nodal points to non-collinear antiferromagnets. Here, we introduce this concept to insulating quantum antiferromagnets on the decorated honeycomb lattice, with spin-1 bosonic quasiparticle excitations known as magnons. We demonstrate the existence of magnonic surface states with constant energy contours that form pairs of magnonic arcs connecting the surface projection of the magnonic triple nodal points. The quasiparticle excitations near the triple nodal points represent three-component bosons beyond that of magnonic Dirac, Weyl, and nodal-line cases. They can be regarded as a direct reflection of the intrinsic spin carried by magnons. Furthermore, we show that the magnonic triple nodal points can split into magnonic Weyl points, as the system transits from a non-collinear spin structure to a non-coplanar one with a non-zero scalar spin chirality. Our results not only apply to insulating antiferromagnets, but also provide a platform to seek for triple nodal points in metallic antiferromagnets.

  10. Design

    DEFF Research Database (Denmark)

    Volf, Mette

    This publication is unique in its demystification and operationalization of the complex and elusive nature of the design process. The publication portrays the designer’s daily work and the creative process, which the designer is a part of. Apart from displaying the designer’s work methods...... and design parameters, the publication shows examples from renowned Danish design firms. Through these examples the reader gets an insight into the designer’s reality....

  11. The New Science of Cybernetics: A Primer

    Directory of Open Access Journals (Sweden)

    Karl H. Müller

    2013-12-01

    Full Text Available Four years after the publication of the first volume on the new science of cybernetics (NSC (Müller, 2009 and after two more books on NSC (Müller, 2011, 2012 it is time to present and to summarize the main features and characteristics of the new science of cybernetics within a single article. - Historically, the new science of cybernetics can be viewed as a potential outline of Heinz von Foerster's vision of second-order cybernetics as the science of observing systems or, alternatively, of living systems by living systems for living systems. Heinz von Foerster introduced the concept of second-order cybernetics on several occasions, without specifying, however, its content and cognitive organization (Foerster, 1974, 2003 - Systematically, the new science of cybernetics operates on a new level which, not quite unexpectedly and surprisingly, can be characterized as second-order level. This second-order level is self-reflexive by nature and by design, because this level comes into play whenever a concept, a model or an academic field turns onto itself, like in understanding or in cybernetics of cybernetics. - Functionally, the new science of cybernetics can be viewed as a trans- or post-disciplinary second-order field for navigating through an ocean of first-order level science. NSC operates primarily with objects or with operations from first-order science and transforms them into new components which exhibit strong comparative advantages in terms of novelty and robustness. This list of historic, systemic and functional features of the new science of cybernetics(NSC may look strange or incomprehensible at first sight. It will become, thus, the main purpose of this article to transform these seemingly vague and unclear descriptions into concise ones which readers with only a weak familiarity with the old science of cybernetics can understand. Eventually, even the short set above of critical characteristics of the new science of cybernetics should

  12. Determination of source terms in a degenerate parabolic equation

    International Nuclear Information System (INIS)

    Cannarsa, P; Tort, J; Yamamoto, M

    2010-01-01

    In this paper, we prove Lipschitz stability results for inverse source problems relative to parabolic equations. We use the method introduced by Imanuvilov and Yamamoto in 1998 based on Carleman estimates. What is new here is that we study a class of one-dimensional degenerate parabolic equations. In our model, the diffusion coefficient vanishes at one extreme point of the domain. Instead of the classical Carleman estimates obtained by Fursikov and Imanuvilov for non degenerate equations, we use and extend some recent Carleman estimates for degenerate equations obtained by Cannarsa, Martinez and Vancostenoble. Finally, we obtain Lipschitz stability results in inverse source problems for our class of degenerate parabolic equations both in the case of a boundary observation and in the case of a locally distributed observation

  13. The degenerate-internal-states approximation for cold collisions

    NARCIS (Netherlands)

    Maan, A.C.; Tiesinga, E.; Stoof, H.T.C.; Verhaar, B.J.

    1990-01-01

    The Degenerate-Internal-States approximation as well as its first-order correction are shown to provide a convenient method for calculating elastic and inelastic collision amplitudes for low temperature atomic scattering.

  14. Magnetism and magnetostriction in a degenerate rigid band

    International Nuclear Information System (INIS)

    Kulakowski, K.; Barbara, B.

    1990-09-01

    We investigate the influence of the spin-orbit coupling on the magnetic and magnetoelastic phenomena in ferromagnetic band systems. The description is within the Stoner model of a degenerate rigid band, for temperature T = O. (author). 14 refs

  15. Relativistic degenerate electron plasma in an intense magnetic field

    International Nuclear Information System (INIS)

    Delsante, A.E.; Frankel, N.E.

    1978-01-01

    The dielectric response function for a dense, ultra-degenerate relativistic electron plasma in an intense uniform magnetic field is presented. Dispersion relations for plasma oscillations parallel and perpendicular to the magnetic field are obtained

  16. Arbitrary electron acoustic waves in degenerate dense plasmas

    Science.gov (United States)

    Rahman, Ata-ur; Mushtaq, A.; Qamar, A.; Neelam, S.

    2017-05-01

    A theoretical investigation is carried out of the nonlinear dynamics of electron-acoustic waves in a collisionless and unmagnetized plasma whose constituents are non-degenerate cold electrons, ultra-relativistic degenerate electrons, and stationary ions. A dispersion relation is derived for linear EAWs. An energy integral equation involving the Sagdeev potential is derived, and basic properties of the large amplitude solitary structures are investigated in such a degenerate dense plasma. It is shown that only negative large amplitude EA solitary waves can exist in such a plasma system. The present analysis may be important to understand the collective interactions in degenerate dense plasmas, occurring in dense astrophysical environments as well as in laser-solid density plasma interaction experiments.

  17. An Unusual Case of Extensive Lattice Degeneration and Retinal Detachment.

    Science.gov (United States)

    Mathew, David J; Sarma, Saurabh Kumar; Basaiawmoit, Jennifer V

    2016-07-01

    Lattice degeneration of the retina is not infrequently encountered on a dilated retinal examination and many of them do not need any intervention. We report a case of atypical lattice degeneration variant with peripheral retinal detachment. An asymptomatic 35-year-old lady with minimal refractive error was found to have extensive lattice degeneration, peripheral retinal detachment and fibrotic changes peripherally with elevation of retinal vessels on dilated retinal examination. There were also areas of white without pressure, chorioretinal scarring and retinal breaks. All the changes were limited to beyond the equator but were found to span 360 degrees. She was treated with barrage laser all around to prevent extension of the retinal detachment posteriorly. She remained stable till her latest follow-up two years after the barrage laser. This case is reported for its rarity with a discussion of the probable differential diagnoses. To the best of our knowledge, this is the first report of such findings in lattice degeneration.

  18. An imbedding theorem and its applications in degenerate elliptic equations

    International Nuclear Information System (INIS)

    Duong Minh Duc.

    1988-06-01

    We improve the Rellich-Kondrachov theorem and apply it to study strongly degenerate and singular elliptic equations. We obtain the maximum principle, Harnacks's inequality and global regularity for solutions of those equations. (author). 11 refs

  19. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

    2000-09-27

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  20. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson

    1998-12-10

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  1. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders; FINAL

    International Nuclear Information System (INIS)

    Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

    2000-01-01

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums

  2. Modified Primers for the Identification of Nonpathogenic Fusarium oxysporum Isolates That Have Biological Control Potential against Fusarium Wilt of Cucumber in Taiwan

    Science.gov (United States)

    Wang, Chaojen; Lin, Yisheng; Lin, Yinghong; Chung, Wenhsin

    2013-01-01

    Previous investigations demonstrated that Fusarium oxysporum (Fo), which is not pathogenic to cucumbers, could serve as a biological control agent for managing Fusarium wilt of cucumber caused by Fo f. sp. cucumerinum (Foc) in Taiwan. However, thus far it has not been possible to separate the populations of pathogenic Fo from the nonpathogenic isolates that have biological control potential through their morphological characteristics. Although these two populations can be distinguished from one another using a bioassay, the work is laborious and time-consuming. In this study, a fragment of the intergenic spacer (IGS) region of ribosomal DNA from an Fo biological control agent, Fo366, was PCR-amplified with published general primers, FIGS11/FIGS12 and sequenced. A new primer, NPIGS-R, which was designed based on the IGS sequence, was paired with the FIGS11 primer. These primers were then evaluated for their specificity to amplify DNA from nonpathogenic Fo isolates that have biological control potential. The results showed that the modified primer pair, FIGS11/NPIGS-R, amplified a 500-bp DNA fragment from five of seven nonpathogenic Fo isolates. These five Fo isolates delayed symptom development of cucumber Fusarium wilt in greenhouse bioassay tests. Seventy-seven Fo isolates were obtained from the soil and plant tissues and then subjected to amplification using the modified primer pair; six samples showed positive amplification. These six isolates did not cause symptoms on cucumber seedlings when grown in peat moss infested with the isolates and delayed disease development when the same plants were subsequently inoculated with a virulent isolate of Foc. Therefore, the modified primer pair may prove useful for the identification of Fo isolates that are nonpathogenic to cucumber which can potentially act as biocontrol agents for Fusarium wilt of cucumber. PMID:23762289

  3. Profil Gangguan Kognitif pada Tumor Intrakranial Primer dan Metastasis

    OpenAIRE

    Kartika Maharani; Andira Larasari; Tiara Aninditha; Yetty Ramli

    2015-01-01

    Gangguan kognitif sering menyertai pasien tumor intrakranial dan menjadi penyebab utama disabilitas. Perbedaan patofisiologi tumor intrakranial primer (TIP) dan metastasis (TM) menyebabkan perbedaan gambaran klinis dan derajat  gangguan kognitif. Tujuan penelitian ini untuk mengetahui prevalensi dan profil gangguan kognitif pasien TIP dan TM. Disain penelitian potong-lintang retrospektif menggunakan data sekunder dari Poliklinik Saraf RSCM pada bulan Januari 2011-Desember 2013. Subjek b...

  4. A primer on the mortgage market and mortgage finance

    OpenAIRE

    Daniel J. McDonald; Daniel L. Thornton

    2008-01-01

    This article is a primer on mortgage finance. It discusses the basics of the mortgage market and mortgage finance. In so doing, it provides useful information that can aid individuals in making better mortgage finance decisions. The discussion and the tools are presented within the context of mortgage finance; however, these same principles and tools can be applied to a wide range of financial decisions.

  5. Primer on molecular genetics. DOE Human Genome Program

    Energy Technology Data Exchange (ETDEWEB)

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  6. Transient Heat Transfer Model for Car Body Primer Curing

    OpenAIRE

    D. Zabala; N. Sánchez; J. Pinto

    2010-01-01

    A transient heat transfer mathematical model for the prediction of temperature distribution in the car body during primer baking has been developed by considering the thermal radiation and convection in the furnace chamber and transient heat conduction governing equations in the car framework. The car cockpit is considered like a structure with six flat plates, four vertical plates representing the car doors and the rear and front panels. The other two flat plates are the...

  7. Small Commercial Building Re-tuning: A Primer

    Energy Technology Data Exchange (ETDEWEB)

    Cort, Katherine A.; Hostick, Donna J.; Underhill, Ronald M.; Fernandez, Nicholas; Katipamula, Srinivas

    2013-09-30

    To help building owners and managers address issues related to energy-efficient operation of small buildings, DOE has developed a Small Building Re-tuning training curriculum. This "primer" provides additional background information to understand some of the concepts presented in the Small Building Re-tuning training. The intent is that those who are less familiar with the buidling energy concepts will review this material before taking the building re-tuning training class.

  8. Use of antidementia drugs in frontotemporal lobar degeneration.

    Science.gov (United States)

    López-Pousa, Secundino; Calvó-Perxas, Laia; Lejarreta, Saioa; Cullell, Marta; Meléndez, Rosa; Hernández, Erélido; Bisbe, Josep; Perkal, Héctor; Manzano, Anna; Roig, Anna Maria; Turró-Garriga, Oriol; Vilalta-Franch, Joan; Garre-Olmo, Josep

    2012-06-01

    Clinical evidence indicates that acetylcholinesterase inhibitors (AChEIs) are not efficacious to treat frontotemporal lobar degeneration (FTLD). The British Association for Psychopharmacology recommends avoiding the use of AChEI and memantine in patients with FTLD. Cross-sectional design using 1092 cases with Alzheimer's disease (AD) and 64 cases with FTLD registered by the Registry of Dementias of Girona. Bivariate analyses were performed, and binary logistic regressions were used to detect variables associated with antidementia drugs consumption. The AChEIs were consumed by 57.6% and 42.2% of the patients with AD and FTLD, respectively. Memantine was used by 17.2% and 10.9% of patients with AD and FTLD, respectively. Binary logistic regressions yielded no associations with antidementia drugs consumption. There is a discrepancy regarding clinical practice and the recommendations based upon clinical evidence. The increased central nervous system drug use detected in FTLD requires multicentric studies aiming at finding the best means to treat these patients.

  9. The brain basis of musicophilia: evidence from frontotemporal lobar degeneration

    OpenAIRE

    Phillip David Fletcher; Laura eDowney; Pirada eWitoonpanich; Jason eWarren

    2013-01-01

    Musicophilia, or abnormal craving for music, is a poorly understood phenomenon that has been associated in particular with focal degeneration of the temporal lobes. Here we addressed the brain basis of musicophilia using voxel-based morphometry (VBM) on MR volumetric brain images in a retrospectively ascertained cohort of patients meeting clinical consensus criteria for frontotemporal lobar degeneration: of 37 cases ascertained, 12 had musicophilia and 25 did not exhibit the phenomenon. The s...

  10. Degenerated uterine leiomyomas mimicking malignant bilateral ovarian surface epithelial tumors

    Energy Technology Data Exchange (ETDEWEB)

    Hwang, Yi Boem Ha; Lee, Hae Kyung; Lee, Min Hee; Choi, Seo Youn; Chung, Soo Ho [Bucheon Hospital, Soonchunhyang University College of Medicine, Bucheon (Korea, Republic of)

    2017-07-15

    Uterine leiomyomas are the most common benign uterine neoplasms. Undegenerated uterine leiomyomas are easily recognizable by the typical imaging findings on radiologic studies. However, degenerated fibroids can have unusual and variable appearances. The atypical appearances due to degenerative changes may cause confusion in diagnosis of leiomyomas. In this article, we report a case of a patient with extensive cystic and myxoid degeneration of uterine leiomyoma, mimicking malignant bilateral ovarian surface epithelial tumors.

  11. Electromagnetic solitons in degenerate relativistic electron–positron plasma

    International Nuclear Information System (INIS)

    Berezhiani, V I; Shatashvili, N L; Tsintsadze, N L

    2015-01-01

    The existence of soliton-like electromagnetic (EM) distributions in a fully degenerate electron–positron plasma is studied applying relativistic hydrodynamic and Maxwell equations. For a circularly polarized wave it is found that the soliton solutions exist both in relativistic as well as nonrelativistic degenerate plasmas. Plasma density in the region of soliton pulse localization is reduced considerably. The possibility of plasma cavitation is also shown. (invited comment)

  12. SINGLE-DEGENERATE TYPE Ia SUPERNOVAE ARE PREFERENTIALLY OVERLUMINOUS

    International Nuclear Information System (INIS)

    Fisher, Robert; Jumper, Kevin

    2015-01-01

    Recent observational and theoretical progress has favored merging and helium-accreting sub-Chandrasekhar mass white dwarfs (WDs) in the double-degenerate and the double-detonation channels, respectively, as the most promising progenitors of normal Type Ia supernovae (SNe Ia). Thus the fate of rapidly accreting Chandrasekhar mass WDs in the single-degenerate channel remains more mysterious then ever. In this paper, we clarify the nature of ignition in Chandrasekhar-mass single-degenerate SNe Ia by analytically deriving the existence of a characteristic length scale which establishes a transition from central ignitions to buoyancy-driven ignitions. Using this criterion, combined with data from three-dimensional simulations of convection and ignition, we demonstrate that the overwhelming majority of ignition events within Chandrasekhar-mass WDs in the single-degenerate channel are buoyancy-driven, and consequently lack a vigorous deflagration phase. We thus infer that single-degenerate SNe Ia are generally expected to lead to overluminous 1991T-like SNe Ia events. We establish that the rates predicted from both the population of supersoft X-ray sources (SSSs) and binary population synthesis models of the single-degenerate channel are broadly consistent with the observed rates of overluminous SNe Ia, and suggest that the population of SSSs are the dominant stellar progenitors of SNe 1991T-like events. We further demonstrate that the single-degenerate channel contribution to the normal and failed 2002cx-like rates is not likely to exceed 1% of the total SNe Ia rate. We conclude with a range of observational tests of overluminous SNe Ia which will either support or strongly constrain the single-degenerate scenario

  13. Death Receptor 6 Promotes Wallerian Degeneration in Peripheral Axons.

    Science.gov (United States)

    Gamage, Kanchana K; Cheng, Irene; Park, Rachel E; Karim, Mardeen S; Edamura, Kazusa; Hughes, Christopher; Spano, Anthony J; Erisir, Alev; Deppmann, Christopher D

    2017-03-20

    Axon degeneration during development is required to sculpt a functional nervous system and is also a hallmark of pathological insult, such as injury [1, 2]. Despite similar morphological characteristics, very little overlap in molecular mechanisms has been reported between pathological and developmental degeneration [3-5]. In the peripheral nervous system (PNS), developmental axon pruning relies on receptor-mediated extrinsic degeneration mechanisms to determine which axons are maintained or degenerated [5-7]. Receptors have not been implicated in Wallerian axon degeneration; instead, axon autonomous, intrinsic mechanisms are thought to be the primary driver for this type of axon disintegration [8-10]. Here we survey the role of neuronally expressed, paralogous tumor necrosis factor receptor super family (TNFRSF) members in Wallerian degeneration. We find that an orphan receptor, death receptor 6 (DR6), is required to drive axon degeneration after axotomy in sympathetic and sensory neurons cultured in microfluidic devices. We sought to validate these in vitro findings in vivo using a transected sciatic nerve model. Consistent with the in vitro findings, DR6 -/- animals displayed preserved axons up to 4 weeks after injury. In contrast to phenotypes observed in Wld s and Sarm1 -/- mice, preserved axons in DR6 -/- animals display profound myelin remodeling. This indicates that deterioration of axons and myelin after axotomy are mechanistically distinct processes. Finally, we find that JNK signaling after injury requires DR6, suggesting a link between this novel extrinsic pathway and the axon autonomous, intrinsic pathways that have become established for Wallerian degeneration. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Natural history of seminiferous tubule degeneration in Klinefelter syndrome

    DEFF Research Database (Denmark)

    Aksglaede, Lise; Wikström, Anne M; Rajpert-De Meyts, Ewa

    2006-01-01

    Klinefelter syndrome (47,XXY) is characterized by small, firm testis, gynaecomastia, azoospermia and hypergonadotropic hypogonadism. Degeneration of the seminiferous tubules in 47,XXY males is a well-described phenomenon. It begins in the fetus, progresses through infancy and accelerates dramatic......Klinefelter syndrome (47,XXY) is characterized by small, firm testis, gynaecomastia, azoospermia and hypergonadotropic hypogonadism. Degeneration of the seminiferous tubules in 47,XXY males is a well-described phenomenon. It begins in the fetus, progresses through infancy and accelerates...

  15. [Depression in Patients with Age-Related Macular Degeneration].

    Science.gov (United States)

    Narváez, Yamile Reveiz; Gómez-Restrepo, Carlos

    2012-09-01

    Age-related macular degeneration is a cause for disability in the elderly since it greatly affects their quality of life and increases depression likelihood. This article discusses the negative effect depression has on patients with age-related macular degeneration and summarizes the interventions available for decreasing their depression index. Copyright © 2012 Asociación Colombiana de Psiquiatría. Publicado por Elsevier España. All rights reserved.

  16. Phonon emission in a degenerate semiconductor at low lattice temperatures

    International Nuclear Information System (INIS)

    Midday, S.; Nag, S.; Bhattacharya, D.P.

    2015-01-01

    The characteristics of phonon growth in a degenerate semiconductor at low lattice temperatures have been studied for inelastic interaction of non-equilibrium electrons with the intravalley acoustic phonons. The energy of the phonon and the full form of the phonon distribution are taken into account. The results reveal significant changes in the growth characteristics compared to the same for a non-degenerate material

  17. Posterior Lattice Degeneration Characterized by Spectral Domain Optical Tomography

    OpenAIRE

    Manjunath, Varsha; Taha, Mohammed; Fujimoto, James G.; Duker, Jay S.

    2011-01-01

    PURPOSE: To utilize high-resolution spectral domain optical coherence tomography (SD-OCT) in the characterization of retinal and vitreal morphological changes overlying posterior lattice degeneration. METHODS: A cross-sectional, retrospective analysis was performed on 13 eyes of 13 nonconsecutive subjects with posterior lattice degeneration seen at the New England Eye Center, Tufts Medical Center between October 2009 and January 2010. SD-OCT images taken through the region of latti...

  18. Sensory reception of the primer pheromone ethyl oleate

    Science.gov (United States)

    Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang

    2012-05-01

    Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.

  19. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    Energy Technology Data Exchange (ETDEWEB)

    D. S. Lucas

    2004-10-01

    A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at www.microfusionlab.com.

  20. The prevalence of sacroiliac joint degeneration in asymptomatic adults.

    Science.gov (United States)

    Eno, Jonathan-James T; Boone, Christopher R; Bellino, Michael J; Bishop, Julius A

    2015-06-03

    Degenerative changes of the sacroiliac joint have been implicated as a cause of lower back pain in adults. The purpose of this study was to determine the prevalence of sacroiliac joint degeneration in asymptomatic patients. Five hundred consecutive pelvic computed tomography (CT) scans, made at a tertiary-care medical center, of patients with no history of pain in the lower back or pelvic girdle were retrospectively reviewed and analyzed for degenerative changes of the sacroiliac joint. After exclusion criteria were applied, 373 CT scans (746 sacroiliac joints) were evaluated for degenerative changes. Regression analysis was used to determine the association between age and the degree of sacroiliac joint degeneration. The prevalence of sacroiliac joint degeneration was 65.1%, with substantial degeneration occurring in 30.5% of asymptomatic subjects. The prevalence steadily increased with age, with 91% of subjects in the ninth decade of life displaying degenerative changes. Radiographic evidence of sacroiliac joint degeneration is highly prevalent in the asymptomatic population and is associated with age. Caution must be exercised when attributing lower back or pelvic girdle pain to sacroiliac joint degeneration seen on imaging. Prognostic Level IV. See Instructions for Authors for a complete description of levels of evidence. Copyright © 2015 by The Journal of Bone and Joint Surgery, Incorporated.

  1. Risk of retinal detachment in patients with lattice degeneration.

    Science.gov (United States)

    Sasaki, K; Ideta, H; Yonemoto, J; Tanaka, S; Hirose, A; Oka, C

    1998-01-01

    To determine the risk of retinal detachment in patients with lattice degeneration of the retina, we statistically analyzed the incidence of retinal detachment in these patients. The data of hospital patients with retinal detachment associated with lattice degeneration in Kumamoto Prefecture, Japan, in 1990 were collected. The prevalence of lattice degeneration in Kumamoto was reported to be 9.5% in 1980. Based on population data from the 1990 census, the cumulative incidence of retinal detachment associated with lattice degeneration was calculated in this study. Among 1,840,000 residents in Kumamoto, there were 110 patients with retinal detachment associated with lattice degeneration; 72 with detachment resulting from tractional tears (tears), and 38 with detachment from atrophic holes. The cumulative incidence of retinal detachment from atrophic holes was 1.5% at the age of 40 years; from tears it was 3.6% at the age of 80 years. The cumulative incidence of detachment from both atrophic holes and tears was 5.3% at the age of 80 years. The results of this study are useful for clarifying the natural course of lattice degeneration.

  2. Posterior lattice degeneration characterized by spectral domain optical coherence tomography.

    Science.gov (United States)

    Manjunath, Varsha; Taha, Mohammed; Fujimoto, James G; Duker, Jay S

    2011-03-01

    The purpose of this study was to use high-resolution spectral domain optical coherence tomography in the characterization of retinal and vitreal morphological changes overlying posterior lattice degeneration. A cross-sectional retrospective analysis was performed on 13 eyes of 13 nonconsecutive subjects with posterior lattice degeneration seen at the New England Eye Center, Tufts Medical Center between October 2009 and January 2010. Spectral domain optical coherence tomography images taken through the region of lattice degeneration were qualitatively analyzed. Four characteristic changes of the retina and vitreous were seen in the 13 eyes with lattice degeneration: 1) anterior/posterior U-shaped vitreous traction; 2) retinal breaks; 3) focal retinal thinning; and 4) vitreous membrane formation. The morphologic appearance of vitreous traction and retinal breaks were found to be consistent with previous histologic reports. It is possible to image posterior lattice degeneration in many eyes using spectral domain optical coherence tomography and to visualize the spectrum of retinal and vitreous changes throughout the area of lattice degeneration.

  3. Differential charge-transfer cross sections for systems with energetically degenerate or near-degenerate channels

    International Nuclear Information System (INIS)

    Nguyen, H.; Bredy, R.; Camp, H.A.; DePaola, B.D.; Awata, T.

    2004-01-01

    Resolution plays a vital role in spectroscopic studies. In the usual recoil-ion momentum spectroscopy (RIMS), Q-value resolution is relied upon to distinguish between different collision channels: The better the Q-value resolution, the better one is able to resolve energetically similar channels. Although traditional COLTRIMS greatly improves Q-value resolution by cooling the target and thus greatly reducing the initial target momentum spread, the resolution of the technique is still limited by target temperature. However, with the recent development in RIMS, namely, magneto-optical trap recoil ion momentum spectroscopy (MOTRIMS) superior recoil ion momentum resolution as well as charge transfer measurements with laser excited targets have become possible. Through MOTRIMS, methods for the measurements of target excited state fraction and kinematically complete relative charge transfer cross sections have been developed, even for some systems having energetically degenerate or nearly degenerate channels. In the present work, the systems of interest having energy degeneracies or near degeneracies are Rb + , K + , and Li + colliding with trapped Rb(5l), where l=s and p

  4. Frontotemporal Lobar Degeneration and microRNAs

    Directory of Open Access Journals (Sweden)

    Paola ePiscopo

    2016-02-01

    Full Text Available Frontotemporal lobar degeneration (FTLD includes a spectrum of disorders characterized by changes of personality and social behaviour and, often, a gradual and progressive language dysfunction. In the last years, several efforts have been fulfilled in identifying both genetic mutations and pathological proteins associated with FTLD. The molecular bases undergoing the onset and progression of the disease remain still unknown. Recent literature prompts an involvement of RNA metabolism in FTLD, particularly miRNAs. Dysregulation of miRNAs in several disorders, including neurodegenerative diseases, and increasing importance of circulating miRNAs in different pathologies has suggested to implement the study of their possible application as biological markers and new therapeutic targets; moreover, miRNA-based therapy is becoming a powerful tool to deepen the function of a gene, the mechanism of a disease, and validate therapeutic targets. Regarding FTLD, different studies showed that miRNAs are playing an important role. For example, several reports have evaluated miRNA regulation of the progranulin gene suggesting that it is under their control, as described for miR-29b, miR-107 and miR-659. More recently, it has been demonstrated that TMEM106B gene, which protein is elevated in FTLD-TDP brains, is repressed by miR-132/212 cluster; this post-transcriptional mechanism increases intracellular levels of progranulin, affecting its pathways. These findings if confirmed could suggest that these microRNAs have a role as potential targets for some related-FTLD genes. In this review, we focus on the emerging roles of the miRNAs in the pathogenesis of FTLD.

  5. Designing motivation

    DEFF Research Database (Denmark)

    How can products be designed to change our habits for the better? What is some of the leading research that designers can draw on to create new systems that motivate people towards healthier behaviour? Designing Motivation is an edited collection of ‘industrialist cheat sheets’: 22 single......-page summaries of research articles relating to technology design, motivation, and behaviour change. Ranging across the fields of economics, sociology, design research and behavioural science, each summary draws out the design implications of the research. It is intended as a resource for designers who...... are grappling with how to create motivating products, and as a primer for students who want a brief introduction to some of the relevant theories, findings and design interventions in these fields. The editor's introduction raises a number of issues encountered when we try to apply behavioural research...

  6. Transferability of retrotransposon primers derived from Persimmon (Diospyros kaki Thunb.) across other plant species.

    Science.gov (United States)

    Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R

    2013-06-06

    Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.

  7. An optoelectronic detecting based environment perception experiment for primer students using multiple-layer laser scanner

    Science.gov (United States)

    Wang, Shifeng; Wang, Rui; Zhang, Pengfei; Dai, Xiang; Gong, Dawei

    2017-08-01

    One of the motivations of OptoBot Lab is to train primer students into qualified engineers or researchers. The series training programs have been designed by supervisors and implemented with tutoring for students to test and practice their knowledge from textbooks. An environment perception experiment using a 32 layers laser scanner is described in this paper. The training program design and laboratory operation is introduced. The four parts of the experiments which are preparation, sensor calibration, 3D space reconstruction, and object recognition, are the participating students' main tasks for different teams. This entire program is one of the series training programs that play significant role in establishing solid research skill foundation for opto-electronic students.

  8. A primer on industrial ecosystems : a strategy for sustainable industrial development

    Energy Technology Data Exchange (ETDEWEB)

    Cote, R P [Dalhousie Univ., Halifax, NS (Canada). Eco-Efficiency Centre; [Dalhousie Univ., Halifax, NS (Canada). Faculty of Management, School for Resource and Environmental Studies

    2003-07-01

    Industrial ecology incorporates ecological theories, functions and limits into the design of industrial production systems, processes and products. The main objective is to enhance environmental and economic performance through collaboration in managing environmental resource issues such as energy, water and materials. Industrial ecology recognizes the connectedness and synergies of materials, products and infrastructure. As such, it considers the life cycle of products, the design of buildings, infrastructure and industrial parks. By working together, businesses gain a collective benefit which is greater than the total of the individual benefits each company could achieve on its own. Industrial ecology also considers the reuse, recovery and recycling of resources. The benefits include: efficiency of resource use; cost reduction for industrial infrastructure; sustainable development support; and, new opportunities in economic development, technology development, manufacturing, and business management. This primer also presents guidelines for win-win projects in industrial ecology. refs., figs.

  9. Laboratory and gas-fired furnace performance tests of epoxy primers for intumescent coatings

    DEFF Research Database (Denmark)

    Nørgaard, Kristian Petersen; Dam-Johansen, Kim; Catala, Pere

    2014-01-01

    , either to ensure adhesion of the intumescent coating to the steel or to provide corrosion resistance. It is essential to document the performance of the intumescent coating together with the primer to ensure the overall quality of coating system. In the present work, two epoxy primers were used...... to a gas-fired furnace following the ISO834 fire curve (a so-called cellulosic fire), one of the primers selected performed well and the other poorly. From tests in the electrically heated oven, it was found that both primers were sensitive to the film thickness employed and the presence of oxygen....... At oxygen-rich conditions, higher primer thicknesses gave weaker performance. In addition, a color change from red to black was observed in nitrogen, while the color remained red in the oxygen-nitrogen mixture. In summary, the results suggest that an adequate choice of primer, primer thickness...

  10. Identification of E. coli O157:H7 by Using Specific Primers for rfbE and stx2b Genes

    Directory of Open Access Journals (Sweden)

    Mostafa Bakhshi

    2017-07-01

    Sorbitol-MacConkey agar was used to verification of growth ability of selected colonies during PCR. Results: By appearance of the bonds belong to rfbE and stx2B genes on agarose gel, the ability of designed primers in gene detection in samples of E .coli O157:H7 was verified. Colonies which selected during PCR have growth potency on sorbitol-MacConkey agar medium. Conclusion: It was revealed that we can prepare a fast, precise and relative comfortable method for detection of E. coli O157:H7 strain by using PCR technique and specific primers than other available methods.

  11. Application of a double-enrichment procedure for microsatellite isolation and the use of tailed primers for high throughput genotyping

    Directory of Open Access Journals (Sweden)

    Fábio Mendonça Diniz

    2007-03-01

    Full Text Available The number of microsatellite loci and their allelic diversity contribute to increase accuracy and informativity of genetic estimates, however, the isolation of microsatellite loci is not only laborious but also quite expensive. We used (GATAn and (GACAn tetranucleotide probes and single- and double-enrichment hybridization to construct and screen a genomic library with an increased proportion of DNA fragments containing repeat motifs. Repeats were found using both types of hybridization but the double-enrichment procedure recovered sequences of which 100% contained (GATAn and (GACAn motifs. Microsatellite loci primers were then designed with an M13R-tail or CAG-tag to produce scorable PCR products with minimal stutter. The approach used in this study suggests that double-enrichment is a worthwhile strategy when isolating repeat motifs from eukaryotic genomes. Moreover, the use of tailed microsatellite primers provides increased resolution for compound microsatellite loci, with a significant decrease in costs.

  12. Improved primer sequences for the mitochondrial ND1, ND3/4 and ND5/6 segments in salmonid fishes : application to RFLP analysis of Atlantic salmon

    DEFF Research Database (Denmark)

    Eg Nielsen, Einar; Hansen, Michael Møller; Mensberg, Karen-Lise Dons

    1998-01-01

    New specific primers for the mtDNA segments ND1, ND3/4 and ND5/6 designed from the rainbow trout sequence, improved PCR amplification for salmonid fishes. RFLP analysis revealed restriction site variation for all three segments in Atlantic salmon. Eleven haplotypes were detected in a screening...

  13. Risk factors of age-related macular degeneration in Argentina

    Directory of Open Access Journals (Sweden)

    María Eugenia Nano

    2013-04-01

    Full Text Available PURPOSES: To assess the risk factors of age-related macular degeneration in Argentina using a case-control study. METHODS: Surveys were used for subjects' antioxidant intake, age/gender, race, body mass index, hypertension, diabetes (and type of treatment, smoking, sunlight exposure, red meat consumption, fish consumption, presence of age-related macular degeneration and family history of age-related macular degeneration. Main effects models for logistic regression and ordinal logistic regression were used to analyze the results. RESULTS: There were 175 cases and 175 controls with a mean age of 75.4 years and 75.5 years, respectively, of whom 236 (67.4% were female. Of the cases with age-related macular degeneration, 159 (45.4% had age-related macular degeneration in their left eyes, 154 (44.0% in their right eyes, and 138 (39.4% in both eyes. Of the cases with age-related macular degeneration in their left eyes, 47.8% had the dry type, 40.3% had the wet type, and the type was unknown for 11.9%. The comparable figures for right eyes were: 51.9%, 34.4%, and 13.7%, respectively. The main effects model was dominated by higher sunlight exposure (OR [odds ratio]: 3.3 and a family history of age-related macular degeneration (OR: 4.3. Other factors included hypertension (OR: 2.1, smoking (OR: 2.2, and being of the Mestizo race, which lowered the risk of age-related macular degeneration (OR: 0.40. Red meat/fish consumption, body mass index, and iris color did not have an effect. Higher age was associated with progression to more severe age-related macular degeneration. CONCLUSION: Sunlight exposure, family history of age-related macular degeneration, and an older age were the significant risk factors. There may be other variables, as the risk was not explained very well by the existing factors. A larger sample may produce different and better results.

  14. Structure of stable degeneration of K3 surfaces into pairs of rational elliptic surfaces

    OpenAIRE

    Kimura, Yusuke

    2018-01-01

    F-theory/heterotic duality is formulated in the stable degeneration limit of a K3 fibration on the F-theory side. In this note, we analyze the structure of the stable degeneration limit. We discuss whether stable degeneration exists for pairs of rational elliptic surfaces. We demonstrate that, when two rational elliptic surfaces have an identical complex structure, stable degeneration always exists. We provide an equation that systematically describes the stable degeneration of a K3 surface i...

  15. Cytotoxic and genotoxic evaluation of orthodontic adhesives with primer and without primer exposed to electron beam irradiation - an in-vitro study

    International Nuclear Information System (INIS)

    Ravi, M.S.; Panchasara, Chirag; Vijay, R.; Suchetha Kumari, N.; Sanjeev, Ganesh

    2013-01-01

    To evaluate the in vitro genotoxicity and cytotoxicity of two visible light-cured adhesives. The materials tested were 1. orthodontic adhesive with primer (Transbond XT3M) and 2. Orthodontic adhesive without primer (Heliosit, Ivoclar Vivadent AG), Cured sterile individual masses were exposed to 2 kGy electron beam radiation, both irradiated and non irradiated materials were immersed in Phosphate buffer saline and left at 370℃ for 24 hr. Then a volume of 200 μL of the extract medium was mixed with human peripheral blood lymphocyte tested for comet assay by single cell DNA Damage assay and Apoptosis by DNA diffusion agar assay. Evaluation of cytotoxicity was carried out by Hemolysis assay method. Haemolytic activity of orthodontic adhesive without primer (53.34±3.12) was slightly more than that of orthodontic adhesive with primer (52.9±.88). In case of Apoptosis, adhesive with primer (188.92±55.05) and adhesives without primer (186.75±101.83) showed increased diffusion of DNA compared to normal lymphocyte (111.22±8.78). However the level of DNA diffusion was not significantly different between the two adhesives. Both adhesives were cytotoxic and induced apoptosis. Adhesives without primer were found to be slightly toxic than that of adhesive with primer. Both the adhesives had no significant effect on the percentage of DNA tail and olive tail moment of DNA exposed to electron beam radiation. (author)

  16. APLIKASI ANIMASI INTERAKTIF PENCAMPURAN TIGA WARNA PRIMER DAN PENGENALAN BENTUK GEOMETRI PADA PAUD AL-MUSLIMUN

    Directory of Open Access Journals (Sweden)

    Mayya Nurbayanti Shobary

    2016-03-01

    Full Text Available Abstract - The development of Interactive animation application mixing three colors and introduction of geometric shapes for early childhood, aims to increase learning tool for parents and teachers to attract the attention of children to learn about colors and shapes using interactive animation application. Application built using the concept of PAUD Al-Muslimun in educating early childhood in knowing the result of mixing three primary colors and geometric shapes. The development of application take an example of how theachers in educating early childhood that began with the introduction of color and shapes, and practice how to mix the primary three colors, by showing interisting picture related to colors and shapes are introduced. Data collection methods used for this study is the direct observation of the teaching and learning activities from the perspective of teachers, children and parents to get an idea of the optimal design of an application built on. The development of Interactive animation application mixing three primary colors and introduction of geometric shapes for early childhood for early childhood through the five steps, analyzing, designing, implemeting, testing, and revision errors or shortfall. In this application there are learning processes knowing the primary color and introduction of geometric shapes with support interactive buttons, interesting picture and audio to enhance the absorption of early childhood to the contents of the material, learning and display concerned and to help parents or teachers role in educating children once more creative . Keywords: Applications, Animation, Interactive, Early Childhood Abstrak - Pembangunan aplikasi animasi interaktif pencampuran tiga warna primer dan pengenalan bentuk geometri untuk anak usia dini, bertujuan untuk menambah sarana pembelajaran untuk orang tua dan guru dalam menarik perhatian anak untuk belajar mengenal warna dan bentuk dengan menggunakan aplikasi animasi interaktif

  17. Construção de iniciadores e otimização de ensaios de PCR e de nested-PCR para a detecção específica de Tritrichomonas foetus Primers design and optimization of PCR and nested-PCR assays for the specific detection of Tritrichomonas foetus

    Directory of Open Access Journals (Sweden)

    Paula Rogério Fernandes

    2008-09-01

    Full Text Available Tritrichomonas foetus é um protozoário patogênico responsável por doença venérea em bovinos conhecida por tricomonose genital bovina. A tricomonose bovina é uma doença venérea causada pelo protozoário cujo habitat natural é o trato genital. Os protocolos já desenvolvidos para o diagnóstico deste parasito por PCR, apesar de serem eficazes na identificação do DNA genômico alvo, promovem algumas amplificações inespecíficas ou são incapazes de distinguir T. foetus das outras espécies do gênero. O presente trabalho foi desenvolvido com o objetivo de estabelecer e otimizar protocolos de ensaio de PCR e nested-PCR para o diagnóstico específico de T. foetus, empregando-se novos iniciadores, selecionados do alinhamento das seqüências dos genes 18S rRNA, 5,8S rRNA, 28S rRNA e dos espaços transcritos do rDNA (ITS1 e ITS2. Um par de iniciadores foi construído para amplificação gênero-específica de um fragmento de 648 pares de base e outros dois para a obtenção de produtos espécie- específicos de 343 e 429 pb. Nenhuma reação cruzada foi observada frente ao DNA genômico de Bos taurus ou de microrganismos responsáveis por infecções genitais. A sensibilidade dos ensaios de PCR e de nested-PCR apresentados neste estudo permitiu um limiar de detecção de até dois parasitos.Tritrichomonas foetus is a pathogenic protozoan that causes a venereal disease in cattle known as bovine genital tricomonosis. In spite of the efficacy to recognize the target genomic DNA, the protocols so far developed for the diagnosis of this organism by PCR promote some inespecific amplifications or they are unable to discriminate T. foetus against other species within the genus. The objective of this study was to assess and optimize PCR and nested-PCR assays for the specific diagnosis of T. foetus, using novel primers selected from the alignment of sequences of the genes 18S rRNA, 5.8S rRNA, 28S rRNA and of the internal transcribed spacers of the

  18. LAVA: An Open-Source Approach To Designing LAMP (Loop-Mediated Isothermal Amplification DNA Signatures

    Directory of Open Access Journals (Sweden)

    Gardner Shea N

    2011-06-01

    Full Text Available Abstract Background We developed an extendable open-source Loop-mediated isothermal AMPlification (LAMP signature design program called LAVA (LAMP Assay Versatile Analysis. LAVA was created in response to limitations of existing LAMP signature programs. Results LAVA identifies combinations of six primer regions for basic LAMP signatures, or combinations of eight primer regions for LAMP signatures with loop primers, which can be used as LAMP signatures. The identified primers are conserved among target organism sequences. Primer combinations are optimized based on lengths, melting temperatures, and spacing among primer sites. We compare LAMP signature candidates for Staphylococcus aureus created both by LAVA and by PrimerExplorer. We also include signatures from a sample run targeting all strains of Mycobacterium tuberculosis. Conclusions We have designed and demonstrated new software for identifying signature candidates appropriate for LAMP assays. The software is available for download at http://lava-dna.googlecode.com/.

  19. Statins for age-related macular degeneration.

    Science.gov (United States)

    Gehlbach, Peter; Li, Tianjing; Hatef, Elham

    2015-02-11

    Age-related macular degeneration (AMD) is a progressive late onset disorder of the macula affecting central vision. Age-related macular degeneration is the leading cause of blindness in people over 65 years in industrialized countries. Recent epidemiologic, genetic, and pathological evidence has shown AMD shares a number of risk factors with atherosclerosis, leading to the hypothesis that statins may exert protective effects in AMD. The objective of this review was to examine the effectiveness of statins compared with other treatments, no treatment, or placebo in delaying the onset and progression of AMD. We searched CENTRAL (which contains the Cochrane Eyes and Vision Group Trials Register) (2014, Issue 6), Ovid MEDLINE, Ovid MEDLINE In-Process and Other Non-Indexed Citations, Ovid MEDLINE Daily, Ovid OLDMEDLINE (January 1946 to June 2014), EMBASE (January 1980 to June 2014), Latin American and Caribbean Health Sciences Literature Database (LILACS) (January 1982 to June 2014), PubMed (January 1946 to June 2014), the metaRegister of Controlled Trials (mRCT) (www.controlled-trials.com), ClinicalTrials.gov (www.clinicaltrials.gov), and the WHO International Clinical Trials Registry Platform (ICTRP) (www.who.int/ictrp/search/en). We did not use any date or language restrictions in the electronic searches for trials. We last searched the electronic databases on 5 June 2014. We included randomized controlled trials (RCTs) that compared statins with other treatments, no treatment, or placebo in participants who were either susceptible to or diagnosed as having early stages of AMD. We used standard methodological procedures expected by The Cochrane Collaboration. Two authors independently evaluated the search results against the selection criteria, abstracted data, and assessed risk of bias. We did not perform meta-analysis due to heterogeneity in the interventions and outcomes among the included studies. Two RCTs with 144 total participants met the selection criteria

  20. Notochord Cells in Intervertebral Disc Development and Degeneration

    Science.gov (United States)

    McCann, Matthew R.; Séguin, Cheryle A.

    2016-01-01

    The intervertebral disc is a complex structure responsible for flexibility, multi-axial motion, and load transmission throughout the spine. Importantly, degeneration of the intervertebral disc is thought to be an initiating factor for back pain. Due to a lack of understanding of the pathways that govern disc degeneration, there are currently no disease-modifying treatments to delay or prevent degenerative disc disease. This review presents an overview of our current understanding of the developmental processes that regulate intervertebral disc formation, with particular emphasis on the role of the notochord and notochord-derived cells in disc homeostasis and how their loss can result in degeneration. We then describe the role of small animal models in understanding the development of the disc and their use to interrogate disc degeneration and associated pathologies. Finally, we highlight essential development pathways that are associated with disc degeneration and/or implicated in the reparative response of the tissue that might serve as targets for future therapeutic approaches. PMID:27252900

  1. Notochord Cells in Intervertebral Disc Development and Degeneration

    Directory of Open Access Journals (Sweden)

    Matthew R. McCann

    2016-01-01

    Full Text Available The intervertebral disc is a complex structure responsible for flexibility, multi-axial motion, and load transmission throughout the spine. Importantly, degeneration of the intervertebral disc is thought to be an initiating factor for back pain. Due to a lack of understanding of the pathways that govern disc degeneration, there are currently no disease-modifying treatments to delay or prevent degenerative disc disease. This review presents an overview of our current understanding of the developmental processes that regulate intervertebral disc formation, with particular emphasis on the role of the notochord and notochord-derived cells in disc homeostasis and how their loss can result in degeneration. We then describe the role of small animal models in understanding the development of the disc and their use to interrogate disc degeneration and associated pathologies. Finally, we highlight essential development pathways that are associated with disc degeneration and/or implicated in the reparative response of the tissue that might serve as targets for future therapeutic approaches.

  2. Mechanisms of Distal Axonal Degeneration in Peripheral Neuropathies

    Science.gov (United States)

    Cashman, Christopher R.; Höke, Ahmet

    2015-01-01

    Peripheral neuropathy is a common complication of a variety of diseases and treatments, including diabetes, cancer chemotherapy, and infectious causes (HIV, hepatitis C, and Campylobacter jejuni). Despite the fundamental difference between these insults, peripheral neuropathy develops as a combination of just six primary mechanisms: altered metabolism, covalent modification, altered organelle function and reactive oxygen species formation, altered intracellular and inflammatory signaling, slowed axonal transport, and altered ion channel dynamics and expression. All of these pathways converge to lead to axon dysfunction and symptoms of neuropathy. The detailed mechanisms of axon degeneration itself have begun to be elucidated with studies of animal models with altered degeneration kinetics, including the slowed Wallerian degeneration (Wlds) and Sarmknockout animal models. These studies have shown axonal degeneration to occur througha programmed pathway of injury signaling and cytoskeletal degradation. Insights into the common disease insults that converge on the axonal degeneration pathway promise to facilitate the development of therapeutics that may be effective against other mechanisms of neurodegeneration. PMID:25617478

  3. LONGITUDINAL STRUCTURAL CHANGES IN LATE-ONSET RETINAL DEGENERATION.

    Science.gov (United States)

    Cukras, Catherine; Flamendorf, Jason; Wong, Wai T; Ayyagari, Radha; Cunningham, Denise; Sieving, Paul A

    2016-12-01

    To characterize longitudinal structural changes in early stages of late-onset retinal degeneration to investigate pathogenic mechanisms. Two affected siblings, both with a S163R missense mutation in the causative gene C1QTNF5, were followed for 8+ years. Color fundus photos, fundus autofluorescence images, near-infrared reflectance fundus images, and spectral domain optical coherence tomography scans were acquired during follow-up. Both patients, aged 45 and 50 years, had good visual acuities (>20/20) in the context of prolonged dark adaptation. Baseline color fundus photography demonstrated yellow-white, punctate lesions in the temporal macula that correlated with a reticular pattern on fundus autofluorescence and near-infrared reflectance imaging. Baseline spectral domain optical coherence tomography imaging revealed subretinal deposits that resemble reticular pseudodrusen described in age-related macular degeneration. During follow-up, these affected areas developed confluent thickening of the retinal pigment epithelial layer and disruption of the ellipsoid zone of photoreceptors before progressing to overt retinal pigment epithelium and outer retinal atrophy. Structural changes in early stages of late-onset retinal degeneration, revealed by multimodal imaging, resemble those of reticular pseudodrusen observed in age-related macular degeneration and other retinal diseases. Longitudinal follow-up of these lesions helps elucidate their progression to frank atrophy and may lend insight into the pathogenic mechanisms underlying diverse retinal degenerations.

  4. Deficiency of adaptive immunity does not interfere with Wallerian degeneration.

    Directory of Open Access Journals (Sweden)

    Christopher R Cashman

    Full Text Available Following injury, distal axons undergo the process of Wallerian degeneration, and then cell debris is cleared to create a permissive environment for axon regeneration. The innate and adaptive immune systems are believed to be critical for facilitating the clearance of myelin and axonal debris during this process. However, immunodeficient animal models are regularly used in transplantation studies investigating cell therapies to modulate the degenerative/regenerative response. Given the importance of the immune system in preparing a permissive environment for regeneration by clearing debris, animals lacking, in part or in full, a functional immune system may have an impaired ability to regenerate due to poor myelin clearance, and may, thus, be poor hosts to study modulators of regeneration and degeneration. To study this hypothesis, three different mouse models with impaired adaptive immunity were compared to wild type animals in their ability to degenerate axons and clear myelin debris one week following sciatic nerve transection. Immunofluorescent staining for axons and quantitation of axon density with nerve histomorphometry of the distal stump showed no consistent discrepancy between immunodeficient and wild type animals, suggesting axons tended to degenerate equally between the two groups. Debris clearance was assessed by macrophage density and relative myelin basic protein expression within the denervated nerve stump, and no consistent impairment of debris clearance was found. These data suggested deficiency of the adaptive immune system does not have a substantial effect on axon degeneration one week following axonal injury.

  5. Design

    DEFF Research Database (Denmark)

    Volf, Mette

    Design - proces & metode iBog®  er enestående i sit fokus på afmystificering og operationalisering af designprocessens flygtige og komplekse karakter. Udgivelsen går bag om designerens daglige arbejde og giver et indblik i den kreative skabelsesproces, som designeren er en del af. Udover et bredt...... indblik i designerens arbejdsmetoder og designparametre giver Design - proces & metode en række eksempler fra anerkendte designvirksomheder, der gør det muligt at komme helt tæt på designerens virkelighed....

  6. Plan de negocio de una escuela infantil (primer ciclo)

    OpenAIRE

    San Román Gómez, Ana de

    2014-01-01

    El presente documento establece los pasos a seguir para poner en marcha una escuela infantil en el barrio de Butarque, en Madrid. En un primer lugar se han realizado diversos estudios, tanto sobre el sector como sobre el área geográfica, ya que se partía de una situación de absoluto desconocimiento. En el análisis del sector se ha puesto de manifiesto que las competencias en educación en España están reguladas por el Ministerio en primera instancia, pero las Autonomías tienen también una g...

  7. A primer on physical-layer network coding

    CERN Document Server

    Liew, Soung Chang; Zhang, Shengli

    2015-01-01

    The concept of physical-layer network coding (PNC) was proposed in 2006 for application in wireless networks. Since then it has developed into a subfield of communications and networking with a wide following. This book is a primer on PNC. It is the outcome of a set of lecture notes for a course for beginning graduate students at The Chinese University of Hong Kong. The target audience is expected to have some prior background knowledge in communication theory and wireless communications, but not working knowledge at the research level. Indeed, a goal of this book/course is to allow the reader

  8. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Weber, James R.; Schell, Charlotte J.; Marino, T; Bilyard, Gordon R.

    2004-02-10

    This version of the communication primer comprises two interlocking parts: Pat 1, a practical section, intended to prepare you for public interactions, and Part 2, a theoretical section that provides social and technical bases for the practices recommended in Part 1. The mutual support of practice and theory is very familiar in science and clearly requires a willingness to observe and revise our prior assumptions--in this document, we invoke both. We hope that is offering will represent a step both towards improving practice and maturing the theory of practical science communication.

  9. A finite element primer for beginners the basics

    CERN Document Server

    Zohdi, Tarek I

    2014-01-01

    The purpose of this primer is to provide the basics of the Finite Element Method, primarily illustrated through a classical model problem, linearized elasticity. The topics covered are:(1) Weighted residual methods and Galerkin approximations,(2) A model problem for one-dimensional?linear elastostatics,(3) Weak formulations in one dimension,(4) Minimum principles in one dimension,(5) Error estimation in one dimension,(5) Construction of Finite Element basis functions in one dimension,(6) Gaussian Quadrature,(7) Iterative solvers and element by element data structures,(8) A model problem for th

  10. Discrete random signal processing and filtering primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2013-01-01

    Engineers in all fields will appreciate a practical guide that combines several new effective MATLAB® problem-solving approaches and the very latest in discrete random signal processing and filtering.Numerous Useful Examples, Problems, and Solutions - An Extensive and Powerful ReviewWritten for practicing engineers seeking to strengthen their practical grasp of random signal processing, Discrete Random Signal Processing and Filtering Primer with MATLAB provides the opportunity to doubly enhance their skills. The author, a leading expert in the field of electrical and computer engineering, offe

  11. Accelerating MATLAB with GPU computing a primer with examples

    CERN Document Server

    Suh, Jung W

    2013-01-01

    Beyond simulation and algorithm development, many developers increasingly use MATLAB even for product deployment in computationally heavy fields. This often demands that MATLAB codes run faster by leveraging the distributed parallelism of Graphics Processing Units (GPUs). While MATLAB successfully provides high-level functions as a simulation tool for rapid prototyping, the underlying details and knowledge needed for utilizing GPUs make MATLAB users hesitate to step into it. Accelerating MATLAB with GPUs offers a primer on bridging this gap. Starting with the basics, setting up MATLAB for

  12. Automated guided vehicle systems a primer with practical applications

    CERN Document Server

    Ullrich, Günter

    2015-01-01

    This primer is directed at experts and practitioners in intralogistics who are concerned with optimizing material flows. The presentation is comprehensive covering both, practical and theoretical aspects with a moderate degree of specialization, using clear and concise language. Areas of operation as well as technical standards of all relevant components and functions are described. Recent developments in technology and in the markets are taken into account. The goal of this book is to further stronger use of automated guided transport systems and the enhancement of their future performance.

  13. Adhesion of epoxy primer to hydrotalcite conversion coated AA2024

    Science.gov (United States)

    Leggat, Robert Benton, III

    Hydrotalcite-based (HT) conversion coatings are being developed as an environmentally benign alternative to chromate conversion coatings (CCC). Accelerated exposure tests were conducted on epoxy primed, HT-modified AA2024 to gauge service performance. HT-based conversion coatings did not perform as well as the CCC when used with an epoxy primer. The current HT chemistries are optimized for stand-alone corrosion protection, however additional research into the primer/HT interactions is necessary before they can be implemented within a coating scheme. The relative contribution of mechanical and physico-chemical interactions in controlling adhesion has been investigated in this study. Practical adhesion tests were used to assess the dry and wet bond strength of epoxy primer on HT coatings using the pull-off tensile strength (POTS) as the figure of merit. The practical adhesion of HT coated samples generally fell between that observed for the CCC and bare AA2024. Laboratory testing was done to assess the physical and chemical properties of HT coatings. Contact angle measurements were performed using powders representative of different HT chemistries to evaluate the dispersive and acid-base character of the surface. The wet POTS correlated with the electrodynamic (dipole + dispersive) parameter of the surface tension. The HT surfaces were found to be predominantly basic. Given the basicity of epoxy, these results indicate that increasing the acidic character of HT coatings may increase the adhesion performance. This was supported by electrokinetic measurements in which the dry POTS was found to increase with decreasing conversion coating iso-electric point. The correlations with the dry and wet state adhesion are interpreted as indicating that dry state adhesion is optimized by minimizing unfavorable polar interactions between the basic epoxy and HT interfaces. Wet state adhesion, where polar interactions are disrupted, is dictated by non-polar bonding. FTIR

  14. Transport phenomena in Newtonian fluids a concise primer

    CERN Document Server

    Olsson, Per

    2013-01-01

    This short primer provides a concise and tutorial-style introduction to transport phenomena in Newtonian fluids , in particular the transport of mass, energy and momentum.  The reader will find detailed derivations of the transport equations for these phenomena, as well as selected analytical solutions to the transport equations in some simple geometries. After a brief introduction to the basic mathematics used in the text, Chapter 2, which deals with momentum transport, presents a derivation of the Navier-Stokes-Duhem equation describing the basic flow in a Newtonian fluid.  Also provided at

  15. Design

    Science.gov (United States)

    Buchanan, Richard; Cross, Nigel; Durling, David; Nelson, Harold; Owen, Charles; Valtonen, Anna; Boling, Elizabeth; Gibbons, Andrew; Visscher-Voerman, Irene

    2013-01-01

    Scholars representing the field of design were asked to identify what they considered to be the most exciting and imaginative work currently being done in their field, as well as how that work might change our understanding. The scholars included Richard Buchanan, Nigel Cross, David Durling, Harold Nelson, Charles Owen, and Anna Valtonen. Scholars…

  16. The social and economic burden of frontotemporal degeneration.

    Science.gov (United States)

    Galvin, James E; Howard, David H; Denny, Sharon S; Dickinson, Susan; Tatton, Nadine

    2017-11-14

    To quantify the socioeconomic burden of frontotemporal degeneration (FTD) compared to previously published data for Alzheimer disease (AD). A 250-item internet survey was administered to primary caregivers of patients with behavioral-variant FTD (bvFTD), primary progressive aphasia, FTD with motor neuron disease, corticobasal syndrome, or progressive supranuclear palsy. The survey included validated scales for disease staging, behavior, activities of daily living, caregiver burden, and health economics, as well as investigator-designed questions to capture patient and caregiver experience with FTD. The entire survey was completed by 674 of 956 respondents (70.5%). Direct costs (2016 US dollars) equaled $47,916 and indirect costs $71,737, for a total annual per-patient cost of $119,654, nearly 2 times higher than reported costs for AD. Patients ≥65 years of age, with later stages of disease, and with bvFTD correlated with higher direct costs, while patients <65 years of age and men were associated with higher indirect costs. An FTD diagnosis produced a mean decrease in household income from $75,000 to $99,000 12 months before diagnosis to $50,000 to $59,999 12 months after diagnosis, resulting from lost days of work and early departure from the workforce. The economic burden of FTD is substantial. Counting productivity-related costs, per-patient costs for FTD appear to be greater than per-patient costs reported for AD. There is a need for biomarkers for accurate and timely diagnosis, effective treatments, and services to reduce this socioeconomic burden. Copyright © 2017 The Author(s). Published by Wolters Kluwer Health, Inc. on behalf of the American Academy of Neurology.

  17. Role of ranibizumab in management of macular degeneration

    Directory of Open Access Journals (Sweden)

    Singh Rishi

    2007-01-01

    Full Text Available Age-related macular degeneration (AMD is one of the most common causes of severe vision loss in the western world. Both animal and human studies have established that vascular endothelial growth factor (VEGF plays an important role in the pathogenesis of this process. Ranibizumab (Lucentis™, Genentech, South San Francisco, CA is a monoclonal antibody fragment (Fab directed toward all isoforms of VEGF-A that was specifically designed to target wet AMD. The human antibody fragment is produced by an E. coli expression system and has a molecular weight of 48kD allowing for excellent retinal penetration. The most common ocular complaints of patients receiving ranibizumab injections in randomized clinical trials were transient conjunctival hemorrhage, vitreous floaters, intraocular inflammation, increased intraocular pressure and eye pain. The rates of serious adverse events such as retinal detachment, cataract and endophthalmitis were similar to those that have been reported with other intravitreal injections and patients should always be treated under strict aseptic conditions to reduce this risk. There were no significant non-ocular events found during any study so far and the risk of thromboembolic events was less than 4% and not different than sham. The MARINA, ANCHOR and PIER studies validated the safety and efficacy of ranibizumab amongst a large population with different choroidal neovascular membrane lesion types against sham or standard of care treatment. These studies recommended monthly intravitreal ranibizumab for patients. However, the PIER study reported that an alternative dosing of every three months is acceptable but less effective than monthly injections.

  18. Cystic degeneration of liver malignancies. Study by US and CT

    Energy Technology Data Exchange (ETDEWEB)

    Kumada, Takashi; Nakano, Satoshi; Kitamura, Kimio; Watahiki, Hajime; Takeda, Isao

    1983-03-01

    CT and US were carried out on 81 patients with hepatocellular carcinoma, 20 patients with cholangiocellular carcinoma and 94 patients with metastatic liver cancer. 1) Cystic degeneration was observed in one with hepatocellular carcinoma (1.2%), one with cholangiocellular carcinoma (5.0%) and 12 with metastatic liver cancer (12.8%) by US, but this change was observed in only 5 by CT (1,0,4, respectively). Metastatic liver cancer showed the highest incidence among these tumors. 2) The characteristics of cystic degeneration of the liver tumors were thickened wall and irregularity of the inner surface of the wall. 3) Judging from macroscopic and histopathological findings, liquefactive necrosis in the tumors was shown as ''echoluent'' area. We concluded that cystic degeneration was one of the important findings in metastatic liver cancer and that careful observation by US and CT avoided the confusion with other hepatic cystic diseases.

  19. Quantization with maximally degenerate Poisson brackets: the harmonic oscillator!

    International Nuclear Information System (INIS)

    Nutku, Yavuz

    2003-01-01

    Nambu's construction of multi-linear brackets for super-integrable systems can be thought of as degenerate Poisson brackets with a maximal set of Casimirs in their kernel. By introducing privileged coordinates in phase space these degenerate Poisson brackets are brought to the form of Heisenberg's equations. We propose a definition for constructing quantum operators for classical functions, which enables us to turn the maximally degenerate Poisson brackets into operators. They pose a set of eigenvalue problems for a new state vector. The requirement of the single-valuedness of this eigenfunction leads to quantization. The example of the harmonic oscillator is used to illustrate this general procedure for quantizing a class of maximally super-integrable systems

  20. Natural history of seminiferous tubule degeneration in Klinefelter syndrome

    DEFF Research Database (Denmark)

    Aksglaede, Lise; Wikström, Anne M; Rajpert-De Meyts, Ewa

    2006-01-01

    Klinefelter syndrome (47,XXY) is characterized by small, firm testis, gynaecomastia, azoospermia and hypergonadotropic hypogonadism. Degeneration of the seminiferous tubules in 47,XXY males is a well-described phenomenon. It begins in the fetus, progresses through infancy and accelerates dramatic......Klinefelter syndrome (47,XXY) is characterized by small, firm testis, gynaecomastia, azoospermia and hypergonadotropic hypogonadism. Degeneration of the seminiferous tubules in 47,XXY males is a well-described phenomenon. It begins in the fetus, progresses through infancy and accelerates...... summarize current knowledge on the development of the classical endocrinological and histological features of 47,XXY males from fetus to adulthood and review the literature concerning the degeneration of the seminiferous tubules in this syndrome....