WorldWideScience

Sample records for degenerate primers designed

  1. Degenerate primer design for highly variable genomes.

    Science.gov (United States)

    Li, Kelvin; Shrivastava, Susmita; Stockwell, Timothy B

    2015-01-01

    The application of degenerate PCR primers towards target amplification and sequencing is a useful technique when a population of organisms under investigation is evolving rapidly, or is highly diverse. Degenerate bases in these primers are specified with ambiguity codes that represent alternative nucleotide configurations. Degenerate PCR primers allow the simultaneous amplification of a heterogeneous population by providing a mixture of PCR primers each of which anneal to an alternative genotype found in the isolated sample. However, as the number of degenerate bases specified in a pair of primers rises, the likelihood of amplifying unwanted alternative products also increases. These alternative products may confound downstream data analyses if their levels begin to obfuscate the desired PCR products. This chapter describes a set of computational methodologies that may be used to minimize the degeneracy of designed primers, while still maximizing the proportion of genotypes assayed in the targeted population.

  2. CEMAsuite: open source degenerate PCR primer design.

    Science.gov (United States)

    Lane, Courtney E; Hulgan, Daniel; O'Quinn, Kelly; Benton, Michael G

    2015-11-15

    The codon-equivalent multiple alignment suite begins conservational analysis for polymerase chain reaction primer design at the protein level, allowing the user to design consensus primers capable of detecting homologous coding sequences even when low-to-moderate sequence information is available. This package also condenses the wealth of information associated with multiple sequence alignments and presents them in an intuitive manner, allowing the user to quickly and effectively address degenerate primer design considerations. https://sourceforge.net/projects/cemasuite/. benton@lsu.edu or cemasuite@gmail.com Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  3. Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing

    Directory of Open Access Journals (Sweden)

    Li Kelvin

    2012-11-01

    Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus

  4. Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing.

    Science.gov (United States)

    Li, Kelvin; Shrivastava, Susmita; Brownley, Anushka; Katzel, Dan; Bera, Jayati; Nguyen, Anh Thu; Thovarai, Vishal; Halpin, Rebecca; Stockwell, Timothy B

    2012-11-06

    In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute's (JCVI) high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus sequence that encapsulates the allelic variation of the targeted

  5. Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes

    Directory of Open Access Journals (Sweden)

    Shea N. Gardner

    2014-01-01

    Full Text Available Background. Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results. A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus. Each group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions. This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family.

  6. Design and implementation of degenerate microsatellite primers for the mammalian clade.

    Directory of Open Access Journals (Sweden)

    Emmanuel Buschiazzo

    Full Text Available Microsatellites are popular genetic markers in molecular ecology, genetic mapping and forensics. Unfortunately, despite recent advances, the isolation of de novo polymorphic microsatellite loci often requires expensive and intensive groundwork. Primers developed for a focal species are commonly tested in a related, non-focal species of interest for the amplification of orthologous polymorphic loci; when successful, this approach significantly reduces cost and time of microsatellite development. However, transferability of polymorphic microsatellite loci decreases rapidly with increasing evolutionary distance, and this approach has shown its limits. Whole genome sequences represent an under-exploited resource to develop cross-species primers for microsatellites. Here we describe a three-step method that combines a novel in silico pipeline that we use to (1 identify conserved microsatellite loci from a multiple genome alignments, (2 design degenerate primer pairs, with (3 a simple PCR protocol used to implement these primers across species. Using this approach we developed a set of primers for the mammalian clade. We found 126,306 human microsatellites conserved in mammalian aligned sequences, and isolated 5,596 loci using criteria based on wide conservation. From a random subset of ~1000 dinucleotide repeats, we designed degenerate primer pairs for 19 loci, of which five produced polymorphic fragments in up to 18 mammalian species, including the distinctly related marsupials and monotremes, groups that diverged from other mammals 120-160 million years ago. Using our method, many more cross-clade microsatellite loci can be harvested from the currently available genomic data, and this ability is set to improve exponentially as further genomes are sequenced.

  7. Degenerate PCR primer design for the specific identification of rhinovirus C.

    Science.gov (United States)

    Nam, Young Ran; Lee, Uk; Choi, Han Seok; Lee, Kyoung Jin; Kim, Nari; Jang, Yong Ju; Joo, Chul Hyun

    2015-03-01

    Human rhinovirus (HRV)-A and -B is a common cause of upper respiratory tract infections. Recently, a third species, HRV-C, was categorized based on molecular typing studies. The results showed that the HRV-C genome had diverged from that of HRV-A and -B. Despite its late identification, increasing evidence suggests that HRV-C causes more severe pathogenic infections than HRV-A or -B; however, a large amount of epidemiological data is required to confirm this association in different clinical settings. Consequently, a simple and rapid method for identifying HRV-C is required to expedite such epidemiological studies. Here, two degenerate primer sets (HEV and HRVC) were designed based on bioinformatic analyses. The HEV set targeting the fifth IRES domain sequence within the 5'-UTR, which is highly conserved among enteroviruses, was designed to detect all enteroviruses, whereas the HRVC set, which targeted the VP2 coding region, was designed to detect HRV-C alone. Both primer sets were tested against a panel of standard enteroviruses and clinical lavage samples. HEV detected all enteroviruses tested whereas HRVC was specific for HRV-C. Although the primer design strategy was confirmed with a limited number of samples, extensive tests are required to be applied in clinical settings. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. Quantitative PCR measurements of the effects of introducing inosines into primers provides guidelines for improved degenerate primer design.

    Science.gov (United States)

    Zheng, Linda; Gibbs, Mark J; Rodoni, Brendan C

    2008-11-01

    Polymerase chain reaction (PCR) is used to detect groups of viruses with the use of group-specific degenerate primers. Inosine residues are sometimes used in the primers to match variable positions within the complementary target sequences, but there is little data on their effects on cDNA synthesis and amplification. A quantitative reverse-transcription PCR was used to measure the rate of amplification with primers containing inosine residues substituted at different positions and in increasing numbers. Experiments were conducted using standard quantities of cloned DNA copied from Potato virus Y genomic RNA and RNA (cRNA) transcribed from the cloned DNA. Single inosine residues had no affect on the amplification rate in the forward primer, except at one position close to the 3' terminus. Conversely, single inosine residues significantly reduced the amplification rate when placed at three out of four positions in the reverse primer. Four or five inosine substitutions could be tolerated with some decline in rates, but amplification often failed from cRNA templates with primers containing larger numbers of inosines. Greater declines in the rate of amplification were observed with RNA templates, suggesting that reverse transcription suffers more than PCR amplification when inosine is included in the reverse primer.

  9. DegePrime, a program for degenerate primer design for broad-taxonomic-range PCR in microbial ecology studies.

    Science.gov (United States)

    Hugerth, Luisa W; Wefer, Hugo A; Lundin, Sverker; Jakobsson, Hedvig E; Lindberg, Mathilda; Rodin, Sandra; Engstrand, Lars; Andersson, Anders F

    2014-08-01

    The taxonomic composition of a microbial community can be deduced by analyzing its rRNA gene content by, e.g., high-throughput DNA sequencing or DNA chips. Such methods typically are based on PCR amplification of rRNA gene sequences using broad-taxonomic-range PCR primers. In these analyses, the use of optimal primers is crucial for achieving an unbiased representation of community composition. Here, we present the computer program DegePrime that, for each position of a multiple sequence alignment, finds a degenerate oligomer of as high coverage as possible and outputs its coverage among taxonomic divisions. We show that our novel heuristic, which we call weighted randomized combination, performs better than previously described algorithms for solving the maximum coverage degenerate primer design problem. We previously used DegePrime to design a broad-taxonomic-range primer pair that targets the bacterial V3-V4 region (341F-805R) (D. P. Herlemann, M. Labrenz, K. Jurgens, S. Bertilsson, J. J. Waniek, and A. F. Andersson, ISME J. 5:1571-1579, 2011, http://dx.doi.org/10.1038/ismej.2011.41), and here we use the program to significantly increase the coverage of a primer pair (515F-806R) widely used for Illumina-based surveys of bacterial and archaeal diversity. By comparison with shotgun metagenomics, we show that the primers give an accurate representation of microbial diversity in natural samples. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  10. DNA sequencing by synthesis with degenerate primers

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    The degenerate primer-based sequencing Was developed by a synthesis method(DP-SBS)for high-throughput DNA sequencing,in which a set of degenerate primers are hybridized on the arrayed DNA templates and extended by DNA polymerase on microarrays.In this method,adifferent set of degenerate primers containing a give nnumber(n)of degenerate nucleotides at the 3'-ends were annealed to the sequenced templates that were immobilized on the solid surface.The nucleotides(n+1)on the template sequences were determined by detecting the incorporation of fluorescent labeled nucleotides.The fluorescent labeled nucleotide was incorporated into the primer in a base-specific manner after the enzymatic primer extension reactions and nine-base length were read out accurately.The main advanmge of the DP-SBS is that the method only uses very conventional biochemical reagents and avoids the complicated special chemical reagents for removing the labeled nucleotides and reactivating the primer for further extension.From the present study,it is found that the DP-SBS method is reliable,simple,and cost-effective for laboratory-sequencing a large amount of short DNA fragments.

  11. PCR Amplicon Prediction from Multiplex Degenerate Primer and Probe Sets

    Energy Technology Data Exchange (ETDEWEB)

    2013-08-08

    Assessing primer specificity and predicting both desired and off-target amplification products is an essential step for robust PCR assay design. Code is described to predict potential polymerase chain reaction (PCR) amplicons in a large sequence database such as NCBI nt from either singleplex or a large multiplexed set of primers, allowing degenerate primer and probe bases, with target mismatch annotates amplicons with gene information automatically downloaded from NCBI, and optionally it can predict whether there are also TaqMan/Luminex probe matches within predicted amplicons.

  12. CODEHOP PCR and CODEHOP PCR primer design.

    Science.gov (United States)

    Staheli, Jeannette P; Boyce, Richard; Kovarik, Dina; Rose, Timothy M

    2011-01-01

    While PCR primer design for the amplification of known sequences is usually quite straightforward, the design, and successful application of primers aimed at the detection of as yet unknown genes is often not. The search for genes that are presumed to be distantly related to a known gene sequence, such as homologous genes in different species, paralogs in the same genome, or novel pathogens in diverse hosts, often turns into the proverbial search for the needle in the haystack. PCR-based methods commonly used to address this issue involve the use of either consensus primers or degenerate primers, both of which have significant shortcomings regarding sensitivity and specificity. We have developed a novel primer design approach that diminishes these shortcomings and instead takes advantage of the strengths of both consensus and degenerate primer designs, by combining the two concepts into a Consensus-Degenerate Hybrid Oligonucleotide Primer (CODEHOP) approach. CODEHOP PCR primers contain a relatively short degenerate 3' core and a 5' nondegenerate clamp. The 3' degenerate core consists of a pool of primers containing all possible codons for a 3-4 aminoacid motif that is highly conserved in multiply aligned sequences from known members of a protein family. Each primer in the pool also contains a single 5' nondegenerate nucleotide sequence derived from a codon consensus across the aligned aminoacid sequences flanking the conserved motif. During the initial PCR amplification cycles, the degenerate core is responsible for specific binding to sequences encoding the conserved aminoacid motif. The longer consensus clamp region serves to stabilize the primer and allows the participation of all primers in the pool in the efficient amplification of products during later PCR cycles. We have developed an interactive web site and algorithm (iCODEHOP) for designing CODEHOP PCR primers from multiply aligned protein sequences, which is freely available online. Here, we describe the

  13. Cloning of hog1 gene fragment from Dunalilla salina using CODEHOP-designed degenerate primers%用CODEHOP设计简并引物克隆杜氏盐藻hog1基因片段

    Institute of Scientific and Technical Information of China (English)

    王传胜; 蒋彦

    2012-01-01

    根据NCBI上已经报道的hog1序列,利用简并引物在线设计工具CODEHOP设计出两对简并引物,通过巢式PCR扩增,得到一段大小为635 bp的基因片段,将其克隆到T载体上并测序,将测得的序列在NCBI的Blast搜索发现,其与已报道的其他一些物种的hog1基因有同源性.用CODEHOP程序化设计简并引物可信性强,阳性率高.该基因的成功克隆为研究杜氏盐藻的HOG信号途径奠定了基础.%According to the published sequence of hogl from NCBI database, we designed the degenerate primers of hogl using CODEHOP software. Using these degenerate primers, a partial hogl cDNA of 635bp was amplified from Dunalilla salina and cloned into T vector. Sequence analysis showed that the cloned hogl shares high sequence identity to those of hogl from other species. The results indicated that the degenerate primers designed by the CODEHOP could be used to amplify specific gene fragment. Clo ning of hogl gene fragment would be helpful to further characterize the HOG signaling pathway of Dunalilla salina.

  14. Explanatory chapter: PCR primer design.

    Science.gov (United States)

    Álvarez-Fernández, Rubén

    2013-01-01

    This chapter is intended as a guide on polymerase chain reaction (PCR) primer design (for information on PCR, see General PCR and Explanatory Chapter: Troubleshooting PCR). In the next section, general guidelines will be provided, followed by a discussion on primer design for specific applications. A list of recommended software tools is shown at the end. Copyright © 2013 Elsevier Inc. All rights reserved.

  15. EasyExonPrimer: automated primer design for exon sequences.

    Science.gov (United States)

    Wu, Xiaolin; Munroe, David J

    2006-01-01

    EasyExonPrimer is a web-based software that automates the design of PCR primers to amplify exon sequences from genomic DNA. EasyExonPrimer is written in Perl and uses Primer3 to design PCR primers based on the genome builds and annotation databases available at the University of California, Santa Cruz (UCSC) Genome Browser database (http://genome.ucsc.edu/). It masks repeats and known single nucleotide polymorphism (SNP) sites in the genome and designs standardised primers using optimised conditions. Users can input genes by RefSeq mRNA ID, gene name or keyword. The primer design is optimised for large-scale resequencing of exons. For exons larger than 1 kb, the user has the option of breaking the exon sequence down into overlapping smaller fragments. All primer pairs are then verified using the In-Silico PCR software to test for uniqueness in the genome. We have designed >1000 pairs of primers for 90 genes; 95% of the primer pairs successfully amplified exon sequences under standard PCR conditions without requiring further optimisation. EasyExonPrimer is available from http://129.43.22.27/~primer/. The source code is also available upon request. Xiaolin Wu (forestwu@mail.nih.gov).

  16. A coilgun design primer

    Energy Technology Data Exchange (ETDEWEB)

    Marder, B.

    1991-01-01

    This paper explains how an induction coilgun works and presents the factors which go into its design. Our purpose is to obtain algebraic expressions which, although crude, provide useful predictors of behavior, illustrate the dependence on various parameters, and suggest ways to optimize the design. Detailed prediction of the gun's behavior can be obtained from simulation codes, such as SLINGSHOT.

  17. A coilgun design primer

    Energy Technology Data Exchange (ETDEWEB)

    Marder, B.

    1991-12-31

    This paper explains how an induction coilgun works and presents the factors which go into its design. Our purpose is to obtain algebraic expressions which, although crude, provide useful predictors of behavior, illustrate the dependence on various parameters, and suggest ways to optimize the design. Detailed prediction of the gun`s behavior can be obtained from simulation codes, such as SLINGSHOT.

  18. A coilgun design primer

    Science.gov (United States)

    Marder, B.

    How an induction coilgun works is explained, and the factors which go into its design are presented. Our purpose is to obtain algebraic expressions which, although crude, provide useful predictors of behavior, illustrate the dependence on various parameters, and suggest ways to optimize the design. Detailed prediction of the gun's behavior can be obtained from simulation codes, such as SLINGSHOT.

  19. Generation of polymerase chain reaction-specific probes for library screening using single degenerate primers.

    Science.gov (United States)

    Hommes, N G; Arp, D J; Sayavedra-Soto, L A

    1995-03-01

    Degenerate oligonucleotide primers were made to peptide sequences from hydroxylamine oxidoreductase (HAO) from Nitrosomonas europaea. The primers were used singly in PCR reactions to amplify portions of the gene for HAO from genomic DNA. Southern hybridizations using fragments amplified with each primer showed that they labeled the same genomic DNA fragments. The PCR-amplified fragments were successfully used to screen a gene library for clones containing the HAO gene. The method of isolating genes by PCR with single primers has general utility.

  20. A degenerate pair of primers for simultaneous detection of four alpha- and betanecroviruses.

    Science.gov (United States)

    Varanda, C M R; Cardoso, J M S; Oliveira, M D M; Oliveira, S; Clara, M I E; Félix, M R F

    2014-11-01

    The high infection levels due to Olive latent virus 1 (OLV-1), Olive mild mosaic virus (OMMV) (alphanecrovirus) and Tobacco necrosis virus D (TNV-D) (betanecrovirus) in Portuguese olive orchards prompted us to develop a rapid PCR-based assay for the simultaneous detection of these viruses aimed at the sanitary selection and marketing of plant material in compliance with European Union regulations. A pair of degenerate oligonucleotide primers, parRdRp5' and parCoat3' was designed based on conserved regions located in the RNA-dependent RNA polymerase (RdRp) and coat protein (CP) genes of these viruses and one other alphanecrovirus, Tobacco necrosis virus A. Its use in RT-PCR assays generated a product of ca. 2000 bp for the 4 viral species tested. These primers were compared with virus specific primers in multiplex RT-PCR, and identical results were obtained. Its application to dsRNA extracted from 54 olive field growing trees originated the expected ca. 2000 bp amplicon in 17 trees. The virus identity was determined by sequencing the cloned RT-PCR products. No TNV-A was found. The RT-PCR assay using the degenerate primers described in this study were shown to be reliable in detecting any of the above-mentioned alpha- and betanecroviruses, and it is as sensitive as that which uses virus specific primers in multiplex assays. Therefore, this assay is well suited for the rapid screen of virus-free plant material in selection and improvement crop programmes. Additionally, it has the potential to reveal virus diversity and the presence of new viruses, provided the RT-PCR generated amplicon is further sequenced.

  1. Design and experimental application of a novel non-degenerate universal primer set that amplifies prokaryotic 16S rRNA genes with a low possibility to amplify eukaryotic rRNA genes.

    Science.gov (United States)

    Mori, Hiroshi; Maruyama, Fumito; Kato, Hiromi; Toyoda, Atsushi; Dozono, Ayumi; Ohtsubo, Yoshiyuki; Nagata, Yuji; Fujiyama, Asao; Tsuda, Masataka; Kurokawa, Ken

    2014-01-01

    The deep sequencing of 16S rRNA genes amplified by universal primers has revolutionized our understanding of microbial communities by allowing the characterization of the diversity of the uncultured majority. However, some universal primers also amplify eukaryotic rRNA genes, leading to a decrease in the efficiency of sequencing of prokaryotic 16S rRNA genes with possible mischaracterization of the diversity in the microbial community. In this study, we compared 16S rRNA gene sequences from genome-sequenced strains and identified candidates for non-degenerate universal primers that could be used for the amplification of prokaryotic 16S rRNA genes. The 50 identified candidates were investigated to calculate their coverage for prokaryotic and eukaryotic rRNA genes, including those from uncultured taxa and eukaryotic organelles, and a novel universal primer set, 342F-806R, covering many prokaryotic, but not eukaryotic, rRNA genes was identified. This primer set was validated by the amplification of 16S rRNA genes from a soil metagenomic sample and subsequent pyrosequencing using the Roche 454 platform. The same sample was also used for pyrosequencing of the amplicons by employing a commonly used primer set, 338F-533R, and for shotgun metagenomic sequencing using the Illumina platform. Our comparison of the taxonomic compositions inferred by the three sequencing experiments indicated that the non-degenerate 342F-806R primer set can characterize the taxonomic composition of the microbial community without substantial bias, and is highly expected to be applicable to the analysis of a wide variety of microbial communities.

  2. GPUDePiCt: A Parallel Implementation of a Clustering Algorithm for Computing Degenerate Primers on Graphics Processing Units.

    Science.gov (United States)

    Cickovski, Trevor; Flor, Tiffany; Irving-Sachs, Galen; Novikov, Philip; Parda, James; Narasimhan, Giri

    2015-01-01

    In order to make multiple copies of a target sequence in the laboratory, the technique of Polymerase Chain Reaction (PCR) requires the design of "primers", which are short fragments of nucleotides complementary to the flanking regions of the target sequence. If the same primer is to amplify multiple closely related target sequences, then it is necessary to make the primers "degenerate", which would allow it to hybridize to target sequences with a limited amount of variability that may have been caused by mutations. However, the PCR technique can only allow a limited amount of degeneracy, and therefore the design of degenerate primers requires the identification of reasonably well-conserved regions in the input sequences. We take an existing algorithm for designing degenerate primers that is based on clustering and parallelize it in a web-accessible software package GPUDePiCt, using a shared memory model and the computing power of Graphics Processing Units (GPUs). We test our implementation on large sets of aligned sequences from the human genome and show a multi-fold speedup for clustering using our hybrid GPU/CPU implementation over a pure CPU approach for these sequences, which consist of more than 7,500 nucleotides. We also demonstrate that this speedup is consistent over larger numbers and longer lengths of aligned sequences.

  3. MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling

    Directory of Open Access Journals (Sweden)

    Kitchen James L

    2012-11-01

    Full Text Available Abstract Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  4. MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.

    Science.gov (United States)

    Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G

    2012-11-05

    Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  5. Neuraminidase subtyping of avian influenza viruses with PrimerHunter-designed primers and quadruplicate primer pools.

    Science.gov (United States)

    Huang, Yanyan; Khan, Mazhar I; Khan, Mazhar; Măndoiu, Ion; Măndoiu, Ion I

    2013-01-01

    We have previously developed a software package called PrimerHunter to design primers for PCR-based virus subtyping. In this study, 9 pairs of primers were designed with PrimerHunter and successfully used to differentiate the 9 neuraminidase (NA) genes of avian influenza viruses (AIVs) in multiple PCR-based assays. Furthermore, primer pools were designed and successfully used to decrease the number of reactions needed for NA subtyping from 9 to 4. The quadruplicate primer-pool method is cost-saving, and was shown to be suitable for the NA subtyping of both cultured AIVs and uncultured AIV swab samples. The primers selected for this study showed excellent sensitivity and specificity in NA subtyping by RT-PCR, SYBR green-based Real-time PCR and Real-time RT-PCR methods. AIV RNA of 2 to 200 copies (varied by NA subtypes) could be detected by these reactions. No unspecific amplification was displayed when detecting RNAs of other avian infectious viruses such as Infectious bronchitis virus, Infectious bursal disease virus and Newcastle disease virus. In summary, this study introduced several sensitive and specific PCR-based assays for NA subtyping of AIVs and also validated again the effectiveness of the PrimerHunter tool for the design of subtyping primers.

  6. BatchPrimer3: a high throughput web application for PCR and sequencing primer design.

    Science.gov (United States)

    You, Frank M; Huo, Naxin; Gu, Yong Qiang; Luo, Ming-Cheng; Ma, Yaqin; Hane, Dave; Lazo, Gerard R; Dvorak, Jan; Anderson, Olin D

    2008-05-29

    Microsatellite (simple sequence repeat - SSR) and single nucleotide polymorphism (SNP) markers are two types of important genetic markers useful in genetic mapping and genotyping. Often, large-scale genomic research projects require high-throughput computer-assisted primer design. Numerous such web-based or standard-alone programs for PCR primer design are available but vary in quality and functionality. In particular, most programs lack batch primer design capability. Such a high-throughput software tool for designing SSR flanking primers and SNP genotyping primers is increasingly demanded. A new web primer design program, BatchPrimer3, is developed based on Primer3. BatchPrimer3 adopted the Primer3 core program as a major primer design engine to choose the best primer pairs. A new score-based primer picking module is incorporated into BatchPrimer3 and used to pick position-restricted primers. BatchPrimer3 v1.0 implements several types of primer designs including generic primers, SSR primers together with SSR detection, and SNP genotyping primers (including single-base extension primers, allele-specific primers, and tetra-primers for tetra-primer ARMS PCR), as well as DNA sequencing primers. DNA sequences in FASTA format can be batch read into the program. The basic information of input sequences, as a reference of parameter setting of primer design, can be obtained by pre-analysis of sequences. The input sequences can be pre-processed and masked to exclude and/or include specific regions, or set targets for different primer design purposes as in Primer3Web and primer3Plus. A tab-delimited or Excel-formatted primer output also greatly facilitates the subsequent primer-ordering process. Thousands of primers, including wheat conserved intron-flanking primers, wheat genome-specific SNP genotyping primers, and Brachypodium SSR flanking primers in several genome projects have been designed using the program and validated in several laboratories. BatchPrimer3 is a

  7. URPD: a specific product primer design tool.

    Science.gov (United States)

    Chuang, Li-Yeh; Cheng, Yu-Huei; Yang, Cheng-Hong

    2012-06-19

    Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/.

  8. In silico PCR primer designing and validation.

    Science.gov (United States)

    Kumar, Anil; Chordia, Nikita

    2015-01-01

    Polymerase chain reaction (PCR) is an enzymatic reaction whose efficiency and sensitivity largely depend on the efficiency of the primers that are used for the amplification of a concerned gene/DNA fragment. Selective amplification of nucleic acid molecules initially present in minute quantities provides a powerful tool for analyzing nucleic acids. In silico method helps in designing primers. There are various programs available for PCR primer design. Here we described designing of primers using web-based tools like "Primer3" and "Web Primer". For designing the primer, DNA template sequence is required that can be taken from any of the available sequence databases, e.g., RefSeq database. The in silico validation can be carried out using BLAST tool and Gene Runner software, which check their efficiency and specificity. Thereafter, the primers designed in silico can be validated in the wet lab. After that, these validated primers can be synthesized for use in the amplification of concerned gene/DNA fragment.

  9. Methods for detection and differentiation of existing and new crinivirus species through multiplex and degenerate primer RT-PCR.

    Science.gov (United States)

    Wintermantel, William M; Hladky, Laura L

    2010-12-01

    A method was developed for rapid identification and differentiation of both known and novel crinivirus species involving both multiplex and degenerate reverse transcription-polymerase chain reaction (RT-PCR). The multiplex method can discriminate among known criniviruses infecting vegetable and small fruit crops, and rapidly identify viruses associated with disease symptoms, as well as identification of mixed crinivirus infections. Four host groups for multiplex detection of criniviruses were selected based on the types of crops where specific criniviruses would be expected to occur. Each detection group contained three to four crop-specific primers designed to the same region of the gene encoding the highly conserved RNA-dependent RNA polymerase gene (RdRp) of criniviruses for rapid, single-reaction determination of which crinivirus(es) may be infecting a plant. Degenerate reverse primers used for RT and in PCR were designed to amplify all members of each host group, and were coupled with species-specific forward primers resulting in four separate single-reaction cocktails for detection of most criniviruses sequenced to date, whether present in single or mixed virus infections. Additional viruses can be added to multiplex detection by adjustment of primer concentration for balanced detection of target viruses. In order to identify unknown putative criniviruses or those for which sequence information is not yet available, a genus-wide, universal degenerate primer set was developed. These primers also targeted the crinivirus RdRp gene, and amplify a wide range of crinivirus sequences. Both detection systems can be used with most RNA extraction methods, and with RT-PCR reagents common in most laboratories.

  10. AMPLIFICATION OF AZOSPIRILLUM SP. JG3 GLPD GENE FRAGMENT USING DEGENERATE PRIMERS GENERATED BY WEB-BASED TOOLS

    Directory of Open Access Journals (Sweden)

    Stalis Norma Ethica

    2013-12-01

    Full Text Available Primaclade and In Silico web-based tools were used as a strategy to obtain the correct-size PCR amplicon targeting a fragment of gene encoding glycerol-3-phosphate dehydrogenase (glpD of Azospirillum sp. JG3. The bacterial strains are soil, Gram-negative PGPR (Plant-Growth Promoting Rhizobacteria isolated from an agricultural land in Purwokerto, Central Java, Indonesia, which have ability to produce several commercial enzymes. The aim is to obtain a pair of reliable degenerate primers from a limited number of glpD sequences from other Azospirilla retrieved in GenBank using bioinformatics approach. We demonstrated degenerate primer design that led to successful PCR amplification corresponding to the targeted DNA fragment. Homology analysis showed that the obtained DNA fragment is 61% and 99% similar to sn-glycerol-3-phosphate dehydrogenase genes of Azospirillum brasilense and Stenotrophomonas maltophili respectively.

  11. A thermodynamic approach to PCR primer design.

    Science.gov (United States)

    Mann, Tobias; Humbert, Richard; Dorschner, Michael; Stamatoyannopoulos, John; Noble, William Stafford

    2009-07-01

    We developed a primer design method, Pythia, in which state of the art DNA binding affinity computations are directly integrated into the primer design process. We use chemical reaction equilibrium analysis to integrate multiple binding energy calculations into a conservative measure of polymerase chain reaction (PCR) efficiency, and a precomputed index on genomic sequences to evaluate primer specificity. We show that Pythia can design primers with success rates comparable with those of current methods, but yields much higher coverage in difficult genomic regions. For example, in RepeatMasked sequences in the human genome, Pythia achieved a median coverage of 89% as compared with a median coverage of 51% for Primer3. For parameter settings yielding sensitivities of 81%, our method has a recall of 97%, compared with the Primer3 recall of 48%. Because our primer design approach is based on the chemistry of DNA interactions, it has fewer and more physically meaningful parameters than current methods, and is therefore easier to adjust to specific experimental requirements. Our software is freely available at http://pythia.sourceforge.net.

  12. Degenerate primer MOB typing of multiresistant clinical isolates of E. coli uncovers new plasmid backbones.

    Science.gov (United States)

    Garcillán-Barcia, M Pilar; Ruiz del Castillo, Belén; Alvarado, Andrés; de la Cruz, Fernando; Martínez-Martínez, Luis

    2015-01-01

    Degenerate Primer MOB Typing is a PCR-based protocol for the classification of γ-proteobacterial transmissible plasmids in five phylogenetic relaxase MOB families. It was applied to a multiresistant E. coli collection, previously characterized by PCR-based replicon-typing, in order to compare both methods. Plasmids from 32 clinical isolates of multiresistant E. coli (19 extended spectrum beta-lactamase producers and 13 non producers) and their transconjugants were analyzed. A total of 95 relaxases were detected, at least one per isolate, underscoring the high potential of these strains for antibiotic-resistance transmission. MOBP12 and MOBF12 plasmids were the most abundant. Most MOB subfamilies detected were present in both subsets of the collection, indicating a shared mobilome among multiresistant E. coli. The plasmid profile obtained by both methods was compared, which provided useful data upon which decisions related to the implementation of detection methods in the clinic could be based. The phylogenetic depth at which replicon and MOB-typing classify plasmids is different. While replicon-typing aims at plasmid replication regions with non-degenerate primers, MOB-typing classifies plasmids into relaxase subfamilies using degenerate primers. As a result, MOB-typing provides a deeper phylogenetic depth than replicon-typing and new plasmid groups are uncovered. Significantly, MOB typing identified 17 plasmids and an integrative and conjugative element, which were not detected by replicon-typing. Four of these backbones were different from previously reported elements.

  13. Specific primer design for the polymerase chain reaction.

    Science.gov (United States)

    Chuang, Li-Yeh; Cheng, Yu-Huei; Yang, Cheng-Hong

    2013-10-01

    The design of primers has a major impact on the success of PCR in relation to the specificity and yield of the amplified product. Here, we introduce the applications of PCR as well as the definition and characteristics for PCR primer design. Recent primer design tools based on Primer3, along with several computational intelligence-based primer design methods which have been applied in primer design, are also reviewed. In addition, characteristics of population-based methods used in primer design are discussed in detail.

  14. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

    Directory of Open Access Journals (Sweden)

    Nomin Batnyam

    2012-01-01

    Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.

  15. Internet Primer: Workshop Design and Objectives.

    Science.gov (United States)

    Laverty, Corinne Y. C.

    1996-01-01

    Outlines the design, objectives, and evaluation of an introductory Internet workshop offered with library instruction classes in an electronic classroom at Queens University (Kingston, Ontario, Canada). Presents teaching tips and frequently-asked questions. The Internet primer handouts are appended. (AEF)

  16. Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction.

    Science.gov (United States)

    Ye, Jian; Coulouris, George; Zaretskaya, Irena; Cutcutache, Ioana; Rozen, Steve; Madden, Thomas L

    2012-06-18

    Choosing appropriate primers is probably the single most important factor affecting the polymerase chain reaction (PCR). Specific amplification of the intended target requires that primers do not have matches to other targets in certain orientations and within certain distances that allow undesired amplification. The process of designing specific primers typically involves two stages. First, the primers flanking regions of interest are generated either manually or using software tools; then they are searched against an appropriate nucleotide sequence database using tools such as BLAST to examine the potential targets. However, the latter is not an easy process as one needs to examine many details between primers and targets, such as the number and the positions of matched bases, the primer orientations and distance between forward and reverse primers. The complexity of such analysis usually makes this a time-consuming and very difficult task for users, especially when the primers have a large number of hits. Furthermore, although the BLAST program has been widely used for primer target detection, it is in fact not an ideal tool for this purpose as BLAST is a local alignment algorithm and does not necessarily return complete match information over the entire primer range. We present a new software tool called Primer-BLAST to alleviate the difficulty in designing target-specific primers. This tool combines BLAST with a global alignment algorithm to ensure a full primer-target alignment and is sensitive enough to detect targets that have a significant number of mismatches to primers. Primer-BLAST allows users to design new target-specific primers in one step as well as to check the specificity of pre-existing primers. Primer-BLAST also supports placing primers based on exon/intron locations and excluding single nucleotide polymorphism (SNP) sites in primers. We describe a robust and fully implemented general purpose primer design tool that designs target-specific PCR

  17. PrimerDesign-M: a multiple-alignment based multiple-primer design tool for walking across variable genomes.

    Science.gov (United States)

    Yoon, Hyejin; Leitner, Thomas

    2015-05-01

    Analyses of entire viral genomes or mtDNA requires comprehensive design of many primers across their genomes. Furthermore, simultaneous optimization of several DNA primer design criteria may improve overall experimental efficiency and downstream bioinformatic processing. To achieve these goals, we developed PrimerDesign-M. It includes several options for multiple-primer design, allowing researchers to efficiently design walking primers that cover long DNA targets, such as entire HIV-1 genomes, and that optimizes primers simultaneously informed by genetic diversity in multiple alignments and experimental design constraints given by the user. PrimerDesign-M can also design primers that include DNA barcodes and minimize primer dimerization. PrimerDesign-M finds optimal primers for highly variable DNA targets and facilitates design flexibility by suggesting alternative designs to adapt to experimental conditions. PrimerDesign-M is available as a webtool at http://www.hiv.lanl.gov/content/sequence/PRIMER_DESIGN/primer_design.html tkl@lanl.gov or seq-info@lanl.gov. Published by Oxford University Press 2014. This work is written by US Government employees and is in the public domain in the US.

  18. A multiple-alignment based primer design algorithm for genetically highly variable DNA targets.

    Science.gov (United States)

    Brodin, Johanna; Krishnamoorthy, Mohan; Athreya, Gayathri; Fischer, Will; Hraber, Peter; Gleasner, Cheryl; Green, Lance; Korber, Bette; Leitner, Thomas

    2013-08-21

    Primer design for highly variable DNA sequences is difficult, and experimental success requires attention to many interacting constraints. The advent of next-generation sequencing methods allows the investigation of rare variants otherwise hidden deep in large populations, but requires attention to population diversity and primer localization in relatively conserved regions, in addition to recognized constraints typically considered in primer design. Design constraints include degenerate sites to maximize population coverage, matching of melting temperatures, optimizing de novo sequence length, finding optimal bio-barcodes to allow efficient downstream analyses, and minimizing risk of dimerization. To facilitate primer design addressing these and other constraints, we created a novel computer program (PrimerDesign) that automates this complex procedure. We show its powers and limitations and give examples of successful designs for the analysis of HIV-1 populations. PrimerDesign is useful for researchers who want to design DNA primers and probes for analyzing highly variable DNA populations. It can be used to design primers for PCR, RT-PCR, Sanger sequencing, next-generation sequencing, and other experimental protocols targeting highly variable DNA samples.

  19. 利用抑制性 PCR 提高兼并引物扩增效率及特异性%Enhance the Amplification Efficiency and Specificity of Degenerate Primers wi th Suppression PCR

    Institute of Scientific and Technical Information of China (English)

    朱晓静; 戴忠敏

    2015-01-01

    To enhance the specificity and efficiency of degenerate primer PCR , the design of degenerate primer was improved ,adaptor sequences were added to the degenerate primer to prolong it .And a DNA fragment of a novel polyketide synthase gene was obtained by this method ,which indicates that suppression PCR can be used to enhance the amplification efficiency and specificity of the degenerate primer .%为提高兼并引物PCR的特异性和扩增效率,改进了兼并引物的设计,在兼并引物上加入接头序列,使其延长,并利用该方法成功获得了一个新的聚酮类合成酶的基因片段,表明抑制性 PCR能够提高兼并引物扩增的效率及特异性。

  20. PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection.

    Science.gov (United States)

    O'Halloran, Damien M

    2016-02-08

    Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction.

  1. PHUSER (Primer Help for USER): a novel tool for USER fusion primer design

    DEFF Research Database (Denmark)

    Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads

    2011-01-01

    Uracil-Specific Exision Reagent (USER) fusion is a recently developed technique that allows for assembly of multiple DNA fragments in a few simple steps. However, designing primers for USER fusion is both tedious and time consuming. Here, we present the Primer Help for USER (PHUSER) software......, a novel tool for designing primers specifically for USER fusion and USER cloning applications. We also present proof-of-concept experimental validation of its functionality. PHUSER offers quick and easy design of PCR optimized primers ensuring directionally correct fusion of fragments into a plasmid...... containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (Tm), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers...

  2. CRISPR Primer Designer:Design primers for knockout and chromosome imaging CRISPR-Cas system

    Institute of Scientific and Technical Information of China (English)

    Meng Yan; Shi-Rong Zhou; Hong-Wei Xue

    2015-01-01

    The clustered regularly interspaced short palin-dromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especial y the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran local y and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were stil no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs local y and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system.

  3. CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

    Science.gov (United States)

    Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

    2015-07-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.

  4. PRISE (PRImer SElector): software for designing sequence-selective PCR primers.

    Science.gov (United States)

    Fu, Qi; Ruegger, Paul; Bent, Elizabeth; Chrobak, Marek; Borneman, James

    2008-03-01

    This report presents PRImer Selector (PRISE), a new software package that implements several features that improve and streamline the design of sequence-selective PCR primers. The PRISE design process involves two main steps. In the first step, target and non-target DNA sequences are identified. In the second step, primers are designed to amplify target (but not non-target) sequences. One important feature of PRISE is that it automates the task of placing primer-template mismatches at the 3' end of the primers - a property that is crucial for sequence selectivity. Once a list of candidate primers has been produced, sorting tools in PRISE speed up the selection process by allowing a user to sort the primers by properties such as amplicon length, GC content and sequence selectivity. PRISE can be used to design primers with a range of specificities, targeting individual sequences as well as diverse assemblages of genes. PRISE also allows user-defined primers to be analyzed, enabling their properties to be examined in relation to target and non-target sequences. The utility of PRISE was demonstrated by using it to design sequence-selective PCR primers for an rRNA gene from the fungus Pochonia chlamydosporia.

  5. Primer design versus PCR bias in methylation independent PCR amplifications.

    Science.gov (United States)

    Wojdacz, Tomasz K; Borgbo, Tanni; Hansen, Lise Lotte

    2009-05-16

    Many protocols in methylation studies utilize one primer set to generate a PCR product from bisulfite modified template regardless of its methylation status (methylation independent amplification MIP). However, proportional amplification of methylated and unmethylated alleles is hard to achieve due to PCR bias favoring amplification of unmethylated relatively GC poor sequence. Two primer design systems have been proposed to overcome PCR bias in methylation independent amplifications. The first advises against including any CpG dinucleoteides into the primer sequence (CpG-free primers) and the second, recently published by us, is based on inclusion of a limited number of CpG sites into the primer sequence. Here we used the Methylation Sensitive High Resolution Melting (MS-HRM) technology to investigate the ability of primers designed according to both of the above mentioned primer design systems to proportionally amplify methylated and unmethylated templates. Ten "CpG-free" primer pairs and twenty primers containing limited number of CpGs were tested. In reconstruction experiments the "CpG-free" primers showed primer specific sensitivity and allowed us to detect methylation levels in the range from 5 to 50%. Whereas while using primers containing limited number of CpG sites we were able to consistently detect 1-0.1% methylation levels and effectively control PCR amplification bias. In conclusion, the primers with limited number of CpG sites are able to effectively reverse PCR bias and therefore detect methylated templates with significantly higher sensitivity than CpG free primers.

  6. RT-PCR for detecting five distinct Tospovirus species using degenerate primers and dsRNA template.

    Science.gov (United States)

    Okuda, M; Hanada, K

    2001-08-01

    RT-PCR procedures for detection of multiple species of tospovirus from plant tissues were investigated. Downstream primers were designated from the 3' untranslated sequences of the S RNA. An upstream primer was designated from the degenerated sequences of the nucleocapsid protein. Approximately 450 bp DNA fragments were detected when Tomato spotted wilt virus (TSWV)- or Impatiens necrotic spot virus (INSV)- infected tissues were examined. Approximately 350 bp DNA fragments were detected when Watermelon silver mottle virus (WSMoV)- or Melon yellow spot virus (MYSV)-infected tissues were examined. Template RNA was extracted using CF 11 cellulose powder, and nonspecific amplification became unnoticeable when double-stranded RNA was used. The amplified fragments of WSMoV were differentiated from those of MYSV by AluI or TaqI digestion. The amplified fragments of TSWV were differentiated from those of INSV by DraI or HindIII digestion. An alstroemeria plant that was infected with an unidentified tospovirus was also examined, and a 350 bp fragment that was 97% identical to Iris yellow spot virus was detected. This method, therefore, detected at least five distinct Tospovirus species.

  7. VizPrimer: a web server for visualized PCR primer design based on known gene structure.

    Science.gov (United States)

    Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

    2011-12-15

    The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.

  8. PHUSER (Primer Help for USER): a novel tool for USER fusion primer design.

    Science.gov (United States)

    Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads Tvillinggaard; Genee, Hans Jasper; Holm, Dorte Koefoed; Carlsen, Simon; Hansen, Bjarne Gram; Patil, Kiran Raosaheb; Mortensen, Uffe Hasbro; Wernersson, Rasmus

    2011-07-01

    Uracil-Specific Exision Reagent (USER) fusion is a recently developed technique that allows for assembly of multiple DNA fragments in a few simple steps. However, designing primers for USER fusion is both tedious and time consuming. Here, we present the Primer Help for USER (PHUSER) software, a novel tool for designing primers specifically for USER fusion and USER cloning applications. We also present proof-of-concept experimental validation of its functionality. PHUSER offers quick and easy design of PCR optimized primers ensuring directionally correct fusion of fragments into a plasmid containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (T(m)), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers are individually analysed in terms of GC content, presence of GC clamp at 3'-end, the risk of primer dimer formation, the risk of intra-primer complementarity (secondary structures) and the presence of polyN stretches. Furthermore, PHUSER offers the option to insert linkers between DNA fragments, as well as highly flexible cassette options. PHUSER is publicly available at http://www.cbs.dtu.dk/services/phuser/.

  9. MPprimer: a program for reliable multiplex PCR primer design.

    Science.gov (United States)

    Shen, Zhiyong; Qu, Wubin; Wang, Wen; Lu, Yiming; Wu, Yonghong; Li, Zhifeng; Hang, Xingyi; Wang, Xiaolei; Zhao, Dongsheng; Zhang, Chenggang

    2010-03-18

    Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer) in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs) for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2x to 5x plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy), which has 79 exons, for 20x, 20x, 20x, 14x, and 5x plex PCR reactions in five tubes to detect underlying exon deletions. MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

  10. MPprimer: a program for reliable multiplex PCR primer design

    Directory of Open Access Journals (Sweden)

    Wang Xiaolei

    2010-03-01

    Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

  11. Specific PCR product primer design using memetic algorithm.

    Science.gov (United States)

    Yang, Cheng-Hong; Cheng, Yu-Huei; Chuang, Li-Yeh; Chang, Hsueh-Wei

    2009-01-01

    To provide feasible primer sets for performing a polymerase chain reaction (PCR) experiment, many primer design methods have been proposed. However, the majority of these methods require a relatively long time to obtain an optimal solution since large quantities of template DNA need to be analyzed. Furthermore, the designed primer sets usually do not provide a specific PCR product size. In recent years, evolutionary computation has been applied to PCR primer design and yielded promising results. In this article, a memetic algorithm (MA) is proposed to solve primer design problems associated with providing a specific product size for PCR experiments. The MA is compared with a genetic algorithm (GA) using an accuracy formula to estimate the quality of the primer design and test the running time. Overall, 50 accession nucleotide sequences were sampled for the comparison of the accuracy of the GA and MA for primer design. Five hundred runs of the GA and MA primer design were performed with PCR product lengths of 150-300 bps and 500-800 bps, and two different methods of calculating T(m) for each accession nucleotide sequence were tested. A comparison of the accuracy results for the GA and MA primer design showed that the MA primer design yielded better results than the GA primer design. The results further indicate that the proposed method finds optimal or near-optimal primer sets and effective PCR products in a dry dock experiment. Related materials are available online at http://bio.kuas.edu.tw/ma-pd/. 2009 American Institute of Chemical Engineers

  12. Chaotic Inertia Weight Particle Swarm Optimization for PCR Primer Design

    Directory of Open Access Journals (Sweden)

    Cheng-Huei Yang

    2013-06-01

    Full Text Available In order to provide feasible primer sets for performing a polymerase chain reaction (PCR experiment, many primer design methods have been proposed. However, the majority of these methods require a long time to obtain an optimal solution since large quantities of template DNA need to be analyzed, and the designed primer sets usually do not provide a specific PCR product size. In recent years, particle swarm optimization (PSO has been applied to solve many problems and yielded good results. In this paper, a logistic map is proposed to determine the value of inertia weight of PSO (CIWPSO to design feasible primers. Accuracies for the primer design of the Homo sapiens RNA binding motif protein 11 (RBM11, mRNA (NM_144770, and the Homo sapiens G protein-coupled receptor 78 (GPR78, mRNA (NM_080819 were calculated. Five hundred runs of PSO and the CIWPSO primer design method were performed on different PCR product lengths and the different methods of calculating the melting temperature. A comparison of the accuracy results for PSO and CIWPSO primer design showed that CIWPSO is superior to the PSO for primer design. The proposed method could effectively find optimal or near-optimal primer sets.

  13. Homolog-specific PCR primer design for profiling splice variants.

    Science.gov (United States)

    Srivastava, Gyan Prakash; Hanumappa, Mamatha; Kushwaha, Garima; Nguyen, Henry T; Xu, Dong

    2011-05-01

    To study functional diversity of proteins encoded from a single gene, it is important to distinguish the expression levels among the alternatively spliced variants. A variant-specific primer pair is required to amplify each alternatively spliced variant individually. For this purpose, we developed a new feature, homolog-specific primer design (HSPD), in our high-throughput primer and probe design software tool, PRIMEGENS-v2. The algorithm uses a de novo approach to design primers without any prior information of splice variants or close homologs for an input query sequence. It not only designs primer pairs but also finds potential isoforms and homologs of the input sequence. Efficiency of this algorithm was tested for several gene families in soybean. A total of 187 primer pairs were tested under five different abiotic stress conditions with three replications at three time points. Results indicate a high success rate of primer design. Some primer pairs designed were able to amplify all splice variants of a gene. Furthermore, by utilizing combinations within the same multiplex pool, we were able to uniquely amplify a specific variant or duplicate gene. Our method can also be used to design PCR primers to specifically amplify homologs in the same gene family. PRIMEGENS-v2 is available at: http://primegens.org.

  14. Primer design using Primer Express® for SYBR Green-based quantitative PCR.

    Science.gov (United States)

    Singh, Amarjeet; Pandey, Girdhar K

    2015-01-01

    To quantitate the gene expression, real-time RT-PCR or quantitative PCR (qPCR) is one of the most sensitive, reliable, and commonly used methods in molecular biology. The reliability and success of a real-time PCR assay depend on the optimal experiment design. Primers are the most important constituents of real-time PCR experiments such as in SYBR Green-based detection assays. Designing of an appropriate and specific primer pair is extremely crucial for correct estimation of transcript abundance of any gene in a given sample. Here, we are presenting a quick, easy, and reliable method for designing target-specific primers using Primer Express(®) software for real-time PCR (qPCR) experiments.

  15. Design of phylum-specific hybrid primers for DNA barcoding: addressing the need for efficient COI amplification in the Echinodermata.

    Science.gov (United States)

    Hoareau, T B; Boissin, E

    2010-11-01

    Recent research has shown the usefulness of the Folmer region of the cytochrome oxidase I (COI) as a genetic barcode to assist in species delimitation of echinoderms. However, amplification of COI is often challenging in echinoderms (low success or pseudogenes). We present a method that allows the design of phylum-specific hybrid primers, and use this to develop COI primers for the Echinodermata. We aligned COI sequences from 310 echinoderm species and designed all possible primers along the consensus sequence with two methods (standard degenerate and hybrid). We found much lower degeneracy for hybrid primers (4-fold degeneracy) than for standard degenerate primers (≥48-fold degeneracy). We then designed the most conserved hybrid primers to amplify a >500-bp region within COI. These primers successfully amplified this gene region in all tested taxa (123 species across all echinoderm classes). Sequencing of 30 species among these confirmed both the quality of the sequences (>500 bp, no pseudogenes) and their utility as a DNA barcode. This method should be useful for developing primers for other mitochondrial genes and other phyla. The method will also be of interest for the development of future projects involving both community-based genetic assessments on macroorganisms and biodiversity assessment of environmental samples using high-throughput sequencing.

  16. GENOMEMASKER package for designing unique genomic PCR primers

    Directory of Open Access Journals (Sweden)

    Kaplinski Lauris

    2006-03-01

    Full Text Available Abstract Background The design of oligonucleotides and PCR primers for studying large genomes is complicated by the redundancy of sequences. The eukaryotic genomes are particularly difficult to study due to abundant repeats. The speed of most existing primer evaluation programs is not sufficient for large-scale experiments. Results In order to improve the efficiency and success rate of automatic primer/oligo design, we created a novel method which allows rapid masking of repeats in large sequence files, for example in eukaryotic genomes. It also allows the detection of all alternative binding sites of PCR primers and the prediction of PCR products. The new method was implemented in a collection of efficient programs, the GENOMEMASKER package. The performance of the programs was compared to other similar programs. We also modified the PRIMER3 program, to be able to design primers from lowercase-masked sequences. Conclusion The GENOMEMASKER package is able to mask the entire human genome for non-unique primers within 6 hours and find locations of all binding sites for 10 000 designed primer pairs within 10 minutes. Additionally, it predicts all alternative PCR products from large genomes for given primer pairs.

  17. SINGLE CELL DEGENERATE OLIGONUCLEOTIDE PRIMER-PCR AND COMPARATIVE GENOMIC HYBRIDIZATION WITH MODIFIED CONTROL REFERENCE

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    For investigating the possibility of applying degenerate oligonucleotide primer PCR (DOP-PCR) and comparative genomic hybridization (CGH) technique to analyses of genomic genetics in a single cell, the whole genomic DNA of a single cell with XX, XY, XO, XXY, +13 or +21 was amplified by DOP-PCR. Single cell DOP-PCR CGHs with conventional and modified control references, the genomic DNA and a single cell DOP-PCR product from normal male, were carried out respectively. The results showed that the average profile of the fluorescence intensity ratio in CGH with the genomic DNA as reference fluctuates much and that the standard deviation in about 30% haploid is beyond the normal limits. False positive hyper-representation was found to exist in X chromosome while trisomy 13 and 21 were not detected. However, the distributions of the mean and the standard deviation of the ratio in the CGH with DOP-PCR product as reference were quite acceptable. The copy number changes of chromosome X,Y,13 and 21 were revealed. Those results suggested that there is unrandom unequal amplification in a single cell DOP-PCR. Using a single DOP-PCR product as reference can decrease its influence on CGH. Single cell DOP-PCR-CGH and its application in the genetic analyses of preimplantation embryo or fetal cell in maternal blood may be possible.

  18. RExPrimer: an integrated primer designing tool increases PCR effectiveness by avoiding 3' SNP-in-primer and mis-priming from structural variation.

    Science.gov (United States)

    Piriyapongsa, Jittima; Ngamphiw, Chumpol; Assawamakin, Anunchai; Wangkumhang, Pongsakorn; Suwannasri, Payiarat; Ruangrit, Uttapong; Agavatpanitch, Gallissara; Tongsima, Sissades

    2009-12-03

    Polymerase chain reaction (PCR) is very useful in many areas of molecular biology research. It is commonly observed that PCR success is critically dependent on design of an effective primer pair. Current tools for primer design do not adequately address the problem of PCR failure due to mis-priming on target-related sequences and structural variations in the genome. We have developed an integrated graphical web-based application for primer design, called RExPrimer, which was written in Python language. The software uses Primer3 as the primer designing core algorithm. Locally stored sequence information and genomic variant information were hosted on MySQLv5.0 and were incorporated into RExPrimer. RExPrimer provides many functionalities for improved PCR primer design. Several databases, namely annotated human SNP databases, insertion/deletion (indel) polymorphisms database, pseudogene database, and structural genomic variation databases were integrated into RExPrimer, enabling an effective without-leaving-the-website validation of the resulting primers. By incorporating these databases, the primers reported by RExPrimer avoid mis-priming to related sequences (e.g. pseudogene, segmental duplication) as well as possible PCR failure because of structural polymorphisms (SNP, indel, and copy number variation (CNV)). To prevent mismatching caused by unexpected SNPs in the designed primers, in particular the 3' end (SNP-in-Primer), several SNP databases covering the broad range of population-specific SNP information are utilized to report SNPs present in the primer sequences. Population-specific SNP information also helps customize primer design for a specific population. Furthermore, RExPrimer offers a graphical user-friendly interface through the use of scalable vector graphic image that intuitively presents resulting primers along with the corresponding gene structure. In this study, we demonstrated the program effectiveness in successfully generating primers for strong

  19. PD5: a general purpose library for primer design software.

    Science.gov (United States)

    Riley, Michael C; Aubrey, Wayne; Young, Michael; Clare, Amanda

    2013-01-01

    Complex PCR applications for large genome-scale projects require fast, reliable and often highly sophisticated primer design software applications. Presently, such applications use pipelining methods to utilise many third party applications and this involves file parsing, interfacing and data conversion, which is slow and prone to error. A fully integrated suite of software tools for primer design would considerably improve the development time, the processing speed, and the reliability of bespoke primer design software applications. The PD5 software library is an open-source collection of classes and utilities, providing a complete collection of software building blocks for primer design and analysis. It is written in object-oriented C(++) with an emphasis on classes suitable for efficient and rapid development of bespoke primer design programs. The modular design of the software library simplifies the development of specific applications and also integration with existing third party software where necessary. We demonstrate several applications created using this software library that have already proved to be effective, but we view the project as a dynamic environment for building primer design software and it is open for future development by the bioinformatics community. Therefore, the PD5 software library is published under the terms of the GNU General Public License, which guarantee access to source-code and allow redistribution and modification. The PD5 software library is downloadable from Google Code and the accompanying Wiki includes instructions and examples: http://code.google.com/p/primer-design.

  20. PolyMarker: A fast polyploid primer design pipeline.

    Science.gov (United States)

    Ramirez-Gonzalez, Ricardo H; Uauy, Cristobal; Caccamo, Mario

    2015-06-15

    The design of genetic markers is of particular relevance in crop breeding programs. Despite many economically important crops being polyploid organisms, the current primer design tools are tailored for diploid species. Bread wheat, for instance, is a hexaploid comprising of three related genomes and the performance of genetic markers is diminished if the primers are not genome specific. PolyMarker is a pipeline that generates SNP markers by selecting candidate primers for a specified genome using local alignments and standard primer design tools to test the viability of the primers. A command line tool and a web interface are available to the community. PolyMarker is available as a ruby BioGem: bio-polyploid-tools. Web interface: http://polymarker.tgac.ac.uk. © The Author 2015. Published by Oxford University Press.

  1. Bioinformatic tools and guideline for PCR primer design | Abd ...

    African Journals Online (AJOL)

    Bioinformatic tools and guideline for PCR primer design. ... AFRICAN JOURNALS ONLINE (AJOL) · Journals · Advanced Search · USING AJOL · RESOURCES ... Bioinformatics has become an essential tool not only for basic research but also ...

  2. Real‐time PCR (qPCR) primer design using free online software

    National Research Council Canada - National Science Library

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    ...‐stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green‐based qPCR primers...

  3. PrimerSuite: A High-Throughput Web-Based Primer Design Program for Multiplex Bisulfite PCR.

    Science.gov (United States)

    Lu, Jennifer; Johnston, Andrew; Berichon, Philippe; Ru, Ke-Lin; Korbie, Darren; Trau, Matt

    2017-01-24

    The analysis of DNA methylation at CpG dinucleotides has become a major research focus due to its regulatory role in numerous biological processes, but the requisite need for assays which amplify bisulfite-converted DNA represents a major bottleneck due to the unique design constraints imposed on bisulfite-PCR primers. Moreover, a review of the literature indicated no available software solutions which accommodated both high-throughput primer design, support for multiplex amplification assays, and primer-dimer prediction. In response, the tri-modular software package PrimerSuite was developed to support bisulfite multiplex PCR applications. This software was constructed to (i) design bisulfite primers against multiple regions simultaneously (PrimerSuite), (ii) screen for primer-primer dimerizing artefacts (PrimerDimer), and (iii) support multiplex PCR assays (PrimerPlex). Moreover, a major focus in the development of this software package was the emphasis on extensive empirical validation, and over 1300 unique primer pairs have been successfully designed and screened, with over 94% of them producing amplicons of the expected size, and an average mapping efficiency of 93% when screened using bisulfite multiplex resequencing. The potential use of the software in other bisulfite-based applications such as methylation-specific PCR is under consideration for future updates. This resource is freely available for use at PrimerSuite website (www.primer-suite.com).

  4. PrimerSuite: A High-Throughput Web-Based Primer Design Program for Multiplex Bisulfite PCR

    Science.gov (United States)

    Lu, Jennifer; Johnston, Andrew; Berichon, Philippe; Ru, Ke-lin; Korbie, Darren; Trau, Matt

    2017-01-01

    The analysis of DNA methylation at CpG dinucleotides has become a major research focus due to its regulatory role in numerous biological processes, but the requisite need for assays which amplify bisulfite-converted DNA represents a major bottleneck due to the unique design constraints imposed on bisulfite-PCR primers. Moreover, a review of the literature indicated no available software solutions which accommodated both high-throughput primer design, support for multiplex amplification assays, and primer-dimer prediction. In response, the tri-modular software package PrimerSuite was developed to support bisulfite multiplex PCR applications. This software was constructed to (i) design bisulfite primers against multiple regions simultaneously (PrimerSuite), (ii) screen for primer-primer dimerizing artefacts (PrimerDimer), and (iii) support multiplex PCR assays (PrimerPlex). Moreover, a major focus in the development of this software package was the emphasis on extensive empirical validation, and over 1300 unique primer pairs have been successfully designed and screened, with over 94% of them producing amplicons of the expected size, and an average mapping efficiency of 93% when screened using bisulfite multiplex resequencing. The potential use of the software in other bisulfite-based applications such as methylation-specific PCR is under consideration for future updates. This resource is freely available for use at PrimerSuite website (www.primer-suite.com). PMID:28117430

  5. USER-derived cloning methods and their primer design.

    Science.gov (United States)

    Salomonsen, Bo; Mortensen, Uffe H; Halkier, Barbara A

    2014-01-01

    Uracil excision-based cloning through USER™ (Uracil-Specific Excision Reagent) is an efficient ligase-free cloning technique that comprises USER cloning, USER fusion, and USER cassette-free (UCF) USER fusion. These USER-derived cloning techniques enable seamless assembly of multiple DNA fragments in one construct. Though governed by a few simple rules primer design for USER-based fusion of PCR fragments can prove time-consuming for inexperienced users. The Primer Help for USER (PHUSER) software is an easy-to-use primer design tool for USER-based methods. In this chapter, we present a PHUSER software protocol for designing primers for USER-derived cloning techniques.

  6. [Development of specific and degenerated primers to CesA genes encoding flax (Linum usitatissimum L.) cellulose synthase].

    Science.gov (United States)

    Grushetskaia, Z E; Lemesh, V A; Khotyleva, L V

    2010-01-01

    Cellulose synthase catalytic subunit genes, CesA, have been discovered in several higher plant species, and it has been shown that the CesA gene family has multiple members. HVR2 fragment of these genes determine the class specificity of the CESA protein and its participation in the primary or secondary cell wall synthesis. The aim of this study was development of specific and degenerated primers to flax CesA gene fragments leading to obtaining the class specific HVR2 region of the gene. Two pairs of specific primers to the certain fragments of CesA-1 and CesA-6 genes and one pair of degenerated primers to HVR2 region of all flax CesA genes were developed basing on comparison of six CesA EST sequences of flax and full cDNA sequences of Arabidopsis, poplar, maize and cotton plants, obtained from GenBank. After amplification of flax cDNA, the bands of expected size were detected (201 and 300 b.p. for the CesA-1 and CesA-6, and 600 b.p. for the HVR2 region of CesA respectively). The developed markers can be used for cloning and sequencing of flax CesA genes, identifying their number in flax genome, tissue and stage specificity.

  7. Diversity of reductive dehalogenase genes from environmental samples and enrichment cultures identified with degenerate primer PCR screens.

    Directory of Open Access Journals (Sweden)

    Laura Audrey Hug

    2013-11-01

    Full Text Available Reductive dehalogenases are the critical enzymes for anaerobic organohalide respiration, a microbial metabolic process that has been harnessed for bioremediation efforts to resolve chlorinated solvent contamination in groundwater and is implicated in the global halogen cycle. Reductive dehalogenase sequence diversity is informative for the dechlorination potential of the site or enrichment culture. A suite of degenerate PCR primers targeting a comprehensive curated set of reductive dehalogenase genes was designed and applied to twelve DNA samples extracted from contaminated and pristine sites, as well as six enrichment cultures capable of reducing chlorinated compounds to non-toxic end-products. The amplified gene products from four environmental sites and two enrichment cultures were sequenced using Illumina HiSeq, and the reductive dehalogenase complement of each sample determined. The results indicate that the diversity of the reductive dehalogenase gene family is much deeper than is currently accounted for: one-third of the translated proteins have less than 70% pairwise amino acid identity to database sequences. Approximately 60% of the sequenced reductive dehalogenase genes were broadly distributed, being identified in four or more samples, and often in previously sequenced genomes as well. In contrast, 17% of the sequenced reductive dehalogenases were unique, present in only a single sample and bearing less than 90% pairwise amino acid identity to any previously identified proteins. Many of the broadly distributed reductive dehalogenases are uncharacterized in terms of their substrate specificity, making these intriguing targets for further biochemical experimentation. Finally, comparison of samples from a contaminated site and an enrichment culture derived from the same site eight years prior allowed examination of the effect of the enrichment process.

  8. MPD: multiplex primer design for next-generation targeted sequencing.

    Science.gov (United States)

    Wingo, Thomas S; Kotlar, Alex; Cutler, David J

    2017-01-05

    Targeted resequencing offers a cost-effective alternative to whole-genome and whole-exome sequencing when investigating regions known to be associated with a trait or disease. There are a number of approaches to targeted resequencing, including microfluidic PCR amplification, which may be enhanced by multiplex PCR. Currently, there is no open-source software that can design next-generation multiplex PCR experiments that ensures primers are unique at a genome-level and efficiently pools compatible primers. We present MPD, a software package that automates the design of multiplex PCR primers for next-generation sequencing. The core of MPD is implemented in C for speed and uses a hashed genome to ensure primer uniqueness, avoids placing primers over sites of known variation, and efficiently pools compatible primers. A JavaScript web application ( http://multiplexprimer.io ) utilizing the MPD Perl package provides a convenient platform for users to make designs. Using a realistic set of genes identified by genome-wide association studies (GWAS), we achieve 90% coverage of all exonic regions using stringent design criteria. Using the first 47 primer pools for wet-lab validation, we sequenced ~25Kb at 99.7% completeness with a mean coverage of 300X among 313 samples simultaneously and identified 224 variants. The number and nature of variants we observe are consistent with high quality sequencing. MPD can successfully design multiplex PCR experiments suitable for next-generation sequencing, and simplifies retooling targeted resequencing pipelines to focus on new targets as new genetic evidence emerges.

  9. Rapid and simple method of qPCR primer design.

    Science.gov (United States)

    Thornton, Brenda; Basu, Chhandak

    2015-01-01

    Quantitative real-time polymerase chain reaction (qPCR) is a powerful tool for analysis and quantification of gene expression. It is advantageous compared to traditional gel-based method of PCR, as gene expression can be visualized "real-time" using a computer. In qPCR, a reporter dye system is used which intercalates with DNA's region of interest and detects DNA amplification. Some of the popular reporter systems used in qPCR are the following: Molecular Beacon(®), SYBR Green(®), and Taqman(®). However, success of qPCR depends on the optimal primers used. Some of the considerations for primer design are the following: GC content, primer self-dimer, or secondary structure formation. Freely available software could be used for ideal qPCR primer design. Here we have shown how to use some freely available web-based software programs (such as Primerquest(®), Unafold(®), and Beacon designer(®)) to design qPCR primers.

  10. Design Primer for Reed-Solomon Encoders

    Science.gov (United States)

    Perlman, M.; Lee, J. J.

    1985-01-01

    Design and operation of Reed-Solomon (RS) encoders discussed in document prepared as instruction manual for computer designers and others in dataprocessing field. Conventional and Berlekamp architectures compared. Engineers who equip computer memory chips with burst-error and dropout detection and correction find report especially useful.

  11. De-MetaST-BLAST: a tool for the validation of degenerate primer sets and data mining of publicly available metagenomes.

    Directory of Open Access Journals (Sweden)

    Christopher A Gulvik

    Full Text Available Development and use of primer sets to amplify nucleic acid sequences of interest is fundamental to studies spanning many life science disciplines. As such, the validation of primer sets is essential. Several computer programs have been created to aid in the initial selection of primer sequences that may or may not require multiple nucleotide combinations (i.e., degeneracies. Conversely, validation of primer specificity has remained largely unchanged for several decades, and there are currently few available programs that allows for an evaluation of primers containing degenerate nucleotide bases. To alleviate this gap, we developed the program De-MetaST that performs an in silico amplification using user defined nucleotide sequence dataset(s and primer sequences that may contain degenerate bases. The program returns an output file that contains the in silico amplicons. When De-MetaST is paired with NCBI's BLAST (De-MetaST-BLAST, the program also returns the top 10 nr NCBI database hits for each recovered in silico amplicon. While the original motivation for development of this search tool was degenerate primer validation using the wealth of nucleotide sequences available in environmental metagenome and metatranscriptome databases, this search tool has potential utility in many data mining applications.

  12. Primer design for PCR reactions in forensic biology.

    Science.gov (United States)

    Elkins, Kelly M

    2015-01-01

    The polymerase chain reaction (PCR) is a popular method to copy DNA in vitro. Its invention revolutionized fields ranging from clinical medicine to anthropology, molecular biology, and forensic biology. The method employs one of many available heat-stable DNA polymerases in a reaction that is repeated many times in situ. The DNA polymerase reads a template DNA strand and using the components of the reaction mix, catalyzes the addition of free 2'-deoxynucleotide triphosphate nitrogenous bases to short segment of DNA that forms a complement with the template via Watson-Crick base pairing. This short segment of DNA is referred to as a PCR primer and it is essential to the success of the reaction. The most widely used application of PCR in forensic labs is the amplification of short tandem repeat (STR) loci used in DNA typing. The STRs are routinely evaluated in concert with 16 or more reactions, a multiplex, run in one test tube simultaneously. In a multiplex, it is essential that the primers work specifically and accurately on the intended reactions without hindering the other reactions. The primers, which are very specific, also can be used to probe single nucleotide polymorphisms (SNPs) in a DNA sequence of interest by single base extension. Primers are often designed using one of many available automated software packages. Here the process of manually designing PCR primers for forensic biology using no-cost software is described.

  13. STITCHER 2.0: primer design for overlapping PCR applications

    Science.gov (United States)

    O’Halloran, Damien M.; Uriagereka-Herburger, Isabel; Bode, Katrin

    2017-01-01

    Overlapping polymerase chain reaction (PCR) is a common technique used by researchers in very diverse fields that enables the user to ‘stitch’ individual pieces of DNA together. Previously, we have reported a web based tool called STITCHER that provides a platform for researchers to automate the design of primers for overlapping PCR applications. Here we present STITCHER 2.0, which represents a substantial update to STITCHER. STITCHER 2.0 is a newly designed web tool that automates the design of primers for overlapping PCR. Unlike STITCHER, STITCHER 2.0 considers diverse algorithmic parameters, and returns multiple result files that include a facility for the user to draw their own primers as well as comprehensive visual guides to the user’s input, output, and designed primers. These result files provide greater control and insight during experimental design and troubleshooting. STITCHER 2.0 is freely available to all users without signup or login requirements and can be accessed at the following webpage: www.ohalloranlab.net/STITCHER2.html. PMID:28358011

  14. STITCHER 2.0: primer design for overlapping PCR applications.

    Science.gov (United States)

    O'Halloran, Damien M; Uriagereka-Herburger, Isabel; Bode, Katrin

    2017-03-30

    Overlapping polymerase chain reaction (PCR) is a common technique used by researchers in very diverse fields that enables the user to 'stitch' individual pieces of DNA together. Previously, we have reported a web based tool called STITCHER that provides a platform for researchers to automate the design of primers for overlapping PCR applications. Here we present STITCHER 2.0, which represents a substantial update to STITCHER. STITCHER 2.0 is a newly designed web tool that automates the design of primers for overlapping PCR. Unlike STITCHER, STITCHER 2.0 considers diverse algorithmic parameters, and returns multiple result files that include a facility for the user to draw their own primers as well as comprehensive visual guides to the user's input, output, and designed primers. These result files provide greater control and insight during experimental design and troubleshooting. STITCHER 2.0 is freely available to all users without signup or login requirements and can be accessed at the following webpage: www.ohalloranlab.net/STITCHER2.html.

  15. A Primer on Autonomous Aerial Vehicle Design.

    Science.gov (United States)

    Coppejans, Hugo H G; Myburgh, Herman C

    2015-12-02

    There is a large amount of research currently being done on autonomous micro-aerial vehicles (MAV), such as quadrotor helicopters or quadcopters. The ability to create a working autonomous MAV depends mainly on integrating a simultaneous localization and mapping (SLAM) solution with the rest of the system. This paper provides an introduction for creating an autonomous MAV for enclosed environments, aimed at students and professionals alike. The standard autonomous system and MAV automation are discussed, while we focus on the core concepts of SLAM systems and trajectory planning algorithms. The advantages and disadvantages of using remote processing are evaluated, and recommendations are made regarding the viability of on-board processing. Recommendations are made regarding best practices to serve as a guideline for aspirant MAV designers.

  16. A Primer on Autonomous Aerial Vehicle Design

    Directory of Open Access Journals (Sweden)

    Hugo H. G. Coppejans

    2015-12-01

    Full Text Available There is a large amount of research currently being done on autonomous micro-aerial vehicles (MAV, such as quadrotor helicopters or quadcopters. The ability to create a working autonomous MAV depends mainly on integrating a simultaneous localization and mapping (SLAM solution with the rest of the system. This paper provides an introduction for creating an autonomous MAV for enclosed environments, aimed at students and professionals alike. The standard autonomous system and MAV automation are discussed, while we focus on the core concepts of SLAM systems and trajectory planning algorithms. The advantages and disadvantages of using remote processing are evaluated, and recommendations are made regarding the viability of on-board processing. Recommendations are made regarding best practices to serve as a guideline for aspirant MAV designers.

  17. PrimerSeq:Design and Visualization of RT-PCR Primers for Alternative Splicing Using RNA-seq Data

    Institute of Scientific and Technical Information of China (English)

    Collin Tokheim; Juw Won Park; Yi Xing

    2014-01-01

    The vast majority of multi-exon genes in higher eukaryotes are alternatively spliced and changes in alternative splicing (AS) can impact gene function or cause disease. High-throughput RNA sequencing (RNA-seq) has become a powerful technology for transcriptome-wide analysis of AS, but RT-PCR still remains the gold-standard approach for quantifying and validating exon splicing levels. We have developed PrimerSeq, a user-friendly software for systematic design and visualization of RT-PCR primers using RNA-seq data. PrimerSeq incorporates user-provided tran-scriptome profiles (i.e., RNA-seq data) in the design process, and is particularly useful for large-scale quantitative analysis of AS events discovered from RNA-seq experiments. PrimerSeq features a graphical user interface (GUI) that displays the RNA-seq data juxtaposed with the expected RT-PCR results. To enable primer design and visualization on user-provided RNA-seq data and transcript annotations, we have developed PrimerSeq as a stand-alone software that runs on local computers. PrimerSeq is freely available for Windows and Mac OS X along with source code at http://primerseq.sourceforge.net/. With the growing popularity of RNA-seq for transcriptome stud-ies, we expect PrimerSeq to help bridge the gap between high-throughput RNA-seq discovery of AS events and molecular analysis of candidate events by RT-PCR.

  18. Systematic design of 18S rRNA gene primers for determining eukaryotic diversity in microbial consortia.

    Directory of Open Access Journals (Sweden)

    Luisa W Hugerth

    Full Text Available High-throughput sequencing of ribosomal RNA gene (rDNA amplicons has opened up the door to large-scale comparative studies of microbial community structures. The short reads currently produced by massively parallel sequencing technologies make the choice of sequencing region crucial for accurate phylogenetic assignments. While for 16S rDNA, relevant regions have been well described, no truly systematic design of 18S rDNA primers aimed at resolving eukaryotic diversity has yet been reported. Here we used 31,862 18S rDNA sequences to design a set of broad-taxonomic range degenerate PCR primers. We simulated the phylogenetic information that each candidate primer pair would retrieve using paired- or single-end reads of various lengths, representing different sequencing technologies. Primer pairs targeting the V4 region performed best, allowing discrimination with paired-end reads as short as 150 bp (with 75% accuracy at genus level. The conditions for PCR amplification were optimised for one of these primer pairs and this was used to amplify 18S rDNA sequences from isolates as well as from a range of environmental samples which were then Illumina sequenced and analysed, revealing good concordance between expected and observed results. In summary, the reported primer sets will allow minimally biased assessment of eukaryotic diversity in different microbial ecosystems.

  19. Systematic design of 18S rRNA gene primers for determining eukaryotic diversity in microbial consortia.

    Science.gov (United States)

    Hugerth, Luisa W; Muller, Emilie E L; Hu, Yue O O; Lebrun, Laura A M; Roume, Hugo; Lundin, Daniel; Wilmes, Paul; Andersson, Anders F

    2014-01-01

    High-throughput sequencing of ribosomal RNA gene (rDNA) amplicons has opened up the door to large-scale comparative studies of microbial community structures. The short reads currently produced by massively parallel sequencing technologies make the choice of sequencing region crucial for accurate phylogenetic assignments. While for 16S rDNA, relevant regions have been well described, no truly systematic design of 18S rDNA primers aimed at resolving eukaryotic diversity has yet been reported. Here we used 31,862 18S rDNA sequences to design a set of broad-taxonomic range degenerate PCR primers. We simulated the phylogenetic information that each candidate primer pair would retrieve using paired- or single-end reads of various lengths, representing different sequencing technologies. Primer pairs targeting the V4 region performed best, allowing discrimination with paired-end reads as short as 150 bp (with 75% accuracy at genus level). The conditions for PCR amplification were optimised for one of these primer pairs and this was used to amplify 18S rDNA sequences from isolates as well as from a range of environmental samples which were then Illumina sequenced and analysed, revealing good concordance between expected and observed results. In summary, the reported primer sets will allow minimally biased assessment of eukaryotic diversity in different microbial ecosystems.

  20. Design of the Advanced Virgo non-degenerate recycling cavities

    Energy Technology Data Exchange (ETDEWEB)

    Granata, M; Barsuglia, M [Laboratoire Astroparticule et Cosmologie (APC) 10 rue Alice Domon et Leonie Duquet, 75013 Paris (France); Flaminio, R [Laboratoire des Materiaux Avances (LMA), IN2P3/CNRS F-69622 Villeurbanne, Lyon (France); Freise, A [School of Physics and Astronomy, University of Birmingham Birmingham, B15 2TT (United Kingdom); Hild, S [Institute for Gravitational Research, Department of Physics and Astronomy University of Glasgow, Glasgow, G12 8QQ (United Kingdom); Marque, J, E-mail: granata@apc.univ-paris7.f [European Gravitational Observatory (EGO) I-56021 Cascina (Italy)

    2010-05-01

    Advanced Virgo is the project to upgrade the interferometric gravitational wave detector Virgo, and it foresees the implementation of power and signal non-degenerate recycling cavities. Such cavities suppress the build-up of high order modes of the resonating sidebands, with some advantage for the commissioning of the detector and the build-up of the gravitational signal. Here we present the baseline design of the Advanced Virgo non-degenerate recycling cavities, giving some preliminary results of simulations about the tolerances of this design to astigmatism, mirror figure errors and thermal lensing.

  1. Design of primers and probes for quantitative real-time PCR methods.

    Science.gov (United States)

    Rodríguez, Alicia; Rodríguez, Mar; Córdoba, Juan J; Andrade, María J

    2015-01-01

    Design of primers and probes is one of the most crucial factors affecting the success and quality of quantitative real-time PCR (qPCR) analyses, since an accurate and reliable quantification depends on using efficient primers and probes. Design of primers and probes should meet several criteria to find potential primers and probes for specific qPCR assays. The formation of primer-dimers and other non-specific products should be avoided or reduced. This factor is especially important when designing primers for SYBR(®) Green protocols but also in designing probes to ensure specificity of the developed qPCR protocol. To design primers and probes for qPCR, multiple software programs and websites are available being numerous of them free. These tools often consider the default requirements for primers and probes, although new research advances in primer and probe design should be progressively added to different algorithm programs. After a proper design, a precise validation of the primers and probes is necessary. Specific consideration should be taken into account when designing primers and probes for multiplex qPCR and reverse transcription qPCR (RT-qPCR). This chapter provides guidelines for the design of suitable primers and probes and their subsequent validation through the development of singlex qPCR, multiplex qPCR, and RT-qPCR protocols.

  2. PrecisePrimer: an easy-to-use web server for designing PCR primers for DNA library cloning and DNA shuffling.

    Science.gov (United States)

    Pauthenier, Cyrille; Faulon, Jean-Loup

    2014-07-01

    PrecisePrimer is a web-based primer design software made to assist experimentalists in any repetitive primer design task such as preparing, cloning and shuffling DNA libraries. Unlike other popular primer design tools, it is conceived to generate primer libraries with popular PCR polymerase buffers proposed as pre-set options. PrecisePrimer is also meant to design primers in batches, such as for DNA libraries creation of DNA shuffling experiments and to have the simplest interface possible. It integrates the most up-to-date melting temperature algorithms validated with experimental data, and cross validated with other computational tools. We generated a library of primers for the extraction and cloning of 61 genes from yeast DNA genomic extract using default parameters. All primer pairs efficiently amplified their target without any optimization of the PCR conditions. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. FullSSR: Microsatellite Finder and Primer Designer

    Directory of Open Access Journals (Sweden)

    Sebastián Metz

    2016-01-01

    Full Text Available Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user.

  4. FullSSR: Microsatellite Finder and Primer Designer

    Science.gov (United States)

    Metz, Sebastián; Cabrera, Juan Manuel; Rueda, Eva; Giri, Federico; Amavet, Patricia

    2016-01-01

    Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR) loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user. PMID:27366148

  5. Real-time polymerase chain reaction for detection of encapsulated Haemophilus influenzae using degenerate primers to target the capsule transport gene bexA.

    Science.gov (United States)

    Law, Dennis K S; Tsang, Raymond S W

    2013-05-01

    A real-time polymerase chain reaction assay that uses degenerate primers and a dual-labelled probe was developed to detect the bexA gene of Haemophilus influenzae, including those belonging to non-b serotypes as well as clonal division II strains. This assay is sensitive and specific, detecting 20 copies of the gene, but negative with a variety of bacteria associated with meningitis and bacteremia or septicemia.

  6. Design factors that influence PCR amplification success of cross-species primers among 1147 mammalian primer pairs.

    Science.gov (United States)

    Housley, Donna J E; Zalewski, Zachary A; Beckett, Stephanie E; Venta, Patrick J

    2006-10-09

    Cross-species primers have been used with moderate success to address a variety of questions concerning genome structure, evolution, and gene function. However, the factors affecting their success have never been adequately addressed, particularly with respect to producing a consistent method to achieve high throughput. Using 1,147 mammalian cross-species primer pairs (1089 not previously reported), we tested several factors to determine their influence on the probability that a given target will amplify in a given species under a single amplification condition. These factors included: number of mismatches between the two species (the index species) used to identify conserved regions to which the primers were designed, GC-content of the gene and amplified region, CpG dinucleotides in the primer region, degree of encoded protein conservation, length of the primers, and the degree of evolutionary distance between the target species and the two index species. The amplification success rate for the cross-species primers was significantly influenced by the number of mismatches between the two index species (6-8% decrease per mismatch in a primer pair), the GC-content within the amplified region (for the dog, GC > or = 50%, 56.9% amplified; GCprimer pairs (64.3%) (excluding primers in which dog was an index species) were sequenced and shown to be the expected product, with an additional three percent producing the incorrect sequence. When hamster DNA was used with the single amplification condition in a microtiter plate-based format, 510 of 1087 primer pairs (46.9%) produced amplified products. The primer pairs are spaced at an average distance of 2.3 Mb in the human genome and may be used to produce up to several hundred thousand bp of species-specific sequence. The most important factors influencing the proportion of successful amplifications are the number of index species mismatches, GC-richness of the target amplimer, and the relatedness of the target species to the

  7. A primer design strategy for PCR amplification of GC-rich DNA sequences.

    Science.gov (United States)

    Li, Li-Yan; Li, Qiang; Yu, Yan-Hong; Zhong, Mei; Yang, Lei; Wu, Qing-Hong; Qiu, Yu-Rong; Luo, Shen-Qiu

    2011-06-01

    To establish a primer design method for amplification of GC-rich DNA sequences. A group of 15 pairs of primers with higher T(m) (>79.7°C) and lower level ΔT(m) (designed to amplify GC-rich sequences (66.0%-84.0%). The statistical analysis of primer parameters and GC content of PCR products was performed and compared with literatures. Other control experiments were conducted using shortened primers for GC-rich PCR amplifications in this study, and the statistical analysis of shortened primer parameters and GC content of PCR products was performed compared with primers not shortened. A group of 26 pairs of primers were designed to test the applicability of this primer designing strategy in amplifications of non-GC-rich sequences (35.2%-53.5%). All the DNA sequences in this study were successfully amplified. Statistical analyses show that the T(m) and ΔT(m) were the main factors influencing amplifications. This primer designing strategy offered a perfect tool for amplification of GC-rich sequences. It proves that the secondary structures cannot be formed at higher annealing temperature conditions (>65°C), and we can overcome this difficulty easily by designing primers and using higher annealing temperature. Crown Copyright © 2011. Published by Elsevier Inc. All rights reserved.

  8. ConservedPrimers 2.0: a high-throughput pipeline for comparative genome referenced intron-flanking PCR primer design and its application in wheat SNP discovery.

    Science.gov (United States)

    You, Frank M; Huo, Naxin; Gu, Yong Q; Lazo, Gerard R; Dvorak, Jan; Anderson, Olin D

    2009-10-13

    In some genomic applications it is necessary to design large numbers of PCR primers in exons flanking one or several introns on the basis of orthologous gene sequences in related species. The primer pairs designed by this target gene approach are called "intron-flanking primers" or because they are located in exonic sequences which are usually conserved between related species, "conserved primers". They are useful for large-scale single nucleotide polymorphism (SNP) discovery and marker development, especially in species, such as wheat, for which a large number of ESTs are available but for which genome sequences and intron/exon boundaries are not available. To date, no suitable high-throughput tool is available for this purpose. We have developed, the ConservedPrimers 2.0 pipeline, for designing intron-flanking primers for large-scale SNP discovery and marker development, and demonstrated its utility in wheat. This tool uses non-redundant wheat EST sequences, such as wheat contigs and singleton ESTs, and related genomic sequences, such as those of rice, as inputs. It aligns the ESTs to the genomic sequences to identify unique colinear exon blocks and predicts intron lengths. Intron-flanking primers are then designed based on the intron/exon information using the Primer3 core program or BatchPrimer3. Finally, a tab-delimited file containing intron-flanking primer pair sequences and their primer properties is generated for primer ordering and their PCR applications. Using this tool, 1,922 bin-mapped wheat ESTs (31.8% of the 6,045 in total) were found to have unique colinear exon blocks suitable for primer design and 1,821 primer pairs were designed from these single- or low-copy genes for PCR amplification and SNP discovery. With these primers and subsequently designed genome-specific primers, a total of 1,527 loci were found to contain one or more genome-specific SNPs. The ConservedPrimers 2.0 pipeline for designing intron-flanking primers was developed and its

  9. SP-Designer: a user-friendly program for designing species-specific primer pairs from DNA sequence alignments.

    Science.gov (United States)

    Villard, Pierre; Malausa, Thibaut

    2013-07-01

    SP-Designer is an open-source program providing a user-friendly tool for the design of specific PCR primer pairs from a DNA sequence alignment containing sequences from various taxa. SP-Designer selects PCR primer pairs for the amplification of DNA from a target species on the basis of several criteria: (i) primer specificity, as assessed by interspecific sequence polymorphism in the annealing regions, (ii) the biochemical characteristics of the primers and (iii) the intended PCR conditions. SP-Designer generates tables, detailing the primer pair and PCR characteristics, and a FASTA file locating the primer sequences in the original sequence alignment. SP-Designer is Windows-compatible and freely available from http://www2.sophia.inra.fr/urih/sophia_mart/sp_designer/info_sp_designer.php. © 2013 John Wiley & Sons Ltd.

  10. Allele dropout caused by a non-primer-site SNV affecting PCR amplification--a call for next-generation primer design algorithm.

    Science.gov (United States)

    Lam, Ching-wan; Mak, Chloe Miu

    2013-06-05

    PCR-based technology is indispensable for genetic diagnosis. On the other hand, allele dropout is one significant cause of genotyping errors. Most allele dropout mechanisms are related to annealing failure caused by single nucleotide variant (SNV) situated inside the primer sequences. Here, we demonstrate a novel allele dropout mechanism caused by a non-primer-binding-site SNV. We demonstrate that the apparent homozygosity of NM_000137.1(FAH):c.1035_1037del was caused by allele dropout. The non-primer-binding-site SNV causes a strong secondary hairpin structure formation of the PCR products and leads to amplification failure. SNV check of the primer sequences per se during primer design is not adequate to avoid allele dropout. The next-generation primer design software should analyze the secondary structure of primers and template sequence taking SNV in both sequences into account in order to avoid genotyping errors. Copyright © 2013 Elsevier B.V. All rights reserved.

  11. A tool for design of primers for microRNA-specific quantitative RT-qPCR.

    Science.gov (United States)

    Busk, Peter K

    2014-01-28

    MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. I have developed the software miRprimer for automatic design of primers for the method miR-specific RT-qPCR, which is one of the best performing microRNA qPCR methods available. The algorithm is based on an implementation of the previously published rules for manual design of miR-specific primers with the additional feature of evaluating the propensity of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed by this method have been distributed to several labs and used successfully in published studies. The software miRprimer is an automatic and easy method for design of functional primers for miR-specific RT-qPCR. The application is available as stand-alone software that will work on the MS Windows platform and in a developer version written in the Ruby programming language.

  12. PRISE2: software for designing sequence-selective PCR primers and probes.

    Science.gov (United States)

    Huang, Yu-Ting; Yang, Jiue-in; Chrobak, Marek; Borneman, James

    2014-09-25

    PRISE2 is a new software tool for designing sequence-selective PCR primers and probes. To achieve high level of selectivity, PRISE2 allows the user to specify a collection of target sequences that the primers are supposed to amplify, as well as non-target sequences that should not be amplified. The program emphasizes primer selectivity on the 3' end, which is crucial for selective amplification of conserved sequences such as rRNA genes. In PRISE2, users can specify desired properties of primers, including length, GC content, and others. They can interactively manipulate the list of candidate primers, to choose primer pairs that are best suited for their needs. A similar process is used to add probes to selected primer pairs. More advanced features include, for example, the capability to define a custom mismatch penalty function. PRISE2 is equipped with a graphical, user-friendly interface, and it runs on Windows, Macintosh or Linux machines. PRISE2 has been tested on two very similar strains of the fungus Dactylella oviparasitica, and it was able to create highly selective primers and probes for each of them, demonstrating the ability to create useful sequence-selective assays. PRISE2 is a user-friendly, interactive software package that can be used to design high-quality selective primers for PCR experiments. In addition to choosing primers, users have an option to add a probe to any selected primer pair, enabling design of Taqman and other primer-probe based assays. PRISE2 can also be used to design probes for FISH and other hybridization-based assays.

  13. Two generic PCR primer sets for the detection of members of the genus Torradovirus

    NARCIS (Netherlands)

    Verbeek, M.; Tang, J.; Ward, L.

    2012-01-01

    Two degenerate primer pairs were designed for the universal detection of members of the genus Torradovirus. Primer pair Torrado-1F/Torrado-1R was designed based on the RNA-dependent RNA polymerase region located in RNA1 and primer pair Torrado-2F/Torrado-2R based on a region overlapping the two firs

  14. Degenerative primer design and gene sequencing validation for select turkey genes.

    Science.gov (United States)

    Hutsko, Stephanie L; Lilburn, Michael S; Wick, Macdonald

    2016-06-01

    We successfully designed and validated degenerative primers for turkey genes MUC2, RPS13, TBP and TFF2 based on chicken sequences in order to use gene transcription analysis to evaluate (quantify) the mucin transcription to probiotic supplementation in turkeys. Primers were designed for the genes MUC2, TFF2, RPS13 and TBP using a degenerative primer design method based on the available Gallus gallus sequences. All primer sets, which produced a single PCR amplicon of the expected sizes, were cloned into the TOPO(®) vector and then transformed into TOP 10(®) competent cells. Plasmid DNA isolation was performed on the TOP10(®) cell culture and sent for sequencing. Sequences were analyzed using NCBI BLAST. All genes sequenced had over 90% homology with both the chicken and predicted turkey sequences. The sequences were used to design new 100% homologous primer sets for the genes of interest. © 2016 Poultry Science Association Inc.

  15. Mutagenic primer design for mismatch PCR-RFLP SNP genotyping using a genetic algorithm.

    Science.gov (United States)

    Yang, Cheng-Hong; Cheng, Yu-Huei; Yang, Cheng-Huei; Chuang, Li-Yeh

    2012-01-01

    Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) is useful in small-scale basic research studies of complex genetic diseases that are associated with single nucleotide polymorphism (SNP). Designing a feasible primer pair is an important work before performing PCR-RFLP for SNP genotyping. However, in many cases, restriction enzymes to discriminate the target SNP resulting in the primer design is not applicable. A mutagenic primer is introduced to solve this problem. GA-based Mismatch PCR-RFLP Primers Design (GAMPD) provides a method that uses a genetic algorithm to search for optimal mutagenic primers and available restriction enzymes from REBASE. In order to improve the efficiency of the proposed method, a mutagenic matrix is employed to judge whether a hypothetical mutagenic primer can discriminate the target SNP by digestion with available restriction enzymes. The available restriction enzymes for the target SNP are mined by the updated core of SNP-RFLPing. GAMPD has been used to simulate the SNPs in the human SLC6A4 gene under different parameter settings and compared with SNP Cutter for mismatch PCR-RFLP primer design. The in silico simulation of the proposed GAMPD program showed that it designs mismatch PCR-RFLP primers. The GAMPD program is implemented in JAVA and is freely available at http://bio.kuas.edu.tw/gampd/.

  16. Novel computational methods for increasing PCR primer design effectiveness in directed sequencing

    Directory of Open Access Journals (Sweden)

    Busam Dana

    2008-04-01

    Full Text Available Abstract Background Polymerase chain reaction (PCR is used in directed sequencing for the discovery of novel polymorphisms. As the first step in PCR directed sequencing, effective PCR primer design is crucial for obtaining high-quality sequence data for target regions. Since current computational primer design tools are not fully tuned with stable underlying laboratory protocols, researchers may still be forced to iteratively optimize protocols for failed amplifications after the primers have been ordered. Furthermore, potentially identifiable factors which contribute to PCR failures have yet to be elucidated. This inefficient approach to primer design is further intensified in a high-throughput laboratory, where hundreds of genes may be targeted in one experiment. Results We have developed a fully integrated computational PCR primer design pipeline that plays a key role in our high-throughput directed sequencing pipeline. Investigators may specify target regions defined through a rich set of descriptors, such as Ensembl accessions and arbitrary genomic coordinates. Primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the specified target regions. As part of the tiling process, primer pairs are computationally screened to meet the criteria for success with one of two PCR amplification protocols. In the process of improving our sequencing success rate, which currently exceeds 95% for exons, we have discovered novel and accurate computational methods capable of identifying primers that may lead to PCR failures. We reveal the laboratory protocols and their associated, empirically determined computational parameters, as well as describe the novel computational methods which may benefit others in future primer design research. Conclusion The high-throughput PCR primer design pipeline has been very successful in providing the basis for high-quality directed sequencing results and for minimizing

  17. Comparison of Gene Amplification Effect under Three Methods of PCR Based on Degenerate Primers%基于兼并引物的 PCR 扩增特定基因的效果比较

    Institute of Scientific and Technical Information of China (English)

    李志强; 何德; 李翠新

    2015-01-01

    Three PCR methods(conventional PCR, touchdown PCR, nested PCR) were used to amplify the DNA topoisomeraseⅡfragments of Pleurotus ostreatus and P.eryngii var ferulae with degenerate prim-ers,which were designed with the gene sequences of DNA topoisomerase Ⅱfrom NCBI.Their PCR sensi-tivity and specificity were compared .The result showed that the sensitivity and specificity of nested PCR were highest , and its sensitivity was 100 fold higher than conventional PCR , which indicated that the nested PCR was more suitable for PCR amplification under degenerate primers .This study will have some guidance significance to obtain the specific gene through degenerate primers .%根据NCBI上的DNA拓扑异构酶Ⅱ基因序列设计兼并引物,采用常规PCR、降落PCR、巢式PCR三种方法扩增糙皮侧耳和阿魏侧耳的拓扑异构酶Ⅱ部分基因序列,比较三种方法扩增效果的特异性、灵敏度。结果表明,巢式PCR的灵敏度和特异性都优于常规PCR和降落PCR,并且巢式PCR的灵敏度是常规PCR灵敏度的100倍以上,更加适合兼并引物扩增。这对利用兼并引物获取特异基因具有指导意义。

  18. Design of a Combined Ballistic Simulator and Primer Force Experimental Fixture

    Science.gov (United States)

    2015-08-01

    ARL-MR-0896 ●AUG 2015 US Army Research Laboratory Design of a Combined Ballistic Simulator and Primer Force Experimental Fixture...SUBTITLE Design of a Combined Ballistic Simulator and Primer Force Experimental Fixture 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT...Contents List of Figures iv Acknowledgments v 1. Introduction 1 2. Background 1 3. Technical Approach 4 3.1 Hardware Design 4 3.2 Experimental Setup

  19. Design and in vitro evaluation of new rpoB-DGGE primers for ruminants.

    Science.gov (United States)

    Perumbakkam, Sudeep; Craig, A Morrie

    2011-04-01

    Two new primer sets based on the rpoB gene were designed and evaluated with bovine and ovine rumen samples. The newly developed rpoB-DGGE primer set was used along with the 16S rRNA gene-V3, and another (old) rpoB-DGGE-based primer set from a previous study to in vitro compare the bovine and ovine rumen ecosystems. The results indicate a significant (Pprimers used in the analysis. Qualitative comparison of the data provides evidence for the presence of similar phyla profiles between the 16S rRNA gene and the newly developed rpoB primers. A comparison between the two rpoB-based primer sets (old and new) showed that the old rpoB-based primers failed to amplify phylum Bacteroidetes (a common phylum in the rumen) in both bovine and ovine rumen samples. The old and new rpoB-DGGE-based primers amplified a large number of clones belonging to phylum Proteobacteria, providing a useful insight into the microbial structure of the rumen. ChaoI, ACE, Simpson, and Shannon-Weaver index analysis estimated the bovine rumen to be more diverse than the ovine rumen for all three primer sets. These results provide a new insight into the community structure among ruminants using the newly developed primers in this study. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  20. A new approach to primer design for the control of PCR bias in methylation studies

    Directory of Open Access Journals (Sweden)

    Hansen Lise

    2008-07-01

    Full Text Available Abstract Primer design for PCR-based methylation analysis following bisulfite conversion of DNA is considerably more complex than primer design for regular PCR. The choice of the optimal primer set is critical to the performance and correct interpretation of the results. Most methodologies in methylation analysis utilize primers that theoretically amplify methylated and unmethylated templates at the same time. The proportional amplification of all templates is critical but difficult to achieve due to PCR bias favouring the amplification of the unmethylated template. The focus of this brief communication is to point out the important criteria needed for the successful choice of primers that will enable the control of PCR bias in bisulfite based methylation-screening protocols.

  1. Design and evaluation of a specific primer pair for the diagnosis and identification of Acanthamoeba polyphaga.

    Science.gov (United States)

    Ortega-Rivas, Antonio; Lorenzo-Morales, Jacob; Martinez-Carretero, Enrique; Villa Lloberas, Mercedes; Valladares Hernández, Basilio; del Castillo-Remiro, Antonio

    2004-05-01

    Random amplified polymorphism DNA (RAPD) is a useful tool for species identification. The obtained band patterns can be used for specific primer pair design that may be useful for species diagnosis. In this study, a distinctive a 962-bp band in A. polyphaga band patterns was found, by using the OPC20 primer (ACTTCGCCAC). The DNA fragment was used to design a specific primer pair that was useful for the identification of different isolates as A. polyphaga species. A case of A. polyphaga in disseminated acanthamoebiasis affecting mesenteric nodes is also reported.

  2. QuantPrime--a flexible tool for reliable high-throughput primer design for quantitative PCR

    National Research Council Canada - National Science Library

    Arvidsson, Samuel; Kwasniewski, Miroslaw; Riaño-Pachón, Diego Mauricio; Mueller-Roeber, Bernd

    2008-01-01

    ...) assays are becoming increasingly important in genomics research. A major bottleneck in experiment preparation is the design of specific primer pairs, where researchers have to make several informed choices, often outside their area of expertise...

  3. HTP-OligoDesigner: An Online Primer Design Tool for High-Throughput Gene Cloning and Site-Directed Mutagenesis

    National Research Council Canada - National Science Library

    Camilo, Cesar M; Lima, Gustavo M.A; Maluf, Fernando V; Guido, Rafael V.C; Polikarpov, Igor

    2016-01-01

    .... HTP-OligoDesigner was created to provide the scientific community with a simple and intuitive online primer design tool for both laboratory-scale and high-throughput projects of sequence-independent...

  4. Characterization of the 18S rRNA gene for designing universal eukaryote specific primers.

    Science.gov (United States)

    Hadziavdic, Kenan; Lekang, Katrine; Lanzen, Anders; Jonassen, Inge; Thompson, Eric M; Troedsson, Christofer

    2014-01-01

    High throughput sequencing technology has great promise for biodiversity studies. However, an underlying assumption is that the primers used in these studies are universal for the prokaryotic or eukaryotic groups of interest. Full primer universality is difficult or impossible to achieve and studies using different primer sets make biodiversity comparisons problematic. The aim of this study was to design and optimize universal eukaryotic primers that could be used as a standard in future biodiversity studies. Using the alignment of all eukaryotic sequences from the publicly available SILVA database, we generated a full characterization of variable versus conserved regions in the 18S rRNA gene. All variable regions within this gene were analyzed and our results suggested that the V2, V4 and V9 regions were best suited for biodiversity assessments. Previously published universal eukaryotic primers as well as a number of self-designed primers were mapped to the alignment. Primer selection will depend on sequencing technology used, and this study focused on the 454 pyrosequencing GS FLX Titanium platform. The results generated a primer pair yielding theoretical matches to 80% of the eukaryotic and 0% of the prokaryotic sequences in the SILVA database. An empirical test of marine sediments using the AmpliconNoise pipeline for analysis of the high throughput sequencing data yielded amplification of sequences for 71% of all eukaryotic phyla with no isolation of prokaryotic sequences. To our knowledge this is the first characterization of the complete 18S rRNA gene using all eukaryotes present in the SILVA database, providing a robust test for universal eukaryotic primers. Since both in silico and empirical tests using high throughput sequencing retained high inclusion of eukaryotic phyla and exclusion of prokaryotes, we conclude that these primers are well suited for assessing eukaryote diversity, and can be used as a standard in biodiversity studies.

  5. Characterization of the 18S rRNA gene for designing universal eukaryote specific primers.

    Directory of Open Access Journals (Sweden)

    Kenan Hadziavdic

    Full Text Available High throughput sequencing technology has great promise for biodiversity studies. However, an underlying assumption is that the primers used in these studies are universal for the prokaryotic or eukaryotic groups of interest. Full primer universality is difficult or impossible to achieve and studies using different primer sets make biodiversity comparisons problematic. The aim of this study was to design and optimize universal eukaryotic primers that could be used as a standard in future biodiversity studies. Using the alignment of all eukaryotic sequences from the publicly available SILVA database, we generated a full characterization of variable versus conserved regions in the 18S rRNA gene. All variable regions within this gene were analyzed and our results suggested that the V2, V4 and V9 regions were best suited for biodiversity assessments. Previously published universal eukaryotic primers as well as a number of self-designed primers were mapped to the alignment. Primer selection will depend on sequencing technology used, and this study focused on the 454 pyrosequencing GS FLX Titanium platform. The results generated a primer pair yielding theoretical matches to 80% of the eukaryotic and 0% of the prokaryotic sequences in the SILVA database. An empirical test of marine sediments using the AmpliconNoise pipeline for analysis of the high throughput sequencing data yielded amplification of sequences for 71% of all eukaryotic phyla with no isolation of prokaryotic sequences. To our knowledge this is the first characterization of the complete 18S rRNA gene using all eukaryotes present in the SILVA database, providing a robust test for universal eukaryotic primers. Since both in silico and empirical tests using high throughput sequencing retained high inclusion of eukaryotic phyla and exclusion of prokaryotes, we conclude that these primers are well suited for assessing eukaryote diversity, and can be used as a standard in biodiversity studies.

  6. Characterization of the 18S rRNA Gene for Designing Universal Eukaryote Specific Primers

    Science.gov (United States)

    Hadziavdic, Kenan; Lekang, Katrine; Lanzen, Anders; Jonassen, Inge; Thompson, Eric M.; Troedsson, Christofer

    2014-01-01

    High throughput sequencing technology has great promise for biodiversity studies. However, an underlying assumption is that the primers used in these studies are universal for the prokaryotic or eukaryotic groups of interest. Full primer universality is difficult or impossible to achieve and studies using different primer sets make biodiversity comparisons problematic. The aim of this study was to design and optimize universal eukaryotic primers that could be used as a standard in future biodiversity studies. Using the alignment of all eukaryotic sequences from the publicly available SILVA database, we generated a full characterization of variable versus conserved regions in the 18S rRNA gene. All variable regions within this gene were analyzed and our results suggested that the V2, V4 and V9 regions were best suited for biodiversity assessments. Previously published universal eukaryotic primers as well as a number of self-designed primers were mapped to the alignment. Primer selection will depend on sequencing technology used, and this study focused on the 454 pyrosequencing GS FLX Titanium platform. The results generated a primer pair yielding theoretical matches to 80% of the eukaryotic and 0% of the prokaryotic sequences in the SILVA database. An empirical test of marine sediments using the AmpliconNoise pipeline for analysis of the high throughput sequencing data yielded amplification of sequences for 71% of all eukaryotic phyla with no isolation of prokaryotic sequences. To our knowledge this is the first characterization of the complete 18S rRNA gene using all eukaryotes present in the SILVA database, providing a robust test for universal eukaryotic primers. Since both in silico and empirical tests using high throughput sequencing retained high inclusion of eukaryotic phyla and exclusion of prokaryotes, we conclude that these primers are well suited for assessing eukaryote diversity, and can be used as a standard in biodiversity studies. PMID:24516555

  7. PRIMEGENSw3: a web-based tool for high-throughput primer and probe design.

    Science.gov (United States)

    Kushwaha, Garima; Srivastava, Gyan Prakash; Xu, Dong

    2015-01-01

    Highly specific and efficient primer and probe design has been a major hurdle in many high-throughput techniques. Successful implementation of any PCR or probe hybridization technique depends on the quality of primers and probes used in terms of their specificity and cross-hybridization. Here we describe PRIMEGENSw3, a set of web-based utilities for high-throughput primer and probe design. These utilities allow users to select genomic regions and to design primer/probe for selected regions in an interactive, user-friendly, and automatic fashion. The system runs the PRIMEGENS algorithm in the back-end on the high-performance server with the stored genomic database or user-provided custom database for cross-hybridization check. Cross-hybridization is checked not only using BLAST but also by checking mismatch positions and energy calculation of potential hybridization hits. The results can be visualized online and also can be downloaded. The average success rate of primer design using PRIMEGENSw3 is ~90 %. The web server also supports primer design for methylated sequences, which is used in epigenetic studies. Stand-alone version of the software is also available for download at the website.

  8. Design and evaluation of reverse transcription nested PCR primers for the detection of betanodavirus in finfish.

    Science.gov (United States)

    Rajan, J Joseph Sahaya; Praveena, P Ezhil; Bhuvaneswari, T; Jithendran, K P

    2016-06-01

    Viral encephalopathy and retinopathy otherwise known as viral nervous necrosis (VNN) is a neuropathological condition affecting more than 50 fish species worldwide, mostly marine. Different PCR protocols with specific primers were reported from many countries for confirmation of VNN in fishes. In the present study, two pairs of primers were designed and evaluated for the diagnosis of clinical and subclinical cases of infections from field. These primers designated as BARL-F1/BARL-R1 amplified a 902 bp product in the variable region (T4) of the coat protein gene by first step PCR. Nested PCR primers BARL-F2/BARL-R2 amplified a fragment of 313 bp. The results were comparable with other commonly used primer sets such as F2/R3 and RG668f/RG919r primers. These new primers could detect betanodavirus in standard reference samples containing low, moderate and high viral load. Known positive and negative control samples of fish also revealed a predictive value of 100 % by RT-PCR diagnosis.

  9. Comprehensive primer design for analysis of population genetics in non-sequenced organisms.

    Directory of Open Access Journals (Sweden)

    Ayumi Tezuka

    Full Text Available Nuclear sequence markers are useful tool for the study of the history of populations and adaptation. However, it is not easy to obtain multiple nuclear primers for organisms with poor or no genomic sequence information. Here we used the genomes of organisms that have been fully sequenced to design comprehensive sets of primers to amplify polymorphic genomic fragments of multiple nuclear genes in non-sequenced organisms. First, we identified a large number of candidate polymorphic regions that were flanked on each side by conserved regions in the reference genomes. We then designed primers based on these conserved sequences and examined whether the primers could be used to amplify sequences in target species, montane brown frog (Rana ornativentris, anole lizard (Anolis sagrei, guppy (Poecilia reticulata, and fruit fly (Drosophila melanogaster, for population genetic analysis. We successfully obtained polymorphic markers for all target species studied. In addition, we found that sequence identities of the regions between the primer sites in the reference genomes affected the experimental success of DNA amplification and identification of polymorphic loci in the target genomes, and that exonic primers had a higher success rate than intronic primers in amplifying readable sequences. We conclude that this comparative genomic approach is a time- and cost-effective way to obtain polymorphic markers for non-sequenced organisms, and that it will contribute to the further development of evolutionary ecology and population genetics for non-sequenced organisms, aiding in the understanding of the genetic basis of adaptation.

  10. Comprehensive primer design for analysis of population genetics in non-sequenced organisms.

    Science.gov (United States)

    Tezuka, Ayumi; Matsushima, Noe; Nemoto, Yoriko; Akashi, Hiroshi D; Kawata, Masakado; Makino, Takashi

    2012-01-01

    Nuclear sequence markers are useful tool for the study of the history of populations and adaptation. However, it is not easy to obtain multiple nuclear primers for organisms with poor or no genomic sequence information. Here we used the genomes of organisms that have been fully sequenced to design comprehensive sets of primers to amplify polymorphic genomic fragments of multiple nuclear genes in non-sequenced organisms. First, we identified a large number of candidate polymorphic regions that were flanked on each side by conserved regions in the reference genomes. We then designed primers based on these conserved sequences and examined whether the primers could be used to amplify sequences in target species, montane brown frog (Rana ornativentris), anole lizard (Anolis sagrei), guppy (Poecilia reticulata), and fruit fly (Drosophila melanogaster), for population genetic analysis. We successfully obtained polymorphic markers for all target species studied. In addition, we found that sequence identities of the regions between the primer sites in the reference genomes affected the experimental success of DNA amplification and identification of polymorphic loci in the target genomes, and that exonic primers had a higher success rate than intronic primers in amplifying readable sequences. We conclude that this comparative genomic approach is a time- and cost-effective way to obtain polymorphic markers for non-sequenced organisms, and that it will contribute to the further development of evolutionary ecology and population genetics for non-sequenced organisms, aiding in the understanding of the genetic basis of adaptation.

  11. MSP-HTPrimer: a high-throughput primer design tool to improve assay design for DNA methylation analysis in epigenetics.

    Science.gov (United States)

    Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas

    2016-01-01

    Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic

  12. UniPrime2: a web service providing easier Universal Primer design.

    Science.gov (United States)

    Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C

    2009-07-01

    The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.

  13. Estimation of teaching-learning-based optimization primer design using regression analysis for different melting temperature calculations.

    Science.gov (United States)

    Cheng, Yu-Huei

    2015-01-01

    Primers plays important role in polymerase chain reaction (PCR) experiments, thus it is necessary to select characteristic primers. Unfortunately, manual primer design manners are time-consuming and easy to get human negligence because many PCR constraints must be considered simultaneously. Automatic programs for primer design were developed urgently. In this study, the teaching-learning-based optimization (TLBO), a robust and free of algorithm-specific parameters method, is applied to screen primers conformed primer constraints. The optimal primer frequency (OPF) based on three known melting temperature formulas is estimated by 500 runs for primer design in each different number of generations. We selected optimal primers from fifty random nucleotide sequences of Homo sapiens at NCBI. The results indicate that the SantaLucia's formula is better coupled with the method to get higher optimal primer frequency and shorter CPU-time than the Wallace's formula and the Bolton and McCarthy's formula. Through the regression analysis, we also find the generations are significantly associated with the optimal primer frequency. The results are helpful for developing the novel TLBO-based computational method to design feasible primers.

  14. A tool for design of primers for microRNA-specific quantitative RT-qPCR. BMC Bioinformatics

    DEFF Research Database (Denmark)

    Busk, Peter Kamp

    2014-01-01

    Background MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come...... design of primers for the method miR-specific RT-qPCR, which is one of the best performing microRNA qPCR methods available. The algorithm is based on an implementation of the previously published rules for manual design of miR-specific primers with the additional feature of evaluating the propensity...... of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed...

  15. CloneAssistant 1.0: a stand-alone software for automated cloning primer design.

    Science.gov (United States)

    Shao, Chaogang; Meng, Yijun; Lv, Shaolei; Zhong, Wei; Wang, Zheyu; Chen, Ming

    2010-11-01

    "CloneAssistant 1.0" is a stand-alone software compatible with the current Windows operating systems, which can automatically design cloning primers with full consideration of the sequence information of vectors and genes, cloning strategies, the principles of primer design, reading frames, position effects, and enzymatic reaction conditions for users. Five internal XML (extensible markup language) databases [restriction enzymes, plasmids, universal buffers, PCR (polymerase chain reaction) protection bases, and an MCS (multiple cloning site) double digest interference database] were established to serve as the basic support for "CloneAssistant 1.0". The primer pairs designed are sorted according to the difficulty of the follow-up experiments. Once a primer pair is selected by the user, detailed experimental guidance for this primer pair will be provided. In addition, "CloneAssistant 1.0" can be used for restriction map analysis, ORF (open reading frame) finding, sequence alignment and complementary analysis, translation, restriction enzyme and universal buffer queries, and isocaudamer analysis. "CloneAssistant 1.0" makes gene clone design much easier, and it can be freely downloaded from http://bis.zju.edu.cn/clone. Copyright © 2010 Elsevier B.V. All rights reserved.

  16. Polarization degenerate micropillars fabricated by designing elliptical oxide apertures

    CERN Document Server

    Bakker, Morten P; Zhan, Alan; Coldren, Larry A; van Exter, Martin P; Bouwmeester, Dirk

    2014-01-01

    A method for fabrication of polarization degenerate oxide apertured micropillar cavities is demon- strated. Micropillars are etched such that the size and shape of the oxide front is controlled. The polarization splitting in the circular micropillar cavities due to the native and strain induced bire- fringence can be compensated by elongating the oxide front in the [110] direction, thereby reducing stress in this direction. By using this technique we fabricate a polarization degenerate cavity with a quality factor of 1.7*?10^4 and a mode volume of 2.7 u?m3, enabling a calculated maximum Purcell factor of 11.

  17. Experimental Design and Some Threats to Experimental Validity: A Primer

    Science.gov (United States)

    Skidmore, Susan

    2008-01-01

    Experimental designs are distinguished as the best method to respond to questions involving causality. The purpose of the present paper is to explicate the logic of experimental design and why it is so vital to questions that demand causal conclusions. In addition, types of internal and external validity threats are discussed. To emphasize the…

  18. A tool for design of primers for microRNA-specific quantitative RT-qPCR. BMC Bioinformatics

    DEFF Research Database (Denmark)

    Busk, Peter Kamp

    2014-01-01

    at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. Results I have developed the software miRprimer for automatic...... design of primers for the method miR-specific RT-qPCR, which is one of the best performing microRNA qPCR methods available. The algorithm is based on an implementation of the previously published rules for manual design of miR-specific primers with the additional feature of evaluating the propensity...... of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed...

  19. Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia.

    Science.gov (United States)

    Zuiter, Afnan Saeid; Sawwan, Jammal; Al Abdallat, Ayed

    2012-08-10

    Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs) and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.

  20. Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

    Directory of Open Access Journals (Sweden)

    Zuiter Afnan

    2012-08-01

    Full Text Available Abstract Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.

  1. Efficient newly designed primers for the amplification and sequencing of bird mitochondrial genomes.

    Science.gov (United States)

    Amer, Sayed A M; Ahmed, Mohamed Mohamed; Shobrak, Mohammed

    2013-01-01

    In the present study, 27 mitochondrial genomes of diverse avian supra-orders were collected from the Genbank database and their genes were aligned separately. From the alignments, the conserved sequences were selected to design novel conserved primers for amplification and sequencing of the different mitochondrial genes. The reproducibility of these primers was tested in the amplification and sequencing of diverse avian supra-order mitochondrial genomes and was confirmed. This method helped in designing a new set of primers to accelerate both the amplification and the sequencing of bird mitogenomes. It also aids in building mitogenome markers in studying the genetic framework of endemic birds as a preliminary strategy for conservation management of them.

  2. MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR.

    Science.gov (United States)

    Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo

    2015-11-16

    Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. HTP-OligoDesigner: An Online Primer Design Tool for High-Throughput Gene Cloning and Site-Directed Mutagenesis.

    Science.gov (United States)

    Camilo, Cesar M; Lima, Gustavo M A; Maluf, Fernando V; Guido, Rafael V C; Polikarpov, Igor

    2016-01-01

    Following burgeoning genomic and transcriptomic sequencing data, biochemical and molecular biology groups worldwide are implementing high-throughput cloning and mutagenesis facilities in order to obtain a large number of soluble proteins for structural and functional characterization. Since manual primer design can be a time-consuming and error-generating step, particularly when working with hundreds of targets, the automation of primer design process becomes highly desirable. HTP-OligoDesigner was created to provide the scientific community with a simple and intuitive online primer design tool for both laboratory-scale and high-throughput projects of sequence-independent gene cloning and site-directed mutagenesis and a Tm calculator for quick queries.

  4. Fatigue criterion to system design, life and reliability: A primer

    Science.gov (United States)

    Zaretsky, Erwin V.

    1992-01-01

    A method for estimating a component's design survivability by incorporating finite element analysis and probabilistic material properties was developed. The method evaluates design parameters through direct comparisons of component survivability expressed in terms of Weibull parameters. The analysis was applied to a rotating disk with mounting bolt holes. The highest probability of failure occurred at, or near, the maximum shear stress region of the bolt holes. Distribution of material failure as a function of Weibull slope affects the probability of survival. Where Weibull parameters are unknown for a rotating disk, it may be permissible to assume Weibull parameters, as well as the stress-life exponent, in order to determine the qualitative effect of disk speed on the probability of survival.

  5. A web-based adaptive tutor to teach PCR primer design

    NARCIS (Netherlands)

    van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.

    2012-01-01

    When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used

  6. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    Science.gov (United States)

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  7. A web-based adaptive tutor to teach PCR primer design

    NARCIS (Netherlands)

    van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.

    2012-01-01

    When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used par

  8. A Web-Based Adaptive Tutor to Teach PCR Primer Design

    Science.gov (United States)

    van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.

    2012-01-01

    When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used part of the Taxonomy of Educational Objectives (the…

  9. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    Science.gov (United States)

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  10. A Web-Based Adaptive Tutor to Teach PCR Primer Design

    Science.gov (United States)

    van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.

    2012-01-01

    When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used part of the Taxonomy of Educational Objectives (the…

  11. A web-based adaptive tutor to teach PCR primer design

    NARCIS (Netherlands)

    van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.

    2012-01-01

    When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used par

  12. A Web-based Adaptive Tutor to Teach PCR Primer Design

    NARCIS (Netherlands)

    Seters, van J.R.; Wellink, J.; Tramper, J.; Goedhart, M.J.; Ossevoort, M.A.

    2012-01-01

    When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used par

  13. An in silico approach to design T-arms primers for VDR locus to detect osteoporosis

    OpenAIRE

    Maheswari, C.; Sheebanancy, K.; Kavitha, V. J.

    2017-01-01

    Osteoporosis is a skeletal disorder characterized by an increased risk of fractures. Studies have shown that BMD and bone turnover are under strong genetic control. The polymorphisms in the Vitamin D receptor (VDR) have been implicated in many studies as a cause of osteoporosis. We aimed at developing a molecular diagnostic kit to detect osteoporosis. We started with designing multiplex primers and finally designed T-ARMS PCR Kit for the VDR locus. We used the currently available softwares fo...

  14. Confronting two-pair primer design for enzyme-free SNP genotyping based on a genetic algorithm

    Directory of Open Access Journals (Sweden)

    Chuang Li-Yeh

    2010-10-01

    Full Text Available Abstract Background Polymerase chain reaction with confronting two-pair primers (PCR-CTPP method produces allele-specific DNA bands of different lengths by adding four designed primers and it achieves the single nucleotide polymorphism (SNP genotyping by electrophoresis without further steps. It is a time- and cost-effective SNP genotyping method that has the advantage of simplicity. However, computation of feasible CTPP primers is still challenging. Results In this study, we propose a GA (genetic algorithm-based method to design a feasible CTPP primer set to perform a reliable PCR experiment. The SLC6A4 gene was tested with 288 SNPs for dry dock experiments which indicated that the proposed algorithm provides CTPP primers satisfied most primer constraints. One SNP rs12449783 in the SLC6A4 gene was taken as an example for the genotyping experiments using electrophoresis which validated the GA-based design method as providing reliable CTPP primer sets for SNP genotyping. Conclusions The GA-based CTPP primer design method provides all forms of estimation for the common primer constraints of PCR-CTPP. The GA-CTPP program is implemented in JAVA and a user-friendly input interface is freely available at http://bio.kuas.edu.tw/ga-ctpp/.

  15. Confronting two-pair primer design for enzyme-free SNP genotyping based on a genetic algorithm.

    Science.gov (United States)

    Yang, Cheng-Hong; Cheng, Yu-Huei; Chuang, Li-Yeh; Chang, Hsueh-Wei

    2010-10-13

    Polymerase chain reaction with confronting two-pair primers (PCR-CTPP) method produces allele-specific DNA bands of different lengths by adding four designed primers and it achieves the single nucleotide polymorphism (SNP) genotyping by electrophoresis without further steps. It is a time- and cost-effective SNP genotyping method that has the advantage of simplicity. However, computation of feasible CTPP primers is still challenging. In this study, we propose a GA (genetic algorithm)-based method to design a feasible CTPP primer set to perform a reliable PCR experiment. The SLC6A4 gene was tested with 288 SNPs for dry dock experiments which indicated that the proposed algorithm provides CTPP primers satisfied most primer constraints. One SNP rs12449783 in the SLC6A4 gene was taken as an example for the genotyping experiments using electrophoresis which validated the GA-based design method as providing reliable CTPP primer sets for SNP genotyping. The GA-based CTPP primer design method provides all forms of estimation for the common primer constraints of PCR-CTPP. The GA-CTPP program is implemented in JAVA and a user-friendly input interface is freely available at http://bio.kuas.edu.tw/ga-ctpp/.

  16. Edesign: Primer and Enhanced Internal Probe Design Tool for Quantitative PCR Experiments and Genotyping Assays.

    Directory of Open Access Journals (Sweden)

    Yasumasa Kimura

    Full Text Available Analytical PCR experiments preferably use internal probes for monitoring the amplification reaction and specific detection of the amplicon. Such internal probes have to be designed in close context with the amplification primers, and may require additional considerations for the detection of genetic variations. Here we describe Edesign, a new online and stand-alone tool for designing sets of PCR primers together with an internal probe for conducting quantitative real-time PCR (qPCR and genotypic experiments. Edesign can be used for selecting standard DNA oligonucleotides like for instance TaqMan probes, but has been further extended with new functions and enhanced design features for Eprobes. Eprobes, with their single thiazole orange-labelled nucleotide, allow for highly sensitive genotypic assays because of their higher DNA binding affinity as compared to standard DNA oligonucleotides. Using new thermodynamic parameters, Edesign considers unique features of Eprobes during primer and probe design for establishing qPCR experiments and genotyping by melting curve analysis. Additional functions in Edesign allow probe design for effective discrimination between wild-type sequences and genetic variations either using standard DNA oligonucleotides or Eprobes. Edesign can be freely accessed online at http://www.dnaform.com/edesign2/, and the source code is available for download.

  17. Edesign: Primer and Enhanced Internal Probe Design Tool for Quantitative PCR Experiments and Genotyping Assays.

    Science.gov (United States)

    Kimura, Yasumasa; Soma, Takahiro; Kasahara, Naoko; Delobel, Diane; Hanami, Takeshi; Tanaka, Yuki; de Hoon, Michiel J L; Hayashizaki, Yoshihide; Usui, Kengo; Harbers, Matthias

    2016-01-01

    Analytical PCR experiments preferably use internal probes for monitoring the amplification reaction and specific detection of the amplicon. Such internal probes have to be designed in close context with the amplification primers, and may require additional considerations for the detection of genetic variations. Here we describe Edesign, a new online and stand-alone tool for designing sets of PCR primers together with an internal probe for conducting quantitative real-time PCR (qPCR) and genotypic experiments. Edesign can be used for selecting standard DNA oligonucleotides like for instance TaqMan probes, but has been further extended with new functions and enhanced design features for Eprobes. Eprobes, with their single thiazole orange-labelled nucleotide, allow for highly sensitive genotypic assays because of their higher DNA binding affinity as compared to standard DNA oligonucleotides. Using new thermodynamic parameters, Edesign considers unique features of Eprobes during primer and probe design for establishing qPCR experiments and genotyping by melting curve analysis. Additional functions in Edesign allow probe design for effective discrimination between wild-type sequences and genetic variations either using standard DNA oligonucleotides or Eprobes. Edesign can be freely accessed online at http://www.dnaform.com/edesign2/, and the source code is available for download.

  18. Selection strategy and the design of hybrid oligonucleotide primers for RACE-PCR: cloning a family of toxin-like sequences from Agelena orientalis

    Directory of Open Access Journals (Sweden)

    Lipkin Alexey

    2007-05-01

    Full Text Available Abstract Background the use of specific but partially degenerate primers for nucleic acid hybridisations and PCRs amplification of known or unknown gene families was first reported well over a decade ago and the technique has been used widely since then. Results here we report a novel and successful selection strategy for the design of hybrid partially degenerate primers for use with RT-PCR and RACE-PCR for the identification of unknown gene families. The technique (named PaBaLiS has proven very effective as it allowed us to identify and clone a large group of mRNAs encoding neurotoxin-like polypeptide pools from the venom of Agelena orientalis species of spider. Our approach differs radically from the generally accepted CODEHOP principle first reported in 1998. Most importantly, our method has proven very efficient by performing better than an independently generated high throughput EST cloning programme. Our method yielded nearly 130 non-identical sequences from Agelena orientalis, whilst the EST cloning technique yielded only 48 non-identical sequences from 2100 clones obtained from the same Agelena material. In addition to the primer design approach reported here, which is almost universally applicable to any PCR cloning application, our results also indicate that venom of Agelena orientalis spider contains a much larger family of related toxin-like sequences than previously thought. Conclusion with upwards of 100,000 species of spider thought to exist, and a propensity for producing diverse peptide pools, many more peptides of pharmacological importance await discovery. We envisage that some of these peptides and their recombinant derivatives will provide a new range of tools for neuroscience research and could also facilitate the development of a new generation of analgesic drugs and insecticides.

  19. MSRE-HTPrimer: a high-throughput and genome-wide primer design pipeline optimized for epigenetic research.

    Science.gov (United States)

    Pandey, Ram Vinay; Pulverer, Walter; Walter, Pulverer; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas

    2016-01-01

    Methylation-sensitive restriction enzymes-polymerase chain reaction (MSRE-PCR) has been used in epigenetic research to identify genome-wide and gene-specific DNA methylation. Currently, epigenome-wide discovery studies provide many candidate regions for which the MSREqPCR approach can be very effective to confirm the findings. MSREqPCR provides high multiplexing capabilities also when starting with limited amount of DNA-like cfDNA to validate many targets in a time- and cost-effective manner. Multiplex design is challenging and cumbersome to define specific primers in an effective manner, and no suitable software tools are freely available for high-throughput primer design in a time-effective manner and to automatically annotate the resulting primers with known SNPs, CpG, repeats, and RefSeq genes. Therefore a robust, powerful, high-throughput, optimized, and methylation-specific primer design tool with great accuracy will be very useful. We have developed a novel pipeline, called MSRE-HTPrimer, to design MSRE-PCR and genomic PCR primers pairs in a very efficient manner and with high success rate. First, our pipeline designs all possible PCR primer pairs and oligos, followed by filtering for SNPs loci and repeat regions. Next, each primer pair is annotated with the number of cut sites in primers and amplicons, upstream and downstream genes, and CpG islands loci. Finally, MSRE-HTPrimer selects resulting primer pairs for all target sequences based on a custom quality matrix defined by the user. MSRE-HTPrimer produces a table for all resulting primer pairs as well as a custom track in GTF file format for each target sequence to visualize it in UCSC genome browser. MSRE-HTPrimer, based on Primer3, is a high-throughput pipeline and has no limitation on the number and size of target sequences for primer design and provides full flexibility to customize it for specific requirements. It is a standalone web-based pipeline, which is fully configured within a virtual machine

  20. PTPan--overcoming memory limitations in oligonucleotide string matching for primer/probe design.

    Science.gov (United States)

    Eissler, Tilo; Hodges, Christopher P; Meier, Harald

    2011-10-15

    Nucleic acid diagnostics has high demands for non-heuristic exact and approximate oligonucleotide string matching concerning in silico primer/probe design in huge nucleic acid sequence collections. Unfortunately, public sequence repositories grow much faster than computer hardware performance and main memory capacity do. This growth imposes severe problems on existing oligonucleotide primer/probe design applications necessitating new approaches based on space-efficient indexing structures. We developed PTPan (spoken Peter Pan, 'PT' is for Position Tree, the earlier name of suffix trees), a space-efficient indexing structure for approximate oligonucleotide string matching in nucleic acid sequence data. Based on suffix trees, it combines partitioning, truncation and a new suffix tree stream compression to deal with large amounts of aligned and unaligned data. PTPan operates efficiently in main memory and on secondary storage, balancing between memory consumption and runtime during construction and application. Based on PTPan, applications supporting similarity search and primer/probe design have been implemented, namely FindFamily, ProbeMatch and ProbeDesign. All three use a weighted Levenshtein distance metric for approximative queries to find and rate matches with indels as well as substitutions. We integrated PTPan in the worldwide used software package ARB to demonstrate usability and performance. Comparing PTPan and the original ARB index for the very large ssu-rRNA database SILVA, we recognized a shorter construction time, extended functionality and dramatically reduced memory requirements at the price of expanded, but very reasonable query times. PTPan enables indexing of huge nucleic acid sequence collections at reasonable application response times. Not being limited by main memory, PTPan constitutes a major advancement regarding rapid oligonucleotide string matching in primer/probe design now and in the future facing the enormous growth of molecular

  1. Specificity of Methylation Assays in Cancer Research: A Guideline for Designing Primers and Probes

    Directory of Open Access Journals (Sweden)

    Zeinab Barekati

    2010-01-01

    Full Text Available DNA methylation is an epigenetic regulation mechanism of genomic function, and aberrant methylation pattern has been found to be a common event in many diseases and human cancers. A large number of cancer studies have been focused on identification of methylation changes as biomarkers (i.e., breast cancer. However, still clinical use of them is very limited because of lack of specificity and sensitivity for diagnostic test. This highlights the critical need for specific primer and probe design to avoid false-positive detection of methylation profiling. The guideline and online web tools that are introduced in this paper might help to perform a successful experiment and to develop specific diagnosis biomarkers by designing right primer pair and probe prior to experimental step.

  2. PRIMEGENS-v2: genome-wide primer design for analyzing DNA methylation patterns of CpG islands.

    Science.gov (United States)

    Srivastava, Gyan P; Guo, Juyuan; Shi, Huidong; Xu, Dong

    2008-09-01

    DNA methylation plays important roles in biological processes and human diseases, especially cancers. High-throughput bisulfite genomic sequencing based on new generation of sequencers, such as the 454-sequencing system provides an efficient method for analyzing DNA methylation patterns. The successful implementation of this approach depends on the use of primer design software capable of performing genome-wide scan for optimal primers from in silico bisulfite-treated genome sequences. We have developed a method, which fulfills this requirement and conduct primer design for sequences including regions of given promoter CpG islands. The developed method has been implemented using the C and JAVA programming languages. The primer design results were tested in the PCR experiments of 96 selected human DNA sequences containing CpG islands in the promoter regions. The results indicate that this method is efficient and reliable for designing sequence-specific primers. The sequence-specific primer design for DNA meth-ylated sequences including CpG islands has been integrated into the second version of PRIMEGENS as one of the primer design features. The software is freely available for academic use at http://digbio.missouri.edu/primegens/.

  3. STITCHER: A web resource for high-throughput design of primers for overlapping PCR applications.

    Science.gov (United States)

    O'Halloran, Damien M

    2015-06-01

    Overlapping PCR is routinely used in a wide number of molecular applications. These include stitching PCR fragments together, generating fluorescent transcriptional and translational fusions, inserting mutations, making deletions, and PCR cloning. Overlapping PCR is also used for genotyping by traditional PCR techniques and in detection experiments using techniques such as loop-mediated isothermal amplification (LAMP). STITCHER is a web tool providing a central resource for researchers conducting all types of overlapping PCR experiments with an intuitive interface for automated primer design that's fast, easy to use, and freely available online (http://ohalloranlab.net/STITCHER.html). STITCHER can handle both single sequence and multi-sequence input, and specific features facilitate numerous other PCR applications, including assembly PCR, adapter PCR, and primer walking. Field PCR, and in particular, LAMP, offers promise as an on site tool for pathogen detection in underdeveloped areas, and STITCHER includes off-target detection features for pathogens commonly targeted using LAMP technology.

  4. FONZIE: An optimized pipeline for minisatellite marker discovery and primer design from large sequence data sets

    Directory of Open Access Journals (Sweden)

    Balesdent Marie-Hélène

    2010-11-01

    Full Text Available Abstract Background Micro-and minisatellites are among the most powerful genetic markers known to date. They have been used as tools for a large number of applications ranging from gene mapping to phylogenetic studies and isolate typing. However, identifying micro-and minisatellite markers on large sequence data sets is often a laborious process. Results FONZIE was designed to successively 1 perform a search for markers via the external software Tandem Repeat Finder, 2 exclude user-defined specific genomic regions, 3 screen for the size and the percent matches of each relevant marker found by Tandem Repeat Finder, 4 evaluate marker specificity (i.e., occurrence of the marker as a single copy in the genome using BLAST2.0, 5 design minisatellite primer pairs via the external software Primer3, and 6 check the specificity of each final PCR product by BLAST. A final file returns to users all the results required to amplify markers. A biological validation of the approach was performed using the whole genome sequence of the phytopathogenic fungus Leptosphaeria maculans, showing that more than 90% of the minisatellite primer pairs generated by the pipeline amplified a PCR product, 44.8% of which showed agarose-gel resolvable polymorphism between isolates. Segregation analyses confirmed that the polymorphic minisatellites corresponded to single-locus markers. Conclusion FONZIE is a stand-alone and user-friendly application developed to minimize tedious manual operations, reduce errors, and speed up the search for efficient minisatellite and microsatellite markers departing from whole-genome sequence data. This pipeline facilitates the integration of data and provides a set of specific primer sequences for PCR amplification of single-locus markers. FONZIE is freely downloadable at: http://www.versailles-grignon.inra.fr/bioger/equipes/leptosphaeria_maculans/outils_d_analyses/fonzie

  5. FastPCR: An in silico tool for fast primer and probe design and advanced sequence analysis.

    Science.gov (United States)

    Kalendar, Ruslan; Khassenov, Bekbolat; Ramankulov, Yerlan; Samuilova, Olga; Ivanov, Konstantin I

    2017-07-01

    Polymerase chain reaction (PCR) is one of the most important laboratory techniques used in molecular biology, genetics and molecular diagnostics. The success of a PCR-based method largely depends on the correct nucleic acid sequence analysis in silico prior to a wet-bench experiment. Here, we report the development of an online Java-based software for virtual PCR on linear or circular DNA templates and multiple primer or probe search from large or small databases. Primer or probe sensitivity and specificity are predicted by searching a database to find sequences with an optimal number of mismatches, similarity and stability. The software determines primer location, orientation, efficiency of binding and calculates primer melting temperatures for standard and degenerate oligonucleotides. The software is suitable for batch file processing, which is essential for automation when working with large amounts of data. The online Java software is available for download at http://primerdigital.com/tools/pcr.html. Accession numbers for the sequences resulting from this study: EU140956 EU177767 EU867815 EU882730 FJ975775-FJ975780 HM481419 HM481420 KC686837-KC686839 KM262797. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. A Novel Teaching-Learning-Based Optimization for Improved Mutagenic Primer Design in Mismatch PCR-RFLP SNP Genotyping.

    Science.gov (United States)

    Cheng, Yu-Huei

    2016-01-01

    Many single nucleotide polymorphisms (SNPs) for complex genetic diseases are genotyped by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) in small-scale basic research studies. It is an essential work to design feasible PCR-RFLP primer pair and find out available restriction enzymes to recognize the target SNP for PCR experiments. However, many SNPs are incapable of performing PCR-RFLP makes SNP genotyping become unpractical. A genetic algorithm (GA) had been proposed for designing mutagenic primer and get available restriction enzymes, but it gives an unrefined solution in mutagenic primers. In order to improve the mutagenic primer design, we propose TLBOMPD (TLBO-based Mutagenic Primer Design) a novel computational intelligence-based method that uses the notion of "teaching and learning" to search for more feasible mutagenic primers and provide the latest available restriction enzymes. The original Wallace's formula for the calculation of melting temperature is maintained, and more accurate calculation formulas of GC-based melting temperature and thermodynamic melting temperature are introduced into the proposed method. Mutagenic matrix is also reserved to increase the efficiency of judging a hypothetical mutagenic primer if involve available restriction enzymes for recognizing the target SNP. Furthermore, the core of SNP-RFLPing version 2 is used to enhance the mining work for restriction enzymes based on the latest REBASE. Twenty-five SNPs with mismatch PCR-RFLP screened from 288 SNPs in human SLC6A4 gene are used to appraise the TLBOMPD. Also, the computational results are compared with those of the GAMPD. In the future, the usage of the mutagenic primers in the wet lab needs to been validated carefully to increase the reliability of the method. The TLBOMPD is implemented in JAVA and it is freely available at http://tlbompd.googlecode.com/.

  7. Statistical genetics with application to population-based study design: a primer for clinicians.

    Science.gov (United States)

    Beyene, Joseph; Pare, Guillaume

    2014-02-01

    With the completion of the entire human genome sequence and remarkable advances in genotyping technologies, there has been an increased interest in the application of genetics and genomics in biomedical research over the last decade. Large-scale population-based genetic association studies have now become routine and their application to several multifactorial diseases such as cardiovascular disorders has led to the identification of a number of novel susceptibility genes. However, to be able to interpret results from such studies, clinicians need to have a basic understanding of unique concepts and issues related to this fast-moving area of research. In this primer, we provide a broad overview of design, analysis, and methodological issues with a focus on population-based study design.

  8. Improvements in Limb Kinetic Apraxia by Repetition of a Newly Designed Facilitation Exercise in a Patient with Corticobasal Degeneration

    Science.gov (United States)

    Kawahira, Kazumi; Noma, Tomokazu; Iiyama, Junichi; Etoh, Seiji; Ogata, Atsuko; Shimodozono, Megumi

    2009-01-01

    Corticobasal degeneration is a progressive neurological disorder characterized by a combination of parkinsonism and cortical dysfunction such as limb kinetic apraxia, alien limb phenomenon, and dementia. To study the effect of repetitive facilitation exercise (RFE) in a patient with corticobasal degeneration, we used a newly designed facilitation…

  9. Exon-primed, intron-crossing (EPIC) loci for five nuclear genes in deep-sea protobranch bivalves: primer design, PCR protocols and locus utility.

    Science.gov (United States)

    Jennings, Robert M; Etter, R J

    2011-11-01

    We describe PCR primers and amplification protocols developed to obtain introns from conserved nuclear genes in deep-sea protobranch bivalves. Because almost no sequence data for protobranchs are publically available, mollusk and other protostome sequences from GenBank were used to design degenerate primers, making these loci potentially useful in other invertebrate taxa. Amplification and sequencing success varied across the test group of 30 species, and we present five loci spanning this range of outcomes. Intron presence in the targeted regions also varied across genes and species, often within single genera; for instance, the calmodulin and β-tubulin loci contained introns with high frequency, whereas the triose phosphate isomerase locus never contained an intron. In introns for which we were able to obtain preliminary estimates of polymorphism levels in single species, polymorphism was greater than traditional mitochondrial loci. These markers will greatly increase the ability to assess population structure in the ecologically important protobranchs, and may prove useful in other taxa as well.

  10. Alignment-free design of highly discriminatory diagnostic primer sets for Escherichia coli O104:H4 outbreak strains.

    Science.gov (United States)

    Pritchard, Leighton; Holden, Nicola J; Bielaszewska, Martina; Karch, Helge; Toth, Ian K

    2012-01-01

    An Escherichia coli O104:H4 outbreak in Germany in summer 2011 caused 53 deaths, over 4000 individual infections across Europe, and considerable economic, social and political impact. This outbreak was the first in a position to exploit rapid, benchtop high-throughput sequencing (HTS) technologies and crowdsourced data analysis early in its investigation, establishing a new paradigm for rapid response to disease threats. We describe a novel strategy for design of diagnostic PCR primers that exploited this rapid draft bacterial genome sequencing to distinguish between E. coli O104:H4 outbreak isolates and other pathogenic E. coli isolates, including the historical hæmolytic uræmic syndrome (HUSEC) E. coli HUSEC041 O104:H4 strain, which possesses the same serotype as the outbreak isolates. Primers were designed using a novel alignment-free strategy against eleven draft whole genome assemblies of E. coli O104:H4 German outbreak isolates from the E. coli O104:H4 Genome Analysis Crowd-Sourcing Consortium website, and a negative sequence set containing 69 E. coli chromosome and plasmid sequences from public databases. Validation in vitro against 21 'positive' E. coli O104:H4 outbreak and 32 'negative' non-outbreak EHEC isolates indicated that individual primer sets exhibited 100% sensitivity for outbreak isolates, with false positive rates of between 9% and 22%. A minimal combination of two primers discriminated between outbreak and non-outbreak E. coli isolates with 100% sensitivity and 100% specificity. Draft genomes of isolates of disease outbreak bacteria enable high throughput primer design and enhanced diagnostic performance in comparison to traditional molecular assays. Future outbreak investigations will be able to harness HTS rapidly to generate draft genome sequences and diagnostic primer sets, greatly facilitating epidemiology and clinical diagnostics. We expect that high throughput primer design strategies will enable faster, more precise responses to

  11. Conserved PCR primer set designing for closely-related species to complete mitochondrial genome sequencing using a sliding window-based PSO algorithm.

    Science.gov (United States)

    Yang, Cheng-Hong; Chang, Hsueh-Wei; Ho, Chang-Hsuan; Chou, Yii-Cheng; Chuang, Li-Yeh

    2011-03-18

    Complete mitochondrial (mt) genome sequencing is becoming increasingly common for phylogenetic reconstruction and as a model for genome evolution. For long template sequencing, i.e., like the entire mtDNA, it is essential to design primers for Polymerase Chain Reaction (PCR) amplicons which are partly overlapping each other. The presented chromosome walking strategy provides the overlapping design to solve the problem for unreliable sequencing data at the 5' end and provides the effective sequencing. However, current algorithms and tools are mostly focused on the primer design for a local region in the genomic sequence. Accordingly, it is still challenging to provide the primer sets for the entire mtDNA. The purpose of this study is to develop an integrated primer design algorithm for entire mt genome in general, and for the common primer sets for closely-related species in particular. We introduce ClustalW to generate the multiple sequence alignment needed to find the conserved sequences in closely-related species. These conserved sequences are suitable for designing the common primers for the entire mtDNA. Using a heuristic algorithm particle swarm optimization (PSO), all the designed primers were computationally validated to fit the common primer design constraints, such as the melting temperature, primer length and GC content, PCR product length, secondary structure, specificity, and terminal limitation. The overlap requirement for PCR amplicons in the entire mtDNA is satisfied by defining the overlapping region with the sliding window technology. Finally, primer sets were designed within the overlapping region. The primer sets for the entire mtDNA sequences were successfully demonstrated in the example of two closely-related fish species. The pseudo code for the primer design algorithm is provided. In conclusion, it can be said that our proposed sliding window-based PSO algorithm provides the necessary primer sets for the entire mt genome amplification and

  12. Conserved PCR primer set designing for closely-related species to complete mitochondrial genome sequencing using a sliding window-based PSO algorithm.

    Directory of Open Access Journals (Sweden)

    Cheng-Hong Yang

    Full Text Available BACKGROUND: Complete mitochondrial (mt genome sequencing is becoming increasingly common for phylogenetic reconstruction and as a model for genome evolution. For long template sequencing, i.e., like the entire mtDNA, it is essential to design primers for Polymerase Chain Reaction (PCR amplicons which are partly overlapping each other. The presented chromosome walking strategy provides the overlapping design to solve the problem for unreliable sequencing data at the 5' end and provides the effective sequencing. However, current algorithms and tools are mostly focused on the primer design for a local region in the genomic sequence. Accordingly, it is still challenging to provide the primer sets for the entire mtDNA. METHODOLOGY/PRINCIPAL FINDINGS: The purpose of this study is to develop an integrated primer design algorithm for entire mt genome in general, and for the common primer sets for closely-related species in particular. We introduce ClustalW to generate the multiple sequence alignment needed to find the conserved sequences in closely-related species. These conserved sequences are suitable for designing the common primers for the entire mtDNA. Using a heuristic algorithm particle swarm optimization (PSO, all the designed primers were computationally validated to fit the common primer design constraints, such as the melting temperature, primer length and GC content, PCR product length, secondary structure, specificity, and terminal limitation. The overlap requirement for PCR amplicons in the entire mtDNA is satisfied by defining the overlapping region with the sliding window technology. Finally, primer sets were designed within the overlapping region. The primer sets for the entire mtDNA sequences were successfully demonstrated in the example of two closely-related fish species. The pseudo code for the primer design algorithm is provided. CONCLUSIONS/SIGNIFICANCE: In conclusion, it can be said that our proposed sliding window-based PSO

  13. QuantPrime – a flexible tool for reliable high-throughput primer design for quantitative PCR

    Directory of Open Access Journals (Sweden)

    Kwasniewski Miroslaw

    2008-11-01

    Full Text Available Abstract Background Medium- to large-scale expression profiling using quantitative polymerase chain reaction (qPCR assays are becoming increasingly important in genomics research. A major bottleneck in experiment preparation is the design of specific primer pairs, where researchers have to make several informed choices, often outside their area of expertise. Using currently available primer design tools, several interactive decisions have to be made, resulting in lengthy design processes with varying qualities of the assays. Results Here we present QuantPrime, an intuitive and user-friendly, fully automated tool for primer pair design in small- to large-scale qPCR analyses. QuantPrime can be used online through the internet http://www.quantprime.de/ or on a local computer after download; it offers design and specificity checking with highly customizable parameters and is ready to use with many publicly available transcriptomes of important higher eukaryotic model organisms and plant crops (currently 295 species in total, while benefiting from exon-intron border and alternative splice variant information in available genome annotations. Experimental results with the model plant Arabidopsis thaliana, the crop Hordeum vulgare and the model green alga Chlamydomonas reinhardtii show success rates of designed primer pairs exceeding 96%. Conclusion QuantPrime constitutes a flexible, fully automated web application for reliable primer design for use in larger qPCR experiments, as proven by experimental data. The flexible framework is also open for simple use in other quantification applications, such as hydrolyzation probe design for qPCR and oligonucleotide probe design for quantitative in situ hybridization. Future suggestions made by users can be easily implemented, thus allowing QuantPrime to be developed into a broad-range platform for the design of RNA expression assays.

  14. Design of a Percussion and Electric Primer Gun Firing Power Supply

    Science.gov (United States)

    2014-07-01

    to drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks to...gun, percussion, electric primer, capacitor 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT UU 18. NUMBER OF PAGES 30 19a. NAME...initial pull of the solenoid, which can be over 50 A. The old linear power supply has large filter capacitors on its output, which does provide the surge

  15. MRPrimerW: a tool for rapid design of valid high-quality primers for multiple target qPCR experiments.

    Science.gov (United States)

    Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Koo, JaeHyung; Kim, Min-Soo

    2016-07-08

    Design of high-quality primers for multiple target sequences is essential for qPCR experiments, but is challenging due to the need to consider both homology tests on off-target sequences and the same stringent filtering constraints on the primers. Existing web servers for primer design have major drawbacks, including requiring the use of BLAST-like tools for homology tests, lack of support for ranking of primers, TaqMan probes and simultaneous design of primers against multiple targets. Due to the large-scale computational overhead, the few web servers supporting homology tests use heuristic approaches or perform homology tests within a limited scope. Here, we describe the MRPrimerW, which performs complete homology testing, supports batch design of primers for multi-target qPCR experiments, supports design of TaqMan probes and ranks the resulting primers to return the top-1 best primers to the user. To ensure high accuracy, we adopted the core algorithm of a previously reported MapReduce-based method, MRPrimer, but completely redesigned it to allow users to receive query results quickly in a web interface, without requiring a MapReduce cluster or a long computation. MRPrimerW provides primer design services and a complete set of 341 963 135 in silico validated primers covering 99% of human and mouse genes. Free access: http://MRPrimerW.com. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. Design of 16S rRNA gene primers for 454 pyrosequencing of the human foregut microbiome

    Institute of Scientific and Technical Information of China (English)

    Carlos; W; Nossa; William; E; Oberdorf; Jφrn; A; Aas; Bruce; J; Paster; Todd; Z; DeSantis; Eoin; L; Brodie; Daniel; Malamud; Michael; A; Poles

    2010-01-01

    AIM:To design and validate broad-range 16S rRNA primers for use in high throughput sequencing to classify bacteria isolated from the human foregut microbiome.METHODS:A foregut microbiome dataset was constructed using 16S rRNA gene sequences obtained from oral,esophageal,and gastric microbiomes produced by Sanger sequencing in previous studies represented by 219 bacterial species.Candidate primers evaluated were from the European rRNA database.To assess the effect of sequence length on accuracy of classifica...

  17. Primers are designed for amplification and direct sequencing of ITS region of rDNA from Myxomycetes.

    Science.gov (United States)

    Martín, María P; Lado, Carlos; Johansen, Steinar

    2003-01-01

    Four new primers were designed, based on comparison of Physarum polycephalum sequences retrieved from Genbank (primers PHYS-5 and PHYS-4) and our own sequences (primers PHYS-3 and PHYS-2), to amplify the ITS regions of rDNA, including the 5.8S gene segment from Lamproderma species. Sequencing analysis shows that Lamproderma contains ITS1-5.8S-ITS2 regions of approximately 900 bp, which is similar in size to most eukaryotes. However, the corresponding region in another common myxomycete, Fuligo septica, is more than 2000 bp due to the presence of large direct-repeat motifs in ITS1. Myxomycete rDNA ITS regions are interesting both as phylogenetic markers in taxonomic studies and as model sequences for molecular evolution.

  18. Effective Natural PCR-RFLP Primer Design for SNP Genotyping Using Teaching-Learning-Based Optimization With Elite Strategy.

    Science.gov (United States)

    Cheng, Yu-Huei; Kuo, Che-Nan; Lai, Ching-Ming

    2016-10-01

    SNP (single nucleotide polymorphism) genotyping is the determination of genetic variations of SNPs between members of a species. In many laboratories, PCR-RFLP (polymerase chain reaction-restriction fragment length polymorphism) is a usually used biotechnology for SNP genotyping, especially in small-scale basic research studies of complex genetic diseases. PCR-RFLP requires an available restriction enzyme at least for identify a target SNP and an effective primer pair conforms numerous constraints. However, the lots of restriction enzymes, tedious sequence and complicated constraints make the mining of available restriction enzymes and the design of effective primer pairs become a major challenge. In the study, we propose a novel and available CI (Computation Intelligence)-based method called TLBO (teaching-learning-based optimization) and introduce the elite strategy to design effective primer pairs. Three common melting temperature computations are available in the method. REHUNT (Restriction Enzymes HUNTing) is first combined with the method to mine available restriction enzymes. Robust in silico simulations for the GA (genetic algorithm), the PSO (particle swarm optimization), and the method for natural PCR-RFLP primer design in the SLC6A4 gene with two hundred and eighty-eight SNPs had been performed and compared. These methods had been implemented in JAVA and they are freely available at https://sites.google.com/site/yhcheng1981/tlbonpd-elite for users of academic and non-commercial interests.

  19. Bridging the Gap: A Manual Primer into Design Computing in the Context of Basic Design Education

    Science.gov (United States)

    Uysal, V. Safak; Topaloglu, Fulden

    2017-01-01

    Design education is in need of a wider restructuring to accommodate new developments and paradigmatic shifts brought forth by the information age, all of which capitalise a move towards complexity theory, systems science and digital technologies. The intention of this article is to approach one particular aspect of this need: that is, how basic…

  20. Applying Instructional Design Theories to Bioinformatics Education in Microarray Analysis and Primer Design Workshops

    Science.gov (United States)

    Shachak, Aviv; Ophir, Ron; Rubin, Eitan

    2005-01-01

    The need to support bioinformatics training has been widely recognized by scientists, industry, and government institutions. However, the discussion of instructional methods for teaching bioinformatics is only beginning. Here we report on a systematic attempt to design two bioinformatics workshops for graduate biology students on the basis of…

  1. Systematic design of mouse Vh gene family-specific oligonucleotides

    NARCIS (Netherlands)

    Seijen, AM; Seijen, HG; Bos, NA

    2001-01-01

    Kabat's database has often been used to design mouse Vh gene-specific 5 ' primers. The emphasis was mostly on constructing a universal (degenerate) 5 ' primer or 5 ' primer set, which would be able to match every mouse Vh gene. We were interested in finding oligonucleotides that could be used as pri

  2. Systematic design of mouse Vh gene family-specific oligonucleotides

    NARCIS (Netherlands)

    Seijen, AM; Seijen, HG; Bos, NA

    2001-01-01

    Kabat's database has often been used to design mouse Vh gene-specific 5 ' primers. The emphasis was mostly on constructing a universal (degenerate) 5 ' primer or 5 ' primer set, which would be able to match every mouse Vh gene. We were interested in finding oligonucleotides that could be used as pri

  3. Alignment-free design of highly discriminatory diagnostic primer sets for Escherichia coli O104:H4 outbreak strains.

    Directory of Open Access Journals (Sweden)

    Leighton Pritchard

    Full Text Available BACKGROUND: An Escherichia coli O104:H4 outbreak in Germany in summer 2011 caused 53 deaths, over 4000 individual infections across Europe, and considerable economic, social and political impact. This outbreak was the first in a position to exploit rapid, benchtop high-throughput sequencing (HTS technologies and crowdsourced data analysis early in its investigation, establishing a new paradigm for rapid response to disease threats. We describe a novel strategy for design of diagnostic PCR primers that exploited this rapid draft bacterial genome sequencing to distinguish between E. coli O104:H4 outbreak isolates and other pathogenic E. coli isolates, including the historical hæmolytic uræmic syndrome (HUSEC E. coli HUSEC041 O104:H4 strain, which possesses the same serotype as the outbreak isolates. METHODOLOGY/PRINCIPAL FINDINGS: Primers were designed using a novel alignment-free strategy against eleven draft whole genome assemblies of E. coli O104:H4 German outbreak isolates from the E. coli O104:H4 Genome Analysis Crowd-Sourcing Consortium website, and a negative sequence set containing 69 E. coli chromosome and plasmid sequences from public databases. Validation in vitro against 21 'positive' E. coli O104:H4 outbreak and 32 'negative' non-outbreak EHEC isolates indicated that individual primer sets exhibited 100% sensitivity for outbreak isolates, with false positive rates of between 9% and 22%. A minimal combination of two primers discriminated between outbreak and non-outbreak E. coli isolates with 100% sensitivity and 100% specificity. CONCLUSIONS/SIGNIFICANCE: Draft genomes of isolates of disease outbreak bacteria enable high throughput primer design and enhanced diagnostic performance in comparison to traditional molecular assays. Future outbreak investigations will be able to harness HTS rapidly to generate draft genome sequences and diagnostic primer sets, greatly facilitating epidemiology and clinical diagnostics. We expect that high

  4. Employment of Near Full-Length Ribosome Gene TA-Cloning and Primer-Blast to Detect Multiple Species in a Natural Complex Microbial Community Using Species-Specific Primers Designed with Their Genome Sequences.

    Science.gov (United States)

    Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou

    2016-11-01

    It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.

  5. Bisprimer--a program for the design of primers for bisulfite-based genomic sequencing of both plant and Mammalian DNA samples.

    Science.gov (United States)

    Kovacova, Viera; Janousek, Bohuslav

    2012-01-01

    Plants and animals differ in the sequence context of the methylated sites in DNA. Plants exhibit cytosine methylation in CG, CHG, and CHH sites, whereas CG methylation is the only form present in mammals (with an exception of the early embryonic development). This fact must be taken into account in the design of primers for bisulfite-based genomic sequencing because CHG and CHH sites can remain unmodified. Surprisingly, no user-friendly primer design program is publicly available that could be used to design primers in plants and to simultaneously check the properties of primers such as the potential for primer-dimer formation. For studies concentrating on particular DNA loci, the correct design of primers is crucial. The program, called BisPrimer, includes 2 different subprograms for the primer design, the first one for mammals and the second one for angiosperm plants. Each subprogram is divided into 2 variants. The first variant serves to design primers that preferentially bind to the bisulfite-modified primer-binding sites (C to U conversion). This type of primer preferentially amplifies the bisulfite-converted DNA strands. This feature can help to avoid problems connected with an incomplete bisulfite modification that can sometimes occur for technical reasons. The second variant is intended for the analysis of samples that are supposed to consist of a mixture of DNA molecules that have different levels of cytosine methylation (e.g., pollen DNA). In this case, the aim is to minimize the selection in favor of either less methylated or more methylated molecules.

  6. Synteny analysis provides a route to design genus-specific PCR primers for rapid identification of all Saccharomyces species.

    Science.gov (United States)

    Sharpe, Ben; Hulin, Michelle; Thorne-Wallis, James; Wheals, Alan

    2014-05-01

    The genus Saccharomyces comprises seven single-genome species (S. arboricola, S. cerevisiae, S. eubayanus, S. kudriavzevii, S. mikatae, S. paradoxus and S. uvarum) and two hybrid species - S. pastorianus (S. cerevisiae plus S. eubayanus) and S. bayanus (mostly S. uvarum plus S. eubayanus). Species-specific primers have already been developed for the identification of each of the single-genome species, and these primers can usually detect both genomes in hybrids. It would be advantageous if a single reaction could detect any member of the clade. We have investigated three potentially generic approaches to design genus-specific primers. Two methods that both use sequence alignment differences for primer design were only partly successful. A third method used synteny data to identify 136 target genes that are potentially present only in all species of the Saccharomyces clade. HSP30 (YCR021C) was fully successful; different primer pairs were developed with high G+C content for use at 63 °C. In < 3 h, using a robust colony-PCR followed by gel electrophoresis, the method can reliably detect any member of the genus. This novel approach still uses conventional sequence alignment mismatches but relies principally on the presence of the target gene only within the genus Saccharomyces. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  7. Design and evaluation of nematode 18S rDNA primers for PCR and denaturing gradient gel electrophoresis (DGGE) of soil community DNA

    NARCIS (Netherlands)

    Waite, I.S.; O'Donnell, A.G.; Harrison, A.; Davies, J.T.; Colvan, S.R.; Ekschmitt, K.; Dogan, H.; Wolters, V.; Bongers, A.M.T.; Bongers, M.; Bakonyi, G.; Nagy, P.; Papatheodorou, E.M.; Stamou, G.P.; Boström, S.

    2003-01-01

    Consensus nematode 185 ribosomal DNA primers were designed by aligning available 185 sequences and identifying a variable region flanked by highly conserved regions. These primers were then used to amplify nematode 18S rDNA from whole soil community DNA extracted from a range of European grassland t

  8. PCR Primer Design for 16S rRNAs for Experimental Horizontal Gene Transfer Test in Escherichia coli

    Science.gov (United States)

    Miyazaki, Kentaro; Sato, Mitsuharu; Tsukuda, Miyuki

    2017-01-01

    We recently demonstrated that the Escherichia coli ribosome is robust enough to accommodate foreign 16S rRNAs from diverse gamma- and betaproteobacteria bacteria (Kitahara et al., 2012). Therein, we used the common universal primers Bac8f and UN1541r to obtain a nearly full-length gene. However, we noticed that these primers overlap variable sites at 19[A/C] and 1527[U/C] in Bac8f and UN1541r, respectively, and thus, the amplicon could contain mutations. This is problematic, particularly for the former site, because the 19th nucleotide pairs with the 916th nucleotide, which is a part of the “central pseudoknot” and is critical for function. Therefore, we mutationally investigated the role of the base pair using several 16S rRNAs from gamma- and betaproteobacteria. We found that both the native base pairs (gammaproteobacterial 19A–916U and betaproteobacterial 19C–916G) and the non-native 19A–916G pair retained function, whereas the non-native 19C–916U was defective 16S rRNAs. We next designed a new primer set, Bac1f and UN1542r, so that they do not overlap the potential mismatch sites. 16S rRNA amplicons obtained from the environmental metagenome using the new primer set were dominated by proteobacterial species (~85%). Subsequent functional screening identified various 16S rRNAs from proteobacteria, all of which contained native 19A–916U or 19C–916G base pairs. The primers developed in this study are thus advantageous for functional characterization of foreign 16S rRNA in E. coli with no artifacts.

  9. Comparison of nine PCR primer sets designed to detect Pantoea stewartii subsp. stewartii in maize

    Science.gov (United States)

    Pantoea stewartii subsp. stewartii, the causal agent of Stewart's bacterial wilt of maize, is a major quarantine pest in maize seed. Verifying freedom from P. stewartii remains a significant hurdle in exporting corn seed from the U.S. Several PCR primer sets have been developed and suggested as bein...

  10. Multiplex PCR for detection of the Vibrio genus and five pathogenic Vibrio species with primer sets designed using comparative genomics.

    Science.gov (United States)

    Kim, Hyun-Joong; Ryu, Ji-Oh; Lee, Shin-Young; Kim, Ei-Seul; Kim, Hae-Yeong

    2015-10-26

    The genus Vibrio is clinically significant and major pathogenic Vibrio species causing human Vibrio infections are V. cholerae, V. parahaemolyticus, V. vulnificus, V. alginolyticus and V. mimicus. In this study, we screened for novel genetic markers using comparative genomics and developed a Vibrio multiplex PCR for the reliable diagnosis of the Vibrio genus and the associated major pathogenic Vibrio species. A total of 30 Vibrio genome sequences were subjected to comparative genomics, and specific genes of the Vibrio genus and five major pathogenic Vibrio species were screened. The designed primer sets from the screened genes were evaluated by single PCR using DNAs from various Vibrio spp. and other non-Vibrio bacterial strains. A sextuplet multiplex PCR using six primer sets was developed to enable detection of the Vibrio genus and five pathogenic Vibrio species. The designed primer sets from the screened genes yielded specific diagnostic results for target the Vibrio genus and Vibrio species. The specificity of the developed multiplex PCR was confirmed with various Vibrio and non-Vibrio strains. This Vibrio multiplex PCR was evaluated using 117 Vibrio strains isolated from the south seashore areas in Korea and Vibrio isolates were identified as Vibrio spp., V. parahaemolyticus, V. vulnificus and V. alginolyticus, demonstrating the specificity and discriminative ability of the assay towards Vibrio species. This novel multiplex PCR method could provide reliable and informative identification of the Vibrio genus and major pathogenic Vibrio species in the food safety industry and in early clinical treatment, thereby protecting humans against Vibrio infection.

  11. A New Multiplex-PCR for Urinary Tract Pathogen Detection Using Primer Design Based on an Evolutionary Computation Method.

    Science.gov (United States)

    García, Liliana Torcoroma; Cristancho, Laura Maritza; Vera, Erika Patricia; Begambre, Oscar

    2015-10-01

    This work describes a new strategy for optimal design of Multiplex-PCR primer sequences. The process is based on the Particle Swarm Optimization-Simplex algorithm (Mult-PSOS). Diverging from previous solutions centered on heuristic tools, the Mult-PSOS is selfconfigured because it does not require the definition of the algorithm's initial search parameters. The successful performance of this method was validated in vitro using Multiplex- PCR assays. For this validation, seven gene sequences of the most prevalent bacteria implicated in urinary tract infections were taken as DNA targets. The in vitro tests confirmed the good performance of the Mult-PSOS, with respect to infectious disease diagnosis, in the rapid and efficient selection of the optimal oligonucleotide sequences for Multiplex-PCRs. The predicted sequences allowed the adequate amplification of all amplicons in a single step (with the correct amount of DNA template and primers), reducing significantly the need for trial and error experiments. In addition, owing to its independence from the initial selection of the heuristic constants, the Mult-PSOS can be employed by non-expert users in computational techniques or in primer design problems.

  12. An easy-to-use primer design tool to address paralogous loci and T-DNA insertion sites in the genome of Arabidopsis thaliana

    National Research Council Canada - National Science Library

    Huep, Gunnar; Kleinboelting, Nils; Weisshaar, Bernd

    2014-01-01

    .... In such cases, the prediction of the correct insertion site must include careful sequence analyses on the one hand and a paralog specific primer design for experimental confirmation of the prediction on the other hand...

  13. Linear-After-The-Exponential (LATE)-PCR: Primer design criteria for high yields of specific single-stranded DNA and improved real-time detection

    Science.gov (United States)

    Pierce, Kenneth E.; Sanchez, J. Aquiles; Rice, John E.; Wangh, Lawrence J.

    2005-01-01

    Traditional asymmetric PCR uses conventional PCR primers at unequal concentrations to generate single-stranded DNA. This method, however, is difficult to optimize, often inefficient, and tends to promote nonspecific amplification. An alternative approach, Linear-After-The-Exponential (LATE)-PCR, solves these problems by using primer pairs deliberately designed for use at unequal concentrations. The present report systematically examines the primer design parameters that affect the exponential and linear phases of LATE-PCR amplification. In particular, we investigated how altering the concentration-adjusted melting temperature (Tm) of the limiting primer (TmL) relative to that of the excess primer (TmX) affects both amplification efficiency and specificity during the exponential phase of LATE-PCR. The highest reaction efficiency and specificity were observed when TmL - TmX ≥ 5°C. We also investigated how altering TmX relative to the higher Tm of the double-stranded amplicon (TmA) affects the rate and extent of linear amplification. Excess primers with TmX closer to TmA yielded higher rates of linear amplification and stronger signals from a hybridization probe. These design criteria maximize the yield of specific single-stranded DNA products and make LATE-PCR more robust and easier to implement. The conclusions were validated by using primer pairs that amplify sequences within the cystic fibrosis transmembrane regulator (CFTR) gene, mutations of which are responsible for cystic fibrosis. PMID:15937116

  14. Improving function in age-related macular degeneration: design and methods of a randomized clinical trial.

    Science.gov (United States)

    Rovner, Barry W; Casten, Robin J; Hegel, Mark T; Massof, Robert W; Leiby, Benjamin E; Tasman, William S

    2011-03-01

    Age-Related Macular Degeneration (AMD) is the leading cause of severe vision loss in older adults and impairs the ability to read, drive, and live independently and increases the risk for depression, falls, and earlier mortality. Although new medical treatments have improved AMD's prognosis, vision-related disability remains a major public health problem. Improving Function in AMD (IF-AMD) is a two-group randomized, parallel design, controlled clinical trial that compares the efficacy of Problem-Solving Therapy (PST) with Supportive Therapy (ST) (an attention control treatment) to improve vision function in 240 patients with AMD. PST and ST therapists deliver 6 one-hour respective treatment sessions to subjects in their homes over 2 months. Outcomes are assessed masked to treatment assignment at 3 months (main trial endpoint) and 6 months (maintenance effects). The primary outcome is targeted vision function (TVF), which refers to specific vision-dependent functional goals that subjects highly value but find difficult to achieve. TVF is an innovative outcome measure in that it is targeted and tailored to individual subjects yet is measured in a standardized way. This paper describes the research methods, theoretical and clinical aspects of the study treatments, and the measures used to evaluate functional and psychiatric outcomes in this population. Copyright © 2010 Elsevier Inc. All rights reserved.

  15. The genetics of age-related macular degeneration (AMD)--Novel targets for designing treatment options?

    Science.gov (United States)

    Grassmann, Felix; Fauser, Sascha; Weber, Bernhard H F

    2015-09-01

    Age-related macular degeneration (AMD) is a progressive disease of the central retina and the main cause of legal blindness in industrialized countries. Risk to develop the disease is conferred by both individual as well as genetic factors with the latter being increasingly deciphered over the last decade. Therapeutically, striking advances have been made for the treatment of the neovascular form of late stage AMD while for the late stage atrophic form of the disease, which accounts for almost half of the visually impaired, there is currently no effective therapy on the market. This review highlights our current knowledge on the genetic architecture of early and late stage AMD and explores its potential for the discovery of novel, target-guided treatment options. We reflect on current clinical and experimental therapies for all forms of AMD and specifically note a persisting lack of efficacy for treatment in atrophic AMD. We further explore the current insight in AMD-associated genes and pathways and critically question whether this knowledge is suited to design novel treatment options. Specifically, we point out that known genetic factors associated with AMD govern the risk to develop disease and thus may not play a role in its severity or progression. Treatments based on such knowledge appear appropriate rather for prevention than treatment of manifest disease. As a consequence, future research in AMD needs to be greatly focused on approaches relevant to the patients and their medical needs.

  16. The importance of molecular markers and primer design when characterizing biodiversity from environmental DNA.

    Science.gov (United States)

    Freeland, Joanna R

    2017-04-01

    Environmental DNA (eDNA) comprises DNA fragments that have been shed into the environment by organisms, and which can be extracted from environmental samples such as water or soil. Characterization of eDNA can allow researchers to infer the presence or absence of species from a particular site without the need to locate and identify individuals, and therefore may provide an extremely valuable tool for quantifying biodiversity. However, as is often the case with relatively new protocols, methodological challenges remain. A number of earlier reviews have discussed these challenges, but none have provided extensive treatment of the critical decisions surrounding molecular markers and primer development for use in eDNA assays. This review discusses a number of options and approaches that can be used when determining which primers and gene regions are most appropriate for either targeted species detection or metabarcoding macro-organisms from eDNA. The latter represents a new field that is growing rapidly, and which has the potential to revolutionize future assessments of community and ecosystem diversity.

  17. Universal primers that amplify RNA from all three flavivirus subgroups

    Directory of Open Access Journals (Sweden)

    Barnard Ross T

    2008-01-01

    Full Text Available Abstract Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5 coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers.

  18. Hepatitis C Virus RNA Real-Time Quantitative RT-PCR Method Based on a New Primer Design Strategy.

    Science.gov (United States)

    Chen, Lida; Li, Wenli; Zhang, Kuo; Zhang, Rui; Lu, Tian; Hao, Mingju; Jia, Tingting; Sun, Yu; Lin, Guigao; Wang, Lunan; Li, Jinming

    2016-01-01

    Viral nucleic acids are unstable when improperly collected, handled, and stored, resulting in decreased sensitivity of currently available commercial quantitative nucleic acid testing kits. Using known unstable hepatitis C virus RNA, we developed a quantitative RT-PCR method based on a new primer design strategy to reduce the impact of nucleic acid instability on nucleic acid testing. The performance of the method was evaluated for linearity, limit of detection, precision, specificity, and agreement with commercial hepatitis C virus assays. Its clinical application was compared to that of two commercial kits--Cobas AmpliPrep/Cobas TaqMan (CAP/CTM) and Kehua. The quantitative RT-PCR method delivered a good performance, with a linearity of R(2) = 0.99, a total limit of detection (genotypes 1 to 6) of 42.6 IU/mL (95% CI, 32.84 to 67.76 IU/mL), a CV of 1.06% to 3.34%, a specificity of 100%, and a high concordance with the CAP/CTM assay (R(2) = 0.97), with a means ± SD value of -0.06 ± 1.96 log IU/mL (range, -0.38 to 0.25 log IU/mL). The method was superior to commercial assays in detecting unstable hepatitis C virus RNA (P quantitative RT-PCR method can effectively eliminate the influence of RNA instability on nucleic acid testing. The principle of primer design strategy may be applied to the detection of other RNA or DNA viruses.

  19. Design of Degenerate Drimers and Cloning Analysis of Three Novel DNA Fragments of WAX from Euphorbiaceae%简并引物设计与大戟科3种植物WAX基因片段的克隆

    Institute of Scientific and Technical Information of China (English)

    夏志强; 陈新; 王海燕; 周新成; 王文泉

    2012-01-01

    在大戟科3种重要经济植物木薯、蓖麻、小桐子中,扩增WAX基因片段。利用CODEHOP方法设计简并引物,同时在3种植物中提取高质量的总RNA并反转录为eDNA,结果扩增在3种植物中得到特异性片段,克隆测序,并采用生物信息学技术进行序列分析。结果证明CODEHOP简并引物设计科学。同时证明WAX基因的保守性较高,在大戟科3个物种中同时得到了WAX基因片段序列信息,具有较高同源性。为以后WAX基因研究奠定重要基础。%Using degenerate primers which are designed according to known sequences to amplify new members in a gene family is a good way to find WAX gene Fragments from three important economic plant Cassava, Castor bean, Jatropha in Euphorbiaceae. The fragment was compared in the Genbank by blastx, and the results prove CODEHOP degenerate primer design science. Prove conservative WAX gene is higher, at the same time to get the in Euphorbiaceae three species WAX gene fragment sequences with high homology. WAX gene research has important foundation in future.

  20. A robust PCR primer design platform applied to the detection of Acidobacteria Group 1 in soil

    OpenAIRE

    2012-01-01

    Environmental biosurveillance and microbial ecology studies use PCR-based assays to detect and quantify microbial taxa and gene sequences within a complex background of microorganisms. However, the fragmentary nature and growing quantity of DNA-sequence data make group-specific assay design challenging. We solved this problem by developing a software platform that enables PCR-assay design at an unprecedented scale. As a demonstration, we developed quantitative PCR assays for a globally widesp...

  1. AAscan, PCRdesign and MutantChecker: a suite of programs for primer design and sequence analysis for high-throughput scanning mutagenesis.

    Science.gov (United States)

    Sun, Dawei; Ostermaier, Martin K; Heydenreich, Franziska M; Mayer, Daniel; Jaussi, Rolf; Standfuss, Joerg; Veprintsev, Dmitry B

    2013-01-01

    Scanning mutagenesis is a powerful protein engineering technique used to study protein structure-function relationship, map binding sites and design more stable proteins or proteins with altered properties. One of the time-consuming tasks encountered in application of this technique is the design of primers for site-directed mutagenesis. Here we present an open-source multi-platform software AAscan developed to design primers for this task according to a set of empirical rules such as melting temperature, overall length, length of overlap regions, and presence of GC clamps at the 3' end, for any desired substitution. We also describe additional software tools which are used to analyse a large number of sequencing results for the presence of desired mutations, as well as related software to design primers for ligation independent cloning. We have used AAscan software to design primers to make over 700 mutants, with a success rate of over 80%. We hope that the open-source nature of our software and ready availability of freeware tools used for its development will facilitate its adaptation and further development. The software is distributed under GPLv3 licence and is available at http://www.psi.ch/lbr/aascan.

  2. Integrating PCR Theory and Bioinformatics into a Research-oriented Primer Design Exercise

    Science.gov (United States)

    Robertson, Amber L.; Phillips, Allison R.

    2008-01-01

    Polymerase chain reaction (PCR) is a conceptually difficult technique that embodies many fundamental biological processes. Traditionally, students have struggled to analyze PCR results due to an incomplete understanding of the biological concepts (theory) of DNA replication and strand complementarity. Here we describe the design of a novel…

  3. Integrating PCR Theory and Bioinformatics into a Research-oriented Primer Design Exercise

    Science.gov (United States)

    Robertson, Amber L.; Phillips, Allison R.

    2008-01-01

    Polymerase chain reaction (PCR) is a conceptually difficult technique that embodies many fundamental biological processes. Traditionally, students have struggled to analyze PCR results due to an incomplete understanding of the biological concepts (theory) of DNA replication and strand complementarity. Here we describe the design of a novel…

  4. A robust PCR primer design platform applied to the detection of Acidobacteria Group 1 in soil

    Science.gov (United States)

    Gans, Jason D.; Dunbar, John; Eichorst, Stephanie A.; Gallegos-Graves, La Verne; Wolinsky, Murray; Kuske, Cheryl R.

    2012-01-01

    Environmental biosurveillance and microbial ecology studies use PCR-based assays to detect and quantify microbial taxa and gene sequences within a complex background of microorganisms. However, the fragmentary nature and growing quantity of DNA-sequence data make group-specific assay design challenging. We solved this problem by developing a software platform that enables PCR-assay design at an unprecedented scale. As a demonstration, we developed quantitative PCR assays for a globally widespread, ecologically important bacterial group in soil, Acidobacteria Group 1. A total of 33 684 Acidobacteria 16S rRNA gene sequences were used for assay design. Following 1 week of computation on a 376-core cluster, 83 assays were obtained. We validated the specificity of the top three assays, collectively predicted to detect 42% of the Acidobacteria Group 1 sequences, by PCR amplification and sequencing of DNA from soil. Based on previous analyses of 16S rRNA gene sequencing, Acidobacteria Group 1 species were expected to decrease in response to elevated atmospheric CO2. Quantitative PCR results, using the Acidobacteria Group 1-specific PCR assays, confirmed the expected decrease and provided higher statistical confidence than the 16S rRNA gene-sequencing data. These results demonstrate a powerful capacity to address previously intractable assay design challenges. PMID:22434885

  5. Theory vs. "Real Life" Instructional Media Design: A Primer for Those New to the Field.

    Science.gov (United States)

    Saito, Yoshio

    1982-01-01

    Presents a model for instructional media design, adapted from the theoretical model and viewed to work well with reasonable effort and time. An example of the model in use is provided to give evidence of reasonableness. Outlines of both the theoretical and adapted models are provided. (MP)

  6. A Primer for the Design of Practice Manuals: Four Stages of Development

    Science.gov (United States)

    Galinsky, Maeda J.; Fraser, Mark W.; Day, Steven H.; Richman, Jack M.

    2013-01-01

    Treatment manuals are increasingly being used to guide interventions with individuals, families, groups, organizations, and communities. However, little is known about best practices in designing manuals. We describe a process that provides for the development of manuals and specifies the means by which manuals can be adapted for practice…

  7. A CRISPR/Cas9-based method and primer design tool for seamless genome editing in fission yeast

    Science.gov (United States)

    Rodríguez-López, María; Cotobal, Cristina; Fernández-Sánchez, Oscar; Borbarán Bravo, Natalia; Oktriani, Risky; Abendroth, Heike; Uka, Dardan; Hoti, Mimoza; Wang, Jin; Zaratiegui, Mikel; Bähler, Jürg

    2017-01-01

    In the fission yeast Schizosaccharomyces pombe the prevailing approach for gene manipulations is based on homologous recombination of a PCR product that contains genomic target sequences and a selectable marker. The CRISPR/Cas9 system has recently been implemented in fission yeast, which allows for seamless genome editing without integration of a selection marker or leaving any other genomic ‘scars’. The published method involves manual design of the single guide RNA (sgRNA), and digestion of a large plasmid with a problematic restriction enzyme to clone the sgRNA. To increase the efficiency of this approach, we have established and optimized a PCR-based system to clone the sgRNA without restriction enzymes into a plasmid with a dominant natMX6 (nourseothricin) selection marker. We also provide a web-tool, CRISPR4P, to support the design of the sgRNAs and the primers required for the entire process of seamless DNA deletion. Moreover, we report the preparation of G1-synchronized and cryopreserved S. pombe cells, which greatly increases the efficiency and speed for transformations, and may also facilitate standard gene manipulations. Applying this optimized CRISPR/Cas9-based approach, we have successfully deleted over 80 different non-coding RNA genes, which are generally lowly expressed, and have inserted 7 point mutations in 4 different genomic regions. PMID:28612052

  8. New design strategy for development of specific primer sets for PCR-based detection of Chlorophyceae and Bacillariophyceae in environmental samples.

    Science.gov (United States)

    Moro, Claire Valiente; Crouzet, Olivier; Rasconi, Séréna; Thouvenot, Antoine; Coffe, Gérard; Batisson, Isabelle; Bohatier, Jacques

    2009-09-01

    Studying aquatic microalgae is essential for monitoring biodiversity and water quality. We designed new sets of 18S rRNA PCR primers for Chlorophyceae and Bacillariophyceae by using the ARB software and implementing a virtual PCR program. The results of specificity analysis showed that most of the targeted algal families were identified and nontargeted organisms, such as fungi or ciliates, were excluded. These newly developed PCR primer sets were also able to amplify microalgal rRNA genes from environmental samples with accurate specificity. These tools could be of great interest for studying freshwater microalgal ecology and for developing bioindicators of the health status of aquatic environments.

  9. New Design Strategy for Development of Specific Primer Sets for PCR-Based Detection of Chlorophyceae and Bacillariophyceae in Environmental Samples▿ †

    Science.gov (United States)

    Valiente Moro, Claire; Crouzet, Olivier; Rasconi, Séréna; Thouvenot, Antoine; Coffe, Gérard; Batisson, Isabelle; Bohatier, Jacques

    2009-01-01

    Studying aquatic microalgae is essential for monitoring biodiversity and water quality. We designed new sets of 18S rRNA PCR primers for Chlorophyceae and Bacillariophyceae by using the ARB software and implementing a virtual PCR program. The results of specificity analysis showed that most of the targeted algal families were identified and nontargeted organisms, such as fungi or ciliates, were excluded. These newly developed PCR primer sets were also able to amplify microalgal rRNA genes from environmental samples with accurate specificity. These tools could be of great interest for studying freshwater microalgal ecology and for developing bioindicators of the health status of aquatic environments. PMID:19592531

  10. Understanding the internet, website design and intranet development: a primer for radiologists.

    Science.gov (United States)

    Perriss, R W; Graham, R N J; Scarsbrook, A F

    2006-05-01

    The internet has become an essential part of daily life for almost all radiologists and yet few fully understand how this works or how best to harness the technology within the workplace. This article will explore the basics of computer networking which has allowed the internet to become a valuable resource. In addition, the process of designing and implementing a website or intranet site for the benefit of radiology departmental administration and education will be discussed. The options of how to develop a website, what to include, and how to achieve this using easy to use, freely available and low-cost software will also be explored.

  11. Understanding the internet, website design and intranet development: a primer for radiologists

    Energy Technology Data Exchange (ETDEWEB)

    Perriss, R.W. [Department of Radiology, John Radcliffe Hospital, Headington, Oxford (United Kingdom); Graham, R.N.J. [Department of Radiology, John Radcliffe Hospital, Headington, Oxford (United Kingdom); Scarsbrook, A.F. [Department of Radiology, John Radcliffe Hospital, Headington, Oxford (United Kingdom)]. E-mail: andyscarsbrook1@aol.com

    2006-05-15

    The internet has become an essential part of daily life for almost all radiologists and yet few fully understand how this works or how best to harness the technology within the workplace. This article will explore the basics of computer networking which has allowed the internet to become a valuable resource. In addition, the process of designing and implementing a website or intranet site for the benefit of radiology departmental administration and education will be discussed. The options of how to develop a website, what to include, and how to achieve this using easy to use, freely available and low-cost software will also be explored.

  12. Survey says? A primer on web-based survey design and distribution.

    Science.gov (United States)

    Oppenheimer, Adam J; Pannucci, Christopher J; Kasten, Steven J; Haase, Steven C

    2011-07-01

    The Internet has changed the way in which we gather and interpret information. Although books were once the exclusive bearers of data, knowledge is now only a keystroke away. The Internet has also facilitated the synthesis of new knowledge. Specifically, it has become a tool through which medical research is conducted. A review of the literature reveals that in the past year, over 100 medical publications have been based on Web-based survey data alone. Because of emerging Internet technologies, Web-based surveys can now be launched with little computer knowledge. They may also be self-administered, eliminating personnel requirements. Ultimately, an investigator may build, implement, and analyze survey results with speed and efficiency, obviating the need for mass mailings and data processing. All of these qualities have rendered telephone and mail-based surveys virtually obsolete. Despite these capabilities, Web-based survey techniques are not without their limitations, namely, recall and response biases. When used properly, however, Web-based surveys can greatly simplify the research process. This article discusses the implications of Web-based surveys and provides guidelines for their effective design and distribution.

  13. Design and analysis of metabolomics studies in epidemiologic research: a primer on -omic technologies.

    Science.gov (United States)

    Tzoulaki, Ioanna; Ebbels, Timothy M D; Valdes, Ana; Elliott, Paul; Ioannidis, John P A

    2014-07-15

    Metabolomics is the field of "-omics" research concerned with the comprehensive characterization of the small low-molecular-weight metabolites in biological samples. In epidemiology, it represents an emerging technology and an unprecedented opportunity to measure environmental and other exposures with improved precision and far less measurement error than with standard epidemiologic methods. Advances in the application of metabolomics in large-scale epidemiologic research are now being realized through a combination of improved sample preparation and handling, automated laboratory and processing methods, and reduction in costs. The number of epidemiologic studies that use metabolic profiling is still limited, but it is fast gaining popularity in this area. In the present article, we present a roadmap for metabolomic analyses in epidemiologic studies and discuss the various challenges these data pose to large-scale studies. We discuss the steps of data preprocessing, univariate and multivariate data analysis, correction for multiplicity of comparisons with correlated data, and finally the steps of cross-validation and external validation. As data from metabolomic studies accumulate in epidemiology, there is a need for large-scale replication and synthesis of findings, increased availability of raw data, and a focus on good study design, all of which will highlight the potential clinical impact of metabolomics in this field. © The Author 2014. Published by Oxford University Press on behalf of the Johns Hopkins Bloomberg School of Public Health. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  14. The macular degeneration and aging study: Design and research protocol of a randomized trial for a psychosocial intervention with macular degeneration patients.

    Science.gov (United States)

    Sörensen, Silvia; White, Katherine; Mak, Wingyun; Zanibbi, Katherine; Tang, Wan; O'Hearn, Amanda; Hegel, Mark T

    2015-05-01

    Age-related Macular Degeneration (AMD) is the leading cause of irreversible and predictable blindness among older adults with serious physical and mental health consequences. Visual impairment is associated with negative future outlook and depression and has serious consequences for older adults' quality of life and, by way of depression, on long-term survival. Psychosocial interventions have the potential to alleviate and prevent depression symptoms among older AMD patients. We describe the protocol of the Macular Degeneration and Aging Study, a randomized clinical trial of a psychosocial Preventive Problem-Solving Intervention. The intervention is aimed at enhancing well-being and future planning among older adults with macular degeneration by increasing preparation for future care. Adequate randomization and therapeutic fidelity were achieved. Current retention rates were acceptable, given the vulnerability of the population. Acceptability (adherence and satisfaction) was high. Given the high public health significance and impact on quality of life among older adults with vision loss, this protocol contributes a valid test of a promising intervention for maintaining mental and physical health in this population. Copyright © 2015 Elsevier Inc. All rights reserved.

  15. Design and testing of multiplex RT-PCR primers for the rapid detection of influenza A virus genomic segments: Application to equine influenza virus.

    Science.gov (United States)

    Lee, EunJung; Kim, Eun-Ju; Shin, Yeun-Kyung; Song, Jae-Young

    2016-02-01

    The avian influenza A virus causes respiratory infections in animal species. It can undergo genomic recombination with newly obtained genetic material through an interspecies transmission. However, the process is an unpredictable event, making it difficult to predict the emergence of a new pandemic virus and distinguish its origin, especially when the virus is the result of multiple infections. Therefore, identifying a novel influenza is entirely dependent on sequencing its whole genome. Occasionally, however, it can be time-consuming, costly, and labor-intensive when sequencing many influenza viruses. To compensate for the difficulty, we developed a rapid, cost-effective, and simple multiplex RT-PCR to identify the viral genomic segments. As an example to evaluate its performance, H3N8 equine influenza virus (EIV) was studied for the purpose. In developing this protocol to amplify the EIV eight-segments, a series of processes, including phylogenetic analysis based on different influenza hosts, in silico analyses to estimate primer specificity, coverage, and variation scores, and investigation of host-specific amino acids, were progressively conducted to reduce or eliminate the negative factors that might affect PCR amplification. Selectively, EIV specific primers were synthesized with dual priming oligonucleotides (DPO) system to increase primer specificity. As a result, 16 primer pairs were selected to screen the dominantly circulating H3N8 EIV 8 genome segments: PA (3), PB2 (1), PA (3), NP (3), NA8 (2), HA3 (1), NS (1), and M (2). The diagnostic performance of the primers was evaluated with eight sets composing of four segment combinations using viral samples from various influenza hosts. The PCR results suggest that the multiplex RT-PCR has a wide range of applications in detection and diagnosis of newly emerging EIVs. Further, the proposed procedures of designing multiplex primers are expected to be used for detecting other animal influenza A viruses

  16. Disclosing bias in bisulfite assay: MethPrimers underestimate high DNA methylation.

    Directory of Open Access Journals (Sweden)

    Andrea Fuso

    Full Text Available Discordant results obtained in bisulfite assays using MethPrimers (PCR primers designed using MethPrimer software or assuming that non-CpGs cytosines are non methylated versus primers insensitive to cytosine methylation lead us to hypothesize a technical bias. We therefore used the two kinds of primers to study different experimental models and methylation statuses. We demonstrated that MethPrimers negatively select hypermethylated DNA sequences in the PCR step of the bisulfite assay, resulting in CpG methylation underestimation and non-CpG methylation masking, failing to evidence differential methylation statuses. We also describe the characteristics of "Methylation-Insensitive Primers" (MIPs, having degenerated bases (G/A to cope with the uncertain C/U conversion. As CpG and non-CpG DNA methylation patterns are largely variable depending on the species, developmental stage, tissue and cell type, a variable extent of the bias is expected. The more the methylome is methylated, the greater is the extent of the bias, with a prevalent effect of non-CpG methylation. These findings suggest a revision of several DNA methylation patterns so far documented and also point out the necessity of applying unbiased analyses to the increasing number of epigenomic studies.

  17. RATMAC PRIMER

    Energy Technology Data Exchange (ETDEWEB)

    Munn, R. J.; Stewart, J. M.; Norden, A. P.; Pagoaga, M. Katherine

    1980-10-01

    The language RATMAC is a direct descendant of one of the most successful structured FORTRAN languages, rational FORTRAN, RATFOR. RATMAC has all of the characteristics of RATFOR, but is augmented by a powerful recursive macro processor which is extremely useful in generating transportable FORTRAN programs. A macro is a collection of programming steps which are associated with a keyword. This keyword uniquely identifies the macro, and whenever it appears in a RATMAC program it is replaced by the collection of steps. This primer covers the language's control and decision structures, macros, file inclusion, symbolic constants, and error messages.

  18. An easy-to-use primer design tool to address paralogous loci and T-DNA insertion sites in the genome of Arabidopsis thaliana.

    Science.gov (United States)

    Huep, Gunnar; Kleinboelting, Nils; Weisshaar, Bernd

    2014-01-01

    More than 90% of the Arabidopsis thaliana genes are members of multigene families. DNA sequence similarities present in such related genes can cause trouble, e.g. when molecularly analysing mutant alleles of these genes. Also, flanking-sequence-tag (FST) based predictions of T-DNA insertion positions are often located within paralogous regions of the genome. In such cases, the prediction of the correct insertion site must include careful sequence analyses on the one hand and a paralog specific primer design for experimental confirmation of the prediction on the other hand. GABI-Kat is a large A. thaliana insertion line resource, which uses in-house confirmation to provide highly reliable access to T-DNA insertion alleles. To offer trustworthy mutant alleles of paralogous loci, we considered multiple insertion site predictions for single FSTs and implemented this 1-to-N relation in our database. The resulting paralogous predictions were addressed experimentally and the correct insertion locus was identified in most cases, including cases in which there were multiple predictions with identical prediction scores. A newly developed primer design tool that takes paralogous regions into account was developed to streamline the confirmation process for paralogs. The tool is suitable for all parts of the genome and is freely available at the GABI-Kat website. Although the tool was initially designed for the analysis of T-DNA insertion mutants, it can be used for any experiment that requires locus-specific primers for the A. thaliana genome. It is easy to use and also able to design amplimers with two genome-specific primers as required for genotyping segregating families of insertion mutants when looking for homozygous offspring. The paralog-aware confirmation process significantly improved the reliability of the insertion site assignment when paralogous regions of the genome were affected. An automatic online primer design tool that incorporates experience from the in

  19. Designing, optimization and validation of tetra-primer ARMS PCR protocol for genotyping mutations in caprine Fec genes.

    Science.gov (United States)

    Ahlawat, Sonika; Sharma, Rekha; Maitra, A; Roy, Manoranjan; Tantia, M S

    2014-12-01

    New, quick, and inexpensive methods for genotyping novel caprine Fec gene polymorphisms through tetra-primer ARMS PCR were developed in the present investigation. Single nucleotide polymorphism (SNP) genotyping needs to be attempted to establish association between the identified mutations and traits of economic importance. In the current study, we have successfully genotyped three new SNPs identified in caprine fecundity genes viz. T(-242)C (BMPR1B), G1189A (GDF9) and G735A (BMP15). Tetra-primer ARMS PCR protocol was optimized and validated for these SNPs with short turn-around time and costs. The optimized techniques were tested on 158 random samples of Black Bengal goat breed. Samples with known genotypes for the described genes, previously tested in duplicate using the sequencing methods, were employed for validation of the assay. Upon validation, complete concordance was observed between the tetra-primer ARMS PCR assays and the sequencing results. These results highlight the ability of tetra-primer ARMS PCR in genotyping of mutations in Fec genes. Any associated SNP could be used to accelerate the improvement of goat reproductive traits by identifying high prolific animals at an early stage of life. Our results provide direct evidence that tetra-primer ARMS-PCR is a rapid, reliable, and cost-effective method for SNP genotyping of mutations in caprine Fec genes.

  20. Designing, optimization and validation of tetra-primer ARMS PCR protocol for genotyping mutations in caprine Fec genes

    Directory of Open Access Journals (Sweden)

    Sonika Ahlawat

    2014-12-01

    Full Text Available New, quick, and inexpensive methods for genotyping novel caprine Fec gene polymorphisms through tetra-primer ARMS PCR were developed in the present investigation. Single nucleotide polymorphism (SNP genotyping needs to be attempted to establish association between the identified mutations and traits of economic importance. In the current study, we have successfully genotyped three new SNPs identified in caprine fecundity genes viz. T(-242C (BMPR1B, G1189A (GDF9 and G735A (BMP15. Tetra-primer ARMS PCR protocol was optimized and validated for these SNPs with short turn-around time and costs. The optimized techniques were tested on 158 random samples of Black Bengal goat breed. Samples with known genotypes for the described genes, previously tested in duplicate using the sequencing methods, were employed for validation of the assay. Upon validation, complete concordance was observed between the tetra-primer ARMS PCR assays and the sequencing results. These results highlight the ability of tetra-primer ARMS PCR in genotyping of mutations in Fec genes. Any associated SNP could be used to accelerate the improvement of goat reproductive traits by identifying high prolific animals at an early stage of life. Our results provide direct evidence that tetra-primer ARMS-PCR is a rapid, reliable, and cost-effective method for SNP genotyping of mutations in caprine Fec genes.

  1. Design and application of specific 16S rDNA-targeted primers for assessing endophytic diversity in Dendrobium officinale using nested PCR-DGGE.

    Science.gov (United States)

    Yu, Jie; Zhou, Xiao-Feng; Yang, Sui-Juan; Liu, Wen-Hong; Hu, Xiu-Fang

    2013-11-01

    Novel specific 16S rDNA-targeted primers were successfully designed and applied to the characterization of endophytic diversity in Dendrobium officinale. Using the popular universal bacterial primers 27f/1492r, the fragments of chloroplast and mitochondrion 16S/18S rDNA were amplified from D. officinale. They shared high nucleotide identity with the chloroplast 16S rDNAs (99-100 %) and with the mitochondrion 18S rDNAs (93-100 %) from various plants, respectively, and both shared 73-86 % identities with the bacterial 16S rDNA sequences in GenBank. The current bacterial universal primers, including 27f/1492r, match well with the chloroplast and mitochondrion 16S/18S rDNAs, which accordingly renders these primers not useful for endophytic diversity analysis. Novel 16S rDNA-targeted primers fM1 (5'-CCGCGTGNRBGAHGAAGGYYYT-3') and rC5 (5'-TAATCCTGTTTGCTCC CCAC-3') were designed, which show good specificity compared to the 16S/18S rDNAs of D. officinale, and perfect universality within bacteria except for Cyanobacteria. The primers fM1/rC5, together with 515f-GC/rC5, which overlaps the whole V4 region of 16S rDNA, were subjected to nested polymerase chain reaction denaturing gradient gel electrophoresis (PCR-DGGE) to analyze the diversity of endophytic bacteria in D. officinale from three different sources in China. The results showed diversities in roots and stems of the plants from all three locations. Altogether, 29 bands were identified as bacteria, with the dominant group being Proteobacteria and the dominant genus being Burkholderia, some of which commonly has the function of nitrogen fixation and thus may play potentially important roles in D. officinale. Therefore, the nested PCR-DGGE method based on the novel primers provides a good alternative for investigating the communities and roles of endophytes in D. officinale.

  2. 类群特异性PCR引物设计与评估%Design and evaluation of group-targeted PCR primers

    Institute of Scientific and Technical Information of China (English)

    董声; 俞志明; 宋秀贤; 韩笑天; 曹西华

    2013-01-01

    本文以真核藻类18S rDNA类群特异性PCR引物的设计与评估为例,详细介绍了如何利用Primrose等一系列程序设计类群特异性PCR引物并评估其敏感性与特异性,并对这一方法的优势与应用类群特异性PCR引物进行群落多样性分析需要注意的问题进行了讨论.%We take the design and evaluation of eukaryotic algae-targeted 18S rDNA PCR primers as an example,to give a step-by-step illustration of how to design and assess group-targeted PCR primers using Primrose and other programs.Then we summarize the advantages of the design & evaluation pipeline by comparing the amplification efficiency of newly designed and previously reported 18S rDNA universal primers.Cautions are also emphasized on using PCR-based strategies to assess community diversity.

  3. Innovative Comparison of Transient Ignition Temperature at the Booster Interface, New Stainless Steel Pyrovalve Primer Chamber Assembly "V" (PCA) Design Versus the Current Aluminum "Y" PCA Design

    Science.gov (United States)

    Saulsberry, Regor L.; McDougle, Stephen H.; Garcia,Roberto; Johnson, Kenneth L.; Sipes, William; Rickman, Steven; Hosangadi, Ashvin

    2011-01-01

    An assessment of four spacecraft pyrovalve anomalies that occurred during ground testing was conducted by the NASA Engineering & Safety Center (NESC) in 2008. In all four cases, a common aluminum (Al) primer chamber assembly (PCA) was used with dual NASA Standard Initiators (NSIs) and the nearly simultaneous (separated by less than 80 microseconds) firing of both initiators failed to ignite the booster charge. The results of the assessment and associated test program were reported in AIAA Paper AIAA-2008-4798, NESC Independent Assessment of Pyrovalve Ground Test Anomalies. As a result of the four Al PCA anomalies, and the test results and findings of the NESC assessment, the Mars Science Laboratory (MSL) project team decided to make changes to the PCA. The material for the PCA body was changed from aluminum (Al) to stainless steel (SS) to avoid melting, distortion, and potential leakage of the NSI flow passages when the device functioned. The flow passages, which were interconnected in a Y-shaped configuration (Y-PCA) in the original design, were changed to a V-shaped configuration (V-PCA). The V-shape was used to more efficiently transfer energy from the NSIs to the booster. Development and qualification testing of the new design clearly demonstrated faster booster ignition times compared to the legacy AL Y-PCA design. However, the final NESC assessment report recommended that the SS V-PCA be experimentally characterized and quantitatively compared to the Al Y-PCA design. This data was deemed important for properly evaluating the design options for future NASA projects. This test program has successfully quantified the improvement of the SS V-PCA over the Al Y-PCA. A phase B of the project was also conducted and evaluated the effect of firing command skew and enlargement of flame channels to further assist spacecraft applications.

  4. Design of Vibrio 16S rRNA Gene Specific Primers and Their Application in the Analysis of Seawater Vibrio Community

    Institute of Scientific and Technical Information of China (English)

    LIU Yong; YANG Guanpin; WANG Hualei; CHEN Jixiang; SHI Xianming; ZOU Guiwei; WEI Qiwei; SUN Xiuqin

    2006-01-01

    The pathogenic species of genus Vibrio cause vibriosis, one of the most prevalent diseases of maricultured animals and seafood consumers. Monitoring their kinetics in the chain of seafood production, processing and consumption is of great importance for food and mariculture safety. In order to enrich Vibrio-representing 16S ribosomal RNA gene (rDNA) fragments and identify these bacteria further real-timely and synchronously among bacterial flora in the chain, a pair of primers that selectively amplify Vibrio 16S rDNA fragments were designed with their specificities and coverage testified in the analysis of seawater Vibrio community. The specificities and coverage of two primers, VF169 and VR744, were determined theoretically among bacterial 16S rDNAs available in GenBank by using BLAST program and practically by amplifying Vibrio 16S rDNA fragments from seawater DNA. More than 88.3% of sequences in GenBank, which showed identical matches with VR744, belong to Vibrio genus. A total of 33 clones were randomly selected and sequenced. All of the sequences showed their highest similarities to and clustered around those of diverse known Vibrio species. The primers designed are capable of retrieving a wide range of Vibrio 16S rDNA fragments specifically among bacterial flora in seawater, the most important natural environment of seafood cultivation.

  5. PhiSiGns: an online tool to identify signature genes in phages and design PCR primers for examining phage diversity

    Directory of Open Access Journals (Sweden)

    Dwivedi Bhakti

    2012-03-01

    Full Text Available Abstract Background Phages (viruses that infect bacteria have gained significant attention because of their abundance, diversity and important ecological roles. However, the lack of a universal gene shared by all phages presents a challenge for phage identification and characterization, especially in environmental samples where it is difficult to culture phage-host systems. Homologous conserved genes (or "signature genes" present in groups of closely-related phages can be used to explore phage diversity and define evolutionary relationships amongst these phages. Bioinformatic approaches are needed to identify candidate signature genes and design PCR primers to amplify those genes from environmental samples; however, there is currently no existing computational tool that biologists can use for this purpose. Results Here we present PhiSiGns, a web-based and standalone application that performs a pairwise comparison of each gene present in user-selected phage genomes, identifies signature genes, generates alignments of these genes, and designs potential PCR primer pairs. PhiSiGns is available at (http://www.phantome.org/phisigns/; http://phisigns.sourceforge.net/ with a link to the source code. Here we describe the specifications of PhiSiGns and demonstrate its application with a case study. Conclusions PhiSiGns provides phage biologists with a user-friendly tool to identify signature genes and design PCR primers to amplify related genes from uncultured phages in environmental samples. This bioinformatics tool will facilitate the development of novel signature genes for use as molecular markers in studies of phage diversity, phylogeny, and evolution.

  6. Evaluation of revised polymerase chain reaction primers for more inclusive quantification of ammonia-oxidizing archaea and bacteria.

    Science.gov (United States)

    Meinhardt, Kelley A; Bertagnolli, Anthony; Pannu, Manmeet W; Strand, Stuart E; Brown, Sally L; Stahl, David A

    2015-04-01

    Ammonia-oxidizing archaea (AOA) and bacteria (AOB) fill key roles in the nitrogen cycle. Thus, well-vetted methods for characterizing their distribution are essential for framing studies of their significance in natural and managed systems. Quantification of the gene coding for one subunit of the ammonia monooxygenase (amoA) by polymerase chain reaction is frequently employed to enumerate the two groups. However, variable amplification of sequence variants comprising this conserved genetic marker for ammonia oxidizers potentially compromises within- and between-system comparisons. We compared the performance of newly designed non-degenerate quantitative polymerase chain reaction primer sets to existing primer sets commonly used to quantify the amoA of AOA and AOB using a collection of plasmids and soil DNA samples. The new AOA primer set provided improved quantification of model mixtures of different amoA sequence variants and increased detection of amoA in DNA recovered from soils. Although both primer sets for the AOB provided similar results for many comparisons, the new primers demonstrated increased detection in environmental application. Thus, the new primer sets should provide a useful complement to primers now commonly used to characterize the environmental distribution of AOA and AOB.

  7. Intervertebral disc degeneration in dogs

    NARCIS (Netherlands)

    Bergknut, Niklas

    2011-01-01

    Back pain is common in both dogs and humans, and is often associated with intervertebral disc (IVD) degeneration. The IVDs are essential structures of the spine and degeneration can ultimately result in diseases such as IVD herniation or spinal instability. In order to design new treatments halting

  8. Coal Bed Methane Primer

    Energy Technology Data Exchange (ETDEWEB)

    Dan Arthur; Bruce Langhus; Jon Seekins

    2005-05-25

    During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

  9. QDD version 3.1: a user-friendly computer program for microsatellite selection and primer design revisited: experimental validation of variables determining genotyping success rate.

    Science.gov (United States)

    Meglécz, Emese; Pech, Nicolas; Gilles, André; Dubut, Vincent; Hingamp, Pascal; Trilles, Aurélie; Grenier, Rémi; Martin, Jean-François

    2014-11-01

    Microsatellite marker development has been greatly simplified by the use of high-throughput sequencing followed by in silico microsatellite detection and primer design. However, the selection of markers designed by the existing pipelines depends either on arbitrary criteria, or older studies on PCR success. Based on wet laboratory experiments, we have identified the following factors that are most likely to influence genotyping success rate: alignment score between the primers and the amplicon; the distance between primers and microsatellites; the length of the PCR product; target region complexity and the number of reads underlying the sequence. The QDD pipeline has been modified to include these most pertinent factors in the output to help the selection of markers. Furthermore, new features are also included in the present version: (i) not only raw sequencing reads are accepted as input, but also contigs, allowing the analysis of assembled high-coverage data; (ii) input data can be both in fasta and fastq format to facilitate the use of Illumina and IonTorrent reads; (iii) A comparison to known transposable elements allows their detection; (iv) A contamination check can be carried out by BLASTing potential markers against the nucleotide (nt) database of NCBI; (v) QDD3 is now also available imbedded into a virtual machine making installation easier and operating system independent. It can be used both on command-line version as well as integrated into a Galaxy server, providing a user-friendly interface, as well as the possibility to utilize a large variety of NGS tools. © 2014 John Wiley & Sons Ltd.

  10. Specific primers design based on the superoxide dismutase b gene for Trypanosoma cruzi as a screening tool:Validation method using strains from Colombia classified according to their discrete typing unit

    Institute of Scientific and Technical Information of China (English)

    Francisco Olmo; Javier Escobedo-Ortegn; Patricia Palma; Manuel Snchez-Moreno; Ana Meja-Jaramillo; Omar Triana; Clotilde Marn

    2014-01-01

    Objective:To classify 21 new isolates of Trypanosoma cruzi (T. cruzi) according to the Discrete Typing Unit (DTU) which they belong to, as well as tune up a new pair of primers designed to detect the parasite in biological samples. Methods: Strains were isolated, DNA extracted, and classified by using three Polymerase Chain Reactions (PCR). Subsequently this DNA was used along with other isolates of various biological samples, for a new PCR using primers designed. Finally, the amplified fragments were sequenced. Results: It was observed the predominance of DTU I in Colombia, as well as the specificity of our primers for detection of T. cruzi, while no band was obtained when other species were used. Conclusions:This work reveals the genetic variability of 21 new isolates of T. cruzi in Colombia.Our primers confirmed their specificity for detecting the presence of T. cruzi.

  11. VGRAF primer

    Energy Technology Data Exchange (ETDEWEB)

    Padilla, G.C.; Thompson, S.L.

    1980-10-01

    VGRAF is a powerful FORTRAN program which is designed to produce professional-quality color slides, viewgraphs, posters, and data plots for presentations or reports. The program is easy to use and requires no a priori knowledge of a programming language and little or no previous programming experience. This report describes a subset of the VGRAF commands which will enable the user to make very simple plots. For enhanced plotting, the user is referred to SAND79-2147.

  12. Detection of minimal residual disease in patients with multiple myeloma using clonotype-specific PCR primers designed from DNA extracted from archival bone marrow slides.

    Science.gov (United States)

    Takamatsu, Hiroyuki; Ogawa, Yoshiyasu; Kobayashi, Noriko; Obata, Kazue; Narisawa, Tadashi; Nakayama, Kouji; Munemoto, Saori; Aoki, Go; Ohata, Kinya; Kumano, Yoshihisa; Ozaki, Jun; Murata, Ryoichi; Kondo, Yukio; Terasaki, Yasushi; Kurokawa, Toshiro; Miyamoto, Toshihiro; Shimizu, Naomi; Fukushima, Toshihiro; Yoshida, Akira; Ueda, Takanori; Yoshida, Takashi; Nakao, Shinji

    2013-10-01

    Polymerase chain reaction (PCR)-negative molecular complete remission (mCR) can be induced by stem cell transplantation in some patients with multiple myeloma (MM) and is associated with long-term progression-free survival (PFS). The detection of molecular minimal residual disease (MRD), however, requires fresh or frozen materials for designing clone-specific primers, which are not always readily available. In this study, we used DNA extracted from archival bone marrow (BM) slides for PCR to detect MRD in 50 patients with MM who received various induction therapies and autologous peripheral blood stem cell transplantation (ASCT). Clonotype-specific immunoglobulin (Ig) H PCR primers were prepared for 32 of 50 cases (64%) using BM slides, and for 9 of 14 cases (64%) using fresh BM cells. DNA in peripheral blood stem cell autografts of the 22 patients who achieved at least a partial response after ASCT was subjected to PCR to amplify clonotype-specific rearranged IgH gene sequences. The median PFS of the eight patients with MRD-positive autografts was 18 months, whereas that of 14 patients with MRD-negative autografts was not reached at a median follow-up of 27 months (p = 0.012). Post-ASCT PFS of the four patients who achieved mCR was 100% at a median follow-up of 47 months. These results indicate that archival BM slides can serve as a source of DNA for preparing clonotype-specific primers for MRD monitoring in patients with MM whose cryopreserved myeloma cells are not available for DNA preparation. Our results also suggest that patients with MM who received MRD-negative autografts and achieved mCR have a long PFS.

  13. Designing and Screening of Microsatellite Primers in Chinese Hamster%中国地鼠微卫星DNA引物的设计及筛选

    Institute of Scientific and Technical Information of China (English)

    宋国华; 耿佳宁; 贾若愚; 岳文斌; 刘田福; 胡松年

    2012-01-01

    本研究旨在筛选中国地鼠微卫星位点,为中国地鼠遗传分析提供遗传标记.根据建立的中国地鼠微卫星富集文库,对筛选的含微卫星DNA序列的克隆应用引物设计软件Primer 3.0设计引物135对,选择合成11对理论上易出现影子带的引物,用20个中国地鼠个体对这些引物进行了评估.结果显示,11对引物均能扩增出谱带,这11条带的平均多态信息含量(PIC)为0.4195,平均观察杂合度(Ho)为0.3895,平均期望杂合度(He)为0.4565,每个位点的平均等位基因数为5.818.筛选出的微卫星位点均可用于中国地鼠种群遗传结构分析,这将为中国地鼠品种选育、种系评估提供更多的微卫星遗传标记信息.%The objectives of the present study were to screen new microsatellite loci in Chinese hamster to develop genetic markers for genetic analysis. A library of partial small size fractionated genomic DNA was constructed with the Chinese hamster. 135 pairs of primers were designed with the software Primer 3. 0 for rnicrosatellites positive clones obtained. 11 pairs primers that the stutter bands easily in theory were synthesized and 20 samples were tested with them. The results showed 10 of the 11 loci were found to be polymorphic,and PIC, the mean observed heterozygosities (Ho) , the mean expected heterozy-gosities( He) were 0. 4195, 0. 3895 and 0. 4565, respectively. The microsatellite markers would be useful for further studying on accessions identification and breeding of Chinese hamster,which would provide some evaluable tools for marker-assisted selection breeding and gene mapping in Chinese hamster.

  14. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

    KAUST Repository

    Wang, Yong

    2009-10-09

    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.

  15. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies.

    Science.gov (United States)

    Wang, Yong; Qian, Pei-Yuan

    2009-10-09

    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969-983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies.

  16. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies.

    Directory of Open Access Journals (Sweden)

    Yong Wang

    Full Text Available Bacterial 16S ribosomal DNA (rDNA amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90% were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969-983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies.

  17. Design and validation of four new primers for next-generation sequencing to target the 18S rRNA genes of gastrointestinal ciliate protozoa.

    Science.gov (United States)

    Ishaq, Suzanne L; Wright, André-Denis G

    2014-09-01

    Four new primers and one published primer were used to PCR amplify hypervariable regions within the protozoal 18S rRNA gene to determine which primer pair provided the best identification and statistical analysis. PCR amplicons of 394 to 498 bases were generated from three primer sets, sequenced using Roche 454 pyrosequencing with Titanium, and analyzed using the BLAST database (NCBI) and MOTHUR version 1.29. The protozoal diversity of rumen contents from moose in Alaska was assessed. In the present study, primer set 1, P-SSU-316F and GIC758R (amplicon of 482 bases), gave the best representation of diversity using BLAST classification, and the set amplified Entodinium simplex and Ostracodinium spp., which were not amplified by the other two primer sets. Primer set 2, GIC1080F and GIC1578R (amplicon of 498 bases), had similar BLAST results and a slightly higher percentage of sequences that were identified with a higher sequence identity. Primer sets 1 and 2 are recommended for use in ruminants. However, primer set 1 may be inadequate to determine protozoal diversity in nonruminants. The amplicons created by primer set 1 were indistinguishable for certain species within the genera Bandia, Blepharocorys, Polycosta, and Tetratoxum and between Hemiprorodon gymnoprosthium and Prorodonopsis coli, none of which are normally found in the rumen. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  18. A Hearing Aid Primer 1

    Science.gov (United States)

    Yetter, Carol J.

    2009-01-01

    This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

  19. Alternative Teacher Compensation: A Primer

    Science.gov (United States)

    Koppich, Julia E.; Rigby, Jessica

    2009-01-01

    This policy primer is designed to provide base-line information about new forms of teacher pay that are emerging around the country, to support the local conversations and negotiations that will lead to the development of innovative compensation systems. It identifies reasons why teacher compensation is high on local, state, and federal policy…

  20. Redesign of PCR primers for mitochondrial cytochrome c oxidase subunit I for marine invertebrates and application in all-taxa biotic surveys.

    Science.gov (United States)

    Geller, J; Meyer, C; Parker, M; Hawk, H

    2013-09-01

    DNA barcoding is a powerful tool for species detection, identification and discovery. Metazoan DNA barcoding is primarily based upon a specific region of the cytochrome c oxidase subunit I gene that is PCR amplified by primers HCO2198 and LCO1490 ('Folmer primers') designed by Folmer et al. (Molecular Marine Biology and Biotechnology, 3, 1994, 294). Analysis of sequences published since 1994 has revealed mismatches in the Folmer primers to many metazoans. These sequences also show that an extremely high level of degeneracy would be necessary in updated Folmer primers to maintain broad taxonomic utility. In primers jgHCO2198 and jgLCO1490, we replaced most fully degenerated sites with inosine nucleotides that complement all four natural nucleotides and modified other sites to better match major marine invertebrate groups. The modified primers were used to amplify and sequence cytochrome c oxidase subunit I from 9105 specimens from Moorea, French Polynesia and San Francisco Bay, California, USA representing 23 phyla, 42 classes and 121 orders. The new primers, jgHCO2198 and jgLCO1490, are well suited for routine DNA barcoding, all-taxon surveys and metazoan metagenomics.

  1. Design of primers for pertussis diagnosis by Real Time PCR and determination of its sensitivity and specificity in comparison with commercial kits.

    Directory of Open Access Journals (Sweden)

    Hamidreza Monavari

    2013-12-01

    Results: Performance of our home made primers for detecting pertussis using Real Time PCR in comparison with those by commercial kit was acceptable based on diagnostic classical guidance (WHO and the (CDC. Conclusions: Real time PCR test with new primers in comparison with culture techniques is more suitable, high sensitivity and can provide more informative values for pertussis detection.

  2. Design and evaluation of universal 16S rRNA gene primers for high-throughput sequencing to simultaneously detect DAMO microbes and anammox bacteria.

    Science.gov (United States)

    Lu, Yong-Ze; Ding, Zhao-Wei; Ding, Jing; Fu, Liang; Zeng, Raymond J

    2015-12-15

    To develop universal 16S rRNA gene primers for high-throughput sequencing for the simultaneous detection of denitrifying anaerobic methane oxidation (DAMO) archaea, DAMO bacteria, and anaerobic ammonium oxidation (anammox) bacteria, four published primer sets (PS2-PS5) were modified. The overall coverage of the four primer pairs was evaluated in silico with the Silva SSU r119 dataset. Based on the virtual evaluation, the two best primer pairs (PS4 and PS5) were selected for further verification. Illumina MiSeq sequencing of a freshwater sediment and a culture from a DAMO-anammox reactor using these two primer pairs revealed that PS5 (341b4F-806R) was the most promising universal primer pair. This pair of primers detected both archaea and bacteria with less bias than PS4. Furthermore, an anaerobic fermentation culture and a wastewater treatment plant culture were used to verify the accuracy of PS5. More importantly, it detected DAMO archaea, DAMO bacteria, and anammox bacteria simultaneously with no false positives appeared. This universal 16S rRNA gene primer pair extends the existing molecular tools for studying the community structures and distributions of DAMO microbes and their potential interactions with anammox bacteria in different environments. Copyright © 2015 Elsevier Ltd. All rights reserved.

  3. A versatile method to design stem-loop primer-based quantitative PCR assays for detecting small regulatory RNA molecules.

    Directory of Open Access Journals (Sweden)

    Zsolt Czimmerer

    Full Text Available Short regulatory RNA-s have been identified as key regulators of gene expression in eukaryotes. They have been involved in the regulation of both physiological and pathological processes such as embryonal development, immunoregulation and cancer. One of their relevant characteristics is their high stability, which makes them excellent candidates for use as biomarkers. Their number is constantly increasing as next generation sequencing methods reveal more and more details of their synthesis. These novel findings aim for new detection methods for the individual short regulatory RNA-s in order to be able to confirm the primary data and characterize newly identified subtypes in different biological conditions. We have developed a flexible method to design RT-qPCR assays that are very sensitive and robust. The newly designed assays were tested extensively in samples from plant, mouse and even human formalin fixed paraffin embedded tissues. Moreover, we have shown that these assays are able to quantify endogenously generated shRNA molecules. The assay design method is freely available for anyone who wishes to use a robust and flexible system for the quantitative analysis of matured regulatory RNA-s.

  4. A CRISPR/Cas9-based method and primer design tool for seamless genome editing in fission yeast [version 2; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    María Rodríguez-López

    2017-01-01

    Full Text Available In the fission yeast Schizosaccharomyces pombe the prevailing approach for gene manipulations is based on homologous recombination of a PCR product that contains genomic target sequences and a selectable marker. The CRISPR/Cas9 system has recently been implemented in fission yeast, which allows for seamless genome editing without integration of a selection marker or leaving any other genomic ‘scars’. The published method involves manual design of the single guide RNA (sgRNA, and digestion of a large plasmid with a problematic restriction enzyme to clone the sgRNA. To increase the efficiency of this approach, we have established and optimized a PCR-based system to clone the sgRNA without restriction enzymes into a plasmid with a dominant natMX6 (nourseothricin selection marker. We also provide a web-tool, CRISPR4P, to support the design of the sgRNAs and the primers required for the entire process of seamless DNA deletion. Moreover, we report the preparation of G1-synchronized and cryopreserved S. pombe cells, which greatly increases the efficiency and speed for transformations, and may also facilitate standard gene manipulations. Applying this optimized CRISPR/Cas9-based approach, we have successfully deleted over 80 different non-coding RNA genes, which are generally lowly expressed, and have inserted 7 point mutations in 4 different genomic regions.

  5. A CRISPR/Cas9-based method and primer design tool for seamless genome editing in fission yeast [version 3; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    María Rodríguez-López

    2017-05-01

    Full Text Available In the fission yeast Schizosaccharomyces pombe the prevailing approach for gene manipulations is based on homologous recombination of a PCR product that contains genomic target sequences and a selectable marker. The CRISPR/Cas9 system has recently been implemented in fission yeast, which allows for seamless genome editing without integration of a selection marker or leaving any other genomic ‘scars’. The published method involves manual design of the single guide RNA (sgRNA, and digestion of a large plasmid with a problematic restriction enzyme to clone the sgRNA. To increase the efficiency of this approach, we have established and optimized a PCR-based system to clone the sgRNA without restriction enzymes into a plasmid with a dominant natMX6 (nourseothricin selection marker. We also provide a web-tool, CRISPR4P, to support the design of the sgRNAs and the primers required for the entire process of seamless DNA deletion. Moreover, we report the preparation of G1-synchronized and cryopreserved S. pombe cells, which greatly increases the efficiency and speed for transformations, and may also facilitate standard gene manipulations. Applying this optimized CRISPR/Cas9-based approach, we have successfully deleted over 80 different non-coding RNA genes, which are generally lowly expressed, and have inserted 7 point mutations in 4 different genomic regions.

  6. Analysis and meta-analysis of single-case designs with a standardized mean difference statistic: a primer and applications.

    Science.gov (United States)

    Shadish, William R; Hedges, Larry V; Pustejovsky, James E

    2014-04-01

    This article presents a d-statistic for single-case designs that is in the same metric as the d-statistic used in between-subjects designs such as randomized experiments and offers some reasons why such a statistic would be useful in SCD research. The d has a formal statistical development, is accompanied by appropriate power analyses, and can be estimated using user-friendly SPSS macros. We discuss both advantages and disadvantages of d compared to other approaches such as previous d-statistics, overlap statistics, and multilevel modeling. It requires at least three cases for computation and assumes normally distributed outcomes and stationarity, assumptions that are discussed in some detail. We also show how to test these assumptions. The core of the article then demonstrates in depth how to compute d for one study, including estimation of the autocorrelation and the ratio of between case variance to total variance (between case plus within case variance), how to compute power using a macro, and how to use the d to conduct a meta-analysis of studies using single-case designs in the free program R, including syntax in an appendix. This syntax includes how to read data, compute fixed and random effect average effect sizes, prepare a forest plot and a cumulative meta-analysis, estimate various influence statistics to identify studies contributing to heterogeneity and effect size, and do various kinds of publication bias analyses. This d may prove useful for both the analysis and meta-analysis of data from SCDs.

  7. Bayesian methodology for the design and interpretation of clinical trials in critical care medicine: a primer for clinicians.

    Science.gov (United States)

    Kalil, Andre C; Sun, Junfeng

    2014-10-01

    To review Bayesian methodology and its utility to clinical decision making and research in the critical care field. Clinical, epidemiological, and biostatistical studies on Bayesian methods in PubMed and Embase from their inception to December 2013. Bayesian methods have been extensively used by a wide range of scientific fields, including astronomy, engineering, chemistry, genetics, physics, geology, paleontology, climatology, cryptography, linguistics, ecology, and computational sciences. The application of medical knowledge in clinical research is analogous to the application of medical knowledge in clinical practice. Bedside physicians have to make most diagnostic and treatment decisions on critically ill patients every day without clear-cut evidence-based medicine (more subjective than objective evidence). Similarly, clinical researchers have to make most decisions about trial design with limited available data. Bayesian methodology allows both subjective and objective aspects of knowledge to be formally measured and transparently incorporated into the design, execution, and interpretation of clinical trials. In addition, various degrees of knowledge and several hypotheses can be tested at the same time in a single clinical trial without the risk of multiplicity. Notably, the Bayesian technology is naturally suited for the interpretation of clinical trial findings for the individualized care of critically ill patients and for the optimization of public health policies. We propose that the application of the versatile Bayesian methodology in conjunction with the conventional statistical methods is not only ripe for actual use in critical care clinical research but it is also a necessary step to maximize the performance of clinical trials and its translation to the practice of critical care medicine.

  8. Design, development, and use of molecular primers and probes for the detection of Gluconacetobacter species in the pink sugarcane mealybug.

    Science.gov (United States)

    Franke-Whittle, Ingrid H; O'Shea, Michael G; Leonard, Graham J; Sly, Lindsay I

    2005-07-01

    Molecular tools for the species-specific detection of Gluconacetobacter sacchari, Gluconacetobacter diazotrophicus, and Gluconacetobacter liquefaciens from the pink sugarcane mealybug (PSMB) Saccharicoccus sacchari Cockerell (Homiptera: Pseudococcidae) were developed and used in polymerase chain reactions (PCR) and in fluorescence in situ hybridizations (FISH) to better understand the microbial diversity and the numerical significance of the acetic acid bacteria in the PSMB microenvironment. The presence of these species in the PSMB occurred over a wide range of sites, but not in all sites in sugarcane-growing areas of Queensland, Australia, and was variable over time. Molecular probes for use in FISH were also designed for the three acetic acid bacterial species, and shown to be specific only for the target species. Use of these probes in FISH of "squashed" whole mealybugs indicated that these acetic acid bacteria species represent only a small proportion of the microbial population of the PSMB. Despite the detection of Glac. sacchari, Glac. diazotrophicus, and Glac. liquefaciens by PCR from different mealybugs isolated at various times and from various sugarcane-growing areas in Queensland, Australia, these bacteria do not appear to be significant commensals in the PSMB environment.

  9. [Hepatolenticular degeneration].

    Science.gov (United States)

    Zudenigo, D; Relja, M

    1990-01-01

    Hepatolenticular degeneration (Wilson's disease) is a hereditary disease in which metabolic disorder of copper leads to its accumulation in the liver, brain, cornea and kidneys with consequent pathologic changes in those organs. Hereditary mechanism of the disease is autosomal recessive with prevalence of 30-100 per 1,000,000 inhabitants. Etiology of this disease is not yet explained. There are two hypotheses. The first one is that it is the disorder of ceruloplasmine metabolism caused by insufficient synthesis of normal ceruloplasmine, or synthesis of functionally abnormal ceruloplasmine. The second one is: the block of copper biliar excretion which is the consequence of the liver lysosomes functional defect. Pathogenetic mechanism of disease is firstly long-term accumulation of copper in the liver, and later, when the liver depo is full, its releasing in circulation and accumulation in the brain, cornea, kidneys and bones, which causes adequate pathologic changes. Toxic activity of copper is the consequence of its activity on enzymes, particularly on those with -SH group. There are two basic clinical forms of the disease: liver disease or neurologic disease. Before puberty the liver damage is more frequent, while in adolescents and young adults neurologic form of the disease is usual. The liver disease is nonspecific and characterized by symptoms of cirrhosis and chronic aggressive hepatitis. The only specificity is hemolytic anemia which, in combination with previous symptoms, is important for diagnosis of the disease. Neurologic symptoms are the most frequent consequence of pathologic changes in the basal ganglia. In our patients the most frequent symptoms were tremor (63%); dysarthria, choreoathetosis and rigor (38%); ataxia and mental disorders (31%); dysphagia and dystonia (12%), diplopia, hypersalivation, nystagmus and Babinski's sign (6%). Among pathologic changes in other tissues and organs the most important is the finding of Kayser-Fleischer ring in the

  10. SBE primer : multiplexing minisequencing-based genotyping

    Energy Technology Data Exchange (ETDEWEB)

    Kaderali, L. (Lars); Deshpande, A. (Alina); Uribe-Romeo, F. J. (Francisco J.); Schliep, A.; Torney, D. C. (David C.)

    2002-01-01

    Single-nucleotide polymorphism (SNP) analysis is a powerful tool for mapping and diagnosing disease-related alleles. Most of the known genetic diseases are caused by point mutations, and a growing number of SNPs will be routinely analyzed to diagnose genetic disorders. Mutation analysis by polymerase mediated single-base primer extension (minisequencing) can be massively parallelized using for example DNA microchips or flow cytometry with microspheres as solid support. By adding a unique oligonucleotide tag to the 5-inch end of the minisequencing primer and attaching the complementary anti-tag to the array or bead surface, the assay can be 'demultiplexed'. However, such high-throughput scoring of SNPs requires a high level of primer multiplexing in order to analyze multiple loci in one assay, thus enabling inexpensive and fast polymorphism scoring. Primers can be chosen from either the plus or the minus strand, and primers used in the same experiment must not bind to one another. To genotype a given number of polymorphic sites, the question is which primer to use for each SNP, and which primers to group into the same experiment. Furthermore, a crosshybridization-free tag/anti-tag code is required in order to sort the extended primers to the corresponding microspheres or chip spots. These problems pose challenging algorithmic questions. We present a computer program lo automate the design process for the assay. Oligonucleotide primers for the reaction are automatically selected by the software, a unique DNA tag/anti-tag system is generated, and the pairing of primers and DNA-Tags is automatically done in a way to avoid any crossreactivity. We report first results on a 45-plex genotyping assay, indicating that minisequencing can be adapted to be a powerful tool for high-throughput, massively parallel genotyping.

  11. Fusion primer and nested integrated PCR (FPNI-PCR: a new high-efficiency strategy for rapid chromosome walking or flanking sequence cloning

    Directory of Open Access Journals (Sweden)

    Wang Zhen

    2011-11-01

    Full Text Available Abstract Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs. These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures.

  12. Development of TRAP primers for Ricinus communis L.

    Science.gov (United States)

    Simões, K S; Silva, S A; Machado, E L; Brasileiro, H S

    2017-04-13

    The objective of this article was to develop TRAP (target region amplification polymorphism) primers for castor bean, with the goal of making functional markers available for genetic studies about the species. To do this, oligonucleotides were designed based on ESTs, obtained from the NCBI (National Center for Biotechnology Information) databank, which code enzymes involved in metabolic routes of fatty acid synthesis, ricin synthesis, and resistance to castor bean pathogens. The forward primers were designed with the help of the Primer3 software and, for the reverse, six arbitrary primers were used. To standardize the amplification reactions, the following criteria were used to select the primers: sizes between 18 and 20 bp, guanine/cytosine (GC) in the range of 40 to 60%, and average annealing temperature between 55° and 62°C. The design quality of the primers was verified using the Net Primer application. Fifty-six primers were designed, which had an average GC percentage of 53.2%. A total of 336 combinations were obtained using the 56 fixed and 6 arbitrary primers. Based on polymerase chain reaction, 330 combinations (89%) presented good amplification patterns for the genomic DNA of castor bean. The size of the fragments amplified varied between 50 and 2072 bp. The TRAP primers designed and validated in this study are the first for castor bean and represent a significant increase in the molecular markers for this species.

  13. Wet Macular Degeneration

    Science.gov (United States)

    ... macular degeneration Overview By Mayo Clinic Staff Wet macular degeneration is a chronic eye disease that causes blurred vision or a blind spot in your visual field. It's generally caused by abnormal blood vessels that leak fluid or blood into ... macular degeneration is one of two types of age-related ...

  14. Multiplexing Short Primers for Viral Family PCR

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

    2008-06-26

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  15. Design and fabrication of 3D-printed anatomically shaped lumbar cage for intervertebral disc (IVD) degeneration treatment.

    Science.gov (United States)

    Serra, T; Capelli, C; Toumpaniari, R; Orriss, I R; Leong, J J H; Dalgarno, K; Kalaskar, D M

    2016-07-19

    Spinal fusion is the gold standard surgical procedure for degenerative spinal conditions when conservative therapies have been unsuccessful in rehabilitation of patients. Novel strategies are required to improve biocompatibility and osseointegration of traditionally used materials for lumbar cages. Furthermore, new design and technologies are needed to bridge the gap due to the shortage of optimal implant sizes to fill the intervertebral disc defect. Within this context, additive manufacturing technology presents an excellent opportunity to fabricate ergonomic shape medical implants. The goal of this study is to design and manufacture a 3D-printed lumbar cage for lumbar interbody fusion. Optimisations of the proposed implant design and its printing parameters were achieved via in silico analysis. The final construct was characterised via scanning electron microscopy, contact angle, x-ray micro computed tomography (μCT), atomic force microscopy, and compressive test. Preliminary in vitro cell culture tests such as morphological assessment and metabolic activities were performed to access biocompatibility of 3D-printed constructs. Results of in silico analysis provided a useful platform to test preliminary cage design and to find an optimal value of filling density for 3D printing process. Surface characterisation confirmed a uniform coating of nHAp with nanoscale topography. Mechanical evaluation showed mechanical properties of final cage design similar to that of trabecular bone. Preliminary cell culture results showed promising results in terms of cell growth and activity confirming biocompatibility of constructs. Thus for the first time, design optimisation based on computational and experimental analysis combined with the 3D-printing technique for intervertebral fusion cage has been reported in a single study. 3D-printing is a promising technique for medical applications and this study paves the way for future development of customised implants in spinal

  16. Designing primers and evaluation of the efficiency of propidium monoazide – Quantitative polymerase chain reaction for counting the viable cells of Lactobacillus gasseri and Lactobacillus salivarius

    Directory of Open Access Journals (Sweden)

    Chieh-Hsien Lai

    2017-07-01

    Full Text Available The purpose of this study is to evaluate the efficiency of using propidium monoazide (PMA real-time quantitative polymerase chain reaction (qPCR to count the viable cells of Lactobacillus gasseri and Lactobacillus salivarius in probiotic products. Based on the internal transcription spacer and 23S rRNA genes, two primer sets specific for these two Lactobacillus species were designed. For a probiotic product, the total deMan Rogosa Sharpe plate count was 8.65±0.69 log CFU/g, while for qPCR, the cell counts of L. gasseri and L. salivarius were 8.39±0.14 log CFU/g and 8.57±0.24 log CFU/g, respectively. Under the same conditions, for its heat-killed product, qPCR counts for L. gasseri and L. salivarius were 6.70±0.16 log cells/g and 7.67±0.20 log cells/g, while PMA-qPCR counts were 5.33±0.18 log cells/g and 5.05±0.23 log cells/g, respectively. For cell dilutions with a viable cell count of 8.5 log CFU/mL for L. gasseri and L. salivarius, after heat killing, the PMA-qPCR count for both Lactobacillus species was near 5.5 log cells/mL. When the PMA-qPCR counts of these cell dilutions were compared before and after heat killing, although some DNA might be lost during the heat killing, significant qPCR signals from dead cells, i.e., about 4–5 log cells/mL, could not be reduced by PMA treatment. Increasing PMA concentrations from 100 μM to 200 μM or light exposure time from 5 minutes to 15 minutes had no or, if any, only minor effect on the reduction of qPCR signals from their dead cells. Thus, to differentiate viable lactic acid bacterial cells from dead cells using the PMA-qPCR method, the efficiency of PMA to reduce the qPCR signals from dead cells should be notable.

  17. 一种基于免费在线工具的定量PCR引物设计方法%A Simple Method for Real-time PCR Primer Design Based on Free Online Softwares

    Institute of Scientific and Technical Information of China (English)

    姚建; 董振辉; 马雪西; 王晓飞

    2015-01-01

    定量PCR (real-time polymerase chain reaction)技术在分子生物学领域被广泛应用,其中SYBR Green染料法因其简便、经济,深受分子生物学家和检测机构青睐.本研究介绍一种针对SYBR Green染料法的定量PCR引物设计方法,该方法基于免费在线工具的组合设计定量PCR引物,通过Primer Quest、Primer-BLAST、UNAFold以及Beacon DesignerTM Free Edition获得最佳引物.

  18. China Energy Primer

    Energy Technology Data Exchange (ETDEWEB)

    Ni, Chun Chun

    2009-11-16

    Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

  19. An SAT® Validity Primer

    Science.gov (United States)

    Shaw, Emily J.

    2015-01-01

    This primer should provide the reader with a deeper understanding of the concept of test validity and will present the recent available validity evidence on the relationship between SAT® scores and important college outcomes. In addition, the content examined on the SAT will be discussed as well as the fundamental attention paid to the fairness of…

  20. The importance of RT-qPCR primer design for the detection of siRNA-mediated mRNA silencing

    Directory of Open Access Journals (Sweden)

    Lasham Annette

    2011-05-01

    Full Text Available Abstract Background The use of RNAi to analyse gene function in vitro is now widely applied in biological research. However, several difficulties are associated with its use in vivo, mainly relating to inefficient delivery and non-specific effects of short RNA duplexes in animal models. The latter can lead to false positive results when real-time RT-qPCR alone is used to measure target mRNA knockdown. Findings We observed that detection of an apparent siRNA-mediated knockdown in vivo was dependent on the primers used for real-time RT-qPCR measurement of the target mRNA. Two siRNAs specific for RRM1 with equivalent activity in vitro were administered to A549 xenografts via intratumoural injection. In each case, apparent knockdown of RRM1 mRNA was observed only when the primer pair used in RT-qPCR flanked the siRNA cleavage site. This false-positive result was found to result from co-purified siRNA interfering with both reverse transcription and qPCR. Conclusions Our data suggest that using primers flanking the siRNA-mediated cleavage site in RT-qPCR-based measurements of mRNA knockdown in vivo can lead to false positive results. This is particularly relevant where high concentrations of siRNA are introduced, particularly via intratumoural injection, as the siRNA may be co-purified with the RNA and interfere with downstream enzymatic steps. Based on these results, using primers flanking the siRNA target site should be avoided when measuring knockdown of target mRNA by real-time RT-qPCR.

  1. PrimerSNP: a web tool for whole-genome selection of allele-specific and common primers of phylogenetically-related bacterial genomic sequences

    Directory of Open Access Journals (Sweden)

    Lemos Eliana

    2008-10-01

    Full Text Available Abstract Background The increasing number of genomic sequences of bacteria makes it possible to select unique SNPs of a particular strain/species at the whole genome level and thus design specific primers based on the SNPs. The high similarity of genomic sequences among phylogenetically-related bacteria requires the identification of the few loci in the genome that can serve as unique markers for strain differentiation. PrimerSNP attempts to identify reliable strain-specific markers, on which specific primers are designed for pathogen detection purpose. Results PrimerSNP is an online tool to design primers based on strain specific SNPs for multiple strains/species of microorganisms at the whole genome level. The allele-specific primers could distinguish query sequences of one strain from other homologous sequences by standard PCR reaction. Additionally, PrimerSNP provides a feature for designing common primers that can amplify all the homologous sequences of multiple strains/species of microorganisms. PrimerSNP is freely available at http://cropdisease.ars.usda.gov/~primer. Conclusion PrimerSNP is a high-throughput specific primer generation tool for the differentiation of phylogenetically-related strains/species. Experimental validation showed that this software had a successful prediction rate of 80.4 – 100% for strain specific primer design.

  2. PriFi - Using a Multiple Alignment of Related Sequences to Find Primers for  Amplification of Homologs

    DEFF Research Database (Denmark)

    Fredslund, Jakob; Schauser, Leif; Madsen, Lene Heegaard

    2005-01-01

    phylogenetically related species and outputs a list of possibly degenerate primer pairs fulfilling a number of criteria, such that the primers have a maximal probability of amplifying orthologous sequences in other phylogenetically related species. Operating on a genome-wide scale, PriFi automates the first steps...

  3. iCFD: Interpreted Computational Fluid Dynamics - Degeneration of CFD to one-dimensional advection-dispersion models using statistical experimental design - The secondary clarifier.

    Science.gov (United States)

    Guyonvarch, Estelle; Ramin, Elham; Kulahci, Murat; Plósz, Benedek Gy

    2015-10-15

    The present study aims at using statistically designed computational fluid dynamics (CFD) simulations as numerical experiments for the identification of one-dimensional (1-D) advection-dispersion models - computationally light tools, used e.g., as sub-models in systems analysis. The objective is to develop a new 1-D framework, referred to as interpreted CFD (iCFD) models, in which statistical meta-models are used to calculate the pseudo-dispersion coefficient (D) as a function of design and flow boundary conditions. The method - presented in a straightforward and transparent way - is illustrated using the example of a circular secondary settling tank (SST). First, the significant design and flow factors are screened out by applying the statistical method of two-level fractional factorial design of experiments. Second, based on the number of significant factors identified through the factor screening study and system understanding, 50 different sets of design and flow conditions are selected using Latin Hypercube Sampling (LHS). The boundary condition sets are imposed on a 2-D axi-symmetrical CFD simulation model of the SST. In the framework, to degenerate the 2-D model structure, CFD model outputs are approximated by the 1-D model through the calibration of three different model structures for D. Correlation equations for the D parameter then are identified as a function of the selected design and flow boundary conditions (meta-models), and their accuracy is evaluated against D values estimated in each numerical experiment. The evaluation and validation of the iCFD model structure is carried out using scenario simulation results obtained with parameters sampled from the corners of the LHS experimental region. For the studied SST, additional iCFD model development was carried out in terms of (i) assessing different density current sub-models; (ii) implementation of a combined flocculation, hindered, transient and compression settling velocity function; and (iii

  4. 共有序列简并杂合寡核苷酸引物聚合酶链反应在呼吸道副黏病毒科病毒诊断中的应用%Consensus-degenerate hybrid oligonucleotide primer polymerase chain reaction-A powerful technique for the identification of Paramyxoviridae in clinical specimens

    Institute of Scientific and Technical Information of China (English)

    赵百慧; 张泓; 张曦; 王春; 沈佳仁; 俞雪莲; 高烨; 滕峥; 朱兆奎; 储维; 宋黎黎

    2013-01-01

    The present paper aims to compare the sensitivity, specificity and accordance rate of consensus-degenerate hybrid oligonucleotide primer polymerase chain reaction (CODEHOP PCR) technique and commercial kit in diagnosis of paramyxovirus infection in clinical specimens and to further evaluate the value of CODEHOP PCR assay in detection of known and novel respiratory viruses . A total of 572 specimens from lower respiratory tract were collected from Children' Hospital of Shanghai inpatients with acute respiratory infections during 2011. These specimens were analyzed by CODEHOP PCR and commercial RV12 kit for the detection of paramyxoviruses, including known parainfluenza virus type 1 (PIV-1), PIV-2 , PIV-3, respiratory syncytial virus A (RSVA) , RSVB , human metapneumovirus (HMPV) and novel viruses . The results showed that 102 out of 572 specimens (19 .76% ) were detected positive by the RV12 kit, and 113 were detected positive by CODEHOP PCR . The accordance rate of the two methods was 85.39% . CODEHOP PCR is more sensitive than RV12 kit in detecting RSVA infection in cell culture . The study suggests that CODEHOP PCR is a powerful technique for the identification of paramyxoviruses in clinical specimens . It can be optimized by combining with some new techniques , and is worthy of application in the future.%采用共有序列简并杂合寡核苷酸引物聚合酶链反应(CODEHOP PCR)体系和商品化RV12试剂盒对急性呼吸道感染患儿下呼吸道标本中的副黏病毒科病毒进行检测,比较CODEHOP PCR与RV12试剂盒检测结果的符合率和敏感度,观察CODEHOP PCR在临床呼吸道标本中对副黏病毒诊断的应用价值,进一步探讨具备检测已知呼吸道病毒和未知新病毒特点的CODEHOP PCR在呼吸道疾病谱和未知潜在呼吸道病毒诊断中的推广价值.采集2011年上海市儿童医院因急性呼吸道感染住院的患儿下呼吸道标本572份,分别采用2种方法

  5. Development of SCAR marker specific to non-toxic Jatropha curcas L. and designing a novel multiplexing PCR along with nrDNA ITS primers to circumvent the false negative detection

    KAUST Repository

    Mastan, Shaik G.

    2011-05-10

    Jatropha curcas L., a multipurpose shrub, has acquired significant economic importance for its seed oil which can be converted to biodiesel an emerging alternative to petro-diesel. In addition to the commercial value, it is also having medicinal and even high nutritional value to use as animal fodder which is limited due to the toxicity. Development of molecular marker will enable to differentiate non-toxic from toxic variety of J. curcas in a mixed population and also for quality control since the toxic components of J. curcas has deleterious effect on animals. In the present study, the efforts were made to generate the specific SCAR marker for toxic and/or non-toxic J. curcas from RAPD markers. Among the markers specific for toxic and non-toxic varieties, four were selected, purified, cloned, sequenced, and designed primers out of which one set of primers NT-JC/SCAR I/OPQ15-F and R could able to discriminate the non-toxic with toxic Jatropha by giving expected 430 bp size amplification in non-toxic variety. Furthermore, novel multiplex PCR was designed using the nrDNA ITS primers to overcome the false negatives. Present work also demonstrates utility of the conserved regions of nrDNA coding genes in ruling out the artifacts in PCR-like false negatives frequently occur in SCAR due to various reasons. The specific SCAR markers generated in the present investigation will help to distinguish non-toxic from toxic varieties of J. curcas or vice versa, and isolated marker along with designed multiplex protocol has applications in quality control for selective cultivation of non-toxic variety and will also assist in breeding and molecular mapping studies. © 2011 Springer Science+Business Media, LLC.

  6. Lead Free Electric Primer

    Science.gov (United States)

    2011-10-06

    comply with a collection of information if it does not display a currently valid OMB control number. PLEASE DO NOT RETURN YOUR FORM TO THE ABOVE...D-1 4 ACRONYMS AB Acetylene Black ADN Ammonium dinitramide Al Aluminum ATK...electrical conductivity of the MIC material used in the primer mix significantly changed over a relatively short interval of time. The initiation of MIC

  7. Primer on molecular genetics

    Energy Technology Data Exchange (ETDEWEB)

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  8. Degenerate Euler zeta function

    OpenAIRE

    Kim, Taekyun

    2015-01-01

    Recently, T. Kim considered Euler zeta function which interpolates Euler polynomials at negative integer (see [3]). In this paper, we study degenerate Euler zeta function which is holomorphic function on complex s-plane associated with degenerate Euler polynomials at negative integers.

  9. Beam shaping for laser initiated optical primers

    Science.gov (United States)

    Lizotte, Todd E.

    2008-08-01

    Remington was one of the first firearm manufacturing companies to file a patent for laser initiated firearms, in 1969. Nearly 40 years later, the development of laser initiated firearms has not become a mainstream technology in the civilian market. Requiring a battery is definitely a short coming, so it is easy to see how such a concept would be problematic. Having a firearm operate reliably and the delivery of laser energy in an efficient manner to ignite the shock-sensitive explosive primer mixtures is a tall task indeed. There has been considerable research on optical element based methods of transferring or compressing laser energy to ignite primer charges, including windows, laser chip primers and various lens shaped windows to focus the laser energy. The focusing of laser light needs to achieve igniting temperatures upwards of >400°C. Many of the patent filings covering this type of technology discuss simple approaches where a single point of light might be sufficient to perform this task. Alternatively a multi-point method might provide better performance, especially for mission critical applications, such as precision military firearms. This paper covers initial design and performance test of the laser beam shaping optics to create simultaneous multiple point ignition locations and a circumferential intense ring for igniting primer charge compounds. A simple initial test of the ring beam shaping technique was evaluated on a standard large caliber primer to determine its effectiveness on igniting the primer material. Several tests were conducted to gauge the feasibility of laser beam shaping, including optic fabrication and mounting on a cartridge, optic durability and functional ignition performance. Initial data will be presented, including testing of optically elements and empirical primer ignition / burn analysis.

  10. 8种新型HPV的分型及特异型引物设计%Typing and specific primer design of eight novel HPVs

    Institute of Scientific and Technical Information of China (English)

    王启广; 谌芳; 曹友德

    2016-01-01

    目的 本文主要研究近几年来NCBI数据库最新释放出来的8种新型HPV即HPV(126,135,136,137,140,144,154,166),对其进行分子进化树分析,进行分类并设计特异型引物. 方法 NCBI检索8种新型HPV的基因组序列,然后用Blast相似性比较得到与其L1高度相似的HPV,其次选择HPV αβγ各属具代表性的HPV,最后用Clustal W对以上所有58种HPV L1区氨基酸序列进行比较分析,构建分子进化树;进一步用Primer-Blast对8种新型HPV进行特异型引物设计. 结果 系统进化树分析得出8种HPV均属于γ属,利用Primer-Blast分析得到这8种HPV特异型引物.结论 HPV126、HPV135、HPV136、HPV137、HPV140、HPV144、HPV154、HPV166均为γ属.

  11. Math primer for engineers

    CERN Document Server

    Cryer, CW

    2014-01-01

    Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula

  12. The R primer

    CERN Document Server

    Ekstrom, Claus Thorn

    2011-01-01

    Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i

  13. High universality of matK primers for barcoding gymnosperms

    Institute of Scientific and Technical Information of China (English)

    Yan LI; Lian-Ming GAO; RAM C.POUDEL; De-Zhu Li; Alan FORREST

    2011-01-01

    DNA barcoding is a tool to provide rapid and accurate taxonomic identification using a standard DNA region. A two-marker combination of rnatK+rbcL was formally proposed as the core barcode for land plants by the Consortium for the Barcode of Life Plant Working Group. However, there are currently no barcoding primers for matK showing high universality in gymnosperms. We used 57 gymnosperm species representing 40 genera, 11families and four subclasses to evaluate the universality of nine candidate matK primers and one rbcL primer in this study. Primer (1F/724R) of rbcL is proposed here as a universal primer for gymnosperms due to high universality. One of the nine candidate matK primers (Gym_F1A/Gym_R1A) is proposed as the best "universal" matK primer for gynnosperms because of high polymerase chain reaction success and routine generation of high quality bidirectional sequences. A specific matK primer for Ephedra was newly designed in this study, which performed well on the sampled species. The primers proposed here for rbcL and matK can be easily and successfully amplified for most gymnosperms.

  14. El primer virreinato americano

    Directory of Open Access Journals (Sweden)

    Cassá, Roberto

    2006-12-01

    Full Text Available This article explores the government of viceroy Christopher Columbus in the American territories. We return to the first Spanish settlement in Santo Domingo and the contradictions inherent to this expansionist proyect. The contradictions were part of the logic of the absolutist state and Columbus’ reaction against the controls imposed by the monarchs. Secondly, we look into the dificulties that the Admiral encountered to develop a mercantilist model. In this context, we examine the rationale behind the first government of the Indies and the features that defined the new West Indian society.

    El artículo trata sobre el gobierno de Cristóbal Colón en tierras americanas. Retomamos el tema del primer emplazamiento español en Santo Domingo y las contradicciones que tuvo aquel proyecto debido a la lógica del estado absolutista, a la ambición desmedida del descubridor y a su reacción ante los controles que desde un principio impusieron los monarcas. En un segundo momento analizamos las dificultades que encontró el Almirante para desarrollar un modelo mercantilista acorde a sus ideas y a los acuerdos a que llegó con la Corona. En ese contexto analizamos la lógica del primer gobierno colombinista en las Indias y los rasgos que definieron la nueva sociedad antillana.

  15. Design Method Amelioration of Human Immunoglobulin Gene Primer in Heavy Chain Variable Region%人免疫球蛋白重链可变区基因引物设计方法的改良

    Institute of Scientific and Technical Information of China (English)

    姜晶; 孙颖; 刘红艳; 牟玲; 罗恩杰

    2012-01-01

    针对抗体胚系基因数据库的数据不断更新和完善,为获得人全部免疫球蛋白(Ig)重链可变区基因,改进引物设计方法,自主设计针对可变区基因高度保守的框架区1(FR1)和框架区4(FR4)的引物,提取未经免疫的健康人外周血单个核细胞,通过RT-PCR扩增重链可变区基因.其DNA序列与GenBank数据库和IMGT/V-QUEST软件比对,序列分析符合人免疫球蛋白重链基本框架结构,为胚系基因重排产生的序列.多个克隆的测序结果对比分析显示了良好的多样性.获得的重链序列为研制基因工程抗体及构建噬菌体抗体库奠定了物质基础,也为扩增其他物种Ig可变区基因的引物提供新的设计思路.%Aiming at the continuous renovation and consummation of dala of databank on antibody germ line gene, in order to obtain full gene of heavy chain variable region of human immunoglobin (Ig) , to ameliorate primer design method, a primer was independently designed aiming at variable gene highly conservative region framework 1 ( FR1) and framework 4 ( FR4) , and extracted peripheral blood mononuclear cells (PBMCs) from healthy volunteer, and amplified its heavy chain variable region gene through RT-PCR. After comparison with databank in CenBank and IMGT/V-QUEST software and sequence analysis, the DNA sequence accorded with basic framework structure of human Ig heavy chain, and was the sequence produced by the rearrangement of germ line gene. Comparative analysis of multiple clones sequencing showed a good diversity. The obtained data of heavy chain sequence had provided the material foundation for research and development of gene engineering antibodies and phage libraries, and new design ideas for amplifying Ig variable region gene primers of other species.

  16. Degenerate Density Perturbation Theory

    CERN Document Server

    Palenik, Mark C

    2016-01-01

    Fractional occupation numbers can be used in density functional theory to create a symmetric Kohn-Sham potential, resulting in orbitals with degenerate eigenvalues. We develop the corresponding perturbation theory and apply it to a system of $N_d$ degenerate electrons in a harmonic oscillator potential. The order-by-order expansions of both the fractional occupation numbers and unitary transformations within the degenerate subspace are determined by the requirement that a differentiable map exists connecting the initial and perturbed states. Using the X$\\alpha$ exchange-correlation (XC) functional, we find an analytic solution for the first-order density and first through third-order energies as a function of $\\alpha$, with and without a self-interaction correction. The fact that the XC Hessian is not positive definite plays an important role in the behavior of the occupation numbers.

  17. Degenerate density perturbation theory

    Science.gov (United States)

    Palenik, Mark C.; Dunlap, Brett I.

    2016-09-01

    Fractional occupation numbers can be used in density functional theory to create a symmetric Kohn-Sham potential, resulting in orbitals with degenerate eigenvalues. We develop the corresponding perturbation theory and apply it to a system of Nd degenerate electrons in a harmonic oscillator potential. The order-by-order expansions of both the fractional occupation numbers and unitary transformations within the degenerate subspace are determined by the requirement that a differentiable map exists connecting the initial and perturbed states. Using the X α exchange-correlation (XC) functional, we find an analytic solution for the first-order density and first- through third-order energies as a function of α , with and without a self-interaction correction. The fact that the XC Hessian is not positive definite plays an important role in the behavior of the occupation numbers.

  18. Vortices as degenerate metrics

    CERN Document Server

    Baptista, J M

    2012-01-01

    We note that the Bogomolny equation for abelian vortices is precisely the condition for invariance of the Hermitian-Einstein equation under a degenerate conformal transformation. This leads to a natural interpretation of vortices as degenerate hermitian metrics that satisfy a certain curvature equation. Using this viewpoint, we rephrase standard results about vortices and make some new observations. We note the existence of a conceptually simple, non-linear rule for superposing vortex solutions, and we describe the natural behaviour of the L^2-metric on the moduli space upon certain restrictions.

  19. Design of a novel quantitative PCR (QPCR-based protocol for genotyping mice carrying the neuroprotective Wallerian degeneration slow (Wlds gene

    Directory of Open Access Journals (Sweden)

    Coleman Michael P

    2007-10-01

    Full Text Available Abstract Background Mice carrying the spontaneous genetic mutation known as Wallerian degeneration slow (Wlds have a unique neuroprotective phenotype, where axonal and synaptic compartments of neurons are protected from degeneration following a wide variety of physical, toxic and inherited disease-inducing stimuli. This remarkable phenotype has been shown to delay onset and progression in several mouse models of neurodegenerative disease, suggesting that Wlds-mediated neuroprotection may assist in the identification of novel therapeutic targets. As a result, cross-breeding of Wlds mice with mouse models of neurodegenerative diseases is used increasingly to understand the roles of axon and synapse degeneration in disease. However, the phenotype shows strong gene-dose dependence so it is important to distinguish offspring that are homozygous or heterozygous for the mutation. Since the Wlds mutation comprises a triplication of a region already present in the mouse genome, the most stringent way to quantify the number of mutant Wlds alleles is using copy number. Current approaches to genotype Wlds mice are based on either Southern blots or pulsed field gel electrophoresis, neither of which are as rapid or efficient as quantitative PCR (QPCR. Results We have developed a rapid, robust and efficient genotyping method for Wlds using QPCR. This approach differentiates, based on copy number, homozygous and heterozygous Wlds mice from wild-type mice and each other. We show that this approach can be used to genotype mice carrying the spontaneous Wlds mutation as well as animals expressing the Wlds transgene. Conclusion We have developed a QPCR genotyping method that permits rapid and effective genotyping of Wlds copy number. This technique will be of particular benefit in studies where Wlds mice are cross-bred with other mouse models of neurodegenerative disease in order to understand the neuroprotective processes conferred by the Wlds mutation.

  20. Kraepelin and degeneration theory.

    Science.gov (United States)

    Hoff, Paul

    2008-06-01

    Emil Kraepelin's contribution to the clinical and scientific field of psychiatry is recognized world-wide. In recent years, however, there have been a number of critical remarks on his acceptance of degeneration theory in particular and on his political opinion in general, which was said to have carried "overtones of proto-fascism" by Michael Shepherd [28]. The present paper discusses the theoretical cornerstones of Kraepelinian psychiatry with regard to their relevance for Kraepelin's attitude towards degeneration theory. This theory had gained wide influence not only in scientific, but also in philosophical and political circles in the last decades of the nineteenth century. There is no doubt that Kraepelin, on the one hand, accepted and implemented degeneration theory into the debate on etiology and pathogenesis of mental disorders. On the other hand, it is not appropriate to draw a simple and direct line from early versions of degeneration theory to the crimes of psychiatrists and politicians during the rule of national socialism. What we need, is a differentiated view, since this will be the only scientific one. Much research needs to be done here in the future, and such research will surely have a significant impact not only on the historical field, but also on the continuous debate about psychiatry, neuroscience and neurophilosophy.

  1. X-82 to Treat Age-related Macular Degeneration

    Science.gov (United States)

    2017-01-12

    Age-Related Macular Degeneration (AMD); Macular Degeneration; Exudative Age-related Macular Degeneration; AMD; Macular Degeneration, Age-related, 10; Eye Diseases; Retinal Degeneration; Retinal Diseases

  2. Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples

    Directory of Open Access Journals (Sweden)

    Alexandre R. Zuntini

    2013-08-01

    Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  3. Impulse Observability and Impulse Controllability of Regular Degenerate Evolution Systems

    Institute of Scientific and Technical Information of China (English)

    GE Zhaoqiang

    2016-01-01

    Impulse observability and impulse controllability of regular degenerate evolution systems are discussed by using functional analysis and operator theory in Banach space.Necessary and sufficient conditions for the impulse observability and impulse controllability of the system are obtained.This research is theoretically important for studying the design of the degenerate evolution system.

  4. Equipment Design and Cost Estimation for Small Modular Biomass Systems, Synthesis Gas Cleanup, and Oxygen Separation Equipment; Task 2.3: Sulfur Primer

    Energy Technology Data Exchange (ETDEWEB)

    Nexant Inc.

    2006-05-01

    This deliverable is Subtask 2.3 of Task 2, Gas Cleanup Design and Cost Estimates, of NREL Award ACO-5-44027, ''Equipment Design and Cost Estimation for Small Modular Biomass Systems, Synthesis Gas Cleanup and Oxygen Separation Equipment''. Subtask 2.3 builds upon the sulfur removal information first presented in Subtask 2.1, Gas Cleanup Technologies for Biomass Gasification by adding additional information on the commercial applications, manufacturers, environmental footprint, and technical specifications for sulfur removal technologies. The data was obtained from Nexant's experience, input from GTI and other vendors, past and current facility data, and existing literature.

  5. On Degenerate Partial Differential Equations

    OpenAIRE

    Chen, Gui-Qiang G.

    2010-01-01

    Some of recent developments, including recent results, ideas, techniques, and approaches, in the study of degenerate partial differential equations are surveyed and analyzed. Several examples of nonlinear degenerate, even mixed, partial differential equations, are presented, which arise naturally in some longstanding, fundamental problems in fluid mechanics and differential geometry. The solution to these fundamental problems greatly requires a deep understanding of nonlinear degenerate parti...

  6. Primer to Design Safe School Projects in Case of Terrorist Attacks and School Shootings. Buildings and Infrastructure Protection Series. FEMA-428/BIPS-07/January 2012. Edition 2

    Science.gov (United States)

    Chipley, Michael; Lyon, Wesley; Smilowitz, Robert; Williams, Pax; Arnold, Christopher; Blewett, William; Hazen, Lee; Krimgold, Fred

    2012-01-01

    This publication, part of the new Building and Infrastructure Protection Series (BIPS) published by the Department of Homeland Security (DHS) Science and Technology Directorate (S&T) Infrastructure Protection and Disaster Management Division (IDD), serves to advance high performance and integrated design for buildings and infrastructure. This…

  7. Bioinformatic Analysis of Microsatellites in the Genome of Sporisorium reilianum and the Design of SSR Primers%玉米丝黑穗病菌基因组SSR信息分析及其引物设计

    Institute of Scientific and Technical Information of China (English)

    王雪梅; 李新凤; 路平; 王建明

    2015-01-01

    探讨玉米丝黑穗病菌(Sporisorium reilianum)基因组序列中 SSR 位点的分布与组成特点,为开发可用于玉米丝黑穗病菌遗传多样性分析的 Genomic‐SSR 标记奠定基础。从 NCBI 公共数据库下载玉米丝黑穗病菌的23条染色体基因组序列,利用 SSRIT 在线软件对第4、5、6、7条染色体进行 SSR 位点的搜索,并且利用 Primer 3.0软件设计Genomic‐SSR 引物。结果表明:在玉米丝黑穗病菌基因组序列的第4、5、6、7条染色体中,共搜索到317个 SSR 位点,平均每条染色体出现79个 SSR 位点,其总长度为6.89 kb ,占这四条染色体基因组总长的0.21%,大约每10.3 kb 中就有一个大于18 bp 的 SSR 序列。其中,主要的重复类型是三核苷酸重复单元,占全部 SSR 的53.94%(171个),其次为二核苷酸重复单元,占全部 SSR 的16.09%(51个)。数量最少的是六碱基重复单元,为17个(5.36%)。出现频率最高的的重复基序为(GCA /TGC)n(13.25%),其次是(AGC/GCT )n 和(CAG/CTG)n ,出现频率分别为8.52%、8.20%。并在此基础上,利用 Primer3.0在线软件设计了40对 SSR 引物。玉米丝黑穗病菌基因组序列中 SSR 位点丰富,具有发掘玉米丝黑穗病菌 SSR 标记的潜力。%The objective of this study is to investigate the distribution and components of Sporisorium reilianum SSRs derived from Genomics. These researches could lay the foundation for the development of Genomic‐SSR markers that would be useful for the genetic diversity analysis of Sporisorium reilianum. The whole genome sequence of Sporisorium reilianum were obtained from NCBI.SSRIT (simple sequence repeat identification tool) was used to search SSRs in fourth ,fifth ,sixth and seventh chromosome and Primer3.0 was used to design Genomic‐SSR primers. A total of 171 SSRs were observed in fourth ,fifth ,sixth and seventh chromosome ,with an average of 79

  8. Laenderyggens degeneration og radiologi

    DEFF Research Database (Denmark)

    Jacobsen, Steffen; Gosvig, Kasper Kjaerulf; Sonne-Holm, Stig

    2006-01-01

    Low back pain (LBP) is one of the most common conditions, and at the same time one of the most complex nosological entities. The lifetime prevalence is approximately 80%, and radiological features of lumbar degeneration are almost universal in adults. The individual risk factors for LBP and signi......Low back pain (LBP) is one of the most common conditions, and at the same time one of the most complex nosological entities. The lifetime prevalence is approximately 80%, and radiological features of lumbar degeneration are almost universal in adults. The individual risk factors for LBP...... and significant relationships between radiological findings and subjective symptoms have both been notoriously difficult to identify. The lack of consensus on clinical criteria and radiological definitions has hampered the undertaking of properly executed epidemiological studies. The natural history of LBP...

  9. Quantum degenerate systems

    Energy Technology Data Exchange (ETDEWEB)

    Micheli, Fiorenza de [Centro de Estudios Cientificos, Arturo Prat 514, Valdivia (Chile); Instituto de Fisica, Pontificia Universidad Catolica de Valparaiso, Casilla 4059, Valparaiso (Chile); Zanelli, Jorge [Centro de Estudios Cientificos, Arturo Prat 514, Valdivia (Chile); Universidad Andres Bello, Av. Republica 440, Santiago (Chile)

    2012-10-15

    A degenerate dynamical system is characterized by a symplectic structure whose rank is not constant throughout phase space. Its phase space is divided into causally disconnected, nonoverlapping regions in each of which the rank of the symplectic matrix is constant, and there are no classical orbits connecting two different regions. Here the question of whether this classical disconnectedness survives quantization is addressed. Our conclusion is that in irreducible degenerate systems-in which the degeneracy cannot be eliminated by redefining variables in the action-the disconnectedness is maintained in the quantum theory: there is no quantum tunnelling across degeneracy surfaces. This shows that the degeneracy surfaces are boundaries separating distinct physical systems, not only classically, but in the quantum realm as well. The relevance of this feature for gravitation and Chern-Simons theories in higher dimensions cannot be overstated.

  10. Comparative assessment of 5' A/T-rich overhang sequences with optimal and sub-optimal primers to increase PCR yields and sensitivity.

    Science.gov (United States)

    Arif, M; Ochoa-Corona, F M

    2013-09-01

    Efficient PCR amplifications require precisely designed and optimized oligonucleotide primers, components, and cycling conditions. Despite recent software development and reaction improvement, primer design can still be enhanced. The aims of this research are to understand (1) the effect on PCR efficiency and DNA yields of primer thermodynamics parameters, and (2) the incorporation of 5' A/T-rich overhanging sequences (flaps) during primer design. Two primer sets, one optimal (ΔG = 0) and one sub-optimal (ΔG = 0.9), were designed using web interface software Primer3, BLASTn, and mFold to target a movement protein gene of Tobacco mosaic virus. The optimal primer set amplifies a product of 195 bp and supports higher PCR sensitivity and yields compared to the sub-optimal primer set, which amplifies a product of 192 bp. Greater fluorescence was obtained using optimal primers compared to that with sub-optimal primers. Primers designed with sub-optimal thermodynamics can be substantially improved by adding 5' flaps. Results indicate that even if the performance of some primers can be improved substantially by 5' flap addition, not all primers will be similarly improved. Optimal 5' flap sequences are dependent on the primer sequences, and alter the primer's T m value. The manipulation of this feature may enhance primer's efficiency to increase the PCR sensitivity and DNA yield.

  11. Cataracts and macular degeneration.

    Science.gov (United States)

    Shoch, D

    1979-09-01

    The intraocular lens restores general vision and some degree of independence and mobility to patients with dense cataracts and macular degeneration. The patient, however, must be repeatedly warned that fine central vision, particularly reading, will not be possible after the surgery. An aphakic spectacle leaves such patients a narrow band of vision when superimposed over the macular lesion, and contact lenses are too small for the patient to manage insertion without help.

  12. Recovery of the mitochondrial COI barcode region in diverse Hexapoda through tRNA-based primers

    Directory of Open Access Journals (Sweden)

    Oh Hyun-Woo

    2010-07-01

    Full Text Available Abstract Background DNA barcoding uses a 650 bp segment of the mitochondrial cytochrome c oxidase I (COI gene as the basis for an identification system for members of the animal kingdom and some other groups of eukaryotes. PCR amplification of the barcode region is a key step in the analytical chain, but it sometimes fails because of a lack of homology between the standard primer sets and target DNA. Results Two forward PCR primers were developed following analysis of all known arthropod mitochondrial genome arrangements and sequence alignment of the tRNA-W gene which was usually located within 200 bp upstream of the COI gene. These two primers were combined with a standard reverse primer (LepR1 to produce a cocktail which generated a barcode amplicon from 125 of 141 species that included representatives of 121 different families of Hexapoda. High quality sequences were recovered from 79% of the species including groups, such as scale insects, that invariably fail to amplify with standard primers. Conclusions A cocktail of two tRNA-W forward primers coupled with a standard reverse primer amplifies COI for most hexapods, allowing characterization of the standard barcode primer binding region in COI 5' as well as the barcode segment. The current results show that primers designed to bind to highly conserved gene regions upstream of COI will aid the amplification of this gene region in species where standard primers fail and provide valuable information to design a primer for problem groups.

  13. Genetic Fingerprinting Using Microsatellite Markers in a Multiplex PCR Reaction: A Compilation of Methodological Approaches from Primer Design to Detection Systems.

    Science.gov (United States)

    Krüger, Jacqueline; Schleinitz, Dorit

    2017-01-01

    Microsatellites are polymorphic DNA loci comprising repeated sequence motifs of two to five base pairs which are dispersed throughout the genome. Genotyping of microsatellites is a widely accepted tool for diagnostic and research purposes such as forensic investigations and parentage testing, but also in clinics (e.g. monitoring of bone marrow transplantation), as well as for the agriculture and food industries. The co-amplification of several short tandem repeat (STR) systems in a multiplex reaction with simultaneous detection helps to obtain more information from a DNA sample where its availability may be limited. Here, we introduce and describe this commonly used genotyping technique, providing an overview on available resources on STRs, multiplex design, and analysis.

  14. New universal matK primers for DNA barcoding angiosperms

    Institute of Scientific and Technical Information of China (English)

    Jing YU; Jian-Hua XUE; Shi-Liang ZHOU

    2011-01-01

    The chloroplast maturase K gene (matK) is one of the most variable coding genes of angiosperms and has been suggested to be a "barcode" for land plants. However, matK exhibits low amplification and sequencing rates due to low universality of currently available primers and mononucleotide repeats. To resolve these technical problems, we evaluated the entire matK region to find a region of 600-800 bp that is highly variable, represents the best of all matK regions with priming sites conservative enough to design universal primers, and avoids the mononucleotide repeats. After careful evaluation, a region in the middle was chosen and a pair of primers named natK472F and matK1248R was designed to amplify and sequence the matK fragment of approximately 776 bp. This region encompasses the most variable sites, represents the entire matK region best, and also exhibits high amplification rates and quality of sequences. The universality of this primer pair was tested using 58 species from 47 families of angiosperm plants. The primers showed a strong amplification (93.1%) and sequencing (92.6%)successes in the species tested. We propose that the new primers will solve, in part, the problems encountered when using matK and promote the adoption of matK as a DNA barcode for angiosperms.

  15. Geometric phases for non-degenerate and degenerate mixed states

    CERN Document Server

    Singh, K; Basu, K; Chen, J L; Du Jiang Feng

    2003-01-01

    This paper focuses on the geometric phase of general mixed states under unitary evolution. Here we analyze both non-degenerate as well as degenerate states. Starting with the non-degenerate case, we show that the usual procedure of subtracting the dynamical phase from the total phase to yield the geometric phase for pure states, does not hold for mixed states. To this end, we furnish an expression for the geometric phase that is gauge invariant. The parallelity conditions are shown to be easily derivable from this expression. We also extend our formalism to states that exhibit degeneracies. Here with the holonomy taking on a non-abelian character, we provide an expression for the geometric phase that is manifestly gauge invariant. As in the case of the non-degenerate case, the form also displays the parallelity conditions clearly. Finally, we furnish explicit examples of the geometric phases for both the non-degenerate as well as degenerate mixed states.

  16. A primer of statistical methods for correlating parameters and properties of electrospun poly(l -lactide) scaffolds for tissue engineering-PART 1: Design of experiments

    KAUST Repository

    Seyedmahmoud, Rasoul

    2014-03-20

    Tissue engineering scaffolds produced by electrospinning are of enormous interest, but still lack a true understanding about the fundamental connection between the outstanding functional properties, the architecture, the mechanical properties, and the process parameters. Fragmentary results from several parametric studies only render some partial insights that are hard to compare and generally miss the role of parameters interactions. To bridge this gap, this article (Part-1 of 2) features a case study on poly-l-lactide scaffolds to demonstrate how statistical methods such as design of experiments can quantitatively identify the correlations existing between key scaffold properties and control parameters, in a systematic, consistent, and comprehensive manner disentangling main effects from interactions. The morphological properties (i.e., fiber distribution and porosity) and mechanical properties (Young\\'s modulus) are "charted" as a function of molecular weight (MW) and other electrospinning process parameters (the Xs), considering the single effect as well as interactions between Xs. For the first time, the major role of the MW emerges clearly in controlling all scaffold properties. The correlation between mechanical and morphological properties is also addressed.

  17. A Cobit primer.

    Energy Technology Data Exchange (ETDEWEB)

    Campbell, Philip LaRoche

    2005-06-01

    COBIT is a set of documents that provides guidance for computer security. This report introduces COBIT by answering the following questions, after first defining acronyms and presenting definitions: 1. Why is COBIT valuable? 2. What is COBIT?, and 3. What documents are related to COBIT? (The answer to the last question constitutes the bulk of this report.) This report also provides more detailed review of three documents. The first two documents--COBIT Security Baseline{trademark} and COBIT Quickstart{trademark}--are initial documents, designed to get people started. The third document-Control Practices-is a ''final'' document, so to speak, designed to take people all the way down into the details. Control Practices is the detail.

  18. Design, synthesis, and evaluation of nonretinoid retinol binding protein 4 antagonists for the potential treatment of atrophic age-related macular degeneration and Stargardt disease.

    Science.gov (United States)

    Cioffi, Christopher L; Dobri, Nicoleta; Freeman, Emily E; Conlon, Michael P; Chen, Ping; Stafford, Douglas G; Schwarz, Daniel M C; Golden, Kathy C; Zhu, Lei; Kitchen, Douglas B; Barnes, Keith D; Racz, Boglarka; Qin, Qiong; Michelotti, Enrique; Cywin, Charles L; Martin, William H; Pearson, Paul G; Johnson, Graham; Petrukhin, Konstantin

    2014-09-25

    Accumulation of lipofuscin in the retina is associated with pathogenesis of atrophic age-related macular degeneration and Stargardt disease. Lipofuscin bisretinoids (exemplified by N-retinylidene-N-retinylethanolamine) seem to mediate lipofuscin toxicity. Synthesis of lipofuscin bisretinoids depends on the influx of retinol from serum to the retina. Compounds antagonizing the retinol-dependent interaction of retinol-binding protein 4 (RBP4) with transthyretin in the serum would reduce serum RBP4 and retinol and inhibit bisretinoid formation. We recently showed that A1120 (3), a potent carboxylic acid based RBP4 antagonist, can significantly reduce lipofuscin bisretinoid formation in the retinas of Abca4(-/-) mice. As part of the NIH Blueprint Neurotherapeutics Network project we undertook the in vitro exploration to identify novel conformationally flexible and constrained RBP4 antagonists with improved potency and metabolic stability. We also demonstrate that upon acute and chronic dosing in rats, 43, a potent cyclopentyl fused pyrrolidine antagonist, reduced circulating plasma RBP4 protein levels by approximately 60%.

  19. Vygotsky on Education Primer. Peter Lang Primer. Volume 30

    Science.gov (United States)

    Lake, Robert

    2012-01-01

    The "Vygotsky on Education Primer" serves as an introduction to the life and work of the Russian psychologist Lev Vygotsky. Even though he died almost eighty years ago, his life's work remains both relevant and significant to the field of education today. This book examines Vygotsky's emphasis on the role of cultural and historical context in…

  20. Vygotsky on Education Primer. Peter Lang Primer. Volume 30

    Science.gov (United States)

    Lake, Robert

    2012-01-01

    The "Vygotsky on Education Primer" serves as an introduction to the life and work of the Russian psychologist Lev Vygotsky. Even though he died almost eighty years ago, his life's work remains both relevant and significant to the field of education today. This book examines Vygotsky's emphasis on the role of cultural and historical context in…

  1. Primer on hardware prefetching

    CERN Document Server

    Falsafi, Babak

    2014-01-01

    Since the 1970's, microprocessor-based digital platforms have been riding Moore's law, allowing for doubling of density for the same area roughly every two years. However, whereas microprocessor fabrication has focused on increasing instruction execution rate, memory fabrication technologies have focused primarily on an increase in capacity with negligible increase in speed. This divergent trend in performance between the processors and memory has led to a phenomenon referred to as the "Memory Wall."To overcome the memory wall, designers have resorted to a hierarchy of cache memory levels, whi

  2. Use of self-quenched, fluorogenic LUX primers for gene expression profiling.

    Science.gov (United States)

    Kusser, Wolfgang

    2006-01-01

    Application of a real-time detection system based on a novel primer design in gene expression profiling is described. In this system, called LUX (Light Upon eXtension), the generation of signal is based on a single fluorescent dye molecule that is attached to an oligonucleotide close to the 3'-end. A primer design software is available that identifies LUX primer pairs based on a set of rules for optimum signal development. The use of LUX fluorogenic primers to determine the expression patterns of various transcripts during differentiation in the P-19 mouse neuronal model is described.

  3. Freshwater Wetlands: A Citizen's Primer.

    Science.gov (United States)

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of wetland…

  4. Freshwater Wetlands: A Citizen's Primer.

    Science.gov (United States)

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…

  5. Freshwater Wetlands: A Citizen's Primer.

    Science.gov (United States)

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…

  6. DNA Extraction and Primer Selection

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

    Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

  7. PCR primers for metazoan mitochondrial 12S ribosomal DNA sequences.

    Directory of Open Access Journals (Sweden)

    Ryuji J Machida

    Full Text Available BACKGROUND: Assessment of the biodiversity of communities of small organisms is most readily done using PCR-based analysis of environmental samples consisting of mixtures of individuals. Known as metagenetics, this approach has transformed understanding of microbial communities and is beginning to be applied to metazoans as well. Unlike microbial studies, where analysis of the 16S ribosomal DNA sequence is standard, the best gene for metazoan metagenetics is less clear. In this study we designed a set of PCR primers for the mitochondrial 12S ribosomal DNA sequence based on 64 complete mitochondrial genomes and then tested their efficacy. METHODOLOGY/PRINCIPAL FINDINGS: A total of the 64 complete mitochondrial genome sequences representing all metazoan classes available in GenBank were downloaded using the NCBI Taxonomy Browser. Alignment of sequences was performed for the excised mitochondrial 12S ribosomal DNA sequences, and conserved regions were identified for all 64 mitochondrial genomes. These regions were used to design a primer pair that flanks a more variable region in the gene. Then all of the complete metazoan mitochondrial genomes available in NCBI's Organelle Genome Resources database were used to determine the percentage of taxa that would likely be amplified using these primers. Results suggest that these primers will amplify target sequences for many metazoans. CONCLUSIONS/SIGNIFICANCE: Newly designed 12S ribosomal DNA primers have considerable potential for metazoan metagenetic analysis because of their ability to amplify sequences from many metazoans.

  8. IDP physics primer

    Energy Technology Data Exchange (ETDEWEB)

    Lockwood, E H

    1958-05-01

    In this document it is proposed to describe the plant site and to outline the nature of the pile in order to show the specific design and layout requirements for the production of plutonium by nuclear synthesis. The selection of the plant site involved a number of special considerations. An essential requirement was a large dependable supply of relatively pure water that remains at a fairly low temperature throughout the year. A large source of power was required to circulate the tremendous quantities of water. The potential dangers connected with the high energies of the nuclear reaction and the formation of a large quantity of radioactive by- products required large distances between each operating section of the plant, and between the plant and main rail and highway routes. The plant site layout and reactor areas are discussed in the first part of the chapter, followed by a functional description of the more essential pile components. The chapter concludes with a discussion of reactor instrumentation. 24 figs., 2 tabs.

  9. Active noise control primer

    CERN Document Server

    Snyder, Scott D

    2000-01-01

    Active noise control - the reduction of noise by generating an acoustic signal that actively interferes with the noise - has become an active area of basic research and engineering applications. The aim of this book is to present all of the basic knowledge one needs for assessing how useful active noise control will be for a given problem and then to provide some guidance for designing, setting up, and tuning an active noise-control system. Written for students who have no prior knowledge of acoustics, signal processing, or noise control but who do have a reasonable grasp of basic physics and mathematics, the book is short and descriptive. It leaves for more advanced texts or research monographs all mathematical details and proofs concerning vibrations, signal processing and the like. The book can thus be used in independent study, in a classroom with laboratories, or in conjunction with a kit for experiment or demonstration. Topics covered include: basic acoustics; human perception and sound; sound intensity...

  10. Complexity management in engineering design a primer

    CERN Document Server

    Maurer, Maik

    2017-01-01

    The treatise supports understanding the phenomena of complexity in engineering, distinguishes complexity from other challenges and presents an overview of definitions and applied approaches. The historical background of complexity management is explained by highlighting the important epochs, their key actors and their discoveries, findings and developments. Knowing about the appearance of early system awareness in ancient Greece, the creation of mechanical philosophy in the 17th century and the discovery of classic physics enables the reader to better comprehend modern system sciences and management approaches. A classification of complexity management approaches by research fields indicates current focus areas and starting points for future discussions. In a comprehensive map, the classification points out mutual overlaps between engineering disciplines in terms of similar complexity management approaches. Finally, the treatise introduces a generic complexity management framework, which is based on structura...

  11. A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

    Directory of Open Access Journals (Sweden)

    Dunn Sade N

    2008-06-01

    Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

  12. Double Degenerate Stars

    Institute of Scientific and Technical Information of China (English)

    LUO Xin-Lian; BAI Hua; ZHAO Lei

    2008-01-01

    Regardless of the formation mechanism, an exotic object, the double degenerate star (DDS), is introduced and investigated, which is composed of baryonic matter and some unknown fermion dark matter. Different from the simple white dwarfs (WDs), there is additional gravitational force provided by the unknown fermion component inside DDSs, which may strongly affect the structure and the stability of such kind of objects. Many possible and strange observational phenomena connecting with them are concisely discussed. Similar to the normal WD, this object can also experience thermonuclear explosion as type Ia supernova explosion when DDS's mass exceeds the maximum mass that can be supported by electron degeneracy pressure. However, since the total mass of baryonic matter can be much lower than that of WD at Chandrasekhar mass limit, the peak luminosity should be much dimmer than what we expect before, which may throw a slight shadow on the standard candle of SN Ia in the research of cosmology.

  13. Facts about Age-Related Macular Degeneration

    Science.gov (United States)

    ... Degeneration (AMD) > Facts About Age-Related Macular Degeneration Facts About Age-Related Macular Degeneration This information was ... an Eye Care Professional Last Reviewed: September 2015 Fact Sheet Blurb The National Eye Institute (NEI) is ...

  14. El primer congreso constituyente mexicano

    OpenAIRE

    José Luis Soberanes Fernández

    2012-01-01

    En el presente trabajo se describe uno de los momentos más difíciles de la historia constitucional de México, por no decir el más difícil, que va desde la Consumación de la Independencia Nacional del 27 de septiembre de 1821 al 30 de noviembre de 1823 en que clausuró sus sesiones el Primer Congreso Constituyente. Fue cuando se erigió el Imperio de Iturbide y su ocaso, en consecuencia triunfó la república y se planteó seriamente el federalismo. Se eligió ese primer constituyente, se clausuró, ...

  15. Environmental Acceptable Medium Caliber Ammunition Percussion Primers

    Science.gov (United States)

    2008-05-01

    percussion primers typically consist of lead styphnate and antimony sulfide. Although highly effective, these heavy material compounds were identified under...Percussion primers, including those used in medium caliber ammunition, typically contain lead styphnate and antimony sulfide along with other constituents...Furthermore, current percussion primer compositions also contain barium nitrate. Although not negatively categorized by the Environmental Protection

  16. Degenerate four wave mixing in solid core photonic bandgap fibers

    DEFF Research Database (Denmark)

    Rasmussen, Per Dalgaard; Lægsgaard, Jesper; Bang, Ole

    2008-01-01

    Degenerate four wave mixing in solid core photonic bandgap fibers is studied theoretically. We demonstrate the possibility of generating parametric gain across bandgaps, and propose a specific design suited for degenerate four wave mixing when pumping at 532nmm. the possibility of tuning the effi...... the efficency of the parametric gain by varying the temperature is also considered. The sults are verified by numerical simultations of pulse propagation....

  17. iCFD: Interpreted Computational Fluid Dynamics – Degeneration of CFD to one-dimensional advection-dispersion models using statistical experimental design – The secondary clarifier

    DEFF Research Database (Denmark)

    Guyonvarch, Estelle; Ramin, Elham; Kulahci, Murat

    2015-01-01

    The present study aims at using statistically designed computational fluid dynamics (CFD) simulations as numerical experiments for the identification of one-dimensional (1-D) advection-dispersion models – computationally light tools, used e.g., as sub-models in systems analysis. The objective...... using the example of a circular secondary settling tank (SST). First, the significant design and flow factors are screened out by applying the statistical method of two-level fractional factorial design of experiments. Second, based on the number of significant factors identified through the factor...... both in 2-D and 1-D was undertaken. Results suggest that the iCFD model developed for the SST through the proposed methodology is able to predict solid distribution with high accuracy – taking a reasonable computational effort – when compared to multi-dimensional numerical experiments, under a wide...

  18. A Comprehensive Evaluation of PCR Primers to Amplify the nifH Gene of Nitrogenase

    OpenAIRE

    John Christian Gaby; Buckley, Daniel H.

    2012-01-01

    The nifH gene is the most widely sequenced marker gene used to identify nitrogen-fixing Bacteria and Archaea. Numerous PCR primers have been designed to amplify nifH, but a comprehensive evaluation of nifH PCR primers has not been performed. We performed an in silico analysis of the specificity and coverage of 51 universal and 35 group-specific nifH primers by using an aligned database of 23,847 nifH sequences. We found that there are 15 universal nifH primers that target 90% or more of nitro...

  19. Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

    DEFF Research Database (Denmark)

    Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.

    2011-01-01

    be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...... samples than a similar method based on locked nucleic acids-spiked primers, which is in agreement with the observation that locked nucleic acid interferes with efficient amplification of short templates. The higher amplification efficiency of DNA primers translates into higher sensitivity and precision...... settings. RESULTS: We describe a PCR method for quantification of microRNAs based on a single reverse transcription reaction for all microRNAs combined with real-time PCR with two, microRNA-specific DNA primers. Primer annealing temperatures were optimized by adding a DNA tail to the primers and could...

  20. Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

    DEFF Research Database (Denmark)

    Balcells, Ingrid; Cirera, Susanna; Busk, Peter Kamp

    2011-01-01

    be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...... settings. Results We describe a PCR method for quantification of microRNAs based on a single reverse transcription reaction for all microRNAs combined with real-time PCR with two, microRNA-specific DNA primers. Primer annealing temperatures were optimized by adding a DNA tail to the primers and could...... samples than a similar method based on locked nucleic acids-spiked primers, which is in agreement with the observation that locked nucleic acid interferes with efficient amplification of short templates. The higher amplification efficiency of DNA primers translates into higher sensitivity and precision...

  1. Primer on CDM programme of activities

    Energy Technology Data Exchange (ETDEWEB)

    Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)

    2009-07-01

    As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)

  2. A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

    Directory of Open Access Journals (Sweden)

    Wang Xiaowei

    2008-12-01

    Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

  3. [Age related macular degeneration].

    Science.gov (United States)

    Sayen, Alexandra; Hubert, Isabelle; Berrod, Jean-Paul

    2011-02-01

    Age-related macular degeneration (ARMD) is a multifactorial disease caused by a combination of genetic and environmental factors. It is the first cause of blindness in patients over 50 in the western world. The disease has been traditionally classified into early and late stages with dry (atrophic) and wet (neovascular) forms: neovascular form is characterized by new blood vessels development under the macula (choroidal neovascularisation) which lead to a rapid decline of vision associated with metamorphopsia and requiring an urgent ophtalmological examination. Optical coherence tomography is now one of the most important part of the examination for diagnosis and treatment. Patient with age related maculopathy should consider taking a dietary supplement such that used in AREDS. The treatment of the wet ARMD has largely beneficied since year 2006 of anti-VEGF (vascular endothelial growth factor) molecules such as ranibizumab or bevacizumab given as repeated intravitreal injections. A systematic follow up each 4 to 8 week in required for several years. There is no effective treatment at the moment for dry AMD. For patients with binocular visual acuity under 60/200 rehabilitation includes low vision specialist, vision aids and psychological support.

  4. Taxon-specific PCR primers to detect two inconspicuous arbuscular mycorrhizal fungi from temperate agricultural grassland

    NARCIS (Netherlands)

    Gamper, H.A.; Leuchtmann, A.

    2007-01-01

    Taxon-specific polymerase chain reaction (PCR) primers enable detection of arbuscular mycorrhizal fungi (AMF, Glomeromycota) in plant roots where the fungi lack discriminative morphological and biochemical characters. We designed and validated pairs of new PCR primers targeted to the flanking

  5. Novel multiple 5'-amino-modified primer for DNA microarrays.

    Science.gov (United States)

    Han, Jing; Lee, Hin; Nguyen, Nga Yen; Beaucage, Serge L; Puri, Raj K

    2005-08-01

    For DNA microarray analysis, total RNA is reverse-transcribed, labeled by incorporating fluorescent dye into the cDNA, and used to hybridize microarray. This protocol requires a minimum of 20 microg of total RNA. To overcome the sample limitation, an RNA amplification technique has been developed. Although it needs less RNA, this amplification technique is relatively expensive, time consuming, and, unfortunately, has been found to introduce bias. In this study, we designed a novel 5'-amino-modified primer and used it for priming cDNA synthesis. The novel primer has a special structure that contains four Uni-Link molecules with two nucleotide (thymine) residues inserted between them as spacers. This novel primer is used in the reverse-transcription reaction for cDNA synthesis. Using the novel 5'-modified primer combined with indirect labeling method, cDNA probes can be prepared with much less total RNA (5 microg or less) without amplification producing optimal results after hybridization of arrays. This primer can also be used to label nucleotides for other purposes.

  6. KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

    Energy Technology Data Exchange (ETDEWEB)

    Bowman, Stephen M [ORNL

    2008-09-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

  7. Degenerate pseudo-Riemannian metrics

    CERN Document Server

    Hervik, Sigbjorn; Yamamoto, Kei

    2014-01-01

    In this paper we study pseudo-Riemannian spaces with a degenerate curvature structure i.e. there exists a continuous family of metrics having identical polynomial curvature invariants. We approach this problem by utilising an idea coming from invariant theory. This involves the existence of a boost, the existence of this boost is assumed to extend to a neighbourhood. This approach proves to be very fruitful: It produces a class of metrics containing all known examples of degenerate metrics. To date, only Kundt and Walker metrics have been given, however, our study gives a plethora of examples showing that degenerate metrics extend beyond the Kundt and Walker examples. The approach also gives a useful criterion for a metric to be degenerate. Specifically, we use this to study the subclass of VSI and CSI metrics (i.e., spaces where polynomial curvature invariants are all vanishing or constants, respectively).

  8. Age-Related Macular Degeneration

    Science.gov (United States)

    ... version of this page please turn Javascript on. Age-related Macular Degeneration About AMD Click for more ... a leading cause of vision loss among people age 60 and older. It causes damage to the ...

  9. A High Temperature Hermetic Primer and a Variable Spring Tester

    Energy Technology Data Exchange (ETDEWEB)

    Begeal, D.R.

    1994-05-01

    Percussion primers are used at Sandia to ignite energetic components such as pyrotechnic actuators and thermal batteries. This report describes a High Temperature Hermetic Primer (HTHP) that was developed to replace a previous G16 Percussion Primer Subassembly (Gl6PPS). The ignition mix in these primers is the same as in the discontinued Remington 44G16 (KC1O{sub 3}, SbS{sub 3}, and Ca{sub 2}Si). The HTHP has nearly the same sensitivity as the 44G16 and a significantly lower sensitivity than the G16PPS. In parallel with the HTHP development, we also designed a Variable Spring Tester (VST) to determine percussion primer ignition sensitivity with firing pins that have the same mass as those used in field applications. The tester is capable of accelerating firing pins over a velocity range of 100 to 600 inches per second for pins weighing up to 6 grams. The desired impulse can be preselected with an accuracy of better than {plus_minus}1%. The actual impulse is measured on every shot. The VST was characterized using the WW42Cl primer, as well as with the G16PPS and the HTHP. Compared to data from conventional ball drop testers, we found that ignition sensitivities were lower and there was less scatter in the sensitivity data. Our experiments indicate that ignition sensitivity is not strictly energy dependent, but also depends on the rate of deposition, or firing pin velocity in this case. Development results for the HTHP and Variable Spring Tester are discussed and design details are shown.

  10. On the degenerate phase boundaries

    CERN Document Server

    Ma, Y; Kuang, Z; Ma, Yongge; Liang, Canbin; Kuang, Zhiquan

    1999-01-01

    The structure of the phase boundary between degenerate and non-degenerate regions in Ashtekar's gravity has been studied by Bengtsson and Jacobson who conjectured that the "phase boundary" should always be null. In this paper, we reformulate the reparametrization procedure in the mapping language and distinguish a phase boundary from its image. It is shown that the image has to be null, while the nullness of the phase boundary requries more suitable criterion.

  11. A primer of Lebesgue integration

    CERN Document Server

    Bear, H S

    2001-01-01

    The Lebesgue integral is now standard for both applications and advanced mathematics. This books starts with a review of the familiar calculus integral and then constructs the Lebesgue integral from the ground up using the same ideas. A Primer of Lebesgue Integration has been used successfully both in the classroom and for individual study.Bear presents a clear and simple introduction for those intent on further study in higher mathematics. Additionally, this book serves as a refresher providing new insight for those in the field. The author writes with an engaging, commonsense style that appeals to readers at all levels.

  12. A primer of multivariate statistics

    CERN Document Server

    Harris, Richard J

    2014-01-01

    Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why

  13. Loop quantum geometry: a primer

    Energy Technology Data Exchange (ETDEWEB)

    Corichi, Alejandro [Instituto de Ciencias Nucleares, Universidad Nacional Autonoma de Mexico, A. Postal 70-543, Mexico D.F. 04510 (Mexico)

    2005-01-15

    This is the written version of a lecture given at the 'VI Mexican School of Gravitation and Mathematical Physics' (Nov 21-27, 2004, Playa del Carmen, Mexico), introducing the basics of Loop Quantum Geometry. The purpose of the written contribution is to provide a Primer version, that is, a first entry into Loop Quantum Gravity and to present at the same time a friendly guide to the existing pedagogical literature on the subject. This account is geared towards graduate students and non-experts interested in learning the basics of the subject.

  14. A primer of special relativity

    CERN Document Server

    Sardesai, PL

    2004-01-01

    A Primer of Special Relativity1 is an unusually lucid introduction to the subject specifically written for Indian students. It is intended to give the beginner a firm grounding for a more advanced course in relativity. An entire chapter is devoted to applications of the theory to elucidate a large number of topics the students (B.Sc. Physics) come across in Modern Physics. Detailed and well-selected examples are used to illuminate aspects of the theory as well as to show techniques of application. A large number of Illustrative Examples enables the students to gain confidence to solve any problem in relativity normally expected of B.Sc. students.

  15. Loop Quantum Geometry: A primer

    OpenAIRE

    Corichi, Alejandro

    2005-01-01

    This is the written version of a lecture given at the ``VI Mexican School of Gravitation and Mathematical Physics" (Nov 21-27, 2004, Playa del Carmen, Mexico), introducing the basics of Loop Quantum Geometry. The purpose of the written contribution is to provide a Primer version, that is, a first entry into Loop Quantum Gravity and to present at the same time a friendly guide to the existing pedagogical literature on the subject. This account is geared towards graduate students and non-expert...

  16. Primer on tritium safe handling practices

    Energy Technology Data Exchange (ETDEWEB)

    1994-12-01

    This Primer is designed for use by operations and maintenance personnel to improve their knowledge of tritium safe handling practices. It is applicable to many job classifications and can be used as a reference for classroom work or for self-study. It is presented in general terms for use throughout the DOE Complex. After reading it, one should be able to: describe methods of measuring airborne tritium concentration; list types of protective clothing effective against tritium uptake from surface and airborne contamination; name two methods of reducing the body dose after a tritium uptake; describe the most common method for determining amount of tritium uptake in the body; describe steps to take following an accidental release of airborne tritium; describe the damage to metals that results from absorption of tritium; explain how washing hands or showering in cold water helps reduce tritium uptake; and describe how tritium exchanges with normal hydrogen in water and hydrocarbons.

  17. Visual hallucinations in patients with macular degeneration.

    Science.gov (United States)

    Holroyd, S; Rabins, P V; Finkelstein, D; Nicholson, M C; Chase, G A; Wisniewski, S C

    1992-12-01

    This study was undertaken to determine the prevalence of visual hallucinations in patients with macular degeneration, describe such hallucinations phenomenologically, and possibly determine factors predisposing to their development. Using a case-control design, the authors screened 100 consecutive patients with age-related macular degeneration for visual hallucinations. Each patient with visual hallucinations was matched to the next three patients without hallucinations. The patients and comparison subjects were compared in terms of scores on the Beck Depression Inventory, Eysenck Personality Questionnaire, Telephone Interview for Cognitive Status, and a structured questionnaire including demographic characteristics, family history, and medical and psychiatric history. Ophthalmologic data were obtained by chart review. Of the 100 patients, 13 experienced visual hallucinations. Four variables were significantly associated with having hallucinations: living alone, lower cognition score, history of stroke, and bilaterally worse visual acuity. Hallucinations were not associated with family or personal history of psychiatric disorder or with personality traits. In 11 (84.6%) of the 13 patients, the hallucinations had begun in association with an acute change in vision. These results indicate that visual hallucinations are prevalent among patients with macular degeneration. They appear unrelated to primary psychiatric disorder. The predisposing factors of bilaterally worse vision and living alone support an association with sensory deprivation, while history of stroke and worse cognition support a decreased cortical inhibition theory.

  18. Single-primer fluorescent sequencing

    Energy Technology Data Exchange (ETDEWEB)

    Ruth, J.L.; Morgan, C.A.; Middendorf, L.R.; Grone, D.L.; Brumbaugh, J.A.

    1987-05-01

    Modified linker arm oligonucleotides complementary to standard M13 priming sites were synthesized, labelled with either one, two, or three fluoresceins, and purified by reverse-phase HPLC. When used as primers in standard dideoxy M13 sequencing with /sup 32/P-dNTPs, normal autoradiographic patterns were obtained. To eliminate the radioactivity, direct on-line fluorescence detection was achieved by the use of a scanning 10 mW Argon laser emitting 488 nm light. Fluorescent bands were detected directly in standard 0.2 or 0.35 mm thick polyacrylamide gels at a distance of 24 cm from the loading wells by a photomultiplier tube filtered at 520 nm. Horizontal and temporal location of each band was displayed by computer as a band in real time, providing visual appearance similar to normal 4-lane autoradiograms. Using a single primer labelled with two fluoresceins, sequences of between 500 and 600 bases have been read in a single loading with better than 98% accuracy; up to 400 bases can be read reproducibly with no errors. More than 50 sequences have been determined by this method. This approach requires only 1-2 ug of cloned template, and produces continuous sequence data at about one band per minute.

  19. Wilson's disease (hepatolenticular degeneration).

    Science.gov (United States)

    Herron, B E

    1976-01-01

    Wilson's disease, or hepatolenticular degeneration, is a rare inherited disorder of copper metabolism which usually affects young people. Excess copper accumulates in the tissues, primarily in the liver, brain, and cornea. This copper deposition results in a wide range of hepatic and neurological symptoms, and may produce psychiatric illness. Hepatic involvement often occurs in childhood, while neurological deficits generally are detected at a later age. The disease is inherited in an autosomal recessive fashion. Ocular findings are of particular importance because the corneal copper deposition, forming the Kayser-Fleischer ring,is the only pathognomonic sign of the disease. The structure of the ring and the presence of copper have been well established. An anterior capsular deposition of copper in the lens results in a characteristic sunflower cataract in some of these patients. Other ocular abnormalities have been described but are much less common. The pathogenesis of the disease and the basic genetic defect remain obscure. It is clear that there is excess copper in the tissues, but the mechanism of its deposition is unknown. It is in some way associated with a failure to synthesize the serum copper protein ceruloplasmin normally. Another theory suggests that an abnormal protein with a high affinity for copper may bind the metal in the tissues. The diagnosis may be suggested by the clinical manifestations and confirmed by the presence of a Kayser-Fleischer ring. In the absence of these findings biochemical determinations are necessary. The most important of these are the serum ceruloplasmin, the urinary copper, and the hepatic copper concentration on biopsy. Treatment consists in the administration of the copper chelating agent, penicillamine, and the avoidance of a high copper intake. This usually results in marked clinical improvement if irreversible tissue damage has not occurred. Maintenance therapy for life is necessary in order to continue the negative

  20. Development of a ceramic primer with higher bond durability for resin cement.

    Science.gov (United States)

    Li, Rui

    2010-07-01

    To increase the bond durability of resin to the CAD/CAM ceramic surface, two types of two-bottle type ceramic primers, consisting of Primer A1 or A2 and Primer B, were designed. Primer A1 was prepared by dissolving 25, 50, or 100 mg of gamma-methacryloxypropyltrimethoxysilane in 1 mL of ethanol. Primer A2 was prepared by dissolving 50 mg of mixed silanes, consisting of 1,2-bis(trimethoxysilyl)ethane to gamma-methacryloxypropyltrimethoxysilane, in 1 mL of ethanol. Mole fractions of 1,2-bis(trimethoxysilyl)ethane to gamma-methacryloxypropyltrimethoxysilane were 0, 10, 20, 30, 40 and 50 mol%. Primer B was prepared after dissolving 0.01, 0.05 or 0.1 mol L(-1) hydrochloric acid in ethanol by 50 vol%. Ceramic surface was silanated with a mixture of Primers A1 and B or Primers A2 and B for 1 min, and then air-dried. Commercial GC ceramic primer and Porcelain Liner M were utilized. Thereafter, dual-curing type resin cement was bonded to silanated ceramic surface through visible-light irradiation. Shear bond strength of resin to the ceramic surface was measured, before and after thermo-cycling. Addition of 0.01 or 0.05 mol L(-1) hydrochloric acid to the gamma-methacryloxypropyltrimethoxysilane allowed for significant increases in the bond strength. However, thermo-cycling resulted in significant decreases of approximately 5 MPa in the bond strength. Conversely, when the mixed silane, where 30 mol% of 1,2-bis(trimethoxysilyl)ethane dissolved in gamma-methacryloxypropyltrimethoxysilane, was utilized with 0.05 mol L(-1) hydrochloric acid, the reduction in the bond strength decreased to approximately 2 MPa. The designed ceramic primers exhibited higher ceramic bond durability than commercial ceramic primers.

  1. New cyt b gene universal primer set for forensic analysis.

    Science.gov (United States)

    Lopez-Oceja, A; Gamarra, D; Borragan, S; Jiménez-Moreno, S; de Pancorbo, M M

    2016-07-01

    Analysis of mitochondrial DNA, and in particular the cytochrome b gene (cyt b), has become an essential tool for species identification in routine forensic practice. In cases of degraded samples, where the DNA is fractionated, universal primers that are highly efficient for the amplification of the target region are necessary. Therefore, in the present study a new universal cyt b primer set with high species identification capabilities, even in samples with highly degraded DNA, has been developed. In order to achieve this objective, the primers were designed following the alignment of complete sequences of the cyt b from 751 species from the Class of Mammalia listed in GenBank. A highly variable region of 148bp flanked by highly conserved sequences was chosen for placing the primers. The effectiveness of the new pair of primers was examined in 63 animal species belonging to 38 Families from 14 Orders and 5 Classes (Mammalia, Aves, Reptilia, Actinopterygii, and Malacostraca). Species determination was possible in all cases, which shows that the fragment analyzed provided a high capability for species identification. Furthermore, to ensure the efficiency of the 148bp fragment, the intraspecific variability was analyzed by calculating the concordance between individuals with the BLAST tool from the NCBI (National Center for Biotechnological Information). The intraspecific concordance levels were superior to 97% in all species. Likewise, the phylogenetic information from the selected fragment was confirmed by obtaining the phylogenetic tree from the sequences of the species analyzed. Evidence of the high power of phylogenetic discrimination of the analyzed fragment of the cyt b was obtained, as 93.75% of the species were grouped within their corresponding Orders. Finally, the analysis of 40 degraded samples with small-size DNA fragments showed that the new pair of primers permits identifying the species, even when the DNA is highly degraded as it is very common in

  2. A Practical Primer on Geostatistics

    Science.gov (United States)

    Olea, Ricardo A.

    2009-01-01

    significant methodological implications. HISTORICAL REMARKS As a discipline, geostatistics was firmly established in the 1960s by the French engineer Georges Matheron, who was interested in the appraisal of ore reserves in mining. Geostatistics did not develop overnight. Like other disciplines, it has built on previous results, many of which were formulated with different objectives in various fields. PIONEERS Seminal ideas conceptually related to what today we call geostatistics or spatial statistics are found in the work of several pioneers, including: 1940s: A.N. Kolmogorov in turbulent flow and N. Wiener in stochastic processing; 1950s: D. Krige in mining; 1960s: B. Mathern in forestry and L.S. Gandin in meteorology CALCULATIONS Serious applications of geostatistics require the use of digital computers. Although for most geostatistical techniques rudimentary implementation from scratch is fairly straightforward, coding programs from scratch is recommended only as part of a practice that may help users to gain a better grasp of the formulations. SOFTWARE For professional work, the reader should employ software packages that have been thoroughly tested to handle any sampling scheme, that run as efficiently as possible, and that offer graphic capabilities for the analysis and display of results. This primer employs primarily the package Stanford Geomodeling Software (SGeMS) - recently developed at the Energy Resources Engineering Department at Stanford University - as a way to show how to obtain results practically. This applied side of the primer should not be interpreted as the notes being a manual for the use of SGeMS. The main objective of the primer is to help the reader gain an understanding of the fundamental concepts and tools in geostatistics. ORGANIZATION OF THE PRIMER The chapters of greatest importance are those covering kriging and simulation. All other materials are peripheral and are included for better comprehension of th

  3. A primer on quantum fluids

    CERN Document Server

    Barenghi, Carlo

    2016-01-01

    The aim of this primer is to cover the essential theoretical information, quickly and concisely, in order to enable senior undergraduate and beginning graduate students to tackle projects in topical research areas of quantum fluids, for example, solitons, vortices and collective modes. The selection of the material, both regarding the content and level of presentation, draws on the authors analysis of the success of relevant research projects with newcomers to the field, as well as of the students feedback from many taught and self-study courses on the subject matter. Starting with a brief historical overview, this text covers particle statistics, weakly interacting condensates and their dynamics and finally superfluid helium and quantum turbulence. At the end of each chapter (apart from the first) there will be some exercises. Detailed solutions can be made available to instructors upon request to the authors. .

  4. Identification of degenerate nuclei and development of a SCAR marker for Flammulina velutipes.

    Directory of Open Access Journals (Sweden)

    Sun Young Kim

    Full Text Available Flammulina velutipes is one of the major edible mushrooms in the world. Recently, abnormalities that have a negative impact on crop production have been reported in this mushroom. These symptoms include slow vegetative growth, a compact mycelial mat, and few or even no fruiting bodies. The morphologies and fruiting capabilities of monokaryons of wild-type and degenerate strains that arose through arthrospore formation were investigated through test crossing. Only one monokaryotic group of the degenerate strains and its hybrid strains showed abnormal phenotypes. Because the monokaryotic arthrospore has the same nucleus as the parent strain, these results indicated that only one aberrant nucleus of the two nuclei in the degenerate strain was responsible for the degeneracy. A sequence-characterized amplified region marker that is linked to the degenerate monokaryon was identified based on a polymorphic sequence that was generated using random primers. Comparative analyses revealed the presence of a degenerate-specific genomic region in a telomere, which arose via the transfer of a genomic fragment harboring a putative helicase gene. Our findings have narrowed down the potential molecular targets responsible for this phenotype for future studies and have provided a marker for the detection of degenerate strains.

  5. [New drug therapy for retinal degeneration].

    Science.gov (United States)

    Ohguro, Hiroshi

    2008-01-01

    Retinitis pigmentosa (RP) is an inherited retinal degeneration characterized by nyctalopia, ring scotoma, and bone-spicule pigmentation of the retina. So far, no effective therapy has been found for RP. As a possible molecular etiology of RP, retina-specific gene deficits are most likely involved, but little has been identified in terms of intracellular mechanisms leading to retinal photoreceptor cell death at post-translational levels. In order to find an effective therapy for RP, we must look for underlying common mechanisms that are responsible for the development of RP, instead of designing a specific therapy for each of the RP types with different causes. Therefore, in the present study, several animal models with different causes of RP were studied, including (1)Royal College of Surgeons (RCS) rats with a deficit of retinal pigment epithelium (RPE) function caused by rhodopsin mutation; (2) P23H rats, (3) S334ter rats, (4) photo stress rats, (5) retinal degeneration (rd) mice with a deficit of phosphodiesterase(PDE) function; and (6) cancer-associated retinopathy (CAR) model rats with a deficit of recoverin-dependent photoreceptor adaptation function. In each of these models, the following assessments were made in order to elucidate common pathological mechanisms among the models: (1) retinal function assessed by electroretinogram (ERG), (2) retinal morphology, (3) retinoid analysis, (4) rhodopsin regeneration, (5) rhodopsin phosphorylation and dephosphorylation, and (6) cytosolic cGMP levels. We found that unregulated photoreceptor adaptation processes caused by an imbalance of rhodopsin phosphorylation and dephosphorylation caused retinal dysfunction leading to photoreceptor cell death. As possible candidate drugs for normalizing these retinal dysfunctions and stopping further retinal degeneration, nilvadipine, a Ca channel blocker, retinoid derivatives, and anthocyanine were chosen and tested to determine their effect on the above animal models with

  6. Sensitive and robust detection of citrus greening (huanglongbing) bacterium "Candidatus Liberibacter asiaticus" by DNA amplification with new 16S rDNA-specific primers.

    Science.gov (United States)

    Fujikawa, Takashi; Iwanami, Toru

    2012-10-01

    Citrus greening disease is caused by "Candidatus Liberibacter spp.," including "Candidatus Liberibacter asiaticus (Las)." For detecting this disease, we designed new primers from the Las 16S rDNA and used a very small DNA template for PCR. More Las-infected tissues were detected with our primers than with the common primers. Copyright © 2012 Elsevier Ltd. All rights reserved.

  7. ANT: Software for Generating and Evaluating Degenerate Codons for Natural and Expanded Genetic Codes.

    Science.gov (United States)

    Engqvist, Martin K M; Nielsen, Jens

    2015-08-21

    The Ambiguous Nucleotide Tool (ANT) is a desktop application that generates and evaluates degenerate codons. Degenerate codons are used to represent DNA positions that have multiple possible nucleotide alternatives. This is useful for protein engineering and directed evolution, where primers specified with degenerate codons are used as a basis for generating libraries of protein sequences. ANT is intuitive and can be used in a graphical user interface or by interacting with the code through a defined application programming interface. ANT comes with full support for nonstandard, user-defined, or expanded genetic codes (translation tables), which is important because synthetic biology is being applied to an ever widening range of natural and engineered organisms. The Python source code for ANT is freely distributed so that it may be used without restriction, modified, and incorporated in other software or custom data pipelines.

  8. Criticality calculations with MCNP{trademark}: A primer

    Energy Technology Data Exchange (ETDEWEB)

    Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A. [New Mexico Univ., Albuquerque, NM (United States)

    1994-06-06

    With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand.

  9. Generation and characterization of ABBV642, a dual variable domain immunoglobulin molecule (DVD-Ig) that potently neutralizes VEGF and PDGF-BB and is designed for the treatment of exudative age-related macular degeneration.

    Science.gov (United States)

    Ding, Kun; Eaton, Lucia; Bowley, Diana; Rieser, Matthew; Chang, Qing; Harris, Maria C; Clabbers, Anca; Dong, Feng; Shen, Jikui; Hackett, Sean F; Touw, Debra S; Bixby, Jacqueline; Zhong, Suju; Benatuil, Lorenzo; Bose, Sahana; Grinnell, Christine; Preston, Gregory M; Iyer, Ramesh; Sadhukhan, Ramkrishna; Marchie, Susan; Overmeyer, Gary; Ghayur, Tariq; van Riet, Deborah A; Tang, Shibo; Campochario, Peter A; Gu, Jijie

    Exudative age-related macular degeneration (AMD) is the most common cause of moderate and severe vision loss in developed countries. Intraocular injections of vascular endothelial growth factor (VEGF or VEGF-A)-neutralizing proteins provide substantial benefit, but frequent, long-term injections are needed. In addition, many patients experience initial visual gains that are ultimately lost due to subretinal fibrosis. Preclinical studies and early phase clinical trials suggest that combined suppression of VEGF and platelet-derived growth factor-BB (PDGF-BB) provides better outcomes than suppression of VEGF alone, due to more frequent regression of neovascularization (NV) and suppression of subretinal fibrosis. We generated a dual variable domain immunoglobulin molecule, ABBV642 that specifically and potently binds and neutralizes VEGF and PDGF-BB. ABBV642 has been optimized for treatment of exudative AMD based on the following design characteristics: 1) high affinity binding to all VEGF-A isoforms and both soluble and extracellular matrix (ECM)-associated PDGF-BB; 2) potential for extended residence time in the vitreous cavity to decrease the frequency of intraocular injections; 3) rapid clearance from systemic circulation compared with molecules with wild type Fc region for normal FcRn binding, which may reduce the risk of systemic complications; and 4) low risk of potential effector function. The bispecificity of ABBV642 allows for a single injection of a single therapeutic agent, and thus a more streamlined development and regulatory path compared with combination products. In a mouse model of exudative AMD, ABBV642 was observed to be more effective than aflibercept. ABBV642 has potential to improve efficacy with reduced injection frequency in patients with exudative AMD, thereby reducing the enormous disease burden for patients and society.

  10. The design and implementation of a study to investigate the effectiveness of community vs hospital eye service follow-up for patients with neovascular age-related macular degeneration with quiescent disease.

    Science.gov (United States)

    Taylor, J; Scott, L J; Rogers, C A; Muldrew, A; O'Reilly, D; Wordsworth, S; Mills, N; Hogg, R; Violato, M; Harding, S P; Peto, T; Townsend, D; Chakravarthy, U; Reeves, B C

    2016-01-01

    IntroductionStandard treatment for neovascular age-related macular degeneration (nAMD) is intravitreal injections of anti-VEGF drugs. Following multiple injections, nAMD lesions often become quiescent but there is a high risk of reactivation, and regular review by hospital ophthalmologists is the norm. The present trial examines the feasibility of community optometrists making lesion reactivation decisions.MethodsThe Effectiveness of Community vs Hospital Eye Service (ECHoES) trial is a virtual trial; lesion reactivation decisions were made about vignettes that comprised clinical data, colour fundus photographs, and optical coherence tomograms displayed on a web-based platform. Participants were either hospital ophthalmologists or community optometrists. All participants were provided with webinar training on the disease, its management, and assessment of the retinal imaging outputs. In a balanced design, 96 participants each assessed 42 vignettes; a total of 288 vignettes were assessed seven times by each professional group.The primary outcome is a participant's judgement of lesion reactivation compared with a reference standard. Secondary outcomes are the frequency of sight threatening errors; judgements about specific lesion components; participant-rated confidence in their decisions about the primary outcome; cost effectiveness of follow-up by optometrists rather than ophthalmologists.DiscussionThis trial addresses an important question for the NHS, namely whether, with appropriate training, community optometrists can make retreatment decisions for patients with nAMD to the same standard as hospital ophthalmologists. The trial employed a novel approach as participation was entirely through a web-based application; the trial required very few resources compared with those that would have been needed for a conventional randomised controlled clinical trial.

  11. Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia (DEVELOPMENt OF PRIMERS FOR REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION TO DETECT AVIAN INFLUENZA VIRUS IN INDONESIA

    Directory of Open Access Journals (Sweden)

    Ni Luh Putu Indi Dharmayanti

    2016-07-01

    Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.

  12. Electrostatic Discharge testing of propellants and primers

    Energy Technology Data Exchange (ETDEWEB)

    Berry, R.B.

    1994-02-01

    This report presents the results of testing of selected propellants and primers to Electrostatic Discharge (ESD) characteristic of the human body. It describes the tests and the fixturing built to accommodate loose material (propellants) and the packed energetic material of the primer. The results indicate that all powders passed and some primers, especially the electric primers, failed to pass established requirements which delineate insensitive energetic components. This report details the testing of components and materials to four ESD environments (Standard ESD, Severe ESD, Modified Standard ESD, and Modified Severe ESD). The purpose of this study was to collect data based on the customer requirements as defined in the Sandia Environmental Safety & Health (ES&H) Manual, Chapter 9, and to define static sensitive and insensitive propellants and primers.

  13. Polymerase chain reaction with nearby primers.

    Science.gov (United States)

    Garafutdinov, Ravil R; Galimova, Aizilya A; Sakhabutdinova, Assol R

    2017-02-01

    DNA analysis of biological specimens containing degraded nucleic acids such as mortal remains, archaeological artefacts, forensic samples etc. has gained more attention in recent years. DNA extracted from these samples is often inapplicable for conventional polymerase chain reaction (PCR), so for its amplification the nearby primers are commonly used. Here we report the data that clarify the features of PCR with nearby and abutting primers. We have shown that the proximity of primers leads to significant reduction of the reaction time and ensures the successful performance of DNA amplification even in the presence of PCR inhibitors. The PCR with abutting primers is usually characterized by the absence of nonspecific amplification products that causes extreme sensitivity with limit of detection on single copy level. The feasibility of PCR with abutting primers was demonstrated on species identification of 100 years old rotten wood. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. A Phylogenetic Index for Cichlid Microsatellite Primers

    Directory of Open Access Journals (Sweden)

    Robert D. Kunkle

    2010-01-01

    Full Text Available Microsatellites abound in most organisms and have proven useful for a range of genetic and genomic studies. Once primers have been created, they can be applied to populations or taxa that have diverged from the source taxon. We use PCR amplification, in a 96-well format, to determine the presence and absence of 46 microsatellite loci in 13 cichlid species. At least one primer set amplified a product in each species tested, and some products were present in nearly all species. These results are compared to the known phylogenetic relationships among cichlids. While we do not address intraspecies variation, our results present a phylogenetic index for the success of microsatellite PCR primer product amplification, thus providing information regarding a collection of primers that are applicable to wide range of species. Through the use of such a uniform primer panel, the potential impact for cross species would be increased.

  15. Changes of 5' Terminal Nucleotides of PCR Primers Causing Variable T-A Cloning Efficiency

    Institute of Scientific and Technical Information of China (English)

    Mei-Qin Liu; Xin Shen; Wei-Lun Yin; Cun-Fu Lu

    2007-01-01

    T-A cloning takes advantage of the unpaired adenosyl residue added to the 3' terminus of amplified DNAs by Taq and other thermostable DNA polymerase and uses a linearized plasmid vector with a protruding 3' thymidylate residue at each of its 3' termini to clone polymerase chain reaction (PCR)-derived DNA fragments. It is a simple,reliable, and efficient ligation-dependent cloning method for PCR products, but the drawback of variable cloning efficiency occurs during application. In the present work, the relationship between variable T-A cloning efficiency and the different 5' end nucleotide base of primers used in PCR amplification was studied. The results showed that different cloning efficiency was obtained with different primer pairs containing A, T, C and G at the 5' terminus respectively. The data shows that when the 5' end base of primer pair was adenosyl, more white colonies could be obtained in cloning the corresponding PCR product in comparison with other bases. And the least white colonies were formed when using the primer pair with 5' cytidylate end. The gluanylate end primers resulted in almost the same cloning efficiency in the white colonies amount as the thymidylate end primer did, and this efficiency was much lower than that of adenosyl end primers. This presumably is a consequence of variability in 3'dA addition to PCR products mediated by Taq polymerase. Our results offer instructions for primer design for researchers who choose T-A cloning to clone PCR products.

  16. Genetics Home Reference: age-related macular degeneration

    Science.gov (United States)

    ... Resources (3 links) BrightFocus Foundation: Macular Degeneration Treatment Macular Degeneration Partnership: Low Vision Rehabilitation Prevent Blindness America: Age-Related Macular Degeneration (AMD) ...

  17. A practical primer on geostatistics

    Science.gov (United States)

    Olea, Ricardo A.

    2009-01-01

    has significant methodological implications.Historical Remarks—As a discipline, geostatistics was firmly established in the 1960s by the French engineer Georges Matheron, who was interested in the appraisal of ore reserves in mining. Geostatistics did not develop overnight. Like other disciplines, it has built on previous results, many of which were formulated with different objectives in various fields.Pioneers—Seminal ideas conceptually related to what today we call geostatistics or spatial statistics are found in the work of several pioneers, including: 1940s: A.N. Kolmogorov in turbulent flow and N. Wiener in stochastic processing; 1950s: D. Krige in mining; 1960s: B. Mathern in forestry and L.S. Gandin in meteorologyCalculations—Serious applications of geostatistics require the use of digital computers. Although for most geostatistical techniques rudimentary implementation from scratch is fairly straightforward, coding programs from scratch is recommended only as part of a practice that may help users to gain a better grasp of the formulations.Software—For professional work, the reader should employ software packages that have been thoroughly tested to handle any sampling scheme, that run as efficiently as possible, and that offer graphic capabilities for the analysis and display of results. This primer employs primarily the package Stanford Geomodeling Software (SGeMS) - recently developed at the Energy Resources Engineering Department at Stanford University - as a way to show how to obtain results practically. This applied side of the primer should not be interpreted as the notes being a manual for the use of SGeMS. The main objective of the primer is to help the reader gain an understanding of the fundamental concepts and tools in geostatistics.Organization of the Primer—The chapters of greatest importance are those covering kriging and simulation. All other materials are peripheral and are included for better comprehension of these main

  18. KULTUR PRIMER FIBROBLAS: PENELITIAN PENDAHULUAN

    Directory of Open Access Journals (Sweden)

    Yuli Kurniawati

    2015-05-01

    Full Text Available AbstrakKultur sel fibroblas banyak digunakan untuk penelitian proses penyembuhan luka dan penuaankulit. Metode ini digunakan untuk melihat perkembangan sel, proliferasi kinetik seluler, sertabiosintesis komponen matriks ekstraseluler. Penelitian pendahuluan ini dilakukan untuk optimasiteknik laboratorium serta berbagai kendala yang didapatkan saat kultur fibroblas. Kultur primerfibroblas dibagi menjadi 2 jenis sampel yaitu sampel yang berasal dari embrio mencit usia 7,5–9,5 hari, dan kulit pasien keloid. Sampel dari embrio mencit dilakukan kultur primer denganmetode dissociated fibroblast. Sampel jaringan keloid dan kulit normal dikultur dengan metodeskin explant. Fibroblas yang berasal dari kultur primer embrio mencit tumbuh baik sehinggadapat dilakukan subkultur dan disimpan di dalam nitrogen cair suhu -198°C. Fibroblas yangberasal dari sampel keloid pertama tumbuh sesuai pola pertumbuhan fibroblas, namun padasampel kedua terdapat kontaminasi Paecilomyces sp. yang merupakan salah satu jenis jamurkontaminan. Sel fibroblas mudah untuk dikultur karena memiliki kemampuan tumbuh danmelekat yang tinggi serta regenerasi cepat, namun penelitian lebih lanjut untuk optimasi teknikkultur dan pencegahan kontaminasi masih dibutuhkan sehingga sel dapat tumbuh baik.AbstractFibroblast cell culture method has been used for wound healing and skin aging studies. Thismethod was used for cell development imaging study, celullar kinetic proliferation andextracelullar matrix component biosynthesis. This preeliminary study was done for laboratoricaltechnic optimation as well as problems appeared in fibroblast culture. Fibroblasts primary culturewas divided into 2 type of samples, from 7.5-9.5-day-mice embryo and keloid-patient skin.Primary culture with dissociated fibroblast method was done for mice embryo sample. Keloidtissue sample and normal skin were cultured with skin explant method. Fibroblasts that weretaken from mice embryo primary culture grew well

  19. Gribov ambiguity and degenerate systems

    CERN Document Server

    Canfora, Fabrizio; Salgado-Rebolledo, Patricio; Zanelli, Jorge

    2014-01-01

    The relation between Gribov ambiguity and degeneracies in the symplectic structure of physical systems is analyzed. It is shown that, in finite-dimensional systems, the presence of Gribov ambiguities in regular constrained systems (those where the constraints are functionally independent) always leads to a degenerate symplectic structure upon Dirac reduction. The implications for the Gribov-Zwanziger approach to QCD are discussed.

  20. Reproducible long-term disc degeneration in a large animal model

    NARCIS (Netherlands)

    Hoogendoorn, R.J.W.; Helder, M.N.; Kroeze, R.J.; Bank, R.A.; Smit, T.H.; Wuisman, P.I.J.M.

    2008-01-01

    STUDY DESIGN. Twelve goats were chemically degenerated and the development of the degenerative signs was followed for 26 weeks to evaluate the progression of the induced degeneration. The results were also compared with a previous study to determine the reproducibility. OBJECTIVES. The purpose of th

  1. Climate change primer for respirologists.

    Science.gov (United States)

    Takaro, Tim K; Henderson, Sarah B

    2015-01-01

    Climate change is already affecting the cardiorespiratory health of populations around the world, and these impacts are expected to increase. The present overview serves as a primer for respirologists who are concerned about how these profound environmental changes may affect their patients. The authors consider recent peer-reviewed literature with a focus on climate interactions with air pollution. They do not discuss in detail cardiorespiratory health effects for which the potential link to climate change is poorly understood. For example, pneumonia and influenza, which affect >500 million people per year, are not addressed, although clear seasonal variation suggests climate-related effects. Additionally, large global health impacts in low-resource countries, including migration precipitated by environmental change, are omitted. The major cardiorespiratory health impacts addressed are due to heat, air pollution and wildfires, shifts in allergens and infectious diseases along with respiratory impacts from flooding. Personal and societal choices about carbon use and fossil energy infrastructure should be informed by their impacts on health, and respirologists can play an important role in this discussion.

  2. PCR primers for metazoan nuclear 18S and 28S ribosomal DNA sequences.

    Directory of Open Access Journals (Sweden)

    Ryuji J Machida

    Full Text Available BACKGROUND: Metagenetic analyses, which amplify and sequence target marker DNA regions from environmental samples, are increasingly employed to assess the biodiversity of communities of small organisms. Using this approach, our understanding of microbial diversity has expanded greatly. In contrast, only a few studies using this approach to characterize metazoan diversity have been reported, despite the fact that many metazoan species are small and difficult to identify or are undescribed. One of the reasons for this discrepancy is the availability of universal primers for the target taxa. In microbial studies, analysis of the 16S ribosomal DNA is standard. In contrast, the best gene for metazoan metagenetics is less clear. In the present study, we have designed primers that amplify the nuclear 18S and 28S ribosomal DNA sequences of most metazoan species with the goal of providing effective approaches for metagenetic analyses of metazoan diversity in environmental samples, with a particular emphasis on marine biodiversity. METHODOLOGY/PRINCIPAL FINDINGS: Conserved regions suitable for designing PCR primers were identified using 14,503 and 1,072 metazoan sequences of the nuclear 18S and 28S rDNA regions, respectively. The sequence similarity of both these newly designed and the previously reported primers to the target regions of these primers were compared for each phylum to determine the expected amplification efficacy. The nucleotide diversity of the flanking regions of the primers was also estimated for genera or higher taxonomic groups of 11 phyla to determine the variable regions within the genes. CONCLUSIONS/SIGNIFICANCE: The identified nuclear ribosomal DNA primers (five primer pairs for 18S and eleven for 28S and the results of the nucleotide diversity analyses provide options for primer combinations for metazoan metagenetic analyses. Additionally, advantages and disadvantages of not only the 18S and 28S ribosomal DNA, but also other

  3. Adjacent segment degeneration: observations in a goat spinal fusion study

    NARCIS (Netherlands)

    R.J.W. Hoogendoorn; M.N. Helder; P.I.J.M. Wuisman; R.A. Bank; V. Everts; T.H. Smit

    2008-01-01

    Study Design. The adjacent discs of 13 goats, originally used in a lumbar spinal fusion model study, were analyzed for symptoms of intervertebral disc degeneration by means of magnetic resonance imaging (MRI), macroscopy, and histology. These goats were followed for 6 months and the results were com

  4. Noncontinuously binding loop-out primers for avoiding problematic DNA sequences in PCR and sanger sequencing.

    Science.gov (United States)

    Sumner, Kelli; Swensen, Jeffrey J; Procter, Melinda; Jama, Mohamed; Wooderchak-Donahue, Whitney; Lewis, Tracey; Fong, Michael; Hubley, Lindsey; Schwarz, Monica; Ha, Youna; Paul, Eleri; Brulotte, Benjamin; Lyon, Elaine; Bayrak-Toydemir, Pinar; Mao, Rong; Pont-Kingdon, Genevieve; Best, D Hunter

    2014-09-01

    We present a method in which noncontinuously binding (loop-out) primers are used to exclude regions of DNA that typically interfere with PCR amplification and/or analysis by Sanger sequencing. Several scenarios were tested using this design principle, including M13-tagged PCR primers, non-M13-tagged PCR primers, and sequencing primers. With this technique, a single oligonucleotide is designed in two segments that flank, but do not include, a short region of problematic DNA sequence. During PCR amplification or sequencing, the problematic region is looped-out from the primer binding site, where it does not interfere with the reaction. Using this method, we successfully excluded regions of up to 46 nucleotides. Loop-out primers were longer than traditional primers (27 to 40 nucleotides) and had higher melting temperatures. This method allows the use of a standardized PCR protocol throughout an assay, keeps the number of PCRs to a minimum, reduces the chance for laboratory error, and, above all, does not interrupt the clinical laboratory workflow.

  5. Construction of Specific Primers for Rapid Detection of South African Exportable Vegetable Macergens

    Directory of Open Access Journals (Sweden)

    Bukola Rhoda Aremu

    2015-09-01

    Full Text Available Macergens are bacteria causing great damages to the parenchymatous tissues of vegetable both on the field and in transit. To effectively and rapidly investigate the diversity and distribution of these macergens, four specific primers were designed by retrieving 16S rDNA sequences of pectolytic bacteria from GenBank through the National Center for Biotechnology Information (NCBI. These were aligned using ClusterW via BioEdit and primers were designed using Primer3Plus platform. The size and primer location of each species and PCR product size were accurately defined. For specificity enhancement, DNA template of known macergens (Pectobacterium chrysanthermi and fresh healthy vegetable were used. These primers yielded expected size of approximately 1100 bp product only when tested with known macergens and no amplicon with fresh healthy vegetable was detected. Rapid detection of macergens in rotten vegetable samples was then carried out using these primers. Nucleotide sequences of macergens identified were deposited into the GenBank and were assigned accession numbers. Hence, with these specific primers, macergens can be identified with minimal quantities of the vegetable tissues using molecular techniques, for future use of the quarantine section of the Agricultural Department of the country for quick and rapid detection of macergens before exportation.

  6. Oligonucleotide primers for targeted amplification of single-copy nuclear genes in apocritan Hymenoptera.

    Directory of Open Access Journals (Sweden)

    Gerrit Hartig

    Full Text Available BACKGROUND: Published nucleotide sequence data from the mega-diverse insect order Hymenoptera (sawflies, bees, wasps, and ants are taxonomically scattered and still inadequate for reconstructing a well-supported phylogenetic tree for the order. The analysis of comprehensive multiple gene data sets obtained via targeted PCR could provide a cost-effective solution to this problem. However, oligonucleotide primers for PCR amplification of nuclear genes across a wide range of hymenopteran species are still scarce. FINDINGS: Here we present a suite of degenerate oligonucleotide primer pairs for PCR amplification of 154 single-copy nuclear protein-coding genes from Hymenoptera. These primers were inferred from genome sequence data from nine Hymenoptera (seven species of ants, the honeybee, and the parasitoid wasp Nasonia vitripennis. We empirically tested a randomly chosen subset of these primer pairs for amplifying target genes from six Hymenoptera, representing the families Chrysididae, Crabronidae, Gasteruptiidae, Leucospidae, Pompilidae, and Stephanidae. Based on our results, we estimate that these primers are suitable for studying a large number of nuclear genes across a wide range of apocritan Hymenoptera (i.e., all hymenopterans with a wasp-waist and of aculeate Hymenoptera in particular (i.e., apocritan wasps with stingers. CONCLUSIONS: The amplified nucleotide sequences are (a with high probability from single-copy genes, (b easily generated at low financial costs, especially when compared to phylogenomic approaches, (c easily sequenced by means of an additionally provided set of sequencing primers, and (d suitable to address a wide range of phylogenetic questions and to aid rapid species identification via barcoding, as many amplicons contain both exonic and fast-evolving intronic nucleotides.

  7. Primer on spontaneous heating and pyrophoricity

    Energy Technology Data Exchange (ETDEWEB)

    1994-12-01

    This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

  8. Improved COI barcoding primers for Southeast Asian perching birds (Aves: Passeriformes).

    Science.gov (United States)

    Lohman, David J; Prawiradilaga, Dewi M; Meier, Rudolf

    2009-01-01

    The All Birds Barcoding Initiative aims to assemble a DNA barcode database for all bird species, but the 648-bp 'barcoding' region of cytochrome c oxidase subunit I (COI) can be difficult to amplify in Southeast Asian perching birds (Aves: Passeriformes). Using COI sequences from complete mitochondrial genomes, we designed a primer pair that more reliably amplifies and sequences the COI barcoding region of Southeast Asian passerine birds. The 655-bp region amplified with these primers overlaps the COI region amplified with other barcoding primer pairs, enabling direct comparison of sequences with previously published DNA barcodes.

  9. Laboratory and gas-fired furnace performance tests of epoxy primers for intumescent coatings

    DEFF Research Database (Denmark)

    Nørgaard, Kristian Petersen; Dam-Johansen, Kim; Catala, Pere

    2014-01-01

    to investigate the potential failure mechanism of a primer applied prior to an intumescent coating. The analysis was carried out using; (1) gas-fired test furnace, (2) a specially designed electrically heated oven, and (3) thermo gravimetric analysis. When tested below an acrylic intumescent coating, exposed...... to a gas-fired furnace following the ISO834 fire curve (a so-called cellulosic fire), one of the primers selected performed well and the other poorly. From tests in the electrically heated oven, it was found that both primers were sensitive to the film thickness employed and the presence of oxygen...

  10. Lipids, lipid genes, and incident age-related macular degeneration: The three continent age-related macular degeneration consortium

    NARCIS (Netherlands)

    R. Klein (Ronald); C.E. Myers (Chelsea); G.H.S. Buitendijk (Gabrielle); E. Rochtchina (Elena); X. Gao (Xiaoyi); P.T.V.M. de Jong (Paulus); T.A. Sivakumaran (Theru); G. Burlutsky (George); R. McKean-Cowdin (Roberta); A. Hofman (Albert); S.K. Iyengar (Sudha); K.E. Lee (Kristine); B.H.Ch. Stricker (Bruno); J.R. Vingerling (Hans); P. Mitchell (Paul); B.E.K. Klein (Barbara); C.C.W. Klaver (Caroline); J.J. Wang (Jie Jin)

    2014-01-01

    textabstractPurpose To describe associations of serum lipid levels and lipid pathway genes to the incidence of age-related macular degeneration (AMD). Design Meta-analysis. Methods setting: Three population-based cohorts. population: A total of 6950 participants from the Beaver Dam Eye Study (BDES),

  11. Lipids, lipid genes, and incident age-related macular degeneration : the three continent age-related macular degeneration consortium

    NARCIS (Netherlands)

    Klein, Ronald; Myers, Chelsea E; Buitendijk, Gabriëlle H S; Rochtchina, Elena; Gao, Xiaoyi; de Jong, Paulus T V M; Sivakumaran, Theru A; Burlutsky, George; McKean-Cowdin, Roberta; Hofman, Albert; Iyengar, Sudha K; Lee, Kristine E; Stricker, Bruno H; Vingerling, Johannes R; Mitchell, Paul; Klein, Barbara E K; Klaver, Caroline C W; Wang, Jie Jin

    PURPOSE: To describe associations of serum lipid levels and lipid pathway genes to the incidence of age-related macular degeneration (AMD). DESIGN: Meta-analysis. METHODS: setting: Three population-based cohorts. population: A total of 6950 participants from the Beaver Dam Eye Study (BDES), Blue

  12. Spheroidal Degeneration of the Cornea

    Directory of Open Access Journals (Sweden)

    Erdem Dinç

    2011-08-01

    Full Text Available A thirty-one-year-old male patient presented with bilateral epiphora and stinging sensation in the cornea. Detailed history revealed that a bilateral corneal scraping had been made regarding the initial diagnosis of fungal keratitis. His bestcorrected visual acuities were 20/20 and 20/30 in right and left eyes, respectively. Biomicroscopy showed bilateral amber colored spherules in the anterior stroma of the central cornea. The diagnosis of spheroidal corneal degeneration was established and symptomatic therapy with artificial tear drops was prescribed. Ultraviolet light is widely accepted to be the main etiological factor in the pathogenesis of spheroidal degeneration. Because of difficulties in the early stages of the diagnostic process of the disease, incorrect diagnoses can be made with inappropriate interventions. (Turk J Ophthalmol 2011; 41: 264-6

  13. Quantitative Microbial Risk Assessment Tutorial - Primer

    Science.gov (United States)

    This document provides a Quantitative Microbial Risk Assessment (QMRA) primer that organizes QMRA tutorials. The tutorials describe functionality of a QMRA infrastructure, guide the user through software use and assessment options, provide step-by-step instructions for implementi...

  14. Menopause 101: A Primer for the Perimenopausal

    Science.gov (United States)

    ... in the News Press Room Assistance Society Overview Menopause 101: A primer for the perimenopausal The information ... about 2 years earlier. Common Body Changes at Menopause Each woman’s experience of menopause is different. Many ...

  15. Radial keratotomy associated endothelial degeneration

    Directory of Open Access Journals (Sweden)

    Moshirfar M

    2012-02-01

    Full Text Available Majid Moshirfar, Andrew Ollerton, Rodmehr T Semnani, Maylon HsuJohn A Moran Eye Center, Department of Ophthalmology and Visual Sciences, University of Utah, Salt Lake City, UT, USAPurpose: To describe the presentation and clinical course of eyes with a history of radial keratotomy (RK and varying degrees of endothelial degeneration.Methods: Retrospective case series were used.Results: Thirteen eyes (seven patients were identified with clinical findings of significant guttata and a prior history of RK. The mean age of presentation for cornea evaluation was 54.3 years (range: 38–72 years, averaging 18.7 years (range: 11–33 years after RK. The presentation of guttata varied in degree from moderate to severe. Best corrected visual acuity (BCVA ranged from 20/25 to 20/80. All patients had a history of bilateral RK, except one patient who did not develop any guttata in the eye without prior RK. No patients reported a family history of Fuch’s Dystrophy. One patient underwent a penetrating keratoplasty in one eye and a Descemet’s stripping automated endothelial keratoplasty (DSAEK in the other eye.Conclusions: RK may induce a spectrum of endothelial degeneration. In elderly patients, the findings of guttata may signify comorbid Fuch’s dystrophy in which RK incisions could potentially hasten endothelial decomposition. In these select patients with stable cornea topography and prior RK, DSAEK may successfully treat RK endothelial degeneration.Keywords: radial keratotomy, RK, Descemet’s stripping automated endothelial keratoplasty, DSAEK, guttata, endothelial degeneration, Fuch’s dystrophy

  16. Degenerating the elliptic Schlesinger system

    Science.gov (United States)

    Aminov, G. A.; Artamonov, S. B.

    2013-01-01

    We study various ways of degenerating the Schlesinger system on the elliptic curve with R marked points. We construct a limit procedure based on an infinite shift of the elliptic curve parameter and on shifts of the marked points. We show that using this procedure allows obtaining a nonautonomous Hamiltonian system describing the Toda chain with additional spin sl(N, ℂ) degrees of freedom.

  17. Radial keratotomy associated endothelial degeneration.

    Science.gov (United States)

    Moshirfar, Majid; Ollerton, Andrew; Semnani, Rodmehr T; Hsu, Maylon

    2012-01-01

    To describe the presentation and clinical course of eyes with a history of radial keratotomy (RK) and varying degrees of endothelial degeneration. Retrospective case series were used. Thirteen eyes (seven patients) were identified with clinical findings of significant guttata and a prior history of RK. The mean age of presentation for cornea evaluation was 54.3 years (range: 38-72 years), averaging 18.7 years (range: 11-33 years) after RK. The presentation of guttata varied in degree from moderate to severe. Best corrected visual acuity (BCVA) ranged from 20/25 to 20/80. All patients had a history of bilateral RK, except one patient who did not develop any guttata in the eye without prior RK. No patients reported a family history of Fuch's Dystrophy. One patient underwent a penetrating keratoplasty in one eye and a Descemet's stripping automated endothelial keratoplasty (DSAEK) in the other eye. RK may induce a spectrum of endothelial degeneration. In elderly patients, the findings of guttata may signify comorbid Fuch's dystrophy in which RK incisions could potentially hasten endothelial decomposition. In these select patients with stable cornea topography and prior RK, DSAEK may successfully treat RK endothelial degeneration.

  18. Primers for low-copy nuclear genes in the Melastomataceae 1

    OpenAIRE

    Reginato,Marcelo; Michelangeli, Fabián A.

    2016-01-01

    Premise of the study: Low-copy nuclear gene primers were developed for phylogenetic studies across the Melastomataceae. Methods and Results: Total genomic libraries from eight species in the Melastomataceae along with one transcriptome were used for marker identification and primer design. Eight exon-primed intron-crossing markers were amplified with success in taxa of nine tribes in the Melastomataceae. The new markers were directly sequenced for eight samples of closely related species of M...

  19. Detection of Luminous Vibrio harveyi in Penaeid Shrimp Through Nested PCR Using Haemolysin Gene Primer

    OpenAIRE

    Wawan Abdullah Setiawan; Utut Widyastuti; Munti Yuhana

    2015-01-01

    Whiteleg shrimp (Litopenaeus vannamei) is one of the most important aquaculture commodity in Indonesia. However, the luminous disease primarily caused by Vibrio harveyi bacteria still becomes an obstacle in penaeid shrimp farming, especially in shrimp hatchery. This study was aimed to identify the presence of V. harveyi in L. vannamei through nested PCR using haemolysin gene primer. First, initial primers were designed using V. harveyi VIB 391 haemolysin gene sequence (accession number: DQ64...

  20. Effect of oligonucleotide primers in determining viral variability within hosts

    Directory of Open Access Journals (Sweden)

    Moya Andrés

    2004-12-01

    Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  1. Novel degenerate PCR method for whole genome amplification applied to Peru Margin (ODP Leg 201 subsurface samples

    Directory of Open Access Journals (Sweden)

    Amanda eMartino

    2012-01-01

    Full Text Available A degenerate PCR-based method of whole-genome amplification, designed to work fluidly with 454 sequencing technology, was developed and tested for use on deep marine subsurface DNA samples. The method, which we have called Random Amplification Metagenomic PCR (RAMP, involves the use of specific primers from Roche 454 amplicon sequencing, modified by the addition of a degenerate region at the 3’ end. It utilizes a PCR reaction, which resulted in no amplification from blanks, even after 50 cycles of PCR. After efforts to optimize experimental conditions, the method was tested with DNA extracted from cultured E. coli cells, and genome coverage was estimated after sequencing on three different occasions. Coverage did not vary greatly with the different experimental conditions tested, and was around 62% with a sequencing effort equivalent to a theoretical genome coverage of 14.10X. The GC content of the sequenced amplification product was within 2% of the predicted values for this strain of E. coli. The method was also applied to DNA extracted from marine subsurface samples from ODP Leg 201 site 1229 (Peru Margin, and results of a taxonomic analysis revealed microbial communities dominated by Proteobacteria, Chloroflexi, Firmicutes, Euryarchaeota, and Crenarchaeota, among others. These results were similar to those obtained previously for those samples; however, variations in the proportions of taxa show that community analysis can be sensitive to both the amplification technique used and the method of assigning sequences to taxonomic groups. Overall, we find that RAMP represents a valid methodology for amplifying metagenomes from low biomass samples.

  2. Disc degeneration: current surgical options

    Directory of Open Access Journals (Sweden)

    C Schizas

    2010-10-01

    Full Text Available Chronic low back pain attributed to lumbar disc degeneration poses a serious challenge to physicians. Surgery may be indicated in selected cases following failure of appropriate conservative treatment. For decades, the only surgical option has been spinal fusion, but its results have been inconsistent. Some prospective trials show superiority over usual conservative measures while others fail to demonstrate its advantages. In an effort to improve results of fusion and to decrease the incidence of adjacent segment degeneration, total disc replacement techniques have been introduced and studied extensively. Short-term results have shown superiority over some fusion techniques. Mid-term results however tend to show that this approach yields results equivalent to those of spinal fusion. Nucleus replacement has gained some popularity initially, but evidence on its efficacy is scarce. Dynamic stabilisation, a technique involving less rigid implants than in spinal fusion and performed without the need for bone grafting, represents another surgical option. Evidence again is lacking on its superiority over other surgical strategies and conservative measures. Insertion of interspinous devices posteriorly, aiming at redistributing loads and relieving pain, has been used as an adjunct to disc removal surgery for disc herniation. To date however, there is no clear evidence on their efficacy. Minimally invasive intradiscal thermocoagulation techniques have also been tried, but evidence of their effectiveness is questioned. Surgery using novel biological solutions may be the future of discogenic pain treatment. Collaboration between clinicians and basic scientists in this multidisciplinary field will undoubtedly shape the future of treating symptomatic disc degeneration.

  3. Mechanism of Concerted RNA-DNA Primer Synthesis by the Human Primosome.

    Science.gov (United States)

    Baranovskiy, Andrey G; Babayeva, Nigar D; Zhang, Yinbo; Gu, Jianyou; Suwa, Yoshiaki; Pavlov, Youri I; Tahirov, Tahir H

    2016-05-06

    The human primosome, a 340-kilodalton complex of primase and DNA polymerase α (Polα), synthesizes chimeric RNA-DNA primers to be extended by replicative DNA polymerases δ and ϵ. The intricate mechanism of concerted primer synthesis by two catalytic centers was an enigma for over three decades. Here we report the crystal structures of two key complexes, the human primosome and the C-terminal domain of the primase large subunit (p58C) with bound DNA/RNA duplex. These structures, along with analysis of primase/polymerase activities, provide a plausible mechanism for all transactions of the primosome including initiation, elongation, accurate counting of RNA primer length, primer transfer to Polα, and concerted autoregulation of alternate activation/inhibition of the catalytic centers. Our findings reveal a central role of p58C in the coordinated actions of two catalytic domains in the primosome and ultimately could impact the design of anticancer drugs.

  4. Rapid DNA extraction methods and new primers for randomly amplified polymorphic DNA analysis of Giardia duodenalis.

    Science.gov (United States)

    Deng, M Q; Cliver, D O

    1999-08-01

    A randomly amplified polymorphic DNA (RAPD) procedure using simple genomic DNA preparation methods and newly designed primers was optimized for analyzing Giardia duodenalis strains. Genomic DNA was extracted from in vitro cultivated trophozoites by five freezing-thawing cycles or by sonic treatment. Compared to a conventional method involving proteinase K digestion and phenol extraction, both freezing-thawing and sonication were equally efficient, yet with the advantage of being much less time- and labor-intensive. Five of the 10 tested RAPD primers produced reproducible polymorphisms among five human origin G. duodenalis strains, and grouping of these strains based on RAPD profiles was in agreement among these primers. The consistent classification of two standard laboratory reference strains, Portland-1 and WB, in the same group confirmed previous results using other fingerprinting methods, indicating that the reported simple DNA extraction methods and the selected primers are useful in RAPD for molecular characterization of G. duodenalis strains.

  5. New Primers for Denaturing Gradient Gel Electrophoresis Analysis of Nitrate-Reducing Bacterial Community in Soil

    Institute of Scientific and Technical Information of China (English)

    R.PASTORELLI; R.PICCOLO; S.SIMONCINI; S.LANDI

    2013-01-01

    The narG gene is frequently used as a molecular marker for bacterial nitrate-reducing community analysis.In this study,a new set of primers targeting the narG gene was designed and applied to semi-nested polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE) assay.The potential of the new primers was verified on DNA directly extracted from soils from five different experimental sites distributed in Central and Southern Italy.Specificity of the primers was determined by excision,amplification,and sequencing of bands resolved by DGGE.A phylogenetic analysis showed the correlation between the sequences retrieved from the soils studied and the narG sequences from β and γ-Proteobacteria.These primers expanded the existing molecular tools for ecological study on the size and diversity of nitrate-reducing bacterial community in soil.

  6. The UVM primer a step-by-step introduction to the universal verification methodology

    CERN Document Server

    Salemi, Ray

    2013-01-01

    The UVM Primer uses simple, runnable code examples, accessible analogies, and an easy-to-read style to introduce you to the foundation of the Universal Verification Methodology. You will learn the basics of object-oriented programming with SystemVerilog and build upon that foundation to learn how to design testbenches using the UVM. Use the UVM Primer to brush up on your UVM knowledge before a job interview to be able to confidently answer questions such as "What is a uvm_agent?" , "How do you use uvm_sequences?", and "When do you use the UVM's factory." The UVM Primer's downloadable code examples give you hands-on experience with real UVM code. Ray Salemi uses online videos (on www.uvmprimer.com) to walk through the code from each chapter and build your confidence. Read The UVM Primer today and start down the path to the UVM.

  7. Regularized degenerate multi-solitons

    CERN Document Server

    Correa, Francisco

    2016-01-01

    We report complex PT-symmetric multi-soliton solutions to the Korteweg de-Vries equation that asymptotically contain one-soliton solutions, with each of them possessing the same amount of finite real energy. We demonstrate how these solutions originate from degenerate energy solutions of the Schroedinger equation. Technically this is achieved by the application of Darboux-Crum transformations involving Jordan states with suitable regularizing shifts. Alternatively they may be constructed from a limiting process within the context Hirota's direct method or on a nonlinear superposition obtained from multiple Baecklund transformations. The proposed procedure is completely generic and also applicable to other types of nonlinear integrable systems.

  8. Degenerate Neutrinos and CP Violation

    CERN Document Server

    Ioannisian, A N

    2003-01-01

    We have studied mixing and masses of three left handed Majorana neutrinos in the model, which assumes exactly degenerate neutrino masses at some "neutrino unification" scale. Such a simple theoretical ansatz naturally leads to quasidegenerate neutrinos. The neutrino mass splittings induced by renormalization effects. In the model we found that the parameters of the neutrino physics (neutrino mass spectrum, mixing angles and CP violation phases) are strongly intercorrelated to each other. From these correlations we got strong bounds on the parameters which could be checked in the oscillation experiments.

  9. Radiative seesaw and degenerate neutrinos

    CERN Document Server

    Bajc, B; Bajc, Borut; Senjanovic, Goran

    2005-01-01

    The radiative see-saw mechanism of Witten generates the right-handed neutrino masses in SO(10) with the spinorial 16_H Higgs field. We study here analytically the 2nd and 3rd generations for the minimal Yukawa structure containing 10_H and 120_H Higgs representations. In the approximation of small 2nd generation masses and gauge loop domination we find the following results : (1) b-tau unification, (2) natural coexistence between large theta_l and small theta_q, (3) degenerate neutrinos.

  10. Detection of Luminous Vibrio harveyi in Penaeid Shrimp Through Nested PCR Using Haemolysin Gene Primer

    Directory of Open Access Journals (Sweden)

    Wawan Abdullah Setiawan

    2015-04-01

    Full Text Available Whiteleg shrimp (Litopenaeus vannamei is one of the most important aquaculture commodity in Indonesia. However, the luminous disease primarily caused by Vibrio harveyi bacteria still becomes an obstacle in penaeid shrimp farming, especially in shrimp hatchery. This study was aimed to identify the presence of V. harveyi in L. vannamei through nested PCR using haemolysin gene primer. First, initial primers were designed using V. harveyi VIB 391 haemolysin gene sequence (accession number: DQ640264, flanking the position 133 to 756. This primer pairs were used to identify haemolysin gene in both V. harveyi MR5339 and V. harveyi 275 strain. Sequencing results from each sample showed 99% similarity with haemolysin gene sequence in Genebank. Furthermore, the sequence of V. harveyi MR5339 haemolysin gene was used to design the nested PCR primers. The first primer pairs of nested PCR have successfully amplified the haemolysin gene fragment of all V. harveyi strains samples from position 52 to 405. The second primer pairs of nested PCR have amplified position 204 to 405 where it can detect all of V. harveyi strains used as sample sources in this study. The application of nested PCR technique in this study was able to identify V. harveyi strains at serial dilution of cells density as low as 100 cfu/mL, which is equal to a single cell or at DNA concentration up to 101 fg/µL.

  11. Java to C: A Primer

    DEFF Research Database (Denmark)

    McDowell, Charlie; Villadsen, Jørgen

    This book is designed to be used as a quick introduction to C for programmers already familiar with Java. It is not a replacement for a reference book on C but is instead a supplement. For the programmer already familiar with Java, the typical book on C requires the reader to wade through many...

  12. 区别检测小肠结肠炎耶尔森氏菌与布鲁氏菌LAMP引物的设计与分析%Design and analysis of LAMP primers used in differentially detecting Yersinia enterocolitica and Brucella spp

    Institute of Scientific and Technical Information of China (English)

    徐云明; 卢士英; 李兆辉; 任洪林; 邹德颖; 唐峰; 郭兴; 王光明; 宋杰; 刘楠楠; 周玉; 柳增善

    2013-01-01

    目的 小肠结肠炎耶尔森氏菌(耶氏菌)和布鲁氏菌都是人兽共患细菌病的主要病原菌,血清学检测过程中,两者常出现交叉反应,尤其是O:9型耶氏菌与布鲁氏菌干扰更为明显.本实验目的 是在DNA水平上区别检测这两种致病菌.方法 根据耶氏菌outL基因设计一套可用于环介导等温扩增(LAMP)检测方法的引物,拟采用该项特异性强、灵敏性高、操作简单的核酸检测技术,对两种菌进行检测.结果 LAMP方法检测耶氏菌结果为阳性,检测布鲁氏菌结果为阴性.结论 成功地在DNA水平上区别检测这两种致病菌.并且为建立耶氏菌的非特异性干扰小的LAMP检测方法提供可应用的引物,同时也为LAMP技术的开发应用以及LAMP引物设计提供应用参考.%Objective Yersina enterocolitica and Brucella spp. arc both high infectious and zoonotic bacteria. False-positive scrological reactions due to infections with brucellosis arc problems in tests for Yersinia enterocolitica especially scrotypc O:9. In this study, Loop-mediated isothermal amplification (LAMP) was used to distinguish the Yersinia enterocolitica from the Brucella at the molecular level. Methods LAMP which has the charactcrisitcs of high specificity, sensitivity, easy to operate and simple to get the result was carried out to distinguish Yersinia enterocolitica from Brucella with the primers that were designed by oulL gene from Yersinia enterocolitica. Results The result of Yersinia enterocolitica was positive and the one of Brucella was negative. Conclusion This study distinguishes the Yersinia enterocolitica from the Brucella successfully at the molecular level at the same time is beneficial for offering high spccific primers to establish a LAMP method for detection of Yersinia enlerocolilica and for giving some suggestions to design LAMP primers for the development and application of LAMP method.

  13. Macular Degeneration Prevention and Risk Factors

    Science.gov (United States)

    ... Grant Terms & Conditions Patent & Intellectual Property Policy For Current Awardees FAQs Our Funding Philosophy ... Alzheimer’s Disease Research Macular Degeneration Research National Glaucoma Research ...

  14. [Pathogenesis of age-related macular degeneration].

    Science.gov (United States)

    Kaarniranta, Kai; Seitsonen, Sanna; Paimela, Tuomas; Meri, Seppo; Immonen, Ilkka

    2009-01-01

    Age-related macular degeneration is a multiform disease of the macula, the region responsible for detailed central vision. In recent years, plenty of new knowledge of the pathogenesis of this disease has been obtained, and the treatment of exudative macular degeneration has greatly progressed. The number of patients with age-related macular degeneration will multiply in the following decades, because knowledge of mechanisms of development of macular degeneration that could be subject to therapeutic measures is insufficient. Central underlying factors are genetic inheritance, exposure of the retina to chronic oxidative stress and accumulation of inflammation-inducing harmful proteins into or outside of retinal cells.

  15. Climate Change, Health, and Communication: A Primer.

    Science.gov (United States)

    Chadwick, Amy E

    2016-01-01

    Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.

  16. Structure of Degenerate Block Algebras

    Institute of Scientific and Technical Information of China (English)

    Linsheng Zhu; Daoji Meng

    2003-01-01

    Given a non-trivial torsion-free abelian group (A,+,0), a field F of characteristic 0, and a non-degenerate bi-additive skew-symmetric map φ :A × A → F, we define a Lie algebra ∑ = ∑(A, φ) over F with basis {ex | x ∈ A\\{0}}and Lie product [ex, ey] = φ(x, y)ex+y. We show that ∑ is endowed uniquely with a non-degenerate symmetric invariant bilinear form and the derivation algebra Der ∑ of ∑ is a complete Lie algebra. We describe the double extension D(∑, T) of ∑ by T, where T is spanned by the locally finite derivations of ∑, and determine the second cohomology group H2(D(∑,T),F) using anti-derivations related to the form on D(∑, T). Finally, we compute the second Leibniz cohomology groups HL2(∑, F) and HL2(D(∑, T), F).

  17. Streamlining DNA barcoding protocols: automated DNA extraction and a new cox1 primer in arachnid systematics.

    Directory of Open Access Journals (Sweden)

    Nina Vidergar

    Full Text Available BACKGROUND: DNA barcoding is a popular tool in taxonomic and phylogenetic studies, but for most animal lineages protocols for obtaining the barcoding sequences--mitochondrial cytochrome C oxidase subunit I (cox1 AKA CO1--are not standardized. Our aim was to explore an optimal strategy for arachnids, focusing on the species-richest lineage, spiders by (1 improving an automated DNA extraction protocol, (2 testing the performance of commonly used primer combinations, and (3 developing a new cox1 primer suitable for more efficient alignment and phylogenetic analyses. METHODOLOGY: We used exemplars of 15 species from all major spider clades, processed a range of spider tissues of varying size and quality, optimized genomic DNA extraction using the MagMAX Express magnetic particle processor-an automated high throughput DNA extraction system-and tested cox1 amplification protocols emphasizing the standard barcoding region using ten routinely employed primer pairs. RESULTS: The best results were obtained with the commonly used Folmer primers (LCO1490/HCO2198 that capture the standard barcode region, and with the C1-J-2183/C1-N-2776 primer pair that amplifies its extension. However, C1-J-2183 is designed too close to HCO2198 for well-interpreted, continuous sequence data, and in practice the resulting sequences from the two primer pairs rarely overlap. We therefore designed a new forward primer C1-J-2123 60 base pairs upstream of the C1-J-2183 binding site. The success rate of this new primer (93% matched that of C1-J-2183. CONCLUSIONS: The use of C1-J-2123 allows full, indel-free overlap of sequences obtained with the standard Folmer primers and with C1-J-2123 primer pair. Our preliminary tests suggest that in addition to spiders, C1-J-2123 will also perform in other arachnids and several other invertebrates. We provide optimal PCR protocols for these primer sets, and recommend using them for systematic efforts beyond DNA barcoding.

  18. Microsatellite primers for fungus-growing ants

    DEFF Research Database (Denmark)

    Villesen, Palle; Gertsch, P J; Boomsma, JJ

    2002-01-01

    developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants.......We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...

  19. Microsatellite Primers for Fungus-Growing Ants

    DEFF Research Database (Denmark)

    Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)

    2002-01-01

    developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants.......We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...

  20. Microsatellite Primers for Fungus-Growing Ants

    DEFF Research Database (Denmark)

    Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  1. Microsatellite primers for fungus-growing ants

    DEFF Research Database (Denmark)

    Villesen, Palle; Gertsch, P J; Boomsma, JJ

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  2. A one-step reaction for the rapid identification of Lactobacillus mindensis, Lactobacillus panis, Lactobacillus paralimentarius, Lactobacillus pontis and Lactobacillus frumenti using oligonucleotide primers designed from the 16S-23S rRNA intergenic sequences

    National Research Council Canada - National Science Library

    Ferchichi, M; Valcheva, R; Prévost, H; Onno, B; Dousset, X

    2008-01-01

    ...) were designed to rapidly discriminate between Lactobacillus mindensis, Lactobacillus panis, Lactobacillus paralimentarius, Lactobacillus pontis and Lactobacillus frumenti species recently isolated from French sourdough...

  3. Java to C: A Primer

    DEFF Research Database (Denmark)

    McDowell, Charlie; Villadsen, Jørgen

    This book is designed to be used as a quick introduction to C for programmers already familiar with Java. It is not a replacement for a reference book on C but is instead a supplement. For the programmer already familiar with Java, the typical book on C requires the reader to wade through many...... details of already-familiar material. In this book, we quickly present the main concepts needed to begin writing serious programs in C, highlighting the differences between C and Java....

  4. A primer on electromagnetic fields

    CERN Document Server

    Frezza, Fabrizio

    2015-01-01

    This book is a concise introduction to electromagnetics and electromagnetic fields that covers the aspects of most significance for engineering applications by means of a rigorous, analytical treatment. After an introduction to equations and basic theorems, topics of fundamental theoretical and applicative importance, including plane waves, transmission lines, waveguides, and Green's functions, are discussed in a deliberately general way. Care has been taken to ensure that the text is readily accessible and self-consistent, with conservation of the intermediate steps in the analytical derivations. The book offers the reader a clear, succinct course in basic electromagnetic theory. It will also be a useful lookup tool for students and designers.

  5. Shining On: A primer on solar radiation data

    Energy Technology Data Exchange (ETDEWEB)

    Dunlap, M.A.; Cook, G. (eds.); Marion, B.; Riordan, C.; Renne, D.

    1992-05-01

    This document is a primer on solar radiation data. General uses of solar energy are presented. The manner in which solar radiation data is used to aid engineers in optimizing the use of solar thermal conversion and photovoltaic conversion is discussed. Methods for acquiring and assimilating the solar radiation data are illustrated. This would include the design and use of pyranometers and pyrheliometers. Seasonal and geographical variations in solar flux reaching the earth are evaluated. Other uses of compiled data include the determination of meteorological impacts of atmospheric disturbances such as volcano eruptions.

  6. Atmel AVR Microcontroller Primer Programming and Interfacing, Second Edition

    CERN Document Server

    Barrett, Steven F

    2012-01-01

    This textbook provides practicing scientists and engineers a primer on the Atmel AVR microcontroller. In this second edition we highlight the popular ATmega164 microcontroller and other pin-for-pin controllers in the family with a complement of flash memory up to 128 kbytes. The second edition also adds a chapter on embedded system design fundamentals and provides extended examples on two different autonomous robots. Our approach is to provide the fundamental skills to quickly get up and operating with this internationally popular microcontroller. We cover the main subsystems aboard the ATmega

  7. New primers for the class Actinobacteria: application to marine and terrestrial environments.

    Science.gov (United States)

    Stach, James E M; Maldonado, Luis A; Ward, Alan C; Goodfellow, Michael; Bull, Alan T

    2003-10-01

    In this study, we redesigned and evaluated primers for the class Actinobacteria. In silico testing showed that the primers had a perfect match with 82% of genera in the class Actinobacteria, representing a 26-213% improvement over previously reported primers. Only 4% of genera that displayed mismatches did so in the terminal three bases of the 3' end, which is most critical for polymerase chain reaction success. The primers, designated S-C-Act-0235-a-S-20 and S-C-Act-0878-a-A-19, amplified an approximately 640 bp stretch of the 16S rRNA gene from all actinobacteria tested (except Rubrobacter radiotolerans) up to an annealing temperature of 72 degrees C. An Actinobacteria Amplification Resource (http://microbe2.ncl.ac.uk/MMB/AAR.htm) was generated to provide a visual guide to aid the amplification of actinobacterial 16S rDNA. Application of the primers to DNA extracted from marine and terrestrial samples revealed the presence of actinobacteria that have not been described previously. The use of 16S rDNA similarity and DNA-DNA pairing correlations showed that almost every actinomycete clone represented either a new species or a novel genus. The results of this study reinforce the proposition that current culture-based techniques drastically underestimate the diversity of Actinobacteria in the environment and highlight the need to evaluate taxon-specific primers regularly in line with improvements in databases holding 16S rDNA sequences.

  8. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Science.gov (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  9. MIPE: A metagenome-based community structure explorer and SSU primer evaluation tool

    Science.gov (United States)

    Zhou, Quan

    2017-01-01

    An understanding of microbial community structure is an important issue in the field of molecular ecology. The traditional molecular method involves amplification of small subunit ribosomal RNA (SSU rRNA) genes by polymerase chain reaction (PCR). However, PCR-based amplicon approaches are affected by primer bias and chimeras. With the development of high-throughput sequencing technology, unbiased SSU rRNA gene sequences can be mined from shotgun sequencing-based metagenomic or metatranscriptomic datasets to obtain a reflection of the microbial community structure in specific types of environment and to evaluate SSU primers. However, the use of short reads obtained through next-generation sequencing for primer evaluation has not been well resolved. The software MIPE (MIcrobiota metagenome Primer Explorer) was developed to adapt numerous short reads from metagenomes and metatranscriptomes. Using metagenomic or metatranscriptomic datasets as input, MIPE extracts and aligns rRNA to reveal detailed information on microbial composition and evaluate SSU rRNA primers. A mock dataset, a real Metagenomics Rapid Annotation using Subsystem Technology (MG-RAST) test dataset, two PrimerProspector test datasets and a real metatranscriptomic dataset were used to validate MIPE. The software calls Mothur (v1.33.3) and the SILVA database (v119) for the alignment and classification of rRNA genes from a metagenome or metatranscriptome. MIPE can effectively extract shotgun rRNA reads from a metagenome or metatranscriptome and is capable of classifying these sequences and exhibiting sensitivity to different SSU rRNA PCR primers. Therefore, MIPE can be used to guide primer design for specific environmental samples. PMID:28350876

  10. A Primer on Policies for Jobs

    OpenAIRE

    Nallari, Raj; Griffith, Breda; Wang, Yidan; Andriamananjara, Soamiely; Derek H. C. Chen; Bhattacharya, Rwitwika

    2012-01-01

    A primer on policies for jobs is based on materials and input provided during the labor market courses conducted during the past 10 years. Its objective is to provide government policy makers, researchers, and labor market practitioners and other specialists with a practical guide on how to strengthen labor market institutions, especially in light of the global financial crisis. This prime...

  11. Environmentally Acceptable Medium Caliber Ammunition Percussion Primers

    Science.gov (United States)

    2007-10-31

    typically contain lead styphnate and antimony sulfide along with other constituents. Although highly effective, these heavy metal compounds have been...contain barium nitrate. Although not negatively categorized by the EPA itself, barium compounds are generally regarded as toxic and likewise should...contains the lead styphnate based FA956 composition2 which is a typical formulation of conventional military ammunition percussion primers. The

  12. Issues Primer. EEE708 Negotiated Study Program.

    Science.gov (United States)

    Jennings, Leonie

    This issues primer is structured around a series of 20 contemporary concerns in the changing world of work and training in Australia in the early 1990s. It is part of the study materials for the one-semester distance education unit, Negotiated Study Program, in the Open Campus Program at Deakin University (Australia). Information on each issue is…

  13. Genetic association studies in lumbar disc degeneration

    DEFF Research Database (Denmark)

    Eskola, Pasi J; Lemmelä, Susanna; Kjaer, Per

    2012-01-01

    Low back pain is associated with lumbar disc degeneration, which is mainly due to genetic predisposition. The objective of this study was to perform a systematic review to evaluate genetic association studies in lumbar disc degeneration as defined on magnetic resonance imaging (MRI) in humans....

  14. Degenerated differential pair with controllable transconductance

    NARCIS (Netherlands)

    Mensink, Clemens; Mensink, Clemens H.J.; Nauta, Bram

    1998-01-01

    A differential pair with input transistors and provided with a variable degeneration resistor. The degeneration resistor comprises a series arrangement of two branches of coupled resistors which are shunted in mutually corresponding points by respective control transistors whose gates are interconne

  15. Regularized degenerate multi-solitons

    Science.gov (United States)

    Correa, Francisco; Fring, Andreas

    2016-09-01

    We report complex {P}{T} -symmetric multi-soliton solutions to the Korteweg de-Vries equation that asymptotically contain one-soliton solutions, with each of them possessing the same amount of finite real energy. We demonstrate how these solutions originate from degenerate energy solutions of the Schrödinger equation. Technically this is achieved by the application of Darboux-Crum transformations involving Jordan states with suitable regularizing shifts. Alternatively they may be constructed from a limiting process within the context Hirota's direct method or on a nonlinear superposition obtained from multiple Bäcklund transformations. The proposed procedure is completely generic and also applicable to other types of nonlinear integrable systems.

  16. Naturalness of nearly degenerate neutrinos

    CERN Document Server

    Casas, J A; Ibarra, Alejandro; Navarro, I

    1999-01-01

    If neutrinos are to play a relevant cosmological role, they must be essentially degenerate. We study whether radiative corrections can or cannot be responsible for the small mass splittings, in agreement with all the available experimental data. We perform an exhaustive exploration of the bimaximal mixing scenario, finding that (i) the vacuum oscillations solution to the solar neutrino problem is always excluded; (ii) if the mass matrix is produced by a see-saw mechanism, there are large regions of the parameter space consistent with the large angle MSW solution, providing a natural origin for the Delta m^2_{sol} << Delta m^2_{atm} hierarchy; (iii) the bimaximal structure becomes then stable under radiative corrections. We also provide analytical expressions for the mass splittings and mixing angles and present a particularly simple see-saw ansatz consistent with all the observations.

  17. Degenerate doping of metallic anodes

    Science.gov (United States)

    Friesen, Cody A; Zeller, Robert A; Johnson, Paul B; Switzer, Elise E

    2015-05-12

    Embodiments of the invention relate to an electrochemical cell comprising: (i) a fuel electrode comprising a metal fuel, (ii) a positive electrode, (iii) an ionically conductive medium, and (iv) a dopant; the electrodes being operable in a discharge mode wherein the metal fuel is oxidized at the fuel electrode and the dopant increases the conductivity of the metal fuel oxidation product. In an embodiment, the oxidation product comprises an oxide of the metal fuel which is doped degenerately. In an embodiment, the positive electrode is an air electrode that absorbs gaseous oxygen, wherein during discharge mode, oxygen is reduced at the air electrode. Embodiments of the invention also relate to methods of producing an electrode comprising a metal and a doped metal oxidation product.

  18. LOMA: A fast method to generate efficient tagged-random primers despite amplification bias of random PCR on pathogens

    Directory of Open Access Journals (Sweden)

    Lee Wah

    2008-09-01

    Full Text Available Abstract Background Pathogen detection using DNA microarrays has the potential to become a fast and comprehensive diagnostics tool. However, since pathogen detection chips currently utilize random primers rather than specific primers for the RT-PCR step, bias inherent in random PCR amplification becomes a serious problem that causes large inaccuracies in hybridization signals. Results In this paper, we study how the efficiency of random PCR amplification affects hybridization signals. We describe a model that predicts the amplification efficiency of a given random primer on a target viral genome. The prediction allows us to filter false-negative probes of the genome that lie in regions of poor random PCR amplification and improves the accuracy of pathogen detection. Subsequently, we propose LOMA, an algorithm to generate random primers that have good amplification efficiency. Wet-lab validation showed that the generated random primers improve the amplification efficiency significantly. Conclusion The blind use of a random primer with attached universal tag (random-tagged primer in a PCR reaction on a pathogen sample may not lead to a successful amplification. Thus, the design of random-tagged primers is an important consideration when performing PCR.

  19. Quantification of Porphyromonas gingivalis by real time PCR : new primers targeting the rgpA and rgpB gene encoding RGP

    OpenAIRE

    KAMAGUCHI,Arihide/NAKAMURA,Reiko/WATANABE,Toshihiro/OHYAMA,Tohru/BABA,Hisae

    2003-01-01

    We designed new primers for the quantification of Porphyromonas gingivalis by real time PCR. The new primer set targeted the rgpA and rgpB genes that encode arginine specific cysteine proteinase (Arggingipain or Rgp), one of the putative pathogenic factors of P. gingivalis. The PCR product obtained using our primers showed no by-products by melting curve analysis. The PCR product sequence showed no significant matches to other sequences by BLAST searching of genetic databases except for match...

  20. Functional genes to assess nitrogen cycling and aromatic hydrocarbon degradation: primers and processing matter

    Directory of Open Access Journals (Sweden)

    Christopher Ryan Penton

    2013-09-01

    Full Text Available Targeting sequencing to genes involved in key environmental processes, i.e. ecofunctional genes, provides an opportunity to sample nature’s gene guilds to greater depth and help link community structure to process-level outcomes. Vastly different approaches have been implemented for sequence processing and, ultimately, for taxonomic placement of these gene reads. The overall quality of next generation sequence analysis of functional genes is dependent on multiple steps and assumptions of unknown diversity. To illustrate current issues surrounding amplicon read processing we provide examples for three ecofunctional gene groups. A combination of in-silico, environmental and cultured strain sequences was used to test new primers targeting the dioxin and dibenzofuran degrading genes dxnA1, dbfA1, and carAa. The majority of obtained environmental sequences were classified into novel sequence clusters, illustrating the discovery value of the approach. For the nitrite reductase step in denitrification, the well-known nirK primers exhibited deficiencies in reference database coverage, illustrating the need to refine primer-binding sites and/or to design multiple primers, while nirS primers exhibited bias against five phyla. Amino acid-based OTU clustering of these two N-cycle genes from soil samples yielded only 114 unique nirK and 45 unique nirS genus-level groupings, likely a reflection of constricted primer coverage. Finally, supervised and non-supervised OTU analysis methods were compared using the nifH gene of nitrogen fixation, with generally similar outcomes, but the clustering (non-supervised method yielded higher diversity estimates and stronger site-based differences. High throughput amplicon sequencing can provide inexpensive and rapid access to nature’s related sequences by circumventing the culturing barrier, but each unique gene requires individual considerations in terms of primer design and sequence processing and classification.

  1. Searching for Beta-Haemolysin hlb Gene in Staphylococcus pseudintermedius with Species-Specific Primers.

    Science.gov (United States)

    Kmieciak, Wioletta; Szewczyk, Eligia M; Ciszewski, Marcin

    2016-07-01

    The paper presents an analysis of 51 Staphylococcus pseudintermedius clinically isolated strains from humans and from animals. Staphylococcus pseudintermedius strains' ability to produce β-haemolysin was evaluated with phenotypic methods (hot-cold effect, reverse CAMP test). In order to determine the hlb gene presence (coding for β-haemolysin) in a genomic DNA, PCR reactions were conducted with two different pairs of primers: one described in the literature for Staphylococcus aureus and recommended for analysing SIG group staphylococci and newly designed one in CLC Main Workbench software. Only reactions with newly designed primers resulted in product amplification, the presence of which was fully compatible with the results of phenotypic β-haemolysin test. Negative results for S. aureus and S. intermedius reference ATCC strains suggest that after further analysis the fragment of hlb gene amplified with primers described in this study might be included in the process of S. pseudintermedius strains identification.

  2. Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.

    Science.gov (United States)

    Françoso, E; Arias, M C

    2013-09-01

    Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode.

  3. Enhanced primers for amplification of DNA barcodes from a broad range of marine metazoans.

    Science.gov (United States)

    Lobo, Jorge; Costa, Pedro M; Teixeira, Marcos A L; Ferreira, Maria S G; Costa, Maria H; Costa, Filipe O

    2013-09-10

    Building reference libraries of DNA barcodes is relatively straightforward when specifically designed primers are available to amplify the COI-5P region from a relatively narrow taxonomic group (e.g. single class or single order). DNA barcoding marine communities have been comparatively harder to accomplish due to the broad taxonomic diversity and lack of consistently efficient primers. Although some of the so-called "universal" primers have been relatively successful, they still fail to amplify COI-5P of many marine animal groups, while displaying random success even among species within each group. Here we propose a new pair of primers designed to enhance amplification of the COI-5P region in a wide range of marine organisms. Amplification tests conducted on a wide range of marine animal taxa, rendered possible the first-time sequencing of DNA barcodes from eight separated phyla (Annelida, Arthropoda, Chordata, Cnidaria, Echinodermata, Mollusca, Nemertea and Platyhelminthes), comprising a total of 14 classes, 28 orders, 57 families, 68 genus and 76 species. These primers demonstrated to be highly cost-effective, which is of key importance for DNA barcoding procedures, such as for building comprehensive DNA barcode libraries of marine communities, where the processing of a large numbers of specimens from a wide variety of marine taxa is compulsory.

  4. Modified gravitational instability of degenerate and non-degenerate dusty plasma

    Science.gov (United States)

    Jain, Shweta; Sharma, Prerana

    2016-09-01

    The gravitational instability of strongly coupled dusty plasma (SCDP) is studied considering degenerate and non-degenerate dusty plasma situations. The SCDP system is assumed to be composed of the electrons, ions, neutrals, and strongly coupled dust grains. First, in the high density regime, due to small interparticle distance, the electrons are considered degenerate, whereas the neutrals, dust grains, and ions are treated non-degenerate. In this case, the dynamics of inertialess electrons are managed by Fermi pressure and Bohm potential, while the inertialess ions are by only thermal pressure. Second, in the non-degenerate regime, both the electrons and ions are governed by the thermal pressure. The generalized hydrodynamic model and the normal mode analysis technique are employed to examine the low frequency waves and gravitational instability in both degenerate and non-degenerate cases. The general dispersion relation is discussed for a characteristic timescale which provides two regimes of frequency, i.e., hydrodynamic regime and kinetic regime. Analytical solutions reveal that the collisions reduce the growth rate and have a strong impact on structure formation in both degenerate and non-degenerate circumstances. Numerical estimation on the basis of observed parameters for the degenerate and non-degenerate cases is presented to show the effects of dust-neutral collisions and dust effective velocity in the presence of polarization force. The values of Jeans length and Jeans mass have been estimated for degenerate white dwarfs as Jeans length L J = 1.3 × 10 5 cm and Jeans mass M J = 0.75 × 10 - 3 M⊙ and for non-degenerate laboratory plasma Jeans length L J = 6.86 × 10 16 cm and Jeans mass M J = 0.68 × 10 10 M⊙. The stability of the SCDP system is discussed using the Routh-Hurwitz criterion.

  5. Degeneration in dysplastic hips. A computer tomography study

    DEFF Research Database (Denmark)

    Jacobsen, Steffen; Rømer, Lone; Søballe, Kjeld

    2005-01-01

    BACKGROUND: Hip dysplasia is considered pre-osteoarthritic, causing degeneration in young individuals. OBJECTIVE: To determine the pattern of degenerative change in moderate to severely dysplastic hips in young patients. DESIGN AND PATIENTS: One hundred and ninety-three consecutively......-referred younger patients with hip pain believed to be caused by hip dysplasia constituted the study cohort. The average age was 35.5 years (range, 15-61 years). They were examined by close-cut transverse pelvic and knee computed tomography and antero-posterior radiographs (CT). We identified 197 hips...... with moderate to severe dysplasia, and 78 hips with normal morphology in the study cohort, whilst 111 hip joints were borderline dysplastic according to preset definitions. Comparative analyses of anatomy and distribution of degeneration between dysplastic and normal hips in the study cohort were performed...

  6. A Monte Carlo algorithm for degenerate plasmas

    Energy Technology Data Exchange (ETDEWEB)

    Turrell, A.E., E-mail: a.turrell09@imperial.ac.uk; Sherlock, M.; Rose, S.J.

    2013-09-15

    A procedure for performing Monte Carlo calculations of plasmas with an arbitrary level of degeneracy is outlined. It has possible applications in inertial confinement fusion and astrophysics. Degenerate particles are initialised according to the Fermi–Dirac distribution function, and scattering is via a Pauli blocked binary collision approximation. The algorithm is tested against degenerate electron–ion equilibration, and the degenerate resistivity transport coefficient from unmagnetised first order transport theory. The code is applied to the cold fuel shell and alpha particle equilibration problem of inertial confinement fusion.

  7. Horizon Supertranslation and Degenerate Black Hole Solution

    CERN Document Server

    Cai, Rong-Gen; Zhang, Yun-Long

    2016-01-01

    In this note we first review the degenerate vacua arising from the BMS symmetries. According to the discussion in [1] one can define BMS-analogous supertranslation and superrotation for spacetime with black hole in Gaussian null coordinates. In the leading and subleading orders of near horizon approximation, the infinitely degenerate black hole solutions are derived by considering Einstein equations with or without cosmological constant, and they are related to each other by the diffeomorphism generated by horizon supertranslation. Higher order results and degenerate Rindler horizon solutions also are given in appendices.

  8. Aluminum Rich Epoxy Primer for Ground and Air Vehicles

    Science.gov (United States)

    2017-03-01

    UNCLASSIFIED DOCUMENT Aluminum Rich Epoxy Primer for Ground and Air Vehicles Monthly Technical Report for the Period: January 20, 2017...Objective: To further develop the Aluminum Rich Epoxy Primer systems for Air and Ground Vehicles while addressing the objective requirements... Epoxy Primers in order to afford a lower initial viscosity allowing for better application properties; lower VOC; and the incorporation of various

  9. Genetics and health communication: a primer.

    Science.gov (United States)

    Greenberg, Marisa S

    2015-01-01

    The progress of genetic knowledge has been swift and steadfast. As we move forward in the genomic era, post Human Genome Project, and continue to explore how one's genes interact with one's environment, it becomes increasingly important for all audiences to have a firm grasp of the vocabulary used in this health context. This primer is intended to be used as a reference and to introduce and/or make more clear concepts related to genetics to increase understanding.

  10. Status of NC Primer Demonstration & Transition

    Science.gov (United States)

    2014-11-20

    skid coating – Navy facilities- plan to assess as alternative to zinc -rich primers – General: internal funding in place through at least 2019 to...anodized aluminum, magnesium, high-strength steel with cadmium, aluminum and zinc - nickel , composites • Stress corrosion cracking and corrosion...this data, NAVAIR authorizes the use of PPG, Inc. – Deft 02-GN-084 over conversion coatings qualified to MIL-DTL-81706, Type I, Class 1A when used

  11. Genetics of frontotemporal lobar degeneration

    Directory of Open Access Journals (Sweden)

    Aswathy P

    2010-10-01

    Full Text Available Frontotemporal lobar degeneration (FTLD is a highly heterogenous group of progressive neurodegenerative disorders characterized by atrophy of prefrontal and anterior temporal cortices. Recently, the research in the field of FTLD has gained increased attention due to the clinical, neuropathological, and genetic heterogeneity and has increased our understanding of the disease pathogenesis. FTLD is a genetically complex disorder. It has a strong genetic basis and 50% of patients show a positive family history for FTLD. Linkage studies have revealed seven chromosomal loci and a number of genes including MAPT, PGRN, VCP, and CHMB-2B are associated with the disease. Neuropathologically, FTLD is classified into tauopathies and ubiquitinopathies. The vast majority of FTLD cases are characterized by pathological accumulation of tau or TDP-43 positive inclusions, each as an outcome of mutations in MAPT or PGRN, respectively. Identification of novel proteins involved in the pathophysiology of the disease, such as progranulin and TDP-43, may prove to be excellent biomarkers of disease progression and thereby lead to the development of better therapeutic options through pharmacogenomics. However, much more dissections into the causative pathways are needed to get a full picture of the etiology. Over the past decade, advances in research on the genetics of FTLD have revealed many pathogenic mutations leading to different clinical manifestations of the disease. This review discusses the current concepts and recent advances in our understanding of the genetics of FTLD.

  12. Universal COI primers for DNA barcoding amphibians.

    Science.gov (United States)

    Che, Jing; Chen, Hong-Man; Yang, Jun-Xiao; Jin, Jie-Qiong; Jiang, Ke; Yuan, Zhi-Yong; Murphy, Robert W; Zhang, Ya-Ping

    2012-03-01

    DNA barcoding is a proven tool for the rapid and unambiguous identification of species, which is essential for many activities including the vouchering tissue samples in the genome 10K initiative, genealogical reconstructions, forensics and biodiversity surveys, among many other applications. A large-scale effort is underway to barcode all amphibian species using the universally sequenced DNA region, a partial fragment of mitochondrial cytochrome oxidase subunit I COI. This fragment is desirable because it appears to be superior to 16S for barcoding, at least for some groups of salamanders. The barcoding of amphibians is essential in part because many species are now endangered. Unfortunately, existing primers for COI often fail to achieve this goal. Herein, we report two new pairs of primers (➀, ➁) that in combination serve to universally amplify and sequence all three orders of Chinese amphibians as represented by 36 genera. This taxonomic diversity, which includes caecilians, salamanders and frogs, suggests that the new primer pairs will universally amplify COI for the vast majority species of amphibians.

  13. Vitelliform macular degeneration associated with mitochondrial myopathy.

    OpenAIRE

    Modi, G; Heckman, J M; Saffer, D

    1992-01-01

    A patient with mitochondrial myopathy is described. Examination of his fundus revealed bilateral vitelliform degeneration of the maculae. This lesion is a focal abnormality of the retinal pigment epithelium and may be a manifestation of the underlying mitochondrial disease.

  14. Magnetic resonance imaging of intervertebral disc degeneration

    Energy Technology Data Exchange (ETDEWEB)

    Maeda, Hiroshi; Noguchi, Masao (Kitakyushu City Yahata Hospital, Fukuoka (Japan)); Kira, Hideaki; Fujiki, Hiroshi; Shimokawa, Isao; Hinoue, Kaichi

    1993-02-01

    The aim of this study was to correlate the degree of lumbar intervertebral disc degeneration with findings of magnetic resonance imaging (MRI). Seventeen autopsied (from 7 patients) and 21 surgical (from 20 patients) intervertebral discs were used as specimens for histopathological examination. In addition, 21 intervertebral discs were examined on T2-weighted images. Histopathological findings from both autopsied and surgical specimens were well correlated with MRI findings. In particular, T2-weighted images reflected increased collagen fibers and rupture within the fibrous ring accurately. However, when severely degenerated intervertebral discs and hernia protruding the posterior longitudinal ligament existed, histological findings were not concordant well with T2-weighted images. Morphological appearances of autopsy specimens, divided into four on T2-weighted images, were well consistent with histological degeneration. This morphological classification, as shown on T2-weighted images, could also be used in the evaluation of intervertebral disc degeneration. (N.K.).

  15. Age related macular degeneration and visual disability.

    Science.gov (United States)

    Christoforidis, John B; Tecce, Nicola; Dell'Omo, Roberto; Mastropasqua, Rodolfo; Verolino, Marco; Costagliola, Ciro

    2011-02-01

    Age-related macular degeneration (AMD) is the leading cause of central blindness or low vision among the elderly in industrialized countries. AMD is caused by a combination of genetic and environmental factors. Among modifiable environmental risk factors, cigarette smoking has been associated with both the dry and wet forms of AMD and may increase the likelihood of worsening pre-existing AMD. Despite advances, the treatment of AMD has limitations and affected patients are often referred for low vision rehabilitation to help them cope with their remaining eyesight. The characteristic visual impairment for both forms of AMD is loss of central vision (central scotoma). This loss results in severe difficulties with reading that may be only partly compensated by magnifying glasses or screen-projection devices. The loss of central vision associated with the disease has a profound impact on patient quality of life. With progressive central visual loss, patients lose their ability to perform the more complex activities of daily living. Common vision aids include low vision filters, magnifiers, telescopes and electronic aids. Low vision rehabilitation (LVR) is a new subspecialty emerging from the traditional fields of ophthalmology, optometry, occupational therapy, and sociology, with an ever-increasing impact on the usual concepts of research, education, and services for visually impaired patients. Relatively few ophthalmologists practise LVR and fewer still routinely use prismatic image relocation (IR) in AMD patients. IR is a method of stabilizing oculomotor functions with the purpose of promoting better function of preferred retinal loci (PRLs). The aim of vision rehabilitation therapy consists in the achievement of techniques designed to improve PRL usage. The use of PRLs to compensate for diseased foveae has offered hope to these patients in regaining some function. However, in a recently published meta-analysis, prism spectacles were found to be unlikely to be of

  16. Barcoding the kingdom Plantae: new PCR primers for ITS regions of plants with improved universality and specificity.

    Science.gov (United States)

    Cheng, Tao; Xu, Chao; Lei, Li; Li, Changhao; Zhang, Yu; Zhou, Shiliang

    2016-01-01

    The internal transcribed spacer (ITS) of nuclear ribosomal DNA is one of the most commonly used DNA markers in plant phylogenetic and DNA barcoding analyses, and it has been recommended as a core plant DNA barcode. Despite this popularity, the universality and specificity of PCR primers for the ITS region are not satisfactory, resulting in amplification and sequencing difficulties. By thoroughly surveying and analysing the 18S, 5.8S and 26S sequences of Plantae and Fungi from GenBank, we designed new universal and plant-specific PCR primers for amplifying the whole ITS region and a part of it (ITS1 or ITS2) of plants. In silico analyses of the new and the existing ITS primers based on these highly representative data sets indicated that (i) the newly designed universal primers are suitable for over 95% of plants in most groups; and (ii) the plant-specific primers are suitable for over 85% of plants in most groups without amplification of fungi. A total of 335 samples from 219 angiosperm families, 11 gymnosperm families, 24 fern and lycophyte families, 16 moss families and 17 fungus families were used to test the performances of these primers. In vitro PCR produced similar results to those from the in silico analyses. Our new primer pairs gave PCR improvements up to 30% compared with common-used ones. The new universal ITS primers will find wide application in both plant and fungal biology, and the new plant-specific ITS primers will, by eliminating PCR amplification of nonplant templates, significantly improve the quality of ITS sequence information collections in plant molecular systematics and DNA barcoding.

  17. Degenerate second order mean field games systems

    OpenAIRE

    Tonon, Daniela; Cardaliaguet, Pierre; Graber, Philip,; Poretta, Alessio

    2014-01-01

    Parallel session; International audience; We consider degenerate second order mean field games systems with a local coupling. The starting point is the idea that mean field games systems can be understood as an optimality condition for optimal control of PDEs. Developing this strategy for the degenerate second order case, we discuss the existence and uniqueness of a weak solution as well as its stability (vanishing viscosity limit). Speaker: Daniela TONON

  18. The nature of apraxia in corticobasal degeneration.

    OpenAIRE

    Leiguarda, R; Lees, A J; Merello, M; STARKSTEIN, S; Marsden, C D

    1994-01-01

    Although apraxia is one of the most frequent signs in corticobasal degeneration, the phenomenology of this disorder has not been formally examined. Hence 10 patients with corticobasal degeneration were studied with a standardised evaluation for different types of apraxia. To minimise the confounding effects of the primary motor disorder, apraxia was assessed in the least affected limb. Whereas none of the patients showed buccofacial apraxia, seven showed deficits on tests of ideomotor apraxia...

  19. Retinal Cell Degeneration in Animal Models

    OpenAIRE

    Masayuki Niwa; Hitomi Aoki; Akihiro Hirata; Hiroyuki Tomita; Green, Paul G.; Akira Hara

    2016-01-01

    The aim of this review is to provide an overview of various retinal cell degeneration models in animal induced by chemicals (N-methyl-d-aspartate- and CoCl2-induced), autoimmune (experimental autoimmune encephalomyelitis), mechanical stress (optic nerve crush-induced, light-induced) and ischemia (transient retinal ischemia-induced). The target regions, pathology and proposed mechanism of each model are described in a comparative fashion. Animal models of retinal cell degeneration provide insi...

  20. Splitting deformations of degenerations of complex curves towards the classification of atoms of degenerations

    CERN Document Server

    2006-01-01

    The author develops a deformation theory for degenerations of complex curves; specifically, he treats deformations which induce splittings of the singular fiber of a degeneration. He constructs a deformation of the degeneration in such a way that a subdivisor is "barked" (peeled) off from the singular fiber. These "barking deformations" are related to deformations of surface singularities (in particular, cyclic quotient singularities) as well as the mapping class groups of Riemann surfaces (complex curves) via monodromies. Important applications, such as the classification of atomic degenerations, are also explained.

  1. A set of 100 chloroplast DNA primer pairs to study population genetics and phylogeny in monocotylenons

    DEFF Research Database (Denmark)

    Scarcelli, Nora; Bernaud, Adeline; Eiserhardt, Wolf L.;

    2011-01-01

    Chloroplast DNA sequences are of great interest for population genetics and phylogenetic studies. However, only a small set of markers are commonly used. Most of them have been designed for amplification in a large range of Angiosperms and are located in the Large Single Copy (LSC). Here we...... developed a new set of 100 primer pairs optimized for amplification in Monocotyledons. Primer pairs amplify coding (exon) and non-coding regions (intron and intergenic spacer). They span the different chloroplast regions: 72 are located in the LSC, 13 in the Small Single Copy (SSC) and 15 in the Inverted...

  2. Development of species-specific primers for detection of Streptococcus mutans in mixed bacterial samples

    OpenAIRE

    Chen, Zhou; Saxena, Deepak; Caufield, Page W.; Ge, Yao; Wang, Minqi; Li, Yihong

    2007-01-01

    Streptococcus mutans is the major microbial pathogen associated with dental caries in children. The objectives of this study were to design and evaluate species-specific primers for the identification of S. mutans. Validation of the best primer set, Sm479F/R, was performed using 7 S. mutans reference strains, 48 ATCC non-S. mutans strains, 92 S. mutans clinical isolates, DNA samples of S. mutans-S. sobrinus or S. mutans-S. sanguinis, and mixed bacterial DNA of saliva samples from 33 18-month-...

  3. High-speed measurement of rifle primer blast waves

    CERN Document Server

    Courtney, Michael

    2011-01-01

    This article describes a method and results for direct high-speed measurements of rifle primer blast waves employing a high-speed pressure transducer located at the muzzle to record the blast pressure wave produced by primer ignition. Our key findings are: 1) Most of the primer models tested show 5-12% standard deviation in the magnitudes of their peak pressure. 2) For most primer types tested, peak pressure magnitudes are well correlated with measured primer masses so that significant reductions in standard deviation are expected to result from sorting primers by mass. 3) A range of peak pressures from below 200 psi to above 500 psi is available in different primer types.

  4. Wet-lab tested microRNA assays for qPCR studies with SYBR®Green and DNA primers in pig tissues

    DEFF Research Database (Denmark)

    Mentzel, Caroline M. Junker; Skovgaard, Kerstin; Córdoba, Sarai

    2014-01-01

    have previously developed two useful tools in the field of microRNA quantitative real time PCR (qPCR): 1) a very specific, sensitive and simple qPCR method based on DNA primers, MiR-specific qPCR; and 2) the free primer-design software miRprimer. The present study integrates in a publicly accessible...

  5. PCR primers for an aldolase-B intron in acanthopterygian fishes

    Directory of Open Access Journals (Sweden)

    Jones William J

    2001-11-01

    Full Text Available Abstract Background Nuclear DNA sequences provide genetic information that complements studies using mitochondrial DNA. Some 'universal' primer sets have been developed that target introns within protein-coding loci, but many simultaneously amplify introns from paralogous loci. Refining existing primer sets to target a single locus could circumvent this problem. Results Aldolase intron 'G' was amplified from four fish species using previously described primer sets that target several loci indiscriminately. Phylogenetic analyses were used to group these fragments and other full-length aldolase proteins from teleost fishes into orthologous clades and a primer set was designed to target specifically an intron within the aldolase-B locus in acanthopterygian fishes. DNA amplifications were tried in a variety of acanthopterygian fishes and amplification products, identifiable as aldolase-B intron 'G', were observed in all atherinomorph and percomorph taxa examined. Sequence variation within this locus was found within and among several species examined. Conclusions Using 'universal' primer sets coupled with phylogenetic analyses it was possible to develop a genetic assay to target a specific locus in a variety of fish taxa. Sequence variation was observed within and among species suggesting that this targeted assay might facilitate interspecific and intraspecific comparisons.

  6. A Novel Universal Primer-Multiplex-PCR Method with Sequencing Gel Electrophoresis Analysis

    Science.gov (United States)

    Huang, Kunlun; Zhang, Nan; Yuan, Yanfang; Shang, Ying; Luo, Yunbo

    2012-01-01

    In this study, a novel universal primer-multiplex-PCR (UP-M-PCR) method adding a universal primer (UP) in the multiplex PCR reaction system was described. A universal adapter was designed in the 5′-end of each specific primer pairs which matched with the specific DNA sequences for each template and also used as the universal primer (UP). PCR products were analyzed on sequencing gel electrophoresis (SGE) which had the advantage of exhibiting extraordinary resolution. This method overcame the disadvantages rooted deeply in conventional multiplex PCR such as complex manipulation, lower sensitivity, self-inhibition and amplification disparity resulting from different primers, and it got a high specificity and had a low detection limit of 0.1 ng for single kind of crops when screening the presence of genetically modified (GM) crops in mixture samples. The novel developed multiplex PCR assay with sequencing gel electrophoresis analysis will be useful in many fields, such as verifying the GM status of a sample irrespective of the crop and GM trait and so on. PMID:22272223

  7. Novel Primers From Informative Nuclear Loci for Louse Molecular Phylogenetics (Insecta: Phthiraptera).

    Science.gov (United States)

    Sweet, Andrew D; Allen, Julie M; Johnson, Kevin P

    2014-11-01

    While parasitic lice (Insecta: Phthiraptera) have historically been an important model taxon for understanding host-parasite coevolution, very few molecular markers have been developed for phylogenetic analysis. The current markers are insufficient to resolve many of the deeper nodes in this group; therefore, sequences from additional genetic loci are necessary. Here, we design primers targeting several nuclear protein coding genes based on a complete genome and transcriptome of Pediculus humanus L. plus transcriptomes and modest coverage genomic data from five genera of avian feather lice. These primers were tested on 32 genera of avian feather lice (Ischnocera), including multiple species within some genera. All of the new primer combinations produced sequences for the majority of the genera and had similar or higher divergences than the most widely used nuclear protein-coding gene in lice, EF-1α. These results indicate that these new loci will be useful in resolving phylogenetic relationships among parasitic lice.

  8. Inpatient Rehabilitation Performance of Patients with Paraneoplastic Cerebellar Degeneration

    Science.gov (United States)

    Fu, Jack B.; Raj, Vishwa S.; Asher, Arash; Lee, Jay; Guo, Ying; Konzen, Benedict S.; Bruera, Eduardo

    2014-01-01

    Objective To evaluate the functional improvement of rehabilitation inpatients with paraneoplastic cerebellar degeneration. Design Retrospective Review Setting Three tertiary referral based hospitals. Interventions Medical records were retrospectively analyzed for demographic, laboratory, medical and functional data. Main Outcome Measure Functional Independence Measure (FIM) Participants Cancer rehabilitation inpatients admitted to three different cancer centers with a diagnosis of paraneoplastic cerebellar degeneration (n=7). Results All 7 patients were white females. Median age was 62. Primary cancers included ovarian carcinoma (2), small cell lung cancer (2), uterine carcinoma (2), and invasive ductal breast carcinoma. Mean admission total FIM score was 61.0 (SD=23.97). Mean discharge total FIM score was 73.6 (SD=29.35). The mean change in total FIM score was 12.6 (p=.0018). The mean length of rehabilitation stay was 17.1 days. The mean total FIM efficiency was 0.73. 5/7 (71%) patients were discharged home. 1/7 (14%) was discharged to a nursing home. 1/7 (14%) transferred to the primary acute care service. Conclusions This is the first study to demonstrate the functional performance of a group of rehabilitation inpatients with paraneoplastic cerebellar degeneration. Despite the poor neurologic prognosis associated with this syndrome, these patients made significant functional improvements on inpatient rehabilitation. When appropriate, inpatient rehabilitation should be considered. Further studies with larger sample sizes are needed. PMID:25051460

  9. An ASIC Low Power Primer Analysis, Techniques and Specification

    CERN Document Server

    Chadha, Rakesh

    2013-01-01

    This book provides an invaluable primer on the techniques utilized in the design of low power digital semiconductor devices.  Readers will benefit from the hands-on approach which starts form the ground-up, explaining with basic examples what power is, how it is measured and how it impacts on the design process of application-specific integrated circuits (ASICs).  The authors use both the Unified Power Format (UPF) and Common Power Format (CPF) to describe in detail the power intent for an ASIC and then guide readers through a variety of architectural and implementation techniques that will help meet the power intent.  From analyzing system power consumption, to techniques that can employed in a low power design, to a detailed description of two alternate standards for capturing the power directives at various phases of the design, this book is filled with information that will give ASIC designers a competitive edge in low-power design. Starts from the ground-up and explains what power is, how it is measur...

  10. High-coverage ITS primers for the DNA-based identification of ascomycetes and basidiomycetes in environmental samples.

    Directory of Open Access Journals (Sweden)

    Hirokazu Toju

    Full Text Available The kingdom Fungi is estimated to include 1.5 million or more species, playing key roles as decomposers, mutualists, and parasites in every biome on the earth. To comprehensively understand the diversity and ecology of this huge kingdom, DNA barcoding targeting the internal transcribed spacer (ITS region of the nuclear ribosomal repeat has been regarded as a prerequisite procedure. By extensively surveying ITS sequences in public databases, we designed new ITS primers with improved coverage across diverse taxonomic groups of fungi compared to existing primers. An in silico analysis based on public sequence databases indicated that the newly designed primers matched 99% of ascomycete and basidiomycete ITS taxa (species, subspecies or varieties, causing little taxonomic bias toward either fungal group. Two of the newly designed primers could inhibit the amplification of plant sequences and would enable the selective investigation of fungal communities in mycorrhizal associations, soil, and other types of environmental samples. Optimal PCR conditions for the primers were explored in an in vitro investigation. The new primers developed in this study will provide a basis for ecological studies on the diversity and community structures of fungi in the era of massive DNA sequencing.

  11. Spectrophotometric determination of tetrazene in primers and primer mixes by use of resorcinol.

    Science.gov (United States)

    Norwitz, G; Keliher, P N

    1979-06-01

    A spectrophotometric method is proposed for the determination of tetrazene (tetracene) in primers and primer mixes that involves treatment of the tetrazene with resorcinol solution and measurement of the intensity of the yellow colour of the diazo-dye produced. In the application of the method, lead styphnate and barium nitrate are first removed by extraction with ammonium acetate solution and then nitrocellulose and PETN are removed by extraction with acetone. The insoluble matter containing the tetrazene is boiled with resorcinol reagent, the solution filtered, and the absorbance measured at 400 nm. Conditions for optimum colour development are studied and the nature of the reaction is considered.

  12. Highly effective sequencing whole chloroplast genomes of angiosperms by nine novel universal primer pairs.

    Science.gov (United States)

    Yang, Jun-Bo; Li, De-Zhu; Li, Hong-Tao

    2014-09-01

    Chloroplast genomes supply indispensable information that helps improve the phylogenetic resolution and even as organelle-scale barcodes. Next-generation sequencing technologies have helped promote sequencing of complete chloroplast genomes, but compared with the number of angiosperms, relatively few chloroplast genomes have been sequenced. There are two major reasons for the paucity of completely sequenced chloroplast genomes: (i) massive amounts of fresh leaves are needed for chloroplast sequencing and (ii) there are considerable gaps in the sequenced chloroplast genomes of many plants because of the difficulty of isolating high-quality chloroplast DNA, preventing complete chloroplast genomes from being assembled. To overcome these obstacles, all known angiosperm chloroplast genomes available to date were analysed, and then we designed nine universal primer pairs corresponding to the highly conserved regions. Using these primers, angiosperm whole chloroplast genomes can be amplified using long-range PCR and sequenced using next-generation sequencing methods. The primers showed high universality, which was tested using 24 species representing major clades of angiosperms. To validate the functionality of the primers, eight species representing major groups of angiosperms, that is, early-diverging angiosperms, magnoliids, monocots, Saxifragales, fabids, malvids and asterids, were sequenced and assembled their complete chloroplast genomes. In our trials, only 100 mg of fresh leaves was used. The results show that the universal primer set provided an easy, effective and feasible approach for sequencing whole chloroplast genomes in angiosperms. The designed universal primer pairs provide a possibility to accelerate genome-scale data acquisition and will therefore magnify the phylogenetic resolution and species identification in angiosperms. © 2014 John Wiley & Sons Ltd.

  13. An engineering primer on extreme value statistics

    Energy Technology Data Exchange (ETDEWEB)

    Novog, D.R.; Hoppe, F. [McMaster Univ., Hamilton, Ontario (Canada); Nainer, O. [Bruce Power, Tiverton, Ontario (Canada); Phan, B. [Ontario Power Generation, Toronto, Ontario (Canada)

    2009-07-01

    This primer is intended for individuals interested in gaining an understanding of Extreme Value Statistics (EVS). This work provides an explanation of EVS at a level that can be accessible to most people with an engineering or science background. While this work represents a simplification of the discussions from Reference 1, it is hoped that the authors will forgive any liberties taken in this paper. Some of the simplifications presented here may not be rigorous in all aspects, but the sacrifice in rigour is intended to aid the fundamental understanding of the EVS formulation and basic application. (author)

  14. Primer Concilio Provincial del Nuevo Reino

    Directory of Open Access Journals (Sweden)

    Manuel Lucena Salmoral

    1963-01-01

    Full Text Available El acontecimiento más sobresaliente del patriarcado de don Fernando Arias de Ugarte, en el que hubo muchos notables, fue el Primer Concilio Provincial del Nuevo Reino de Granada, celebrado en el año 1623. Cumplió así una vieja aspiración de los arzobispos santafereños y la obligación impuesta en el Concilio de Trento, por lo que resulta incomprensible lo historiado por don José Antonio Plaza quien, al referirse a este hecho, dice lo siguiente...

  15. Precedentes musulmanes y primer arte cristiano

    OpenAIRE

    Cabañero Subiza, Bernabé

    2006-01-01

    La comarca de las Cinco Villas en la que en los siglos X y XI no existió ningún centro artístico de primer orden en el que se crearan concepciones espaciales y soluciones formales propias. Por eso los monumentos de esta comarca pertenecientes a dichas centurias constituyen en casi todos los casos manifestaciones periféricas de corrientes artísticas creadas y desarrolladas fuera de sus confines. Esta llegada de soluciones formales foráneas a las Cinco Villas es tanto más explicable si...

  16. Lógica de Primer Orden

    OpenAIRE

    Castel De Haro, María Jesús; Llorens Largo, Faraón

    1999-01-01

    Estos papeles que ahora tenéis en vuestras manos, nacieron con la idea de servir de material de apoyo a las clases de la asignatura “Lógica de Primer Orden”, que forma parte del programa de los estudios de Ingeniería Informática impartidos en la Escuela Politécnica Superior de la Universidad de Alicante. No se trata, por tanto, de un libro de texto sobre Lógica, ya que existen excelentes libros que cubren este objetivo y es una pérdida de tiempo volverlos a escribir. En ningún momento ha sido...

  17. Emulsion primers, their contribution to bonding

    OpenAIRE

    González Sburlati, Rubén Osmar; Sapei, José

    2014-01-01

    Asphalt irrigation in its various types, performs specific functions in the structure of a road during the construction phase or their service life. In particular, the so-called "Irrigation Primer " is used in underlying layers, in order to generate a transition surface with the new asphalt layer; thus the tack or prime coat will be placed on a surface to ensure a good bond with the overlying layer. For a long time Diluted Asphalts (Cut Back mediums) where used, but have been discontinued for...

  18. Bayesian models a statistical primer for ecologists

    CERN Document Server

    Hobbs, N Thompson

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods-in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach. Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probabili

  19. Signals and systems primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2006-01-01

    Signals and Systems Primer with MATLAB® equally emphasizes the fundamentals of both analog and digital signals and systems. To ensure insight into the basic concepts and methods, the text presents a variety of examples that illustrate a wide range of applications, from microelectromechanical to worldwide communication systems. It also provides MATLAB functions and procedures for practice and verification of these concepts.Taking a pedagogical approach, the author builds a solid foundation in signal processing as well as analog and digital systems. The book first introduces orthogonal signals,

  20. Dogmatismo en estudiantes de primer semestre

    OpenAIRE

    Beltrán Montero, María Gladys

    2009-01-01

    Rokeach, (1960). Postula el dogmatismo como una teoría psicológica de la personalidad y plantea una escala para su evaluación. Este trabajo analiza la estructura factorial de esta escala, en su forma E, y compara los resultados de una muestra de 1320 estudiantes de primer semestre de carrera de la Universidad Nacional de Colombia, con los obtenidos por Rokeach y sus colaboradores en sus investigaciones. Analiza, además, el nivel de dogmatismo de esta muestra en relación con el ...

  1. Improving efficiency of supercontinuum generation in photonic crystal|fibers by direct degenerate four-wave-mixing

    DEFF Research Database (Denmark)

    Nikolov, Nikola Ivanov; Bang, Ole; Bjarklev, Anders Overgaard

    2002-01-01

    The efficiency of supercontinuum generation in photonic crystal fibers is significantly improved by designing the dispersion to allow widely separated spectral lines generated by degenerate four-wave-mixing directly from the pump to broaden and merge.......The efficiency of supercontinuum generation in photonic crystal fibers is significantly improved by designing the dispersion to allow widely separated spectral lines generated by degenerate four-wave-mixing directly from the pump to broaden and merge....

  2. Detection of N2O-producing fungi in environment using nitrite reductase gene (nirK)-targeting primers.

    Science.gov (United States)

    Chen, Huaihai; Yu, Fangbo; Shi, Wei

    2016-12-01

    Fungal denitrification has been increasingly investigated, but its community ecology is poorly understood due to the lack of culture-independent tools. In this work, four pairs of nirK-targeting primers were designed and evaluated for primer specificity and efficiency using thirty N2O-producing fungal cultures and an agricultural soil. All primers amplified nirK from fungi and soil, but their efficiency and specificity were different. A primer set, FnirK_F3/R2 amplified ∼80 % of tested fungi, including Aspergillus, Fusarium, Penicillium, and Trichoderma, as compared to ∼40-70 % for other three primers. The nirK fragments of fungal and soil DNA amplified by FnirK_F3/R2 were phylogenetically related to denitrifying fungi in the orders Eurotiales, Hypocreales, and Sordariales; and clone sequences were also distributed in the clusters of Chaetomium, Metarhizium, and Myceliophthora that were uncultured from soil in our previous work. This proved the wide-range capability of primers for amplifying diverse denitrifying fungi from environment. However, our primers and recently-developed other primers amplified bacterial nirK from soil and this co-amplification of fungal and bacterial nirK was theoretically discussed. The FnirK_F3/R2 was further compared with published primers; results from clone libraries demonstrated that FnirK_F3/R2 was more specifically targeted on fungi and had broader taxonomical coverage than some others. Copyright © 2016 British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  3. Microsatellite primers for the rare sedge Lepidosperma bungalbin (Cyperaceae)1

    Science.gov (United States)

    Nevill, Paul G.; Wardell-Johnson, Grant

    2016-01-01

    Premise of the study: Microsatellite markers were developed for the rare sedge Lepidosperma bungalbin (Cyperaceae) to assess genetic variation and its spatial structuring. Methods and Results: We conducted shotgun sequencing on an Illumina MiSeq and produced 6,215,872 sequence reads. The QDD pipeline was used to design 60 primer pairs that were screened using PCR. We developed 17 loci, of which 12 loci were identified that were polymorphic, amplified reliably, and could be consistently scored. We then screened these loci for variation in individuals from three populations. The number of alleles observed for these 12 loci across the three populations ranged from nine to 19 and expected heterozygosity ranged from 0.41 to 0.89. Conclusions: These markers will enable the quantification of the potential impact of mining on genetic variation within L. bungalbin and establish a baseline for future management of genetic variation of the rare sedge. PMID:27843727

  4. Postpositivism and Accounting Research : A (Personal Primer on Critical Realism

    Directory of Open Access Journals (Sweden)

    Jayne Bisman

    2010-12-01

    Full Text Available This paper presents an overview and primer on the postpositivist philosophy of critical realism. Theexamination of this research paradigm commences with the identification of the underlying motivations thatprompted a personal exploration of critical realism. A brief review of ontology, epistemology andmethodology and the research philosophies and methods popularly applied in accounting is then provided.The meta-theoretical basis of critical realism and the ontological and epistemological assumptions that gotowards establishing the ‘truth’ and validity criteria underpinning this paradigm are detailed, and therelevance and potential applications of critical realism to accounting research are also discussed. The purposeof this discussion is to make a call to diversify the approaches to accounting research, and – specifically – toassist researchers to realise the potential for postpositivist multiple method research designs in accounting.This is aided through an illustration that functions to highlight how and why this approach was applied in areal-world accounting research study.

  5. Primer Part 1-The building blocks of epilepsy genetics.

    Science.gov (United States)

    Helbig, Ingo; Heinzen, Erin L; Mefford, Heather C

    2016-06-01

    This is the first of a two-part primer on the genetics of the epilepsies within the Genetic Literacy Series of the Genetics Commission of the International League Against Epilepsy. In Part 1, we cover the foundations of epilepsy genetics including genetic epidemiology and the range of genetic variants that can affect the risk for developing epilepsy. We discuss various epidemiologic study designs that have been applied to the genetics of the epilepsies including population studies, which provide compelling evidence for a strong genetic contribution in many epilepsies. We discuss genetic risk factors varying in size, frequency, inheritance pattern, effect size, and phenotypic specificity, and provide examples of how genetic risk factors within the various categories increase the risk for epilepsy. We end by highlighting trends in epilepsy genetics including the increasing use of massive parallel sequencing technologies. Wiley Periodicals, Inc. © 2016 International League Against Epilepsy.

  6. Prospectives for gene therapy of retinal degenerations.

    Science.gov (United States)

    Thumann, Gabriele

    2012-08-01

    Retinal degenerations encompass a large number of diseases in which the retina and associated retinal pigment epithelial (RPE) cells progressively degenerate leading to severe visual disorders or blindness. Retinal degenerations can be divided into two groups, a group in which the defect has been linked to a specific gene and a second group that has a complex etiology that includes environmental and genetic influences. The first group encompasses a number of relatively rare diseases with the most prevalent being Retinitis pigmentosa that affects approximately 1 million individuals worldwide. Attempts have been made to correct the defective gene by transfecting the appropriate cells with the wild-type gene and while these attempts have been successful in animal models, human gene therapy for these inherited retinal degenerations has only begun recently and the results are promising. To the second group belong glaucoma, age-related macular degeneration (AMD) and diabetic retinopathy (DR). These retinal degenerations have a genetic component since they occur more often in families with affected probands but they are also linked to environmental factors, specifically elevated intraocular pressure, age and high blood sugar levels respectively. The economic and medical impact of these three diseases can be assessed by the number of individuals affected; AMD affects over 30 million, DR over 40 million and glaucoma over 65 million individuals worldwide. The basic defect in these diseases appears to be the relative lack of a neurogenic environment; the neovascularization that often accompanies these diseases has suggested that a decrease in pigment epithelium-derived factor (PEDF), at least in part, may be responsible for the neurodegeneration since PEDF is not only an effective neurogenic and neuroprotective agent but also a potent inhibitor of neovascularization. In the last few years inhibitors of vascularization, especially antibodies against vascular endothelial cell

  7. Optic pathway degeneration in Japanese black cattle.

    Science.gov (United States)

    Chiba, Shiori; Funato, Shingo; Horiuchi, Noriyuki; Matsumoto, Kotaro; Inokuma, Hisashi; Furuoka, Hidefumi; Kobayashi, Yoshiyasu

    2015-02-01

    Degeneration of the optic pathway has been reported in various animal species including cattle. We experienced a case of bilateral optic tract degeneration characterized by severe gliosis in a Japanese black cattle without any obvious visual defects. To evaluate the significance, pathological nature and pathogenesis of the lesions, we examined the optic pathway in 60 cattle (41 Japanese black, 13 Holstein and 6 crossbreed) with or without ocular abnormalities. None of these animals had optic canal stenosis. Degenerative changes with severe gliosis in the optic pathway, which includes the optic nerve, optic chiasm and optic tract, were only observed in 8 Japanese black cattle with or without ocular abnormalities. Furthermore, strong immunoreactivity of glial fibrillary acidic protein was observed in the retinal stratum opticum and ganglion cell layer in all 5 cattle in which the optic pathway lesions could be examined. As etiological research, we also examined whether the concentrations of vitamin A and vitamin B12 or bovine viral diarrhea virus (BVDV) infection was associated with optic pathway degeneration. However, our results suggested that the observed optic pathway degeneration was probably not caused by these factors. These facts indicate the presence of optic pathway degeneration characterized by severe gliosis that has never been reported in cattle without bilateral compressive lesions in the optic pathway or bilateral severe retinal atrophy.

  8. Vision rehabilitation of persons with age related macular degeneration.

    Science.gov (United States)

    Siemsen, Dennis W; Brown, William L

    2011-05-01

    As the population of the United States ages, there is an increase in the number of persons with age related macular degeneration (ARMD). Even as new prevention and treatment techniques are developed, the vision loss associated with ARMD may lead to loss of independence and quality of life. Low vision is a rehabilitative process designed to improve visual function and restore independence. This paper is a review of the current research related to low vision in the areas of magnification, contrast and illumination, reading, training, driving and outcomes assessment.

  9. Levetiracetam reduces myoclonus in corticobasal degeneration: report of two cases.

    Science.gov (United States)

    Kovács, Tibor; Farsang, Marianna; Vitaszil, Edina; Barsi, Péter; Györke, Tamás; Szirmai, Imre; Kamondi, Anita

    2009-12-01

    Levetiracetam (LEV) has been shown to suppress myoclonus of various origins. Corticobasal degeneration (CBD), a progressive neurodegenerative disorder with Parkinsonian syndrome, is frequently accompanied by myoclonus. We investigated the effect of LEV on myoclonus in two CBD patients. LEV remarkably decreased the myoclonic activity in both patients already at 1,500 mg/day dose. This is the first report on LEV alleviating myoclonus in CBD. Our data indicate that it might be worthwhile to assess this effect in an appropriately designed study.

  10. Mass-degenerate heavy vector mesons at hadron colliders

    Science.gov (United States)

    Piai, M.; Round, M.

    2010-08-01

    We study the LHC phenomenology of two mass-degenerate heavy gauge bosons with the same quantum numbers as Z and γ. We give a leading-order estimate of the number of events expected in Drell-Yan processes in terms of the parameters of the model (mass and coupling) and of the LHC machine specifications (integrated luminosity and energy). We consider the feasibility of measuring a forward-backward asymmetry for various choices of the parameters and estimate the potential reach. We comment on how the results may affect future collider design and apply our results to a specific model of electro-weak symmetry breaking by way of example.

  11. Mass-degenerate Heavy Vector Mesons at Hadron Colliders

    CERN Document Server

    Piai, Maurizio

    2009-01-01

    We study the LHC phenomenology of a couple of mass-degenerate heavy new gauge bosons with the quantum numbers of the Z and photon. We give a leading-order estimate of the number of events expected in Drell-Yan processes in terms of the parameters of the model (mass and coupling) and of the LHC machine specifications (luminosity and energy). We consider the feasibility of measuring a forward-backward asymmetry for various choices of the parameters and estimate the potential reach. We comment on how the results may affect future collider design and the results for a specific model of electro-weak symmetry breaking by way of example.

  12. Establishment of Quantitative Analysis Method for Genetically Modified Maize Using a Reference Plasmid and Novel Primers

    Science.gov (United States)

    Moon, Gi-Seong; Shin, Weon-Sun

    2012-01-01

    For the quantitative analysis of genetically modified (GM) maize in processed foods, primer sets and probes based on the 35S promoter (p35S), nopaline synthase terminator (tNOS), p35S-hsp70 intron, and zSSIIb gene encoding starch synthase II for intrinsic control were designed. Polymerase chain reaction (PCR) products (80~101 bp) were specifically amplified and the primer sets targeting the smaller regions (80 or 81 bp) were more sensitive than those targeting the larger regions (94 or 101 bp). Particularly, the primer set 35F1-R1 for p35S targeting 81 bp of sequence was even more sensitive than that targeting 101 bp of sequence by a 3-log scale. The target DNA fragments were also specifically amplified from all GM labeled food samples except for one item we tested when 35F1-R1 primer set was applied. A reference plasmid pGMmaize (3 kb) including the smaller PCR products for p35S, tNOS, p35S-hsp70 intron, and the zSSIIb gene was constructed for real-time PCR (RT-PCR). The linearity of standard curves was confirmed by using diluents ranging from 2×101~105 copies of pGMmaize and the R2 values ranged from 0.999~1.000. In the RT-PCR, the detection limit using the novel primer/probe sets was 5 pg of genomic DNA from MON810 line indicating that the primer sets targeting the smaller regions (80 or 81 bp) could be used for highly sensitive detection of foreign DNA fragments from GM maize in processed foods. PMID:24471096

  13. Phase space methods for degenerate quantum gases

    CERN Document Server

    Dalton, Bryan J; Barnett, Stephen M

    2015-01-01

    Recent experimental progress has enabled cold atomic gases to be studied at nano-kelvin temperatures, creating new states of matter where quantum degeneracy occurs - Bose-Einstein condensates and degenerate Fermi gases. Such quantum states are of macroscopic dimensions. This book presents the phase space theory approach for treating the physics of degenerate quantum gases, an approach already widely used in quantum optics. However, degenerate quantum gases involve massive bosonic and fermionic atoms, not massless photons. The book begins with a review of Fock states for systems of identical atoms, where large numbers of atoms occupy the various single particle states or modes. First, separate modes are considered, and here the quantum density operator is represented by a phase space distribution function of phase space variables which replace mode annihilation, creation operators, the dynamical equation for the density operator determines a Fokker-Planck equation for the distribution function, and measurable...

  14. The cell stress machinery and retinal degeneration.

    Science.gov (United States)

    Athanasiou, Dimitra; Aguilà, Monica; Bevilacqua, Dalila; Novoselov, Sergey S; Parfitt, David A; Cheetham, Michael E

    2013-06-27

    Retinal degenerations are a group of clinically and genetically heterogeneous disorders characterised by progressive loss of vision due to neurodegeneration. The retina is a highly specialised tissue with a unique architecture and maintaining homeostasis in all the different retinal cell types is crucial for healthy vision. The retina can be exposed to a variety of environmental insults and stress, including light-induced damage, oxidative stress and inherited mutations that can lead to protein misfolding. Within retinal cells there are different mechanisms to cope with disturbances in proteostasis, such as the heat shock response, the unfolded protein response and autophagy. In this review, we discuss the multiple responses of the retina to different types of stress involved in retinal degenerations, such as retinitis pigmentosa, age-related macular degeneration and glaucoma. Understanding the mechanisms that maintain and re-establish proteostasis in the retina is important for developing new therapeutic approaches to fight blindness.

  15. Families and degenerations of conformal field theories

    Energy Technology Data Exchange (ETDEWEB)

    Roggenkamp, D.

    2004-09-01

    In this work, moduli spaces of conformal field theories are investigated. In the first part, moduli spaces corresponding to current-current deformation of conformal field theories are constructed explicitly. For WZW models, they are described in detail, and sigma model realizations of the deformed WZW models are presented. The second part is devoted to the study of boundaries of moduli spaces of conformal field theories. For this purpose a notion of convergence of families of conformal field theories is introduced, which admits certain degenerated conformal field theories to occur as limits. To such a degeneration of conformal field theories, a degeneration of metric spaces together with additional geometric structures can be associated, which give rise to a geometric interpretation. Boundaries of moduli spaces of toroidal conformal field theories, orbifolds thereof and WZW models are analyzed. Furthermore, also the limit of the discrete family of Virasoro minimal models is investigated. (orig.)

  16. Intrageneric Primer Design: Bringing Bioinformatics Tools to the Class

    Science.gov (United States)

    Lima, Andre O. S.; Garces, Sergio P. S.

    2006-01-01

    Bioinformatics is one of the fastest growing scientific areas over the last decade. It focuses on the use of informatics tools for the organization and analysis of biological data. An example of their importance is the availability nowadays of dozens of software programs for genomic and proteomic studies. Thus, there is a growing field (private…

  17. Intrageneric Primer Design: Bringing Bioinformatics Tools to the Class

    Science.gov (United States)

    Lima, Andre O. S.; Garces, Sergio P. S.

    2006-01-01

    Bioinformatics is one of the fastest growing scientific areas over the last decade. It focuses on the use of informatics tools for the organization and analysis of biological data. An example of their importance is the availability nowadays of dozens of software programs for genomic and proteomic studies. Thus, there is a growing field (private…

  18. Screening for the familial defective apolipoprotein B-100 R3500W by mutagenic primers PCR

    Institute of Scientific and Technical Information of China (English)

    冯纪安; 冯铮

    2002-01-01

    Objective A method combining the mutagenic primers PCR and restriction enzyme digestion was designed to facilitate the detection of gene mutation in familial defective apolipoprotein B-1O0 R3500W. Methods A pair of primer was designed and a mismatch nucleotide was introduced in its upstream primer. A segment of target DNA including the possibly mutated nucleotide was amplified by PCR and the products were digested by restriction enzyme Nco 1. To overcome the potential false negative results due to improper digestion conditions, a segment of DNA with Ncol cut size was added as reference.Results The target sequence was successfully amplified by PCR, producing a 144 bp DNA fragment as expected. When incubated with Ncol, the enzyme could digest the DNA, producing a 114 bp segment,only if it was amplified from the mutated gene, but not from the normal allele. This difference in length of DNA could be separated by electrophoresis on a 2 %agarose gel. Thus we successfully detected two carriers of heterozygous FDB R3500W in 162 hypercholesterolemic patients. Conclusions Mutagenic primers PCR can be used to detect the gene mutation of apo B-100 R3500W, two cases were detected among 162patients with hypercholesterolemia. It suggests that this mutation is not rare in mainland China.

  19. Brownfields Technology Primer: Selecting and Using Phytoremediation for Site Cleanup

    Science.gov (United States)

    This primer explains the phytoremediation process, discusses the potential advantages and considerations in selecting phytoremediation to clean up brownfields sites, and provides information on additional resources about phytoremediation.

  20. Great Lakes rivermouths: a primer for managers

    Science.gov (United States)

    Pebbles, Victoria; Larson, James; Seelbach, Paul; Pebbles, Victoria; Larson, James; Seelbach, Paul

    2013-01-01

    Between the North American Great Lakes and their tributaries are the places where the confluence of river and lake waters creates a distinct ecosystem: the rivermouth ecosystem. Human development has often centered around these rivermouths, in part, because they provide a rich array of ecosystem services. Not surprisingly, centuries of intense human activity have led to substantial pressures on, and alterations to, these ecosystems, often diminishing or degrading their ecological functions and associated ecological services. Many Great Lakes rivermouths are the focus of intense restoration efforts. For example, 36 of the active Great Lakes Areas of Concern (AOCs) are rivermouths or areas that include one or more rivermouths. Historically, research of rivermouth ecosystems has been piecemeal, focused on the Great Lakes proper or on the upper reaches of tributaries, with little direct study of the rivermouth itself. Researchers have been divided among disciplines, agencies and institutions; and they often work independently and use disparate venues to communicate their work. Management has also been fragmented with a focus on smaller, localized, sub-habitat units and socio-political or economic elements, rather than system-level consideration. This Primer presents the case for a more holistic approach to rivermouth science and management that can enable restoration of ecosystem services with multiple benefits to humans and the Great Lakes ecosystem. A conceptual model is presented with supporting text that describes the structures and processes common to all rivermouths, substantiating the case for treating these ecosystems as an identifiable class.1 Ecological services provided by rivermouths and changes in how humans value those services over time are illustrated through case studies of two Great Lakes rivermouths—the St. Louis River and the Maumee River. Specific ecosystem services are identified in italics throughout this Primer and follow definitions described

  1. [New aspects in age related macular degeneration].

    Science.gov (United States)

    Turlea, C

    2012-01-01

    Being the leading cause of blindness in modern world Age Related Macular Degeneration has beneficiated in the last decade of important progress in diagnosis, classification and the discovery of diverse factors who contribute to the etiology of this disease. Treatments have arised who can postpone the irreversible evolution of the disease and thus preserve vision. Recent findings have identified predisposing genetic factors and also inflamatory and imunological parameters that can be modified trough a good and adequate prevention and therapy This articole reviews new aspects of patology of Age Related Macular Degeneration like the role of complement in maintaining inflamation and the role of oxidative stress on different structures of the retina.

  2. Intracavity frequency-doubled degenerate laser

    CERN Document Server

    Liew, Seng Fatt; Weiler, Sascha; Monjardin-Lopez, Jesus Fernando; Ramme, Mark; Redding, Brandon; Choma, Michael A; Cao, Hui

    2016-01-01

    We develop a green light source with low spatial coherence via intracavity frequency doubling of a solid-state degenerate laser. The second harmonic emission supports many more transverse modes than the fundamental emission, and exhibit lower spatial coherence. A strong suppression of speckle formation is demonstrated for both fundamental and second harmonic beams. Using the green emission for fluorescence excitation, we show the coherent artifacts are removed from the full-field fluorescence images. The high power, low spatial coherence and good directionality makes the green degenerate laser an attractive illumination source for parallel imaging and projection display.

  3. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2015-01-01

    This primer offers readers an introduction to the central concepts that form our modern understanding of complex and emergent behavior, together with detailed coverage of accompanying mathematical methods. All calculations are presented step by step and are easy to follow. This new fourth edition has been fully reorganized and includes new chapters, figures and exercises. The core aspects of modern complex system sciences are presented in the first chapters, covering network theory, dynamical systems, bifurcation and catastrophe theory, chaos and adaptive processes, together with the principle of self-organization in reaction-diffusion systems and social animals. Modern information theoretical principles are treated in further chapters, together with the concept of self-organized criticality, gene regulation networks, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase transitions and the cognitive system approach to the brain. Technical course prerequisites are the standard ...

  4. Complex and Adaptive Dynamical Systems A Primer

    CERN Document Server

    Gros, Claudius

    2011-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  5. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2007-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  6. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2013-01-01

    Complex system theory is rapidly developing and gaining importance, providing tools and concepts central to our modern understanding of emergent phenomena. This primer offers an introduction to this area together with detailed coverage of the mathematics involved. All calculations are presented step by step and are straightforward to follow. This new third edition comes with new material, figures and exercises. Network theory, dynamical systems and information theory, the core of modern complex system sciences, are developed in the first three chapters, covering basic concepts and phenomena like small-world networks, bifurcation theory and information entropy. Further chapters use a modular approach to address the most important concepts in complex system sciences, with the emergence and self-organization playing a central role. Prominent examples are self-organized criticality in adaptive systems, life at the edge of chaos, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase...

  7. Angels and Degenerates: Artistic Virtuosity and Degeneration Theory in Fin de Siècle Fiction

    OpenAIRE

    2015-01-01

    The aim in "Angels and Degenerates: Artistic Virtuosity and Degeneration Theory in Fin de Siècle Fiction" is to complicate the popular image of the fin de siècle as uniformly pessimistic by examining the continuities between a range of novelists, as well as other late nineteenth century writers from such disparate fields as psychology and cultural criticism, as they critique degeneration theory. Some of these writers, like Thomas Hardy, H.G. Wells, and Sarah Grand, are typically read as promo...

  8. Universal Primers Used for Detection of Bacterial Meningitis

    Directory of Open Access Journals (Sweden)

    MohammadReza Pourmand

    2015-10-01

    Full Text Available Background: Acute bacterial meningitis is among serious infections of the central nervous system (CNS. The early diagnosis and empiric antibiotic treatments have led to a reduction in morbidity and mortality rates. PCR and the enzymatic digestion of 16S rDNA fragment following the PCR by universal primers led up fast and sensitive determination. The aims of the present study was to improve our previous method for rapid and specific detection of common bacteria causing acute meningitis.Methods: According to the gene encoding 16S rDNA found in all bacteria, a set of primers was designed. Then the universal PCR was performed for bacterial agents of meningitis by employing broad-range DNA extraction method. The amplicons were digested with restriction enzymes to identify bacterial species.Results:  By the  enzymatic  digestion  of  the  amplicons  of  each  standard strain, specific patterns were achieved. These specific patterns may be usedfor comparison in CSF examination. The analytical sensitivity of the assay was  approximately 1.5×102   CFU/ml  of  CSF  even in  samples with  high amount of proteins.Conclusion: The universal PCR coupled with enzymatic digestion can be used to detect and identify bacterial pathogens in clinical specimens rapidly and accurately. Molecular diagnostic of bacterial meningitis, though expensive and labor-intensive, but is valuable and critical in patient management.

  9. A novel noise optimization technique for inductively degenerated CMOS LNA

    Institute of Scientific and Technical Information of China (English)

    Geng Zhiqing; Wang Haiyong; Wu Nanjian

    2009-01-01

    This paper proposes a novel noise optimization technique. The technique gives analytical formulae for the noise performance of inductively degenerated CMOS low noise amplifier (LNA) circuits with an ideal gate inductor for a fixed bias voltage and nonideal gate inductor for a fixed power dissipation, respectively, by mathematical analysis and reasonable approximation methods. LNA circuits with required noise figure can be designed effectively and rapidly just by using hand calculations of the proposed formulae. We design a 1.8 GHz LNA in a TSMC 0.25 pan CMOS process. The measured results show a noise figure of 1.6 dB with a forward gain of 14.4 dB at a power consumption of 5 mW, demonstrating that the designed LNA circuits can achieve low noise figure levels at low power dissipation.

  10. A novel noise optimization technique for inductively degenerated CMOS LNA

    Science.gov (United States)

    Zhiqing, Geng; Haiyong, Wang; Nanjian, Wu

    2009-10-01

    This paper proposes a novel noise optimization technique. The technique gives analytical formulae for the noise performance of inductively degenerated CMOS low noise amplifier (LNA) circuits with an ideal gate inductor for a fixed bias voltage and nonideal gate inductor for a fixed power dissipation, respectively, by mathematical analysis and reasonable approximation methods. LNA circuits with required noise figure can be designed effectively and rapidly just by using hand calculations of the proposed formulae. We design a 1.8 GHz LNA in a TSMC 0.25 μm CMOS process. The measured results show a noise figure of 1.6 dB with a forward gain of 14.4 dB at a power consumption of 5 mW, demonstrating that the designed LNA circuits can achieve low noise figure levels at low power dissipation.

  11. Detection of varicella-zoster virus and herpes simplex virus by the polymerase chain reaction with degenerate primers

    NARCIS (Netherlands)

    Jacobs, J.J.L.; Folkers, E.; Vreeswijk, J.

    1999-01-01

    Varicella-zoster virus (VZV) and herpes simplex virus (HSV) are human pathogens of significance involved in multiple diseases with either typical or atypical clinical features. In neonates and immunocompromised patients these alphaherpesviruses may cause life-threatening diseases such as

  12. Detection of varicella-zoster virus and herpes simplex virus by the polymerase chain reaction with degenerate primers

    NARCIS (Netherlands)

    Jacobs, J.J.L.; Folkers, E.; Vreeswijk, J.

    1999-01-01

    Varicella-zoster virus (VZV) and herpes simplex virus (HSV) are human pathogens of significance involved in multiple diseases with either typical or atypical clinical features. In neonates and immunocompromised patients these alphaherpesviruses may cause life-threatening diseases such as encephaliti

  13. [Analysis of effectiveness of cDNA synthesis, induced using complementary primers and primers containing a noncomplementary base matrix].

    Science.gov (United States)

    D'iachenko, L B; Chenchik, A A; Khaspekov, G L; Tatarenko, A O; Bibilashvili, R Sh

    1994-01-01

    We have studied the efficiency of DNA synthesis catalyzed by M-MLV reverse transcriptase or Thermus aquaticus DNA polymerase for primers (4-17 nucleotides long) either completely matched or possessing a single mismatched base pair at all possible positions in the primer. It has been shown that DNA synthesis efficiency depends not only on the position of mismatched base pair but on the length and primary structure of the primer. The enzyme, template, and primer concentrations determine the relative level of mismatched DNA synthesis.

  14. Motor axon excitability during Wallerian degeneration

    DEFF Research Database (Denmark)

    Moldovan, Mihai; Alvarez, Susana; Krarup, Christian

    2008-01-01

    , action potential propagation and structural integrity of the distal segment are maintained. The aim of this study was to investigate in vivo the changes in membrane function of motor axons during the 'latent' phase of Wallerian degeneration. Multiple indices of axonal excitability of the tibial nerve...

  15. MR findings of degenerating parenchymal neurocysticercosis

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Yul; Chung, Eun A; Yang, Ik; Park, Hae Jung; Chung, Soo Young [Hallym Univ. Kangnam Sungshim Hospital, Seoul (Korea, Republic of)

    1996-06-01

    To evaluate MR imaging findings of degenerating parenchymal neurocysticercosis and to determine the characteristics which distinguish it from other brain diseases. MR imagings of 19 patients (56 lesions) of degenerating parenchymal neurocysticercosis were retrospectively evaluated, focusing on the size and location of lesions signal intensity patterns of cyst fluid and wall, the extent of the surrounding edema and features of contrast enhancement. Degenerating parenchymal neurocysticercosis was located in gray or subcortical while matter in 89.3% of 56 lesions (50/56) ; most of these (98.2%) were smaller than 2 cm in diameter. Cyst fluid signal was hyperintense relative to CSF on T1 and proton density weighted images (92.9%). A hypointense signal rim of the cyst wall was noted in the lesions on proton density (92.9%) and T2 weighted (98.2%) images, Surrounding edema was mostly mild. Peripheral rim enhancement was noted in all lesions, and this was frequently irregular and lobulated (67.9%) with a focal defect in the enhancing rim(41.1%). Findings which could be helpful in distinguishing degenerating parencymal neurocysticercosis from other brain diseases are as follows : small, superficial lesions ; hyperintense signal of the cyst fluid on T1 and proton density weighted images ; hypointense signal of the cyst wall on proton density and T2 weighted images ; relatively mild extent of surrounding edema, and peripheral rim enhancement which is frequently irregular and lobulated with a focal defect in the enhancing rim.

  16. Single Degenerate Progenitors of Type Ia Supernovae

    Science.gov (United States)

    Bours, Madelon; Toonen, Silvia; Nelemans, Gijs

    2013-01-01

    There is a general agreement that Type Ia supernovae correspond to the thermonuclear runaway of a white dwarf (WD) in a compact binary. The details of these progenitor systems are still unclear. Using the population synthesis code SeBa and several assumption for the WD retention efficiency, we estimate the delay times and supernova rates for the single degenerate scenario.

  17. Driving and Age-Related Macular Degeneration

    Science.gov (United States)

    Owsley, Cynthia; McGwin, Gerald, Jr.

    2008-01-01

    This article reviews the research literature on driving and age-related macular degeneration, which is motivated by the link between driving and the quality of life of older adults and their increased collision rate. It addresses the risk of crashes, driving performance, driving difficulty, self-regulation, and interventions to enhance, safety,…

  18. The nature of apraxia in corticobasal degeneration.

    Science.gov (United States)

    Leiguarda, R; Lees, A J; Merello, M; Starkstein, S; Marsden, C D

    1994-01-01

    Although apraxia is one of the most frequent signs in corticobasal degeneration, the phenomenology of this disorder has not been formally examined. Hence 10 patients with corticobasal degeneration were studied with a standardised evaluation for different types of apraxia. To minimise the confounding effects of the primary motor disorder, apraxia was assessed in the least affected limb. Whereas none of the patients showed buccofacial apraxia, seven showed deficits on tests of ideomotor apraxia and movement imitation, four on tests of sequential arm movements (all of whom had ideomotor apraxia), and three on tests of ideational apraxia (all of whom had ideomotor apraxia). Ideomotor apraxia significantly correlated with deficit in both the mini mental state examination and in a task sensitive to frontal lobe dysfunction (picture arrangement). Two of the three patients with ideomotor apraxia and ideational apraxia showed severe cognitive impairments. The alien limb behaviour was present only in patients with ideomotor apraxia. In conclusion, ideomotor apraxia is the most frequent type of apraxia in corticobasal degeneration, and may be due to dysfunction of the supplementary motor area. There is a subgroup of patients with corticobasal degeneration who have a severe apraxia (ideomotor and ideational apraxia), which correlates with global cognitive impairment, and may result from additional parietal or diffuse cortical damage. PMID:8163995

  19. Specific heats of degenerate ideal gases

    OpenAIRE

    Caruso, Francisco; Oguri, Vitor; Silveira, Felipe

    2017-01-01

    From arguments based on Heisenberg's uncertainty principle and Pauli's exclusion principle, the molar specific heats of degenerate ideal gases at low temperatures are estimated, giving rise to values consistent with the Nerst-Planck Principle (third law of Thermodynamics). The Bose-Einstein condensation phenomenon based on the behavior of specific heat of massive and non-relativistic boson gases is also presented.

  20. Transversal heteroclinic orbits in general degenerate cases

    Institute of Scientific and Technical Information of China (English)

    朱德明

    1996-01-01

    A geometrical method using the exponential dichotomy and the invariant manifold thoery is given to set up the criteria for the existence of transversal and tangential heterodinic orbits under the most general degenerate cases. Conclusions given here extend and contain the relevant known results.

  1. Depression in Age-Related Macular Degeneration

    Science.gov (United States)

    Casten, Robin; Rovner, Barry

    2008-01-01

    Age-related macular degeneration (AMD) is a major cause of disability in the elderly, substantially degrades the quality of their lives, and is a risk factor for depression. Rates of depression in AMD are substantially greater than those found in the general population of older people, and are on par with those of other chronic and disabling…

  2. Nonunital Spectral Triples Associated to Degenerate Metrics

    Science.gov (United States)

    Rennie, A.

    We show that one can define (p,∞)-summable spectral triples using degenerate metrics on smooth manifolds. Furthermore, these triples satisfy Connes-Moscovici's discrete and finite dimension spectrum hypothesis, allowing one to use the Local Index Theorem [1] to compute the pairing with K-theory. We demonstrate this with a concrete example.

  3. Assessment of primer/template mismatch effects on real-time PCR amplification of target taxa for GMO quantification.

    Science.gov (United States)

    Ghedira, Rim; Papazova, Nina; Vuylsteke, Marnik; Ruttink, Tom; Taverniers, Isabel; De Loose, Marc

    2009-10-28

    GMO quantification, based on real-time PCR, relies on the amplification of an event-specific transgene assay and a species-specific reference assay. The uniformity of the nucleotide sequences targeted by both assays across various transgenic varieties is an important prerequisite for correct quantification. Single nucleotide polymorphisms (SNPs) frequently occur in the maize genome and might lead to nucleotide variation in regions used to design primers and probes for reference assays. Further, they may affect the annealing of the primer to the template and reduce the efficiency of DNA amplification. We assessed the effect of a minor DNA template modification, such as a single base pair mismatch in the primer attachment site, on real-time PCR quantification. A model system was used based on the introduction of artificial mismatches between the forward primer and the DNA template in the reference assay targeting the maize starch synthase (SSIIb) gene. The results show that the presence of a mismatch between the primer and the DNA template causes partial to complete failure of the amplification of the initial DNA template depending on the type and location of the nucleotide mismatch. With this study, we show that the presence of a primer/template mismatch affects the estimated total DNA quantity to a varying degree.

  4. Sequence-modified primers for the differential RT-PCR detection of Andean potato latent and Andean potato mild mosaic viruses in quarantine tests.

    Science.gov (United States)

    Koenig, Renate; Ziebell, Heiko

    2014-05-01

    To enable the differential PCR detection of Andean potato latent virus (APLV) and Andean potato mild mosaic virus (APMMV) strains, sense primers were designed that correspond to regions directly upstream of the coat protein genes. Their differentiating power was increased by A->C or T->C replacements in their 3'-terminal parts. Together with the broad-specificity antisense primer EM3, primer AL-a-mod3C detected all APLV strains tested, but none of the APMMV strains. Primer AM-a-mod4C yielded PCR products with all APMMV preparations, but also with some APLV preparations. Sequence analysis revealed that this was not due to a lack of primer specificity, but to the sensitive detection of contaminating APMMV in some of our APLV preparations.

  5. On Doubly Degenerate Quasilinear Parabolic Equations of Higher Order

    Institute of Scientific and Technical Information of China (English)

    Zhen Hai LIU

    2005-01-01

    We deal with the existence of periodic solutions for doubly degenerate quasilinear parabolic equations of higher order, which can degenerate, on a part of the boundary, on a segment in the interior of the domain and in time.

  6. Quasiconformal mappings and degenerate elliptic and parabolic equations

    Directory of Open Access Journals (Sweden)

    Filippo Chiarenza

    1987-11-01

    Full Text Available In this paper two Harnak inequalities are proved concerning a degenerate elliptic and a degenerate parabolic equation. In both cases the weight giving the degeneracy is a power of the jacobian of a quasiconformal mapping.

  7. Degenerate solutions obtained from several variants of factor analysis

    NARCIS (Netherlands)

    Zijlstra, Bonne J.H.; Kiers, Henk A.L.

    2002-01-01

    Considerable research has been performed concerning degenerate solutions from the Parafac model. However, degenerate solutions have also been reported to occur with the shifted multiplicative model and a model for component analysis of multitrait multimethod matrices. Furthermore, we obtained

  8. The Fluid Reading Primer: Animated Decoding Support for Emergent Readers.

    Science.gov (United States)

    Zellweger, Polle T.; Mackinlay, Jock D.

    A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…

  9. Development of Species-specific Primers for Rapid Detection of Phellinus linteus and P. baumii.

    Science.gov (United States)

    Kim, Mun-Ok; Kim, Gi-Young; Nam, Byung-Hyouk; Jin, Cheng-Yun; Lee, Ki-Won; Park, Jae-Min; Lee, Sang-Joon; Lee, Jae-Dong

    2005-06-01

    Genus Phellinus taxonomically belongs to Aphyllophorales and some species of this genus have been used as a medicinal ingredients and Indian folk medicines. Especially, P. linteus and morphological-related species are well-known medicinal fungi that have various biological activities such as humoral and cell-mediated, anti-mutagenic, and anti-cancer activities. However, little is known about the rapid detection for complex Phellinus species. Therefore, this study was carried out to develop specific primers for the rapid detection of P. linteus and other related species. Designing the species-specific primers was done based on internal transcribed spacer sequence data. Each primer set detected specifically P. linteus (PL2/PL5R) and P. baumii (PB1/PB4R). These primer sets could be useful for the rapid detection of specific-species among unidentified Phellinus species. Moreover, restriction fragment length polymorphism analysis of the ITS region with HaeIII was also useful for clarifying the relationship between each 5 Phellinus species.

  10. Screening for Residual Disease in Pediatric Burkitt Lymphoma Using Consensus Primer Pools

    Directory of Open Access Journals (Sweden)

    Melissa Agsalda

    2009-01-01

    Full Text Available Assessing molecular persistent or minimal residual disease (PD/MRD in childhood Burkitt lymphoma (BL is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs. Because BL is characterized by rearranged immunoglobulin heavy chain (IgVH genes, IgVH primer pools from IgVH1–IgVH7 regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgVH primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgVH primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

  11. Polymerase chain reaction of Au nanoparticle-bound primers

    Institute of Scientific and Technical Information of China (English)

    SHEN Hebai; HU Min; YANG Zhongnan; WANG Chen; ZHU Longzhang

    2005-01-01

    Polymerase chain reaction (PCR) is a useful technique for in vitro amplification of a DNA fragment. In this paper, a PCR procedure using Au nanoparticle (AuNP) -bound primers was systemically studied. The 5′-SH- (CH2)6-modified primers were covalently attached to the AuNP surface via Au-S bonds, and plasmid pBluescript SK was used as a template. The effects of the concentration of AuNP-bound primers, annealing temperature and PCR cycles were evaluated, respectively. The results indicate that PCR can proceed successfully under optimized condition, with either forward or reverse primers bound to the AuNP surface or with both the two primers bound to the AuNP surface. Development of PCR procedure based on AuNPs not only makes the isolation of PCR products very convenient, but also provides novel methods to prepare AuNP-bound ssDNA and nanostructured material.

  12. Uncoupling primer and releaser responses to pheromone in honey bees

    Science.gov (United States)

    Grozinger, Christina M.; Fischer, Patrick; Hampton, Jacob E.

    2007-05-01

    Pheromones produce dramatic behavioral and physiological responses in a wide variety of species. Releaser pheromones elicit rapid responses within seconds or minutes, while primer pheromones produce long-term changes which may take days to manifest. Honeybee queen mandibular pheromone (QMP) elicits multiple distinct behavioral and physiological responses in worker bees, as both a releaser and primer, and thus produces responses on vastly different time scales. In this study, we demonstrate that releaser and primer responses to QMP can be uncoupled. First, treatment with the juvenile hormone analog methoprene leaves a releaser response (attraction to QMP) intact, but modulates QMP’s primer effects on sucrose responsiveness. Secondly, two components of QMP (9-ODA and 9-HDA) do not elicit a releaser response (attraction) but are as effective as QMP at modulating a primer response, downregulation of foraging-related brain gene expression. These results suggest that different responses to a single pheromone may be produced via distinct pathways.

  13. High-speed measurement of firearm primer blast waves

    CERN Document Server

    Courtney, Michael; Eng, Jonathan; Courtney, Amy

    2012-01-01

    This article describes a method and results for direct high-speed measurements of firearm primer blast waves employing a high-speed pressure transducer located at the muzzle to record the blast pressure wave produced by primer ignition. Key findings are: 1) Most of the lead styphnate based primer models tested show 5.2-11.3% standard deviation in the magnitudes of their peak pressure. 2) In contrast, lead-free diazodinitrophenol (DDNP) based primers had standard deviations of the peak blast pressure of 8.2-25.0%. 3) Combined with smaller blast waves, these large variations in peak blast pressure of DDNP-based primers led to delayed ignition and failure to fire in brief field tests.

  14. Human mitochondrial DNA complete amplification and sequencing: a new validated primer set that prevents nuclear DNA sequences of mitochondrial origin co-amplification.

    Science.gov (United States)

    Ramos, Amanda; Santos, Cristina; Alvarez, Luis; Nogués, Ramon; Aluja, Maria Pilar

    2009-05-01

    To date, there are no published primers to amplify the entire mitochondrial DNA (mtDNA) that completely prevent the amplification of nuclear DNA (nDNA) sequences of mitochondrial origin. The main goal of this work was to design, validate and describe a set of primers, to specifically amplify and sequence the complete human mtDNA, allowing the correct interpretation of mtDNA heteroplasmy in healthy and pathological samples. Validation was performed using two different approaches: (i) Basic Local Alignment Search Tool and (ii) amplification using isolated nDNA obtained from sperm cells by differential lyses. During the validation process, two mtDNA regions, with high similarity with nDNA, represent the major problematic areas for primer design. One of these could represent a non-published nuclear DNA sequence of mitochondrial origin. For two of the initially designed fragments, the amplification results reveal PCR artifacts that can be attributed to the poor quality of the DNA. After the validation, nine overlapping primer pairs to perform mtDNA amplification and 22 additional internal primers for mtDNA sequencing were obtained. These primers could be a useful tool in future projects that deal with mtDNA complete sequencing and heteroplasmy detection, since they represent a set of primers that have been tested for the non-amplification of nDNA.

  15. Development of amplified fragment length polymorphism (AFLP)-derived specific primer for the detection of Fusarium solani aetiological agent of peanut brown root rot.

    Science.gov (United States)

    Casasnovas, F; Fantini, E N; Palazzini, J M; Giaj-Merlera, G; Chulze, S N; Reynoso, M M; Torres, A M

    2013-06-01

    The objective of this work was to design an amplified fragment length polymorphism (AFLP)-derived specific primer for the detection of Fusarium solani aetiological agent of peanut brown root rot (PBRR) in plant material and soil. Specific primers for the detection of the pathogen were designed based on an amplified region using AFLPs. The banding patterns by AFLPs showed that isolates from diseased roots were clearly distinguishable from others members of the F. solani species complex. Many bands were specific to F. solani PBRR, one of these fragments was selected and sequenced. Sequence obtained was used to develop specific PCR primers for the identification of pathogen in pure culture and in plant material and soil. Primer pair FS1/FS2 amplified a single DNA product of 175 bp. Other fungal isolates occurring in soil, included F. solani non-PBRR, were not detected by these specific primers. The assay was effective for the detection of pathogen from diseased root and infected soils. The designed primers for F. solani causing PBRR can be used in a PCR diagnostic protocol to rapidly and reliably detect and identify this pathogen. These diagnostic PCR primers will aid the detection of F. solani causing PBRR in diseased root and natural infected soils. The method developed could be a helpful tool for epidemiological studies and to avoid the spread of this serious disease in new areas. © 2013 The Society for Applied Microbiology.

  16. DNA sequencing technology, walking with modular primers. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Ulanovsky, L.

    1996-12-31

    The success of the Human Genome Project depends on the development of adequate technology for rapid and inexpensive DNA sequencing, which will also benefit biomedical research in general. The authors are working on DNA technologies that eliminate primer synthesis, the main bottleneck in sequencing by primer walking. They have developed modular primers that are assembled from three 5-mer, 6-mer or 7-mer modules selected from a presynthesized library of as few as 1,000 oligonucleotides ({double_bond}4, {double_bond}5, {double_bond}7). The three modules anneal contiguously at the selected template site and prime there uniquely, even though each is not unique for the most part when used alone. This technique is expected to speed up primer walking 30 to 50 fold, and reduce the sequencing cost by a factor of 5 to 15. Time and expensive will be saved on primer synthesis itself and even more so due to closed-loop automation of primer walking, made possible by the instant availability of primers. Apart from saving time and cost, closed-loop automation would also minimize the errors and complications associated with human intervention between the walks. The author has also developed two additional approaches to primer-library based sequencing. One involves a branched structure of modular primers which has a distinctly different mechanism of achieving priming specificity. The other introduces the concept of ``Differential Extension with Nucleotide Subsets`` as an approach increasing priming specificity, priming strength and allowing cycle sequencing. These approaches are expected to be more robust than the original version of the modular primer technique.

  17. Prediction of age-related macular degeneration in the general population: The three continent AMD consortium

    NARCIS (Netherlands)

    G.H.S. Buitendijk (Gabrielle); E. Rochtchina (Elena); C.E. Myers (Chelsea); C.M. van Duijn (Cock); K.E. Lee (Kristine); B.E.K. Klein (Barbara); S.M. Meuer (Stacy); P.T.V.M. de Jong (Paulus); E.G. Holliday (Elizabeth); A.G. Tan (Ava); A.G. Uitterlinden (André); T.A. Sivakumaran (Theru); J. Attia (John); A. Hofman (Albert); P. Mitchell (Paul); J.R. Vingerling (Hans); S.K. Iyengar (Sudha); A.C.J.W. Janssens (Cécile); J.J. Wang (Jie Jin); B.E.K. Klein (Barbara); C.C.W. Klaver (Caroline)

    2013-01-01

    textabstractPurpose Prediction models for age-related macular degeneration (AMD) based on case-control studies have a tendency to overestimate risks. The aim of this study is to develop a prediction model for late AMD based on data from population-based studies. Design Three population-based studies

  18. Reduced impact of induced gate noise on inductively degenerated LNAs in deep submicron CMOS technologies

    DEFF Research Database (Denmark)

    Rossi, P.; Svelto, F.; Mazzanti, A.

    2005-01-01

    Designers of radio-frequency inductively-degenerated CMOS low-noise-amplifiers have usually not followed the guidelines for achieving minimum noise figure. Nonetheless, state-of-the- art implementations display noise figure values very close to the theoretical minimum. In this paper, we point out...

  19. Reduced impact of induced gate noise on inductively degenerated LNAs in deep submicron CMOS technologies

    DEFF Research Database (Denmark)

    Rossi, P.; Svelto, F.; Mazzanti, A.

    2005-01-01

    Designers of radio-frequency inductively-degenerated CMOS low-noise-amplifiers have usually not followed the guidelines for achieving minimum noise figure. Nonetheless, state-of-the- art implementations display noise figure values very close to the theoretical minimum. In this paper, we point out...

  20. Single-Chain Antibody Fragment VEGF Inhibitor RTH258 for Neovascular Age-Related Macular Degeneration

    DEFF Research Database (Denmark)

    Holz, Frank G; Dugel, Pravin U; Weissgerber, Georges

    2016-01-01

    PURPOSE: To assess the safety and efficacy of different doses of RTH258 applied as single intravitreal administration compared with ranibizumab 0.5 mg in patients with neovascular age-related macular degeneration (AMD). DESIGN: Six-month, phase 1/2, prospective, multicenter, double-masked, random...