WorldWideScience

Sample records for degenerate primers based

  1. An iterative method for selecting degenerate multiplex PCR primers.

    Science.gov (United States)

    Souvenir, Richard; Buhler, Jeremy; Stormo, Gary; Zhang, Weixiong

    2007-01-01

    Single-nucleotide polymorphism (SNP) genotyping is an important molecular genetics process, which can produce results that will be useful in the medical field. Because of inherent complexities in DNA manipulation and analysis, many different methods have been proposed for a standard assay. One of the proposed techniques for performing SNP genotyping requires amplifying regions of DNA surrounding a large number of SNP loci. To automate a portion of this particular method, it is necessary to select a set of primers for the experiment. Selecting these primers can be formulated as the Multiple Degenerate Primer Design (MDPD) problem. The Multiple, Iterative Primer Selector (MIPS) is an iterative beam-search algorithm for MDPD. Theoretical and experimental analyses show that this algorithm performs well compared with the limits of degenerate primer design. Furthermore, MIPS outperforms an existing algorithm that was designed for a related degenerate primer selection problem.

  2. A rapid method of accurate detection and differentiation of Newcastle disease virus pathotypes by demonstrating multiple bands in degenerate primer based nested RT-PCR.

    Science.gov (United States)

    Desingu, P A; Singh, S D; Dhama, K; Kumar, O R Vinodh; Singh, R; Singh, R K

    2015-02-01

    A rapid and accurate method of detection and differentiation of virulent and avirulent Newcastle disease virus (NDV) pathotypes was developed. The NDV detection was carried out for different domestic avian field isolates and pigeon paramyxo virus-1 (25 field isolates and 9 vaccine strains) by using APMV-I "fusion" (F) gene Class II specific external primer A and B (535bp), internal primer C and D (238bp) based reverses transcriptase PCR (RT-PCR). The internal degenerative reverse primer D is specific for F gene cleavage position of virulent strain of NDV. The nested RT-PCR products of avirulent strains showed two bands (535bp and 424bp) while virulent strains showed four bands (535bp, 424bp, 349bp and 238bp) on agar gel electrophoresis. This is the first report regarding development and use of degenerate primer based nested RT-PCR for accurate detection and differentiation of NDV pathotypes by demonstrating multiple PCR band patterns. Being a rapid, simple, and economical test, the developed method could serve as a valuable alternate diagnostic tool for characterizing NDV isolates and carrying out molecular epidemiological surveillance studies for this important pathogen of poultry. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. Degenerate primer MOB typing of multiresistant clinical isolates of E. coli uncovers new plasmid backbones.

    Science.gov (United States)

    Garcillán-Barcia, M Pilar; Ruiz del Castillo, Belén; Alvarado, Andrés; de la Cruz, Fernando; Martínez-Martínez, Luis

    2015-01-01

    Degenerate Primer MOB Typing is a PCR-based protocol for the classification of γ-proteobacterial transmissible plasmids in five phylogenetic relaxase MOB families. It was applied to a multiresistant E. coli collection, previously characterized by PCR-based replicon-typing, in order to compare both methods. Plasmids from 32 clinical isolates of multiresistant E. coli (19 extended spectrum beta-lactamase producers and 13 non producers) and their transconjugants were analyzed. A total of 95 relaxases were detected, at least one per isolate, underscoring the high potential of these strains for antibiotic-resistance transmission. MOBP12 and MOBF12 plasmids were the most abundant. Most MOB subfamilies detected were present in both subsets of the collection, indicating a shared mobilome among multiresistant E. coli. The plasmid profile obtained by both methods was compared, which provided useful data upon which decisions related to the implementation of detection methods in the clinic could be based. The phylogenetic depth at which replicon and MOB-typing classify plasmids is different. While replicon-typing aims at plasmid replication regions with non-degenerate primers, MOB-typing classifies plasmids into relaxase subfamilies using degenerate primers. As a result, MOB-typing provides a deeper phylogenetic depth than replicon-typing and new plasmid groups are uncovered. Significantly, MOB typing identified 17 plasmids and an integrative and conjugative element, which were not detected by replicon-typing. Four of these backbones were different from previously reported elements. Copyright © 2014 Elsevier Inc. All rights reserved.

  4. Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing

    Directory of Open Access Journals (Sweden)

    Li Kelvin

    2012-11-01

    Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus

  5. De-MetaST-BLAST: a tool for the validation of degenerate primer sets and data mining of publicly available metagenomes.

    Directory of Open Access Journals (Sweden)

    Christopher A Gulvik

    Full Text Available Development and use of primer sets to amplify nucleic acid sequences of interest is fundamental to studies spanning many life science disciplines. As such, the validation of primer sets is essential. Several computer programs have been created to aid in the initial selection of primer sequences that may or may not require multiple nucleotide combinations (i.e., degeneracies. Conversely, validation of primer specificity has remained largely unchanged for several decades, and there are currently few available programs that allows for an evaluation of primers containing degenerate nucleotide bases. To alleviate this gap, we developed the program De-MetaST that performs an in silico amplification using user defined nucleotide sequence dataset(s and primer sequences that may contain degenerate bases. The program returns an output file that contains the in silico amplicons. When De-MetaST is paired with NCBI's BLAST (De-MetaST-BLAST, the program also returns the top 10 nr NCBI database hits for each recovered in silico amplicon. While the original motivation for development of this search tool was degenerate primer validation using the wealth of nucleotide sequences available in environmental metagenome and metatranscriptome databases, this search tool has potential utility in many data mining applications.

  6. [Development of specific and degenerated primers to CesA genes encoding flax (Linum usitatissimum L.) cellulose synthase].

    Science.gov (United States)

    Grushetskaia, Z E; Lemesh, V A; Khotyleva, L V

    2010-01-01

    Cellulose synthase catalytic subunit genes, CesA, have been discovered in several higher plant species, and it has been shown that the CesA gene family has multiple members. HVR2 fragment of these genes determine the class specificity of the CESA protein and its participation in the primary or secondary cell wall synthesis. The aim of this study was development of specific and degenerated primers to flax CesA gene fragments leading to obtaining the class specific HVR2 region of the gene. Two pairs of specific primers to the certain fragments of CesA-1 and CesA-6 genes and one pair of degenerated primers to HVR2 region of all flax CesA genes were developed basing on comparison of six CesA EST sequences of flax and full cDNA sequences of Arabidopsis, poplar, maize and cotton plants, obtained from GenBank. After amplification of flax cDNA, the bands of expected size were detected (201 and 300 b.p. for the CesA-1 and CesA-6, and 600 b.p. for the HVR2 region of CesA respectively). The developed markers can be used for cloning and sequencing of flax CesA genes, identifying their number in flax genome, tissue and stage specificity.

  7. Development of degenerate and species-specific primers for the differential and simultaneous RT-PCR detection of grapevine-infecting nepoviruses of subgroups A, B and C.

    Science.gov (United States)

    Digiaro, Michele; Elbeaino, Toufic; Martelli, Giovanni Paolo

    2007-04-01

    Based on the nucleotide sequence homology of RNA-1 and RNA-2 of nepoviruses isolated from grapevines, three sets of degenerate primers, one for each of the three subgroups of the genus (A, B and C), were designed and proved effective for RT-PCR detection of subgroups in infected grapevines and herbaceous hosts. Primers designed specifically for detecting subgroup A species amplified a fragment of 255 bp from samples infected by Grapevine fanleaf virus (GFLV), Arabis mosaic virus (ArMV), Tobacco ringspot virus (TRSV) and Grapevine deformation virus (GDefV), but not from samples infected by other nepovirus species. Similarly, primers for detection of subgroup B nepoviruses amplified a 390 bp product from samples infected by Grapevine chrome mosaic virus (GCMV), Tomato black ring virus (TBRV), Grapevine Anatolian ringspot virus (GARSV) and Artichoke Italian latent virus (AILV). The third set of primers amplified a 640 bp fragment, only from samples infected by subgroup C nepoviruses, i.e Tomato ringspot virus (ToRSV) Grapevine Bulgarian latent virus (GBLV), and Grapevine Tunisian ringspot virus (GTRSV). These primers were able to detect simultaneously all viral species belonging to the same subgroup and to discriminate species of different subgroups. Multiplex-PCR detection of subgroup A and B nepoviruses was obtained using a specific primer (sense for subgroup A and antisense for subgroup B) for each of the species of the same subgroup in combination with the degenerate subgroup-specific primers. In this way it was possible to detect four different viral species in single samples containing mixtures of viruses of the same subgroup. In particular, for viruses of subgroup A (TRSV, GFLV, ArMV and GDefV) amplicons of 190, 259, 301 and 371 bp were obtained, whereas amplicons of 190, 278, 425 and 485 bp, respectively, were obtained from samples infected with viruses of subgroup B (GCMV, AILV, GARSV and TBRV).

  8. A degenerate primer MOB typing (DPMT method to classify gamma-proteobacterial plasmids in clinical and environmental settings.

    Directory of Open Access Journals (Sweden)

    Andrés Alvarado

    Full Text Available Transmissible plasmids are responsible for the spread of genetic determinants, such as antibiotic resistance or virulence traits, causing a large ecological and epidemiological impact. Transmissible plasmids, either conjugative or mobilizable, have in common the presence of a relaxase gene. Relaxases were previously classified in six protein families according to their phylogeny. Degenerate primers hybridizing to coding sequences of conserved amino acid motifs were designed to amplify related relaxase genes from γ-Proteobacterial plasmids. Specificity and sensitivity of a selected set of 19 primer pairs were first tested using a collection of 33 reference relaxases, representing the diversity of γ-Proteobacterial plasmids. The validated set was then applied to the analysis of two plasmid collections obtained from clinical isolates. The relaxase screening method, which we call "Degenerate Primer MOB Typing" or DPMT, detected not only most known Inc/Rep groups, but also a plethora of plasmids not previously assigned to any Inc group or Rep-type.

  9. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

    Directory of Open Access Journals (Sweden)

    Nomin Batnyam

    2012-01-01

    Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.

  10. Resistance gene candidates identified by PCR with degenerate oligonucleotide primers map to clusters of resistance genes in lettuce.

    Science.gov (United States)

    Shen, K A; Meyers, B C; Islam-Faridi, M N; Chin, D B; Stelly, D M; Michelmore, R W

    1998-08-01

    The recent cloning of genes for resistance against diverse pathogens from a variety of plants has revealed that many share conserved sequence motifs. This provides the possibility of isolating numerous additional resistance genes by polymerase chain reaction (PCR) with degenerate oligonucleotide primers. We amplified resistance gene candidates (RGCs) from lettuce with multiple combinations of primers with low degeneracy designed from motifs in the nucleotide binding sites (NBSs) of RPS2 of Arabidopsis thaliana and N of tobacco. Genomic DNA, cDNA, and bacterial artificial chromosome (BAC) clones were successfully used as templates. Four families of sequences were identified that had the same similarity to each other as to resistance genes from other species. The relationship of the amplified products to resistance genes was evaluated by several sequence and genetic criteria. The amplified products contained open reading frames with additional sequences characteristic of NBSs. Hybridization of RGCs to genomic DNA and to BAC clones revealed large numbers of related sequences. Genetic analysis demonstrated the existence of clustered multigene families for each of the four RGC sequences. This parallels classical genetic data on clustering of disease resistance genes. Two of the four families mapped to known clusters of resistance genes; these two families were therefore studied in greater detail. Additional evidence that these RGCs could be resistance genes was gained by the identification of leucine-rich repeat (LRR) regions in sequences adjoining the NBS similar to those in RPM1 and RPS2 of A. thaliana. Fluorescent in situ hybridization confirmed the clustered genomic distribution of these sequences. The use of PCR with degenerate oligonucleotide primers is therefore an efficient method to identify numerous RGCs in plants.

  11. A Two-Step Lyssavirus Real-Time Polymerase Chain Reaction Using Degenerate Primers with Superior Sensitivity to the Fluorescent Antigen Test

    Directory of Open Access Journals (Sweden)

    Vanessa Suin

    2014-01-01

    Full Text Available A generic two-step lyssavirus real-time reverse transcriptase polymerase chain reaction (qRT-PCR, based on a nested PCR strategy, was validated for the detection of different lyssavirus species. Primers with 17 to 30% of degenerate bases were used in both consecutive steps. The assay could accurately detect RABV, LBV, MOKV, DUVV, EBLV-1, EBLV-2, and ABLV. In silico sequence alignment showed a functional match with the remaining lyssavirus species. The diagnostic specificity was 100% and the sensitivity proved to be superior to that of the fluorescent antigen test. The limit of detection was ≤1 50% tissue culture infectious dose. The related vesicular stomatitis virus was not recognized, confirming the selectivity for lyssaviruses. The assay was applied to follow the evolution of rabies virus infection in the brain of mice from 0 to 10 days after intranasal inoculation. The obtained RNA curve corresponded well with the curves obtained by a one-step monospecific RABV-qRT-PCR, the fluorescent antigen test, and virus titration. Despite the presence of degenerate bases, the assay proved to be highly sensitive, specific, and reproducible.

  12. A two-step lyssavirus real-time polymerase chain reaction using degenerate primers with superior sensitivity to the fluorescent antigen test.

    Science.gov (United States)

    Suin, Vanessa; Nazé, Florence; Francart, Aurélie; Lamoral, Sophie; De Craeye, Stéphane; Kalai, Michael; Van Gucht, Steven

    2014-01-01

    A generic two-step lyssavirus real-time reverse transcriptase polymerase chain reaction (qRT-PCR), based on a nested PCR strategy, was validated for the detection of different lyssavirus species. Primers with 17 to 30% of degenerate bases were used in both consecutive steps. The assay could accurately detect RABV, LBV, MOKV, DUVV, EBLV-1, EBLV-2, and ABLV. In silico sequence alignment showed a functional match with the remaining lyssavirus species. The diagnostic specificity was 100% and the sensitivity proved to be superior to that of the fluorescent antigen test. The limit of detection was ≤ 1 50% tissue culture infectious dose. The related vesicular stomatitis virus was not recognized, confirming the selectivity for lyssaviruses. The assay was applied to follow the evolution of rabies virus infection in the brain of mice from 0 to 10 days after intranasal inoculation. The obtained RNA curve corresponded well with the curves obtained by a one-step monospecific RABV-qRT-PCR, the fluorescent antigen test, and virus titration. Despite the presence of degenerate bases, the assay proved to be highly sensitive, specific, and reproducible.

  13. Gene Isolation Using Degenerate Primers Targeting Protein Motif: A Laboratory Exercise

    Science.gov (United States)

    Yeo, Brandon Pei Hui; Foong, Lian Chee; Tam, Sheh May; Lee, Vivian; Hwang, Siaw San

    2018-01-01

    Structures and functions of protein motifs are widely included in many biology-based course syllabi. However, little emphasis is placed to link this knowledge to applications in biotechnology to enhance the learning experience. Here, the conserved motifs of nucleotide binding site-leucine rich repeats (NBS-LRR) proteins, successfully used for the…

  14. Diversity of reductive dehalogenase genes from environmental samples and enrichment cultures identified with degenerate primer PCR screens.

    Directory of Open Access Journals (Sweden)

    Laura Audrey Hug

    2013-11-01

    Full Text Available Reductive dehalogenases are the critical enzymes for anaerobic organohalide respiration, a microbial metabolic process that has been harnessed for bioremediation efforts to resolve chlorinated solvent contamination in groundwater and is implicated in the global halogen cycle. Reductive dehalogenase sequence diversity is informative for the dechlorination potential of the site or enrichment culture. A suite of degenerate PCR primers targeting a comprehensive curated set of reductive dehalogenase genes was designed and applied to twelve DNA samples extracted from contaminated and pristine sites, as well as six enrichment cultures capable of reducing chlorinated compounds to non-toxic end-products. The amplified gene products from four environmental sites and two enrichment cultures were sequenced using Illumina HiSeq, and the reductive dehalogenase complement of each sample determined. The results indicate that the diversity of the reductive dehalogenase gene family is much deeper than is currently accounted for: one-third of the translated proteins have less than 70% pairwise amino acid identity to database sequences. Approximately 60% of the sequenced reductive dehalogenase genes were broadly distributed, being identified in four or more samples, and often in previously sequenced genomes as well. In contrast, 17% of the sequenced reductive dehalogenases were unique, present in only a single sample and bearing less than 90% pairwise amino acid identity to any previously identified proteins. Many of the broadly distributed reductive dehalogenases are uncharacterized in terms of their substrate specificity, making these intriguing targets for further biochemical experimentation. Finally, comparison of samples from a contaminated site and an enrichment culture derived from the same site eight years prior allowed examination of the effect of the enrichment process.

  15. VizPrimer: a web server for visualized PCR primer design based on known gene structure.

    Science.gov (United States)

    Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

    2011-12-15

    The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.

  16. Cycle-Based Budgeting Toolkit: A Primer

    Science.gov (United States)

    Yan, Bo

    2016-01-01

    At the core, budgeting is about distributing and redistributing limited financial resources for continuous improvement. Incremental budgeting is limited in achieving the goal due to lack of connection between outcomes and budget decisions. Zero-based budgeting fills the gap, but is cumbersome to implement, especially for large urban school…

  17. Detection and identification of Toscana and other phleboviruses by RT-nested-PCR assays with degenerated primers.

    Science.gov (United States)

    Sánchez-Seco, María-Paz; Echevarría, José-Manuel; Hernández, Lourdes; Estévez, Domingo; Navarro-Marí, José-María; Tenorio, Antonio

    2003-09-01

    Phleboviruses are a large and widespread group of viruses that are transmitted by arthropods. Toscana virus is one of the principal agents that causes meningitis in humans during the summer in Italy and, possibly, in other Mediterranean countries. Rift Valley Fever virus can cause serious illness in both animals and humans, leading to high morbidity and mortality, and is considered to be a potential agent for epizootics and human epidemics. Since information on this group of viruses is still scant, reliable laboratory tools for diagnosis and epidemiological surveillance must be developed, in order to ascertain their real impact on Public Health. Sequence data obtained from Spanish isolates of Toscana virus and other phleboviruses confirmed that natural genome variability may hamper the diagnosis of these agents by molecular methods, so this must be borne in mind when developing reliable assays. In view of the above, a novel and useful protocol has been developed for the detection and specific identification of every member of the phlebovirus genus present in a sample, including Toscana virus, based on a generic RT-nested-PCR, followed by sequencing of the amplified fragment. A change in this method also allowed specific direct detection and identification of wild isolates of Toscana virus of different geographical origin, using newly designed primers. Testing clinical samples with these assays confirmed the role of Toscana virus as an agent that causes acute aseptic meningitis in the central region of Spain. Copyright 2003 Wiley-Liss, Inc.

  18. Chromosome copy analysis by single-cell comparative genomic hybridization technique based on primer extension preamplification and degenerate oligonucleotide primed-PCR%引物延伸预扩增结合简并引物PCR在单细胞比较基因组杂交分析染色体异常中的应用

    Institute of Scientific and Technical Information of China (English)

    谭珂; 狄玉芬; 程德华; 徐芳; 卢光绣; 谭跃球

    2010-01-01

    Objective To establish a single-cell whole genome amplification (WGA) technique, in combination with comparative genomic hybridization (CGH), for analyzing chromosomal copy number changes, and to explore its clinical application in preimplantation genetic diagnosis (PGD). Methods Twelve single cell samples with known karyotypes, including 5 chorionic villus samples, 4 human embryonic stem cell (hESC) samples and 3 peripheral lymphocyte samples, and 4 single blastomere samples carrying chromosomal abnormalities detected by PGD, were collected for whole genome amplification by combining primer extension preamplification (PEP) with degenerate oligonucleotide primed-PCR (DOP-PCR)amplification. The amplified products labeled by red fluorescence were mixed with control DNA labeled by green fluorescence, and then the mixture was analyzed by CGH. As a comparison, 10 single cell samples were amplified by DOP-PCR only and then CGH analysis was performed. Results The amplification using PEP-DOP-PCR was more stable than traditional DOP-PCR. The products of PEP-DOP-PCR range from 100 bp to 1000 bp, with the mean size being about 400 bp. The CGH results were consistent with analyses by other methods. However, only 6 out of 10 single cell samples were successfully amplified by DOP-PCR,and CGH analysis showed a high background and 2 samples showed inconsistent results from other methods. Conclusion PEP-DOP-PCR can effectively amplify the whole genome DNA of single cell.Combined with CGH, this WGA method can successfully detect single-cell chromosomal copy number changes, while DOP-PCR was easy to fail to amplify and amplify inhomogeneousty, and CGH analysis using this PCR product usually showed high background. These results suggest that PEP-DOP-CGH is a promising method for preimplantation genetic diagnosis.%目的 建立一种可信的单细胞全基因组扩增(whole genome amplification.WGA)技术,结合比较基因组杂交(comparative genomic hybridization,CGH)分析单细

  19. Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

    Science.gov (United States)

    Cheng, Yu-Huei

    2014-12-01

    Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

  20. MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling

    Directory of Open Access Journals (Sweden)

    Kitchen James L

    2012-11-01

    Full Text Available Abstract Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  1. MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.

    Science.gov (United States)

    Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G

    2012-11-05

    Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  2. Value-based medicine and interventions for macular degeneration.

    Science.gov (United States)

    Brown, Melissa M; Brown, Gary C; Brown, Heidi

    2007-05-01

    The aim of this article is to review the patient value conferred by interventions for neovascular macular degeneration. Value-based medicine is the practice of medicine based upon the patient value (improvement in quality of life and length of life) conferred by an intervention. For ophthalmologic interventions, in which length-of-life is generally unaffected, the value gain is equivalent to the improvement in quality of life. Photodynamic therapy delivers a value gain (improvement in quality of life) of 8.1% for the average person with classic subfoveal choroidal neovascularization, while laser photocoagulation for the same entity confers a 4.4% improvement in quality of life. Preliminary data suggest the value gain for the treatment of occult/minimally classic choroidal neovascularization with ranibizumab is greater than 15%. The average value gain for statins for the treatment of hyperlipidemia is 3.9%, while that for the use of biphosphonates for the treatment of osteoporosis is 1.1% and that for drugs to treat benign prostatic hyperplasia is 1-2%. Interventions, especially ranibizumab therapy, for neovascular macular degeneration appear to deliver an extraordinary degree of value compared with many other interventions across healthcare.

  3. A primer on polymer nomenclature: Structure-based, sourced-based and trade names

    Science.gov (United States)

    Polymer nomenclature is important because it is part of the language of polymer science and is needed for polymer identification, reference, and documentation. A primer on polymer nomenclature is provided herein for people new to the field or for instructional use. Both structure-based and source-...

  4. Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.

    Science.gov (United States)

    Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong

    2014-08-01

    The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. Copyright © 2014 Elsevier Ltd. All rights reserved.

  5. PRIMEGENSw3: a web-based tool for high-throughput primer and probe design.

    Science.gov (United States)

    Kushwaha, Garima; Srivastava, Gyan Prakash; Xu, Dong

    2015-01-01

    Highly specific and efficient primer and probe design has been a major hurdle in many high-throughput techniques. Successful implementation of any PCR or probe hybridization technique depends on the quality of primers and probes used in terms of their specificity and cross-hybridization. Here we describe PRIMEGENSw3, a set of web-based utilities for high-throughput primer and probe design. These utilities allow users to select genomic regions and to design primer/probe for selected regions in an interactive, user-friendly, and automatic fashion. The system runs the PRIMEGENS algorithm in the back-end on the high-performance server with the stored genomic database or user-provided custom database for cross-hybridization check. Cross-hybridization is checked not only using BLAST but also by checking mismatch positions and energy calculation of potential hybridization hits. The results can be visualized online and also can be downloaded. The average success rate of primer design using PRIMEGENSw3 is ~90 %. The web server also supports primer design for methylated sequences, which is used in epigenetic studies. Stand-alone version of the software is also available for download at the website.

  6. Typing of multiple single-nucleotide polymorphisms using ribonuclease cleavage of DNA/RNA chimeric single-base extension primers and detection by MALDI-TOF mass spectrometry

    DEFF Research Database (Denmark)

    Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus

    2005-01-01

    A novel single-base extension (SBE) assay using cleavable and noncleavable SBE primers in the same reaction mix is described. The cleavable SBE primers consisted of deoxyribonucleotides and one ribonucleotide (hereafter denoted chimeric primers), whereas the noncleavable SBE primers consisted....... A ribonuclease mix was developed to specifically cleave the chimeric primers, irrespective of the base of the ribonucleotide, whereas standard primers without a ribonucleotide were unaffected by the ribonuclease treatment. The SBE products were analyzed in linear mode using a matrix-assisted laser desorption...... containing 9 chimeric primers and 8 standard primers....

  7. Multicolor-based discrimination of 21 short tandem repeats and amelogenin using four fluorescent universal primers.

    Science.gov (United States)

    Asari, Masaru; Okuda, Katsuhiro; Hoshina, Chisato; Omura, Tomohiro; Tasaki, Yoshikazu; Shiono, Hiroshi; Matsubara, Kazuo; Shimizu, Keiko

    2016-02-01

    The aim of this study was to develop a cost-effective genotyping method using high-quality DNA for human identification. A total of 21 short tandem repeats (STRs) and amelogenin were selected, and fluorescent fragments at 22 loci were simultaneously amplified in a single-tube reaction using locus-specific primers with 24-base universal tails and four fluorescent universal primers. Several nucleotide substitutions in universal tails and fluorescent universal primers enabled the detection of specific fluorescent fragments from the 22 loci. Multiplex polymerase chain reaction (PCR) produced intense FAM-, VIC-, NED-, and PET-labeled fragments ranging from 90 to 400 bp, and these fragments were discriminated using standard capillary electrophoretic analysis. The selected 22 loci were also analyzed using two commercial kits (the AmpFLSTR Identifiler Kit and the PowerPlex ESX 17 System), and results for two loci (D19S433 and D16S539) were discordant between these kits due to mutations at the primer binding sites. All genotypes from the 100 samples were determined using 2.5 ng of DNA by our method, and the expected alleles were completely recovered. Multiplex 22-locus genotyping using four fluorescent universal primers effectively reduces the costs to less than 20% of genotyping using commercial kits, and our method would be useful to detect silent alleles from commercial kit analysis. Copyright © 2015 Elsevier Inc. All rights reserved.

  8. A Web-Based Adaptive Tutor to Teach PCR Primer Design

    Science.gov (United States)

    van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.

    2012-01-01

    When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used part of the Taxonomy of Educational Objectives (the…

  9. A web-based adaptive tutor to teach PCR primer design

    NARCIS (Netherlands)

    van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.

    2012-01-01

    When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used

  10. A Web-based Adaptive Tutor to Teach PCR Primer Design

    NARCIS (Netherlands)

    Seters, van J.R.; Wellink, J.; Tramper, J.; Goedhart, M.J.; Ossevoort, M.A.

    2012-01-01

    When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used

  11. Magnesium-Based Sacrificial Anode Cathodic Protection Coatings (Mg-Rich Primers for Aluminum Alloys

    Directory of Open Access Journals (Sweden)

    Michael D. Blanton

    2012-09-01

    Full Text Available Magnesium is electrochemically the most active metal employed in common structural alloys of iron and aluminum. Mg is widely used as a sacrificial anode to provide cathodic protection of underground and undersea metallic structures, ships, submarines, bridges, decks, aircraft and ground transportation systems. Following the same principle of utilizing Mg characteristics in engineering advantages in a decade-long successful R&D effort, Mg powder is now employed in organic coatings (termed as Mg-rich primers as a sacrificial anode pigment to protect aerospace grade aluminum alloys against corrosion. Mg-rich primers have performed very well on aluminum alloys when compared against the current chromate standard, but the carcinogenic chromate-based coatings/pretreatments are being widely used by the Department of Defense (DoD to protect its infrastructure and fleets against corrosion damage. Factors such as reactivity of Mg particles in the coating matrix during exposure to aggressive corrosion environments, interaction of atmospheric gases with Mg particles and the impact of Mg dissolution, increases in pH and hydrogen gas liberation at coating-metal interface, and primer adhesion need to be considered for further development of Mg-rich primer technology.

  12. Degenerated-Inverse-Matrix-Based Channel Estimation for OFDM Systems

    Directory of Open Access Journals (Sweden)

    Makoto Yoshida

    2009-01-01

    Full Text Available This paper addresses time-domain channel estimation for pilot-symbol-aided orthogonal frequency division multiplexing (OFDM systems. By using a cyclic sinc-function matrix uniquely determined by Nc transmitted subcarriers, the performance of our proposed scheme approaches perfect channel state information (CSI, within a maximum of 0.4 dB degradation, regardless of the delay spread of the channel, Doppler frequency, and subcarrier modulation. Furthermore, reducing the matrix size by splitting the dispersive channel impulse response into clusters means that the degenerated inverse matrix estimator (DIME is feasible for broadband, high-quality OFDM transmission systems. In addition to theoretical analysis on normalized mean squared error (NMSE performance of DIME, computer simulations over realistic nonsample spaced channels also showed that the DIME is robust for intersymbol interference (ISI channels and fast time-invariant channels where a minimum mean squared error (MMSE estimator does not work well.

  13. Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

    International Nuclear Information System (INIS)

    Zhan Fangfang; Zhou Xiaoming; Xing Da

    2013-01-01

    Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs–TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: ► A novel method for detection of rotavirus has been developed. ► In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. ► To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. ► The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2′-bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs–TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection. In this study, rotavirus in fecal specimens was successfully detected within 1.5 h. Experimental

  14. Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Zhan Fangfang; Zhou Xiaoming [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China); Xing Da, E-mail: xingda@scnu.edu.cn [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China)

    2013-01-25

    Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs-TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: Black-Right-Pointing-Pointer A novel method for detection of rotavirus has been developed. Black-Right-Pointing-Pointer In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. Black-Right-Pointing-Pointer To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. Black-Right-Pointing-Pointer The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2 Prime -bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs-TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection

  15. Computational Principle and Performance Evaluation of Coherent Ising Machine Based on Degenerate Optical Parametric Oscillator Network

    Directory of Open Access Journals (Sweden)

    Yoshitaka Haribara

    2016-04-01

    Full Text Available We present the operational principle of a coherent Ising machine (CIM based on a degenerate optical parametric oscillator (DOPO network. A quantum theory of CIM is formulated, and the computational ability of CIM is evaluated by numerical simulation based on c-number stochastic differential equations. We also discuss the advanced CIM with quantum measurement-feedback control and various problems which can be solved by CIM.

  16. Nanotechnology-based drug delivery treatments and specific targeting therapy for age-related macular degeneration

    Directory of Open Access Journals (Sweden)

    Tai-Chi Lin

    2015-11-01

    Full Text Available Nanoparticles combined with cells, drugs, and specially designed genes provide improved therapeutic efficacy in studies and clinical setting, demonstrating a new era of treatment strategy, especially in retinal diseases. Nanotechnology-based drugs can provide an essential platform for sustaining, releasing and a specific targeting design to treat retinal diseases. Poly-lactic-co-glycolic acid is the most widely used biocompatible and biodegradable polymer approved by the Food and Drug Administration. Many studies have attempted to develop special devices for delivering small-molecule drugs, proteins, and other macromolecules consistently and slowly. In this article, we first review current progress in the treatment of age-related macular degeneration. Then, we discuss the function of vascular endothelial growth factor (VEGF and the pharmacological effects of anti-VEGF-A antibodies and soluble or modified VEGF receptors. Lastly, we summarize the combination of antiangiogenic therapy and nanomedicines, and review current potential targeting therapy in age-related macular degeneration.

  17. Universal primers that amplify RNA from all three flavivirus subgroups

    Directory of Open Access Journals (Sweden)

    Barnard Ross T

    2008-01-01

    Full Text Available Abstract Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5 coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers.

  18. Broadband Polarization-Insensitive Wavelength Conversion Based on Non-Degenerate Four-Wave Mixing in a Silicon Nanowire

    DEFF Research Database (Denmark)

    Pu, Minhao; Hu, Hao; Ji, Hua

    2012-01-01

    We experimentally demonstrate broadband polarization-insensitive one-to-two wavelength conversion of a 10-Gb/s DPSK data signal based on non-degenerate four-wave mixing in a silicon nanowire with bit-error rate measurements.......We experimentally demonstrate broadband polarization-insensitive one-to-two wavelength conversion of a 10-Gb/s DPSK data signal based on non-degenerate four-wave mixing in a silicon nanowire with bit-error rate measurements....

  19. Conserved PCR primer set designing for closely-related species to complete mitochondrial genome sequencing using a sliding window-based PSO algorithm.

    Directory of Open Access Journals (Sweden)

    Cheng-Hong Yang

    Full Text Available BACKGROUND: Complete mitochondrial (mt genome sequencing is becoming increasingly common for phylogenetic reconstruction and as a model for genome evolution. For long template sequencing, i.e., like the entire mtDNA, it is essential to design primers for Polymerase Chain Reaction (PCR amplicons which are partly overlapping each other. The presented chromosome walking strategy provides the overlapping design to solve the problem for unreliable sequencing data at the 5' end and provides the effective sequencing. However, current algorithms and tools are mostly focused on the primer design for a local region in the genomic sequence. Accordingly, it is still challenging to provide the primer sets for the entire mtDNA. METHODOLOGY/PRINCIPAL FINDINGS: The purpose of this study is to develop an integrated primer design algorithm for entire mt genome in general, and for the common primer sets for closely-related species in particular. We introduce ClustalW to generate the multiple sequence alignment needed to find the conserved sequences in closely-related species. These conserved sequences are suitable for designing the common primers for the entire mtDNA. Using a heuristic algorithm particle swarm optimization (PSO, all the designed primers were computationally validated to fit the common primer design constraints, such as the melting temperature, primer length and GC content, PCR product length, secondary structure, specificity, and terminal limitation. The overlap requirement for PCR amplicons in the entire mtDNA is satisfied by defining the overlapping region with the sliding window technology. Finally, primer sets were designed within the overlapping region. The primer sets for the entire mtDNA sequences were successfully demonstrated in the example of two closely-related fish species. The pseudo code for the primer design algorithm is provided. CONCLUSIONS/SIGNIFICANCE: In conclusion, it can be said that our proposed sliding window-based PSO

  20. Evaluation of intravertebral changes associated with the disk degeneration based on the MRI findings

    International Nuclear Information System (INIS)

    Saiki, Natoru

    2000-01-01

    The magnetic resonance images (MRI) of 441 vertebral bodies of the 199 patients with intravertebral abnormality associated with adjacent disk degeneration were evaluated according to the Modic classification and a new geographic classification. They were also evaluated in relation with the various factors including disk space narrowing, vacuum phenomenon, disk herniation, Schmorl's node, ostephyte formation and spondylolisthesis. The new geographic classification is based on the three factors; depth of invasion: stage 1 (thin layer along the end-plate), stage 2 (less than a half of the vertebral height) and stage 3 (more than a half of the vertebral height), shape: end-plate type, Schmorl's node type, triangle type, meniscus type and band type, location: front type, center type, rear type, front and rear type and whole type. Only about a half of the vertebral bodies with intervertebral abnormality showed bilateral invasion adjacent to the degenerative disks on both sides and the superior edges were much more frequently involved than the inferior ones. There was relatively higher incidence (7%) of Modic Type I degeneration defined as high signal intensity (HSI) on T2 weighted spin-echo images (T2WI) and low signal intensity (LSI) on T1 weighted spin-echo images (T1WI) representing vascularized fibrous tissue than those previously reported. On the other hand there was relatively lower incidence (5%) of Modic Type II degeneration defined as high or iso intensity on T1WI and HSI on T2WI. Triangle front type was seen in almost a half of the vertebrae in stage 2 and stage 3, and the rest was divided into meniscus type and band type almost evenly. The end plate front type must be a precursor of the triangle front type. The Schmorl's node type was considered to be a precursor of the meniscus type as well as band type in some but many must stay in its form transformed to Type II degeneration. In general, the intravertebral abnormality may not be necessary to be progressive

  1. A value-based medicine comparison of interventions for subfoveal neovascular macular degeneration.

    Science.gov (United States)

    Brown, Gary C; Brown, Melissa M; Brown, Heidi C; Kindermann, Sylvia; Sharma, Sanjay

    2007-06-01

    To perform a value-based medicine analysis of clinical trials that evaluate the interventions of laser photocoagulation, intravitreal pegaptanib therapy, and photodynamic therapy (PDT) with verteporfin for the treatment of classic subfoveal choroidal neovascularization. Reference case cost-utility analysis using value-based medicine principles, which use patient-based utility values and standardized, input variable criteria. Data from participants in the Macular Photocoagulation Study, Pegaptanib for Neovascular Age-Related Macular Degeneration Study, and the Treatment of Age-Related Macular Degeneration with Photodynamic Therapy Study. Visual data were converted to a value-based format using time tradeoff utility analysis values from patients with macular degeneration. Costs were obtained from 2005 Medicare data. Outcomes (quality-adjusted life-years [QALYs]) and costs were discounted at a 3% annual rate. Interventional QALYs gained, percent improvement in quality of life, and dollars spent per QALY gained. Laser photocoagulation confers a 4.4% (P = 0.03 versus pegaptanib therapy) improvement in quality of life for the reference case, whereas pegaptanib therapy confers a 5.9% improvement and PDT confers an 8.1% (P = 0.0002 versus pegaptanib therapy) improvement. The cost-utility associated with laser photocoagulation is $8179, that for pegaptanib therapy is $66978, and that for PDT is $31544. All sensitivity analyses remain within the conventional standards of cost-effectiveness. Photodynamic therapy confers greater patient value than intravitreal pegaptanib therapy and laser photocoagulation for the treatment of classic subfoveal choroidal neovascularization. Despite the fact that laser photocoagulation is the most cost-effective intervention, both PDT and pegaptanib therapy deliver greater value, and thus are both preferred over laser photocoagulation. Using an economic measure, photodynamic therapy is the preferred treatment among these 3 interventions.

  2. Development of Prevotella intermedia-specific PCR primers based on the nucleotide sequences of a DNA probe Pig27.

    Science.gov (United States)

    Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki

    2011-03-01

    The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.

  3. THE GOAL OF VALUE-BASED MEDICINE ANALYSES: COMPARABILITY. THE CASE FOR NEOVASCULAR MACULAR DEGENERATION

    Science.gov (United States)

    Brown, Gary C.; Brown, Melissa M.; Brown, Heidi C.; Kindermann, Sylvia; Sharma, Sanjay

    2007-01-01

    Purpose To evaluate the comparability of articles in the peer-reviewed literature assessing the (1) patient value and (2) cost-utility (cost-effectiveness) associated with interventions for neovascular age-related macular degeneration (ARMD). Methods A search was performed in the National Library of Medicine database of 16 million peer-reviewed articles using the key words cost-utility, cost-effectiveness, value, verteporfin, pegaptanib, laser photocoagulation, ranibizumab, and therapy. All articles that used an outcome of quality-adjusted life-years (QALYs) were studied in regard to (1) percent improvement in quality of life, (2) utility methodology, (3) utility respondents, (4) types of costs included (eg, direct healthcare, direct nonhealthcare, indirect), (5) cost bases (eg, Medicare, National Health Service in the United Kingdom), and (6) study cost perspective (eg, government, societal, third-party insurer). To qualify as a value-based medicine analysis, the patient value had to be measured using the outcome of the QALYs conferred by respective interventions. As with value-based medicine analyses, patient-based time tradeoff utility analysis had to be utilized, patient utility respondents were necessary, and direct medical costs were used. Results Among 21 cost-utility analyses performed on interventions for neovascular macular degeneration, 15 (71%) met value-based medicine criteria. The 6 others (29%) were not comparable owing to (1) varying utility methodology, (2) varying utility respondents, (3) differing costs utilized, (4) differing cost bases, and (5) varying study perspectives. Among value-based medicine studies, laser photocoagulation confers a 4.4% value gain (improvement in quality of life) for the treatment of classic subfoveal choroidal neovascularization. Intravitreal pegaptanib confers a 5.9% value gain (improvement in quality of life) for classic, minimally classic, and occult subfoveal choroidal neovascularization, and photodynamic therapy

  4. The goal of value-based medicine analyses: comparability. The case for neovascular macular degeneration.

    Science.gov (United States)

    Brown, Gary C; Brown, Melissa M; Brown, Heidi C; Kindermann, Sylvia; Sharma, Sanjay

    2007-01-01

    To evaluate the comparability of articles in the peer-reviewed literature assessing the (1) patient value and (2) cost-utility (cost-effectiveness) associated with interventions for neovascular age-related macular degeneration (ARMD). A search was performed in the National Library of Medicine database of 16 million peer-reviewed articles using the key words cost-utility, cost-effectiveness, value, verteporfin, pegaptanib, laser photocoagulation, ranibizumab, and therapy. All articles that used an outcome of quality-adjusted life-years (QALYs) were studied in regard to (1) percent improvement in quality of life, (2) utility methodology, (3) utility respondents, (4) types of costs included (eg, direct healthcare, direct nonhealthcare, indirect), (5) cost bases (eg, Medicare, National Health Service in the United Kingdom), and (6) study cost perspective (eg, government, societal, third-party insurer). To qualify as a value-based medicine analysis, the patient value had to be measured using the outcome of the QALYs conferred by respective interventions. As with value-based medicine analyses, patient-based time tradeoff utility analysis had to be utilized, patient utility respondents were necessary, and direct medical costs were used. Among 21 cost-utility analyses performed on interventions for neovascular macular degeneration, 15 (71%) met value-based medicine criteria. The 6 others (29%) were not comparable owing to (1) varying utility methodology, (2) varying utility respondents, (3) differing costs utilized, (4) differing cost bases, and (5) varying study perspectives. Among value-based medicine studies, laser photocoagulation confers a 4.4% value gain (improvement in quality of life) for the treatment of classic subfoveal choroidal neovascularization. Intravitreal pegaptanib confers a 5.9% value gain (improvement in quality of life) for classic, minimally classic, and occult subfoveal choroidal neovascularization, and photodynamic therapy with verteporfin confers

  5. MethPrimer: designing primers for methylation PCRs.

    Science.gov (United States)

    Li, Long-Cheng; Dahiya, Rajvir

    2002-11-01

    DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.

  6. Molecular and cell-based therapies for muscle degenerations: a road under construction.

    Science.gov (United States)

    Berardi, Emanuele; Annibali, Daniela; Cassano, Marco; Crippa, Stefania; Sampaolesi, Maurilio

    2014-01-01

    Despite the advances achieved in understanding the molecular biology of muscle cells in the past decades, there is still need for effective treatments of muscular degeneration caused by muscular dystrophies and for counteracting the muscle wasting caused by cachexia or sarcopenia. The corticosteroid medications currently in use for dystrophic patients merely help to control the inflammatory state and only slightly delay the progression of the disease. Unfortunately, walkers and wheel chairs are the only options for such patients to maintain independence and walking capabilities until the respiratory muscles become weak and the mechanical ventilation is needed. On the other hand, myostatin inhibition, IL-6 antagonism and synthetic ghrelin administration are examples of promising treatments in cachexia animal models. In both dystrophies and cachectic syndrome the muscular degeneration is extremely relevant and the translational therapeutic attempts to find a possible cure are well defined. In particular, molecular-based therapies are common options to be explored in order to exploit beneficial treatments for cachexia, while gene/cell therapies are mostly used in the attempt to induce a substantial improvement of the dystrophic muscular phenotype. This review focuses on the description of the use of molecular administrations and gene/stem cell therapy to treat muscular degenerations. It reviews previous trials using cell delivery protocols in mice and patients starting with the use of donor myoblasts, outlining the likely causes for their poor results and briefly focusing on satellite cell studies that raise new hope. Then it proceeds to describe recently identified stem/progenitor cells, including pluripotent stem cells and in relationship to their ability to home within a dystrophic muscle and to differentiate into skeletal muscle cells. Different known features of various stem cells are compared in this perspective, and the few available examples of their use in

  7. Aag-initiated base excision repair drives alkylation-induced retinal degeneration in mice.

    Science.gov (United States)

    Meira, Lisiane B; Moroski-Erkul, Catherine A; Green, Stephanie L; Calvo, Jennifer A; Bronson, Roderick T; Shah, Dharini; Samson, Leona D

    2009-01-20

    Vision loss affects >3 million Americans and many more people worldwide. Although predisposing genes have been identified their link to known environmental factors is unclear. In wild-type animals DNA alkylating agents induce photoreceptor apoptosis and severe retinal degeneration. Alkylation-induced retinal degeneration is totally suppressed in the absence of the DNA repair protein alkyladenine DNA glycosylase (Aag) in both differentiating and postmitotic retinas. Moreover, transgenic expression of Aag activity restores the alkylation sensitivity of photoreceptors in Aag null animals. Aag heterozygotes display an intermediate level of retinal degeneration, demonstrating haploinsufficiency and underscoring that Aag expression confers a dominant retinal degeneration phenotype.

  8. Striatonigral Degeneration

    Science.gov (United States)

    ... See More About Research The NINDS supports and conducts research on disorders of the brain and nervous system such as striatonigral degeneration. This research ... Publications Definition Striatonigral ...

  9. Degenerate Quadtree Latitude/Longitude Grid Based on WGS-84 Ellipsoidal Facet

    Directory of Open Access Journals (Sweden)

    HU Bailin

    2016-12-01

    Full Text Available For the needs of digital earth development and solving many global problems, a new discrete global grid system-DQLLG (degenerate quadtree latitude/longitude grid was put forward, which was based on WGS-84 ellipsoidal facet. The hierarchical subdivision method, characteristics and grid column/row coordinate system were detailed. The Latitude/Longitude coordinate, area and side length of multi-resolution meshes on different subdivision levels were calculated. Then the changes of mesh areas and side lengths were analyzed and compared that with spherical DQLLG. The research indicates that the DQLLG had many excellent features:uniformity, hierarchy, consistency of direction, extensive data compatibility and so on. It has certain practicality for Global GIS in the future.

  10. Disclosing bias in bisulfite assay: MethPrimers underestimate high DNA methylation.

    Directory of Open Access Journals (Sweden)

    Andrea Fuso

    Full Text Available Discordant results obtained in bisulfite assays using MethPrimers (PCR primers designed using MethPrimer software or assuming that non-CpGs cytosines are non methylated versus primers insensitive to cytosine methylation lead us to hypothesize a technical bias. We therefore used the two kinds of primers to study different experimental models and methylation statuses. We demonstrated that MethPrimers negatively select hypermethylated DNA sequences in the PCR step of the bisulfite assay, resulting in CpG methylation underestimation and non-CpG methylation masking, failing to evidence differential methylation statuses. We also describe the characteristics of "Methylation-Insensitive Primers" (MIPs, having degenerated bases (G/A to cope with the uncertain C/U conversion. As CpG and non-CpG DNA methylation patterns are largely variable depending on the species, developmental stage, tissue and cell type, a variable extent of the bias is expected. The more the methylome is methylated, the greater is the extent of the bias, with a prevalent effect of non-CpG methylation. These findings suggest a revision of several DNA methylation patterns so far documented and also point out the necessity of applying unbiased analyses to the increasing number of epigenomic studies.

  11. TREHALOSE-BASED ADDITIVE IMPROVED INTER-PRIMER BINDING SITE REACTIONS FOR DNA ISOLATED FROM RECALCITRANT PLANTS

    Directory of Open Access Journals (Sweden)

    Veronika Lancíková

    2014-02-01

    Full Text Available Trehalose-based (TBT-PAR additive was tested in order to optimize PCR amplification for DNA isolated from recalcitrant plants. Retrotransposon-based inter-primer binding site reactions were significantly improved with TBT-PAR solution using genomic DNA isolated from flax (Linum usitatissimum L., genotypes Kyivskyi, Bethune grown in radio-contaminated and non-radioactive remediated Chernobyl experimental fields. Additionally, similar improvements were observed using 19 recalcitrant genotypes of maize (Zea mays L. and three genotypes of yacon (Smallanthus sonchifolius, Poepp. et Endl., genotypes PER05, ECU45, BOL22 grown in standard field conditions.

  12. China Energy Primer

    Energy Technology Data Exchange (ETDEWEB)

    Ni, Chun Chun

    2009-11-16

    Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

  13. [Non-pharmacologic therapy of age-related macular degeneration, based on the etiopathogenesis of the disease].

    Science.gov (United States)

    Fischer, Tamás

    2015-07-12

    It has a great therapeutic significance that the disorder of the vascular endothelium, which supplies the affected ocular structures, plays a major role in the development of age-related macular degeneration. Chronic inflammation is closely linked to diseases associated with endothelial dysfuncition and age-related macular degeneration is accompanied by a general inflammatory response. The vascular wall including those in chorioids may be activated by several repeated and/or prolonged mechanical, physical, chemical, microbiological, immunologic and genetic factors causing a protracted host defence response with a consequent vascular damage, which leads to age-related macular degeneration. Based on this concept, age-related macular degeneration is a local manifestation of the systemic vascular disease. This recognition should have therapeutic implications because restoration of endothelial dysfunction can stabilize the condition of chronic vascular disease including age-related macular degeneration, as well. Restoration of endothelial dysfunction by non-pharmacological or pharmacological interventions may prevent the development or improve endothelial dysfunction resulting in prevention or improvement of age-related macular degeneration. Non-pharmacological interventions which may have beneficial effect in endothelial dysfunction include (1) smoking cessation; (2) reduction of increased body weight; (3) adequate physical activity; (4) appropriate diet (a) proper dose of flavonoids, polyphenols and kurcumin; (b) omega-3 long-chain polyunsaturated fatty acids: docosahexaenoic acid and eicosapentaenoic acid; (c) carotenoids, lutein and zeaxanthins), (d) management of dietary glycemic index, (e) caloric restriction, and (5) elimination of stressful lifestyle. Non-pharmacological interventions should be preferable even if medicaments are also used for the treatment of endothelial dysfunction.

  14. Interventions for Age-Related Macular Degeneration: Are Practice Guidelines Based on Systematic Reviews?

    Science.gov (United States)

    Lindsley, Kristina; Li, Tianjing; Ssemanda, Elizabeth; Virgili, Gianni; Dickersin, Kay

    2016-04-01

    Are existing systematic reviews of interventions for age-related macular degeneration incorporated into clinical practice guidelines? High-quality systematic reviews should be used to underpin evidence-based clinical practice guidelines and clinical care. We examined the reliability of systematic reviews of interventions for age-related macular degeneration (AMD) and described the main findings of reliable reviews in relation to clinical practice guidelines. Eligible publications were systematic reviews of the effectiveness of treatment interventions for AMD. We searched a database of systematic reviews in eyes and vision without language or date restrictions; the database was up to date as of May 6, 2014. Two authors independently screened records for eligibility and abstracted and assessed the characteristics and methods of each review. We classified reviews as reliable when they reported eligibility criteria, comprehensive searches, methodologic quality of included studies, appropriate statistical methods for meta-analysis, and conclusions based on results. We mapped treatment recommendations from the American Academy of Ophthalmology (AAO) Preferred Practice Patterns (PPPs) for AMD to systematic reviews and citations of reliable systematic reviews to support each treatment recommendation. Of 1570 systematic reviews in our database, 47 met inclusion criteria; most targeted neovascular AMD and investigated anti-vascular endothelial growth factor (VEGF) interventions, dietary supplements, or photodynamic therapy. We classified 33 (70%) reviews as reliable. The quality of reporting varied, with criteria for reliable reporting met more often by Cochrane reviews and reviews whose authors disclosed conflicts of interest. Anti-VEGF agents and photodynamic therapy were the only interventions identified as effective by reliable reviews. Of 35 treatment recommendations extracted from the PPPs, 15 could have been supported with reliable systematic reviews; however, only 1

  15. The Influence of No-Primer Adhesives and Anchor Pylons Bracket Bases on Shear Bond Strength of Orthodontic Brackets

    Directory of Open Access Journals (Sweden)

    Andrea Scribante

    2013-01-01

    Full Text Available Objective. The aim of this study was to compare the shear bond strength (SBS and adhesive remnant index (ARI scores of no-primer adhesives tested with two different bracket bases. Materials and Methods. 120 bovine permanent mandibular incisors were divided into 6 groups of 20 specimens. Two brackets (ODP with different bracket bases (anchor pylons and 80-gauge mesh were bonded to the teeth using a conventional adhesive (Transbond XT and two different no-primer adhesive (Ortho Cem; Heliosit systems. Groups were tested using an instron universal testing machine. SBS values were recorded. ARI scores were measured. SEM microphotographs were taken to evaluate the pattern of bracket bases. Statistical analysis was performed. ANOVA and Tukey tests were carried out for SBS values, whereas a chi-squared test was applied for ARI scores. Results. Highest bond strength values were reported with Transbond XT (with both pad designs, Ortho Cem bonded on anchor pylons and Heliosit on 80-gauge mesh. A higher frequency of ARI score of “3” was reported for Transbond XT groups. Other groups showed a higher frequency of ARI score “2” and “1.” Conclusion. Transbond XT showed the highest shear bond strength values with both pad designs.

  16. Cerebellar Degeneration

    Science.gov (United States)

    ... FARA) National Ataxia Foundation (NAF) National Multiple Sclerosis Society See all related organizations Publications Degeneración cerebelosa Order NINDS Publications Definition Cerebellar degeneration is a process in which neurons ( ...

  17. Macular degeneration

    Science.gov (United States)

    The macula is the part of the retina that distinguishes fine details at the center of the field of vision. Macular degeneration results from a partial breakdown of the insulating layer between the retina and the choroid layer of ...

  18. [Pharmacological therapy of age-related macular degeneration based on etiopathogenesis].

    Science.gov (United States)

    Fischer, Tamás

    2015-11-15

    It is of great therapeutic significance that disordered function of the vascular endothelium which supply the affected ocular structures plays a major role in the pathogenesis and development of age-related macular degeneration. Chronic inflammation is closely linked to diseases associated with endothelial dysfunction, and age-related macular degeneration is accompanied by a general inflammatory response. According to current concept, age-related macular degeneration is a local manifestation of systemic vascular disease. This recognition could have therapeutic implications because restoration of endothelial dysfunction can restabilize the condition of chronic vascular disease including age-related macular degeneration as well. Restoration of endothelial dysfunction by pharmaacological or non pharmacological interventions may prevent the development or improve endothelial dysfunction, which result in prevention or improvement of age related macular degeneration as well. Medicines including inhibitors of the renin-angiotensin system (converting enzyme inhibitors, angiotensin-receptor blockers and renin inhibitors), statins, acetylsalicylic acid, trimetazidin, third generation beta-blockers, peroxisome proliferator-activated receptor gamma agonists, folate, vitamin D, melatonin, advanced glycation end-product crosslink breaker alagebrium, endothelin-receptor antagonist bosentan, coenzyme Q10; "causal" antioxidant vitamins, N-acetyl-cysteine, resveratrol, L-arginine, serotonin receptor agonists, tumor necrosis factor-alpha blockers, specific inhibitor of the complement alternative pathway, curcumin and doxycyclin all have beneficial effects on endothelial dysfunction. Restoration of endothelial dysfunction can restabilize chronic vascular disease including age-related macular degeneration as well. Considering that the human vascular system is consubstantial, medicines listed above should be given to patients (1) who have no macular degeneration but have risk factors

  19. An optoelectronic detecting based environment perception experiment for primer students using multiple-layer laser scanner

    Science.gov (United States)

    Wang, Shifeng; Wang, Rui; Zhang, Pengfei; Dai, Xiang; Gong, Dawei

    2017-08-01

    One of the motivations of OptoBot Lab is to train primer students into qualified engineers or researchers. The series training programs have been designed by supervisors and implemented with tutoring for students to test and practice their knowledge from textbooks. An environment perception experiment using a 32 layers laser scanner is described in this paper. The training program design and laboratory operation is introduced. The four parts of the experiments which are preparation, sensor calibration, 3D space reconstruction, and object recognition, are the participating students' main tasks for different teams. This entire program is one of the series training programs that play significant role in establishing solid research skill foundation for opto-electronic students.

  20. Frequent dual initiation of reverse transcription in murine leukemia virus-based vectors containing two primer-binding sites

    International Nuclear Information System (INIS)

    Voronin, Yegor A.; Pathak, Vinay K.

    2003-01-01

    Retroviruses package two copies of viral RNA into each virion. Although each RNA contains a primer-binding site for initiation of DNA synthesis, it is unknown whether reverse transcription is initiated on both RNAs. To determine whether a single virion is capable of initiating reverse transcription more than once, we constructed a murine leukemia virus-based vector containing a second primer-binding site (PBS) derived from spleen necrosis virus and inserted the green fluorescent protein gene (GFP) between the two PBSs. Initiation of reverse transcription at either PBS results in a provirus that expresses GFP. However, initiation at both PBSs can result in the deletion of GFP, which can be detected by flow cytometry and Southern blotting analysis. Approximately 22-29% of the proviruses formed deleted the GFP in a single replication cycle, indicating the minimum proportion of virions that initiated reverse transcription on both PBSs. These results show that a significant proportion of MLV-based vectors containing two PBSs have the capacity to initiate reverse transcription more than once

  1. MRI Primer

    International Nuclear Information System (INIS)

    Oldendorf, W.; Oldendorf, W. Jr.

    1991-01-01

    Designed for studies, radiologists, and clinicians at all levels of training, this book provides a basic introduction to the principles, physics, and instrumentation of magnetic resonance imaging. The fundamental concepts that are essential for the optimal clinical use of MRI are thoroughly explained in easily accessible terms. To facilitate the reader's comprehension, the material is presented nonmathematically, using no equations and a minimum of symbols and abbreviations. MRI Primer presents a clear account of the phenomenon of nuclear magnetic resonance and the use of gradient magnetic fields to create clinically useful images of cross-sectional slices. Close attention is given to the magnetization vector as a means of expressing nuclear behavior, the role of T 1 and T 2 weighing in imaging, the use of contrast agents, and the pulse sequences most often used in clinical practice, as well as to the relative capabilities and limitations of MRI and CT. The basic hardware components of an MRI scanner are described in detail. Sample MRI scans illustrate how MRI characterizes tissue. An appendix provides a brief introduction to quantum processes in MRI

  2. Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.

    Science.gov (United States)

    Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela

    2014-08-01

    Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.

  3. Evaluation of shear bond strength of metal bracket to enamel after application of primers over bracket base-an in vitro study

    Directory of Open Access Journals (Sweden)

    Firuzbakht MM

    2011-04-01

    Full Text Available "nBackground and Aims: The aim of this study was to evaluate the effect of application of two types of primers over bracket bases on the shear bond strength (SBS and mode of bond failure."nMaterials and Methods: In this study, 75 human premolar teeth were divided into three equal groups. In group 1 (control, after surface preparation of enamel by conventional method (acid etching+primer brackets were bonded with Transbond XT composite. In group 2 (TX, brackets were bonded to enamel same as the first group but Transbond XT primer were used on bracket bases before placement of composite. In group 3 (PL, Transbond plus primer was applied on bracket bases before placement of composite. After 24 h, the SBS test was performed by universal testing machine at crosshead speed of 0.5 mm/min. Then, adhesive remnant index (ARI scores and percentage of cohesive fracture were determined using stereomicroscopy. SBS data were analyzed by one-way ANOVA and Duncan tests. Kruskal-Wallis and Mann-Whitney tests were used to analyze ARI and cohesive fracture results."nResults: There was significant difference in SBS values among the groups (P<0.001. The highest SBS was shown in TX group and the lowest was seen in PL group. There was no significant difference between control and TX groups in ARI scores (P=0.199. No significant difference was found in cohesive fracture values between the groups (P=0.093. Both the control and TX groups showed significant difference in ARI scores and cohesive fracture compared with the PL group in all of the comparisons (P<0.001."nConclusion: Application of Transbond XT primer over bracket base affects the bond strength and failure mode. Transbond XT primer increased the bond strength but Transbond plus primer decreased it.

  4. Prevalence and pattern of radiographic intervertebral disc degeneration in Vietnamese: a population-based study.

    Science.gov (United States)

    Ho-Pham, Lan T; Lai, Thai Q; Mai, Linh D; Doan, Minh C; Pham, Hoa N; Nguyen, Tuan V

    2015-06-01

    Intervertebral disc degeneration (IDD) is one of the most common skeletal disorders, yet few data are available in Asian populations. We sought to assess the prevalence and pattern of radiographic IDD in a Vietnamese population. This population-based cross-sectional investigation involved 170 men and 488 women aged ≥40 years, who were randomly sampled from the Ho Chi Minh City (Vietnam). Anthropometric data, clinical history and self-reported back and neck pain were ascertained by a questionnaire. Plain radiographs (from the cervical spine, thoracic spine to the lumbar spine) were examined for the presence of disc space narrowing and/or osteophytosis using the Kellgren-Lawrence (KL) grading system. The presence of radiographic IDD was defined if the KL grade was 2 or greater in at least one disc. The prevalence of radiographic IDD was 62.4% (n = 106) in men and 54.7% (n = 267) in women. The most frequently affected site was the lumbar spine with prevalence being 50.6 and 43.2% in men and women, respectively. The prevalence of IDD increased with advancing age: 18.8% among those aged 40-49 years, and increased to 83.4% in those aged ≥60 years. Self-reported neck pain and lower back pain were found in 30 and 44% of individuals, respectively. There was no statistically significant association between self-reported neck pain and cervical spine OA. These data suggest that radiographic IDD is highly prevalent in the Vietnamese population, and that self-reported back pain is not a sensitive indicator of IDD.

  5. Defense Primer: DOD Contractors

    Science.gov (United States)

    2017-02-10

    functions, from intelligence analysis or software development to landscaping or food service. Why does DOD use individual contractors? Going back to...that provide professional services, from research to management support. The bulk of contractors—more than 70%—provide products, and these include...10 U.S.C. Part IV: Service, Supply, and Procurement. CRS Products CRS In Focus IF10548, Defense Primer: U.S. Defense Industrial Base, by Daniel

  6. A Sensitive and Specific PCR Based Method for Identification of Cryptosporidium Sp. Using New Primers from 18S Ribosomal RNA

    Directory of Open Access Journals (Sweden)

    M Heydarnezhadi

    2011-09-01

    Full Text Available Background: The main goal of the present study was to develop a new sensitive and specific PCR based method for Identification of Cryptosporidium sp. using novel primers from 18S ribosomal RNA. Cryptosporidi­osis in high-risk host groups particularly in neonates and immuno-compromised individuals may result in death. To the best of our knowledge this is the first study regarding develop a new PCR based method to diagnose the cryptosporidiosis in Iran.Methods: A total of 850 human fecal samples from patients clinically suspected to cryptosporidiosis and 100 healthy and diarrheic cattle stool specimens were collected. The simplified formol-ether concentration method was carried out for all samples. They were then examined microscopically by modified Ziehl-Neel­sen staining method. Total DNA was extracted by QIA amp DNA stool mini kit was carried out by using designed prim­ers.Results: Twenty nine cases of cryptosporidiosis infection in human and 30 samples from cattle microscopi­cally were posi­tive. The described primary and nested PCR method could detect all Cryptospori­dium positive samples from human and cattle. Regards to suspected negative samples in pri­mary PCR examination, the Nested PCR could ap­prove two more positive results. Furthermore, Nested PCR analysis was able to detect one more case which was nega­tive in both microscopically examination and primary PCR. Specificity of the test was 100%. Sensitivity of Nested PCR in comparison to our gold standard; microscopy after Ridley concentration modified ziehl-Neelsen, was 100 %.Conclusion: Our developed PCR based method by using new primers devised from 18S ribosomal RNA revealed the ability for identification of the Cryptosporidium species such as C. parvum and C. huminis with high specificity and sensitivity.

  7. Accelerator-based neutron source using a cold deuterium target with degenerate electrons

    Directory of Open Access Journals (Sweden)

    R. E. Phillips

    2013-07-01

    Full Text Available A neutron generator is considered in which a beam of tritons is incident on a hypothetical cold deuterium target with degenerate electrons. The energy efficiency of neutron generation is found to increase substantially with electron density. Recent reports of potential targets are discussed.

  8. Cataract surgery and age-related macular degeneration. An evidence-based update

    DEFF Research Database (Denmark)

    Kessel, Line; Erngaard, Ditte; Flesner, Per

    2015-01-01

    PURPOSE: Age-related macular degeneration (AMD) and cataract often coexist in patients and concerns that cataract surgery is associated with an increased risk of incidence or progression of existing AMD has been raised. This systematic review and meta-analysis is focused on presenting the evidence...

  9. An Introduction to Programming for Bioscientists: A Python-Based Primer.

    Directory of Open Access Journals (Sweden)

    Berk Ekmekci

    2016-06-01

    Full Text Available Computing has revolutionized the biological sciences over the past several decades, such that virtually all contemporary research in molecular biology, biochemistry, and other biosciences utilizes computer programs. The computational advances have come on many fronts, spurred by fundamental developments in hardware, software, and algorithms. These advances have influenced, and even engendered, a phenomenal array of bioscience fields, including molecular evolution and bioinformatics; genome-, proteome-, transcriptome- and metabolome-wide experimental studies; structural genomics; and atomistic simulations of cellular-scale molecular assemblies as large as ribosomes and intact viruses. In short, much of post-genomic biology is increasingly becoming a form of computational biology. The ability to design and write computer programs is among the most indispensable skills that a modern researcher can cultivate. Python has become a popular programming language in the biosciences, largely because (i its straightforward semantics and clean syntax make it a readily accessible first language; (ii it is expressive and well-suited to object-oriented programming, as well as other modern paradigms; and (iii the many available libraries and third-party toolkits extend the functionality of the core language into virtually every biological domain (sequence and structure analyses, phylogenomics, workflow management systems, etc.. This primer offers a basic introduction to coding, via Python, and it includes concrete examples and exercises to illustrate the language's usage and capabilities; the main text culminates with a final project in structural bioinformatics. A suite of Supplemental Chapters is also provided. Starting with basic concepts, such as that of a "variable," the Chapters methodically advance the reader to the point of writing a graphical user interface to compute the Hamming distance between two DNA sequences.

  10. An Introduction to Programming for Bioscientists: A Python-Based Primer.

    Science.gov (United States)

    Ekmekci, Berk; McAnany, Charles E; Mura, Cameron

    2016-06-01

    Computing has revolutionized the biological sciences over the past several decades, such that virtually all contemporary research in molecular biology, biochemistry, and other biosciences utilizes computer programs. The computational advances have come on many fronts, spurred by fundamental developments in hardware, software, and algorithms. These advances have influenced, and even engendered, a phenomenal array of bioscience fields, including molecular evolution and bioinformatics; genome-, proteome-, transcriptome- and metabolome-wide experimental studies; structural genomics; and atomistic simulations of cellular-scale molecular assemblies as large as ribosomes and intact viruses. In short, much of post-genomic biology is increasingly becoming a form of computational biology. The ability to design and write computer programs is among the most indispensable skills that a modern researcher can cultivate. Python has become a popular programming language in the biosciences, largely because (i) its straightforward semantics and clean syntax make it a readily accessible first language; (ii) it is expressive and well-suited to object-oriented programming, as well as other modern paradigms; and (iii) the many available libraries and third-party toolkits extend the functionality of the core language into virtually every biological domain (sequence and structure analyses, phylogenomics, workflow management systems, etc.). This primer offers a basic introduction to coding, via Python, and it includes concrete examples and exercises to illustrate the language's usage and capabilities; the main text culminates with a final project in structural bioinformatics. A suite of Supplemental Chapters is also provided. Starting with basic concepts, such as that of a "variable," the Chapters methodically advance the reader to the point of writing a graphical user interface to compute the Hamming distance between two DNA sequences.

  11. Fluorescent quenching-based quantitative detection of specific DNA/RNA using a BODIPY® FL-labeled probe or primer

    Science.gov (United States)

    Kurata, Shinya; Kanagawa, Takahiro; Yamada, Kazutaka; Torimura, Masaki; Yokomaku, Toyokazu; Kamagata, Yoichi; Kurane, Ryuichiro

    2001-01-01

    We have developed a simple method for the quantitative detection of specific DNA or RNA molecules based on the finding that BODIPY® FL fluorescence was quenched by its interaction with a uniquely positioned guanine. This approach makes use of an oligonucleotide probe or primer containing a BODIPY® FL-modified cytosine at its 5′-end. When such a probe was hybridized with a target DNA, its fluorescence was quenched by the guanine in the target, complementary to the modified cytosine, and the quench rate was proportional to the amount of target DNA. This widely applicable technique will be used directly with larger samples or in conjunction with the polymerase chain reaction to quantify small DNA samples. PMID:11239011

  12. Development and validation of an rDNA operon based primer walking strategy applicable to de novo bacterial genome finishing.

    Directory of Open Access Journals (Sweden)

    Alexander William Eastman

    2015-01-01

    Full Text Available Advances in sequencing technology have drastically increased the depth and feasibility of bacterial genome sequencing. However, little information is available that details the specific techniques and procedures employed during genome sequencing despite the large numbers of published genomes. Shotgun approaches employed by second-generation sequencing platforms has necessitated the development of robust bioinformatics tools for in silico assembly, and complete assembly is limited by the presence of repetitive DNA sequences and multi-copy operons. Typically, re-sequencing with multiple platforms and laborious, targeted Sanger sequencing are employed to finish a draft bacterial genome. Here we describe a novel strategy based on the identification and targeted sequencing of repetitive rDNA operons to expedite bacterial genome assembly and finishing. Our strategy was validated by finishing the genome of Paenibacillus polymyxa strain CR1, a bacterium with potential in sustainable agriculture and bio-based processes. An analysis of the 38 contigs contained in the P. polymyxa strain CR1 draft genome revealed 12 repetitive rDNA operons with varied intragenic and flanking regions of variable length, unanimously located at contig boundaries and within contig gaps. These highly similar but not identical rDNA operons were experimentally verified and sequenced simultaneously with multiple, specially designed primer sets. This approach also identified and corrected significant sequence rearrangement generated during the initial in silico assembly of sequencing reads. Our approach reduces the required effort associated with blind primer walking for contig assembly, increasing both the speed and feasibility of genome finishing. Our study further reinforces the notion that repetitive DNA elements are major limiting factors for genome finishing. Moreover, we provided a step-by-step workflow for genome finishing, which may guide future bacterial genome finishing

  13. THE BURDEN OF AGE-RELATED MACULAR DEGENERATION: A VALUE-BASED MEDICINE ANALYSIS

    Science.gov (United States)

    Brown, Gary C; Brown, Melissa M; Sharma, Sanjay; Stein, Joshua D; Roth, Zachary; Campanella, Joseph; Beauchamp, George R

    2005-01-01

    Purpose To assess the quality-of-life loss and the macroeconomic financial consequences associated with age-related macular degeneration (ARMD). Methods Time tradeoff utility analysis was performed to assess the quality-of-life diminution caused by ARMD (both dry and neovascular) in cohorts consisting of (1) patients with ARMD, (2) ophthalmologists asked to assume they had various degrees of severity of ARMD, (3) healthcare providers asked to assume they had various degrees of severity of ARMD, and (4) participants from the general community asked to assume they had various degrees of severity of ARMD. ARMD was classified according to vision in the better-seeing eye as (1) mild: 20/20 to 20/40, (2) moderate: 20/50 to 20/100, (3) severe: ≤ 20/200, or (4) very severe: ≤ 20/800. Results Mild ARMD caused a 17% decrement in the quality of life of the average patient, similar to that encountered with moderate cardiac angina or symptomatic human immunodeficiency virus syndrome. Moderate ARMD caused a 32% decrease in the average patient’s quality of life, similar to that associated with severe cardiac angina or a fractured hip. Severe ARMD caused a 53% decrease in quality, more than that of dialysis, and very severe ARMD caused a 60% decrease in the average ARMD patient’s quality of life, similar to that encountered with end-stage prostate cancer or a catastrophic stroke that leaves a person bedridden, incontinent, and requiring constant nursing care. Patients with varying degrees of severity of ARMD were found to have quality-of-life impairment ranging from 96% to 750% greater than that estimated by treating ophthalmologists for the same condition. An economic analysis based upon losses to the gross domestic product suggests that ARMD has approximately a $30 billion annual negative impact. The return on investment is therefore potentially high for both treatment with current ARMD therapies and the research costs invested in the development of new ARMD treatment

  14. In Vivo Mouse Intervertebral Disc Degeneration Model Based on a New Histological Classification.

    Directory of Open Access Journals (Sweden)

    Takashi Ohnishi

    Full Text Available Although human intervertebral disc degeneration can lead to several spinal diseases, its pathogenesis remains unclear. This study aimed to create a new histological classification applicable to an in vivo mouse intervertebral disc degeneration model induced by needle puncture. One hundred six mice were operated and the L4/5 intervertebral disc was punctured with a 35- or 33-gauge needle. Micro-computed tomography scanning was performed, and the punctured region was confirmed. Evaluation was performed by using magnetic resonance imaging and histology by employing our classification scoring system. Our histological classification scores correlated well with the findings of magnetic resonance imaging and could detect degenerative progression, irrespective of the punctured region. However, the magnetic resonance imaging analysis revealed that there was no significant degenerative intervertebral disc change between the ventrally punctured and non-punctured control groups. To induce significant degeneration in the lumbar intervertebral discs, the central or dorsal region should be punctured instead of the ventral region.

  15. Development of a one-step RT-PCR assay for detection of pancoronaviruses (α-, β-, γ-, and δ-coronaviruses) using newly designed degenerate primers for porcine and avian `fecal samples.

    Science.gov (United States)

    Hu, Hui; Jung, Kwonil; Wang, Qiuhong; Saif, Linda J; Vlasova, Anastasia N

    2018-06-01

    Coronaviruses (CoVs) are critical human and animal pathogens because of their potential to cause severe epidemics of respiratory or enteric diseases. In pigs, the newly emerged porcine deltacoronavirus (PDCoV) and re-emerged porcine epidemic diarrhea virus (PEDV) reported in the US and Asia, as well as the discovery of novel CoVs in wild bats or birds, has necessitated development of improved detection and control measures for these CoVs. Because the previous pancoronavirus (panCoV) RT-PCR established in our laboratory in 2007-2011 did not detect deltacoronaviruses (δ-CoVs) in swine fecal and serum samples, our goal was to develop a new panCoV RT-PCR assay to detect known human and animal CoVs, including δ-CoVs. In this study, we designed a new primer set to amplify a 668 bp-region within the RNA-dependent RNA polymerase (RdRP) gene that encodes the most conserved protein domain of α-, β-, γ-, and δ-CoVs. We established a one-step panCoV RT-PCR assay and standardized the assay conditions. The newly established panCoV RT-PCR assay was demonstrated to have a high sensitivity and specificity. Using a panel of 60 swine biological samples (feces, intestinal contents, and sera) characterized by PEDV, PDCoV and transmissible gastroenteritis virus-specific RT-PCR assays, we demonstrated that sensitivity and specificity of the newly established panCoV RT-PCR assay were 100%. 400 avian fecal (RNA) samples were further tested simultaneously for CoV by the new panCoV RT-PCR and a one-step RT-PCR assay with the δ-CoV nucleocapsid-specific universal primers. Four of 400 avian samples were positive for CoV, three of which were positive for δ-CoV by the conventional RT-PCR. PanCoV RT-PCR fragments for 3 of the 4 CoVs were sequenced. Phylogenetic analysis revealed the presence of one γ-CoV and two δ-CoV in the sequenced samples. The newly designed panCoV RT-PCR assay should be useful for the detection of currently known CoVs in animal biological samples. Copyright © 2018

  16. Reliable allele detection using SNP-based PCR primers containing Locked Nucleic Acid: application in genetic mapping

    Directory of Open Access Journals (Sweden)

    Trognitz Friederike

    2007-02-01

    Full Text Available Abstract Background The diploid, Solanum caripense, a wild relative of potato and tomato, possesses valuable resistance to potato late blight and we are interested in the genetic base of this resistance. Due to extremely low levels of genetic variation within the S. caripense genome it proved impossible to generate a dense genetic map and to assign individual Solanum chromosomes through the use of conventional chromosome-specific SSR, RFLP, AFLP, as well as gene- or locus-specific markers. The ease of detection of DNA polymorphisms depends on both frequency and form of sequence variation. The narrow genetic background of close relatives and inbreds complicates the detection of persisting, reduced polymorphism and is a challenge to the development of reliable molecular markers. Nonetheless, monomorphic DNA fragments representing not directly usable conventional markers can contain considerable variation at the level of single nucleotide polymorphisms (SNPs. This can be used for the design of allele-specific molecular markers. The reproducible detection of allele-specific markers based on SNPs has been a technical challenge. Results We present a fast and cost-effective protocol for the detection of allele-specific SNPs by applying Sequence Polymorphism-Derived (SPD markers. These markers proved highly efficient for fingerprinting of individuals possessing a homogeneous genetic background. SPD markers are obtained from within non-informative, conventional molecular marker fragments that are screened for SNPs to design allele-specific PCR primers. The method makes use of primers containing a single, 3'-terminal Locked Nucleic Acid (LNA base. We demonstrate the applicability of the technique by successful genetic mapping of allele-specific SNP markers derived from monomorphic Conserved Ortholog Set II (COSII markers mapped to Solanum chromosomes, in S. caripense. By using SPD markers it was possible for the first time to map the S. caripense alleles

  17. A Value-Based Medicine cost-utility analysis of genetic testing for neovascular macular degeneration.

    Science.gov (United States)

    Brown, Gary C; Brown, Melissa M; Lieske, Heidi B; Lieske, Philip A; Brown, Kathryn S

    2015-01-01

    There is a dearth of patient, preference-based cost-effectiveness analyses evaluating genetic testing for neovascular age-related macular degeneration (NVAMD). A Value-Based Medicine, 12-year, combined-eye model, cost-utility analysis evaluated genetic testing of Category 3 AMD patients at age 65 for progression to NVAMD. The benefit of genetic testing was predicated upon the fact that early-treatment ranibizumab therapy (baseline vision 20/40-20/80) for NVAMD confers greater patient value than late-treatment (baseline vision ≤20/160). Published genetic data and MARINA Study ranibizumab therapy data were utilized in the analysis. Patient value (quality-of-life gain) and financial value (2012 US real dollar) outcomes were discounted at 3 % annually. Genetic testing-enabled, early-treatment ranibizumab therapy per patient conferred mean 20/40 -1 vision, a 0.845 QALY gain and 14.1 % quality-of-life gain over sham therapy. Late-treatment ranibizumab therapy conferred mean 20/160 +2 vision, a 0.250 QALY gain and 4.2 % quality-of-life gain over sham therapy. The gain from early-treatment over late-treatment was 0.595 QALY (10.0 % quality-of-life gain). The per-patient cost for genetic testing/closer monitoring was $2205 per screened person, $2.082 billion for the 944,000 estimated new Category 3 AMD patients annually. Genetic testing/monitoring costs per early-treatment patient totaled $66,180. Costs per early-treatment patient included: genetic testing costs: $66,180 + direct non-ophthalmic medical costs: -$40,914 + caregiver costs: -$172,443 + employment costs: -$14,098 = a net societal cost saving of $160,582 per early treatment patient. When genetic screening facilitated an incremental 12,965 (8.0 %) of the 161,754, new annual NVAMD patients aged ≥65 in the US to undergo early-treatment ranibizumab therapy, each additional patient treated accrued an overall, net financial gain for society of $160,582. Genetic screening was cost-effective, using World

  18. Evidence-based analysis of prophylactic treatment of asymptomatic retinal breaks and lattice degeneration.

    Science.gov (United States)

    Wilkinson, C P

    2000-01-01

    To assess the quality of information in the literature regarding the benefits of prophylactic treatment of asymptomatic retinal tears and lattice degeneration. Asymptomatic retinal breaks occur in approximately 7% of patients over age 40, and lattice degeneration is present in approximately 8% of the general population. Because retinal breaks cause retinal detachment and lattice degeneration is associated with approximately 30% of retinal detachments, prophylactic treatment of these lesions has sometimes been recommended. A panel of vitreoretinal experts performed a literature review of all publications regarding prevention of retinal detachment that have been published in English. These articles were then used to prepare recommendations for patient care in an American Academy of Ophthalmology Preferred Practice Pattern (PPP). Each recommendation was rated according to: (1) its importance in the care process and (2) the strength of evidence supporting the given recommendation. Most recommendations were rated as A (most important to patient care). Only a single publication was graded as I (providing strong evidence in support of a recommendation), and this was not a prospective trial. Of the few publications rated as II (substantial evidence), most were studies documenting a lack of treatment benefit. Because of an absence of level I and level II studies in the literature, level III (consensus of expert opinion) was the basis for most recommendations in the PPP. The current literature regarding prevention of retinal detachment does not provide sufficient information to support strongly prophylactic treatment of lesions other than symptomatic flap tears. Prospective randomized trials of prophylactic therapy are indicated. Eyes highly predisposed to retinal detachment should be considered for such studies.

  19. Primer sets for cloning the human repertoire of T cell Receptor Variable regions

    Directory of Open Access Journals (Sweden)

    Santoro Claudio

    2008-08-01

    Full Text Available Abstract Background Amplification and cloning of naïve T cell Receptor (TR repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Results Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT®, the ImMunoGeneTics information system®. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. Conclusion This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

  20. Primer sets for cloning the human repertoire of T cell Receptor Variable regions.

    Science.gov (United States)

    Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele

    2008-08-29

    Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

  1. Identification of degenerate nuclei and development of a SCAR marker for Flammulina velutipes.

    Directory of Open Access Journals (Sweden)

    Sun Young Kim

    Full Text Available Flammulina velutipes is one of the major edible mushrooms in the world. Recently, abnormalities that have a negative impact on crop production have been reported in this mushroom. These symptoms include slow vegetative growth, a compact mycelial mat, and few or even no fruiting bodies. The morphologies and fruiting capabilities of monokaryons of wild-type and degenerate strains that arose through arthrospore formation were investigated through test crossing. Only one monokaryotic group of the degenerate strains and its hybrid strains showed abnormal phenotypes. Because the monokaryotic arthrospore has the same nucleus as the parent strain, these results indicated that only one aberrant nucleus of the two nuclei in the degenerate strain was responsible for the degeneracy. A sequence-characterized amplified region marker that is linked to the degenerate monokaryon was identified based on a polymorphic sequence that was generated using random primers. Comparative analyses revealed the presence of a degenerate-specific genomic region in a telomere, which arose via the transfer of a genomic fragment harboring a putative helicase gene. Our findings have narrowed down the potential molecular targets responsible for this phenotype for future studies and have provided a marker for the detection of degenerate strains.

  2. Patient Awareness of Cataract and Age-related Macular Degeneration among the Korean Elderly: A Population-based Study.

    Science.gov (United States)

    Lee, Hankil; Jang, Yong Jung; Lee, Hyung Keun; Kang, Hye Young

    2017-12-01

    Age-related eye disease is often considered part of natural aging. Lack of awareness of eye conditions can result in missed treatment. We investigated the rates of awareness of cataract and age-related macular degeneration, the most common age-related eye-diseases, and the associated factors among elderly Koreans. We identified 7,403 study subjects (≥40 years old) with cataract or age-related macular degeneration based on ophthalmic examination results during the 5th Korean National Health and Nutrition Examination Survey conducted between 2010 and 2012. We assessed whether patients were aware of their eye condition based on a previous diagnosis by a physician. The average awareness rate over the 3-year study period was 23.69% in subjects with cataract and 1.45% in subjects with age-related macular degeneration. Logistic regression analysis showed that patients with cataract were more likely to recognize their condition if they had myopia (odds ratio, 2.08), hyperopia (odds ratio, 1.33), family history of eye disease (odds ratio, 1.44), or a past eye examination (odds ratio, 4.07-29.10). The presence of diabetes mellitus was also a significant predictor of patient awareness of cataract (odds ratio, 1.88). Poor patient recognition of eye disease among the Korean elderly highlights the seriousness of this potential public health problem in our aging society. Pre-existing eye-related conditions and diabetes were significant predictors of awareness; therefore, patients in frequent contact with their doctors have a greater chance of detecting eye disease. © 2017 The Korean Ophthalmological Society

  3. A Quantum Groups Primer

    Science.gov (United States)

    Majid, Shahn

    2002-05-01

    Here is a self-contained introduction to quantum groups as algebraic objects. Based on the author's lecture notes for the Part III pure mathematics course at Cambridge University, the book is suitable as a primary text for graduate courses in quantum groups or supplementary reading for modern courses in advanced algebra. The material assumes knowledge of basic and linear algebra. Some familiarity with semisimple Lie algebras would also be helpful. The volume is a primer for mathematicians but it will also be useful for mathematical physicists.

  4. Retinal Structure Measurements as Inclusion Criteria for Stem Cell-Based Therapies of Retinal Degenerations.

    Science.gov (United States)

    Jacobson, Samuel G; Matsui, Rodrigo; Sumaroka, Alexander; Cideciyan, Artur V

    2016-04-01

    We reviewed and illustrated the most optimal retinal structural measurements to make in stem cell clinical trials. Optical coherence tomography (OCT) and autofluorescence (AF) imaging were used to evaluate patients with severe visual loss from nonsyndromic and syndromic retinitis pigmentosa (RP), ABCA4-Stargardt disease, and nonneovascular age-related macular degeneration (AMD). Outer nuclear layer (ONL), rod outer segment (ROS) layer, inner retina, ganglion cell layer (GCL), and nerve fiber layer (NFL) thicknesses were quantified. All patients had severely reduced visual acuities. Retinitis pigmentosa patients had limited visual fields; maculopathy patients had central scotomas with retained peripheral function. For the forms of RP illustrated, there was detectable albeit severely reduced ONL across the scanned retina, and normal or hyperthick GCL and NFL. Maculopathy patients had no measurable ONL centrally; it became detectable with eccentricity. Some maculopathy patients showed unexpected GCL losses. Autofluorescence imaging illustrated central losses of RPE integrity. A hypothetical scheme to relate patient data with different phases of retinal remodeling in animal models of retinal degeneration was presented. Stem cell science is advancing, but it is not too early to open the discussion of criteria for patient selection and monitoring. Available clinical tools, such as OCT and AF imaging, can provide inclusion/exclusion criteria and robust objective outcomes. Accepting that early trials may not lead to miraculous cures, we should be prepared to know why-scientifically and clinically-so we can improve subsequent trials. We also must determine if retinal remodeling is an impediment to efficacy.

  5. Progress of stem/progenitor cell-based therapy for retinal degeneration.

    Science.gov (United States)

    Tang, Zhimin; Zhang, Yi; Wang, Yuyao; Zhang, Dandan; Shen, Bingqiao; Luo, Min; Gu, Ping

    2017-05-10

    Retinal degeneration (RD), such as age-related macular degeneration (AMD) and retinitis pigmentosa, is one of the leading causes of blindness. Presently, no satisfactory therapeutic options are available for these diseases principally because the retina and retinal pigmented epithelium (RPE) do not regenerate, although wet AMD can be prevented from further progression by anti-vascular endothelial growth factor therapy. Nevertheless, stem/progenitor cell approaches exhibit enormous potential for RD treatment using strategies mainly aimed at the rescue and replacement of photoreceptors and RPE. The sources of stem/progenitor cells are classified into two broad categories in this review, which are (1) ocular-derived progenitor cells, such as retinal progenitor cells, and (2) non-ocular-derived stem cells, including embryonic stem cells, induced pluripotent stem cells, and mesenchymal stromal cells. Here, we discuss in detail the progress in the study of four predominant stem/progenitor cell types used in animal models of RD. A short overview of clinical trials involving the stem/progenitor cells is also presented. Currently, stem/progenitor cell therapies for RD still have some drawbacks such as inhibited proliferation and/or differentiation in vitro (with the exception of the RPE) and limited long-term survival and function of grafts in vivo. Despite these challenges, stem/progenitor cells represent the most promising strategy for RD treatment in the near future.

  6. The Merit-based Incentive Payment System (MIPS): A Primer for Otolaryngologists.

    Science.gov (United States)

    Rathi, Vinay K; Naunheim, Matthew R; Varvares, Mark A; Holmes, Kenneth; Gagliano, Nancy; Hartnick, Christopher J

    2018-05-01

    Following passage of the 2015 Medicare Access and CHIP Reauthorization Act, most clinicians caring for Medicare Part B patients were required to participate in a new value-based reimbursement system known as the Merit-based Incentive Payment System (MIPS) beginning in 2017. The MIPS adjusts payment rates to providers based on a composite score of performance across 4 categories: quality, advancing care information, clinical practice improvement activities, and resource use. However, factors such as practice size, setting, informational capabilities, and patient population may pose challenges as otolaryngologists endeavor to adapt to this broad-reaching payment reform. Given potential barriers to adoption, otolaryngologists should be aware of several important initiatives to help optimize their performance, including advocacy efforts by the American Academy of Otolaryngology-Head and Neck Surgery, the development of otolaryngology-specific MIPS quality measures, and the launch of a Centers for Medicare & Medicaid Services-qualified otolaryngology clinical data registry to facilitate reporting.

  7. Contemporary Test Validity in Theory and Practice: A Primer for Discipline-Based Education Researchers

    Science.gov (United States)

    Reeves, Todd D.; Marbach-Ad, Gili

    2016-01-01

    Most discipline-based education researchers (DBERs) were formally trained in the methods of scientific disciplines such as biology, chemistry, and physics, rather than social science disciplines such as psychology and education. As a result, DBERs may have never taken specific courses in the social science research methodology--either quantitative…

  8. A primer on thermodynamic-based models for deciphering transcriptional regulatory logic.

    Science.gov (United States)

    Dresch, Jacqueline M; Richards, Megan; Ay, Ahmet

    2013-09-01

    A rigorous analysis of transcriptional regulation at the DNA level is crucial to the understanding of many biological systems. Mathematical modeling has offered researchers a new approach to understanding this central process. In particular, thermodynamic-based modeling represents the most biophysically informed approach aimed at connecting DNA level regulatory sequences to the expression of specific genes. The goal of this review is to give biologists a thorough description of the steps involved in building, analyzing, and implementing a thermodynamic-based model of transcriptional regulation. The data requirements for this modeling approach are described, the derivation for a specific regulatory region is shown, and the challenges and future directions for the quantitative modeling of gene regulation are discussed. Copyright © 2013 Elsevier B.V. All rights reserved.

  9. Academic Primer Series: Key Papers About Competency-Based Medical Education

    Directory of Open Access Journals (Sweden)

    Robert Cooney

    2017-05-01

    Full Text Available Introduction: Competency-based medical education (CBME presents a paradigm shift in medical training. This outcome-based education movement has triggered substantive changes across the globe. Since this transition is only beginning, many faculty members may not have experience with CBME nor a solid foundation in the grounding literature. We identify and summarize key papers to help faculty members learn more about CBME. Methods: Based on the online discussions of the 2016–2017 ALiEM Faculty Incubator program, a series of papers on the topic of CBME was developed. Augmenting this list with suggestions by a guest expert and by an open call on Twitter for other important papers, we were able to generate a list of 21 papers in total. Subsequently, we used a modified Delphi study methodology to narrow the list to key papers that describe the importance and significance for educators interested in learning about CBME. To determine the most impactful papers, the mixed junior and senior faculty authorship group used three-round voting methodology based upon the Delphi method. Results: Summaries of the five most highly rated papers on the topic of CBME, as determined by this modified Delphi approach, are presented in this paper. Major themes include a definition of core CBME themes, CBME principles to consider in the design of curricula, a history of the development of the CBME movement, and a rationale for changes to accreditation with CBME. The application of the study findings to junior faculty and faculty developers is discussed. Conclusion: We present five key papers on CBME that junior faculty members and faculty experts identified as essential to faculty development. These papers are a mix of foundational and explanatory papers that may provide a basis from which junior faculty members may build upon as they help to implement CBME programs.

  10. Academic Primer Series: Key Papers About Competency-Based Medical Education.

    Science.gov (United States)

    Cooney, Robert; Chan, Teresa M; Gottlieb, Michael; Abraham, Michael; Alden, Sylvia; Mongelluzzo, Jillian; Pasirstein, Michael; Sherbino, Jonathan

    2017-06-01

    Competency-based medical education (CBME) presents a paradigm shift in medical training. This outcome-based education movement has triggered substantive changes across the globe. Since this transition is only beginning, many faculty members may not have experience with CBME nor a solid foundation in the grounding literature. We identify and summarize key papers to help faculty members learn more about CBME. Based on the online discussions of the 2016-2017 ALiEM Faculty Incubator program, a series of papers on the topic of CBME was developed. Augmenting this list with suggestions by a guest expert and by an open call on Twitter for other important papers, we were able to generate a list of 21 papers in total. Subsequently, we used a modified Delphi study methodology to narrow the list to key papers that describe the importance and significance for educators interested in learning about CBME. To determine the most impactful papers, the mixed junior and senior faculty authorship group used three-round voting methodology based upon the Delphi method. Summaries of the five most highly rated papers on the topic of CBME, as determined by this modified Delphi approach, are presented in this paper. Major themes include a definition of core CBME themes, CBME principles to consider in the design of curricula, a history of the development of the CBME movement, and a rationale for changes to accreditation with CBME. The application of the study findings to junior faculty and faculty developers is discussed. We present five key papers on CBME that junior faculty members and faculty experts identified as essential to faculty development. These papers are a mix of foundational and explanatory papers that may provide a basis from which junior faculty members may build upon as they help to implement CBME programs.

  11. An αII Spectrin-Based Cytoskeleton Protects Large-Diameter Myelinated Axons from Degeneration.

    Science.gov (United States)

    Huang, Claire Yu-Mei; Zhang, Chuansheng; Zollinger, Daniel R; Leterrier, Christophe; Rasband, Matthew N

    2017-11-22

    Axons must withstand mechanical forces, including tension, torsion, and compression. Spectrins and actin form a periodic cytoskeleton proposed to protect axons against these forces. However, because spectrins also participate in assembly of axon initial segments (AISs) and nodes of Ranvier, it is difficult to uncouple their roles in maintaining axon integrity from their functions at AIS and nodes. To overcome this problem and to determine the importance of spectrin cytoskeletons for axon integrity, we generated mice with αII spectrin-deficient peripheral sensory neurons. The axons of these neurons are very long and exposed to the mechanical forces associated with limb movement; most lack an AIS, and some are unmyelinated and have no nodes. We analyzed αII spectrin-deficient mice of both sexes and found that, in myelinated axons, αII spectrin forms a periodic cytoskeleton with βIV and βII spectrin at nodes of Ranvier and paranodes, respectively, but that loss of αII spectrin disrupts this organization. Avil-cre;Sptan1 f/f mice have reduced numbers of nodes, disrupted paranodal junctions, and mislocalized Kv1 K + channels. We show that the density of nodal βIV spectrin is constant among axons, but the density of nodal αII spectrin increases with axon diameter. Remarkably, Avil-cre;Sptan1 f/f mice have intact nociception and small-diameter axons, but severe ataxia due to preferential degeneration of large-diameter myelinated axons. Our results suggest that nodal αII spectrin helps resist the mechanical forces experienced by large-diameter axons, and that αII spectrin-dependent cytoskeletons are also required for assembly of nodes of Ranvier. SIGNIFICANCE STATEMENT A periodic axonal cytoskeleton consisting of actin and spectrin has been proposed to help axons resist the mechanical forces to which they are exposed (e.g., compression, torsion, and stretch). However, until now, no vertebrate animal model has tested the requirement of the spectrin cytoskeleton in

  12. Efficient One-Step Fusion PCR Based on Dual-Asymmetric Primers and Two-Step Annealing

    DEFF Research Database (Denmark)

    Liu, Yilan; Chen, Jinjin; Thygesen, Anders

    2018-01-01

    Gene splicing by fusion PCR is a versatile and widely used methodology, especially in synthetic biology. We here describe a rapid method for splicing two fragments by one-round fusion PCR with a dual-asymmetric primers and two-step annealing (ODT) method. During the process, the asymmetric...... intermediate fragments were generated in the early stage. Thereafter, they were hybridized in the subsequent cycles to serve as template for the target full-length product. The process parameters such as primer ratio, elongation temperature and cycle numbers were optimized. In addition, the fusion products...

  13. Primer3_masker: integrating masking of template sequence with primer design software.

    Science.gov (United States)

    Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido

    2018-06-01

    Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.

  14. Induced pluripotent stem cell-based therapy for age-related macular degeneration.

    Science.gov (United States)

    Bracha, Peter; Moore, Nicholas A; Ciulla, Thomas A

    2017-09-01

    In age-related macular degeneration (AMD), stem cells could possibly replace or regenerate disrupted pathologic retinal pigment epithelium (RPE), and produce supportive growth factors and cytokines such as brain-derived neurotrophic factor.  Induced pluripotent stem cells (iPSCs)-derived RPE was first subretinally transplanted in a neovascular AMD patient in 2014. Areas covered: Induced PSCs are derived from the introduction of transcription factors to adult cells under specific cell culture conditions, followed by differentiation into RPE cells. Induced PSC-derived RPE cells exhibit ion transport, membrane potential, polarized VEGF secretion and gene expression that is similar to native RPE. Despite having similar in vitro function, morphology, immunostaining and microscopic analysis, it remains to be seen if iPSC-derived RPE can replicate the myriad of in vivo functions, including immunomodulatory effects, of native RPE cells.  Historically, adjuvant RPE transplantation during CNV resections were technically difficult and complicated by immune rejection. Autologous iPSCs are hypothesized to reduce the risk of immune rejection, but their production is time-consuming and expensive.  Alternatively, allogenic transplantation using human leukocyte antigen (HLA)-matched iPSCs, similar to HLA-matched organ transplantation, is currently being investigated. Expert opinion: Challenges to successful transplantation with iPSCs include surgical technique, a pathologic subretinal microenvironment, possible immune rejection, and complications of immunosuppression.

  15. Polyacid macromolecule primers

    Science.gov (United States)

    Sugama, Toshifumi.

    1989-12-26

    Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.

  16. Effectiveness of different adhesive primers on the bond strength between an indirect composite resin and a base metal alloy.

    Science.gov (United States)

    Sarafianou, Aspasia; Seimenis, Ioannis; Papadopoulos, Triantafillos

    2008-05-01

    There is a need for achieving reliable chemical bond strength between veneering composites resins and casting alloys through the use of simplified procedures. The purpose of this study was to examine the shear bond strength of an indirect composite resin to a Ni-Cr alloy, using 4 primers and 2 airborne-particle-abrasion procedures. Fifty-six Ni-Cr (Heraenium NA) discs, 10 mm in diameter and 1.5 mm in height, were fabricated. Twenty-four discs were airborne-particle abraded with 50-microm Al2O3 particles, while another 24 were airborne-particle abraded with 250-microm Al2O3 particles. The following primers were applied on 6 discs of each airborne-particle-abrasion treatment group: Solidex Metal Photo Primer (MPP50, MPP250), Metal Primer II (MPII50, MPII250), SR Link (SRL50, SRL250), and Tender Bond (TB50, TB250). The Rocatec system was used on another 6 discs, airborne-particle abraded according to the manufacturer's recommendations, which served as the control group (R). Two more discs were airborne-particle abraded with 50-microm and 250-microm Al2O3 particles, respectively, to determine the Al content on their surfaces, without any bonding procedure. The indirect composite resin used was Sinfony. Specimens were thermally cycled (5 degrees C and 55 degrees C, 30-second dwell time, 5000 cycles) and tested in shear mode in a universal testing machine. The failure mode was determined with an optical microscope, and selected specimens were subjected to energy dispersive spectroscopy (EDS). Mean bond strength values were analyzed using 2-way ANOVA followed by Tukey's multiple comparison tests (alpha=.05) and compared to the control group using 1-way ANOVA followed by Tukey's multiple comparison tests (alpha=.05). The groups abraded with 50-microm particles exhibited significantly higher bond strength compared to the groups abraded with 250-microm particles. Group MPII50 exhibited the highest mean value (17.4 +/-2 MPa). Groups MPP50, MPP250, and TB50, TB250 showed

  17. Metabolomics: A Primer.

    Science.gov (United States)

    Liu, Xiaojing; Locasale, Jason W

    2017-04-01

    Metabolomics generates a profile of small molecules that are derived from cellular metabolism and can directly reflect the outcome of complex networks of biochemical reactions, thus providing insights into multiple aspects of cellular physiology. Technological advances have enabled rapid and increasingly expansive data acquisition with samples as small as single cells; however, substantial challenges in the field remain. In this primer we provide an overview of metabolomics, especially mass spectrometry (MS)-based metabolomics, which uses liquid chromatography (LC) for separation, and discuss its utilities and limitations. We identify and discuss several areas at the frontier of metabolomics. Our goal is to give the reader a sense of what might be accomplished when conducting a metabolomics experiment, now and in the near future. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. A Brief Taxometrics Primer

    Science.gov (United States)

    Beauchaine, Theodore P.

    2009-01-01

    Taxometric procedures provide an empirical means of determining which psychiatric disorders are typologically distinct from normal behavioral functioning. Although most disorders reflect extremes along continuously distributed behavioral traits, identifying those that are discrete has important implications for accurate diagnosis, effective treatment, early identification of risk, and improved understanding of etiology. This article provides (a) brief descriptions of the conceptual bases of several taxometric procedures, (b) example analyses using simulated data, and (c) strategies for avoiding common pitfalls that are often observed in taxometrics research. To date, most taxometrics studies have appeared in the adult psychopathology literature. It is hoped that this primer will encourage interested readers to extend taxometrics research to child and adolescent populations. PMID:18088222

  19. Can DNA-Based Ecosystem Assessments Quantify Species Abundance? Testing Primer Bias and Biomass--Sequence Relationships with an Innovative Metabarcoding Protocol.

    Directory of Open Access Journals (Sweden)

    Vasco Elbrecht

    Full Text Available Metabarcoding is an emerging genetic tool to rapidly assess biodiversity in ecosystems. It involves high-throughput sequencing of a standard gene from an environmental sample and comparison to a reference database. However, no consensus has emerged regarding laboratory pipelines to screen species diversity and infer species abundances from environmental samples. In particular, the effect of primer bias and the detection limit for specimens with a low biomass has not been systematically examined, when processing samples in bulk. We developed and tested a DNA metabarcoding protocol that utilises the standard cytochrome c oxidase subunit I (COI barcoding fragment to detect freshwater macroinvertebrate taxa. DNA was extracted in bulk, amplified in a single PCR step, and purified, and the libraries were directly sequenced in two independent MiSeq runs (300-bp paired-end reads. Specifically, we assessed the influence of specimen biomass on sequence read abundance by sequencing 31 specimens of a stonefly species with known haplotypes spanning three orders of magnitude in biomass (experiment I. Then, we tested the recovery of 52 different freshwater invertebrate taxa of similar biomass using the same standard barcoding primers (experiment II. Each experiment was replicated ten times to maximise statistical power. The results of both experiments were consistent across replicates. We found a distinct positive correlation between species biomass and resulting numbers of MiSeq reads. Furthermore, we reliably recovered 83% of the 52 taxa used to test primer bias. However, sequence abundance varied by four orders of magnitudes between taxa despite the use of similar amounts of biomass. Our metabarcoding approach yielded reliable results for high-throughput assessments. However, the results indicated that primer efficiency is highly species-specific, which would prevent straightforward assessments of species abundance and biomass in a sample. Thus, PCR-based

  20. Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

    Science.gov (United States)

    Yofe, Ido; Schuldiner, Maya

    2014-02-01

    The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.

  1. Comparison among amoA Primers Suited for Quantification and Diversity Analyses of Ammonia-Oxidizing Bacteria in Soil

    Science.gov (United States)

    Shimomura, Yumi; Morimoto, Sho; Hoshino, Yuko Takada; Uchida, Yoshitaka; Akiyama, Hiroko; Hayatsu, Masahito

    2012-01-01

    Ammonia monooxygenase subunit A gene (amoA) is frequently used as a functional gene marker for diversity analysis of ammonia-oxidizing bacteria (AOB). To select a suitable amoA primer for real-time PCR and PCR-denaturing gradient gel electrophoresis (DGGE), three reverse primers (degenerate primer amoA-2R; non-degenerate primers amoA-2R-GG and amoA-2IR) were examined. No significant differences were observed among the three primers in terms of quantitative values of amoA from environmental samples using real-time PCR. We found that PCR-DGGE analysis with the amoA-2IR primer gave the best results in this studied soil. These results indicate that amoA-2IR is a suitable primer for community analysis of AOB in the environment. PMID:22075625

  2. Fusion primer and nested integrated PCR (FPNI-PCR: a new high-efficiency strategy for rapid chromosome walking or flanking sequence cloning

    Directory of Open Access Journals (Sweden)

    Wang Zhen

    2011-11-01

    Full Text Available Abstract Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs. These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures.

  3. Quick spacecraft charging primer

    International Nuclear Information System (INIS)

    Larsen, Brian Arthur

    2014-01-01

    This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.

  4. Nanotechnology: A Policy Primer

    Science.gov (United States)

    2013-06-24

    savings in the United States of 24 million barrels of oil.4 • Universal access to clean water. Nanotechnology water desalination and filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...COVERED 00-00-2013 to 00-00-2013 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT

  5. PCR-based molecular discrimination of Pandora neoaphidis isolates from related entomopathogenic fungi and development of species-specific diagnostic primers.

    Science.gov (United States)

    Tymon, Anna M; Shah, Paresh A; Pell, Judith K

    2004-04-01

    Studies were performed to assess the genetic variation amongst isolates of the aphid-pathogenic fungus Pandora neoaphidis (syn. Erynia neoaphidis). 37 isolates were examined, from a range of pest and non-pest aphid species, as well as 21 from eight other entomophthoralean species. Universal primers were used to amplify the ITS rDNA regions and all of the species tested produced discrete ITS groups, with the exception of Conidiobolus spp. Neighbour-joining analysis of the ITS2 regions from P. neoaphidis, P. kondoiensis and Zoophthora radicans demonstrated that these three species formed distinct groups with sequence identities of 58-82% between the groups. An ITS size of ca 1,100 bp was diagnostic for P. neoaphidis, while ca 1,450 bp was characteristic of P. kondoiensis. ITS-RFLP analysis failed to yield intraspecific polymorphisms in any of the P. neoaphidis isolates screened, although it was useful in distinguishing between different entomophthoralean species. Some intraspecific variation in the ITS region was detected in a number of isolates of Z. radicans and Conidiobolus spp. We propose that two isolates previously identified as P. neoaphidis based on conidia morphology, are actually P. kondoiensis based on molecular studies. Sequencing analysis of the complete ITS region from P. neoaphidis and P. kondoiensis allowed species-specific primers to be developed for P. neoaphidis and P. kondoiensis. These were used to screen aphids infected in laboratory bioassays and from field-collected samples, without prior isolation of the fungus. The primers are useful tools for quantifying the epizootiology of P. neoaphidis in aphid populations, as well as assessing competitive interactions between these two species.

  6. Current Treatment Limitations in Age-Related Macular Degeneration and Future Approaches Based on Cell Therapy and Tissue Engineering

    Science.gov (United States)

    Fernández-Robredo, P.; Sancho, A.; Johnen, S.; Recalde, S.; Gama, N.; Thumann, G.; Groll, J.; García-Layana, A.

    2014-01-01

    Age-related macular degeneration (AMD) is the leading cause of blindness in the Western world. With an ageing population, it is anticipated that the number of AMD cases will increase dramatically, making a solution to this debilitating disease an urgent requirement for the socioeconomic future of the European Union and worldwide. The present paper reviews the limitations of the current therapies as well as the socioeconomic impact of the AMD. There is currently no cure available for AMD, and even palliative treatments are rare. Treatment options show several side effects, are of high cost, and only treat the consequence, not the cause of the pathology. For that reason, many options involving cell therapy mainly based on retinal and iris pigment epithelium cells as well as stem cells are being tested. Moreover, tissue engineering strategies to design and manufacture scaffolds to mimic Bruch's membrane are very diverse and under investigation. Both alternative therapies are aimed to prevent and/or cure AMD and are reviewed herein. PMID:24672707

  7. A Primer to Slow Light

    OpenAIRE

    Leonhardt, U.

    2001-01-01

    Laboratory-based optical analogs of astronomical objects such as black holes rely on the creation of light with an extremely low or even vanishing group velocity (slow light). These brief notes represent a pedagogical attempt towards elucidating this extraordinary form of light. This paper is a contribution to the book Artificial Black Holes edited by Mario Novello, Matt Visser and Grigori Volovik. The paper is intended as a primer, an introduction to the subject for non-experts, not as a det...

  8. Macular degeneration (image)

    Science.gov (United States)

    ... macula in the back of the eye. The macula is important for clear central vision, allowing an individual to see fine details. There are two types of macular degeneration, dry and wet. Dry macular degeneration is more ...

  9. Research on Degeneration Model of Neural Network for Deep Groove Ball Bearing Based on Feature Fusion

    Directory of Open Access Journals (Sweden)

    Lijun Zhang

    2018-02-01

    Full Text Available Aiming at the pitting fault of deep groove ball bearing during service, this paper uses the vibration signal of five different states of deep groove ball bearing and extracts the relevant features, then uses a neural network to model the degradation for identifying and classifying the fault type. By comparing the effects of training samples with different capacities through performance indexes such as the accuracy and convergence speed, it is proven that an increase in the sample size can improve the performance of the model. Based on the polynomial fitting principle and Pearson correlation coefficient, fusion features based on the skewness index are proposed, and the performance improvement of the model after incorporating the fusion features is also validated. A comparison of the performance of the support vector machine (SVM model and the neural network model on this dataset is given. The research shows that neural networks have more potential for complex and high-volume datasets.

  10. A new detection method for the K variant of butyrylcholinesterase based on PCR primer introduced restriction analysis (PCR-PIRA).

    Science.gov (United States)

    Shibuta, K; Abe, M; Suzuki, T

    1994-01-01

    The K variant of human butyrylcholinesterase is caused by a G/A transition in the butyrylcholinesterase gene, which neither creates nor destroys any restriction site. In an attempt to detect the K variant both simply and rapidly, we developed a two step method of "PCR primer introduced restriction analysis" (PCR-PIRA). The first step was used to introduce a new Fun4HI site into the normal allele for a screening test, while the second step was performed to create a new MaeIII site on the variant allele for a specific test. This method thus enabled us to distinguish clearly the K variant from the normal allele, and also showed that the frequency of the K variant allele is 0.164 in the Japanese population. Images PMID:7966197

  11. The Los Alamos primer

    CERN Document Server

    Serber, Robert

    2018-01-01

    Unabridged declassified value reproduction of The Los Alamos Primer by Robert Serber, in full color with all censor markings. This is the booklet given to new workers at Los Alamos during World War II, to catch them up on how to build a practical fission bomb. The Primer was driven by Robert Oppenheimer asking his protégé Robert Serber to summarize all knowledge and possible solutions known as of April 1943 in a series of lectures. Serber did such an excellent job that the notes from the series was turned into The Los Alamos Primer. Serber was known as an expert that bridged theory and reality, and so was also chosen to be one of the first Americans to enter Hiroshima and Nagasaki to assess the atomic damage in 1945.

  12. Degenerate band edge laser

    Science.gov (United States)

    Veysi, Mehdi; Othman, Mohamed A. K.; Figotin, Alexander; Capolino, Filippo

    2018-05-01

    We propose a class of lasers based on a fourth-order exceptional point of degeneracy (EPD) referred to as the degenerate band edge (DBE). EPDs have been found in parity-time-symmetric photonic structures that require loss and/or gain; here we show that the DBE is a different kind of EPD since it occurs in periodic structures that are lossless and gainless. Because of this property, a small level of gain is sufficient to induce single-frequency lasing based on a synchronous operation of four degenerate Floquet-Bloch eigenwaves. This lasing scheme constitutes a light-matter interaction mechanism that leads also to a unique scaling law of the laser threshold with the inverse of the fifth power of the laser-cavity length. The DBE laser has the lowest lasing threshold in comparison to a regular band edge laser and to a conventional laser in cavities with the same loaded quality (Q ) factor and length. In particular, even without mirror reflectors the DBE laser exhibits a lasing threshold which is an order of magnitude lower than that of a uniform cavity laser of the same length and with very high mirror reflectivity. Importantly, this novel DBE lasing regime enforces mode selectivity and coherent single-frequency operation even for pumping rates well beyond the lasing threshold, in contrast to the multifrequency nature of conventional uniform cavity lasers.

  13. Semantic Web Primer

    NARCIS (Netherlands)

    Antoniou, Grigoris; Harmelen, Frank van

    2004-01-01

    The development of the Semantic Web, with machine-readable content, has the potential to revolutionize the World Wide Web and its use. A Semantic Web Primer provides an introduction and guide to this still emerging field, describing its key ideas, languages, and technologies. Suitable for use as a

  14. Prevalence of age-related macular degeneration in Nakuru, Kenya: a cross-sectional population-based study.

    Directory of Open Access Journals (Sweden)

    Wanjiku Mathenge

    Full Text Available Diseases of the posterior segment of the eye, including age-related macular degeneration (AMD, have recently been recognised as the leading or second leading cause of blindness in several African countries. However, prevalence of AMD alone has not been assessed. We hypothesized that AMD is an important cause of visual impairment among elderly people in Nakuru, Kenya, and therefore sought to assess the prevalence and predictors of AMD in a diverse adult Kenyan population.In a population-based cross-sectional survey in the Nakuru District of Kenya, 100 clusters of 50 people 50 y of age or older were selected by probability-proportional-to-size sampling between 26 January 2007 and 11 November 2008. Households within clusters were selected through compact segment sampling. All participants underwent a standardised interview and comprehensive eye examination, including dilated slit lamp examination by an ophthalmologist and digital retinal photography. Images were graded for the presence and severity of AMD lesions following a modified version of the International Classification and Grading System for Age-Related Maculopathy. Comparison was made between slit lamp biomicroscopy (SLB and photographic grading. Of 4,381 participants, fundus photographs were gradable for 3,304 persons (75.4%, and SLB was completed for 4,312 (98%. Early and late AMD prevalence were 11.2% and 1.2%, respectively, among participants graded on images. Prevalence of AMD by SLB was 6.7% and 0.7% for early and late AMD, respectively. SLB underdiagnosed AMD relative to photographic grading by a factor of 1.7. After controlling for age, women had a higher prevalence of early AMD than men (odds ratio 1.5; 95% CI, 1.2-1.9. Overall prevalence rose significantly with each decade of age. We estimate that, in Kenya, 283,900 to 362,800 people 50 y and older have early AMD and 25,200 to 50,500 have late AMD, based on population estimates in 2007.AMD is an important cause of visual

  15. Progression, incidence, and risk factors for intervertebral disc degeneration in a longitudinal population-based cohort: the Wakayama Spine Study.

    Science.gov (United States)

    Teraguchi, M; Yoshimura, N; Hashizume, H; Yamada, H; Oka, H; Minamide, A; Nagata, K; Ishimoto, Y; Kagotani, R; Kawaguchi, H; Tanaka, S; Akune, T; Nakamura, K; Muraki, S; Yoshida, M

    2017-07-01

    The present study examined the progression, incidence, and risk factors for intervertebral disc degeneration (DD) throughout the lumbar spine using magnetic resonance imaging (MRI) in a large population-based cohort. We followed up 617 subjects for more than 4 years as part of the Wakayama Spine Study. 1) "Progression of DD" in each of the entire, upper (L1/2 to L3/4) and lower (L4/5 and L5/S1) lumbar spine was defined as Pfirrmann grade progression at follow-up in at least one disc in the affected region. 2) "Incidence of DD" in each of these regions was defined if all discs were grade 3 or lower (white disc) at baseline, and at least one disc had progressed to grade 4 or higher (black disc) at follow-up. Logistic regression analyses were used to determine the risk factors for progression and incidence of DD. DD progression and incidence in the entire lumbar spine were 52.0% and 31.6% in men, and 60.4% and 44.7% in women, respectively. Women was associated with DD progression in the upper lumbar spine (odds ratio [OR] = 1.68, 95% confidence interval [CI] = 1.18-2.42). Aging was associated with the incidence of DD in each region (entire: OR = 1.14, CI = 1.06-1.14; upper: OR = 1.10, CI = 1.05-1.15; lower: OR = 1.11, CI = 1.05-1.19). Diabetes mellitus (DM) was associated with the incidence of DD in the upper lumbar spine (OR = 6.83, CI = 1.07-133.7). This 4-year longitudinal study is the first to demonstrate DD progression and incidence in the lumbar spine and their risk factors in a large population-based cohort. Copyright © 2017 Osteoarthritis Research Society International. Published by Elsevier Ltd. All rights reserved.

  16. Development and use of tuf gene-based primers for the multiplex PCR detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum in commercial dairy products.

    Science.gov (United States)

    Sheu, Sen-Je; Hwang, Wen-zhe; Chen, Hsin-Chih; Chiang, Yu-Cheng; Tsen, Hau-Yang

    2009-01-01

    PCR primers specific for the detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum were designed based on the elongation factor Tu gene (tuf). The specificity of these four primer sets were confirmed by PCR with 88 bacterial strains of Lactobacillus, Enterococcus, Bifidobacterium, and other bacterial species. Results indicated that these primer sets generated predicted PCR products of 397, 230, 202, and 161 bp for L. acidophilus, L. delbrueckii, L. casei group, and B. longum, respectively. Bacterial species other than the target organisms tested did not generate false-positive results. When these four primer sets were combined for the simultaneous detection of the lactic acid bacteria (LAB) in fermented milk products including yogurt, the LAB species listed on the labels of these products could be identified without the preenrichment step. The identification limit for each LAB strain with this multiplex PCR method was N X 10(3) CFU/ml in milk samples. The results of our multiplex PCR method were confirmed by PCR assay using primers based on the 16S rDNA or the 16S-23S intergenic spacer region and by biochemical tests using the API 50 CHL kit. When this multiplex PCR method was used with the determination of counts of total viable LAB and bifidobacteria, the quality of commercial fermented milk products could be assured.

  17. MRI-based relationships between spine pathology, intervertebral disc degeneration, and muscle fatty infiltration in chondrodystrophic and non-chondrodystrophic dogs.

    Science.gov (United States)

    Lerer, Assaf; Nykamp, Stephanie G; Harriss, Alexandra B; Gibson, Thomas W G; Koch, Thomas G; Brown, Stephen H M

    2015-11-01

    Human studies have revealed a link between muscle degeneration and low back pain, although the cause and effect of this relationship is not clear. Dogs provide a naturally developing model of intervertebral disc (IVD)-related low back pain that may provide insight into relationships between IVD and muscle degeneration. This study aimed to quantify, via magnetic resonance imaging (MRI), the magnitude and location of fatty infiltration in spine muscles of chondrodystrophic (CD) and non-chondrodystrophic (NCD) dogs suffering from both intervertebral disc herniation (IVDH) and non-disc-related spinal disorders, and relate this to intervertebral disc degeneration (IVDD). This study used retrospective MRI-based analysis of IVDD and muscle fatty infiltration in CD and NCD dogs. A portion of this study was funded ($1,000) by the Pet Trust Fund, Ontario Veterinary College. Magnetic resonance imaging from 180 dogs were separated into four groups: (1) CD with IVDH; (2) CD with non-IVDH spinal pathology; (3) NCD with IVDH; (4) NCD with non-IVDH spinal pathology. For each dog at intervertebral levels T12-T13 to L6-L7, IVDD was subjectively graded and muscle-fat indices (MFIndices) were quantified for multifidus, erector spinae, and psoas muscle groups. Intervertebral disc degeneration grade was higher (ppathology. Muscle-fat indices of multifidus and psoas were higher (ppathology compared with dogs with IVDH. Erector spinae demonstrated higher (ppathology. Dog groups with higher average IVDD grades demonstrated less fatty infiltration within their multifidus and psoas muscles, compared with groups with lower IVDD grades. This finding was consistent across both CD and NCD breeds as well as across dogs presenting with IVDH and those presenting with a non-IVDH spinal pathology. Thus, the presence or severity of IVDD is not uniquely related to fatty infiltration in these muscles, but rather the presence, or possibly severity or chronicity, of general spine pathology is likely a

  18. Age-Related Macular Degeneration.

    Science.gov (United States)

    Mehta, Sonia

    2015-09-01

    Age-related macular degeneration (AMD) is the leading cause of vision loss in the elderly. AMD is diagnosed based on characteristic retinal findings in individuals older than 50. Early detection and treatment are critical in increasing the likelihood of retaining good and functional vision. Copyright © 2015 Elsevier Inc. All rights reserved.

  19. RPA physically interacts with the human DNA glycosylase NEIL1 to regulate excision of oxidative DNA base damage in primer-template structures.

    Science.gov (United States)

    Theriot, Corey A; Hegde, Muralidhar L; Hazra, Tapas K; Mitra, Sankar

    2010-06-04

    The human DNA glycosylase NEIL1, activated during the S-phase, has been shown to excise oxidized base lesions in single-strand DNA substrates. Furthermore, our previous work demonstrating functional interaction of NEIL1 with PCNA and flap endonuclease 1 (FEN1) suggested its involvement in replication-associated repair. Here we show interaction of NEIL1 with replication protein A (RPA), the heterotrimeric single-strand DNA binding protein that is essential for replication and other DNA transactions. The NEIL1 immunocomplex isolated from human cells contains RPA, and its abundance in the complex increases after exposure to oxidative stress. NEIL1 directly interacts with the large subunit of RPA (K(d) approximately 20 nM) via the common interacting interface (residues 312-349) in NEIL1's disordered C-terminal region. RPA inhibits the base excision activity of both wild-type NEIL1 (389 residues) and its C-terminal deletion CDelta78 mutant (lacking the interaction domain) for repairing 5-hydroxyuracil (5-OHU) in a primer-template structure mimicking the DNA replication fork. This inhibition is reduced when the damage is located near the primer-template junction. Contrarily, RPA moderately stimulates wild-type NEIL1 but not the CDelta78 mutant when 5-OHU is located within the duplex region. While NEIL1 is inhibited by both RPA and Escherichia coli single-strand DNA binding protein, only inhibition by RPA is relieved by PCNA. These results showing modulation of NEIL1's activity on single-stranded DNA substrate by RPA and PCNA support NEIL1's involvement in repairing the replicating genome. Copyright 2010 Elsevier B.V. All rights reserved.

  20. MPprimer: a program for reliable multiplex PCR primer design

    Directory of Open Access Journals (Sweden)

    Wang Xiaolei

    2010-03-01

    Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

  1. First large-scale DNA barcoding assessment of reptiles in the biodiversity hotspot of Madagascar, based on newly designed COI primers.

    Science.gov (United States)

    Nagy, Zoltán T; Sonet, Gontran; Glaw, Frank; Vences, Miguel

    2012-01-01

    DNA barcoding of non-avian reptiles based on the cytochrome oxidase subunit I (COI) gene is still in a very early stage, mainly due to technical problems. Using a newly developed set of reptile-specific primers for COI we present the first comprehensive study targeting the entire reptile fauna of the fourth-largest island in the world, the biodiversity hotspot of Madagascar. Representatives of the majority of Madagascan non-avian reptile species (including Squamata and Testudines) were sampled and successfully DNA barcoded. The new primer pair achieved a constantly high success rate (72.7-100%) for most squamates. More than 250 species of reptiles (out of the 393 described ones; representing around 64% of the known diversity of species) were barcoded. The average interspecific genetic distance within families ranged from a low of 13.4% in the Boidae to a high of 29.8% in the Gekkonidae. Using the average genetic divergence between sister species as a threshold, 41-48 new candidate (undescribed) species were identified. Simulations were used to evaluate the performance of DNA barcoding as a function of completeness of taxon sampling and fragment length. Compared with available multi-gene phylogenies, DNA barcoding correctly assigned most samples to species, genus and family with high confidence and the analysis of fewer taxa resulted in an increased number of well supported lineages. Shorter marker-lengths generally decreased the number of well supported nodes, but even mini-barcodes of 100 bp correctly assigned many samples to genus and family. The new protocols might help to promote DNA barcoding of reptiles and the established library of reference DNA barcodes will facilitate the molecular identification of Madagascan reptiles. Our results might be useful to easily recognize undescribed diversity (i.e. novel taxa), to resolve taxonomic problems, and to monitor the international pet trade without specialized expert knowledge.

  2. First Large-Scale DNA Barcoding Assessment of Reptiles in the Biodiversity Hotspot of Madagascar, Based on Newly Designed COI Primers

    Science.gov (United States)

    Nagy, Zoltán T.; Sonet, Gontran; Glaw, Frank; Vences, Miguel

    2012-01-01

    Background DNA barcoding of non-avian reptiles based on the cytochrome oxidase subunit I (COI) gene is still in a very early stage, mainly due to technical problems. Using a newly developed set of reptile-specific primers for COI we present the first comprehensive study targeting the entire reptile fauna of the fourth-largest island in the world, the biodiversity hotspot of Madagascar. Methodology/Principal Findings Representatives of the majority of Madagascan non-avian reptile species (including Squamata and Testudines) were sampled and successfully DNA barcoded. The new primer pair achieved a constantly high success rate (72.7–100%) for most squamates. More than 250 species of reptiles (out of the 393 described ones; representing around 64% of the known diversity of species) were barcoded. The average interspecific genetic distance within families ranged from a low of 13.4% in the Boidae to a high of 29.8% in the Gekkonidae. Using the average genetic divergence between sister species as a threshold, 41–48 new candidate (undescribed) species were identified. Simulations were used to evaluate the performance of DNA barcoding as a function of completeness of taxon sampling and fragment length. Compared with available multi-gene phylogenies, DNA barcoding correctly assigned most samples to species, genus and family with high confidence and the analysis of fewer taxa resulted in an increased number of well supported lineages. Shorter marker-lengths generally decreased the number of well supported nodes, but even mini-barcodes of 100 bp correctly assigned many samples to genus and family. Conclusions/Significance The new protocols might help to promote DNA barcoding of reptiles and the established library of reference DNA barcodes will facilitate the molecular identification of Madagascan reptiles. Our results might be useful to easily recognize undescribed diversity (i.e. novel taxa), to resolve taxonomic problems, and to monitor the international pet trade

  3. Coal Bed Methane Primer

    Energy Technology Data Exchange (ETDEWEB)

    Dan Arthur; Bruce Langhus; Jon Seekins

    2005-05-25

    During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

  4. Predictive maintenance primer

    International Nuclear Information System (INIS)

    Flude, J.W.; Nicholas, J.R.

    1991-04-01

    This Predictive Maintenance Primer provides utility plant personnel with a single-source reference to predictive maintenance analysis methods and technologies used successfully by utilities and other industries. It is intended to be a ready reference to personnel considering starting, expanding or improving a predictive maintenance program. This Primer includes a discussion of various analysis methods and how they overlap and interrelate. Additionally, eighteen predictive maintenance technologies are discussed in sufficient detail for the user to evaluate the potential of each technology for specific applications. This document is designed to allow inclusion of additional technologies in the future. To gather the information necessary to create this initial Primer the Nuclear Maintenance Applications Center (NMAC) collected experience data from eighteen utilities plus other industry and government sources. NMAC also contacted equipment manufacturers for information pertaining to equipment utilization, maintenance, and technical specifications. The Primer includes a discussion of six methods used by analysts to study predictive maintenance data. These are: trend analysis; pattern recognition; correlation; test against limits or ranges; relative comparison data; and statistical process analysis. Following the analysis methods discussions are detailed descriptions for eighteen technologies analysts have found useful for predictive maintenance programs at power plants and other industrial facilities. Each technology subchapter has a description of the operating principles involved in the technology, a listing of plant equipment where the technology can be applied, and a general description of the monitoring equipment. Additionally, these descriptions include a discussion of results obtained from actual equipment users and preferred analysis techniques to be used on data obtained from the technology. 5 refs., 30 figs

  5. High-speed measurement of firearm primer blast waves

    OpenAIRE

    Courtney, Michael; Daviscourt, Joshua; Eng, Jonathan; Courtney, Amy

    2012-01-01

    This article describes a method and results for direct high-speed measurements of firearm primer blast waves employing a high-speed pressure transducer located at the muzzle to record the blast pressure wave produced by primer ignition. Key findings are: 1) Most of the lead styphnate based primer models tested show 5.2-11.3% standard deviation in the magnitudes of their peak pressure. 2) In contrast, lead-free diazodinitrophenol (DDNP) based primers had standard deviations of the peak blast p...

  6. Comparison between effectiveness of a low-viscosity glass ionomer and a resin-based glutaraldehyde containing primer in treating dentine hypersensitivity--a 25.2-month evaluation.

    NARCIS (Netherlands)

    Polderman, R.N.; Frencken, J.E.F.M.

    2007-01-01

    OBJECTIVES: The null-hypothesis tested was; there is no difference in effectiveness between a new low-viscosity glass ionomer and a resin-based glutaraldehyde containing primer in treating hypersensitive teeth after 2 years. METHODS: Using a split-mouth design, hypersensitive teeth in 14 adult

  7. Transverse magnetic field effect on the giant Goos–Hänchen shifts based on a degenerate two-level system

    Science.gov (United States)

    Nasehi, R.

    2018-06-01

    We study the effect of the Goos–Hänchen (GH) shifts through a cavity with degenerate two-level systems in the line of . For this purpose, we focus on the transverse magnetic field (TMF) in a Floquet frame to obtain the giant GH shifts. Physically, the collisional effects of TMF lead to increasing the population trapping in the ground state. However, we demonstrate that the population trapping generates the large negative or positive GH shifts and simultaneously switches from superluminal to subluminal (or vice versa). Also, we investigate the other optical properties such as the longitudinal magnetic field (LMF), which plays an important role in the control of the GH shifts and leads to the generation of new subsystems. In the next step, we evaluate the GH shifts beyond the multi-photon resonance condition by the control of TMF. Moreover, we compute the appearance of negative and positive GH shifts by setting the width of the incident Gaussian beams in the presence of a multi-photon resonance condition. Our results show that superluminal or subluminal light propagation can be simultaneously controlled by adjusting the rates of the TMF and LMF. The significant effects of these factors on the degenerate two-level systems provide different applications such as slow light, optical switches and quantum information storage.

  8. The R primer

    CERN Document Server

    Ekstrom, Claus Thorn

    2011-01-01

    Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i

  9. Primer on Health Surveys

    Directory of Open Access Journals (Sweden)

    David L Nordstrom

    2012-06-01

    Full Text Available The aim of this paper is to introduce novice researchers to surveys as a method of data collection. It starts with the definition of a survey, its major purposes and types as well as changes in the goals surveys have helped to achieve over time. Advantages and disadvantages of surveys over population censuses and medical examinations are discussed. Approaches to questionnaire construction are introduced along with properties that questionnaires are evaluated for. Modes of administration, sample size issues, and data analysis approaches are also introduced. The primer is illustrated with examples of surveys conducted in different countries with various public health purposes.

  10. Math primer for engineers

    CERN Document Server

    Cryer, CW

    2014-01-01

    Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula

  11. El primer virreinato americano

    Directory of Open Access Journals (Sweden)

    Cassá, Roberto

    2006-12-01

    Full Text Available This article explores the government of viceroy Christopher Columbus in the American territories. We return to the first Spanish settlement in Santo Domingo and the contradictions inherent to this expansionist proyect. The contradictions were part of the logic of the absolutist state and Columbus’ reaction against the controls imposed by the monarchs. Secondly, we look into the dificulties that the Admiral encountered to develop a mercantilist model. In this context, we examine the rationale behind the first government of the Indies and the features that defined the new West Indian society.

    El artículo trata sobre el gobierno de Cristóbal Colón en tierras americanas. Retomamos el tema del primer emplazamiento español en Santo Domingo y las contradicciones que tuvo aquel proyecto debido a la lógica del estado absolutista, a la ambición desmedida del descubridor y a su reacción ante los controles que desde un principio impusieron los monarcas. En un segundo momento analizamos las dificultades que encontró el Almirante para desarrollar un modelo mercantilista acorde a sus ideas y a los acuerdos a que llegó con la Corona. En ese contexto analizamos la lógica del primer gobierno colombinista en las Indias y los rasgos que definieron la nueva sociedad antillana.

  12. A spin-frustrated trinuclear copper complex based on triaminoguanidine with an energetically well-separated degenerate ground state.

    Science.gov (United States)

    Spielberg, Eike T; Gilb, Aksana; Plaul, Daniel; Geibig, Daniel; Hornig, David; Schuch, Dirk; Buchholz, Axel; Ardavan, Arzhang; Plass, Winfried

    2015-04-06

    We present the synthesis and crystal structure of the trinuclear copper complex [Cu3(saltag)(bpy)3]ClO4·3DMF [H5saltag = tris(2-hydroxybenzylidene)triaminoguanidine; bpy = 2,2'-bipyridine]. The complex crystallizes in the trigonal space group R3̅, with all copper ions being crystallographically equivalent. Analysis of the temperature dependence of the magnetic susceptibility shows that the triaminoguanidine ligand mediates very strong antiferromagnetic interactions (JCuCu = -324 cm(-1)). Detailed analysis of the magnetic susceptibility and magnetization data as well as X-band electron spin resonance spectra, all recorded on both powdered samples and single crystals, show indications of neither antisymmetric exchange nor symmetry lowering, thus indicating only a very small splitting of the degenerate S = (1)/2 ground state. These findings are corroborated by density functional theory calculations, which explain both the strong isotropic and negligible antisymmetric exchange interactions.

  13. Degenerate nonlinear diffusion equations

    CERN Document Server

    Favini, Angelo

    2012-01-01

    The aim of these notes is to include in a uniform presentation style several topics related to the theory of degenerate nonlinear diffusion equations, treated in the mathematical framework of evolution equations with multivalued m-accretive operators in Hilbert spaces. The problems concern nonlinear parabolic equations involving two cases of degeneracy. More precisely, one case is due to the vanishing of the time derivative coefficient and the other is provided by the vanishing of the diffusion coefficient on subsets of positive measure of the domain. From the mathematical point of view the results presented in these notes can be considered as general results in the theory of degenerate nonlinear diffusion equations. However, this work does not seek to present an exhaustive study of degenerate diffusion equations, but rather to emphasize some rigorous and efficient techniques for approaching various problems involving degenerate nonlinear diffusion equations, such as well-posedness, periodic solutions, asympt...

  14. Forest Interpreter's Primer on Fire Management.

    Science.gov (United States)

    Zelker, Thomas M.

    Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…

  15. A primer on water

    Science.gov (United States)

    Leopold, Luna Bergere; Langbein, Walter Basil

    1960-01-01

    When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to

  16. Hamiltonization of theories with degenerate coordinates

    International Nuclear Information System (INIS)

    Gitman, D.M.; Tyutin, I.V.

    2002-01-01

    We consider a class of Lagrangian theories where part of the coordinates does not have any time derivatives in the Lagrange function (we call such coordinates degenerate). We advocate that it is reasonable to reconsider the conventional definition of singularity based on the usual Hessian and, moreover, to simplify the conventional hamiltonization procedure. In particular, in such a procedure, it is not necessary to complete the degenerate coordinates with the corresponding conjugate momenta

  17. Hamiltonization of theories with degenerate coordinates

    Energy Technology Data Exchange (ETDEWEB)

    Gitman, D.M. E-mail: gitman@fma.if.usp.br; Tyutin, I.V. E-mail: tyutin@lpi.ru

    2002-05-27

    We consider a class of Lagrangian theories where part of the coordinates does not have any time derivatives in the Lagrange function (we call such coordinates degenerate). We advocate that it is reasonable to reconsider the conventional definition of singularity based on the usual Hessian and, moreover, to simplify the conventional hamiltonization procedure. In particular, in such a procedure, it is not necessary to complete the degenerate coordinates with the corresponding conjugate momenta.

  18. Promotion primer. Foerderfibel

    Energy Technology Data Exchange (ETDEWEB)

    1981-01-01

    This revised edition of the promotion primer is to serve as a topical orientation aid for industrial firms, unions, boards and other bodies interested where the actions of governmental R and D and innovation policy are compiled and clearly arranged. It is important for the success of governmental aids that the institutions concerned are informed about all possibilities of the promotion, financing and advisory programme. Beyond the presentation of the research promotion sectors, the fiscal measures and the contractual as well as the joint research this revised edition focussess on the fields of consultative services for innovation and information. For many firms the access to qualified information and guidance is of particular importance. That is why this brochure points out the ways towards governmental research promotion. The BMFT has provided a remarkable contribution to research promotion by establishing information and consultative services for trade and industry.

  19. Preparation and Characterization of Coating Solution Based on Waterborne Polyurethane Dispersion containing Fluorine for Primer on Electro Galvanized Steel Sheet

    International Nuclear Information System (INIS)

    Jin, Chung Keun; Lim, Sung Hyung

    2015-01-01

    The purpose of this research was to synthesize fluorine modified waterborne polyurethane dispersion (F-WPU) by soap-free (internal emulsifier) emulsion polymerization techniques, to prepare coating solution based on fluorine modified waterborne polyurethane dispersion (F-WPU) and to compare the chemical and thermo-mechanical properties on the electrogalvanized steel sheet. Environmentally friendly F-WPU was prepared with a fluorinated polyol containing 60 wt% of fluorine. There are various ways of combining a wide variety of fluorinated polyols and diisocyanate to exhibit novel properties of waterborne polyurethane dispersion. Components of coating solution were largely divided into 4 kinds i.e., F-WPU, acrylic emulsion, silane coupling agent, and colloidal silicate. F-WPU coating solution on the electro-galvanized steel sheet showed excellent properties of corrosion resistance, alkali resistance and heat resistance, as compared to other coating solutions using a general waterborne resin. The F-WPU coating solution's reliable effects are possibly due to the fluorine atoms incorporated even in a small amount of F-WPU

  20. Preparation and Characterization of Coating Solution Based on Waterborne Polyurethane Dispersion containing Fluorine for Primer on Electro Galvanized Steel Sheet

    Energy Technology Data Exchange (ETDEWEB)

    Jin, Chung Keun; Lim, Sung Hyung [Buhmwoo Institute of Technology Research, Hwaseong (Korea, Republic of)

    2015-10-15

    The purpose of this research was to synthesize fluorine modified waterborne polyurethane dispersion (F-WPU) by soap-free (internal emulsifier) emulsion polymerization techniques, to prepare coating solution based on fluorine modified waterborne polyurethane dispersion (F-WPU) and to compare the chemical and thermo-mechanical properties on the electrogalvanized steel sheet. Environmentally friendly F-WPU was prepared with a fluorinated polyol containing 60 wt% of fluorine. There are various ways of combining a wide variety of fluorinated polyols and diisocyanate to exhibit novel properties of waterborne polyurethane dispersion. Components of coating solution were largely divided into 4 kinds i.e., F-WPU, acrylic emulsion, silane coupling agent, and colloidal silicate. F-WPU coating solution on the electro-galvanized steel sheet showed excellent properties of corrosion resistance, alkali resistance and heat resistance, as compared to other coating solutions using a general waterborne resin. The F-WPU coating solution's reliable effects are possibly due to the fluorine atoms incorporated even in a small amount of F-WPU.

  1. A Primer on Observational Measurement.

    Science.gov (United States)

    Girard, Jeffrey M; Cohn, Jeffrey F

    2016-08-01

    Observational measurement plays an integral role in a variety of scientific endeavors within biology, psychology, sociology, education, medicine, and marketing. The current article provides an interdisciplinary primer on observational measurement; in particular, it highlights recent advances in observational methodology and the challenges that accompany such growth. First, we detail the various types of instrument that can be used to standardize measurements across observers. Second, we argue for the importance of validity in observational measurement and provide several approaches to validation based on contemporary validity theory. Third, we outline the challenges currently faced by observational researchers pertaining to measurement drift, observer reactivity, reliability analysis, and time/expense. Fourth, we describe recent advances in computer-assisted measurement, fully automated measurement, and statistical data analysis. Finally, we identify several key directions for future observational research to explore.

  2. The novel primers for mammal species identification-based mitochondrial cytochrome b sequence: implication for reserved wild animals in Thailand and endangered mammal species in Southeast Asia.

    Science.gov (United States)

    Muangkram, Yuttamol; Wajjwalku, Worawidh; Amano, Akira; Sukmak, Manakorn

    2018-01-01

    We presented the powerful techniques for species identification using the short amplicon of mitochondrial cytochrome b gene sequence. Two faecal samples and one single hair sample of the Asian tapir were tested using the new cytochrome b primers. The results showed a high sequence similarity with the mainland Asian tapir group. The comparative sequence analysis of the reserved wild mammals in Thailand and the other endangered mammal species from Southeast Asia comprehensibly verified the potential of our novel primers. The forward and reverse primers were 94.2 and 93.2%, respectively, by the average value of the sequence identity among 77 species sequences, and the overall mean distance was 35.9%. This development technique could provide rapid, simple, and reliable tools for species confirmation. Especially, it could recognize the problematic biological specimens contained less DNA material from illegal products and assist with wildlife crime investigation of threatened species and related forensic casework.

  3. The dose-response relationship between cumulative lifting load and lumbar disk degeneration based on magnetic resonance imaging findings.

    Science.gov (United States)

    Hung, Yu-Ju; Shih, Tiffany T-F; Chen, Bang-Bin; Hwang, Yaw-Huei; Ma, Li-Ping; Huang, Wen-Chuan; Liou, Saou-Hsing; Ho, Ing-Kang; Guo, Yue L

    2014-11-01

    Lumbar disk degeneration (LDD) has been related to heavy physical loading. However, the quantification of the exposure has been controversial, and the dose-response relationship with the LDD has not been established. The purpose of this study was to investigate the dose-response relationship between lifetime cumulative lifting load and LDD. This was a cross-sectional study. Every participant received assessments with a questionnaire, magnetic resonance imaging (MRI) of the lumbar spine, and estimation of lumbar disk compression load. The MRI assessments included assessment of disk dehydration, annulus tear, disk height narrowing, bulging, protrusion, extrusion, sequestration, degenerative and spondylolytic spondylolisthesis, foramina narrowing, and nerve root compression on each lumbar disk level. The compression load was predicted using a biomechanical software system. A total of 553 participants were recruited in this study and categorized into tertiles by cumulative lifting load (ie, lifting load. The best dose-response relationships were found at the L5-S1 disk level, in which high cumulative lifting load was associated with elevated odds ratios of 2.5 (95% confidence interval [95% CI]=1.5, 4.1) for dehydration and 4.1 (95% CI=1.9, 10.1) for disk height narrowing compared with low lifting load. Participants exposed to intermediate lifting load had an increased odds ratio of 2.1 (95% CI=1.3, 3.3) for bulging compared with low lifting load. The tests for trend were significant. There is no "gold standard" assessment tool for measuring the lumbar compression load. The results suggest a dose-response relationship between cumulative lifting load and LDD. © 2014 American Physical Therapy Association.

  4. Laenderyggens degeneration og radiologi

    DEFF Research Database (Denmark)

    Jacobsen, Steffen; Gosvig, Kasper Kjaerulf; Sonne-Holm, Stig

    2006-01-01

    Low back pain (LBP) is one of the most common conditions, and at the same time one of the most complex nosological entities. The lifetime prevalence is approximately 80%, and radiological features of lumbar degeneration are almost universal in adults. The individual risk factors for LBP and signi...... is cyclic: exacerbations relieved by asymptomatic periods. New imaging modalities, including the combination of MR imaging and multiplanar 3-D CT scans, have broadened our awareness of possible pain-generating degenerative processes of the lumbar spine other than disc degeneration....

  5. Radiation protection primer

    International Nuclear Information System (INIS)

    Aigner, R.; Melzer, E.; Seissler, H.

    1986-01-01

    This 'radiation protection primer' does not pretend to give absolute, final answers to the many questions that have been arising after the Chernobyl accident. What it is intended to supply, as a schematic overview of problems resulting from nuclear accidents, and a likewise systematic outline of possible solutions and sensible reactions to such an event. The book takes up questions such as: What has happened to the soil. Will future harvests be 'clean' again. What does radioactivity to our drinking water and other waters. What are the effects of a radioactive fallout on food. What may we eat or drink. What happens to the human body after intake of radioactive air, or - even only slightly - contaminated food or water. What can we do to protect our health, and the health of our children. Is there anything else we can do in order to avoid such a disaster in future, except from shutting-off all reactors. The book itself presents some answers and advice, along with a list of terms and explanations, and addresses to apply to for further advice and information. (orig./HP) [de

  6. CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

    Science.gov (United States)

    Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

    2015-07-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.

  7. Rust transformation/rust compatible primers

    Science.gov (United States)

    Emeric, Dario A.; Miller, Christopher E.

    1993-01-01

    Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

  8. Development of ent-kaurene Oxidase-Based Conserved Intron Spanning Primers for Species Identification in the Genus Poa (Poaceae; Bluegrass

    Directory of Open Access Journals (Sweden)

    Jonathan M. LaMantia

    2018-04-01

    Full Text Available Interspecific hybridization has been attempted to combine the heat and drought of Poa arachnifera Torr. with the turf quality characteristics of several Poa species. Confirmation of an F1 hybrid through morphological analysis of vegetative and flowering characteristics is often time consuming and ambiguous. Ent-kaurene oxidase (KO has been sequenced in rice, barley, and wheat. In rice, each of the five copies of KO gene has unique lengths for the first intron. Conserved intron spanning primers (CISP can be used as a DNA marker to exploit variations of intron lengths that flank conserved gene sequences. In the present study, we developed CISP to sequence partial genomic fragments of the KO gene from seven Poa species. Through sequence analysis, species-specific primers were also developed to produce co-dominant markers that can be used to identify interspecific hybrids between Texas bluegrass and six other Poa species used in the present study.

  9. Molecular diversity analysis of Tetradium ruticarpum (WuZhuYu) in China based on inter-primer binding site (iPBS) markers and inter-simple sequence repeat (ISSR) markers.

    Science.gov (United States)

    Xu, Jing-Yuan; Zhu, Yan; Yi, Ze; Wu, Gang; Xie, Guo-Yong; Qin, Min-Jian

    2018-01-01

    "Wu zhu yu", which is obtained from the dried unripe fruits of Tetradium ruticarpum (A. Jussieu) T. G. Hartley, has been used as a traditional Chinese medicine for treatment of headaches, abdominal colic, and hypertension for thousands of years. The present study was designed to assess the molecular genetic diversity among 25 collected accessions of T. ruticarpum (Wu zhu yu in Chinese) from different areas of China, based on inter-primer binding site (iPBS) markers and inter-simple sequence repeat (ISSR) markers. Thirteen ISSR primers generated 151 amplification bands, of which 130 were polymorphic. Out of 165 bands that were amplified using 10 iPBS primers, 152 were polymorphic. The iPBS markers displayed a higher proportion of polymorphic loci (PPL = 92.5%) than the ISSR markers (PPL = 84.9%). The results showed that T. ruticarpum possessed high loci polymorphism and genetic differentiation occurred in this plant. The combined data of iPBS and ISSR markers scored on 25 accessions produced five clusters that approximately matched the geographic distribution of the species. The results indicated that both iPBS and ISSR markers were reliable and effective tools for analyzing the genetic diversity in T. ruticarpum. Copyright © 2018 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.

  10. On Degenerate Partial Differential Equations

    OpenAIRE

    Chen, Gui-Qiang G.

    2010-01-01

    Some of recent developments, including recent results, ideas, techniques, and approaches, in the study of degenerate partial differential equations are surveyed and analyzed. Several examples of nonlinear degenerate, even mixed, partial differential equations, are presented, which arise naturally in some longstanding, fundamental problems in fluid mechanics and differential geometry. The solution to these fundamental problems greatly requires a deep understanding of nonlinear degenerate parti...

  11. Optical coherence tomography-based decision making in exudative age-related macular degeneration: comparison of time- vs spectral-domain devices.

    Science.gov (United States)

    Cukras, C; Wang, Y D; Meyerle, C B; Forooghian, F; Chew, E Y; Wong, W T

    2010-05-01

    To determine whether optical coherence tomography (OCT) device-type influences clinical grading of OCT imaging in the context of exudative age-related macular degeneration (AMD). Ninety-six paired OCT scans from 49 patients with active exudative AMD were obtained on both the time-domain Stratus OCT system and the spectral-domain Cirrus OCT system at the same visit. Three independent graders judged each scan for the presence of intraretinal fluid (IRF) or subretinal fluid (SRF). The degree of grader consensus was evaluated and the ability of the systems to detect the presence of disease activity was analysed. Cirrus OCT generated a higher degree of inter-grader consensus than Stratus OCT with higher intraclass correlation coefficients for all parameters analysed. A pair-wise comparison of Cirrus OCT with Stratus OCT systems revealed that Cirrus-based gradings more frequently reported the presence of SRF and IRF and detected overall neovascular activity at a higher rate (P<0.05) compared with Stratus-based gradings. The choice of time-domain (Stratus) vs spectra-domain (Cirrus) OCT systems has a measurable impact on clinical decision making in exudative AMD. Spectral-domain OCT systems may be able to generate more consensus in clinical interpretation and, in particular cases, detect disease activity not detected by time-domain systems. Clinical trials using OCT-based clinical evaluations of exudative AMD may need to account for these inter-system differences in planning and analysis.

  12. Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples.

    Science.gov (United States)

    Zuntini, Alexandre R; Fonseca, Luiz Henrique M; Lohmann, Lúcia G

    2013-09-01

    New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. • Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. • The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  13. Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples

    Directory of Open Access Journals (Sweden)

    Alexandre R. Zuntini

    2013-08-01

    Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  14. Laenderyggens degeneration og radiologi

    DEFF Research Database (Denmark)

    Jacobsen, Steffen; Gosvig, Kasper Kjaerulf; Sonne-Holm, Stig

    2006-01-01

    Low back pain (LBP) is one of the most common conditions, and at the same time one of the most complex nosological entities. The lifetime prevalence is approximately 80%, and radiological features of lumbar degeneration are almost universal in adults. The individual risk factors for LBP and signi......Low back pain (LBP) is one of the most common conditions, and at the same time one of the most complex nosological entities. The lifetime prevalence is approximately 80%, and radiological features of lumbar degeneration are almost universal in adults. The individual risk factors for LBP...... and significant relationships between radiological findings and subjective symptoms have both been notoriously difficult to identify. The lack of consensus on clinical criteria and radiological definitions has hampered the undertaking of properly executed epidemiological studies. The natural history of LBP...

  15. Quantum degenerate systems

    Energy Technology Data Exchange (ETDEWEB)

    Micheli, Fiorenza de [Centro de Estudios Cientificos, Arturo Prat 514, Valdivia (Chile); Instituto de Fisica, Pontificia Universidad Catolica de Valparaiso, Casilla 4059, Valparaiso (Chile); Zanelli, Jorge [Centro de Estudios Cientificos, Arturo Prat 514, Valdivia (Chile); Universidad Andres Bello, Av. Republica 440, Santiago (Chile)

    2012-10-15

    A degenerate dynamical system is characterized by a symplectic structure whose rank is not constant throughout phase space. Its phase space is divided into causally disconnected, nonoverlapping regions in each of which the rank of the symplectic matrix is constant, and there are no classical orbits connecting two different regions. Here the question of whether this classical disconnectedness survives quantization is addressed. Our conclusion is that in irreducible degenerate systems-in which the degeneracy cannot be eliminated by redefining variables in the action-the disconnectedness is maintained in the quantum theory: there is no quantum tunnelling across degeneracy surfaces. This shows that the degeneracy surfaces are boundaries separating distinct physical systems, not only classically, but in the quantum realm as well. The relevance of this feature for gravitation and Chern-Simons theories in higher dimensions cannot be overstated.

  16. Specific heats of degenerate ideal gases

    OpenAIRE

    Caruso, Francisco; Oguri, Vitor; Silveira, Felipe

    2017-01-01

    From arguments based on Heisenberg's uncertainty principle and Pauli's exclusion principle, the molar specific heats of degenerate ideal gases at low temperatures are estimated, giving rise to values consistent with the Nerst-Planck Principle (third law of Thermodynamics). The Bose-Einstein condensation phenomenon based on the behavior of specific heat of massive and non-relativistic boson gases is also presented.

  17. Laenderyggens degeneration og radiologi

    DEFF Research Database (Denmark)

    Jacobsen, Steffen; Gosvig, Kasper Kjaerulf; Sonne-Holm, Stig

    2006-01-01

    and significant relationships between radiological findings and subjective symptoms have both been notoriously difficult to identify. The lack of consensus on clinical criteria and radiological definitions has hampered the undertaking of properly executed epidemiological studies. The natural history of LBP...... is cyclic: exacerbations relieved by asymptomatic periods. New imaging modalities, including the combination of MR imaging and multiplanar 3-D CT scans, have broadened our awareness of possible pain-generating degenerative processes of the lumbar spine other than disc degeneration....

  18. Newly diagnosed exudative age-related macular degeneration treated with pegaptanib sodium monotherapy in US community-based practices: medical chart review study

    Directory of Open Access Journals (Sweden)

    Xu Xiao

    2010-02-01

    Full Text Available Abstract Background Studies have shown that early detection and treatment of neovascular age-related macular degeneration (NV-AMD can delay vision loss and blindness. The objective of this study was to evaluate the efficacy/safety of intravitreal pegaptanib sodium monotherapy in treatment-naïve subjects with newly diagnosed NV-AMD and to gain insight into characteristics of lesions treated in community-based practices. Methods From seven private US practices, charts were retrospectively reviewed on 73 subjects with previously untreated subfoveal choroidal NV-AMD treated with their first dose of pegaptanib monotherapy on/after 4/1/2005 through 6/5/2006, receiving ≥4 treatments at 6-week intervals over 21 weeks. Primary endpoint: mean visual acuity (VA change from baseline to month 6. Results 75% of lesions were occult, and 82% were subfoveal. From baseline to month 6, mean VA change was -0.68 lines; 58% and 16% gained ≥0 and ≥3 lines of VA, and 70% were responders ( Conclusion Pegaptanib is effective in real-world patients with treatment-naïve NV-AMD in uncontrolled community-based retina practices.

  19. PPDS compas-primer

    International Nuclear Information System (INIS)

    Alekhin, S.I.; Bazeeva, V.V.; Grudtsin, S.N.

    1987-01-01

    Catalogue of IHEP data bases on particle physics (PPDS) and short guide for unexperienced user are presented. All data bases are under common data base management system and include bibliographic and factographic ones. Binary search and set of applied programs controlling input and formatting output make using of system easy and convenient. Basic programs are developed in FORTRAN

  20. Optical Coherence Tomography-Based Decision Making in Exudative Age-related Macular Degeneration: Comparison of Time- versus Spectral-Domain Devices

    Science.gov (United States)

    Cukras, Catherine; Wang, Yunqing D.; Meyerle, Catherine B.; Forooghian, Farzin; Chew, Emily Y.; Wong, Wai T.

    2010-01-01

    Purpose To determine if optical coherence tomography (OCT) device-type influences clinical grading of OCT imaging in the context of exudative age-related macular degeneration (AMD). Methods Ninety-six paired OCT scans from 49 patients with active exudative AMD were obtained on both the time-domain Stratus™ OCT system and the spectral-domain Cirrus™ OCT system at the same visit. Three independent graders judged each scan for the presence of intraretinal fluid (IRF) or subretinal fluid (SRF). The degree of grader consensus was evaluated and the ability of the systems to detect the presence of disease activity was analyzed. Results Cirrus™ OCT generated a higher degree of inter-grader consensus than Stratus OCT with higher intraclass correlation coefficients (ICC) for all parameters analyzed. A pair-wise comparison of Cirrus™ OCT to Stratus™ OCT systems revealed that Cirrus™-based gradings more frequently reported the presence of SRF and IRF and detected overall neovascular activity at a higher rate (p<0.05) compared to Stratus™-based gradings Conclusions The choice of time-domain (Stratus™) versus spectra-domain (Cirrus™) OCT systems has a measurable impact on clinical decision making in exudative AMD. Spectral-domain OCT systems may be able to generate more consensus in clinical interpretation and, in particular cases, detect disease activity not detected by time-domain systems. Clinical trials employing OCT-based clinical evaluations of exudative AMD may need to account for these inter-system differences in planning and analysis. PMID:19696804

  1. Simple sequence repeat marker loci discovery using SSR primer.

    Science.gov (United States)

    Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David

    2004-06-12

    Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/

  2. Transferability of retrotransposon primers derived from Persimmon (Diospyros kaki Thunb.) across other plant species.

    Science.gov (United States)

    Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R

    2013-06-06

    Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.

  3. Evaluation of Alkyd Primers

    National Research Council Canada - National Science Library

    Marshall, Orange

    2000-01-01

    ...) for them. Alkyd paint systems include a wide range of natural and synthetic oil-based paint systems that have been used worldwide since ancient times to decorate and protect wood and metals. The U.S...

  4. Freshwater Wetlands: A Citizen's Primer.

    Science.gov (United States)

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…

  5. A Hearing Aid Primer 1

    Science.gov (United States)

    Yetter, Carol J.

    2009-01-01

    This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

  6. DNA Extraction and Primer Selection

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

    Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

  7. A classical primer for QCD

    International Nuclear Information System (INIS)

    Moriyasu, K.

    1981-01-01

    A basic primer for QCD is presented using a semiclassical approach to the colour Maxwell equations. The non-Abelian nature of colour symmetry and the violation of superposition by colour fields is compared with QED. A simple discussion of asymptotic freedom is also presented. (author)

  8. Optimizing power to track brain degeneration in Alzheimer's disease and mild cognitive impairment with tensor-based morphometry: an ADNI study of 515 subjects.

    Science.gov (United States)

    Hua, Xue; Lee, Suh; Yanovsky, Igor; Leow, Alex D; Chou, Yi-Yu; Ho, April J; Gutman, Boris; Toga, Arthur W; Jack, Clifford R; Bernstein, Matt A; Reiman, Eric M; Harvey, Danielle J; Kornak, John; Schuff, Norbert; Alexander, Gene E; Weiner, Michael W; Thompson, Paul M

    2009-12-01

    Tensor-based morphometry (TBM) is a powerful method to map the 3D profile of brain degeneration in Alzheimer's disease (AD) and mild cognitive impairment (MCI). We optimized a TBM-based image analysis method to determine what methodological factors, and which image-derived measures, maximize statistical power to track brain change. 3D maps, tracking rates of structural atrophy over time, were created from 1030 longitudinal brain MRI scans (1-year follow-up) of 104 AD patients (age: 75.7+/-7.2 years; MMSE: 23.3+/-1.8, at baseline), 254 amnestic MCI subjects (75.0+/-7.2 years; 27.0+/-1.8), and 157 healthy elderly subjects (75.9+/-5.1 years; 29.1+/-1.0), as part of the Alzheimer's Disease Neuroimaging Initiative (ADNI). To determine which TBM designs gave greatest statistical power, we compared different linear and nonlinear registration parameters (including different regularization functions), and different numerical summary measures derived from the maps. Detection power was greatly enhanced by summarizing changes in a statistically-defined region-of-interest (ROI) derived from an independent training sample of 22 AD patients. Effect sizes were compared using cumulative distribution function (CDF) plots and false discovery rate methods. In power analyses, the best method required only 48 AD and 88 MCI subjects to give 80% power to detect a 25% reduction in the mean annual change using a two-sided test (at alpha=0.05). This is a drastic sample size reduction relative to using clinical scores as outcome measures (619 AD/6797 MCI for the ADAS-Cog, and 408 AD/796 MCI for the Clinical Dementia Rating sum-of-boxes scores). TBM offers high statistical power to track brain changes in large, multi-site neuroimaging studies and clinical trials of AD.

  9. Optimizing power to track brain degeneration in Alzheimer’s disease and mild cognitive impairment with tensor-based morphometry: An ADNI study of 515 subjects

    Science.gov (United States)

    Hua, Xue; Lee, Suh; Yanovsky, Igor; Leow, Alex D.; Chou, Yi-Yu; Ho, April J.; Gutman, Boris; Toga, Arthur W.; Jack, Clifford R.; Bernstein, Matt A.; Reiman, Eric M.; Harvey, Danielle J.; Kornak, John; Schuff, Norbert; Alexander, Gene E.; Weiner, Michael W.; Thompson, Paul M.

    2010-01-01

    Tensor-based morphometry (TBM) is a powerful method to map the 3D profile of brain degeneration in Alzheimer’s disease (AD) and mild cognitive impairment (MCI). We optimized a TBM-based image analysis method to determine what methodological factors, and which image-derived measures, maximize statistical power to track brain change. 3D maps, tracking rates of structural atrophy over time, were created from 1030 longitudinal brain MRI scans (1-year follow-up) of 104 AD patients (age: 75.7 ± 7.2 years; MMSE: 23.3 ± 1.8, at baseline), 254 amnestic MCI subjects (75.0 ± 7.2 years; 27.0 ± 1.8), and 157 healthy elderly subjects (75.9 ± 5.1 years; 29.1 ± 1.0), as part of the Alzheimer’s Disease Neuroimaging Initiative (ADNI). To determine which TBM designs gave greatest statistical power, we compared different linear and nonlinear registration parameters (including different regularization functions), and different numerical summary measures derived from the maps. Detection power was greatly enhanced by summarizing changes in a statistically-defined region-of-interest (ROI) derived from an independent training sample of 22 AD patients. Effect sizes were compared using cumulative distribution function (CDF) plots and false discovery rate methods. In power analyses, the best method required only 48 AD and 88 MCI subjects to give 80% power to detect a 25% reduction in the mean annual change using a two-sided test (at α = 0.05). This is a drastic sample size reduction relative to using clinical scores as outcome measures (619 AD/6797 MCI for the ADAS-Cog, and 408 AD/796 MCI for the Clinical Dementia Rating sum-of-boxes scores). TBM offers high statistical power to track brain changes in large, multi-site neuroimaging studies and clinical trials of AD. PMID:19615450

  10. Sequence diversity in haloalkane dehalogenases, as revealed by PCR using family-specific primers

    Czech Academy of Sciences Publication Activity Database

    Kotík, Michael; Faměrová, Veronika

    2012-01-01

    Roč. 88, č. 2 (2012), s. 212-217 ISSN 0167-7012 R&D Projects: GA ČR GAP504/10/0137; GA ČR GAP207/10/0135 Institutional research plan: CEZ:AV0Z50200510 Keywords : Dehalogenation * Consensus sequence * Degenerate PCR primer Subject RIV: EE - Microbiology, Virology Impact factor: 2.161, year: 2012

  11. Library Budget Primer.

    Science.gov (United States)

    Warner, Alice Sizer

    1993-01-01

    Discusses the advantages and disadvantages of six types of budgets commonly used by many different kinds of libraries. The budget types covered are lump-sum; formula; line or line-item; program; performance or function; and zero-based. Accompanying figures demonstrate the differences between four of the budget types. (three references) (KRN)

  12. A Brief Taxometrics Primer

    OpenAIRE

    Beauchaine, Theodore P.

    2007-01-01

    Taxometric procedures provide an empirical means of determining which psychiatric disorders are typologically distinct from normal behavioral functioning. Although most disorders reflect extremes along continuously distributed behavioral traits, identifying those that are discrete has important implications for accurate diagnosis, effective treatment, early identification of risk, and improved understanding of etiology. This article provides (a) brief descriptions of the conceptual bases of s...

  13. Lead Free Electric Primer

    Science.gov (United States)

    2011-10-06

    fluorocarbon-based polymer (PolyChloroTriFluoroEthylene). No longer produced by 3M, this material is available from sources in Japan . This material contains...2. Filter 3. Vacuum dry MIC 4. Lightly grind MIC (mortar and pestle ) 5. Add hexane 6. Add BTATz 7. Magnetic stirring (20 min.) 8. Add

  14. Defense Primer: Procurement

    Science.gov (United States)

    2017-02-10

    Usually, incremental funding is used to mitigate peaks and valleys in annual budgets caused by the cost of one item significantly changing the...base defense budget . DOD uses these funds to buy several different types of materiel, including  new items easily recognizable as military...pursues a policy of full funding for procurement, meaning that the total estimated cost of each unit must be funded in the year it is budgeted . In a

  15. Neovascular age-related macular degeneration is not associated with coronary heart disease in a Chinese Population: a population-based study.

    Science.gov (United States)

    Hu, Chao-Chien; Lin, Herng-Ching; Sheu, Jau-Jiuan; Kao, Li-Ting

    2017-11-01

    This case-control study aimed to explore the association between prior coronary heart disease (CHD) and neovascular age-related macular degeneration (AMD) using a population-based data set in Taiwan. We analysed data sourced from the Taiwan Longitudinal Health Insurance Database 2005. The study consisted of 1970 patients with neovascular AMD as cases and 5910 age- and sex-matched controls. We performed a conditional logistic regression to examine the odds ratio (OR) and its corresponding 95% confidence interval (CI) for previously diagnosed CHD between cases and controls. Of the 7880 sampled patients, 24.5% had a prior history of CHD; CHD was found in 25.7% of cases and in 22.7% of controls (p = 0.008). The conditional logistic regression analysis indicated that the OR for prior CHD for cases was 1.17 [95% confidence interval (CI): 1.04-1.32] compared to the controls. However, after adjusting for patient's monthly income, geographic location, urbanization level, age, hyperlipidaemia, diabetes and hypertension, we failed to observe an association between prior CHD and AMD (OR = 1.03, 95% CI = 0.91-1.17). Additionally, the medical comorbidities of hyperlipidaemia (adjusted OR = 1.29, 95% CI = 1.15-1.45), hypertension (adjusted OR = 1.20, 95% CI = 1.05-1.37) and diabetes (adjusted OR = 1.47, 95% CI = 1.32-1.65) were significantly associated with AMD. This study presented no significant difference in the odds of prior CHD between patients with AMD and those without AMD after adjusting for comorbidities and sociodemographic characteristics in a Chinese population. © 2016 Acta Ophthalmologica Scandinavica Foundation. Published by John Wiley & Sons Ltd.

  16. Primer on hardware prefetching

    CERN Document Server

    Falsafi, Babak

    2014-01-01

    Since the 1970's, microprocessor-based digital platforms have been riding Moore's law, allowing for doubling of density for the same area roughly every two years. However, whereas microprocessor fabrication has focused on increasing instruction execution rate, memory fabrication technologies have focused primarily on an increase in capacity with negligible increase in speed. This divergent trend in performance between the processors and memory has led to a phenomenon referred to as the "Memory Wall."To overcome the memory wall, designers have resorted to a hierarchy of cache memory levels, whi

  17. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)

    ES

    reaction (PCR), oligo hybridization and DNA sequencing. Proper primer design is actually one of the most important factors/steps in successful DNA sequencing. Various bioinformatics programs are available for selection of primer pairs from a template sequence. The plethora programs for PCR primer design reflects the.

  18. 30 CFR 56.6304 - Primer protection.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives...

  19. Intervertebral disc degeneration in dogs

    NARCIS (Netherlands)

    Bergknut, N.

    2011-01-01

    Back pain is common in both dogs and humans, and is often associated with intervertebral disc (IVD) degeneration. The IVDs are essential structures of the spine and degeneration can ultimately result in diseases such as IVD herniation or spinal instability. In order to design new treatments halting

  20. Intervertebral disc degeneration in dogs

    NARCIS (Netherlands)

    Bergknut, Niklas

    Back pain is common in both dogs and humans, and is often associated with intervertebral disc (IVD) degeneration. The IVDs are essential structures of the spine and degeneration can ultimately result in diseases such as IVD herniation or spinal instability. In order to design new treatments halting

  1. Second order degenerate elliptic equations

    International Nuclear Information System (INIS)

    Duong Minh Duc.

    1988-08-01

    Using an improved Sobolev inequality we study a class of elliptic operators which is degenerate inside the domain and strongly degenerate near the boundary of the domain. Our results are applicable to the L 2 -boundary value problem and the mixed boundary problem. (author). 18 refs

  2. Biostatistics primer: part I.

    Science.gov (United States)

    Overholser, Brian R; Sowinski, Kevin M

    2007-12-01

    Biostatistics is the application of statistics to biologic data. The field of statistics can be broken down into 2 fundamental parts: descriptive and inferential. Descriptive statistics are commonly used to categorize, display, and summarize data. Inferential statistics can be used to make predictions based on a sample obtained from a population or some large body of information. It is these inferences that are used to test specific research hypotheses. This 2-part review will outline important features of descriptive and inferential statistics as they apply to commonly conducted research studies in the biomedical literature. Part 1 in this issue will discuss fundamental topics of statistics and data analysis. Additionally, some of the most commonly used statistical tests found in the biomedical literature will be reviewed in Part 2 in the February 2008 issue.

  3. Pulmonary ablation: a primer.

    Science.gov (United States)

    Roberton, Benjamin J; Liu, David; Power, Mark; Wan, John M C; Stuart, Sam; Klass, Darren; Yee, John

    2014-05-01

    Percutaneous image-guided thermal ablation is safe and efficacious in achieving local control and improving outcome in the treatment of both early stage non-small-cell lung cancer and pulmonary metastatic disease, in which surgical treatment is precluded by comorbidity, poor cardiorespiratory reserve, or unfavorable disease distribution. Radiofrequency ablation is the most established technology, but new thermal ablation technologies such as microwave ablation and cryoablation may offer some advantages. The use of advanced techniques, such as induced pneumothorax and the popsicle stick technique, or combining thermal ablation with radiotherapy, widens the treatment options available to the multidisciplinary team. The intent of this article is to provide the reader with a practical knowledge base of pulmonary ablation by concentrating on indications, techniques, and follow-up. Copyright © 2014 Canadian Association of Radiologists. Published by Elsevier Inc. All rights reserved.

  4. Double Degenerate Stars

    International Nuclear Information System (INIS)

    Xin-Lian, Luo; Hua, Bai; Lei, Zhao

    2008-01-01

    Regardless of the formation mechanism, an exotic object, the double degenerate star (DDS), is introduced and investigated, which is composed of baryonic matter and some unknown fermion dark matter. Different from the simple white dwarfs (WDs), there is additional gravitational force provided by the unknown fermion component inside DDSs, which may strongly affect the structure and the stability of such kind of objects. Many possible and strange observational phenomena connecting with them are concisely discussed. Similar to the normal WD, this object can also experience thermonuclear explosion as type Ia supernova explosion when DDS's mass exceeds the maximum mass that can be supported by electron degeneracy pressure. However, since the total mass of baryonic matter can be much lower than that of WD at Chandrasekhar mass limit, the peak luminosity should be much dimmer than what we expect before, which may throw a slight shadow on the standard candle of SN Ia in the research of cosmology. (general)

  5. A primer on metagenomics.

    Directory of Open Access Journals (Sweden)

    John C Wooley

    2010-02-01

    Full Text Available Metagenomics is a discipline that enables the genomic study of uncultured microorganisms. Faster, cheaper sequencing technologies and the ability to sequence uncultured microbes sampled directly from their habitats are expanding and transforming our view of the microbial world. Distilling meaningful information from the millions of new genomic sequences presents a serious challenge to bioinformaticians. In cultured microbes, the genomic data come from a single clone, making sequence assembly and annotation tractable. In metagenomics, the data come from heterogeneous microbial communities, sometimes containing more than 10,000 species, with the sequence data being noisy and partial. From sampling, to assembly, to gene calling and function prediction, bioinformatics faces new demands in interpreting voluminous, noisy, and often partial sequence data. Although metagenomics is a relative newcomer to science, the past few years have seen an explosion in computational methods applied to metagenomic-based research. It is therefore not within the scope of this article to provide an exhaustive review. Rather, we provide here a concise yet comprehensive introduction to the current computational requirements presented by metagenomics, and review the recent progress made. We also note whether there is software that implements any of the methods presented here, and briefly review its utility. Nevertheless, it would be useful if readers of this article would avail themselves of the comment section provided by this journal, and relate their own experiences. Finally, the last section of this article provides a few representative studies illustrating different facets of recent scientific discoveries made using metagenomics.

  6. Canadian municipal carbon trading primer

    International Nuclear Information System (INIS)

    Seskus, A.

    2002-01-01

    The trading of greenhouse gas (GHG) emissions is being suggested as an effective economic way to meet Canada's Kyoto target. Emissions trading is a market-based instrument that can help achieve environmental improvements while using the market to absorb the economical and effective measures to achieve emissions reductions. Placing a value on emissions means that in order to minimize costs, companies will be motivated to apply the lowest-cost emission reductions possible for regulatory approval. The two main types of emissions trading that exist in Canada are the trading of emissions that lead to the formation of smog or acid rain, and the trading of greenhouse gas emissions that lead to climate change. Since carbon dioxide is the most prevalent GHG, making up approximately 75 per cent of Canadian GHG emissions, the trading of units of GHGs is often referred to as carbon trading. The impact that emissions trading will have on municipal operations was the focus of this primer. The trading of GHG involves buying and selling of allowances of GHGs between contracting parties, usually between one party that is short of GHG credits and another that has excess credits. The 3 common approaches to emissions trading include allowance trading (cap and trade), credit trading (baseline and credit), and a hybrid system which combines both credit and allowance trading systems. The issues that impact municipalities include the debate regarding who owns the credits from landfills, particularly if power is generated using landfill gas and the power is sold as green power. Other viable questions were also addressed, including who can claim emission reduction credits if a city implements energy efficiency projects, or fuel substitution programs. Also, will municipalities be allowed to trade internationally, for example, with municipalities in the United States, and how should they spend their money earned from selling credits. This report also presents highlights from 3 emissions

  7. Performance testing of lead free primers: blast waves, velocity variations, and environmental testing

    OpenAIRE

    Courtney, Elya; Courtney, Amy; Summer, Peter David; Courtney, Michael

    2014-01-01

    Results are presented for lead free primers based on diazodinitrophenol (DDNP)compared with tests on lead styphnate based primers. First, barrel friction measurements in 5.56 mm NATO are presented. Second, shot to shot variations in blast waves are presented as determined by detonating primers in a 7.62x51mm rifle chamber with a firing pin, but without any powder or bullet loaded and measuring the blast wave at the muzzle with a high speed pressure transducer. Third, variations in primer blas...

  8. A temperature-tolerant multiplex elements and genes screening system for genetically modified organisms based on dual priming oligonucleotide primers and capillary electrophoresis.

    Science.gov (United States)

    Fu, Wei; Wei, Shuang; Wang, Chenguang; Du, Zhixin; Zhu, Pengyu; Wu, Xiyang; Wu, Gang; Zhu, Shuifang

    2017-08-15

    High throughput screening systems are the preferred solution to meet the urgent requirement of increasing number of genetically modified organisms (GMOs). In this study, we have successfully developed a multiplex GMO element screening system with dual priming oligonucleotide (DPO) primers. This system can detect the cauliflower mosaic virus 35S (CaMV 35S), terminator of nopaline synthase gene (NOS), figwort mosaic virus 35S (FMV 35S) promoter, neomycin phosphotransferaseII (NPTII), Bt Cry 1Ab, phosphinothricin acetyltransferase genes (bar) and Streptomyces viridochromogenes (pat) simultaneously, which covers more than 90% of all authorized GMO species worldwide. This system exhibits a high tolerance to annealing temperatures, high specificity and a limit of detection equal to conventional PCR. A total of 214 samples from markets, national entry-exit agencies, the Institute for Reference Materials and Measurement (IRMM) and the American Oil Chemists' Society (AOCS) were also tested for applicability. This screening system is therefore suitable for GMO screening. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. [Lattice degeneration of the retina].

    Science.gov (United States)

    Boĭko, E V; Suetov, A A; Mal'tsev, D S

    2014-01-01

    Lattice degeneration of the retina is a clinically important type of peripheral retinal dystrophies due to its participation in the pathogenesis of rhegmatogenous retinal detachment. In spite of extensive epidemiological, morphological, and clinical data, the question on causes of this particular type of retinal dystrophies currently remains debatable. Existing hypotheses on pathogenesis of retinal structural changes in lattice degeneration explain it to a certain extent. In clinical ophthalmology it is necessary to pay close attention to this kind of degenerations and distinguish between cases requiring preventive treatment and those requiring monitoring.

  10. Macular degeneration - age-related

    Science.gov (United States)

    ... AMD occurs when the blood vessels under the macula become thin and brittle. Small yellow deposits, called drusen, form. Almost all people with macular degeneration start with the dry form. Wet AMD occurs ...

  11. Systems biology-based analysis implicates a novel role for vitamin D metabolism in the pathogenesis of age-related macular degeneration

    Directory of Open Access Journals (Sweden)

    Morrison Margaux A

    2011-10-01

    Full Text Available Abstract Vitamin D has been shown to have anti-angiogenic properties and to play a protective role in several types of cancer, including breast, prostate and cutaneous melanoma. Similarly, vitamin D levels have been shown to be protective for risk of a number of conditions, including cardiovascular disease and chronic kidney disease, as well as numerous autoimmune disorders such as multiple sclerosis, inflammatory bowel diseases and type 1 diabetes mellitus. A study performed by Parekh et al. was the first to suggest a role for vitamin D in age-related macular degeneration (AMD and showed a correlation between reduced serum vitamin D levels and risk for early AMD. Based on this study and the protective role of vitamin D in diseases with similar pathophysiology to AMD, we examined the role of vitamin D in a family-based cohort of 481 sibling pairs. Using extremely phenotypically discordant sibling pairs, initially we evaluated the association of neovascular AMD and vitamin D/sunlight-related epidemiological factors. After controlling for established AMD risk factors, including polymorphisms of the genes encoding complement factor H (CFH and age-related maculopathy susceptibility 2/HtrA serine peptidase (ARMS2/HTRA1, and smoking history, we found that ultraviolet irradiance was protective for the development of neovascular AMD (p = 0.001. Although evaluation of serum vitamin D levels (25-hydroxyvitamin D [25(OHD] was higher in unaffected individuals than in their affected siblings, this finding did not reach statistical significance. Based on the relationship between ultraviolet irradiance and vitamin D production, we employed a candidate gene approach for evaluating common variation in key vitamin D pathway genes (the genes encoding the vitamin D receptor [VDR]; cytochrome P450, family 27, subfamily B, polypeptide 1 [CYP27B1]; cytochrome P450, family 24, subfamily A, polypeptide 1 [CYP24A1]; and CYP27A1 in this same family-based cohort. Initial

  12. A primer of multivariate statistics

    CERN Document Server

    Harris, Richard J

    2014-01-01

    Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why

  13. Primer on CDM programme of activities

    Energy Technology Data Exchange (ETDEWEB)

    Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)

    2009-07-01

    As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)

  14. Computed tomography of Wallerian degeneration

    International Nuclear Information System (INIS)

    Uchino, Akira; Maeda, Fumihiko

    1986-01-01

    CT findings of wallerian degeneration of the pyramidal tract at the midbrain (atrophy of cerebral peduncle following cerebrovascular accident) were studied in 34 patients (44 CT scans) with old cerebrovascular accidents. Severe atrophy of cerebral peduncle was noted when the ipsilateral motor cortex was involved. However, when the posterior limb of the internal capsule was involved, atrophy of the ipsilateral cerebral peduncle was mild. In this series, the shortest interval between cerebrovascular accident and wallerian degeneration was 8 month. (author)

  15. Detection of subgenomic mRNA of feline coronavirus by real-time polymerase chain reaction based on primer-probe energy transfer (P-sg-QPCR).

    Science.gov (United States)

    Hornyák, Akos; Bálint, Adám; Farsang, Attila; Balka, Gyula; Hakhverdyan, Mikhayil; Rasmussen, Thomas Bruun; Blomberg, Jonas; Belák, Sándor

    2012-05-01

    Feline infectious peritonitis is one of the most severe devastating diseases of the Felidae. Upon the appearance of clinical signs, a cure for the infected animal is impossible. Therefore rapid and proper diagnosis for both the presence of the causative agent, feline coronavirus (FCoV) and the manifestation of feline infectious peritonitis is of paramount importance. In the present work, a novel real-time RT-PCR method is described which is able to detect FCoV and to determine simultaneously the quantity of the viral RNA. The new assay combines the M gene subgenomic messenger RNA (sg-mRNA) detection and the quantitation of the genome copies of FCoV. In order to detect the broadest spectrum of potential FCoV variants and to achieve the most accurate results in the detection ability the new assay is applying the primer-probe energy transfer (PriProET) principle. This technology was chosen since PriProET is very robust to tolerate the nucleotide substitutions in the target area. Therefore, this technology provides a very broad-range system, which is able to detect simultaneously many variants of the virus(es) even if the target genomic regions show large scale of variations. The detection specificity of the new assay was proven by positive amplification from a set of nine different FCoV strains and negative from the tested non-coronaviral targets. Examination of faecal samples of healthy young cats, organ samples of perished animals, which suffered from feline infectious peritonitis, and cat leukocytes from uncertain clinical cases were also subjected to the assay. The sensitivity of the P-sg-QPCR method was high, since as few as 10 genome copies of FCoV were detected. The quantitative sg-mRNA detection method revealed more than 10-50,000 times increase of the M gene sg-mRNA in organ materials of feline infectious peritonitis cases, compared to those of the enteric FCoV variants present in the faeces of normal, healthy cats. These results indicate the applicability of

  16. What Is Age-Related Macular Degeneration?

    Science.gov (United States)

    ... Eye Health / Eye Health A-Z Age-Related Macular Degeneration Sections What Is Macular Degeneration? How is AMD ... What Does Macular Degeneration Look Like? What Is Macular Degeneration? Leer en Español: ¿Qué es la degeneración macular ...

  17. Is the transport of a gadolinium-based contrast agent decreased in a degenerated or aged disc? A post contrast MRI study.

    Directory of Open Access Journals (Sweden)

    Marta Tibiletti

    Full Text Available A post contrast magnetic resonance imaging study has been performed in a wide population of low back pain patients to investigate which radiological and phenotypic characteristics influence the penetration of the contrast agent in lumbar discs in vivo. 37 patients affected by different pathologies (disc herniation, spondylolisthesis, foraminal stenosis, central canal stenosis were enrolled in the study. The selected population included 26 male and 11 female subjects, with a mean age of 42.4 ± 9.3 years (range 18-60. Magnetic resonance images of the lumbar spine were obtained with a 1.5 T scanner (Avanto, Siemens, Erlangen, Germany with a phased-array back coil. A paramagnetic non-ionic contrast agent was injected with a dose of 0.4 ml/kg. T1-weighted magnetic resonance images were subsequently acquired at 5 time points, 5 and 10 minutes, 2, 4 and 6 hours after injection. Endplates presented clear enhancement already 5 minutes after injection, and showed an increase in the next 2 hours followed by a decrease. At 5 and 10 minutes, virtually no contrast medium was present inside the intervertebral disc; afterwards, enhancement significantly increased. Highly degenerated discs showed higher enhancement in comparison with low and medium degenerated discs. Discs classified as Pfirrmann 5 showed a statistically significant higher enhancement than Pfirrmann 1, 2 and 3 at all time points but the first one, possibly due to vascularization. Disc height collapse and Modic changes significantly increased enhancement. Presence of endplate defects did not show any significant influence on post contrast enhancement, but the lack of a clear classification of endplate defects as seen on magnetic resonance scans may be shadowing some effects. In conclusion, disc height, high level of degeneration and presence of Modic changes are factors which increase post contrast enhancement in the intervertebral disc. The effect of age could not be demonstrated.

  18. The role of the carotenoids, lutein and zeaxanthin, in protecting against age-related macular degeneration: A review based on controversial evidence

    Directory of Open Access Journals (Sweden)

    Sacu Stefan

    2003-12-01

    Full Text Available Abstract Purpose A review of the role of the carotenoids, lutein and zeaxanthin, and their function in altering the pathogenesis of age-related macular degeneration (AMD. Methods Medline and Embase search. Results Recent evidence introduces the possibility that lutein and zeaxanthin, carotenoids found in a variety of fruits and vegetables may protect against the common eye disease of macular degeneration. This potential and the lack to slow the progression of macular degeneration, has fueled high public interest in the health benefits of these carotenoids and prompted their inclusion in various supplements. The body of evidence supporting a role in this disease ranges from basic studies in experimental animals to various other clinical and epidemiological studies. Whilst some epidemiological studies suggest a beneficial role for carotenoids in the prevention of AMD, others are found to be unrelated to it. Results of some clinical studies indicate that the risk for AMD is reduced when levels of the carotenoids are elevated in the serum or diet, but this correlation is not observed in other studies. Published data concerning the toxicity of the carotenoids or the optimum dosage of these supplements is lacking. Conclusion An intake of dietary supplied nutrients rich in the carotenoids, lutein and zeaxanthin, appears to be beneficial in protecting retinal tissues, but this is not proven. Until scientifically sound knowledge is available we recommend for patients judged to be at risk for AMD to: alter their diet to more dark green leafy vegetables, wear UV protective lenses and a hat when outdoors. Future investigations on the role of nutrition, light exposure, genetics, and combinations of photodynamic therapy with intravitreal steroid (triamcinolone-acetonide injections hold potential for future treatment possibilities.

  19. The role of the carotenoids, lutein and zeaxanthin, in protecting against age-related macular degeneration: a review based on controversial evidence.

    Science.gov (United States)

    Mozaffarieh, Maneli; Sacu, Stefan; Wedrich, Andreas

    2003-12-11

    A review of the role of the carotenoids, lutein and zeaxanthin, and their function in altering the pathogenesis of age-related macular degeneration (AMD). Medline and Embase search. Recent evidence introduces the possibility that lutein and zeaxanthin, carotenoids found in a variety of fruits and vegetables may protect against the common eye disease of macular degeneration. This potential and the lack to slow the progression of macular degeneration, has fueled high public interest in the health benefits of these carotenoids and prompted their inclusion in various supplements. The body of evidence supporting a role in this disease ranges from basic studies in experimental animals to various other clinical and epidemiological studies. Whilst some epidemiological studies suggest a beneficial role for carotenoids in the prevention of AMD, others are found to be unrelated to it. Results of some clinical studies indicate that the risk for AMD is reduced when levels of the carotenoids are elevated in the serum or diet, but this correlation is not observed in other studies. Published data concerning the toxicity of the carotenoids or the optimum dosage of these supplements is lacking. An intake of dietary supplied nutrients rich in the carotenoids, lutein and zeaxanthin, appears to be beneficial in protecting retinal tissues, but this is not proven. Until scientifically sound knowledge is available we recommend for patients judged to be at risk for AMD to: alter their diet to more dark green leafy vegetables, wear UV protective lenses and a hat when outdoors. Future investigations on the role of nutrition, light exposure, genetics, and combinations of photodynamic therapy with intravitreal steroid (triamcinolone-acetonide) injections hold potential for future treatment possibilities.

  20. The brain basis of musicophilia: evidence from frontotemporal lobar degeneration

    OpenAIRE

    Phillip David Fletcher; Laura eDowney; Pirada eWitoonpanich; Jason eWarren

    2013-01-01

    Musicophilia, or abnormal craving for music, is a poorly understood phenomenon that has been associated in particular with focal degeneration of the temporal lobes. Here we addressed the brain basis of musicophilia using voxel-based morphometry (VBM) on MR volumetric brain images in a retrospectively ascertained cohort of patients meeting clinical consensus criteria for frontotemporal lobar degeneration: of 37 cases ascertained, 12 had musicophilia and 25 did not exhibit the phenomenon. The s...

  1. Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

    Science.gov (United States)

    Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

    2018-03-01

    Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

  2. The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers

    Science.gov (United States)

    Danford, M. D.; Mendrek, M. J.; Walsh, D. W.

    1995-01-01

    The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

  3. KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

    International Nuclear Information System (INIS)

    Bowman, Stephen M.

    2008-01-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

  4. Single primer amplification reaction methods reveal exotic and ...

    Indian Academy of Sciences (India)

    Unknown

    mulberry varieties using three different PCR based single primer amplification ..... the results of a multi- variate analysis using Mahalanobis D2 statistic in case of .... Rajan M V, Chaturvedi H K and Sarkar A 1997 Multivariate analysis as an aid ...

  5. Using Patient-Specific Induced Pluripotent Stem Cells and Wild-Type Mice to Develop a Gene Augmentation-Based Strategy to Treat CLN3-Associated Retinal Degeneration.

    Science.gov (United States)

    Wiley, Luke A; Burnight, Erin R; Drack, Arlene V; Banach, Bailey B; Ochoa, Dalyz; Cranston, Cathryn M; Madumba, Robert A; East, Jade S; Mullins, Robert F; Stone, Edwin M; Tucker, Budd A

    2016-10-01

    Juvenile neuronal ceroid lipofuscinosis (JNCL) is a childhood neurodegenerative disease with early-onset, severe central vision loss. Affected children develop seizures and CNS degeneration accompanied by severe motor and cognitive deficits. There is no cure for JNCL, and patients usually die during the second or third decade of life. In this study, independent lines of induced pluripotent stem cells (iPSCs) were generated from two patients with molecularly confirmed mutations in CLN3, the gene mutated in JNCL. Clinical-grade adeno-associated adenovirus serotype 2 (AAV2) carrying the full-length coding sequence of human CLN3 was generated in a U.S. Food and Drug Administration-registered cGMP facility. AAV2-CLN3 was efficacious in restoring full-length CLN3 transcript and protein in patient-specific fibroblasts and iPSC-derived retinal neurons. When injected into the subretinal space of wild-type mice, purified AAV2-CLN3 did not show any evidence of retinal toxicity. This study provides proof-of-principle for initiation of a clinical trial using AAV-mediated gene augmentation for the treatment of children with CLN3-associated retinal degeneration.

  6. Determination of source terms in a degenerate parabolic equation

    International Nuclear Information System (INIS)

    Cannarsa, P; Tort, J; Yamamoto, M

    2010-01-01

    In this paper, we prove Lipschitz stability results for inverse source problems relative to parabolic equations. We use the method introduced by Imanuvilov and Yamamoto in 1998 based on Carleman estimates. What is new here is that we study a class of one-dimensional degenerate parabolic equations. In our model, the diffusion coefficient vanishes at one extreme point of the domain. Instead of the classical Carleman estimates obtained by Fursikov and Imanuvilov for non degenerate equations, we use and extend some recent Carleman estimates for degenerate equations obtained by Cannarsa, Martinez and Vancostenoble. Finally, we obtain Lipschitz stability results in inverse source problems for our class of degenerate parabolic equations both in the case of a boundary observation and in the case of a locally distributed observation

  7. A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

    Directory of Open Access Journals (Sweden)

    Dunn Sade N

    2008-06-01

    Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

  8. PHUSER (Primer Help for USER): a novel tool for USER fusion primer design

    DEFF Research Database (Denmark)

    Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads

    2011-01-01

    containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (Tm), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers...

  9. ANT: Software for Generating and Evaluating Degenerate Codons for Natural and Expanded Genetic Codes.

    Science.gov (United States)

    Engqvist, Martin K M; Nielsen, Jens

    2015-08-21

    The Ambiguous Nucleotide Tool (ANT) is a desktop application that generates and evaluates degenerate codons. Degenerate codons are used to represent DNA positions that have multiple possible nucleotide alternatives. This is useful for protein engineering and directed evolution, where primers specified with degenerate codons are used as a basis for generating libraries of protein sequences. ANT is intuitive and can be used in a graphical user interface or by interacting with the code through a defined application programming interface. ANT comes with full support for nonstandard, user-defined, or expanded genetic codes (translation tables), which is important because synthetic biology is being applied to an ever widening range of natural and engineered organisms. The Python source code for ANT is freely distributed so that it may be used without restriction, modified, and incorporated in other software or custom data pipelines.

  10. A primer on pseudorandom generators

    CERN Document Server

    Goldreich, Oded

    2010-01-01

    A fresh look at the question of randomness was taken in the theory of computing: A distribution is pseudorandom if it cannot be distinguished from the uniform distribution by any efficient procedure. This paradigm, originally associating efficient procedures with polynomial-time algorithms, has been applied with respect to a variety of natural classes of distinguishing procedures. The resulting theory of pseudorandomness is relevant to science at large and is closely related to central areas of computer science, such as algorithmic design, complexity theory, and cryptography. This primer surveys the theory of pseudorandomness, starting with the general paradigm, and discussing various incarnations while emphasizing the case of general-purpose pseudorandom generators (withstanding any polynomial-time distinguisher). Additional topics include the "derandomization" of arbitrary probabilistic polynomial-time algorithms, pseudorandom generators withstanding space-bounded distinguishers, and several natural notions...

  11. A primer on quantum fluids

    CERN Document Server

    Barenghi, Carlo

    2016-01-01

    The aim of this primer is to cover the essential theoretical information, quickly and concisely, in order to enable senior undergraduate and beginning graduate students to tackle projects in topical research areas of quantum fluids, for example, solitons, vortices and collective modes. The selection of the material, both regarding the content and level of presentation, draws on the authors analysis of the success of relevant research projects with newcomers to the field, as well as of the students feedback from many taught and self-study courses on the subject matter. Starting with a brief historical overview, this text covers particle statistics, weakly interacting condensates and their dynamics and finally superfluid helium and quantum turbulence. At the end of each chapter (apart from the first) there will be some exercises. Detailed solutions can be made available to instructors upon request to the authors. .

  12. 30 CFR 57.6304 - Primer protection.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a...

  13. Rapid identification of probiotic Lactobacillus species by multiplex PCR using species-specific primers based on the region extending from 16S rRNA through 23S rRNA.

    Science.gov (United States)

    Kwon, Hyuk-Sang; Yang, Eun-Hee; Yeon, Seung-Woo; Kang, Byoung-Hwa; Kim, Tae-Yong

    2004-10-15

    This study aimed to develop a novel multiplex polymerase chain reaction (PCR) primer set for the identification of seven probiotic Lactobacillus species such as Lactobacillus acidophilus, Lactobacillus delbrueckii, Lactobacillus casei, Lactobacillus gasseri, Lactobacillus plantarum, Lactobacillus reuteri and Lactobacillus rhamnosus. The primer set, comprising of seven specific and two conserved primers, was derived from the integrated sequences of 16S and 23S rRNA genes and their rRNA intergenic spacer region of each species. It was able to identify the seven target species with 93.6% accuracy, which exceeds that of the general biochemical methods. The phylogenetic analyses, using 16S rDNA sequences of the probiotic isolates, also provided further support that the results from the multiplex PCR assay were trustworthy. Taken together, we suggest that the multiplex primer set is an efficient tool for simple, rapid and reliable identification of seven Lactobacillus species.

  14. Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

    Science.gov (United States)

    Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

    2018-01-01

    Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

  15. Risk of retinal detachment in patients with lattice degeneration.

    Science.gov (United States)

    Sasaki, K; Ideta, H; Yonemoto, J; Tanaka, S; Hirose, A; Oka, C

    1998-01-01

    To determine the risk of retinal detachment in patients with lattice degeneration of the retina, we statistically analyzed the incidence of retinal detachment in these patients. The data of hospital patients with retinal detachment associated with lattice degeneration in Kumamoto Prefecture, Japan, in 1990 were collected. The prevalence of lattice degeneration in Kumamoto was reported to be 9.5% in 1980. Based on population data from the 1990 census, the cumulative incidence of retinal detachment associated with lattice degeneration was calculated in this study. Among 1,840,000 residents in Kumamoto, there were 110 patients with retinal detachment associated with lattice degeneration; 72 with detachment resulting from tractional tears (tears), and 38 with detachment from atrophic holes. The cumulative incidence of retinal detachment from atrophic holes was 1.5% at the age of 40 years; from tears it was 3.6% at the age of 80 years. The cumulative incidence of detachment from both atrophic holes and tears was 5.3% at the age of 80 years. The results of this study are useful for clarifying the natural course of lattice degeneration.

  16. MCNPTM criticality primer and training experiences

    International Nuclear Information System (INIS)

    Briesmeister, J.; Forster, R.A.; Busch, R.

    1995-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, the analyst may have little experience with the specific codes available at his or her facility. Usually, the codes are quite complex, black boxes capable of analyzing numerous problems with a myriad of input options. Documentation for these codes is designed to cover all the possible configurations and types of analyses but does not give much detail on any particular type of analysis. For criticality calculations, the user of a code is primarily interested in the value of the effective multiplication factor for a system (k eff ). Most codes will provide this, and truckloads of other information that may be less pertinent to criticality calculations. Based on discussions with code users in the nuclear criticality safety community, it was decided that a simple document discussing the ins and outs of criticality calculations with specific codes would be quite useful. The Transport Methods Group, XTM, at Los Alamos National Laboratory (LANL) decided to develop a primer for criticality calculations with their Monte Carlo code, MCNP. This was a joint task between LANL with a knowledge and understanding of the nuances and capabilities of MCNP and the University of New Mexico with a knowledge and understanding of nuclear criticality safety calculations and educating first time users of neutronics calculations. The initial problem was that the MCNP manual just contained too much information. Almost everything one needs to know about MCNP can be found in the manual; the problem is that there is more information than a user requires to do a simple k eff calculation. The basic concept of the primer was to distill the manual to create a document whose only focus was criticality calculations using MCNP

  17. KULTUR PRIMER FIBROBLAS: PENELITIAN PENDAHULUAN

    Directory of Open Access Journals (Sweden)

    Yuli Kurniawati

    2015-05-01

    Full Text Available AbstrakKultur sel fibroblas banyak digunakan untuk penelitian proses penyembuhan luka dan penuaankulit. Metode ini digunakan untuk melihat perkembangan sel, proliferasi kinetik seluler, sertabiosintesis komponen matriks ekstraseluler. Penelitian pendahuluan ini dilakukan untuk optimasiteknik laboratorium serta berbagai kendala yang didapatkan saat kultur fibroblas. Kultur primerfibroblas dibagi menjadi 2 jenis sampel yaitu sampel yang berasal dari embrio mencit usia 7,5–9,5 hari, dan kulit pasien keloid. Sampel dari embrio mencit dilakukan kultur primer denganmetode dissociated fibroblast. Sampel jaringan keloid dan kulit normal dikultur dengan metodeskin explant. Fibroblas yang berasal dari kultur primer embrio mencit tumbuh baik sehinggadapat dilakukan subkultur dan disimpan di dalam nitrogen cair suhu -198°C. Fibroblas yangberasal dari sampel keloid pertama tumbuh sesuai pola pertumbuhan fibroblas, namun padasampel kedua terdapat kontaminasi Paecilomyces sp. yang merupakan salah satu jenis jamurkontaminan. Sel fibroblas mudah untuk dikultur karena memiliki kemampuan tumbuh danmelekat yang tinggi serta regenerasi cepat, namun penelitian lebih lanjut untuk optimasi teknikkultur dan pencegahan kontaminasi masih dibutuhkan sehingga sel dapat tumbuh baik.AbstractFibroblast cell culture method has been used for wound healing and skin aging studies. Thismethod was used for cell development imaging study, celullar kinetic proliferation andextracelullar matrix component biosynthesis. This preeliminary study was done for laboratoricaltechnic optimation as well as problems appeared in fibroblast culture. Fibroblasts primary culturewas divided into 2 type of samples, from 7.5-9.5-day-mice embryo and keloid-patient skin.Primary culture with dissociated fibroblast method was done for mice embryo sample. Keloidtissue sample and normal skin were cultured with skin explant method. Fibroblasts that weretaken from mice embryo primary culture grew well

  18. Multi-criteria clinical decision support: A primer on the use of multiple criteria decision making methods to promote evidence-based, patient-centered healthcare.

    Science.gov (United States)

    Dolan, James G

    2010-01-01

    Current models of healthcare quality recommend that patient management decisions be evidence-based and patient-centered. Evidence-based decisions require a thorough understanding of current information regarding the natural history of disease and the anticipated outcomes of different management options. Patient-centered decisions incorporate patient preferences, values, and unique personal circumstances into the decision making process and actively involve both patients along with health care providers as much as possible. Fundamentally, therefore, evidence-based, patient-centered decisions are multi-dimensional and typically involve multiple decision makers.Advances in the decision sciences have led to the development of a number of multiple criteria decision making methods. These multi-criteria methods are designed to help people make better choices when faced with complex decisions involving several dimensions. They are especially helpful when there is a need to combine "hard data" with subjective preferences, to make trade-offs between desired outcomes, and to involve multiple decision makers. Evidence-based, patient-centered clinical decision making has all of these characteristics. This close match suggests that clinical decision support systems based on multi-criteria decision making techniques have the potential to enable patients and providers to carry out the tasks required to implement evidence-based, patient-centered care effectively and efficiently in clinical settings.The goal of this paper is to give readers a general introduction to the range of multi-criteria methods available and show how they could be used to support clinical decision-making. Methods discussed include the balance sheet, the even swap method, ordinal ranking methods, direct weighting methods, multi-attribute decision analysis, and the analytic hierarchy process (AHP).

  19. Value-Based Payment Reform and the Medicare Access and Children's Health Insurance Program Reauthorization Act of 2015: A Primer for Plastic Surgeons.

    Science.gov (United States)

    Squitieri, Lee; Chung, Kevin C

    2017-07-01

    In 2015, the U.S. Congress passed the Medicare Access and Children's Health Insurance Program Reauthorization Act, which effectively repealed the Centers for Medicare and Medicaid Services sustainable growth rate formula and established the Centers for Medicare and Medicaid Services Quality Payment Program. The Medicare Access and Children's Health Insurance Program Reauthorization Act represents an unparalleled acceleration toward value-based payment models and a departure from traditional volume-driven fee-for-service reimbursement. The Quality Payment Program includes two paths for provider participation: the Merit-Based Incentive Payment System and Advanced Alternative Payment Models. The Merit-Based Incentive Payment System pathway replaces existing quality reporting programs and adds several new measures to create a composite performance score for each provider (or provider group) that will be used to adjust reimbursed payment. The advanced alternative payment model pathway is available to providers who participate in qualifying Advanced Alternative Payment Models and is associated with an initial 5 percent payment incentive. The first performance period for the Merit-Based Incentive Payment System opens January 1, 2017, and closes on December 31, 2017, and is associated with payment adjustments in January of 2019. The Centers for Medicare and Medicaid Services estimates that the majority of providers will begin participation in 2017 through the Merit-Based Incentive Payment System pathway, but aims to have 50 percent of payments tied to quality or value through Advanced Alternative Payment Models by 2018. In this article, the authors describe key components of the Medicare Access and Children's Health Insurance Program Reauthorization Act to providers navigating through the Quality Payment Program and discuss how plastic surgeons may optimize their performance in this new value-based payment program.

  20. Bioinspired Catecholic Primers for Rigid and Ductile Dental Resin Composites.

    Science.gov (United States)

    Shin, Eeseul; Ju, Sung Won; An, Larry; Ahn, Eungjin; Ahn, Jin-Soo; Kim, Byeong-Su; Ahn, B Kollbe

    2018-01-17

    In the construction of dental restorative polymer composite materials, surface priming on mineral fillers is essential to improve the mechanical performance of the composites. Here we present bioinspired catechol-functionalized primers for a tougher dental resin composite containing glass fillers. The catecholic primers with different polymerizable end groups were designed and then coated on glass surfaces using a simple drop-casting or dip-coating process. The surface binding ability and possible cross-linking (coupling or chemical bridging between the glass substrate and the dental resin) of the catecholic bifunctional primers were evaluated using atomic force microscopy, contact angle measurements, and the knife shear bonding test and compared to a state-of-the-art silane-based coupling agent. Various mechanical tests including shrinkage and compression tests of the dental resin composites were also conducted. Compression tests of the composites containing the catecholic primed fillers exhibited enhanced mechanical properties, owing to the bidentate hydrogen bonding of catechol moieties to the oxide mineral surface. Furthermore, the superior biocompatibility of the primed surface was confirmed via cell attachment assay, thus providing applicability of catecholic primers for practical dental and biomedical applications.

  1. Development of a real-time RT-PCR assay based on primer-probe energy transfer for the detection of all serotypes of bluetongue virus

    DEFF Research Database (Denmark)

    Leblanc, N; Rasmussen, Thomas Bruun; Fernandez, J

    2010-01-01

    A real-time RT-PCR assay based on the primer–probe energy transfer (PriProET) was developed to detect all 24 serotypes of bluetongue virus (BTV). BTV causes serious disease, primarily in sheep, but in other ruminants as well. A distinguishing characteristic of the assay is its tolerance toward...

  2. Degenerated differential pair with controllable transconductance

    NARCIS (Netherlands)

    Mensink, Clemens; Mensink, Clemens H.J.; Nauta, Bram

    1998-01-01

    A differential pair with input transistors and provided with a variable degeneration resistor. The degeneration resistor comprises a series arrangement of two branches of coupled resistors which are shunted in mutually corresponding points by respective control transistors whose gates are

  3. Thinking in systems a primer

    CERN Document Server

    Meadows, Donella H

    2008-01-01

    In the years following her role as the lead author of the international bestseller, "Limits to Growth"-the first book to show the consequences of unchecked growth on a finite planet- Donella Meadows remained a pioneer of environmental and social analysis until her untimely death in 2001. Meadows' newly released manuscript, "Thinking in Systems", is a concise and crucial book offering insight for problem solving on scales ranging from the personal to the global. Edited by the Sustainability Institute's Diana Wright, this essential primer brings systems thinking out of the realm of computers and equations and into the tangible world, showing readers how to develop the systems-thinking skills that thought leaders across the globe consider critical for 21st-century life. Some of the biggest problems facing the world-war, hunger, poverty, and environmental degradation-are essentially system failures. They cannot be solved by fixing one piece in isolation from the others, because even seemingly minor details have e...

  4. Primer on spontaneous heating and pyrophoricity

    Energy Technology Data Exchange (ETDEWEB)

    1994-12-01

    This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

  5. Self-Testing of Vision in Age-Related Macula Degeneration: A Longitudinal Pilot Study Using a Smartphone-Based Rarebit Test

    Directory of Open Access Journals (Sweden)

    Christina Winther

    2015-01-01

    Full Text Available Purpose. There is a need for efficient self-tests of vision in patients with neovascular age-related macula degeneration. A new tablet/smartphone application aiming to meet this need is described and its performance is assessed in a longitudinal pilot study. Materials and Methods. The new MultiBit Test (MBT employs segmented digits defined by rarebits, that is, receptive field-size bright dots briefly presented against a dark background. The number of rarebits per digit segment was varied in a cyclic fashion, in preset steps. There were no fixation demands. Twenty-eight patients with neovascular AMD of varying severity were monitored for an average of 30 weeks. Test scores were evaluated on an individual basis, by contrasting observed trends with the clinical status recorded at independently scheduled clinical examinations. Results. Serial plots of MBT results revealed gradual improvement after successful antineovascular treatment. Recurrences were signalled by gradual deteriorations of results. Test results remained stable during clinically stable time intervals. MBT results agreed well with clinical assessments whereas an acuity test performed at chance level. The MBT was well accepted by all subjects. Conclusions. The MBT appears to have a good potential for effective self-testing of vision in AMD and merits large-scale studies. Exploration of MBT performance with other forms of macula conditions may be worthwhile.

  6. Choice of Cell Source in Cell-Based Therapies for Retinal Damage due to Age-Related Macular Degeneration: A Review

    Directory of Open Access Journals (Sweden)

    Sudhakar John

    2013-01-01

    Full Text Available Background. Age-related macular degeneration (AMD is a complex disorder that affects primarily the macula involving the retinal pigment epithelium (RPE but also to a certain extent the photoreceptor layer and the retinal neurons. Cell transplantation is a promising option for AMD and clinical trials are underway using different cell types. Methods. We hypothesize that instead of focusing on a particular cell source for concurrent regeneration of all the retinal layers and also to prevent exhaustive research on an array of cell sources for regeneration of each layer, the choice should depend on, precisely, which layer is damaged. Results. Thus, for a damage limited to the retinal pigment epithelial (RPE layer, the choice we suggest would be RPE cells. When the damage extends to rods and cones, the choice would be bone marrow stem cells and when retinal neurons are involved, relatively immature stem cell populations with an inherent capacity to yield neuronal lineage such as hematopoietic stem cells, embryonic stem cells, or induced pluripotent stem cells can be tried. Conclusion. This short review will prove to be a valuable guideline for those working on cell therapy for AMD to plan their future directions of research and therapy for this condition.

  7. Improved detection of genetic markers of antimicrobial resistance by hybridization probe-based melting curve analysis using primers to mask proximal mutations: examples include the influenza H275Y substitution.

    Science.gov (United States)

    Whiley, David M; Jacob, Kevin; Nakos, Jennifer; Bletchly, Cheryl; Nimmo, Graeme R; Nissen, Michael D; Sloots, Theo P

    2012-06-01

    Numerous real-time PCR assays have been described for detection of the influenza A H275Y alteration. However, the performance of these methods can be undermined by sequence variation in the regions flanking the codon of interest. This is a problem encountered more broadly in microbial diagnostics. In this study, we developed a modification of hybridization probe-based melting curve analysis, whereby primers are used to mask proximal mutations in the sequence targets of hybridization probes, so as to limit the potential for sequence variation to interfere with typing. The approach was applied to the H275Y alteration of the influenza A (H1N1) 2009 strain, as well as a Neisseria gonorrhoeae mutation associated with antimicrobial resistance. Assay performances were assessed using influenza A and N. gonorrhoeae strains characterized by DNA sequencing. The modified hybridization probe-based approach proved successful in limiting the effects of proximal mutations, with the results of melting curve analyses being 100% consistent with the results of DNA sequencing for all influenza A and N. gonorrhoeae strains tested. Notably, these included influenza A and N. gonorrhoeae strains exhibiting additional mutations in hybridization probe targets. Of particular interest was that the H275Y assay correctly typed influenza A strains harbouring a T822C nucleotide substitution, previously shown to interfere with H275Y typing methods. Overall our modified hybridization probe-based approach provides a simple means of circumventing problems caused by sequence variation, and offers improved detection of the influenza A H275Y alteration and potentially other resistance mechanisms.

  8. A practical primer on geostatistics

    Science.gov (United States)

    Olea, Ricardo A.

    2009-01-01

    has significant methodological implications.Historical Remarks—As a discipline, geostatistics was firmly established in the 1960s by the French engineer Georges Matheron, who was interested in the appraisal of ore reserves in mining. Geostatistics did not develop overnight. Like other disciplines, it has built on previous results, many of which were formulated with different objectives in various fields.Pioneers—Seminal ideas conceptually related to what today we call geostatistics or spatial statistics are found in the work of several pioneers, including: 1940s: A.N. Kolmogorov in turbulent flow and N. Wiener in stochastic processing; 1950s: D. Krige in mining; 1960s: B. Mathern in forestry and L.S. Gandin in meteorologyCalculations—Serious applications of geostatistics require the use of digital computers. Although for most geostatistical techniques rudimentary implementation from scratch is fairly straightforward, coding programs from scratch is recommended only as part of a practice that may help users to gain a better grasp of the formulations.Software—For professional work, the reader should employ software packages that have been thoroughly tested to handle any sampling scheme, that run as efficiently as possible, and that offer graphic capabilities for the analysis and display of results. This primer employs primarily the package Stanford Geomodeling Software (SGeMS) - recently developed at the Energy Resources Engineering Department at Stanford University - as a way to show how to obtain results practically. This applied side of the primer should not be interpreted as the notes being a manual for the use of SGeMS. The main objective of the primer is to help the reader gain an understanding of the fundamental concepts and tools in geostatistics.Organization of the Primer—The chapters of greatest importance are those covering kriging and simulation. All other materials are peripheral and are included for better comprehension of these main

  9. Tools for Ultraspecific Probe/Primer Design

    National Research Council Canada - National Science Library

    Fofanov, Yurly

    2006-01-01

    .... Our approach will deliver DNA probes and PCR primers that have an unprecedentedly low probability of false positives or confusion by environmental background, and which resist evasion by threat agent engineering...

  10. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)

    ES

    Bioinformatics is an emerging scientific discipline that uses information ... complex biological questions. ... and computer programs for various purposes of primer ..... polymerase chain reaction: Human Immunodeficiency Virus 1 model studies.

  11. Hexavalent Chromium IV-Free Primer Development

    Science.gov (United States)

    Alldredge, Michael J.; Buck, Amy L.

    2015-01-01

    Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.

  12. Quantitative Microbial Risk Assessment Tutorial - Primer

    Science.gov (United States)

    This document provides a Quantitative Microbial Risk Assessment (QMRA) primer that organizes QMRA tutorials. The tutorials describe functionality of a QMRA infrastructure, guide the user through software use and assessment options, provide step-by-step instructions for implementi...

  13. Menopause 101: A Primer for the Perimenopausal

    Science.gov (United States)

    ... Abstracts Media Award Recipients Media Policy Media Requests Menopause 101: A primer for the perimenopausal The information ... about 2 years earlier. Common Body Changes at Menopause Each woman’s experience of menopause is different. Many ...

  14. Multiplexing Short Primers for Viral Family PCR

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

    2008-06-26

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  15. Comparison of pedicle screw-based dynamic stabilization and fusion surgery in the treatment of radiographic adjacent-segment degeneration: a retrospective analysis of single L5-S1 degenerative spondylosis covering 4 years.

    Science.gov (United States)

    Han, Yu; Sun, Jianguang; Luo, Chenghan; Huang, Shilei; Li, Liren; Ji, Xiang; Duan, Xiaozong; Wang, Zhenqing; Pi, Guofu

    2016-12-01

    OBJECTIVE Pedicle screw-based dynamic spinal stabilization systems (PDSs) were devised to decrease, theoretically, the risk of long-term complications such as adjacent-segment degeneration (ASD) after lumbar fusion surgery. However, to date, there have been few studies that fully proved that a PDS can reduce the risk of ASD. The purpose of this study was to examine whether a PDS can influence the incidence of ASD and to discuss the surgical coping strategy for L5-S1 segmental spondylosis with preexisting L4-5 degeneration with no related symptoms or signs. METHODS This study retrospectively compared 62 cases of L5-S1 segmental spondylosis in patients who underwent posterior lumbar interbody fusion (n = 31) or K-Rod dynamic stabilization (n = 31) with a minimum of 4 years' follow-up. The authors measured the intervertebral heights and spinopelvic parameters on standing lateral radiographs and evaluated preexisting ASD on preoperative MR images using the modified Pfirrmann grading system. Radiographic ASD was evaluated according to the results of radiography during follow-up. RESULTS All 62 patients achieved remission of their neurological symptoms without surgical complications. The Kaplan-Meier curve and Cox proportional-hazards model showed no statistically significant differences between the 2 surgical groups in the incidence of radiographic ASD (p > 0.05). In contrast, the incidence of radiographic ASD was 8.75 times (95% CI 1.955-39.140; p = 0.005) higher in the patients with a preoperative modified Pfirrmann grade higher than 3 than it was in patients with a modified Pfirrmann grade of 3 or lower. In addition, no statistical significance was found for other risk factors such as age, sex, and spinopelvic parameters. CONCLUSIONS Pedicle screw-based dynamic spinal stabilization systems were not found to be superior to posterior lumbar interbody fusion in preventing radiographic ASD (L4-5) during the midterm follow-up. Preexisting ASD with a modified Pfirrmann

  16. Routes to effective evacuation planning primer series : evacuating populations with special needs.

    Science.gov (United States)

    2009-04-01

    Evacuation operations are conducted under the authority of, and based on decisions by, local and state authorities. The purpose of this primer, Evacuating Populations with Special Needs, is to provide local and state emergency managers, government of...

  17. Relativistic Astrophysics and Cosmology: A Primer

    International Nuclear Information System (INIS)

    Abramowicz, Marek A

    2007-01-01

    'Relativistic Astrophysics and Cosmology: A Primer' by Peter Hoyng, was published last year by Springer. The book is based on lectures given by the author at University of Utrecht to advanced undergraduates. This is a short and scholarly book. In about 300 pages, the author has covered the most interesting and important applications of Albert Einstein's general relativity in present-day astrophysics and cosmology: black holes, neutron stars, gravitational waves, and the cosmic microwave background. The book stresses theory, but also discusses several experimental and observational topics, such as the Gravity Probe B mission, interferometer detectors of gravitational waves and the power spectrum of the cosmic microwave background. The coverage is not uniform. Some topics are discussed in depth, others are only briefly mentioned. The book obviously reflects the author's own research interests and his preferences for specific mathematical methods, and the choice of the original artwork that illustrates the book (and appears on its cover) is a very personal one. I consider this personal touch an advantage, even if I do not always agree with the author's choices. For example, I employ Killing vectors as a very useful mathematical tool not only in my research on black holes, but also in my classes. I find that my students prefer it when discussions of particle, photon and fluid motion in the Schwarzschild and Kerr spacetimes are based explicitly and directly on the Killing vectors rather than on coordinate calculations. The latter approach is, of course, the traditional one, and is used in Peter Hoyng's book. Reading the book is a stimulating experience, because the reader can almost feel the author's presence. The author's opinions, his mathematical taste, his research pleasures, and his pedagogical passion are apparent everywhere. Lecturers contemplating a new course on relativistic astrophysics could adopt Hoyng's book as the text. Their students will be in the author

  18. Degeneration of osteoarthritis cartilage

    DEFF Research Database (Denmark)

    Jørgensen, Dan Richter

    of sensitive biomarkers for monitoring disease progression. This thesis investigates how subregional measures of cartilage thickness can be used to improve upon current imaging biomarkers. The first part of this investigation aims to discover discriminative areas in the cartilage using machine......-learning techniques specifically developed to take advantage of the spatial nature of the problem. The methods were evaluated on data from a longitudinal study where detailed cartilage thickness maps were quantified from magnetic resonance images. The results showed that focal differences in cartilage thickness may...... be relevant for both OA diagnosis and for prediction of future cartilage loss. The second part of the thesis investigates spatial patterns of longitudinal cartilage thickness changes in healthy and OA knees. Based on our findings, we propose a new, conceptually simple biomarker that embraces the heterogeneous...

  19. Light and inherited retinal degeneration

    OpenAIRE

    Paskowitz, D M; LaVail, M M; Duncan, J L

    2006-01-01

    Light deprivation has long been considered a potential treatment for patients with inherited retinal degenerative diseases, but no therapeutic benefit has been demonstrated to date. In the few clinical studies that have addressed this issue, the underlying mutations were unknown. Our rapidly expanding knowledge of the genes and mechanisms involved in retinal degeneration have made it possible to reconsider the potential value of light restriction in specific genetic contexts. This review summ...

  20. Prevalence and determinants of age-related macular degeneration in the 50 years and older population: A hospital based study in Maharashtra, India

    Directory of Open Access Journals (Sweden)

    Sucheta R Kulkarni

    2013-01-01

    Full Text Available Background: We present the magnitude and determinants of age-related macular degeneration (ARMD among the 50 year and older population that visited our hospital. Materials and Methods: This was a cohort of eye patients with ARMD, seen from 2006 to 2009. Optometrist noted the best-corrected vision. Ophthalmologists examined eyes using a slit-lamp bio-microscope. The ARMD was confirmed by fluoresceine angiography and optical coherent tomography. The age, sex, history of smoking, sun exposure, family history of ARMD, diet, body mass index (BMI, hypertension, and diabetes were associated with ARMD. Result: Of the 19,140 persons of ≥ 50 years of age-attending eye clinic in our hospital, 302 persons had ARMD in at least one eye. The proportion of overall ARMD was 1.38% (95% CI 1.21--1.55. The proportion of age-related maculopathy (ARM and late ARMD was 1.14% (95% CI 0.99--1.29 and 0.24% (95% CI 0.21-0.24 respectively. ARM was unilateral and bilateral in 64 (29.2% and 155 (70.8% persons respectively. Dry ARMD was found in 47.8%. On regression analysis, old age (OR = 1.05, male (OR = 0.54, and history of smoking (OR = 2.32 were significant risk factors of ARMD. A total of 4.2% of persons with ARMD were blind (vision <3/60. Only 43% of persons with ARMD had J6 grade of the best-corrected near vision. Conclusion: ARMD does not seem to be of public health magnitude in the study area. Early stages of ARMD were common among patients. ge, being male, and history of smoking were significant risk factors for ARMD.

  1. Conservatively treated knee injury is associated with knee cartilage matrix degeneration measured with MRI-based T2 relaxation times. Data from the osteoarthritis initiative

    Energy Technology Data Exchange (ETDEWEB)

    Hofmann, Felix C. [University of California San Francisco, Musculoskeletal Quantitative Imaging Research Group, Department of Radiology and Biomedical Imaging, San Francisco, CA (United States); Technical University of Munich, Department of Radiology, Munich (Germany); Neumann, Jan; Heilmeier, Ursula; Joseph, Gabby B.; Link, Thomas M. [University of California San Francisco, Musculoskeletal Quantitative Imaging Research Group, Department of Radiology and Biomedical Imaging, San Francisco, CA (United States); Nevitt, Michael C.; McCulloch, Charles E. [University of California San Francisco, Department of Epidemiology and Biostatistics, San Francisco, CA (United States)

    2018-01-15

    To investigate the association of cartilage degeneration with previous knee injuries not undergoing surgery, determined by morphologic and quantitative 3-T magnetic resonance imaging (MRI). We performed a nested cross-sectional study of right knee MRIs from participants in the Osteoarthritis Initiative (OAI) aged 45-79 with baseline Kellgren-Lawrence score of 0-2. Cases were 142 right knees of patients with self-reported history of injury limiting the ability to walk for at least 2 days. Controls were 426 right knees without history of injury, frequency-matched to cases on age, BMI, gender, KL scores and race (1:3 ratio). Cases and controls were compared using covariate-adjusted linear regression analysis, with the outcomes of region-specific T2 mean, laminar analysis and heterogeneity measured by texture analysis to investigate early cartilage matrix abnormalities and the Whole-Organ Magnetic Resonance Imaging Score (WORMS) to investigate morphologic knee lesions. Compared to control subjects, we found significantly higher mean T2 values in the injury [lateral tibia (28.10 ms vs. 29.11 ms, p = 0.001), medial tibia (29.70 ms vs. 30.40 ms, p = 0.014) and global knee cartilage (32.73 ms vs. 33.29 ms, p = 0.005)]. Injury subjects also had more heterogeneous cartilage as measured by GLCM texture contrast, variance and entropy (p < 0.05 in 14 out of 18 texture parameters). WORMS gradings were not significantly different between the two groups (p > 0.05). A history of knee injury not treated surgically is associated with higher and more heterogeneous T2 values, but not with morphologic knee abnormalities. Our findings suggest that significant, conservatively treated knee injuries are associated with permanent cartilage matrix abnormalities. (orig.)

  2. Conservatively treated knee injury is associated with knee cartilage matrix degeneration measured with MRI-based T2 relaxation times. Data from the osteoarthritis initiative

    International Nuclear Information System (INIS)

    Hofmann, Felix C.; Neumann, Jan; Heilmeier, Ursula; Joseph, Gabby B.; Link, Thomas M.; Nevitt, Michael C.; McCulloch, Charles E.

    2018-01-01

    To investigate the association of cartilage degeneration with previous knee injuries not undergoing surgery, determined by morphologic and quantitative 3-T magnetic resonance imaging (MRI). We performed a nested cross-sectional study of right knee MRIs from participants in the Osteoarthritis Initiative (OAI) aged 45-79 with baseline Kellgren-Lawrence score of 0-2. Cases were 142 right knees of patients with self-reported history of injury limiting the ability to walk for at least 2 days. Controls were 426 right knees without history of injury, frequency-matched to cases on age, BMI, gender, KL scores and race (1:3 ratio). Cases and controls were compared using covariate-adjusted linear regression analysis, with the outcomes of region-specific T2 mean, laminar analysis and heterogeneity measured by texture analysis to investigate early cartilage matrix abnormalities and the Whole-Organ Magnetic Resonance Imaging Score (WORMS) to investigate morphologic knee lesions. Compared to control subjects, we found significantly higher mean T2 values in the injury [lateral tibia (28.10 ms vs. 29.11 ms, p = 0.001), medial tibia (29.70 ms vs. 30.40 ms, p = 0.014) and global knee cartilage (32.73 ms vs. 33.29 ms, p = 0.005)]. Injury subjects also had more heterogeneous cartilage as measured by GLCM texture contrast, variance and entropy (p < 0.05 in 14 out of 18 texture parameters). WORMS gradings were not significantly different between the two groups (p > 0.05). A history of knee injury not treated surgically is associated with higher and more heterogeneous T2 values, but not with morphologic knee abnormalities. Our findings suggest that significant, conservatively treated knee injuries are associated with permanent cartilage matrix abnormalities. (orig.)

  3. Generation of sequence signatures from DNA amplification fingerprints with mini-hairpin and microsatellite primers.

    Science.gov (United States)

    Caetano-Anollés, G; Gresshoff, P M

    1996-06-01

    DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.

  4. Primer on electricity futures and other derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area.

  5. A primer on systematic reviews in toxicology.

    Science.gov (United States)

    Hoffmann, Sebastian; de Vries, Rob B M; Stephens, Martin L; Beck, Nancy B; Dirven, Hubert A A M; Fowle, John R; Goodman, Julie E; Hartung, Thomas; Kimber, Ian; Lalu, Manoj M; Thayer, Kristina; Whaley, Paul; Wikoff, Daniele; Tsaioun, Katya

    2017-07-01

    Systematic reviews, pioneered in the clinical field, provide a transparent, methodologically rigorous and reproducible means of summarizing the available evidence on a precisely framed research question. Having matured to a well-established approach in many research fields, systematic reviews are receiving increasing attention as a potential tool for answering toxicological questions. In the larger framework of evidence-based toxicology, the advantages and obstacles of, as well as the approaches for, adapting and adopting systematic reviews to toxicology are still being explored. To provide the toxicology community with a starting point for conducting or understanding systematic reviews, we herein summarized available guidance documents from various fields of application. We have elaborated on the systematic review process by breaking it down into ten steps, starting with planning the project, framing the question, and writing and publishing the protocol, and concluding with interpretation and reporting. In addition, we have identified the specific methodological challenges of toxicological questions and have summarized how these can be addressed. Ultimately, this primer is intended to stimulate scientific discussions of the identified issues to fuel the development of toxicology-specific methodology and to encourage the application of systematic review methodology to toxicological issues.

  6. Primer on electricity futures and other derivatives

    International Nuclear Information System (INIS)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area

  7. Matrix units and Schur elements for the degenerate cyclotomic Hecke algebras

    OpenAIRE

    Zhao, Deke

    2011-01-01

    The paper uses the cellular basis of the (semi-simple) degenerate cyclotomic Hecke algebras to investigate these algebras exhaustively. As a consequence, we describe explicitly the "Young's seminormal form" and a orthogonal bases for Specht modules and determine explicitly the closed formula for the natural bilinear form on Specht modules and Schur elements for the degenerate cyclotomic Hekce algebras.

  8. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

    2000-09-27

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  9. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson

    1998-12-10

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  10. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders; FINAL

    International Nuclear Information System (INIS)

    Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

    2000-01-01

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums

  11. Qualitative and quantitative assessment of degeneration of cervical intervertebral discs and facet joints.

    Science.gov (United States)

    Walraevens, Joris; Liu, Baoge; Meersschaert, Joke; Demaerel, Philippe; Delye, Hans; Depreitere, Bart; Vander Sloten, Jos; Goffin, Jan

    2009-03-01

    Degeneration of intervertebral discs and facet joints is one of the most frequently encountered spinal disorders. In order to describe and quantify degeneration and evaluate a possible relationship between degeneration and biomechanical parameters, e.g., the intervertebral range of motion and intradiscal pressure, a scoring system for degeneration is mandatory. However, few scoring systems for the assessment of degeneration of the cervical spine exist. Therefore, two separate objective scoring systems to qualitatively and quantitatively assess the degree of cervical intervertebral disc and facet joint degeneration were developed and validated. The scoring system for cervical disc degeneration consists of three variables which are individually scored on neutral lateral radiographs: "height loss" (0-4 points), "anterior osteophytes" (0-3 points) and "endplate sclerosis" (0-2 points). The scoring system for facet joint degeneration consists of four variables which are individually scored on neutral computed tomography scans: "hypertrophy" (0-2 points), "osteophytes" (0-1 point), "irregularity" on the articular surface (0-1 point) and "joint space narrowing" (0-1 point). Each variable contributes with varying importance to the overall degeneration score (max 9 points for the scoring system of cervical disc degeneration and max 5 points for facet joint degeneration). Degeneration of 20 discs and facet joints of 20 patients was blindly assessed by four raters: two neurosurgeons (one senior and one junior) and two radiologists (one senior and one junior), firstly based on first subjective impression and secondly using the scoring systems. Measurement errors and inter- and intra-rater agreement were determined. The measurement error of the scoring system for cervical disc degeneration was 11.1 versus 17.9% of the subjective impression results. This scoring system showed excellent intra-rater agreement (ICC = 0.86, 0.75-0.93) and excellent inter-rater agreement (ICC = 0

  12. Disc degeneration: current surgical options

    Directory of Open Access Journals (Sweden)

    C Schizas

    2010-10-01

    Full Text Available Chronic low back pain attributed to lumbar disc degeneration poses a serious challenge to physicians. Surgery may be indicated in selected cases following failure of appropriate conservative treatment. For decades, the only surgical option has been spinal fusion, but its results have been inconsistent. Some prospective trials show superiority over usual conservative measures while others fail to demonstrate its advantages. In an effort to improve results of fusion and to decrease the incidence of adjacent segment degeneration, total disc replacement techniques have been introduced and studied extensively. Short-term results have shown superiority over some fusion techniques. Mid-term results however tend to show that this approach yields results equivalent to those of spinal fusion. Nucleus replacement has gained some popularity initially, but evidence on its efficacy is scarce. Dynamic stabilisation, a technique involving less rigid implants than in spinal fusion and performed without the need for bone grafting, represents another surgical option. Evidence again is lacking on its superiority over other surgical strategies and conservative measures. Insertion of interspinous devices posteriorly, aiming at redistributing loads and relieving pain, has been used as an adjunct to disc removal surgery for disc herniation. To date however, there is no clear evidence on their efficacy. Minimally invasive intradiscal thermocoagulation techniques have also been tried, but evidence of their effectiveness is questioned. Surgery using novel biological solutions may be the future of discogenic pain treatment. Collaboration between clinicians and basic scientists in this multidisciplinary field will undoubtedly shape the future of treating symptomatic disc degeneration.

  13. Lattice degeneration of the retina.

    Science.gov (United States)

    Byer, N E

    1979-01-01

    Lattice degeneration of the retina is the most important of all clinically distinct entities that effect the peripheral fundus and are related to retinal detachment. The purpose of this review is to survey the extensive literature, to evaluate the many diverse opinions on this subject, and to correlate and summarize all the known facts regarding this disease entity. The disease is fully defined and described, both clinically and histologically. Some aspects of the disease are still poorly understood, and some remain controversial, especially in the area of management. For this reason, the indications for treatment are discussed under eight subsections, with a view toward providing practical guidelines for recommendations in management.

  14. Age-related macular degeneration

    DEFF Research Database (Denmark)

    la Cour, Morten; Kiilgaard, Jens Folke; Nissen, Mogens Holst

    2002-01-01

    Age-related macular degeneration (AMD) is a common macular disease affecting elderly people in the Western world. It is characterised by the appearance of drusen in the macula, accompanied by choroidal neovascularisation (CNV) or geographic atrophy. The disease is more common in Caucasian....... Smoking is probably also a risk factor. Preventive strategies using macular laser photocoagulation are under investigation, but their efficacy in preventing visual loss is as yet unproven. There is no treatment with proven efficacy for geographic atrophy. Optimal treatment for exudative AMD requires...

  15. Climate Change, Health, and Communication: A Primer.

    Science.gov (United States)

    Chadwick, Amy E

    2016-01-01

    Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.

  16. Effect of oligonucleotide primers in determining viral variability within hosts

    Directory of Open Access Journals (Sweden)

    Moya Andrés

    2004-12-01

    Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  17. Effect of oligonucleotide primers in determining viral variability within hosts.

    Science.gov (United States)

    Bracho, Maria Alma; García-Robles, Inmaculada; Jiménez, Nuria; Torres-Puente, Manuela; Moya, Andrés; González-Candelas, Fernando

    2004-12-09

    Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR) based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV) populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient). Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  18. Sensory reception of the primer pheromone ethyl oleate

    Science.gov (United States)

    Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang

    2012-05-01

    Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.

  19. Microsatellite Primers for Fungus-Growing Ants

    DEFF Research Database (Denmark)

    Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  20. Microsatellite primers for fungus-growing ants

    DEFF Research Database (Denmark)

    Villesen, Palle; Gertsch, P J; Boomsma, JJ

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  1. Lipids, lipid genes, and incident age-related macular degeneration: the three continent age-related macular degeneration consortium

    NARCIS (Netherlands)

    Klein, Ronald; Myers, Chelsea E.; Buitendijk, Gabriëlle H. S.; Rochtchina, Elena; Gao, Xiaoyi; de Jong, Paulus T. V. M.; Sivakumaran, Theru A.; Burlutsky, George; McKean-Cowdin, Roberta; Hofman, Albert; Iyengar, Sudha K.; Lee, Kristine E.; Stricker, Bruno H.; Vingerling, Johannes R.; Mitchell, Paul; Klein, Barbara E. K.; Klaver, Caroline C. W.; Wang, Jie Jin

    2014-01-01

    To describe associations of serum lipid levels and lipid pathway genes to the incidence of age-related macular degeneration (AMD). Meta-analysis. setting: Three population-based cohorts. population: A total of 6950 participants from the Beaver Dam Eye Study (BDES), Blue Mountains Eye Study (BMES),

  2. Relationship between facet tropism and facet joint degeneration in the sub-axial cervical spine

    Directory of Open Access Journals (Sweden)

    Xin Rong

    2017-02-01

    Full Text Available Abstract Background Facet tropism is the angular asymmetry between the left and right facet joint orientation. Although debatable, facet tropism was suggested to be associated with disc degeneration, facet degeneration and degenerative spondylolisthesis in the lumbar spine. The purpose of this study was to explore the relationship between facet tropism and facet degeneration in the sub-axial cervical spine. Methods A total of 200 patients with cervical spondylosis were retrospectively analyzed. Facet degeneration was categorized into 4 grade: grade I, normal; grade II, degenerative changes including joint space narrowing, cyst formation, small osteophytes (3 mm without fusion of the joint; grade IV, bony fusion of the facet joints. Facet orientations and facet tropisms with respect to the transverse, sagittal and coronal plane were calculated from the reconstructed cervical spine, which was based on the axial CT scan images. The paired facet joints were then categorized into three types: symmetric, moderated tropism and severe tropism. Univariate and multivariate analysis were performed to evaluate the relationship between any demographic and anatomical factor and facet degeneration. Results The mean age of enrolled patients was 46.23 years old (ranging from 30 to 64 years old. There were 114 males and 86 females. The degrees of facet degeneration varied according to cervical levels and ages. Degenerated facet joints were most common at C2-C3 level and more common in patients above 50 years old. The facet orientations were also different from level to level. By univariate analysis, genders, ages, cervical levels, facet orientations and facet tropisms were all significantly different between the normal facets and degenerated facets. However, results from multivariate logistic regression suggested only age and facet tropism with respect to the sagittal plane were related to facet degeneration. Conclusion Facet degeneration were more common at

  3. Novel degenerate PCR method for whole genome amplification applied to Peru Margin (ODP Leg 201 subsurface samples

    Directory of Open Access Journals (Sweden)

    Amanda eMartino

    2012-01-01

    Full Text Available A degenerate PCR-based method of whole-genome amplification, designed to work fluidly with 454 sequencing technology, was developed and tested for use on deep marine subsurface DNA samples. The method, which we have called Random Amplification Metagenomic PCR (RAMP, involves the use of specific primers from Roche 454 amplicon sequencing, modified by the addition of a degenerate region at the 3’ end. It utilizes a PCR reaction, which resulted in no amplification from blanks, even after 50 cycles of PCR. After efforts to optimize experimental conditions, the method was tested with DNA extracted from cultured E. coli cells, and genome coverage was estimated after sequencing on three different occasions. Coverage did not vary greatly with the different experimental conditions tested, and was around 62% with a sequencing effort equivalent to a theoretical genome coverage of 14.10X. The GC content of the sequenced amplification product was within 2% of the predicted values for this strain of E. coli. The method was also applied to DNA extracted from marine subsurface samples from ODP Leg 201 site 1229 (Peru Margin, and results of a taxonomic analysis revealed microbial communities dominated by Proteobacteria, Chloroflexi, Firmicutes, Euryarchaeota, and Crenarchaeota, among others. These results were similar to those obtained previously for those samples; however, variations in the proportions of taxa show that community analysis can be sensitive to both the amplification technique used and the method of assigning sequences to taxonomic groups. Overall, we find that RAMP represents a valid methodology for amplifying metagenomes from low biomass samples.

  4. Novel Degenerate PCR Method for Whole-Genome Amplification Applied to Peru Margin (ODP Leg 201) Subsurface Samples

    Science.gov (United States)

    Martino, Amanda J.; Rhodes, Matthew E.; Biddle, Jennifer F.; Brandt, Leah D.; Tomsho, Lynn P.; House, Christopher H.

    2011-01-01

    A degenerate polymerase chain reaction (PCR)-based method of whole-genome amplification, designed to work fluidly with 454 sequencing technology, was developed and tested for use on deep marine subsurface DNA samples. While optimized here for use with Roche 454 technology, the general framework presented may be applicable to other next generation sequencing systems as well (e.g., Illumina, Ion Torrent). The method, which we have called random amplification metagenomic PCR (RAMP), involves the use of specific primers from Roche 454 amplicon sequencing, modified by the addition of a degenerate region at the 3′ end. It utilizes a PCR reaction, which resulted in no amplification from blanks, even after 50 cycles of PCR. After efforts to optimize experimental conditions, the method was tested with DNA extracted from cultured E. coli cells, and genome coverage was estimated after sequencing on three different occasions. Coverage did not vary greatly with the different experimental conditions tested, and was around 62% with a sequencing effort equivalent to a theoretical genome coverage of 14.10×. The GC content of the sequenced amplification product was within 2% of the predicted values for this strain of E. coli. The method was also applied to DNA extracted from marine subsurface samples from ODP Leg 201 site 1229 (Peru Margin), and results of a taxonomic analysis revealed microbial communities dominated by Proteobacteria, Chloroflexi, Firmicutes, Euryarchaeota, and Crenarchaeota, among others. These results were similar to those obtained previously for those samples; however, variations in the proportions of taxa identified illustrates well the generally accepted view that community analysis is sensitive to both the amplification technique used and the method of assigning sequences to taxonomic groups. Overall, we find that RAMP represents a valid methodology for amplifying metagenomes from low-biomass samples. PMID:22319519

  5. Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia (DEVELOPMENt OF PRIMERS FOR REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION TO DETECT AVIAN INFLUENZA VIRUS IN INDONESIA

    Directory of Open Access Journals (Sweden)

    Ni Luh Putu Indi Dharmayanti

    2016-07-01

    Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.

  6. KENO V.a Primer: A Primer for Criticality Calculations with SCALE/KENO V.a Using CSPAN for Input

    International Nuclear Information System (INIS)

    Busch, R.D.

    2003-01-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory (ORNL) is widely used and accepted around the world for criticality safety analyses. The well-known KENO V.a three-dimensional Monte Carlo criticality computer code is the primary criticality safety analysis tool in SCALE. The KENO V.a primer is designed to help a new user understand and use the SCALE/KENO V.a Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO V.a in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO V.a that are useful in criticality analyses. The primer is based on SCALE 4.4a, which includes the Criticality Safety Processor for Analysis (CSPAN) input processor for Windows personal computers (PCs). A second edition of the primer, which uses the new KENO Visual Editor, is currently under development at ORNL and is planned for publication in late 2003. Each example in this first edition of the primer uses CSPAN to provide the framework for data input. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO V.a input and allows the user to quickly run a simple criticality problem with SCALE/KENO V.a. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO V.a features which are covered in detail in the example problems in that section. Upon completion of the primer, a new user should be comfortable using CSPAN to set up criticality problems in SCALE/KENO V.a

  7. A primer on motor vehicle air pollution.

    Science.gov (United States)

    1973-01-01

    This primer presents a brief state-of-the art review of motor vehicle air pollution. Its purpose is to aid highway personnel in understanding the nature of this environmental problem on our highways and to present possible solutions for its abatement...

  8. A Primer on Basic Effect Size Concepts.

    Science.gov (United States)

    Elmore, Patricia B.; Rotou, Ourania

    The increased interest in reporting effect sizes means that it is necessary to consider what should be included in a primer on effect sizes. A review of papers on effect sizes and commonly repeated statistical analyses suggests that it is important to discuss effect sizes relative to bivariate correlation, t-tests, analysis of variance/covariance,…

  9. Scrimer: designing primers from transcriptome data

    Czech Academy of Sciences Publication Activity Database

    Mořkovský, Libor; Pačes, Jan; Rídl, Jakub; Reifová, R.

    2015-01-01

    Roč. 15, č. 6 (2015), s. 1415-1420 ISSN 1755-098X R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 ; RVO:68378050 Keywords : next-generation sequencing * primer design * SNaPshot * SNP genotyping * transcriptome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.298, year: 2015

  10. Criticality calculations with MCNP trademark: A primer

    International Nuclear Information System (INIS)

    Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.

    1994-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand

  11. MSP-HTPrimer: a high-throughput primer design tool to improve assay design for DNA methylation analysis in epigenetics.

    Science.gov (United States)

    Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas

    2016-01-01

    Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic

  12. Cruce de datos de calidad y seguridad de medicamentos nacionales a partir de bases de datos automatizadas: Primer semestre 2006 Cross of quality and safety data of national drugs starting from the automated databases: First semester 2006

    Directory of Open Access Journals (Sweden)

    Giset Jiménez López

    2007-12-01

    Full Text Available Dentro del sistema de vigilancia poscomercialización, la cooperación entre centros es crucial, la Dirección de Calidad de QUIMEFA, la cual rige la vigilancia de la calidad de productos de la industria nacional, y la Unidad Coordinadora Nacional de Farmacovigilancia del Centro para el Desarrollo de la Farmacoepidemiología, que coordina a su vez el Sistema Nacional de Monitoreo de Sospechas de Reacciones Adversas producidas por medicamentos, establecieron un sistema de consultas de sus bases de datos. El Sistema de Vigilancia de Calidad de Productos se lleva en una base de datos en Access, y las sospechas de reacciones adversas en una hoja de Excel con funciones de bases de datos. Mensualmente se realiza un cruce de estos datos entre ambos sistemas, que se basa en el nombre del producto, lote, fabricante, lugar de reporte, etc. y se retroalimentan ambos subsistemas. También mensualmente se realiza una reunión para chequear los resultados de los sistemas. En el primer semestre del 2006 el subsistema de calidad ha procesado más de 800 quejas de calidad provenientes de las droguerías, por lo que se establecieron 11 planes de aviso de retención y 28 planes de aviso de retiro de productos. Por su parte el sistema de reporte de reacciones adversas ha recibido 4 254 notificaciones y se han establecido 9 expedientes donde los productos tienen reportes de reacciones adversas a medicamentos. Toda la información es enviada al sistema de poscomercialización del Centro Estatal de Control de Calidad de los MedicamentosWithin the system of postmarketing surveillance, the cooperation between centres is crucial. That's why, the Quality Division of Quimefa, which rules the vigilance of the quality of the national industry products, and the National Coordinating Pharmacovigilance Unit of the Center for Pharmacoepidemiology Development that coordinates the National Monitoring System of Adverse Reactions Suspicions produced by drugs, established a database

  13. Primer on nuclear exchange models

    Energy Technology Data Exchange (ETDEWEB)

    Hafemeister, David [Physics Department, Cal Poly University, San Luis Obispo, California (United States)

    2014-05-09

    Basic physics is applied to nuclear force exchange models between two nations. Ultimately, this scenario approach can be used to try and answer the age old question of 'how much is enough?' This work is based on Chapter 2 of Physics of Societal Issues: Calculations on National Security, Environment and Energy (Springer, 2007 and 2014)

  14. Genetics of Frontotemporal Lobar Degeneration

    Directory of Open Access Journals (Sweden)

    Daniela eGalimberti

    2012-04-01

    Full Text Available Frontotemporal Lobar Degeneration (FTLD is the most frequent neurodegenerative disorder with a presenile onset. It presents with a spectrum of clinical manifestations, ranging from behavioural and executive impairment to language disorders and motor dysfunction. Familial aggregation is frequently reported in FTLD, and about 10% of cases have an autosomal dominant transmission. Microtubule Associated Protein Tau gene (MAPT mutations have been the first ones identified and are generally associated with early onset behavioural variant Frontotemporal Dementia (bvFTD phenotype. More recently, progranulin gene (GRN mutations were recognized in association with familial form of FTLD. In addition, other genes are linked to rare cases of familial FTLD. Lastly, a number of genetic risk factors for sporadic forms have also been identified.

  15. Frontotemporal Degeneration in a Child.

    Science.gov (United States)

    Terrill, Tyler; Pascual, Juan M

    2017-07-01

    There is a predilection for the frontal and temporal lobes in certain cases of dementia in the adult, leading to the syndrome of frontotemporal dementia. However, this syndrome has seemed to elude the developing brain until now. We describe an example of apparently selective neurodegeneration of the frontal and temporal regions during development associated with some of the clinical, magnetic resonance imaging, and fludeoxyglucose positron emission tomography (FDG PET) scan features of canonical frontotemporal dementia in the adult. This patient does not have any of the common frontotemporal dementia-causing mutations or known progressive brain disorders of children. This patient illustrates that symptomatic, selective, and progressive vulnerability of the frontal and temporal lobes is not restricted to adulthood, expanding the phenotype of frontotemporal degeneration. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Naturalness of nearly degenerate neutrinos

    International Nuclear Information System (INIS)

    Casas, J.A.; Espinosa, J.R.; Ibarra, A.; Navarro, I.

    1999-01-01

    If neutrinos are to play a relevant cosmological role, they must be essentially degenerate. We study whether radiative corrections can or cannot be responsible for the small mass splittings, in agreement with all the available experimental data. We perform an exhaustive exploration of the bimaximal mixing scenario, finding that (i) the vacuum oscillations solution to the solar neutrino problem is always excluded; (ii) if the mass matrix is produced by a see-saw mechanism, there are large regions of the parameter space consistent with the large angle MSW solution, providing a natural origin for the Δm sol 2 atm 2 hierarchy; (iii) the bimaximal structure becomes then stable under radiative corrections. We also provide analytical expressions for the mass splittings and mixing angles and present a particularly simple see-saw ansatz consistent with all observations

  17. Eigenstate Thermalization for Degenerate Observables

    Science.gov (United States)

    Anza, Fabio; Gogolin, Christian; Huber, Marcus

    2018-04-01

    Under unitary time evolution, expectation values of physically reasonable observables often evolve towards the predictions of equilibrium statistical mechanics. The eigenstate thermalization hypothesis (ETH) states that this is also true already for individual energy eigenstates. Here we aim at elucidating the emergence of the ETH for observables that can realistically be measured due to their high degeneracy, such as local, extensive, or macroscopic observables. We bisect this problem into two parts, a condition on the relative overlaps and one on the relative phases between the eigenbases of the observable and Hamiltonian. We show that the relative overlaps are unbiased for highly degenerate observables and demonstrate that unless relative phases conspire to cumulative effects, this makes such observables verify the ETH. Through this we elucidate potential pathways towards proofs of thermalization.

  18. Adhesion and thermal stability enhancement of IZO films by adding a primer layer on polycarbonate substrate

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Xuan; Zhang, Xiaofeng; Yan, Yue; Zhong, Yanli; Li, Lei; Zhang, Guanli [Beijing Institute of Aeronautical Materials (BIAM), Haidian District, Beijing, 100095 (China)

    2015-04-01

    A silicone-based primer layer was developed to improve the adhesion and thermal stability of amorphous transparent indium zinc oxide (IZO) films on polycarbonate (PC). The IZO films deposited by direct current magnetron sputtering at room temperature on primer-treated and untreated PCs were evaluated ex situ in terms of surface morphology, adhesion, optical, and electrical properties during annealing at 120 C in air. Nano-scratch tests indicated the adhesion of IZO films on primer-treated substrates was superior to that on untreated PCs. This superior adhesion can be attributed to the strong Si-O-Si inorganic bonds abundant in the primer layer and better matches of the primer layer in the terms of thermal expansion to the IZO. Moreover, the electrical resistivity of IZO films prepared on primer-treated PCs remained stable during the annealing treatment, whereas those of IZO films on untreated PCs presented a continuously increasing trend, which was attributed to the decrease in carrier concentration that resulted from oxygen adsorption. (copyright 2015 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  19. Evaluation of highly conserved hsp65-specific nested PCR primers for diagnosing Mycobacterium tuberculosis.

    Science.gov (United States)

    Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G

    2017-02-01

    To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.

  20. Economics : pricing, demand, and economic efficiency : a primer.

    Science.gov (United States)

    2008-11-01

    The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...

  1. Primer on consumer marketing research : procedures, methods, and tools

    Science.gov (United States)

    1994-03-01

    The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...

  2. Cartilage Degeneration and Alignment in Severe Varus Knee Osteoarthritis.

    Science.gov (United States)

    Nakagawa, Yasuaki; Mukai, Shogo; Yabumoto, Hiromitsu; Tarumi, Eri; Nakamura, Takashi

    2015-10-01

    The aim of this study was to examine the relationship between cartilage, ligament, and meniscus degeneration and radiographic alignment in severe varus knee osteoarthritis in order to understand the development of varus knee osteoarthritis. Fifty-three patients (71 knees) with primary varus knee osteoarthritis and who underwent total knee arthroplasty were selected for this study. There were 6 men and 47 women, with 40 right knees and 31 left knees studied; their mean age at operation was 73.5 years. The ligament, meniscus, degeneration of joint cartilage, and radiographic alignments were examined visually. The tibial plateau-tibial shaft angle was larger if the condition of the cartilage in the lateral femoral condyle was worse. The femorotibial angle and tibial plateau-tibial shaft angle were larger if the conditions of the lateral meniscus or the cartilage in the lateral tibial plateau were worse. Based on the results of this study, progression of varus knee osteoarthritis may occur in the following manner: medial knee osteoarthritis starts in the central portion of the medial tibial plateau, and accompanied by medial meniscal extrusion and anterior cruciate ligament rupture, cartilage degeneration expands from the anterior to the posterior in the medial tibial plateau. Bone attrition occurs in the medial tibial plateau, and the femoro-tibial angle and tibial plateau-tibial shaft angle increase. Therefore, the lateral intercondylar eminence injures the cartilage of the lateral femoral condyle in the longitudinal fissure type. Thereafter, the cartilage degeneration expands in the whole of the knee joints.

  3. Novel acsF Gene Primers Revealed a Diverse Phototrophic Bacterial Population, Including Gemmatimonadetes, in Lake Taihu (China)

    DEFF Research Database (Denmark)

    Huang, Yili; Zeng, Yanhua; Lu, Hang

    2016-01-01

    Seq sequencing of the 16S rRNA, pufM, and bchY genes was carried out to assess the diversity of local phototrophic communities. In addition, we designed new degenerate primers of aerobic cyclase gene acsF, which serves as a convenient marker for both phototrophic Gemmatimonadetes and phototrophic Proteobacteria...... a diverse community of phototrophic Gemmatimonadetes forming 30 operational taxonomic units. These species represented 10.5 and 17.3% of the acsF reads in the upper semiaerobic sediment and anoxic sediment, whereas their abundance in the water column was ... fundamental biological processes on Earth. Recently, the presence of photosynthetic reaction centers has been reported from a rarely studied bacterial phylum, Gemmatimonadetes, but almost nothing is known about the diversity and environmental distribution of these organisms. The newly designed acsF primers...

  4. Bioinformatic tools and guideline for PCR primer design | Abd ...

    African Journals Online (AJOL)

    Bioinformatics has become an essential tool not only for basic research but also for applied research in biotechnology and biomedical sciences. Optimal primer sequence and appropriate primer concentration are essential for maximal specificity and efficiency of PCR. A poorly designed primer can result in little or no ...

  5. Degeneration and height of cervical discs classified from MRI compared with precise height measurements from radiographs

    Energy Technology Data Exchange (ETDEWEB)

    Kolstad, Frode [National Centre of Spinal Disorders, Norwegian University of Science and Technology, University Hospital of Trondheim, 7006 Trondheim (Norway)]. E-mail: frode.kolstad@medisin.ntnu.no; Myhr, Gunnar [Department of Radiology, University Hospital of Trondheim, 7006 Trondheim (Norway); Kvistad, Kjell Arne [Department of Radiology, University Hospital of Trondheim, 7006 Trondheim (Norway); Nygaard, Oystein P. [National Centre of Spinal Disorders, Norwegian University of Science and Technology, University Hospital of Trondheim, 7006 Trondheim (Norway); Leivseth, Gunnar [Department of Neuromedicine, Faculty of Medicine, Norwegian University of Science and Technology, University Hospital of Trondheim, 7006 Trondheim (Norway)

    2005-09-01

    Study design: Descriptive study comparing MRI classifications with measurements from radiographs. Objectives: 1.Define the relationship between MRI classified cervical disc degeneration and objectively measured disc height. 2.Assess the level of inter- and intra-observer errors using MRI in defining cervical disc degeneration. Summary of background data: Cervical spine degeneration has been defined radiologically by loss of disc height, decreased disc and bone marrow signal intensity and disc protrusion/herniation on MRI. The intra- and inter-observer error using MRI in defining cervical degeneration influences data interpretation. Few previous studies have addressed this source of error. The relation and time sequence between cervical disc degeneration classified by MRI and cervical disc height decrease measured from radiographs is unclear. Methods: The MRI classification of degeneration was based on nucleus signal, prolaps identification and bone marrow signal. Two neuro-radiologists evaluated the MR-images independently in a blinded fashion. The radiographic disc height measurements were done by a new computer-assisted method compensating for image distortion and permitting comparison with normal level-, age- and gender-appropriate disc height. Results/conclusions: 1.Progressing disc degeneration classified from MRI is on average significantly associated with a decrease of disc height as measured from radiographs. Within each MRI defined category of degeneration measured disc heights, however, scatter in a wide range. 2.The inter-observer agreement between two neuro-radiologists in both defining degeneration and disc height by MRI was only moderate. Studies addressing questions related to cervical disc degeneration should take this into consideration.

  6. Degeneration and height of cervical discs classified from MRI compared with precise height measurements from radiographs

    International Nuclear Information System (INIS)

    Kolstad, Frode; Myhr, Gunnar; Kvistad, Kjell Arne; Nygaard, Oystein P.; Leivseth, Gunnar

    2005-01-01

    Study design: Descriptive study comparing MRI classifications with measurements from radiographs. Objectives: 1.Define the relationship between MRI classified cervical disc degeneration and objectively measured disc height. 2.Assess the level of inter- and intra-observer errors using MRI in defining cervical disc degeneration. Summary of background data: Cervical spine degeneration has been defined radiologically by loss of disc height, decreased disc and bone marrow signal intensity and disc protrusion/herniation on MRI. The intra- and inter-observer error using MRI in defining cervical degeneration influences data interpretation. Few previous studies have addressed this source of error. The relation and time sequence between cervical disc degeneration classified by MRI and cervical disc height decrease measured from radiographs is unclear. Methods: The MRI classification of degeneration was based on nucleus signal, prolaps identification and bone marrow signal. Two neuro-radiologists evaluated the MR-images independently in a blinded fashion. The radiographic disc height measurements were done by a new computer-assisted method compensating for image distortion and permitting comparison with normal level-, age- and gender-appropriate disc height. Results/conclusions: 1.Progressing disc degeneration classified from MRI is on average significantly associated with a decrease of disc height as measured from radiographs. Within each MRI defined category of degeneration measured disc heights, however, scatter in a wide range. 2.The inter-observer agreement between two neuro-radiologists in both defining degeneration and disc height by MRI was only moderate. Studies addressing questions related to cervical disc degeneration should take this into consideration

  7. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Weber, James R.; Schell, Charlotte J.; Marino, T; Bilyard, Gordon R.

    2004-02-10

    This version of the communication primer comprises two interlocking parts: Pat 1, a practical section, intended to prepare you for public interactions, and Part 2, a theoretical section that provides social and technical bases for the practices recommended in Part 1. The mutual support of practice and theory is very familiar in science and clearly requires a willingness to observe and revise our prior assumptions--in this document, we invoke both. We hope that is offering will represent a step both towards improving practice and maturing the theory of practical science communication.

  8. Adhesion of epoxy primer to hydrotalcite conversion coated AA2024

    Science.gov (United States)

    Leggat, Robert Benton, III

    Hydrotalcite-based (HT) conversion coatings are being developed as an environmentally benign alternative to chromate conversion coatings (CCC). Accelerated exposure tests were conducted on epoxy primed, HT-modified AA2024 to gauge service performance. HT-based conversion coatings did not perform as well as the CCC when used with an epoxy primer. The current HT chemistries are optimized for stand-alone corrosion protection, however additional research into the primer/HT interactions is necessary before they can be implemented within a coating scheme. The relative contribution of mechanical and physico-chemical interactions in controlling adhesion has been investigated in this study. Practical adhesion tests were used to assess the dry and wet bond strength of epoxy primer on HT coatings using the pull-off tensile strength (POTS) as the figure of merit. The practical adhesion of HT coated samples generally fell between that observed for the CCC and bare AA2024. Laboratory testing was done to assess the physical and chemical properties of HT coatings. Contact angle measurements were performed using powders representative of different HT chemistries to evaluate the dispersive and acid-base character of the surface. The wet POTS correlated with the electrodynamic (dipole + dispersive) parameter of the surface tension. The HT surfaces were found to be predominantly basic. Given the basicity of epoxy, these results indicate that increasing the acidic character of HT coatings may increase the adhesion performance. This was supported by electrokinetic measurements in which the dry POTS was found to increase with decreasing conversion coating iso-electric point. The correlations with the dry and wet state adhesion are interpreted as indicating that dry state adhesion is optimized by minimizing unfavorable polar interactions between the basic epoxy and HT interfaces. Wet state adhesion, where polar interactions are disrupted, is dictated by non-polar bonding. FTIR

  9. Statistics in Matlab a primer

    CERN Document Server

    Cho, MoonJung

    2014-01-01

    List of Tables Preface MATLAB BasicsDesktop Environment Getting Help and Other Documentation Data Import and Export Data I/O via the Command Line The Import Wizard Examples of Data I/O in MATLAB Data I/O with the Statistics Toolbox More Functions for Data I/O Data in MATLAB Data Objects in Base MATLAB Accessing Data Elements Examples of Joining Data Sets Data Types in the Statistics Toolbox Object-Oriented Programming Miscellaneous Topics File and Workspace Management Punctuation in MATLAB Arithmetic Operators Functions in MATLAB Summary and Further Reading Visualizing DataBasic Plot Functions Plotting 2-D Data Plotting 3-D Data Examples Scatter Plots Basic 2-D and 3-D Scatter Plots Scatter Plot Matrix Examples GUIs for Graphics Simple Plot Editing Plotting Tools Interface PLOTS Tab Summary and Further Reading Descriptive StatisticsMeasures of Location Means, Medians, and Modes Examples Measures of Dispersion Range Variance and Standard Deviation Covariance and Correlation Examples Describing the Distribution...

  10. Frontotemporal lobar degeneration: current perspectives

    Directory of Open Access Journals (Sweden)

    Riedl L

    2014-02-01

    Full Text Available Lina Riedl,1 Ian R Mackenzie,2 Hans Förstl,1 Alexander Kurz,1 Janine Diehl-Schmid1 1Center for Cognitive Disorders, Department of Psychiatry and Psychotherapy, Klinikum rechts der Isar, Technische Universität München, Munich, Germany; 2Department of Pathology and Laboratory Medicine, University of British Columbia, Vancouver, Canada Abstract: The term frontotemporal lobar degeneration (FTLD refers to a group of progressive brain diseases, which preferentially involve the frontal and temporal lobes. Depending on the primary site of atrophy, the clinical manifestation is dominated by behavior alterations or impairment of language. The onset of symptoms usually occurs before the age of 60 years, and the mean survival from diagnosis varies between 3 and 10 years. The prevalence is estimated at 15 per 100,000 in the population aged between 45 and 65 years, which is similar to the prevalence of Alzheimer's disease in this age group. There are two major clinical subtypes, behavioral-variant frontotemporal dementia and primary progressive aphasia. The neuropathology underlying the clinical syndromes is also heterogeneous. A common feature is the accumulation of certain neuronal proteins. Of these, the microtubule-associated protein tau (MAPT, the transactive response DNA-binding protein, and the fused in sarcoma protein are most important. Approximately 10% to 30% of FTLD shows an autosomal dominant pattern of inheritance, with mutations in the genes for MAPT, progranulin (GRN, and in the chromosome 9 open reading frame 72 (C9orf72 accounting for more than 80% of familial cases. Although significant advances have been made in recent years regarding diagnostic criteria, clinical assessment instruments, neuropsychological tests, cerebrospinal fluid biomarkers, and brain imaging techniques, the clinical diagnosis remains a challenge. To date, there is no specific pharmacological treatment for FTLD. Some evidence has been provided for serotonin reuptake

  11. Menopause is associated with articular cartilage degeneration: a clinical study of knee joint in 860 women.

    Science.gov (United States)

    Lou, Chao; Xiang, Guangheng; Weng, Qiaoyou; Chen, Zhaojie; Chen, Deheng; Wang, Qingqing; Zhang, Di; Zhou, Bin; He, Dengwei; Chen, Hongliang

    2016-11-01

    The purpose of this study was to investigate the association between menopause and severity of knee joint cartilage degeneration using a magnetic resonance imaging-based six-level grading system, with six cartilage surfaces, the medial and lateral femoral condyle, the femoral trochlea, the medial and lateral tibia plateau, and the patella. The study cohort comprised 860 healthy women (age 36-83 y), and 5,160 cartilage surfaces were analyzed. Age, weight, height, age at natural menopause, and years since menopause (YSM) were obtained. Cartilage degeneration was assessed using a magnetic resonance imaging-based six-level grading system. After removing the age, height, and weight effects, postmenopausal women had more severe cartilage degeneration than pre- and perimenopausal women (P  0.05). No significant difference was observed in lateral tibia plateau and lateral femoral condyle in postmenopausal women. Menopause is associated with cartilage degeneration of knee joint. After menopause, cartilage showed progressive severe degeneration that occurred in the first 25 YSM, suggesting estrogen deficiency might be a risk factor of cartilage degeneration of the knee joint. Further studies are needed to investigate whether age or menopause plays a more important role in the progression of cartilage degeneration in the knee joint.

  12. Motor axon excitability during Wallerian degeneration

    DEFF Research Database (Denmark)

    Moldovan, Mihai; Alvarez, Susana; Krarup, Christian

    2008-01-01

    Axonal loss and degeneration are major factors in determining long-term outcome in patients with peripheral nerve disorders or injury. Following loss of axonal continuity, the isolated nerve stump distal to the lesion undergoes Wallerian degeneration in several phases. In the initial 'latent' phase......, action potential propagation and structural integrity of the distal segment are maintained. The aim of this study was to investigate in vivo the changes in membrane function of motor axons during the 'latent' phase of Wallerian degeneration. Multiple indices of axonal excitability of the tibial nerve...

  13. Disk degeneration in 14 year old children

    International Nuclear Information System (INIS)

    Erkintalo, M.; Salminen, J.J.; Paajanen, H.; Terho, P.; Kormano, M.

    1989-01-01

    This paper reports low back symptoms of 1,500 school children (14 years old) evaluated with a questionnaire and with a standardized clinical examination. Forty children who complained of recurrent and/or persistent low back pain and 40 matching symptomless controls were randomly chosen to undergo MR imaging of the lumbar spine. Premature disk degeneration was seen in 25.5% of asymptomatic children and in 40% of those with low back pain. The difference was statistically not significant. Disk degeneration is a surprisingly frequent MR finding in symptomless children. Premature disk degeneration may be the cause of low back pain in some children but is not always symptomatic in childhood

  14. Total absorption by degenerate critical coupling

    Energy Technology Data Exchange (ETDEWEB)

    Piper, Jessica R., E-mail: jrylan@stanford.edu; Liu, Victor; Fan, Shanhui, E-mail: shanhui@stanford.edu [Ginzton Laboratory, Department of Electrical Engineering, Stanford University, Stanford, California 94305 (United States)

    2014-06-23

    We consider a mirror-symmetric resonator with two ports. We show that, when excited from a single port, complete absorption can be achieved through critical coupling to degenerate resonances with opposite symmetry. Moreover, any time two resonances with opposite symmetry are degenerate in frequency and absorption is always significantly enhanced. In contrast, when two resonances with the same symmetry are nearly degenerate, there is no absorption enhancement. We numerically demonstrate these effects using a graphene monolayer on top of a photonic crystal slab, illuminated from a single side in the near-infrared.

  15. Functional genes to assess nitrogen cycling and aromatic hydrocarbon degradation: primers and processing matter

    Directory of Open Access Journals (Sweden)

    Christopher Ryan Penton

    2013-09-01

    Full Text Available Targeting sequencing to genes involved in key environmental processes, i.e. ecofunctional genes, provides an opportunity to sample nature’s gene guilds to greater depth and help link community structure to process-level outcomes. Vastly different approaches have been implemented for sequence processing and, ultimately, for taxonomic placement of these gene reads. The overall quality of next generation sequence analysis of functional genes is dependent on multiple steps and assumptions of unknown diversity. To illustrate current issues surrounding amplicon read processing we provide examples for three ecofunctional gene groups. A combination of in-silico, environmental and cultured strain sequences was used to test new primers targeting the dioxin and dibenzofuran degrading genes dxnA1, dbfA1, and carAa. The majority of obtained environmental sequences were classified into novel sequence clusters, illustrating the discovery value of the approach. For the nitrite reductase step in denitrification, the well-known nirK primers exhibited deficiencies in reference database coverage, illustrating the need to refine primer-binding sites and/or to design multiple primers, while nirS primers exhibited bias against five phyla. Amino acid-based OTU clustering of these two N-cycle genes from soil samples yielded only 114 unique nirK and 45 unique nirS genus-level groupings, likely a reflection of constricted primer coverage. Finally, supervised and non-supervised OTU analysis methods were compared using the nifH gene of nitrogen fixation, with generally similar outcomes, but the clustering (non-supervised method yielded higher diversity estimates and stronger site-based differences. High throughput amplicon sequencing can provide inexpensive and rapid access to nature’s related sequences by circumventing the culturing barrier, but each unique gene requires individual considerations in terms of primer design and sequence processing and classification.

  16. Primer Extension Mutagenesis Powered by Selective Rolling Circle Amplification

    Science.gov (United States)

    Huovinen, Tuomas; Brockmann, Eeva-Christine; Akter, Sultana; Perez-Gamarra, Susan; Ylä-Pelto, Jani; Liu, Yuan; Lamminmäki, Urpo

    2012-01-01

    Primer extension mutagenesis is a popular tool to create libraries for in vitro evolution experiments. Here we describe a further improvement of the method described by T.A. Kunkel using uracil-containing single-stranded DNA as the template for the primer extension by additional uracil-DNA glycosylase treatment and rolling circle amplification (RCA) steps. It is shown that removal of uracil bases from the template leads to selective amplification of the nascently synthesized circular DNA strand carrying the desired mutations by phi29 DNA polymerase. Selective RCA (sRCA) of the DNA heteroduplex formed in Kunkel's mutagenesis increases the mutagenesis efficiency from 50% close to 100% and the number of transformants 300-fold without notable diversity bias. We also observed that both the mutated and the wild-type DNA were present in at least one third of the cells transformed directly with Kunkel's heteroduplex. In contrast, the cells transformed with sRCA product contained only mutated DNA. In sRCA, the complex cell-based selection for the mutant strand is replaced with the more controllable enzyme-based selection and less DNA is needed for library creation. Construction of a gene library of ten billion members is demonstrated with the described method with 240 nanograms of DNA as starting material. PMID:22355397

  17. The Role of Degeneration Theory in the Understanding of Mental Illness, Colombia First Half of the Twentieth Century

    Directory of Open Access Journals (Sweden)

    María Fernanda Vásquez Valencia

    2018-01-01

    Full Text Available Based on medical journals and theses from the first half of the twentieth century, this article analyzes the role played by the theory of degeneration in the understanding of mental illness in Colombia. It is particularly interesting to show how Colombian physicians have appropriated concepts such as degeneration, diathesis, morbid heredity and stigmas of degeneration since the early 20th century to describe, classify and define mental illnesses present in Colombian territory. During this period the theory of degeneration served as the conceptual and theoretical framework for understanding the etiology, genesis and evolution of mental illness.

  18. Genetics of frontotemporal lobar degeneration

    Directory of Open Access Journals (Sweden)

    Aswathy P

    2010-10-01

    Full Text Available Frontotemporal lobar degeneration (FTLD is a highly heterogenous group of progressive neurodegenerative disorders characterized by atrophy of prefrontal and anterior temporal cortices. Recently, the research in the field of FTLD has gained increased attention due to the clinical, neuropathological, and genetic heterogeneity and has increased our understanding of the disease pathogenesis. FTLD is a genetically complex disorder. It has a strong genetic basis and 50% of patients show a positive family history for FTLD. Linkage studies have revealed seven chromosomal loci and a number of genes including MAPT, PGRN, VCP, and CHMB-2B are associated with the disease. Neuropathologically, FTLD is classified into tauopathies and ubiquitinopathies. The vast majority of FTLD cases are characterized by pathological accumulation of tau or TDP-43 positive inclusions, each as an outcome of mutations in MAPT or PGRN, respectively. Identification of novel proteins involved in the pathophysiology of the disease, such as progranulin and TDP-43, may prove to be excellent biomarkers of disease progression and thereby lead to the development of better therapeutic options through pharmacogenomics. However, much more dissections into the causative pathways are needed to get a full picture of the etiology. Over the past decade, advances in research on the genetics of FTLD have revealed many pathogenic mutations leading to different clinical manifestations of the disease. This review discusses the current concepts and recent advances in our understanding of the genetics of FTLD.

  19. Degeneration of biogenic superparamagnetic magnetite.

    Science.gov (United States)

    Li, Y-L; Pfiffner, S M; Dyar, M D; Vali, H; Konhauser, K; Cole, D R; Rondinone, A J; Phelps, T J

    2009-01-01

    Magnetite crystals precipitated as a consequence of Fe(III) reduction by Shewanella algae BrY after 265 h incubation and 5-year anaerobic storage were investigated with transmission electron microscopy, Mössbauer spectroscopy and X-ray diffraction. The magnetite crystals were typically superparamagnetic with an approximate size of 13 nm. The lattice constants of the 265 h and 5-year crystals are 8.4164A and 8.3774A, respectively. The Mössbauer spectra indicated that the 265 h magnetite had excess Fe(II) in its crystal-chemistry (Fe(3+) (1.990)Fe(2+) (1.015)O(4)) but the 5-year magnetite was Fe(II)-deficient in stoichiometry (Fe(3+) (2.388)Fe(2+) (0.419)O(4)). Such crystal-chemical changes may be indicative of the degeneration of superparamagnetic magnetite through the aqueous oxidization of Fe(II) anaerobically, and the concomitant oxidation of the organic phases (fatty acid methyl esters) that were present during the initial formation of the magnetite. The observation of a corona structure on the aged magnetite corroborates the anaerobic oxidation of Fe(II) on the outer layers of magnetite crystals. These results suggest that there may be a possible link between the enzymatic activity of the bacteria and the stability of Fe(II)-excess magnetite, which may help explain why stable nano-magnetite grains are seldom preserved in natural environments.

  20. Degeneration of Biogenic Superparamagnetic Magnetite

    Energy Technology Data Exchange (ETDEWEB)

    Li, Dr. Yi-Liang [University of Tennessee, Knoxville (UTK); Pfiffner, Susan M. [University of Tennessee, Knoxville (UTK); Dyar, Dr. M Darby [Mount Holyoke College; Vali, Dr. Hojatolah [McGill University, Montreal, Quebec; Konhauser, Dr, Kurt [University of Alberta; Cole, David R [ORNL; Rondinone, Adam Justin [ORNL; Phelps, Tommy Joe [ORNL

    2009-01-01

    ABSTRACT. Magnetite crystals precipitated as a consequence of Fe(III) reduction by Shewanella algae BrY after 265 hours incubation and 5-year storage were investigated with transmission electron microscopy, M ssbauer spectroscopy and X-ray diffraction. The magnetite crystals were typically superparamagnetic with an approximate size of 13 nm. The lattice constants of the 265 hour and 5-year crystals are 8.4164 and 8.3774 , respectively. The M ssbauer spectra indicated that the 265 hour magnetite had excess Fe(II) in its crystal-chemistry (Fe3+1.9901Fe2+ 1.0149O4) but the 5-year magnetite was Fe(II)-deficient in stoichiometry (Fe3+2.3875Fe2+0.4188O4). Such crystal-hemical changes may be indicative of the degeneration of superparamagnetic magnetite through the aqueous oxidization of Fe(II) anaerobically, and the concomitant oxidation of the organic phases(fatty acid methyl esters) that were present during the initial formation of the magnetite. The observation of a corona structure on the aged magnetite corroborates the oxidation of Fe(II) on the outer layers of magnetite crystals. These results suggest that there may be a possible link between the enzymatic activity of the bacteria and the stability of Fe(II)-excess magnetite, which may help explain why stable nano-magnetite grains are seldom preserved in natural environments.

  1. Antisense Oligonucleotide-based Splice Correction for USH2A-associated Retinal Degeneration Caused by a Frequent Deep-intronic Mutation

    Directory of Open Access Journals (Sweden)

    Radulfus WN Slijkerman

    2016-01-01

    Full Text Available Usher syndrome (USH is the most common cause of combined deaf-blindness in man. The hearing loss can be partly compensated by providing patients with hearing aids or cochlear implants, but the loss of vision is currently untreatable. In general, mutations in the USH2A gene are the most frequent cause of USH explaining up to 50% of all patients worldwide. The first deep-intronic mutation in the USH2A gene (c.7595-2144A>G was reported in 2012, leading to the insertion of a pseudoexon (PE40 into the mature USH2A transcript. When translated, this PE40-containing transcript is predicted to result in a truncated non-functional USH2A protein. In this study, we explored the potential of antisense oligonucleotides (AONs to prevent aberrant splicing of USH2A pre-mRNA as a consequence of the c.7595-2144A>G mutation. Engineered 2'-O-methylphosphorothioate AONs targeting the PE40 splice acceptor site and/or exonic splice enhancer regions displayed significant splice correction potential in both patient derived fibroblasts and a minigene splice assay for USH2A c.7595-2144A>G, whereas a non-binding sense oligonucleotide had no effect on splicing. Altogether, AON-based splice correction could be a promising approach for the development of a future treatment for USH2A-associated retinitis pigmentosa caused by the deep-intronic c.7595-2144A>G mutation.

  2. Employment of Near Full-Length Ribosome Gene TA-Cloning and Primer-Blast to Detect Multiple Species in a Natural Complex Microbial Community Using Species-Specific Primers Designed with Their Genome Sequences.

    Science.gov (United States)

    Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou

    2016-11-01

    It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.

  3. Identifying Initial Condition in Degenerate Parabolic Equation with Singular Potential

    Directory of Open Access Journals (Sweden)

    K. Atifi

    2017-01-01

    Full Text Available A hybrid algorithm and regularization method are proposed, for the first time, to solve the one-dimensional degenerate inverse heat conduction problem to estimate the initial temperature distribution from point measurements. The evolution of the heat is given by a degenerate parabolic equation with singular potential. This problem can be formulated in a least-squares framework, an iterative procedure which minimizes the difference between the given measurements and the value at sensor locations of a reconstructed field. The mathematical model leads to a nonconvex minimization problem. To solve it, we prove the existence of at least one solution of problem and we propose two approaches: the first is based on a Tikhonov regularization, while the second approach is based on a hybrid genetic algorithm (married genetic with descent method type gradient. Some numerical experiments are given.

  4. Magnetic resonance imaging of intervertebral disc degeneration

    International Nuclear Information System (INIS)

    Maeda, Hiroshi; Noguchi, Masao; Kira, Hideaki; Fujiki, Hiroshi; Shimokawa, Isao; Hinoue, Kaichi.

    1993-01-01

    The aim of this study was to correlate the degree of lumbar intervertebral disc degeneration with findings of magnetic resonance imaging (MRI). Seventeen autopsied (from 7 patients) and 21 surgical (from 20 patients) intervertebral discs were used as specimens for histopathological examination. In addition, 21 intervertebral discs were examined on T2-weighted images. Histopathological findings from both autopsied and surgical specimens were well correlated with MRI findings. In particular, T2-weighted images reflected increased collagen fibers and rupture within the fibrous ring accurately. However, when severely degenerated intervertebral discs and hernia protruding the posterior longitudinal ligament existed, histological findings were not concordant well with T2-weighted images. Morphological appearances of autopsy specimens, divided into four on T2-weighted images, were well consistent with histological degeneration. This morphological classification, as shown on T2-weighted images, could also be used in the evaluation of intervertebral disc degeneration. (N.K.)

  5. Magnetic resonance imaging of intervertebral disc degeneration

    Energy Technology Data Exchange (ETDEWEB)

    Maeda, Hiroshi; Noguchi, Masao (Kitakyushu City Yahata Hospital, Fukuoka (Japan)); Kira, Hideaki; Fujiki, Hiroshi; Shimokawa, Isao; Hinoue, Kaichi

    1993-02-01

    The aim of this study was to correlate the degree of lumbar intervertebral disc degeneration with findings of magnetic resonance imaging (MRI). Seventeen autopsied (from 7 patients) and 21 surgical (from 20 patients) intervertebral discs were used as specimens for histopathological examination. In addition, 21 intervertebral discs were examined on T2-weighted images. Histopathological findings from both autopsied and surgical specimens were well correlated with MRI findings. In particular, T2-weighted images reflected increased collagen fibers and rupture within the fibrous ring accurately. However, when severely degenerated intervertebral discs and hernia protruding the posterior longitudinal ligament existed, histological findings were not concordant well with T2-weighted images. Morphological appearances of autopsy specimens, divided into four on T2-weighted images, were well consistent with histological degeneration. This morphological classification, as shown on T2-weighted images, could also be used in the evaluation of intervertebral disc degeneration. (N.K.).

  6. Genetics Home Reference: Stargardt macular degeneration

    Science.gov (United States)

    ... recognizing faces. In most people with Stargardt macular degeneration , a fatty yellow pigment (lipofuscin) builds up in cells underlying the macula. Over time, the abnormal accumulation of this substance ...

  7. Ataxias and Cerebellar or Spinocerebellar Degeneration

    Science.gov (United States)

    ... and conducts a broad range of basic and clinical research on cerebellar and spinocerebellar degeneration, including work aimed at finding the cause(s) of ataxias and ways to ... Publications Definition Ataxia ...

  8. Progressive Supranuclear Palsy and Corticobasal Degeneration: Pathophysiology and Treatment Options

    OpenAIRE

    Lamb, Ruth; Rohrer, Jonathan D.; Lees, Andrew J.; Morris, Huw R.

    2016-01-01

    Opinion statement There are currently no disease-modifying treatments for progressive supranuclear palsy (PSP) or corticobasal degeneration (CBD), and no approved pharmacological or therapeutic treatments that are effective in controlling their symptoms. The use of most pharmacological treatment options are based on experience in other disorders or from non-randomized historical controls, case series, or expert opinion. Levodopa may provide some improvement in symptoms of Parkinsonism (specif...

  9. Progressive Supranuclear Palsy and Corticobasal Degeneration: Pathophysiology and Treatment Options

    OpenAIRE

    Lamb, R.; Rohrer, J. D.; Lees, A. J.; Morris, H. R.

    2016-01-01

    There are currently no disease-modifying treatments for progressive supranuclear palsy (PSP) or corticobasal degeneration (CBD), and no approved pharmacological or therapeutic treatments that are effective in controlling their symptoms. The use of most pharmacological treatment options are based on experience in other disorders or from non-randomized historical controls, case series, or expert opinion. Levodopa may provide some improvement in symptoms of Parkinsonism (specifically bradykinesi...

  10. Real-time PCR (qPCR) primer design using free online software.

    Science.gov (United States)

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.

  11. Splitting deformations of degenerations of complex curves towards the classification of atoms of degenerations

    CERN Document Server

    2006-01-01

    The author develops a deformation theory for degenerations of complex curves; specifically, he treats deformations which induce splittings of the singular fiber of a degeneration. He constructs a deformation of the degeneration in such a way that a subdivisor is "barked" (peeled) off from the singular fiber. These "barking deformations" are related to deformations of surface singularities (in particular, cyclic quotient singularities) as well as the mapping class groups of Riemann surfaces (complex curves) via monodromies. Important applications, such as the classification of atomic degenerations, are also explained.

  12. Low-copy nuclear primers and ycf1 primers in Cactaceae.

    Science.gov (United States)

    Franck, Alan R; Cochrane, Bruce J; Garey, James R

    2012-10-01

    To increase the number of variable regions available for phylogenetic study in the Cactaceae, primers were developed for a portion of the plastid ycf1 gene and intron-spanning regions of two low-copy nuclear genes (isi1, nhx1). • Primers were tested on several families within Caryophyllales, focusing on the Cactaceae. Gel electrophoresis indicated positive amplification in most samples. Sequences of these three regions (isi1, nhx1, ycf1) from Harrisia exhibited variation similar to or greater than two plastid regions (atpB-rbcL intergenic spacer and rpl16 intron). • The isi, nhx, and ycf1 primers amplify phylogenetically useful information applicable to the Cactaceae and other families in the Caryophyllales.

  13. Generating markers based on biotic stress of protein system in and tandem repeats sequence for Aquilaria sp

    International Nuclear Information System (INIS)

    Azhar Mohamad; Muhammad Hanif Azhari N; Siti Norhayati Ismail

    2014-01-01

    Aquilaria sp. belongs to the Thymelaeaceae family and is well distributed in Asia region. The species has multipurpose use from root to shoot and is an economically important crop, which generates wide interest in understanding genetic diversity of the species. Knowledge on DNA-based markers has become a prerequisite for more effective application of molecular marker techniques in breeding and mapping programs. In this work, both targeted genes and tandem repeat sequences were used for DNA fingerprinting in Aquilaria sp. A total of 100 ISSR (inter simple sequence repeat) primers and 50 combination pairs of specific primers derived from conserved region of a specific protein known as system in were optimized. 38 ISSR primers were found affirmative for polymorphism evaluation study and were generated from both specific and degenerate ISSR primers. And one utmost combination of system in primers showed significant results in distinguishing the Aquilaria sp. In conclusion, polymorphism derived from ISSR profiling and targeted stress genes of protein system in proved as a powerful approach for identification and molecular classification of Aquilaria sp. which will be useful for diversification in identifying any mutant lines derived from nature. (author)

  14. Age-related macular degeneration.

    Science.gov (United States)

    Cheung, Lily K; Eaton, Angie

    2013-08-01

    Age-related macular degeneration (AMD) is the leading cause of blindness in the elderly, and the prevalence of the disease increases exponentially with every decade after age 50 years. It is a multifactorial disease involving a complex interplay of genetic, environmental, metabolic, and functional factors. Besides smoking, hypertension, obesity, and certain dietary habits, a growing body of evidence indicates that inflammation and the immune system may play a key role in the development of the disease. AMD may progress from the early form to the intermediate form and then to the advanced form, where two subtypes exist: the nonneovascular (dry) type and the neovascular (wet) type. The results from the Age-Related Eye Disease Study have shown that for the nonneovascular type of AMD, supplementation with high-dose antioxidants (vitamin C, vitamin E, and β-carotene) and zinc is recommended for those with the intermediate form of AMD in one or both eyes or with advanced AMD or vision loss due to AMD in one eye. As for the neovascular type of the advanced AMD, the current standard of therapy is intravitreal injections of vascular endothelial growth factor inhibitors. In addition, lifestyle and dietary modifications including improved physical activity, reduced daily sodium intake, and reduced intake of solid fats, added sugars, cholesterol, and refined grain foods are recommended. To date, no study has demonstrated that AMD can be cured or effectively prevented. Clearly, more research is needed to fully understand the pathophysiology as well as to develop prevention and treatment strategies for this devastating disease. © 2013 Pharmacotherapy Publications, Inc.

  15. Indian hedgehog contributes to human cartilage endplate degeneration.

    Science.gov (United States)

    Wang, Shaowei; Yang, Kun; Chen, Shuai; Wang, Jiying; Du, Guoqing; Fan, Shunwu; Wei, Lei

    2015-08-01

    To determine the role of Indian hedgehog (Ihh) signaling in human cartilage endplate (CEP) degeneration. CEP-degenerated tissues from patients with Modic I or II changes (n = 9 and 45, respectively) and normal tissues from vertebral burst fracture patients (n = 17) were collected. Specimens were either cut into slices for organ culture ex vivo or digested to isolate chondrocytes for cell culture in vitro. Ihh expression and the effect of Ihh on cartilage degeneration were determined by investigating degeneration markers in this study. Ihh expression and cartilage degeneration markers significantly increased in the Modic I and II groups. The expression of cartilage degeneration markers was positively correlated with degeneration severity. Gain-of-function for Ihh promoted expression of cartilage degeneration markers in vitro, while loss-of-function for Ihh inhibited their expression both in vitro and ex vivo. These findings demonstrated that Ihh promotes CEP degeneration. Blocking Ihh pathway has potential clinical usage for attenuating CEP degeneration.

  16. Sudden acquired retinal degeneration syndrome in western Canada: 93 cases.

    Science.gov (United States)

    Leis, Marina L; Lucyshyn, Danica; Bauer, Bianca S; Grahn, Bruce H; Sandmeyer, Lynne S

    2017-11-01

    This study reviewed clinical data from dogs diagnosed with sudden acquired retinal degeneration syndrome (SARDS) in western Canada. Medical records from the Western College of Veterinary Medicine from 2002 to 2016 showed that 93 cases of SARDS were diagnosed based on presentation for sudden blindness and a bilaterally extinguished electroretinogram. The most common pure breeds were the miniature schnauzer, dachshund, and pug. The mean age at diagnosis was 8.1 years and males and females were equally affected. Most of the dogs were presented with normal non-chromatic, but abnormal chromatic pupillary light reflexes. The incidence of retinal degeneration as detected via ophthalmoscopy increased over time after SARDS diagnosis. Polyuria, polydipsia, polyphagia, weight gain, elevated liver enzyme values, isosthenuria, and proteinuria were common clinical and laboratory findings. Chromatic pupillary light reflex testing may be more valuable than non-chromatic pupillary light testing in detecting pupil response abnormalities in dogs with SARDS, although electroretinography remains the definitive diagnostic test.

  17. Nonlinear electromagnetic waves in a degenerate electron-positron plasma

    Energy Technology Data Exchange (ETDEWEB)

    El-Labany, S.K., E-mail: skellabany@hotmail.com [Department of Physics, Faculty of Science, Damietta University, New Damietta (Egypt); El-Taibany, W.F., E-mail: eltaibany@hotmail.com [Department of Physics, College of Science for Girls in Abha, King Khalid University, Abha (Saudi Arabia); El-Samahy, A.E.; Hafez, A.M.; Atteya, A., E-mail: ahmedsamahy@yahoo.com, E-mail: am.hafez@sci.alex.edu.eg, E-mail: ahmed_ateya2002@yahoo.com [Department of Physics, Faculty of Science, Alexandria University, Alexandria (Egypt)

    2015-08-15

    Using the reductive perturbation technique (RPT), the nonlinear propagation of magnetosonic solitary waves in an ultracold, degenerate (extremely dense) electron-positron (EP) plasma (containing ultracold, degenerate electron, and positron fluids) is investigated. The set of basic equations is reduced to a Korteweg-de Vries (KdV) equation for the lowest-order perturbed magnetic field and to a KdV type equation for the higher-order perturbed magnetic field. The solutions of these evolution equations are obtained. For better accuracy and searching on new features, the new solutions are analyzed numerically based on compact objects (white dwarf) parameters. It is found that including the higher-order corrections results as a reduction (increment) of the fast (slow) electromagnetic wave amplitude but the wave width is increased in both cases. The ranges where the RPT can describe adequately the total magnetic field including different conditions are discussed. (author)

  18. Sudden acquired retinal degeneration syndrome in western Canada: 93 cases

    Science.gov (United States)

    Leis, Marina L.; Lucyshyn, Danica; Bauer, Bianca S.; Grahn, Bruce H.; Sandmeyer, Lynne S.

    2017-01-01

    This study reviewed clinical data from dogs diagnosed with sudden acquired retinal degeneration syndrome (SARDS) in western Canada. Medical records from the Western College of Veterinary Medicine from 2002 to 2016 showed that 93 cases of SARDS were diagnosed based on presentation for sudden blindness and a bilaterally extinguished electroretinogram. The most common pure breeds were the miniature schnauzer, dachshund, and pug. The mean age at diagnosis was 8.1 years and males and females were equally affected. Most of the dogs were presented with normal non-chromatic, but abnormal chromatic pupillary light reflexes. The incidence of retinal degeneration as detected via ophthalmoscopy increased over time after SARDS diagnosis. Polyuria, polydipsia, polyphagia, weight gain, elevated liver enzyme values, isosthenuria, and proteinuria were common clinical and laboratory findings. Chromatic pupillary light reflex testing may be more valuable than non-chromatic pupillary light testing in detecting pupil response abnormalities in dogs with SARDS, although electroretinography remains the definitive diagnostic test. PMID:29089658

  19. Bayesian models a statistical primer for ecologists

    CERN Document Server

    Hobbs, N Thompson

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods-in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach. Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probabili

  20. Signals and systems primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2006-01-01

    Signals and Systems Primer with MATLAB® equally emphasizes the fundamentals of both analog and digital signals and systems. To ensure insight into the basic concepts and methods, the text presents a variety of examples that illustrate a wide range of applications, from microelectromechanical to worldwide communication systems. It also provides MATLAB functions and procedures for practice and verification of these concepts.Taking a pedagogical approach, the author builds a solid foundation in signal processing as well as analog and digital systems. The book first introduces orthogonal signals,

  1. The use of a fluoropolymer containing primer to enhance adhesion of rotolined fluoropolymer coatings

    Energy Technology Data Exchange (ETDEWEB)

    Lech, L.M. [DuPont, Parkersburg, WV (United States)

    1999-11-01

    Fluoropolymers such as PFA and ETFE are often used in rotolining applications. A common source of failure for rotolined coatings is delamination from the metal substrate. Extensive thermal cycling of the coated part, permeation of the contained liquid to the substrate, or a combination of both thermal cycling and permeation causes this. Rotolined coatings are typically applied directly to the metal part. It has been found that applying an aqueous fluoropolymer based primer to the metal substrate prior to applying the rotolined resin increases the time before delamination is observed. The primer is applied by conventional spray techniques and can either be force dried at low temperature or air-dried under ambient conditions. The primer consists primarily of a fluoropolymer such as ETFE or PFA and a bonding agent such as polyamide-imide, polyphenylene sulfide, or polyether sulfone. After the primer is applied to the metal part, the fluoropolymer in the primer melt blends with the fluoropolymer rotolining resin during the rotolining process. The bonding agent enhances the adhesion of the entire coating system to the metal part. This extends the lifetime of the rotolined coatings.

  2. Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.

    Science.gov (United States)

    Françoso, E; Arias, M C

    2013-09-01

    Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.

  3. Polyadenylated Sequencing Primers Enable Complete Readability of PCR Amplicons Analyzed by Dideoxynucleotide Sequencing

    Directory of Open Access Journals (Sweden)

    Martin Beránek

    2012-01-01

    Full Text Available Dideoxynucleotide DNA sequencing is one of the principal procedures in molecular biology. Loss of an initial part of nucleotides behind the 3' end of the sequencing primer limits the readability of sequenced amplicons. We present a method which extends the readability by using sequencing primers modified by polyadenylated tails attached to their 5' ends. Performing a polymerase chain reaction, we amplified eight amplicons of six human genes (AMELX, APOE, HFE, MBL2, SERPINA1 and TGFB1 ranging from 106 bp to 680 bp. Polyadenylation of the sequencing primers minimized the loss of bases in all amplicons. Complete sequences of shorter products (AMELX 106 bp, SERPINA1 121 bp, HFE 208 bp, APOE 244 bp, MBL2 317 bp were obtained. In addition, in the case of TGFB1 products (366 bp, 432 bp, and 680 bp, respectively, the lengths of sequencing readings were significantly longer if adenylated primers were used. Thus, single strand dideoxynucleotide sequencing with adenylated primers enables complete or near complete readability of short PCR amplicons.

  4. Evaluating primers for profiling anaerobic ammonia oxidizing bacteria within freshwater environments.

    Directory of Open Access Journals (Sweden)

    Puntipar Sonthiphand

    Full Text Available Anaerobic ammonia oxidizing (anammox bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library

  5. Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

    DEFF Research Database (Denmark)

    Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.

    2011-01-01

    BACKGROUND: MicroRNAs are important regulators of gene expression at the post-transcriptional level and play an important role in many biological processes. Due to the important biological role it is of great interest to quantitatively determine their expression level in different biological...... be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...... samples than a similar method based on locked nucleic acids-spiked primers, which is in agreement with the observation that locked nucleic acid interferes with efficient amplification of short templates. The higher amplification efficiency of DNA primers translates into higher sensitivity and precision...

  6. GST-PRIME: an algorithm for genome-wide primer design.

    Science.gov (United States)

    Leister, Dario; Varotto, Claudio

    2007-01-01

    The profiling of mRNA expression based on DNA arrays has become a powerful tool to study genome-wide transcription of genes in a number of organisms. GST-PRIME is a software package created to facilitate large-scale primer design for the amplification of probes to be immobilized on arrays for transcriptome analyses, even though it can be also applied in low-throughput approaches. GST-PRIME allows highly efficient, direct amplification of gene-sequence tags (GSTs) from genomic DNA (gDNA), starting from annotated genome or transcript sequences. GST-PRIME provides a customer-friendly platform for automatic primer design, and despite the relative simplicity of the algorithm, experimental tests in the model plant species Arabidopsis thaliana confirmed the reliability of the software. This chapter describes the algorithm used for primer design, its input and output files, and the installation of the standalone package and its use.

  7. Gold nanoparticle-assisted primer walking for closing the human chromosomal gap

    DEFF Research Database (Denmark)

    Li, H; Shi, B; Li, X

    2013-01-01

    The finished sequence of the human genome still contains 260 euchromatic gaps. All the PCR-based genome walking techniques used to close gaps have common limitations, such as low efficiency and low specificity. We herein describe a strategy to solve this problem by employing gold nanoparticles (Au......NPs) to improve the efficiency in primer walking amplification. We used this strategy to close a gap in human chromosome 5 containing a DNA stretch composed of the 12SAT repeat. The obtained gap sequence is highly conserved among several mammalian genomes. The demonstrated AuNP-assisted primer walking strategy...

  8. Bayesian models: A statistical primer for ecologists

    Science.gov (United States)

    Hobbs, N. Thompson; Hooten, Mevin B.

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods—in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach.Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probability and develops a step-by-step sequence of connected ideas, including basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and inference from single and multiple models. This unique book places less emphasis on computer coding, favoring instead a concise presentation of the mathematical statistics needed to understand how and why Bayesian analysis works. It also explains how to write out properly formulated hierarchical Bayesian models and use them in computing, research papers, and proposals.This primer enables ecologists to understand the statistical principles behind Bayesian modeling and apply them to research, teaching, policy, and management.Presents the mathematical and statistical foundations of Bayesian modeling in language accessible to non-statisticiansCovers basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and moreDeemphasizes computer coding in favor of basic principlesExplains how to write out properly factored statistical expressions representing Bayesian models

  9. Medium Caliber Lead-Free Electric Primer. Version 2

    Science.gov (United States)

    2012-09-01

    2008). Safe Drinking Water Act of 1986 lists lead compounds as carcinogens (27 CCR 27001 – Dec. 2008). EPA began a Phase I assessment to determine...primer cups was our standard method, wet loading using solvents (hexane and iso -propanol) was investigated to reduce risk of accidental ignition...LOADING OPERATION (Single Die) Wet primer mix charge with solvent (Hexane/ Iso -Propanol) and stir to mix to a uniform slurry Insert primer cup in

  10. Humor and laughter in patients with cerebellar degeneration.

    Science.gov (United States)

    Frank, B; Propson, B; Göricke, S; Jacobi, H; Wild, B; Timmann, D

    2012-06-01

    Humor is a complex behavior which includes cognitive, affective and motor responses. Based on observations of affective changes in patients with cerebellar lesions, the cerebellum may support cerebral and brainstem areas involved in understanding and appreciation of humorous stimuli and expression of laughter. The aim of the present study was to examine if humor appreciation, perception of humorous stimuli, and the succeeding facial reaction differ between patients with cerebellar degeneration and healthy controls. Twenty-three adults with pure cerebellar degeneration were compared with 23 age-, gender-, and education-matched healthy control subjects. No significant difference in humor appreciation and perception of humorous stimuli could be found between groups using the 3 Witz-Dimensionen Test, a validated test asking for funniness and aversiveness of jokes and cartoons. Furthermore, while observing jokes, humorous cartoons, and video sketches, facial expressions of subjects were videotaped and afterwards analysed using the Facial Action Coding System. Using depression as a covariate, the number, and to a lesser degree, the duration of facial expressions during laughter were reduced in cerebellar patients compared to healthy controls. In sum, appreciation of humor appears to be largely preserved in patients with chronic cerebellar degeneration. Cerebellar circuits may contribute to the expression of laughter. Findings add to the literature that non-motor disorders in patients with chronic cerebellar disease are generally mild, but do not exclude that more marked disorders may show up in acute cerebellar disease and/or in more specific tests of humor appreciation.

  11. Brownfields Technology Primer: Selecting and Using Phytoremediation for Site Cleanup

    Science.gov (United States)

    This primer explains the phytoremediation process, discusses the potential advantages and considerations in selecting phytoremediation to clean up brownfields sites, and provides information on additional resources about phytoremediation.

  12. Human immunodeficiency virus uses tRNA(Lys,3) as primer for reverse transcription in HeLa-CD4+ cells

    NARCIS (Netherlands)

    Das, A. T.; Koken, S. E.; Essink, B. B.; van Wamel, J. L.; Berkhout, B.

    1994-01-01

    Significant amounts of different tRNA molecules are present in retroviral particles, but one specific tRNA species functions as primer in reverse transcription. It is generally believed that the HIV-1 virus uses the tRNA(Lys,3) molecule as primer. This is based on sequence complementarity between

  13. Design of primers for pertussis diagnosis by Real Time PCR and determination of its sensitivity and specificity in comparison with commercial kits.

    Directory of Open Access Journals (Sweden)

    Hamidreza Monavari

    2013-12-01

    Results: Performance of our home made primers for detecting pertussis using Real Time PCR in comparison with those by commercial kit was acceptable based on diagnostic classical guidance (WHO and the (CDC. Conclusions: Real time PCR test with new primers in comparison with culture techniques is more suitable, high sensitivity and can provide more informative values for pertussis detection.

  14. Optimisation of the PCR-invA primers for the detection of Salmonella ...

    African Journals Online (AJOL)

    A polymerase chain reaction (PCR)-based method for the detection of Salmonella species in water samples was optimised and evaluated for speed, specificity and sensitivity. Optimisation of Mg2+ and primer concentrations and cycling parameters increased the sensitivity and limit of detection of PCR to 2.6 x 104 cfu/m.

  15. Detection of three porcine vesicular viruses using multiplex real-time primer-probe energy transfer

    DEFF Research Database (Denmark)

    Rasmussen, Thomas Bruun; Uttenthal, Åse; Aguero, M.

    2006-01-01

    Rapid identification of the etiologic agent in infected animals is important for the control of an outbreak of vesicular disease in livestock. We have in the present study developed a multiplex real-time reverse transcription-PCR, based on primer-probe energy transfer (PriProET), for simultaneous...

  16. Families and degenerations of conformal field theories

    Energy Technology Data Exchange (ETDEWEB)

    Roggenkamp, D.

    2004-09-01

    In this work, moduli spaces of conformal field theories are investigated. In the first part, moduli spaces corresponding to current-current deformation of conformal field theories are constructed explicitly. For WZW models, they are described in detail, and sigma model realizations of the deformed WZW models are presented. The second part is devoted to the study of boundaries of moduli spaces of conformal field theories. For this purpose a notion of convergence of families of conformal field theories is introduced, which admits certain degenerated conformal field theories to occur as limits. To such a degeneration of conformal field theories, a degeneration of metric spaces together with additional geometric structures can be associated, which give rise to a geometric interpretation. Boundaries of moduli spaces of toroidal conformal field theories, orbifolds thereof and WZW models are analyzed. Furthermore, also the limit of the discrete family of Virasoro minimal models is investigated. (orig.)

  17. Intramuscular degeneration process in Duchenne muscular dystrophy

    International Nuclear Information System (INIS)

    Hasegawa, Takeshi; Matsumra, Kiichiro; Hashimoto, Takahiro; Ikehira, Hiroo; Fukuda, Hiroshi; Tateno, Yukio.

    1992-01-01

    Intramuscular degeneration process of Duchenne dystrophy skeletal muscles was investigated by longitudinal skeletal muscle imaging with high-field-strength NMR-CT of 1.5 Tesla. Thigh muscles in 10 cases ranging in age from 4 to 19 years were examined by T 1 -weighted longitudinal images (TR=215∼505 ms, TE=19∼20 ms). The following results were obtained. Skeletal muscle degeneration was depicted as high signal intensity area reflecting its high fat contents. These high signal intensity areas had a longitudinally streaky appearance in parallel direction with myofibers. These findings were more prominent toward myotendon junction than muscle bellies. Skeletal muscle degeneration progressed rapidly between 7 to 10 years of age, and reached a plateau after that. (author)

  18. [Peripheral retinal degenerations--treatment recommendations].

    Science.gov (United States)

    Joussen, A M; Kirchhof, B

    2004-10-01

    This report reviews the clinical appearance of degenerative diseases of the peripheral retina in relationship to the risk of developing a rhegmatogenous retinal detachment. We present recommendations for preventive treatment in eyes at increased risk of developing retinal detachment. Retinal degenerations are common lesions involving the peripheral retina but most of them are clinically insignificant. Lattice degeneration, degenerative retinoschisis, cystic retinal tufts, and very rarely zonular traction tufts can result in rhegmatogenous retinal detachment. Therefore, these lesions have been considered for prophylactic treatment; however, adequate studies have not been performed to date. Most of the peripheral retinal degenerations may not require treatment except in rare, high-risk situations. According to current knowledge there is no higher incidence of secondary pucker or other side effects after laser coagulation. Therefore, generous laser indication is recommended if risk factors apply.

  19. Metabolic primers for detection of (Per)chlorate-reducing bacteria in the environment and phylogenetic analysis of cld gene sequences.

    Science.gov (United States)

    Bender, Kelly S; Rice, Melissa R; Fugate, William H; Coates, John D; Achenbach, Laurie A

    2004-09-01

    Natural attenuation of the environmental contaminant perchlorate is a cost-effective alternative to current removal methods. The success of natural perchlorate remediation is dependent on the presence and activity of dissimilatory (per)chlorate-reducing bacteria (DPRB) within a target site. To detect DPRB in the environment, two degenerate primer sets targeting the chlorite dismutase (cld) gene were developed and optimized. A nested PCR approach was used in conjunction with these primer sets to increase the sensitivity of the molecular detection method. Screening of environmental samples indicated that all products amplified by this method were cld gene sequences. These sequences were obtained from pristine sites as well as contaminated sites from which DPRB were isolated. More than one cld phylotype was also identified from some samples, indicating the presence of more than one DPRB strain at those sites. The use of these primer sets represents a direct and sensitive molecular method for the qualitative detection of (per)chlorate-reducing bacteria in the environment, thus offering another tool for monitoring natural attenuation. Sequences of cld genes isolated in the course of this project were also generated from various DPRB and provided the first opportunity for a phylogenetic treatment of this metabolic gene. Comparisons of the cld and 16S ribosomal DNA (rDNA) gene trees indicated that the cld gene does not track 16S rDNA phylogeny, further implicating the possible role of horizontal transfer in the evolution of (per)chlorate respiration.

  20. Great Lakes rivermouths: a primer for managers

    Science.gov (United States)

    Pebbles, Victoria; Larson, James; Seelbach, Paul; Pebbles, Victoria; Larson, James; Seelbach, Paul

    2013-01-01

    Between the North American Great Lakes and their tributaries are the places where the confluence of river and lake waters creates a distinct ecosystem: the rivermouth ecosystem. Human development has often centered around these rivermouths, in part, because they provide a rich array of ecosystem services. Not surprisingly, centuries of intense human activity have led to substantial pressures on, and alterations to, these ecosystems, often diminishing or degrading their ecological functions and associated ecological services. Many Great Lakes rivermouths are the focus of intense restoration efforts. For example, 36 of the active Great Lakes Areas of Concern (AOCs) are rivermouths or areas that include one or more rivermouths. Historically, research of rivermouth ecosystems has been piecemeal, focused on the Great Lakes proper or on the upper reaches of tributaries, with little direct study of the rivermouth itself. Researchers have been divided among disciplines, agencies and institutions; and they often work independently and use disparate venues to communicate their work. Management has also been fragmented with a focus on smaller, localized, sub-habitat units and socio-political or economic elements, rather than system-level consideration. This Primer presents the case for a more holistic approach to rivermouth science and management that can enable restoration of ecosystem services with multiple benefits to humans and the Great Lakes ecosystem. A conceptual model is presented with supporting text that describes the structures and processes common to all rivermouths, substantiating the case for treating these ecosystems as an identifiable class.1 Ecological services provided by rivermouths and changes in how humans value those services over time are illustrated through case studies of two Great Lakes rivermouths—the St. Louis River and the Maumee River. Specific ecosystem services are identified in italics throughout this Primer and follow definitions described

  1. Frontotemporal Lobar Degeneration and microRNAs

    Directory of Open Access Journals (Sweden)

    Paola ePiscopo

    2016-02-01

    Full Text Available Frontotemporal lobar degeneration (FTLD includes a spectrum of disorders characterized by changes of personality and social behaviour and, often, a gradual and progressive language dysfunction. In the last years, several efforts have been fulfilled in identifying both genetic mutations and pathological proteins associated with FTLD. The molecular bases undergoing the onset and progression of the disease remain still unknown. Recent literature prompts an involvement of RNA metabolism in FTLD, particularly miRNAs. Dysregulation of miRNAs in several disorders, including neurodegenerative diseases, and increasing importance of circulating miRNAs in different pathologies has suggested to implement the study of their possible application as biological markers and new therapeutic targets; moreover, miRNA-based therapy is becoming a powerful tool to deepen the function of a gene, the mechanism of a disease, and validate therapeutic targets. Regarding FTLD, different studies showed that miRNAs are playing an important role. For example, several reports have evaluated miRNA regulation of the progranulin gene suggesting that it is under their control, as described for miR-29b, miR-107 and miR-659. More recently, it has been demonstrated that TMEM106B gene, which protein is elevated in FTLD-TDP brains, is repressed by miR-132/212 cluster; this post-transcriptional mechanism increases intracellular levels of progranulin, affecting its pathways. These findings if confirmed could suggest that these microRNAs have a role as potential targets for some related-FTLD genes. In this review, we focus on the emerging roles of the miRNAs in the pathogenesis of FTLD.

  2. Nonspecific amplification of human DNA by Streptococcus pneumoniae LytA primer

    Directory of Open Access Journals (Sweden)

    Helen Hencida Thangamony

    2018-01-01

    Full Text Available Background: Determination of various analytical parameters is essential for the validation of primers used for in-house nucleic acid amplification tests. While standardising a high-resolution melt analysis (HRMA for detection of Streptococcus pneumoniae in acute pyogenic meningitis, we encountered non-specific amplification of certain base pair sequences of human DNA by Centers for Disease Control & Prevention, USA recommended S. pneumoniae LytA primer. Materials and Methods: HRMA was standardised using DNA extracted from an ATCC strain of S. pneumoniae using SP LytA F373 primer and Type-it HRMTM polymerase chain reaction kit in Rotor-Gene Q Thermal Cycler according to the manufacturer's instructions. Specificity of the primers was determined in dry and wet laboratory experiments against diverse related and unrelated microbial pathogens by HRMA and on DNA extracted from unspiked clinical samples negative for SP DNA. Sensitivity was determined by calculating lower limit of detection threshold in experiments with spiked samples. The amplicon from spiked experiments was sequenced and analysed through Gene Bank. Results: Our dry/wet laboratory experiments showed two separate curves and different Tm values indicating certain non-specific amplification by the primer. Basic Local Alignment Search Tool (BLAST analysis of the amplicon obtained in the spiked experiment showed sequences of human chromosome 20 associated with Homo sapiens protein tyrosine phosphatase, receptor type T gene. The problem was resolved by stopping the reaction at 30th Ct cycle and observing the Tm values. Conclusion: Since HRMA is done without a specific probe, one should be aware of non-specific amplifications while using primers for HRMA of human clinical samples.

  3. Retinal Cell Degeneration in Animal Models

    Directory of Open Access Journals (Sweden)

    Masayuki Niwa

    2016-01-01

    Full Text Available The aim of this review is to provide an overview of various retinal cell degeneration models in animal induced by chemicals (N-methyl-d-aspartate- and CoCl2-induced, autoimmune (experimental autoimmune encephalomyelitis, mechanical stress (optic nerve crush-induced, light-induced and ischemia (transient retinal ischemia-induced. The target regions, pathology and proposed mechanism of each model are described in a comparative fashion. Animal models of retinal cell degeneration provide insight into the underlying mechanisms of the disease, and will facilitate the development of novel effective therapeutic drugs to treat retinal cell damage.

  4. Kinematic control of robot with degenerate wrist

    Science.gov (United States)

    Barker, L. K.; Moore, M. C.

    1984-01-01

    Kinematic resolved rate equations allow an operator with visual feedback to dynamically control a robot hand. When the robot wrist is degenerate, the computed joint angle rates exceed operational limits, and unwanted hand movements can result. The generalized matrix inverse solution can also produce unwanted responses. A method is introduced to control the robot hand in the region of the degenerate robot wrist. The method uses a coordinated movement of the first and third joints of the robot wrist to locate the second wrist joint axis for movement of the robot hand in the commanded direction. The method does not entail infinite joint angle rates.

  5. Late complications following cryotherapy of lattice degeneration.

    Science.gov (United States)

    Benson, W E; Morse, P H; Nantawan, P

    1977-10-01

    We observed 341 patients who had received cryotherapy for lattice degeneration in order to identify possible late complications. Sequelae such as retinal tears posterior to an operculum or flap tears within treated areas showed that treatment did not necessarily prevent subsequent vitreous traction. Moreover, the newly created flap tears may extend beyond the treated area and can cause retinal detachment. Even scleral buckling did not necesserily prevent further traction. Therefore, we concluded that when cryotherapy is used to treat lattice degeneration, an adequate margin of surrounding retina should be treated and the treatment should extend to the ora serrata.

  6. Genetics of lattice degeneration of the retina.

    Science.gov (United States)

    Murakami, F; Ohba, N

    1982-01-01

    First-degree relatives of proband patients with lattice degeneration of the retina revealed a significantly higher prevalence of the disease than the prevalence in the general population: the former had the disease about three times as frequently as the latter. The observed data were analyzed in terms of their accordance with recognized genetic models. The inheritance pattern did not fit well to a monogenic mode of inheritance, and it was hypothesized that a polygenic or multifactorial mode of inheritance is the most likely for lattice degeneration of the retina.

  7. CT of sarcomatous degeneration in neurofibromatosis

    International Nuclear Information System (INIS)

    Coleman, B.G.; Arger, P.H.; Dalinka, M.K.; Obringer, A.C.; Raney, B.R.; Meadows, A.T.

    1983-01-01

    Neurofibromatosis is a relatively common disorder that often involves many organ systems. One of the least understood aspects of this malady is a well documented potential for sarcomatous degeneration of neurofibromas. The inability to identify patients at risk and the lack of noninvasive screening methods for symptomatic patients often leads to late diagnosis. In six of seven subsequently proven neurofibrosarcomas, CT demonstrated low-density areas that histopathologically appeared to be due to necrosis, hemorrhage, and/or cystic degeneration. The density differences within these sarcomas were enhanced by the intravenous adminstration of iodinated contrast agents

  8. Invading stacking primer: A trigger for high-efficiency isothermal amplification reaction with superior selectivity for detecting microRNA variants.

    Science.gov (United States)

    Liu, Weipeng; Zhu, Minjun; Liu, Hongxing; Wei, Jitao; Zhou, Xiaoming; Xing, Da

    2016-07-15

    Searching for a strategy to enhance the efficiency of nucleic acid amplification and achieve exquisite discrimination of nucleic acids at the single-base level for biological detection has become an exciting research direction in recent years. Here, we have developed a simple and universal primer design strategy which produces a fascinating effect on isothermal strand displacement amplification (iSDA). We refer to the resultant primer as "invading stacking primer (IS-Primer)" which is based on contiguous stacking hybridization and toehold-mediated exchange reaction and function by merely changing the hybridization location of the primer. Using the IS-Primer, the sensitivity in detecting the target miR-21 is improved approximately five fold compared with the traditional iSDA reaction. It was further demonstrated that the IS-Primer acts as an invading strand to initiate branch migration which can increase the efficiency of the untwisting of the hairpin probe. This effect is equivalent to reducing the free energy of the stem, and the technique shows superior selectivity for single-base mismatches. By demonstrating the enhanced effect of the IS-Primer in the iSDA reaction, this work may provide a potentially new avenue for developing more sensitive and selective nucleic acids assays. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Self-reported optometric practise patterns in age-related macular degeneration.

    Science.gov (United States)

    Ly, Angelica; Nivison-Smith, Lisa; Zangerl, Barbara; Assaad, Nagi; Kalloniatis, Michael

    2017-11-01

    The use of advanced imaging in clinical practice is emerging and the use of this technology by optometrists in assessing patients with age-related macular degeneration is of interest. Therefore, this study explored contemporary, self-reported patterns of practice regarding age-related macular degeneration diagnosis and management using a cross-sectional survey of optometrists in Australia and New Zealand. Practising optometrists were surveyed on four key areas, namely, demographics, clinical skills and experience, assessment and management of age-related macular degeneration. Questions pertaining to self-rated competency, knowledge and attitudes used a five-point Likert scale. Completed responses were received from 127 and 87 practising optometrists in Australia and New Zealand, respectively. Advanced imaging showed greater variation in service delivery than traditional techniques (such as slitlamp funduscopy) and trended toward optical coherence tomography, which was routinely performed in age-related macular degeneration by 49 per cent of respondents. Optical coherence tomography was also associated with higher self-rated competency, knowledge and perceived relevance to practice than other modalities. Most respondents (93 per cent) indicated that they regularly applied patient symptoms, case history, visual function results and signs from traditional testing, when queried about their management of patients with age-related macular degeneration. Over half (63 per cent) also considered advanced imaging, while 31 per cent additionally considered all of these as well as the disease stage and clinical guidelines. Contrary to the evidence base, 68 and 34 per cent rated nutritional supplements as highly relevant or relevant in early age-related macular degeneration and normal aging changes, respectively. These results highlight the emergence of multimodal and advanced imaging (especially optical coherence tomography) in the assessment of age-related macular degeneration

  10. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2015-01-01

    This primer offers readers an introduction to the central concepts that form our modern understanding of complex and emergent behavior, together with detailed coverage of accompanying mathematical methods. All calculations are presented step by step and are easy to follow. This new fourth edition has been fully reorganized and includes new chapters, figures and exercises. The core aspects of modern complex system sciences are presented in the first chapters, covering network theory, dynamical systems, bifurcation and catastrophe theory, chaos and adaptive processes, together with the principle of self-organization in reaction-diffusion systems and social animals. Modern information theoretical principles are treated in further chapters, together with the concept of self-organized criticality, gene regulation networks, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase transitions and the cognitive system approach to the brain. Technical course prerequisites are the standard ...

  11. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2007-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  12. Complex and Adaptive Dynamical Systems A Primer

    CERN Document Server

    Gros, Claudius

    2011-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  13. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2013-01-01

    Complex system theory is rapidly developing and gaining importance, providing tools and concepts central to our modern understanding of emergent phenomena. This primer offers an introduction to this area together with detailed coverage of the mathematics involved. All calculations are presented step by step and are straightforward to follow. This new third edition comes with new material, figures and exercises. Network theory, dynamical systems and information theory, the core of modern complex system sciences, are developed in the first three chapters, covering basic concepts and phenomena like small-world networks, bifurcation theory and information entropy. Further chapters use a modular approach to address the most important concepts in complex system sciences, with the emergence and self-organization playing a central role. Prominent examples are self-organized criticality in adaptive systems, life at the edge of chaos, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase...

  14. The non-invasive investigation of lumbar disc degeneration in patients with chronic low back pain

    International Nuclear Information System (INIS)

    Buirski, G.

    1989-01-01

    The painful degenerate disc is a recognised cause of low back pain. Magnetic Resonance Imaging (MRI) has now replaced discography in the non-invasive assessment of disk degeneration. However, the prohibitive capital expense of MRI and the small number of MR units in Australia produce limitations in clinical access. In contrast, Computed Tomography (CT) is readily available and is performed in most patients prior to MRI referral. This prospective study was undertaken to determine whether preliminary CT could offer any information about disc degeneration and so reduce the demand on a MRI scanner. 30 consecutive patients were studied all of whom had both CT and MRI examinations. Of a total 107 discs examined by both techniques, MRI was able to identify 37 degenerate discs. Conclusive evidence of degeneration (i.e. the presence of intervertebral gas) was only seen in 3 discs at CT (1 patient). Of the 29 posterior disc bulges found on CT, all were both bulging and degenerate on MRI. Indications for MRI based on the CT findings are recommended. Using these criteria, 13% (4 patients) of this study group could have avoided an expensive and unnecessary MR investigation. A useful algorithm for the investigation and assessment of patients with chronic low back pain is discussed. 8 refs., 5 figs., 1 tab

  15. Evaluation of genetic diversity in open pollinated guava by iPBS primers

    International Nuclear Information System (INIS)

    Mehmood, A.; Jaskani, M.J.; Ahmad, S.; Ahmad, R.

    2013-01-01

    DNA markers are important tools for assessing genetic diversity and relationships among species, cultivars and breeding materials. Many horticultural species are lacking genomic information. DNA markers that do not require prior knowledge of DNA sequences are therefore appealing for horticultural research. A retrotransposon-based DNA marker system, iPBS (inter primer binding sites) developed from conserved primer binding sites within retrotransposons, was used to study the genetic variation and relationships in ornamental guava. PCR from 6 iPBS primers (dominant markers) produced a total of 113 bands (52.38-100% polymorphic) ranging from 150 bp to 3000 bp, and the mean PIC value for each primer ranging from 0.1245 to 0.3698. Molecular information generated from both iPBS was separately scored in a matrix for phylogenetic dendrogram construction. The phylogenetic dendrogram based on iPBS markers reflected morphologic classifications of the accessions that were studied. The iPBS PCR-based genome fingerprinting technology in this study is low-cost and provides another effective alternative in differentiation of accessions in guava (Psidium guajava Linn.) and related species or genera. (author)

  16. Detection of Ophiocordyceps sinensis and Its Common Adulterates Using Species-Specific Primers

    Science.gov (United States)

    Liu, Yang; Wang, Xiao-yue; Gao, Zi-tong; Han, Jian-ping; Xiang, Li

    2017-01-01

    Ophiocordyceps sinensis is a fungus that infects Hepialidae caterpillars, mummifying the larvae and producing characteristic fruiting bodies (stromata) that are processed into one of the most valued traditional Chinese medicines (TCM). The product commands a very high price due to a high demand but a very limited supply. Adulteration with other fungi is a common problem and there is a need to test preparation for the presence of the correct fungus. In the current study, a PCR-based approach for the identification of O. sinensis based on a segment of the internal transcribed spacer (ITS) region was developed. The segments is 146-bp in size and is likely to be amplified even in materials where processing led to DNA fragmentation. Primer development was based on the alignment of sequence data generated from a total of 89 samples of O. sinensis and potential adulterants as well as sequences date from 41 Ophiocordyceps species and 26 Cordyceps species available in GenBank. Tests with primer pair, DCF4/DCR4, demonstrated generation of an amplicon from DNA extracted from O. sinensis stromata, but not from extracts derived from adulterants. Species-specific primer pairs were also developed and tested for detection of the common adulterants, Cordyceps gunnii, Cordyceps cicadae, Cordyceps militaris, Cordyceps liangshanensis and Ophiocordyceps nutans. The collection of primers developed in the present study will be useful for the authentication of preparation claiming to only contain O. sinensis and for the detection of fungi used as adulterants in these preparations. PMID:28680424

  17. Primer for criticality calculations with DANTSYS

    International Nuclear Information System (INIS)

    Busch, R.D.

    1996-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his or her facility. Typically, two types of codes are available: deterministic codes such as ANISN or DANTSYS that solve an approximate model exactly and Monte Carlo Codes such as KENO or MCNP that solve an exact model approximately. Often, the analyst feels that the deterministic codes are too simple and will not provide the necessary information, so most modeling uses Monte Carlo methods. This sometimes means that hours of effort are expended to produce results available in minutes from deterministic codes. A substantial amount of reliable information on nuclear systems can be obtained using deterministic methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico in cooperation with the Radiation Transport Group at Los Alamos National Laboratory has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. (DANTSYS is the name of a suite of codes that users more commonly know as ONEDANT, TWODANT, TWOHEX, and THREEDANT.) It assumes a college education in a technical field, but there is no assumption of familiarity with neutronics codes in general or with DANTSYS in particular. The primer is designed to teach by example, with each example illustrating two or three DANTSYS features useful in criticality analyses

  18. The Fluid Reading Primer: Animated Decoding Support for Emergent Readers.

    Science.gov (United States)

    Zellweger, Polle T.; Mackinlay, Jock D.

    A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…

  19. Marketing Information Products and Services : A Primer for ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Couverture du livre Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Directeur(s) : Abhinandan K. Jain, Ashok Jambhekar, T.P.Rama Rao et S. Sreenivas Rao. Maison(s) ...

  20. RUCS: Rapid identification of PCR primers for unique core sequences

    DEFF Research Database (Denmark)

    Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik

    2017-01-01

    Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...

  1. Driving and Age-Related Macular Degeneration

    OpenAIRE

    Owsley, Cynthia; McGwin, Gerald

    2008-01-01

    This article reviews the research literature on driving and age-related macular degeneration, which is motivated by the link between driving and the quality of life of older adults and their increased collision rate. It addresses the risk of crashes, driving performance, driving difficulty, self-regulation, and interventions to enhance, safety, and considers directions for future research.

  2. Ecological transition predictably associated with gene degeneration.

    Science.gov (United States)

    Wessinger, Carolyn A; Rausher, Mark D

    2015-02-01

    Gene degeneration or loss can significantly contribute to phenotypic diversification, but may generate genetic constraints on future evolutionary trajectories, potentially restricting phenotypic reversal. Such constraints may manifest as directional evolutionary trends when parallel phenotypic shifts consistently involve gene degeneration or loss. Here, we demonstrate that widespread parallel evolution in Penstemon from blue to red flowers predictably involves the functional inactivation and degeneration of the enzyme flavonoid 3',5'-hydroxylase (F3'5'H), an anthocyanin pathway enzyme required for the production of blue floral pigments. Other types of genetic mutations do not consistently accompany this phenotypic shift. This pattern may be driven by the relatively large mutational target size of degenerative mutations to this locus and the apparent lack of associated pleiotropic effects. The consistent degeneration of F3'5'H may provide a mechanistic explanation for the observed asymmetry in the direction of flower color evolution in Penstemon: Blue to red transitions are common, but reverse transitions have not been observed. Although phenotypic shifts in this system are likely driven by natural selection, internal constraints may generate predictable genetic outcomes and may restrict future evolutionary trajectories. © The Author 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  3. Geometry of non-degenerate Susskind fermions

    International Nuclear Information System (INIS)

    Mitra, P.

    1983-01-01

    The Dirac-Kaehler equation on the lattice is known to describe the degenerate ''flavours'' appering in Susskind's approach to lattice fermions. We study the modification that has to be made in this equation in order to lift the degeneracy and give the flavours arbitrary different masses. (orig.)

  4. Exploring Nonconvex, Crossed and Degenerate Polygons

    Science.gov (United States)

    Contreras, Jose N.

    2004-01-01

    An exploration of nonconvex, crossed, and degenerate polygons (NCCDPs) are described with the help of examples with pedagogical tips and recommendations that are found useful when teaching the mathematical process of extending geometric patterns to NCCDPs. The study concludes that investigating such extensions with interactive geometry software…

  5. Degenerate parabolic stochastic partial differential equations

    Czech Academy of Sciences Publication Activity Database

    span class="emphasis">Hofmanová, Martinaspan>

    2013-01-01

    Roč. 123, č. 12 (2013), s. 4294-4336 ISSN 0304-4149 R&D Projects: GA ČR GAP201/10/0752 Institutional support: RVO:67985556 Keywords : kinetic solutions * degenerate stochastic parabolic equations Subject RIV: BA - General Mathematics Impact factor: 1.046, year: 2013 http://library.utia.cas.cz/separaty/2013/SI/hofmanova-0397241.pdf

  6. MR findings of degenerating parenchymal neurocysticercosis

    International Nuclear Information System (INIS)

    Lee, Yul; Chung, Eun A; Yang, Ik; Park, Hae Jung; Chung, Soo Young

    1996-01-01

    To evaluate MR imaging findings of degenerating parenchymal neurocysticercosis and to determine the characteristics which distinguish it from other brain diseases. MR imagings of 19 patients (56 lesions) of degenerating parenchymal neurocysticercosis were retrospectively evaluated, focusing on the size and location of lesions signal intensity patterns of cyst fluid and wall, the extent of the surrounding edema and features of contrast enhancement. Degenerating parenchymal neurocysticercosis was located in gray or subcortical while matter in 89.3% of 56 lesions (50/56) ; most of these (98.2%) were smaller than 2 cm in diameter. Cyst fluid signal was hyperintense relative to CSF on T1 and proton density weighted images (92.9%). A hypointense signal rim of the cyst wall was noted in the lesions on proton density (92.9%) and T2 weighted (98.2%) images, Surrounding edema was mostly mild. Peripheral rim enhancement was noted in all lesions, and this was frequently irregular and lobulated (67.9%) with a focal defect in the enhancing rim(41.1%). Findings which could be helpful in distinguishing degenerating parencymal neurocysticercosis from other brain diseases are as follows : small, superficial lesions ; hyperintense signal of the cyst fluid on T1 and proton density weighted images ; hypointense signal of the cyst wall on proton density and T2 weighted images ; relatively mild extent of surrounding edema, and peripheral rim enhancement which is frequently irregular and lobulated with a focal defect in the enhancing rim

  7. Degenerate conformal theories on higher-genus surfaces

    International Nuclear Information System (INIS)

    Gerasimov, A.A.

    1989-01-01

    Two-dimensional degenerate field theories on higher-genus surfaces are investigated. Objects are built on the space of moduli, whose linear combinations are hypothetically conformal blocks in degenerate theories

  8. MR imaging of central nervous system white matter tract degeneration (Wallerian degeneration)

    International Nuclear Information System (INIS)

    Kuhn, M.J.; Johnson, K.A.; Davis, K.R.

    1987-01-01

    Wallerian degeneration is readily demonstrated by MR imaging. Twenty-one patients with MR signal abnormalities in various central nervous system (CNS) white matter tracts were evaluated with regard to (1) nature of signal abnormality, (2) MR anatomy of the involved tract, and (3) primary pathology (e.g., infarct, tumor, hemorrhage). Most examples of wallerian degeneration result in a thin, continuous band of long T1, long T2 signal abnormality conforming to the known anatomic pathway of a CNS axonal tract. Old, large cortical infarcts have the greatest propensity to show subsequent white-matter tract degeneration. Corticospinal tract degeneration is the type most readily visualized, often seen extending completely from the cerebral cortex through the medulla

  9. Determination of the species specificity of the primers for the detection of chicken and turkey meat by realtime PCR method

    Directory of Open Access Journals (Sweden)

    Lenka Maršálková

    2014-07-01

    Full Text Available The aim of this work was to use TaqMan Real-Time PCR for quantitative authentication of chicken and turkey meat. To meet this purpose, a specific pair of primers and TaqMan probe was used. The test was aimed at identifying the reaction cycle of turkey and chicken meat using by two sets of primers. With first set of primer designed for chicken we obtained the following results: Cp = 16.18 for 100% chicken DNA Cp = 29, 18 100% turkey DNA It was also amplified DNA of pig that exceeded the detection threshold fluorescence intensities in the 31.07 cycle (Cp = 31.07. Using primers designed for turkey we obtained the following results Cp = 31.16 for 100% CHDNA, Cp =16.18 100% TDNA. It was also amplified the 100% DNA of rabbit in 31.63 cycle (Cp = 31.63 and deer in cycle 32 (Cp = 32. The DNA of all other animal species was amplificated after more than 35 cycles (Cp >35. It follows that the second detection primer pair is specific enough to unrelated species of animals by 30 cycles of the reaction. Species authentication based on DNA analysis from this perspective overcomes all the shortcomings of proteins. At present, DNA analysis use different types of PCR. Is the most progressive Real-time PCR, which is suitable for the specific use of detection (primers and TaqMan probe. The TaqMan Real-time PCR is within the sensitivity and specificity, clearly one of the best methods for identifying the species of chicken and turkey meat. The specificity of this method, however, depends primarily on the specificity of the primers and TaqMan probe. The 30 cycle reaction was chosen by us as the threshold for specificity using primers for authentication chicken and turkey meat.

  10. Ethanol Exposure Causes Muscle Degeneration in Zebrafish

    Directory of Open Access Journals (Sweden)

    Elizabeth C. Coffey

    2018-03-01

    Full Text Available Alcoholic myopathies are characterized by neuromusculoskeletal symptoms such as compromised movement and weakness. Although these symptoms have been attributed to neurological damage, EtOH may also target skeletal muscle. EtOH exposure during zebrafish primary muscle development or adulthood results in smaller muscle fibers. However, the effects of EtOH exposure on skeletal muscle during the growth period that follows primary muscle development are not well understood. We determined the effects of EtOH exposure on muscle during this phase of development. Strikingly, muscle fibers at this stage are acutely sensitive to EtOH treatment: EtOH induces muscle degeneration. The severity of EtOH-induced muscle damage varies but muscle becomes more refractory to EtOH as muscle develops. NF-kB induction in muscle indicates that EtOH triggers a pro-inflammatory response. EtOH-induced muscle damage is p53-independent. Uptake of Evans blue dye shows that EtOH treatment causes sarcolemmal instability before muscle fiber detachment. Dystrophin-null sapje mutant zebrafish also exhibit sarcolemmal instability. We tested whether Trichostatin A (TSA, which reduces muscle degeneration in sapje mutants, would affect EtOH-treated zebrafish. We found that TSA and EtOH are a lethal combination. EtOH does, however, exacerbate muscle degeneration in sapje mutants. EtOH also disrupts adhesion of muscle fibers to their extracellular matrix at the myotendinous junction: some detached muscle fibers retain beta-Dystroglycan indicating failure of muscle end attachments. Overexpression of Paxillin, which reduces muscle degeneration in zebrafish deficient for beta-Dystroglycan, is not sufficient to rescue degeneration. Taken together, our results suggest that EtOH exposure has pleiotropic deleterious effects on skeletal muscle.

  11. A method for automatically extracting infectious disease-related primers and probes from the literature

    Directory of Open Access Journals (Sweden)

    Pérez-Rey David

    2010-08-01

    Full Text Available Abstract Background Primer and probe sequences are the main components of nucleic acid-based detection systems. Biologists use primers and probes for different tasks, some related to the diagnosis and prescription of infectious diseases. The biological literature is the main information source for empirically validated primer and probe sequences. Therefore, it is becoming increasingly important for researchers to navigate this important information. In this paper, we present a four-phase method for extracting and annotating primer/probe sequences from the literature. These phases are: (1 convert each document into a tree of paper sections, (2 detect the candidate sequences using a set of finite state machine-based recognizers, (3 refine problem sequences using a rule-based expert system, and (4 annotate the extracted sequences with their related organism/gene information. Results We tested our approach using a test set composed of 297 manuscripts. The extracted sequences and their organism/gene annotations were manually evaluated by a panel of molecular biologists. The results of the evaluation show that our approach is suitable for automatically extracting DNA sequences, achieving precision/recall rates of 97.98% and 95.77%, respectively. In addition, 76.66% of the detected sequences were correctly annotated with their organism name. The system also provided correct gene-related information for 46.18% of the sequences assigned a correct organism name. Conclusions We believe that the proposed method can facilitate routine tasks for biomedical researchers using molecular methods to diagnose and prescribe different infectious diseases. In addition, the proposed method can be expanded to detect and extract other biological sequences from the literature. The extracted information can also be used to readily update available primer/probe databases or to create new databases from scratch.

  12. Calcium channel blockers inhibit retinal degeneration in the retinal-degeneration-B mutant of Drosophila.

    Science.gov (United States)

    Sahly, I; Bar Nachum, S; Suss-Toby, E; Rom, A; Peretz, A; Kleiman, J; Byk, T; Selinger, Z; Minke, B

    1992-01-01

    Light accelerates degeneration of photoreceptor cells of the retinal degeneration B (rdgB) mutant of Drosophila. During early stages of degeneration, light stimuli evoke spikes from photoreceptors of the mutant fly; no spikes can be recorded from photoreceptors of the wild-type fly. Production of spike potentials from mutant photoreceptors was blocked by diltiazem, verapamil hydrochloride, and cadmium. Little, if any, effect of the (-)-cis isomer or (+)-cis isomer of diltiazem on the light response was seen. Further, the (+)-cis isomer was approximately 50 times more effective than the (-)-cis isomer in blocking the Ca2+ spikes, indicating that diltiazem action on the rdgB eye is mediated by means of blocking voltage-sensitive Ca2+ channels, rather than by blocking the light-sensitive channels. Application of the Ca(2+)-channel blockers (+)-cis-diltiazem and verapamil hydrochloride to the eyes of rdgB flies over a 7-day period largely inhibited light-dependent degeneration of the photoreceptor cells. Pulse labeling with [32P]phosphate showed much greater incorporation into eye proteins of [32P]phosphate in rdgB flies than in wild-type flies. Retarding the light-induced photoreceptor degeneration in the mutant by Ca(2+)-channel blockers, thus, suggests that toxic increase in intracellular Ca2+ by means of voltage-gated Ca2+ channels, possibly secondary to excessive phosphorylation, leads to photoreceptor degeneration in the rdgB mutant. Images PMID:1309615

  13. Eigenvalue problems for degenerate nonlinear elliptic equations in anisotropic media

    Directory of Open Access Journals (Sweden)

    Vicenţiu RăDulescu

    2005-06-01

    Full Text Available We study nonlinear eigenvalue problems of the type −div(a(x∇u=g(λ,x,u in ℝN, where a(x is a degenerate nonnegative weight. We establish the existence of solutions and we obtain information on qualitative properties as multiplicity and location of solutions. Our approach is based on the critical point theory in Sobolev weighted spaces combined with a Caffarelli-Kohn-Nirenberg-type inequality. A specific minimax method is developed without making use of Palais-Smale condition.

  14. Degenerate r-Stirling Numbers and r-Bell Polynomials

    Science.gov (United States)

    Kim, T.; Yao, Y.; Kim, D. S.; Jang, G.-W.

    2018-01-01

    The purpose of this paper is to exploit umbral calculus in order to derive some properties, recurrence relations, and identities related to the degenerate r-Stirling numbers of the second kind and the degenerate r-Bell polynomials. Especially, we will express the degenerate r-Bell polynomials as linear combinations of many well-known families of special polynomials.

  15. Value for money assessment for public-private partnerships : a primer.

    Science.gov (United States)

    2015-01-01

    This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion : primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of : primers.

  16. Primer Vector Optimization: Survey of Theory, new Analysis and Applications

    Science.gov (United States)

    Guzman

    This paper presents a preliminary study in developing a set of optimization tools for orbit rendezvous, transfer and station keeping. This work is part of a large scale effort undergoing at NASA Goddard Space Flight Center and a.i. solutions, Inc. to build generic methods, which will enable missions with tight fuel budgets. Since no single optimization technique can solve efficiently all existing problems, a library of tools where the user could pick the method most suited for the particular mission is envisioned. The first trajectory optimization technique explored is Lawden's primer vector theory [Ref. 1]. Primer vector theory can be considered as a byproduct of applying Calculus of Variations (COV) techniques to the problem of minimizing the fuel usage of impulsive trajectories. For an n-impulse trajectory, it involves the solution of n-1 two-point boundary value problems. In this paper, we look at some of the different formulations of the primer vector (dependent on the frame employed and on the force model). Also, the applicability of primer vector theory is examined in effort to understand when and why the theory can fail. Specifically, since COV is based on "small variations", singularities in the linearized (variational) equations of motion along the arcs must be taken into account. These singularities are a recurring problem in analyzes that employ "small variations" [Refs. 2, 3]. For example, singularities in the (2-body problem) variational equations along elliptic arcs occur when [Ref. 4], 1) the difference between the initial and final times is a multiple of the reference orbit period, 2) the difference between the initial and final true anomalies are given by k, for k= 0, 1, 2, 3,..., note that this cover the 3) the time of flight is a minimum for the given difference in true anomaly. For the N-body problem, the situation is more complex and is still under investigation. Several examples, such as the initialization of an orbit (ascent trajectory) and

  17. Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J

    1997-01-01

    , but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology....

  18. Screening for residual disease in pediatric burkitt lymphoma using consensus primer pools.

    Science.gov (United States)

    Agsalda, Melissa; Kusao, Ian; Troelstrup, David; Shiramizu, Bruce

    2009-01-01

    Assessing molecular persistent or minimal residual disease (PD/MRD) in childhood Burkitt lymphoma (BL) is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs). Because BL is characterized by rearranged immunoglobulin heavy chain (IgV(H)) genes, IgV(H) primer pools from IgV(H1)-IgV(H7) regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgV(H) primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgV(H) primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

  19. Targeted reduction of highly abundant transcripts using pseudo-random primers.

    Science.gov (United States)

    Arnaud, Ophélie; Kato, Sachi; Poulain, Stéphane; Plessy, Charles

    2016-04-01

    Transcriptome studies based on quantitative sequencing can estimate levels of gene expression by measuring target RNA abundance in sequencing libraries. Sequencing costs are proportional to the total number of sequenced reads, and in order to cover rare RNAs, considerable quantities of abundant and identical reads are needed. This major limitation can be addressed by depleting a proportion of the most abundant sequences from the library. However, such depletion strategies involve either extra handling of the input RNA sample or use of a large number of reverse transcription primers, termed not-so-random (NSR) primers, which are costly to synthesize. Taking advantage of the high tolerance of reverse transcriptase to mis-prime, we found that it is possible to use as few as 40 pseudo-random (PS) reverse transcription primers to decrease the rate of undesirable abundant sequences within a library without affecting the overall transcriptome diversity. PS primers are simple to design and can be used to deplete several undesirable RNAs simultaneously, thus creating a flexible tool for enriching transcriptome libraries for rare transcript sequences.

  20. Screening for Residual Disease in Pediatric Burkitt Lymphoma Using Consensus Primer Pools

    Directory of Open Access Journals (Sweden)

    Melissa Agsalda

    2009-01-01

    Full Text Available Assessing molecular persistent or minimal residual disease (PD/MRD in childhood Burkitt lymphoma (BL is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs. Because BL is characterized by rearranged immunoglobulin heavy chain (IgVH genes, IgVH primer pools from IgVH1–IgVH7 regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgVH primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgVH primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

  1. Detection of Mycosphaerella graminicola in Wheat Leaves by a Microsatellite Dinucleotide Specific-Primer

    Directory of Open Access Journals (Sweden)

    Joseph-Alexander Verreet

    2011-01-01

    Full Text Available Early detection of infection is very important for efficient management of Mycosphaerella graminicola leaf blotch. To monitor and quantify the occurrence of this fungus during the growing season, a diagnostic method based on real-time PCR was developed. Standard and real-time PCR assays were developed using SYBR Green chemistry to quantify M. graminicola in vitro or in wheat samples. Microsatellite dinucleotide specific-primers were designed based on microsatellite repeats of sequences present in the genome of M. graminicola. Specificity was checked by analyzing DNA of 55 M. graminicola isolates obtained from different geographical origins. The method appears to be highly specific for detecting M. graminicola; no fluorescent signals were observed from 14 other closely related taxa. Primer (CT 7 G amplified a specific amplicon of 570 bp from all M. graminicola isolates. The primers did not amplify DNA extracted from 14 other fungal species. The approximate melting temperature (Tm of the (CT 7 G primer was 84.2 °C. The detection limit of the real-time PCR assay with the primer sets (CT 7 G is 10 fg/25 µL, as compared to 10 pg/25 µL using conventional PCR technology. From symptomless leaves, a PCR fragment could be generated two days after inoculation. Both conventional and real-time PCR could successfully detect the fungus from artificially inoculated wheat leaves. However, real-time PCR appeared much more sensitive than conventional PCR. The developed quantitative real-time PCR method proved to be rapid, sensitive, specific, cost-effective and reliable for the identification and quantification of M. graminicola in wheat.

  2. DESAIN PRIMER UNTUK AMPLIFIKASI FRAGMEN GEN inhA ISOLAT 134 MULTIDRUG RESISTANCE TUBERCULOSIS (MDR-TB DENGAN METODE POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Luk Ketut Budi Maitriani

    2015-10-01

    frequently mutated position and can lead to coresistance of isoniazid and ethionamide. The primer was designed using sequences of inhA gene Mycobacterium tuberculosis from www.ncbi.nlm.nih.gov (bank genes: AF106077. Results obtained the best primer pair and tested in vitro using Polymerase Chain Reaction method. DNA template used were MDR-TB clinical isolate. Amplifying process was begun with predenaturation at 95°C for 15 minutes and followed by 45 cycles of amplification (denaturation at 94°C for 1 minutes, annealing at 56°C for 1 minute 20 seconds and extension at 72°C for 2 minutes with a final extension at 72°C for 10 minutes. The PCR products were detected using 1,5% b/v agarose gel electrophoresis. In conclusion the best primer pair selected based on the criteria of the Clone Manager Suite 6 program (University of Groningen such as: primer length, %GC, Tm (melting temperature, primers interaction (dimers and hairpins, stability, repeats, runs, and false priming. The primer sequence were forward primer (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3' and reverse primer (pR-inhA 5' CGACCGTCATCC-AGTTGTA 3' with the length 460 bp. ne if they are suitable for consumption according to the guideline by the Director General of Food and Drug Monitoring in terms of lead and cadmium contents. The study was conducted by collecting samples in the area of ??the Sungai Mati estuary and Pemogan area. Samples were prepared by wet destruction method using reverse aqua regia and were analysed using atomic absorption spectrophotometer (AAS at 283,3 nm for Pb and 228,8 nm for Cd. The results show that all fruits investigated contain Pb and Cd with consentrations higher than the guideline.

  3. Association between menopause and lumbar disc degeneration: an MRI study of 1,566 women and 1,382 men.

    Science.gov (United States)

    Lou, Chao; Chen, Hongliang; Mei, Liangwei; Yu, Weiyang; Zhu, Kejun; Liu, Feijun; Chen, Zhenzhong; Xiang, Guangheng; Chen, Minjiang; Weng, Qiaoyou; He, Dengwei

    2017-10-01

    The aim of this study was to revisit and further investigate the association between menopause and disc degeneration in the lumbar spine using a magnetic resonance imaging-based eight-level grading system. This study cohort comprised of 1,566 women and 1,382 age-matched men who were admitted for low back pain from June 2013 to October 2016. Data on age, weight, height, body mass index, age at natural menopause, and years since menopause (YSM) were obtained. Lumbar disc degeneration was assessed using a magnetic resonance imaging-based eight-level grading system. After adjustment for the confounding factors of age, height, and weight, young age-matched men were more susceptible to disc degeneration than premenopausal women (P menopause, postmenopausal women had a significant tendency to develop more severe disc degeneration than their age-matched men (P  0.05). Menopause is associated with lumbar disc degeneration. The association occurred in the first 15 YSM, suggesting estrogen deficiency might be a risk factor of disc degeneration of the lumbar spine. Further studies need to be carried out for deciding whether age or menopause plays a more important role in the progression of disc degeneration in the lumbar spine.

  4. Microsatellite Primers in the Lichen Symbiotic Alga Trebouxia decolorans (Trebouxiophyceae

    Directory of Open Access Journals (Sweden)

    Francesco Dal Grande

    2013-03-01

    Full Text Available Premise of the study: Polymorphic microsatellite markers were developed for the symbiotic green alga Trebouxia decolorans to study fine-scale population structure and clonal diversity. Methods and Results: Using Illumina pyrosequencing, 20 microsatellite primer sets were developed for T. decolorans. The primer sets were tested on 43 individuals sampled from four subpopulations in Germany. The primers amplified di-, tri-, and tetranucleotide repeats with three to 15 alleles per locus, and the unbiased haploid diversity per locus ranged from 0.636 to 0.821. Conclusions: The identified microsatellite markers will be useful to study the genetic diversity, dispersal, and reproductive mode of this common lichen photobiont.

  5. A physicists guide to The Los Alamos Primer

    International Nuclear Information System (INIS)

    Reed, B Cameron

    2016-01-01

    In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer , which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons. (invited comment)

  6. Automated design of degenerate codon libraries.

    Science.gov (United States)

    Mena, Marco A; Daugherty, Patrick S

    2005-12-01

    Degenerate codon libraries are frequently used in protein engineering and evolution studies but are often limited to targeting a small number of positions to adequately limit the search space. To mitigate this, codon degeneracy can be limited using heuristics or previous knowledge of the targeted positions. To automate design of libraries given a set of amino acid sequences, an algorithm (LibDesign) was developed that generates a set of possible degenerate codon libraries, their resulting size, and their score relative to a user-defined scoring function. A gene library of a specified size can then be constructed that is representative of the given amino acid distribution or that includes specific sequences or combinations thereof. LibDesign provides a new tool for automated design of high-quality protein libraries that more effectively harness existing sequence-structure information derived from multiple sequence alignment or computational protein design data.

  7. Atomic rate coefficients in a degenerate plasma

    Science.gov (United States)

    Aslanyan, Valentin; Tallents, Greg

    2015-11-01

    The electrons in a dense, degenerate plasma follow Fermi-Dirac statistics, which deviate significantly in this regime from the usual Maxwell-Boltzmann approach used by many models. We present methods to calculate the atomic rate coefficients for the Fermi-Dirac distribution and present a comparison of the ionization fraction of carbon calculated using both models. We have found that for densities close to solid, although the discrepancy is small for LTE conditions, there is a large divergence from the ionization fraction by using classical rate coefficients in the presence of strong photoionizing radiation. We have found that using these modified rates and the degenerate heat capacity may affect the time evolution of a plasma subject to extreme ultraviolet and x-ray radiation such as produced in free electron laser irradiation of solid targets.

  8. K-causality and degenerate spacetimes

    Science.gov (United States)

    Dowker, H. F.; Garcia, R. S.; Surya, S.

    2000-11-01

    The causal relation K+ was introduced by Sorkin and Woolgar to extend the standard causal analysis of C2 spacetimes to those that are only C0. Most of their results also hold true in the case of metrics with degeneracies which are C0 but vanish at isolated points. In this paper we seek to examine K+ explicitly in the case of topology-changing `Morse histories' which contain degeneracies. We first demonstrate some interesting features of this relation in globally Lorentzian spacetimes. In particular, we show that K+ is robust and the Hawking and Sachs characterization of causal continuity translates into a natural condition in terms of K+. We then examine K+ in topology-changing Morse spacetimes with the degenerate points excised and then for the Morse histories in which the degenerate points are reinstated. We find further characterizations of causal continuity in these cases.

  9. Degenerate RFID Channel Modeling for Positioning Applications

    Directory of Open Access Journals (Sweden)

    A. Povalac

    2012-12-01

    Full Text Available This paper introduces the theory of channel modeling for positioning applications in UHF RFID. It explains basic parameters for channel characterization from both the narrowband and wideband point of view. More details are given about ranging and direction finding. Finally, several positioning scenarios are analyzed with developed channel models. All the described models use a degenerate channel, i.e. combined signal propagation from the transmitter to the tag and from the tag to the receiver.

  10. Degenerate odd Poisson bracket on Grassmann variables

    International Nuclear Information System (INIS)

    Soroka, V.A.

    2000-01-01

    A linear degenerate odd Poisson bracket (antibracket) realized solely on Grassmann variables is proposed. It is revealed that this bracket has at once three Grassmann-odd nilpotent Δ-like differential operators of the first, second and third orders with respect to the Grassmann derivatives. It is shown that these Δ-like operators, together with the Grassmann-odd nilpotent Casimir function of this bracket, form a finite-dimensional Lie superalgebra

  11. Immunology of age-related macular degeneration

    Science.gov (United States)

    Ambati, Jayakrishna; Atkinson, John P.; Gelfand, Bradley D.

    2014-01-01

    Age-related macular degeneration (AMD) is a leading cause of blindness in aged individuals. Recent advances have highlighted the essential role of immune processes in the development, progression and treatment of AMD. In this Review we discuss recent discoveries related to the immunological aspects of AMD pathogenesis. We outline the diverse immune cell types, inflammatory activators and pathways that are involved. Finally, we discuss the future of inflammation-directed therapeutics to treat AMD in the growing aged population. PMID:23702979

  12. Ex vivo quantitative multiparametric MRI mapping of human meniscus degeneration

    International Nuclear Information System (INIS)

    Nebelung, Sven; Kuhl, Christiane; Truhn, Daniel; Tingart, Markus; Jahr, Holger; Pufe, Thomas

    2016-01-01

    To evaluate the diagnostic performance of T1, T1ρ, T2, T2*, and UTE-T2* (ultrashort-echo time-enhanced T2*) mapping in the refined graduation of human meniscus degeneration with histology serving as standard-of-reference. This IRB-approved intra-individual comparative ex vivo study was performed on 24 lateral meniscus body samples obtained from 24 patients undergoing total knee replacement. Samples were assessed on a 3.0-T MRI scanner using inversion-recovery (T1), spin-lock multi-gradient-echo (T1ρ), multi-spin-echo (T2) and multi-gradient-echo (T2* and UTE-T2*) sequences to determine relaxation times of quantitative MRI (qMRI) parameters. Relaxation times were calculated on the respective maps, averaged to the entire meniscus and to its zones. Histologically, samples were analyzed on a four-point score according to Williams (0-III). QMRI results and Williams (sub)scores were correlated using Spearman's ρ, while Williams grade-dependent differences were assessed using Kruskal-Wallis and Dunn's tests. Sensitivities and specificities in the detection of intact (Williams grade [WG]-0) and severely degenerate meniscus (WG-II-III) were calculated. Except for T2*, significant increases in qMRI parameters with increasing Williams grades were observed. T1, T1ρ, T2, and UTE-T2* exhibited high sensitivity and variable specificity rates. Significant marked-to-strong correlations were observed for these parameters with each other, with histological WGs and the subscores tissue integrity and cellularity. QMRI mapping holds promise in the objective evaluation of human meniscus. Although sufficient discriminatory power of T1, T1ρ, T2, and UTE-T2* was only demonstrated for the histological extremes, these data may aid in the future MRI-based parameterization and quantification of human meniscus degeneration. (orig.)

  13. Ex vivo quantitative multiparametric MRI mapping of human meniscus degeneration

    Energy Technology Data Exchange (ETDEWEB)

    Nebelung, Sven; Kuhl, Christiane; Truhn, Daniel [Aachen University Hospital, Department of Diagnostic and Interventional Radiology, Aachen (Germany); Tingart, Markus; Jahr, Holger [Aachen University Hospital, Department of Orthopaedics, Aachen (Germany); Pufe, Thomas [RWTH Aachen University, Institute of Anatomy and Cell Biology, Aachen (Germany)

    2016-12-15

    To evaluate the diagnostic performance of T1, T1ρ, T2, T2*, and UTE-T2* (ultrashort-echo time-enhanced T2*) mapping in the refined graduation of human meniscus degeneration with histology serving as standard-of-reference. This IRB-approved intra-individual comparative ex vivo study was performed on 24 lateral meniscus body samples obtained from 24 patients undergoing total knee replacement. Samples were assessed on a 3.0-T MRI scanner using inversion-recovery (T1), spin-lock multi-gradient-echo (T1ρ), multi-spin-echo (T2) and multi-gradient-echo (T2* and UTE-T2*) sequences to determine relaxation times of quantitative MRI (qMRI) parameters. Relaxation times were calculated on the respective maps, averaged to the entire meniscus and to its zones. Histologically, samples were analyzed on a four-point score according to Williams (0-III). QMRI results and Williams (sub)scores were correlated using Spearman's ρ, while Williams grade-dependent differences were assessed using Kruskal-Wallis and Dunn's tests. Sensitivities and specificities in the detection of intact (Williams grade [WG]-0) and severely degenerate meniscus (WG-II-III) were calculated. Except for T2*, significant increases in qMRI parameters with increasing Williams grades were observed. T1, T1ρ, T2, and UTE-T2* exhibited high sensitivity and variable specificity rates. Significant marked-to-strong correlations were observed for these parameters with each other, with histological WGs and the subscores tissue integrity and cellularity. QMRI mapping holds promise in the objective evaluation of human meniscus. Although sufficient discriminatory power of T1, T1ρ, T2, and UTE-T2* was only demonstrated for the histological extremes, these data may aid in the future MRI-based parameterization and quantification of human meniscus degeneration. (orig.)

  14. Ex vivo quantitative multiparametric MRI mapping of human meniscus degeneration.

    Science.gov (United States)

    Nebelung, Sven; Tingart, Markus; Pufe, Thomas; Kuhl, Christiane; Jahr, Holger; Truhn, Daniel

    2016-12-01

    To evaluate the diagnostic performance of T1, T1ρ, T2, T2*, and UTE-T2* (ultrashort-echo time-enhanced T2*) mapping in the refined graduation of human meniscus degeneration with histology serving as standard-of-reference. This IRB-approved intra-individual comparative ex vivo study was performed on 24 lateral meniscus body samples obtained from 24 patients undergoing total knee replacement. Samples were assessed on a 3.0-T MRI scanner using inversion-recovery (T1), spin-lock multi-gradient-echo (T1ρ), multi-spin-echo (T2) and multi-gradient-echo (T2* and UTE-T2*) sequences to determine relaxation times of quantitative MRI (qMRI) parameters. Relaxation times were calculated on the respective maps, averaged to the entire meniscus and to its zones. Histologically, samples were analyzed on a four-point score according to Williams (0-III). QMRI results and Williams (sub)scores were correlated using Spearman's ρ, while Williams grade-dependent differences were assessed using Kruskal-Wallis and Dunn's tests. Sensitivities and specificities in the detection of intact (Williams grade [WG]-0) and severely degenerate meniscus (WG-II-III) were calculated. Except for T2*, significant increases in qMRI parameters with increasing Williams grades were observed. T1, T1ρ, T2, and UTE-T2* exhibited high sensitivity and variable specificity rates. Significant marked-to-strong correlations were observed for these parameters with each other, with histological WGs and the subscores tissue integrity and cellularity. QMRI mapping holds promise in the objective evaluation of human meniscus. Although sufficient discriminatory power of T1, T1ρ, T2, and UTE-T2* was only demonstrated for the histological extremes, these data may aid in the future MRI-based parameterization and quantification of human meniscus degeneration.

  15. In vivo effect of a self-etching primer on dentin.

    Science.gov (United States)

    Milia, E; Lallai, M R; García-Godoy, F

    1999-08-01

    To determine the ultrastructural aspects of the dentin collagen area in the cavity preparation floor produced in vivo after phosphoric acid acid-etching or after using Clearfil Liner Bond 2 self-etching primer (LB2 Primer). Twenty-four non-carious third molars scheduled for extraction from young adult patients (16-30 years old) were used. Conventional Class I cavities (+/- 2 mm deep) were prepared on the occlusal surfaces of all teeth using a cylindrical diamond bur on a high-speed handpiece with copious water spray. To avoid dehydration of the dentin, the smear layer-covered dentin was briefly air-dried for 2 seconds. Cavities were assigned at random to the following groups: Group A: Dentin etched for 15 seconds with 34% phosphoric acid, rinsed for 20 seconds and then briefly air-dried for 2 seconds with oil-free compressed air leaving the surfaces slightly moist. Group B: LB2 Primer was applied to the cavity surfaces for 30 seconds and then briefly air-dried to remove the solvent. Group C: The untreated dentin smear layer was used as a control. In all three groups, the cavities were filled incrementally with a resin-based composite (APX), light curing every increment for 40 seconds. After 30 minutes, the teeth were extracted atraumatically and the samples immediately prepared for evaluation with the transmission electron microscope. The use of a self-etching primer did not produce significant morphological changes in the moist dentin substrate. Adverse morphological conditions where observed when there was an excess water on the dentin surface. Phosphoric acid altered the collagen more severely than the self-etching primer.

  16. Molecular pharmacodynamics of emixustat in protection against retinal degeneration.

    Science.gov (United States)

    Zhang, Jianye; Kiser, Philip D; Badiee, Mohsen; Palczewska, Grazyna; Dong, Zhiqian; Golczak, Marcin; Tochtrop, Gregory P; Palczewski, Krzysztof

    2015-07-01

    Emixustat is a visual cycle modulator that has entered clinical trials as a treatment for age-related macular degeneration (AMD). This molecule has been proposed to inhibit the visual cycle isomerase RPE65, thereby slowing regeneration of 11-cis-retinal and reducing production of retinaldehyde condensation byproducts that may be involved in AMD pathology. Previously, we reported that all-trans-retinal (atRAL) is directly cytotoxic and that certain primary amine compounds that transiently sequester atRAL via Schiff base formation ameliorate retinal degeneration. Here, we have shown that emixustat stereoselectively inhibits RPE65 by direct active site binding. However, we detected the presence of emixustat-atRAL Schiff base conjugates, indicating that emixustat also acts as a retinal scavenger, which may contribute to its therapeutic effects. Using agents that lack either RPE65 inhibitory activity or the capacity to sequester atRAL, we assessed the relative importance of these 2 modes of action in protection against retinal phototoxicity in mice. The atRAL sequestrant QEA-B-001-NH2 conferred protection against phototoxicity without inhibiting RPE65, whereas an emixustat derivative incapable of atRAL sequestration was minimally protective, despite direct inhibition of RPE65. These data indicate that atRAL sequestration is an essential mechanism underlying the protective effects of emixustat and related compounds against retinal phototoxicity. Moreover, atRAL sequestration should be considered in the design of next-generation visual cycle modulators.

  17. Degenerate pressure driven modified nucleus-acoustic waves in degenerate plasmas

    Science.gov (United States)

    Mamun, A. A.

    2018-02-01

    The existence of degenerate pressure driven modified nucleus-acoustic (DPDMNA) waves propagating in a cold degenerate quantum plasma (DQP) system [containing cold inertialess degenerate electron species (DES), cold inertial non-degenerate light nucleus species (LNS), and stationary heavy nucleus species (HNS)] is predicted for the first time. The DPDMNA waves (in which the mass density of the cold LNS provides the inertia and the cold inertialess DES gives rise to the restoring force) are new since they completely disappear if the degenerate pressure of the cold DES is neglected. It is found that the phase speed (Vp) of the DPDMNA waves decreases with the rise of the charge number density of the stationary HNS for both non-relativistic and ultra-relativistic DES, and that the ultra-relativistic DES does not have any effect on Vp when β = 1, where β = Λc/Λe with Λ e = ne 0 - 1 / 3 being the average inter-electron distance in the DQP system and Λc being the constant (˜10-10 cm) for the DES. However, the ultra-relativistic DES does have quite a significant effect on Vp for β ≫ 1 and β ≪ 1, and the ultra-relativistic effect significantly enhances (reduces) Vp for β ≫ 1 (β ≪ 1). The DPDMNA waves and their dispersion properties are expected to be useful in understanding the basic features of the electrostatic perturbation mode in space and laboratory DQP systems.

  18. Preparation and Characterization of Acrylic Primer for Concrete Substrate Application

    Directory of Open Access Journals (Sweden)

    El-Sayed Negim

    2016-01-01

    Full Text Available This study dealt with the properties of acrylic primer for concrete substrate using acrylic syrup, made from a methyl methacrylate monomer solution of terpolymers. Terpolymer systems consisting of methyl methacrylate (MMA, 2-ethylhexyl acrylate (2-EHA, and methacrylic acid (MAA with different chemical composition ratios of MMA and 2-EHA were synthesized through bulk polymerization using azobisisobutyronitrile (AIBN as initiator. The terpolymer composition is characterized by FTIR, 1H NMR, DSC, TGA, and SEM. The glass transition temperature and the thermal stability increased with increasing amounts of MMA in the terpolymer backbone. The effect of chemical composition of terpolymers on physicomechanical properties of primer films was investigated. However, increasing the amount of MMA in terpolymer backbone increased tensile and contact angle of primer films while elongation at break, water absorption, and bond strength are decreased. In particular, the primer syrup containing 65% 2-EHA has good bonding strength with concrete substrate around 1.1 MPa.

  19. Designing for transportation management and operations : a primer.

    Science.gov (United States)

    2013-02-01

    This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...

  20. Primer: Using Watershed Modeling System (WMS) for Gridded Surface Subsurface Hydrologic Analysis (GSSHA) Data Development - WMS 6.1 and GSSHA 1.43C

    National Research Council Canada - National Science Library

    Downer, Charles

    2003-01-01

    This document is a primer for use of the Watershed Modeling System (WMS) interface with the physically based, distributed-parameter hydrologic model Gridded Surface Subsurface Hydrologic Analysis (GSSHA...

  1. Primer design for a prokaryotic differential display RT-PCR.

    Science.gov (United States)

    Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

    1997-05-01

    We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.

  2. New primers for amplification of cytochrome c oxidase subunit I barcode region designed for species of Decapoda (Crustacea

    Directory of Open Access Journals (Sweden)

    Fernando L. Mantelatto

    Full Text Available Abstract We designed 14 new primers for amplification of the COI barcode region of decapod crustacean species. We tested, with high level of success, the generation of ~ 640 ± 49 base-pair sequences in selected groups of decapods (hermit crabs, squat lobsters, marine and freshwater crabs and shrimps, encompassing representatives of 27 genera of 15 families, 11 of Pleocyemata (Anomura, Brachyura, and Caridea and 4 of Dendrobranchiata. Based on the results we expect the applicability of these primers for several studies with different taxa within Decapoda.

  3. Human disc degeneration is associated with increased MMP 7 expression.

    Science.gov (United States)

    Le Maitre, C L; Freemont, A J; Hoyland, J A

    2006-01-01

    During intervertebral disc (IVD) degeneration, normal matrix synthesis decreases and degradation of disc matrix increases. A number of proteases that are increased during disc degeneration are thought to be involved in its pathogenesis. Matrix metalloproteinase 7 (MMP 7) (Matrilysin, PUMP-1) is known to cleave the major matrix molecules found within the IVD, i.e., the proteoglycan aggrecan and collagen type II. To date, however, it is not known how its expression changes with degeneration or its exact location. We investigated the localization of MMP 7 in human, histologically graded, nondegenerate, degenerated and prolapsed discs to ascertain whether MMP 7 is up-regulated during disc degeneration. Samples of human IVD tissue were fixed in neutral buffered formalin, embedded in paraffin, and sections stained with hematoxylin and eosin to score the degree of morphological degeneration. Immunohistochemistry was performed to localize MMP 7 in 41 human IVDs with varying degrees of degeneration. We found that the chondrocyte-like cells of the nucleus pulposus and inner annulus fibrosus were MMP 7 immunopositive; little immunopositivity was observed in the outer annulus. Nondegenerate discs showed few immunopositive cells. A significant increase in the proportion of MMP 7 immunopositive cells was seen in the nucleus pulposus of discs classified as showing intermediate levels of degeneration and a further increase was seen in discs with severe degeneration. Prolapsed discs showed more MMP 7 immunopositive cells compared to nondegenerated discs, but fewer than those seen in cases of severe degeneration.

  4. Applied ecosystem analysis - a primer; the ecosystem diagnosis and treatment method

    International Nuclear Information System (INIS)

    Lestelle, L.C.; Mobrand, L.E.; Lichatowich, J.A.; Vogel, T.S.

    1996-05-01

    The aim of this document is to inform and instruct the reader about an approach to ecosystem management that is based upon salmon as an indicator species. It is intended to provide natural resource management professionals with the background information needed to answer questions about why and how to apply the approach. The methods and tools the authors describe are continually updated and refined, so this primer should be treated as a first iteration of a sequentially revised manual

  5. PIPEMicroDB: microsatellite database and primer generation tool for pigeonpea genome.

    Science.gov (United States)

    Sarika; Arora, Vasu; Iquebal, M A; Rai, Anil; Kumar, Dinesh

    2013-01-01

    Molecular markers play a significant role for crop improvement in desirable characteristics, such as high yield, resistance to disease and others that will benefit the crop in long term. Pigeonpea (Cajanus cajan L.) is the recently sequenced legume by global consortium led by ICRISAT (Hyderabad, India) and been analysed for gene prediction, synteny maps, markers, etc. We present PIgeonPEa Microsatellite DataBase (PIPEMicroDB) with an automated primer designing tool for pigeonpea genome, based on chromosome wise as well as location wise search of primers. Total of 123 387 Short Tandem Repeats (STRs) were extracted from pigeonpea genome, available in public domain using MIcroSAtellite tool (MISA). The database is an online relational database based on 'three-tier architecture' that catalogues information of microsatellites in MySQL and user-friendly interface is developed using PHP. Search for STRs may be customized by limiting their location on chromosome as well as number of markers in that range. This is a novel approach and is not been implemented in any of the existing marker database. This database has been further appended with Primer3 for primer designing of selected markers with left and right flankings of size up to 500 bp. This will enable researchers to select markers of choice at desired interval over the chromosome. Furthermore, one can use individual STRs of a targeted region over chromosome to narrow down location of gene of interest or linked Quantitative Trait Loci (QTLs). Although it is an in silico approach, markers' search based on characteristics and location of STRs is expected to be beneficial for researchers. Database URL: http://cabindb.iasri.res.in/pigeonpea/

  6. Applied Ecosystem Analysis - - a Primer : EDT the Ecosystem Diagnosis and Treatment Method.

    Energy Technology Data Exchange (ETDEWEB)

    Lestelle, Lawrence C.; Mobrand, Lars E.

    1996-05-01

    The aim of this document is to inform and instruct the reader about an approach to ecosystem management that is based upon salmon as an indicator species. It is intended to provide natural resource management professionals with the background information needed to answer questions about why and how to apply the approach. The methods and tools the authors describe are continually updated and refined, so this primer should be treated as a first iteration of a sequentially revised manual.

  7. The brain basis of musicophilia: evidence from frontotemporal lobar degeneration

    Directory of Open Access Journals (Sweden)

    Phillip David Fletcher

    2013-06-01

    Full Text Available Musicophilia, or abnormal craving for music, is a poorly understood phenomenon that has been associated in particular with focal degeneration of the temporal lobes. Here we addressed the brain basis of musicophilia using voxel-based morphometry (VBM on MR volumetric brain images in a retrospectively ascertained cohort of patients meeting clinical consensus criteria for frontotemporal lobar degeneration: of 37 cases ascertained, 12 had musicophilia and 25 did not exhibit the phenomenon. The syndrome of semantic dementia was relatively over-represented among the musicophilic subgroup. A VBM analysis revealed significantly increased regional grey matter volume in left posterior hippocampus in the musicophilic subgroup relative to the non-musicophilic group (p<0.05 corrected for regional comparisons; at a relaxed significance threshold (P<0.001 uncorrected across the brain volume musicophilia was associated with additional relative sparing of regional grey matter in other temporal lobe and prefrontal areas and atrophy of grey matter in posterior parietal and orbitofrontal areas. The present findings suggest a candidate brain substrate for musicophilia as a signature of distributed network damage that may reflect a shift of hedonic processing toward more abstract (non-social stimuli, with some specificity for particular neurodegenerative pathologies.

  8. Quasi-degenerate perturbation theory using matrix product states

    International Nuclear Information System (INIS)

    Sharma, Sandeep; Jeanmairet, Guillaume; Alavi, Ali

    2016-01-01

    In this work, we generalize the recently proposed matrix product state perturbation theory (MPSPT) for calculating energies of excited states using quasi-degenerate (QD) perturbation theory. Our formulation uses the Kirtman-Certain-Hirschfelder canonical Van Vleck perturbation theory, which gives Hermitian effective Hamiltonians at each order, and also allows one to make use of Wigner’s 2n + 1 rule. Further, our formulation satisfies Granovsky’s requirement of model space invariance which is important for obtaining smooth potential energy curves. Thus, when we use MPSPT with the Dyall Hamiltonian, we obtain a model space invariant version of quasi-degenerate n-electron valence state perturbation theory (NEVPT), a property that the usual formulation of QD-NEVPT2 based on a multipartitioning technique lacked. We use our method on the benchmark problems of bond breaking of LiF which shows ionic to covalent curve crossing and the twist around the double bond of ethylene where significant valence-Rydberg mixing occurs in the excited states. In accordance with our previous work, we find that multi-reference linearized coupled cluster theory is more accurate than other multi-reference theories of similar cost

  9. Quasi-degenerate perturbation theory using matrix product states

    Energy Technology Data Exchange (ETDEWEB)

    Sharma, Sandeep, E-mail: sanshar@gmail.com; Jeanmairet, Guillaume [Max Planck Institute for Solid State Research, Heisenbergstraße 1, 70569 Stuttgart (Germany); Alavi, Ali, E-mail: a.alavi@fkf.mpg.de [Max Planck Institute for Solid State Research, Heisenbergstraße 1, 70569 Stuttgart (Germany); Department of Chemistry, University of Cambridge, Lensfield Road, Cambridge CB2 1EW (United Kingdom)

    2016-01-21

    In this work, we generalize the recently proposed matrix product state perturbation theory (MPSPT) for calculating energies of excited states using quasi-degenerate (QD) perturbation theory. Our formulation uses the Kirtman-Certain-Hirschfelder canonical Van Vleck perturbation theory, which gives Hermitian effective Hamiltonians at each order, and also allows one to make use of Wigner’s 2n + 1 rule. Further, our formulation satisfies Granovsky’s requirement of model space invariance which is important for obtaining smooth potential energy curves. Thus, when we use MPSPT with the Dyall Hamiltonian, we obtain a model space invariant version of quasi-degenerate n-electron valence state perturbation theory (NEVPT), a property that the usual formulation of QD-NEVPT2 based on a multipartitioning technique lacked. We use our method on the benchmark problems of bond breaking of LiF which shows ionic to covalent curve crossing and the twist around the double bond of ethylene where significant valence-Rydberg mixing occurs in the excited states. In accordance with our previous work, we find that multi-reference linearized coupled cluster theory is more accurate than other multi-reference theories of similar cost.

  10. Quasi-degenerate perturbation theory using matrix product states

    Science.gov (United States)

    Sharma, Sandeep; Jeanmairet, Guillaume; Alavi, Ali

    2016-01-01

    In this work, we generalize the recently proposed matrix product state perturbation theory (MPSPT) for calculating energies of excited states using quasi-degenerate (QD) perturbation theory. Our formulation uses the Kirtman-Certain-Hirschfelder canonical Van Vleck perturbation theory, which gives Hermitian effective Hamiltonians at each order, and also allows one to make use of Wigner's 2n + 1 rule. Further, our formulation satisfies Granovsky's requirement of model space invariance which is important for obtaining smooth potential energy curves. Thus, when we use MPSPT with the Dyall Hamiltonian, we obtain a model space invariant version of quasi-degenerate n-electron valence state perturbation theory (NEVPT), a property that the usual formulation of QD-NEVPT2 based on a multipartitioning technique lacked. We use our method on the benchmark problems of bond breaking of LiF which shows ionic to covalent curve crossing and the twist around the double bond of ethylene where significant valence-Rydberg mixing occurs in the excited states. In accordance with our previous work, we find that multi-reference linearized coupled cluster theory is more accurate than other multi-reference theories of similar cost.

  11. Testing the single degenerate channel for supernova Ia

    Science.gov (United States)

    Parsons, Steven

    2014-10-01

    The progenitors of supernova Ia are close binaries containing white dwarfs. Of crucial importance to the evolution of these systems is how much material the white dwarf can stably accrete and hence grow in mass. This occurs during a short-lived intense phase of mass transfer known as the super soft source (SSS) phase. The short duration of this phase and large extinction to soft X-rays means that only a handful are known in our Galaxy. Far more can be learned from the underlying SSS progenitor population of close white dwarf plus FGK type binaries. Unfortunately, these systems are hard to find since the main-sequence stars completely outshine the white dwarfs at optical wavelengths. Because of this, there are currently no known close white dwarf binaries with F, G or early K type companions, making it impossible to determine the contribution of the single degenerate channel towards supernova Ia. Using the GALEX and RAVE surveys we have now identified the first large sample of FGK stars with UV excesses, a fraction of which are these illusive, close systems. Following an intense ground based spectroscopic investigation of these systems, we have identified 5 definite close binaries, with periods of less than a few days. Here we apply for COS spectroscopic observations to measure the mass and temperature of the white dwarfs in order to determine the future evolution of these systems. This will provide a crucial test for the single degenerate channel towards supernova Ia.

  12. Correlation between T2 relaxation time and intervertebral disk degeneration

    Energy Technology Data Exchange (ETDEWEB)

    Takashima, Hiroyuki; Takebayashi, Tsuneo; Yoshimoto, Mitsunori; Terashima, Yoshinori; Tsuda, Hajime; Ida, Kazunori; Yamashita, Toshihiko [Sapporo Medical University, Department of Orthopedic Surgery, School of Medicine, Sapporo, Hokkaido (Japan)

    2012-02-15

    Magnetic resonance T2 mapping allows for the quantification of water and proteoglycan content within tissues and can be used to detect early cartilage abnormalities as well as to track the response to therapy. The goal of the present study was to use T2 mapping to quantify intervertebral disk water content according to the Pfirrmann classification. This study involved 60 subjects who underwent lumbar magnetic resonance imaging (a total of 300 lumbar disks). The degree of disk degeneration was assessed in the midsagittal section on T2-weighted images according to the Pfirrmann classification (grades I to V). Receiver operating characteristic (ROC) analysis was performed among grades to determine the cut-off values. In the nucleus pulposus, T2 values tended to decrease with increasing grade, and there was a significant difference in T2 values between each grade from grades I to IV. However, there was no significant difference in T2 values in the anterior or posterior annulus fibrosus. T2 values according to disk degeneration level classification were as follows: grade I (>116.8 ms), grade II (92.7-116.7 ms), grade III (72.1-92.6 ms), grade IV (<72.0 ms). T2 values decreased with increasing Pfirrmann classification grade in the nucleus pulposus, likely reflecting a decrease in proteoglycan and water content. Thus, T2 value-based measurements of intervertebral disk water content may be useful for future clinical research on degenerative disk diseases. (orig.)

  13. indCAPS: A tool for designing screening primers for CRISPR/Cas9 mutagenesis events.

    Science.gov (United States)

    Hodgens, Charles; Nimchuk, Zachary L; Kieber, Joseph J

    2017-01-01

    Genetic manipulation of organisms using CRISPR/Cas9 technology generally produces small insertions/deletions (indels) that can be difficult to detect. Here, we describe a technique to easily and rapidly identify such indels. Sequence-identified mutations that alter a restriction enzyme recognition site can be readily distinguished from wild-type alleles using a cleaved amplified polymorphic sequence (CAPS) technique. If a restriction site is created or altered by the mutation such that only one allele contains the restriction site, a polymerase chain reaction (PCR) followed by a restriction digest can be used to distinguish the two alleles. However, in the case of most CRISPR-induced alleles, no such restriction sites are present in the target sequences. In this case, a derived CAPS (dCAPS) approach can be used in which mismatches are purposefully introduced in the oligonucleotide primers to create a restriction site in one, but not both, of the amplified templates. Web-based tools exist to aid dCAPS primer design, but when supplied sequences that include indels, the current tools often fail to suggest appropriate primers. Here, we report the development of a Python-based, species-agnostic web tool, called indCAPS, suitable for the design of PCR primers used in dCAPS assays that is compatible with indels. This tool should have wide utility for screening editing events following CRISPR/Cas9 mutagenesis as well as for identifying specific editing events in a pool of CRISPR-mediated mutagenesis events. This tool was field-tested in a CRISPR mutagenesis experiment targeting a cytokinin receptor (AHK3) in Arabidopsis thaliana. The tool suggested primers that successfully distinguished between wild-type and edited alleles of a target locus and facilitated the isolation of two novel ahk3 null alleles. Users can access indCAPS and design PCR primers to employ dCAPS to identify CRISPR/Cas9 alleles at http://indcaps.kieber.cloudapps.unc.edu/.

  14. A Primer on Alberta’s Oil sands Royalties

    Directory of Open Access Journals (Sweden)

    Sarah Dobson

    2015-12-01

    Full Text Available Fulfilling its campaign promise, the new NDP government announced a review of Alberta’s royalty framework in June 2015. The province receives royalty revenue from three main sources – natural gas, crude oil, and oil sands. Since the 2009-10 fiscal year the largest contributor to Alberta’s royalty revenues has been the oil sands. If you want a sense of how important oil sands royalties have been for Alberta’s finances, consider this: In the 2014–15 fiscal year, the government collected just over $5 billion from oil sands royalties. These royalties covered over 10 per cent of the province’s operational expenses of $48.6 billion in the same fiscal year. Over the last six fiscal years the oil sands have contributed an average of 10 per cent of revenues to provincial coffers. This makes oil sands royalties the fourth largest contributor behind personal income taxes (23 per cent, federal transfers (13 per cent and corporate income taxes (11 per cent. But how many Albertans really understand how the royalty system works? What do we mean when we say “royalty”? How does the Alberta Government calculate royalties on oil sands producers? If the system is going to change, it’s important that Albertans understand how the current system works. That is what this paper is designed to do. For Albertans to properly judge the impact of new policy, they need a solid understanding of the current policy environment. We all know that oil prices have dropped and oil sands producers are losing profitability. As such, changes to the royalty system could have a deep and profound impact on the sector. Here are some of the issues this primer will study: • Pre-payout projects vs. post-payout projects, in other words, the classification of projects for royalty purposes based on whether the cumulative costs of a project exceed its cumulative revenues • Monthly payment of royalties vs. annual payment • Understanding the unit price of bitumen and how that

  15. Risk factors for age-related macular degeneration: Pooled findings from three continents

    NARCIS (Netherlands)

    Smith, W.; Assink, J.; Klein, R.; Mitchell, P.; Klaver, C. C.; Klein, B. E.; Hofman, A.; Jensen, S.; Wang, J. J.; de Jong, P. T.

    2001-01-01

    To assess the prevalence and potential risk factors for late age-related macular degeneration (AMD) in three racially similar populations from North America, Europe, and AUSTRALIA: Combined analysis of population-based eye disease prevalence data. There were 14,752 participants with gradable

  16. Mediterranean Diet Score and Its Association with Age-Related Macular Degeneration : The European Eye Study

    NARCIS (Netherlands)

    Hogg, Ruth E; Woodside, Jayne V; McGrath, Alanna; Young, Ian S; Vioque, Jesus L; Chakravarthy, Usha; de Jong, Paulus T; Rahu, Mati; Seland, Johan; Soubrane, Gisele; Tomazzoli, Laura; Topouzis, Fotis; Fletcher, Astrid E

    2017-01-01

    PURPOSE: To examine associations between adherence to a Mediterranean diet and prevalence of age-related macular degeneration (AMD) in countries ranging from Southern to Northern Europe. DESIGN: Cross-sectional, population-based epidemiologic study. PARTICIPANTS: Of 5060 randomly sampled people aged

  17. Cardiovascular risk factors associated with age-related macular degeneration: the Tromso Study

    DEFF Research Database (Denmark)

    Erke, M. G.; Bertelsen, G.; Peto, T.

    2014-01-01

    PurposeTo examine associations between cardiovascular risk factors and age-related macular degeneration (AMD). MethodsA population-based, cross-sectional study of Caucasians aged 65-87years was conducted in Norway in 2007/2008. Retinal photographs were graded for AMD. Multivariable logistic...

  18. Does elite swimming accelerate lumbar intervertebral disc degeneration and increase low back pain?

    DEFF Research Database (Denmark)

    Folkvardsen, Steffen; Magnussen, Erland; Karppinen, Jaro

    2016-01-01

    PURPOSE: The aim was to elucidate elite swimming's possible influence on lumbar disc degeneration (DD) and low back pain (LBP). METHODS: Lumbar spine MRI was performed on a group of elite swimmers and compared to a matched Finnish population-based no-sport group. RESULTS: One hundred elite swimmers...

  19. Intacs for early pellucid marginal degeneration.

    Science.gov (United States)

    Kymionis, George D; Aslanides, Ioannis M; Siganos, Charalambos S; Pallikaris, Ioannis G

    2004-01-01

    A 42-year-old man had Intacs (Addition Technology Inc.) implantation for early pellucid marginal degeneration (PMD). Two Intacs segments (0.45 mm thickness) were inserted uneventfully in the fashion typically used for low myopia correction (nasal-temporal). Eleven months after the procedure, the uncorrected visual acuity was 20/200, compared with counting fingers preoperatively, while the best spectacle-corrected visual acuity improved to 20/25 from 20/50. Corneal topographic pattern also improved. Although the results are encouraging, concern still exists regarding the long-term effect of this approach for the management of patients with PMD.

  20. Genome instability: Linking ageing and brain degeneration.

    Science.gov (United States)

    Barzilai, Ari; Schumacher, Björn; Shiloh, Yosef

    2017-01-01

    Ageing is a multifactorial process affected by cumulative physiological changes resulting from stochastic processes combined with genetic factors, which together alter metabolic homeostasis. Genetic variation in maintenance of genome stability is emerging as an important determinant of ageing pace. Genome instability is also closely associated with a broad spectrum of conditions involving brain degeneration. Similarities and differences can be found between ageing-associated decline of brain functionality and the detrimental effect of genome instability on brain functionality and development. This review discusses these similarities and differences and highlights cell classes whose role in these processes might have been underestimated-glia and microglia. Copyright © 2016. Published by Elsevier B.V.

  1. Degenerate stars. XII - Recognition of hot nondegenerates

    Science.gov (United States)

    Greenstein, J. L.

    1980-12-01

    Fifty-one newly observed degenerate stars and 14 nondegenerates include 13 faint red stars, most of which do not show any lines except DF, Gr 554. Hot subdwarfs and an X-ray source are discussed along with the problem of low-resolution spectroscopic classification of dense hot stars. The multichannel spectrum of the carbon-rich magnetic star LP 790-29 is examined by fitting the undisturbed parts of the spectrum to a black body of 7625 K by the least squares method; the Swan bands absorb 600 A of the spectrum assuming that the blocked radiation is redistributed in the observed region.

  2. Aneutronic fusion in a degenerate plasma

    International Nuclear Information System (INIS)

    Son, S.; Fisch, N.J.

    2004-01-01

    In a Fermi-degenerate plasma, the electronic stopping of a slow ion is smaller than that given by the classical formula, because some transitions between the electron states are forbidden. The bremsstrahlung losses are then smaller, so that the nuclear burning of an aneutronic fuel is more efficient. Consequently, there occurs a parameter regime in which self-burning is possible. Practical obstacles in this regime that must be overcome before net energy can be realized include the compression of the fuel to an ultra dense state and the creation of a hot spot

  3. Aneutronic Fusion in a Degenerate Plasma

    International Nuclear Information System (INIS)

    Son, S.; Fisch, N.J.

    2004-01-01

    In a Fermi-degenerate plasma, the electronic stopping of a slow ion is smaller than that given by the classical formula, because some transitions between the electron states are forbidden. The bremsstrahlung losses are then smaller, so that the nuclear burning of an aneutronic fuel is more efficient. Consequently, there occurs a parameter regime in which self-burning is possible. Practical obstacles in this regime that must be overcome before net energy can be realized include the compression of the fuel to an ultra dense state and the creation of a hot spot

  4. Amplification of marine methanotrophic enrichment DNA with 16S rDNA PCR primers for type II alpha proteobacteria methanotrophs.

    Science.gov (United States)

    Rockne, Karl J; Strand, Stuart E

    2003-09-01

    Type II alpha proteobacteria methanotrophs are capable of a wide range of cometabolic transformations of chlorinated solvents and polycyclic aromatic hydrocarbons (PAHs), and this activity has been exploited in many terrestrial bioremediation systems. However, at present, all known obligately marine methanotrophic isolates are Type I gamma proteobacteria which do not have this activity to the extent of Type II methanotrophs. In previous work in our laboratory, determining the presence of Type II alpha proteobacteria methanotrophs in marine enrichment cultures that co-metabolized PAHs required a more sensitive assay. 16S rDNA PCR primers were designed based on oligonucleotide probes for serine pathway methanotrophs and serine pathway methylotrophs with an approximate amplification fragment size of 870 base pairs. Comparison of the primers using double primer BLAST searches in established nucleotide databases showed potential amplification with all Methylocystis and Methylosinus spp., as well as potential amplification with Methylocella palustrus. DNA from Methylosinus trichosporium OB3b, a Type II methanotroph, amplified with the primers with a fragment size of approximately 850 base pairs, whereas DNA extracted from Methylomonas methanica, a Type I methanotroph, did not. The primers were used to amplify DNA extracted from two marine methanotrophic enrichment cultures: a low nitrogen/low copper enrichment to select for Type II methanotrophs and a high nitrogen/high copper enrichment to select for Type I methanotrophs. Although DNA from both cultures amplified with the PCR primers, amplification was stronger in cultures that were specifically enriched for Type II methanotrophs, suggesting the presence of higher numbers of Type II methanotrophs. These results provide further evidence for the existence of Type II marine methanotrophs, suggesting the possibility of exploiting cometabolic activity in marine systems.

  5. MRI and MR tractography in bilateral hypertrophic olivary degeneration

    Directory of Open Access Journals (Sweden)

    Debraj Sen

    2014-01-01

    Full Text Available Hypertrophic olivary degeneration is a trans-synaptic neuronal degeneration associated with hypertrophy of the inferior olivary nucleus due to a lesion in the triangle of Guillain-Mollaret. Familiarity with this entity on magnetic resonance imaging (MRI is essential to avoid other erroneous ominous diagnoses. We present a case of bilateral hypertrophic olivary degeneration and discuss the etiopathogenesis and MRI findings in this entity. The contributory role of MR tractography in the diagnosis is also highlighted.

  6. MRI and MR tractography in bilateral hypertrophic olivary degeneration.

    Science.gov (United States)

    Sen, Debraj; Gulati, Yoginder S; Malik, Virender; Mohimen, Aneesh; Sibi, Eranki; Reddy, Deepak Chandra

    2014-10-01

    Hypertrophic olivary degeneration is a trans-synaptic neuronal degeneration associated with hypertrophy of the inferior olivary nucleus due to a lesion in the triangle of Guillain-Mollaret. Familiarity with this entity on magnetic resonance imaging (MRI) is essential to avoid other erroneous ominous diagnoses. We present a case of bilateral hypertrophic olivary degeneration and discuss the etiopathogenesis and MRI findings in this entity. The contributory role of MR tractography in the diagnosis is also highlighted.

  7. An Unusual Case of Extensive Lattice Degeneration and Retinal Detachment

    OpenAIRE

    Mathew, David J.; Sarma, Saurabh Kumar; Basaiawmoit, Jennifer V.

    2016-01-01

    Lattice degeneration of the retina is not infrequently encountered on a dilated retinal examination and many of them do not need any intervention. We report a case of atypical lattice degeneration variant with peripheral retinal detachment. An asymptomatic 35-year-old lady with minimal refractive error was found to have extensive lattice degeneration, peripheral retinal detachment and fibrotic changes peripherally with elevation of retinal vessels on dilated retinal examination. There were al...

  8. MRI and MR tractography in bilateral hypertrophic olivary degeneration

    International Nuclear Information System (INIS)

    Sen, Debraj; Gulati, Yoginder S.; Malik, Virender; Mohimen, Aneesh; Sibi, Eranki; Reddy, Deepak Chandra

    2014-01-01

    Hypertrophic olivary degeneration is a trans-synaptic neuronal degeneration associated with hypertrophy of the inferior olivary nucleus due to a lesion in the triangle of Guillain-Mollaret. Familiarity with this entity on magnetic resonance imaging (MRI) is essential to avoid other erroneous ominous diagnoses. We present a case of bilateral hypertrophic olivary degeneration and discuss the etiopathogenesis and MRI findings in this entity. The contributory role of MR tractography in the diagnosis is also highlighted

  9. Mutations in ABCR (ABCA4) in patients with Stargardt macular degeneration or cone-rod degeneration.

    Science.gov (United States)

    Briggs, C E; Rucinski, D; Rosenfeld, P J; Hirose, T; Berson, E L; Dryja, T P

    2001-09-01

    To determine the spectrum of ABCR mutations associated with Stargardt macular degeneration and cone-rod degeneration (CRD). One hundred eighteen unrelated patients with recessive Stargardt macular degeneration and eight with recessive CRD were screened for mutations in ABCR (ABCA4) by single-strand conformation polymorphism analysis. Variants were characterized by direct genomic sequencing. Segregation analysis was performed on the families of 20 patients in whom at least two or more likely pathogenic sequence changes were identified. The authors found 77 sequence changes likely to be pathogenic: 21 null mutations (15 novel), 55 missense changes (26 novel), and one deletion of a consensus glycosylation site (also novel). Fifty-two patients with Stargardt macular degeneration (44% of those screened) and five with CRD each had two of these sequence changes or were homozygous for one of them. Segregation analyses in the families of 19 of these patients were informative and revealed that the index cases and all available affected siblings were compound heterozygotes or homozygotes. The authors found one instance of an apparently de novo mutation, Ile824Thr, in a patient. Thirty-seven (31%) of the 118 patients with Stargardt disease and one with CRD had only one likely pathogenic sequence change. Twenty-nine patients with Stargardt disease (25%) and two with CRD had no identified sequence changes. This report of 42 novel mutations brings the growing number of identified likely pathogenic sequence changes in ABCR to approximately 250.

  10. Quantitative OCT and MRI biomarkers for the differentiation of cartilage degeneration

    International Nuclear Information System (INIS)

    Nebelung, Sven; Brill, Nicolai; Tingart, Markus; Jahr, Holger; Pufe, Thomas; Kuhl, Christiane; Truhn, Daniel

    2016-01-01

    To evaluate the usefulness of quantitative parameters obtained by optical coherence tomography (OCT) and magnetic resonance imaging (MRI) in the comprehensive assessment of human articular cartilage degeneration. Human osteochondral samples of variable degeneration (n = 45) were obtained from total knee replacements and assessed by MRI sequences measuring T1, T1ρ, T2 and T2* relaxivity and by OCT-based quantification of irregularity (OII, optical irregularity index), homogeneity (OHI, optical homogeneity index) and attenuation (OAI, optical attenuation index). Samples were also assessed macroscopically (Outerbridge classification) and histologically (Mankin classification) as grade-0 (Mankin scores 0-4)/grade-I (scores 5-8)/grade-II (scores 9-10)/grade-III (score 11-14). After data normalisation, differences between Mankin grades and correlations between imaging parameters were assessed using ANOVA and Tukey's post-hoc test and Spearman's correlation coefficients, respectively. Sensitivities and specificities in the detection of Mankin grade-0 were calculated. Significant degeneration-related increases were found for T2 and OII and decreases for OAI, while T1, T1ρ, T2* or OHI did not reveal significant changes in relation to degeneration. A number of significant correlations between imaging parameters and histological (sub)scores were found, in particular for T2 and OII. Sensitivities and specificities in the detection of Mankin grade-0 were highest for OHI/T1 and OII/T1ρ, respectively. Quantitative OCT and MRI techniques seem to complement each other in the comprehensive assessment of cartilage degeneration. Sufficiently large structural and compositional changes in the extracellular matrix may thus be parameterized and quantified, while the detection of early degeneration remains challenging. (orig.)

  11. Quantitative OCT and MRI biomarkers for the differentiation of cartilage degeneration

    Energy Technology Data Exchange (ETDEWEB)

    Nebelung, Sven [Aachen University Hospital, Department of Orthopaedics, Aachen (Germany); Institute of Anatomy and Cell Biology, RWTH, Aachen (Germany); Brill, Nicolai [Fraunhofer Institute for Production Technology, Aachen (Germany); Tingart, Markus; Jahr, Holger [Aachen University Hospital, Department of Orthopaedics, Aachen (Germany); Pufe, Thomas [Institute of Anatomy and Cell Biology, RWTH, Aachen (Germany); Kuhl, Christiane; Truhn, Daniel [Aachen University Hospital, Department of Diagnostic and Interventional Radiology, Aachen (Germany)

    2016-04-15

    To evaluate the usefulness of quantitative parameters obtained by optical coherence tomography (OCT) and magnetic resonance imaging (MRI) in the comprehensive assessment of human articular cartilage degeneration. Human osteochondral samples of variable degeneration (n = 45) were obtained from total knee replacements and assessed by MRI sequences measuring T1, T1ρ, T2 and T2* relaxivity and by OCT-based quantification of irregularity (OII, optical irregularity index), homogeneity (OHI, optical homogeneity index) and attenuation (OAI, optical attenuation index). Samples were also assessed macroscopically (Outerbridge classification) and histologically (Mankin classification) as grade-0 (Mankin scores 0-4)/grade-I (scores 5-8)/grade-II (scores 9-10)/grade-III (score 11-14). After data normalisation, differences between Mankin grades and correlations between imaging parameters were assessed using ANOVA and Tukey's post-hoc test and Spearman's correlation coefficients, respectively. Sensitivities and specificities in the detection of Mankin grade-0 were calculated. Significant degeneration-related increases were found for T2 and OII and decreases for OAI, while T1, T1ρ, T2* or OHI did not reveal significant changes in relation to degeneration. A number of significant correlations between imaging parameters and histological (sub)scores were found, in particular for T2 and OII. Sensitivities and specificities in the detection of Mankin grade-0 were highest for OHI/T1 and OII/T1ρ, respectively. Quantitative OCT and MRI techniques seem to complement each other in the comprehensive assessment of cartilage degeneration. Sufficiently large structural and compositional changes in the extracellular matrix may thus be parameterized and quantified, while the detection of early degeneration remains challenging. (orig.)

  12. Degeneration of the long biceps tendon: comparison of MRI with gross anatomy and histology.

    Science.gov (United States)

    Buck, Florian M; Grehn, Holger; Hilbe, Monika; Pfirrmann, Christian W A; Manzanell, Silvana; Hodler, Jürg

    2009-11-01

    The objective of our study was to relate alterations in biceps tendon diameter and signal on MR images to gross anatomy and histology. T1-weighted, T2-weighted fat-saturated, and proton density-weighted fat-saturated spin-echo sequences were acquired in 15 cadaveric shoulders. Biceps tendon diameter (normal, flattened, thickened, and partially or completely torn) and signal intensity (compared with bone, fat, muscle, and joint fluid) were graded by two readers independently and in a blinded fashion. The distance of tendon abnormalities from the attachment at the glenoid were noted in millimeters. MRI findings were related to gross anatomic and histologic findings. On the basis of gross anatomy, there were six normal, five flattened, two thickened, and two partially torn tendons. Reader 1 graded nine diameter changes correctly, missed two, and incorrectly graded four. The corresponding values for reader 2 were seven, one, and five, respectively, with kappa = 0.75. Histology showed mucoid degeneration (n = 13), lipoid degeneration (n = 7), and fatty infiltration (n = 6). At least one type of abnormality was found in each single tendon. Mucoid degeneration was hyperintense compared with fatty infiltration on T2-weighted fat-saturated images and hyperintense compared with magic-angle artifacts on proton density-weighted fat-saturated images. MRI-based localization of degeneration agreed well with histologic findings. Diameter changes are specific but not sensitive in diagnosing tendinopathy of the biceps tendon. Increased tendon signal is most typical for mucoid degeneration but should be used with care as a sign of tendon degeneration.

  13. Many-Body Green Function of Degenerate Systems

    International Nuclear Information System (INIS)

    Brouder, Christian; Panati, Gianluca; Stoltz, Gabriel

    2009-01-01

    A rigorous nonperturbative adiabatic approximation of the evolution operator in the many-body physics of degenerate systems is derived. This approximation is used to solve the long-standing problem of the choice of the initial states of H 0 leading to eigenstates of H 0 +V for degenerate systems. These initial states are eigenstates of P 0 VP 0 , where P 0 is the projection onto a degenerate eigenspace of H 0 . This result is used to give the proper definition of the Green function, the statistical Green function and the nonequilibrium Green function of degenerate systems. The convergence of these Green functions is established.

  14. The prognosis of retinal detachment due to lattice degeneration.

    Science.gov (United States)

    Benson, W E; Morse, P H

    1978-09-01

    In a series of 553 consecutive retinal detachments, 29% (120) were due to lattice degeneration. Forty-five percent of these were due to atrophic holes in the lattice degeneration and 55% were due to tears caused by traction posterior to or at the end of a patch of lattice. In phakic patients, retinal detachments due to atrophic holes were most common in young myopes. Detachments due to traction tears were seen in older, less myopic patients. The incidence of massive periretinal proliferation was less (5%) in detachments due to lattice degeneration than in detachments not due to lattice degeneration (6.5%).

  15. Getting superstring amplitudes by degenerating Riemann surfaces

    International Nuclear Information System (INIS)

    Matone, Marco; Volpato, Roberto

    2010-01-01

    We explicitly show how the chiral superstring amplitudes can be obtained through factorisation of the higher genus chiral measure induced by suitable degenerations of Riemann surfaces. This powerful tool also allows to derive, at any genera, consistency relations involving the amplitudes and the measure. A key point concerns the choice of the local coordinate at the node on degenerate Riemann surfaces that greatly simplifies the computations. As a first application, starting from recent ansaetze for the chiral measure up to genus five, we compute the chiral two-point function for massless Neveu-Schwarz states at genus two, three and four. For genus higher than three, these computations include some new corrections to the conjectural formulae appeared so far in the literature. After GSO projection, the two-point function vanishes at genus two and three, as expected from space-time supersymmetry arguments, but not at genus four. This suggests that the ansatz for the superstring measure should be corrected for genus higher than four.

  16. Metabolic anatomy of paraneoplastic cerebellar degeneration

    International Nuclear Information System (INIS)

    Anderson, N.E.; Posner, J.B.; Sidtis, J.J.; Moeller, J.R.; Strother, S.C.; Dhawan, V.; Rottenberg, D.A.

    1988-01-01

    Eleven patients with acquired cerebellar degeneration (10 of whom had paraneoplastic cerebellar degeneration [PCD]) were evaluated using neuropsychological tests and 18 F-fluorodeoxyglucose/positron emission tomography to (1) quantify motor, cognitive, and metabolic abnormalities; (2) determine if characteristic alterations in the regional cerebral metabolic rate for glucose (rCMRGlc) are associated with PCD; and (3) correlate behavioral and metabolic measures of disease severity. Eighteen volunteer subjects served as normal controls. Although some PCD neuropsychological test scores were abnormal, these results could not, in general, be dissociated from the effects of dysarthria and ataxia. rCMRGlc was reduced in patients with PCD (versus normal control subjects) in all regions except the brainstem. Analysis of patient and control rCMRGlc data using a mathematical model of regional metabolic interactions revealed two metabolic pattern descriptors, SSF1 and SSF2, which distinguished patients with PCD from normal control subjects; SSF2, which described a metabolic coupling between cerebellum, cuneus, and posterior temporal, lateral frontal, and paracentral cortex, correlated with quantitative indices of cerebellar dysfunction. Our inability to document substantial intellectual impairment in 7 of 10 patients with PCD contrasts with the 50% incidence of dementia in PCD reported by previous investigators. Widespread reductions in PCD rCMRGlc may result from the loss of cerebellar efferents to thalamus and forebrain structures, a reverse cerebellar diaschisis

  17. Progranulin in frontotemporal lobar degeneration and neuroinflammation

    Directory of Open Access Journals (Sweden)

    Hutton Michael L

    2007-02-01

    Full Text Available Abstract Progranulin (PGRN is a pleiotropic protein that has gained the attention of the neuroscience community with recent discoveries of mutations in the gene for PGRN that cause frontotemporal lobar degeneration (FTLD. Pathogenic mutations in PGRN result in null alleles, and the disease is likely the result of haploinsufficiency. Little is known about the normal function of PGRN in the central nervous system apart from a role in brain development. It is expressed by microglia and neurons. In the periphery, PGRN is involved in wound repair and inflammation. High PGRN expression has been associated with more aggressive growth of various tumors. The properties of full length PGRN are distinct from those of proteolytically derived peptides, referred to as granulins (GRNs. While PGRN has trophic properties, GRNs are more akin to inflammatory mediators such as cytokines. Loss of the neurotrophic properties of PGRN may play a role in selective neuronal degeneration in FTLD, but neuroinflammation may also be important. Gene expression studies suggest that PGRN is up-regulated in a variety of neuroinflammatory conditions, and increased PGRN expression by microglia may play a pivotal role in the response to brain injury, neuroinflammation and neurodegeneration.

  18. Observable consequences of partially degenerate leptogenesis

    CERN Document Server

    Ellis, Jonathan Richard; Yanagida, T; Ellis, John; Raidal, Martti

    2002-01-01

    In the context of the seesaw mechanism, it is natural that the large solar and atmospheric neutrino mixing angles originate separately from large 2 by 2 mixings in the neutrino and charged-lepton sectors, respectively, and large mixing in the neutrino couplings is in turn more plausible if two of the heavy singlet neutrinos are nearly degenerate. We study the phenomenology of this scenario, calculating leptogenesis by solving numerically the set of coupled Boltzmann equations for out-of-equilibrium heavy singlet neutrino decays in the minimal supersymmetric seesaw model. The near-degenerate neutrinos may weigh < 10^8 GeV, avoiding the cosmological gravitino problem. This scenario predicts that Br(mu to e gamma) should be strongly suppressed, because of the small singlet neutrino masses, whilst Br(tau to mu gamma) may be large enough to be observable in B-factory or LHC experiments. If the light neutrino masses are hierarchical, we predict that the neutrinoless double-beta decay parameter m_{ee} is approxim...

  19. MR imaging findings of hypertrophic olivary degeneration

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Do Joong; Jeon, Pyung; Kim, Dong Ik [Yonsei Univ. College of Medicine, Seoul (Korea, Republic of)

    1997-06-01

    To describe the magnetic resonance (MR) imaging findings of hypertrophic olivary degeneration (HOD) MR images of seven patients with HOD were retrospectively reviewed. Two were women and five were men, and they were aged between 48 and 65 (mean 58) years. Imaging examinations were performed with a 1.5-T unit, and the findings were used to evaluate the size and signal intensity of olivary lesions. The time interval from hemorrhagic ictus to MR imaging was between two and 30 months. Follow-up examinations were performed in two patients. All four patients with hemorrhages involving the central tegmental tract in the pons or midbrain showed ipsilateral HOD. Among these four, bilateral HOD was seen in one patient with hemorrhage involving the bilateral central tegmental tract, and in another with tegmental hemorrhage extending to the ipsilateral superior cerebellar peduncle. One patient with cerebellar hemorrhage involving the dentate nucleus had contralateral HOD. Two patients with multiple hemorrhages involving both the pons and cerebellum showed bilateral HOD. Axial MR images showed mild enlargement of the involved olivary mucleus, with high signal intensity on both proton density and T2 weighted images. There was no apparent enhancement on postcontrast T1-weighted images. MR imaging can clearly distinguish secondary olivary degeneration from underlying pathology involving the central tegmental tract in the pons or midbrain and cerebellum. These olivary abnormalities should not, however, be mistaken for primary medullary lesions.

  20. Vitreous in lattice degeneration of retina.

    Science.gov (United States)

    Foos, R Y; Simons, K B

    1984-05-01

    A localized pocket of missing vitreous invariably overlies lattice degeneration of the retina. Subjects with lattice also have a higher rate of rhegmatogenous retinal detachment, which is usually a complication of retinal tears. The latter are in turn a result of alterations in the central vitreous--that is, synchysis senilis leading to posterior vitreous detachment. In order to determine if there is either an association or a deleterious interaction between the local and central lesions of the vitreous in eyes with lattice, a comparison was made in autopsy eyes with and without lattice the degree of synchysis and rate of vitreous detachment. Results show no association between the local and central vitreous lesions, indicating that a higher rate of vitreous detachment is not the basis for the higher rate of retinal detachment in eyes with lattice. Also, there was no suggestion of deleterious interaction between the local and central vitreous lesions, either through vitreodonesis as a basis for precocious vitreous detachment, or through a greater degree of synchysis as a basis for interconnection of local and central lacunae (which could extend the localized retinal detachment in eyes with holes in lattice degeneration).

  1. MR imaging findings of hypertrophic olivary degeneration

    International Nuclear Information System (INIS)

    Kim, Do Joong; Jeon, Pyung; Kim, Dong Ik

    1997-01-01

    To describe the magnetic resonance (MR) imaging findings of hypertrophic olivary degeneration (HOD) MR images of seven patients with HOD were retrospectively reviewed. Two were women and five were men, and they were aged between 48 and 65 (mean 58) years. Imaging examinations were performed with a 1.5-T unit, and the findings were used to evaluate the size and signal intensity of olivary lesions. The time interval from hemorrhagic ictus to MR imaging was between two and 30 months. Follow-up examinations were performed in two patients. All four patients with hemorrhages involving the central tegmental tract in the pons or midbrain showed ipsilateral HOD. Among these four, bilateral HOD was seen in one patient with hemorrhage involving the bilateral central tegmental tract, and in another with tegmental hemorrhage extending to the ipsilateral superior cerebellar peduncle. One patient with cerebellar hemorrhage involving the dentate nucleus had contralateral HOD. Two patients with multiple hemorrhages involving both the pons and cerebellum showed bilateral HOD. Axial MR images showed mild enlargement of the involved olivary mucleus, with high signal intensity on both proton density and T2 weighted images. There was no apparent enhancement on postcontrast T1-weighted images. MR imaging can clearly distinguish secondary olivary degeneration from underlying pathology involving the central tegmental tract in the pons or midbrain and cerebellum. These olivary abnormalities should not, however, be mistaken for primary medullary lesions

  2. Hyaline cartilage degenerates after autologous osteochondral transplantation.

    Science.gov (United States)

    Tibesku, C O; Szuwart, T; Kleffner, T O; Schlegel, P M; Jahn, U R; Van Aken, H; Fuchs, S

    2004-11-01

    Autologous osteochondral grafting is a well-established clinical procedure to treat focal cartilage defects in patients, although basic research on this topic remains sparse. The aim of the current study was to evaluate (1) histological changes of transplanted hyaline cartilage of osteochondral grafts and (2) the tissue that connects the transplanted cartilage with the adjacent cartilage in a sheep model. Both knee joints of four sheep were opened surgically and osteochondral grafts were harvested and simultaneously transplanted to the contralateral femoral condyle. The animals were sacrificed after three months and the received knee joints were evaluated histologically. Histological evaluation showed a complete ingrowth of the osseous part of the osteochondral grafts. A healing or ingrowth at the level of the cartilage could not be observed. Histological evaluation of the transplanted grafts according to Mankin revealed significantly more and more severe signs of degeneration than the adjacent cartilage, such as cloning of chondrocytes and irregularities of the articular surface. We found no connecting tissue between the transplanted and the adjacent cartilage and histological signs of degeneration of the transplanted hyaline cartilage. In the light of these findings, long-term results of autologous osteochondral grafts in human beings have to be followed critically.

  3. [Influence of patellofemoral joint degeneration on outcome of medial unicompartmental knee arthroplasty].

    Science.gov (United States)

    Xu, B Y; Ji, B C; Guo, W T; Mu, W B; Cao, L

    2017-06-01

    Altman and Outerbridge scoring system. There was no significant difference between patellofemoral joint degeneration group and normal group based on Ahlback grading system. According to Altman classification, compared to normal group, there was no statistically differences in OKS, WOMAC and Lonner scoring system between patients with degeneration in the medial patellofemoral joint group, OKS and WOMAC increased (20.2±1.4 vs .18.2±2.7, 12.5±1.7 vs .10.5±2.5) ( t =-4.30, P =0.03; t =-4.80, P =0.02), the Lonner score decreased (84.3±2.8 vs .87.4±3.2) ( t =-6.20, P =0.01) in lateral patellofemoral degeneration group. According to Outerbridge scoring system, there were no statistically differences in patients in patellofemoral joint degeneration group and normal group. Conclusions: There is a good evidence that neither mild to moderate degree of patellofemoral joint degeneration nor pre-operative pain location will compromise the short-term outcome of medial Oxford UKA, and should not be considered as contraindications. The situation is less clear for lateral patellofemoral degeneration, and more cautious option is advised.

  4. Improvement of Protective Properties of Top Coatings Applied on Zinc-Rich Primer by 3-Aminopropyl-Triethoxysilan and 2-(Benzothialylthio) Succinic acid

    International Nuclear Information System (INIS)

    Truc, Trinh Anh; Hang, Thi Xuan; Oanh, Vu Ke; Dung, Nguyen Tuan

    2004-01-01

    Corrosion resistance of coating system consisting of zinc-rich primer (ZRP) and topcoat based on polyurethane resin with the presence of 3-aminopropyl-triethoxysilan (APS) and 2-(benzothialylthio) succinic acid (BSA) was studied by electrochemical impedance and wet adhesion. The interface metal/primer/topcoat was analyzed by scanning electronic microscopy. It was found that the presence of APS and BSA improved adhesion and barrier property of the topcoats

  5. Schrodinger's scat: a critical review of the currently available tiger (Panthera Tigris) and leopard (Panthera pardus) specific primers in India, and a novel leopard specific primer.

    Science.gov (United States)

    Maroju, Pranay Amruth; Yadav, Sonu; Kolipakam, Vishnupriya; Singh, Shweta; Qureshi, Qamar; Jhala, Yadvendradev

    2016-02-09

    Non-invasive sampling has opened avenues for the genetic study of elusive species, which has contributed significantly to their conservation. Where field based identity of non-invasive sample is ambiguous (e.g. carnivore scats), it is essential to establish identity of the species through molecular approaches. A cost effective procedure to ascertain species identity is to use species specific primers (SSP) for PCR amplification and subsequent resolution through agarose gel electrophoresis. However, SSPs if ill designed can often cross amplify non-target sympatric species. Herein we report the problem of cross amplification with currently published SSPs, which have been used in several recent scientific articles on tigers (Panthera tigris) and leopards (Panthera pardus) in India. Since these papers form pioneering research on which future work will be based, an early rectification is required so as to not propagate this error further. We conclusively show cross amplification of three of the four SSPs, in sympatric non-target species like tiger SSP amplifying leopard and striped hyena (Hyaena hyaena), and leopard SSP amplifying tiger, lion (Panthera leo persica) and clouded leopard (Neofelis nebulosa), with the same product size. We develop and test a non-cross-amplifying leopard specific primer pair within the mitochondrial cytochrome b region. We also standardize a duplex PCR method to screen tiger and leopard samples simultaneously in one PCR reaction to reduce cost and time. These findings suggest the importance of an often overlooked preliminary protocol of conclusive identification of species from non-invasive samples. The cross amplification of published primers in conspecifics suggests the need to revisit inferences drawn by earlier work.

  6. Differential transferability of EST-SSR primers developed from diploid species Pseudoroegneria spicata, Thinopyrum bessarabicum, and Th. elongatum

    Science.gov (United States)

    Simple sequence repeat technology based on expressed sequence tag (EST-SSR) is a useful genomic tool for genome mapping, characterizing plant species relationships, elucidating genome evolution, and tracing genes on alien chromosome segments. EST-SSR primers developed from three perennial diploid T...

  7. Variation in extragenic repetitive DNA sequences in Pseudomonas syringae and potential use of modified REP primers in the identification of closely related isolates

    Directory of Open Access Journals (Sweden)

    Elif Çepni

    2012-01-01

    Full Text Available In this study, Pseudomonas syringe pathovars isolated from olive, tomato and bean were identified by species-specific PCR and their genetic diversity was assessed by repetitive extragenic palindromic (REP-PCR. Reverse universal primers for REP-PCR were designed by using the bases of A, T, G or C at the positions of 1, 4 and 11 to identify additional polymorphism in the banding patterns. Binding of the primers to different annealing sites in the genome revealed additional fingerprint patterns in eight isolates of P. savastanoi pv. savastanoi and two isolates of P. syringae pv. tomato. The use of four different bases in the primer sequences did not affect the PCR reproducibility and was very efficient in revealing intra-pathovar diversity, particularly in P. savastanoi pv. savastanoi. At the pathovar level, the primer BOX1AR yielded shared fragments, in addition to five bands that discriminated among the pathovars P. syringae pv. phaseolicola, P. savastanoi pv. savastanoi and P. syringae pv. tomato. REP-PCR with a modified primer containing C produced identical bands among the isolates in a pathovar but separated three pathovars more distinctly than four other primers. Although REP-and BOX-PCRs have been successfully used in the molecular identification of Pseudomonas isolates from Turkish flora, a PCR based on inter-enterobacterial repetitive intergenic concensus (ERIC sequences failed to produce clear banding patterns in this study.

  8. The standard and degenerate primordial nucleosynthesis versus recent experimental data

    International Nuclear Information System (INIS)

    Esposito, S.; Mangano, G.; Miele, G.; Pisanti, O.

    2000-01-01

    We report the results on Big Bang Nucleosynthesis (BBN) based on an updated code, with accuracy of the order of 0.1% on He4 abundance, compared with the predictions of other recent similar analysis. We discuss the compatibility of the theoretical results, for vanishing neutrino chemical potentials, with the observational data. Bounds on the number of relativistic neutrinos and baryon abundance are obtained by a likelihood analysis. We also analyze the effect of large neutrino chemical potentials on primordial nucleosynthesis, motivated by the recent results on the Cosmic Microwave Background Radiation spectrum. The BBN exclusion plots for electron neutrino chemical potential and the effective number of relativistic neutrinos are reported. We find that the standard BBN seems to be only marginally in agreement with the recent BOOMERANG and MAXIMA-1 results, while the agreement is much better for degenerate BBN scenarios for large effective number of neutrinos, N ν ∼ 10. (author)

  9. Perilesional edema in radiation necrosis reflects axonal degeneration

    International Nuclear Information System (INIS)

    Perez-Torres, Carlos J; Yuan, Liya; Schmidt, Robert E; Rich, Keith M; Ackerman, Joseph JH; Garbow, Joel R

    2015-01-01

    Recently, we characterized a Gamma Knife® radiation necrosis mouse model with various magnetic resonance imaging (MRI) protocols to identify biomarkers useful in differentiation from tumors. Though the irradiation was focal to one hemisphere, a contralateral injury was observed that appeared to be localized in the white matter only. Interestingly, this injury was identifiable in T2-weighted images, apparent diffusion coefficient (ADC), and magnetization transfer ratio (MTR) maps, but not on post-contrast T1-weighted images. This observation of edema independent of vascular changes is akin to the perilesional edema seen in clinical radiation necrosis. The pathology underlying the observed white-matter MRI changes was explored by performing immunohistochemistry for healthy axons and myelin. The presence of both healthy axons and myelin was reduced in the contralateral white-matter lesion. Based on our immunohistochemical findings, the contralateral white-matter injury is most likely due to axonal degeneration

  10. Null alleles and sequence variations at primer binding sites of STR loci within multiplex typing systems.

    Science.gov (United States)

    Yao, Yining; Yang, Qinrui; Shao, Chengchen; Liu, Baonian; Zhou, Yuxiang; Xu, Hongmei; Zhou, Yueqin; Tang, Qiqun; Xie, Jianhui

    2018-01-01

    Rare variants are widely observed in human genome and sequence variations at primer binding sites might impair the process of PCR amplification resulting in dropouts of alleles, named as null alleles. In this study, 5 cases from routine paternity testing using PowerPlex ® 21 System for STR genotyping were considered to harbor null alleles at TH01, FGA, D5S818, D8S1179, and D16S539, respectively. The dropout of alleles was confirmed by using alternative commercial kits AGCU Expressmarker 22 PCR amplification kit and AmpFℓSTR ® . Identifiler ® Plus Kit, and sequencing results revealed a single base variation at the primer binding site of each STR locus. Results from the collection of previous reports show that null alleles at D5S818 were frequently observed in population detected by two PowerPlex ® typing systems and null alleles at D19S433 were mostly observed in Japanese population detected by two AmpFℓSTR™ typing systems. Furthermore, the most popular mutation type appeared the transition from C to T with G to A, which might have a potential relationship with DNA methylation. Altogether, these results can provide helpful information in forensic practice to the elimination of genotyping discrepancy and the development of primer sets. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Structure of Hepatitis C Virus Polymerase in Complex with Primer-Template RNA

    Energy Technology Data Exchange (ETDEWEB)

    Mosley, Ralph T.; Edwards, Thomas E.; Murakami, Eisuke; Lam, Angela M.; Grice, Rena L.; Du, Jinfa; Sofia, Michael J.; Furman, Philip A.; Otto, Michael J. (Pharmasset); (Emerald)

    2012-08-01

    The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory {beta}-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesis at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory {beta}-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus.

  12. Inteligencia emocional y autoconcepto en los estudiantes de primer ciclo

    OpenAIRE

    Castillo Canales, Braulio

    2017-01-01

    En nuestra investigación se tuvo como problema: ¿Qué relación existe entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II? Además el objetivo fue: Determinar la relación entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II. El tipo de estudio fue básica...

  13. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    Energy Technology Data Exchange (ETDEWEB)

    Lucas, D.S.

    2004-10-03

    This paper covers the basics of the implementation of the control volume method in the context of the Homogeneous Equilibrium Model (HEM)(T/H) code using the conservation equations of mass, momentum, and energy. This primer uses the advection equation as a template. The discussion will cover the basic equations of the control volume portion of the course in the primer, which includes the advection equation, numerical methods, along with the implementation of the various equations via FORTRAN into computer programs and the final result for a three equation HEM code and its validation.

  14. A dam for retrograde axonal degeneration in multiple sclerosis?

    NARCIS (Netherlands)

    Balk, L.J.; Twisk, J.W.R.; Steenwijk, M.D.; Daams, M.; Tewarie, P.; Killestein, J.; Uitdehaag, B.M.J.; Polman, C.H.; Petzold, A.F.S.

    2014-01-01

    Objective: Trans-synaptic axonal degeneration is a mechanism by which neurodegeneration can spread from a sick to a healthy neuron in the central nervous system. This study investigated to what extent trans-synaptic axonal degeneration takes place within the visual pathway in multiple sclerosis

  15. New treatment strategies for canine intervertebral disc degeneration

    NARCIS (Netherlands)

    Smolders, L.A.

    2013-01-01

    Degeneration of the intervertebral disc (IVD) is a common problem in dogs and humans. IVD degeneration can lead to herniation of the IVD with subsequent compression of neural structures and various clinical signs, including back pain. Current treatment of IVD disease is conservative or surgical.

  16. Lattice degeneration of the retina and retinal detachment.

    Science.gov (United States)

    Semes, L P

    1992-01-01

    Lattice retinal degeneration is considered the most significant peripheral retinal disorder potentially predisposing to retinal breaks and retinal detachment. Lattice degeneration affects the vitreous and inner retinal layers with secondary changes as deep as the retinal pigment epithelium and perhaps the choriocapillaris. Variations in clinical appearance are the rule; geographically, lattice lesions favor the vertical meridians between the equator and the ora serrata. Lattice degeneration begins early in life and has been reported in sequential generations of the same family. Along with its customary bilateral occurrence, lattice shares other characteristics of a dystrophy. The association between the vitreous and retina in lattice lesions may be responsible for the majority of lattice-induced retinal detachments. The tumultuous event of posterior vitreous separation in the presence of abnormally strong vitreoretinal adherence is the trigger for a retinal tear that, in turn, may lead to retinal detachment. Although retinal holes in young patients with lattice degeneration may play a role in the evolution of retinal detachment, the clinical course of lattice degeneration seems to be one of dormancy rather than of progressive change. This discussion outlines the pathophysiology of lattice retinal degeneration and the relationship of pathophysiology to clinical presentation. The epidemiology of lattice degeneration is summarized, as are the possible precursors to retinal detachment. A clinical characterization of the natural history of lattice degeneration is offered, and interventions for complications are described. To conclude, management strategies from a primary-care standpoint are reviewed.

  17. Prevalence of age-related macular degeneration in elderly Caucasians

    DEFF Research Database (Denmark)

    Erke, Maja G; Bertelsen, Geir; Peto, Tunde

    2012-01-01

    To describe the sex- and age-specific prevalence of drusen, geographic atrophy, and neovascular age-related macular degeneration (AMD).......To describe the sex- and age-specific prevalence of drusen, geographic atrophy, and neovascular age-related macular degeneration (AMD)....

  18. Negative electroretinograms in pericentral pigmentary retinal degeneration.

    Science.gov (United States)

    Hotta, Kazuki; Kondo, Mineo; Nakamura, Makoto; Hotta, Junko; Terasaki, Hiroko; Miyake, Yozo; Hida, Tetsuo

    2006-01-01

    The clinical presentation and electrophysiological findings are described of three consecutive cases with pericentral pigmentary retinal degeneration. The responses to bright flashes after dark adaptation showed negative waveform shape in all cases. Rod responses were strongly reduced compared with cone responses. Cone electroretinograms elicited by long-duration stimuli showed greater loss of the on-response than the off-response. The ratio of the on-response amplitude to off-response amplitude of these patients (0.52 +/- 0.12; mean +/- SD, n = 6) was significantly smaller than that of normal subject (0.83 +/- 0.21; mean +/- SD, n = 8) (Mann-Whitney U-test, P retinal function, especially in transmission between photoreceptors and depolarizing bipolar cells.

  19. Tidal effects in twin-degenerate binaries

    International Nuclear Information System (INIS)

    Campbell, C.G.

    1984-01-01

    The tidal velocity field is calculated for an initially non-rotating low mass white dwarf secondary in a twin-degenerate binary. These motions are used to find the tidal torque on the secondary, to first order in the orbital frequency, and an expression is derived for the synchronization time. For a lobe-filling secondary the synchronization time has a weak dependence on the mass and luminosity of the star, and for the binary G61-29 is found to be of the same order as the estimated lifetime of the system. It is emphasized, however, that tidal excitation of non-radial oscillatory modes in the secondary may significantly shorten the synchronization time. (author)

  20. A COMPUTATIONAL MODEL OF MOTOR NEURON DEGENERATION

    Science.gov (United States)

    Le Masson, Gwendal; Przedborski, Serge; Abbott, L.F.

    2014-01-01

    SUMMARY To explore the link between bioenergetics and motor neuron degeneration, we used a computational model in which detailed morphology and ion conductance are paired with intracellular ATP production and consumption. We found that reduced ATP availability increases the metabolic cost of a single action potential and disrupts K+/Na+ homeostasis, resulting in a chronic depolarization. The magnitude of the ATP shortage at which this ionic instability occurs depends on the morphology and intrinsic conductance characteristic of the neuron. If ATP shortage is confined to the distal part of the axon, the ensuing local ionic instability eventually spreads to the whole neuron and involves fasciculation-like spiking events. A shortage of ATP also causes a rise in intracellular calcium. Our modeling work supports the notion that mitochondrial dysfunction can account for salient features of the paralytic disorder amyotrophic lateral sclerosis, including motor neuron hyperexcitability, fasciculation, and differential vulnerability of motor neuron subpopulations. PMID:25088365

  1. A computational model of motor neuron degeneration.

    Science.gov (United States)

    Le Masson, Gwendal; Przedborski, Serge; Abbott, L F

    2014-08-20

    To explore the link between bioenergetics and motor neuron degeneration, we used a computational model in which detailed morphology and ion conductance are paired with intracellular ATP production and consumption. We found that reduced ATP availability increases the metabolic cost of a single action potential and disrupts K+/Na+ homeostasis, resulting in a chronic depolarization. The magnitude of the ATP shortage at which this ionic instability occurs depends on the morphology and intrinsic conductance characteristic of the neuron. If ATP shortage is confined to the distal part of the axon, the ensuing local ionic instability eventually spreads to the whole neuron and involves fasciculation-like spiking events. A shortage of ATP also causes a rise in intracellular calcium. Our modeling work supports the notion that mitochondrial dysfunction can account for salient features of the paralytic disorder amyotrophic lateral sclerosis, including motor neuron hyperexcitability, fasciculation, and differential vulnerability of motor neuron subpopulations. Copyright © 2014 Elsevier Inc. All rights reserved.

  2. Degenerate R-S perturbation theory

    Science.gov (United States)

    Hirschfelder, J. O.; Certain, P. R.

    1973-01-01

    A concise, systematic procedure is given for determining the Rayleigh-Schrodinger energies and wave functions of degenerate states to arbitrarily high orders even when the degeneracies of the various states are resolved in arbitrary orders. The procedure is expressed in terms of an iterative cycle in which the energy through the (2n+1)st order is expressed in terms of the partially determined wave function through the n-th order. Both a direct and an operator derivation are given. The two approaches are equivalent and can be transcribed into each other. The direct approach deals with the wave functions (without the use of formal operators) and has the advantage that it resembles the usual treatment of nondegenerate perturbations and maintains close contact with the basic physics. In the operator approach, the wave functions are expressed in terms of infinite order operators which are determined by the successive resolution of the space of the zeroth order functions.

  3. Nearly degenerate neutrinos, supersymmetry and radiative corrections

    International Nuclear Information System (INIS)

    Casas, J.A.; Espinosa, J.R.; Ibarra, A.; Navarro, I.

    2000-01-01

    If neutrinos are to play a relevant cosmological role, they must be essentially degenerate with a mass matrix of the bimaximal mixing type. We study this scenario in the MSSM framework, finding that if neutrino masses are produced by a see-saw mechanism, the radiative corrections give rise to mass splittings and mixing angles that can accommodate the atmospheric and the (large angle MSW) solar neutrino oscillations. This provides a natural origin for the Δm 2 sol 2 atm hierarchy. On the other hand, the vacuum oscillation solution to the solar neutrino problem is always excluded. We discuss also in the SUSY scenario other possible effects of radiative corrections involving the new neutrino Yukawa couplings, including implications for triviality limits on the Majorana mass, the infrared fixed point value of the top Yukawa coupling, and gauge coupling and bottom-tau unification

  4. Prevention of age-related macular degeneration.

    Science.gov (United States)

    Wong, Ian Yat Hin; Koo, Simon Chi Yan; Chan, Clement Wai Nang

    2011-02-01

    Age-related macular degeneration (AMD) is one of the leading causes of blindness in the developed world. Although effective treatment modalities such as anti-VEGF treatment have been developed for neovascular AMD, there is still no effective treatment for geographical atrophy, and therefore the most cost-effective management of AMD is to start with prevention. This review looks at current evidence on preventive measures targeted at AMD. Modalities reviewed include (1) nutritional supplements such as the Age-Related Eye Disease Study (AREDS) formula, lutein and zeaxanthin, omega-3 fatty acid, and berry extracts, (2) lifestyle modifications, including smoking and body-mass-index, and (3) filtering sunlight, i.e. sunglasses and blue-blocking intraocular lenses. In summary, the only proven effective preventive measures are stopping smoking and the AREDS formula.

  5. Progression of Fatty Muscle Degeneration in Atraumatic Rotator Cuff Tears.

    Science.gov (United States)

    Hebert-Davies, Jonah; Teefey, Sharlene A; Steger-May, Karen; Chamberlain, Aaron M; Middleton, William; Robinson, Kathryn; Yamaguchi, Ken; Keener, Jay D

    2017-05-17

    The purpose of this prospective study was to examine the progression of fatty muscle degeneration over time in asymptomatic shoulders with degenerative rotator cuff tears. Subjects with an asymptomatic rotator cuff tear in 1 shoulder and pain due to rotator cuff disease in the contralateral shoulder were enrolled in a prospective cohort. Subjects were followed annually with shoulder ultrasonography, which evaluated tear size, location, and fatty muscle degeneration. Tears that were either full-thickness at enrollment or progressed to a full-thickness defect during follow-up were examined. A minimum follow-up of 2 years was necessary for eligibility. One hundred and fifty-six shoulders with full-thickness rotator cuff tears were potentially eligible. Seventy shoulders had measurable fatty muscle degeneration of at least 1 rotator cuff muscle at some time point. Patients with fatty muscle degeneration in the shoulder were older than those without degeneration (mean, 65.8 years [95% confidence interval (CI), 64.0 to 67.6 years] compared with 61.0 years [95% CI, 59.1 to 62.9 years]; p tears at baseline was larger in shoulders with degeneration than in shoulders that did not develop degeneration (13 and 10 mm wide, respectively, and 13 and 10 mm long; p Tears with fatty muscle degeneration were more likely to have enlarged during follow-up than were tears that never developed muscle degeneration (79% compared with 58%; odds ratio, 2.64 [95% CI, 1.29 to 5.39]; p muscle degeneration occurred more frequently in shoulders with tears that had enlarged (43%; 45 of 105) than in shoulders with tears that had not enlarged (20%; 10 of 51; p tears with enlargement and progression of muscle degeneration were more likely to extend into the anterior supraspinatus than were those without progression (53% and 17%, respectively; p tear size (p = 0.56). The median time from tear enlargement to progression of fatty muscle degeneration was 1.0 year (range, -2.0 to 6.9 years) for the

  6. Formation of Degenerate Band Gaps in Layered Systems

    Directory of Open Access Journals (Sweden)

    Alexey P. Vinogradov

    2012-06-01

    Full Text Available In the review, peculiarities of spectra of one-dimensional photonic crystals made of anisotropic and/or magnetooptic materials are considered. The attention is focused on band gaps of a special type—the so called degenerate band gaps which are degenerate with respect to polarization. Mechanisms of formation and properties of these band gaps are analyzed. Peculiarities of spectra of photonic crystals that arise due to the linkage between band gaps are discussed. Particularly, it is shown that formation of a frozen mode is caused by linkage between Brillouin and degenerate band gaps. Also, existence of the optical Borrmann effect at the boundaries of degenerate band gaps and optical Tamm states at the frequencies of degenerate band gaps are analyzed.

  7. [Lattice degeneration of the peripheral retina: ultrastructural study].

    Science.gov (United States)

    Bec, P; Malecaze, F; Arne, J L; Mathis, A

    1985-01-01

    The ultrastructural study of a case of snail track degeneration shows the presence of lipid inclusions in both the glial and the macrophage cells in every layer of the retina, and the existence of intraretinal fibers different from collagen fibers appearing to be glial filaments similar to those found in astrocytic gliomes and to the Rosenthal fibers observed in senile nervous cells. Other features were thinning of the retina and absence of blood vessels in the retina. There are no abnormalities of the vitreo-retinal juncture. All the lesions are in agreement with those observed by Daicker [Ophthalmologica, Basel 165: 360-365, 1972; Klin. Mbl. Augenheilk. 172: 581-583, 1978] with some differences, however. They are different from those found in lattice degeneration. They show that snail track degeneration is a specific form of peripheral retinal degeneration which is quite different from lattice degeneration and must not be considered similar.

  8. Progressive Retinal Degeneration and Accumulation of Autofluorescent Lipopigments in Progranulin Deficient Mice

    Science.gov (United States)

    Hafler, Brian P.; Klein, Zoe A.; Zhou, Z. Jimmy; Strittmatter, Stephen M.

    2014-01-01

    Prior investigations have shown that patients with neuronal ceroid lipofuscinosis (NCL) develop neurodegeneration characterized by vision loss, motor dysfunction, seizures, and often early death. Neuropathological analysis of patients with NCL shows accumulation of intracellular autofluorescent storage material, lipopigment, throughout neurons in the central nervous system including in the retina. A recent study of a sibling pair with adult onset NCL and retinal degeneration showed linkage to the region of the progranulin (GRN) locus and a homozygous mutation was demonstrated in GRN. In particular, the sibling pair with a mutation in GRN developed retinal degeneration and optic atrophy. This locus for this form of adult onset neuronal ceroid lipofuscinosis was designated neuronal ceroid lipofuscinosis-11 (CLN11). Based on these clinical observations, we wished to determine whether Grn-null mice develop accumulation of autofluorescent particles and retinal degeneration. Retinas of both wild-type and Progranulin deficient mice were examined by immunostaining and autofluorescence. Accumulation of autofluorescent material was present in Progranulin deficient mice at 12 months. Degeneration of multiple classes of neurons including photoreceptors and retinal ganglion cells was noted in mice at 12 and 18 months. Our data shows that Grn−/− mice develop degenerative pathology similar to features of human CLN11. PMID:25234724

  9. Callosal degeneration topographically correlated with cognitive function in amnestic mild cognitive impairment and Alzheimer's disease dementia.

    Science.gov (United States)

    Wang, Pei-Ning; Chou, Kun-Hsien; Chang, Ni-Jung; Lin, Ker-Neng; Chen, Wei-Ta; Lan, Gong-Yau; Lin, Ching-Po; Lirng, Jiing-Feng

    2014-04-01

    Degeneration of the corpus callosum (CC) is evident in the pathogenesis of Alzheimer's disease (AD). However, the correlation of microstructural damage in the CC on the cognitive performance of patients with amnestic mild cognitive impairment (aMCI) and AD dementia is undetermined. We enrolled 26 normal controls, 24 patients with AD dementia, and 40 single-domain aMCI patients with at least grade 1 hippocampal atrophy and isolated memory impairment. Diffusion tensor imaging (DTI) with fractional anisotropy (FA), mean diffusivity (MD), axial diffusivity (DA), and radial diffusivity (DR) were measured. The entire CC was parcellated based on fiber trajectories to specific cortical Brodmann areas using a probabilistic tractography method. The relationship between the DTI measures in the subregions of the CC and cognitive performance was examined. Although the callosal degeneration in the patients with aMCI was less extended than in the patients with AD dementia, degeneration was already exhibited in several subregions of the CC at the aMCI stage. Scores of various neuropsychological tests were correlated to the severity of microstructural changes in the subregional CC connecting to functionally corresponding cortical regions. Our results confirm that CC degeneration is noticeable as early as the aMCI stage of AD and the disconnection of the CC subregional fibers to the corresponding Brodmann areas has an apparent impact on the related cognitive performance. Copyright © 2013 Wiley Periodicals, Inc.

  10. Binary electrokinetic separation of target DNA from background DNA primers.

    Energy Technology Data Exchange (ETDEWEB)

    James, Conrad D.; Derzon, Mark Steven

    2005-10-01

    This report contains the summary of LDRD project 91312, titled ''Binary Electrokinetic Separation of Target DNA from Background DNA Primers''. This work is the first product of a collaboration with Columbia University and the Northeast BioDefense Center of Excellence. In conjunction with Ian Lipkin's lab, we are developing a technique to reduce false positive events, due to the detection of unhybridized reporter molecules, in a sensitive and multiplexed detection scheme for nucleic acids developed by the Lipkin lab. This is the most significant problem in the operation of their capability. As they are developing the tools for rapidly detecting the entire panel of hemorrhagic fevers this technology will immediately serve an important national need. The goal of this work was to attempt to separate nucleic acid from a preprocessed sample. We demonstrated the preconcentration of kilobase-pair length double-stranded DNA targets, and observed little preconcentration of 60 base-pair length single-stranded DNA probes. These objectives were accomplished in microdevice formats that are compatible with larger detection systems for sample pre-processing. Combined with Columbia's expertise, this technology would enable a unique, fast, and potentially compact method for detecting/identifying genetically-modified organisms and multiplexed rapid nucleic acid identification. Another competing approach is the DARPA funded IRIS Pharmaceutical TIGER platform which requires many hours for operation, and an 800k$ piece of equipment that fills a room. The Columbia/SNL system could provide a result in 30 minutes, at the cost of a few thousand dollars for the platform, and would be the size of a shoebox or smaller.

  11. Online Social Networking: A Primer for Radiology

    OpenAIRE

    Prasanna, Prasanth M.; Seagull, F. Jacob; Nagy, Paul

    2011-01-01

    Online social networking is an immature, but rapidly evolving industry of web-based technologies that allow individuals to develop online relationships. News stories populate the headlines about various websites which can facilitate patient and doctor interaction. There remain questions about protecting patient confidentiality and defining etiquette in order to preserve the doctor/patient relationship and protect physicians. How much social networking-based communication or other forms of E-c...

  12. Primers As Socializing Agents in American and Finnish Schools.

    Science.gov (United States)

    Hyona, Jukka; And Others

    1995-01-01

    Content analysis of 12 Finnish and 18 American primers for grades 3 through 6 published primarily during the 1980s examined story type, plot setting, protagonist's characteristics, dramatic tasks, portrayals of family structure and parental responsibility, and extrafamilial peer and adult relationships. Results suggest that a nation's cultural…

  13. Bond strength of compomers to dentin using acidic primers.

    Science.gov (United States)

    Tate, W H; You, C; Powers, J M

    1999-10-01

    To determine the in vitro bond strengths of seven compomer/bonding agent restorative systems to human dentin. Seven compomer/bonding agents were bonded to human dentin, stored in water at 37 degrees C for 24 hours, and debonded in tension. Bonding conditions were with and without phosphoric acid etching, with and without the use of combined primer/bonding agents, and under moist and wet bond interfaces. Without phosphoric acid etching, F2000/F2000 Compomer Primer/Adhesive and F2000/Single Bond Dental Adhesive System were less sensitive to dentin wetness. With moist dentin, bond strengths of Dyract/Prime & Bond 2.1, Dyract AP/Prime & Bond 2.1, Hytac/OSB light-curing, one-component bonding agent, F2000/Single Bond, and Freedom/STAE single component light-cured dentin/enamel adhesive system, were improved with phosphoric acid etching. Also, with moist dentin, the bond strength of F2000/F2000 Compomer Primer/Adhesive in the 3M Clicker dispensing system was higher without phosphoric acid etching, whereas bonds of Compoglass/Syntac Single-component were not affected by phosphoric acid etching. Bonding did not occur without primer/bonding agent, regardless of surface condition or use of phosphoric acid etching.

  14. Diversity of internal structures in inhibited epoxy primers

    Directory of Open Access Journals (Sweden)

    Anthony E. Hughes

    2015-10-01

    Full Text Available Computed tomography is making a significant impact in the field of materials science in recent years. In this paper the authors report on advances made in three areas of characterization and also identified where further research needs to be focused. First we report on a new approach to data analysis called “Data Constrained Modelling (DCM” in which compositional tomography can be undertaken rather than adsorption or phase contrast tomography. This is achieved by collecting X-ray CT data at different energies and then combining the datasets to reconstruct 3D compositional tomography. Second, on the application of this approach to inhibited primers typical of those used in the aerospace industry. Aerospace primers are effectively composite materials containing inorganic phases which are bound together with a polymer. Understanding the materials science of these systems requires information over several orders of magnitude in length-scale. In this paper we report on how DCM can be used to extend our understanding at the smaller length scales at the limits of resolution of the technique. The third and final advance is in extending the approach to include 4-dimensional studies. In this case we examine the primer before and after leaching. This process causes changes in the primer which can be both detected and quantified using the above approach.

  15. Development of specific primers for genus Fusarium and F. solani ...

    African Journals Online (AJOL)

    Yomi

    2012-01-05

    Jan 5, 2012 ... reproductive parts of plants. They are ... plant species in most parts of the world. .... 20 µl 2.5X master mix (Eppendorf) and 1 µl of each forward and ... List of primers developed for rapid detection of Fusarium sp. and F. solani.

  16. Development of a microsatellite primer set to investigate the genetic ...

    Indian Academy of Sciences (India)

    Development of a microsatellite primer set to investigate the genetic population structure of Armadillidium nasatum (Crustacea, Oniscidea). Séverine Masson, Cédric Faivre, Isabelle Giraud, Catherine Souty-Grosset, Richard Cordaux, Carine Delaunay,. Didier Bouchon and Nicolas Bech. J. Genet. 93, 545-549. Table 1.

  17. Blood Donation and Transfusion: A Primer for Health Educators.

    Science.gov (United States)

    Felts, W. Michael; Glascoff, Mary A.

    1991-01-01

    Presents a primer for health educators about blood donation and transfusion, examining the nature of human blood, the background of blood transfusion, blood donation criteria, risks related to homologous blood transfusion, directed blood donation, potential alternatives to homologous transfusion, and resources for education on the subject. (SM)

  18. A Primer on Concepts and Applications of Proteomics in Neuroscience

    DEFF Research Database (Denmark)

    Hosp, Fabian; Mann, Matthias

    2017-01-01

    The enormous complexity of the central nervous system has impeded its systemic exploration for decades but powerful "omic" technologies are now pushing forward the frontiers of neuroscience research at an increasing pace. This Primer reviews the most recent progress in mass spectrometry (MS...

  19. Note: Primer Amysat 001; Fragment size is 211bp

    Indian Academy of Sciences (India)

    Renuka

    Bhandara : Lanes 1–14 represent different strains of Bhandara Ecorace. Note: Primer Amysat 001; Fragment size is 211bp. Fig. 1. SSR profiles generated from genomic DNA of 16 strains from different individuals of (A.L, D. TV, D. BV, Modal, Sukinda, Raily, Bhandara) ecoraces of tasar silk worm, Antheraea mylitta using the.

  20. Characteristics of the population employed in primer sector in Turkey

    Directory of Open Access Journals (Sweden)

    Bayar Rüya

    2006-01-01

    Full Text Available Activities related to the production of raw material like agriculture husbandry, forestry, fishery are called as primer activities. Especially people living in rural areas earn their livings on primer activities, mainly agriculture. Rural planning is inevitable for providing rural development which has an important place in all development of a country. And achievement of this planning depends on putting forth the characteristics of the population living in rural areas with its different aspects. Therefore, the requirements will be introduced more clearly and the increase in the welfare levels of the people living in rural areas will have been achieved. To achieve the rural development and progress, in addition to the features like the size of agricultural products, products that are cultivated, activities like husbandry, forestry, hunting, etc. and the qualities of the enterprises in which these activities are carried out, policies applied, capital, market and technology, the characteristics of the population employed in this sector is also of importance. Considering these points, what is aimed in this study is to put forth the characteristics of the population employed in primer sector in Turkey. According to the census results of the year 2000 in Turkey 38% of the population is employed, and 48% of this work is in primer sector.

  1. Controlling Air Pollution; A Primer on Stationary Source Control Techniques.

    Science.gov (United States)

    Corman, Rena

    This companion document to "Air Pollution Primer" is written for the nonexpert in air pollution; however, it does assume a familiarity with air pollution problems. This work is oriented toward providing the reader with knowledge about current and proposed air quality legislation and knowledge about available technology to meet these standards for…

  2. Direct RNA-based detection and differentiation of CTX-M-type extended-spectrum β-lactamases (ESBL.

    Directory of Open Access Journals (Sweden)

    Claudia Stein

    Full Text Available The current global spread of multi-resistant Gram-negatives, particularly extended spectrum β-lactamases expressing bacteria, increases the likelihood of inappropriate empiric treatment of critically ill patients with subsequently increased mortality. From a clinical perspective, fast detection of resistant pathogens would allow a pre-emptive correction of an initially inappropriate treatment. Here we present diagnostic amplification-sequencing approach as proof of principal based on the fast molecular detection and correct discrimination of CTX-M-β-lactamases, the most frequent ESBL family. The workflow consists of the isolation of total mRNA and CTX-M-specific reverse transcription (RT, amplification and pyrosequencing. Due to the high variability of the CTX-M-β-lactamase-genes, degenerated primers for RT, qRT as well as for pyrosequencing, were used and the suitability and discriminatory performance of two conserved positions within the CTX-M genes were analyzed, using one protocol for all isolates and positions, respectively. Using this approach, no information regarding the expected CTX-M variant is needed since all sequences are covered by these degenerated primers. The presented workflow can be conducted within eight hours and has the potential to be expanded to other β-lactamase families.

  3. A primer on precision medicine informatics.

    Science.gov (United States)

    Sboner, Andrea; Elemento, Olivier

    2016-01-01

    In this review, we describe key components of a computational infrastructure for a precision medicine program that is based on clinical-grade genomic sequencing. Specific aspects covered in this review include software components and hardware infrastructure, reporting, integration into Electronic Health Records for routine clinical use and regulatory aspects. We emphasize informatics components related to reproducibility and reliability in genomic testing, regulatory compliance, traceability and documentation of processes, integration into clinical workflows, privacy requirements, prioritization and interpretation of results to report based on clinical needs, rapidly evolving knowledge base of genomic alterations and clinical treatments and return of results in a timely and predictable fashion. We also seek to differentiate between the use of precision medicine in germline and cancer. © The Author 2015. Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.

  4. Pediatric Perioperative Pulmonary Arterial Hypertension: A Case-Based Primer

    Directory of Open Access Journals (Sweden)

    Shilpa Shah

    2017-10-01

    Full Text Available The perioperative period is an extremely tenuous time for the pediatric patient with pulmonary arterial hypertension. This article will discuss a multidisciplinary approach to preoperative planning, the importance of early identification of pulmonary hypertensive crises, and practical strategies for postoperative management for this unique group of children.

  5. Transplantation of retinal pigment epithelial cells - a possible future treatment for age-related macular degeneration

    DEFF Research Database (Denmark)

    Wiencke, Anne Katrine

    2001-01-01

    ophthalmology, age-related macular degeneration, transplantation, retinal pigment epithelial cells, treatment......ophthalmology, age-related macular degeneration, transplantation, retinal pigment epithelial cells, treatment...

  6. Transplantation of retinal pigment epithelial cells - a possible future treatment for age-related macular degeneration

    DEFF Research Database (Denmark)

    Wiencke, Anne Katrine

    2001-01-01

    ophthalmology, age-related macular degeneration, retinal pigment epithelial cells, transplantation, treatment......ophthalmology, age-related macular degeneration, retinal pigment epithelial cells, transplantation, treatment...

  7. Science Consistency Reviews A Primer for Application

    Science.gov (United States)

    James M. Guldin; David Cawrse; Russell Graham; Miles Hemstrom; Linda Joyce; Steve Kessler; Ranotta McNair; George Peterson; Charles G. Shaw; Peter Stine; Mark Twery; Jeffrey Walter

    2003-01-01

    Concern over Federal land management decisions has grown in recent years. Public debates over activities on Federal land have been contentious, especially regarding management of national forests. Decisions on the management and use of national forest lands are based on many different considerations and values. Although Federal land managers can make choices concerning...

  8. Simultaneous identification and DNA barcoding of six Eimeria species infecting turkeys using PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus.

    Science.gov (United States)

    Hafeez, Mian A; Shivaramaiah, Srichaitanya; Dorsey, Kristi Moore; Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Cobean, Julie; Barta, John R

    2015-05-01

    Species-specific PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus were generated that allow for the specific identification of the most common Eimeria species infecting turkeys (i.e., Eimeria adenoeides, Eimeria meleagrimitis, Eimeria gallopavonis, Eimeria meleagridis, Eimeria dispersa, and Eimeria innocua). PCR reaction chemistries were optimized with respect to divalent cation (MgCl2) and dNTP concentrations, as well as PCR cycling conditions (particularly anneal temperature for primers). Genomic DNA samples from single oocyst-derived lines of six Eimeria species were tested to establish specificity and sensitivity of these newly designed primer pairs. A mixed 60-ng total DNA sample containing 10 ng of each of the six Eimeria species was used as DNA template to demonstrate specific amplification of the correct product using each of the species-specific primer pairs. Ten nanograms of each of the five non-target Eimeria species was pooled to provide a non-target, control DNA sample suitable to test the specificity of each primer pair. The amplifications of the COI region with species-specific primer pairs from pooled samples yielded products of expected sizes (209 to 1,012 bp) and no amplification of non-target Eimeria sp. DNA was detected using the non-target, control DNA samples. These primer pairs specific for Eimeria spp. of turkeys did not amplify any of the seven Eimeria species infecting chickens. The newly developed PCR primers can be used as a diagnostic tool capable of specifically identifying six turkey Eimeria species; additionally, sequencing of the PCR amplification products yields sequence-based genotyping data suitable for identification and molecular phylogenetics.

  9. Touch-down reverse transcriptase-PCR detection of IgV(H) rearrangement and Sybr-Green-based real-time RT-PCR quantitation of minimal residual disease in patients with chronic lymphocytic leukemia.

    Science.gov (United States)

    Peková, Sona; Marková, Jana; Pajer, Petr; Dvorák, Michal; Cetkovský, Petr; Schwarz, Jirí

    2005-01-01

    Patients with chronic lymphocytic leukemia (CLL) can relapse even after aggressive therapy and autografts. It is commonly assumed that to prevent relapse the level of minimal residual disease (MRD) should be as low as possible. To evaluate MRD, highly sensitive quantitative assays are needed. The aim of the study was to develop a robust and sensitive method for detection of the clonal immunoglobulin heavy-chain variable (IgV(H)) rearrangement in CLL and to introduce a highly sensitive and specific methodology for MRD monitoring in patients with CLL who undergo intensive treatment. As a prerequisite for MRD detection, touch-down reverse transcriptase (RT)-PCR using degenerate primers were used for the diagnostic identification of (H) gene rearrangement(s). For quantitative MRD detection in 18 patients, we employed a real-time RT-PCR assay (RQ-PCR) making use of patient-specific primers and the cost-saving Sybr-Green reporter dye (SG). For precise calibration of RQ-PCR, patient-specific IgV(H) sequences were cloned. Touch-down RT-PCR with degenerate primers allowed the successful detection of IgV(H) clonal rearrangement(s) in 252 of 257 (98.1%) diagnostic samples. Biallelic rearrangements were found in 27 of 252 (10.7%) cases. Degenerate primers used for the identification of clonal expansion at diagnosis were not sensitive enough for MRD detection. In contrast, our RQ-PCR assay using patient-specific primers and SG reached the sensitivity of 10(-)(6). We demonstrated MRD in each patient tested, including four of four patients in complete remission following autologous hematopoietic stem cell transplantation (HSCT) and three of three following allogeneic 'mini'-HSCT. Increments in MRD might herald relapse; aggressive chemotherapy could induce molecular remission. Our touch-down RT-PCR has higher efficiency to detect clonal IgV(H) rearrangements including the biallelic ones. MRD quantitation of IgV(H) expression using SG-based RQ-PCR represents a highly specific

  10. Evaluation of the shear bond strength of lingual brackets manufactured by three different processes using two different adhesive primers: An in vitro study

    Directory of Open Access Journals (Sweden)

    Shrinivas Ashtekar

    2016-01-01

    Full Text Available Objective: To compare and evaluate the shear bond strength (SBS of lingual brackets, manufactured by three different processes, that is, laser sintering, milling, and casting, bonded with two different adhesive primers. Materials and Methods: One hundred and twenty premolars were selected, and three types of lingual brackets were used, namely, STB (milling, 7th Generation (casting, and lingualmatrix (laser sintering. Forty brackets per system were used half of which were sandblasted while the other half were used as available. Further, these were subdivided and bonded with Transbond XT primer and adhesive and 3M ESPE Primer and Transbond XT adhesive. Customization of STB and 7th Generation was done by Torque Angulation Reference Guide, Lingualmatrix had bases customized by Computer-aided design/computer-aided manufacturing. SBS was tested with universal testing machine and evaluated for adhesive remnant index (ARI. Results: Statistical analysis showed that surface treatment, use of different primers, method of customization influenced the SBS, and ARI suggested that the fracture occurred between composite and bracket interface. Conclusion: Lingualmatrix bracket showed greater SBS as compared to STB and 7th Generation, sandblasting increased SBS. 3M ESPE primer group showed increased SBS as that bonded with Transbond XT primer. The fracture was between the composite bracket interface.

  11. Progress toward the maintenance and repair of degenerating retinal circuitry.

    Science.gov (United States)

    Vugler, Anthony A

    2010-01-01

    Retinal diseases such as age-related macular degeneration and retinitis pigmentosa remain major causes of severe vision loss in humans. Clinical trials for treatment of retinal degenerations are underway and advancements in our understanding of retinal biology in health/disease have implications for novel therapies. A review of retinal biology is used to inform a discussion of current strategies to maintain/repair neural circuitry in age-related macular degeneration, retinitis pigmentosa, and Type 2 Leber congenital amaurosis. In age-related macular degeneration/retinitis pigmentosa, a progressive loss of rods/cones results in corruption of bipolar cell circuitry, although retinal output neurons/photoreceptive melanopsin cells survive. Visual function can be stabilized/enhanced after treatment in age-related macular degeneration, but in advanced degenerations, reorganization of retinal circuitry may preclude attempts to restore cone function. In Type 2 Leber congenital amaurosis, useful vision can be restored by gene therapy where central cones survive. Remarkable progress has been made in restoring vision to rodents using light-responsive ion channels inserted into bipolar cells/retinal ganglion cells. Advances in genetic, cellular, and prosthetic therapies show varying degrees of promise for treating retinal degenerations. While functional benefits can be obtained after early therapeutic interventions, efforts should be made to minimize circuitry changes as soon as possible after rod/cone loss. Advances in retinal anatomy/physiology and genetic technologies should allow refinement of future reparative strategies.

  12. Microcurrent stimulation in the treatment of dry and wet macular degeneration

    Directory of Open Access Journals (Sweden)

    Chaikin L

    2015-12-01

    Full Text Available Laurie Chaikin,1 Kellen Kashiwa,2 Michael Bennet,2 George Papastergiou,3 Walter Gregory4 1Private practice, Alameda, CA, USA; 2Retina Institute of Hawaii, Honolulu, HI, USA; 3California Retinal Associates, San Diego, CA, USA; 4Clinical Trials Research Unit, Faculty of Medicine and Health, University of Leeds, Leeds, UK Purpose: To determine the safety and efficacy of the application of transcutaneous (transpalpebral microcurrent stimulation to slow progression of dry and wet macular degeneration or improve vision in dry and wet macular degeneration. Methods: Seventeen patients aged between 67 and 95 years with an average age of 83 years were selected to participate in the study over a period of 3 months in two eye care centers. There were 25 eyes with dry age-related macular degeneration (DAMD and six eyes with wet age-related macular degeneration (WAMD. Frequency-specific microcurrent stimulation was applied in a transpalpebral manner, using two programmable dual channel microcurrent units delivering pulsed microcurrent at 150 µA for 35 minutes once a week. The frequency pairs selected were based on targeting tissues, which are typically affected by the disease combined with frequencies that target disease processes. Early Treatment Diabetic Retinopathy Study or Snellen visual acuity (VA was measured before and after each treatment session. All treatment was administered in a clinical setting. Results: Significant increases were seen in VA in DAMD (P=0.012, Wilcoxon one-sample test, but in WAMD, improvements did not reach statistical significance (P=0.059. In DAMD eyes, twice as many patients showed increase in VA (52% compared to those showing deterioration (26%, with improvements being often sizeable, whereas deteriorations were usually very slight. In WAMD eyes, five of six (83% patients showed an increase and none showed deterioration. Conclusion: The substantial changes observed over this period, combined with continued improvement for

  13. Age related macular degeneration and visual disability.

    Science.gov (United States)

    Christoforidis, John B; Tecce, Nicola; Dell'Omo, Roberto; Mastropasqua, Rodolfo; Verolino, Marco; Costagliola, Ciro

    2011-02-01

    Age-related macular degeneration (AMD) is the leading cause of central blindness or low vision among the elderly in industrialized countries. AMD is caused by a combination of genetic and environmental factors. Among modifiable environmental risk factors, cigarette smoking has been associated with both the dry and wet forms of AMD and may increase the likelihood of worsening pre-existing AMD. Despite advances, the treatment of AMD has limitations and affected patients are often referred for low vision rehabilitation to help them cope with their remaining eyesight. The characteristic visual impairment for both forms of AMD is loss of central vision (central scotoma). This loss results in severe difficulties with reading that may be only partly compensated by magnifying glasses or screen-projection devices. The loss of central vision associated with the disease has a profound impact on patient quality of life. With progressive central visual loss, patients lose their ability to perform the more complex activities of daily living. Common vision aids include low vision filters, magnifiers, telescopes and electronic aids. Low vision rehabilitation (LVR) is a new subspecialty emerging from the traditional fields of ophthalmology, optometry, occupational therapy, and sociology, with an ever-increasing impact on the usual concepts of research, education, and services for visually impaired patients. Relatively few ophthalmologists practise LVR and fewer still routinely use prismatic image relocation (IR) in AMD patients. IR is a method of stabilizing oculomotor functions with the purpose of promoting better function of preferred retinal loci (PRLs). The aim of vision rehabilitation therapy consists in the achievement of techniques designed to improve PRL usage. The use of PRLs to compensate for diseased foveae has offered hope to these patients in regaining some function. However, in a recently published meta-analysis, prism spectacles were found to be unlikely to be of

  14. Localized thermonuclear runaways and volcanoes on degenerate dwarf stars

    Energy Technology Data Exchange (ETDEWEB)

    Shara, M.M.

    1982-10-15

    Practically all studies to date of thermonuclear runaways on degenerate dwarf stars in binary systems have considered only spherically symmetric eruptions. We emphasize that even slightly non-spherically symmetric accretion leads to transverse temperature gradients in the dwarfs' accreted envelopes. Over a rather broad range of parameter space, thermalization time scales in accreted envelopes are much longer than thermonuclear runaway time scales. Thus localized thermonuclear runaways (i.e., runaways much smaller than the host degenerate star) rather than spherically symmetric global eruptions are likely to occur on many degenerate dwarfs. Localized runaways are more likely to occur on more massive and/or hotter dwarfs.

  15. Cystic adventitial degeneration: ectopic ganglia from adjacent joint capsules.

    Science.gov (United States)

    Ortmann, J; Widmer, M K; Gretener, S; Do, D D; Willenberg, T; Daliri, A; Baumgartner, I

    2009-11-01

    Cystic adventitial degeneration is a rare non-atherosclerotic cause of peripheral arterial occlusive disease, mainly seen in young men without other evidence of vascular disease. Diagnosis will be established by clinical findings and by ultrasound or angiography and can be treated by excision or enucleation of the affected arterial segment or by percutaneous ultrasound-guided aspiration. However, the etiology of adventitial cysts remains unknown. We report a case of cystic adventitial degeneration showing a connection between the joint capsule and the adventitial cyst, supporting the theory that cystic adventitial degeneration may represent ectopic ganglia from adjacent joint capsules.

  16. Acquired Nonpigmented Vitreous Cyst Associated With Lattice Degeneration.

    Science.gov (United States)

    Lu, Jing; Mai, Guiying; Liu, Ruyuan; Luo, Yan; Lu, Lin

    2017-10-01

    A 63-year-old male presented with a round-shaped floater and visual obscuration in the right eye. Clinical evaluation showed a nonpigmented vitreous cyst connected to a lattice degeneration by a stalk. Immunostaining of the vitreous cyst obtained from vitrectomy showed its origin of retinal neuroepithelium. The cyst was formed by continuous vitreous traction, which might tear up the disrupted retina at the area of lattice degeneration. This report added the lattice degeneration to the list of causes for the acquired vitreous cyst. [Ophthalmic Surg Lasers Imaging Retina. 2017;48:856-858.]. Copyright 2017, SLACK Incorporated.

  17. [Clinical features and prognosis of retinal lattice degeneration].

    Science.gov (United States)

    Guo, X R

    1990-07-01

    110 cases (110 eyes) of retinal lattice degeneration were clinically observed and followed up for 3-8 years. Most lesions were located in the superotemporal quadrant, band-shaped, and parallel to the ora serrata. 80.9% of the lesions presented various degrees of pigmentation, 67.1% yellowish white spots, and 83.6% white lines. 32.9% of the eyes developed retinal holes. Most lattice degenerations were accompanied by vitreous degeneration and vitreoretinal traction. The disease progressed only slowly, though in a few cases it tended to expand.

  18. [Current concepts in pathogenesis of age-related macular degeneration].

    Science.gov (United States)

    Kubicka-Trząska, Agnieszka; Karska-Basta, Izabella; Romanowska-Dixon, Bożena

    2014-01-01

    Age-related macular degeneration is the leading cause of central blindness in elderly population of the western world. The pathogenesis of this disease, likely multifactorial, is not well known, although a number of theories have been put forward, including oxidative stress, genetic interactions, hemodynamic imbalance, immune and inflammatory processes. The understanding of age-related macular degeneration pathogenesis will give rise to new approaches in prevention and treatment of the early and late stages of both atrophic and neovascular age-related macular degeneration.

  19. The ability of T2/B4 primers to detect Leishmania infantum among ...

    African Journals Online (AJOL)

    SERVER

    2008-04-03

    Apr 3, 2008 ... Reverse Primer (5`-CCT CTC TTT TTT CNC TGT GC-3`). (Schönian et al., 1996),. B. Forward Primer (RV1) (5`-GTG GGG GAG GGG CGT TCT-3`) and Reverse Primer (RV2) (5`-ATT TTA CAC CAA CCC CCA GTT-. 3`) (Lachaud et al., 2002; Reale et al., 1999),. C. Forward Primer (T2) (5`-CGG CTT CGC ...

  20. Health economic assessment: a methodological primer.

    Science.gov (United States)

    Simoens, Steven

    2009-12-01

    This review article aims to provide an introduction to the methodology of health economic assessment of a health technology. Attention is paid to defining the fundamental concepts and terms that are relevant to health economic assessments. The article describes the methodology underlying a cost study (identification, measurement and valuation of resource use, calculation of costs), an economic evaluation (type of economic evaluation, the cost-effectiveness plane, trial- and model-based economic evaluation, discounting, sensitivity analysis, incremental analysis), and a budget impact analysis. Key references are provided for those readers who wish a more advanced understanding of health economic assessments.