An iterative method for selecting degenerate multiplex PCR primers.
Souvenir, Richard; Buhler, Jeremy; Stormo, Gary; Zhang, Weixiong
2007-01-01
Single-nucleotide polymorphism (SNP) genotyping is an important molecular genetics process, which can produce results that will be useful in the medical field. Because of inherent complexities in DNA manipulation and analysis, many different methods have been proposed for a standard assay. One of the proposed techniques for performing SNP genotyping requires amplifying regions of DNA surrounding a large number of SNP loci. To automate a portion of this particular method, it is necessary to select a set of primers for the experiment. Selecting these primers can be formulated as the Multiple Degenerate Primer Design (MDPD) problem. The Multiple, Iterative Primer Selector (MIPS) is an iterative beam-search algorithm for MDPD. Theoretical and experimental analyses show that this algorithm performs well compared with the limits of degenerate primer design. Furthermore, MIPS outperforms an existing algorithm that was designed for a related degenerate primer selection problem.
Directory of Open Access Journals (Sweden)
Li Kelvin
2012-11-01
Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus
Directory of Open Access Journals (Sweden)
Christopher A Gulvik
Full Text Available Development and use of primer sets to amplify nucleic acid sequences of interest is fundamental to studies spanning many life science disciplines. As such, the validation of primer sets is essential. Several computer programs have been created to aid in the initial selection of primer sequences that may or may not require multiple nucleotide combinations (i.e., degeneracies. Conversely, validation of primer specificity has remained largely unchanged for several decades, and there are currently few available programs that allows for an evaluation of primers containing degenerate nucleotide bases. To alleviate this gap, we developed the program De-MetaST that performs an in silico amplification using user defined nucleotide sequence dataset(s and primer sequences that may contain degenerate bases. The program returns an output file that contains the in silico amplicons. When De-MetaST is paired with NCBI's BLAST (De-MetaST-BLAST, the program also returns the top 10 nr NCBI database hits for each recovered in silico amplicon. While the original motivation for development of this search tool was degenerate primer validation using the wealth of nucleotide sequences available in environmental metagenome and metatranscriptome databases, this search tool has potential utility in many data mining applications.
Garcillán-Barcia, M Pilar; Ruiz del Castillo, Belén; Alvarado, Andrés; de la Cruz, Fernando; Martínez-Martínez, Luis
2015-01-01
Degenerate Primer MOB Typing is a PCR-based protocol for the classification of γ-proteobacterial transmissible plasmids in five phylogenetic relaxase MOB families. It was applied to a multiresistant E. coli collection, previously characterized by PCR-based replicon-typing, in order to compare both methods. Plasmids from 32 clinical isolates of multiresistant E. coli (19 extended spectrum beta-lactamase producers and 13 non producers) and their transconjugants were analyzed. A total of 95 relaxases were detected, at least one per isolate, underscoring the high potential of these strains for antibiotic-resistance transmission. MOBP12 and MOBF12 plasmids were the most abundant. Most MOB subfamilies detected were present in both subsets of the collection, indicating a shared mobilome among multiresistant E. coli. The plasmid profile obtained by both methods was compared, which provided useful data upon which decisions related to the implementation of detection methods in the clinic could be based. The phylogenetic depth at which replicon and MOB-typing classify plasmids is different. While replicon-typing aims at plasmid replication regions with non-degenerate primers, MOB-typing classifies plasmids into relaxase subfamilies using degenerate primers. As a result, MOB-typing provides a deeper phylogenetic depth than replicon-typing and new plasmid groups are uncovered. Significantly, MOB typing identified 17 plasmids and an integrative and conjugative element, which were not detected by replicon-typing. Four of these backbones were different from previously reported elements. Copyright © 2014 Elsevier Inc. All rights reserved.
Grushetskaia, Z E; Lemesh, V A; Khotyleva, L V
2010-01-01
Cellulose synthase catalytic subunit genes, CesA, have been discovered in several higher plant species, and it has been shown that the CesA gene family has multiple members. HVR2 fragment of these genes determine the class specificity of the CESA protein and its participation in the primary or secondary cell wall synthesis. The aim of this study was development of specific and degenerated primers to flax CesA gene fragments leading to obtaining the class specific HVR2 region of the gene. Two pairs of specific primers to the certain fragments of CesA-1 and CesA-6 genes and one pair of degenerated primers to HVR2 region of all flax CesA genes were developed basing on comparison of six CesA EST sequences of flax and full cDNA sequences of Arabidopsis, poplar, maize and cotton plants, obtained from GenBank. After amplification of flax cDNA, the bands of expected size were detected (201 and 300 b.p. for the CesA-1 and CesA-6, and 600 b.p. for the HVR2 region of CesA respectively). The developed markers can be used for cloning and sequencing of flax CesA genes, identifying their number in flax genome, tissue and stage specificity.
Directory of Open Access Journals (Sweden)
Andrés Alvarado
Full Text Available Transmissible plasmids are responsible for the spread of genetic determinants, such as antibiotic resistance or virulence traits, causing a large ecological and epidemiological impact. Transmissible plasmids, either conjugative or mobilizable, have in common the presence of a relaxase gene. Relaxases were previously classified in six protein families according to their phylogeny. Degenerate primers hybridizing to coding sequences of conserved amino acid motifs were designed to amplify related relaxase genes from γ-Proteobacterial plasmids. Specificity and sensitivity of a selected set of 19 primer pairs were first tested using a collection of 33 reference relaxases, representing the diversity of γ-Proteobacterial plasmids. The validated set was then applied to the analysis of two plasmid collections obtained from clinical isolates. The relaxase screening method, which we call "Degenerate Primer MOB Typing" or DPMT, detected not only most known Inc/Rep groups, but also a plethora of plasmids not previously assigned to any Inc group or Rep-type.
Desingu, P A; Singh, S D; Dhama, K; Kumar, O R Vinodh; Singh, R; Singh, R K
2015-02-01
A rapid and accurate method of detection and differentiation of virulent and avirulent Newcastle disease virus (NDV) pathotypes was developed. The NDV detection was carried out for different domestic avian field isolates and pigeon paramyxo virus-1 (25 field isolates and 9 vaccine strains) by using APMV-I "fusion" (F) gene Class II specific external primer A and B (535bp), internal primer C and D (238bp) based reverses transcriptase PCR (RT-PCR). The internal degenerative reverse primer D is specific for F gene cleavage position of virulent strain of NDV. The nested RT-PCR products of avirulent strains showed two bands (535bp and 424bp) while virulent strains showed four bands (535bp, 424bp, 349bp and 238bp) on agar gel electrophoresis. This is the first report regarding development and use of degenerate primer based nested RT-PCR for accurate detection and differentiation of NDV pathotypes by demonstrating multiple PCR band patterns. Being a rapid, simple, and economical test, the developed method could serve as a valuable alternate diagnostic tool for characterizing NDV isolates and carrying out molecular epidemiological surveillance studies for this important pathogen of poultry. Copyright © 2014 Elsevier B.V. All rights reserved.
Digiaro, Michele; Elbeaino, Toufic; Martelli, Giovanni Paolo
2007-04-01
Based on the nucleotide sequence homology of RNA-1 and RNA-2 of nepoviruses isolated from grapevines, three sets of degenerate primers, one for each of the three subgroups of the genus (A, B and C), were designed and proved effective for RT-PCR detection of subgroups in infected grapevines and herbaceous hosts. Primers designed specifically for detecting subgroup A species amplified a fragment of 255 bp from samples infected by Grapevine fanleaf virus (GFLV), Arabis mosaic virus (ArMV), Tobacco ringspot virus (TRSV) and Grapevine deformation virus (GDefV), but not from samples infected by other nepovirus species. Similarly, primers for detection of subgroup B nepoviruses amplified a 390 bp product from samples infected by Grapevine chrome mosaic virus (GCMV), Tomato black ring virus (TBRV), Grapevine Anatolian ringspot virus (GARSV) and Artichoke Italian latent virus (AILV). The third set of primers amplified a 640 bp fragment, only from samples infected by subgroup C nepoviruses, i.e Tomato ringspot virus (ToRSV) Grapevine Bulgarian latent virus (GBLV), and Grapevine Tunisian ringspot virus (GTRSV). These primers were able to detect simultaneously all viral species belonging to the same subgroup and to discriminate species of different subgroups. Multiplex-PCR detection of subgroup A and B nepoviruses was obtained using a specific primer (sense for subgroup A and antisense for subgroup B) for each of the species of the same subgroup in combination with the degenerate subgroup-specific primers. In this way it was possible to detect four different viral species in single samples containing mixtures of viruses of the same subgroup. In particular, for viruses of subgroup A (TRSV, GFLV, ArMV and GDefV) amplicons of 190, 259, 301 and 371 bp were obtained, whereas amplicons of 190, 278, 425 and 485 bp, respectively, were obtained from samples infected with viruses of subgroup B (GCMV, AILV, GARSV and TBRV).
MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling
Directory of Open Access Journals (Sweden)
Kitchen James L
2012-11-01
Full Text Available Abstract Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.
MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.
Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G
2012-11-05
Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.
Suin, Vanessa; Nazé, Florence; Francart, Aurélie; Lamoral, Sophie; De Craeye, Stéphane; Kalai, Michael; Van Gucht, Steven
2014-01-01
A generic two-step lyssavirus real-time reverse transcriptase polymerase chain reaction (qRT-PCR), based on a nested PCR strategy, was validated for the detection of different lyssavirus species. Primers with 17 to 30% of degenerate bases were used in both consecutive steps. The assay could accurately detect RABV, LBV, MOKV, DUVV, EBLV-1, EBLV-2, and ABLV. In silico sequence alignment showed a functional match with the remaining lyssavirus species. The diagnostic specificity was 100% and the sensitivity proved to be superior to that of the fluorescent antigen test. The limit of detection was ≤ 1 50% tissue culture infectious dose. The related vesicular stomatitis virus was not recognized, confirming the selectivity for lyssaviruses. The assay was applied to follow the evolution of rabies virus infection in the brain of mice from 0 to 10 days after intranasal inoculation. The obtained RNA curve corresponded well with the curves obtained by a one-step monospecific RABV-qRT-PCR, the fluorescent antigen test, and virus titration. Despite the presence of degenerate bases, the assay proved to be highly sensitive, specific, and reproducible.
Directory of Open Access Journals (Sweden)
Vanessa Suin
2014-01-01
Full Text Available A generic two-step lyssavirus real-time reverse transcriptase polymerase chain reaction (qRT-PCR, based on a nested PCR strategy, was validated for the detection of different lyssavirus species. Primers with 17 to 30% of degenerate bases were used in both consecutive steps. The assay could accurately detect RABV, LBV, MOKV, DUVV, EBLV-1, EBLV-2, and ABLV. In silico sequence alignment showed a functional match with the remaining lyssavirus species. The diagnostic specificity was 100% and the sensitivity proved to be superior to that of the fluorescent antigen test. The limit of detection was ≤1 50% tissue culture infectious dose. The related vesicular stomatitis virus was not recognized, confirming the selectivity for lyssaviruses. The assay was applied to follow the evolution of rabies virus infection in the brain of mice from 0 to 10 days after intranasal inoculation. The obtained RNA curve corresponded well with the curves obtained by a one-step monospecific RABV-qRT-PCR, the fluorescent antigen test, and virus titration. Despite the presence of degenerate bases, the assay proved to be highly sensitive, specific, and reproducible.
Shen, K A; Meyers, B C; Islam-Faridi, M N; Chin, D B; Stelly, D M; Michelmore, R W
1998-08-01
The recent cloning of genes for resistance against diverse pathogens from a variety of plants has revealed that many share conserved sequence motifs. This provides the possibility of isolating numerous additional resistance genes by polymerase chain reaction (PCR) with degenerate oligonucleotide primers. We amplified resistance gene candidates (RGCs) from lettuce with multiple combinations of primers with low degeneracy designed from motifs in the nucleotide binding sites (NBSs) of RPS2 of Arabidopsis thaliana and N of tobacco. Genomic DNA, cDNA, and bacterial artificial chromosome (BAC) clones were successfully used as templates. Four families of sequences were identified that had the same similarity to each other as to resistance genes from other species. The relationship of the amplified products to resistance genes was evaluated by several sequence and genetic criteria. The amplified products contained open reading frames with additional sequences characteristic of NBSs. Hybridization of RGCs to genomic DNA and to BAC clones revealed large numbers of related sequences. Genetic analysis demonstrated the existence of clustered multigene families for each of the four RGC sequences. This parallels classical genetic data on clustering of disease resistance genes. Two of the four families mapped to known clusters of resistance genes; these two families were therefore studied in greater detail. Additional evidence that these RGCs could be resistance genes was gained by the identification of leucine-rich repeat (LRR) regions in sequences adjoining the NBS similar to those in RPM1 and RPS2 of A. thaliana. Fluorescent in situ hybridization confirmed the clustered genomic distribution of these sequences. The use of PCR with degenerate oligonucleotide primers is therefore an efficient method to identify numerous RGCs in plants.
UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes
Directory of Open Access Journals (Sweden)
Nomin Batnyam
2012-01-01
Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.
Shimomura, Yumi; Morimoto, Sho; Hoshino, Yuko Takada; Uchida, Yoshitaka; Akiyama, Hiroko; Hayatsu, Masahito
2012-01-01
Ammonia monooxygenase subunit A gene (amoA) is frequently used as a functional gene marker for diversity analysis of ammonia-oxidizing bacteria (AOB). To select a suitable amoA primer for real-time PCR and PCR-denaturing gradient gel electrophoresis (DGGE), three reverse primers (degenerate primer amoA-2R; non-degenerate primers amoA-2R-GG and amoA-2IR) were examined. No significant differences were observed among the three primers in terms of quantitative values of amoA from environmental samples using real-time PCR. We found that PCR-DGGE analysis with the amoA-2IR primer gave the best results in this studied soil. These results indicate that amoA-2IR is a suitable primer for community analysis of AOB in the environment. PMID:22075625
MethPrimer: designing primers for methylation PCRs.
Li, Long-Cheng; Dahiya, Rajvir
2002-11-01
DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.
Primer sets for cloning the human repertoire of T cell Receptor Variable regions.
Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele
2008-08-29
Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.
Disclosing bias in bisulfite assay: MethPrimers underestimate high DNA methylation.
Directory of Open Access Journals (Sweden)
Andrea Fuso
Full Text Available Discordant results obtained in bisulfite assays using MethPrimers (PCR primers designed using MethPrimer software or assuming that non-CpGs cytosines are non methylated versus primers insensitive to cytosine methylation lead us to hypothesize a technical bias. We therefore used the two kinds of primers to study different experimental models and methylation statuses. We demonstrated that MethPrimers negatively select hypermethylated DNA sequences in the PCR step of the bisulfite assay, resulting in CpG methylation underestimation and non-CpG methylation masking, failing to evidence differential methylation statuses. We also describe the characteristics of "Methylation-Insensitive Primers" (MIPs, having degenerated bases (G/A to cope with the uncertain C/U conversion. As CpG and non-CpG DNA methylation patterns are largely variable depending on the species, developmental stage, tissue and cell type, a variable extent of the bias is expected. The more the methylome is methylated, the greater is the extent of the bias, with a prevalent effect of non-CpG methylation. These findings suggest a revision of several DNA methylation patterns so far documented and also point out the necessity of applying unbiased analyses to the increasing number of epigenomic studies.
Cheng, Yu-Huei
2014-12-01
Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.
Primer sets for cloning the human repertoire of T cell Receptor Variable regions
Directory of Open Access Journals (Sweden)
Santoro Claudio
2008-08-01
Full Text Available Abstract Background Amplification and cloning of naïve T cell Receptor (TR repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Results Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT®, the ImMunoGeneTics information system®. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. Conclusion This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.
Directory of Open Access Journals (Sweden)
Wang Zhen
2011-11-01
Full Text Available Abstract Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs. These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures.
Universal primers that amplify RNA from all three flavivirus subgroups
Directory of Open Access Journals (Sweden)
Barnard Ross T
2008-01-01
Full Text Available Abstract Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5 coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers.
Identification of degenerate nuclei and development of a SCAR marker for Flammulina velutipes.
Directory of Open Access Journals (Sweden)
Sun Young Kim
Full Text Available Flammulina velutipes is one of the major edible mushrooms in the world. Recently, abnormalities that have a negative impact on crop production have been reported in this mushroom. These symptoms include slow vegetative growth, a compact mycelial mat, and few or even no fruiting bodies. The morphologies and fruiting capabilities of monokaryons of wild-type and degenerate strains that arose through arthrospore formation were investigated through test crossing. Only one monokaryotic group of the degenerate strains and its hybrid strains showed abnormal phenotypes. Because the monokaryotic arthrospore has the same nucleus as the parent strain, these results indicated that only one aberrant nucleus of the two nuclei in the degenerate strain was responsible for the degeneracy. A sequence-characterized amplified region marker that is linked to the degenerate monokaryon was identified based on a polymorphic sequence that was generated using random primers. Comparative analyses revealed the presence of a degenerate-specific genomic region in a telomere, which arose via the transfer of a genomic fragment harboring a putative helicase gene. Our findings have narrowed down the potential molecular targets responsible for this phenotype for future studies and have provided a marker for the detection of degenerate strains.
VizPrimer: a web server for visualized PCR primer design based on known gene structure.
Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang
2011-12-15
The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.
Primer3_masker: integrating masking of template sequence with primer design software.
Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido
2018-06-01
Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.
Sequence diversity in haloalkane dehalogenases, as revealed by PCR using family-specific primers
Czech Academy of Sciences Publication Activity Database
Kotík, Michael; Faměrová, Veronika
2012-01-01
Roč. 88, č. 2 (2012), s. 212-217 ISSN 0167-7012 R&D Projects: GA ČR GAP504/10/0137; GA ČR GAP207/10/0135 Institutional research plan: CEZ:AV0Z50200510 Keywords : Dehalogenation * Consensus sequence * Degenerate PCR primer Subject RIV: EE - Microbiology, Virology Impact factor: 2.161, year: 2012
Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.
Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong
2014-08-01
The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. Copyright © 2014 Elsevier Ltd. All rights reserved.
Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.
Yofe, Ido; Schuldiner, Maya
2014-02-01
The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.
A primer on polymer nomenclature: Structure-based, sourced-based and trade names
Polymer nomenclature is important because it is part of the language of polymer science and is needed for polymer identification, reference, and documentation. A primer on polymer nomenclature is provided herein for people new to the field or for instructional use. Both structure-based and source-...
PRIMEGENSw3: a web-based tool for high-throughput primer and probe design.
Kushwaha, Garima; Srivastava, Gyan Prakash; Xu, Dong
2015-01-01
Highly specific and efficient primer and probe design has been a major hurdle in many high-throughput techniques. Successful implementation of any PCR or probe hybridization technique depends on the quality of primers and probes used in terms of their specificity and cross-hybridization. Here we describe PRIMEGENSw3, a set of web-based utilities for high-throughput primer and probe design. These utilities allow users to select genomic regions and to design primer/probe for selected regions in an interactive, user-friendly, and automatic fashion. The system runs the PRIMEGENS algorithm in the back-end on the high-performance server with the stored genomic database or user-provided custom database for cross-hybridization check. Cross-hybridization is checked not only using BLAST but also by checking mismatch positions and energy calculation of potential hybridization hits. The results can be visualized online and also can be downloaded. The average success rate of primer design using PRIMEGENSw3 is ~90 %. The web server also supports primer design for methylated sequences, which is used in epigenetic studies. Stand-alone version of the software is also available for download at the website.
Directory of Open Access Journals (Sweden)
Laura Audrey Hug
2013-11-01
Full Text Available Reductive dehalogenases are the critical enzymes for anaerobic organohalide respiration, a microbial metabolic process that has been harnessed for bioremediation efforts to resolve chlorinated solvent contamination in groundwater and is implicated in the global halogen cycle. Reductive dehalogenase sequence diversity is informative for the dechlorination potential of the site or enrichment culture. A suite of degenerate PCR primers targeting a comprehensive curated set of reductive dehalogenase genes was designed and applied to twelve DNA samples extracted from contaminated and pristine sites, as well as six enrichment cultures capable of reducing chlorinated compounds to non-toxic end-products. The amplified gene products from four environmental sites and two enrichment cultures were sequenced using Illumina HiSeq, and the reductive dehalogenase complement of each sample determined. The results indicate that the diversity of the reductive dehalogenase gene family is much deeper than is currently accounted for: one-third of the translated proteins have less than 70% pairwise amino acid identity to database sequences. Approximately 60% of the sequenced reductive dehalogenase genes were broadly distributed, being identified in four or more samples, and often in previously sequenced genomes as well. In contrast, 17% of the sequenced reductive dehalogenases were unique, present in only a single sample and bearing less than 90% pairwise amino acid identity to any previously identified proteins. Many of the broadly distributed reductive dehalogenases are uncharacterized in terms of their substrate specificity, making these intriguing targets for further biochemical experimentation. Finally, comparison of samples from a contaminated site and an enrichment culture derived from the same site eight years prior allowed examination of the effect of the enrichment process.
Engqvist, Martin K M; Nielsen, Jens
2015-08-21
The Ambiguous Nucleotide Tool (ANT) is a desktop application that generates and evaluates degenerate codons. Degenerate codons are used to represent DNA positions that have multiple possible nucleotide alternatives. This is useful for protein engineering and directed evolution, where primers specified with degenerate codons are used as a basis for generating libraries of protein sequences. ANT is intuitive and can be used in a graphical user interface or by interacting with the code through a defined application programming interface. ANT comes with full support for nonstandard, user-defined, or expanded genetic codes (translation tables), which is important because synthetic biology is being applied to an ever widening range of natural and engineered organisms. The Python source code for ANT is freely distributed so that it may be used without restriction, modified, and incorporated in other software or custom data pipelines.
International Nuclear Information System (INIS)
Zhan Fangfang; Zhou Xiaoming; Xing Da
2013-01-01
Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs–TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: ► A novel method for detection of rotavirus has been developed. ► In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. ► To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. ► The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2′-bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs–TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection. In this study, rotavirus in fecal specimens was successfully detected within 1.5 h. Experimental
A web-based adaptive tutor to teach PCR primer design
van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.
2012-01-01
When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used
A Web-based Adaptive Tutor to Teach PCR Primer Design
Seters, van J.R.; Wellink, J.; Tramper, J.; Goedhart, M.J.; Ossevoort, M.A.
2012-01-01
When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used
Energy Technology Data Exchange (ETDEWEB)
Zhan Fangfang; Zhou Xiaoming [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China); Xing Da, E-mail: xingda@scnu.edu.cn [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China)
2013-01-25
Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs-TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: Black-Right-Pointing-Pointer A novel method for detection of rotavirus has been developed. Black-Right-Pointing-Pointer In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. Black-Right-Pointing-Pointer To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. Black-Right-Pointing-Pointer The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2 Prime -bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs-TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection
High-speed measurement of firearm primer blast waves
Courtney, Michael; Daviscourt, Joshua; Eng, Jonathan; Courtney, Amy
2012-01-01
This article describes a method and results for direct high-speed measurements of firearm primer blast waves employing a high-speed pressure transducer located at the muzzle to record the blast pressure wave produced by primer ignition. Key findings are: 1) Most of the lead styphnate based primer models tested show 5.2-11.3% standard deviation in the magnitudes of their peak pressure. 2) In contrast, lead-free diazodinitrophenol (DDNP) based primers had standard deviations of the peak blast p...
Value-based medicine and interventions for macular degeneration.
Brown, Melissa M; Brown, Gary C; Brown, Heidi
2007-05-01
The aim of this article is to review the patient value conferred by interventions for neovascular macular degeneration. Value-based medicine is the practice of medicine based upon the patient value (improvement in quality of life and length of life) conferred by an intervention. For ophthalmologic interventions, in which length-of-life is generally unaffected, the value gain is equivalent to the improvement in quality of life. Photodynamic therapy delivers a value gain (improvement in quality of life) of 8.1% for the average person with classic subfoveal choroidal neovascularization, while laser photocoagulation for the same entity confers a 4.4% improvement in quality of life. Preliminary data suggest the value gain for the treatment of occult/minimally classic choroidal neovascularization with ranibizumab is greater than 15%. The average value gain for statins for the treatment of hyperlipidemia is 3.9%, while that for the use of biphosphonates for the treatment of osteoporosis is 1.1% and that for drugs to treat benign prostatic hyperplasia is 1-2%. Interventions, especially ranibizumab therapy, for neovascular macular degeneration appear to deliver an extraordinary degree of value compared with many other interventions across healthcare.
A Web-Based Adaptive Tutor to Teach PCR Primer Design
van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.
2012-01-01
When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used part of the Taxonomy of Educational Objectives (the…
DEFF Research Database (Denmark)
Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus
2005-01-01
A novel single-base extension (SBE) assay using cleavable and noncleavable SBE primers in the same reaction mix is described. The cleavable SBE primers consisted of deoxyribonucleotides and one ribonucleotide (hereafter denoted chimeric primers), whereas the noncleavable SBE primers consisted....... A ribonuclease mix was developed to specifically cleave the chimeric primers, irrespective of the base of the ribonucleotide, whereas standard primers without a ribonucleotide were unaffected by the ribonuclease treatment. The SBE products were analyzed in linear mode using a matrix-assisted laser desorption...... containing 9 chimeric primers and 8 standard primers....
Magnesium-Based Sacrificial Anode Cathodic Protection Coatings (Mg-Rich Primers for Aluminum Alloys
Directory of Open Access Journals (Sweden)
Michael D. Blanton
2012-09-01
Full Text Available Magnesium is electrochemically the most active metal employed in common structural alloys of iron and aluminum. Mg is widely used as a sacrificial anode to provide cathodic protection of underground and undersea metallic structures, ships, submarines, bridges, decks, aircraft and ground transportation systems. Following the same principle of utilizing Mg characteristics in engineering advantages in a decade-long successful R&D effort, Mg powder is now employed in organic coatings (termed as Mg-rich primers as a sacrificial anode pigment to protect aerospace grade aluminum alloys against corrosion. Mg-rich primers have performed very well on aluminum alloys when compared against the current chromate standard, but the carcinogenic chromate-based coatings/pretreatments are being widely used by the Department of Defense (DoD to protect its infrastructure and fleets against corrosion damage. Factors such as reactivity of Mg particles in the coating matrix during exposure to aggressive corrosion environments, interaction of atmospheric gases with Mg particles and the impact of Mg dissolution, increases in pH and hydrogen gas liberation at coating-metal interface, and primer adhesion need to be considered for further development of Mg-rich primer technology.
CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.
Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei
2015-07-01
The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.
[Pharmacological therapy of age-related macular degeneration based on etiopathogenesis].
Fischer, Tamás
2015-11-15
It is of great therapeutic significance that disordered function of the vascular endothelium which supply the affected ocular structures plays a major role in the pathogenesis and development of age-related macular degeneration. Chronic inflammation is closely linked to diseases associated with endothelial dysfunction, and age-related macular degeneration is accompanied by a general inflammatory response. According to current concept, age-related macular degeneration is a local manifestation of systemic vascular disease. This recognition could have therapeutic implications because restoration of endothelial dysfunction can restabilize the condition of chronic vascular disease including age-related macular degeneration as well. Restoration of endothelial dysfunction by pharmaacological or non pharmacological interventions may prevent the development or improve endothelial dysfunction, which result in prevention or improvement of age related macular degeneration as well. Medicines including inhibitors of the renin-angiotensin system (converting enzyme inhibitors, angiotensin-receptor blockers and renin inhibitors), statins, acetylsalicylic acid, trimetazidin, third generation beta-blockers, peroxisome proliferator-activated receptor gamma agonists, folate, vitamin D, melatonin, advanced glycation end-product crosslink breaker alagebrium, endothelin-receptor antagonist bosentan, coenzyme Q10; "causal" antioxidant vitamins, N-acetyl-cysteine, resveratrol, L-arginine, serotonin receptor agonists, tumor necrosis factor-alpha blockers, specific inhibitor of the complement alternative pathway, curcumin and doxycyclin all have beneficial effects on endothelial dysfunction. Restoration of endothelial dysfunction can restabilize chronic vascular disease including age-related macular degeneration as well. Considering that the human vascular system is consubstantial, medicines listed above should be given to patients (1) who have no macular degeneration but have risk factors
Energy Technology Data Exchange (ETDEWEB)
Ni, Chun Chun
2009-11-16
Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.
DEFF Research Database (Denmark)
Pu, Minhao; Hu, Hao; Ji, Hua
2012-01-01
We experimentally demonstrate broadband polarization-insensitive one-to-two wavelength conversion of a 10-Gb/s DPSK data signal based on non-degenerate four-wave mixing in a silicon nanowire with bit-error rate measurements.......We experimentally demonstrate broadband polarization-insensitive one-to-two wavelength conversion of a 10-Gb/s DPSK data signal based on non-degenerate four-wave mixing in a silicon nanowire with bit-error rate measurements....
DEFF Research Database (Denmark)
Huang, Yili; Zeng, Yanhua; Lu, Hang
2016-01-01
Seq sequencing of the 16S rRNA, pufM, and bchY genes was carried out to assess the diversity of local phototrophic communities. In addition, we designed new degenerate primers of aerobic cyclase gene acsF, which serves as a convenient marker for both phototrophic Gemmatimonadetes and phototrophic Proteobacteria...... a diverse community of phototrophic Gemmatimonadetes forming 30 operational taxonomic units. These species represented 10.5 and 17.3% of the acsF reads in the upper semiaerobic sediment and anoxic sediment, whereas their abundance in the water column was ... fundamental biological processes on Earth. Recently, the presence of photosynthetic reaction centers has been reported from a rarely studied bacterial phylum, Gemmatimonadetes, but almost nothing is known about the diversity and environmental distribution of these organisms. The newly designed acsF primers...
Asari, Masaru; Okuda, Katsuhiro; Hoshina, Chisato; Omura, Tomohiro; Tasaki, Yoshikazu; Shiono, Hiroshi; Matsubara, Kazuo; Shimizu, Keiko
2016-02-01
The aim of this study was to develop a cost-effective genotyping method using high-quality DNA for human identification. A total of 21 short tandem repeats (STRs) and amelogenin were selected, and fluorescent fragments at 22 loci were simultaneously amplified in a single-tube reaction using locus-specific primers with 24-base universal tails and four fluorescent universal primers. Several nucleotide substitutions in universal tails and fluorescent universal primers enabled the detection of specific fluorescent fragments from the 22 loci. Multiplex polymerase chain reaction (PCR) produced intense FAM-, VIC-, NED-, and PET-labeled fragments ranging from 90 to 400 bp, and these fragments were discriminated using standard capillary electrophoretic analysis. The selected 22 loci were also analyzed using two commercial kits (the AmpFLSTR Identifiler Kit and the PowerPlex ESX 17 System), and results for two loci (D19S433 and D16S539) were discordant between these kits due to mutations at the primer binding sites. All genotypes from the 100 samples were determined using 2.5 ng of DNA by our method, and the expected alleles were completely recovered. Multiplex 22-locus genotyping using four fluorescent universal primers effectively reduces the costs to less than 20% of genotyping using commercial kits, and our method would be useful to detect silent alleles from commercial kit analysis. Copyright © 2015 Elsevier Inc. All rights reserved.
Optimization Of ISSR Markers For DNA Fingerprinting In Stevia Rebaudiana Bertoni
International Nuclear Information System (INIS)
Lyena Watty Zuraine Ahmad; Lyena Watty Zuraine Ahmad; Azhar Mohamad; Mohamad Osman; Zarina Zainuddin; Fatin Izzati Mohd Khari
2014-01-01
ISSR or inter-simple sequence repeat is PCR based markers which required no prior DNA sequence knowledge of the studied organism. It has been proved to overcome limitations in other genetic marker techniques. In this study, 100 ISSR primers which comprised of 80 specific primers and 20 degenerate primers were used. All of the primers were tested on gradient temperatures from 45-55 degree Celsius. For positive amplification, 62 specific primers (77.5 %) and 18 degenerate primers (90.0 %) were recorded as working primers. The most efficient temperature for 25 primers was 55 degree Celsius. Marker derived from ISSR profiling is a powerful approach for identification and molecular classification of Stevia rebaudiana bertoni. (author)
Simple sequence repeat marker loci discovery using SSR primer.
Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David
2004-06-12
Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/
Burns, Cara C; Kilpatrick, David R; Iber, Jane C; Chen, Qi; Kew, Olen M
2016-01-01
Virologic surveillance is essential to the success of the World Health Organization initiative to eradicate poliomyelitis. Molecular methods have been used to detect polioviruses in tissue culture isolates derived from stool samples obtained through surveillance for acute flaccid paralysis. This chapter describes the use of realtime PCR assays to identify and serotype polioviruses. In particular, a degenerate, inosine-containing, panpoliovirus (panPV) PCR primer set is used to distinguish polioviruses from NPEVs. The high degree of nucleotide sequence diversity among polioviruses presents a challenge to the systematic design of nucleic acid-based reagents. To accommodate the wide variability and rapid evolution of poliovirus genomes, degenerate codon positions on the template were matched to mixed-base or deoxyinosine residues on both the primers and the TaqMan™ probes. Additional assays distinguish between Sabin vaccine strains and non-Sabin strains. This chapter also describes the use of generic poliovirus specific primers, along with degenerate and inosine-containing primers, for routine VP1 sequencing of poliovirus isolates. These primers, along with nondegenerate serotype-specific Sabin primers, can also be used to sequence individual polioviruses in mixtures.
A simple RT-PCR-based strategy for screening connexin identity
Directory of Open Access Journals (Sweden)
M. Urban
1999-08-01
Full Text Available Vertebrate gap junctions are aggregates of transmembrane channels which are composed of connexin (Cx proteins encoded by at least fourteen distinct genes in mammals. Since the same Cx type can be expressed in different tissues and more than one Cx type can be expressed by the same cell, the thorough identification of which connexin is in which cell type and how connexin expression changes after experimental manipulation has become quite laborious. Here we describe an efficient, rapid and simple method by which connexin type(s can be identified in mammalian tissue and cultured cells using endonuclease cleavage of RT-PCR products generated from "multi primers" (sense primer, degenerate oligonucleotide corresponding to a region of the first extracellular domain; antisense primer, degenerate oligonucleotide complementary to the second extracellular domain that amplify the cytoplasmic loop regions of all known connexins except Cx36. In addition, we provide sequence information on RT-PCR primers used in our laboratory to screen individual connexins and predictions of extension of the "multi primer" method to several human connexins.
KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz
International Nuclear Information System (INIS)
Bowman, Stephen M.
2008-01-01
The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of
A value-based medicine comparison of interventions for subfoveal neovascular macular degeneration.
Brown, Gary C; Brown, Melissa M; Brown, Heidi C; Kindermann, Sylvia; Sharma, Sanjay
2007-06-01
To perform a value-based medicine analysis of clinical trials that evaluate the interventions of laser photocoagulation, intravitreal pegaptanib therapy, and photodynamic therapy (PDT) with verteporfin for the treatment of classic subfoveal choroidal neovascularization. Reference case cost-utility analysis using value-based medicine principles, which use patient-based utility values and standardized, input variable criteria. Data from participants in the Macular Photocoagulation Study, Pegaptanib for Neovascular Age-Related Macular Degeneration Study, and the Treatment of Age-Related Macular Degeneration with Photodynamic Therapy Study. Visual data were converted to a value-based format using time tradeoff utility analysis values from patients with macular degeneration. Costs were obtained from 2005 Medicare data. Outcomes (quality-adjusted life-years [QALYs]) and costs were discounted at a 3% annual rate. Interventional QALYs gained, percent improvement in quality of life, and dollars spent per QALY gained. Laser photocoagulation confers a 4.4% (P = 0.03 versus pegaptanib therapy) improvement in quality of life for the reference case, whereas pegaptanib therapy confers a 5.9% improvement and PDT confers an 8.1% (P = 0.0002 versus pegaptanib therapy) improvement. The cost-utility associated with laser photocoagulation is $8179, that for pegaptanib therapy is $66978, and that for PDT is $31544. All sensitivity analyses remain within the conventional standards of cost-effectiveness. Photodynamic therapy confers greater patient value than intravitreal pegaptanib therapy and laser photocoagulation for the treatment of classic subfoveal choroidal neovascularization. Despite the fact that laser photocoagulation is the most cost-effective intervention, both PDT and pegaptanib therapy deliver greater value, and thus are both preferred over laser photocoagulation. Using an economic measure, photodynamic therapy is the preferred treatment among these 3 interventions.
Directory of Open Access Journals (Sweden)
Firuzbakht MM
2011-04-01
Full Text Available "nBackground and Aims: The aim of this study was to evaluate the effect of application of two types of primers over bracket bases on the shear bond strength (SBS and mode of bond failure."nMaterials and Methods: In this study, 75 human premolar teeth were divided into three equal groups. In group 1 (control, after surface preparation of enamel by conventional method (acid etching+primer brackets were bonded with Transbond XT composite. In group 2 (TX, brackets were bonded to enamel same as the first group but Transbond XT primer were used on bracket bases before placement of composite. In group 3 (PL, Transbond plus primer was applied on bracket bases before placement of composite. After 24 h, the SBS test was performed by universal testing machine at crosshead speed of 0.5 mm/min. Then, adhesive remnant index (ARI scores and percentage of cohesive fracture were determined using stereomicroscopy. SBS data were analyzed by one-way ANOVA and Duncan tests. Kruskal-Wallis and Mann-Whitney tests were used to analyze ARI and cohesive fracture results."nResults: There was significant difference in SBS values among the groups (P<0.001. The highest SBS was shown in TX group and the lowest was seen in PL group. There was no significant difference between control and TX groups in ARI scores (P=0.199. No significant difference was found in cohesive fracture values between the groups (P=0.093. Both the control and TX groups showed significant difference in ARI scores and cohesive fracture compared with the PL group in all of the comparisons (P<0.001."nConclusion: Application of Transbond XT primer over bracket base affects the bond strength and failure mode. Transbond XT primer increased the bond strength but Transbond plus primer decreased it.
Polyacid macromolecule primers
Sugama, Toshifumi.
1989-12-26
Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.
MPprimer: a program for reliable multiplex PCR primer design
Directory of Open Access Journals (Sweden)
Wang Xiaolei
2010-03-01
Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.
Aag-initiated base excision repair drives alkylation-induced retinal degeneration in mice.
Meira, Lisiane B; Moroski-Erkul, Catherine A; Green, Stephanie L; Calvo, Jennifer A; Bronson, Roderick T; Shah, Dharini; Samson, Leona D
2009-01-20
Vision loss affects >3 million Americans and many more people worldwide. Although predisposing genes have been identified their link to known environmental factors is unclear. In wild-type animals DNA alkylating agents induce photoreceptor apoptosis and severe retinal degeneration. Alkylation-induced retinal degeneration is totally suppressed in the absence of the DNA repair protein alkyladenine DNA glycosylase (Aag) in both differentiating and postmitotic retinas. Moreover, transgenic expression of Aag activity restores the alkylation sensitivity of photoreceptors in Aag null animals. Aag heterozygotes display an intermediate level of retinal degeneration, demonstrating haploinsufficiency and underscoring that Aag expression confers a dominant retinal degeneration phenotype.
PHUSER (Primer Help for USER): a novel tool for USER fusion primer design
DEFF Research Database (Denmark)
Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads
2011-01-01
containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (Tm), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers...
Fischer, Tamás
2015-07-12
It has a great therapeutic significance that the disorder of the vascular endothelium, which supplies the affected ocular structures, plays a major role in the development of age-related macular degeneration. Chronic inflammation is closely linked to diseases associated with endothelial dysfuncition and age-related macular degeneration is accompanied by a general inflammatory response. The vascular wall including those in chorioids may be activated by several repeated and/or prolonged mechanical, physical, chemical, microbiological, immunologic and genetic factors causing a protracted host defence response with a consequent vascular damage, which leads to age-related macular degeneration. Based on this concept, age-related macular degeneration is a local manifestation of the systemic vascular disease. This recognition should have therapeutic implications because restoration of endothelial dysfunction can stabilize the condition of chronic vascular disease including age-related macular degeneration, as well. Restoration of endothelial dysfunction by non-pharmacological or pharmacological interventions may prevent the development or improve endothelial dysfunction resulting in prevention or improvement of age-related macular degeneration. Non-pharmacological interventions which may have beneficial effect in endothelial dysfunction include (1) smoking cessation; (2) reduction of increased body weight; (3) adequate physical activity; (4) appropriate diet (a) proper dose of flavonoids, polyphenols and kurcumin; (b) omega-3 long-chain polyunsaturated fatty acids: docosahexaenoic acid and eicosapentaenoic acid; (c) carotenoids, lutein and zeaxanthins), (d) management of dietary glycemic index, (e) caloric restriction, and (5) elimination of stressful lifestyle. Non-pharmacological interventions should be preferable even if medicaments are also used for the treatment of endothelial dysfunction.
Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.
Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela
2014-08-01
Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.
Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki
2011-03-01
The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Cheng-Hong Yang
Full Text Available BACKGROUND: Complete mitochondrial (mt genome sequencing is becoming increasingly common for phylogenetic reconstruction and as a model for genome evolution. For long template sequencing, i.e., like the entire mtDNA, it is essential to design primers for Polymerase Chain Reaction (PCR amplicons which are partly overlapping each other. The presented chromosome walking strategy provides the overlapping design to solve the problem for unreliable sequencing data at the 5' end and provides the effective sequencing. However, current algorithms and tools are mostly focused on the primer design for a local region in the genomic sequence. Accordingly, it is still challenging to provide the primer sets for the entire mtDNA. METHODOLOGY/PRINCIPAL FINDINGS: The purpose of this study is to develop an integrated primer design algorithm for entire mt genome in general, and for the common primer sets for closely-related species in particular. We introduce ClustalW to generate the multiple sequence alignment needed to find the conserved sequences in closely-related species. These conserved sequences are suitable for designing the common primers for the entire mtDNA. Using a heuristic algorithm particle swarm optimization (PSO, all the designed primers were computationally validated to fit the common primer design constraints, such as the melting temperature, primer length and GC content, PCR product length, secondary structure, specificity, and terminal limitation. The overlap requirement for PCR amplicons in the entire mtDNA is satisfied by defining the overlapping region with the sliding window technology. Finally, primer sets were designed within the overlapping region. The primer sets for the entire mtDNA sequences were successfully demonstrated in the example of two closely-related fish species. The pseudo code for the primer design algorithm is provided. CONCLUSIONS/SIGNIFICANCE: In conclusion, it can be said that our proposed sliding window-based PSO
Low-copy nuclear primers and ycf1 primers in Cactaceae.
Franck, Alan R; Cochrane, Bruce J; Garey, James R
2012-10-01
To increase the number of variable regions available for phylogenetic study in the Cactaceae, primers were developed for a portion of the plastid ycf1 gene and intron-spanning regions of two low-copy nuclear genes (isi1, nhx1). • Primers were tested on several families within Caryophyllales, focusing on the Cactaceae. Gel electrophoresis indicated positive amplification in most samples. Sequences of these three regions (isi1, nhx1, ycf1) from Harrisia exhibited variation similar to or greater than two plastid regions (atpB-rbcL intergenic spacer and rpl16 intron). • The isi, nhx, and ycf1 primers amplify phylogenetically useful information applicable to the Cactaceae and other families in the Caryophyllales.
Courtney, Elya; Courtney, Amy; Summer, Peter David; Courtney, Michael
2014-01-01
Results are presented for lead free primers based on diazodinitrophenol (DDNP)compared with tests on lead styphnate based primers. First, barrel friction measurements in 5.56 mm NATO are presented. Second, shot to shot variations in blast waves are presented as determined by detonating primers in a 7.62x51mm rifle chamber with a firing pin, but without any powder or bullet loaded and measuring the blast wave at the muzzle with a high speed pressure transducer. Third, variations in primer blas...
KENO V.a Primer: A Primer for Criticality Calculations with SCALE/KENO V.a Using CSPAN for Input
International Nuclear Information System (INIS)
Busch, R.D.
2003-01-01
The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory (ORNL) is widely used and accepted around the world for criticality safety analyses. The well-known KENO V.a three-dimensional Monte Carlo criticality computer code is the primary criticality safety analysis tool in SCALE. The KENO V.a primer is designed to help a new user understand and use the SCALE/KENO V.a Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO V.a in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO V.a that are useful in criticality analyses. The primer is based on SCALE 4.4a, which includes the Criticality Safety Processor for Analysis (CSPAN) input processor for Windows personal computers (PCs). A second edition of the primer, which uses the new KENO Visual Editor, is currently under development at ORNL and is planned for publication in late 2003. Each example in this first edition of the primer uses CSPAN to provide the framework for data input. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO V.a input and allows the user to quickly run a simple criticality problem with SCALE/KENO V.a. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO V.a features which are covered in detail in the example problems in that section. Upon completion of the primer, a new user should be comfortable using CSPAN to set up criticality problems in SCALE/KENO V.a
Molecular and cell-based therapies for muscle degenerations: a road under construction.
Berardi, Emanuele; Annibali, Daniela; Cassano, Marco; Crippa, Stefania; Sampaolesi, Maurilio
2014-01-01
Despite the advances achieved in understanding the molecular biology of muscle cells in the past decades, there is still need for effective treatments of muscular degeneration caused by muscular dystrophies and for counteracting the muscle wasting caused by cachexia or sarcopenia. The corticosteroid medications currently in use for dystrophic patients merely help to control the inflammatory state and only slightly delay the progression of the disease. Unfortunately, walkers and wheel chairs are the only options for such patients to maintain independence and walking capabilities until the respiratory muscles become weak and the mechanical ventilation is needed. On the other hand, myostatin inhibition, IL-6 antagonism and synthetic ghrelin administration are examples of promising treatments in cachexia animal models. In both dystrophies and cachectic syndrome the muscular degeneration is extremely relevant and the translational therapeutic attempts to find a possible cure are well defined. In particular, molecular-based therapies are common options to be explored in order to exploit beneficial treatments for cachexia, while gene/cell therapies are mostly used in the attempt to induce a substantial improvement of the dystrophic muscular phenotype. This review focuses on the description of the use of molecular administrations and gene/stem cell therapy to treat muscular degenerations. It reviews previous trials using cell delivery protocols in mice and patients starting with the use of donor myoblasts, outlining the likely causes for their poor results and briefly focusing on satellite cell studies that raise new hope. Then it proceeds to describe recently identified stem/progenitor cells, including pluripotent stem cells and in relationship to their ability to home within a dystrophic muscle and to differentiate into skeletal muscle cells. Different known features of various stem cells are compared in this perspective, and the few available examples of their use in
Rust transformation/rust compatible primers
Emeric, Dario A.; Miller, Christopher E.
1993-01-01
Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.
Directory of Open Access Journals (Sweden)
Dunn Sade N
2008-06-01
Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.
Hamiltonization of theories with degenerate coordinates
International Nuclear Information System (INIS)
Gitman, D.M.; Tyutin, I.V.
2002-01-01
We consider a class of Lagrangian theories where part of the coordinates does not have any time derivatives in the Lagrange function (we call such coordinates degenerate). We advocate that it is reasonable to reconsider the conventional definition of singularity based on the usual Hessian and, moreover, to simplify the conventional hamiltonization procedure. In particular, in such a procedure, it is not necessary to complete the degenerate coordinates with the corresponding conjugate momenta
Hamiltonization of theories with degenerate coordinates
Energy Technology Data Exchange (ETDEWEB)
Gitman, D.M. E-mail: gitman@fma.if.usp.br; Tyutin, I.V. E-mail: tyutin@lpi.ru
2002-05-27
We consider a class of Lagrangian theories where part of the coordinates does not have any time derivatives in the Lagrange function (we call such coordinates degenerate). We advocate that it is reasonable to reconsider the conventional definition of singularity based on the usual Hessian and, moreover, to simplify the conventional hamiltonization procedure. In particular, in such a procedure, it is not necessary to complete the degenerate coordinates with the corresponding conjugate momenta.
Real-time PCR (qPCR) primer design using free online software.
Thornton, Brenda; Basu, Chhandak
2011-01-01
Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.
Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples.
Zuntini, Alexandre R; Fonseca, Luiz Henrique M; Lohmann, Lúcia G
2013-09-01
New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. • Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. • The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.
Sánchez-Seco, María-Paz; Echevarría, José-Manuel; Hernández, Lourdes; Estévez, Domingo; Navarro-Marí, José-María; Tenorio, Antonio
2003-09-01
Phleboviruses are a large and widespread group of viruses that are transmitted by arthropods. Toscana virus is one of the principal agents that causes meningitis in humans during the summer in Italy and, possibly, in other Mediterranean countries. Rift Valley Fever virus can cause serious illness in both animals and humans, leading to high morbidity and mortality, and is considered to be a potential agent for epizootics and human epidemics. Since information on this group of viruses is still scant, reliable laboratory tools for diagnosis and epidemiological surveillance must be developed, in order to ascertain their real impact on Public Health. Sequence data obtained from Spanish isolates of Toscana virus and other phleboviruses confirmed that natural genome variability may hamper the diagnosis of these agents by molecular methods, so this must be borne in mind when developing reliable assays. In view of the above, a novel and useful protocol has been developed for the detection and specific identification of every member of the phlebovirus genus present in a sample, including Toscana virus, based on a generic RT-nested-PCR, followed by sequencing of the amplified fragment. A change in this method also allowed specific direct detection and identification of wild isolates of Toscana virus of different geographical origin, using newly designed primers. Testing clinical samples with these assays confirmed the role of Toscana virus as an agent that causes acute aseptic meningitis in the central region of Spain. Copyright 2003 Wiley-Liss, Inc.
Bioinformatic tools for PCR Primer design
African Journals Online (AJOL)
ES
reaction (PCR), oligo hybridization and DNA sequencing. Proper primer design is actually one of the most important factors/steps in successful DNA sequencing. Various bioinformatics programs are available for selection of primer pairs from a template sequence. The plethora programs for PCR primer design reflects the.
... macula in the back of the eye. The macula is important for clear central vision, allowing an individual to see fine details. There are two types of macular degeneration, dry and wet. Dry macular degeneration is more ...
Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples
Directory of Open Access Journals (Sweden)
Alexandre R. Zuntini
2013-08-01
Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.
30 CFR 56.6304 - Primer protection.
2010-07-01
... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives...
Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou
2016-11-01
It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.
Defense Primer: DOD Contractors
2017-02-10
functions, from intelligence analysis or software development to landscaping or food service. Why does DOD use individual contractors? Going back to...that provide professional services, from research to management support. The bulk of contractors—more than 70%—provide products, and these include...10 U.S.C. Part IV: Service, Supply, and Procurement. CRS Products CRS In Focus IF10548, Defense Primer: U.S. Defense Industrial Base, by Daniel
MR imaging of central nervous system white matter tract degeneration (Wallerian degeneration)
International Nuclear Information System (INIS)
Kuhn, M.J.; Johnson, K.A.; Davis, K.R.
1987-01-01
Wallerian degeneration is readily demonstrated by MR imaging. Twenty-one patients with MR signal abnormalities in various central nervous system (CNS) white matter tracts were evaluated with regard to (1) nature of signal abnormality, (2) MR anatomy of the involved tract, and (3) primary pathology (e.g., infarct, tumor, hemorrhage). Most examples of wallerian degeneration result in a thin, continuous band of long T1, long T2 signal abnormality conforming to the known anatomic pathway of a CNS axonal tract. Old, large cortical infarcts have the greatest propensity to show subsequent white-matter tract degeneration. Corticospinal tract degeneration is the type most readily visualized, often seen extending completely from the cerebral cortex through the medulla
Risk of retinal detachment in patients with lattice degeneration.
Sasaki, K; Ideta, H; Yonemoto, J; Tanaka, S; Hirose, A; Oka, C
1998-01-01
To determine the risk of retinal detachment in patients with lattice degeneration of the retina, we statistically analyzed the incidence of retinal detachment in these patients. The data of hospital patients with retinal detachment associated with lattice degeneration in Kumamoto Prefecture, Japan, in 1990 were collected. The prevalence of lattice degeneration in Kumamoto was reported to be 9.5% in 1980. Based on population data from the 1990 census, the cumulative incidence of retinal detachment associated with lattice degeneration was calculated in this study. Among 1,840,000 residents in Kumamoto, there were 110 patients with retinal detachment associated with lattice degeneration; 72 with detachment resulting from tractional tears (tears), and 38 with detachment from atrophic holes. The cumulative incidence of retinal detachment from atrophic holes was 1.5% at the age of 40 years; from tears it was 3.6% at the age of 80 years. The cumulative incidence of detachment from both atrophic holes and tears was 5.3% at the age of 80 years. The results of this study are useful for clarifying the natural course of lattice degeneration.
Evaluation of genetic diversity in open pollinated guava by iPBS primers
International Nuclear Information System (INIS)
Mehmood, A.; Jaskani, M.J.; Ahmad, S.; Ahmad, R.
2013-01-01
DNA markers are important tools for assessing genetic diversity and relationships among species, cultivars and breeding materials. Many horticultural species are lacking genomic information. DNA markers that do not require prior knowledge of DNA sequences are therefore appealing for horticultural research. A retrotransposon-based DNA marker system, iPBS (inter primer binding sites) developed from conserved primer binding sites within retrotransposons, was used to study the genetic variation and relationships in ornamental guava. PCR from 6 iPBS primers (dominant markers) produced a total of 113 bands (52.38-100% polymorphic) ranging from 150 bp to 3000 bp, and the mean PIC value for each primer ranging from 0.1245 to 0.3698. Molecular information generated from both iPBS was separately scored in a matrix for phylogenetic dendrogram construction. The phylogenetic dendrogram based on iPBS markers reflected morphologic classifications of the accessions that were studied. The iPBS PCR-based genome fingerprinting technology in this study is low-cost and provides another effective alternative in differentiation of accessions in guava (Psidium guajava Linn.) and related species or genera. (author)
Determination of source terms in a degenerate parabolic equation
International Nuclear Information System (INIS)
Cannarsa, P; Tort, J; Yamamoto, M
2010-01-01
In this paper, we prove Lipschitz stability results for inverse source problems relative to parabolic equations. We use the method introduced by Imanuvilov and Yamamoto in 1998 based on Carleman estimates. What is new here is that we study a class of one-dimensional degenerate parabolic equations. In our model, the diffusion coefficient vanishes at one extreme point of the domain. Instead of the classical Carleman estimates obtained by Fursikov and Imanuvilov for non degenerate equations, we use and extend some recent Carleman estimates for degenerate equations obtained by Cannarsa, Martinez and Vancostenoble. Finally, we obtain Lipschitz stability results in inverse source problems for our class of degenerate parabolic equations both in the case of a boundary observation and in the case of a locally distributed observation
Age-Related Macular Degeneration.
Mehta, Sonia
2015-09-01
Age-related macular degeneration (AMD) is the leading cause of vision loss in the elderly. AMD is diagnosed based on characteristic retinal findings in individuals older than 50. Early detection and treatment are critical in increasing the likelihood of retaining good and functional vision. Copyright © 2015 Elsevier Inc. All rights reserved.
What Is Age-Related Macular Degeneration?
... Eye Health / Eye Health A-Z Age-Related Macular Degeneration Sections What Is Macular Degeneration? How is AMD ... What Does Macular Degeneration Look Like? What Is Macular Degeneration? Leer en Español: ¿Qué es la degeneración macular ...
2006-01-01
The author develops a deformation theory for degenerations of complex curves; specifically, he treats deformations which induce splittings of the singular fiber of a degeneration. He constructs a deformation of the degeneration in such a way that a subdivisor is "barked" (peeled) off from the singular fiber. These "barking deformations" are related to deformations of surface singularities (in particular, cyclic quotient singularities) as well as the mapping class groups of Riemann surfaces (complex curves) via monodromies. Important applications, such as the classification of atomic degenerations, are also explained.
Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas
2016-01-01
Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic
Brown, Gary C.; Brown, Melissa M.; Brown, Heidi C.; Kindermann, Sylvia; Sharma, Sanjay
2007-01-01
Purpose To evaluate the comparability of articles in the peer-reviewed literature assessing the (1) patient value and (2) cost-utility (cost-effectiveness) associated with interventions for neovascular age-related macular degeneration (ARMD). Methods A search was performed in the National Library of Medicine database of 16 million peer-reviewed articles using the key words cost-utility, cost-effectiveness, value, verteporfin, pegaptanib, laser photocoagulation, ranibizumab, and therapy. All articles that used an outcome of quality-adjusted life-years (QALYs) were studied in regard to (1) percent improvement in quality of life, (2) utility methodology, (3) utility respondents, (4) types of costs included (eg, direct healthcare, direct nonhealthcare, indirect), (5) cost bases (eg, Medicare, National Health Service in the United Kingdom), and (6) study cost perspective (eg, government, societal, third-party insurer). To qualify as a value-based medicine analysis, the patient value had to be measured using the outcome of the QALYs conferred by respective interventions. As with value-based medicine analyses, patient-based time tradeoff utility analysis had to be utilized, patient utility respondents were necessary, and direct medical costs were used. Results Among 21 cost-utility analyses performed on interventions for neovascular macular degeneration, 15 (71%) met value-based medicine criteria. The 6 others (29%) were not comparable owing to (1) varying utility methodology, (2) varying utility respondents, (3) differing costs utilized, (4) differing cost bases, and (5) varying study perspectives. Among value-based medicine studies, laser photocoagulation confers a 4.4% value gain (improvement in quality of life) for the treatment of classic subfoveal choroidal neovascularization. Intravitreal pegaptanib confers a 5.9% value gain (improvement in quality of life) for classic, minimally classic, and occult subfoveal choroidal neovascularization, and photodynamic therapy
Brown, Gary C; Brown, Melissa M; Brown, Heidi C; Kindermann, Sylvia; Sharma, Sanjay
2007-01-01
To evaluate the comparability of articles in the peer-reviewed literature assessing the (1) patient value and (2) cost-utility (cost-effectiveness) associated with interventions for neovascular age-related macular degeneration (ARMD). A search was performed in the National Library of Medicine database of 16 million peer-reviewed articles using the key words cost-utility, cost-effectiveness, value, verteporfin, pegaptanib, laser photocoagulation, ranibizumab, and therapy. All articles that used an outcome of quality-adjusted life-years (QALYs) were studied in regard to (1) percent improvement in quality of life, (2) utility methodology, (3) utility respondents, (4) types of costs included (eg, direct healthcare, direct nonhealthcare, indirect), (5) cost bases (eg, Medicare, National Health Service in the United Kingdom), and (6) study cost perspective (eg, government, societal, third-party insurer). To qualify as a value-based medicine analysis, the patient value had to be measured using the outcome of the QALYs conferred by respective interventions. As with value-based medicine analyses, patient-based time tradeoff utility analysis had to be utilized, patient utility respondents were necessary, and direct medical costs were used. Among 21 cost-utility analyses performed on interventions for neovascular macular degeneration, 15 (71%) met value-based medicine criteria. The 6 others (29%) were not comparable owing to (1) varying utility methodology, (2) varying utility respondents, (3) differing costs utilized, (4) differing cost bases, and (5) varying study perspectives. Among value-based medicine studies, laser photocoagulation confers a 4.4% value gain (improvement in quality of life) for the treatment of classic subfoveal choroidal neovascularization. Intravitreal pegaptanib confers a 5.9% value gain (improvement in quality of life) for classic, minimally classic, and occult subfoveal choroidal neovascularization, and photodynamic therapy with verteporfin confers
Degenerate pressure driven modified nucleus-acoustic waves in degenerate plasmas
Mamun, A. A.
2018-02-01
The existence of degenerate pressure driven modified nucleus-acoustic (DPDMNA) waves propagating in a cold degenerate quantum plasma (DQP) system [containing cold inertialess degenerate electron species (DES), cold inertial non-degenerate light nucleus species (LNS), and stationary heavy nucleus species (HNS)] is predicted for the first time. The DPDMNA waves (in which the mass density of the cold LNS provides the inertia and the cold inertialess DES gives rise to the restoring force) are new since they completely disappear if the degenerate pressure of the cold DES is neglected. It is found that the phase speed (Vp) of the DPDMNA waves decreases with the rise of the charge number density of the stationary HNS for both non-relativistic and ultra-relativistic DES, and that the ultra-relativistic DES does not have any effect on Vp when β = 1, where β = Λc/Λe with Λ e = ne 0 - 1 / 3 being the average inter-electron distance in the DQP system and Λc being the constant (˜10-10 cm) for the DES. However, the ultra-relativistic DES does have quite a significant effect on Vp for β ≫ 1 and β ≪ 1, and the ultra-relativistic effect significantly enhances (reduces) Vp for β ≫ 1 (β ≪ 1). The DPDMNA waves and their dispersion properties are expected to be useful in understanding the basic features of the electrostatic perturbation mode in space and laboratory DQP systems.
Directory of Open Access Journals (Sweden)
Veronika Lancíková
2014-02-01
Full Text Available Trehalose-based (TBT-PAR additive was tested in order to optimize PCR amplification for DNA isolated from recalcitrant plants. Retrotransposon-based inter-primer binding site reactions were significantly improved with TBT-PAR solution using genomic DNA isolated from flax (Linum usitatissimum L., genotypes Kyivskyi, Bethune grown in radio-contaminated and non-radioactive remediated Chernobyl experimental fields. Additionally, similar improvements were observed using 19 recalcitrant genotypes of maize (Zea mays L. and three genotypes of yacon (Smallanthus sonchifolius, Poepp. et Endl., genotypes PER05, ECU45, BOL22 grown in standard field conditions.
Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.
Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis
2018-03-01
Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.
Serber, Robert
2018-01-01
Unabridged declassified value reproduction of The Los Alamos Primer by Robert Serber, in full color with all censor markings. This is the booklet given to new workers at Los Alamos during World War II, to catch them up on how to build a practical fission bomb. The Primer was driven by Robert Oppenheimer asking his protégé Robert Serber to summarize all knowledge and possible solutions known as of April 1943 in a series of lectures. Serber did such an excellent job that the notes from the series was turned into The Los Alamos Primer. Serber was known as an expert that bridged theory and reality, and so was also chosen to be one of the first Americans to enter Hiroshima and Nagasaki to assess the atomic damage in 1945.
Directory of Open Access Journals (Sweden)
Tai-Chi Lin
2015-11-01
Full Text Available Nanoparticles combined with cells, drugs, and specially designed genes provide improved therapeutic efficacy in studies and clinical setting, demonstrating a new era of treatment strategy, especially in retinal diseases. Nanotechnology-based drugs can provide an essential platform for sustaining, releasing and a specific targeting design to treat retinal diseases. Poly-lactic-co-glycolic acid is the most widely used biocompatible and biodegradable polymer approved by the Food and Drug Administration. Many studies have attempted to develop special devices for delivering small-molecule drugs, proteins, and other macromolecules consistently and slowly. In this article, we first review current progress in the treatment of age-related macular degeneration. Then, we discuss the function of vascular endothelial growth factor (VEGF and the pharmacological effects of anti-VEGF-A antibodies and soluble or modified VEGF receptors. Lastly, we summarize the combination of antiangiogenic therapy and nanomedicines, and review current potential targeting therapy in age-related macular degeneration.
DEFF Research Database (Denmark)
Lund, Anders Henrik; Duch, M; Lovmand, J
1997-01-01
, but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology....
Nanotechnology: A Policy Primer
2013-06-24
savings in the United States of 24 million barrels of oil.4 • Universal access to clean water. Nanotechnology water desalination and filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...COVERED 00-00-2013 to 00-00-2013 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT
International Nuclear Information System (INIS)
Voronin, Yegor A.; Pathak, Vinay K.
2003-01-01
Retroviruses package two copies of viral RNA into each virion. Although each RNA contains a primer-binding site for initiation of DNA synthesis, it is unknown whether reverse transcription is initiated on both RNAs. To determine whether a single virion is capable of initiating reverse transcription more than once, we constructed a murine leukemia virus-based vector containing a second primer-binding site (PBS) derived from spleen necrosis virus and inserted the green fluorescent protein gene (GFP) between the two PBSs. Initiation of reverse transcription at either PBS results in a provirus that expresses GFP. However, initiation at both PBSs can result in the deletion of GFP, which can be detected by flow cytometry and Southern blotting analysis. Approximately 22-29% of the proviruses formed deleted the GFP in a single replication cycle, indicating the minimum proportion of virions that initiated reverse transcription on both PBSs. These results show that a significant proportion of MLV-based vectors containing two PBSs have the capacity to initiate reverse transcription more than once
International Nuclear Information System (INIS)
Azhar Mohamad; Muhammad Hanif Azhari N; Siti Norhayati Ismail
2014-01-01
Aquilaria sp. belongs to the Thymelaeaceae family and is well distributed in Asia region. The species has multipurpose use from root to shoot and is an economically important crop, which generates wide interest in understanding genetic diversity of the species. Knowledge on DNA-based markers has become a prerequisite for more effective application of molecular marker techniques in breeding and mapping programs. In this work, both targeted genes and tandem repeat sequences were used for DNA fingerprinting in Aquilaria sp. A total of 100 ISSR (inter simple sequence repeat) primers and 50 combination pairs of specific primers derived from conserved region of a specific protein known as system in were optimized. 38 ISSR primers were found affirmative for polymorphism evaluation study and were generated from both specific and degenerate ISSR primers. And one utmost combination of system in primers showed significant results in distinguishing the Aquilaria sp. In conclusion, polymorphism derived from ISSR profiling and targeted stress genes of protein system in proved as a powerful approach for identification and molecular classification of Aquilaria sp. which will be useful for diversification in identifying any mutant lines derived from nature. (author)
Evaluation of intravertebral changes associated with the disk degeneration based on the MRI findings
International Nuclear Information System (INIS)
Saiki, Natoru
2000-01-01
The magnetic resonance images (MRI) of 441 vertebral bodies of the 199 patients with intravertebral abnormality associated with adjacent disk degeneration were evaluated according to the Modic classification and a new geographic classification. They were also evaluated in relation with the various factors including disk space narrowing, vacuum phenomenon, disk herniation, Schmorl's node, ostephyte formation and spondylolisthesis. The new geographic classification is based on the three factors; depth of invasion: stage 1 (thin layer along the end-plate), stage 2 (less than a half of the vertebral height) and stage 3 (more than a half of the vertebral height), shape: end-plate type, Schmorl's node type, triangle type, meniscus type and band type, location: front type, center type, rear type, front and rear type and whole type. Only about a half of the vertebral bodies with intervertebral abnormality showed bilateral invasion adjacent to the degenerative disks on both sides and the superior edges were much more frequently involved than the inferior ones. There was relatively higher incidence (7%) of Modic Type I degeneration defined as high signal intensity (HSI) on T2 weighted spin-echo images (T2WI) and low signal intensity (LSI) on T1 weighted spin-echo images (T1WI) representing vascularized fibrous tissue than those previously reported. On the other hand there was relatively lower incidence (5%) of Modic Type II degeneration defined as high or iso intensity on T1WI and HSI on T2WI. Triangle front type was seen in almost a half of the vertebrae in stage 2 and stage 3, and the rest was divided into meniscus type and band type almost evenly. The end plate front type must be a precursor of the triangle front type. The Schmorl's node type was considered to be a precursor of the meniscus type as well as band type in some but many must stay in its form transformed to Type II degeneration. In general, the intravertebral abnormality may not be necessary to be progressive
Peková, Sona; Marková, Jana; Pajer, Petr; Dvorák, Michal; Cetkovský, Petr; Schwarz, Jirí
2005-01-01
Patients with chronic lymphocytic leukemia (CLL) can relapse even after aggressive therapy and autografts. It is commonly assumed that to prevent relapse the level of minimal residual disease (MRD) should be as low as possible. To evaluate MRD, highly sensitive quantitative assays are needed. The aim of the study was to develop a robust and sensitive method for detection of the clonal immunoglobulin heavy-chain variable (IgV(H)) rearrangement in CLL and to introduce a highly sensitive and specific methodology for MRD monitoring in patients with CLL who undergo intensive treatment. As a prerequisite for MRD detection, touch-down reverse transcriptase (RT)-PCR using degenerate primers were used for the diagnostic identification of (H) gene rearrangement(s). For quantitative MRD detection in 18 patients, we employed a real-time RT-PCR assay (RQ-PCR) making use of patient-specific primers and the cost-saving Sybr-Green reporter dye (SG). For precise calibration of RQ-PCR, patient-specific IgV(H) sequences were cloned. Touch-down RT-PCR with degenerate primers allowed the successful detection of IgV(H) clonal rearrangement(s) in 252 of 257 (98.1%) diagnostic samples. Biallelic rearrangements were found in 27 of 252 (10.7%) cases. Degenerate primers used for the identification of clonal expansion at diagnosis were not sensitive enough for MRD detection. In contrast, our RQ-PCR assay using patient-specific primers and SG reached the sensitivity of 10(-)(6). We demonstrated MRD in each patient tested, including four of four patients in complete remission following autologous hematopoietic stem cell transplantation (HSCT) and three of three following allogeneic 'mini'-HSCT. Increments in MRD might herald relapse; aggressive chemotherapy could induce molecular remission. Our touch-down RT-PCR has higher efficiency to detect clonal IgV(H) rearrangements including the biallelic ones. MRD quantitation of IgV(H) expression using SG-based RQ-PCR represents a highly specific
Direct RNA-based detection and differentiation of CTX-M-type extended-spectrum β-lactamases (ESBL.
Directory of Open Access Journals (Sweden)
Claudia Stein
Full Text Available The current global spread of multi-resistant Gram-negatives, particularly extended spectrum β-lactamases expressing bacteria, increases the likelihood of inappropriate empiric treatment of critically ill patients with subsequently increased mortality. From a clinical perspective, fast detection of resistant pathogens would allow a pre-emptive correction of an initially inappropriate treatment. Here we present diagnostic amplification-sequencing approach as proof of principal based on the fast molecular detection and correct discrimination of CTX-M-β-lactamases, the most frequent ESBL family. The workflow consists of the isolation of total mRNA and CTX-M-specific reverse transcription (RT, amplification and pyrosequencing. Due to the high variability of the CTX-M-β-lactamase-genes, degenerated primers for RT, qRT as well as for pyrosequencing, were used and the suitability and discriminatory performance of two conserved positions within the CTX-M genes were analyzed, using one protocol for all isolates and positions, respectively. Using this approach, no information regarding the expected CTX-M variant is needed since all sequences are covered by these degenerated primers. The presented workflow can be conducted within eight hours and has the potential to be expanded to other β-lactamase families.
Directory of Open Access Journals (Sweden)
Yoshitaka Haribara
2016-04-01
Full Text Available We present the operational principle of a coherent Ising machine (CIM based on a degenerate optical parametric oscillator (DOPO network. A quantum theory of CIM is formulated, and the computational ability of CIM is evaluated by numerical simulation based on c-number stochastic differential equations. We also discuss the advanced CIM with quantum measurement-feedback control and various problems which can be solved by CIM.
Forest Interpreter's Primer on Fire Management.
Zelker, Thomas M.
Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…
International Nuclear Information System (INIS)
Flude, J.W.; Nicholas, J.R.
1991-04-01
This Predictive Maintenance Primer provides utility plant personnel with a single-source reference to predictive maintenance analysis methods and technologies used successfully by utilities and other industries. It is intended to be a ready reference to personnel considering starting, expanding or improving a predictive maintenance program. This Primer includes a discussion of various analysis methods and how they overlap and interrelate. Additionally, eighteen predictive maintenance technologies are discussed in sufficient detail for the user to evaluate the potential of each technology for specific applications. This document is designed to allow inclusion of additional technologies in the future. To gather the information necessary to create this initial Primer the Nuclear Maintenance Applications Center (NMAC) collected experience data from eighteen utilities plus other industry and government sources. NMAC also contacted equipment manufacturers for information pertaining to equipment utilization, maintenance, and technical specifications. The Primer includes a discussion of six methods used by analysts to study predictive maintenance data. These are: trend analysis; pattern recognition; correlation; test against limits or ranges; relative comparison data; and statistical process analysis. Following the analysis methods discussions are detailed descriptions for eighteen technologies analysts have found useful for predictive maintenance programs at power plants and other industrial facilities. Each technology subchapter has a description of the operating principles involved in the technology, a listing of plant equipment where the technology can be applied, and a general description of the monitoring equipment. Additionally, these descriptions include a discussion of results obtained from actual equipment users and preferred analysis techniques to be used on data obtained from the technology. 5 refs., 30 figs
Majid, Shahn
2002-05-01
Here is a self-contained introduction to quantum groups as algebraic objects. Based on the author's lecture notes for the Part III pure mathematics course at Cambridge University, the book is suitable as a primary text for graduate courses in quantum groups or supplementary reading for modern courses in advanced algebra. The material assumes knowledge of basic and linear algebra. Some familiarity with semisimple Lie algebras would also be helpful. The volume is a primer for mathematicians but it will also be useful for mathematical physicists.
Bender, Kelly S; Rice, Melissa R; Fugate, William H; Coates, John D; Achenbach, Laurie A
2004-09-01
Natural attenuation of the environmental contaminant perchlorate is a cost-effective alternative to current removal methods. The success of natural perchlorate remediation is dependent on the presence and activity of dissimilatory (per)chlorate-reducing bacteria (DPRB) within a target site. To detect DPRB in the environment, two degenerate primer sets targeting the chlorite dismutase (cld) gene were developed and optimized. A nested PCR approach was used in conjunction with these primer sets to increase the sensitivity of the molecular detection method. Screening of environmental samples indicated that all products amplified by this method were cld gene sequences. These sequences were obtained from pristine sites as well as contaminated sites from which DPRB were isolated. More than one cld phylotype was also identified from some samples, indicating the presence of more than one DPRB strain at those sites. The use of these primer sets represents a direct and sensitive molecular method for the qualitative detection of (per)chlorate-reducing bacteria in the environment, thus offering another tool for monitoring natural attenuation. Sequences of cld genes isolated in the course of this project were also generated from various DPRB and provided the first opportunity for a phylogenetic treatment of this metabolic gene. Comparisons of the cld and 16S ribosomal DNA (rDNA) gene trees indicated that the cld gene does not track 16S rDNA phylogeny, further implicating the possible role of horizontal transfer in the evolution of (per)chlorate respiration.
Degenerate nonlinear diffusion equations
Favini, Angelo
2012-01-01
The aim of these notes is to include in a uniform presentation style several topics related to the theory of degenerate nonlinear diffusion equations, treated in the mathematical framework of evolution equations with multivalued m-accretive operators in Hilbert spaces. The problems concern nonlinear parabolic equations involving two cases of degeneracy. More precisely, one case is due to the vanishing of the time derivative coefficient and the other is provided by the vanishing of the diffusion coefficient on subsets of positive measure of the domain. From the mathematical point of view the results presented in these notes can be considered as general results in the theory of degenerate nonlinear diffusion equations. However, this work does not seek to present an exhaustive study of degenerate diffusion equations, but rather to emphasize some rigorous and efficient techniques for approaching various problems involving degenerate nonlinear diffusion equations, such as well-posedness, periodic solutions, asympt...
On Degenerate Partial Differential Equations
Chen, Gui-Qiang G.
2010-01-01
Some of recent developments, including recent results, ideas, techniques, and approaches, in the study of degenerate partial differential equations are surveyed and analyzed. Several examples of nonlinear degenerate, even mixed, partial differential equations, are presented, which arise naturally in some longstanding, fundamental problems in fluid mechanics and differential geometry. The solution to these fundamental problems greatly requires a deep understanding of nonlinear degenerate parti...
Targeted reduction of highly abundant transcripts using pseudo-random primers.
Arnaud, Ophélie; Kato, Sachi; Poulain, Stéphane; Plessy, Charles
2016-04-01
Transcriptome studies based on quantitative sequencing can estimate levels of gene expression by measuring target RNA abundance in sequencing libraries. Sequencing costs are proportional to the total number of sequenced reads, and in order to cover rare RNAs, considerable quantities of abundant and identical reads are needed. This major limitation can be addressed by depleting a proportion of the most abundant sequences from the library. However, such depletion strategies involve either extra handling of the input RNA sample or use of a large number of reverse transcription primers, termed not-so-random (NSR) primers, which are costly to synthesize. Taking advantage of the high tolerance of reverse transcriptase to mis-prime, we found that it is possible to use as few as 40 pseudo-random (PS) reverse transcription primers to decrease the rate of undesirable abundant sequences within a library without affecting the overall transcriptome diversity. PS primers are simple to design and can be used to deplete several undesirable RNAs simultaneously, thus creating a flexible tool for enriching transcriptome libraries for rare transcript sequences.
Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R
2013-06-06
Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.
GST-PRIME: an algorithm for genome-wide primer design.
Leister, Dario; Varotto, Claudio
2007-01-01
The profiling of mRNA expression based on DNA arrays has become a powerful tool to study genome-wide transcription of genes in a number of organisms. GST-PRIME is a software package created to facilitate large-scale primer design for the amplification of probes to be immobilized on arrays for transcriptome analyses, even though it can be also applied in low-throughput approaches. GST-PRIME allows highly efficient, direct amplification of gene-sequence tags (GSTs) from genomic DNA (gDNA), starting from annotated genome or transcript sequences. GST-PRIME provides a customer-friendly platform for automatic primer design, and despite the relative simplicity of the algorithm, experimental tests in the model plant species Arabidopsis thaliana confirmed the reliability of the software. This chapter describes the algorithm used for primer design, its input and output files, and the installation of the standalone package and its use.
Degenerate Quadtree Latitude/Longitude Grid Based on WGS-84 Ellipsoidal Facet
Directory of Open Access Journals (Sweden)
HU Bailin
2016-12-01
Full Text Available For the needs of digital earth development and solving many global problems, a new discrete global grid system-DQLLG (degenerate quadtree latitude/longitude grid was put forward, which was based on WGS-84 ellipsoidal facet. The hierarchical subdivision method, characteristics and grid column/row coordinate system were detailed. The Latitude/Longitude coordinate, area and side length of multi-resolution meshes on different subdivision levels were calculated. Then the changes of mesh areas and side lengths were analyzed and compared that with spherical DQLLG. The research indicates that the DQLLG had many excellent features:uniformity, hierarchy, consistency of direction, extensive data compatibility and so on. It has certain practicality for Global GIS in the future.
Efficient One-Step Fusion PCR Based on Dual-Asymmetric Primers and Two-Step Annealing
DEFF Research Database (Denmark)
Liu, Yilan; Chen, Jinjin; Thygesen, Anders
2018-01-01
Gene splicing by fusion PCR is a versatile and widely used methodology, especially in synthetic biology. We here describe a rapid method for splicing two fragments by one-round fusion PCR with a dual-asymmetric primers and two-step annealing (ODT) method. During the process, the asymmetric...... intermediate fragments were generated in the early stage. Thereafter, they were hybridized in the subsequent cycles to serve as template for the target full-length product. The process parameters such as primer ratio, elongation temperature and cycle numbers were optimized. In addition, the fusion products...
Directory of Open Access Journals (Sweden)
Ni Luh Putu Indi Dharmayanti
2016-07-01
Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.
Directory of Open Access Journals (Sweden)
Puntipar Sonthiphand
Full Text Available Anaerobic ammonia oxidizing (anammox bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library
Sensory reception of the primer pheromone ethyl oleate
Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang
2012-05-01
Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.
Single primer amplification reaction methods reveal exotic and ...
Indian Academy of Sciences (India)
Unknown
mulberry varieties using three different PCR based single primer amplification ..... the results of a multi- variate analysis using Mahalanobis D2 statistic in case of .... Rajan M V, Chaturvedi H K and Sarkar A 1997 Multivariate analysis as an aid ...
Indian hedgehog contributes to human cartilage endplate degeneration.
Wang, Shaowei; Yang, Kun; Chen, Shuai; Wang, Jiying; Du, Guoqing; Fan, Shunwu; Wei, Lei
2015-08-01
To determine the role of Indian hedgehog (Ihh) signaling in human cartilage endplate (CEP) degeneration. CEP-degenerated tissues from patients with Modic I or II changes (n = 9 and 45, respectively) and normal tissues from vertebral burst fracture patients (n = 17) were collected. Specimens were either cut into slices for organ culture ex vivo or digested to isolate chondrocytes for cell culture in vitro. Ihh expression and the effect of Ihh on cartilage degeneration were determined by investigating degeneration markers in this study. Ihh expression and cartilage degeneration markers significantly increased in the Modic I and II groups. The expression of cartilage degeneration markers was positively correlated with degeneration severity. Gain-of-function for Ihh promoted expression of cartilage degeneration markers in vitro, while loss-of-function for Ihh inhibited their expression both in vitro and ex vivo. These findings demonstrated that Ihh promotes CEP degeneration. Blocking Ihh pathway has potential clinical usage for attenuating CEP degeneration.
Directory of Open Access Journals (Sweden)
Amanda eMartino
2012-01-01
Full Text Available A degenerate PCR-based method of whole-genome amplification, designed to work fluidly with 454 sequencing technology, was developed and tested for use on deep marine subsurface DNA samples. The method, which we have called Random Amplification Metagenomic PCR (RAMP, involves the use of specific primers from Roche 454 amplicon sequencing, modified by the addition of a degenerate region at the 3’ end. It utilizes a PCR reaction, which resulted in no amplification from blanks, even after 50 cycles of PCR. After efforts to optimize experimental conditions, the method was tested with DNA extracted from cultured E. coli cells, and genome coverage was estimated after sequencing on three different occasions. Coverage did not vary greatly with the different experimental conditions tested, and was around 62% with a sequencing effort equivalent to a theoretical genome coverage of 14.10X. The GC content of the sequenced amplification product was within 2% of the predicted values for this strain of E. coli. The method was also applied to DNA extracted from marine subsurface samples from ODP Leg 201 site 1229 (Peru Margin, and results of a taxonomic analysis revealed microbial communities dominated by Proteobacteria, Chloroflexi, Firmicutes, Euryarchaeota, and Crenarchaeota, among others. These results were similar to those obtained previously for those samples; however, variations in the proportions of taxa show that community analysis can be sensitive to both the amplification technique used and the method of assigning sequences to taxonomic groups. Overall, we find that RAMP represents a valid methodology for amplifying metagenomes from low biomass samples.
Liu, Weipeng; Zhu, Minjun; Liu, Hongxing; Wei, Jitao; Zhou, Xiaoming; Xing, Da
2016-07-15
Searching for a strategy to enhance the efficiency of nucleic acid amplification and achieve exquisite discrimination of nucleic acids at the single-base level for biological detection has become an exciting research direction in recent years. Here, we have developed a simple and universal primer design strategy which produces a fascinating effect on isothermal strand displacement amplification (iSDA). We refer to the resultant primer as "invading stacking primer (IS-Primer)" which is based on contiguous stacking hybridization and toehold-mediated exchange reaction and function by merely changing the hybridization location of the primer. Using the IS-Primer, the sensitivity in detecting the target miR-21 is improved approximately five fold compared with the traditional iSDA reaction. It was further demonstrated that the IS-Primer acts as an invading strand to initiate branch migration which can increase the efficiency of the untwisting of the hairpin probe. This effect is equivalent to reducing the free energy of the stem, and the technique shows superior selectivity for single-base mismatches. By demonstrating the enhanced effect of the IS-Primer in the iSDA reaction, this work may provide a potentially new avenue for developing more sensitive and selective nucleic acids assays. Copyright © 2016 Elsevier B.V. All rights reserved.
In Vivo Mouse Intervertebral Disc Degeneration Model Based on a New Histological Classification.
Directory of Open Access Journals (Sweden)
Takashi Ohnishi
Full Text Available Although human intervertebral disc degeneration can lead to several spinal diseases, its pathogenesis remains unclear. This study aimed to create a new histological classification applicable to an in vivo mouse intervertebral disc degeneration model induced by needle puncture. One hundred six mice were operated and the L4/5 intervertebral disc was punctured with a 35- or 33-gauge needle. Micro-computed tomography scanning was performed, and the punctured region was confirmed. Evaluation was performed by using magnetic resonance imaging and histology by employing our classification scoring system. Our histological classification scores correlated well with the findings of magnetic resonance imaging and could detect degenerative progression, irrespective of the punctured region. However, the magnetic resonance imaging analysis revealed that there was no significant degenerative intervertebral disc change between the ventrally punctured and non-punctured control groups. To induce significant degeneration in the lumbar intervertebral discs, the central or dorsal region should be punctured instead of the ventral region.
Specific heats of degenerate ideal gases
Caruso, Francisco; Oguri, Vitor; Silveira, Felipe
2017-01-01
From arguments based on Heisenberg's uncertainty principle and Pauli's exclusion principle, the molar specific heats of degenerate ideal gases at low temperatures are estimated, giving rise to values consistent with the Nerst-Planck Principle (third law of Thermodynamics). The Bose-Einstein condensation phenomenon based on the behavior of specific heat of massive and non-relativistic boson gases is also presented.
Sahly, I; Bar Nachum, S; Suss-Toby, E; Rom, A; Peretz, A; Kleiman, J; Byk, T; Selinger, Z; Minke, B
1992-01-01
Light accelerates degeneration of photoreceptor cells of the retinal degeneration B (rdgB) mutant of Drosophila. During early stages of degeneration, light stimuli evoke spikes from photoreceptors of the mutant fly; no spikes can be recorded from photoreceptors of the wild-type fly. Production of spike potentials from mutant photoreceptors was blocked by diltiazem, verapamil hydrochloride, and cadmium. Little, if any, effect of the (-)-cis isomer or (+)-cis isomer of diltiazem on the light response was seen. Further, the (+)-cis isomer was approximately 50 times more effective than the (-)-cis isomer in blocking the Ca2+ spikes, indicating that diltiazem action on the rdgB eye is mediated by means of blocking voltage-sensitive Ca2+ channels, rather than by blocking the light-sensitive channels. Application of the Ca(2+)-channel blockers (+)-cis-diltiazem and verapamil hydrochloride to the eyes of rdgB flies over a 7-day period largely inhibited light-dependent degeneration of the photoreceptor cells. Pulse labeling with [32P]phosphate showed much greater incorporation into eye proteins of [32P]phosphate in rdgB flies than in wild-type flies. Retarding the light-induced photoreceptor degeneration in the mutant by Ca(2+)-channel blockers, thus, suggests that toxic increase in intracellular Ca2+ by means of voltage-gated Ca2+ channels, possibly secondary to excessive phosphorylation, leads to photoreceptor degeneration in the rdgB mutant. Images PMID:1309615
Klein, Ronald; Myers, Chelsea E.; Buitendijk, Gabriëlle H. S.; Rochtchina, Elena; Gao, Xiaoyi; de Jong, Paulus T. V. M.; Sivakumaran, Theru A.; Burlutsky, George; McKean-Cowdin, Roberta; Hofman, Albert; Iyengar, Sudha K.; Lee, Kristine E.; Stricker, Bruno H.; Vingerling, Johannes R.; Mitchell, Paul; Klein, Barbara E. K.; Klaver, Caroline C. W.; Wang, Jie Jin
2014-01-01
To describe associations of serum lipid levels and lipid pathway genes to the incidence of age-related macular degeneration (AMD). Meta-analysis. setting: Three population-based cohorts. population: A total of 6950 participants from the Beaver Dam Eye Study (BDES), Blue Mountains Eye Study (BMES),
Hexavalent Chromium IV-Free Primer Development
Alldredge, Michael J.; Buck, Amy L.
2015-01-01
Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.
Bioinspired Catecholic Primers for Rigid and Ductile Dental Resin Composites.
Shin, Eeseul; Ju, Sung Won; An, Larry; Ahn, Eungjin; Ahn, Jin-Soo; Kim, Byeong-Su; Ahn, B Kollbe
2018-01-17
In the construction of dental restorative polymer composite materials, surface priming on mineral fillers is essential to improve the mechanical performance of the composites. Here we present bioinspired catechol-functionalized primers for a tougher dental resin composite containing glass fillers. The catecholic primers with different polymerizable end groups were designed and then coated on glass surfaces using a simple drop-casting or dip-coating process. The surface binding ability and possible cross-linking (coupling or chemical bridging between the glass substrate and the dental resin) of the catecholic bifunctional primers were evaluated using atomic force microscopy, contact angle measurements, and the knife shear bonding test and compared to a state-of-the-art silane-based coupling agent. Various mechanical tests including shrinkage and compression tests of the dental resin composites were also conducted. Compression tests of the composites containing the catecholic primed fillers exhibited enhanced mechanical properties, owing to the bidentate hydrogen bonding of catechol moieties to the oxide mineral surface. Furthermore, the superior biocompatibility of the primed surface was confirmed via cell attachment assay, thus providing applicability of catecholic primers for practical dental and biomedical applications.
Multiplexing Short Primers for Viral Family PCR
Energy Technology Data Exchange (ETDEWEB)
Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W
2008-06-26
We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.
PIPEMicroDB: microsatellite database and primer generation tool for pigeonpea genome.
Sarika; Arora, Vasu; Iquebal, M A; Rai, Anil; Kumar, Dinesh
2013-01-01
Molecular markers play a significant role for crop improvement in desirable characteristics, such as high yield, resistance to disease and others that will benefit the crop in long term. Pigeonpea (Cajanus cajan L.) is the recently sequenced legume by global consortium led by ICRISAT (Hyderabad, India) and been analysed for gene prediction, synteny maps, markers, etc. We present PIgeonPEa Microsatellite DataBase (PIPEMicroDB) with an automated primer designing tool for pigeonpea genome, based on chromosome wise as well as location wise search of primers. Total of 123 387 Short Tandem Repeats (STRs) were extracted from pigeonpea genome, available in public domain using MIcroSAtellite tool (MISA). The database is an online relational database based on 'three-tier architecture' that catalogues information of microsatellites in MySQL and user-friendly interface is developed using PHP. Search for STRs may be customized by limiting their location on chromosome as well as number of markers in that range. This is a novel approach and is not been implemented in any of the existing marker database. This database has been further appended with Primer3 for primer designing of selected markers with left and right flankings of size up to 500 bp. This will enable researchers to select markers of choice at desired interval over the chromosome. Furthermore, one can use individual STRs of a targeted region over chromosome to narrow down location of gene of interest or linked Quantitative Trait Loci (QTLs). Although it is an in silico approach, markers' search based on characteristics and location of STRs is expected to be beneficial for researchers. Database URL: http://cabindb.iasri.res.in/pigeonpea/
International Nuclear Information System (INIS)
Ravi, M.S.; Panchasara, Chirag; Vijay, R.; Suchetha Kumari, N.; Sanjeev, Ganesh
2013-01-01
To evaluate the in vitro genotoxicity and cytotoxicity of two visible light-cured adhesives. The materials tested were 1. orthodontic adhesive with primer (Transbond XT3M) and 2. Orthodontic adhesive without primer (Heliosit, Ivoclar Vivadent AG), Cured sterile individual masses were exposed to 2 kGy electron beam radiation, both irradiated and non irradiated materials were immersed in Phosphate buffer saline and left at 370℃ for 24 hr. Then a volume of 200 μL of the extract medium was mixed with human peripheral blood lymphocyte tested for comet assay by single cell DNA Damage assay and Apoptosis by DNA diffusion agar assay. Evaluation of cytotoxicity was carried out by Hemolysis assay method. Haemolytic activity of orthodontic adhesive without primer (53.34±3.12) was slightly more than that of orthodontic adhesive with primer (52.9±.88). In case of Apoptosis, adhesive with primer (188.92±55.05) and adhesives without primer (186.75±101.83) showed increased diffusion of DNA compared to normal lymphocyte (111.22±8.78). However the level of DNA diffusion was not significantly different between the two adhesives. Both adhesives were cytotoxic and induced apoptosis. Adhesives without primer were found to be slightly toxic than that of adhesive with primer. Both the adhesives had no significant effect on the percentage of DNA tail and olive tail moment of DNA exposed to electron beam radiation. (author)
Directory of Open Access Journals (Sweden)
Andrea Scribante
2013-01-01
Full Text Available Objective. The aim of this study was to compare the shear bond strength (SBS and adhesive remnant index (ARI scores of no-primer adhesives tested with two different bracket bases. Materials and Methods. 120 bovine permanent mandibular incisors were divided into 6 groups of 20 specimens. Two brackets (ODP with different bracket bases (anchor pylons and 80-gauge mesh were bonded to the teeth using a conventional adhesive (Transbond XT and two different no-primer adhesive (Ortho Cem; Heliosit systems. Groups were tested using an instron universal testing machine. SBS values were recorded. ARI scores were measured. SEM microphotographs were taken to evaluate the pattern of bracket bases. Statistical analysis was performed. ANOVA and Tukey tests were carried out for SBS values, whereas a chi-squared test was applied for ARI scores. Results. Highest bond strength values were reported with Transbond XT (with both pad designs, Ortho Cem bonded on anchor pylons and Heliosit on 80-gauge mesh. A higher frequency of ARI score of “3” was reported for Transbond XT groups. Other groups showed a higher frequency of ARI score “2” and “1.” Conclusion. Transbond XT showed the highest shear bond strength values with both pad designs.
Lee, Hankil; Jang, Yong Jung; Lee, Hyung Keun; Kang, Hye Young
2017-12-01
Age-related eye disease is often considered part of natural aging. Lack of awareness of eye conditions can result in missed treatment. We investigated the rates of awareness of cataract and age-related macular degeneration, the most common age-related eye-diseases, and the associated factors among elderly Koreans. We identified 7,403 study subjects (≥40 years old) with cataract or age-related macular degeneration based on ophthalmic examination results during the 5th Korean National Health and Nutrition Examination Survey conducted between 2010 and 2012. We assessed whether patients were aware of their eye condition based on a previous diagnosis by a physician. The average awareness rate over the 3-year study period was 23.69% in subjects with cataract and 1.45% in subjects with age-related macular degeneration. Logistic regression analysis showed that patients with cataract were more likely to recognize their condition if they had myopia (odds ratio, 2.08), hyperopia (odds ratio, 1.33), family history of eye disease (odds ratio, 1.44), or a past eye examination (odds ratio, 4.07-29.10). The presence of diabetes mellitus was also a significant predictor of patient awareness of cataract (odds ratio, 1.88). Poor patient recognition of eye disease among the Korean elderly highlights the seriousness of this potential public health problem in our aging society. Pre-existing eye-related conditions and diabetes were significant predictors of awareness; therefore, patients in frequent contact with their doctors have a greater chance of detecting eye disease. © 2017 The Korean Ophthalmological Society
The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers
Danford, M. D.; Mendrek, M. J.; Walsh, D. W.
1995-01-01
The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.
Primer on spontaneous heating and pyrophoricity
Energy Technology Data Exchange (ETDEWEB)
1994-12-01
This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.
Leonhardt, U.
2001-01-01
Laboratory-based optical analogs of astronomical objects such as black holes rely on the creation of light with an extremely low or even vanishing group velocity (slow light). These brief notes represent a pedagogical attempt towards elucidating this extraordinary form of light. This paper is a contribution to the book Artificial Black Holes edited by Mario Novello, Matt Visser and Grigori Volovik. The paper is intended as a primer, an introduction to the subject for non-experts, not as a det...
30 CFR 57.6304 - Primer protection.
2010-07-01
... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a...
Matrix units and Schur elements for the degenerate cyclotomic Hecke algebras
Zhao, Deke
2011-01-01
The paper uses the cellular basis of the (semi-simple) degenerate cyclotomic Hecke algebras to investigate these algebras exhaustively. As a consequence, we describe explicitly the "Young's seminormal form" and a orthogonal bases for Specht modules and determine explicitly the closed formula for the natural bilinear form on Specht modules and Schur elements for the degenerate cyclotomic Hekce algebras.
... See More About Research The NINDS supports and conducts research on disorders of the brain and nervous system such as striatonigral degeneration. This research ... Publications Definition Striatonigral ...
Directory of Open Access Journals (Sweden)
Martin Beránek
2012-01-01
Full Text Available Dideoxynucleotide DNA sequencing is one of the principal procedures in molecular biology. Loss of an initial part of nucleotides behind the 3' end of the sequencing primer limits the readability of sequenced amplicons. We present a method which extends the readability by using sequencing primers modified by polyadenylated tails attached to their 5' ends. Performing a polymerase chain reaction, we amplified eight amplicons of six human genes (AMELX, APOE, HFE, MBL2, SERPINA1 and TGFB1 ranging from 106 bp to 680 bp. Polyadenylation of the sequencing primers minimized the loss of bases in all amplicons. Complete sequences of shorter products (AMELX 106 bp, SERPINA1 121 bp, HFE 208 bp, APOE 244 bp, MBL2 317 bp were obtained. In addition, in the case of TGFB1 products (366 bp, 432 bp, and 680 bp, respectively, the lengths of sequencing readings were significantly longer if adenylated primers were used. Thus, single strand dideoxynucleotide sequencing with adenylated primers enables complete or near complete readability of short PCR amplicons.
[Lattice degeneration of the retina].
Boĭko, E V; Suetov, A A; Mal'tsev, D S
2014-01-01
Lattice degeneration of the retina is a clinically important type of peripheral retinal dystrophies due to its participation in the pathogenesis of rhegmatogenous retinal detachment. In spite of extensive epidemiological, morphological, and clinical data, the question on causes of this particular type of retinal dystrophies currently remains debatable. Existing hypotheses on pathogenesis of retinal structural changes in lattice degeneration explain it to a certain extent. In clinical ophthalmology it is necessary to pay close attention to this kind of degenerations and distinguish between cases requiring preventive treatment and those requiring monitoring.
Sheu, Sen-Je; Hwang, Wen-zhe; Chen, Hsin-Chih; Chiang, Yu-Cheng; Tsen, Hau-Yang
2009-01-01
PCR primers specific for the detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum were designed based on the elongation factor Tu gene (tuf). The specificity of these four primer sets were confirmed by PCR with 88 bacterial strains of Lactobacillus, Enterococcus, Bifidobacterium, and other bacterial species. Results indicated that these primer sets generated predicted PCR products of 397, 230, 202, and 161 bp for L. acidophilus, L. delbrueckii, L. casei group, and B. longum, respectively. Bacterial species other than the target organisms tested did not generate false-positive results. When these four primer sets were combined for the simultaneous detection of the lactic acid bacteria (LAB) in fermented milk products including yogurt, the LAB species listed on the labels of these products could be identified without the preenrichment step. The identification limit for each LAB strain with this multiplex PCR method was N X 10(3) CFU/ml in milk samples. The results of our multiplex PCR method were confirmed by PCR assay using primers based on the 16S rDNA or the 16S-23S intergenic spacer region and by biochemical tests using the API 50 CHL kit. When this multiplex PCR method was used with the determination of counts of total viable LAB and bifidobacteria, the quality of commercial fermented milk products could be assured.
... FARA) National Ataxia Foundation (NAF) National Multiple Sclerosis Society See all related organizations Publications Degeneración cerebelosa Order NINDS Publications Definition Cerebellar degeneration is a process in which neurons ( ...
Directory of Open Access Journals (Sweden)
Christopher Ryan Penton
2013-09-01
Full Text Available Targeting sequencing to genes involved in key environmental processes, i.e. ecofunctional genes, provides an opportunity to sample nature’s gene guilds to greater depth and help link community structure to process-level outcomes. Vastly different approaches have been implemented for sequence processing and, ultimately, for taxonomic placement of these gene reads. The overall quality of next generation sequence analysis of functional genes is dependent on multiple steps and assumptions of unknown diversity. To illustrate current issues surrounding amplicon read processing we provide examples for three ecofunctional gene groups. A combination of in-silico, environmental and cultured strain sequences was used to test new primers targeting the dioxin and dibenzofuran degrading genes dxnA1, dbfA1, and carAa. The majority of obtained environmental sequences were classified into novel sequence clusters, illustrating the discovery value of the approach. For the nitrite reductase step in denitrification, the well-known nirK primers exhibited deficiencies in reference database coverage, illustrating the need to refine primer-binding sites and/or to design multiple primers, while nirS primers exhibited bias against five phyla. Amino acid-based OTU clustering of these two N-cycle genes from soil samples yielded only 114 unique nirK and 45 unique nirS genus-level groupings, likely a reflection of constricted primer coverage. Finally, supervised and non-supervised OTU analysis methods were compared using the nifH gene of nitrogen fixation, with generally similar outcomes, but the clustering (non-supervised method yielded higher diversity estimates and stronger site-based differences. High throughput amplicon sequencing can provide inexpensive and rapid access to nature’s related sequences by circumventing the culturing barrier, but each unique gene requires individual considerations in terms of primer design and sequence processing and classification.
The brain basis of musicophilia: evidence from frontotemporal lobar degeneration
Phillip David Fletcher; Laura eDowney; Pirada eWitoonpanich; Jason eWarren
2013-01-01
Musicophilia, or abnormal craving for music, is a poorly understood phenomenon that has been associated in particular with focal degeneration of the temporal lobes. Here we addressed the brain basis of musicophilia using voxel-based morphometry (VBM) on MR volumetric brain images in a retrospectively ascertained cohort of patients meeting clinical consensus criteria for frontotemporal lobar degeneration: of 37 cases ascertained, 12 had musicophilia and 25 did not exhibit the phenomenon. The s...
Veysi, Mehdi; Othman, Mohamed A. K.; Figotin, Alexander; Capolino, Filippo
2018-05-01
We propose a class of lasers based on a fourth-order exceptional point of degeneracy (EPD) referred to as the degenerate band edge (DBE). EPDs have been found in parity-time-symmetric photonic structures that require loss and/or gain; here we show that the DBE is a different kind of EPD since it occurs in periodic structures that are lossless and gainless. Because of this property, a small level of gain is sufficient to induce single-frequency lasing based on a synchronous operation of four degenerate Floquet-Bloch eigenwaves. This lasing scheme constitutes a light-matter interaction mechanism that leads also to a unique scaling law of the laser threshold with the inverse of the fifth power of the laser-cavity length. The DBE laser has the lowest lasing threshold in comparison to a regular band edge laser and to a conventional laser in cavities with the same loaded quality (Q ) factor and length. In particular, even without mirror reflectors the DBE laser exhibits a lasing threshold which is an order of magnitude lower than that of a uniform cavity laser of the same length and with very high mirror reflectivity. Importantly, this novel DBE lasing regime enforces mode selectivity and coherent single-frequency operation even for pumping rates well beyond the lasing threshold, in contrast to the multifrequency nature of conventional uniform cavity lasers.
Cataract surgery and age-related macular degeneration. An evidence-based update
DEFF Research Database (Denmark)
Kessel, Line; Erngaard, Ditte; Flesner, Per
2015-01-01
PURPOSE: Age-related macular degeneration (AMD) and cataract often coexist in patients and concerns that cataract surgery is associated with an increased risk of incidence or progression of existing AMD has been raised. This systematic review and meta-analysis is focused on presenting the evidence...
Caetano-Anollés, G; Gresshoff, P M
1996-06-01
DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.
Nonspecific amplification of human DNA by Streptococcus pneumoniae LytA primer
Directory of Open Access Journals (Sweden)
Helen Hencida Thangamony
2018-01-01
Full Text Available Background: Determination of various analytical parameters is essential for the validation of primers used for in-house nucleic acid amplification tests. While standardising a high-resolution melt analysis (HRMA for detection of Streptococcus pneumoniae in acute pyogenic meningitis, we encountered non-specific amplification of certain base pair sequences of human DNA by Centers for Disease Control & Prevention, USA recommended S. pneumoniae LytA primer. Materials and Methods: HRMA was standardised using DNA extracted from an ATCC strain of S. pneumoniae using SP LytA F373 primer and Type-it HRMTM polymerase chain reaction kit in Rotor-Gene Q Thermal Cycler according to the manufacturer's instructions. Specificity of the primers was determined in dry and wet laboratory experiments against diverse related and unrelated microbial pathogens by HRMA and on DNA extracted from unspiked clinical samples negative for SP DNA. Sensitivity was determined by calculating lower limit of detection threshold in experiments with spiked samples. The amplicon from spiked experiments was sequenced and analysed through Gene Bank. Results: Our dry/wet laboratory experiments showed two separate curves and different Tm values indicating certain non-specific amplification by the primer. Basic Local Alignment Search Tool (BLAST analysis of the amplicon obtained in the spiked experiment showed sequences of human chromosome 20 associated with Homo sapiens protein tyrosine phosphatase, receptor type T gene. The problem was resolved by stopping the reaction at 30th Ct cycle and observing the Tm values. Conclusion: Since HRMA is done without a specific probe, one should be aware of non-specific amplifications while using primers for HRMA of human clinical samples.
Intervertebral disc degeneration in dogs
Bergknut, N.
2011-01-01
Back pain is common in both dogs and humans, and is often associated with intervertebral disc (IVD) degeneration. The IVDs are essential structures of the spine and degeneration can ultimately result in diseases such as IVD herniation or spinal instability. In order to design new treatments halting
Intervertebral disc degeneration in dogs
Bergknut, Niklas
Back pain is common in both dogs and humans, and is often associated with intervertebral disc (IVD) degeneration. The IVDs are essential structures of the spine and degeneration can ultimately result in diseases such as IVD herniation or spinal instability. In order to design new treatments halting
Second order degenerate elliptic equations
International Nuclear Information System (INIS)
Duong Minh Duc.
1988-08-01
Using an improved Sobolev inequality we study a class of elliptic operators which is degenerate inside the domain and strongly degenerate near the boundary of the domain. Our results are applicable to the L 2 -boundary value problem and the mixed boundary problem. (author). 18 refs
Tymon, Anna M; Shah, Paresh A; Pell, Judith K
2004-04-01
Studies were performed to assess the genetic variation amongst isolates of the aphid-pathogenic fungus Pandora neoaphidis (syn. Erynia neoaphidis). 37 isolates were examined, from a range of pest and non-pest aphid species, as well as 21 from eight other entomophthoralean species. Universal primers were used to amplify the ITS rDNA regions and all of the species tested produced discrete ITS groups, with the exception of Conidiobolus spp. Neighbour-joining analysis of the ITS2 regions from P. neoaphidis, P. kondoiensis and Zoophthora radicans demonstrated that these three species formed distinct groups with sequence identities of 58-82% between the groups. An ITS size of ca 1,100 bp was diagnostic for P. neoaphidis, while ca 1,450 bp was characteristic of P. kondoiensis. ITS-RFLP analysis failed to yield intraspecific polymorphisms in any of the P. neoaphidis isolates screened, although it was useful in distinguishing between different entomophthoralean species. Some intraspecific variation in the ITS region was detected in a number of isolates of Z. radicans and Conidiobolus spp. We propose that two isolates previously identified as P. neoaphidis based on conidia morphology, are actually P. kondoiensis based on molecular studies. Sequencing analysis of the complete ITS region from P. neoaphidis and P. kondoiensis allowed species-specific primers to be developed for P. neoaphidis and P. kondoiensis. These were used to screen aphids infected in laboratory bioassays and from field-collected samples, without prior isolation of the fungus. The primers are useful tools for quantifying the epizootiology of P. neoaphidis in aphid populations, as well as assessing competitive interactions between these two species.
Primer on CDM programme of activities
Energy Technology Data Exchange (ETDEWEB)
Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)
2009-07-01
As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)
Bioinformatic tools and guideline for PCR primer design | Abd ...
African Journals Online (AJOL)
Bioinformatics has become an essential tool not only for basic research but also for applied research in biotechnology and biomedical sciences. Optimal primer sequence and appropriate primer concentration are essential for maximal specificity and efficiency of PCR. A poorly designed primer can result in little or no ...
Medium Caliber Lead-Free Electric Primer. Version 2
2012-09-01
2008). Safe Drinking Water Act of 1986 lists lead compounds as carcinogens (27 CCR 27001 – Dec. 2008). EPA began a Phase I assessment to determine...primer cups was our standard method, wet loading using solvents (hexane and iso -propanol) was investigated to reduce risk of accidental ignition...LOADING OPERATION (Single Die) Wet primer mix charge with solvent (Hexane/ Iso -Propanol) and stir to mix to a uniform slurry Insert primer cup in
Detection of Ophiocordyceps sinensis and Its Common Adulterates Using Species-Specific Primers
Liu, Yang; Wang, Xiao-yue; Gao, Zi-tong; Han, Jian-ping; Xiang, Li
2017-01-01
Ophiocordyceps sinensis is a fungus that infects Hepialidae caterpillars, mummifying the larvae and producing characteristic fruiting bodies (stromata) that are processed into one of the most valued traditional Chinese medicines (TCM). The product commands a very high price due to a high demand but a very limited supply. Adulteration with other fungi is a common problem and there is a need to test preparation for the presence of the correct fungus. In the current study, a PCR-based approach for the identification of O. sinensis based on a segment of the internal transcribed spacer (ITS) region was developed. The segments is 146-bp in size and is likely to be amplified even in materials where processing led to DNA fragmentation. Primer development was based on the alignment of sequence data generated from a total of 89 samples of O. sinensis and potential adulterants as well as sequences date from 41 Ophiocordyceps species and 26 Cordyceps species available in GenBank. Tests with primer pair, DCF4/DCR4, demonstrated generation of an amplicon from DNA extracted from O. sinensis stromata, but not from extracts derived from adulterants. Species-specific primer pairs were also developed and tested for detection of the common adulterants, Cordyceps gunnii, Cordyceps cicadae, Cordyceps militaris, Cordyceps liangshanensis and Ophiocordyceps nutans. The collection of primers developed in the present study will be useful for the authentication of preparation claiming to only contain O. sinensis and for the detection of fungi used as adulterants in these preparations. PMID:28680424
Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G
2017-02-01
To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.
Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers
DEFF Research Database (Denmark)
Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.
2011-01-01
BACKGROUND: MicroRNAs are important regulators of gene expression at the post-transcriptional level and play an important role in many biological processes. Due to the important biological role it is of great interest to quantitatively determine their expression level in different biological...... be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...... samples than a similar method based on locked nucleic acids-spiked primers, which is in agreement with the observation that locked nucleic acid interferes with efficient amplification of short templates. The higher amplification efficiency of DNA primers translates into higher sensitivity and precision...
Liu, Xiaojing; Locasale, Jason W
2017-04-01
Metabolomics generates a profile of small molecules that are derived from cellular metabolism and can directly reflect the outcome of complex networks of biochemical reactions, thus providing insights into multiple aspects of cellular physiology. Technological advances have enabled rapid and increasingly expansive data acquisition with samples as small as single cells; however, substantial challenges in the field remain. In this primer we provide an overview of metabolomics, especially mass spectrometry (MS)-based metabolomics, which uses liquid chromatography (LC) for separation, and discuss its utilities and limitations. We identify and discuss several areas at the frontier of metabolomics. Our goal is to give the reader a sense of what might be accomplished when conducting a metabolomics experiment, now and in the near future. Copyright © 2017 Elsevier Ltd. All rights reserved.
Value for money assessment for public-private partnerships : a primer.
2015-01-01
This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion : primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of : primers.
Self-reported optometric practise patterns in age-related macular degeneration.
Ly, Angelica; Nivison-Smith, Lisa; Zangerl, Barbara; Assaad, Nagi; Kalloniatis, Michael
2017-11-01
The use of advanced imaging in clinical practice is emerging and the use of this technology by optometrists in assessing patients with age-related macular degeneration is of interest. Therefore, this study explored contemporary, self-reported patterns of practice regarding age-related macular degeneration diagnosis and management using a cross-sectional survey of optometrists in Australia and New Zealand. Practising optometrists were surveyed on four key areas, namely, demographics, clinical skills and experience, assessment and management of age-related macular degeneration. Questions pertaining to self-rated competency, knowledge and attitudes used a five-point Likert scale. Completed responses were received from 127 and 87 practising optometrists in Australia and New Zealand, respectively. Advanced imaging showed greater variation in service delivery than traditional techniques (such as slitlamp funduscopy) and trended toward optical coherence tomography, which was routinely performed in age-related macular degeneration by 49 per cent of respondents. Optical coherence tomography was also associated with higher self-rated competency, knowledge and perceived relevance to practice than other modalities. Most respondents (93 per cent) indicated that they regularly applied patient symptoms, case history, visual function results and signs from traditional testing, when queried about their management of patients with age-related macular degeneration. Over half (63 per cent) also considered advanced imaging, while 31 per cent additionally considered all of these as well as the disease stage and clinical guidelines. Contrary to the evidence base, 68 and 34 per cent rated nutritional supplements as highly relevant or relevant in early age-related macular degeneration and normal aging changes, respectively. These results highlight the emergence of multimodal and advanced imaging (especially optical coherence tomography) in the assessment of age-related macular degeneration
In vivo effect of a self-etching primer on dentin.
Milia, E; Lallai, M R; García-Godoy, F
1999-08-01
To determine the ultrastructural aspects of the dentin collagen area in the cavity preparation floor produced in vivo after phosphoric acid acid-etching or after using Clearfil Liner Bond 2 self-etching primer (LB2 Primer). Twenty-four non-carious third molars scheduled for extraction from young adult patients (16-30 years old) were used. Conventional Class I cavities (+/- 2 mm deep) were prepared on the occlusal surfaces of all teeth using a cylindrical diamond bur on a high-speed handpiece with copious water spray. To avoid dehydration of the dentin, the smear layer-covered dentin was briefly air-dried for 2 seconds. Cavities were assigned at random to the following groups: Group A: Dentin etched for 15 seconds with 34% phosphoric acid, rinsed for 20 seconds and then briefly air-dried for 2 seconds with oil-free compressed air leaving the surfaces slightly moist. Group B: LB2 Primer was applied to the cavity surfaces for 30 seconds and then briefly air-dried to remove the solvent. Group C: The untreated dentin smear layer was used as a control. In all three groups, the cavities were filled incrementally with a resin-based composite (APX), light curing every increment for 40 seconds. After 30 minutes, the teeth were extracted atraumatically and the samples immediately prepared for evaluation with the transmission electron microscope. The use of a self-etching primer did not produce significant morphological changes in the moist dentin substrate. Adverse morphological conditions where observed when there was an excess water on the dentin surface. Phosphoric acid altered the collagen more severely than the self-etching primer.
Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders
Energy Technology Data Exchange (ETDEWEB)
Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.
2000-09-27
This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.
Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders
Energy Technology Data Exchange (ETDEWEB)
A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson
1998-12-10
This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.
Lou, Chao; Xiang, Guangheng; Weng, Qiaoyou; Chen, Zhaojie; Chen, Deheng; Wang, Qingqing; Zhang, Di; Zhou, Bin; He, Dengwei; Chen, Hongliang
2016-11-01
The purpose of this study was to investigate the association between menopause and severity of knee joint cartilage degeneration using a magnetic resonance imaging-based six-level grading system, with six cartilage surfaces, the medial and lateral femoral condyle, the femoral trochlea, the medial and lateral tibia plateau, and the patella. The study cohort comprised 860 healthy women (age 36-83 y), and 5,160 cartilage surfaces were analyzed. Age, weight, height, age at natural menopause, and years since menopause (YSM) were obtained. Cartilage degeneration was assessed using a magnetic resonance imaging-based six-level grading system. After removing the age, height, and weight effects, postmenopausal women had more severe cartilage degeneration than pre- and perimenopausal women (P 0.05). No significant difference was observed in lateral tibia plateau and lateral femoral condyle in postmenopausal women. Menopause is associated with cartilage degeneration of knee joint. After menopause, cartilage showed progressive severe degeneration that occurred in the first 25 YSM, suggesting estrogen deficiency might be a risk factor of cartilage degeneration of the knee joint. Further studies are needed to investigate whether age or menopause plays a more important role in the progression of cartilage degeneration in the knee joint.
Energy Technology Data Exchange (ETDEWEB)
Zhang, Xuan; Zhang, Xiaofeng; Yan, Yue; Zhong, Yanli; Li, Lei; Zhang, Guanli [Beijing Institute of Aeronautical Materials (BIAM), Haidian District, Beijing, 100095 (China)
2015-04-01
A silicone-based primer layer was developed to improve the adhesion and thermal stability of amorphous transparent indium zinc oxide (IZO) films on polycarbonate (PC). The IZO films deposited by direct current magnetron sputtering at room temperature on primer-treated and untreated PCs were evaluated ex situ in terms of surface morphology, adhesion, optical, and electrical properties during annealing at 120 C in air. Nano-scratch tests indicated the adhesion of IZO films on primer-treated substrates was superior to that on untreated PCs. This superior adhesion can be attributed to the strong Si-O-Si inorganic bonds abundant in the primer layer and better matches of the primer layer in the terms of thermal expansion to the IZO. Moreover, the electrical resistivity of IZO films prepared on primer-treated PCs remained stable during the annealing treatment, whereas those of IZO films on untreated PCs presented a continuously increasing trend, which was attributed to the decrease in carrier concentration that resulted from oxygen adsorption. (copyright 2015 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)
The macula is the part of the retina that distinguishes fine details at the center of the field of vision. Macular degeneration results from a partial breakdown of the insulating layer between the retina and the choroid layer of ...
Specific primer design of mitochondrial 12S rRNA for species identification in raw meats
Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.
2018-01-01
Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.
Beauchaine, Theodore P.
2009-01-01
Taxometric procedures provide an empirical means of determining which psychiatric disorders are typologically distinct from normal behavioral functioning. Although most disorders reflect extremes along continuously distributed behavioral traits, identifying those that are discrete has important implications for accurate diagnosis, effective treatment, early identification of risk, and improved understanding of etiology. This article provides (a) brief descriptions of the conceptual bases of several taxometric procedures, (b) example analyses using simulated data, and (c) strategies for avoiding common pitfalls that are often observed in taxometrics research. To date, most taxometrics studies have appeared in the adult psychopathology literature. It is hoped that this primer will encourage interested readers to extend taxometrics research to child and adolescent populations. PMID:18088222
Gold nanoparticle-assisted primer walking for closing the human chromosomal gap
DEFF Research Database (Denmark)
Li, H; Shi, B; Li, X
2013-01-01
The finished sequence of the human genome still contains 260 euchromatic gaps. All the PCR-based genome walking techniques used to close gaps have common limitations, such as low efficiency and low specificity. We herein describe a strategy to solve this problem by employing gold nanoparticles (Au......NPs) to improve the efficiency in primer walking amplification. We used this strategy to close a gap in human chromosome 5 containing a DNA stretch composed of the 12SAT repeat. The obtained gap sequence is highly conserved among several mammalian genomes. The demonstrated AuNP-assisted primer walking strategy...
Directory of Open Access Journals (Sweden)
Vasco Elbrecht
Full Text Available Metabarcoding is an emerging genetic tool to rapidly assess biodiversity in ecosystems. It involves high-throughput sequencing of a standard gene from an environmental sample and comparison to a reference database. However, no consensus has emerged regarding laboratory pipelines to screen species diversity and infer species abundances from environmental samples. In particular, the effect of primer bias and the detection limit for specimens with a low biomass has not been systematically examined, when processing samples in bulk. We developed and tested a DNA metabarcoding protocol that utilises the standard cytochrome c oxidase subunit I (COI barcoding fragment to detect freshwater macroinvertebrate taxa. DNA was extracted in bulk, amplified in a single PCR step, and purified, and the libraries were directly sequenced in two independent MiSeq runs (300-bp paired-end reads. Specifically, we assessed the influence of specimen biomass on sequence read abundance by sequencing 31 specimens of a stonefly species with known haplotypes spanning three orders of magnitude in biomass (experiment I. Then, we tested the recovery of 52 different freshwater invertebrate taxa of similar biomass using the same standard barcoding primers (experiment II. Each experiment was replicated ten times to maximise statistical power. The results of both experiments were consistent across replicates. We found a distinct positive correlation between species biomass and resulting numbers of MiSeq reads. Furthermore, we reliably recovered 83% of the 52 taxa used to test primer bias. However, sequence abundance varied by four orders of magnitudes between taxa despite the use of similar amounts of biomass. Our metabarcoding approach yielded reliable results for high-throughput assessments. However, the results indicated that primer efficiency is highly species-specific, which would prevent straightforward assessments of species abundance and biomass in a sample. Thus, PCR-based
Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.
Françoso, E; Arias, M C
2013-09-01
Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.
Motor axon excitability during Wallerian degeneration
DEFF Research Database (Denmark)
Moldovan, Mihai; Alvarez, Susana; Krarup, Christian
2008-01-01
Axonal loss and degeneration are major factors in determining long-term outcome in patients with peripheral nerve disorders or injury. Following loss of axonal continuity, the isolated nerve stump distal to the lesion undergoes Wallerian degeneration in several phases. In the initial 'latent' phase......, action potential propagation and structural integrity of the distal segment are maintained. The aim of this study was to investigate in vivo the changes in membrane function of motor axons during the 'latent' phase of Wallerian degeneration. Multiple indices of axonal excitability of the tibial nerve...
Total absorption by degenerate critical coupling
Energy Technology Data Exchange (ETDEWEB)
Piper, Jessica R., E-mail: jrylan@stanford.edu; Liu, Victor; Fan, Shanhui, E-mail: shanhui@stanford.edu [Ginzton Laboratory, Department of Electrical Engineering, Stanford University, Stanford, California 94305 (United States)
2014-06-23
We consider a mirror-symmetric resonator with two ports. We show that, when excited from a single port, complete absorption can be achieved through critical coupling to degenerate resonances with opposite symmetry. Moreover, any time two resonances with opposite symmetry are degenerate in frequency and absorption is always significantly enhanced. In contrast, when two resonances with the same symmetry are nearly degenerate, there is no absorption enhancement. We numerically demonstrate these effects using a graphene monolayer on top of a photonic crystal slab, illuminated from a single side in the near-infrared.
Many-Body Green Function of Degenerate Systems
International Nuclear Information System (INIS)
Brouder, Christian; Panati, Gianluca; Stoltz, Gabriel
2009-01-01
A rigorous nonperturbative adiabatic approximation of the evolution operator in the many-body physics of degenerate systems is derived. This approximation is used to solve the long-standing problem of the choice of the initial states of H 0 leading to eigenstates of H 0 +V for degenerate systems. These initial states are eigenstates of P 0 VP 0 , where P 0 is the projection onto a degenerate eigenspace of H 0 . This result is used to give the proper definition of the Green function, the statistical Green function and the nonequilibrium Green function of degenerate systems. The convergence of these Green functions is established.
Economics : pricing, demand, and economic efficiency : a primer.
2008-11-01
The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...
Antoniou, Grigoris; Harmelen, Frank van
2004-01-01
The development of the Semantic Web, with machine-readable content, has the potential to revolutionize the World Wide Web and its use. A Semantic Web Primer provides an introduction and guide to this still emerging field, describing its key ideas, languages, and technologies. Suitable for use as a
Degenerated differential pair with controllable transconductance
Mensink, Clemens; Mensink, Clemens H.J.; Nauta, Bram
1998-01-01
A differential pair with input transistors and provided with a variable degeneration resistor. The degeneration resistor comprises a series arrangement of two branches of coupled resistors which are shunted in mutually corresponding points by respective control transistors whose gates are
The use of a fluoropolymer containing primer to enhance adhesion of rotolined fluoropolymer coatings
Energy Technology Data Exchange (ETDEWEB)
Lech, L.M. [DuPont, Parkersburg, WV (United States)
1999-11-01
Fluoropolymers such as PFA and ETFE are often used in rotolining applications. A common source of failure for rotolined coatings is delamination from the metal substrate. Extensive thermal cycling of the coated part, permeation of the contained liquid to the substrate, or a combination of both thermal cycling and permeation causes this. Rotolined coatings are typically applied directly to the metal part. It has been found that applying an aqueous fluoropolymer based primer to the metal substrate prior to applying the rotolined resin increases the time before delamination is observed. The primer is applied by conventional spray techniques and can either be force dried at low temperature or air-dried under ambient conditions. The primer consists primarily of a fluoropolymer such as ETFE or PFA and a bonding agent such as polyamide-imide, polyphenylene sulfide, or polyether sulfone. After the primer is applied to the metal part, the fluoropolymer in the primer melt blends with the fluoropolymer rotolining resin during the rotolining process. The bonding agent enhances the adhesion of the entire coating system to the metal part. This extends the lifetime of the rotolined coatings.
Adhesion of epoxy primer to hydrotalcite conversion coated AA2024
Leggat, Robert Benton, III
Hydrotalcite-based (HT) conversion coatings are being developed as an environmentally benign alternative to chromate conversion coatings (CCC). Accelerated exposure tests were conducted on epoxy primed, HT-modified AA2024 to gauge service performance. HT-based conversion coatings did not perform as well as the CCC when used with an epoxy primer. The current HT chemistries are optimized for stand-alone corrosion protection, however additional research into the primer/HT interactions is necessary before they can be implemented within a coating scheme. The relative contribution of mechanical and physico-chemical interactions in controlling adhesion has been investigated in this study. Practical adhesion tests were used to assess the dry and wet bond strength of epoxy primer on HT coatings using the pull-off tensile strength (POTS) as the figure of merit. The practical adhesion of HT coated samples generally fell between that observed for the CCC and bare AA2024. Laboratory testing was done to assess the physical and chemical properties of HT coatings. Contact angle measurements were performed using powders representative of different HT chemistries to evaluate the dispersive and acid-base character of the surface. The wet POTS correlated with the electrodynamic (dipole + dispersive) parameter of the surface tension. The HT surfaces were found to be predominantly basic. Given the basicity of epoxy, these results indicate that increasing the acidic character of HT coatings may increase the adhesion performance. This was supported by electrokinetic measurements in which the dry POTS was found to increase with decreasing conversion coating iso-electric point. The correlations with the dry and wet state adhesion are interpreted as indicating that dry state adhesion is optimized by minimizing unfavorable polar interactions between the basic epoxy and HT interfaces. Wet state adhesion, where polar interactions are disrupted, is dictated by non-polar bonding. FTIR
Walraevens, Joris; Liu, Baoge; Meersschaert, Joke; Demaerel, Philippe; Delye, Hans; Depreitere, Bart; Vander Sloten, Jos; Goffin, Jan
2009-03-01
Degeneration of intervertebral discs and facet joints is one of the most frequently encountered spinal disorders. In order to describe and quantify degeneration and evaluate a possible relationship between degeneration and biomechanical parameters, e.g., the intervertebral range of motion and intradiscal pressure, a scoring system for degeneration is mandatory. However, few scoring systems for the assessment of degeneration of the cervical spine exist. Therefore, two separate objective scoring systems to qualitatively and quantitatively assess the degree of cervical intervertebral disc and facet joint degeneration were developed and validated. The scoring system for cervical disc degeneration consists of three variables which are individually scored on neutral lateral radiographs: "height loss" (0-4 points), "anterior osteophytes" (0-3 points) and "endplate sclerosis" (0-2 points). The scoring system for facet joint degeneration consists of four variables which are individually scored on neutral computed tomography scans: "hypertrophy" (0-2 points), "osteophytes" (0-1 point), "irregularity" on the articular surface (0-1 point) and "joint space narrowing" (0-1 point). Each variable contributes with varying importance to the overall degeneration score (max 9 points for the scoring system of cervical disc degeneration and max 5 points for facet joint degeneration). Degeneration of 20 discs and facet joints of 20 patients was blindly assessed by four raters: two neurosurgeons (one senior and one junior) and two radiologists (one senior and one junior), firstly based on first subjective impression and secondly using the scoring systems. Measurement errors and inter- and intra-rater agreement were determined. The measurement error of the scoring system for cervical disc degeneration was 11.1 versus 17.9% of the subjective impression results. This scoring system showed excellent intra-rater agreement (ICC = 0.86, 0.75-0.93) and excellent inter-rater agreement (ICC = 0
Directory of Open Access Journals (Sweden)
Joseph-Alexander Verreet
2011-01-01
Full Text Available Early detection of infection is very important for efficient management of Mycosphaerella graminicola leaf blotch. To monitor and quantify the occurrence of this fungus during the growing season, a diagnostic method based on real-time PCR was developed. Standard and real-time PCR assays were developed using SYBR Green chemistry to quantify M. graminicola in vitro or in wheat samples. Microsatellite dinucleotide specific-primers were designed based on microsatellite repeats of sequences present in the genome of M. graminicola. Specificity was checked by analyzing DNA of 55 M. graminicola isolates obtained from different geographical origins. The method appears to be highly specific for detecting M. graminicola; no fluorescent signals were observed from 14 other closely related taxa. Primer (CT 7 G amplified a specific amplicon of 570 bp from all M. graminicola isolates. The primers did not amplify DNA extracted from 14 other fungal species. The approximate melting temperature (Tm of the (CT 7 G primer was 84.2 °C. The detection limit of the real-time PCR assay with the primer sets (CT 7 G is 10 fg/25 µL, as compared to 10 pg/25 µL using conventional PCR technology. From symptomless leaves, a PCR fragment could be generated two days after inoculation. Both conventional and real-time PCR could successfully detect the fungus from artificially inoculated wheat leaves. However, real-time PCR appeared much more sensitive than conventional PCR. The developed quantitative real-time PCR method proved to be rapid, sensitive, specific, cost-effective and reliable for the identification and quantification of M. graminicola in wheat.
Energy Technology Data Exchange (ETDEWEB)
Dan Arthur; Bruce Langhus; Jon Seekins
2005-05-25
During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of
Martino, Amanda J.; Rhodes, Matthew E.; Biddle, Jennifer F.; Brandt, Leah D.; Tomsho, Lynn P.; House, Christopher H.
2011-01-01
A degenerate polymerase chain reaction (PCR)-based method of whole-genome amplification, designed to work fluidly with 454 sequencing technology, was developed and tested for use on deep marine subsurface DNA samples. While optimized here for use with Roche 454 technology, the general framework presented may be applicable to other next generation sequencing systems as well (e.g., Illumina, Ion Torrent). The method, which we have called random amplification metagenomic PCR (RAMP), involves the use of specific primers from Roche 454 amplicon sequencing, modified by the addition of a degenerate region at the 3′ end. It utilizes a PCR reaction, which resulted in no amplification from blanks, even after 50 cycles of PCR. After efforts to optimize experimental conditions, the method was tested with DNA extracted from cultured E. coli cells, and genome coverage was estimated after sequencing on three different occasions. Coverage did not vary greatly with the different experimental conditions tested, and was around 62% with a sequencing effort equivalent to a theoretical genome coverage of 14.10×. The GC content of the sequenced amplification product was within 2% of the predicted values for this strain of E. coli. The method was also applied to DNA extracted from marine subsurface samples from ODP Leg 201 site 1229 (Peru Margin), and results of a taxonomic analysis revealed microbial communities dominated by Proteobacteria, Chloroflexi, Firmicutes, Euryarchaeota, and Crenarchaeota, among others. These results were similar to those obtained previously for those samples; however, variations in the proportions of taxa identified illustrates well the generally accepted view that community analysis is sensitive to both the amplification technique used and the method of assigning sequences to taxonomic groups. Overall, we find that RAMP represents a valid methodology for amplifying metagenomes from low-biomass samples. PMID:22319519
Directory of Open Access Journals (Sweden)
Pérez-Rey David
2010-08-01
Full Text Available Abstract Background Primer and probe sequences are the main components of nucleic acid-based detection systems. Biologists use primers and probes for different tasks, some related to the diagnosis and prescription of infectious diseases. The biological literature is the main information source for empirically validated primer and probe sequences. Therefore, it is becoming increasingly important for researchers to navigate this important information. In this paper, we present a four-phase method for extracting and annotating primer/probe sequences from the literature. These phases are: (1 convert each document into a tree of paper sections, (2 detect the candidate sequences using a set of finite state machine-based recognizers, (3 refine problem sequences using a rule-based expert system, and (4 annotate the extracted sequences with their related organism/gene information. Results We tested our approach using a test set composed of 297 manuscripts. The extracted sequences and their organism/gene annotations were manually evaluated by a panel of molecular biologists. The results of the evaluation show that our approach is suitable for automatically extracting DNA sequences, achieving precision/recall rates of 97.98% and 95.77%, respectively. In addition, 76.66% of the detected sequences were correctly annotated with their organism name. The system also provided correct gene-related information for 46.18% of the sequences assigned a correct organism name. Conclusions We believe that the proposed method can facilitate routine tasks for biomedical researchers using molecular methods to diagnose and prescribe different infectious diseases. In addition, the proposed method can be expanded to detect and extract other biological sequences from the literature. The extracted information can also be used to readily update available primer/probe databases or to create new databases from scratch.
Formation of Degenerate Band Gaps in Layered Systems
Directory of Open Access Journals (Sweden)
Alexey P. Vinogradov
2012-06-01
Full Text Available In the review, peculiarities of spectra of one-dimensional photonic crystals made of anisotropic and/or magnetooptic materials are considered. The attention is focused on band gaps of a special type—the so called degenerate band gaps which are degenerate with respect to polarization. Mechanisms of formation and properties of these band gaps are analyzed. Peculiarities of spectra of photonic crystals that arise due to the linkage between band gaps are discussed. Particularly, it is shown that formation of a frozen mode is caused by linkage between Brillouin and degenerate band gaps. Also, existence of the optical Borrmann effect at the boundaries of degenerate band gaps and optical Tamm states at the frequencies of degenerate band gaps are analyzed.
Quick spacecraft charging primer
International Nuclear Information System (INIS)
Larsen, Brian Arthur
2014-01-01
This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.
Primer design for a prokaryotic differential display RT-PCR.
Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H
1997-05-01
We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.
Laenderyggens degeneration og radiologi
DEFF Research Database (Denmark)
Jacobsen, Steffen; Gosvig, Kasper Kjaerulf; Sonne-Holm, Stig
2006-01-01
Low back pain (LBP) is one of the most common conditions, and at the same time one of the most complex nosological entities. The lifetime prevalence is approximately 80%, and radiological features of lumbar degeneration are almost universal in adults. The individual risk factors for LBP and signi...... is cyclic: exacerbations relieved by asymptomatic periods. New imaging modalities, including the combination of MR imaging and multiplanar 3-D CT scans, have broadened our awareness of possible pain-generating degenerative processes of the lumbar spine other than disc degeneration....
Lattice degeneration of the retina and retinal detachment.
Semes, L P
1992-01-01
Lattice retinal degeneration is considered the most significant peripheral retinal disorder potentially predisposing to retinal breaks and retinal detachment. Lattice degeneration affects the vitreous and inner retinal layers with secondary changes as deep as the retinal pigment epithelium and perhaps the choriocapillaris. Variations in clinical appearance are the rule; geographically, lattice lesions favor the vertical meridians between the equator and the ora serrata. Lattice degeneration begins early in life and has been reported in sequential generations of the same family. Along with its customary bilateral occurrence, lattice shares other characteristics of a dystrophy. The association between the vitreous and retina in lattice lesions may be responsible for the majority of lattice-induced retinal detachments. The tumultuous event of posterior vitreous separation in the presence of abnormally strong vitreoretinal adherence is the trigger for a retinal tear that, in turn, may lead to retinal detachment. Although retinal holes in young patients with lattice degeneration may play a role in the evolution of retinal detachment, the clinical course of lattice degeneration seems to be one of dormancy rather than of progressive change. This discussion outlines the pathophysiology of lattice retinal degeneration and the relationship of pathophysiology to clinical presentation. The epidemiology of lattice degeneration is summarized, as are the possible precursors to retinal detachment. A clinical characterization of the natural history of lattice degeneration is offered, and interventions for complications are described. To conclude, management strategies from a primary-care standpoint are reviewed.
Lou, Chao; Chen, Hongliang; Mei, Liangwei; Yu, Weiyang; Zhu, Kejun; Liu, Feijun; Chen, Zhenzhong; Xiang, Guangheng; Chen, Minjiang; Weng, Qiaoyou; He, Dengwei
2017-10-01
The aim of this study was to revisit and further investigate the association between menopause and disc degeneration in the lumbar spine using a magnetic resonance imaging-based eight-level grading system. This study cohort comprised of 1,566 women and 1,382 age-matched men who were admitted for low back pain from June 2013 to October 2016. Data on age, weight, height, body mass index, age at natural menopause, and years since menopause (YSM) were obtained. Lumbar disc degeneration was assessed using a magnetic resonance imaging-based eight-level grading system. After adjustment for the confounding factors of age, height, and weight, young age-matched men were more susceptible to disc degeneration than premenopausal women (P menopause, postmenopausal women had a significant tendency to develop more severe disc degeneration than their age-matched men (P 0.05). Menopause is associated with lumbar disc degeneration. The association occurred in the first 15 YSM, suggesting estrogen deficiency might be a risk factor of disc degeneration of the lumbar spine. Further studies need to be carried out for deciding whether age or menopause plays a more important role in the progression of disc degeneration in the lumbar spine.
Climate Change, Health, and Communication: A Primer.
Chadwick, Amy E
2016-01-01
Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.
Degenerate conformal theories on higher-genus surfaces
International Nuclear Information System (INIS)
Gerasimov, A.A.
1989-01-01
Two-dimensional degenerate field theories on higher-genus surfaces are investigated. Objects are built on the space of moduli, whose linear combinations are hypothetically conformal blocks in degenerate theories
Marketing Information Products and Services : A Primer for ...
International Development Research Centre (IDRC) Digital Library (Canada)
Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Couverture du livre Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Directeur(s) : Abhinandan K. Jain, Ashok Jambhekar, T.P.Rama Rao et S. Sreenivas Rao. Maison(s) ...
Accelerator-based neutron source using a cold deuterium target with degenerate electrons
Directory of Open Access Journals (Sweden)
R. E. Phillips
2013-07-01
Full Text Available A neutron generator is considered in which a beam of tritons is incident on a hypothetical cold deuterium target with degenerate electrons. The energy efficiency of neutron generation is found to increase substantially with electron density. Recent reports of potential targets are discussed.
An environmentally acceptable primer for galvanized steel: Formulation and evaluation by SVET
Energy Technology Data Exchange (ETDEWEB)
Simoes, A.M.P., E-mail: alda.simoes@ist.utl.p [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Carbonari, R.O.; Di Sarli, A.R.; Amo, B. del [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Romagnoli, R., E-mail: estelectro@cidepint.gov.a [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal)
2011-01-15
Research highlights: {yields} Chromates can be replaced successfully by aluminium phosphosilicate in paint systems. {yields} The solvents of the primer are eco-friendly ones. {yields} The primer adheres on galvanized steel and allows top-coating. {yields} The binder of the primer is compatible with other binders for top-coating. - Abstract: The object of this paper was to formulate a two-pack wash primer employing aluminium phosphosilicate as active anticorrosive pigment instead of basic zinc chromate. The anticorrosive action of the primer was evaluated by the polarization technique and the scanning vibrating electrode technique (SVET). The exposed surface was then examined by scanning electron microscopy (SEM) and the surface composition determined by energy dispersive X-ray (EDX) analysis. The primer was finally integrated in a complete paint scheme whose anticorrosive performance was evaluated by the salt spray chamber and electrochemical impedance spectroscopy. The adhesion of the primer plus a painting system was also evaluated by standard ASTM D 3359-90 test method. The wash primer pigmented with zinc chromate was used as reference. Results indicated that basic zinc chromate could be replaced by the more eco-friendly wash-primer containing aluminium phosphosilicate.
Microsatellite primers for fungus-growing ants
DEFF Research Database (Denmark)
Villesen, Palle; Gertsch, P J; Boomsma, JJ
2002-01-01
We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....
Microsatellite Primers for Fungus-Growing Ants
DEFF Research Database (Denmark)
Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)
2002-01-01
We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....
Progress of stem/progenitor cell-based therapy for retinal degeneration.
Tang, Zhimin; Zhang, Yi; Wang, Yuyao; Zhang, Dandan; Shen, Bingqiao; Luo, Min; Gu, Ping
2017-05-10
Retinal degeneration (RD), such as age-related macular degeneration (AMD) and retinitis pigmentosa, is one of the leading causes of blindness. Presently, no satisfactory therapeutic options are available for these diseases principally because the retina and retinal pigmented epithelium (RPE) do not regenerate, although wet AMD can be prevented from further progression by anti-vascular endothelial growth factor therapy. Nevertheless, stem/progenitor cell approaches exhibit enormous potential for RD treatment using strategies mainly aimed at the rescue and replacement of photoreceptors and RPE. The sources of stem/progenitor cells are classified into two broad categories in this review, which are (1) ocular-derived progenitor cells, such as retinal progenitor cells, and (2) non-ocular-derived stem cells, including embryonic stem cells, induced pluripotent stem cells, and mesenchymal stromal cells. Here, we discuss in detail the progress in the study of four predominant stem/progenitor cell types used in animal models of RD. A short overview of clinical trials involving the stem/progenitor cells is also presented. Currently, stem/progenitor cell therapies for RD still have some drawbacks such as inhibited proliferation and/or differentiation in vitro (with the exception of the RPE) and limited long-term survival and function of grafts in vivo. Despite these challenges, stem/progenitor cells represent the most promising strategy for RD treatment in the near future.
Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders; FINAL
International Nuclear Information System (INIS)
Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.
2000-01-01
This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums
Degenerate r-Stirling Numbers and r-Bell Polynomials
Kim, T.; Yao, Y.; Kim, D. S.; Jang, G.-W.
2018-01-01
The purpose of this paper is to exploit umbral calculus in order to derive some properties, recurrence relations, and identities related to the degenerate r-Stirling numbers of the second kind and the degenerate r-Bell polynomials. Especially, we will express the degenerate r-Bell polynomials as linear combinations of many well-known families of special polynomials.
[Peripheral retinal degenerations--treatment recommendations].
Joussen, A M; Kirchhof, B
2004-10-01
This report reviews the clinical appearance of degenerative diseases of the peripheral retina in relationship to the risk of developing a rhegmatogenous retinal detachment. We present recommendations for preventive treatment in eyes at increased risk of developing retinal detachment. Retinal degenerations are common lesions involving the peripheral retina but most of them are clinically insignificant. Lattice degeneration, degenerative retinoschisis, cystic retinal tufts, and very rarely zonular traction tufts can result in rhegmatogenous retinal detachment. Therefore, these lesions have been considered for prophylactic treatment; however, adequate studies have not been performed to date. Most of the peripheral retinal degenerations may not require treatment except in rare, high-risk situations. According to current knowledge there is no higher incidence of secondary pucker or other side effects after laser coagulation. Therefore, generous laser indication is recommended if risk factors apply.
Screening for Residual Disease in Pediatric Burkitt Lymphoma Using Consensus Primer Pools
Directory of Open Access Journals (Sweden)
Melissa Agsalda
2009-01-01
Full Text Available Assessing molecular persistent or minimal residual disease (PD/MRD in childhood Burkitt lymphoma (BL is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs. Because BL is characterized by rearranged immunoglobulin heavy chain (IgVH genes, IgVH primer pools from IgVH1–IgVH7 regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgVH primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgVH primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.
Screening for residual disease in pediatric burkitt lymphoma using consensus primer pools.
Agsalda, Melissa; Kusao, Ian; Troelstrup, David; Shiramizu, Bruce
2009-01-01
Assessing molecular persistent or minimal residual disease (PD/MRD) in childhood Burkitt lymphoma (BL) is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs). Because BL is characterized by rearranged immunoglobulin heavy chain (IgV(H)) genes, IgV(H) primer pools from IgV(H1)-IgV(H7) regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgV(H) primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgV(H) primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.
A physicists guide to The Los Alamos Primer
International Nuclear Information System (INIS)
Reed, B Cameron
2016-01-01
In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer , which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons. (invited comment)
Relationship between facet tropism and facet joint degeneration in the sub-axial cervical spine
Directory of Open Access Journals (Sweden)
Xin Rong
2017-02-01
Full Text Available Abstract Background Facet tropism is the angular asymmetry between the left and right facet joint orientation. Although debatable, facet tropism was suggested to be associated with disc degeneration, facet degeneration and degenerative spondylolisthesis in the lumbar spine. The purpose of this study was to explore the relationship between facet tropism and facet degeneration in the sub-axial cervical spine. Methods A total of 200 patients with cervical spondylosis were retrospectively analyzed. Facet degeneration was categorized into 4 grade: grade I, normal; grade II, degenerative changes including joint space narrowing, cyst formation, small osteophytes (3 mm without fusion of the joint; grade IV, bony fusion of the facet joints. Facet orientations and facet tropisms with respect to the transverse, sagittal and coronal plane were calculated from the reconstructed cervical spine, which was based on the axial CT scan images. The paired facet joints were then categorized into three types: symmetric, moderated tropism and severe tropism. Univariate and multivariate analysis were performed to evaluate the relationship between any demographic and anatomical factor and facet degeneration. Results The mean age of enrolled patients was 46.23 years old (ranging from 30 to 64 years old. There were 114 males and 86 females. The degrees of facet degeneration varied according to cervical levels and ages. Degenerated facet joints were most common at C2-C3 level and more common in patients above 50 years old. The facet orientations were also different from level to level. By univariate analysis, genders, ages, cervical levels, facet orientations and facet tropisms were all significantly different between the normal facets and degenerated facets. However, results from multivariate logistic regression suggested only age and facet tropism with respect to the sagittal plane were related to facet degeneration. Conclusion Facet degeneration were more common at
SINGLE-DEGENERATE TYPE Ia SUPERNOVAE ARE PREFERENTIALLY OVERLUMINOUS
International Nuclear Information System (INIS)
Fisher, Robert; Jumper, Kevin
2015-01-01
Recent observational and theoretical progress has favored merging and helium-accreting sub-Chandrasekhar mass white dwarfs (WDs) in the double-degenerate and the double-detonation channels, respectively, as the most promising progenitors of normal Type Ia supernovae (SNe Ia). Thus the fate of rapidly accreting Chandrasekhar mass WDs in the single-degenerate channel remains more mysterious then ever. In this paper, we clarify the nature of ignition in Chandrasekhar-mass single-degenerate SNe Ia by analytically deriving the existence of a characteristic length scale which establishes a transition from central ignitions to buoyancy-driven ignitions. Using this criterion, combined with data from three-dimensional simulations of convection and ignition, we demonstrate that the overwhelming majority of ignition events within Chandrasekhar-mass WDs in the single-degenerate channel are buoyancy-driven, and consequently lack a vigorous deflagration phase. We thus infer that single-degenerate SNe Ia are generally expected to lead to overluminous 1991T-like SNe Ia events. We establish that the rates predicted from both the population of supersoft X-ray sources (SSSs) and binary population synthesis models of the single-degenerate channel are broadly consistent with the observed rates of overluminous SNe Ia, and suggest that the population of SSSs are the dominant stellar progenitors of SNe 1991T-like events. We further demonstrate that the single-degenerate channel contribution to the normal and failed 2002cx-like rates is not likely to exceed 1% of the total SNe Ia rate. We conclude with a range of observational tests of overluminous SNe Ia which will either support or strongly constrain the single-degenerate scenario
indCAPS: A tool for designing screening primers for CRISPR/Cas9 mutagenesis events.
Hodgens, Charles; Nimchuk, Zachary L; Kieber, Joseph J
2017-01-01
Genetic manipulation of organisms using CRISPR/Cas9 technology generally produces small insertions/deletions (indels) that can be difficult to detect. Here, we describe a technique to easily and rapidly identify such indels. Sequence-identified mutations that alter a restriction enzyme recognition site can be readily distinguished from wild-type alleles using a cleaved amplified polymorphic sequence (CAPS) technique. If a restriction site is created or altered by the mutation such that only one allele contains the restriction site, a polymerase chain reaction (PCR) followed by a restriction digest can be used to distinguish the two alleles. However, in the case of most CRISPR-induced alleles, no such restriction sites are present in the target sequences. In this case, a derived CAPS (dCAPS) approach can be used in which mismatches are purposefully introduced in the oligonucleotide primers to create a restriction site in one, but not both, of the amplified templates. Web-based tools exist to aid dCAPS primer design, but when supplied sequences that include indels, the current tools often fail to suggest appropriate primers. Here, we report the development of a Python-based, species-agnostic web tool, called indCAPS, suitable for the design of PCR primers used in dCAPS assays that is compatible with indels. This tool should have wide utility for screening editing events following CRISPR/Cas9 mutagenesis as well as for identifying specific editing events in a pool of CRISPR-mediated mutagenesis events. This tool was field-tested in a CRISPR mutagenesis experiment targeting a cytokinin receptor (AHK3) in Arabidopsis thaliana. The tool suggested primers that successfully distinguished between wild-type and edited alleles of a target locus and facilitated the isolation of two novel ahk3 null alleles. Users can access indCAPS and design PCR primers to employ dCAPS to identify CRISPR/Cas9 alleles at http://indcaps.kieber.cloudapps.unc.edu/.
[Lattice degeneration of the peripheral retina: ultrastructural study].
Bec, P; Malecaze, F; Arne, J L; Mathis, A
1985-01-01
The ultrastructural study of a case of snail track degeneration shows the presence of lipid inclusions in both the glial and the macrophage cells in every layer of the retina, and the existence of intraretinal fibers different from collagen fibers appearing to be glial filaments similar to those found in astrocytic gliomes and to the Rosenthal fibers observed in senile nervous cells. Other features were thinning of the retina and absence of blood vessels in the retina. There are no abnormalities of the vitreo-retinal juncture. All the lesions are in agreement with those observed by Daicker [Ophthalmologica, Basel 165: 360-365, 1972; Klin. Mbl. Augenheilk. 172: 581-583, 1978] with some differences, however. They are different from those found in lattice degeneration. They show that snail track degeneration is a specific form of peripheral retinal degeneration which is quite different from lattice degeneration and must not be considered similar.
Quantitative OCT and MRI biomarkers for the differentiation of cartilage degeneration
International Nuclear Information System (INIS)
Nebelung, Sven; Brill, Nicolai; Tingart, Markus; Jahr, Holger; Pufe, Thomas; Kuhl, Christiane; Truhn, Daniel
2016-01-01
To evaluate the usefulness of quantitative parameters obtained by optical coherence tomography (OCT) and magnetic resonance imaging (MRI) in the comprehensive assessment of human articular cartilage degeneration. Human osteochondral samples of variable degeneration (n = 45) were obtained from total knee replacements and assessed by MRI sequences measuring T1, T1ρ, T2 and T2* relaxivity and by OCT-based quantification of irregularity (OII, optical irregularity index), homogeneity (OHI, optical homogeneity index) and attenuation (OAI, optical attenuation index). Samples were also assessed macroscopically (Outerbridge classification) and histologically (Mankin classification) as grade-0 (Mankin scores 0-4)/grade-I (scores 5-8)/grade-II (scores 9-10)/grade-III (score 11-14). After data normalisation, differences between Mankin grades and correlations between imaging parameters were assessed using ANOVA and Tukey's post-hoc test and Spearman's correlation coefficients, respectively. Sensitivities and specificities in the detection of Mankin grade-0 were calculated. Significant degeneration-related increases were found for T2 and OII and decreases for OAI, while T1, T1ρ, T2* or OHI did not reveal significant changes in relation to degeneration. A number of significant correlations between imaging parameters and histological (sub)scores were found, in particular for T2 and OII. Sensitivities and specificities in the detection of Mankin grade-0 were highest for OHI/T1 and OII/T1ρ, respectively. Quantitative OCT and MRI techniques seem to complement each other in the comprehensive assessment of cartilage degeneration. Sufficiently large structural and compositional changes in the extracellular matrix may thus be parameterized and quantified, while the detection of early degeneration remains challenging. (orig.)
Quantitative OCT and MRI biomarkers for the differentiation of cartilage degeneration
Energy Technology Data Exchange (ETDEWEB)
Nebelung, Sven [Aachen University Hospital, Department of Orthopaedics, Aachen (Germany); Institute of Anatomy and Cell Biology, RWTH, Aachen (Germany); Brill, Nicolai [Fraunhofer Institute for Production Technology, Aachen (Germany); Tingart, Markus; Jahr, Holger [Aachen University Hospital, Department of Orthopaedics, Aachen (Germany); Pufe, Thomas [Institute of Anatomy and Cell Biology, RWTH, Aachen (Germany); Kuhl, Christiane; Truhn, Daniel [Aachen University Hospital, Department of Diagnostic and Interventional Radiology, Aachen (Germany)
2016-04-15
To evaluate the usefulness of quantitative parameters obtained by optical coherence tomography (OCT) and magnetic resonance imaging (MRI) in the comprehensive assessment of human articular cartilage degeneration. Human osteochondral samples of variable degeneration (n = 45) were obtained from total knee replacements and assessed by MRI sequences measuring T1, T1ρ, T2 and T2* relaxivity and by OCT-based quantification of irregularity (OII, optical irregularity index), homogeneity (OHI, optical homogeneity index) and attenuation (OAI, optical attenuation index). Samples were also assessed macroscopically (Outerbridge classification) and histologically (Mankin classification) as grade-0 (Mankin scores 0-4)/grade-I (scores 5-8)/grade-II (scores 9-10)/grade-III (score 11-14). After data normalisation, differences between Mankin grades and correlations between imaging parameters were assessed using ANOVA and Tukey's post-hoc test and Spearman's correlation coefficients, respectively. Sensitivities and specificities in the detection of Mankin grade-0 were calculated. Significant degeneration-related increases were found for T2 and OII and decreases for OAI, while T1, T1ρ, T2* or OHI did not reveal significant changes in relation to degeneration. A number of significant correlations between imaging parameters and histological (sub)scores were found, in particular for T2 and OII. Sensitivities and specificities in the detection of Mankin grade-0 were highest for OHI/T1 and OII/T1ρ, respectively. Quantitative OCT and MRI techniques seem to complement each other in the comprehensive assessment of cartilage degeneration. Sufficiently large structural and compositional changes in the extracellular matrix may thus be parameterized and quantified, while the detection of early degeneration remains challenging. (orig.)
Chinchilla-Brenes, Sonia; Sánchez-Oller, Sylvia
2001-01-01
Proyecto de Investigación El problema de la deserción estudiantil es un fenómeno mundial que involucra principalmente a alumnos de primer ingreso a los centros educativos y de manera particular a las instituciones de educación superior las cuales reportan índices de deserción de alrededor del 30% en el primer año. Ante esta situación se hace necesaria la atención de la población de primer ingreso con programas específicos que acompañen a los y las estudiantes en este proceso de ajuste al m...
Primer Extension Mutagenesis Powered by Selective Rolling Circle Amplification
Huovinen, Tuomas; Brockmann, Eeva-Christine; Akter, Sultana; Perez-Gamarra, Susan; Ylä-Pelto, Jani; Liu, Yuan; Lamminmäki, Urpo
2012-01-01
Primer extension mutagenesis is a popular tool to create libraries for in vitro evolution experiments. Here we describe a further improvement of the method described by T.A. Kunkel using uracil-containing single-stranded DNA as the template for the primer extension by additional uracil-DNA glycosylase treatment and rolling circle amplification (RCA) steps. It is shown that removal of uracil bases from the template leads to selective amplification of the nascently synthesized circular DNA strand carrying the desired mutations by phi29 DNA polymerase. Selective RCA (sRCA) of the DNA heteroduplex formed in Kunkel's mutagenesis increases the mutagenesis efficiency from 50% close to 100% and the number of transformants 300-fold without notable diversity bias. We also observed that both the mutated and the wild-type DNA were present in at least one third of the cells transformed directly with Kunkel's heteroduplex. In contrast, the cells transformed with sRCA product contained only mutated DNA. In sRCA, the complex cell-based selection for the mutant strand is replaced with the more controllable enzyme-based selection and less DNA is needed for library creation. Construction of a gene library of ten billion members is demonstrated with the described method with 240 nanograms of DNA as starting material. PMID:22355397
RUCS: Rapid identification of PCR primers for unique core sequences
DEFF Research Database (Denmark)
Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik
2017-01-01
Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...
Human disc degeneration is associated with increased MMP 7 expression.
Le Maitre, C L; Freemont, A J; Hoyland, J A
2006-01-01
During intervertebral disc (IVD) degeneration, normal matrix synthesis decreases and degradation of disc matrix increases. A number of proteases that are increased during disc degeneration are thought to be involved in its pathogenesis. Matrix metalloproteinase 7 (MMP 7) (Matrilysin, PUMP-1) is known to cleave the major matrix molecules found within the IVD, i.e., the proteoglycan aggrecan and collagen type II. To date, however, it is not known how its expression changes with degeneration or its exact location. We investigated the localization of MMP 7 in human, histologically graded, nondegenerate, degenerated and prolapsed discs to ascertain whether MMP 7 is up-regulated during disc degeneration. Samples of human IVD tissue were fixed in neutral buffered formalin, embedded in paraffin, and sections stained with hematoxylin and eosin to score the degree of morphological degeneration. Immunohistochemistry was performed to localize MMP 7 in 41 human IVDs with varying degrees of degeneration. We found that the chondrocyte-like cells of the nucleus pulposus and inner annulus fibrosus were MMP 7 immunopositive; little immunopositivity was observed in the outer annulus. Nondegenerate discs showed few immunopositive cells. A significant increase in the proportion of MMP 7 immunopositive cells was seen in the nucleus pulposus of discs classified as showing intermediate levels of degeneration and a further increase was seen in discs with severe degeneration. Prolapsed discs showed more MMP 7 immunopositive cells compared to nondegenerated discs, but fewer than those seen in cases of severe degeneration.
Do we need primer for orthodontic bonding? A randomized controlled trial.
Nandhra, Sarabjit Singh; Littlewood, Simon J; Houghton, Nadine; Luther, Friedy; Prabhu, Jagadish; Munyombwe, Theresa; Wood, Simon R
2015-04-01
To evaluate the clinical performance of APC™II Victory Series™ (3M Unitek) brackets in direct orthodontic bonding with and without the use of primer. A single-operator, two-centre prospective, non-inferiority randomized controlled clinical trial. The Orthodontic departments at the Leeds Dental Institute and St Luke's Hospital, Bradford, UK. Ethical approval was granted by Leeds (East) Research Ethics Committee on 18th of December 2009 (Reference 09/H1306/102). The protocol was not published prior to trial commencement. Ninety-two patients requiring orthodontic treatment with fixed appliances were randomly allocated to the control (bonded with primer) or test groups (bonded without primer). Patients were randomly allocated to either the control or experimental group. This was performed by preparing opaque numbered sealed envelopes in advance using a random numbers table generated by a computer by an independent third party . Once the envelopes were opened, blinding of the operator and the patient was no longer possible due to the nature of the intervention. Patients were approached for inclusion in the trial if they qualified for NHS orthodontic treatment requiring fixed appliances and had no previous orthodontic treatment. Number of bracket failures, time to bond-up appliances, and the adhesive remnant index (ARI) when bracket failure occurred, over a 12-month period Failure rate with primer was 11.1 per cent and without primer was 15.8 per cent. Bonding without primer was shown statistically to be non-inferior to bonding with primer odds ratio 0.95-2.25 (P = 0.08). Mean difference in bond-up time per bracket was 0.068 minutes (4 seconds), which was not statistically significant (P = 0.402). There was a statistically significant difference in the Adhesive Remnant Index - ARI 0 with primer 49.4 per cent, no primer 76.5 per cent, (P failure rate of 2% to be clinically significant. When bonding with APC™II Victory Series™ brackets without primer was shown
Notochord Cells in Intervertebral Disc Development and Degeneration
McCann, Matthew R.; Séguin, Cheryle A.
2016-01-01
The intervertebral disc is a complex structure responsible for flexibility, multi-axial motion, and load transmission throughout the spine. Importantly, degeneration of the intervertebral disc is thought to be an initiating factor for back pain. Due to a lack of understanding of the pathways that govern disc degeneration, there are currently no disease-modifying treatments to delay or prevent degenerative disc disease. This review presents an overview of our current understanding of the developmental processes that regulate intervertebral disc formation, with particular emphasis on the role of the notochord and notochord-derived cells in disc homeostasis and how their loss can result in degeneration. We then describe the role of small animal models in understanding the development of the disc and their use to interrogate disc degeneration and associated pathologies. Finally, we highlight essential development pathways that are associated with disc degeneration and/or implicated in the reparative response of the tissue that might serve as targets for future therapeutic approaches. PMID:27252900
Notochord Cells in Intervertebral Disc Development and Degeneration
Directory of Open Access Journals (Sweden)
Matthew R. McCann
2016-01-01
Full Text Available The intervertebral disc is a complex structure responsible for flexibility, multi-axial motion, and load transmission throughout the spine. Importantly, degeneration of the intervertebral disc is thought to be an initiating factor for back pain. Due to a lack of understanding of the pathways that govern disc degeneration, there are currently no disease-modifying treatments to delay or prevent degenerative disc disease. This review presents an overview of our current understanding of the developmental processes that regulate intervertebral disc formation, with particular emphasis on the role of the notochord and notochord-derived cells in disc homeostasis and how their loss can result in degeneration. We then describe the role of small animal models in understanding the development of the disc and their use to interrogate disc degeneration and associated pathologies. Finally, we highlight essential development pathways that are associated with disc degeneration and/or implicated in the reparative response of the tissue that might serve as targets for future therapeutic approaches.
Mechanisms of Distal Axonal Degeneration in Peripheral Neuropathies
Cashman, Christopher R.; Höke, Ahmet
2015-01-01
Peripheral neuropathy is a common complication of a variety of diseases and treatments, including diabetes, cancer chemotherapy, and infectious causes (HIV, hepatitis C, and Campylobacter jejuni). Despite the fundamental difference between these insults, peripheral neuropathy develops as a combination of just six primary mechanisms: altered metabolism, covalent modification, altered organelle function and reactive oxygen species formation, altered intracellular and inflammatory signaling, slowed axonal transport, and altered ion channel dynamics and expression. All of these pathways converge to lead to axon dysfunction and symptoms of neuropathy. The detailed mechanisms of axon degeneration itself have begun to be elucidated with studies of animal models with altered degeneration kinetics, including the slowed Wallerian degeneration (Wlds) and Sarmknockout animal models. These studies have shown axonal degeneration to occur througha programmed pathway of injury signaling and cytoskeletal degradation. Insights into the common disease insults that converge on the axonal degeneration pathway promise to facilitate the development of therapeutics that may be effective against other mechanisms of neurodegeneration. PMID:25617478
Primer on consumer marketing research : procedures, methods, and tools
1994-03-01
The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...
Computed tomography of Wallerian degeneration
International Nuclear Information System (INIS)
Uchino, Akira; Maeda, Fumihiko
1986-01-01
CT findings of wallerian degeneration of the pyramidal tract at the midbrain (atrophy of cerebral peduncle following cerebrovascular accident) were studied in 34 patients (44 CT scans) with old cerebrovascular accidents. Severe atrophy of cerebral peduncle was noted when the ipsilateral motor cortex was involved. However, when the posterior limb of the internal capsule was involved, atrophy of the ipsilateral cerebral peduncle was mild. In this series, the shortest interval between cerebrovascular accident and wallerian degeneration was 8 month. (author)
International Nuclear Information System (INIS)
Kolstad, Frode; Myhr, Gunnar; Kvistad, Kjell Arne; Nygaard, Oystein P.; Leivseth, Gunnar
2005-01-01
Study design: Descriptive study comparing MRI classifications with measurements from radiographs. Objectives: 1.Define the relationship between MRI classified cervical disc degeneration and objectively measured disc height. 2.Assess the level of inter- and intra-observer errors using MRI in defining cervical disc degeneration. Summary of background data: Cervical spine degeneration has been defined radiologically by loss of disc height, decreased disc and bone marrow signal intensity and disc protrusion/herniation on MRI. The intra- and inter-observer error using MRI in defining cervical degeneration influences data interpretation. Few previous studies have addressed this source of error. The relation and time sequence between cervical disc degeneration classified by MRI and cervical disc height decrease measured from radiographs is unclear. Methods: The MRI classification of degeneration was based on nucleus signal, prolaps identification and bone marrow signal. Two neuro-radiologists evaluated the MR-images independently in a blinded fashion. The radiographic disc height measurements were done by a new computer-assisted method compensating for image distortion and permitting comparison with normal level-, age- and gender-appropriate disc height. Results/conclusions: 1.Progressing disc degeneration classified from MRI is on average significantly associated with a decrease of disc height as measured from radiographs. Within each MRI defined category of degeneration measured disc heights, however, scatter in a wide range. 2.The inter-observer agreement between two neuro-radiologists in both defining degeneration and disc height by MRI was only moderate. Studies addressing questions related to cervical disc degeneration should take this into consideration
Energy Technology Data Exchange (ETDEWEB)
Kolstad, Frode [National Centre of Spinal Disorders, Norwegian University of Science and Technology, University Hospital of Trondheim, 7006 Trondheim (Norway)]. E-mail: frode.kolstad@medisin.ntnu.no; Myhr, Gunnar [Department of Radiology, University Hospital of Trondheim, 7006 Trondheim (Norway); Kvistad, Kjell Arne [Department of Radiology, University Hospital of Trondheim, 7006 Trondheim (Norway); Nygaard, Oystein P. [National Centre of Spinal Disorders, Norwegian University of Science and Technology, University Hospital of Trondheim, 7006 Trondheim (Norway); Leivseth, Gunnar [Department of Neuromedicine, Faculty of Medicine, Norwegian University of Science and Technology, University Hospital of Trondheim, 7006 Trondheim (Norway)
2005-09-01
Study design: Descriptive study comparing MRI classifications with measurements from radiographs. Objectives: 1.Define the relationship between MRI classified cervical disc degeneration and objectively measured disc height. 2.Assess the level of inter- and intra-observer errors using MRI in defining cervical disc degeneration. Summary of background data: Cervical spine degeneration has been defined radiologically by loss of disc height, decreased disc and bone marrow signal intensity and disc protrusion/herniation on MRI. The intra- and inter-observer error using MRI in defining cervical degeneration influences data interpretation. Few previous studies have addressed this source of error. The relation and time sequence between cervical disc degeneration classified by MRI and cervical disc height decrease measured from radiographs is unclear. Methods: The MRI classification of degeneration was based on nucleus signal, prolaps identification and bone marrow signal. Two neuro-radiologists evaluated the MR-images independently in a blinded fashion. The radiographic disc height measurements were done by a new computer-assisted method compensating for image distortion and permitting comparison with normal level-, age- and gender-appropriate disc height. Results/conclusions: 1.Progressing disc degeneration classified from MRI is on average significantly associated with a decrease of disc height as measured from radiographs. Within each MRI defined category of degeneration measured disc heights, however, scatter in a wide range. 2.The inter-observer agreement between two neuro-radiologists in both defining degeneration and disc height by MRI was only moderate. Studies addressing questions related to cervical disc degeneration should take this into consideration.
Routes to effective evacuation planning primer series : evacuating populations with special needs.
2009-04-01
Evacuation operations are conducted under the authority of, and based on decisions by, local and state authorities. The purpose of this primer, Evacuating Populations with Special Needs, is to provide local and state emergency managers, government of...
Arbitrary electron acoustic waves in degenerate dense plasmas
Rahman, Ata-ur; Mushtaq, A.; Qamar, A.; Neelam, S.
2017-05-01
A theoretical investigation is carried out of the nonlinear dynamics of electron-acoustic waves in a collisionless and unmagnetized plasma whose constituents are non-degenerate cold electrons, ultra-relativistic degenerate electrons, and stationary ions. A dispersion relation is derived for linear EAWs. An energy integral equation involving the Sagdeev potential is derived, and basic properties of the large amplitude solitary structures are investigated in such a degenerate dense plasma. It is shown that only negative large amplitude EA solitary waves can exist in such a plasma system. The present analysis may be important to understand the collective interactions in degenerate dense plasmas, occurring in dense astrophysical environments as well as in laser-solid density plasma interaction experiments.
Optimization of ISSR-PCR reaction system and selection of primers in Bryum argenteum
Directory of Open Access Journals (Sweden)
Ma Xiaoying
2017-02-01
Full Text Available In order to determine optimum ISSR-PCR reaction system for moss Bryum argenteum,the concentrations of template DNA primers,dNTPs,Mg2+ and Taq DNA polymerase were optimized in four levels by PCR orthogonal experimental method. The appropriate primers were screened from 100 primers by temperature gradient PCR,and the optimal anneal temperature of the screened primers were determined. The results showed that the optimized 20 μL ISSR-PCR reaction system was as follows:template DNA 20 ng/20 μL,primers 0.45 μmol/L,Mg2+2.65 mmol/L,Taq DNA polymerase 0.4 U/20 μL,dNTPs 0.45 mmol/L. Using this system,50 primers with clear bands,repeatability well and polymorphism highly were selected from 100 primers. The establishment of this system,the screened primers and the annealing temperature could provide a theoretical basis for further research on the genetic diversity of bryophytes using ISSR molecular markers.
Energy Technology Data Exchange (ETDEWEB)
Micheli, Fiorenza de [Centro de Estudios Cientificos, Arturo Prat 514, Valdivia (Chile); Instituto de Fisica, Pontificia Universidad Catolica de Valparaiso, Casilla 4059, Valparaiso (Chile); Zanelli, Jorge [Centro de Estudios Cientificos, Arturo Prat 514, Valdivia (Chile); Universidad Andres Bello, Av. Republica 440, Santiago (Chile)
2012-10-15
A degenerate dynamical system is characterized by a symplectic structure whose rank is not constant throughout phase space. Its phase space is divided into causally disconnected, nonoverlapping regions in each of which the rank of the symplectic matrix is constant, and there are no classical orbits connecting two different regions. Here the question of whether this classical disconnectedness survives quantization is addressed. Our conclusion is that in irreducible degenerate systems-in which the degeneracy cannot be eliminated by redefining variables in the action-the disconnectedness is maintained in the quantum theory: there is no quantum tunnelling across degeneracy surfaces. This shows that the degeneracy surfaces are boundaries separating distinct physical systems, not only classically, but in the quantum realm as well. The relevance of this feature for gravitation and Chern-Simons theories in higher dimensions cannot be overstated.
Criticality calculations with MCNP trademark: A primer
International Nuclear Information System (INIS)
Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.
1994-01-01
With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand
Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.
2012-01-01
DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820
Effect of oligonucleotide primers in determining viral variability within hosts
Directory of Open Access Journals (Sweden)
Moya Andrés
2004-12-01
Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.
Effect of oligonucleotide primers in determining viral variability within hosts.
Bracho, Maria Alma; García-Robles, Inmaculada; Jiménez, Nuria; Torres-Puente, Manuela; Moya, Andrés; González-Candelas, Fernando
2004-12-09
Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR) based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV) populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient). Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.
UniPrime2: a web service providing easier Universal Primer design.
Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C
2009-07-01
The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.
Risk factors of age-related macular degeneration in Argentina
Directory of Open Access Journals (Sweden)
María Eugenia Nano
2013-04-01
Full Text Available PURPOSES: To assess the risk factors of age-related macular degeneration in Argentina using a case-control study. METHODS: Surveys were used for subjects' antioxidant intake, age/gender, race, body mass index, hypertension, diabetes (and type of treatment, smoking, sunlight exposure, red meat consumption, fish consumption, presence of age-related macular degeneration and family history of age-related macular degeneration. Main effects models for logistic regression and ordinal logistic regression were used to analyze the results. RESULTS: There were 175 cases and 175 controls with a mean age of 75.4 years and 75.5 years, respectively, of whom 236 (67.4% were female. Of the cases with age-related macular degeneration, 159 (45.4% had age-related macular degeneration in their left eyes, 154 (44.0% in their right eyes, and 138 (39.4% in both eyes. Of the cases with age-related macular degeneration in their left eyes, 47.8% had the dry type, 40.3% had the wet type, and the type was unknown for 11.9%. The comparable figures for right eyes were: 51.9%, 34.4%, and 13.7%, respectively. The main effects model was dominated by higher sunlight exposure (OR [odds ratio]: 3.3 and a family history of age-related macular degeneration (OR: 4.3. Other factors included hypertension (OR: 2.1, smoking (OR: 2.2, and being of the Mestizo race, which lowered the risk of age-related macular degeneration (OR: 0.40. Red meat/fish consumption, body mass index, and iris color did not have an effect. Higher age was associated with progression to more severe age-related macular degeneration. CONCLUSION: Sunlight exposure, family history of age-related macular degeneration, and an older age were the significant risk factors. There may be other variables, as the risk was not explained very well by the existing factors. A larger sample may produce different and better results.
Identifying Initial Condition in Degenerate Parabolic Equation with Singular Potential
Directory of Open Access Journals (Sweden)
K. Atifi
2017-01-01
Full Text Available A hybrid algorithm and regularization method are proposed, for the first time, to solve the one-dimensional degenerate inverse heat conduction problem to estimate the initial temperature distribution from point measurements. The evolution of the heat is given by a degenerate parabolic equation with singular potential. This problem can be formulated in a least-squares framework, an iterative procedure which minimizes the difference between the given measurements and the value at sensor locations of a reconstructed field. The mathematical model leads to a nonconvex minimization problem. To solve it, we prove the existence of at least one solution of problem and we propose two approaches: the first is based on a Tikhonov regularization, while the second approach is based on a hybrid genetic algorithm (married genetic with descent method type gradient. Some numerical experiments are given.
Human immunodeficiency virus uses tRNA(Lys,3) as primer for reverse transcription in HeLa-CD4+ cells
Das, A. T.; Koken, S. E.; Essink, B. B.; van Wamel, J. L.; Berkhout, B.
1994-01-01
Significant amounts of different tRNA molecules are present in retroviral particles, but one specific tRNA species functions as primer in reverse transcription. It is generally believed that the HIV-1 virus uses the tRNA(Lys,3) molecule as primer. This is based on sequence complementarity between
Magnetic resonance imaging of intervertebral disc degeneration
International Nuclear Information System (INIS)
Maeda, Hiroshi; Noguchi, Masao; Kira, Hideaki; Fujiki, Hiroshi; Shimokawa, Isao; Hinoue, Kaichi.
1993-01-01
The aim of this study was to correlate the degree of lumbar intervertebral disc degeneration with findings of magnetic resonance imaging (MRI). Seventeen autopsied (from 7 patients) and 21 surgical (from 20 patients) intervertebral discs were used as specimens for histopathological examination. In addition, 21 intervertebral discs were examined on T2-weighted images. Histopathological findings from both autopsied and surgical specimens were well correlated with MRI findings. In particular, T2-weighted images reflected increased collagen fibers and rupture within the fibrous ring accurately. However, when severely degenerated intervertebral discs and hernia protruding the posterior longitudinal ligament existed, histological findings were not concordant well with T2-weighted images. Morphological appearances of autopsy specimens, divided into four on T2-weighted images, were well consistent with histological degeneration. This morphological classification, as shown on T2-weighted images, could also be used in the evaluation of intervertebral disc degeneration. (N.K.)
Magnetic resonance imaging of intervertebral disc degeneration
Energy Technology Data Exchange (ETDEWEB)
Maeda, Hiroshi; Noguchi, Masao (Kitakyushu City Yahata Hospital, Fukuoka (Japan)); Kira, Hideaki; Fujiki, Hiroshi; Shimokawa, Isao; Hinoue, Kaichi
1993-02-01
The aim of this study was to correlate the degree of lumbar intervertebral disc degeneration with findings of magnetic resonance imaging (MRI). Seventeen autopsied (from 7 patients) and 21 surgical (from 20 patients) intervertebral discs were used as specimens for histopathological examination. In addition, 21 intervertebral discs were examined on T2-weighted images. Histopathological findings from both autopsied and surgical specimens were well correlated with MRI findings. In particular, T2-weighted images reflected increased collagen fibers and rupture within the fibrous ring accurately. However, when severely degenerated intervertebral discs and hernia protruding the posterior longitudinal ligament existed, histological findings were not concordant well with T2-weighted images. Morphological appearances of autopsy specimens, divided into four on T2-weighted images, were well consistent with histological degeneration. This morphological classification, as shown on T2-weighted images, could also be used in the evaluation of intervertebral disc degeneration. (N.K.).
Rockne, Karl J; Strand, Stuart E
2003-09-01
Type II alpha proteobacteria methanotrophs are capable of a wide range of cometabolic transformations of chlorinated solvents and polycyclic aromatic hydrocarbons (PAHs), and this activity has been exploited in many terrestrial bioremediation systems. However, at present, all known obligately marine methanotrophic isolates are Type I gamma proteobacteria which do not have this activity to the extent of Type II methanotrophs. In previous work in our laboratory, determining the presence of Type II alpha proteobacteria methanotrophs in marine enrichment cultures that co-metabolized PAHs required a more sensitive assay. 16S rDNA PCR primers were designed based on oligonucleotide probes for serine pathway methanotrophs and serine pathway methylotrophs with an approximate amplification fragment size of 870 base pairs. Comparison of the primers using double primer BLAST searches in established nucleotide databases showed potential amplification with all Methylocystis and Methylosinus spp., as well as potential amplification with Methylocella palustrus. DNA from Methylosinus trichosporium OB3b, a Type II methanotroph, amplified with the primers with a fragment size of approximately 850 base pairs, whereas DNA extracted from Methylomonas methanica, a Type I methanotroph, did not. The primers were used to amplify DNA extracted from two marine methanotrophic enrichment cultures: a low nitrogen/low copper enrichment to select for Type II methanotrophs and a high nitrogen/high copper enrichment to select for Type I methanotrophs. Although DNA from both cultures amplified with the PCR primers, amplification was stronger in cultures that were specifically enriched for Type II methanotrophs, suggesting the presence of higher numbers of Type II methanotrophs. These results provide further evidence for the existence of Type II marine methanotrophs, suggesting the possibility of exploiting cometabolic activity in marine systems.
Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok
2018-03-01
We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.
Directory of Open Access Journals (Sweden)
Trognitz Friederike
2007-02-01
Full Text Available Abstract Background The diploid, Solanum caripense, a wild relative of potato and tomato, possesses valuable resistance to potato late blight and we are interested in the genetic base of this resistance. Due to extremely low levels of genetic variation within the S. caripense genome it proved impossible to generate a dense genetic map and to assign individual Solanum chromosomes through the use of conventional chromosome-specific SSR, RFLP, AFLP, as well as gene- or locus-specific markers. The ease of detection of DNA polymorphisms depends on both frequency and form of sequence variation. The narrow genetic background of close relatives and inbreds complicates the detection of persisting, reduced polymorphism and is a challenge to the development of reliable molecular markers. Nonetheless, monomorphic DNA fragments representing not directly usable conventional markers can contain considerable variation at the level of single nucleotide polymorphisms (SNPs. This can be used for the design of allele-specific molecular markers. The reproducible detection of allele-specific markers based on SNPs has been a technical challenge. Results We present a fast and cost-effective protocol for the detection of allele-specific SNPs by applying Sequence Polymorphism-Derived (SPD markers. These markers proved highly efficient for fingerprinting of individuals possessing a homogeneous genetic background. SPD markers are obtained from within non-informative, conventional molecular marker fragments that are screened for SNPs to design allele-specific PCR primers. The method makes use of primers containing a single, 3'-terminal Locked Nucleic Acid (LNA base. We demonstrate the applicability of the technique by successful genetic mapping of allele-specific SNP markers derived from monomorphic Conserved Ortholog Set II (COSII markers mapped to Solanum chromosomes, in S. caripense. By using SPD markers it was possible for the first time to map the S. caripense alleles
Structure of Hepatitis C Virus Polymerase in Complex with Primer-Template RNA
Energy Technology Data Exchange (ETDEWEB)
Mosley, Ralph T.; Edwards, Thomas E.; Murakami, Eisuke; Lam, Angela M.; Grice, Rena L.; Du, Jinfa; Sofia, Michael J.; Furman, Philip A.; Otto, Michael J. (Pharmasset); (Emerald)
2012-08-01
The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory {beta}-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesis at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory {beta}-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus.
Death Receptor 6 Promotes Wallerian Degeneration in Peripheral Axons.
Gamage, Kanchana K; Cheng, Irene; Park, Rachel E; Karim, Mardeen S; Edamura, Kazusa; Hughes, Christopher; Spano, Anthony J; Erisir, Alev; Deppmann, Christopher D
2017-03-20
Axon degeneration during development is required to sculpt a functional nervous system and is also a hallmark of pathological insult, such as injury [1, 2]. Despite similar morphological characteristics, very little overlap in molecular mechanisms has been reported between pathological and developmental degeneration [3-5]. In the peripheral nervous system (PNS), developmental axon pruning relies on receptor-mediated extrinsic degeneration mechanisms to determine which axons are maintained or degenerated [5-7]. Receptors have not been implicated in Wallerian axon degeneration; instead, axon autonomous, intrinsic mechanisms are thought to be the primary driver for this type of axon disintegration [8-10]. Here we survey the role of neuronally expressed, paralogous tumor necrosis factor receptor super family (TNFRSF) members in Wallerian degeneration. We find that an orphan receptor, death receptor 6 (DR6), is required to drive axon degeneration after axotomy in sympathetic and sensory neurons cultured in microfluidic devices. We sought to validate these in vitro findings in vivo using a transected sciatic nerve model. Consistent with the in vitro findings, DR6 -/- animals displayed preserved axons up to 4 weeks after injury. In contrast to phenotypes observed in Wld s and Sarm1 -/- mice, preserved axons in DR6 -/- animals display profound myelin remodeling. This indicates that deterioration of axons and myelin after axotomy are mechanistically distinct processes. Finally, we find that JNK signaling after injury requires DR6, suggesting a link between this novel extrinsic pathway and the axon autonomous, intrinsic pathways that have become established for Wallerian degeneration. Copyright © 2017 Elsevier Ltd. All rights reserved.
Polderman, R.N.; Frencken, J.E.F.M.
2007-01-01
OBJECTIVES: The null-hypothesis tested was; there is no difference in effectiveness between a new low-viscosity glass ionomer and a resin-based glutaraldehyde containing primer in treating hypersensitive teeth after 2 years. METHODS: Using a split-mouth design, hypersensitive teeth in 14 adult
Directory of Open Access Journals (Sweden)
María Fernanda Vásquez Valencia
2018-01-01
Full Text Available Based on medical journals and theses from the first half of the twentieth century, this article analyzes the role played by the theory of degeneration in the understanding of mental illness in Colombia. It is particularly interesting to show how Colombian physicians have appropriated concepts such as degeneration, diathesis, morbid heredity and stigmas of degeneration since the early 20th century to describe, classify and define mental illnesses present in Colombian territory. During this period the theory of degeneration served as the conceptual and theoretical framework for understanding the etiology, genesis and evolution of mental illness.
The prognosis of retinal detachment due to lattice degeneration.
Benson, W E; Morse, P H
1978-09-01
In a series of 553 consecutive retinal detachments, 29% (120) were due to lattice degeneration. Forty-five percent of these were due to atrophic holes in the lattice degeneration and 55% were due to tears caused by traction posterior to or at the end of a patch of lattice. In phakic patients, retinal detachments due to atrophic holes were most common in young myopes. Detachments due to traction tears were seen in older, less myopic patients. The incidence of massive periretinal proliferation was less (5%) in detachments due to lattice degeneration than in detachments not due to lattice degeneration (6.5%).
Laboratory and gas-fired furnace performance tests of epoxy primers for intumescent coatings
DEFF Research Database (Denmark)
Nørgaard, Kristian Petersen; Dam-Johansen, Kim; Catala, Pere
2014-01-01
, either to ensure adhesion of the intumescent coating to the steel or to provide corrosion resistance. It is essential to document the performance of the intumescent coating together with the primer to ensure the overall quality of coating system. In the present work, two epoxy primers were used...... to a gas-fired furnace following the ISO834 fire curve (a so-called cellulosic fire), one of the primers selected performed well and the other poorly. From tests in the electrically heated oven, it was found that both primers were sensitive to the film thickness employed and the presence of oxygen....... At oxygen-rich conditions, higher primer thicknesses gave weaker performance. In addition, a color change from red to black was observed in nitrogen, while the color remained red in the oxygen-nitrogen mixture. In summary, the results suggest that an adequate choice of primer, primer thickness...
Lerer, Assaf; Nykamp, Stephanie G; Harriss, Alexandra B; Gibson, Thomas W G; Koch, Thomas G; Brown, Stephen H M
2015-11-01
Human studies have revealed a link between muscle degeneration and low back pain, although the cause and effect of this relationship is not clear. Dogs provide a naturally developing model of intervertebral disc (IVD)-related low back pain that may provide insight into relationships between IVD and muscle degeneration. This study aimed to quantify, via magnetic resonance imaging (MRI), the magnitude and location of fatty infiltration in spine muscles of chondrodystrophic (CD) and non-chondrodystrophic (NCD) dogs suffering from both intervertebral disc herniation (IVDH) and non-disc-related spinal disorders, and relate this to intervertebral disc degeneration (IVDD). This study used retrospective MRI-based analysis of IVDD and muscle fatty infiltration in CD and NCD dogs. A portion of this study was funded ($1,000) by the Pet Trust Fund, Ontario Veterinary College. Magnetic resonance imaging from 180 dogs were separated into four groups: (1) CD with IVDH; (2) CD with non-IVDH spinal pathology; (3) NCD with IVDH; (4) NCD with non-IVDH spinal pathology. For each dog at intervertebral levels T12-T13 to L6-L7, IVDD was subjectively graded and muscle-fat indices (MFIndices) were quantified for multifidus, erector spinae, and psoas muscle groups. Intervertebral disc degeneration grade was higher (ppathology. Muscle-fat indices of multifidus and psoas were higher (ppathology compared with dogs with IVDH. Erector spinae demonstrated higher (ppathology. Dog groups with higher average IVDD grades demonstrated less fatty infiltration within their multifidus and psoas muscles, compared with groups with lower IVDD grades. This finding was consistent across both CD and NCD breeds as well as across dogs presenting with IVDH and those presenting with a non-IVDH spinal pathology. Thus, the presence or severity of IVDD is not uniquely related to fatty infiltration in these muscles, but rather the presence, or possibly severity or chronicity, of general spine pathology is likely a
Stereotactic radiotherapy for wet age-related macular degeneration: current perspectives
Directory of Open Access Journals (Sweden)
Neffendorf JE
2015-09-01
Full Text Available James E Neffendorf, Timothy L Jackson Department of Ophthalmology, School of Medicine, King’s College London, London, United Kingdom Abstract: Neovascular age-related macular degeneration is a leading cause of blindness in the developed world. Currently, the treatment of choice is intravitreal injections of anti-VEGF medications. These require frequent dosing, up to monthly, and impose a substantial burden on patients and the health economy. Ionizing radiation was proposed as a possible treatment for age-related macular degeneration due to its anti-inflammatory and anti-fibrotic properties. Stereotactic radiotherapy is an outpatient-based radiotherapy platform that provides stereotactic application of low energy X-ray to the retina in three highly collimated beams that cross the inferior sclera to overlap at the macula. A randomized, double-masked, sham-controlled trial of 230 patients (INTREPID showed that a single dose of stereotactic radiotherapy significantly reduces the number of intravitreal anti-VEGF injections needed over 2 years. A larger randomized controlled trial (STAR is underway. Keywords: wet age-related macular degeneration, radiation therapy, stereotactic radiotherapy, vascular endothelial growth factor
Mutations in ABCR (ABCA4) in patients with Stargardt macular degeneration or cone-rod degeneration.
Briggs, C E; Rucinski, D; Rosenfeld, P J; Hirose, T; Berson, E L; Dryja, T P
2001-09-01
To determine the spectrum of ABCR mutations associated with Stargardt macular degeneration and cone-rod degeneration (CRD). One hundred eighteen unrelated patients with recessive Stargardt macular degeneration and eight with recessive CRD were screened for mutations in ABCR (ABCA4) by single-strand conformation polymorphism analysis. Variants were characterized by direct genomic sequencing. Segregation analysis was performed on the families of 20 patients in whom at least two or more likely pathogenic sequence changes were identified. The authors found 77 sequence changes likely to be pathogenic: 21 null mutations (15 novel), 55 missense changes (26 novel), and one deletion of a consensus glycosylation site (also novel). Fifty-two patients with Stargardt macular degeneration (44% of those screened) and five with CRD each had two of these sequence changes or were homozygous for one of them. Segregation analyses in the families of 19 of these patients were informative and revealed that the index cases and all available affected siblings were compound heterozygotes or homozygotes. The authors found one instance of an apparently de novo mutation, Ile824Thr, in a patient. Thirty-seven (31%) of the 118 patients with Stargardt disease and one with CRD had only one likely pathogenic sequence change. Twenty-nine patients with Stargardt disease (25%) and two with CRD had no identified sequence changes. This report of 42 novel mutations brings the growing number of identified likely pathogenic sequence changes in ABCR to approximately 250.
A database of PCR primers for the chloroplast genomes of higher plants
Heinze, Berthold
2007-01-01
Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny) or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species). The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata). Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution. PMID:17326828
A database of PCR primers for the chloroplast genomes of higher plants
Directory of Open Access Journals (Sweden)
Heinze Berthold
2007-02-01
Full Text Available Abstract Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species. The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata. Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution.
Wilkinson, C P
2000-01-01
To assess the quality of information in the literature regarding the benefits of prophylactic treatment of asymptomatic retinal tears and lattice degeneration. Asymptomatic retinal breaks occur in approximately 7% of patients over age 40, and lattice degeneration is present in approximately 8% of the general population. Because retinal breaks cause retinal detachment and lattice degeneration is associated with approximately 30% of retinal detachments, prophylactic treatment of these lesions has sometimes been recommended. A panel of vitreoretinal experts performed a literature review of all publications regarding prevention of retinal detachment that have been published in English. These articles were then used to prepare recommendations for patient care in an American Academy of Ophthalmology Preferred Practice Pattern (PPP). Each recommendation was rated according to: (1) its importance in the care process and (2) the strength of evidence supporting the given recommendation. Most recommendations were rated as A (most important to patient care). Only a single publication was graded as I (providing strong evidence in support of a recommendation), and this was not a prospective trial. Of the few publications rated as II (substantial evidence), most were studies documenting a lack of treatment benefit. Because of an absence of level I and level II studies in the literature, level III (consensus of expert opinion) was the basis for most recommendations in the PPP. The current literature regarding prevention of retinal detachment does not provide sufficient information to support strongly prophylactic treatment of lesions other than symptomatic flap tears. Prospective randomized trials of prophylactic therapy are indicated. Eyes highly predisposed to retinal detachment should be considered for such studies.
Disk degeneration in 14 year old children
International Nuclear Information System (INIS)
Erkintalo, M.; Salminen, J.J.; Paajanen, H.; Terho, P.; Kormano, M.
1989-01-01
This paper reports low back symptoms of 1,500 school children (14 years old) evaluated with a questionnaire and with a standardized clinical examination. Forty children who complained of recurrent and/or persistent low back pain and 40 matching symptomless controls were randomly chosen to undergo MR imaging of the lumbar spine. Premature disk degeneration was seen in 25.5% of asymptomatic children and in 40% of those with low back pain. The difference was statistically not significant. Disk degeneration is a surprisingly frequent MR finding in symptomless children. Premature disk degeneration may be the cause of low back pain in some children but is not always symptomatic in childhood
Cartilage Degeneration and Alignment in Severe Varus Knee Osteoarthritis.
Nakagawa, Yasuaki; Mukai, Shogo; Yabumoto, Hiromitsu; Tarumi, Eri; Nakamura, Takashi
2015-10-01
The aim of this study was to examine the relationship between cartilage, ligament, and meniscus degeneration and radiographic alignment in severe varus knee osteoarthritis in order to understand the development of varus knee osteoarthritis. Fifty-three patients (71 knees) with primary varus knee osteoarthritis and who underwent total knee arthroplasty were selected for this study. There were 6 men and 47 women, with 40 right knees and 31 left knees studied; their mean age at operation was 73.5 years. The ligament, meniscus, degeneration of joint cartilage, and radiographic alignments were examined visually. The tibial plateau-tibial shaft angle was larger if the condition of the cartilage in the lateral femoral condyle was worse. The femorotibial angle and tibial plateau-tibial shaft angle were larger if the conditions of the lateral meniscus or the cartilage in the lateral tibial plateau were worse. Based on the results of this study, progression of varus knee osteoarthritis may occur in the following manner: medial knee osteoarthritis starts in the central portion of the medial tibial plateau, and accompanied by medial meniscal extrusion and anterior cruciate ligament rupture, cartilage degeneration expands from the anterior to the posterior in the medial tibial plateau. Bone attrition occurs in the medial tibial plateau, and the femoro-tibial angle and tibial plateau-tibial shaft angle increase. Therefore, the lateral intercondylar eminence injures the cartilage of the lateral femoral condyle in the longitudinal fissure type. Thereafter, the cartilage degeneration expands in the whole of the knee joints.
Progression of Fatty Muscle Degeneration in Atraumatic Rotator Cuff Tears.
Hebert-Davies, Jonah; Teefey, Sharlene A; Steger-May, Karen; Chamberlain, Aaron M; Middleton, William; Robinson, Kathryn; Yamaguchi, Ken; Keener, Jay D
2017-05-17
The purpose of this prospective study was to examine the progression of fatty muscle degeneration over time in asymptomatic shoulders with degenerative rotator cuff tears. Subjects with an asymptomatic rotator cuff tear in 1 shoulder and pain due to rotator cuff disease in the contralateral shoulder were enrolled in a prospective cohort. Subjects were followed annually with shoulder ultrasonography, which evaluated tear size, location, and fatty muscle degeneration. Tears that were either full-thickness at enrollment or progressed to a full-thickness defect during follow-up were examined. A minimum follow-up of 2 years was necessary for eligibility. One hundred and fifty-six shoulders with full-thickness rotator cuff tears were potentially eligible. Seventy shoulders had measurable fatty muscle degeneration of at least 1 rotator cuff muscle at some time point. Patients with fatty muscle degeneration in the shoulder were older than those without degeneration (mean, 65.8 years [95% confidence interval (CI), 64.0 to 67.6 years] compared with 61.0 years [95% CI, 59.1 to 62.9 years]; p tears at baseline was larger in shoulders with degeneration than in shoulders that did not develop degeneration (13 and 10 mm wide, respectively, and 13 and 10 mm long; p Tears with fatty muscle degeneration were more likely to have enlarged during follow-up than were tears that never developed muscle degeneration (79% compared with 58%; odds ratio, 2.64 [95% CI, 1.29 to 5.39]; p muscle degeneration occurred more frequently in shoulders with tears that had enlarged (43%; 45 of 105) than in shoulders with tears that had not enlarged (20%; 10 of 51; p tears with enlargement and progression of muscle degeneration were more likely to extend into the anterior supraspinatus than were those without progression (53% and 17%, respectively; p tear size (p = 0.56). The median time from tear enlargement to progression of fatty muscle degeneration was 1.0 year (range, -2.0 to 6.9 years) for the
[Clinical features and prognosis of retinal lattice degeneration].
Guo, X R
1990-07-01
110 cases (110 eyes) of retinal lattice degeneration were clinically observed and followed up for 3-8 years. Most lesions were located in the superotemporal quadrant, band-shaped, and parallel to the ora serrata. 80.9% of the lesions presented various degrees of pigmentation, 67.1% yellowish white spots, and 83.6% white lines. 32.9% of the eyes developed retinal holes. Most lattice degenerations were accompanied by vitreous degeneration and vitreoretinal traction. The disease progressed only slowly, though in a few cases it tended to expand.
The non-invasive investigation of lumbar disc degeneration in patients with chronic low back pain
International Nuclear Information System (INIS)
Buirski, G.
1989-01-01
The painful degenerate disc is a recognised cause of low back pain. Magnetic Resonance Imaging (MRI) has now replaced discography in the non-invasive assessment of disk degeneration. However, the prohibitive capital expense of MRI and the small number of MR units in Australia produce limitations in clinical access. In contrast, Computed Tomography (CT) is readily available and is performed in most patients prior to MRI referral. This prospective study was undertaken to determine whether preliminary CT could offer any information about disc degeneration and so reduce the demand on a MRI scanner. 30 consecutive patients were studied all of whom had both CT and MRI examinations. Of a total 107 discs examined by both techniques, MRI was able to identify 37 degenerate discs. Conclusive evidence of degeneration (i.e. the presence of intervertebral gas) was only seen in 3 discs at CT (1 patient). Of the 29 posterior disc bulges found on CT, all were both bulging and degenerate on MRI. Indications for MRI based on the CT findings are recommended. Using these criteria, 13% (4 patients) of this study group could have avoided an expensive and unnecessary MR investigation. A useful algorithm for the investigation and assessment of patients with chronic low back pain is discussed. 8 refs., 5 figs., 1 tab
Oxygen-induced retinopathy in mice with retinal photoreceptor cell degeneration.
Zhang, Qian; Zhang, Zuo-Ming
2014-04-25
It is reported that retinal neovascularization seems to rarely co-exist with retinitis pigmentosa in patients and in some mouse models; however, it is not widely acknowledged as a universal phenomenon in all strains of all animal species. We aimed to further explore this phenomenon with an oxygen-induced retinopathy model in mice with retinal photoreceptor cell degeneration. Oxygen-induced retinopathy of colored and albino mice with rapid retinal degeneration were compared to homologous wild-type mice. The retinas were analyzed using high-molecular-weight FITC-dextran stained flat-mount preparation, hematoxylin and eosin (H&E) stained cross-sections, an immunohistochemical test for vascular endothelial growth factor (VEGF) distribution and Western blotting for VEGF expression after exposure to hyperoxia between postnatal days 17 (P17) and 21. Leakage and areas of non-perfusion of the retinal blood vessels were alleviated in the retinal degeneration mice. The number of preretinal vascular endothelial cell nuclei in the retinal degeneration mice was smaller than that in the homologous wild-type mice after exposure to hyperoxia (Poxygen-induced retinopathy was positively correlated with the VEGF expression level. However, the VEGF expression level was lower in the retinal degeneration mice. Proliferative retinopathy occurred in mice with rapid retinal degeneration, but retinal photoreceptor cell degeneration could partially restrain the retinal neovascularization in this rapid retinal degeneration mouse model. Copyright © 2014 Elsevier Inc. All rights reserved.
The ability of T2/B4 primers to detect Leishmania infantum among ...
African Journals Online (AJOL)
SERVER
2008-04-03
Apr 3, 2008 ... Reverse Primer (5`-CCT CTC TTT TTT CNC TGT GC-3`). (Schönian et al., 1996),. B. Forward Primer (RV1) (5`-GTG GGG GAG GGG CGT TCT-3`) and Reverse Primer (RV2) (5`-ATT TTA CAC CAA CCC CCA GTT-. 3`) (Lachaud et al., 2002; Reale et al., 1999),. C. Forward Primer (T2) (5`-CGG CTT CGC ...
Posterior lattice degeneration characterized by spectral domain optical coherence tomography.
Manjunath, Varsha; Taha, Mohammed; Fujimoto, James G; Duker, Jay S
2011-03-01
The purpose of this study was to use high-resolution spectral domain optical coherence tomography in the characterization of retinal and vitreal morphological changes overlying posterior lattice degeneration. A cross-sectional retrospective analysis was performed on 13 eyes of 13 nonconsecutive subjects with posterior lattice degeneration seen at the New England Eye Center, Tufts Medical Center between October 2009 and January 2010. Spectral domain optical coherence tomography images taken through the region of lattice degeneration were qualitatively analyzed. Four characteristic changes of the retina and vitreous were seen in the 13 eyes with lattice degeneration: 1) anterior/posterior U-shaped vitreous traction; 2) retinal breaks; 3) focal retinal thinning; and 4) vitreous membrane formation. The morphologic appearance of vitreous traction and retinal breaks were found to be consistent with previous histologic reports. It is possible to image posterior lattice degeneration in many eyes using spectral domain optical coherence tomography and to visualize the spectrum of retinal and vitreous changes throughout the area of lattice degeneration.
Directory of Open Access Journals (Sweden)
Elif Çepni
2012-01-01
Full Text Available In this study, Pseudomonas syringe pathovars isolated from olive, tomato and bean were identified by species-specific PCR and their genetic diversity was assessed by repetitive extragenic palindromic (REP-PCR. Reverse universal primers for REP-PCR were designed by using the bases of A, T, G or C at the positions of 1, 4 and 11 to identify additional polymorphism in the banding patterns. Binding of the primers to different annealing sites in the genome revealed additional fingerprint patterns in eight isolates of P. savastanoi pv. savastanoi and two isolates of P. syringae pv. tomato. The use of four different bases in the primer sequences did not affect the PCR reproducibility and was very efficient in revealing intra-pathovar diversity, particularly in P. savastanoi pv. savastanoi. At the pathovar level, the primer BOX1AR yielded shared fragments, in addition to five bands that discriminated among the pathovars P. syringae pv. phaseolicola, P. savastanoi pv. savastanoi and P. syringae pv. tomato. REP-PCR with a modified primer containing C produced identical bands among the isolates in a pathovar but separated three pathovars more distinctly than four other primers. Although REP-and BOX-PCRs have been successfully used in the molecular identification of Pseudomonas isolates from Turkish flora, a PCR based on inter-enterobacterial repetitive intergenic concensus (ERIC sequences failed to produce clear banding patterns in this study.
Lindsley, Kristina; Li, Tianjing; Ssemanda, Elizabeth; Virgili, Gianni; Dickersin, Kay
2016-04-01
Are existing systematic reviews of interventions for age-related macular degeneration incorporated into clinical practice guidelines? High-quality systematic reviews should be used to underpin evidence-based clinical practice guidelines and clinical care. We examined the reliability of systematic reviews of interventions for age-related macular degeneration (AMD) and described the main findings of reliable reviews in relation to clinical practice guidelines. Eligible publications were systematic reviews of the effectiveness of treatment interventions for AMD. We searched a database of systematic reviews in eyes and vision without language or date restrictions; the database was up to date as of May 6, 2014. Two authors independently screened records for eligibility and abstracted and assessed the characteristics and methods of each review. We classified reviews as reliable when they reported eligibility criteria, comprehensive searches, methodologic quality of included studies, appropriate statistical methods for meta-analysis, and conclusions based on results. We mapped treatment recommendations from the American Academy of Ophthalmology (AAO) Preferred Practice Patterns (PPPs) for AMD to systematic reviews and citations of reliable systematic reviews to support each treatment recommendation. Of 1570 systematic reviews in our database, 47 met inclusion criteria; most targeted neovascular AMD and investigated anti-vascular endothelial growth factor (VEGF) interventions, dietary supplements, or photodynamic therapy. We classified 33 (70%) reviews as reliable. The quality of reporting varied, with criteria for reliable reporting met more often by Cochrane reviews and reviews whose authors disclosed conflicts of interest. Anti-VEGF agents and photodynamic therapy were the only interventions identified as effective by reliable reviews. Of 35 treatment recommendations extracted from the PPPs, 15 could have been supported with reliable systematic reviews; however, only 1
Macular degeneration - age-related
... AMD occurs when the blood vessels under the macula become thin and brittle. Small yellow deposits, called drusen, form. Almost all people with macular degeneration start with the dry form. Wet AMD occurs ...
Design of a Percussion and Electric Primer Gun Firing Power Supply
2014-07-01
solenoid failure. As new instrumentation techniques such as high-speed video and laser interferometry have been introduced into our gun testing...to drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks to...drive the solenoid or ignite the primer. This report details the design and construction of the power supplies. 15. SUBJECT TERMS power supply
Mohan, S.B.; Schmid, M.C.; Jetten, M.S.M.; Cole, J.
2004-01-01
Degenerate primers to detect nrfA were designed by aligning six nrfA sequences including Escherichia coli K-12, Sufurospirillum deleyianum and Wolinella succinogenes. These primers amplified a 490 by fragment of nrfA. The ability of these primers to detect nrfA was tested with chromosomal DNA
Kurata, Shinya; Kanagawa, Takahiro; Yamada, Kazutaka; Torimura, Masaki; Yokomaku, Toyokazu; Kamagata, Yoichi; Kurane, Ryuichiro
2001-01-01
We have developed a simple method for the quantitative detection of specific DNA or RNA molecules based on the finding that BODIPY® FL fluorescence was quenched by its interaction with a uniquely positioned guanine. This approach makes use of an oligonucleotide probe or primer containing a BODIPY® FL-modified cytosine at its 5′-end. When such a probe was hybridized with a target DNA, its fluorescence was quenched by the guanine in the target, complementary to the modified cytosine, and the quench rate was proportional to the amount of target DNA. This widely applicable technique will be used directly with larger samples or in conjunction with the polymerase chain reaction to quantify small DNA samples. PMID:11239011
The prevalence of sacroiliac joint degeneration in asymptomatic adults.
Eno, Jonathan-James T; Boone, Christopher R; Bellino, Michael J; Bishop, Julius A
2015-06-03
Degenerative changes of the sacroiliac joint have been implicated as a cause of lower back pain in adults. The purpose of this study was to determine the prevalence of sacroiliac joint degeneration in asymptomatic patients. Five hundred consecutive pelvic computed tomography (CT) scans, made at a tertiary-care medical center, of patients with no history of pain in the lower back or pelvic girdle were retrospectively reviewed and analyzed for degenerative changes of the sacroiliac joint. After exclusion criteria were applied, 373 CT scans (746 sacroiliac joints) were evaluated for degenerative changes. Regression analysis was used to determine the association between age and the degree of sacroiliac joint degeneration. The prevalence of sacroiliac joint degeneration was 65.1%, with substantial degeneration occurring in 30.5% of asymptomatic subjects. The prevalence steadily increased with age, with 91% of subjects in the ninth decade of life displaying degenerative changes. Radiographic evidence of sacroiliac joint degeneration is highly prevalent in the asymptomatic population and is associated with age. Caution must be exercised when attributing lower back or pelvic girdle pain to sacroiliac joint degeneration seen on imaging. Prognostic Level IV. See Instructions for Authors for a complete description of levels of evidence. Copyright © 2015 by The Journal of Bone and Joint Surgery, Incorporated.
Gene Isolation Using Degenerate Primers Targeting Protein Motif: A Laboratory Exercise
Yeo, Brandon Pei Hui; Foong, Lian Chee; Tam, Sheh May; Lee, Vivian; Hwang, Siaw San
2018-01-01
Structures and functions of protein motifs are widely included in many biology-based course syllabi. However, little emphasis is placed to link this knowledge to applications in biotechnology to enhance the learning experience. Here, the conserved motifs of nucleotide binding site-leucine rich repeats (NBS-LRR) proteins, successfully used for the…
Comparison of shear bond strength of orthodontic brackets using various zirconia primers.
Lee, Ji-Yeon; Kim, Jin-Seok; Hwang, Chung-Ju
2015-07-01
The aim of this study was to compare the shear bond strength (SBS) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer, and subjected to thermocycling. We designed 10 experimental groups following the surface treatment and thermocycling. The surface was treated with one of the following method: no-primer (NP), Porcelain Conditioner (PC), Z-PRIME Plus (ZP), Monobond Plus (MP) and Zirconia Liner Premium (ZL) (n=20). Then each group was subdivided to non-thermocycled and thermocycled groups (NPT, PC, ZPT, MPT, ZLT) (n=10). Orthodontic brackets were bonded to the specimens using Transbond™ XT Paste and light cured for 15 s at 1,100 mW/cm(2). The SBS was measured at a 1 mm/min crosshead speed. The failure mode was assessed by examination with a stereomicroscope and the amount of bonding resin remaining on the zirconia surface was scored using the modified adhesive remnant index (ARI). The SBS of all experimental groups decreased after thermocycling. Before thermocycling, the SBS was ZL, ZP ≥ MP ≥ PC > NP but after thermocycling, the SBS was ZLT ≥ MPT ≥ ZPT > PCT = NPT (p > 0.05). For the ARI score, both of the groups lacking primer (NP and NPT) displayed adhesive failure modes, but the groups with zirconia primers (ZP, ZPT, MP, MPT, ZL, and ZLT) were associated with mixed failure modes. Surface treatment with a zirconia primer increases the SBS relative to no-primer or silane primer application between orthodontic brackets and zirconia prostheses.
Xu, B Y; Ji, B C; Guo, W T; Mu, W B; Cao, L
2017-06-01
Altman and Outerbridge scoring system. There was no significant difference between patellofemoral joint degeneration group and normal group based on Ahlback grading system. According to Altman classification, compared to normal group, there was no statistically differences in OKS, WOMAC and Lonner scoring system between patients with degeneration in the medial patellofemoral joint group, OKS and WOMAC increased (20.2±1.4 vs .18.2±2.7, 12.5±1.7 vs .10.5±2.5) ( t =-4.30, P =0.03; t =-4.80, P =0.02), the Lonner score decreased (84.3±2.8 vs .87.4±3.2) ( t =-6.20, P =0.01) in lateral patellofemoral degeneration group. According to Outerbridge scoring system, there were no statistically differences in patients in patellofemoral joint degeneration group and normal group. Conclusions: There is a good evidence that neither mild to moderate degree of patellofemoral joint degeneration nor pre-operative pain location will compromise the short-term outcome of medial Oxford UKA, and should not be considered as contraindications. The situation is less clear for lateral patellofemoral degeneration, and more cautious option is advised.
Bioinformatic tools for PCR Primer design
African Journals Online (AJOL)
ES
Bioinformatics is an emerging scientific discipline that uses information ... complex biological questions. ... and computer programs for various purposes of primer ..... polymerase chain reaction: Human Immunodeficiency Virus 1 model studies.
Laenderyggens degeneration og radiologi
DEFF Research Database (Denmark)
Jacobsen, Steffen; Gosvig, Kasper Kjaerulf; Sonne-Holm, Stig
2006-01-01
Low back pain (LBP) is one of the most common conditions, and at the same time one of the most complex nosological entities. The lifetime prevalence is approximately 80%, and radiological features of lumbar degeneration are almost universal in adults. The individual risk factors for LBP and signi......Low back pain (LBP) is one of the most common conditions, and at the same time one of the most complex nosological entities. The lifetime prevalence is approximately 80%, and radiological features of lumbar degeneration are almost universal in adults. The individual risk factors for LBP...... and significant relationships between radiological findings and subjective symptoms have both been notoriously difficult to identify. The lack of consensus on clinical criteria and radiological definitions has hampered the undertaking of properly executed epidemiological studies. The natural history of LBP...
MRI and MR tractography in bilateral hypertrophic olivary degeneration.
Sen, Debraj; Gulati, Yoginder S; Malik, Virender; Mohimen, Aneesh; Sibi, Eranki; Reddy, Deepak Chandra
2014-10-01
Hypertrophic olivary degeneration is a trans-synaptic neuronal degeneration associated with hypertrophy of the inferior olivary nucleus due to a lesion in the triangle of Guillain-Mollaret. Familiarity with this entity on magnetic resonance imaging (MRI) is essential to avoid other erroneous ominous diagnoses. We present a case of bilateral hypertrophic olivary degeneration and discuss the etiopathogenesis and MRI findings in this entity. The contributory role of MR tractography in the diagnosis is also highlighted.
MRI and MR tractography in bilateral hypertrophic olivary degeneration
International Nuclear Information System (INIS)
Sen, Debraj; Gulati, Yoginder S.; Malik, Virender; Mohimen, Aneesh; Sibi, Eranki; Reddy, Deepak Chandra
2014-01-01
Hypertrophic olivary degeneration is a trans-synaptic neuronal degeneration associated with hypertrophy of the inferior olivary nucleus due to a lesion in the triangle of Guillain-Mollaret. Familiarity with this entity on magnetic resonance imaging (MRI) is essential to avoid other erroneous ominous diagnoses. We present a case of bilateral hypertrophic olivary degeneration and discuss the etiopathogenesis and MRI findings in this entity. The contributory role of MR tractography in the diagnosis is also highlighted
Rapid glutamate receptor 2 trafficking during retinal degeneration
Directory of Open Access Journals (Sweden)
Lin Yanhua
2012-02-01
Full Text Available Abstract Background Retinal degenerations, such as age-related macular degeneration (AMD and retinitis pigmentosa (RP, are characterized by photoreceptor loss and anomalous remodeling of the surviving retina that corrupts visual processing and poses a barrier to late-stage therapeutic interventions in particular. However, the molecular events associated with retinal remodeling remain largely unknown. Given our prior evidence of ionotropic glutamate receptor (iGluR reprogramming in retinal degenerations, we hypothesized that the edited glutamate receptor 2 (GluR2 subunit and its trafficking may be modulated in retinal degenerations. Results Adult albino Balb/C mice were exposed to intense light for 24 h to induce light-induced retinal degeneration (LIRD. We found that prior to the onset of photoreceptor loss, protein levels of GluR2 and related trafficking proteins, including glutamate receptor-interacting protein 1 (GRIP1 and postsynaptic density protein 95 (PSD-95, were rapidly increased. LIRD triggered neuritogenesis in photoreceptor survival regions, where GluR2 and its trafficking proteins were expressed in the anomalous dendrites. Immunoprecipitation analysis showed interaction between KIF3A and GRIP1 as well as PSD-95, suggesting that KIF3A may mediate transport of GluR2 and its trafficking proteins to the novel dendrites. However, in areas of photoreceptor loss, GluR2 along with its trafficking proteins nearly vanished in retracted retinal neurites. Conclusions All together, LIRD rapidly triggers GluR2 plasticity, which is a potential mechanism behind functionally phenotypic revisions of retinal neurons and neuritogenesis during retinal degenerations.
A Primer on Observational Measurement.
Girard, Jeffrey M; Cohn, Jeffrey F
2016-08-01
Observational measurement plays an integral role in a variety of scientific endeavors within biology, psychology, sociology, education, medicine, and marketing. The current article provides an interdisciplinary primer on observational measurement; in particular, it highlights recent advances in observational methodology and the challenges that accompany such growth. First, we detail the various types of instrument that can be used to standardize measurements across observers. Second, we argue for the importance of validity in observational measurement and provide several approaches to validation based on contemporary validity theory. Third, we outline the challenges currently faced by observational researchers pertaining to measurement drift, observer reactivity, reliability analysis, and time/expense. Fourth, we describe recent advances in computer-assisted measurement, fully automated measurement, and statistical data analysis. Finally, we identify several key directions for future observational research to explore.
Intramuscular degeneration process in Duchenne muscular dystrophy
International Nuclear Information System (INIS)
Hasegawa, Takeshi; Matsumra, Kiichiro; Hashimoto, Takahiro; Ikehira, Hiroo; Fukuda, Hiroshi; Tateno, Yukio.
1992-01-01
Intramuscular degeneration process of Duchenne dystrophy skeletal muscles was investigated by longitudinal skeletal muscle imaging with high-field-strength NMR-CT of 1.5 Tesla. Thigh muscles in 10 cases ranging in age from 4 to 19 years were examined by T 1 -weighted longitudinal images (TR=215∼505 ms, TE=19∼20 ms). The following results were obtained. Skeletal muscle degeneration was depicted as high signal intensity area reflecting its high fat contents. These high signal intensity areas had a longitudinally streaky appearance in parallel direction with myofibers. These findings were more prominent toward myotendon junction than muscle bellies. Skeletal muscle degeneration progressed rapidly between 7 to 10 years of age, and reached a plateau after that. (author)
Directory of Open Access Journals (Sweden)
Fernando L. Mantelatto
Full Text Available Abstract We designed 14 new primers for amplification of the COI barcode region of decapod crustacean species. We tested, with high level of success, the generation of ~ 640 ± 49 base-pair sequences in selected groups of decapods (hermit crabs, squat lobsters, marine and freshwater crabs and shrimps, encompassing representatives of 27 genera of 15 families, 11 of Pleocyemata (Anomura, Brachyura, and Caridea and 4 of Dendrobranchiata. Based on the results we expect the applicability of these primers for several studies with different taxa within Decapoda.
New treatment strategies for canine intervertebral disc degeneration
Smolders, L.A.
2013-01-01
Degeneration of the intervertebral disc (IVD) is a common problem in dogs and humans. IVD degeneration can lead to herniation of the IVD with subsequent compression of neural structures and various clinical signs, including back pain. Current treatment of IVD disease is conservative or surgical.
Acquired Nonpigmented Vitreous Cyst Associated With Lattice Degeneration.
Lu, Jing; Mai, Guiying; Liu, Ruyuan; Luo, Yan; Lu, Lin
2017-10-01
A 63-year-old male presented with a round-shaped floater and visual obscuration in the right eye. Clinical evaluation showed a nonpigmented vitreous cyst connected to a lattice degeneration by a stalk. Immunostaining of the vitreous cyst obtained from vitrectomy showed its origin of retinal neuroepithelium. The cyst was formed by continuous vitreous traction, which might tear up the disrupted retina at the area of lattice degeneration. This report added the lattice degeneration to the list of causes for the acquired vitreous cyst. [Ophthalmic Surg Lasers Imaging Retina. 2017;48:856-858.]. Copyright 2017, SLACK Incorporated.
Chalcone synthase genes from milk thistle (Silybum marianum)
Indian Academy of Sciences (India)
... the identification of encoding genes in milk thistle plant can be of great importance. In the current research, fragments of genes were amplified using degenerate primers based on the conserved parts of Asteraceae genes, and then cloned and sequenced. Analysis of the resultant nucleotide and deduced ...
Yetter, Carol J.
2009-01-01
This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…
DNA Extraction and Primer Selection
DEFF Research Database (Denmark)
Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads
Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...
International Nuclear Information System (INIS)
Moriyasu, K.
1981-01-01
A basic primer for QCD is presented using a semiclassical approach to the colour Maxwell equations. The non-Abelian nature of colour symmetry and the violation of superposition by colour fields is compared with QED. A simple discussion of asymptotic freedom is also presented. (author)
GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.
Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart
2011-01-01
The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.
Tools for Ultraspecific Probe/Primer Design
National Research Council Canada - National Science Library
Fofanov, Yurly
2006-01-01
.... Our approach will deliver DNA probes and PCR primers that have an unprecedentedly low probability of false positives or confusion by environmental background, and which resist evasion by threat agent engineering...
Hafler, Brian P.; Klein, Zoe A.; Zhou, Z. Jimmy; Strittmatter, Stephen M.
2014-01-01
Prior investigations have shown that patients with neuronal ceroid lipofuscinosis (NCL) develop neurodegeneration characterized by vision loss, motor dysfunction, seizures, and often early death. Neuropathological analysis of patients with NCL shows accumulation of intracellular autofluorescent storage material, lipopigment, throughout neurons in the central nervous system including in the retina. A recent study of a sibling pair with adult onset NCL and retinal degeneration showed linkage to the region of the progranulin (GRN) locus and a homozygous mutation was demonstrated in GRN. In particular, the sibling pair with a mutation in GRN developed retinal degeneration and optic atrophy. This locus for this form of adult onset neuronal ceroid lipofuscinosis was designated neuronal ceroid lipofuscinosis-11 (CLN11). Based on these clinical observations, we wished to determine whether Grn-null mice develop accumulation of autofluorescent particles and retinal degeneration. Retinas of both wild-type and Progranulin deficient mice were examined by immunostaining and autofluorescence. Accumulation of autofluorescent material was present in Progranulin deficient mice at 12 months. Degeneration of multiple classes of neurons including photoreceptors and retinal ganglion cells was noted in mice at 12 and 18 months. Our data shows that Grn−/− mice develop degenerative pathology similar to features of human CLN11. PMID:25234724
Diversity of internal structures in inhibited epoxy primers
Directory of Open Access Journals (Sweden)
Anthony E. Hughes
2015-10-01
Full Text Available Computed tomography is making a significant impact in the field of materials science in recent years. In this paper the authors report on advances made in three areas of characterization and also identified where further research needs to be focused. First we report on a new approach to data analysis called “Data Constrained Modelling (DCM” in which compositional tomography can be undertaken rather than adsorption or phase contrast tomography. This is achieved by collecting X-ray CT data at different energies and then combining the datasets to reconstruct 3D compositional tomography. Second, on the application of this approach to inhibited primers typical of those used in the aerospace industry. Aerospace primers are effectively composite materials containing inorganic phases which are bound together with a polymer. Understanding the materials science of these systems requires information over several orders of magnitude in length-scale. In this paper we report on how DCM can be used to extend our understanding at the smaller length scales at the limits of resolution of the technique. The third and final advance is in extending the approach to include 4-dimensional studies. In this case we examine the primer before and after leaching. This process causes changes in the primer which can be both detected and quantified using the above approach.
MRI and MR tractography in bilateral hypertrophic olivary degeneration
Directory of Open Access Journals (Sweden)
Debraj Sen
2014-01-01
Full Text Available Hypertrophic olivary degeneration is a trans-synaptic neuronal degeneration associated with hypertrophy of the inferior olivary nucleus due to a lesion in the triangle of Guillain-Mollaret. Familiarity with this entity on magnetic resonance imaging (MRI is essential to avoid other erroneous ominous diagnoses. We present a case of bilateral hypertrophic olivary degeneration and discuss the etiopathogenesis and MRI findings in this entity. The contributory role of MR tractography in the diagnosis is also highlighted.
Maroju, Pranay Amruth; Yadav, Sonu; Kolipakam, Vishnupriya; Singh, Shweta; Qureshi, Qamar; Jhala, Yadvendradev
2016-02-09
Non-invasive sampling has opened avenues for the genetic study of elusive species, which has contributed significantly to their conservation. Where field based identity of non-invasive sample is ambiguous (e.g. carnivore scats), it is essential to establish identity of the species through molecular approaches. A cost effective procedure to ascertain species identity is to use species specific primers (SSP) for PCR amplification and subsequent resolution through agarose gel electrophoresis. However, SSPs if ill designed can often cross amplify non-target sympatric species. Herein we report the problem of cross amplification with currently published SSPs, which have been used in several recent scientific articles on tigers (Panthera tigris) and leopards (Panthera pardus) in India. Since these papers form pioneering research on which future work will be based, an early rectification is required so as to not propagate this error further. We conclusively show cross amplification of three of the four SSPs, in sympatric non-target species like tiger SSP amplifying leopard and striped hyena (Hyaena hyaena), and leopard SSP amplifying tiger, lion (Panthera leo persica) and clouded leopard (Neofelis nebulosa), with the same product size. We develop and test a non-cross-amplifying leopard specific primer pair within the mitochondrial cytochrome b region. We also standardize a duplex PCR method to screen tiger and leopard samples simultaneously in one PCR reaction to reduce cost and time. These findings suggest the importance of an often overlooked preliminary protocol of conclusive identification of species from non-invasive samples. The cross amplification of published primers in conspecifics suggests the need to revisit inferences drawn by earlier work.
Preparation and Characterization of Acrylic Primer for Concrete Substrate Application
Directory of Open Access Journals (Sweden)
El-Sayed Negim
2016-01-01
Full Text Available This study dealt with the properties of acrylic primer for concrete substrate using acrylic syrup, made from a methyl methacrylate monomer solution of terpolymers. Terpolymer systems consisting of methyl methacrylate (MMA, 2-ethylhexyl acrylate (2-EHA, and methacrylic acid (MAA with different chemical composition ratios of MMA and 2-EHA were synthesized through bulk polymerization using azobisisobutyronitrile (AIBN as initiator. The terpolymer composition is characterized by FTIR, 1H NMR, DSC, TGA, and SEM. The glass transition temperature and the thermal stability increased with increasing amounts of MMA in the terpolymer backbone. The effect of chemical composition of terpolymers on physicomechanical properties of primer films was investigated. However, increasing the amount of MMA in terpolymer backbone increased tensile and contact angle of primer films while elongation at break, water absorption, and bond strength are decreased. In particular, the primer syrup containing 65% 2-EHA has good bonding strength with concrete substrate around 1.1 MPa.
Primary amines protect against retinal degeneration in mouse models of retinopathies.
Maeda, Akiko; Golczak, Marcin; Chen, Yu; Okano, Kiichiro; Kohno, Hideo; Shiose, Satomi; Ishikawa, Kaede; Harte, William; Palczewska, Grazyna; Maeda, Tadao; Palczewski, Krzysztof
2011-12-25
Vertebrate vision is initiated by photoisomerization of the visual pigment chromophore 11-cis-retinal and is maintained by continuous regeneration of this retinoid through a series of reactions termed the retinoid cycle. However, toxic side reaction products, especially those involving reactive aldehyde groups of the photoisomerized product, all-trans-retinal, can cause severe retinal pathology. Here we lowered peak concentrations of free all-trans-retinal with primary amine-containing Food and Drug Administration (FDA)-approved drugs that did not inhibit chromophore regeneration in mouse models of retinal degeneration. Schiff base adducts between all-trans-retinal and these amines were identified by MS. Adducts were observed in mouse eyes only when an experimental drug protected the retina from degeneration in both short-term and long-term treatment experiments. This study demonstrates a molecular basis of all-trans-retinal-induced retinal pathology and identifies an assemblage of FDA-approved compounds with protective effects against this pathology in a mouse model that shows features of Stargardt's disease and age-related retinal degeneration.
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2017-07-01
Full Text Available Porcine adulteration in meatball samples were analyzed using real-time polymerase chain reaction (RT-PCR, based on the ND5 primer obtained by previous study. This work consisted of three stages which were annealing temperature optimization, method validation, and application. DNA template was extracted using phenol-CIAA (chloroform-iso amyl alcohol method. The optimum annealing temperature for ND5 primers (forward primer 5'-CATTCGCCTCACTCACATTAACC-3' and reverse primer 5'-AAGAGAGAGTTCTACGGTCTGTAG-3' was 58.0 °C, obtained after testing annealing at 50.5 to 59.5 °C gradient temperature with 5 °C interval. Melting curve analysis was done at 65.0 to 95.0 °C, with increasing temperature for 0.5 °C per 2 sec. Method was validated for its specificity, precision and limit of detection. RT-PCR method with ND5 primers produced 227 bp DNA fragment with 78.50 °C Tm value. From eight commercial meatball samples, one was detected containing porcine. The methods showed high specificity and precision, with experimentally determined limits for porcine were no less than 1%.
Bond strength of compomers to dentin using acidic primers.
Tate, W H; You, C; Powers, J M
1999-10-01
To determine the in vitro bond strengths of seven compomer/bonding agent restorative systems to human dentin. Seven compomer/bonding agents were bonded to human dentin, stored in water at 37 degrees C for 24 hours, and debonded in tension. Bonding conditions were with and without phosphoric acid etching, with and without the use of combined primer/bonding agents, and under moist and wet bond interfaces. Without phosphoric acid etching, F2000/F2000 Compomer Primer/Adhesive and F2000/Single Bond Dental Adhesive System were less sensitive to dentin wetness. With moist dentin, bond strengths of Dyract/Prime & Bond 2.1, Dyract AP/Prime & Bond 2.1, Hytac/OSB light-curing, one-component bonding agent, F2000/Single Bond, and Freedom/STAE single component light-cured dentin/enamel adhesive system, were improved with phosphoric acid etching. Also, with moist dentin, the bond strength of F2000/F2000 Compomer Primer/Adhesive in the 3M Clicker dispensing system was higher without phosphoric acid etching, whereas bonds of Compoglass/Syntac Single-component were not affected by phosphoric acid etching. Bonding did not occur without primer/bonding agent, regardless of surface condition or use of phosphoric acid etching.
Humor and laughter in patients with cerebellar degeneration.
Frank, B; Propson, B; Göricke, S; Jacobi, H; Wild, B; Timmann, D
2012-06-01
Humor is a complex behavior which includes cognitive, affective and motor responses. Based on observations of affective changes in patients with cerebellar lesions, the cerebellum may support cerebral and brainstem areas involved in understanding and appreciation of humorous stimuli and expression of laughter. The aim of the present study was to examine if humor appreciation, perception of humorous stimuli, and the succeeding facial reaction differ between patients with cerebellar degeneration and healthy controls. Twenty-three adults with pure cerebellar degeneration were compared with 23 age-, gender-, and education-matched healthy control subjects. No significant difference in humor appreciation and perception of humorous stimuli could be found between groups using the 3 Witz-Dimensionen Test, a validated test asking for funniness and aversiveness of jokes and cartoons. Furthermore, while observing jokes, humorous cartoons, and video sketches, facial expressions of subjects were videotaped and afterwards analysed using the Facial Action Coding System. Using depression as a covariate, the number, and to a lesser degree, the duration of facial expressions during laughter were reduced in cerebellar patients compared to healthy controls. In sum, appreciation of humor appears to be largely preserved in patients with chronic cerebellar degeneration. Cerebellar circuits may contribute to the expression of laughter. Findings add to the literature that non-motor disorders in patients with chronic cerebellar disease are generally mild, but do not exclude that more marked disorders may show up in acute cerebellar disease and/or in more specific tests of humor appreciation.
Lumbosacral interspinous ligament rupture associated with acute intrinsic spinal muscle degeneration
International Nuclear Information System (INIS)
Jinkins, Randy J.
2002-01-01
The objective of this study was to demonstrate lumbosacral interspinous ligament rupture, with or without related acute intrinsic spinal muscle degeneration. This study consisted of a prospective imaging analysis of consecutive 100 MRI studies in adult patients (mean age 56 years) presenting with low back pain. Alterations from the normal in the inter- and perispinal structures of the spine and perispinal soft tissues (e.g., spinal ligaments, perispinal muscles) were sought based upon studies on young volunteers without low back pain (n=10; mean age 23 years). Compared with the group without low back pain, many index cases (n=71, 71%) demonstrated hyperintensity (i.e., sprain or frank ligamentous rupture) of the interspinous ligament(s) on T2-weighted, fat-suppressed MRI studies at one (20 of 71, 28%) or multiple (51 of 71, 72%) levels. Associated intrinsic spinal muscle (e.g., interspinalis, multifidus muscles) degeneration was observed in a minority of cases overall (n=7, 7%), but was only seen in association with cases also demonstrating interspinous ligament degeneration/rupture (7 of 71, 10%). Lumbosacral interspinous ligament sprain or frank rupture, as well as related acute-subacute autotraumatic intrinsic spinal muscle rupture/degeneration, may be overlooked by many observers if fat-suppressed, T2-weighted MRI is not acquired. These musculoligamentous alterations are on occasion the only abnormalities recognized on MRI of the lumbosacral spine and may theoretically be sources of low back morbidity that potentially may respond to specific therapy. Because this study was an observational one, based solely upon medical imaging, future research must focus upon the correlation of the relevance of these findings with an age-matched asymptomatic control group and longitudinal clinicoradiologic therapeutic trials. (orig.)
Progress toward the maintenance and repair of degenerating retinal circuitry.
Vugler, Anthony A
2010-01-01
Retinal diseases such as age-related macular degeneration and retinitis pigmentosa remain major causes of severe vision loss in humans. Clinical trials for treatment of retinal degenerations are underway and advancements in our understanding of retinal biology in health/disease have implications for novel therapies. A review of retinal biology is used to inform a discussion of current strategies to maintain/repair neural circuitry in age-related macular degeneration, retinitis pigmentosa, and Type 2 Leber congenital amaurosis. In age-related macular degeneration/retinitis pigmentosa, a progressive loss of rods/cones results in corruption of bipolar cell circuitry, although retinal output neurons/photoreceptive melanopsin cells survive. Visual function can be stabilized/enhanced after treatment in age-related macular degeneration, but in advanced degenerations, reorganization of retinal circuitry may preclude attempts to restore cone function. In Type 2 Leber congenital amaurosis, useful vision can be restored by gene therapy where central cones survive. Remarkable progress has been made in restoring vision to rodents using light-responsive ion channels inserted into bipolar cells/retinal ganglion cells. Advances in genetic, cellular, and prosthetic therapies show varying degrees of promise for treating retinal degenerations. While functional benefits can be obtained after early therapeutic interventions, efforts should be made to minimize circuitry changes as soon as possible after rod/cone loss. Advances in retinal anatomy/physiology and genetic technologies should allow refinement of future reparative strategies.
Pryadko, Leonid P.; Dumer, Ilya; Kovalev, Alexey A.
2015-03-01
We construct a lower (existence) bound for the threshold of scalable quantum computation which is applicable to all stabilizer codes, including degenerate quantum codes with sublinear distance scaling. The threshold is based on enumerating irreducible operators in the normalizer of the code, i.e., those that cannot be decomposed into a product of two such operators with non-overlapping support. For quantum LDPC codes with logarithmic or power-law distances, we get threshold values which are parametrically better than the existing analytical bound based on percolation. The new bound also gives a finite threshold when applied to other families of degenerate quantum codes, e.g., the concatenated codes. This research was supported in part by the NSF Grant PHY-1416578 and by the ARO Grant W911NF-11-1-0027.
Sarafianou, Aspasia; Seimenis, Ioannis; Papadopoulos, Triantafillos
2008-05-01
There is a need for achieving reliable chemical bond strength between veneering composites resins and casting alloys through the use of simplified procedures. The purpose of this study was to examine the shear bond strength of an indirect composite resin to a Ni-Cr alloy, using 4 primers and 2 airborne-particle-abrasion procedures. Fifty-six Ni-Cr (Heraenium NA) discs, 10 mm in diameter and 1.5 mm in height, were fabricated. Twenty-four discs were airborne-particle abraded with 50-microm Al2O3 particles, while another 24 were airborne-particle abraded with 250-microm Al2O3 particles. The following primers were applied on 6 discs of each airborne-particle-abrasion treatment group: Solidex Metal Photo Primer (MPP50, MPP250), Metal Primer II (MPII50, MPII250), SR Link (SRL50, SRL250), and Tender Bond (TB50, TB250). The Rocatec system was used on another 6 discs, airborne-particle abraded according to the manufacturer's recommendations, which served as the control group (R). Two more discs were airborne-particle abraded with 50-microm and 250-microm Al2O3 particles, respectively, to determine the Al content on their surfaces, without any bonding procedure. The indirect composite resin used was Sinfony. Specimens were thermally cycled (5 degrees C and 55 degrees C, 30-second dwell time, 5000 cycles) and tested in shear mode in a universal testing machine. The failure mode was determined with an optical microscope, and selected specimens were subjected to energy dispersive spectroscopy (EDS). Mean bond strength values were analyzed using 2-way ANOVA followed by Tukey's multiple comparison tests (alpha=.05) and compared to the control group using 1-way ANOVA followed by Tukey's multiple comparison tests (alpha=.05). The groups abraded with 50-microm particles exhibited significantly higher bond strength compared to the groups abraded with 250-microm particles. Group MPII50 exhibited the highest mean value (17.4 +/-2 MPa). Groups MPP50, MPP250, and TB50, TB250 showed
[Current concepts in pathogenesis of age-related macular degeneration].
Kubicka-Trząska, Agnieszka; Karska-Basta, Izabella; Romanowska-Dixon, Bożena
2014-01-01
Age-related macular degeneration is the leading cause of central blindness in elderly population of the western world. The pathogenesis of this disease, likely multifactorial, is not well known, although a number of theories have been put forward, including oxidative stress, genetic interactions, hemodynamic imbalance, immune and inflammatory processes. The understanding of age-related macular degeneration pathogenesis will give rise to new approaches in prevention and treatment of the early and late stages of both atrophic and neovascular age-related macular degeneration.
Optimisation of the PCR-invA primers for the detection of Salmonella ...
African Journals Online (AJOL)
A polymerase chain reaction (PCR)-based method for the detection of Salmonella species in water samples was optimised and evaluated for speed, specificity and sensitivity. Optimisation of Mg2+ and primer concentrations and cycling parameters increased the sensitivity and limit of detection of PCR to 2.6 x 104 cfu/m.
MR findings of degenerating parenchymal neurocysticercosis
International Nuclear Information System (INIS)
Lee, Yul; Chung, Eun A; Yang, Ik; Park, Hae Jung; Chung, Soo Young
1996-01-01
To evaluate MR imaging findings of degenerating parenchymal neurocysticercosis and to determine the characteristics which distinguish it from other brain diseases. MR imagings of 19 patients (56 lesions) of degenerating parenchymal neurocysticercosis were retrospectively evaluated, focusing on the size and location of lesions signal intensity patterns of cyst fluid and wall, the extent of the surrounding edema and features of contrast enhancement. Degenerating parenchymal neurocysticercosis was located in gray or subcortical while matter in 89.3% of 56 lesions (50/56) ; most of these (98.2%) were smaller than 2 cm in diameter. Cyst fluid signal was hyperintense relative to CSF on T1 and proton density weighted images (92.9%). A hypointense signal rim of the cyst wall was noted in the lesions on proton density (92.9%) and T2 weighted (98.2%) images, Surrounding edema was mostly mild. Peripheral rim enhancement was noted in all lesions, and this was frequently irregular and lobulated (67.9%) with a focal defect in the enhancing rim(41.1%). Findings which could be helpful in distinguishing degenerating parencymal neurocysticercosis from other brain diseases are as follows : small, superficial lesions ; hyperintense signal of the cyst fluid on T1 and proton density weighted images ; hypointense signal of the cyst wall on proton density and T2 weighted images ; relatively mild extent of surrounding edema, and peripheral rim enhancement which is frequently irregular and lobulated with a focal defect in the enhancing rim
Microsatellite Primers in the Lichen Symbiotic Alga Trebouxia decolorans (Trebouxiophyceae
Directory of Open Access Journals (Sweden)
Francesco Dal Grande
2013-03-01
Full Text Available Premise of the study: Polymorphic microsatellite markers were developed for the symbiotic green alga Trebouxia decolorans to study fine-scale population structure and clonal diversity. Methods and Results: Using Illumina pyrosequencing, 20 microsatellite primer sets were developed for T. decolorans. The primer sets were tested on 43 individuals sampled from four subpopulations in Germany. The primers amplified di-, tri-, and tetranucleotide repeats with three to 15 alleles per locus, and the unbiased haploid diversity per locus ranged from 0.636 to 0.821. Conclusions: The identified microsatellite markers will be useful to study the genetic diversity, dispersal, and reproductive mode of this common lichen photobiont.
40 CFR 63.745 - Standards: Primer and topcoat application operations.
2010-07-01
... CATEGORIES (CONTINUED) National Emission Standards for Aerospace Manufacturing and Rework Facilities § 63.745.../L (4.5 lb/gal) of primer (less water), as applied, for general aviation rework facilities; or 650 g... (4.5 lb/gal) of primer (less water and exempt solvents), as applied, for general aviation rework...
Degeneration of the long biceps tendon: comparison of MRI with gross anatomy and histology.
Buck, Florian M; Grehn, Holger; Hilbe, Monika; Pfirrmann, Christian W A; Manzanell, Silvana; Hodler, Jürg
2009-11-01
The objective of our study was to relate alterations in biceps tendon diameter and signal on MR images to gross anatomy and histology. T1-weighted, T2-weighted fat-saturated, and proton density-weighted fat-saturated spin-echo sequences were acquired in 15 cadaveric shoulders. Biceps tendon diameter (normal, flattened, thickened, and partially or completely torn) and signal intensity (compared with bone, fat, muscle, and joint fluid) were graded by two readers independently and in a blinded fashion. The distance of tendon abnormalities from the attachment at the glenoid were noted in millimeters. MRI findings were related to gross anatomic and histologic findings. On the basis of gross anatomy, there were six normal, five flattened, two thickened, and two partially torn tendons. Reader 1 graded nine diameter changes correctly, missed two, and incorrectly graded four. The corresponding values for reader 2 were seven, one, and five, respectively, with kappa = 0.75. Histology showed mucoid degeneration (n = 13), lipoid degeneration (n = 7), and fatty infiltration (n = 6). At least one type of abnormality was found in each single tendon. Mucoid degeneration was hyperintense compared with fatty infiltration on T2-weighted fat-saturated images and hyperintense compared with magic-angle artifacts on proton density-weighted fat-saturated images. MRI-based localization of degeneration agreed well with histologic findings. Diameter changes are specific but not sensitive in diagnosing tendinopathy of the biceps tendon. Increased tendon signal is most typical for mucoid degeneration but should be used with care as a sign of tendon degeneration.
Microcurrent stimulation in the treatment of dry and wet macular degeneration
Directory of Open Access Journals (Sweden)
Chaikin L
2015-12-01
Full Text Available Laurie Chaikin,1 Kellen Kashiwa,2 Michael Bennet,2 George Papastergiou,3 Walter Gregory4 1Private practice, Alameda, CA, USA; 2Retina Institute of Hawaii, Honolulu, HI, USA; 3California Retinal Associates, San Diego, CA, USA; 4Clinical Trials Research Unit, Faculty of Medicine and Health, University of Leeds, Leeds, UK Purpose: To determine the safety and efficacy of the application of transcutaneous (transpalpebral microcurrent stimulation to slow progression of dry and wet macular degeneration or improve vision in dry and wet macular degeneration. Methods: Seventeen patients aged between 67 and 95 years with an average age of 83 years were selected to participate in the study over a period of 3 months in two eye care centers. There were 25 eyes with dry age-related macular degeneration (DAMD and six eyes with wet age-related macular degeneration (WAMD. Frequency-specific microcurrent stimulation was applied in a transpalpebral manner, using two programmable dual channel microcurrent units delivering pulsed microcurrent at 150 µA for 35 minutes once a week. The frequency pairs selected were based on targeting tissues, which are typically affected by the disease combined with frequencies that target disease processes. Early Treatment Diabetic Retinopathy Study or Snellen visual acuity (VA was measured before and after each treatment session. All treatment was administered in a clinical setting. Results: Significant increases were seen in VA in DAMD (P=0.012, Wilcoxon one-sample test, but in WAMD, improvements did not reach statistical significance (P=0.059. In DAMD eyes, twice as many patients showed increase in VA (52% compared to those showing deterioration (26%, with improvements being often sizeable, whereas deteriorations were usually very slight. In WAMD eyes, five of six (83% patients showed an increase and none showed deterioration. Conclusion: The substantial changes observed over this period, combined with continued improvement for
CT of sarcomatous degeneration in neurofibromatosis
International Nuclear Information System (INIS)
Coleman, B.G.; Arger, P.H.; Dalinka, M.K.; Obringer, A.C.; Raney, B.R.; Meadows, A.T.
1983-01-01
Neurofibromatosis is a relatively common disorder that often involves many organ systems. One of the least understood aspects of this malady is a well documented potential for sarcomatous degeneration of neurofibromas. The inability to identify patients at risk and the lack of noninvasive screening methods for symptomatic patients often leads to late diagnosis. In six of seven subsequently proven neurofibrosarcomas, CT demonstrated low-density areas that histopathologically appeared to be due to necrosis, hemorrhage, and/or cystic degeneration. The density differences within these sarcomas were enhanced by the intravenous adminstration of iodinated contrast agents
LONGITUDINAL STRUCTURAL CHANGES IN LATE-ONSET RETINAL DEGENERATION.
Cukras, Catherine; Flamendorf, Jason; Wong, Wai T; Ayyagari, Radha; Cunningham, Denise; Sieving, Paul A
2016-12-01
To characterize longitudinal structural changes in early stages of late-onset retinal degeneration to investigate pathogenic mechanisms. Two affected siblings, both with a S163R missense mutation in the causative gene C1QTNF5, were followed for 8+ years. Color fundus photos, fundus autofluorescence images, near-infrared reflectance fundus images, and spectral domain optical coherence tomography scans were acquired during follow-up. Both patients, aged 45 and 50 years, had good visual acuities (>20/20) in the context of prolonged dark adaptation. Baseline color fundus photography demonstrated yellow-white, punctate lesions in the temporal macula that correlated with a reticular pattern on fundus autofluorescence and near-infrared reflectance imaging. Baseline spectral domain optical coherence tomography imaging revealed subretinal deposits that resemble reticular pseudodrusen described in age-related macular degeneration. During follow-up, these affected areas developed confluent thickening of the retinal pigment epithelial layer and disruption of the ellipsoid zone of photoreceptors before progressing to overt retinal pigment epithelium and outer retinal atrophy. Structural changes in early stages of late-onset retinal degeneration, revealed by multimodal imaging, resemble those of reticular pseudodrusen observed in age-related macular degeneration and other retinal diseases. Longitudinal follow-up of these lesions helps elucidate their progression to frank atrophy and may lend insight into the pathogenic mechanisms underlying diverse retinal degenerations.
MR imaging of patellar cartilage degeneration at 0.02 T
International Nuclear Information System (INIS)
Koskinen, S.K.; Komu, M.; Aho, H.J.; Kormano, M.; Turku University Hospital
1991-01-01
MR imaging with a 0.02 T resistive magnet was used to establish the correlation between the histologic grading of patellar cartilage degeneration and fat water separation images or T1- and T2-relaxation times. We examined 23 cadaveric patellae. There was a positive correlation between histologically graded cartilage degeneration and T1-relaxation time. Patellar cartilage was well differentiated from surrounding structures on chemical shift water proton images, and an evaluation of cartilage degeneration was possible. No correlation was found between cartilage degeneration damage and T2-relaxation time. Chemical shift imaging at 0.02 T is easy to perform and gives further information of cartilage disorders. (orig.)
Codon optimizing for increased membrane protein production
DEFF Research Database (Denmark)
Mirzadeh, K.; Toddo, S.; Nørholm, Morten
2016-01-01
. As demonstrated with two membrane-embedded transporters in Escherichia coli, the method was more effective than optimizing the entire coding sequence. The method we present is PCR based and requires three simple steps: (1) the design of two PCR primers, one of which is degenerate; (2) the amplification...
Relationship of Tear Size and Location to Fatty Degeneration of the Rotator Cuff
Kim, H. Mike; Dahiya, Nirvikar; Teefey, Sharlene A.; Keener, Jay D.; Galatz, Leesa M.; Yamaguchi, Ken
2010-01-01
Background: Fatty degeneration of the rotator cuff muscles may have detrimental effects on both anatomical and functional outcomes following shoulder surgery. The purpose of this study was to investigate the relationship between tear geometry and muscle fatty degeneration in shoulders with a deficient rotator cuff. Methods: Ultrasonograms of both shoulders of 262 patients were reviewed to assess the type of rotator cuff tear and fatty degeneration in the supraspinatus and infraspinatus muscles. The 251 shoulders with a full-thickness tear underwent further evaluation for tear size and location. The relationship of tear size and location to fatty degeneration of the supraspinatus and infraspinatus muscles was investigated with use of statistical comparisons and regression models. Results: Fatty degeneration was found almost exclusively in shoulders with a full-thickness rotator cuff tear. Of the 251 shoulders with a full-thickness tear, eighty-seven (34.7%) had fatty degeneration in either the supraspinatus or infraspinatus, or both. Eighty-two (32.7%) of the 251 full-thickness tears had a distance of 0 mm between the biceps tendon and anterior margin of the tear. Ninety percent of the full-thickness tears with fatty degeneration in both muscles had a distance of 0 mm posterior from the biceps, whereas only 9% of those without fatty degeneration had a distance of 0 mm. Tears with fatty degeneration had significantly greater width and length than those without fatty degeneration (p Tears with fatty degeneration had a significantly shorter distance posterior from the biceps than those without fatty degeneration (p tear width and length were found to be the most important predictors for infraspinatus fatty degeneration. Conclusions: Fatty degeneration of the rotator cuff muscles is closely associated with tear size and location. The finding of this study suggests that the integrity of the anterior supraspinatus tendon is important to the development of fatty
Ethanol Exposure Causes Muscle Degeneration in Zebrafish
Directory of Open Access Journals (Sweden)
Elizabeth C. Coffey
2018-03-01
Full Text Available Alcoholic myopathies are characterized by neuromusculoskeletal symptoms such as compromised movement and weakness. Although these symptoms have been attributed to neurological damage, EtOH may also target skeletal muscle. EtOH exposure during zebrafish primary muscle development or adulthood results in smaller muscle fibers. However, the effects of EtOH exposure on skeletal muscle during the growth period that follows primary muscle development are not well understood. We determined the effects of EtOH exposure on muscle during this phase of development. Strikingly, muscle fibers at this stage are acutely sensitive to EtOH treatment: EtOH induces muscle degeneration. The severity of EtOH-induced muscle damage varies but muscle becomes more refractory to EtOH as muscle develops. NF-kB induction in muscle indicates that EtOH triggers a pro-inflammatory response. EtOH-induced muscle damage is p53-independent. Uptake of Evans blue dye shows that EtOH treatment causes sarcolemmal instability before muscle fiber detachment. Dystrophin-null sapje mutant zebrafish also exhibit sarcolemmal instability. We tested whether Trichostatin A (TSA, which reduces muscle degeneration in sapje mutants, would affect EtOH-treated zebrafish. We found that TSA and EtOH are a lethal combination. EtOH does, however, exacerbate muscle degeneration in sapje mutants. EtOH also disrupts adhesion of muscle fibers to their extracellular matrix at the myotendinous junction: some detached muscle fibers retain beta-Dystroglycan indicating failure of muscle end attachments. Overexpression of Paxillin, which reduces muscle degeneration in zebrafish deficient for beta-Dystroglycan, is not sufficient to rescue degeneration. Taken together, our results suggest that EtOH exposure has pleiotropic deleterious effects on skeletal muscle.
Surentheran, T; Harwood, C A; Spink, P J; Sinclair, A L; Leigh, I M; Proby, C M; McGregor, J M; Breuer, J
1998-01-01
AIM: To develop a unified diagnostic approach for the detection of human papillomavirus (HPV) DNA in skin and mucosal biopsies from both immunocompetent and immunosuppressed individuals using a degenerate polymerase chain reaction (PCR) method. METHODS: The sensitivity and specificity of three published degenerate primer sets (HVP2/B5 and F14/B15; MY09/MY11; CP62/69 outer and CP65/68 nested primer pairs) were evaluated in PCR reactions with serial dilutions of 12 representative cloned HPV typ...
Nonlinear electromagnetic waves in a degenerate electron-positron plasma
Energy Technology Data Exchange (ETDEWEB)
El-Labany, S.K., E-mail: skellabany@hotmail.com [Department of Physics, Faculty of Science, Damietta University, New Damietta (Egypt); El-Taibany, W.F., E-mail: eltaibany@hotmail.com [Department of Physics, College of Science for Girls in Abha, King Khalid University, Abha (Saudi Arabia); El-Samahy, A.E.; Hafez, A.M.; Atteya, A., E-mail: ahmedsamahy@yahoo.com, E-mail: am.hafez@sci.alex.edu.eg, E-mail: ahmed_ateya2002@yahoo.com [Department of Physics, Faculty of Science, Alexandria University, Alexandria (Egypt)
2015-08-15
Using the reductive perturbation technique (RPT), the nonlinear propagation of magnetosonic solitary waves in an ultracold, degenerate (extremely dense) electron-positron (EP) plasma (containing ultracold, degenerate electron, and positron fluids) is investigated. The set of basic equations is reduced to a Korteweg-de Vries (KdV) equation for the lowest-order perturbed magnetic field and to a KdV type equation for the higher-order perturbed magnetic field. The solutions of these evolution equations are obtained. For better accuracy and searching on new features, the new solutions are analyzed numerically based on compact objects (white dwarf) parameters. It is found that including the higher-order corrections results as a reduction (increment) of the fast (slow) electromagnetic wave amplitude but the wave width is increased in both cases. The ranges where the RPT can describe adequately the total magnetic field including different conditions are discussed. (author)
Prevalence of age-related macular degeneration in elderly Caucasians
DEFF Research Database (Denmark)
Erke, Maja G; Bertelsen, Geir; Peto, Tunde
2012-01-01
To describe the sex- and age-specific prevalence of drusen, geographic atrophy, and neovascular age-related macular degeneration (AMD).......To describe the sex- and age-specific prevalence of drusen, geographic atrophy, and neovascular age-related macular degeneration (AMD)....
The Fluid Reading Primer: Animated Decoding Support for Emergent Readers.
Zellweger, Polle T.; Mackinlay, Jock D.
A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…
[Myopia: frequency of lattice degeneration and axial length].
Martín Sánchez, M D; Roldán Pallarés, M
2001-05-01
To evaluate the relationship between lattice retinal degeneration and axial length of the eye in different grades of myopia. A sample of 200 eyes from 124 myopic patients was collected by chance. The average age was 34.8 years (20-50 years) and the myopia was between 0.5 and 20 diopters (D). The eyes were grouped according to the degree of refraction defect, the mean axial length of each group (Scan A) and the frequency of lattice retinal degeneration and the relationship between these variables was studied. The possible influence of age on our results was also considered. For the statistical analysis, the SAS 6.07 program with the variance analysis for quantitative variables, and chi(2) test for qualitative variables with a 5% significance were used. A multivariable linear regression model was also adjusted. The highest frequency of lattice retinal degeneration occurred in those myopia patients having more than 15 D, and also in the group of myopia patients between 3 and 6 D, but this did not show statistical significance when compared with the other myopic groups. If the axial length is assessed, a greater frequency of lattice retinal degeneration is also found when the axial length is 25-27 mm and 29-30 mm, which correspond, respectively, to myopias between 3-10 D and more than 15 D. When the multivariable linear regression model was adjusted, the axial length showed the existence of lattice retinal degeneration (beta 0.41 mm; p=0.08) adjusted by the number of diopters (beta 0.38 mm; plattice retinal degeneration was found for myopias with axial eye length between 29-30 mm (more than 15 D), and 25-27 mm (between 3-10 D).
Cesare Lombroso: an anthropologist between evolution and degeneration.
Mazzarello, Paolo
2011-01-01
Cesare Lombroso (1835-1909) was a prominent Italian medical doctor and intellectual in the second half of the nineteenth century. He became world famous for his theory that criminality, madness and genius were all sides of the same psychobiological condition: an expression of degeneration, a sort of regression along the phylogenetic scale, and an arrest at an early stage of evolution. Degeneration affected criminals especially, in particular the "born delinquent" whose development had stopped at an early stage, making them the most "atavistic" types of human being. Lombroso also advocated the theory that genius was closely linked with madness. A man of genius was a degenerate, an example of retrograde evolution in whom madness was a form of "biological compensation" for excessive intellectual development. To confirm this theory, in August 1897, Lombroso, while attending the Twelfth International Medical Congress in Moscow, decided to meet the great Russian writer Lev Tolstoy in order to directly verify, in him, his theory of degeneration in the genius. Lombroso's anthropological ideas fuelled a heated debate on the biological determinism of human behaviour.
Therapeutic Approaches to Histone Reprogramming in Retinal Degeneration.
Berner, Andre K; Kleinman, Mark E
2016-01-01
Recent data have revealed epigenetic derangements and subsequent chromatin remodeling as a potent biologic switch for chronic inflammation and cell survival which are important therapeutic targets in the pathogenesis of several retinal degenerations. Histone deacetylases (HDACs) are a major component of this system and serve as a unique control of the chromatin remodeling process. With a multitude of targeted HDAC inhibitors now available, their use in both basic science and clinical studies has widened substantially. In the field of ocular biology, there are data to suggest that HDAC inhibition may suppress neovascularization and may be a possible treatment for retinitis pigmentosa and dry age-related macular degeneration (AMD). However, the effects of these inhibitors on cell survival and chemokine expression in the chorioretinal tissues remain very unclear. Here, we review the multifaceted biology of HDAC activity and pharmacologic inhibition while offering further insight into the importance of this epigenetic pathway in retinal degenerations. Our laboratory investigations aim to open translational avenues to advance dry AMD therapeutics while exploring the role of acetylation on inflammatory gene expression in the aging and degenerating retina.
Hypersensitivity to DNA-damaging agents in primary degenerations of excitable tissue
International Nuclear Information System (INIS)
Robbins, J.H.
1983-01-01
Defects in DNA-repair mechanisms render xeroderma pigmentosum cells hypersensitive to killing by the uv-type of DNA-damaging agent. Some xeroderma pigmentosum patients develop a primary neuronal degeneration, and cell lines from patients with the earliest onset of neurodegeneration are the most sensitive to killing by uv radiation. These findings led to the neuronal DNA integrity theory which holds that when the integrity of neuronal DNA is destroyed by the accumulation of unrepaired DNA damaged spontaneously or by endogenous metabolites, the neurons will undergo a primary degeneration. Cells from patients with Cockayne syndrome, a demyelinating disorder with a primary retinal degeneration, are also hypersensitive to the uv-type of DNA-damaging agent. Cells from patients with the primary neuronal degeneration of ataxia telangiectasia are hypersensitive to the x-ray-type of DNA-damaging agent. Cells from other patients with primary degeneration of excitable tissue also have hypersensitivity to the x-ray-type of DNA-damaging agent. These disorders include (1) primary neuronal degenerations which are either genetic (e.g., Huntington disease, familial dysautonomia, Friedreich ataxia) or sporadic (e.g., Alzheimer disease, Parkinson disease), (2) primary muscle degenerations (e.g., Duchenne muscular dystrophy), and (3) a primary retinal degeneration (Usher syndrome). Death of excitable tissue in vivo in these radiosensitive diseases may result from unrepaired DNA. This hypersensitivity provides the basis for developing suitable presymptomatic and prenatal tests for these diseases, for elucidating their pathogenesis, and for developing future therapies. 119 references, 3 figures, 3 tables
Degenerated-Inverse-Matrix-Based Channel Estimation for OFDM Systems
Directory of Open Access Journals (Sweden)
Makoto Yoshida
2009-01-01
Full Text Available This paper addresses time-domain channel estimation for pilot-symbol-aided orthogonal frequency division multiplexing (OFDM systems. By using a cyclic sinc-function matrix uniquely determined by Nc transmitted subcarriers, the performance of our proposed scheme approaches perfect channel state information (CSI, within a maximum of 0.4 dB degradation, regardless of the delay spread of the channel, Doppler frequency, and subcarrier modulation. Furthermore, reducing the matrix size by splitting the dispersive channel impulse response into clusters means that the degenerated inverse matrix estimator (DIME is feasible for broadband, high-quality OFDM transmission systems. In addition to theoretical analysis on normalized mean squared error (NMSE performance of DIME, computer simulations over realistic nonsample spaced channels also showed that the DIME is robust for intersymbol interference (ISI channels and fast time-invariant channels where a minimum mean squared error (MMSE estimator does not work well.
Freshwater Wetlands: A Citizen's Primer.
Catskill Center for Conservation and Development, Inc., Hobart, NY.
The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…
Relationship between full-thickness macular hole and retinal break/lattice degeneration.
Zhang, Jinglin; Li, Yonghao; Zhao, Xiujuan; Cai, Yu; Yu, Xiling; Lu, Lin
2015-12-01
The purpose is to investigate the relationship between full-thickness macular hole (MH) and retinal break (RB) and/or lattice degeneration. Patients diagnosed as full-thickness MH and referred to Dr. Lin Lu from January 2009 to December 2013 were evaluated. All patients underwent general ophthalmologic examinations, fundus examination and optical coherence tomography (OCT). The RB and/or lattice degeneration were recorded. Totally 183 eyes of 167 patients were included. The sex ratio of men to women was 1:2.88. A total of 17 eyes were pseudophakic and 166 eyes were phakic. RB and/or lattice degeneration were found in 62 eyes (33.88%). The prevalence of RB and/or lattice degeneration was similar between men and women (P = 0.344 > 0.05). There was no statistical difference between the pseudophakic eyes and phakic eyes (P = 0.138 > 0.05). All of the RB and/or lattice degeneration were located near or anterior to the equator. The inferior quadrants and the vertical meridian were affected more often than the superior quadrants and the horizontal meridian. We identified a high incidence of RB/lattice degeneration in cases of full-thickness MH. Carefully examination of the peripheral retina and prophylactic treatment of RB and/or lattice degeneration are critical.
Quantitative Microbial Risk Assessment Tutorial - Primer
This document provides a Quantitative Microbial Risk Assessment (QMRA) primer that organizes QMRA tutorials. The tutorials describe functionality of a QMRA infrastructure, guide the user through software use and assessment options, provide step-by-step instructions for implementi...
A tool for design of primers for microRNA-specific quantitative RT-qPCR. BMC Bioinformatics
DEFF Research Database (Denmark)
Busk, Peter Kamp
2014-01-01
of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed......Background MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come...... at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. Results I have developed the software miRprimer for automatic...
An Unusual Case of Extensive Lattice Degeneration and Retinal Detachment
Mathew, David J.; Sarma, Saurabh Kumar; Basaiawmoit, Jennifer V.
2016-01-01
Lattice degeneration of the retina is not infrequently encountered on a dilated retinal examination and many of them do not need any intervention. We report a case of atypical lattice degeneration variant with peripheral retinal detachment. An asymptomatic 35-year-old lady with minimal refractive error was found to have extensive lattice degeneration, peripheral retinal detachment and fibrotic changes peripherally with elevation of retinal vessels on dilated retinal examination. There were al...
Retinal Cell Degeneration in Animal Models
Directory of Open Access Journals (Sweden)
Masayuki Niwa
2016-01-01
Full Text Available The aim of this review is to provide an overview of various retinal cell degeneration models in animal induced by chemicals (N-methyl-d-aspartate- and CoCl2-induced, autoimmune (experimental autoimmune encephalomyelitis, mechanical stress (optic nerve crush-induced, light-induced and ischemia (transient retinal ischemia-induced. The target regions, pathology and proposed mechanism of each model are described in a comparative fashion. Animal models of retinal cell degeneration provide insight into the underlying mechanisms of the disease, and will facilitate the development of novel effective therapeutic drugs to treat retinal cell damage.
Software-Supported USER Cloning Strategies for Site-Directed Mutagenesis and DNA Assembly
DEFF Research Database (Denmark)
Genee, Hans Jasper; Bonde, Mads Tvillinggaard; Bagger, Frederik Otzen
2015-01-01
USER cloning is a fast and versatile method for engineering of plasmid DNA. We have developed a user friendly Web server tool that automates the design of optimal PCR primers for several distinct USER cloning-based applications. Our Web server, named AMUSER (Automated DNA Modifications with USER...... cloning), facilitates DNA assembly and introduction of virtually any type of site-directed mutagenesis by designing optimal PCR primers for the desired genetic changes. To demonstrate the utility, we designed primers for a simultaneous two-position site-directed mutagenesis of green fluorescent protein...... (GFP) to yellow fluorescent protein (YFP), which in a single step reaction resulted in a 94% cloning efficiency. AMUSER also supports degenerate nucleotide primers, single insert combinatorial assembly, and flexible parameters for PCR amplification. AMUSER is freely available online at ....
Families and degenerations of conformal field theories
Energy Technology Data Exchange (ETDEWEB)
Roggenkamp, D.
2004-09-01
In this work, moduli spaces of conformal field theories are investigated. In the first part, moduli spaces corresponding to current-current deformation of conformal field theories are constructed explicitly. For WZW models, they are described in detail, and sigma model realizations of the deformed WZW models are presented. The second part is devoted to the study of boundaries of moduli spaces of conformal field theories. For this purpose a notion of convergence of families of conformal field theories is introduced, which admits certain degenerated conformal field theories to occur as limits. To such a degeneration of conformal field theories, a degeneration of metric spaces together with additional geometric structures can be associated, which give rise to a geometric interpretation. Boundaries of moduli spaces of toroidal conformal field theories, orbifolds thereof and WZW models are analyzed. Furthermore, also the limit of the discrete family of Virasoro minimal models is investigated. (orig.)
Ubiquitin–Synaptobrevin Fusion Protein Causes Degeneration of Presynaptic Motor Terminals in Mice
Liu, Yun; Li, Hongqiao; Sugiura, Yoshie; Han, Weiping; Gallardo, Gilbert; Khvotchev, Mikhail; Zhang, Yinan; Kavalali, Ege T.; Südhof, Thomas C.
2015-01-01
Protein aggregates containing ubiquitin (Ub) are commonly observed in neurodegenerative disorders, implicating the involvement of the ubiquitin proteasome system (UPS) in their pathogenesis. Here, we aimed to generate a mouse model for monitoring UPS function using a green fluorescent protein (GFP)-based substrate that carries a “noncleavable” N-terminal ubiquitin moiety (UbG76V). We engineered transgenic mice expressing a fusion protein, consisting of the following: (1) UbG76V, GFP, and a synaptic vesicle protein synaptobrevin-2 (UbG76V-GFP-Syb2); (2) GFP-Syb2; or (3) UbG76V-GFP-Syntaxin1, all under the control of a neuron-specific Thy-1 promoter. As expected, UbG76V-GFP-Syb2, GFP-Syb2, and UbG76V-GFP-Sytaxin1 were highly expressed in neurons, such as motoneurons and motor nerve terminals of the neuromuscular junction (NMJ). Surprisingly, UbG76V-GFP-Syb2 mice developed progressive adult-onset degeneration of motor nerve terminals, whereas GFP-Syb2 and UbG76V-GFP-Syntaxin1 mice were normal. The degeneration of nerve terminals in UbG76V-GFP-Syb2 mice was preceded by a progressive impairment of synaptic transmission at the NMJs. Biochemical analyses demonstrated that UbG76V-GFP-Syb2 interacted with SNAP-25 and Syntaxin1, the SNARE partners of synaptobrevin. Ultrastructural analyses revealed a marked reduction in synaptic vesicle density, accompanying an accumulation of tubulovesicular structures at presynaptic nerve terminals. These morphological defects were largely restricted to motor nerve terminals, as the ultrastructure of motoneuron somata appeared to be normal at the stages when synaptic nerve terminals degenerated. Furthermore, synaptic vesicle endocytosis and membrane trafficking were impaired in UbG76V-GFP-Syb2 mice. These findings indicate that UbG76V-GFP-Syb2 may compete with endogenous synaptobrevin, acting as a gain-of-function mutation that impedes SNARE function, resulting in the depletion of synaptic vesicles and degeneration of the nerve
A dam for retrograde axonal degeneration in multiple sclerosis?
Balk, L.J.; Twisk, J.W.R.; Steenwijk, M.D.; Daams, M.; Tewarie, P.; Killestein, J.; Uitdehaag, B.M.J.; Polman, C.H.; Petzold, A.F.S.
2014-01-01
Objective: Trans-synaptic axonal degeneration is a mechanism by which neurodegeneration can spread from a sick to a healthy neuron in the central nervous system. This study investigated to what extent trans-synaptic axonal degeneration takes place within the visual pathway in multiple sclerosis
Cystic adventitial degeneration: ectopic ganglia from adjacent joint capsules.
Ortmann, J; Widmer, M K; Gretener, S; Do, D D; Willenberg, T; Daliri, A; Baumgartner, I
2009-11-01
Cystic adventitial degeneration is a rare non-atherosclerotic cause of peripheral arterial occlusive disease, mainly seen in young men without other evidence of vascular disease. Diagnosis will be established by clinical findings and by ultrasound or angiography and can be treated by excision or enucleation of the affected arterial segment or by percutaneous ultrasound-guided aspiration. However, the etiology of adventitial cysts remains unknown. We report a case of cystic adventitial degeneration showing a connection between the joint capsule and the adventitial cyst, supporting the theory that cystic adventitial degeneration may represent ectopic ganglia from adjacent joint capsules.
Directory of Open Access Journals (Sweden)
M Heydarnezhadi
2011-09-01
Full Text Available Background: The main goal of the present study was to develop a new sensitive and specific PCR based method for Identification of Cryptosporidium sp. using novel primers from 18S ribosomal RNA. Cryptosporidiosis in high-risk host groups particularly in neonates and immuno-compromised individuals may result in death. To the best of our knowledge this is the first study regarding develop a new PCR based method to diagnose the cryptosporidiosis in Iran.Methods: A total of 850 human fecal samples from patients clinically suspected to cryptosporidiosis and 100 healthy and diarrheic cattle stool specimens were collected. The simplified formol-ether concentration method was carried out for all samples. They were then examined microscopically by modified Ziehl-Neelsen staining method. Total DNA was extracted by QIA amp DNA stool mini kit was carried out by using designed primers.Results: Twenty nine cases of cryptosporidiosis infection in human and 30 samples from cattle microscopically were positive. The described primary and nested PCR method could detect all Cryptosporidium positive samples from human and cattle. Regards to suspected negative samples in primary PCR examination, the Nested PCR could approve two more positive results. Furthermore, Nested PCR analysis was able to detect one more case which was negative in both microscopically examination and primary PCR. Specificity of the test was 100%. Sensitivity of Nested PCR in comparison to our gold standard; microscopy after Ridley concentration modified ziehl-Neelsen, was 100 %.Conclusion: Our developed PCR based method by using new primers devised from 18S ribosomal RNA revealed the ability for identification of the Cryptosporidium species such as C. parvum and C. huminis with high specificity and sensitivity.
Ecological transition predictably associated with gene degeneration.
Wessinger, Carolyn A; Rausher, Mark D
2015-02-01
Gene degeneration or loss can significantly contribute to phenotypic diversification, but may generate genetic constraints on future evolutionary trajectories, potentially restricting phenotypic reversal. Such constraints may manifest as directional evolutionary trends when parallel phenotypic shifts consistently involve gene degeneration or loss. Here, we demonstrate that widespread parallel evolution in Penstemon from blue to red flowers predictably involves the functional inactivation and degeneration of the enzyme flavonoid 3',5'-hydroxylase (F3'5'H), an anthocyanin pathway enzyme required for the production of blue floral pigments. Other types of genetic mutations do not consistently accompany this phenotypic shift. This pattern may be driven by the relatively large mutational target size of degenerative mutations to this locus and the apparent lack of associated pleiotropic effects. The consistent degeneration of F3'5'H may provide a mechanistic explanation for the observed asymmetry in the direction of flower color evolution in Penstemon: Blue to red transitions are common, but reverse transitions have not been observed. Although phenotypic shifts in this system are likely driven by natural selection, internal constraints may generate predictable genetic outcomes and may restrict future evolutionary trajectories. © The Author 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
DEFF Research Database (Denmark)
Devert, Anthony; Fabre, Nicolas; Floris, Maina Huguette Joséphine
2015-01-01
) targeted by RNA silencing. The dsRNA is subsequently cleaved by the ribonuclease DICER-like into secondary small interfering RNAs (siRNAs) that reinforce and/or maintain the silenced state of the target RNA. Models of RNA silencing propose that RDRs could use primer-independent and primer......Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA......-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer...
Risk factors for age-related macular degeneration: Pooled findings from three continents
Smith, W.; Assink, J.; Klein, R.; Mitchell, P.; Klaver, C. C.; Klein, B. E.; Hofman, A.; Jensen, S.; Wang, J. J.; de Jong, P. T.
2001-01-01
To assess the prevalence and potential risk factors for late age-related macular degeneration (AMD) in three racially similar populations from North America, Europe, and AUSTRALIA: Combined analysis of population-based eye disease prevalence data. There were 14,752 participants with gradable
Cardiovascular risk factors associated with age-related macular degeneration: the Tromso Study
DEFF Research Database (Denmark)
Erke, M. G.; Bertelsen, G.; Peto, T.
2014-01-01
PurposeTo examine associations between cardiovascular risk factors and age-related macular degeneration (AMD). MethodsA population-based, cross-sectional study of Caucasians aged 65-87years was conducted in Norway in 2007/2008. Retinal photographs were graded for AMD. Multivariable logistic...
Ekstrom, Claus Thorn
2011-01-01
Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i
THE QUALITY IMPROVEMENT OF PRIMER PACKAGING PROCESS USING SIX SIGMA METHODOLOGY
Directory of Open Access Journals (Sweden)
Prima Ditahardiyani
2008-01-01
Full Text Available The implementation of Six Sigma has become a common theme in many organizations. This paper presents the Six Sigma methodology and its implementation in a primer packaging process of Cranberry drink. DMAIC (Define, Measure, Analyze, Improve and Control approach is used to analyze and to improve the primer packaging process, which have high variability and defects output. After the improvement, the results showed that there was an increasing sigma level. However, it is not significantly and has not achieved the world standard quality, yet. Therefore, the implementation of Six Sigma in primer packaging process of Cranberry drink still has a room for doing a further research.
Electromagnetic solitons in degenerate relativistic electron–positron plasma
International Nuclear Information System (INIS)
Berezhiani, V I; Shatashvili, N L; Tsintsadze, N L
2015-01-01
The existence of soliton-like electromagnetic (EM) distributions in a fully degenerate electron–positron plasma is studied applying relativistic hydrodynamic and Maxwell equations. For a circularly polarized wave it is found that the soliton solutions exist both in relativistic as well as nonrelativistic degenerate plasmas. Plasma density in the region of soliton pulse localization is reduced considerably. The possibility of plasma cavitation is also shown. (invited comment)
Galkiewicz, Julia P; Kellogg, Christina A
2008-12-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.
Galkiewicz, Julia P.; Kellogg, Christina A.
2008-01-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.
Localized thermonuclear runaways and volcanoes on degenerate dwarf stars
Energy Technology Data Exchange (ETDEWEB)
Shara, M.M.
1982-10-15
Practically all studies to date of thermonuclear runaways on degenerate dwarf stars in binary systems have considered only spherically symmetric eruptions. We emphasize that even slightly non-spherically symmetric accretion leads to transverse temperature gradients in the dwarfs' accreted envelopes. Over a rather broad range of parameter space, thermalization time scales in accreted envelopes are much longer than thermonuclear runaway time scales. Thus localized thermonuclear runaways (i.e., runaways much smaller than the host degenerate star) rather than spherically symmetric global eruptions are likely to occur on many degenerate dwarfs. Localized runaways are more likely to occur on more massive and/or hotter dwarfs.
Directory of Open Access Journals (Sweden)
Hamidreza Monavari
2013-12-01
Results: Performance of our home made primers for detecting pertussis using Real Time PCR in comparison with those by commercial kit was acceptable based on diagnostic classical guidance (WHO and the (CDC. Conclusions: Real time PCR test with new primers in comparison with culture techniques is more suitable, high sensitivity and can provide more informative values for pertussis detection.
Xu, Jing-Yuan; Zhu, Yan; Yi, Ze; Wu, Gang; Xie, Guo-Yong; Qin, Min-Jian
2018-01-01
"Wu zhu yu", which is obtained from the dried unripe fruits of Tetradium ruticarpum (A. Jussieu) T. G. Hartley, has been used as a traditional Chinese medicine for treatment of headaches, abdominal colic, and hypertension for thousands of years. The present study was designed to assess the molecular genetic diversity among 25 collected accessions of T. ruticarpum (Wu zhu yu in Chinese) from different areas of China, based on inter-primer binding site (iPBS) markers and inter-simple sequence repeat (ISSR) markers. Thirteen ISSR primers generated 151 amplification bands, of which 130 were polymorphic. Out of 165 bands that were amplified using 10 iPBS primers, 152 were polymorphic. The iPBS markers displayed a higher proportion of polymorphic loci (PPL = 92.5%) than the ISSR markers (PPL = 84.9%). The results showed that T. ruticarpum possessed high loci polymorphism and genetic differentiation occurred in this plant. The combined data of iPBS and ISSR markers scored on 25 accessions produced five clusters that approximately matched the geographic distribution of the species. The results indicated that both iPBS and ISSR markers were reliable and effective tools for analyzing the genetic diversity in T. ruticarpum. Copyright © 2018 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Luk Ketut Budi Maitriani
2015-10-01
frequently mutated position and can lead to coresistance of isoniazid and ethionamide. The primer was designed using sequences of inhA gene Mycobacterium tuberculosis from www.ncbi.nlm.nih.gov (bank genes: AF106077. Results obtained the best primer pair and tested in vitro using Polymerase Chain Reaction method. DNA template used were MDR-TB clinical isolate. Amplifying process was begun with predenaturation at 95°C for 15 minutes and followed by 45 cycles of amplification (denaturation at 94°C for 1 minutes, annealing at 56°C for 1 minute 20 seconds and extension at 72°C for 2 minutes with a final extension at 72°C for 10 minutes. The PCR products were detected using 1,5% b/v agarose gel electrophoresis. In conclusion the best primer pair selected based on the criteria of the Clone Manager Suite 6 program (University of Groningen such as: primer length, %GC, Tm (melting temperature, primers interaction (dimers and hairpins, stability, repeats, runs, and false priming. The primer sequence were forward primer (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3' and reverse primer (pR-inhA 5' CGACCGTCATCC-AGTTGTA 3' with the length 460 bp. ne if they are suitable for consumption according to the guideline by the Director General of Food and Drug Monitoring in terms of lead and cadmium contents. The study was conducted by collecting samples in the area of ??the Sungai Mati estuary and Pemogan area. Samples were prepared by wet destruction method using reverse aqua regia and were analysed using atomic absorption spectrophotometer (AAS at 283,3 nm for Pb and 228,8 nm for Cd. The results show that all fruits investigated contain Pb and Cd with consentrations higher than the guideline.
Molecular passportization of clones of karelian birch using PCRwith semi-specific primers
Directory of Open Access Journals (Sweden)
Tatyana V Matveeva
2008-09-01
Full Text Available Using 4 clones of Karelian birch (Betula pendula Roth var caretica Merckl. from the collection of the karelian birch of the laboratory of genetics of Research Institute of Forest Genetics and Breeding, Voronezh, one normal tree of Betula pendula Roth, and one tree of B. pubescens Ehrh., collected from the nature, we have analyzed the possibility of application of PCR with semi-specific primers for molecular typing. We found primers with high percentage of polymorphic markers. These primers could be recommended for molecular typing of birch.
Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders
Energy Technology Data Exchange (ETDEWEB)
Weber, James R.; Schell, Charlotte J.; Marino, T; Bilyard, Gordon R.
2004-02-10
This version of the communication primer comprises two interlocking parts: Pat 1, a practical section, intended to prepare you for public interactions, and Part 2, a theoretical section that provides social and technical bases for the practices recommended in Part 1. The mutual support of practice and theory is very familiar in science and clearly requires a willingness to observe and revise our prior assumptions--in this document, we invoke both. We hope that is offering will represent a step both towards improving practice and maturing the theory of practical science communication.
Directory of Open Access Journals (Sweden)
Alexander William Eastman
2015-01-01
Full Text Available Advances in sequencing technology have drastically increased the depth and feasibility of bacterial genome sequencing. However, little information is available that details the specific techniques and procedures employed during genome sequencing despite the large numbers of published genomes. Shotgun approaches employed by second-generation sequencing platforms has necessitated the development of robust bioinformatics tools for in silico assembly, and complete assembly is limited by the presence of repetitive DNA sequences and multi-copy operons. Typically, re-sequencing with multiple platforms and laborious, targeted Sanger sequencing are employed to finish a draft bacterial genome. Here we describe a novel strategy based on the identification and targeted sequencing of repetitive rDNA operons to expedite bacterial genome assembly and finishing. Our strategy was validated by finishing the genome of Paenibacillus polymyxa strain CR1, a bacterium with potential in sustainable agriculture and bio-based processes. An analysis of the 38 contigs contained in the P. polymyxa strain CR1 draft genome revealed 12 repetitive rDNA operons with varied intragenic and flanking regions of variable length, unanimously located at contig boundaries and within contig gaps. These highly similar but not identical rDNA operons were experimentally verified and sequenced simultaneously with multiple, specially designed primer sets. This approach also identified and corrected significant sequence rearrangement generated during the initial in silico assembly of sequencing reads. Our approach reduces the required effort associated with blind primer walking for contig assembly, increasing both the speed and feasibility of genome finishing. Our study further reinforces the notion that repetitive DNA elements are major limiting factors for genome finishing. Moreover, we provided a step-by-step workflow for genome finishing, which may guide future bacterial genome finishing
Directory of Open Access Journals (Sweden)
Lenka Maršálková
2014-07-01
Full Text Available The aim of this work was to use TaqMan Real-Time PCR for quantitative authentication of chicken and turkey meat. To meet this purpose, a specific pair of primers and TaqMan probe was used. The test was aimed at identifying the reaction cycle of turkey and chicken meat using by two sets of primers. With first set of primer designed for chicken we obtained the following results: Cp = 16.18 for 100% chicken DNA Cp = 29, 18 100% turkey DNA It was also amplified DNA of pig that exceeded the detection threshold fluorescence intensities in the 31.07 cycle (Cp = 31.07. Using primers designed for turkey we obtained the following results Cp = 31.16 for 100% CHDNA, Cp =16.18 100% TDNA. It was also amplified the 100% DNA of rabbit in 31.63 cycle (Cp = 31.63 and deer in cycle 32 (Cp = 32. The DNA of all other animal species was amplificated after more than 35 cycles (Cp >35. It follows that the second detection primer pair is specific enough to unrelated species of animals by 30 cycles of the reaction. Species authentication based on DNA analysis from this perspective overcomes all the shortcomings of proteins. At present, DNA analysis use different types of PCR. Is the most progressive Real-time PCR, which is suitable for the specific use of detection (primers and TaqMan probe. The TaqMan Real-time PCR is within the sensitivity and specificity, clearly one of the best methods for identifying the species of chicken and turkey meat. The specificity of this method, however, depends primarily on the specificity of the primers and TaqMan probe. The 30 cycle reaction was chosen by us as the threshold for specificity using primers for authentication chicken and turkey meat.
Detection of three porcine vesicular viruses using multiplex real-time primer-probe energy transfer
DEFF Research Database (Denmark)
Rasmussen, Thomas Bruun; Uttenthal, Åse; Aguero, M.
2006-01-01
Rapid identification of the etiologic agent in infected animals is important for the control of an outbreak of vesicular disease in livestock. We have in the present study developed a multiplex real-time reverse transcription-PCR, based on primer-probe energy transfer (PriProET), for simultaneous...
Galkiewicz, Julia P.; Kellogg, Christina A.
2008-01-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299
El primer virreinato americano
Directory of Open Access Journals (Sweden)
Cassá, Roberto
2006-12-01
Full Text Available This article explores the government of viceroy Christopher Columbus in the American territories. We return to the first Spanish settlement in Santo Domingo and the contradictions inherent to this expansionist proyect. The contradictions were part of the
logic of the absolutist state and Columbus’ reaction against the controls imposed by the monarchs. Secondly, we look into the dificulties that the Admiral encountered to develop a mercantilist model. In this context, we examine the rationale behind the first government of the Indies and the features that defined the new West Indian society.
El artículo trata sobre el gobierno de Cristóbal Colón en tierras americanas. Retomamos el tema del primer emplazamiento español en Santo Domingo y las contradicciones que tuvo aquel proyecto debido a la lógica del estado absolutista, a la ambición desmedida del descubridor y a su reacción ante los controles que desde un principio impusieron los monarcas. En un segundo momento analizamos las dificultades que encontró el Almirante para desarrollar un modelo mercantilista acorde a sus ideas y a los acuerdos a que llegó con la Corona. En ese contexto analizamos la lógica del primer gobierno colombinista en las Indias y los rasgos que definieron la nueva sociedad antillana.
[Depression in Patients with Age-Related Macular Degeneration].
Narváez, Yamile Reveiz; Gómez-Restrepo, Carlos
2012-09-01
Age-related macular degeneration is a cause for disability in the elderly since it greatly affects their quality of life and increases depression likelihood. This article discusses the negative effect depression has on patients with age-related macular degeneration and summarizes the interventions available for decreasing their depression index. Copyright © 2012 Asociación Colombiana de Psiquiatría. Publicado por Elsevier España. All rights reserved.
Structure of stable degeneration of K3 surfaces into pairs of rational elliptic surfaces
Kimura, Yusuke
2018-01-01
F-theory/heterotic duality is formulated in the stable degeneration limit of a K3 fibration on the F-theory side. In this note, we analyze the structure of the stable degeneration limit. We discuss whether stable degeneration exists for pairs of rational elliptic surfaces. We demonstrate that, when two rational elliptic surfaces have an identical complex structure, stable degeneration always exists. We provide an equation that systematically describes the stable degeneration of a K3 surface i...
Sediment transport primer: estimating bed-material transport in gravel-bed rivers
Peter Wilcock; John Pitlick; Yantao Cui
2009-01-01
This primer accompanies the release of BAGS, software developed to calculate sediment transport rate in gravel-bed rivers. BAGS and other programs facilitate calculation and can reduce some errors, but cannot ensure that calculations are accurate or relevant. This primer was written to help the software user define relevant and tractable problems, select appropriate...
Degeneration of Bethe subalgebras in the Yangian of gl_n
Ilin, Aleksei; Rybnikov, Leonid
2018-04-01
We study degenerations of Bethe subalgebras B( C) in the Yangian Y(gl_n), where C is a regular diagonal matrix. We show that closure of the parameter space of the family of Bethe subalgebras, which parameterizes all possible degenerations, is the Deligne-Mumford moduli space of stable rational curves \\overline{M_{0,n+2}}. All subalgebras corresponding to the points of \\overline{M_{0,n+2}} are free and maximal commutative. We describe explicitly the "simplest" degenerations and show that every degeneration is the composition of the simplest ones. The Deligne-Mumford space \\overline{M_{0,n+2}} generalizes to other root systems as some De Concini-Procesi resolution of some toric variety. We state a conjecture generalizing our results to Bethe subalgebras in the Yangian of arbitrary simple Lie algebra in terms of this De Concini-Procesi resolution.
Couillerot, O; Poirier, M-A; Prigent-Combaret, C; Mavingui, P; Caballero-Mellado, J; Moënne-Loccoz, Y
2010-08-01
To assess the applicability of sequence characterized amplified region (SCAR) markers obtained from BOX, ERIC and RAPD fragments to design primers for real-time PCR quantification of the phytostimulatory maize inoculants Azospirillum brasilense UAP-154 and CFN-535 in the rhizosphere. Primers were designed based on strain-specific SCAR markers and were screened for successful amplification of target strain and absence of cross-reaction with other Azospirillum strains. The specificity of primers thus selected was verified under real-time PCR conditions using genomic DNA from strain collection and DNA from rhizosphere samples. The detection limit was 60 fg DNA with pure cultures and 4 x 10(3) (for UAP-154) and 4 x 10(4) CFU g(-1) (for CFN-535) in the maize rhizosphere. Inoculant quantification was effective from 10(4) to 10(8) CFU g(-1) soil. BOX-based SCAR markers were useful to find primers for strain-specific real-time PCR quantification of each A. brasilense inoculant in the maize rhizosphere. Effective root colonization is a prerequisite for successful Azospirillum phytostimulation, but cultivation-independent monitoring methods were lacking. The real-time PCR methods developed here will help understand the effect of environmental conditions on root colonization and phytostimulation by A. brasilense UAP-154 and CFN-535.
Genetics of lattice degeneration of the retina.
Murakami, F; Ohba, N
1982-01-01
First-degree relatives of proband patients with lattice degeneration of the retina revealed a significantly higher prevalence of the disease than the prevalence in the general population: the former had the disease about three times as frequently as the latter. The observed data were analyzed in terms of their accordance with recognized genetic models. The inheritance pattern did not fit well to a monogenic mode of inheritance, and it was hypothesized that a polygenic or multifactorial mode of inheritance is the most likely for lattice degeneration of the retina.
Microsatellite Primers in the Foundation Tree Species Pinus edulis and P. monophylla (Pinaceae
Directory of Open Access Journals (Sweden)
Andrew L. Krohn
2013-07-01
Full Text Available Premise of the study: Microsatellite primers were developed in the foundational tree species Pinus edulis to investigate population differentiation of P. edulis and hybridization among closely related species. Methods and Results: Using a hybridization protocol, primer sets for 11 microsatellite loci were developed using megagametophyte tissue from P. edulis and scored for polymorphism in three populations of P. edulis and a single P. monophylla population. The primers amplified simple and compound di-, tri-, and pentanucleotide repeats with two to 18 alleles per locus. Conclusions: These results demonstrate the utility of the described primers for studies of population differentiation within and among P. edulis populations as well as across putative hybrid zones where P. edulis may coexist with sister species.
Ozkok, Ahmet; Sigford, Douglas K; Tezel, Tongalp H
2016-11-01
To test define characteristic fundus autofluorescence patterns of different exudative age-related macular degeneration subtypes. Cross-sectional study. Fifty-two patients with choroidal neovascularization because of three different neovascular age-related macular degeneration subtypes were included in the study. Macular and peripheral fundus autofluorescence patterns of study subjects were compared in a masked fashion. Fundus autofluorescence patterns of all three neovascular age-related macular degeneration subtypes revealed similar patterns. However, peripapillary hypo-autofluorescence was more common among patients with polypoidal choroidal vasculopathy (88.2%) compared with patients with retinal angiomatous proliferation (12.5%) and patients without retinal angiomatous proliferation and polypoidal choroidal vasculopathy (21.1%) (P autofluorescence defects in neovascular age-related macular degeneration maybe suggestive of polypoidal choroidal vasculopathy as a variant of neovascular age-related macular degeneration.
Characteristics of the population employed in primer sector in Turkey
Directory of Open Access Journals (Sweden)
Bayar Rüya
2006-01-01
Full Text Available Activities related to the production of raw material like agriculture husbandry, forestry, fishery are called as primer activities. Especially people living in rural areas earn their livings on primer activities, mainly agriculture. Rural planning is inevitable for providing rural development which has an important place in all development of a country. And achievement of this planning depends on putting forth the characteristics of the population living in rural areas with its different aspects. Therefore, the requirements will be introduced more clearly and the increase in the welfare levels of the people living in rural areas will have been achieved. To achieve the rural development and progress, in addition to the features like the size of agricultural products, products that are cultivated, activities like husbandry, forestry, hunting, etc. and the qualities of the enterprises in which these activities are carried out, policies applied, capital, market and technology, the characteristics of the population employed in this sector is also of importance. Considering these points, what is aimed in this study is to put forth the characteristics of the population employed in primer sector in Turkey. According to the census results of the year 2000 in Turkey 38% of the population is employed, and 48% of this work is in primer sector.
Sequential changes in MR imaging of human wallerian degeneration
Energy Technology Data Exchange (ETDEWEB)
Orita, Tetsuji; Tsurutani, Tohru; Izumihara, Akifumi; Kajiwara, Koji (Shuto General Hospital, Yamaguchi (Japan)); Matsunaga, Tokio
1994-05-01
MRI of wallerian degeneration of the pyramidal tract in the brainstem was repeatedly performed on the same coronal slice in 10 patients, who had infarction or hemorrhage of the basal ganglia and had the exact onset of hemiparesis. The processes of wallerian degeneration were divided into four stages by proton-density weighted images. In stage 1, the axon began to degenerate and was destroyed. It occurred during the first 0.7 month and resulted in no signal intensity abnormality. In stage 2, axon debris disappeared from degenerating tracts. Myelin structure was preserved and myelin lipid remained intact. The lipid water ratio in the tissue became large and the tissue was more hydrophobic. From 0.7 to 2.0 months, low signal intensity was observed. In stage 3, subsequent myelin lipid breakdown began and the lipid/water ratio in the tissue tended to be small. There was no abnormal signal intensity. In stage 4, lipid began to be removed from the tissue. The lipid/water ratio became smaller and the tissue became hydrophilic. Gliosis was more prominent. High signal intensity was observed. (author).
Sequential changes in MR imaging of human wallerian degeneration
International Nuclear Information System (INIS)
Orita, Tetsuji; Tsurutani, Tohru; Izumihara, Akifumi; Kajiwara, Koji; Matsunaga, Tokio.
1994-01-01
MRI of wallerian degeneration of the pyramidal tract in the brainstem was repeatedly performed on the same coronal slice in 10 patients, who had infarction or hemorrhage of the basal ganglia and had the exact onset of hemiparesis. The processes of wallerian degeneration were divided into four stages by proton-density weighted images. In stage 1, the axon began to degenerate and was destroyed. It occurred during the first 0.7 month and resulted in no signal intensity abnormality. In stage 2, axon debris disappeared from degenerating tracts. Myelin structure was preserved and myelin lipid remained intact. The lipid water ratio in the tissue became large and the tissue was more hydrophobic. From 0.7 to 2.0 months, low signal intensity was observed. In stage 3, subsequent myelin lipid breakdown began and the lipid/water ratio in the tissue tended to be small. There was no abnormal signal intensity. In stage 4, lipid began to be removed from the tissue. The lipid/water ratio became smaller and the tissue became hydrophilic. Gliosis was more prominent. High signal intensity was observed. (author)
Quantization with maximally degenerate Poisson brackets: the harmonic oscillator!
International Nuclear Information System (INIS)
Nutku, Yavuz
2003-01-01
Nambu's construction of multi-linear brackets for super-integrable systems can be thought of as degenerate Poisson brackets with a maximal set of Casimirs in their kernel. By introducing privileged coordinates in phase space these degenerate Poisson brackets are brought to the form of Heisenberg's equations. We propose a definition for constructing quantum operators for classical functions, which enables us to turn the maximally degenerate Poisson brackets into operators. They pose a set of eigenvalue problems for a new state vector. The requirement of the single-valuedness of this eigenfunction leads to quantization. The example of the harmonic oscillator is used to illustrate this general procedure for quantizing a class of maximally super-integrable systems
Natural history of seminiferous tubule degeneration in Klinefelter syndrome
DEFF Research Database (Denmark)
Aksglaede, Lise; Wikström, Anne M; Rajpert-De Meyts, Ewa
2006-01-01
Klinefelter syndrome (47,XXY) is characterized by small, firm testis, gynaecomastia, azoospermia and hypergonadotropic hypogonadism. Degeneration of the seminiferous tubules in 47,XXY males is a well-described phenomenon. It begins in the fetus, progresses through infancy and accelerates dramatic......Klinefelter syndrome (47,XXY) is characterized by small, firm testis, gynaecomastia, azoospermia and hypergonadotropic hypogonadism. Degeneration of the seminiferous tubules in 47,XXY males is a well-described phenomenon. It begins in the fetus, progresses through infancy and accelerates...... summarize current knowledge on the development of the classical endocrinological and histological features of 47,XXY males from fetus to adulthood and review the literature concerning the degeneration of the seminiferous tubules in this syndrome....
Menopause 101: A Primer for the Perimenopausal
... Abstracts Media Award Recipients Media Policy Media Requests Menopause 101: A primer for the perimenopausal The information ... about 2 years earlier. Common Body Changes at Menopause Each woman’s experience of menopause is different. Many ...
Ma, Hongwei; Thapa, Arjun; Morris, Lynsie; Redmond, T. Michael; Baehr, Wolfgang; Ding, Xi-Qin
2014-01-01
Photoreceptors degenerate in a wide array of hereditary retinal diseases and age-related macular degeneration. There is currently no treatment available for retinal degenerations. While outnumbered roughly 20:1 by rods in the human retina, it is the cones that mediate color vision and visual acuity, and their survival is critical for vision. In this communication, we investigate whether thyroid hormone (TH) signaling affects cone viability in retinal degeneration mouse models. TH signaling is...
Zhang, Hongtao; Setubal, Joao Carlos; Zhan, Xiaobei; Zheng, Zhiyong; Yu, Lijun; Wu, Jianrong; Chen, Dingqiang
2011-06-01
Agrobacterium sp. ATCC 31749 (formerly named Alcaligenes faecalis var. myxogenes) is a non-pathogenic aerobic soil bacterium used in large scale biotechnological production of curdlan. However, little is known about its genomic information. DNA partial sequence of electron transport chains (ETCs) protein genes were obtained in order to understand the components of ETC and genomic-specificity in Agrobacterium sp. ATCC 31749. Degenerate primers were designed according to ETC conserved sequences in other reported species. DNA partial sequences of ETC genes in Agrobacterium sp. ATCC 31749 were cloned by the PCR method using degenerate primers. Based on comparative genomic analysis, nine electron transport elements were ascertained, including NADH ubiquinone oxidoreductase, succinate dehydrogenase complex II, complex III, cytochrome c, ubiquinone biosynthesis protein ubiB, cytochrome d terminal oxidase, cytochrome bo terminal oxidase, cytochrome cbb (3)-type terminal oxidase and cytochrome caa (3)-type terminal oxidase. Similarity and phylogenetic analyses of these genes revealed that among fully sequenced Agrobacterium species, Agrobacterium sp. ATCC 31749 is closest to Agrobacterium tumefaciens C58. Based on these results a comprehensive ETC model for Agrobacterium sp. ATCC 31749 is proposed.
Study of degenerate four-quark states with SU(2) lattice Monte Carlo techniques
International Nuclear Information System (INIS)
Green, A.M.; Lukkarinen, J.; Pennanen, P.; Michael, C.
1996-01-01
The energies of four-quark states are calculated for geometries in which the quarks are situated on the corners of a series of tetrahedra and also for geometries that correspond to gradually distorting these tetrahedra into a plane. The interest in tetrahedra arises because they are composed of three degenerate partitions of the four quarks into two two-quark color singlets. This is an extension of earlier work showing that geometries with two degenerate partitions (e.g., squares) experience a large binding energy. It is now found that even larger binding energies do not result, but that for the tetrahedra the ground and first excited states become degenerate in energy. The calculation is carried out using SU(2) for static quarks in the quenched approximation with Β=2.4 on a 16 3 x32 lattice. The results are analyzed using the correlation matrix between different Euclidean times and the implications of these results are discussed for a model based on two-quark potentials. copyright 1995 The American Physical Society
Genus-Specific Primers for Study of Fusarium Communities in Field Samples
Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna
2015-01-01
Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387
Association of suprascapular neuropathy with rotator cuff tendon tears and fatty degeneration.
Shi, Lewis L; Boykin, Robert E; Lin, Albert; Warner, Jon J P
2014-03-01
The mutual influence of suprascapular neuropathy (SSN) and rotator cuff tendon tears on muscle pathology is unclear. Debate continues as to how retracted cuff tears can lead to SSN and whether SSN or tendon retraction causes muscle fatty degeneration. A cohort of 87 patients suspected of having SSN was identified from a prospectively collected registry. All underwent electromyography/nerve conduction velocity study (EMG/NCV) and magnetic resonance imaging (MRI) of their shoulders. EMG/NCVs were performed and interpreted by electrodiagnosticians, and MRI cuff tendon quality and muscle fatty degeneration were interpreted by two surgeons. Out of 87 patients, 32 patients had SSN on EMG/NCV, and 55 patients had normal suprascapular nerve. MRI showed that 59 of 87 supraspinatus had no fatty degeneration or mild fatty streaks (Goutallier grades 0 and 1), and 28 patients had significant fatty degeneration (grades 2-4); infraspinatus fatty degeneration was similar. Review of supraspinatus tendon showed 41 patients with intact tendons or partial tears, and 46 with full tears. Infraspinatus tendons pathology was similar. Tendon pathology and fatty degeneration were related (P-valuetears were associated with SSN (P = .01), but SSN was not related to fatty degeneration of either supraspinatus or infraspinatus (P-values .65, .54). The exact association and etiology of SSN in patients with rotator cuff pathology remain unclear. SSN is correlated to tendon tear size, but it does not have significant influence on fatty degeneration of either supraspinatus or infraspinatus. Copyright © 2014 Journal of Shoulder and Elbow Surgery Board of Trustees. Published by Mosby, Inc. All rights reserved.
Genetic association of apolipoprotein E with age-related macular degeneration
M. Kliffen (Mike); C.M. van Duijn (Cornelia); M. Cruts (Marc); D.E. Grobbee (Diederick); P.T.V.M. de Jong (Paulus); C.C.W. Klaver (Caroline); C. van Broeckhoven (Christine); A. Hofman (Albert)
1998-01-01
textabstractAge-related macular degeneration (AMD) is the most common geriatric eye disorder leading to blindness and is characterized by degeneration of the neuroepithelium in the macular area of the eye. Apolipoprotein E (apoE), the major apolipoprotein of the CNS and an
Schraermeyer, U; Thumann, G; Luther, T; Kociok, N; Armhold, S; Kruttwig, K; Andressen, C; Addicks, K; Bartz-Schmidt, K U
2001-01-01
The Royal College of Surgeons (RCS) rat is an animal model for retinal degeneration such as the age-related macular degeneration. The RCS rat undergoes a progressive retinal degeneration during the early postnatal period. A potential treatment to prevent this retinal degeneration is the transplantation into the subretinal space of cells that would replace functions of the degenerating retinal pigment epithelium (RPE) cells or may form neurotrophic factors. In this study we have investigated the potential of subretinally transplanted embryonic stem cells to prevent the genetically determined photoreceptor cell degeneration in the RCS rat. Embryonic stem cells from the inner cell mass of the mouse blastocyst were allowed to differentiate to neural precursor cells in vitro and were then transplanted into the subretinal space of 20-day-old RCS rats. Transplanted and sham-operated rats were sacrificed 2 months following cell transplantation. The eyes were enucleated and photoreceptor degeneration was quantified by analyzing and determining the thickness of the outer nuclear layer by light and electron microscopy. In the eyes transplanted with embryonic cells up to 8 rows of photoreceptor cell nuclei were observed, whereas in nontreated control eyes the outer nuclear layer had degenerated completely. Transplantation of embryonic stem cells appears to delay photoreceptor cell degeneration in RCS rats.
Quasi-degenerate perturbation theory using matrix product states
International Nuclear Information System (INIS)
Sharma, Sandeep; Jeanmairet, Guillaume; Alavi, Ali
2016-01-01
In this work, we generalize the recently proposed matrix product state perturbation theory (MPSPT) for calculating energies of excited states using quasi-degenerate (QD) perturbation theory. Our formulation uses the Kirtman-Certain-Hirschfelder canonical Van Vleck perturbation theory, which gives Hermitian effective Hamiltonians at each order, and also allows one to make use of Wigner’s 2n + 1 rule. Further, our formulation satisfies Granovsky’s requirement of model space invariance which is important for obtaining smooth potential energy curves. Thus, when we use MPSPT with the Dyall Hamiltonian, we obtain a model space invariant version of quasi-degenerate n-electron valence state perturbation theory (NEVPT), a property that the usual formulation of QD-NEVPT2 based on a multipartitioning technique lacked. We use our method on the benchmark problems of bond breaking of LiF which shows ionic to covalent curve crossing and the twist around the double bond of ethylene where significant valence-Rydberg mixing occurs in the excited states. In accordance with our previous work, we find that multi-reference linearized coupled cluster theory is more accurate than other multi-reference theories of similar cost
Quasi-degenerate perturbation theory using matrix product states
Energy Technology Data Exchange (ETDEWEB)
Sharma, Sandeep, E-mail: sanshar@gmail.com; Jeanmairet, Guillaume [Max Planck Institute for Solid State Research, Heisenbergstraße 1, 70569 Stuttgart (Germany); Alavi, Ali, E-mail: a.alavi@fkf.mpg.de [Max Planck Institute for Solid State Research, Heisenbergstraße 1, 70569 Stuttgart (Germany); Department of Chemistry, University of Cambridge, Lensfield Road, Cambridge CB2 1EW (United Kingdom)
2016-01-21
In this work, we generalize the recently proposed matrix product state perturbation theory (MPSPT) for calculating energies of excited states using quasi-degenerate (QD) perturbation theory. Our formulation uses the Kirtman-Certain-Hirschfelder canonical Van Vleck perturbation theory, which gives Hermitian effective Hamiltonians at each order, and also allows one to make use of Wigner’s 2n + 1 rule. Further, our formulation satisfies Granovsky’s requirement of model space invariance which is important for obtaining smooth potential energy curves. Thus, when we use MPSPT with the Dyall Hamiltonian, we obtain a model space invariant version of quasi-degenerate n-electron valence state perturbation theory (NEVPT), a property that the usual formulation of QD-NEVPT2 based on a multipartitioning technique lacked. We use our method on the benchmark problems of bond breaking of LiF which shows ionic to covalent curve crossing and the twist around the double bond of ethylene where significant valence-Rydberg mixing occurs in the excited states. In accordance with our previous work, we find that multi-reference linearized coupled cluster theory is more accurate than other multi-reference theories of similar cost.
Quasi-degenerate perturbation theory using matrix product states
Sharma, Sandeep; Jeanmairet, Guillaume; Alavi, Ali
2016-01-01
In this work, we generalize the recently proposed matrix product state perturbation theory (MPSPT) for calculating energies of excited states using quasi-degenerate (QD) perturbation theory. Our formulation uses the Kirtman-Certain-Hirschfelder canonical Van Vleck perturbation theory, which gives Hermitian effective Hamiltonians at each order, and also allows one to make use of Wigner's 2n + 1 rule. Further, our formulation satisfies Granovsky's requirement of model space invariance which is important for obtaining smooth potential energy curves. Thus, when we use MPSPT with the Dyall Hamiltonian, we obtain a model space invariant version of quasi-degenerate n-electron valence state perturbation theory (NEVPT), a property that the usual formulation of QD-NEVPT2 based on a multipartitioning technique lacked. We use our method on the benchmark problems of bond breaking of LiF which shows ionic to covalent curve crossing and the twist around the double bond of ethylene where significant valence-Rydberg mixing occurs in the excited states. In accordance with our previous work, we find that multi-reference linearized coupled cluster theory is more accurate than other multi-reference theories of similar cost.
Directory of Open Access Journals (Sweden)
Yusmadi Yusmadi
2008-04-01
Full Text Available The quality and palatibility of silage and hay complete ration based on organic primer garbage in peranakan etawah (PE poad ABSTRACT. This research was conducted to study the quality and palatability of silage and hay complete ration based on organic primer garbage in nine heads of Peranakan Etawah (PE Goat. The quality of silage and hay was evaluated By measuring pH, total number of lactic acid Bacteria (LAB, palatability, dry matter (DM and organic matter (OM aroma and color of silage. Nine heads of peranakan etawah were grouped based on their lactation periode and randomly assigned to one of tree dietary treatments. The treatments were (1 Control rations; (2 silage complete ration (SRK; and (3 Hay complete ration (HRK. The results indicated that the silage had PH 4.15 and total number of LAB was 2.4 x 10 cfu/g of silage. Dry matter and organic matter digestibility of SRK were better than those of HRK. The palatability of SRK was higher than HRK but less than control. Storage of SRK for did not change dry matter and organic matter content. Organoleptic analysis indicated that texture and color of HRK were changed at after storage, while SRK was still constant. It is concluded that silage composed of organic primer garbage has high quality in terms of physical, chemical and microbial characteristics, prolong storage.
Galkiewicz, J.P.; Kellogg, C.A.
2008-01-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.
Some Remarks on Space-Time Decompositions, and Degenerate Metrics, in General Relativity
Bengtsson, Ingemar
Space-time decomposition of the Hilbert-Palatini action, written in a form which admits degenerate metrics, is considered. Simple numerology shows why D = 3 and 4 are singled out as admitting a simple phase space. The canonical structure of the degenerate sector turns out to be awkward. However, the real degenerate metrics obtained as solutions are the same as those that occur in Ashtekar's formulation of complex general relativity. An exact solution of Ashtekar's equations, with degenerate metric, shows that the manifestly four-dimensional form of the action, and its 3 + 1 form, are not quite equivalent.
Progressive Supranuclear Palsy and Corticobasal Degeneration: Pathophysiology and Treatment Options
Lamb, Ruth; Rohrer, Jonathan D.; Lees, Andrew J.; Morris, Huw R.
2016-01-01
Opinion statement There are currently no disease-modifying treatments for progressive supranuclear palsy (PSP) or corticobasal degeneration (CBD), and no approved pharmacological or therapeutic treatments that are effective in controlling their symptoms. The use of most pharmacological treatment options are based on experience in other disorders or from non-randomized historical controls, case series, or expert opinion. Levodopa may provide some improvement in symptoms of Parkinsonism (specif...
Progressive Supranuclear Palsy and Corticobasal Degeneration: Pathophysiology and Treatment Options
Lamb, R.; Rohrer, J. D.; Lees, A. J.; Morris, H. R.
2016-01-01
There are currently no disease-modifying treatments for progressive supranuclear palsy (PSP) or corticobasal degeneration (CBD), and no approved pharmacological or therapeutic treatments that are effective in controlling their symptoms. The use of most pharmacological treatment options are based on experience in other disorders or from non-randomized historical controls, case series, or expert opinion. Levodopa may provide some improvement in symptoms of Parkinsonism (specifically bradykinesi...
Cryer, CW
2014-01-01
Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula
International Nuclear Information System (INIS)
Truc, Trinh Anh; Hang, Thi Xuan; Oanh, Vu Ke; Dung, Nguyen Tuan
2004-01-01
Corrosion resistance of coating system consisting of zinc-rich primer (ZRP) and topcoat based on polyurethane resin with the presence of 3-aminopropyl-triethoxysilan (APS) and 2-(benzothialylthio) succinic acid (BSA) was studied by electrochemical impedance and wet adhesion. The interface metal/primer/topcoat was analyzed by scanning electronic microscopy. It was found that the presence of APS and BSA improved adhesion and barrier property of the topcoats
Directory of Open Access Journals (Sweden)
Wang Xiaowei
2008-12-01
Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.
MCNPTM criticality primer and training experiences
International Nuclear Information System (INIS)
Briesmeister, J.; Forster, R.A.; Busch, R.
1995-01-01
With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, the analyst may have little experience with the specific codes available at his or her facility. Usually, the codes are quite complex, black boxes capable of analyzing numerous problems with a myriad of input options. Documentation for these codes is designed to cover all the possible configurations and types of analyses but does not give much detail on any particular type of analysis. For criticality calculations, the user of a code is primarily interested in the value of the effective multiplication factor for a system (k eff ). Most codes will provide this, and truckloads of other information that may be less pertinent to criticality calculations. Based on discussions with code users in the nuclear criticality safety community, it was decided that a simple document discussing the ins and outs of criticality calculations with specific codes would be quite useful. The Transport Methods Group, XTM, at Los Alamos National Laboratory (LANL) decided to develop a primer for criticality calculations with their Monte Carlo code, MCNP. This was a joint task between LANL with a knowledge and understanding of the nuances and capabilities of MCNP and the University of New Mexico with a knowledge and understanding of nuclear criticality safety calculations and educating first time users of neutronics calculations. The initial problem was that the MCNP manual just contained too much information. Almost everything one needs to know about MCNP can be found in the manual; the problem is that there is more information than a user requires to do a simple k eff calculation. The basic concept of the primer was to distill the manual to create a document whose only focus was criticality calculations using MCNP
PARP inhibitors protect against sex- and AAG-dependent alkylation-induced neural degeneration.
Allocca, Mariacarmela; Corrigan, Joshua J; Fake, Kimberly R; Calvo, Jennifer A; Samson, Leona D
2017-09-15
Alkylating agents are commonly used to treat cancer. Although base excision repair (BER) is a major pathway for repairing DNA alkylation damage, under certain conditions, the initiation of BER produces toxic repair intermediates that damage healthy tissues. The initiation of BER by the alkyladenine DNA glycosylase (AAG, a.k.a. MPG) can mediate alkylation-induced cytotoxicity in specific cells in the retina and cerebellum of male mice. Cytotoxicity in both wild-type and Aag -transgenic ( AagTg ) mice is abrogated in the absence of Poly(ADP-ribose) polymerase-1 (PARP1). Here, we tested whether PARP inhibitors can also prevent alkylation-induced retinal and cerebellar degeneration in male and female WT and AagTg mice. Importantly, we found that WT mice display sex-dependent alkylation-induced retinal damage (but not cerebellar damage), with WT males being more sensitive than females. Accordingly, estradiol treatment protects males against alkylation-induced retinal degeneration. In AagTg male and female mice, the alkylation-induced tissue damage in both the retina and cerebellum is exacerbated and the sex difference in the retina is abolished. PARP inhibitors, much like Parp1 gene deletion, protect against alkylation-induced AAG-dependent neuronal degeneration in WT and AagTg mice, regardless of the gender, but their efficacy in preventing alkylation-induced neuronal degeneration depends on PARP inhibitor characteristics and doses. The recent surge in the use of PARP inhibitors in combination with cancer chemotherapeutic alkylating agents might represent a powerful tool for obtaining increased therapeutic efficacy while avoiding the collateral effects of alkylating agents in healthy tissues.
Genetics Home Reference: Stargardt macular degeneration
... recognizing faces. In most people with Stargardt macular degeneration , a fatty yellow pigment (lipofuscin) builds up in cells underlying the macula. Over time, the abnormal accumulation of this substance ...
Sudden acquired retinal degeneration syndrome in western Canada: 93 cases.
Leis, Marina L; Lucyshyn, Danica; Bauer, Bianca S; Grahn, Bruce H; Sandmeyer, Lynne S
2017-11-01
This study reviewed clinical data from dogs diagnosed with sudden acquired retinal degeneration syndrome (SARDS) in western Canada. Medical records from the Western College of Veterinary Medicine from 2002 to 2016 showed that 93 cases of SARDS were diagnosed based on presentation for sudden blindness and a bilaterally extinguished electroretinogram. The most common pure breeds were the miniature schnauzer, dachshund, and pug. The mean age at diagnosis was 8.1 years and males and females were equally affected. Most of the dogs were presented with normal non-chromatic, but abnormal chromatic pupillary light reflexes. The incidence of retinal degeneration as detected via ophthalmoscopy increased over time after SARDS diagnosis. Polyuria, polydipsia, polyphagia, weight gain, elevated liver enzyme values, isosthenuria, and proteinuria were common clinical and laboratory findings. Chromatic pupillary light reflex testing may be more valuable than non-chromatic pupillary light testing in detecting pupil response abnormalities in dogs with SARDS, although electroretinography remains the definitive diagnostic test.
Sudden acquired retinal degeneration syndrome in western Canada: 93 cases
Leis, Marina L.; Lucyshyn, Danica; Bauer, Bianca S.; Grahn, Bruce H.; Sandmeyer, Lynne S.
2017-01-01
This study reviewed clinical data from dogs diagnosed with sudden acquired retinal degeneration syndrome (SARDS) in western Canada. Medical records from the Western College of Veterinary Medicine from 2002 to 2016 showed that 93 cases of SARDS were diagnosed based on presentation for sudden blindness and a bilaterally extinguished electroretinogram. The most common pure breeds were the miniature schnauzer, dachshund, and pug. The mean age at diagnosis was 8.1 years and males and females were equally affected. Most of the dogs were presented with normal non-chromatic, but abnormal chromatic pupillary light reflexes. The incidence of retinal degeneration as detected via ophthalmoscopy increased over time after SARDS diagnosis. Polyuria, polydipsia, polyphagia, weight gain, elevated liver enzyme values, isosthenuria, and proteinuria were common clinical and laboratory findings. Chromatic pupillary light reflex testing may be more valuable than non-chromatic pupillary light testing in detecting pupil response abnormalities in dogs with SARDS, although electroretinography remains the definitive diagnostic test. PMID:29089658
K-causality and degenerate spacetimes
Dowker, H. F.; Garcia, R. S.; Surya, S.
2000-11-01
The causal relation K+ was introduced by Sorkin and Woolgar to extend the standard causal analysis of C2 spacetimes to those that are only C0. Most of their results also hold true in the case of metrics with degeneracies which are C0 but vanish at isolated points. In this paper we seek to examine K+ explicitly in the case of topology-changing `Morse histories' which contain degeneracies. We first demonstrate some interesting features of this relation in globally Lorentzian spacetimes. In particular, we show that K+ is robust and the Hawking and Sachs characterization of causal continuity translates into a natural condition in terms of K+. We then examine K+ in topology-changing Morse spacetimes with the degenerate points excised and then for the Morse histories in which the degenerate points are reinstated. We find further characterizations of causal continuity in these cases.
Late complications following cryotherapy of lattice degeneration.
Benson, W E; Morse, P H; Nantawan, P
1977-10-01
We observed 341 patients who had received cryotherapy for lattice degeneration in order to identify possible late complications. Sequelae such as retinal tears posterior to an operculum or flap tears within treated areas showed that treatment did not necessarily prevent subsequent vitreous traction. Moreover, the newly created flap tears may extend beyond the treated area and can cause retinal detachment. Even scleral buckling did not necesserily prevent further traction. Therefore, we concluded that when cryotherapy is used to treat lattice degeneration, an adequate margin of surrounding retina should be treated and the treatment should extend to the ora serrata.
Degenerate Fermi gas in a combined harmonic-lattice potential
International Nuclear Information System (INIS)
Blakie, P. B.; Bezett, A.; Buonsante, P.
2007-01-01
In this paper we derive an analytic approximation to the density of states for atoms in a combined optical lattice and harmonic trap potential as used in current experiments with quantum degenerate gases. We compare this analytic density of states to numerical solutions and demonstrate its validity regime. Our work explicitly considers the role of higher bands and when they are important in quantitative analysis of this system. Applying our density of states to a degenerate Fermi gas, we consider how adiabatic loading from a harmonic trap into the combined harmonic-lattice potential affects the degeneracy temperature. Our results suggest that occupation of excited bands during loading should lead to more favorable conditions for realizing degenerate Fermi gases in optical lattices
Scrimer: designing primers from transcriptome data
Czech Academy of Sciences Publication Activity Database
Mořkovský, Libor; Pačes, Jan; Rídl, Jakub; Reifová, R.
2015-01-01
Roč. 15, č. 6 (2015), s. 1415-1420 ISSN 1755-098X R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 ; RVO:68378050 Keywords : next-generation sequencing * primer design * SNaPshot * SNP genotyping * transcriptome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.298, year: 2015
Disc degeneration: current surgical options
Directory of Open Access Journals (Sweden)
C Schizas
2010-10-01
Full Text Available Chronic low back pain attributed to lumbar disc degeneration poses a serious challenge to physicians. Surgery may be indicated in selected cases following failure of appropriate conservative treatment. For decades, the only surgical option has been spinal fusion, but its results have been inconsistent. Some prospective trials show superiority over usual conservative measures while others fail to demonstrate its advantages. In an effort to improve results of fusion and to decrease the incidence of adjacent segment degeneration, total disc replacement techniques have been introduced and studied extensively. Short-term results have shown superiority over some fusion techniques. Mid-term results however tend to show that this approach yields results equivalent to those of spinal fusion. Nucleus replacement has gained some popularity initially, but evidence on its efficacy is scarce. Dynamic stabilisation, a technique involving less rigid implants than in spinal fusion and performed without the need for bone grafting, represents another surgical option. Evidence again is lacking on its superiority over other surgical strategies and conservative measures. Insertion of interspinous devices posteriorly, aiming at redistributing loads and relieving pain, has been used as an adjunct to disc removal surgery for disc herniation. To date however, there is no clear evidence on their efficacy. Minimally invasive intradiscal thermocoagulation techniques have also been tried, but evidence of their effectiveness is questioned. Surgery using novel biological solutions may be the future of discogenic pain treatment. Collaboration between clinicians and basic scientists in this multidisciplinary field will undoubtedly shape the future of treating symptomatic disc degeneration.
Wallerian degeneration: the innate-immune response to traumatic nerve injury
Directory of Open Access Journals (Sweden)
Rotshenker Shlomo
2011-08-01
Full Text Available Abstract Traumatic injury to peripheral nerves results in the loss of neural functions. Recovery by regeneration depends on the cellular and molecular events of Wallerian degeneration that injury induces distal to the lesion site, the domain through which severed axons regenerate back to their target tissues. Innate-immunity is central to Wallerian degeneration since innate-immune cells, functions and molecules that are produced by immune and non-immune cells are involved. The innate-immune response helps to turn the peripheral nerve tissue into an environment that supports regeneration by removing inhibitory myelin and by upregulating neurotrophic properties. The characteristics of an efficient innate-immune response are rapid onset and conclusion, and the orchestrated interplay between Schwann cells, fibroblasts, macrophages, endothelial cells, and molecules they produce. Wallerian degeneration serves as a prelude for successful repair when these requirements are met. In contrast, functional recovery is poor when injury fails to produce the efficient innate-immune response of Wallerian degeneration.
An Unusual Case of Extensive Lattice Degeneration and Retinal Detachment.
Mathew, David J; Sarma, Saurabh Kumar; Basaiawmoit, Jennifer V
2016-07-01
Lattice degeneration of the retina is not infrequently encountered on a dilated retinal examination and many of them do not need any intervention. We report a case of atypical lattice degeneration variant with peripheral retinal detachment. An asymptomatic 35-year-old lady with minimal refractive error was found to have extensive lattice degeneration, peripheral retinal detachment and fibrotic changes peripherally with elevation of retinal vessels on dilated retinal examination. There were also areas of white without pressure, chorioretinal scarring and retinal breaks. All the changes were limited to beyond the equator but were found to span 360 degrees. She was treated with barrage laser all around to prevent extension of the retinal detachment posteriorly. She remained stable till her latest follow-up two years after the barrage laser. This case is reported for its rarity with a discussion of the probable differential diagnoses. To the best of our knowledge, this is the first report of such findings in lattice degeneration.
Prunier, Rachel; Latimer, Andrew
2010-01-01
Microsatellite primers were developed in the South African sclerophyllous shrub Protea punctata to investigate the degree of population differentiation within and between P. punctata and closely related species. • 10 primer pairs were identified from three individuals of Protea punctata. The primers amplified di- and tri-nucleotide repeats. Across all P. punctata samples, the loci have 8-49 alleles. All primers also amplified in Protea section Exsertae (P. aurea, P. aurea subsp. potbergensis, P. mundii, P. venusta, P. lacticolor, and P. subvestita). The loci had 14-69 alleles across the subgenus. • These results show the broad utility of microsatellite loci for future studies of population genetics in the white proteas and their potential utility across the entire genus.
Degree of tendon degeneration and stage of rotator cuff disease.
Jo, Chris Hyunchul; Shin, Won Hyoung; Park, Ji Wan; Shin, Ji Sun; Kim, Ji Eun
2017-07-01
While tendon degeneration has been known to be an important cause of rotator cuff disease, few studies have objectively proven the association of tendon degeneration and rotator cuff disease. The purpose of this study was to investigate changes of tendon degeneration with respect to the stage of rotator cuff disease. A total of 48 patients were included in the study: 12 with tendinopathy, 12 with a partial-thickness tear (pRCT), 12 with a full-thickness tear (fRCT), and 12 as the control. A full-thickness supraspinatus tendon sample was harvested en bloc from the middle portion between the lateral edge and the musculotendinous junction of the tendon using a biopsy punch with a diameter of 3 mm. Harvested samples were evaluated using a semi-quantitative grading scale with 7 parameters after haematoxylin and eosin staining. There was no significant difference in age, gender, symptom duration, and Kellgren-Lawrence grade between the groups except for the global fatty degeneration index. All of the seven parameters were significantly different between the groups and could be categorized as follows: early responders (fibre structure and arrangement), gradual responder (rounding of the nuclei), after-tear responders (cellularity, vascularity, and stainability), and late responder (hyalinization). The total degeneration scores were not significantly different between the control (6.08 ± 1.16) and tendinopathy (6.67 ± 1.83) (n.s.). However, the score of pRCT group (10.42 ± 1.31) was greater than that of tendinopathy (P rotator cuff disease progresses from tendinopathy to pRCT, and then to fRCT. The degree of degeneration of tendinopathy was not different from that of normal but aged tendons, and significant tendon degeneration began from the stage of pRCT. The clinical relevance of the study is that strategies and goals of the treatment for rotator cuff disease should be specific to its stage, in order to prevent disease progression for tendinopathy and pRCT, as
Profitability primer: a guide to profitability analysis in the electric power industry
International Nuclear Information System (INIS)
Woo, C.K.; Lloyd-Zannetti, D.; Martin, J.; Price, S.
1996-06-01
As the electric power industry is opened to forces of competition, increased attention must be focused to develop products and services that deliver good value to customers and to identify customer segments that are profitable to serve. This primer introduces the concept of profitability analysis and its application to the electric power industry. The primer recognizes that some segments of the business will remain monopolistic and subject to regulations, while other segments will become competitive. The primer also recognizes that customer profitability is critically dependent on a host of related issues such as how internal costs are allocated to various functions and how revenues are collected and allocated
Relativistic many-body XMCD theory including core degenerate effects
Fujikawa, Takashi
2009-11-01
A many-body relativistic theory to analyze X-ray Magnetic Circular Dichroism (XMCD) spectra has been developed on the basis of relativistic quantum electrodynamic (QED) Keldysh Green's function approach. This theoretical framework enables us to handle relativistic many-body effects in terms of correlated nonrelativistic Green's function and relativistic correction operator Q, which naturally incorporates radiation field screening and other optical field effects in addition to electron-electron interactions. The former can describe the intensity ratio of L2/L3 which deviates from the statistical weight (branching ratio) 1/2. In addition to these effects, we consider the degenerate or nearly degenerate effects of core levels from which photoelectrons are excited. In XPS spectra, for example in Rh 3d sub level excitations, their peak shapes are quite different: This interesting behavior is explained by core-hole moving after the core excitation. We discuss similar problems in X-ray absorption spectra in particular excitation from deep 2p sub levels which are degenerate in each sub levels and nearly degenerate to each other in light elements: The hole left behind is not frozen there. We derive practical multiple scattering formulas which incorporate all those effects.
Identification of Age-Related Macular Degeneration Using OCT Images
Arabi, Punal M., Dr; Krishna, Nanditha; Ashwini, V.; Prathibha, H. M.
2018-02-01
Age-related Macular Degeneration is the most leading retinal disease in the recent years. Macular degeneration occurs when the central portion of the retina, called macula deteriorates. As the deterioration occurs with the age, it is commonly referred as Age-related Macular Degeneration. This disease can be visualized by several imaging modalities such as Fundus imaging technique, Optical Coherence Tomography (OCT) technique and many other. Optical Coherence Tomography is the widely used technique for screening the Age-related Macular Degeneration disease, because it has an ability to detect the very minute changes in the retina. The Healthy and AMD affected OCT images are classified by extracting the Retinal Pigmented Epithelium (RPE) layer of the images using the image processing technique. The extracted layer is sampled, the no. of white pixels in each of the sample is counted and the mean value of the no. of pixels is calculated. The average mean value is calculated for both the Healthy and the AMD affected images and a threshold value is fixed and a decision rule is framed to classify the images of interest. The proposed method showed an accuracy of 75%.
Temas de Física para Ingeniería: Primer principio de la termodinámica
Beléndez Vázquez, Augusto
1992-01-01
Acústica, fluidos y termodinámica: "Primer principio de la termodinámica". Objetivos y caracteres generales de la termodinámica. Conceptos fundamentales de la termodinámica. Capacidad calorífica, calor específico y calor latente. Trabajo. Primer principio de la termodinámica: energía interna. Algunas aplicaciones del primer principio.
Ataxias and Cerebellar or Spinocerebellar Degeneration
... and conducts a broad range of basic and clinical research on cerebellar and spinocerebellar degeneration, including work aimed at finding the cause(s) of ataxias and ways to ... Publications Definition Ataxia ...
The effects of wallerian degeneration of the optic radiations demonstrated by MRI
Energy Technology Data Exchange (ETDEWEB)
Savoiardo, M.; Grisoli, M.; Forester, M.; D' Incerti, L.; Farina, L. (Dept. of Neuroradiology, Ist. Nazionale Neurologico C. Besta, Milan (Italy)); Pareyson, D. (Dept. of Neurology, Ist. Nazionale Neurologico C. Besta, Milan (Italy))
1992-08-01
The effects of wallerian degeneration can be demonstrated by MRI as abnormal signal along the course of the degenerate fibres; they have previously been reported in the corticospinal tract. We report two cases of wallerian degeneration of the right optic radiations due to lesions of the right lateral geniculate body. The anatomy and the MRI visibility of the normal optic radiations are briefly discussed. (orig.).
The effects of wallerian degeneration of the optic radiations demonstrated by MRI
International Nuclear Information System (INIS)
Savoiardo, M.; Grisoli, M.; Forester, M.; D'Incerti, L.; Farina, L.; Pareyson, D.
1992-01-01
The effects of wallerian degeneration can be demonstrated by MRI as abnormal signal along the course of the degenerate fibres; they have previously been reported in the corticospinal tract. We report two cases of wallerian degeneration of the right optic radiations due to lesions of the right lateral geniculate body. The anatomy and the MRI visibility of the normal optic radiations are briefly discussed. (orig.)
A primer on motor vehicle air pollution.
1973-01-01
This primer presents a brief state-of-the art review of motor vehicle air pollution. Its purpose is to aid highway personnel in understanding the nature of this environmental problem on our highways and to present possible solutions for its abatement...
Applied ecosystem analysis - a primer; the ecosystem diagnosis and treatment method
International Nuclear Information System (INIS)
Lestelle, L.C.; Mobrand, L.E.; Lichatowich, J.A.; Vogel, T.S.
1996-05-01
The aim of this document is to inform and instruct the reader about an approach to ecosystem management that is based upon salmon as an indicator species. It is intended to provide natural resource management professionals with the background information needed to answer questions about why and how to apply the approach. The methods and tools the authors describe are continually updated and refined, so this primer should be treated as a first iteration of a sequentially revised manual
An αII Spectrin-Based Cytoskeleton Protects Large-Diameter Myelinated Axons from Degeneration.
Huang, Claire Yu-Mei; Zhang, Chuansheng; Zollinger, Daniel R; Leterrier, Christophe; Rasband, Matthew N
2017-11-22
Axons must withstand mechanical forces, including tension, torsion, and compression. Spectrins and actin form a periodic cytoskeleton proposed to protect axons against these forces. However, because spectrins also participate in assembly of axon initial segments (AISs) and nodes of Ranvier, it is difficult to uncouple their roles in maintaining axon integrity from their functions at AIS and nodes. To overcome this problem and to determine the importance of spectrin cytoskeletons for axon integrity, we generated mice with αII spectrin-deficient peripheral sensory neurons. The axons of these neurons are very long and exposed to the mechanical forces associated with limb movement; most lack an AIS, and some are unmyelinated and have no nodes. We analyzed αII spectrin-deficient mice of both sexes and found that, in myelinated axons, αII spectrin forms a periodic cytoskeleton with βIV and βII spectrin at nodes of Ranvier and paranodes, respectively, but that loss of αII spectrin disrupts this organization. Avil-cre;Sptan1 f/f mice have reduced numbers of nodes, disrupted paranodal junctions, and mislocalized Kv1 K + channels. We show that the density of nodal βIV spectrin is constant among axons, but the density of nodal αII spectrin increases with axon diameter. Remarkably, Avil-cre;Sptan1 f/f mice have intact nociception and small-diameter axons, but severe ataxia due to preferential degeneration of large-diameter myelinated axons. Our results suggest that nodal αII spectrin helps resist the mechanical forces experienced by large-diameter axons, and that αII spectrin-dependent cytoskeletons are also required for assembly of nodes of Ranvier. SIGNIFICANCE STATEMENT A periodic axonal cytoskeleton consisting of actin and spectrin has been proposed to help axons resist the mechanical forces to which they are exposed (e.g., compression, torsion, and stretch). However, until now, no vertebrate animal model has tested the requirement of the spectrin cytoskeleton in
Directory of Open Access Journals (Sweden)
Shrinivas Ashtekar
2016-01-01
Full Text Available Objective: To compare and evaluate the shear bond strength (SBS of lingual brackets, manufactured by three different processes, that is, laser sintering, milling, and casting, bonded with two different adhesive primers. Materials and Methods: One hundred and twenty premolars were selected, and three types of lingual brackets were used, namely, STB (milling, 7th Generation (casting, and lingualmatrix (laser sintering. Forty brackets per system were used half of which were sandblasted while the other half were used as available. Further, these were subdivided and bonded with Transbond XT primer and adhesive and 3M ESPE Primer and Transbond XT adhesive. Customization of STB and 7th Generation was done by Torque Angulation Reference Guide, Lingualmatrix had bases customized by Computer-aided design/computer-aided manufacturing. SBS was tested with universal testing machine and evaluated for adhesive remnant index (ARI. Results: Statistical analysis showed that surface treatment, use of different primers, method of customization influenced the SBS, and ARI suggested that the fracture occurred between composite and bracket interface. Conclusion: Lingualmatrix bracket showed greater SBS as compared to STB and 7th Generation, sandblasting increased SBS. 3M ESPE primer group showed increased SBS as that bonded with Transbond XT primer. The fracture was between the composite bracket interface.
Spin-dependent Hall effect in degenerate semiconductors: a theoretical study
Energy Technology Data Exchange (ETDEWEB)
Idrish Miah, M [Nanoscale Science and Technology Centre, Griffith University, Nathan, Brisbane, QLD 4111 (Australia)], E-mail: m.miah@griffith.edu.au
2008-10-15
The spin-dependent Hall (SDH) effect in degenerate semiconductors is investigated theoretically. Starting from a two-component drift-diffusion equation, an expression for SDH voltage (V{sub SDH}) is derived, and drift and diffusive contributions to V{sub SDH} are studied. For the possible enhancement of the diffusive part, degenerate and nondegenerate cases are examined. We find that due to an increase in the diffusion coefficient V{sub SDH} increases in a degenerate semiconductor, consistent with the experimental observations. The expression for V{sub SDH} is reduced in three limiting cases, namely diffusive, drift-diffusion crossover and drift, and is analysed. The results agree with those obtained in recent theoretical investigations.
Spin-dependent Hall effect in degenerate semiconductors: a theoretical study
International Nuclear Information System (INIS)
Idrish Miah, M
2008-01-01
The spin-dependent Hall (SDH) effect in degenerate semiconductors is investigated theoretically. Starting from a two-component drift-diffusion equation, an expression for SDH voltage (V SDH ) is derived, and drift and diffusive contributions to V SDH are studied. For the possible enhancement of the diffusive part, degenerate and nondegenerate cases are examined. We find that due to an increase in the diffusion coefficient V SDH increases in a degenerate semiconductor, consistent with the experimental observations. The expression for V SDH is reduced in three limiting cases, namely diffusive, drift-diffusion crossover and drift, and is analysed. The results agree with those obtained in recent theoretical investigations.
Directory of Open Access Journals (Sweden)
Marion Fusellier
2016-01-01
Full Text Available Regenerative medicine is considered an attractive prospect for the treatment of intervertebral disc (IVD degeneration. To assess the efficacy of the regenerative approach, animal models of IVD degeneration are needed. Among these animal models, chemonucleolysis based on the enzymatic degradation of the Nucleus Pulposus (NP is often used, but this technique remains far from the natural physiopathological process of IVD degeneration. Recently, we developed an innovative animal model of IVD degeneration based on the use of a laser beam. In the present study, this laser model was compared with the chemonucleolysis model in a longitudinal study in rabbits. The effects of the treatments were studied by MRI (T2-weighted signal intensity (T2wsi, radiography (IVD height index, and histology (NP area and Boos’ scoring. The results showed that both treatments induced a degeneration of the IVD with a decrease in IVD height and T2wsi as well as NP area and an increase in Boos’ scoring. The enzyme treatment leads to a rapid and acute process of IVD degeneration. Conversely, laser radiation induced more progressive and less pronounced degeneration. It can be concluded that laser treatment provides an instrumental in vivo model of slowly evolving IVD degenerative disease that can be of preclinical relevance for assessing new prophylactic biological treatments of disc degeneration.
Designing for transportation management and operations : a primer.
2013-02-01
This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...
Extended Hellmann-Feynman theorem for degenerate eigenstates
Zhang, G. P.; George, Thomas F.
2004-04-01
In a previous paper, we reported a failure of the traditional Hellmann-Feynman theorem (HFT) for degenerate eigenstates. This has generated enormous interest among different groups. In four independent papers by Fernandez, by Balawender, Hola, and March, by Vatsya, and by Alon and Cederbaum, an elegant method to solve the problem was devised. The main idea is that one has to construct and diagonalize the force matrix for the degenerate case, and only the eigenforces are well defined. We believe this is an important extension to HFT. Using our previous example for an energy level of fivefold degeneracy, we find that those eigenforces correctly reflect the symmetry of the molecule.
Kinematic control of robot with degenerate wrist
Barker, L. K.; Moore, M. C.
1984-01-01
Kinematic resolved rate equations allow an operator with visual feedback to dynamically control a robot hand. When the robot wrist is degenerate, the computed joint angle rates exceed operational limits, and unwanted hand movements can result. The generalized matrix inverse solution can also produce unwanted responses. A method is introduced to control the robot hand in the region of the degenerate robot wrist. The method uses a coordinated movement of the first and third joints of the robot wrist to locate the second wrist joint axis for movement of the robot hand in the commanded direction. The method does not entail infinite joint angle rates.
The UVM primer a step-by-step introduction to the universal verification methodology
Salemi, Ray
2013-01-01
The UVM Primer uses simple, runnable code examples, accessible analogies, and an easy-to-read style to introduce you to the foundation of the Universal Verification Methodology. You will learn the basics of object-oriented programming with SystemVerilog and build upon that foundation to learn how to design testbenches using the UVM. Use the UVM Primer to brush up on your UVM knowledge before a job interview to be able to confidently answer questions such as "What is a uvm_agent?" , "How do you use uvm_sequences?", and "When do you use the UVM's factory." The UVM Primer's downloadable code examples give you hands-on experience with real UVM code. Ray Salemi uses online videos (on www.uvmprimer.com) to walk through the code from each chapter and build your confidence. Read The UVM Primer today and start down the path to the UVM.
Prevalence of lattice degeneration and its relation to axial length in severe myopia.
Celorio, J M; Pruett, R C
1991-01-15
We studied 436 eyes of 218 patients with myopia of -6.00 diopters or more in both eyes. Of 218 patients, 72 (33.0%) had lattice degeneration of the retina. Among these 72 patients, lattice lesions were uniocular in 39 (54.2%) and binocular in 33 (45.8%). Of 105 males, 33 (31.4%) had lattice degeneration; of 113 females, 39 (34.5%) had lattice degeneration. Contrary to previously published data, we found an inverse relationship between axial length and the prevalence of lattice degeneration in severely myopic eyes. The greatest prevalence of lattice degeneration (63 of 154 eyes, 40.9%) was found in eyes with an axial length of 26.0 to 26.9 mm (-6.00 to -8.70 diopters), and the least prevalence of lattice degeneration (five of 71 eyes, 7.0%) was found in eyes with an axial length of 32.0 mm (-24.00 diopters) or greater. This may explain the observation that retinal detachment after cataract surgery has been noted more commonly among patients with moderate than severe myopia.
Posterior Lattice Degeneration Characterized by Spectral Domain Optical Tomography
Manjunath, Varsha; Taha, Mohammed; Fujimoto, James G.; Duker, Jay S.
2011-01-01
PURPOSE: To utilize high-resolution spectral domain optical coherence tomography (SD-OCT) in the characterization of retinal and vitreal morphological changes overlying posterior lattice degeneration. METHODS: A cross-sectional, retrospective analysis was performed on 13 eyes of 13 nonconsecutive subjects with posterior lattice degeneration seen at the New England Eye Center, Tufts Medical Center between October 2009 and January 2010. SD-OCT images taken through the region of latti...
A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets
Energy Technology Data Exchange (ETDEWEB)
Warwick, William M.
2002-06-03
This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.
Waldenberg, Christian; Hebelka, Hanna; Brisby, Helena; Lagerstrand, Kerstin Magdalena
2018-05-01
Magnetic resonance imaging (MRI) is the best diagnostic imaging method for low back pain. However, the technique is currently not utilized in its full capacity, often failing to depict painful intervertebral discs (IVDs), potentially due to the rough degeneration classification system used clinically today. MR image histograms, which reflect the IVD heterogeneity, may offer sensitive imaging biomarkers for IVD degeneration classification. This study investigates the feasibility of using histogram analysis as means of objective and continuous grading of IVD degeneration. Forty-nine IVDs in ten low back pain patients (six males, 25-69 years) were examined with MRI (T2-weighted images and T2-maps). Each IVD was semi-automatically segmented on three mid-sagittal slices. Histogram features of the IVD were extracted from the defined regions of interest and correlated to Pfirrmann grade. Both T2-weighted images and T2-maps displayed similar histogram features. Histograms of well-hydrated IVDs displayed two separate peaks, representing annulus fibrosus and nucleus pulposus. Degenerated IVDs displayed decreased peak separation, where the separation was shown to correlate strongly with Pfirrmann grade (P histogram appearances. Histogram features correlated well with IVD degeneration, suggesting that IVD histogram analysis is a suitable tool for objective and continuous IVD degeneration classification. As histogram analysis revealed IVD heterogeneity, it may be a clinical tool for characterization of regional IVD degeneration effects. To elucidate the usefulness of histogram analysis in patient management, IVD histogram features between asymptomatic and symptomatic individuals needs to be compared.
International Nuclear Information System (INIS)
Nguyen, H.; Bredy, R.; Camp, H.A.; DePaola, B.D.; Awata, T.
2004-01-01
Resolution plays a vital role in spectroscopic studies. In the usual recoil-ion momentum spectroscopy (RIMS), Q-value resolution is relied upon to distinguish between different collision channels: The better the Q-value resolution, the better one is able to resolve energetically similar channels. Although traditional COLTRIMS greatly improves Q-value resolution by cooling the target and thus greatly reducing the initial target momentum spread, the resolution of the technique is still limited by target temperature. However, with the recent development in RIMS, namely, magneto-optical trap recoil ion momentum spectroscopy (MOTRIMS) superior recoil ion momentum resolution as well as charge transfer measurements with laser excited targets have become possible. Through MOTRIMS, methods for the measurements of target excited state fraction and kinematically complete relative charge transfer cross sections have been developed, even for some systems having energetically degenerate or nearly degenerate channels. In the present work, the systems of interest having energy degeneracies or near degeneracies are Rb + , K + , and Li + colliding with trapped Rb(5l), where l=s and p
Does elite swimming accelerate lumbar intervertebral disc degeneration and increase low back pain?
DEFF Research Database (Denmark)
Folkvardsen, Steffen; Magnussen, Erland; Karppinen, Jaro
2016-01-01
PURPOSE: The aim was to elucidate elite swimming's possible influence on lumbar disc degeneration (DD) and low back pain (LBP). METHODS: Lumbar spine MRI was performed on a group of elite swimmers and compared to a matched Finnish population-based no-sport group. RESULTS: One hundred elite swimmers...
Urocortin 2 treatment is protective in excitotoxic retinal degeneration.
Szabadfi, K; Kiss, P; Reglodi, D; Fekete, E M; Tamas, A; Danyadi, B; Atlasz, T; Gabriel, R
2014-03-01
Urocortin 2 (Ucn 2) is a corticotrop releasing factor paralog peptide with many physiological functions and it has widespread distribution. There are some data on the cytoprotective effects of Ucn 2, but less is known about its neuro- and retinoprotective actions. We have previously shown that Ucn 2 is protective in ischemia-induced retinal degeneration. The aim of the present study was to examine the protective potential of Ucn 2 in monosodium-glutamate (MSG)-induced retinal degeneration by routine histology and to investigate cell-type specific effects by immunohistochemistry. Rat pups received MSG applied on postnatal days 1, 5 and 9 and Ucn 2 was injected intravitreally into one eye. Retinas were processed for histology and immunocytochemistry after 3 weeks. Immunolabeling was determined for glial fibrillary acidic protein, vesicular glutamate transporter 1, protein kinase Cα, calbindin, parvalbumin and calretinin. Retinal tissue from animals treated with MSG showed severe degeneration compared to normal retinas, but intravitreal Ucn 2 treatment resulted in a retained retinal structure both at histological and neurochemical levels: distinct inner retinal layers and rescued inner retinal cells (different types of amacrine and rod bipolar cells) could be observed. These findings support the neuroprotective function of Ucn 2 in MSG-induced retinal degeneration.
Caro, Florian; Saad, Bilal Mohammed; Saad, Mazen Naufal B M
2013-01-01
Our goal is the mathematical analysis of a two phase (liquid and gas) two components (water and hydrogen) system modeling the hydrogen displacement in a storage site for radioactive waste. We suppose that the water is only in the liquid phase and is incompressible. The hydrogen in the gas phase is supposed compressible and could be dissolved into the water with the Henry law. The flow is described by the conservation of the mass of each components. The model is treated without simplified assumptions on the gas density. This model is degenerated due to vanishing terms. We establish an existence result for the nonlinear degenerate parabolic system based on new energy estimate on pressures.
Caro, Florian
2013-09-01
Our goal is the mathematical analysis of a two phase (liquid and gas) two components (water and hydrogen) system modeling the hydrogen displacement in a storage site for radioactive waste. We suppose that the water is only in the liquid phase and is incompressible. The hydrogen in the gas phase is supposed compressible and could be dissolved into the water with the Henry law. The flow is described by the conservation of the mass of each components. The model is treated without simplified assumptions on the gas density. This model is degenerated due to vanishing terms. We establish an existence result for the nonlinear degenerate parabolic system based on new energy estimate on pressures.
Washington, Ilyas; Saad, Leonide
2016-01-01
One of the earliest events preceding several forms of retinal degeneration is the formation and accumulation of vitamin A dimers in the retinal pigment epithelium (RPE) and underlying Bruch's membrane (BM). Such degenerations include Stargardt disease, Best disease, forms of retinitis pigmentosa, and age-related macular degeneration (AMD). Since their discovery in the 1990's, dimers of vitamin A, have been postulated as chemical triggers driving retinal senescence and degeneration. There is evidence to suggest that the rate at which vitamin A dimerizes and the eye's response to the dimerization products may dictate the retina's lifespan. Here, we present outstanding questions, finding the answers to which may help to elucidate the role of vitamin A dimerization in retinal degeneration.
Peripheral retinal degenerations and the risk of retinal detachment.
Lewis, Hilel
2003-07-01
To review the degenerative diseases of the peripheral retina in relationship with the risk to develop a rhegmatogenous retinal detachment and to present recommendations for use in eyes at increased risk of developing a retinal detachment. Focused literature review and author's clinical experience. Retinal degenerations are common lesions involving the peripheral retina, and most of them are clinically insignificant. Lattice degeneration, degenerative retinoschisis, cystic retinal tufts, and, rarely, zonular traction tufts, can result in a rhegmatogenous retinal detachment. Therefore, these lesions have been considered for prophylactic therapy; however, adequate studies have not been performed to date. Well-designed, prospective, randomized clinical studies are necessary to determine the benefit-risk ratio of prophylactic treatment. In the meantime, the evidence available suggests that most of the peripheral retinal degenerations should not be treated except in rare, high-risk situations.
Inteligencia emocional y autoconcepto en los estudiantes de primer ciclo
Castillo Canales, Braulio
2017-01-01
En nuestra investigación se tuvo como problema: ¿Qué relación existe entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II? Además el objetivo fue: Determinar la relación entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II. El tipo de estudio fue básica...
Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer
Energy Technology Data Exchange (ETDEWEB)
Lucas, D.S.
2004-10-03
This paper covers the basics of the implementation of the control volume method in the context of the Homogeneous Equilibrium Model (HEM)(T/H) code using the conservation equations of mass, momentum, and energy. This primer uses the advection equation as a template. The discussion will cover the basic equations of the control volume portion of the course in the primer, which includes the advection equation, numerical methods, along with the implementation of the various equations via FORTRAN into computer programs and the final result for a three equation HEM code and its validation.
Móvil remisión de V. cinta del primer móvil.
2011-01-01
[ES] Definición del término Móvil remisión de V. cinta del primer móvil. en el diccionario Dicter. [EN] Definition of the word Móvil remisión de V. cinta del primer móvil. in the dictionary Dicter.
Giant amplification in degenerate band edge slow-wave structures interacting with an electron beam
Energy Technology Data Exchange (ETDEWEB)
Othman, Mohamed A. K.; Veysi, Mehdi; Capolino, Filippo [Department of Electrical Engineering and Computer Science, University of California, Irvine, California 92697 (United States); Figotin, Alexander [Department of Mathematics, University of California, Irvine, California 92697 (United States)
2016-03-15
We propose a new amplification regime based on a synchronous operation of four degenerate electromagnetic (EM) modes in a slow-wave structure and the electron beam, referred to as super synchronization. These four EM modes arise in a Fabry-Pérot cavity when degenerate band edge (DBE) condition is satisfied. The modes interact constructively with the electron beam resulting in superior amplification. In particular, much larger gains are achieved for smaller beam currents compared to conventional structures based on synchronization with only a single EM mode. We demonstrate giant gain scaling with respect to the length of the slow-wave structure compared to conventional Pierce type single mode traveling wave tube amplifiers. We construct a coupled transmission line model for a loaded waveguide slow-wave structure exhibiting a DBE, and investigate the phenomenon of giant gain via super synchronization using the Pierce model generalized to multimode interaction.
Leopold, Luna Bergere; Langbein, Walter Basil
1960-01-01
When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to
Deficiency of adaptive immunity does not interfere with Wallerian degeneration.
Directory of Open Access Journals (Sweden)
Christopher R Cashman
Full Text Available Following injury, distal axons undergo the process of Wallerian degeneration, and then cell debris is cleared to create a permissive environment for axon regeneration. The innate and adaptive immune systems are believed to be critical for facilitating the clearance of myelin and axonal debris during this process. However, immunodeficient animal models are regularly used in transplantation studies investigating cell therapies to modulate the degenerative/regenerative response. Given the importance of the immune system in preparing a permissive environment for regeneration by clearing debris, animals lacking, in part or in full, a functional immune system may have an impaired ability to regenerate due to poor myelin clearance, and may, thus, be poor hosts to study modulators of regeneration and degeneration. To study this hypothesis, three different mouse models with impaired adaptive immunity were compared to wild type animals in their ability to degenerate axons and clear myelin debris one week following sciatic nerve transection. Immunofluorescent staining for axons and quantitation of axon density with nerve histomorphometry of the distal stump showed no consistent discrepancy between immunodeficient and wild type animals, suggesting axons tended to degenerate equally between the two groups. Debris clearance was assessed by macrophage density and relative myelin basic protein expression within the denervated nerve stump, and no consistent impairment of debris clearance was found. These data suggested deficiency of the adaptive immune system does not have a substantial effect on axon degeneration one week following axonal injury.
Teixeira, Graciosa Q; Leite Pereira, Catarina; Castro, Flávia; Ferreira, Joana R; Gomez-Lazaro, Maria; Aguiar, Paulo; Barbosa, Mário A; Neidlinger-Wilke, Cornelia; Goncalves, Raquel M
2016-09-15
Intervertebral disc (IVD) degeneration is one of the most common causes of low back pain (LBP), the leading disorder in terms of years lived with disability. Inflammation can play a role in LPB, while impairs IVD regeneration. In spite of this, different inflammatory targets have been purposed in the context of IVD regeneration. Anti-inflammatory nanoparticles (NPs) of Chitosan and Poly-(γ-glutamic acid) with a non-steroidal anti-inflammatory drug, diclofenac (Df), were previously shown to counteract a pro-inflammatory response of human macrophages. Here, the effect of intradiscal injection of Df-NPs in degenerated IVD was evaluated. For that, Df-NPs were injected in a bovine IVD organ culture in pro-inflammatory/degenerative conditions, upon stimulation with needle-puncture and interleukin (IL)-1β. Df-NPs were internalized by IVD cells, down-regulating IL-6, IL-8, MMP1 and MMP3, and decreasing PGE2 production, compared with IL-1β-stimulated IVD punches. Interestingly, at the same time, Df-NPs promoted an up-regulation of extracellular matrix (ECM) proteins, namely collagen type II and aggrecan. Allover, this study suggests that IVD treatment with Df-NPs not only reduces inflammation, but also delays and/or decreases ECM degradation, opening perspectives to new intradiscal therapies for IVD degeneration, based on the modulation of inflammation. Degeneration of the IVD is an age-related progressive process considered to be the major cause of spine disorders. The pro-inflammatory environment and biomechanics of the degenerated IVD is a challenge for regenerative therapies. The novelty of this work is the intradiscal injection of an anti-inflammatory therapy based on Chitosan (Ch)/Poly-(γ-glutamic acid) (γ-PGA) nanoparticles (NPs) with an anti-inflammatory drug (diclofenac, Df), previously developed by us. This drug delivery system was tested in a pro-inflammatory/degenerative intervertebral disc ex vivo model. The main findings support the success of an anti
Rastogi, Neelesh; Smith, R Theodore
2016-01-01
Age-related macular degeneration is the leading cause of adult blindness in the developed world. Thus, major endeavors to understand the risk factors and pathogenesis of this disease have been undertaken. Reticular macular disease is a proposed subtype of age-related macular degeneration correlating histologically with subretinal drusenoid deposits located between the retinal pigment epithelium and the inner segment ellipsoid zone. Reticular lesions are more prevalent in females and in older age groups and are associated with a higher mortality rate. Risk factors for developing age-related macular degeneration include hypertension, smoking, and angina. Several genes related to increased risk for age-related macular degeneration and reticular macular disease are also associated with cardiovascular disease. Better understanding of the clinical and genetic risk factors for age-related macular degeneration and reticular macular disease has led to the hypothesis that these eye diseases are systemic. A systemic origin may help to explain why reticular disease is diagnosed more frequently in females as males suffer cardiovascular mortality at an earlier age, before the age of diagnosis of reticular macular disease and age-related macular degeneration. Copyright © 2015 Elsevier Inc. All rights reserved.
Kwon, Hyuk-Sang; Yang, Eun-Hee; Yeon, Seung-Woo; Kang, Byoung-Hwa; Kim, Tae-Yong
2004-10-15
This study aimed to develop a novel multiplex polymerase chain reaction (PCR) primer set for the identification of seven probiotic Lactobacillus species such as Lactobacillus acidophilus, Lactobacillus delbrueckii, Lactobacillus casei, Lactobacillus gasseri, Lactobacillus plantarum, Lactobacillus reuteri and Lactobacillus rhamnosus. The primer set, comprising of seven specific and two conserved primers, was derived from the integrated sequences of 16S and 23S rRNA genes and their rRNA intergenic spacer region of each species. It was able to identify the seven target species with 93.6% accuracy, which exceeds that of the general biochemical methods. The phylogenetic analyses, using 16S rDNA sequences of the probiotic isolates, also provided further support that the results from the multiplex PCR assay were trustworthy. Taken together, we suggest that the multiplex primer set is an efficient tool for simple, rapid and reliable identification of seven Lactobacillus species.
Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen
2015-09-01
Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.
Family-specific vs. universal PCR primers for the study of mitochondrial DNA in plants
Directory of Open Access Journals (Sweden)
Aleksić Jelena M.
2016-01-01
Full Text Available Mitochondrial genomes (mtDNAs or mitogenomes of seed plants are characterized by a notoriously unstable organization on account of which available so-called universal or consensus primers may fail to fulfil their foreseen function - amplification of various mtDNA regions in a broad range of plant taxa. Thus, the primers developed for groups assumed to have similar organization of their mitogenomes, such as families, may facilitate a broader usage of more variable non-coding portions of these genomes in group members. Using in silico PCR method and six available complete mitogenomes of Fabaceae, it has been demonstrated that only three out of 36 published universal primer and three Medicago sativa-specific primer pairs that amplify various mtDNA regions are suitable for six representatives of the Fabaceae family upon minor modifications, and develop 21 Fabaceae-specific primer pairs for amplification of all 14 cis-splicing introns in genes of NADH subunits (nad genes which represent the most commonly used non-coding mtDNA regions in various studies in plants. Using the same method and six available complete mitogenomes of representatives of related families Cucurbitaceae, Euphorbiaceae and Rosaceae and a model plant, Arabidopsis thaliana, it has further been demonstrated that applicability of newly developed primer pairs for amplification of nad introns in more or less related taxa was dependent not only on species evolutionary distances but also on their genome sizes. A reported set of 24 primer pairs is a valuable resource which may facilitate a broader usage of mtDNA variability in future studies at both intra- and inter-specific levels in Fabaceae, which is the third largest family of flowering plants rarely studied at the mtDNA level, and in other more or less related taxa. [Projekat Ministarstva nauke Republike Srbije, br. 173005
Energy Technology Data Exchange (ETDEWEB)
Ata-ur-Rahman,; Qamar, A. [Institute of Physics and Electronics, University of Peshawar, Peshawar 25000 (Pakistan); National Centre for Physics, QAU Campus, Shahdrah Valley Road, Islamabad 44000 (Pakistan); Masood, W. [National Centre for Physics, QAU Campus, Shahdrah Valley Road, Islamabad 44000 (Pakistan); COMSATS, Institute of Information Technology, Park Road, Chak Shahzad, Islamabad 44000 (Pakistan); Eliasson, B. [Physics Department, University of Strathclyde, Glasgow G4 0NG, Scotland (United Kingdom)
2013-09-15
In this paper, small but finite amplitude electrostatic solitary waves in a relativistic degenerate magnetoplasma, consisting of relativistically degenerate electrons and non-degenerate cold ions, are investigated. The Zakharov-Kuznetsov equation is derived employing the reductive perturbation technique and its solitary wave solution is analyzed. It is shown that only compressive electrostatic solitary structures can propagate in such a degenerate plasma system. The effects of plasma number density, ion cyclotron frequency, and direction cosines on the profiles of ion acoustic solitary waves are investigated and discussed at length. The relevance of the present investigation vis-a-vis pulsating white dwarfs is also pointed out.
D'Alessandro, Oriana; Selmi, Gonzalo J.; Deyá, Cecilia; Di Sarli, Alejandro; Romagnoli, Roberto
2018-02-01
Tannins are polyphenols synthesized by plants and useful for the coating industry as corrosion inhibitors. In addition, lanthanum salts have a great inhibitory effect on steel corrosion. The aim of this study was to obtain lanthanum "tannate" with adequate solubility to be incorporated as the corrosion inhibitor in a wash-primer. The "tannate" was obtained from commercial "Quebracho" tannin and 0.1 M La(NO3)3. The soluble tannin was determined by the Folin-Denis reagent, while the concentration of Lanthanum was obtained by a gravimetric procedure. The protective action of "tannate" on SAE 1010 steel was evaluated by linear polarization curves and corrosion potential measurements. Lanthanum "tannate" was incorporated in a wash-primer formulation and tested by corrosion potential and ionic resistance measurements. The corrosion rate was also determined by the polarization resistance technique. Besides, the primer was incorporated in an alkyd paint system and its anticorrosion performance assessed in the salt spray cabinet and by electrochemical impedance spectroscopy. Results showed that lanthanum "tannate" primer inhibits the development of deleterious iron oxyhydroxides on the steel substrate and incorporated into a paint system had a similar behavior to the primer formulated with zinc tetroxychromate.
Is Preexisting Cervical Disk Degeneration a Prognostic Factor in Whiplash-associated Disorders?
Chung, Nam-Su; Jeon, Chang-Hoon; Lee, Yu-Sang; Park, Jang-Ho; Lee, Han-Dong
2017-11-01
This is a retrospective control study. We aimed to determine whether preexisting cervical disk degeneration is a prognostic factor in Whiplash-associated disorder (WAD). WAD is a common injury of traffic accident and has a broad range of prognoses. Although numerous studies have investigated prognostic factors in WAD, few have evaluated the effect of preexisting disk degeneration. This study involved 45 consecutive patients with grade I or II WAD having advanced disk degeneration (at least 1 disk of Miyazaki grade≥III on magnetic resonance imaging) and a control cohort of 52 patients with no or mild disk degeneration (all disks having Miyazaki grades≤II). Clinical assessment included pain severity (assessed by the visual analog scale), neck pain-related disability (assessed by the neck disability index), and physical and mental health condition [assessed by the short-form 36 (SF-36) physical composite score and SF-36 mental composite score, respectively]. Changes in each parameter were evaluated at baseline and at 3-month, 6-month, and 1-year follow-ups and compared between the 2 groups. There were no differences between the 2 groups regarding demographics and baseline outcome parameters (all P>0.05). There were also no differences in improvement in visual analog scale for neck pain, neck disability index, SF-36 physical composite score, or SF-36 mental composite score between the 2 groups (all P>0.05) for each visit. The number of claim closures was significantly lower among patients with advanced degeneration than among controls at 6-month and 1-year follow-ups (P=0.004 and 0.006, respectively). In the present study, the clinical presentation and prognosis of WAD were not affected by preexisting disk degeneration. However, claim closure was delayed in patients with preexisting disk degeneration. These results suggest that misunderstanding of disk degeneration on magnetic resonance imaging may create persistent illness and lead to continued compensation in WAD.
HUMAN CAPSULE EPITHELIAL-CELL DEGENERATION A LM, SEM AND TEM INVESTIGATION
JONGEBLOED, WL; KALICHARAN, D; WORST, JGF
1993-01-01
The degeneration of the capsule epithelium of cataractous lenses has been studied with LM, SEM on TEM with emphases on TEM. The observed degeneration of the epithelial cells can be described as follows: The cell nucleus becomes picnotic and desintegrates as result of change of the chromatin.
Phonon emission in a degenerate semiconductor at low lattice temperatures
International Nuclear Information System (INIS)
Midday, S.; Nag, S.; Bhattacharya, D.P.
2015-01-01
The characteristics of phonon growth in a degenerate semiconductor at low lattice temperatures have been studied for inelastic interaction of non-equilibrium electrons with the intravalley acoustic phonons. The energy of the phonon and the full form of the phonon distribution are taken into account. The results reveal significant changes in the growth characteristics compared to the same for a non-degenerate material
New approaches and potential treatments for dry age-related macular degeneration
Directory of Open Access Journals (Sweden)
Francisco Max Damico
2012-02-01
Full Text Available Emerging treatments for dry age-related macular degeneration (AMD and geographi c atrophy focus on two strategies that target components involved in physiopathological pathways: prevention of photoreceptors and retinal pigment epithelium loss (neuroprotection induction, oxidative damage prevention, and visual cycle modification and suppression of inflammation. Neuroprotective drugs, such as ciliary neurotrophic factor, brimonidine tartrate, tandospirone, and anti-amyloid β antibodies, aim to prevent apoptosis of retinal cells. Oxidative stress and depletion of essential micronutrients are targeted by the Age-Related Eye Disease Study (AREDS formulation. Visual cycle modulators reduce the activity of the photoreceptors and retinal accumulation of toxic fluorophores and lipofuscin. Eyes with dry age-related macular degeneration present chronic inflammation and potential treatments include corticosteroid and complement inhibition. We review the current concepts and rationale of dry age-related macular degeneration treatment that will most likely include a combination of drugs targeting different pathways involved in the development and progression of age-related macular degeneration.
Removal of PCR error products and unincorporated primers by metal-chelate affinity chromatography.
Directory of Open Access Journals (Sweden)
Indhu Kanakaraj
Full Text Available Immobilized Metal Affinity Chromatography (IMAC has been used for decades to purify proteins on the basis of amino acid content, especially surface-exposed histidines and "histidine tags" genetically added to recombinant proteins. We and others have extended the use of IMAC to purification of nucleic acids via interactions with the nucleotide bases, especially purines, of single-stranded RNA and DNA. We also have demonstrated the purification of plasmid DNA from contaminating genomic DNA by IMAC capture of selectively-denatured genomic DNA. Here we describe an efficient method of purifying PCR products by specifically removing error products, excess primers, and unincorporated dNTPs from PCR product mixtures using flow-through metal-chelate affinity adsorption. By flowing a PCR product mixture through a Cu(2+-iminodiacetic acid (IDA agarose spin column, 94-99% of the dNTPs and nearly all the primers can be removed. Many of the error products commonly formed by Taq polymerase also are removed. Sequencing of the IMAC-processed PCR product gave base-calling accuracy comparable to that obtained with a commercial PCR product purification method. The results show that IMAC matrices (specifically Cu(2+-IDA agarose can be used for the purification of PCR products. Due to the generality of the base-specific mechanism of adsorption, IMAC matrices may also be used in the purification of oligonucleotides, cDNA, mRNA and micro RNAs.
Natural history of seminiferous tubule degeneration in Klinefelter syndrome
DEFF Research Database (Denmark)
Aksglaede, Lise; Wikström, Anne M; Rajpert-De Meyts, Ewa
2006-01-01
Klinefelter syndrome (47,XXY) is characterized by small, firm testis, gynaecomastia, azoospermia and hypergonadotropic hypogonadism. Degeneration of the seminiferous tubules in 47,XXY males is a well-described phenomenon. It begins in the fetus, progresses through infancy and accelerates dramatic......Klinefelter syndrome (47,XXY) is characterized by small, firm testis, gynaecomastia, azoospermia and hypergonadotropic hypogonadism. Degeneration of the seminiferous tubules in 47,XXY males is a well-described phenomenon. It begins in the fetus, progresses through infancy and accelerates...
Factors related to the effect of radiation treatment for age-related macular degeneration
International Nuclear Information System (INIS)
Mandai, Michiko; Takahashi, Masayo; Matsumura, Miyo; Sasai, Keisuke; Honda, Yoshihito; Ogura, Yuichiro
2000-01-01
We treated 31 eyes of 30 patients with age-related macular degeneration by 10 sessions of radiation totalling 20 Gy. One year after treatment, 21 eyes (68%) showed improvement in the score of fundus lesions based on funduscopic and fluorescein angiographic findings. The visual acuity, expressed as LogMAR, improved in 20% and remained stationary in 50% of eyes. Improvement in visual acuity was significantly better in eyes with greater amount of exudate before treatment (p<0.01). Posttreatment visual acuity was correlated neither with the amount of subretinal fluid, presence of retinal hemorrhage, the size of subfoveal vascular membrane, nor its type as classified into classic, mainly occult or occult type. Above findings show that radiation is more effective in eyes of age-related macular degeneration with massive exudate. (author)
Factors related to the effect of radiation treatment for age-related macular degeneration
Energy Technology Data Exchange (ETDEWEB)
Mandai, Michiko; Takahashi, Masayo; Matsumura, Miyo; Sasai, Keisuke; Honda, Yoshihito [Kyoto Univ. (Japan). Graduate School of Medicine; Ogura, Yuichiro
2000-04-01
We treated 31 eyes of 30 patients with age-related macular degeneration by 10 sessions of radiation totalling 20 Gy. One year after treatment, 21 eyes (68%) showed improvement in the score of fundus lesions based on funduscopic and fluorescein angiographic findings. The visual acuity, expressed as LogMAR, improved in 20% and remained stationary in 50% of eyes. Improvement in visual acuity was significantly better in eyes with greater amount of exudate before treatment (p<0.01). Posttreatment visual acuity was correlated neither with the amount of subretinal fluid, presence of retinal hemorrhage, the size of subfoveal vascular membrane, nor its type as classified into classic, mainly occult or occult type. Above findings show that radiation is more effective in eyes of age-related macular degeneration with massive exudate. (author)
Theriot, Corey A; Hegde, Muralidhar L; Hazra, Tapas K; Mitra, Sankar
2010-06-04
The human DNA glycosylase NEIL1, activated during the S-phase, has been shown to excise oxidized base lesions in single-strand DNA substrates. Furthermore, our previous work demonstrating functional interaction of NEIL1 with PCNA and flap endonuclease 1 (FEN1) suggested its involvement in replication-associated repair. Here we show interaction of NEIL1 with replication protein A (RPA), the heterotrimeric single-strand DNA binding protein that is essential for replication and other DNA transactions. The NEIL1 immunocomplex isolated from human cells contains RPA, and its abundance in the complex increases after exposure to oxidative stress. NEIL1 directly interacts with the large subunit of RPA (K(d) approximately 20 nM) via the common interacting interface (residues 312-349) in NEIL1's disordered C-terminal region. RPA inhibits the base excision activity of both wild-type NEIL1 (389 residues) and its C-terminal deletion CDelta78 mutant (lacking the interaction domain) for repairing 5-hydroxyuracil (5-OHU) in a primer-template structure mimicking the DNA replication fork. This inhibition is reduced when the damage is located near the primer-template junction. Contrarily, RPA moderately stimulates wild-type NEIL1 but not the CDelta78 mutant when 5-OHU is located within the duplex region. While NEIL1 is inhibited by both RPA and Escherichia coli single-strand DNA binding protein, only inhibition by RPA is relieved by PCNA. These results showing modulation of NEIL1's activity on single-stranded DNA substrate by RPA and PCNA support NEIL1's involvement in repairing the replicating genome. Copyright 2010 Elsevier B.V. All rights reserved.
Simple sequence repeat technology based on expressed sequence tag (EST-SSR) is a useful genomic tool for genome mapping, characterizing plant species relationships, elucidating genome evolution, and tracing genes on alien chromosome segments. EST-SSR primers developed from three perennial diploid T...
Applied Ecosystem Analysis - - a Primer : EDT the Ecosystem Diagnosis and Treatment Method.
Energy Technology Data Exchange (ETDEWEB)
Lestelle, Lawrence C.; Mobrand, Lars E.
1996-05-01
The aim of this document is to inform and instruct the reader about an approach to ecosystem management that is based upon salmon as an indicator species. It is intended to provide natural resource management professionals with the background information needed to answer questions about why and how to apply the approach. The methods and tools the authors describe are continually updated and refined, so this primer should be treated as a first iteration of a sequentially revised manual.
Directory of Open Access Journals (Sweden)
Jonathan M. LaMantia
2018-04-01
Full Text Available Interspecific hybridization has been attempted to combine the heat and drought of Poa arachnifera Torr. with the turf quality characteristics of several Poa species. Confirmation of an F1 hybrid through morphological analysis of vegetative and flowering characteristics is often time consuming and ambiguous. Ent-kaurene oxidase (KO has been sequenced in rice, barley, and wheat. In rice, each of the five copies of KO gene has unique lengths for the first intron. Conserved intron spanning primers (CISP can be used as a DNA marker to exploit variations of intron lengths that flank conserved gene sequences. In the present study, we developed CISP to sequence partial genomic fragments of the KO gene from seven Poa species. Through sequence analysis, species-specific primers were also developed to produce co-dominant markers that can be used to identify interspecific hybrids between Texas bluegrass and six other Poa species used in the present study.
International Nuclear Information System (INIS)
Ahn, Tae-Joon; Lee, Sang-Ho; Choi, Gun; Ahn, Yong; Liu, Wei-Chiang; Kim, Ho-Jin; Lee, Ho-Yeon
2009-01-01
Magnetic resonance (MR) imaging with axial loading can simulate the physiological standing state and disclose spinal stenosis undetected or underestimated in the conventional position. Intervertebral disk degeneration may be an important factor in spinal stenosis. This study investigated whether intervertebral disk degeneration increases spinal stenosis during axial loading. MR imaging with and without axial loading was obtained in 51 patients with neurogenic intermittent claudication and/or sciatica and reviewed retrospectively. The grade of disk degeneration was rated in four disk spaces from L2-3 to L5-S1. The dural sac cross-sectional area (DCSA) was measured on MR images taken in both conventional and axial loading positions, and the change in the DCSA was calculated. The effect of disk degeneration on the DCSA was statistically analyzed. Significant decreases in the DCSA occurred with grade 4 disk degeneration (mean±standard deviation, 20.1±14.1 mm 2 ), followed by grade 3 (18.3±15.1 mm 2 ) and grade 2 (8.9±13.1 mm 2 ). DCSA decreased considerably with increased severity of disk degeneration with axial loading, except for grade 5 disk degeneration. More accurate diagnosis of stenosis can be achieved using MR imaging with axial loading, especially if grade 2 to 4 disk degeneration is present. (author)
Quantitative genetic analysis of retinal degeneration in the blind cavefish Astyanax mexicanus.
Directory of Open Access Journals (Sweden)
Kelly E O'Quin
Full Text Available The retina is the light-sensitive tissue of the eye that facilitates vision. Mutations within genes affecting eye development and retinal function cause a host of degenerative visual diseases, including retinitis pigmentosa and anophthalmia/microphthalmia. The characin fish Astyanax mexicanus includes both eyed (surface fish and eyeless (cavefish morphs that initially develop eyes with normal retina; however, early in development, the eyes of cavefish degenerate. Since both surface and cave morphs are members of the same species, they serve as excellent evolutionary mutant models with which to identify genes causing retinal degeneration. In this study, we crossed the eyed and eyeless forms of A. mexicanus and quantified the thickness of individual retinal layers among 115 F(2 hybrid progeny. We used next generation sequencing (RAD-seq and microsatellite mapping to construct a dense genetic map of the Astyanax genome, scan for quantitative trait loci (QTL affecting retinal thickness, and identify candidate genes within these QTL regions. The map we constructed for Astyanax includes nearly 700 markers assembled into 25 linkage groups. Based on our scans with this map, we identified four QTL, one each associated with the thickness of the ganglion, inner nuclear, outer plexiform, and outer nuclear layers of the retina. For all but one QTL, cavefish alleles resulted in a clear reduction in the thickness of the affected layer. Comparative mapping of genetic markers within each QTL revealed that each QTL corresponds to an approximately 35 Mb region of the zebrafish genome. Within each region, we identified several candidate genes associated with the function of each affected retinal layer. Our study is the first to examine Astyanax retinal degeneration in the context of QTL mapping. The regions we identify serve as a starting point for future studies on the genetics of retinal degeneration and eye disease using the evolutionary mutant model Astyanax.
Analysis of the RPE sheet in the rd10 retinal degeneration model
Energy Technology Data Exchange (ETDEWEB)
Jiang, Yi [Los Alamos National Laboratory
2011-01-04
The normal RPE sheet in the C57Bl/6J mouse is subclassified into two major tiling patterns: A regular generally hexagonal array covering most of the surface and a 'soft network' near the ciliary body made of irregularly shaped cells. Physics models predict these two patterns based on contractility and elasticity of the RPE cell, and strength of cellular adhesion between cells. We hypothesized and identified major changes in RPE regular hexagonal tiling pattern in rdl0 compared to C57BL/6J mice. RPE sheet damage was extensive but occurred in rd10 later than expected, after most retinal degeneration. RPE sheet changes occur in zones with a bullseye pattern. In the posterior zone around the optic nerve RPE cells take on larger irregular and varied shapes to form an intact monolayer. In mid periphery, there is a higher than normal density of cells that progress into involuted layers of RPE under the retina. The periphery remains mostly normal until late stages of degeneration. The number of neighboring cells varies widely depending on zone and progression. RPE morphology continues to deteriorate long after the photoreceptors have degenerated. The RPE cells are bystanders to the rd10 degeneration within photo receptors, and the collateral damage to the RPE sheet resembles stimulation of migration or chemotaxis. Quantitative measures of the tiling patterns and histopathology detected here, scripted in a pipeline written in Perl and Cell Profiler (an open source Matlab plugin), are directly applicable to RPE sheet images from noninvasive fundus autofluorescence (FAF), adaptive optics confocal scanning laser ophthalmoscope (AO-cSLO), and spectral domain optical coherence tomography (SD-OCT) of patients with early stage AMD or RP.
Three Studies Point to Same Risk Gene for Age-Related Macular Degeneration
... point to same risk gene for age-related macular degeneration NIH-funded research helps unravel the biology of ... rare, but powerful risk factor for age-related macular degeneration (AMD), a common cause of vision loss in ...
Molecular pharmacodynamics of emixustat in protection against retinal degeneration.
Zhang, Jianye; Kiser, Philip D; Badiee, Mohsen; Palczewska, Grazyna; Dong, Zhiqian; Golczak, Marcin; Tochtrop, Gregory P; Palczewski, Krzysztof
2015-07-01
Emixustat is a visual cycle modulator that has entered clinical trials as a treatment for age-related macular degeneration (AMD). This molecule has been proposed to inhibit the visual cycle isomerase RPE65, thereby slowing regeneration of 11-cis-retinal and reducing production of retinaldehyde condensation byproducts that may be involved in AMD pathology. Previously, we reported that all-trans-retinal (atRAL) is directly cytotoxic and that certain primary amine compounds that transiently sequester atRAL via Schiff base formation ameliorate retinal degeneration. Here, we have shown that emixustat stereoselectively inhibits RPE65 by direct active site binding. However, we detected the presence of emixustat-atRAL Schiff base conjugates, indicating that emixustat also acts as a retinal scavenger, which may contribute to its therapeutic effects. Using agents that lack either RPE65 inhibitory activity or the capacity to sequester atRAL, we assessed the relative importance of these 2 modes of action in protection against retinal phototoxicity in mice. The atRAL sequestrant QEA-B-001-NH2 conferred protection against phototoxicity without inhibiting RPE65, whereas an emixustat derivative incapable of atRAL sequestration was minimally protective, despite direct inhibition of RPE65. These data indicate that atRAL sequestration is an essential mechanism underlying the protective effects of emixustat and related compounds against retinal phototoxicity. Moreover, atRAL sequestration should be considered in the design of next-generation visual cycle modulators.
Hogg, Ruth E; Woodside, Jayne V; McGrath, Alanna; Young, Ian S; Vioque, Jesus L; Chakravarthy, Usha; de Jong, Paulus T; Rahu, Mati; Seland, Johan; Soubrane, Gisele; Tomazzoli, Laura; Topouzis, Fotis; Fletcher, Astrid E
2017-01-01
PURPOSE: To examine associations between adherence to a Mediterranean diet and prevalence of age-related macular degeneration (AMD) in countries ranging from Southern to Northern Europe. DESIGN: Cross-sectional, population-based epidemiologic study. PARTICIPANTS: Of 5060 randomly sampled people aged
The study of a Mg-rich epoxy primer for protection of AZ91D magnesium alloy
Energy Technology Data Exchange (ETDEWEB)
Lu Xiangyu [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China); Zuo Yu, E-mail: zuoy@mail.buct.edu.c [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China); Zhao Xuhui; Tang Yuming; Feng Xingguo [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China)
2011-01-15
Research highlights: {yields} A Mg-rich epoxy primer was prepared by adding pure magnesium particles in epoxy coating. Cross scratch testing results showed that in 3% NaCl solution the Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. {yields} The open circuit potential of AZ91D alloy in NaCl solution decreased after coated with Mg-rich coating, suggesting that cathodic protection effect of the Mg-rich coating on AZ91D alloy was present. {yields} EIS studies showed that during the immersion tests of AZ91D alloy with Mg-rich coating the magnesium particles in coating dissolved with the charge-transfer resistance R{sub ct} at the magnesium particle/coating interface decreased and the double-layer capacitance Q{sub dl} increased. While the coating resistance remained stable for a long time and corrosion of the AZ91D alloy substrate was obviously delayed. - Abstract: A Mg-rich epoxy primer was prepared by adding pure magnesium particles to an epoxy coating. The coating properties were studied with electrochemical impedance spectroscopy (EIS), scanning electronic microscopy (SEM) and X-ray diffraction (XRD). The Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. The open circuit potential measurements showed cathodic protection effect of the Mg-rich primer on AZ91D alloy. Cross scratch testing showed that the Mg-rich primer provided better protection for the substrate than original epoxy coating. The precipitation of Mg(OH){sub 2} in the coating also provided some degree of barrier protection.
The study of a Mg-rich epoxy primer for protection of AZ91D magnesium alloy
International Nuclear Information System (INIS)
Lu Xiangyu; Zuo Yu; Zhao Xuhui; Tang Yuming; Feng Xingguo
2011-01-01
Research highlights: → A Mg-rich epoxy primer was prepared by adding pure magnesium particles in epoxy coating. Cross scratch testing results showed that in 3% NaCl solution the Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. → The open circuit potential of AZ91D alloy in NaCl solution decreased after coated with Mg-rich coating, suggesting that cathodic protection effect of the Mg-rich coating on AZ91D alloy was present. → EIS studies showed that during the immersion tests of AZ91D alloy with Mg-rich coating the magnesium particles in coating dissolved with the charge-transfer resistance R ct at the magnesium particle/coating interface decreased and the double-layer capacitance Q dl increased. While the coating resistance remained stable for a long time and corrosion of the AZ91D alloy substrate was obviously delayed. - Abstract: A Mg-rich epoxy primer was prepared by adding pure magnesium particles to an epoxy coating. The coating properties were studied with electrochemical impedance spectroscopy (EIS), scanning electronic microscopy (SEM) and X-ray diffraction (XRD). The Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. The open circuit potential measurements showed cathodic protection effect of the Mg-rich primer on AZ91D alloy. Cross scratch testing showed that the Mg-rich primer provided better protection for the substrate than original epoxy coating. The precipitation of Mg(OH) 2 in the coating also provided some degree of barrier protection.
Experimental model of intervertebral disc degeneration by needle puncture in Wistar rats
International Nuclear Information System (INIS)
Issy, A.C.; Castania, V.; Castania, M.; Salmon, C.E.G.; Nogueira-Barbosa, M.H.; Bel, E. Del; Defino, H.L.A.
2013-01-01
Animal models of intervertebral disc degeneration play an important role in clarifying the physiopathological mechanisms and testing novel therapeutic strategies. The objective of the present study is to describe a simple animal model of disc degeneration involving Wistar rats to be used for research studies. Disc degeneration was confirmed and classified by radiography, magnetic resonance and histological evaluation. Adult male Wistar rats were anesthetized and submitted to percutaneous disc puncture with a 20-gauge needle on levels 6-7 and 8-9 of the coccygeal vertebrae. The needle was inserted into the discs guided by fluoroscopy and its tip was positioned crossing the nucleus pulposus up to the contralateral annulus fibrosus, rotated 360° twice, and held for 30 s. To grade the severity of intervertebral disc degeneration, we measured the intervertebral disc height from radiographic images 7 and 30 days after the injury, and the signal intensity T2-weighted magnetic resonance imaging. Histological analysis was performed with hematoxylin-eosin and collagen fiber orientation using picrosirius red staining and polarized light microscopy. Imaging and histological score analyses revealed significant disc degeneration both 7 and 30 days after the lesion, without deaths or systemic complications. Interobserver histological evaluation showed significant agreement. There was a significant positive correlation between histological score and intervertebral disc height 7 and 30 days after the lesion. We conclude that the tail disc puncture method using Wistar rats is a simple, cost-effective and reproducible model for inducing disc degeneration
Experimental model of intervertebral disc degeneration by needle puncture in Wistar rats
Energy Technology Data Exchange (ETDEWEB)
Issy, A.C.; Castania, V.; Castania, M. [Departamento de Morfologia, Fisiologia e Patologia Básica, Faculdade de Odontologia de Ribeirão Preto, Universidade de São Paulo, Ribeirão Preto, SP (Brazil); Salmon, C.E.G. [Departamento de Física, Faculdade de Filosofia, Ciências e Letras de Ribeirão Preto, Universidade de São Paulo, Ribeirão Preto, SP (Brazil); Nogueira-Barbosa, M.H. [Divisão de Radiologia, Departamento de Clínica Médica, Faculdade de Medicina de Ribeirão Preto, Universidade de São Paulo, Ribeirão Preto, SP (Brazil); Bel, E. Del [Departamento de Morfologia, Fisiologia e Patologia Básica, Faculdade de Odontologia de Ribeirão Preto, Universidade de São Paulo, Ribeirão Preto, SP (Brazil); Defino, H.L.A. [Departamento de Biomecânica, Medicina e Reabilitação do Sistema Locomotor, Faculdade de Medicina de Ribeirão Preto, Universidade de São Paulo, Ribeirão Preto, SP (Brazil)
2013-03-15
Animal models of intervertebral disc degeneration play an important role in clarifying the physiopathological mechanisms and testing novel therapeutic strategies. The objective of the present study is to describe a simple animal model of disc degeneration involving Wistar rats to be used for research studies. Disc degeneration was confirmed and classified by radiography, magnetic resonance and histological evaluation. Adult male Wistar rats were anesthetized and submitted to percutaneous disc puncture with a 20-gauge needle on levels 6-7 and 8-9 of the coccygeal vertebrae. The needle was inserted into the discs guided by fluoroscopy and its tip was positioned crossing the nucleus pulposus up to the contralateral annulus fibrosus, rotated 360° twice, and held for 30 s. To grade the severity of intervertebral disc degeneration, we measured the intervertebral disc height from radiographic images 7 and 30 days after the injury, and the signal intensity T2-weighted magnetic resonance imaging. Histological analysis was performed with hematoxylin-eosin and collagen fiber orientation using picrosirius red staining and polarized light microscopy. Imaging and histological score analyses revealed significant disc degeneration both 7 and 30 days after the lesion, without deaths or systemic complications. Interobserver histological evaluation showed significant agreement. There was a significant positive correlation between histological score and intervertebral disc height 7 and 30 days after the lesion. We conclude that the tail disc puncture method using Wistar rats is a simple, cost-effective and reproducible model for inducing disc degeneration.
Directory of Open Access Journals (Sweden)
Bryant L
2017-12-01
Full Text Available Laura Bryant,1 Olga Lozynska,1 Albert M Maguire,1–3 Tomas S Aleman,1–3 Jean Bennett1–3 1Center for Advanced Retinal and Ocular Therapeutics (CAROT, FM Kirby Center for Molecular Ophthalmology, Scheie Eye Institute, Perelman School of Medicine, University of Pennsylvania, Philadelphia, PA, USA; 2Department of Ophthalmology, The Children’s Hospital of Philadelphia, Philadelphia, PA, USA; 3Department of Ophthalmology, Scheie Eye Institute, Perelman School of Medicine, University of Pennsylvania, Philadelphia, PA, USA Background: Accurate clinical diagnosis and prognosis of retinal degeneration can be aided by the identification of the disease-causing genetic variant. It can confirm the clinical diagnosis as well as inform the clinician of the risk for potential involvement of other organs such as kidneys. It also aids in genetic counseling for affected individuals who want to have a child. Finally, knowledge of disease-causing variants informs laboratory investigators involved in translational research. With the advent of next-generation sequencing, identifying pathogenic mutations is becoming easier, especially the identification of novel pathogenic variants.Methods: We used whole exome sequencing on a cohort of 69 patients with various forms of retinal degeneration and in whom screens for previously identified disease-causing variants had been inconclusive. All potential pathogenic variants were verified by Sanger sequencing and, when possible, segregation analysis of immediate relatives. Potential variants were identified by using a semi-masked approach in which rare variants in candidate genes were identified without knowledge of the clinical diagnosis (beyond “retinal degeneration” or inheritance pattern. After the initial list of genes was prioritized, genetic diagnosis and inheritance pattern were taken into account.Results: We identified the likely pathogenic variants in 64% of the subjects. Seven percent had a single
Directory of Open Access Journals (Sweden)
David L Nordstrom
2012-06-01
Full Text Available The aim of this paper is to introduce novice researchers to surveys as a method of data collection. It starts with the definition of a survey, its major purposes and types as well as changes in the goals surveys have helped to achieve over time. Advantages and disadvantages of surveys over population censuses and medical examinations are discussed. Approaches to questionnaire construction are introduced along with properties that questionnaires are evaluated for. Modes of administration, sample size issues, and data analysis approaches are also introduced. The primer is illustrated with examples of surveys conducted in different countries with various public health purposes.
Glial degeneration with oxidative damage drives neuronal demise in MPSII disease.
Zalfa, Cristina; Verpelli, Chiara; D'Avanzo, Francesca; Tomanin, Rosella; Vicidomini, Cinzia; Cajola, Laura; Manara, Renzo; Sala, Carlo; Scarpa, Maurizio; Vescovi, Angelo Luigi; De Filippis, Lidia
2016-08-11
Mucopolysaccharidosis type II (MPSII) is a lysosomal storage disorder due to the deficit of the iduronate 2-sulfatase (IDS) enzyme, causing progressive neurodegeneration in patients. Neural stem cells (NSCs) derived from the IDS-ko mouse can recapitulate MPSII pathogenesis in vitro. In differentiating IDS-ko NSCs and in the aging IDS-ko mouse brain, glial degeneration precedes neuronal degeneration. Here we show that pure IDS-ko NSC-derived astrocytes are selectively able to drive neuronal degeneration when cocultured with healthy neurons. This phenotype suggests concurrent oxidative damage with metabolic dysfunction. Similar patterns were observed in murine IDS-ko animals and in human MPSII brains. Most importantly, the mutant phenotype of IDS-ko astrocytes was reversed by low oxygen conditions and treatment with vitamin E, which also reversed the toxic effect on cocultured neurons. Moreover, at very early stages of disease we detected in vivo the development of a neuroinflammatory background that precedes astroglial degeneration, thus suggesting a novel model of MPSII pathogenesis, with neuroinflammation preceding glial degeneration, which is finally followed by neuronal death. This hypothesis is also consistent with the progression of white matter abnormalities in MPSII patients. Our study represents a novel breakthrough in the elucidation of MPSII brain pathogenesis and suggests the antioxidant molecules as potential therapeutic tools to delay MPSII onset and progression.
Automated design of degenerate codon libraries.
Mena, Marco A; Daugherty, Patrick S
2005-12-01
Degenerate codon libraries are frequently used in protein engineering and evolution studies but are often limited to targeting a small number of positions to adequately limit the search space. To mitigate this, codon degeneracy can be limited using heuristics or previous knowledge of the targeted positions. To automate design of libraries given a set of amino acid sequences, an algorithm (LibDesign) was developed that generates a set of possible degenerate codon libraries, their resulting size, and their score relative to a user-defined scoring function. A gene library of a specified size can then be constructed that is representative of the given amino acid distribution or that includes specific sequences or combinations thereof. LibDesign provides a new tool for automated design of high-quality protein libraries that more effectively harness existing sequence-structure information derived from multiple sequence alignment or computational protein design data.
Directory of Open Access Journals (Sweden)
Diana Sari
2015-05-01
Full Text Available AbstrakDismenore primer merupakan nyeri menstruasi yang dijumpai tanpa kelainan yang nyata pada alat-alat genital. Lebih dari 50% wanita mengalami dismenore primer dan 15% diantaranya mengalami nyeri yang hebat.Tujuan penelitian ini adalah untuk menentukan hubungan tingkat stres dengan derajat dismenore primer. Penelitian dilakukan pada mahasiswi pendidikan dokter Fakultas Kedokteran Universitas Andalas angkatan 2009 dan 2010. Desain penelitian ini menggunakan cross sectional study dengan jumlah subjek 165 orang. Pengumpulan data dari responden dilakukan dengan wawancara terpimpin (pengisian kuesioner. Analisa statistik yang digunakan adalah uji chi-square dan uji koefisien korelasi sederhana. Uji chi-square menunjukan ada hubungan yang bermakna antara stres dengan kejadian dismenore primer dan uji statistik koefisien korelasi sederhana menunjukkan ada hubungan yang bermakna dengan korelasi agak lemah antara tingkat stres dengan derajat dismenore primer.Kata kunci: stres, dismenore primer, mahasiswi fakultas kedokteran AbstractPrimary dysmenorrhoea is menstrual pain founded without real abnormalities in genital organs. More than 50% woman experiance it and 15% had severe pain. The objective of this study was to determine relationship between stress and primary dysmenorrhoea. Research was executed to education medical female students medical faculty of Andalas University class of 2009 and 2010. This research use cross sectional study design with 165 subjects. Data was collected by guided interview. Statistic analysis use chi-square test and simple correlation test. Chi-square test show there is significant relationship between stress and primary dysmenorrhoea and simple coefficient test show there is weak correlation between stress levels and degree of primary dysmenorrhoea.Keywords: stress, primary dysmenorrhoea, female student of medical faculty
Qualification and Flight Test of Non-Chrome Primers for C-130 Aircraft
2011-08-17
system Significant hexavalent chrome reduction in finish system Potential exposure level of spray applied chromated conversion coating not as...Lockheed Martin Aeronautics Company Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft Scott Jones Lockheed Martin...00-2011 to 00-00-2011 4. TITLE AND SUBTITLE Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft 5a. CONTRACT NUMBER 5b. GRANT
Rivas, R; Velázquez, E; Valverde, A; Mateos, P F; Martínez-Molina, E
2001-04-01
Polymerase chain reation (PCR) fingerprints are used to characterize and recognize bacteria and are generally obtained using universal primers that generate an array of DNA amplicons, which can be separated by electrophoresis. Universal primers 8F and 1491 R have been used to amplify specifically 16S rDNA. We have used these primers at an annealing temperature of 50 degrees C. Agarose gel electrophoresis of PCR products revealed several bands. The band pattern of each bacterial species was different and the strains belonging to the same species shared an identical pattern. The patterns obtained did not show variations with plasmid DNA content or the growth stage of the bacteria. The peculiarity of the randomly amplified polymorphic DNA (RAPD) described in this work lies in the use of two large primers (proximately 20 nt) to obtain the pattern, since normally a only smaller primer is used, and in the new application for the primers used to amplify 16S rDNA. This new procedure, called two primers (TP)-RAPD fingerprinting, is thus rapid, sensitive, reliable, highly reproducible and suitable for experiments with a large number of microorganisms, and can be applied to bacterial taxonomy, ecological studies and for the detection of new bacterial species.
Magnetization transfer and spin lock MR imaging of patellar cartilage degeneration at 0.1 T
International Nuclear Information System (INIS)
Koskinen, S.K.; Ylae-Outinen, H.; Komu, M.E.S.; Aho, H.J.
1997-01-01
Purpose: To investigate magnetization transfer (MT) parameters and rotating frame relaxation time T1ρ in patellar cartilage at different levels of degeneration. Material and Methods: Thirty cadaveric patellae were examined at 0.1 T using the time-dependent saturation-transfer MT technique and the spin lock (SL) technique. In an SL experiment, nuclear spins are locked with a radiofrequency (RF) field, and the locked nuclear magnetization relaxes along the magnetic component of the locking RF field. The specimens were divided into three groups according to the level of cartilage degeneration. MT parameters and T1ρ were measured. Results: The MT effect was greater in degenerated cartilage than in normal cartilage. T1ρ was longer in advanced cartilage degeneration than in intermediate cartilage degeneration. Conculsion: The results suggest that more studies are needed to fully establish the value of SL imaging in cartilage degeneration. (orig.)
Directory of Open Access Journals (Sweden)
Joseph-Alexander Verreet
2012-03-01
Full Text Available The goals of this investigation were to identify and evaluate the use of polymorphic microsatellite marker (PMM analysis for molecular typing of seventeen plant pathogenic fungi. Primers for di-, tri-, and tetranucleotide loci were designed directly from the recently published genomic sequence of Mycospherlla graminicola and Fusarium graminearum. A total of 20 new microsatellite primers as easy-to-score markers were developed. Microsatellite primer PCR (MP-PCR yielded highly reproducible and complex genomic fingerprints, with several bands ranging in size from 200 to 3000 bp. Of the 20 primers tested, only (TAGG4, (TCC5 and (CA7T produced a high number of polymorphic bands from either F. graminearum or F. culmorum. (ATG5 led to successful amplifications in M. graminicola isolates collected from Germany. Percentage of polymorphic bands among Fusarium species ranged from 9 to 100%. Cluster analysis of banding patterns of the isolates corresponded well to the established species delineations based on morphology and other methods of phylogenetic analysis. The current research demonstrates that the newly designed microsatellite primers are reliable, sensitive and technically simple tools for assaying genetic variability in plant pathogenic fungi.
Energy Technology Data Exchange (ETDEWEB)
Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.
2013-06-28
Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource
International Nuclear Information System (INIS)
Jothikumar, N.; Hill, Vincent R.
2013-01-01
Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource
Wang, Chaojen; Lin, Yisheng; Lin, Yinghong; Chung, Wenhsin
2013-01-01
Previous investigations demonstrated that Fusarium oxysporum (Fo), which is not pathogenic to cucumbers, could serve as a biological control agent for managing Fusarium wilt of cucumber caused by Fo f. sp. cucumerinum (Foc) in Taiwan. However, thus far it has not been possible to separate the populations of pathogenic Fo from the nonpathogenic isolates that have biological control potential through their morphological characteristics. Although these two populations can be distinguished from one another using a bioassay, the work is laborious and time-consuming. In this study, a fragment of the intergenic spacer (IGS) region of ribosomal DNA from an Fo biological control agent, Fo366, was PCR-amplified with published general primers, FIGS11/FIGS12 and sequenced. A new primer, NPIGS-R, which was designed based on the IGS sequence, was paired with the FIGS11 primer. These primers were then evaluated for their specificity to amplify DNA from nonpathogenic Fo isolates that have biological control potential. The results showed that the modified primer pair, FIGS11/NPIGS-R, amplified a 500-bp DNA fragment from five of seven nonpathogenic Fo isolates. These five Fo isolates delayed symptom development of cucumber Fusarium wilt in greenhouse bioassay tests. Seventy-seven Fo isolates were obtained from the soil and plant tissues and then subjected to amplification using the modified primer pair; six samples showed positive amplification. These six isolates did not cause symptoms on cucumber seedlings when grown in peat moss infested with the isolates and delayed disease development when the same plants were subsequently inoculated with a virulent isolate of Foc. Therefore, the modified primer pair may prove useful for the identification of Fo isolates that are nonpathogenic to cucumber which can potentially act as biocontrol agents for Fusarium wilt of cucumber. PMID:23762289
Bounded search for de novo identification of degenerate cis-regulatory elements
Directory of Open Access Journals (Sweden)
Khetani Radhika S
2006-05-01
Full Text Available Abstract Background The identification of statistically overrepresented sequences in the upstream regions of coregulated genes should theoretically permit the identification of potential cis-regulatory elements. However, in practice many cis-regulatory elements are highly degenerate, precluding the use of an exhaustive word-counting strategy for their identification. While numerous methods exist for inferring base distributions using a position weight matrix, recent studies suggest that the independence assumptions inherent in the model, as well as the inability to reach a global optimum, limit this approach. Results In this paper, we report PRISM, a degenerate motif finder that leverages the relationship between the statistical significance of a set of binding sites and that of the individual binding sites. PRISM first identifies overrepresented, non-degenerate consensus motifs, then iteratively relaxes each one into a high-scoring degenerate motif. This approach requires no tunable parameters, thereby lending itself to unbiased performance comparisons. We therefore compare PRISM's performance against nine popular motif finders on 28 well-characterized S. cerevisiae regulons. PRISM consistently outperforms all other programs. Finally, we use PRISM to predict the binding sites of uncharacterized regulons. Our results support a proposed mechanism of action for the yeast cell-cycle transcription factor Stb1, whose binding site has not been determined experimentally. Conclusion The relationship between statistical measures of the binding sites and the set as a whole leads to a simple means of identifying the diverse range of cis-regulatory elements to which a protein binds. This approach leverages the advantages of word-counting, in that position dependencies are implicitly accounted for and local optima are more easily avoided. While we sacrifice guaranteed optimality to prevent the exponential blowup of exhaustive search, we prove that the error
Hafeez, Mian A; Shivaramaiah, Srichaitanya; Dorsey, Kristi Moore; Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Cobean, Julie; Barta, John R
2015-05-01
Species-specific PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus were generated that allow for the specific identification of the most common Eimeria species infecting turkeys (i.e., Eimeria adenoeides, Eimeria meleagrimitis, Eimeria gallopavonis, Eimeria meleagridis, Eimeria dispersa, and Eimeria innocua). PCR reaction chemistries were optimized with respect to divalent cation (MgCl2) and dNTP concentrations, as well as PCR cycling conditions (particularly anneal temperature for primers). Genomic DNA samples from single oocyst-derived lines of six Eimeria species were tested to establish specificity and sensitivity of these newly designed primer pairs. A mixed 60-ng total DNA sample containing 10 ng of each of the six Eimeria species was used as DNA template to demonstrate specific amplification of the correct product using each of the species-specific primer pairs. Ten nanograms of each of the five non-target Eimeria species was pooled to provide a non-target, control DNA sample suitable to test the specificity of each primer pair. The amplifications of the COI region with species-specific primer pairs from pooled samples yielded products of expected sizes (209 to 1,012 bp) and no amplification of non-target Eimeria sp. DNA was detected using the non-target, control DNA samples. These primer pairs specific for Eimeria spp. of turkeys did not amplify any of the seven Eimeria species infecting chickens. The newly developed PCR primers can be used as a diagnostic tool capable of specifically identifying six turkey Eimeria species; additionally, sequencing of the PCR amplification products yields sequence-based genotyping data suitable for identification and molecular phylogenetics.
Summary of the primer on tumor immunology and the biological therapy of cancer
Directory of Open Access Journals (Sweden)
Margolin Kim
2009-01-01
Full Text Available Abstract The International Society for Biological Therapy of Cancer (iSBTc is one of the "premier destinations for interaction and innovation in the cancer biologics community". It provides a primer course each year during the annual meeting to address the most important areas of tumor immunology and immunotherapy. The course has been given by prominent investigators in the area of interest, covering the core principles of cancer immunology and immunotherapy. The target audience for this program includes investigators from academic, regulatory, and biopharmaceutical venues. The program goal is to enable the attendees to learn the current status and the most recent advances in biologic therapies, and to leverage this knowledge towards the improvement of cancer therapy. The 2008 immunologic primer course was held on October 30 at the 23rd Annual meeting of iSBTc in San Diego, CA. Nine internationally renowned investigators gave excellent presentations on different topics. The topics covered in this primer included: (1 cytokines in cancer immunology; (2 anti-angiogenic therapy; (3 end stage: immune killing of tumors; (4 blocking T cell checkpoints; (5 approach to identification and therapeutic exploitation of tumor antigens; (6 T regulatory cells; (7 adoptive T cell therapy; (8 immune monitoring of cancer immunotherapy; and (9 immune adjuvants. We summarized the topics in this primer for public education. The related topic slides and schedule can be accessed online http://www.isbtc.org/meetings/am08/primer08.
International Nuclear Information System (INIS)
Kuppuswamy, M.N.; Hoffmann, J.W.; Spitzer, S.G.; Groce, S.L.; Bajaj, S.P.; Kasper, C.K.
1991-01-01
In this report, the authors describe an approach to detect the presence of abnormal alleles in those genetic diseases in which frequency of occurrence of the same mutation is high (e.g., hemophilia B). Initially, from each subject, the DNA fragment containing the putative mutation site is amplified by the polymerase chain reaction. For each fragment two reaction mixtures are then prepared. Each contains the amplified fragment, a primer (18-mer or longer) whose sequence is identical to the coding sequence of the normal gene immediately flanking the 5' end of the mutation site, and either an α- 32 P-labeled nucleotide corresponding to the normal coding sequence at the mutation site or an α- 32 P-labeled nucleotide corresponding to the mutant sequence. An essential feature of the present methodology is that the base immediately 3' to the template-bound primer is one of those altered in the mutant, since in this way an extension of the primer by a single base will give an extended molecule characteristic of either the mutant or the wild type. The method is rapid and should be useful in carrier detection and prenatal diagnosis of every genetic disease with a known sequence variation
Relationship between retinal lattice degeneration and open angle glaucoma.
Rahimi, Mansour
2005-01-01
Patients with retinal disorders may develop glaucoma of both a primary and secondary type. Pigment may contribute to trabecular obstruction in some patients with open-angle glaucoma. Lattice degeneration of the retina in its typical form is a sharply demarcated, circumferentially oriented, degenerative process with significant alterations of retinal pigmentation. The association between myopia, open angle glaucoma and pigment dispersion is striking. Therefore, it could be postulated that there is significant prevalence of open angle glaucoma in patients with retinal lattice degeneration, especially in combination with myopia.
Maximum principles for boundary-degenerate linear parabolic differential operators
Feehan, Paul M. N.
2013-01-01
We develop weak and strong maximum principles for boundary-degenerate, linear, parabolic, second-order partial differential operators, $Lu := -u_t-\\tr(aD^2u)-\\langle b, Du\\rangle + cu$, with \\emph{partial} Dirichlet boundary conditions. The coefficient, $a(t,x)$, is assumed to vanish along a non-empty open subset, $\\mydirac_0!\\sQ$, called the \\emph{degenerate boundary portion}, of the parabolic boundary, $\\mydirac!\\sQ$, of the domain $\\sQ\\subset\\RR^{d+1}$, while $a(t,x)$ may be non-zero at po...
Axon degeneration: make the Schwann cell great again
Directory of Open Access Journals (Sweden)
Keit Men Wong
2017-01-01
Full Text Available Axonal degeneration is a pivotal feature of many neurodegenerative conditions and substantially accounts for neurological morbidity. A widely used experimental model to study the mechanisms of axonal degeneration is Wallerian degeneration (WD, which occurs after acute axonal injury. In the peripheral nervous system (PNS, WD is characterized by swift dismantling and clearance of injured axons with their myelin sheaths. This is a prerequisite for successful axonal regeneration. In the central nervous system (CNS, WD is much slower, which significantly contributes to failed axonal regeneration. Although it is well-documented that Schwann cells (SCs have a critical role in the regenerative potential of the PNS, to date we have only scarce knowledge as to how SCs 'sense' axonal injury and immediately respond to it. In this regard, it remains unknown as to whether SCs play the role of a passive bystander or an active director during the execution of the highly orchestrated disintegration program of axons. Older reports, together with more recent studies, suggest that SCs mount dynamic injury responses minutes after axonal injury, long before axonal breakdown occurs. The swift SC response to axonal injury could play either a pro-degenerative role, or alternatively a supportive role, to the integrity of distressed axons that have not yet committed to degenerate. Indeed, supporting the latter concept, recent findings in a chronic PNS neurodegeneration model indicate that deactivation of a key molecule promoting SC injury responses exacerbates axonal loss. If this holds true in a broader spectrum of conditions, it may provide the grounds for the development of new glia-centric therapeutic approaches to counteract axonal loss.
Verteporfin plus ranibizumab for choroidal neovascularization in age-related macular degeneration
DEFF Research Database (Denmark)
Larsen, Michael; Schmidt-Erfurth, Ursula; Lanzetta, Paolo
2012-01-01
To compare the efficacy and safety of same-day verteporfin photodynamic therapy (PDT) and intravitreal ranibizumab combination treatment versus ranibizumab monotherapy in neovascular age-related macular degeneration.......To compare the efficacy and safety of same-day verteporfin photodynamic therapy (PDT) and intravitreal ranibizumab combination treatment versus ranibizumab monotherapy in neovascular age-related macular degeneration....
Ota, Susumu; Kurokouchi, Kazutoshi; Takahashi, Shigeo; Yoda, Masaki; Yamamoto, Ryuichiro; Sakai, Tadahiro
2017-11-01
Patellofemoral cartilage degeneration is a potential complication of anterior cruciate ligament reconstruction (ACLR) surgery. Hypomobility of the patella in the coronal plane is often observed after ACLR. Few studies, however, have examined the relationship between cartilage degeneration in the patellofemoral joint and mobility after ACLR. The present study investigated 1) the coronal mobility of the patella after ACLR, 2) the relationship between patellar mobility and cartilage degeneration of the patellofemoral joint, and 3) the relationship between patellar mobility and knee joint function after ACLR. Forty patients who underwent medial hamstring-based ACLR participated in the study. Lateral and medial patellar displacements were assessed with a modified patellofemoral arthrometer, and the absolute values of the displacements were normalized to patient height. The International Cartilage Repair Society (ICRS) cartilage injury classification of the patellar and femoral (trochlear) surfaces, and the Lysholm Knee Scoring Scale were used to evaluate knee function. Lateral and medial patellar displacements were reduced compared with the non-operated knee at the second-look arthroscopy and bone staple extraction operation (second operation; 24.4 ± 7.9 months after ACLR, Ppatellofemoral joint (patella and trochlea) were significantly worse than those pre-ACLR. Neither lateral nor medial patellar mobility, however, were significantly correlated with the ICRS grade or the Lysholm score. Although patellar mobility at approximately 2 years after ACLR was decreased compared to the non-operated knee, small displacement of the patella was not related to cartilage degeneration or knee joint function at the time of the second operation.
Zaman, D. M. S.; Amina, M.; Dip, P. R.; Mamun, A. A.
2017-11-01
The basic properties of planar and non-planar (spherical and cylindrical) nucleus-acoustic (NA) shock structures (SSs) in a strongly coupled self-gravitating degenerate quantum plasma system (containing strongly coupled non-relativistically degenerate heavy nuclear species, weakly coupled non-relativistically degenerate light nuclear species, and inertialess non-/ultra-relativistically degenerate electrons) have been investigated. The generalized quantum hydrodynamic model and the reductive perturbation method have been used to derive the modified Burgers equation. It is shown that the strong correlation among heavy nuclear species acts as the source of dissipation and is responsible for the formation of the NA SSs with positive (negative) electrostatic (self-gravitational) potential. It is also observed that the effects of non-/ultra-relativistically degenerate electron pressure, dynamics of non-relativistically degenerate light nuclear species, spherical geometry, etc., significantly modify the basic features of the NA SSs. The applications of our results in astrophysical compact objects like white dwarfs and neutron stars are briefly discussed.
Transsynaptic neuronal degeneration of optic nerves associated with bilateral occipital lesions
Directory of Open Access Journals (Sweden)
Sachdev Mahipal
1990-01-01
Full Text Available A case is reported of a 9-year old male who presented with abnormal behaviour and progressive diminution of vision. Pupils were middilated in both eyes but the pupillary reflexes were preserved. Fundus examination revealed a bilateral optic atrophy and radiological investigations showed a bilateral occipital calcification. We hereby document a case of retrograde transsynaptic neuronal degeneration of the visual system secondary to bilateral occipital lesions. Transsynapptic neuronal degeneration of optic nerves consequent to occipital lobe lesions is a rare phenomenon. Experimentally occipital lobe ablation in non-human primates has been shown to result in optic atrophy. Herein, we document a case of retrograde transsynaptic neuronal degeneration of the visual system secondary to bilateral occipital lesions.
International Nuclear Information System (INIS)
Oldendorf, W.; Oldendorf, W. Jr.
1991-01-01
Designed for studies, radiologists, and clinicians at all levels of training, this book provides a basic introduction to the principles, physics, and instrumentation of magnetic resonance imaging. The fundamental concepts that are essential for the optimal clinical use of MRI are thoroughly explained in easily accessible terms. To facilitate the reader's comprehension, the material is presented nonmathematically, using no equations and a minimum of symbols and abbreviations. MRI Primer presents a clear account of the phenomenon of nuclear magnetic resonance and the use of gradient magnetic fields to create clinically useful images of cross-sectional slices. Close attention is given to the magnetization vector as a means of expressing nuclear behavior, the role of T 1 and T 2 weighing in imaging, the use of contrast agents, and the pulse sequences most often used in clinical practice, as well as to the relative capabilities and limitations of MRI and CT. The basic hardware components of an MRI scanner are described in detail. Sample MRI scans illustrate how MRI characterizes tissue. An appendix provides a brief introduction to quantum processes in MRI
Efficient screening methods for glucosyltransferase genes in Lactobacillus strains
Kralj, S; van Geel-schutten, GH; van der Maarel, MJEC; Dijkhuizen, L
2003-01-01
Limited information is available about homopolysaccharide synthesis in the genus Lactobacillus . Using efficient screening techniques, extracellular glucosyltransferase (GTF) enzyme activity, resulting in alpha-glucan synthesis from sucrose, was detected in various lactobacilli. PCR with degenerate primers based on homologous boxes of known glucosyltransferase (gtf ) genes of lactic acid bacteria strains allowed cloning of fragments of 10 putative gtf genes from eight different glucan produci...
In Vitro Evaluation of Shear Bond Strength of Self Etching Primers to Dentin
Directory of Open Access Journals (Sweden)
Reena Vora
2012-01-01
Full Text Available Objectives: To evaluate and compare the shear bond strength of four self etching primer adhesives to dentin. Materials & Methods: A total of 75 extracted human maxillary and mandibular molars were selected for the study. The teeth were divided into 5 groups of 15 teeth each, Group A- AdheSE (Ivoclar Vivadent, Group B-Adper prompt (3M ESPE, Group C- i bond (Heraeus-Kulzer, Group D-XenoIII (Dentsply, De Trey Group E-Single bond (3M ESPE was used and served as control. All the adhesives were applied according to the manufacturer′s instructions. Composite post was built on these bonded surfaces using Z-100 hybrid composite. The teeth were subjected to thermocycling for 500 cycles between 5°C to 55°C. The teeth were then mounted on universal testing machine and fractured under a shearing load, applied at a speed of 0.2mm/min. The readings were noted, tabulated and shear bond strength calculated in Mega Pascal (Mpa units. Results: There was significant difference in the mean shear bond strength of the four self etching primers, adhesives tested. Shear strength values were in the range of 16.57 to 21.73 Mpa. Xeno III gave the highest mean of shear bond strength whereas Adhe SE showed the lowest value of shear strength. Conclusion: Based on the results of the study, it can be concluded that contemporary self etching primer adhesives bond successfully to dentin. Moreover the bonding ability of Self Etching Systems seems to be comparable to the conventional Total Etch Systems.
A mouse model for degeneration of the spiral ligament.
Kada, Shinpei; Nakagawa, Takayuki; Ito, Juichi
2009-06-01
Previous studies have indicated the importance of the spiral ligament (SL) in the pathogenesis of sensorineural hearing loss. The aim of this study was to establish a mouse model for SL degeneration as the basis for the development of new strategies for SL regeneration. We injected 3-nitropropionic acid (3-NP), an inhibitor of succinate dehydrogenase, at various concentrations into the posterior semicircular canal of adult C57BL/6 mice. Saline-injected animals were used as controls. Auditory function was monitored by measurements of auditory brain stem responses (ABRs). On postoperative day 14, cochlear specimens were obtained after the measurement of the endocochlear potential (EP). Animals that were injected with 5 or 10 mM 3-NP showed a massive elevation of ABR thresholds along with extensive degeneration of the cochleae. Cochleae injected with 1 mM 3-NP exhibited selective degeneration of the SL fibrocytes but alterations in EP levels and ABR thresholds were not of sufficient magnitude to allow for testing functional recovery after therapeutic interventions. Animals injected with 3 mM 3-NP showed a reduction of around 50% in the EP along with a significant loss of SL fibrocytes, although degeneration of spiral ganglion neurons and hair cells was still present in certain regions. These findings indicate that cochleae injected with 3 mM 3-NP may be useful in investigations designed to test the feasibility of new therapeutic manipulations for functional SL regeneration.
Exploring Nonconvex, Crossed and Degenerate Polygons
Contreras, Jose N.
2004-01-01
An exploration of nonconvex, crossed, and degenerate polygons (NCCDPs) are described with the help of examples with pedagogical tips and recommendations that are found useful when teaching the mathematical process of extending geometric patterns to NCCDPs. The study concludes that investigating such extensions with interactive geometry software…
Geometry of non-degenerate Susskind fermions
International Nuclear Information System (INIS)
Mitra, P.
1983-01-01
The Dirac-Kaehler equation on the lattice is known to describe the degenerate ''flavours'' appering in Susskind's approach to lattice fermions. We study the modification that has to be made in this equation in order to lift the degeneracy and give the flavours arbitrary different masses. (orig.)
Degenerated human intervertebral discs contain autoantibodies against extracellular matrix proteins
Directory of Open Access Journals (Sweden)
S Capossela
2014-04-01
Full Text Available Degeneration of intervertebral discs (IVDs is associated with back pain and elevated levels of inflammatory cells. It has been hypothesised that discogenic pain is a direct result of vascular and neural ingrowth along annulus fissures, which may expose the avascular nucleus pulposus (NP to the systemic circulation and induce an autoimmune reaction. In this study, we confirmed our previous observation of antibodies in human degenerated and post-traumatic IVDs cultured in vitro. We hypothesised that the presence of antibodies was due to an autoimmune reaction against specific proteins of the disc. Furthermore we identified antigens which possibly trigger an autoimmune response in degenerative disc diseases. We demonstrated that degenerated and post-traumatic IVDs contain IgG antibodies against typical extracellular proteins of the disc, particularly proteins of the NP. We identified IgGs against collagen type II and aggrecan, confirming an autoimmune reaction against the normally immune privileged NP. We also found specific IgGs against collagens types I and V, but not against collagen type III. In conclusion, this study confirmed the association between disc degeneration and autoimmunity, and may open the avenue for future studies on developing prognostic, diagnostic and therapy-monitoring markers for degenerative disc diseases.
A primer of multivariate statistics
Harris, Richard J
2014-01-01
Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why
Wang, Pei-Ning; Chou, Kun-Hsien; Chang, Ni-Jung; Lin, Ker-Neng; Chen, Wei-Ta; Lan, Gong-Yau; Lin, Ching-Po; Lirng, Jiing-Feng
2014-04-01
Degeneration of the corpus callosum (CC) is evident in the pathogenesis of Alzheimer's disease (AD). However, the correlation of microstructural damage in the CC on the cognitive performance of patients with amnestic mild cognitive impairment (aMCI) and AD dementia is undetermined. We enrolled 26 normal controls, 24 patients with AD dementia, and 40 single-domain aMCI patients with at least grade 1 hippocampal atrophy and isolated memory impairment. Diffusion tensor imaging (DTI) with fractional anisotropy (FA), mean diffusivity (MD), axial diffusivity (DA), and radial diffusivity (DR) were measured. The entire CC was parcellated based on fiber trajectories to specific cortical Brodmann areas using a probabilistic tractography method. The relationship between the DTI measures in the subregions of the CC and cognitive performance was examined. Although the callosal degeneration in the patients with aMCI was less extended than in the patients with AD dementia, degeneration was already exhibited in several subregions of the CC at the aMCI stage. Scores of various neuropsychological tests were correlated to the severity of microstructural changes in the subregional CC connecting to functionally corresponding cortical regions. Our results confirm that CC degeneration is noticeable as early as the aMCI stage of AD and the disconnection of the CC subregional fibers to the corresponding Brodmann areas has an apparent impact on the related cognitive performance. Copyright © 2013 Wiley Periodicals, Inc.
Observable consequences of partially degenerate leptogenesis
Ellis, Jonathan Richard; Yanagida, T; Ellis, John; Raidal, Martti
2002-01-01
In the context of the seesaw mechanism, it is natural that the large solar and atmospheric neutrino mixing angles originate separately from large 2 by 2 mixings in the neutrino and charged-lepton sectors, respectively, and large mixing in the neutrino couplings is in turn more plausible if two of the heavy singlet neutrinos are nearly degenerate. We study the phenomenology of this scenario, calculating leptogenesis by solving numerically the set of coupled Boltzmann equations for out-of-equilibrium heavy singlet neutrino decays in the minimal supersymmetric seesaw model. The near-degenerate neutrinos may weigh < 10^8 GeV, avoiding the cosmological gravitino problem. This scenario predicts that Br(mu to e gamma) should be strongly suppressed, because of the small singlet neutrino masses, whilst Br(tau to mu gamma) may be large enough to be observable in B-factory or LHC experiments. If the light neutrino masses are hierarchical, we predict that the neutrinoless double-beta decay parameter m_{ee} is approxim...
A Primer on Basic Effect Size Concepts.
Elmore, Patricia B.; Rotou, Ourania
The increased interest in reporting effect sizes means that it is necessary to consider what should be included in a primer on effect sizes. A review of papers on effect sizes and commonly repeated statistical analyses suggests that it is important to discuss effect sizes relative to bivariate correlation, t-tests, analysis of variance/covariance,…
Atomic rate coefficients in a degenerate plasma
Aslanyan, Valentin; Tallents, Greg
2015-11-01
The electrons in a dense, degenerate plasma follow Fermi-Dirac statistics, which deviate significantly in this regime from the usual Maxwell-Boltzmann approach used by many models. We present methods to calculate the atomic rate coefficients for the Fermi-Dirac distribution and present a comparison of the ionization fraction of carbon calculated using both models. We have found that for densities close to solid, although the discrepancy is small for LTE conditions, there is a large divergence from the ionization fraction by using classical rate coefficients in the presence of strong photoionizing radiation. We have found that using these modified rates and the degenerate heat capacity may affect the time evolution of a plasma subject to extreme ultraviolet and x-ray radiation such as produced in free electron laser irradiation of solid targets.
Design of the Advanced Virgo non-degenerate recycling cavities
International Nuclear Information System (INIS)
Granata, M; Barsuglia, M; Flaminio, R; Freise, A; Hild, S; Marque, J
2010-01-01
Advanced Virgo is the project to upgrade the interferometric gravitational wave detector Virgo, and it foresees the implementation of power and signal non-degenerate recycling cavities. Such cavities suppress the build-up of high order modes of the resonating sidebands, with some advantage for the commissioning of the detector and the build-up of the gravitational signal. Here we present the baseline design of the Advanced Virgo non-degenerate recycling cavities, giving some preliminary results of simulations about the tolerances of this design to astigmatism, mirror figure errors and thermal lensing.
Automated imaging dark adaptometer for investigating hereditary retinal degenerations
Azevedo, Dario F. G.; Cideciyan, Artur V.; Regunath, Gopalakrishnan; Jacobson, Samuel G.
1995-05-01
We designed and built an automated imaging dark adaptometer (AIDA) to increase accuracy, reliability, versatility and speed of dark adaptation testing in patients with hereditary retinal degenerations. AIDA increases test accuracy by imaging the ocular fundus for precise positioning of bleaching and stimulus lights. It improves test reliability by permitting continuous monitoring of patient fixation. Software control of stimulus presentation provides broad testing versatility without sacrificing speed. AIDA promises to facilitate the measurement of dark adaptation in studies of the pathophysiology of retinal degenerations and in future treatment trials of these diseases.
Transneuronal degeneration in patients with temporal lobe epilepsy: evaluation by MR imaging
Energy Technology Data Exchange (ETDEWEB)
Kodama, Fumiko; Ogawa, Toshihide; Sugihara, Shuji; Kamba, Masayuki; Kinoshita, Toshibumi [Department of Radiology, Faculty of Medicine' ' Tottori University, 36-1 Nishi-cho, 683-8504, Yonago, Tottori (Japan); Kohaya, Norimasa; Kondo, Shinji [Department of Neurosurgery, Faculty of Medicine' ' Tottori University, 36-1 Nishi-cho, 683-8504, Yonago, Tottori (Japan)
2003-09-01
The aim of this study was to assess the MR imaging findings of transneuronal degeneration of limbic system in the patients with temporal lobe epilepsy, and to detect the influence of surgery on the anatomy of the limbic system. Axial and coronal T1- and T2-weighted MR images were retrospectively analyzed in 34 patients with temporal lobe epilepsy, focusing on transneuronal degeneration. In 17 of the 34 patients, MR images were also analyzed after selective amygdalo-hippocampectomy. Atrophy of the fornix, mamillary body, mamillothalamic tract (MTT), and thalamus ipsilateral to the epileptic focus was demonstrated on MR images in 14.7, 17.6, 8.8, and 11.8% of the 34 patients, respectively. Focal hyperintensity of the thalamus was found on T2-weighted images in 8.8% of the 34 patients. In 17 patients who were evaluated before and after surgery, transneuronal degeneration was seen more frequently after surgery: fornix (11.8 vs 29.4%), mamillary body (11.8 vs 52.9%), MTT (5.9 vs 11.8%), and thalamus (11.8 vs 11.8%). Transneuronal degeneration of the limbic system is clearly demonstrated by MR imaging in patients with temporal lobe epilepsy, and surgical intervention induces transneuronal degeneration more frequently. (orig.)