Quantitative assessment of S. mutans and C. albicans in patients with Haas and Hyrax expanders

Directory of Open Access Journals (Sweden)

Matheus Melo Pithon

2012-06-01

Full Text Available OBJECTIVE: To assess and compare the number of Streptococcus mutans and Candida albicans colonies in patients with Haas and Hyrax appliances before and after insertion. METHODS: The sample consisted of 84 patients requiring orthodontic treatment. For all patients a midpalatal suture expansion was indicated. Patients were randomly divided into Group HA, who used the Haas appliance (n = 42 and Group HY, who used the Hyrax appliance (n = 42. Initially and thirty days after appliance insertion all patients were submitted to saliva collections. The saliva was diluted followed by seeding in Mitis Salivarius and CHROMagar media, for growth of S. mutans and C. albicans respectively. RESULTS: Results showed statistically significant difference between groups HA and HY for Streptococcus mutans and Candida albicans (p <0.05. Haas appliance promoted greater S. mutans and C. albicans proliferation when compared to Hyrax appliance. CONCLUSION: The Haas appliance favored greater proliferation of S. mutans and C. albicans when compared with the Hyrax appliance. Insertion of the appliances resulted in greater buildup of microorganisms.

Casein Kinase I Isoform Hrr25 Is a Negative Regulator of Haa1 in the Weak Acid Stress Response Pathway in Saccharomyces cerevisiae.

Science.gov (United States)

Collins, Morgan E; Black, Joshua J; Liu, Zhengchang

2017-07-01

Haa1 is a transcription factor that adapts Saccharomyces cerevisiae cells to weak organic acid stresses by activating the expression of various genes. Many of these genes encode membrane proteins, such as TPO2 and YRO2 How Haa1 is activated by weak acids is not clear. Here, we show that casein kinase I isoform Hrr25 is an important negative regulator of Haa1. Haa1 is known to be multiply phosphorylated. We found that mutations in HRR25 lead to reduced Haa1 phosphorylation and increased expression of Haa1 target genes and that Hrr25 interacts with Haa1. The other three casein kinase I isoforms, Yck1, Yck2, and Yck3, do not seem to play critical roles in Haa1 regulation. Hrr25 has a 200-residue C-terminal region, including a proline- and glutamine-rich domain. Our data suggest that the C-terminal region of Hrr25 is required for normal inhibition of expression of Haa1 target genes TPO2 and YRO2 and is important for cell growth but is not required for cell morphogenesis. We propose that Hrr25 is an important regulator of cellular adaptation to weak acid stress by inhibiting Haa1 through phosphorylation. IMPORTANCE Our study has revealed the casein kinase I protein Hrr25 to be a negative regulator of Haa1, a transcription factor mediating the cellular response to stresses caused by weak acids. Many studies have focused on the target genes of Haa1 and their roles in weak acid stress responses, but little has been reported on the regulatory mechanism of Haa1. Weak acids, such as acetic acid, have long been used for food preservation by slowing down the growth of fungal species, including S. cerevisiae In the biofuel industry, acetic acid in the lignocellulosic hydrolysates limits the production of ethanol, which is undesirable. By understanding how Haa1 is regulated, we can make advances in the field of food sciences to better preserve food and engineer acetic acid-resistant strains that will increase productivity in the biofuel industry. Copyright © 2017 American

Galvano-magnetic properties and Shubnikov de Haas effect of Te-whiskers

International Nuclear Information System (INIS)

Berezovets, Veacheslav; Bondarchuk, Nikolai; Nikolaeva, Albina; Nijankovskii, Victor

2009-01-01

The work is devoted to investigation of the peculiarities of magnetoresistance, Hall effect and Shubnikov de Haas oscillations in Te-whiskers. Te-whiskers was prepared from vapor-gas phase on the substrate pure tellurium and grown naturally, of the walls of a crucible in the course of growing Te single crystals by the Czochralski method . The measurements of the galvanomagnetic properties and Shubnikov de Haas oscillation correspond to the notion of the occurrence of the effect of intraband magnetic breakdown when two different quasi-classical cyclotron trajectories coexist simultaneously in a magnetic field. This effect is a consequence of the presence of the saddle point in the dispersion law of the tellurium valence band. (authors)

Filtration of lager beer with microsieves: Flux, permeate haze and in-line microscope observations

NARCIS (Netherlands)

Kuiper, S.; van Rijn, C.J.M.; Nijdam, W.; Raspe, Onno; van Wolferen, Hendricus A.G.M.; Krijnen, Gijsbertus J.M.; Elwenspoek, Michael Curt

2002-01-01

Membrane fouling during filtration of lager beer with microsieves was studied through in-line microscope observations. It was observed that the main fouling was caused by micrometre-sized particles, presumably aggregated proteins. These particles formed flocks covering parts of the membrane surface.

Loss of lager specific genes and subtelomeric regions define two different Saccharomyces cerevisiae lineages for Saccharomyces pastorianus Group I and II strains.

Science.gov (United States)

Monerawela, Chandre; James, Tharappel C; Wolfe, Kenneth H; Bond, Ursula

2015-03-01

Lager yeasts, Saccharomyces pastorianus, are interspecies hybrids between S. cerevisiae and S. eubayanus and are classified into Group I and Group II clades. The genome of the Group II strain, Weihenstephan 34/70, contains eight so-called 'lager-specific' genes that are located in subtelomeric regions. We evaluated the origins of these genes through bioinformatic and PCR analyses of Saccharomyces genomes. We determined that four are of cerevisiae origin while four originate from S. eubayanus. The Group I yeasts contain all four S. eubayanus genes but individual strains contain only a subset of the cerevisiae genes. We identified S. cerevisiae strains that contain all four cerevisiae 'lager-specific' genes, and distinct patterns of loss of these genes in other strains. Analysis of the subtelomeric regions uncovered patterns of loss in different S. cerevisiae strains. We identify two classes of S. cerevisiae strains: ale yeasts (Foster O) and stout yeasts with patterns of 'lager-specific' genes and subtelomeric regions identical to Group I and II S. pastorianus yeasts, respectively. These findings lead us to propose that Group I and II S. pastorianus strains originate from separate hybridization events involving different S. cerevisiae lineages. Using the combined bioinformatic and PCR data, we describe a potential classification map for industrial yeasts. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permission@oup.com.

75 FR 22627 - Chrysler LLC, St. Louis North Assembly Plant Including On-Site Leased Workers From HAAS TCM, Inc...

Science.gov (United States)

2010-04-29

... North Assembly Plant Including On-Site Leased Workers From HAAS TCM, Inc., Logistics Services, Inc., Robinson Solutions, Logistics Management Services, Inc., Corrigan Company and Murphy Company, Fenton, MO... workers from HAAS TCM, Inc., Logistics Services, Inc., Robinson Solutions, Logistics Management Services...

Evolutionary engineering in chemostat cultures for improved maltotriose fermentation kinetics in saccharomyces pastorianus lager brewing yeast

NARCIS (Netherlands)

Brickwedde, A.; van den Broek, M.A.; Geertman, Jan Maarten A.; Magalhães, Frederico; Kuijpers, Niels G.A.; Gibson, Brian; Pronk, J.T.; Daran, J.G.

2017-01-01

The lager brewing yeast Saccharomyces pastorianus, an interspecies hybrid of S. eubayanus and S. cerevisiae, ferments maltotriose, maltose, sucrose, glucose and fructose in wort to ethanol and carbon dioxide. Complete and timely conversion ("attenuation") of maltotriose by industrial S.

Improved ethanol production from xylose in the presence of acetic acid by the overexpression of the HAA1 gene in Saccharomyces cerevisiae.

Science.gov (United States)

Sakihama, Yuri; Hasunuma, Tomohisa; Kondo, Akihiko

2015-03-01

The hydrolysis of lignocellulosic biomass liberates sugars, primarily glucose and xylose, which are subsequently converted to ethanol by microbial fermentation. The rapid and efficient fermentation of xylose by recombinant Saccharomyces cerevisiae strains is limited by weak acids generated during biomass pretreatment processes. In particular, acetic acid negatively affects cell growth, xylose fermentation rate, and ethanol production. The ability of S. cerevisiae to efficiently utilize xylose in the presence of acetic acid is an essential requirement for the cost-effective production of ethanol from lignocellulosic hydrolysates. Here, an acetic acid-responsive transcriptional activator, HAA1, was overexpressed in a recombinant xylose-fermenting S. cerevisiae strain to yield BY4741X/HAA1. This strain exhibited improved cell growth and ethanol production from xylose under aerobic and oxygen limited conditions, respectively, in the presence of acetic acid. The HAA1p regulon enhanced transcript levels in BY4741X/HAA1. The disruption of PHO13, a p-nitrophenylphosphatase gene, in BY4741X/HAA1 led to further improvement in both yeast growth and the ability to ferment xylose, indicating that HAA1 overexpression and PHO13 deletion act by different mechanisms to enhance ethanol production. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Lactobacillus backii and Pediococcus damnosus isolated from 170-year-old beer recovered from a shipwreck lack the metabolic activities required to grow in modern lager beer.

Science.gov (United States)

Kajala, Ilkka; Bergsveinson, Jordyn; Friesen, Vanessa; Redekop, Anna; Juvonen, Riikka; Storgårds, Erna; Ziola, Barry

2018-01-01

In 2010, bottles of beer containing viable bacteria of the common beer-spoilage species Lactobacillus backii and Pediococcus damnosus were recovered from a shipwreck near the Åland Islands, Finland. The 170-year quiescent state maintained by the shipwreck bacteria presented a unique opportunity to study lactic acid bacteria (LAB) evolution vis-a-vis growth and survival in the beer environment. Three shipwreck bacteria (one L. backii strain and two P. damnosus strains) and modern-day beer-spoilage isolates of the same two species were genome sequenced, characterized for hop iso-α-acid tolerance, and growth in degassed lager and wheat beer. In addition, plasmid variants of the modern-day P. damnosus strain were analyzed for the effect of plasmid-encoded genes on growth in lager beer. Coding content on two plasmids was identified as essential for LAB growth in modern lager beer. Three chromosomal regions containing genes related to sugar transport and cell wall polysaccharides were shared by pediococci able to grow in beer. Our results show that the three shipwreck bacteria lack the necessary plasmid-located genetic content to grow in modern lager beer, but carry additional genes related to acid tolerance and biofilm formation compared to their modern counterparts. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Chromosomal Copy Number Variation in Saccharomyces pastorianus Is Evidence for Extensive Genome Dynamics in Industrial Lager Brewing Strains.

Science.gov (United States)

van den Broek, M; Bolat, I; Nijkamp, J F; Ramos, E; Luttik, M A H; Koopman, F; Geertman, J M; de Ridder, D; Pronk, J T; Daran, J-M

2015-09-01

Lager brewing strains of Saccharomyces pastorianus are natural interspecific hybrids originating from the spontaneous hybridization of Saccharomyces cerevisiae and Saccharomyces eubayanus. Over the past 500 years, S. pastorianus has been domesticated to become one of the most important industrial microorganisms. Production of lager-type beers requires a set of essential phenotypes, including the ability to ferment maltose and maltotriose at low temperature, the production of flavors and aromas, and the ability to flocculate. Understanding of the molecular basis of complex brewing-related phenotypic traits is a prerequisite for rational strain improvement. While genome sequences have been reported, the variability and dynamics of S. pastorianus genomes have not been investigated in detail. Here, using deep sequencing and chromosome copy number analysis, we showed that S. pastorianus strain CBS1483 exhibited extensive aneuploidy. This was confirmed by quantitative PCR and by flow cytometry. As a direct consequence of this aneuploidy, a massive number of sequence variants was identified, leading to at least 1,800 additional protein variants in S. pastorianus CBS1483. Analysis of eight additional S. pastorianus strains revealed that the previously defined group I strains showed comparable karyotypes, while group II strains showed large interstrain karyotypic variability. Comparison of three strains with nearly identical genome sequences revealed substantial chromosome copy number variation, which may contribute to strain-specific phenotypic traits. The observed variability of lager yeast genomes demonstrates that systematic linking of genotype to phenotype requires a three-dimensional genome analysis encompassing physical chromosomal structures, the copy number of individual chromosomes or chromosomal regions, and the allelic variation of copies of individual genes. Copyright © 2015, van den Broek et al.

Microbe domestication and the identification of the wild genetic stock of lager-brewing yeast

Science.gov (United States)

Libkind, Diego; Hittinger, Chris Todd; Valério, Elisabete; Gonçalves, Carla; Dover, Jim; Johnston, Mark; Gonçalves, Paula; Sampaio, José Paulo

2011-01-01

Domestication of plants and animals promoted humanity's transition from nomadic to sedentary lifestyles, demographic expansion, and the emergence of civilizations. In contrast to the well-documented successes of crop and livestock breeding, processes of microbe domestication remain obscure, despite the importance of microbes to the production of food, beverages, and biofuels. Lager-beer, first brewed in the 15th century, employs an allotetraploid hybrid yeast, Saccharomyces pastorianus (syn. Saccharomyces carlsbergensis), a domesticated species created by the fusion of a Saccharomyces cerevisiae ale-yeast with an unknown cryotolerant Saccharomyces species. We report the isolation of that species and designate it Saccharomyces eubayanus sp. nov. because of its resemblance to Saccharomyces bayanus (a complex hybrid of S. eubayanus, Saccharomyces uvarum, and S. cerevisiae found only in the brewing environment). Individuals from populations of S. eubayanus and its sister species, S. uvarum, exist in apparent sympatry in Nothofagus (Southern beech) forests in Patagonia, but are isolated genetically through intrinsic postzygotic barriers, and ecologically through host-preference. The draft genome sequence of S. eubayanus is 99.5% identical to the non-S. cerevisiae portion of the S. pastorianus genome sequence and suggests specific changes in sugar and sulfite metabolism that were crucial for domestication in the lager-brewing environment. This study shows that combining microbial ecology with comparative genomics facilitates the discovery and preservation of wild genetic stocks of domesticated microbes to trace their history, identify genetic changes, and suggest paths to further industrial improvement. PMID:21873232

The measurement of the amplitude of de Haas-van Alphen oscillations in indium

International Nuclear Information System (INIS)

Wilde, J. de; Meredith, D.J.

1976-01-01

A flux-gate magnetometer incorporating a superconducting flux transformer is described and its application to the measurement of de Haas-van Alphen oscillation amplitude is compared with conventional techniques. Measurements on the third zone Fermi surface of indium in magnetic fields of up to 4 T are given to show the advantages of the method. (author)

Study on the TOC concentration in raw water and HAAs in Tehran's water treatment plant outlet.

Science.gov (United States)

Ghoochani, Mahboobeh; Rastkari, Noushin; Nabizadeh Nodehi, Ramin; Mahvi, Amir Hossein; Nasseri, Simin; Nazmara, Shahrokh

2013-11-12

A sampling has been undertaken to investigate the variation of haloacetic acids formation and nature organic matter through 81 samples were collected from three water treatment plant and three major rivers of Tehran Iran. Changes in the total organic matter (TOC), ultraviolet absorbance (UV254), specific ultraviolet absorbance (SUVA) were measured in raw water samples. Haloacetic acids concentrations were monitored using a new static headspace GC-ECD method without a manual pre-concentration in three water treatment plants. The average concentration of TOC and HAAs in three rivers and three water treatment plants in spring, summer and fall, were 4, 2.41 and 4.03 mg/L and 48.75, 43.79 and 51.07 μg/L respectively. Seasonal variation indicated that HAAs levels were much higher in spring and fall.

HAA1 and PRS3 overexpression boosts yeast tolerance towards acetic acid improving xylose or glucose consumption: unravelling the underlying mechanisms.

Science.gov (United States)

Cunha, Joana T; Costa, Carlos E; Ferraz, Luís; Romaní, Aloia; Johansson, Björn; Sá-Correia, Isabel; Domingues, Lucília

2018-04-02

Acetic acid tolerance and xylose consumption are desirable traits for yeast strains used in industrial biotechnological processes. In this work, overexpression of a weak acid stress transcriptional activator encoded by the gene HAA1 and a phosphoribosyl pyrophosphate synthetase encoded by PRS3 in a recombinant industrial Saccharomyces cerevisiae strain containing a xylose metabolic pathway was evaluated in the presence of acetic acid in xylose- or glucose-containing media. HAA1 or PRS3 overexpression resulted in superior yeast growth and higher sugar consumption capacities in the presence of 4 g/L acetic acid, and a positive synergistic effect resulted from the simultaneous overexpression of both genes. Overexpressing these genes also improved yeast adaptation to a non-detoxified hardwood hydrolysate with a high acetic acid content. Furthermore, the overexpression of HAA1 and/or PRS3 was found to increase the robustness of yeast cell wall when challenged with acetic acid stress, suggesting the involvement of the modulation of the cell wall integrity pathway. This study clearly shows HAA1 and/or, for the first time, PRS3 overexpression to play an important role in the improvement of industrial yeast tolerance towards acetic acid. The results expand the molecular toolbox and add to the current understanding of the mechanisms involved in higher acetic acid tolerance, paving the way for the further development of more efficient industrial processes.

Electrons in a Magnetic Field: Special Spin in de Haas-van Alphen effect

International Nuclear Information System (INIS)

Shrivastava, Keshav N

2012-01-01

When the magnetic field is applied in a metal, the electrons behave like a harmonic oscillator. When the field is increased these harmonic oscillator type levels cross the Fermi energy at a particular point resulting into the discontinuities in the population of any particular level at that point. For a large orbital magnetic moment, different from L = 0 and both signs of spin in the total magnetic momentum quantum number, j = l ± s, the discontinuities in the population of the electrons in a particular level become double valued resulting into doubling of oscillations in the magnetization. There is a double valued change in the energy of the electrons when they transfer from the harmonic oscillator type level to the Fermi level. The magnetization depends on the value of j = l ± s so that there is a double valued period in the oscillations. The de Haas-van Alphen effect is usually described for the L = 0 electrons. Hence, we see that the de Haas-van Alphen effect is considerably modified in going from L = 0 to j = l ± s, with both signs in the spin.

Effects of iron and manganese on the formation of HAAs upon chlorinating Chlorella vulgaris

International Nuclear Information System (INIS)

Ge, Fei; Wu, Xiuzhen; Wang, Na; Zhu, Runliang; Wang, Tong; Xu, Yin

2011-01-01

The major objective of the present study was to investigate the role of iron and manganese on the formation of haloacetic acids (HAAs) when algae are chlorinated at different pHs. The results showed that both iron and manganese can reduce the yields of dichloroacetic acid (DCAA) and trichloroacetic acid (TCAA) on chlorinating green alga Chlorella vulgaris (C. vulgaris) at a pH range of 6.0-9.0, and the decline of DCAA and TCAA was shown to be more significant at the low pH range. At pH 6.0, DCAA and TCAA yields decreased by 44.5% and 57.3%, respectively with the addition of 0.5 mg L -1 iron, and decreased 39.5% and 49.4%, respectively with the addition of 0.5 mg L -1 manganese. The main reason for decreasing the yields of HAAs as shown by scanning electron microscope (SEM) is that Fe(OH) 3(am) or MnO 2(am) coat the algal cells , which then improves their agglomeration of algal cells which is also revealed by the laser particle size analysis (LPSA).

Recombination between Homeologous Chromosomes in Lager Yeasts leads to Loss of Function of the Hybrid GPH1 Gene.

OpenAIRE

BOND, URSULA

2009-01-01

PUBLISHED Yeasts used in the production of lagers contain complex allopolyploid genomes, resulting from the fusion of two different yeast species closely related to Saccharomyces cerevisiae and Saccharomyces bayanus. Recombination between the homoeologous chromosomes has generated a number of hybrid chromosomes. These recombination events provide potential for adaptive evolution through the loss or gain of gene function. We have examined the genotypic and phenotypic effects of one of the c...

Transverse effect of Haas and Hyrax appliances on the upper dental arch in patients with unilateral complete cleft lip and palate: A comparative study

Science.gov (United States)

Façanha, Anna Júlia de Oliveira; Lara, Tulio Silva; Garib, Daniela Gamba; da Silva Filho, Omar Gabriel

2014-01-01

Objective The aim of the present study was to evaluate the transverse effect of rapid maxillary expansion in patients with unilateral complete cleft lip and palate while comparing the Haas and Hyrax appliances. Methods The sample consisted of 48 patients divided into two groups: Group I - 25 patients treated with modified Haas appliance (mean age: 10 years 8 months); and Group II - 23 patients treated with Hyrax appliance (mean age: 10 years 6 months). Casts were taken during pre-expansion and after removal of the appliance at the end of the retention period. The models were scanned with the aid of the 3 Shape R700 3D scanner. Initial and final transverse distances were measured at cusp tips and cervical-palatal points of maxillary teeth by using the Ortho AnalyzerTM 3D software. Results The mean expansion obtained between cusp tips and cervical-palatal points for inter-canine width was 4.80 mm and 4.35 mm with the Haas appliance and 5.91 mm and 5.91 mm with the Hyrax appliance. As for first premolars or first deciduous molars, the values obtained were 6.46 mm and 5.90 mm in the Haas group and 7.11 mm and 6.65 mm in the Hyrax group. With regard to first molars, values were 6.11 mm and 5.24 mm in the Haas group and 7.55 mm and 6.31 mm in the Hyrax group. Conclusion Rapid maxillary expansion significantly increased the transverse dimensions of the upper dental arch in patients with cleft palate, with no significant differences between the Hass and Hyrax expanders. PMID:24945513

Transverse effect of Haas and Hyrax appliances on the upper dental arch in patients with unilateral complete cleft lip and palate: A comparative study

Directory of Open Access Journals (Sweden)

Anna Júlia de Oliveira Façanha

2014-04-01

Full Text Available Objective: The aim of the present study was to evaluate the transverse effect of rapid maxillary expansion in patients with unilateral complete cleft lip and palate while comparing the Haas and Hyrax appliances. Methods: The sample consisted of 48 patients divided into two groups: Group I - 25 patients treated with modified Haas appliance (mean age: 10 years 8 months; and Group II - 23 patients treated with Hyrax appliance (mean age: 10 years 6 months. Casts were taken during pre-expansion and after removal of the appliance at the end of the retention period. The models were scanned with the aid of the 3 Shape R700 3D scanner. Initial and final transverse distances were measured at cusp tips and cervical-palatal points of maxillary teeth by using the Ortho Analyzer(tm 3D software. Results: The mean expansion obtained between cusp tips and cervical-palatal points for inter-canine width was 4.80 mm and 4.35 mm with the Haas appliance and 5.91 mm and 5.91 mm with the Hyrax appliance. As for first premolars or first deciduous molars, the values obtained were 6.46 mm and 5.90 mm in the Haas group and 7.11 mm and 6.65 mm in the Hyrax group. With regard to first molars, values were 6.11 mm and 5.24 mm in the Haas group and 7.55 mm and 6.31 mm in the Hyrax group. Conclusion: Rapid maxillary expansion significantly increased the transverse dimensions of the upper dental arch in patients with cleft palate, with no significant differences between the Hass and Hyrax expanders.

Effects of iron and manganese on the formation of HAAs upon chlorinating Chlorella vulgaris

Energy Technology Data Exchange (ETDEWEB)

Ge, Fei, E-mail: gefei@xtu.edu.cn [Department of Environmental Science and Engineering, Xiangtan University, Egongtang Road, Xiangtan, Hunan 411105 (China); Wu, Xiuzhen; Wang, Na; Zhu, Runliang; Wang, Tong; Xu, Yin [Department of Environmental Science and Engineering, Xiangtan University, Egongtang Road, Xiangtan, Hunan 411105 (China)

2011-05-15

The major objective of the present study was to investigate the role of iron and manganese on the formation of haloacetic acids (HAAs) when algae are chlorinated at different pHs. The results showed that both iron and manganese can reduce the yields of dichloroacetic acid (DCAA) and trichloroacetic acid (TCAA) on chlorinating green alga Chlorella vulgaris (C. vulgaris) at a pH range of 6.0-9.0, and the decline of DCAA and TCAA was shown to be more significant at the low pH range. At pH 6.0, DCAA and TCAA yields decreased by 44.5% and 57.3%, respectively with the addition of 0.5 mg L{sup -1} iron, and decreased 39.5% and 49.4%, respectively with the addition of 0.5 mg L{sup -1} manganese. The main reason for decreasing the yields of HAAs as shown by scanning electron microscope (SEM) is that Fe(OH){sub 3(am)} or MnO{sub 2(am)} coat the algal cells{sub ,} which then improves their agglomeration of algal cells which is also revealed by the laser particle size analysis (LPSA).

Determination with a condenser type dosemeter of half value lager of X ray beams generated in the range from 50 to 70 kilovolt

International Nuclear Information System (INIS)

Morales Monzon, J.A.

1994-01-01

The methodology of half value lager measurement based on ratio of unit output measured before and after an additional 4 mm thick aluminium filter has been installed is studied. The use of a condenser type dosemeter model FJ301G3 produced by Beijing Nuclear Instrument Factory for that purpose is studied too. The study is base on measurement of attenuation curves using high purity aluminium filter done with a dosemeter FJ301G3 and a standard ionization chamber model NE 2530/1 from Nuclear Enterprise respectively. The X ray quality generated had similar characteristic 50 high kerma dose rate series normalized by ISO. Expressions that allow estimate half value lager in aluminium with a maximum deviation of 0,25 mm is reported. The easy handling and low cost of dispositives employed are the main advantages of that methodology. According to voltage range in which study was done, the results have application in quality control of dental X ray units

Case note: ECJ (case C-28/08 P, European Commission v. The Bavarian Lager Co. Ltd, not yet reported: privacy of EU government data)

NARCIS (Netherlands)

Curtin, D.M.

2011-01-01

The Bavarian Lager Company challenged the Commission's refusal to grant it full access tot the minutes of a meeting in Brussels with national and European civil servants as well as representatives of the European Beer Brewing Federation, including the names of all those who attended. The Court of

Improved fermentation performance of a lager yeast after repair of its AGT1 maltose and maltotriose transporter genes.

Science.gov (United States)

Vidgren, Virve; Huuskonen, Anne; Virtanen, Hannele; Ruohonen, Laura; Londesborough, John

2009-04-01

The use of more concentrated, so-called high-gravity and very-high-gravity (VHG) brewer's worts for the manufacture of beer has economic and environmental advantages. However, many current strains of brewer's yeasts ferment VHG worts slowly and incompletely, leaving undesirably large amounts of maltose and especially maltotriose in the final beers. alpha-Glucosides are transported into Saccharomyces yeasts by several transporters, including Agt1, which is a good carrier of both maltose and maltotriose. The AGT1 genes of brewer's ale yeast strains encode functional transporters, but the AGT1 genes of the lager strains studied contain a premature stop codon and do not encode functional transporters. In the present work, one or more copies of the AGT1 gene of a lager strain were repaired with DNA sequence from an ale strain and put under the control of a constitutive promoter. Compared to the untransformed strain, the transformants with repaired AGT1 had higher maltose transport activity, especially after growth on glucose (which represses endogenous alpha-glucoside transporter genes) and higher ratios of maltotriose transport activity to maltose transport activity. They fermented VHG (24 degrees Plato) wort faster and more completely, producing beers containing more ethanol and less residual maltose and maltotriose. The growth and sedimentation behaviors of the transformants were similar to those of the untransformed strain, as were the profiles of yeast-derived volatile aroma compounds in the beers.

Pavel Haas Study Day a IMR Study Day: Inter-War Avant-Garde across National and Disciplinary Borders, 30. a 31. ledna 2016, Cardiff University School of Music, Cardiff, Velká Británie

Czech Academy of Sciences Publication Activity Database

Kratochvílová, Markéta; Zapletal, Miloš

2016-01-01

Roč. 53, č. 1 (2016), s. 101-102 ISSN 0018-7003. [Pavel Haas Study Day. Cardiff, 30.01.2016] R&D Projects: GA ČR(CZ) GP14-35842P Institutional support: RVO:68378076 Keywords : Pavel Haas * conference * music * inter-war * avantgarde Subject RIV: AL - Art, Architecture, Cultural Heritage

Kas tasemetööd täidavad oma eesmärki? / Marge Lepik, Kristi Mere, Merike Haas...[jt.

Index Scriptorium Estoniae

2009-01-01

Küsimusele vastavad Lääne-Viru maavalitsuse haridusosakonna juhataja Marge Lepik, Haridus- ja Teadusministeeriumi välishindamisosakonna peaekspert Kristi Mere, Viira kooli klassiõpetaja Merike Haas, Rääma põhikooli direktor Elmo Joa ja Tallinna Ülikooli Haapsalu kolledži õppejõud Sirje Piht

Phenotypic and genetic diversity of Saccharomyces contaminants isolated from lager breweries and their phylogenetic relationship with brewing yeasts

DEFF Research Database (Denmark)

Jespersen, Lene; Kühle, Alis Van der Aa; Petersen, Kamilla M.

2000-01-01

-amplified intergenic transcribed spacer (ITS) regions. Chromosome length polymorphism (CLP) was evident among the Saccharomyces brewing contaminants with chromosome profiles typical of Saccharomyces sensu stricto. Based upon cluster analysis of their chromosome profiles the majority of the brewing contaminants could...... be grouped as either S. cerevisiae or S. pastorianus/S. bayanus. Further, the technique was able to differentiate between almost all brewing contaminants and to separate them from any specific lager brewing yeast. The diversity of the Saccharomyces brewing contaminants clearly demonstrated by their CLP...... in the SaccharomYces brewing contaminants indicate their adaptation to a maltose-enriched environment....

De Haas-van Alphen effect of a two-dimensional ultracold atomic gas

Science.gov (United States)

Farias, B.; Furtado, C.

2016-01-01

In this paper, we show how the ultracold atom analogue of the two-dimensional de Haas-van Alphen effect in electronic condensed matter systems can be induced by optical fields in a neutral atomic system. The interaction between the suitable spatially varying laser fields and tripod-type trapped atoms generates a synthetic magnetic field which leads the particles to organize themselves in Landau levels. Initially, with the atomic gas in a regime of lowest Landau level, we display the oscillatory behaviour of the atomic energy and its derivative with respect to the effective magnetic field (B) as a function of 1/B. Furthermore, we estimate the area of the Fermi circle of the two-dimensional atomic gas.

Grosse Axiallager mit Hybridschmierung - Theoretische und experimentelle Betrachtungen

DEFF Research Database (Denmark)

Santos, Ilmar; Fuerst, Axel

2003-01-01

Der vorliegende Artikel praesentiert die Simulation eines grossen axialen Kippsegmentlagers unter Beruecksichtigung der hybriden Schmierung, d.h. gleichzeitige hydrodynamische und hydrostatische Schmierung. Ein Vergleich mit Messungen zeigt, dass fuer das betrachtete Lager mit 2,2 m Durchmesser die...

Over-expressed maltose transporters in laboratory and lager yeasts: localization and competition with endogenous transporters.

Science.gov (United States)

Vidgren, Virve; Londesborough, John

2018-05-31

Plain and fluorescently tagged versions of Agt1, Mtt1 and Malx1 maltose transporters were over-expressed in two laboratory yeasts and one lager yeast. The plain and tagged versions of each transporter supported similar transport activities, indicating that they are similarly trafficked and have similar catalytic activities. When they were expressed under the control of the strong constitutive PGK1 promoter only minor proportions of the fluorescent transporters were associated with the plasma membrane, the rest being found in intracellular structures. Transport activity of each tagged transporter in each host was roughly proportional to the plasma membrane-associated fluorescence. All three transporters were subject to glucose-triggered inactivation when the medium glucose concentration was abruptly raised. Results also suggest competition between endogenous and over-expressed transporters for access to the plasma membrane. This article is protected by copyright. All rights reserved.

ANALISA MODA DAN EFEK KEGAGALAN (FAILURE MODE AND EFFECTS ANALYSIS / FMEA PADA PRODUK KURSI LIPAT CHITOSE YAMATO HAA

Directory of Open Access Journals (Sweden)

Denny Nurkertamanda

2012-02-01

Full Text Available Chitose Indonesia Manufacturing merupakan perusahaan yang memproduksi dan menjual furniture dari logam dengan kerjasama negara Jepang. Berdasarkan data penjualan Chitose Indonesia Manufacturing pada tahun 2003, kursi lipat Chitose Yamato merupakan jenis kursi lipat yang memiliki angka penjualan sebesar 59% dari keseluruhan jenis produk yang diproduksi. Kursi lipat Chitose Yamato HAA merupakan salah satu sarana untuk duduk yang dilengkapi dengan sandaran sesuai dengan bentuk punggung manusia dan dapat dilipat untuk memudahkan penyimpanannya. Selain itu juga rangka kakinya yang berbentuk H sehingga dapat digunakan pada permukaan yang datar atau bergelombang. Material yang digunakan pada rangka kursi lipat Chitose Yamato HAA adalah berupa elemen struktur rangka yang bersifat isotropik, yakni memiliki keseragaman sifat dan bahan suatu elemen (regangan, tegangan, mekanis, dsb. Pada analisa moda kegagalan dilakukan identifikasi moda kegagalan yang potensial, keparahan yang ditimbulkan, dan frekuensi kejadian moda kegagalan. Dengan menggunakan analisa moda kegagalan, maka diharapkan kualitas produk akan meningkat dan dapat digunakan sesuai dengan fungsinya. RPN adalah indikator kekritisan untuk menentukan tindakan koreksi yang sesuai dengan moda kegagalan. RPN digunakan oleh banyak prosedur FMEA untuk menaksir resiko menggunakan tiga kriteria yaitu Keparahan efek (Severity S, Kejadian penyebab (Occurrence O, Deteksi penyebab (Detection D. Angka prioritas RPN merupakan hasil kali rating keparahan, kejadian, dan deteksi. Angka ini hanyalah menunjukkan rangking atau urutan defisiensi desain sistem. Kata kunci : Moda Kegagalan, Efek Kegagalan, Penyebab Kegagalan, Deteksi, Kejadian, Keparahan, RPN (Risk Priority Number.     Chitose Manufacturing Indonesia is a company that produce and sells furniture made from alloy in cooperation with Japan. Based on Sales data by Chitose Indonesia Manufacturing in 2003, Chitose Yamato foldable chair has a sales number

Microwave radiation absorption and Shubnikov-de Haas oscillations in semimetal InAs/GaSb/AlSb composite quantum wells

Czech Academy of Sciences Publication Activity Database

Mikhailova, M. P.; Veinger, A.I.; Kochman, I.V.; Semenikhin, P.V.; Kalinina, K.V.; Parfeniev, R.V.; Berezovets, V.A.; Safonchik, M.O.; Hospodková, Alice; Pangrác, Jiří; Zíková, Markéta; Hulicius, Eduard

2016-01-01

Roč. 10, č. 4 (2016), 1-8, č. článku 046013. ISSN 1934-2608 R&D Projects: GA ČR GA13-15286S; GA MŠk LO1603 Institutional support: RVO:68378271 Keywords : Shubnikov-de Haas oscillations * microwave absorption * electron-paramagnetic resonance * composite quantum wells * InAs/GaSb/AlSb * MOVPE Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.325, year: 2016

Corrosion in Haas expanders with and without use of an antimicrobial agent: an in situ study

Science.gov (United States)

BAGATIN, Cristhiane Ristum; ITO, Izabel Yoko; ANDRUCIOLI, Marcela Cristina Damião; NELSON-FILHO, Paulo; FERREIRA, José Tarcísio Lima

2011-01-01

Objectives The purpose of this study was to evaluate in situ the occurrence of corrosion in the soldering point areas between the wire, silver brazing and band in Haas expanders. Material and Methods Thirty-four 7-12-year-old patients who needed maxillary expansion with a Haas expander were randomly assigned to two groups of 17 individuals each, according to the oral hygiene protocol adopted during the orthodontic treatment: Group I (control), toothbrushing with a fluoride dentifrice and Group II (experimental), toothbrushing with the same dentifrice plus 0.12% chlorhexidine gluconate (Periogard®) mouthrinses twice a week. The appliances were removed after approximately 4 months. Fragments of the appliances containing a metallic band with a soldered wire were sectioned at random for examination by stereomicroscopy, scanning electron microscopy (SEM) and energy dispersive x-ray spectroscopy (EDS). Data were analyzed statistically by Fisher's test at 5% significance level. Results The analysis by optical microscopy revealed areas with color change suggestive of corrosion in the soldering point areas joining the band and the wire in all specimens of both groups, with no statistically significant difference between the groups (p=1). The peaks of chemical elements (Ni, Fe, Cr, O, C and P) revealed by EDS were also similar in both groups. Conclusion: Color changes and peaks of chemical elements suggestive of corrosion were observed in the soldering point areas between the wire, silver brazing and band in both control and experimental groups, which indicate that the 0.12% chlorhexidine gluconate mouthrinses did not influence the occurrence of corrosion in situ. PMID:22231004

First Results from the Lyman Alpha Galaxies in the Epoch of Reionization (LAGER) Survey: Cosmological Reionization at z ∼ 7

Energy Technology Data Exchange (ETDEWEB)

Zheng, Zhen-Ya; Jiang, Chunyan [CAS Key Laboratory for Research in Galaxies and Cosmology, Shanghai Astronomical Observatory, Shanghai 200030 (China); Wang, Junxian; Hu, Weida; Kong, Xu [CAS Key Laboratory for Research in Galaxies and Cosmology, Department of Astronomy, University of Science and Technology of China, Hefei, Anhui 230026 (China); Rhoads, James; Malhotra, Sangeeta; Gonzalez, Alicia [School of Earth and Space Exploration, Arizona State University, Tempe, AZ 85287 (United States); Infante, Leopoldo; Galaz, Gaspar; Barrientos, L. Felipe [Institute of Astrophysics and Center for Astroengineering, Pontificia Universidad Catolica de Chile, Santiago 7820436 (Chile); Walker, Alistair R. [Cerro Tololo Inter-American Observatory, Casilla 603, La Serena (Chile); Jiang, Linhua [The Kavli Institute for Astronomy and Astrophysics, Peking University, Beijing 100871 (China); Hibon, Pascale [European Southern Observatory, Alonso de Cordova 3107, Casilla 19001, Santiago (Chile); Zheng, XianZhong, E-mail: zhengzy@shao.ac.cn, E-mail: linfante@astro.puc.cl, E-mail: jxw@ustc.edu.cn, E-mail: Sangeeta.Malhotra@asu.edu, E-mail: James.Rhoads@asu.edu [Purple Mountain Observatory, Chinese Academy of Sciences, Nanjing 210008 (China)

2017-06-20

We present the first results from the ongoing Lyman Alpha Galaxies in the Epoch of Reionization (LAGER) project, which is the largest narrowband survey for z ∼ 7 galaxies to date. Using a specially built narrowband filter NB964 for the superb large-area Dark Energy Camera (DECam) on the NOAO/CTIO 4 m Blanco telescope, LAGER has collected 34 hr NB964 narrowband imaging data in the 3 deg{sup 2} COSMOS field. We have identified 23 Ly α Emitter candidates at z = 6.9 in the central 2-deg{sup 2} region, where DECam and public COSMOS multi-band images exist. The resulting luminosity function (LF) can be described as a Schechter function modified by a significant excess at the bright end (four galaxies with L {sub Lyα∼} 10{sup 43.4±0.2} erg s{sup −1}). The number density at L {sub Ly} {sub α} ∼ 10{sup 43.4±0.2} erg s{sup −1} is little changed from z = 6.6, while at fainter L {sub Lyα} it is substantially reduced. Overall, we see a fourfold reduction in Ly α luminosity density from z = 5.7 to z = 6.9. Combined with a more modest evolution of the continuum UV luminosity density, this suggests a factor of ∼3 suppression of Ly α by radiative transfer through the z ∼ 7 intergalactic medium (IGM). It indicates an IGM neutral fraction of x {sub Hi} ∼ 0.4–0.6 (assuming Ly α velocity offsets of 100–200 km s{sup −1}). The changing shape of the Ly α LF between z ≲ 6.6 and z = 6.9 supports the hypothesis of ionized bubbles in a patchy reionization at z ∼ 7.

Shubnikov-de Haas effect study of InAs after transmutation doping at low temperatures

International Nuclear Information System (INIS)

Gerstenberg, H.; Mueller, P.

1990-01-01

Degenerate InAs single crystals have been irradiated by thermal neutrons below 6 K. The Shubnikov-de Haas effect and the electrical resistivity have been measured as a function of the neutron dose and the annealing temperature. The effects of transmutation doping and simultaneous introduction of lattice defects have been analysed in terms of the conduction electron density and the scattering rates τ ρ -1 - ρne 2 /m * and τ x -1 2πkub(B)X/h/2π (where X is the Dingle temperature). The measured conduction electron density after irradiation and thermal annealing agreed well with the values calculated from the experimental and materials parameters. The effects of radiation damage may qualitatively be explained assuming neutral In vacancies to be the most common type of defect in thermal-neutron-irradiated InAs. A comparison with similar experiments on InSb is given. (author)

Brewing and volatiles analysis of three tea beers indicate a potential interaction between tea components and lager yeast.

Science.gov (United States)

Rong, Lei; Peng, Li-Juan; Ho, Chi-Tang; Yan, Shou-He; Meurens, Marc; Zhang, Zheng-Zhu; Li, Da-Xiang; Wan, Xiao-Chun; Bao, Guan-Hu; Gao, Xue-Ling; Ling, Tie-Jun

2016-04-15

Green tea, oolong tea and black tea were separately introduced to brew three kinds of tea beers. A model was designed to investigate the tea beer flavour character. Comparison of the volatiles between the sample of tea beer plus water mixture (TBW) and the sample of combination of tea infusion and normal beer (CTB) was accomplished by triangular sensory test and HS-SPME GC-MS analysis. The PCA of GC-MS data not only showed a significant difference between volatile features of each TBW and CTB group, but also suggested some key compounds to distinguish TBW from CTB. The results of GC-MS showed that the relative concentrations of many typical tea volatiles were significantly changed after the brewing process. More interestingly, the behaviour of yeast fermentation was influenced by tea components. A potential interaction between tea components and lager yeast could be suggested. Copyright © 2015 Elsevier Ltd. All rights reserved.

Upper Critical Field and de Haas-van Alphen Oscillations in KOs2O6 Measured in a Hybrid Magnet

Science.gov (United States)

Taichi Terashima,; Nobuyuki Kurita,; Atsushi Harada,; Kota Kodama,; Jun-ichi Yamaura,; Zenji Hiroi,; Hisatomo Harima,; Shinya Uji,

2010-08-01

Magnetic torque measurements have been performed on a KOs2O6 single crystal in magnetic fields up to 35.3 T and at temperatures down to 0.6 K. The upper critical field is determined to be ˜30 T. De Haas-van Alphen oscillations are observed. A large mass enhancement of (1+λ) = m* / mband = 7.6 is found. It is suggested that, for the large upper critical field to be reconciled with Pauli paramagnetic limiting, the observed mass enhancement must be of electron-phonon origin, including electron-rattling-mode interactions, for the most part.

Chemometric classification of Chinese lager beers according to manufacturer based on data fusion of fluorescence, UV and visible spectroscopies.

Science.gov (United States)

Tan, Jin; Li, Rong; Jiang, Zi-Tao

2015-10-01

We report an application of data fusion for chemometric classification of 135 canned samples of Chinese lager beers by manufacturer based on the combination of fluorescence, UV and visible spectroscopies. Right-angle synchronous fluorescence spectra (SFS) at three wavelength difference Δλ=30, 60 and 80 nm and visible spectra in the range 380-700 nm of undiluted beers were recorded. UV spectra in the range 240-400 nm of diluted beers were measured. A classification model was built using principal component analysis (PCA) and linear discriminant analysis (LDA). LDA with cross-validation showed that the data fusion could achieve 78.5-86.7% correct classification (sensitivity), while those rates using individual spectroscopies ranged from 42.2% to 70.4%. The results demonstrated that the fluorescence, UV and visible spectroscopies complemented each other, yielding higher synergic effect. Copyright © 2015 Elsevier Ltd. All rights reserved.

easyDAS: Automatic creation of DAS servers

Directory of Open Access Journals (Sweden)

Jimenez Rafael C

2011-01-01

Full Text Available Abstract Background The Distributed Annotation System (DAS has proven to be a successful way to publish and share biological data. Although there are more than 750 active registered servers from around 50 organizations, setting up a DAS server comprises a fair amount of work, making it difficult for many research groups to share their biological annotations. Given the clear advantage that the generalized sharing of relevant biological data is for the research community it would be desirable to facilitate the sharing process. Results Here we present easyDAS, a web-based system enabling anyone to publish biological annotations with just some clicks. The system, available at http://www.ebi.ac.uk/panda-srv/easydas is capable of reading different standard data file formats, process the data and create a new publicly available DAS source in a completely automated way. The created sources are hosted on the EBI systems and can take advantage of its high storage capacity and network connection, freeing the data provider from any network management work. easyDAS is an open source project under the GNU LGPL license. Conclusions easyDAS is an automated DAS source creation system which can help many researchers in sharing their biological data, potentially increasing the amount of relevant biological data available to the scientific community.

Effects of caffeine and alcohol on mood and performance changes following consumption of lager.

Science.gov (United States)

Smith, Andrew P

2013-06-01

The present study examined whether caffeine would modify the behavioural effects of alcohol. The aim of the study was to determine whether caffeine modifies the effects of alcohol on mood and psychomotor performance and to identify possible dose-response and temporal relationships. A double-blind study examined the effects of three successive lager drinks (330 ml each) in the early afternoon on mood and psychomotor performance assessed at 30-min intervals over a 2-h period. Participants carried out a baseline session and were then randomly assigned to one of six conditions formed by combining three different doses of caffeine (0, 62.5 and 125 mg per drink) with either no alcohol or 4.3 % alcohol. One hundred and forty-six young adults (65 male, 81 female; age range 18-30 years) participated in the study. Mood (alertness, hedonic tone and anxiety) was assessed before and after performing simple reaction time and choice reaction time tasks. Alcohol was associated with higher hedonic tone (p Caffeine had no modifying effect on hedonic tone or anxiety. However, the highest dose of caffeine did remove the effect of alcohol on alertness (p caffeine were found on the performance tasks (all p values caffeine does not remove the negative effects of alcohol on performance although high doses counteract the drop in subjective alertness produced by alcohol.

Avaliação comparativa dos efeitos maxilares da expansão rápida da maxila com os aparelhos de Haas e Hyrax Comparative evaluation of maxilar effects of rapid maxilar expansion with Haas and Hyrax appliances

Directory of Open Access Journals (Sweden)

Marco Antônio Scanavini

2006-02-01

Full Text Available OBJETIVO: avaliar cefalometricamente os efeitos da expansão rápida da sutura palatina mediana sobre o posicionamento vertical e sagital da maxila, comparando os aparelhos de Haas e Hyrax. METODOLOGIA: a amostra consistiu de 93 telerradiografias obtidas de 31 pacientes jovens, brasileiros, de ambos os gêneros, na faixa etária inicial média de 13 anos e 2 meses. As radiografias foram tomadas ao início do tratamento (pré-disjunção, imediatamente após a disjunção (pós-disjunção e ao final do nivelamento. RESULTADOS E CONCLUSÕES: constatou-se que os dois aparelhos disjuntores apresentaram resultados semelhantes, com a ocorrência de deslocamento da maxila em direção inferior, sem rotação, que se manteve ao final do nivelamento e ocorrência de um deslocamento anterior logo após a disjunção, que retornou aos valores pré-disjunção ao final do nivelamento.AIM: the purpose of this cephalometric study was to evaluate, by lateral cephalograms, the changes in maxilar positioning after rapid disjunction of the midpalatal suture, following the use of two types of maxillary disjunction appliances, checked in different phases, and the likely differences between the two appliances Haas and Hyrax. METHODS: the sample comprised of 93 lateral cephalograms, taken before treatment (pre-disjunction, immediately after disjunction and at the end of levelling, obtained from 31 brazilian youths with both genres and average age of 13 years and 2 months. RESULTS AND CONCLUSIONS: both types of appliances showed similar results, with anterior and lower displacement of maxila right after disjunction. Lower displacement was without rotation, and mainttened stable until the end of levelling. Anterior displacement, however, was not stable and cephalometric measurements like SNA and Nperp-A tended to returned to initial values at the end of levelling.

de Haas-van Alphen effect investigations of the electronic structure of pure and aluminum-doped MgB2

International Nuclear Information System (INIS)

Carrington, A.; Yelland, E.A.; Fletcher, J.D.; Cooper, J.R.

2007-01-01

Our understanding of the superconducting properties of MgB 2 is strongly linked to our knowledge of its electronic structure. In this paper we review experimental measurements of the Fermi surface parameters of pure and Al-doped MgB 2 using the de Haas-van Alphen (dHvA) effect. In general, the measurements are in excellent agreement with the theoretical predictions of the electronic structure, including the strength of the electron-phonon coupling on each Fermi surface sheet. For the Al doped samples, we are able to measure how the band structure changes with doping. These results are in excellent agreement with calculations based on the virtual crystal approximation. We also review work on the dHvA effect in the superconducting state

Topological nature of the node-arc semimetal PtSn4 probed by de Haas-van Alphen quantum oscillations

Science.gov (United States)

Wang, Y. J.; Liang, D. D.; Ge, M.; Yang, J.; Gong, J. X.; Luo, L.; Pi, L.; Zhu, W. K.; Zhang, C. J.; Zhang, Y. H.

2018-04-01

Dirac node arc semimetal state is a new topological quantum state which is proposed to exist in PtSn4 (Wu et al 2016 Dirac node arcs in PtSn4 Nat. Phys. 12 667–71). We present a systematic de Haas-van Alphen quantum oscillation study on this compound. Two intriguing oscillation branches, i.e. F 1 and F 2, are detected in the fast Fourier transformation spectra, both of which are characterized to possess tiny effective mass and ultrahigh quantum mobility. And the F 2 branch exhibits an angle-dependent nontrivial Berry phase. The features are consistent with the existence of the node arc semimetal state and shed new light on its complicated Fermi surfaces and topological nature.

Population structure and reticulate evolution of Saccharomyces eubayanus and its lager-brewing hybrids.

Science.gov (United States)

Peris, David; Sylvester, Kayla; Libkind, Diego; Gonçalves, Paula; Sampaio, José Paulo; Alexander, William G; Hittinger, Chris Todd

2014-04-01

Reticulate evolution can be a major driver of diversification into new niches, especially in disturbed habitats and at the edges of ranges. Industrial fermentation strains of yeast provide a window into these processes, but progress has been hampered by a limited understanding of the natural diversity and distribution of Saccharomyces species and populations. For example, lager beer is brewed with Saccharomyces pastorianus, an alloploid hybrid of S. cerevisiae and S. eubayanus, a species only recently discovered in Patagonia, Argentina. Here, we report that genetically diverse strains of S. eubayanus are readily isolated from Patagonia, demonstrating that the species is well established there. Analyses of multilocus sequence data strongly suggest that there are two diverse and highly differentiated Patagonian populations. The low nucleotide diversity found in the S. eubayanus moiety of hybrid European brewing strains suggests that their alleles were drawn from a small subpopulation that is closely related to one of the Patagonian populations. For the first time, we also report the rare isolation of S. eubayanus outside Patagonia, in Wisconsin, USA. In contrast to the clear population differentiation in Patagonia, the North American strains represent a recent and possibly transient admixture of the two Patagonian populations. These complex and varied reticulation events are not adequately captured by conventional phylogenetic methods and required analyses of Bayesian concordance factors and phylogenetic networks to accurately summarize and interpret. These findings show how genetically diverse eukaryotic microbes can produce rare but economically important hybrids with low genetic diversity when they migrate from their natural ecological context. © 2014 John Wiley & Sons Ltd.

Microarray studies on lager brewer's yeasts reveal cell status in the process of autolysis.

Science.gov (United States)

Xu, Weina; Wang, Jinjing; Li, Qi

2014-08-01

In this work, we performed DNA microarray studies on lager brewer's yeast Saccharomyces pastorianus to investigate changes in gene expression in the process of autolysis. The two strains we used were Qing2 and 5-2. Strain 5-2 is a mutant of Qing2 and autolyzes much more slowly than its parent strain. Four samples of these two strains during different autolysis stages (0% and 15%) were tested using DNA microarray containing > 10,000 yeast's genes. Analysis of genes with the same transcription pattern (up- or down-regulated in both strains) showed that the same 99 genes were up-regulated (transcription levels were increased), and the same 97 genes were down-regulated (transcription levels were decreased) by fivefold or more during autolysis. Genes involved in energy production/utilization, protein anabolism, and stress response were down-regulated. Genes related to cell wall organization and biogenesis, starvation response and DNA damage response were up-regulated. Analysis of genes with opposite transcription patterns (up-regulated in one strain and down-regulated in the other one) showed that 246 genes were up-regulated in 5-2 (autolyzes slowly) and down-regulated in Qing2 (autolyzes rapidly). Another 18 genes had opposite transcription levels, indicating that the strain which autolyzes slowly had better cell vitality despite the same autolysis stage. These findings might further promote the global understanding of autolysis in yeast. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

Evolutionary Engineering in Chemostat Cultures for Improved Maltotriose Fermentation Kinetics in Saccharomyces pastorianus Lager Brewing Yeast

Directory of Open Access Journals (Sweden)

Anja Brickwedde

2017-09-01

Full Text Available The lager brewing yeast Saccharomyces pastorianus, an interspecies hybrid of S. eubayanus and S. cerevisiae, ferments maltotriose, maltose, sucrose, glucose and fructose in wort to ethanol and carbon dioxide. Complete and timely conversion (“attenuation” of maltotriose by industrial S. pastorianus strains is a key requirement for process intensification. This study explores a new evolutionary engineering strategy for improving maltotriose fermentation kinetics. Prolonged carbon-limited, anaerobic chemostat cultivation of the reference strain S. pastorianus CBS1483 on a maltotriose-enriched sugar mixture was used to select for spontaneous mutants with improved affinity for maltotriose. Evolved populations exhibited an up to 5-fold lower residual maltotriose concentration and a higher ethanol concentration than the parental strain. Uptake studies with 14C-labeled sugars revealed an up to 4.75-fold higher transport capacity for maltotriose in evolved strains. In laboratory batch cultures on wort, evolved strains showed improved attenuation and higher ethanol concentrations. These improvements were also observed in pilot fermentations at 1,000-L scale with high-gravity wort. Although the evolved strain exhibited multiple chromosomal copy number changes, analysis of beer made from pilot fermentations showed no negative effects on flavor compound profiles. These results demonstrate the potential of evolutionary engineering for strain improvement of hybrid, alloploid brewing strains.

Evolutionary Engineering in Chemostat Cultures for Improved Maltotriose Fermentation Kinetics in Saccharomyces pastorianus Lager Brewing Yeast.

Science.gov (United States)

Brickwedde, Anja; van den Broek, Marcel; Geertman, Jan-Maarten A; Magalhães, Frederico; Kuijpers, Niels G A; Gibson, Brian; Pronk, Jack T; Daran, Jean-Marc G

2017-01-01

The lager brewing yeast Saccharomyces pastorianus , an interspecies hybrid of S. eubayanus and S. cerevisiae , ferments maltotriose, maltose, sucrose, glucose and fructose in wort to ethanol and carbon dioxide. Complete and timely conversion ("attenuation") of maltotriose by industrial S. pastorianus strains is a key requirement for process intensification. This study explores a new evolutionary engineering strategy for improving maltotriose fermentation kinetics. Prolonged carbon-limited, anaerobic chemostat cultivation of the reference strain S. pastorianus CBS1483 on a maltotriose-enriched sugar mixture was used to select for spontaneous mutants with improved affinity for maltotriose. Evolved populations exhibited an up to 5-fold lower residual maltotriose concentration and a higher ethanol concentration than the parental strain. Uptake studies with 14 C-labeled sugars revealed an up to 4.75-fold higher transport capacity for maltotriose in evolved strains. In laboratory batch cultures on wort, evolved strains showed improved attenuation and higher ethanol concentrations. These improvements were also observed in pilot fermentations at 1,000-L scale with high-gravity wort. Although the evolved strain exhibited multiple chromosomal copy number changes, analysis of beer made from pilot fermentations showed no negative effects on flavor compound profiles. These results demonstrate the potential of evolutionary engineering for strain improvement of hybrid, alloploid brewing strains.

Experimental determination of Rashba and Dresselhaus parameters and g *-factor anisotropy via Shubnikov-de Haas oscillations

Science.gov (United States)

Herzog, F.; Hardtdegen, H.; Schäpers, Th; Grundler, D.; Wilde, M. A.

2017-10-01

The spin splitting of conduction band electrons in inversion-asymmetric InGaAs/InP quantum wells (QWs) is studied by Shubnikov-de Haas measurements combining the analysis of beating patterns and coincidence measurements in doubly tilted magnetic fields. The method allows us to determine the absolute values of the Rashba and linear Dresselhaus spin-orbit interaction (SOI) coefficients, their relative sign and the full Landé g-tensor. This is achieved by analyzing the anisotropy of the beat node positions with respect to both polar and azimuthal angles between the magnetic field direction and the QW normal. We show that the SOI is dominated by a large Rashba coefficient together with a linear Dresselhaus coefficient that is 10% of the Rashba coefficient. Their relative sign is found to be positive. The g-tensor is found to have a marked out-of-plane anisotropy and a smaller but distinct in-plane anisotropy due to SOI.

Experimental determination of Rashba and Dresselhaus parameters and g *-factor anisotropy via Shubnikov-de Haas oscillations

International Nuclear Information System (INIS)

Herzog, F; Grundler, D; Wilde, M A; Hardtdegen, H; Schäpers, Th

2017-01-01

The spin splitting of conduction band electrons in inversion-asymmetric InGaAs/InP quantum wells (QWs) is studied by Shubnikov-de Haas measurements combining the analysis of beating patterns and coincidence measurements in doubly tilted magnetic fields. The method allows us to determine the absolute values of the Rashba and linear Dresselhaus spin–orbit interaction (SOI) coefficients, their relative sign and the full Landé g-tensor. This is achieved by analyzing the anisotropy of the beat node positions with respect to both polar and azimuthal angles between the magnetic field direction and the QW normal. We show that the SOI is dominated by a large Rashba coefficient together with a linear Dresselhaus coefficient that is 10% of the Rashba coefficient. Their relative sign is found to be positive. The g-tensor is found to have a marked out-of-plane anisotropy and a smaller but distinct in-plane anisotropy due to SOI. (paper)

Studie: Lagerverwaltungssysteme und ihr Leistungsprofil: Jetzt auch im Internet

OpenAIRE

Figgener, O.

2001-01-01

Die internationale Marktstudie über Lagerverwaltungssysteme ist für das Jahr 2000 abgeschlossen. Seit April 2001 sind die Ergebnisse in einem neu-geschaffenem Internet-Portal zugänglich. In dem Portal "Warehouse Logistics" werden darüber hinaus Informationen und Veranstaltungen zu dem Themenkomplex Lager und Logistik veröffentlicht. Links zu Anbietern von LVS und Lagertechnik sind dort genauso hinterlegt wie aktuelle Vorträge oder Veröffentlichungen.

Kalyan Das

Indian Academy of Sciences (India)

Home; Journals; Resonance – Journal of Science Education. Kalyan Das. Articles written in Resonance – Journal of Science Education. Volume 5 Issue 12 December 2000 pp 76-76 Book Review. Linear Algebra and Linear Models · Kalyan Das · More Details Fulltext PDF ...

Prediction of the ageing of commercial lager beer during storage based on the degradation of iso-α-acids.

Science.gov (United States)

Blanco, Carlos A; Nimubona, Dieudonné; Caballero, Isabel

2014-08-01

Iso-α-acids and their chemically modified variants are responsible for the bitterness of beer and play a disproportionately large role in the final quality of beer. The current study was undertaken to predict the degradation of commercial lager beers related to changes in the concentration of trans-iso-α-acids during storage by using high-pressure liquid chromatography. In the analysed beers the concentration of isohumulone (average concentration 28 mg L(-1)) was greater than that of isocohumulone (20 mg L(-1)) and isoadhumulone (10 mg L(-1)). The kinetic parameters, activation energy and rate constant, of the trans-iso-α-acids were calculated. In the case of dark beers, the activation energy for the degradation of trans-isocohumulones was found to be higher than for trans-isohumulones and trans-isoadhumulones, whereas in pale and alcohol-free beers activation energies for the degradation of the three trans isomers were similar. The loss of iso-α-acids can be calculated using the activation energy of the degradation of trans-iso-α-acids and the temperature profile of the accelerated ageing. The results obtained in the investigation can be used in the beer industry to predict the alteration of the bitterness of beer during storage. © 2013 Society of Chemical Industry.

Quantum oscillations without a Fermi surface. The anomalous de Haas-van Alphen effect and relation to SmB{sub 6}

Energy Technology Data Exchange (ETDEWEB)

Knolle, Johannes; Cooper, Nigel [T.C.M. Group, Cavendish Laboratory, J. J. Thomson Avenue, Cambridge CB3 0HE (United Kingdom)

2016-07-01

The de Haas-van Alphen effect (dHvAE), describing oscillations of the magnetization as a function of magnetic field, is commonly assumed to be a definite sign for the presence of a Fermi surface (FS). Indeed, the effect forms the basis of a well-established experimental procedure for accurately measuring FS topology and geometry of metallic systems, with parameters commonly extracted by fitting to the Lifshitz-Kosevich (LK) theory based on Fermi liquid theory. Here we show that, in contrast to this canonical situation, there can be quantum oscillations even for band insulators of certain types. We provide simple analytic formulas describing the temperature dependence of the quantum oscillations in this setting, showing strong deviations from LK theory. We draw connections to recent experiments on the tentative topological Kondo insulator SmB{sub 6}.

S Das

Indian Academy of Sciences (India)

Home; Journals; Bulletin of Materials Science. S Das. Articles written in Bulletin of Materials Science. Volume 25 Issue 6 November 2002 pp 557-560. 3-D mapping with ellipsometrically determined physical thickness/refractive index of spin coated sol–gel silica layer · S Das P Pal S Roy S Chakraboarty P K Biswas.

MENYOAL KESENJANGAN ANTARA DAS SOLLEN ISLAM DENGAN DAS SEIN PRAKSIS KEHIDUPAN KAUM MUSLIMIN

Directory of Open Access Journals (Sweden)

Yusuf Suyono

2016-03-01

Full Text Available Abstract:This paper embarks from the question why the valuable Islamic ethics cannot be ethos grounded in the nation-state Muslim majority country-including in Indonesia? Phenomena such as the majlis taklim, majlis dhikr, interest pilgrimage exceeds the quota, the Islamic banking activity is equally excited, is real. However, it is not enough. Muslims should master the science, economics, and the strategic role of national politics. Islamic ethics is Dassollen, the Muslims condition is DasSein. ProphetMuḥammad has abled to unite Das sein andDassollenin his life, because Islam hasbecomehis bloodso that he is a mirror and store front of Islampar excellence. Muslims, as his follower, not been able todo like him. Al-Amir ArsalanSyākib, Muḥammad ‘Abduh, MohammadIqbal, Muḥammadal-Ghazālī, Ḥassan Ḥanafihavetried to formulatehow tobridge the gapbetween Das sollenandDasSein forMuslims. Theyhave adeep concern about thewide gapbetweenDasSeinpraxis in life of Muslims with DassollenIslamicteachings in slogan ya’lu walā yu’la ‘alaih. Whileatthe same timetheyseehowthe berufethos of Calvinismcouldencouragethe ethos ofmoderncapitalismto its adherentsin Western Europe, a Zen Buddhistethoscouldpushthe Japaneseintothe Asiantigers, andspirit Confucius encouragethe Korean peopleintothe Asiandragon. Abstrak:Tulisan ini berangkat dari pertanyaan mengapa etika Islam yang adiluhung itu tidak bisa membumi menjadi etos bangsa di negara-negara yang mayoritas penduduknya Muslim–termasuk di Indonesia. Fenomena seperti majlis taklim, majlis zikir, minat menunaikan ibadah haji melebihi kuota, aktivitas perbankan syariah tak kalah bersemangat, adalah nyata. Namun, itu tidak cukup. Umat Islam seharusnya lebih dari itu dalam penguasaan ilmu pengetahuan, ekonomi, dan peran strategis politik kebangsaan. Etika Islam itulah Das Sollen, keadaan kaum Muslimin itulah Das Sein. Muhammad Rasulullah telah mampu menyatukan Das Sein dan Das Sollen dalam hidupnya. Hal

DAS performance analysis

International Nuclear Information System (INIS)

Bates, G.; Bodine, S.; Carroll, T.; Keller, M.

1984-02-01

This report begins with an overview of the Data Acquisition System (DAS), which supports several of PPPL's experimental devices. Performance measurements which were taken on DAS and the tools used to make them are then described

Tensile strained gray tin: Dirac semimetal for observing negative magnetoresistance with Shubnikov-de Haas oscillations

Science.gov (United States)

Huang, Huaqing; Liu, Feng

2017-05-01

The extremely stringent requirement on material quality has hindered the investigation and potential applications of exotic chiral magnetic effect in Dirac semimetals. Here, we propose that gray tin is a perfect candidate for observing the chiral anomaly effect and Shubnikov-de-Haas (SdH) oscillation at relatively low magnetic field. Based on effective k .p analysis and first-principles calculations, we discover that gray tin becomes a Dirac semimetal under tensile uniaxial strain, in contrast to a topological insulator under compressive uniaxial strain as known before. In this newly found Dirac semimetal state, two Dirac points which are tunable by tensile [001] strains lie in the kz axis and Fermi arcs appear in the (010) surface. Due to the low carrier concentration and high mobility of gray tin, a large chiral anomaly induced negative magnetoresistance and a strong SdH oscillation are anticipated in this half of the strain spectrum. Comparing to other Dirac semimetals, the proposed Dirac semimetal state in the nontoxic elemental gray tin can be more easily manipulated and accurately controlled. We envision that gray tin provides a perfect platform for strain engineering of chiral magnetic effects by sweeping through the strain spectrum from positive to negative and vice versa.

Foundations of relativity theory. 7. ed.; Grundzuege der Relativitaetstheorie

Energy Technology Data Exchange (ETDEWEB)

Einstein, Albert

2009-07-01

In the present elaboration of four speeches, which I have held at the Princeton University in May 1921 I wanted to summarize the main thoughts and mathematical methods of relativity theory. Thereby I have attempted to leave out all less essential but to treat the fundamental so that the whole can serve as introduction for all those which master the elements of advanced mathematics but want not apply all to much time and inconvenience to the object. Completeness can this short presentation self-evidently not require so much as I have not treated the more subtle, more mathematically interesting developments, which are based on the variational calculus. My main goal was to let the fundamental in the whole way of thought of the theory clearly come forward. [German] ''In der vorliegenden Ausarbeitung von vier Vortraegen, die ich an der Universitaet Princeton im Mai 1921 gehalten habe, wollte ich die Hauptgedanken und mathematischen Methoden der Relativitaetstheorie zusammenfassen. Dabei habe ich mich bemueht, alles weniger Wesentliche wegzulassen, das Grundsaetzliche aber doch so zu behandeln, dass das Ganze als Einfuehrung fuer alle diejenigen dienen kann, welche die Elemente der hoeheren Mathematik beherrschen, aber nicht allzuviel Zeit und Muehe auf den Gegenstand verwenden wollen. Auf Vollstaendigkeit kann diese kurze Darlegung selbstverstaendlich keinen Anspruch machen, zumal ich die feineren, mehr mathematisch interessanten Entwicklungen, welche sich auf Variationsrechnung gruenden, nicht behandelt habe. Mein Hauptziel war es, das Grundsaetzliche in dem ganzen Gedankengang der Theorie klar hervortreten zu lassen.'' Albert Einstein (Vorwort zur 1. Auflage der ''Vier Vorlesungen ueber Relativitaetstheorie'') (orig.)

High field magnetoresistance and de Haas-van Alphen effect in antiferromagnetic PrB6 and NdB6

International Nuclear Information System (INIS)

Onuki, Y.; Umezawa, A.; Kwok, W.K.; Crabtree, G.W.; Nishihara, M.; Yamazaki, T.; Omi, T.; Komatsubara, T.

1987-08-01

The transport properties and the de Haas-van Alphen (dHvA) effect have been measured for antiferromagnetic PrB 6 and NdB 6 . The number of conduction electrons is approximately one per unit cell. The magnetoresistance shows the existence of open orbits implying a multiply connected Fermi surface. The angular dependence of the magnetoresistance is roughly similar to that of the reference material, LaB 6 . The dHvA data in PrB 6 shows both paramagnetic and antiferromagnetic Fermi surfaces. The antiferromagnetic Fermi surface arises from new magnetic Brillouin zone boundaries and antiferromagnetic gaps introduced by the magnetic order, and the paramagnetic Fermi surface from magnetic breakdown through the small antiferromagnetic gaps in high field. Hybridization between the conduction electrons and the f electrons has been observed through the cyclotron masses, which in PrB 6 are three times larger than the corresponding masses of LaB 6 . In NdB 6 only the antiferromagnetic Fermi surface, quite different from those of LaB 6 and PrB 6 , has been observed. 26 refs., 10 figs., 3 tabs

MiDAS

DEFF Research Database (Denmark)

McIlroy, Simon Jon; Saunders, Aaron Marc; Albertsen, Mads

2015-01-01

The Microbial Database for Activated Sludge (MiDAS) field guide is a freely available online resource linking the identity of abundant and process critical microorganisms in activated sludge wastewater treatment systems to available data related to their functional importance. Phenotypic properties...... of some of these genera are described, but most are known only from sequence data. The MiDAS taxonomy is a manual curation of the SILVA taxonomy that proposes a name for all genus-level taxa observed to be abundant by large-scale 16 S rRNA gene amplicon sequencing of full-scale activated sludge...... communities. The taxonomy can be used to classify unknown sequences, and the online MiDAS field guide links the identity to the available information about their morphology, diversity, physiology and distribution. The use of a common taxonomy across the field will provide a solid foundation for the study...

Transport properties and giant Shubnikov-de Haas oscillations in the first organic conductor with metal complex anion containing selenocyanate ligand, (ET)2TlHg(SeCN)4

International Nuclear Information System (INIS)

Laukhin, V.N.; Audouard, A.; Rakoto, H.; Broto, J.M.; Goze, F.; Coffe, G.; Brossard, L.; Redoules, J.P.; Kartsovnik, M.V.; Kushch, N.D.; Buravov, L.I.; Khomenko, A.G.; Yagubskii, E.B.; Askenazy, S.; Pari, P.

1995-01-01

Temperature dependence of the resistivity in various crystallographic directions and high pulsed field magnetoresistance of organic metal α-(ET) 2 TlHg(SeCN) 4 have been studied at temperatures down to 80 mK. Giant Shubnikov-de Haas oscillations, which are attributed to the two-dimensional nature of the cylindrical Fermi surface with a very small warping along the direction of the lowest conductivity have been observed. Four harmonics of the fast oscillations with fundamental frequency F 0 =653±3 T and slow frequency oscillations with F s =38±5 T have been revealed. (orig.)

Willkommen in Panorama Theresienstadt. Kinematographie und Zerstörung in der Stadt namens „Als Ob“ (Lesung H. G. Adlers

Directory of Open Access Journals (Sweden)

Irina Sandomirskaja

2016-10-01

Full Text Available In seinem Theresienstadt 1941-1945 beschreibt Hans Günther Adler Episoden aus dem Prozess des Filmens in Theresienstadt. Seine größte Aufmerksamkeit liegt dabei auf der Produktion des Films von 1944, den er zusammenfassend aufgrund seines Zwecks und seiner Durchführung „der grausige Filmkarneval” nennt. Bemerkenswerterweise widmet Adler ein ganzes Buchkapitel der Beschreibung des kulturellen Lebens von Theresienstadt, ohne dabei den Film in zusammen mit anderen Beispielen kultureller Ausdrucksformen zu nennen – die Beschreibung des Films ist in der administrativen Chronik von Theresienstadt eingegliedert. Der Film erhält einen Platz für sich innerhalb des Kontextes der bürokratischen Umgestaltung Theresienstadts von einem geschlossenen Lager zu einem „Ghetto“ und schließlich zu einer rein dekorativen „jüdischen Siedlung“ hin. Diese letztere Umgestaltung beschreibt Adler als Teil einer zynischen Kampagne zur „Verschönerung“ von Theresienstadt, im Zuge derer SS und Verwaltung versuchten, das Lager für internationale Beobachter vorzeigbar zu machen. Adler beschreibt den „grausigen Filmkarneval“ als Aushängeschild der Kampagne und schließt ihn so entschieden aus dem Bereich kultureller Phänomene aus, als würde er jede Möglichkeit zu seiner Entlastung ablehnen. Stattdessen schreibt er das Projekt in die administrative Logik der Vernichtung ein, wodurch das Filmen zu einer zusätzlichen – in ihrer Grausamkeit ideenreichen und effektiven – Technik moralischer Vernichtung in der Welt des „verwalteten Menschen” avanciert. In diesem Artikel werde ich Adlers Sicht auf das Bewegtbild als überwiegend administratives Mittel, nicht als Medium kulturellen Ausdrucks hervorheben. Diese Ansicht wird durchaus herausfordernd und komplex, wenn Adlers Zeugenbericht über das Filmprojekt in Theresienstadt in Zusammenhang mit seinen Überlegungen zu mechanisch reproduzierbaren und vor allem bewegten Bildern in Adlers

P K Das

Indian Academy of Sciences (India)

Home; Journals; Bulletin of Materials Science. P K Das. Articles written in Bulletin of Materials Science. Volume 23 Issue 4 August 2000 pp 249-253 Nitride Ceramics. Optimization of time–temperature schedule for nitridation of silicon compact on the basis of silicon and nitrogen reaction kinetics · J Rakshit P K Das.

P Chaitanya Das

Indian Academy of Sciences (India)

P Chaitanya Das G Srinivasa Murthy C P Gopalakrishnan P C Deshmukh · More Details Fulltext PDF. Volume 9 Issue 7 July 2004 pp 77-85 Classroom. Motion of Charged Particles in Electromagnetic Fields and Special Theory of Relativity · P Chaitanya Das G Srinivasa Murthy P C Deshmukh K Satish Kumar T A Venkatesh.

S K Das

Indian Academy of Sciences (India)

Home; Journals; Bulletin of Materials Science. S K Das. Articles written in Bulletin of Materials Science. Volume 24 Issue 4 August 2001 pp 373-378 Metals and Alloys. Evaluation of solid–liquid interface profile during continuous casting by a spline based formalism · S K Das · More Details Abstract Fulltext PDF. A numerical ...

B P Das

Indian Academy of Sciences (India)

Home; Journals; Bulletin of Materials Science. B P Das. Articles written in Bulletin of Materials Science. Volume 25 Issue 6 November 2002 pp 517-519. Structural, dielectric and electrical properties of Sm-modified Pb(SnTi)O3 ferroelectric system · B P Das R N P Choudhary P K Mahapatra · More Details Abstract Fulltext ...

A K Das

Indian Academy of Sciences (India)

Home; Journals; Bulletin of Materials Science. A K Das. Articles written in Bulletin of Materials Science. Volume 28 Issue 2 April 2005 pp 131-136 Fly Ash. Some studies on the reaction between fly ash and lime · A Basumajumdar A K Das N Bandyopadhyay S Maitra · More Details Abstract Fulltext PDF. The reaction between ...

Estimativa do vigor das sementes e das plântulas de Bixa orellana L.

Directory of Open Access Journals (Sweden)

Roberta Leopoldo Ferreira

Full Text Available RESUMO A multiplicação de espécies como as da planta de urucum tem limitações em função do conhecimento limitado das características morfológicas e fisiológicas das sementes e das plântulas e da restrição de métodos para determinar a qualidade dessas sementes. Nessa pesquisa, o objetivo foi estudar a adequação do teste de envelhecimento acelerado para estimar o vigor das sementes de urucum (Bixa orellana L., relacionando os resultados desse teste com a formação das plântulas e as diferenças de genótipo dos acessos genéticos. As sementes de urucum, representadas por quatro acessos genéticos, e por três lotes, foram avaliadas pelos testes de germinação, primeira contagem da germinação, classificação do vigor das plântulas e emergência das plântulas (total e índice de velocidade. No teste de envelhecimento acelerado foram avaliados a temperatura, de 41 ºC, e os períodos, de 48; 72 e 96 horas, de exposição das sementes às umidades relativas de 100% (água e de 76% (solução saturada de NaCl. A solução saturada reduz a quantidade de água absorvida pelas sementes de urucum, expostas às condições do teste de envelhecimento acelerado, reduzindo a deterioração das sementes, favorecendo a uniformidade dos resultados e a redução da proliferação de fungos, comuns na germinação das sementes de urucum. O teste de envelhecimento acelerado, com água ou solução salina, por 72 horas ou 96 horas, é eficiente para classificar as sementes de urucum quanto à qualidade. Assim, as variações dos teores de água das sementes de urucum devem ser entre 23;6 e 28;9% (72 horas e 29;7 e 32;9% (96 horas para a utilização da água e entre 7,3 e 9,5% para a utilização da solução salina de NaCl.

Uma análise empírica sobre as preferências do consumidor brasileiro de cervejas artesanais

OpenAIRE

Santos, Vinicius Cassar Kfuri

2014-01-01

Um dos produtos mais consumidos do mundo vem passando por grandes transformações, e a cerveja que conhecemos como tipo Pilsen (Light Lager) deixou de ser opção única nas prateleiras. Dado o potencial de crescimento do setor no Brasil, o objetivo deste trabalho é mapear as preferências do consumidor de cerveja artesanal, usando técnicas de preferência declarada, a partir da aplicação de questionários que convidam o entrevistado a elencar suas preferências diante das combinações dos atribut...

First Spectroscopic Confirmations of z ∼ 7.0 Ly α Emitting Galaxies in the LAGER Survey

Energy Technology Data Exchange (ETDEWEB)

Hu, Weida; Wang, Junxian; Kang, Wenyong; Kong, Xu; Yang, Huan [CAS Key Laboratory for Research in Galaxies and Cosmology, Department of Astronomy, University of Science and Technology of China, Hefei, Anhui 230026 (China); Zheng, Zhen-Ya; Jiang, Chunyan [CAS Key Laboratory for Research in Galaxies and Cosmology, Shanghai Astronomical Observatory, Shanghai 200030 (China); Malhotra, Sangeeta; Rhoads, James; Gonzalez, Alicia; Tilvi, Vithal [School of Earth and Space Exploration, Arizona State University, Tempe, AZ 85287 (United States); Infante, Leopoldo [Las Campanas Observatory, Carnegie Institution for Science, Casilla 601, La Serena (Chile); Walker, Alistair R. [Cerro Tololo Inter-American Observatory, Casilla 603, La Serena (Chile); Jiang, Linhua [The Kavli Institute for Astronomy and Astrophysics, Peking University, Beijing 100871 (China); Hibon, Pascale [European Southern Observatory, Alonso de Cordova 3107, Casilla 19001, Santiago (Chile); Barrientos, L. Felipe; Galaz, Gaspar [Centro de Astroingeniería, Facultad de Física, Pontificia Universidad Católica de Chile, Santiago (Chile); Finkelstein, Steven [Department of Astronomy, The University of Texas at Austin, Austin, TX 78712 (United States); Zheng, XianZhong, E-mail: urverda@mail.ustc.edu.cn, E-mail: jxw@ustc.edu.cn, E-mail: zhengzy@shao.ac.cn, E-mail: Sangeeta.Malhotra@asu.edu, E-mail: James.Rhoads@asu.edu, E-mail: linfante@carnegiescience.edu [Purple Mountain Observatory, Chinese Academy of Sciences, Nanjing 210008 (China)

2017-08-20

Narrowband imaging is a highly successful approach for finding large numbers of high-redshift Ly α emitting galaxies (LAEs) up to z ∼ 6.6. However, at z ≳ 7 there are as of yet only three narrowband selected LAEs with spectroscopic confirmations (two at z ∼ 6.9–7.0, one at z ∼ 7.3), which hinders extensive studies on cosmic reionization and galaxy evolution at this key epoch. We have selected 23 candidate z ∼ 6.9 LAEs in COSMOS field with the large area narrowband survey Lyman-Alpha Galaxies at the End of Reionization (LAGER). In this work, we present spectroscopic follow-up observations of 12 candidates using the Inamori Magellan Areal Camera and Spectrograph on Magellan. For nine of these, the observations are sufficiently deep to detect the expected lines. Ly α emission lines are identified in six sources (yielding a success rate of 2/3), including three luminous LAEs with Ly α luminosities of L {sub Lyα} ∼ 10{sup 43.5} erg s{sup −1}, the highest among known spectroscopically confirmed galaxies at ≳7.0. This triples the sample size of spectroscopically confirmed narrowband selected LAEs at z ≳ 7, and confirms the bright-end bump in the Ly α luminosity function we previously derived based on the photometric sample, supporting a patchy reionization scenario. Two luminous LAEs appear physically linked with a projected distance of 1.1 pMpc and velocity difference of ∼170 km s{sup −1}. They likely sit in a common ionized bubble produced by themselves or with close neighbors, which reduces the intergalactic medium attenuation of Ly α . A tentative narrow N v λ 1240 line is seen in one source, hinting at activity of a central massive black hole with metal-rich line-emitting gas.

Transport properties and giant Shubnikov-de Haas oscillations in the first organic conductor with metal complex anion containing selenocyanate ligand, (ET){sub 2}TlHg(SeCN){sub 4}

Energy Technology Data Exchange (ETDEWEB)

Laukhin, V.N. [Service National des Champs Magnetiques Pulses du CNRS et Laboratoire de Physique des Solides, URA CNRS 074, Complexe Scientifique de Rangueil, 31077 Toulouse (France)]|[Institute of Chemical Physics in Chernogolovka, Russian Academy of Sciences, Chernogolovka, MD 142432 (Russian Federation); Audouard, A. [Service National des Champs Magnetiques Pulses du CNRS et Laboratoire de Physique des Solides, URA CNRS 074, Complexe Scientifique de Rangueil, 31077 Toulouse (France); Rakoto, H. [Service National des Champs Magnetiques Pulses du CNRS et Laboratoire de Physique des Solides, URA CNRS 074, Complexe Scientifique de Rangueil, 31077 Toulouse (France); Broto, J.M. [Service National des Champs Magnetiques Pulses du CNRS et Laboratoire de Physique des Solides, URA CNRS 074, Complexe Scientifique de Rangueil, 31077 Toulouse (France); Goze, F. [Service National des Champs Magnetiques Pulses du CNRS et Laboratoire de Physique des Solides, URA CNRS 074, Complexe Scientifique de Rangueil, 31077 Toulouse (France); Coffe, G. [Service National des Champs Magnetiques Pulses du CNRS et Laboratoire de Physique des Solides, URA CNRS 074, Complexe Scientifique de Rangueil, 31077 Toulouse (France); Brossard, L. [Service National des Champs Magnetiques Pulses du CNRS et Laboratoire de Physique des Solides, URA CNRS 074, Complexe Scientifique de Rangueil, 31077 Toulouse (France); Redoules, J.P. [Service National des Champs Magnetiques Pulses du CNRS et Laboratoire de Physique des Solides, URA CNRS 074, Complexe Scientifique de Rangueil, 31077 Toulouse (France); Kartsovnik, M.V. [Institute of Solid State Physics, Russian Academy of Sciences, Chernogolovka, MD 142432 (Russian Federation); Kushch, N.D. [Institute of Chemical Physics in Chernogolovka, Russian Academy of Sciences, Chernogolovka, MD 142432 (Russian Federation); Buravov, L.I.

1995-05-01

Temperature dependence of the resistivity in various crystallographic directions and high pulsed field magnetoresistance of organic metal {alpha}-(ET){sub 2}TlHg(SeCN){sub 4} have been studied at temperatures down to 80 mK. Giant Shubnikov-de Haas oscillations, which are attributed to the two-dimensional nature of the cylindrical Fermi surface with a very small warping along the direction of the lowest conductivity have been observed. Four harmonics of the fast oscillations with fundamental frequency F{sub 0}=653{+-}3 T and slow frequency oscillations with F{sub s}=38{+-}5 T have been revealed. (orig.).

Das Bauhaus in Bewegung - wie das Bauhausgebäude in Dessau funktioniert

OpenAIRE

Seyler Thomas

2016-01-01

Analyse und Deutung des Bauhausentwurfs - wie das Bauhaus funktioniert Ein Architekt analysiert und deutet den Bauhausentwurf Das Bauhaus in Dessau gilt als Inbegriff einer räumlich freien Anordnung. Diese lässt sich jedoch auf den Prozess einer Entfaltung zurückführen. Der Autor erklärt Schritt für Schritt die Systematik des Entwurfs aus seiner beruflichen Erfahrung.

I M L Das

Indian Academy of Sciences (India)

Home; Journals; Bulletin of Materials Science. I M L Das. Articles written in Bulletin of Materials Science. Volume 33 Issue 4 August 2010 pp 383-390 Electrical Properties. Temperature dependence of electromechanical properties of PLZT /57/43 ceramics · A K Shukla V K Agrawal I M L Das Janardan Singh S L Srivastava.

Adaptive evolution of the lager brewing yeast Saccharomyces pastorianus for improved growth under hyperosmotic conditions and its influence on fermentation performance.

Science.gov (United States)

Ekberg, Jukka; Rautio, Jari; Mattinen, Laura; Vidgren, Virve; Londesborough, John; Gibson, Brian R

2013-05-01

An adaptive evolution method to obtain stable Saccharomyces pastorianus brewing yeast variants with improved fermentation capacity is described. The procedure involved selection for rapid growth resumption at high osmotic strength. It was applied to a lager strain and to a previously isolated ethanol-tolerant strain. Fermentation performance of strains was compared at 15 °P wort strength. A selected osmotolerant variant of the ethanol-tolerant strain showed significantly shorter fermentation time than the parent strain, producing 6.45% alcohol by volume beer in 4-5 days with mostly similar organoleptic properties to the original strain. Diacetyl and pentanedione contents were 50-75% and 3-methylbutyl acetate and 2-phenylethyl acetate 50% higher than with the original strain, leading to a small flavour change. The variant contained significantly less intracellular trehalose and glycogen than the parent. Transcriptional analysis of selected genes at 24 h revealed reduced transcription of hexose transport genes and increased transcription of the MALx1 and MALx2 genes, responsible for α-glucoside uptake and metabolism. It is suggested that an attenuated stress response contributes to the improved fermentation performance. Results show that sequential selection for both ethanol tolerance and rapid growth at high osmotic strength can provide strains with enhanced fermentation speed with acceptable product quality. © 2013 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Shubnikov - de Haas oscillations, weak antilocalization effect and large linear magnetoresistance in the putative topological superconductor LuPdBi

Science.gov (United States)

Pavlosiuk, Orest; Kaczorowski, Dariusz; Wiśniewski, Piotr

2015-01-01

We present electronic transport and magnetic properties of single crystals of semimetallic half-Heusler phase LuPdBi, having theoretically predicted band inversion requisite for nontrivial topological properties. The compound exhibits superconductivity below a critical temperature Tc = 1.8 K, with a zero-temperature upper critical field Bc2 ≈ 2.3 T. Although superconducting state is clearly reflected in the electrical resistivity and magnetic susceptibility data, no corresponding anomaly can be seen in the specific heat. Temperature dependence of the electrical resistivity suggests existence of two parallel conduction channels: metallic and semiconducting, with the latter making negligible contribution at low temperatures. The magnetoresistance is huge and clearly shows a weak antilocalization effect in small magnetic fields. Above about 1.5 T, the magnetoresistance becomes linear and does not saturate in fields up to 9 T. The linear magnetoresistance is observed up to room temperature. Below 10 K, it is accompanied by Shubnikov-de Haas oscillations. Their analysis reveals charge carriers with effective mass of 0.06 me and a Berry phase very close to π, expected for Dirac-fermion surface states, thus corroborating topological nature of the material. PMID:25778789

Split Fermi Surfaces of the Spin-Orbit-Coupled Metal Cd2Re2O7 Probed by de Haas-van Alphen Effect

Science.gov (United States)

Matsubayashi, Yasuhito; Sugii, Kaori; Hirose, Hishiro T.; Hirai, Daigorou; Sugiura, Shiori; Terashima, Taichi; Uji, Shinya; Hiroi, Zenji

2018-05-01

The superconducting pyrochlore oxide Cd2Re2O7 shows a structural transition with inversion symmetry breaking (ISB) at Ts1 = 200 K. A recent theory [https://doi.org/10.1103/PhysRevLett.115.026401" xlink:type="simple">L. Fu, Phys. Rev. Lett. 115, 026401 (2015)] suggests that the origin is an electronic instability that leads to a multipolar order in the spin-orbit-coupled metal. To observe the Fermi surface of the low-temperature phase of Cd2Re2O7, we perform de Haas-van Alphen effect measurements by means of magnetic torque. In reference to a calculated band structure, the spin-split Fermi surfaces with large cyclotron masses of 5-9m0 are revealed. The splitting is suggested to be due to an antisymmetric spin-orbit coupling induced by ISB, the strength of which is estimated to be approximately 67 K, which is rather smaller than those of typical non-centrosymmetric metals.

Erklärung der individuellen Existenzgründungsabsicht: Die 'theory of planned behavior' als sozialpsychologisches Modell im Gründungskontext

OpenAIRE

Tegtmeier, Silke

2006-01-01

Mittels einer empirischen Untersuchung (n=208) bei Lüneburger Studierenden wird Ajzens 'Theory of Planned Behavior' - eine einschlägige Theorie zur Erklärung spezifischen Verhaltens- auf die Erklärung der individuellen Gründungsabsicht angewendet. Im Anschluss an die Darlegung des Forschungsansatzes werden Ergebnisse der Untersuchung besprochen. Hierarchische Regressionsanalysen zeigen, dass Einstellung, sozialer Druck und wahrgenommene Verhaltenskontrolle maßgeblich zur Schätzung der Gründun...

Mass Enhancement of Nearly Trivalent Compound EuCo2Si2: Studied by the de Haas-van Alphen Experiments and Energy Band Calculations

International Nuclear Information System (INIS)

Ōnuki, Yoshichika; Hedo, Masato; Nakama, Takao; Nakamura, Ai; Aoki, Dai; Boukahil, Mounir; Haga, Yoshinori; Takeuchi, Tetsuya; Harima, Hisatomo

2015-01-01

We succeeded in growing single crystals of EuCo 2 Si 2 by the Bridgman method, and carried out the de Haas-van Alphen (dHvA) experiments. EuCo 2 Si 2 was previously studied from a viewpoint of the trivalent electronic state on the basis of the magnetic susceptibility and X-ray absorption experiments, whereas most of the other Eu compounds order magnetically, with the divalent electronic state. The detected dHvA branches in the present experiments are found to be explained by the results of the full potential linearized augmented plane wave energy band calculations on the basis of a local density approximation (LDA) for YCo 2 Si 2 (LDA) and EuCo 2 Si 2 (LDA + U), revealing the trivalent electronic state. The detected cyclotron effective masses are moderately large, ranging from 1.2 to 2.9 m 0

How much of our environment do we need?. MIPS - a measuring method for an ecological economy; Wieviel Umwelt braucht der Mensch?. MIPS - Das Mass fuer oekologisches Wirtschaften

Energy Technology Data Exchange (ETDEWEB)

Schmidt-Bleek, F.; Klueting, R.

1994-12-31

This book illustrates how much of our environment we use up with the products and services associated with everyday life, how large the ecological impact of our consume society actually is; we build roads, dams, heavy goods vehicles, warehouses, factories, monocultures and rubbish tips. We take iron ore, sand, gravel, coal oil, water, air and wood from our environment in huge, ever-increasing qualities. Slag heaps, erosion and disrupted water flow are left behind. This man-made materialistic society is altering nature`s balance persistently and for the long term. This materialism is no longer ecologically sustainable. We must learn to prosper with less negative environmental impacts. The author has developed a means of measuring the intensity of environmental impact of products, processes and services, based on the material consumed to allow acurate comparisons. In this comprehensible informative book he reveals, for the first time publicly, the measure/formula by means of many practical examples and illustrations to show a way out of the crisis. (orig./UA) [Deutsch] Dieses Buch veranschaulicht, wieviel Umwelt wir fuer Produkte und Dienstleistungen des taeglichen Lebens verbrauchen, wie gross die `oekologischen Rucksaecke` unseres Konsums wirklich sind: Wir bauen Strassen, Daemme, Lastwagen, Lager, Fabriken, Supermaerkte, Legen Monokulturen und Abfalldeponien an. Aus der Umwelt holen wir Erze, Sand, Kies, Oel, Wasser, Luft und Holz in riesigen und immer wachsenden Mengen. Zurueck bleiben Abraumhalden, Erosionen und gestoerte Wasserlaeufe. Die menschengemachten Materialverschiebungen, die Stoffstroeme, veraendern die natuerlichen Balancen, nachhaltig und unaufhaltsam. Die Materialintensitaet unseres Wohlstandes ist oekologisch nicht mehr tragbar. Wir muessen lernen, Wohlstand mit weniger Umwelt zu erhalten und zu schaffen. Der Autor hat ein neues Mass (mips=Material-Intensitaet pro Serviceeinheit) entwickelt, dessen Basis der Stoffverbrauch ist und das es

Comparison of DNA-based techniques for differentiation of production strains of ale and lager brewing yeast.

Science.gov (United States)

Kopecká, J; Němec, M; Matoulková, D

2016-06-01

Brewing yeasts are classified into two species-Saccharomyces pastorianus and Saccharomyces cerevisiae. Most of the brewing yeast strains are natural interspecies hybrids typically polyploids and their identification is thus often difficult giving heterogenous results according to the method used. We performed genetic characterization of a set of the brewing yeast strains coming from several yeast culture collections by combination of various DNA-based techniques. The aim of this study was to select a method for species-specific identification of yeast and discrimination of yeast strains according to their technological classification. A group of 40 yeast strains were characterized using PCR-RFLP analysis of ITS-5·8S, NTS, HIS4 and COX2 genes, multiplex PCR, RAPD-PCR of genomic DNA, mtDNA-RFLP and electrophoretic karyotyping. Reliable differentiation of yeast to the species level was achieved by PCR-RFLP of HIS4 gene. Numerical analysis of the obtained RAPD-fingerprints and karyotype revealed species-specific clustering corresponding with the technological classification of the strains. Taxonomic position and partial hybrid nature of strains were verified by multiplex PCR. Differentiation among species using the PCR-RFLP of ITS-5·8S and NTS region was shown to be unreliable. Karyotyping and RFLP of mitochondrial DNA evinced small inaccuracies in strain categorization. PCR-RFLP of HIS4 gene and RAPD-PCR of genomic DNA are reliable and suitable methods for fast identification of yeast strains. RAPD-PCR with primer 21 is a fast and reliable method applicable for differentiation of brewing yeasts with only 35% similarity of fingerprint profile between the two main technological groups (ale and lager) of brewing strains. It was proved that PCR-RFLP method of HIS4 gene enables precise discrimination among three technologically important Saccharomyces species. Differentiation of brewing yeast to the strain level can be achieved using the RAPD-PCR technique. © 2016 The

"Das Konkrete ist das Abstrakte, an das man sich schließlich gewöhnt hat." (Laurent Schwartz) Über den Ablauf des mathematischen Verstehens

Science.gov (United States)

Lowsky, Martin

Die im Titel genannte Aussage findet sich in den Lebenserinnerungen von Laurent Schwartz (1915-2002), einem der fruchtbarsten Mathematiker, Mitglied der Gruppe Bourbaki. Im Original lautet die Aussage: "un objet concret est un objet abstrait auquel on a fini par s'habituer." Schwartz erläutert sie am Beispiel des Integrals über {e^{-1/2{x^2}}} , das den Wert Wurzel aus 2π hat und in dem sich also die Zahlen e und π verknüpfen. Was Schwartz aber vor allem ausdrücken will, ist dies: Das mathematische Verständnisd geht langsam vor sich und es bedarf der Anstrengung. "Es ist eine Frage der Zeit und der Energie", sagt Schwartz, und gerade dies mache es so schwer, die höhere Mathematik unter das Volk zu bringen. Das Lernen und Lehren von Mathematik laufe eben mühevoll und langsam ab.

QUAL O FUTURO DAS ESCOLAS NO CAMPO?

Directory of Open Access Journals (Sweden)

Célia Regina Vendramini

2015-09-01

Full Text Available RESUMO:Tendo como ponto de partida a questão sobre o futuro das escolas rurais ou do campo, o artigo aborda o contexto social, político e econômico que suporta ou não a existência das escolas, bem como uma análise sobre a situação das escolas em diferentes contextos, particularmente no Brasil, em Portugal e nos Estados Unidos. Problematizamos as respostas dadas pelo poder público, acadêmicos e organizações e movimentos sociais sobre o fechamento, a redução do número de alunos e de comunidades rurais com escola, as condições de funcionamento, a distância percorrida pelos alunos, além das implicações das escolas para a vitalidade do campo. Concluímos que o futuro das escolas está diretamente relacionado com o futuro do campo.

The cold storage economy in Western Europe; Die Kuehlhauswirtschaft in Westeuropa

Energy Technology Data Exchange (ETDEWEB)

Duiven, J E [AEEF, Bruessel (Belgium)

1996-12-31

This article contains a short explanation of the functions of the AEEF, the European Association for Cold Stores and Deep Freeze Rooms. `Cold` is essential for the preparation and preservation of foodstuffs. `Refrigeration` has become a considerable part of our wellbeing. The production and use of cold is dealt with, where the problems of CFC`s are touched on briefly. Some attention is also devoted to the saving of electricity. Some management instruments connected with the quality of services, with safety and with hygiene are also mentioned. All this will be placed in the context of European Guidelines and European Standards, where these refer to this sector, eg: temperature control in the cooling chain, standardisation, safety and protection of the environment (CEN/TC 182), reducing CFC`s, Packing waste, hygiene (HACCP), CO{sub 2} tax etc. Finally, some trends regarding the direction in which the sector will develop follow. (orig.) [Deutsch] Der Vortrag enthaelt eine kurze Darlegung der Funktion der AEEF, des europaeischen Verbandes fuer gewerbliche Kuehl- und Tiefkuehlhaeuser. Fuer das Bereiten und Konservieren von Nahrungsmitteln ist ``Kaelte`` unerlaesslich. ``Kaelte`` ist ein wesentlicher Unterteil unserer Wohlfahrt geworden. Es wird eingegangen auf das Produzieren und das Verwenden von Kaelte, wobei kurz die Problematik der FCKW beruehrt werden wird. Weiter wird auch der Einsparung von Eletrizitaet Aufmerksamkeit gewidmet. Einige mit Qualitaet der Dienstleistung, mit der Sicherheit und mit Hygiene zusammenhaengende Managementsinstrumente werden auch erwaehnt werden. Dies alles wird in den Rahmen von europaeischen Richtlinien und europaeischen Normen gestellt werden insofern diese sich auf diesen Sektor beziehen, z.B. Temperaturkontrolle in der Kuehlkette, Normung, Sicherheit und Umweltschutz (CEN/TC 182), Abbau FCKW, Verpackungsabfall, Hygiene (HACCP), CO2-tax, usw. Zum Schluss folgen dann noch einige Trends hinsichtlich der Richtung in die sich der Sektor

The cold storage economy in Western Europe; Die Kuehlhauswirtschaft in Westeuropa

Energy Technology Data Exchange (ETDEWEB)

Duiven, J.E. [AEEF, Bruessel (Belgium)

1995-12-31

This article contains a short explanation of the functions of the AEEF, the European Association for Cold Stores and Deep Freeze Rooms. `Cold` is essential for the preparation and preservation of foodstuffs. `Refrigeration` has become a considerable part of our wellbeing. The production and use of cold is dealt with, where the problems of CFC`s are touched on briefly. Some attention is also devoted to the saving of electricity. Some management instruments connected with the quality of services, with safety and with hygiene are also mentioned. All this will be placed in the context of European Guidelines and European Standards, where these refer to this sector, eg: temperature control in the cooling chain, standardisation, safety and protection of the environment (CEN/TC 182), reducing CFC`s, Packing waste, hygiene (HACCP), CO{sub 2} tax etc. Finally, some trends regarding the direction in which the sector will develop follow. (orig.) [Deutsch] Der Vortrag enthaelt eine kurze Darlegung der Funktion der AEEF, des europaeischen Verbandes fuer gewerbliche Kuehl- und Tiefkuehlhaeuser. Fuer das Bereiten und Konservieren von Nahrungsmitteln ist ``Kaelte`` unerlaesslich. ``Kaelte`` ist ein wesentlicher Unterteil unserer Wohlfahrt geworden. Es wird eingegangen auf das Produzieren und das Verwenden von Kaelte, wobei kurz die Problematik der FCKW beruehrt werden wird. Weiter wird auch der Einsparung von Eletrizitaet Aufmerksamkeit gewidmet. Einige mit Qualitaet der Dienstleistung, mit der Sicherheit und mit Hygiene zusammenhaengende Managementsinstrumente werden auch erwaehnt werden. Dies alles wird in den Rahmen von europaeischen Richtlinien und europaeischen Normen gestellt werden insofern diese sich auf diesen Sektor beziehen, z.B. Temperaturkontrolle in der Kuehlkette, Normung, Sicherheit und Umweltschutz (CEN/TC 182), Abbau FCKW, Verpackungsabfall, Hygiene (HACCP), CO2-tax, usw. Zum Schluss folgen dann noch einige Trends hinsichtlich der Richtung in die sich der Sektor

Absence of fks1p in lager brewing yeast results in aberrant cell wall composition and improved beer flavor stability.

Science.gov (United States)

Wang, Jin-jing; Xu, Wei-na; Li, Xin'er; Li, Jia; Li, Qi

2014-06-01

The flavor stability during storage is very important to the freshness and shelf life of beer. However, beer fermented with a yeast strain which is prone to autolyze will significantly affect the flavor of product. In this study, the gene encoding β-1,3-glucan synthetase catalytic subunit (fks1) of the lager yeast was destroyed via self-clone strategy. β-1,3-glucan is the principle cell wall component, so fks1 disruption caused a decrease in β-1,3-glucan level and increase in chitin level in cell wall, resulting in the increased cell wall thickness. Comparing with wild-type strain, the mutant strain had 39.9 and 63.41 % less leakage of octanoic acid and decanoic acid which would significantly affect the flavor of beer during storage. Moreover, the results of European Brewery Convention tube fermentation test showed that the genetic manipulation to the industrial brewing yeast helped with the anti-staling ability, rather than affecting the fermentation ability. The thiobarbituric acid value reduced by 65.59 %, and the resistant staling value increased by 26.56 %. Moreover, the anti-staling index of the beer fermented with mutant strain increased by 2.64-fold than that from wild-type strain respectively. China has the most production and consumption of beer around the world, so the quality of beer has a significant impact on Chinese beer industry. The result of this study could help with the improvement of the quality of beer in China as well as around the world.

The influence of secondary processing on the structural relaxation dynamics of fluticasone propionate.

Science.gov (United States)

Depasquale, Roberto; Lee, Sau L; Saluja, Bhawana; Shur, Jagdeep; Price, Robert

2015-06-01

This study investigated the structural relaxation of micronized fluticasone propionate (FP) under different lagering conditions and its influence on aerodynamic particle size distribution (APSD) of binary and tertiary carrier-based dry powder inhaler (DPI) formulations. Micronized FP was lagered under low humidity (LH 25 C, 33% RH [relative humidity]), high humidity (HH 25°C, 75% RH) for 30, 60, and 90 days, respectively, and high temperature (HT 60°C, 44% RH) for 14 days. Physicochemical, surface interfacial properties via cohesive-adhesive balance (CAB) measurements and amorphous disorder levels of the FP samples were characterized. Particle size, surface area, and rugosity suggested minimal morphological changes of the lagered FP samples, with the exception of the 90-day HH (HH90) sample. HH90 FP samples appeared to undergo surface reconstruction with a reduction in surface rugosity. LH and HH lagering reduced the levels of amorphous content over 90-day exposure, which influenced the CAB measurements with lactose monohydrate and salmeterol xinafoate (SX). CAB analysis suggested that LH and HH lagering led to different interfacial interactions with lactose monohydrate but an increasing adhesive affinity with SX. HT lagering led to no detectable levels of the amorphous disorder, resulting in an increase in the adhesive interaction with lactose monohydrate. APSD analysis suggested that the fine particle mass of FP and SX was affected by the lagering of the FP. In conclusion, environmental conditions during the lagering of FP may have a profound effect on physicochemical and interfacial properties as well as product performance of binary and tertiary carrier-based DPI formulations.

HUMANIZAÇÃO DO DISCURSO DAS MARCAS DIANTE DAS NOVAS EXPERIÊNCIAS DE CONSUMO

Directory of Open Access Journals (Sweden)

Rogério Luiz Covaleski

2014-01-01

Full Text Available Tendo em vista que o processo de consumo não se resume à compra de mercadorias, e que vivenciamos um momento de negociação de discursos entre consumidores e anunciantes, potencializado pelas ferramentas dos meios de comunicação pós-massivos, este artigo pretende refletir sobre o fenômeno da humanização do discurso das marcas. Para isso, tomaremos como referência as considerações sobre a mudança do fluxo comunicacional da linguagem publicitária (BEKESAS, 2012, as características da cibercultura (LEMOS; LÉVY, 2010, a cultura da participação (SHIRKY, 2011 e a necessidade de uma conduta ética para a manutenção da credibilidade das empresas (BLACKSHAW, 2010. Neste trabalho, também citaremos casos ilustrativos da humanização dos discursos das marcas colhidas nas redes sociais na Internet, como forma de exemplificar os esforços das empresas em manter a integridade da imagem da marca no atual cenário do refluxo comunicacional. Palavras-chave: Discurso. Marcas. Consumo. Refluxo comunicacional. Mídias sociais.

Influência das novas tecnologias na gestão das finanças pessoais: desenho de um robo-advisor

OpenAIRE

Pérez Ares, Iago Roi

2016-01-01

A crise económica global atual, junto com a profunda evolução das novas tecnologias, está a produzir a necessidade de aumentar a eficiência da gestão de numerosas atividades da nossa vida. Desta forma, uma das principais preocupações na vida das pessoas, como demonstram numerosos estudos, é a sua gestão das finanças familiares. Se a isto lhe for adicionado a crescente desconfiança no sector bancário, produzida em parte pela duvidosa gestão dos seus responsáveis, entende-se que a gestão patri...

Potentials and limitations of epistemic communities. An analysis of the World Climate Council and the Framework Convention on Climate Change; Potenziale und Grenzen von epistemic communities. Eine Analyse des Weltklimarates und der Klimarahmenkonvention

Energy Technology Data Exchange (ETDEWEB)

Otto, Daniel

2015-07-01

In times of increasing global uncertainties, science takes a central position for policy decisions. According to Peter M. Haas, epistemic communities are able to influence the cooperative behavior of states through their consensual knowledge. This book critically examines this statement. As the case of the Framework Convention on Climate Change shows, the World Climate Council (IPCC) was not in a position to enforce its solution options in the intergovernmental negotiations, as these affected the individual convictions of the decision-makers. While Angela Merkel advocated an agreement, the US government under George W. Bush denied the existence of climate change. Decision-makers and their individual convictions must therefore have a greater significance in international politics. [German] In Zeiten zunehmender globaler Unsicherheiten nimmt die Wissenschaft fuer die Entscheidungen der Politik eine zentrale Stellung ein. Epistemic communities sind nach Peter M. Haas durch ihr konsensuales Wissen in der Lage, das Kooperationsverhalten von Staaten zu beeinflussen. Das vorliegende Buch prueft diese Aussage kritisch. Wie der Fall der Klimarahmenkonvention zeigt, war der Weltklimarat (IPCC) nicht in der Lage, seine Loesungsoptionen in den zwischenstaatlichen Verhandlungen durchzusetzen, da diesen die individuellen Ueberzeugungen der Entscheidungstraeger entgegenstanden. Waehrend Angela Merkel ein Abkommen befuerwortete, bestritt die US-Regierung unter George W. Bush die Existenz des Klimawandels. Entscheidungstraegern und ihren individuellen Ueberzeugungen muss daher in der internationalen Politik eine staerkere Bedeutung zukommen.

Psicoterapia das depressões

Directory of Open Access Journals (Sweden)

Sidnei Schestatsky

1999-05-01

Full Text Available Os autores examinam o status atual das psicoterapias no tratamento das depressões, principalmente das quatro formas melhor testadas empiricamente nos últimos 10 anos: psicoterapia interpessoal, psicoterapia cognitiva e comportamental, e psicoterapia psicodinâmica breve. São descritos os principais estudos de eficácia dessas psicoterapias assim como uma revisão metaanalítica sobre o assunto. Conclui-se que já há sólidas evidências de bons resultados nas depressões ambulatoriais e unipolares quando tratadas por intervenções psicossociais, combinadas ou não com farmacoterapia.It is examined the present status of psychotherapeutic treatment of depression, specially the impact of the four types of psychotherapy best empirically tested for the past 10 years: interpersonal therapy, cognitive and behavioral therapies, and brief psychodynamic therapy. Both the main efficacy studies of those therapies as well as a meta-analytic review of their results are described. The conclusion is that there are already strong evidences of good outcome when ambulatorial unipolar depression is treated by psychossocial interventions, alone or in combination with pharmacotherapy.

A vantagem competitiva das nações e a vantagem competitiva das empresas: o que importa na localização?

Directory of Open Access Journals (Sweden)

Martim Francisco de Oliveira e Silva

2012-06-01

Full Text Available Há dois enfoques dominantes para explicar o desempenho das empresas: a visão da Organização Industrial e a Visão Baseada em Recursos, ambos amplamente pesquisados. Entretanto, a relação entre o desempenho das empresas e a competitividade das nações ainda é pouco explorada. Este estudo buscou verificar se o desempenho das empresas se relaciona ao ambiente de seus países e quais fatores destes são mais relevantes. Foram encontradas evidências da relação entre os indicadores de competitividade dos países e o desempenho sustentável de suas empresas. O estudo relacionou de maneira pioneira os conceitos da vantagem competitiva das nações e da vantagem competitiva das empresas, testou empiricamente o modelo do Diamante Competitivo do professor Michael Porter, destacou três variáveis habitualmente negligenciadas na linha de pesquisas das fontes de desempenho de empresas (a Sofisticação dos Compradores, o PIB e as Compras Governamentais e criou um indicador de desempenho que também traduz sua sustentabilidade, associado à linha da pesquisa da persistência dos retornos extraordinários.

Desvelando a Internet das Coisas

Directory of Open Access Journals (Sweden)

Lucia Santaella

2013-12-01

Full Text Available O presente artigo pretende relatar as origens da Internet das Coisas, seu estado de arte e evidenciar seus principais vetores. Para tal, o estudo percorrerá as eras midiáticas de Santaella (2007, p. 179-189, a par da discussão das máquinas de Turing, da arquitetura Von Neumann até chegar à Internet e seu estado atual, implementada nas coisas.

Lead-free sliding overplate for highly loaded big end bearings; Bleifreie Laufschicht fuer hochbelastete Haupt- und Pleuellager

Energy Technology Data Exchange (ETDEWEB)

Graham, N.; Schnell, L.; Arnold, G. [Federal-Mogul Wiesbaden GmbH and Co. KG (Germany)

2003-10-01

Lead has always been an important metal in plain bearing technology. Completely lead-free solutions for high-end engine applications are still not considered to be technically achievable. Therefore, the European End of Life Directive (2000/53/EC), which took effect on 1 July 2003, lists copper-based lead/bronze bearings as an exception. The bearing group of Federal-Mogul has now announced its exit from the lead industry and addresses the issue layer by layer. A recently introduced adaptive bearing offers a lead-free overplate for high-performance internal combustion engine applications. This new bearing changes its technical characteristics during the running-in phase. (orig.) [German] Blei war schon immer eine wichtige Komponente in der Gleitlagertechnik. Bis heute gelten vollstaendig bleifreie Loesungen fuer hochbelastete Gleitlager als technisch nicht machbar. Deshalb nennt die europaeische Altautoverordnung (2000/53/EG), die seit dem 1. Juli 2003 in Kraft ist, als Ausnahme die kupferbasierten Bleibronzelager. Die Gleitlagergruppe von Federal-Mogul hat jetzt ihren Rueckzug aus der Verarbeitung von Blei angekuendigt und geht das Thema Schicht fuer Schicht an. Ein kuerzlich eingefuehrtes, anpassungsfaehiges Lager fuer High-End-Verbrennungsmotoren verfuegt ueber eine bleifreie Laufschicht. Bei diesem neuen Lager veraendern sich die technischen Eigenschaften waehrend der Einlaufphase. (orig.)

O DESAFIO DA PRIVACIDADE NA INTERNET DAS COISAS

Directory of Open Access Journals (Sweden)

Carlos Cesar Santos

2015-12-01

Full Text Available Na ultima década a internet tornou-se uma ferramenta presente no cotidiano das pessoas e das organizações e por vez indispensável ao bom funcionamento dos negócios. Com o crescente incremento das infraestruturas de redes e popularização em massa da rede de alta velocidade, emerge um avanço relacionado à utilização da internet tornando-a uma plataforma global para deixar máquinas e objetos inteligentes capazes de comunicarem-se de forma autônoma. Esta possibilidade permite que conteúdos e serviços estejam em torno das pessoas, sempre disponíveis, facilitando a comunicação e abrindo o caminho para novas aplicações, possibilitando novas formas de trabalho, de interação e de entretenimento, fazendo com que um novo padrão de vida e de trabalho seja desenvolvido. Este novo padrão torna-se possível através dos avanços das Tecnologias da Informação e Comunicação - TICs até uma nova concepção definida como Internet of Things - IoT. Entretanto, com uma variada coleta de dados e informações, para variados fins, no cotidiano das pessoas e das organizações, a coleta autônoma dos dados e das informações torna a privacidade um dos principais desafios em relação à IoT. Neste contexto, este artigo objetiva discutir em âmbito teórico a privacidade dos usuários da tecnologias da Internet das Coisas, diante de sua legalidade, explorando possíveis soluções neste cenário ainda em construção.

Processing Approaches for DAS-Enabled Continuous Seismic Monitoring

Science.gov (United States)

Dou, S.; Wood, T.; Freifeld, B. M.; Robertson, M.; McDonald, S.; Pevzner, R.; Lindsey, N.; Gelvin, A.; Saari, S.; Morales, A.; Ekblaw, I.; Wagner, A. M.; Ulrich, C.; Daley, T. M.; Ajo Franklin, J. B.

2017-12-01

Distributed Acoustic Sensing (DAS) is creating a "field as laboratory" capability for seismic monitoring of subsurface changes. By providing unprecedented spatial and temporal sampling at a relatively low cost, DAS enables field-scale seismic monitoring to have durations and temporal resolutions that are comparable to those of laboratory experiments. Here we report on seismic processing approaches developed during data analyses of three case studies all using DAS-enabled seismic monitoring with applications ranging from shallow permafrost to deep reservoirs: (1) 10-hour downhole monitoring of cement curing at Otway, Australia; (2) 2-month surface monitoring of controlled permafrost thaw at Fairbanks, Alaska; (3) multi-month downhole and surface monitoring of carbon sequestration at Decatur, Illinois. We emphasize the data management and processing components relevant to DAS-based seismic monitoring, which include scalable approaches to data management, pre-processing, denoising, filtering, and wavefield decomposition. DAS has dramatically increased the data volume to the extent that terabyte-per-day data loads are now typical, straining conventional approaches to data storage and processing. To achieve more efficient use of disk space and network bandwidth, we explore improved file structures and data compression schemes. Because noise floor of DAS measurements is higher than that of conventional sensors, optimal processing workflow involving advanced denoising, deconvolution (of the source signatures), and stacking approaches are being established to maximize signal content of DAS data. The resulting workflow of data management and processing could accelerate the broader adaption of DAS for continuous monitoring of critical processes.

Kajian Degradasi Lahan Sebagai Dasar Pengendalian Banjir di DAS Juwana

Directory of Open Access Journals (Sweden)

Arina Miardini

2016-10-01

Full Text Available Adanya pemanfaatan lahan yang intensif dan ekspolitatif dapat menurunkan daya dukung dan fungsi lingkungan DAS yang menyebabkan lahan menjadi terdegradasi. Tingginya luasan lahan kritis menjadi ancaman terhadap daya dukung DAS yang akan berdampak pada ketidakseimbangan hidrologi dalam DAS. Salah satu akibat ketidakseimbangan hidrologi dalam DAS adalah terjadinya banjir. DAS Juwana merupakan DAS Prioritas I berdasarkan penetapan 108 DAS prioritas. Salah satu indikator untuk menentukan degradasi dalam DAS dapat diketahui berdasarkan nilai koefisien aliran. Penelitian ini bertujuan untuk mengidentifikasi karakteristik fisik DAS yang berpengaruh dalam penentuan koefisien aliran, menghitung koefisien aliran dengan mempertimbangkan parameter karakteristik fisik DAS dan memberikan rekomendasi pengelolaan banjir di DAS Juwana yang potensial banjir dalam mendukung upaya pengelolaan DAS dari hulu sampai hilir. Koefisien aliran dihitung denggan menggunakan metode cook yang memperhitungkan parameter kemiringan lereng, infiltrasi tanah, tutupan vegetasi dan simpanan permukaan. Perumusan pengendalian banjir dilakukan dengan melakukan penatagunaan lahan yang disesuaikan dengan arahan fungsi penggunaan lahan sehingga diharapkan menurunkan nilai koefisien aliran dan debit banjir. Karakteristik fisik DAS Juwana yang mempengaruhi penentuan koefisien aliran berdasarkan metode Cook yaitu Kemiringan lereng dengan rata-rata skor C sebesar 0,178, kerapatan aliran dengan rata-rata skor 0,084, infiltrasi dengan rata-rata skor 0,115 dan tutupan vegetasi dengan rata-rata skor 0,127. Kontribusi masing masing parameter dalam penilaian koefisien aliran yang memiliki pengaruh paling terbesar sampai paling terkecil dalam besarnya koefisien aliran yaitu kemiringan lereng yang memiliki pengaruh sebesar 35,39%, kemudian tutupan vegetasi sebesar 25,25%, infiltrasi sebesar 22,86% dan terakhir adalah kerapatan aliran yang berkontribusi sebesar 16,70%. Nilai koefisien aliran di DAS

Das Muťafi-Lazische

OpenAIRE

Kutscher, Silvia; Mattissen, Johanna; Wodarg, Anke

1995-01-01

Die in der vorliegenden Publikation untersuchte Sprache ist ein Dialekt des Lazischen, der in Muťafi und Umgebung gesprochen wird. Dieser Dialekt ist bis zu diesem Zeitpunkt noch nicht wissenschaftlich untersucht worden. Da er einige Charakteristika aufweist, die in anderen lazischen Dialekten nicht zu finden sind, hielten wir es für notwendig, unsere Untersuchungsergebnisse zu veröffentlichen. Eine auffällige Besonderheit findet sich z.B. im Kasussystem: Sowohl das Georgische als auch das Za...

Analisis Laju Sedimen DAS Serayu Hulu dengan Menggunakan Model SWAT

Directory of Open Access Journals (Sweden)

Nugroho Christanto

2018-03-01

Full Text Available Wilayah DAS Serayu Hulu merupakan DAS prioritas yang memerlukan langkah pengelolaan yang komprehensif. Aplikasi model Soil and Water Assessment Tool (SWAT dapat digunakan sebagai media untuk  perencanaan konservasi ataupun evaluasi respon DAS (debit aliran permukaan, sedimen dan pencemaran sungai. Tujuan utama dari penelitian ini adalah menjalankan model SWAT di DAS Serayu Hulu untuk mengetahui laju sedimen di wilayah ini. Pemodelan SWAT membutuhkan sejumlah input parameter berupa relief, tanah, tutupan lahan dan pengelolaan lahan. Pedogeomorfologi digunakan sebagai batas satuan tanah karena tidak tersedianya peta tanah di wilayah penelitian. Hasil Penerapan model SWAT di DAS Serayu Hulu menghasilkan nilai yang cukup memuaskan, hal ini ditunjukkan nilai R2 mencapai 0,94. Hasil pemodelan SWAT dengan menggunakan data selama 10 tahun (2004-2013 menunjukkan bahwa DAS Serayu Hulu memiliki rerata hasil sedimen sebesar 1.926.900 ton/tahun. Sub DAS 8,9 11, 17, 18, dan 19 merupakan penghasil sedimen tertinggi di DAS Serayu Hulu dengan hasil sedimen 43.931– 121.434 ton/ha/tahun.

Contribuição das incubadoras tecnológicas na internacionalização das empresas incubadas

Directory of Open Access Journals (Sweden)

Raquel Engelman

2013-03-01

Full Text Available Neste trabalho, teve-se como propósito verificar como as incubadoras tecnológicas brasileiras contribuem para a internacionalização das empresas incubadas no ponto de vista dos gestores das incubadoras. Para atender a esse propósito, desenvolveu-se um modelo que, além de oferecer suporte à pesquisa, possa servir de base para estudos e ações sobre internacionalização de empresas de base tecnológica incubadas. O modelo foi elaborado a partir da literatura sobre as duas áreas de interesse do trabalho. De um lado, foram abordadas referências sobre internacionalização de empresas, fazendo-se um levantamento sobre os fatores que influenciam sua internacionalização, principalmente micro e pequenas empresas de base tecnológica; de outro, foram estudados aspectos sobre o processo de incubação de empreendimentos tecnológicos, bem como as ações e os serviços disponibilizados pelas incubadoras. A pesquisa descritiva foi realizada com 40 incubadoras tecnológicas brasileiras (50% da população e que atenderam aos seguintes critérios: estar em efetiva operação há um tempo superior a dois anos e com pelo menos uma empresa graduada. A partir de questionários identificou-se que 40% das incubadoras da amostra possuem programa formal voltado para a internacionalização das incubadas e 60% das incubadoras têm empresas que iniciaram processo de internacionalização. Os resultados apontaram uma relação positiva entre incubação e internacionalização. A pesquisa forneceu indicações de ações e serviços que são efetivos na internacionalização das empresas.

Determinação das curvas de secagem das sementes de andiroba em secador solar

Directory of Open Access Journals (Sweden)

Andreza P. Mendonça

2015-04-01

Full Text Available Comumente, o óleo de andiroba é extraído na Amazônia pelo método tradicional ou ainda por prensa. A eficiência na extração está relacionada ao aquecimento e ao teor de água das sementes. Desta forma, a determinação de um modelo de secagem que represente satisfatoriamente os dados experimentais é de suma importância para minimizar as alterações promovidas pelo processo obtendo-se, consequentemente, produto de qualidade. O objetivo do trabalho foi descrever a cinética de secagem das sementes de andiroba, tal como ajustar os modelos matemáticos aos dados experimentais usando-se secador solar. Foi utilizado, como critério do ajuste dos modelos matemáticos, o coeficiente de determinação, a magnitude do erro médio relativo e o desvio-padrão da estimativa. A secagem em menor tempo (14 dias da Carapa surinamensis para atingir o teor de água de equilíbrio (12,28% se deve, possivelmente, ao menor tamanho das sementes e à maior quantidade de óleo em relação à Carapa guianensis. O modelo Logarítmico e o de Midilli et al. foram os que melhor se ajustaram aos dados experimentais para as sementes das duas espécies de andiroba.

Tendências temporais e espaciais da qualidade das águas superficiais da sub-bacia do Rio das Velhas, estado de Minas Gerais

OpenAIRE

Trindade, Ana Laura Cerqueira; Almeida, Katiane Cristina de Brito; Barbosa, Pedro Engler; Oliveira, Sílvia Maria Alves Corrêa

2016-01-01

RESUMO Este artigo apresenta uma análise da tendência temporal e espacial da qualidade das águas superficiais da sub-bacia do Rio das Velhas, inserida na bacia do Rio São Francisco, em Minas Gerais, Brasil. Foram analisados 16.625 dados coletados no período de 2002 a 2011 pelo programa de monitoramento de qualidade das águas superficiais efetuado pelo Instituto Mineiro de Gestão das Águas (Igam). Testes estatísticos, multivariados e não paramétricos foram utilizados para avaliar 11 variáveis ...

Por que a elasticidade-preço das importações é baixa no Brasil? Evidências a partir das desagregações das importações por categorias de uso

Directory of Open Access Journals (Sweden)

Cláudio Hamilton Matos dos Santos

Full Text Available Resumo Estudos recentes indicam que a elasticidade-preço das importações brasileiras é baixa. Este trabalho procura racionalizar o referido resultado revisitando as estimativas das importações do país desagregadas por “categoria de uso”. Os resultados reportados sugerem que a baixa elasticidade-preço das importações agregadas reflete fundamentalmente a baixa elasticidade-preço das importações de combustíveis, bens intermediários e de alguns tipos de serviços - notadamente, transporte, aluguel de equipamentos e pagamentos de royalties - produtos que, somados, respondem por pouco menos de dois terços do total importado. Isso ocorre porque vários desses produtos têm pouca ou nenhuma possibilidade de substituição por similares nacionais, devido principalmente a deficiências estruturais na oferta nacional.

Das, Prof. Saumitra

Indian Academy of Sciences (India)

Fellow Profile. Elected: 2009 Section: General Biology. Das, Prof. Saumitra Ph.D. (Calcutta), FNASc, FNA. Date of birth: 20 January 1962. Specialization: Molecular Virology, Molecular Biology and Cell Biology Address: Microbiology and Cell Biology Department, Indian Institute of Science, Bengaluru 560 012, Karnataka

O impacto das redes sociais no marketing: perspectiva portuguesa

OpenAIRE

Rosa, Nuno Gonçalo Henriques da

2010-01-01

Mestrado em Marketing As mudanças ocorridas nos últimos anos, no panorama dos media, associados aos desenvolvimentos tecnológicos, originaram novos comportamentos no consumidor. O poder das comunicações das marcas deixou de estar centrada apenas nas iniciativas das empresas, o que permitiu um novo relacionamento das marcas com o consumidor, transformando-o num Prosumer. As Redes Sociais e a importância que as suas plataformas assumem na nossa vida, o que para alguns autores é uma extensão ...

Das, Prof. Gobardhan

Indian Academy of Sciences (India)

Das, Prof. Gobardhan Ph.D. (Imtech), FNASc. Date of birth: 10 December 1966. Specialization: Immunology, Infectious Diseases, Cell Biology Address: Special Centre for Molecular Medicine, Jawaharlal Nehru University, New Delhi 110 067, U.T.. Contact: Office: (011) 2670 4559, 2673 8824. Residence: (0124) 424 2351

Alternativas técnicas para o controle das alterações dimensionais das resinas acrílicas em prótese total

OpenAIRE

GOMEZ Tomas; MORI Matsuyoshi; CORRÊA Gerson de Arruda; MATSON Edmir

1998-01-01

Os autores propõem uma nova técnica para diminuição dos problemas provenientes das alterações dimensionais das resinas acrílicas utilizadas na confecção das próteses totais. Com essa proposta, conseguiu-se praticamente eliminar essas alterações dimensionais tão prejudiciais às próteses totais.

Planejamento das Atividades de Auditoria Interna na UFSC

OpenAIRE

Platt Neto, Orion Augusto; Vieira, Audí Luiz

2006-01-01

Este artigo aborda o planejamento das unidades de auditoria interna que integram o sistema de controle interno do Poder Executivo Federal junto às instituições Federais de Ensino Superior (IFES). O objetivo deste artigo é apresentar noções e instrumentos do planejamento das atividades nas unidades de auditoria interna vinculadas às IFES. Neste sentido, apresenta-se o embasamento normativo, as competências e as atividades das unidades de auditoria interna. Para auxiliar a consec...

Lageroptimierung 2.0: Das Online-WMS

OpenAIRE

Wolf, Oliver; Geißen, Tim; Rahn, Jonas; Haselberger, Julia

2012-01-01

Das Fraunhofer-Institut für Materialfluss und Logistik IML unterstützt zahlreiche Unternehmen sowohl bei der Auswahl des richtigen Warehouse Management Systems als auch durch die Entwicklung einer Plattform, die das Anbieten, Mieten und Anwenden logistischer IT-Unterstützung in der Cloud möglich macht. Von »warehouse logistics« zur »Logistics Mall« - vom konventionell betriebenen Warehouse Management System zum WMS aus der Steckdose.

Ikea das Rendas

OpenAIRE

Bergman, Aeron; Salinas, Alejandra

2008-01-01

FIALENA fabric design by Anna Svanfeldt for IKEA of Sweden. It took Maria da Guia 2 months to reproduce the Ikea pattern using traditional Portuguese improvised knots. 2008 Installasjon i Museu das Rendas, Vila do Conde, Portugal, 01.09.2008 - 01.10.2008. Sponsor: City of Villa do Conde.

Transport properties of Cu-doped bismuth selenide single crystals at high magnetic fields up to 60 Tesla: Shubnikov-de Haas oscillations and π-Berry phase

Science.gov (United States)

Romanova, Taisiia A.; Knyazev, Dmitry A.; Wang, Zhaosheng; Sadakov, Andrey V.; Prudkoglyad, Valery A.

2018-05-01

We report Shubnikov-de Haas (SdH) and Hall oscillations in Cu-doped high quality bismuth selenide single crystals. To increase the accuracy of Berry phase determination by means of the of the SdH oscillations phase analysis we present a study of n-type samples with bulk carrier density n ∼1019 -1020cm-3 at high magnetic field up to 60 Tesla. In particular, Landau level fan diagram starting from the value of the Landau index N = 4 was plotted. Thus, from our data we found π-Berry phase that directly indicates the Dirac nature of the carriers in three-dimensional topological insulator (3D TI) based on Cu-doped bismuth selenide. We argued that in our samples the magnetotransport is determined by a general group of carriers that exhibit quasi-two-dimensional (2D) behaviour and are characterized by topological π-Berry phase. Along with the main contribution to the conductivity the presence of a small group of bulk carriers was registered. For 3D-pocket Berry phase was identified as zero, which is a characteristic of trivial metallic states.

Multigap superconductivity and Shubnikov-de Haas oscillations in single crystals of the layered boride OsB2

Science.gov (United States)

Singh, Yogesh; Martin, C.; Bud'Ko, S. L.; Ellern, A.; Prozorov, R.; Johnston, D. C.

2010-10-01

Single crystals of superconducting OsB2 [Tc=2.10(5)K] have been grown using a Cu-B eutectic flux. We confirm that OsB2 crystallizes in the reported orthorhombic structure (space group Pmmn ) at room temperature. Both the normal and superconducting state properties of the crystals are studied using various techniques. Heat capacity versus temperature C(T) measurements yield the normal state electronic specific heat coefficient γ=1.95(1)mJ/molK2 and the Debye temperature ΘD=539(2)K . The measured frequencies of Shubnikov-de Haas oscillations are in good agreement with those predicted by band structure calculations. Magnetic susceptibility χ(T,H) , electrical resistivity ρ(T) , and C(T,H) measurements ( H is the magnetic field) demonstrate that OsB2 is a bulk low- κ [κ(Tc)=2(1)] type-II superconductor that is intermediate between the clean and dirty limits [(ξ(T=0)/ℓ=0.97)] with a small upper critical magnetic field Hc2(T=0)=186(4)Oe . The penetration depth is λ(T=0)=0.300μm . An anomalous (not single-gap BCS) T dependence of λ was fitted by a two-gap model with Δ1(T=0)/kBTc=1.9 and Δ2(T=0)/kBTc=1.25 , respectively. The discontinuity in the heat capacity at Tc , ΔC/γTc=1.32 , is smaller than the weak-coupling BCS value of 1.43, consistent with the two-gap nature of the superconductivity in OsB2 . An anomalous increase in ΔC at Tc of unknown origin is found in finite H ; e.g., ΔC/γTc≈2.5 for H≈25Oe .

Uma leitura semiótica das multidões

Directory of Open Access Journals (Sweden)

Alexandre Rocha da Silva

2016-12-01

Full Text Available Uma leitura semiótica das multidões tem o objetivo de problematizar as funções do incomensurável na semiose. Tal problematização envolve os problemas da imanência, do primado da mediação que caracteriza o pensamento semiótico contemporâneo e da desconstrução das identidades operada pelas teorias queer. Para tanto, metodologicamente, (1 apresentamos os conceitos de multidão desenvolvidos por Charles Sanders Peirce, Antônio Negri e Michael Hardt; (2 discutimos o caráter descritivo das categorias faneroscópicas de Peirce para propor a Zeroidade como condição e imanência de toda a semiose; (3 identificamos a dupla face – virtual e mediada – da singularidade e (4 demonstramos de que maneira a singularidade, que é uma potência, dá lugar na semiose a identidades. É o caráter indissociável da singularidade, da identidade e das crenças/hábitos que permite a este artigo denunciar falsas dicotomias e afirmar o perspectivismo como horizonte fundamental para os estudos semióticos das multidões.

Kohapärimuslik luule nädalalehes Das Inland / Die Sagendichtung in der Wochenschrift Das Inland

Directory of Open Access Journals (Sweden)

Liina Lukas

2012-01-01

Full Text Available Das spätromantische Interesse für Ortsüberlieferungen, angeregt von den “Deutschen Sagen” (1816–1818 der Brüder Grimm, blühte im Baltikum in den 1830er und 1840er Jahren auf und gipfelte – im estnischen Sprachgebiet – in der zweisprachigen Ausgabe des estnischen Nationalepos “Kalevipoeg” / “Kalew’s Sohn” (1857–1861, dem Friedrich Reinhold Kreutzwald seine Endgestalt gab, aber das von mehreren Sammlern und Bearbeitern geprägt wurde. Literarische Bearbeitungen von Volkssagen fanden schnell ihren Weg in Zeitungen und Zeitschriften, in Gedichtbände und Anthologien – oft in modischer Balladenform, die dem mythisch-romantischen Inhalt der Volkssage am besten zu entsprechen schien. Die Blütezeit der Sagendichtung im Baltikum sind die 1840er Jahre, als vor allem in der Zeitschrift „Das Inland“ mehrere dichterischen Bearbeitungen estnischer und lettischer Volkssagen erschienen (von Heinrich Blindner, Otto Dreistern, Eduard Pabst, Minna von Mädler, Theodor Rutenberg, Robert Falck, P. Otto u. a. 1845 erschien hier das nach einer Sage von Friedrich Robert Faehlmann verfasste Gedicht „Koit und Hämarik / Morgenroth und Abendroth“ von Minna von Mädler – fünf Jahre vor der Fassung von Friedrich Reinhold Kreutzwalds estnischsprachiger Ballade „Koit ja Hämarik“. Zwischen 1831 und 1836 verfasste Friedrich Reinhold Kreutzwald seine deutschsprachigen Balladen, von denen „Die Belagerung von Bewerin im Jahre 1207“ 1846 im „Inland“ gedruckt wurde. Das Jahr 1846 kann als „Balladenjahr“ der Zeitschrift bezeichnet werden. Die eigentliche Domäne der deutschbaltischen (lyro-epischen Dichtung ist die historische Ballade, die fußend auf baltischen Chroniken und Familiengeschichten zumeist von Ruinen alter Schlösser und den sie einst bewohnenden historischen Personen und deren Heldentaten berichtet. Doch schon im Jahre 1847 kann man im Inland die Kritik gegenüber diesem Balladenboom vernehmen, u.a. mit dem

Das perguntas wittgensteinianas à pedagogia das competências: ou desmontando a caixa-preta de Perrenoud

Directory of Open Access Journals (Sweden)

Rafael Ferreira de Souza Mendes Pereira

2015-03-01

Full Text Available Este artigo faz parte de uma pesquisa de mestrado que se propõe a analisar conceitos educacionais e curriculares por meio da filosofia da linguagem elaborada por Ludwig Wittgenstein. Dessa perspectiva, examinamos alguns pressupostos teóricos da chamada pedagogia das competências e interrogamos se esse modelo pedagógico, em nome de pretensa renovação do ensino, não encorajaria a reificação de conceitos mentais concernentes ao processo de aprendizagem. Com este fim, abordamos a reformulação que essa pedagogia oferece a respeito de conceitos como aprender, saber, compreender, destacando as ambiguidades daí decorrentes. Argumenta-se que é possível obter uma leitura mais rigorosa das suas propostas de modernização pedagógica se investigarmos o uso dado a esses conceitos nos jogos de linguagem em que eles são mobilizados. Wittgenstein, na segunda fase de sua produção intelectual, mostrou como a negligência linguística à dinâmica que dá significado aos conceitos e metáforas referentes à nossa vida mental fez com que diversas filosofias assumissem um perfil metafísico. Este artigo não apenas examina como um fenômeno análogo pode ocorrer no campo pedagógico, como também defende que as ferramentas analíticas construídas por Wittgenstein podem ser usadas contra os diferentes dogmatismos pedagógicos. Desse modo, o artigo aponta vias alternativas de problematização acerca do significado das reformas dos sistemas escolares que têm buscado fundamentos naquela pedagogia.

Das DELA-NOBA Projekt

DEFF Research Database (Denmark)

Daryai-Hansen, Petra; Meister, Maive; Tonello, Elisa

2015-01-01

in the English language classroom in Argentina and Denmark var et delprojekt under et større internationalt samarbejde, koordineret af Michael Byram, og belyste, hvordan interkulturelt medborgerskab kan styrkes i grundskolens læringsrum (Byram et al. under udgivelse). Grundidéen i interkulturelle......Artiklen præsenterer et udviklings- og forskningsprojekt på Randersgades Skole. I projektet deltog elever fra 7.v og en 5./6. klasse fra Argentina i et arrangeret kultur- og sprogmøde inden for rammerne af deres engelskundervisning. Projektet Green Kidz. Intercultural environmental citizenship...... langues-Ansatz noch weitreichend unbekannt. Das Projekt Developing the Language Awareness/ Éveil aux langues Approach in the Nordic and Baltic Countries (DELA- NOBA), das von 2013 bis 2016 von NordPlus Horizontal finanziert wird, etabliert eine Zusammenarbeit zwischen Universitäten und Pilotschulen aus...

Tendências temporais e espaciais da qualidade das águas superficiais da sub-bacia do Rio das Velhas, estado de Minas Gerais

Directory of Open Access Journals (Sweden)

Ana Laura Cerqueira Trindade

Full Text Available RESUMO Este artigo apresenta uma análise da tendência temporal e espacial da qualidade das águas superficiais da sub-bacia do Rio das Velhas, inserida na bacia do Rio São Francisco, em Minas Gerais, Brasil. Foram analisados 16.625 dados coletados no período de 2002 a 2011 pelo programa de monitoramento de qualidade das águas superficiais efetuado pelo Instituto Mineiro de Gestão das Águas (Igam. Testes estatísticos, multivariados e não paramétricos foram utilizados para avaliar 11 variáveis físicas, químicas e microbiológicas de 29 estações de monitoramento. Os resultados das análises de tendência Mann-Kendall/Sazonal de Mann-Kendall sugeriram que a maioria dos cursos d'água da região apresentam valores estáveis das variáveis ao longo do período estudado, com maiores alterações associadas a coliformes termotolerantes, demanda bioquímica de oxigênio (DBO, nitrato e índice de qualidade das águas (IQA, principalmente nas proximidades dos grandes centros urbanos. A análise de Cluster definiu três grandes grupos de estações de monitoramento, agrupadas segundo a qualidade de suas águas, correspondentes aos níveis de alta poluição, poluição moderada e baixa poluição. No entanto, ao longo de toda a sub-bacia, foi observada a degradação da qualidade da água durante o período estudado, principalmente relacionada ao lançamento de esgotos domésticos. Uma importante constatação foi a alteração da qualidade da água no baixo Rio das Velhas, apontada pela tendência de redução do IQA em estações localizadas nessa região, o que merece atenção dos órgãos governamentais para ações de manejo.

Tendências temporais e espaciais da qualidade das águas superficiais da sub-bacia do Rio das Velhas, estado de Minas Gerais

Directory of Open Access Journals (Sweden)

Ana Laura Cerqueira Trindade

2016-10-01

Full Text Available RESUMO Este artigo apresenta uma análise da tendência temporal e espacial da qualidade das águas superficiais da sub-bacia do Rio das Velhas, inserida na bacia do Rio São Francisco, em Minas Gerais, Brasil. Foram analisados 16.625 dados coletados no período de 2002 a 2011 pelo programa de monitoramento de qualidade das águas superficiais efetuado pelo Instituto Mineiro de Gestão das Águas (Igam. Testes estatísticos, multivariados e não paramétricos foram utilizados para avaliar 11 variáveis físicas, químicas e microbiológicas de 29 estações de monitoramento. Os resultados das análises de tendência Mann-Kendall/Sazonal de Mann-Kendall sugeriram que a maioria dos cursos d'água da região apresentam valores estáveis das variáveis ao longo do período estudado, com maiores alterações associadas a coliformes termotolerantes, demanda bioquímica de oxigênio (DBO, nitrato e índice de qualidade das águas (IQA, principalmente nas proximidades dos grandes centros urbanos. A análise de Cluster definiu três grandes grupos de estações de monitoramento, agrupadas segundo a qualidade de suas águas, correspondentes aos níveis de alta poluição, poluição moderada e baixa poluição. No entanto, ao longo de toda a sub-bacia, foi observada a degradação da qualidade da água durante o período estudado, principalmente relacionada ao lançamento de esgotos domésticos. Uma importante constatação foi a alteração da qualidade da água no baixo Rio das Velhas, apontada pela tendência de redução do IQA em estações localizadas nessa região, o que merece atenção dos órgãos governamentais para ações de manejo.

Sarma, Prof. Dipankar Das

Indian Academy of Sciences (India)

Home; Fellowship. Fellow Profile. Elected: 1993 Section: Chemistry. Sarma, Prof. Dipankar Das Ph.D. (IISc), FNA, FNASc, FTWAS Council Service: 2016-. Date of birth: 15 September 1955. Specialization: Strongly Interacting Electron Systems, Disordered Systems, Nanomaterials and Energy Materials Address: Professor ...

Auditoria de enfermagem: o impacto das anotaçóes de enfermagem no contexto das glosas hospitalares

OpenAIRE

Ferreira, Tânia S; de Souza-Braga, André Luiz; Cavalcanti-Valente, Geilsa Soraia; Ferreira de Souza, Deise; Moreira Carvalho-Alves, Enilda

2009-01-01

Este estudo tratou da nossa observação frente ao impacto das anotações de enfermagem no contexto das glosas hospitalares. Nesta perspectiva, a pesquisa se norteia pela seguinte questão: como o profissional de enfermagem pode contribuir através dos registros para não ocorrência da glosa? Temos como objetivo identificar o impacto causado pelo não registro de enfermagem contrapondo às eventuais glosas, evidenciando os principais tipos decorrentes destes registros. Metodologicamente a pesquisa ut...

Das IHS und die Rolle der Forschungsinstitute

OpenAIRE

Keuschnigg, Christian

2014-01-01

Das Institut für Höhere Studien und wissenschaftliche Forschung (IHS) ist ein unabhängiges Forschungsinstitut und leistet Forschung und Ausbildung auf Spitzenniveau für Politik, Wirtschaft und Gesellschaft. Im Wettbewerb zwischen Universitäten und angewandten Forschungsinstituten ist das IHS einzigartig, weil es unter einem Dach Grundlagenforschung und forschungsnahe Lehre mit angewandter Forschung für die wissenschaftliche Politikberatung verbindet. Mit den drei Disziplinen Ökonomie, Soziolo...

MiDAS

DEFF Research Database (Denmark)

McIlroy, Simon Jon; Kirkegaard, Rasmus Hansen; McIlroy, Bianca

A deep understanding of the microbial communities and dynamics in wastewater treatment systems is a powerful tool for process optimization and design (Rittmann et al., 2006). With the advent of amplicon sequencing of the 16S rRNA gene, the diversity within the microbial communities can now...... web platform about the microbes in activated sludge and their associated ADs. The MiDAS taxonomy proposes putative names for each genus-level-taxon that can be used as a common vocabulary for all researchers in the field....

ANALISIS WILAYAH KONSERVASI DAERAH ALIRAN SUNGAI (DAS KURANJI DENGAN APLIKASI SWAT

Directory of Open Access Journals (Sweden)

Fadli Irsyad

2015-12-01

Full Text Available Degradasi lahan merupakan penyebab utama tingginya runoff dibandingkan dengan faktor lainnya. Perubahan tata guna lahan yang terjadi pada suatu kawasan menyebabkan terjadinya perubahan kondisi catchment area dan dapat menyebabkan perubahan aliran permukaan (runoff.  Jika limpasan yang terjadi saat hujan kecil dan infiltrasi air ke dalam tanah besar, maka air terlebih dahulu disimpan di dalam tanah sehingga akan meningkatkan ketersediaan air tanah. DAS Kuanji merupakan salah satu DAS di Kota Padang yang memiliki luas 202,7 km2 dan terdiri dari 5 sub-DAS. Penelitian ini dilakukan pada kawasan DAS Kuranji yang secara geografis terletak pada 100o20’31,20” – 100o33’50.40” BT dan 00o55’59.88” - 00o47’24” LS. Penelitian ini dilaksanakan pada bulan Maret – Juni 2013. Penelitian ini menggunakan aplikasi open sources software MapWindows GIS 4.8 RC1 (4.8.1 dari www.mapwindow.org.  Tahapan awal dalam penelitian ini yakni pengumpuan data, analisis SWAT di DAS Kuranji, dan penentuan wilayah konservasi DAS Kuranji. Hasil peneltian yang menggunakan MWSWAT untuk DAS Kuranji didapatkan HRU DAS sebanyak 2.034 HRU. Limpasan terbesar yang terjadi yakni 84 mm dengan luasan 75,195 ha, dan tersebar di empat kecamatan (Pauh, Padang Utara, Nanggalo, dan Kototengah. Wilayah konservasi yang direkomendasikan yakni  Limau Manih (81,56 ha, Lambung Bukit (42,27 ha, Gunung Sarik (86,32 ha, Kuranji (60,20 ha, dan Lubuk Minturun (64,45 ha. Kata kunci: Alih Fungsi Lahan,  DAS Kuranji, Konservasi, Limpasan, MWSWAT.

Novel brewing yeast hybrids: creation and application.

Science.gov (United States)

Krogerus, Kristoffer; Magalhães, Frederico; Vidgren, Virve; Gibson, Brian

2017-01-01

The natural interspecies Saccharomyces cerevisiae × Saccharomyces eubayanus hybrid yeast is responsible for global lager beer production and is one of the most important industrial microorganisms. Its success in the lager brewing environment is due to a combination of traits not commonly found in pure yeast species, principally low-temperature tolerance, and maltotriose utilization. Parental transgression is typical of hybrid organisms and has been exploited previously for, e.g., the production of wine yeast with beneficial properties. The parental strain S. eubayanus has only been discovered recently and newly created lager yeast strains have not yet been applied industrially. A number of reports attest to the feasibility of this approach and artificially created hybrids are likely to have a significant impact on the future of lager brewing. De novo S. cerevisiae × S. eubayanus hybrids outperform their parent strains in a number of respects, including, but not restricted to, fermentation rate, sugar utilization, stress tolerance, and aroma formation. Hybrid genome function and stability, as well as different techniques for generating hybrids and their relative merits are discussed. Hybridization not only offers the possibility of generating novel non-GM brewing yeast strains with unique properties, but is expected to aid in unraveling the complex evolutionary history of industrial lager yeast.

The sick-building syndrome; Das Sick-Building-Syndrom

Energy Technology Data Exchange (ETDEWEB)

Henne, A.; Neumann, H.F.; Winneke, G.

1992-12-31

The sick-building syndrome is characterized by the presence of general, non-specific symptoms (e.g., headache, tiredness, respiratory problems, eye trouble, vertigo, nausea, unspecific hypersensitivity) in association with a particular indoor ambience. It is clearly distinguishable from `building-related illness`, referring to a well-defined clinical syndrome due to staying in a building and for which a cause can, in general, be established. Disorders in the case of the sick-building syndrome are manifold and confirmed objectifiable results are hardly available so far. Yet there are some organ-related methods for the confirmation of findings concerning, for instance, the eyes, the skin and the area of the nose. The causes of the incidence of sick-building syndrome are more or less unclear. It is a multifactorial phenomenon involving physical, biological, chemical, individual-specific and psychological factors. Buildings where sick-building syndrome occurs typically exhibit certain properties. The European Community has already made proposals for the investigation of incriminated buildings. A systematic survey by questionnaire together with individual interviews plays an import part towards clarifying the syndrome. (orig./UWA) [Deutsch] Das Sick-Building-Syndrom beschreibt das Vorhandensein von allgemeinen, nicht spezifischen Symptomen (z.B. Kopfschmerzen, Muedigkeit, Atembeschwerden, Augenreizungen, Schwindelgefuehl, Uebelkeit, unspezifische Ueberempfindlichkeit), assoziiert mit einer besonderen Innenraumumgebung. Deutlich hiervon abzugrenzen ist die ``Building related illness``, bei der ein klinisch definiertes Krankheitsbild vorliegt, das durch den Aufenthalt im Gebaeude verursacht wird und fuer das im allgemeinen eine Ursache ermittelt werden kann. Das Beschwerdebild beim Sick-Building-Syndrom ist vielfaeltig, und gesicherte, objektivierbare Befunde liegen hierzu bisher kaum vor. Dennoch gibt es einige organbezogenen Methoden zur Befundabsicherung, z.B. fuer das

Localization of thrombi using the Ga-67-DFO-DAS fibrinogen

International Nuclear Information System (INIS)

Takahashi, Eriko; Ohta, Yoshiko; Kawasaki, Sachiko; Maki, Masako; Hiroe, Michiaki; Kusakabe, Kiyoko; Kohno, Atsushi; Shigeta, Akiko

1985-01-01

This report shows demonstrable thrombus imaging with Ga-67-DFO-DAS fibrinogen in a patient with Marfan's syndrome. Significant Ga-67-DFO-DAS fibrinogen deposition was noted in the leakage surrounding replased graft of ascending aorta and lesion of pulmonary parenchyma which was suspicious of pulmonary infarction. This results promises that Ga-67-DFO-DAS fibrinogen is a useful tool for evaluation of the clotting under various forms of therapy. (author)

Números reais e curiosidades das somas infinitas

OpenAIRE

Moreno, Priscila Klitzke

2016-01-01

Podemos encontrar muitas surpresas interessantes no estudo das somas infinitas de números reais (series). Nessa perspectiva, este trabalho traz um estudo sobre as somas infinitas e mostra algumas curiosidades sobre elas, em especial sobre a serie harmônica. Começamos nosso estudo sobre somas infinitas, considerando exemplos com interpretações geométricas que tornam o estudo de series mais atraente. Discutimos também propriedades aritméticas, comutativa e associativa, das somas ...

SUB’HAA

Directory of Open Access Journals (Sweden)

Harisnal Hadi

2017-08-01

Full Text Available The preparation of the artwork entitled "Subhaa", is inspired by the Minangkabau cultural phenomenon. This work focuses on the feelings of children who will be circumcised, the pressure and fear felt by the child who will be circumcised tilled in the form of Polymetrik art works. Circumcision or commonly called Basunaik by Minangkabau society is a Sunna that must be run boys of Islam; indirectly circumcision is also required for boys in Minangkabau. In the area of darek (mainland khitan has its own ceremony, begins with a child who will be circumcised is brought to the bako house to change his clothes, then paraded around the village, after arriving at home circumcised will be held. In the evening there will be entertainment in the form of randai and bagurau saluang. This piece of music is in the form of a new composition. The performance focuses more on the composition of sound as a contextual meaning to be conveyed to the appreciator. This work is a little contrary to the aesthetics that have been awakened in the brain and soul of the arts in the Sendratasik Department of FBS Universitas Negeri Padang. But it cannot be denied that a new works will create its own aesthetic realm. Keywords: Basunaik, Artwork Music. Abstrak Penyusunan karya seni yang berjudul “Subhaa”, ini terinspirasi dari fenomena budaya Minangkabau. Karya ini menitik beratkan garapan pada perasaan anak yang akan dikhitan, tekanan dan ketakutan yang dirasakan oleh anak yang akan dikhitan digarap dalam bentuk penggarapan Polymetrik. Khitan atau biasa disebut Basunaik oleh masyarakat Minangkabau merupakan sunah yang harus dijalankan anak laki-laki Islam, secara tidak langsung khitan juga diwajibkan bagi anak laki-laki di Minangkabau. Di daerah darek (daratan khitan memiliki upacara tersendiri, diawali dengan anak yang akan dikhitan dibawa ke rumah bako untuk mengganti baju, lalu diarak keliling kampung, setelah sampai di rumah baru diadakan khitan, malamnya diadakan hiburan berupa randai dan bagurau saluang. Karya musik ini berbentuk komposisi garapan baru. Penggarapan lebih menitik beratkan kepada penggarapan bunyi sebagai makna kontekstual yang akan disampaikan kepada apresiator. Karya ini memang sedikit bertolak belakang dengan estetika yang sudah terbangun dalam otak dan jiwa kalangan seni di jurusan pendidikan sendratasik FBS Universitas Negeri Padang. Namun tidak bisa dipungkiri sebuah karya garapan baru akan menciptakan ranah estetikanya sendiri. Kata Kunci: Basunaik, Karya seni Musik.

O \\"reino das plantas\\" nos livros didáticos de ciências: análise das imagens

OpenAIRE

Rená Manoel de Souza e Silva

2017-01-01

As imagens sempre desempenharam papel fundamental na compreensão do conhecimento científico e, portanto, também nos livros didáticos de ciências. Porém, pesquisas têm mostrado que as imagens não são transparentes; por isso, defendemos a fundamental compreensão dos professores em relação ao uso das imagens no processo de ensino-aprendizagem, e na orientação da leitura e no uso desse recurso como suporte das atividades pedagógicas. Esta pesquisa analisou as imagens presentes nos livros didático...

Desafio ao uso das preparações alcoólicas para higienização das mãos nos serviços de saúde

Directory of Open Access Journals (Sweden)

Maria Fernanda do Prado

2014-09-01

Full Text Available Objetivo: Propor uma reflexão teórica sobre os aspectos relacionados ao uso das preparações alcoólicas para higienização das mãos, no contexto dos serviços de saúde, na perspectiva das recomendações internacionais e nacionais, da eficácia antimicrobiana e fatores associados. Método: Reflexão teórica acerca do uso das preparações alcoólicas para a higienização das mãos nos serviços de saúde, fundamentada nas normativas internacionais e nacionais vigentes. Resultados: A comprovação da eficácia antimicrobiana das preparações alcoólicas por métodos rigorosos que simulam condições práticas de uso é fundamental para a utilização destes produtos nos serviços de saúde. Coexistem ainda outras variáveis envolvidas na eficácia do procedimento de higienização das mãos, tais como a sua duração, o volume do produto a ser aplicado e a aceitabilidade. Conclusão: Identificam-se lacunas nas normativas oficiais, referentes aos aspectos supracitados que podem comprometer um dos componentes mais importantes do controle de infecções e a segurança do paciente.

Beer identity in Denmark

DEFF Research Database (Denmark)

Mejlholm, Ole; Martens, M.

2006-01-01

In this study a sensory profiling and a consumer test including 10 commercially Danish beers were conducted. The 10 beer samples covered four types of beer namely; lager, strong lager, ale and wheat beer, representing both new and more established beers on the Danish market. A trained panel consi...

Variation in α-acetolactate production within the hybrid lager yeast group Saccharomyces pastorianus and affirmation of the central role of the ILV6 gene.

Science.gov (United States)

Gibson, Brian; Krogerus, Kristoffer; Ekberg, Jukka; Monroux, Adrien; Mattinen, Laura; Rautio, Jari; Vidgren, Virve

2015-01-01

A screen of 14 S. pastorianus lager-brewing strains showed as much as a nine-fold difference in wort total diacetyl concentration at equivalent stages of fermentation of 15°Plato brewer's wort. Two strains (A153 and W34), with relatively low and high diacetyl production, respectively, but which did not otherwise differ in fermentation performance, growth or flavour production, were selected for further investigation. Transcriptional analysis of key genes involved in valine biosynthesis showed differences between the two strains that were consistent with the differences in wort diacetyl concentration. In particular, the ILV6 gene, encoding a regulatory subunit of acetohydroxy acid synthase, showed early transcription (only 6 h after inoculation) and up to five-fold greater expression in W34 compared to A153. This earlier transcription was observed for both orthologues of ILV6 in the S. pastorianus hybrid (S. cerevisiae × S. eubayanus), although the S. cerevisiae form of ILV6 in W34 also showed a consistently higher transcript level throughout fermentation relative to the same gene in A153. Overexpression of either form of ILV6 (by placing it under the control of the PGK1 promoter) resulted in an identical two-fold increase in wort total diacetyl concentration relative to a control. The results confirm the role of the Ilv6 subunit in controlling α-acetolactate/diacetyl concentration and indicate no functional divergence between the two forms of Ilv6. The greater contribution of the S. cerevisiae ILV6 to acetolactate production in natural brewing yeast hybrids appears rather to be due to higher levels of transcription relative to the S. eubayanus form. Copyright © 2014 John Wiley & Sons, Ltd.

Recovery from hospital-acquired anemia after acute myocardial infarction and effect on outcomes.

Science.gov (United States)

Salisbury, Adam C; Kosiborod, Mikhail; Amin, Amit P; Reid, Kimberly J; Alexander, Karen P; Spertus, John A; Masoudi, Frederick A

2011-10-01

New-onset, hospital-acquired anemia (HAA) during acute myocardial infarction (AMI) is independently associated with poor outcomes. The patterns of recovery from HAA after AMI and their association with mortality and health status are unknown. In the prospective 24-center Translational Research Investigating Underlying disparities in acute myocardial infarction Patients' Health Status (TRIUMPH) registry, we identified 530 patients with AMI and HAA (defined as normal hemoglobin at admission with the development of anemia by discharge) who had a repeat, protocol-driven hemoglobin measurement at 1 month after discharge. The 1-month measures were used to define persistent (persistent anemia) and transient (anemia resolved) HAA. The patients' health status was assessed at 1, 6, and 12 months after AMI using the Short-Form 12 Physical Component Summary, and the health status of patients with persistent and transient HAA was compared using multivariate repeated measures regression analysis. Mortality was compared using the log-rank test and proportional hazards regression analysis. Overall, 165 patients (31%) developed persistent HAA. The adjusted mean Short-Form 12 Physical Component Summary scores at the follow-up visit were significantly lower in those with persistent HAA than in those with transient HAA (-2.0 points, 95% confidence interval -3.6 to -0.3; p = 0.02). During a median follow-up of 36 months, the crude mortality (13% vs 5%, p = 0.002) and multivariate-adjusted mortality (hazard ratio 2.08, 95% confidence interval 1.02 to 4.21, p = 0.04) was greater in patients with persistent HAA. In conclusion, HAA persists 1 month after discharge in nearly 1 of 3 patients and is associated with worse health status and greater mortality. Additional investigation is needed to understand whether HAA prevention, recognition, and treatment, particularly among those with persistent HAA, will improve outcomes. Copyright © 2011 Elsevier Inc. All rights reserved.

Peran Industri Dan Produk Tekstil Pada Kelestarian Sumberdaya Lingkungan Perairan DAS Citarum

OpenAIRE

sudradjat, ade

2002-01-01

Telah diketahui bahwa sebagian besar industri yang beroperasi di DAS Citarum adalah industri tekstil, yang sebagian besar belum mengolah limbahnya dengan baik dan membuangnya ke DAS Citarum. Oleh karena itulah maka tidak mengherankan jika keberadaan industri- industri tekstil tersebut sering dinyatakan sebagai salah satu penyebab utama tercemarnya kualitas lingkungan perairan DAS Citarum.Untuk mengetahui dengan benar tentang peran industri tekstil di DAS Citarum maka paper ini disusun. Paper ...

PERAN INDUSTRI DAN PRODUK TEKSTIL PADA KELESTARIAN SUMBERDAYA LINGKUNGAN PERAIRAN DAS CITARUM

OpenAIRE

sudradjat, ade

2011-01-01

Telah diketahui bahwa sebagian besar industri yang beroperasi di DAS Citarum adalah industri tekstil, yang sebagian besar belum mengolah limbahnya dengan baik dan membuangnya ke DAS Citarum. Oleh karena itulah maka tidak mengherankan jika keberadaan industri- industri tekstil tersebut sering dinyatakan sebagai salah satu penyebab utama tercemarnya kualitas lingkungan perairan DAS Citarum.Untuk mengetahui dengan benar tentang peran industri tekstil di DAS Citarum maka paper ini disusun. Paper ...

Financiamento das pequenas e médias empresas: análise das empresas do distrito do Porto em Portugal

Directory of Open Access Journals (Sweden)

Fernando Oliveira Tavares

2015-06-01

Full Text Available RESUMO Neste artigo, o objetivo é conhecer e analisar as formas de financiamento e produtos mais utilizados pelas pequenas e médias empresas do distrito do Porto, em Portugal. Pretende-se ainda perceber a aceitabilidade e a propensão para utilização de formas de financiamento alternativas e compreender quais as dificuldades das empresas no acesso ao crédito. O método utilizado é quantitativo e exploratório, um inquérito foi enviado a 1.600 empresas do distrito do Porto, acerca das diferentes formas de financiamento das organizações. Os resultados permitem concluir que o crédito bancário é a principal fonte de financiamento das pequenas e médias empresas, seguindo-se o autofinanciamento. O financiamento pela emissão de ações e obrigações é residual. Os resultados apresentam três fatores preponderantes quando as empresas têm necessidade de financiar-se: o crescimento da empresa, o custo do empréstimo e os aspetos burocráticos. Apesar de tratar-se de um estudo exploratório, os três fatores encontrados são um contributo para o estudo sobre o financiamento de pequenas e médias empresas, merecendo atenção por parte de investidores, gestores e detentores de capital.

Reducing and verifying haloacetic acids in treated drinking water using a biological filter system.

Science.gov (United States)

Lou, Jie C; Chan, Hung Y; Yang, Chih Y; Tseng, Wei B; Han, Jia Y

2014-01-01

This study focused on reducing the haloacetic acid (HAA) concentrations in treated drinking water. HAA has been thought to be one possible nutrient supporting heterotrophic bacteria regrowth in drinking water. In this study, experiments were conducted using a pilot-scale system to evaluate the efficiency of biological filters (BF) for reducing excess HAA concentrations in water. The BF system reduced the total HAA concentration and the concentrations of five HAA species in the water. Dichloroacetic acid (DCAA), monobromoacetic acid (MBAA) and dibromoacetic acid (DBAA) were the three main HAA5 species that were present in the treated drinking water in this investigation. Combined, these three species represent approximately 77% of the HAA5 in the finished water after BF. The verification of the empirical HAA equation for the outlet in the BF system indicated linear relationships with high correlation coefficients. The empirical equation for the HAA5 concentrations in the finished water was established by examining other nutrients (e.g., dissolved organic carbon (DOC), ultraviolet absorbance at 254 nm wavelength (UV254), and ammonia nitrogen) that can reduce pathogenic contamination. These findings may be useful for designing advanced processes for conventional water treatment plants or for managing water treatment and distribution systems for providing high-quality drinking water.

Study of morphometry to debit drainage basin (DAS) arau Padang city

Science.gov (United States)

Utama, Lusi; Amrizal, Berd, Isril; Zuherna

2017-11-01

High intensity rain that happened in Padang city cause the happening of floods at DAS Arau. Floods that happened in Padang besides caused high rain intensity, require to be by research about morphometry that is cause parameter the happening of floods. Morphometry drainage basin physical network (DAS) quantitatively related to DAS geomorphology that is related to form of DAS, river network, closeness of stream, ramp, usage of farm, high and gradient steepness of river. Form DAS will influence rain concentration to outlet. Make an index to closeness of stream depict closeness of river stream at one particular DAS. Speed of river stream influenced by storey, level steepness of river. Steepness storey, level is comparison of difference height of river downstream and upstream. Ever greater of steepness of river stream, excelsior speed of river stream that way on the contrary. High to lower speed of river stream influence occurrence of floods, more than anything else if when influenced by debit big. Usage of farm in glove its link to process of infiltration where if geology type which is impermeable, be difficult the happening of infiltration, this matter will enlarge value of run off. Research by descriptive qualitative that is about characteristic of DAS. Method the used is method survey with data collecting, in the form of rainfall data of year 2005 until year 2015 and Image of DEM IFSAR with resolution 5 meter, analyzed use Software ARGIS. Result of research got by DAS reside in at condition of floods gristle.

Effective mass of two-dimensional electrons in InGaAsN/GaAsSb type II quantum well by Shubnikov-de Haas oscillations

Energy Technology Data Exchange (ETDEWEB)

Kawamata, Shuichi, E-mail: s-kawamata@riast.osakafu-u.ac.jp; Kawamura, Yuichi [Graduate School of Engineering, Osaka Prefecture University, Sakai 599-8531 (Japan); Research Organization for University-Community Collaborations, Osaka Prefecture University, Sakai 599-8570 (Japan); Hibino, Akira; Tanaka, Sho [Graduate School of Engineering, Osaka Prefecture University, Sakai 599-8531 (Japan)

2016-10-14

In order to develop optical devices for 2–3 μm wavelength regions, the InP-based InGaAs/GaAsSb type II multiple quantum well system has been investigated. By doping nitrogen into InGaAs layers, the system becomes effective in creating the optical devices with a longer wavelength. In this report, electrical transport properties are reported on the InGaAsN/GaAsSb type II system. The epitaxial layers with the single hetero or multiple quantum well structure on InP substrates are grown by the molecular beam epitaxy. The electrical resistance of samples with different nitrogen concentrations has been measured as a function of the magnetic field up to 9 Tesla at several temperatures between 2 and 6 K. The oscillation of the resistance due to the Shubnikov-de Haas (SdH) effect has been observed at each temperature. The effective mass is obtained from the temperature dependence of the amplitude of the SdH oscillations. The value of the effective mass increases from 0.048 for N = 0.0% to 0.062 for N = 1.2 and 1.5% as the nitrogen concentration increases. The mass enhancement occurs with corresponding to the reduction of the bandgap energy. These results are consistent with the band anticrossing model.

Ground Motion Analysis of Co-Located DAS and Seismometer Sensors

Science.gov (United States)

Wang, H. F.; Fratta, D.; Lord, N. E.; Lancelle, C.; Thurber, C. H.; Zeng, X.; Parker, L.; Chalari, A.; Miller, D.; Feigl, K. L.; Team, P.

2016-12-01

The PoroTomo research team deployed 8700-meters of Distributed Acoustic Sensing (DAS) cable in a shallow trench and 400-meters in a borehole at Brady Hot Springs, Nevada in March 2016 together with an array of 246, three-component geophones. The seismic sensors occupied a natural laboratory 1500 x 500 x 400 meters overlying the Brady geothermal field. The DAS cable was laid out in three parallel zig-zag lines with line segments approximately 100-meters in length and geophones were spaced at approximately 50-m intervals. In several line segments, geophones were co-located within one meter of the DAS cable. Both DAS and the conventional geophones recorded continuously over 15 days. A large Vibroseis truck (T-Rex) provided the seismic source at approximately 250 locations outside and within the array. The Vibroseis protocol called for excitation in one vertical and two orthogonal horizontal directions at each location. For each mode, three, 5-to-80-Hz upsweeps were made over 20 seconds. In addition, a moderate-sized earthquake with a local magnitude of 4.3 was recorded on March 21, 2016. Its epicenter was approximately 150-km away. Several DAS line segments with co-located geophone stations were used to test relationships between the strain rate recorded by DAS and ground velocity recorded by the geophones.

DAS: A Data Management System for Instrument Tests and Operations

Science.gov (United States)

Frailis, M.; Sartor, S.; Zacchei, A.; Lodi, M.; Cirami, R.; Pasian, F.; Trifoglio, M.; Bulgarelli, A.; Gianotti, F.; Franceschi, E.; Nicastro, L.; Conforti, V.; Zoli, A.; Smart, R.; Morbidelli, R.; Dadina, M.

2014-05-01

The Data Access System (DAS) is a and data management software system, providing a reusable solution for the storage of data acquired both from telescopes and auxiliary data sources during the instrument development phases and operations. It is part of the Customizable Instrument WorkStation system (CIWS-FW), a framework for the storage, processing and quick-look at the data acquired from scientific instruments. The DAS provides a data access layer mainly targeted to software applications: quick-look displays, pre-processing pipelines and scientific workflows. It is logically organized in three main components: an intuitive and compact Data Definition Language (DAS DDL) in XML format, aimed for user-defined data types; an Application Programming Interface (DAS API), automatically adding classes and methods supporting the DDL data types, and providing an object-oriented query language; a data management component, which maps the metadata of the DDL data types in a relational Data Base Management System (DBMS), and stores the data in a shared (network) file system. With the DAS DDL, developers define the data model for a particular project, specifying for each data type the metadata attributes, the data format and layout (if applicable), and named references to related or aggregated data types. Together with the DDL user-defined data types, the DAS API acts as the only interface to store, query and retrieve the metadata and data in the DAS system, providing both an abstract interface and a data model specific one in C, C++ and Python. The mapping of metadata in the back-end database is automatic and supports several relational DBMSs, including MySQL, Oracle and PostgreSQL.

O desenvolvimento das competências coletivas no terceiro setor

Directory of Open Access Journals (Sweden)

Lorena Tello‐Gamarra

2015-11-01

Full Text Available Dentro da abordagem de competências que se focam na gestão de recursos humanos, a abordagem de competências coletivas é uma área de pesquisa emergente. O objetivo da presente pesquisa é compreender as competências coletivas em um projeto voluntário do terceiro setor. O método utilizado foi o estudo de caso, tendo como objeto de estudo o terceiro setor, mais especificamente um projeto social. Para isto, se fez a escolha da Organização Não Governamental Parceiros Voluntários (PV com o projeto «Desenvolvimento de Princípios de Transparência e Prestação de Contas em Organizações da Sociedade Civil». Entre os resultados teóricos se identificaram 7 dimensões das competências coletivas. No que tange aos resultados empíricos referidos ao entendimento das competências coletivas no projeto voluntário do terceiro setor, observaram‐se 4 resultados: (1 todas as dimensões das competências coletivas foram comprovadas no projeto; (2 essas dimensões conseguiram ser determinantes para o desempenho do projeto, (3 as 7 dimensões influenciaram também o desempenho de toda a ONG, (4 as dimensões das competências coletivas do projeto contribuíram para que as organizações sociais pratiquem os princípios da transparência e da prestação de contas em suas atividades. Finalmente, o fato da confirmação das dimensões das competências coletivas como elemento‐chave do desenvolvimento abre a possiblidade de avançar na operacionalização deste construto.

Análise e caracterização das questões das provas da Olimpíada Brasileira de Física

Directory of Open Access Journals (Sweden)

Joao Paulo Casaro Erthal

2014-07-01

Full Text Available http://dx.doi.org/10.5007/2175-7941.2015v32n1p142 No Brasil, anualmente, são organizadas e praticadas olimpíadas escolares em diversas áreas do conhecimento, tais como: língua portuguesa, matemática, biologia, física, entre outras. A Olimpíada Brasileira de Física (OBF tem como objetivo despertar e estimular nos estudantes o interesse pela física, proporcionando desafios e incentivando-os a seguir carreiras científicas e tecnológicas. Este trabalho visa investigar os conteúdos exigidos nas provas da OBF e a forma como estes são abordados, com a finalidade de traçar um perfil das provas da OBF, aplicadas aos estudantes do ensino médio. Para isso, realizou-se uma análise das questões das provas do período de 1999 a 2013, distribuindo os conteúdos das questões das provas em seis áreas de conhecimento da física: mecânica, ondulatória, física térmica, eletromagnetismo, óptica geométrica e física moderna. Após a análise foram construídos gráficos que auxiliaram a identificar peculiaridades destas provas. Os resultados mostram uma evolução no perfil da prova, que atualmente possui uma abordagem mais contextualizada e interdisciplinar quando comparada às edições anteriores, em consonância ao que está descrito nos documentos oficiais da educação brasileira.

Aspectos das fortalezas e fragilidades no uso das metodologias ativas de aprendizagem

Directory of Open Access Journals (Sweden)

Maria José Sanches Marin

Full Text Available A implementação de novos modelos de ensino-aprendizagem vem ocorrendo na Faculdade de Medicina de Marília (Famema há mais de uma década. O presente estudo analisa as fortalezas e fragilidades dos métodos ativos de aprendizagem na ótica dos estudantes. Para a coleta de dados, realizaram-se entrevistas com estudantes dos cursos de Enfermagem e Medicina. Os dados foram interpretados por meio dos parâmetros da hermenêutica dialética. Os sentidos extraídos das falas dos estudantes indicam que as metodologias ativas estimulam o estudo constante, a independência e a responsabilidade, possibilitam a integração das dimensões biopsicossociais, preparam para o trabalho em equipe e aproximam os alunos dos usuários e da equipe. No entanto, nem todos estão preparados para isso; algumas vezes, sentem-se perdidos em busca de conhecimentos, além de apresentarem dificuldades quanto a sua inserção na equipe de saúde. A construção de novos modelos de aprendizagem requer constante empenho, visando ao seu aperfeiçoamento.

Droht den "kleinen Sprachen" das Aussterben?

Directory of Open Access Journals (Sweden)

Anita Lemić

2014-12-01

Full Text Available Die Prozesse der Globalisierung sind die Ursache für viele Änderungen in der Weltgemeinschaft, vor allem die Entfernung von Unterscheidungsmerkmalen (in Bezug darauf, dass „zwischen vielen ethnischen Zeichen, das was dauernd ist, ist die Dichotomisierung/Differenzierung eines „Wir-und-die-Anderen“ (Grbić, 2003, 93-64. Diese Zeichen wirken als Zeichen der Resozialisierung, die die bestehenden Identitäten löschen und sich an der Schaffung neuer Strukturen beteiligen. Die Zeit der Romantik in Europa ermöglichte die Schaffung von Nationalstaaten und ihr Hauptmerkmal war die Nationalsprache. Diese Art der sozialen Differenzierung hatte das Ziel, die Illusion einer vollständig homogenisierten Gesellschaft zu schaffen und damit den Prozess der Zerstörung der „kleinen“ Sprachen zu beginnen. Sprache und Kultur erwiesen sich als Grundlage der Gemeinschaftserhaltung. Die Homogenisierung ermöglicht Aktivitäten mit dem Ziel, einem Individuum zu helfen, sich als Individuum und als Mitglied der Gemeinschaft zu behaupten. Keine dieser beiden Identitäten kann ohne die Wechselwirkung mit der Umgebung erreicht werden. Die sprachliche Interaktion mit anderen Mitgliedern ist das Schlüsselsegment, das Menschen von anderen Lebensformen unterscheidet. Durch den Austausch von Erfahrungen mit anderen kommt der Mensch auf allen Ebenen voran und mit der Erfindung der Schrift öffnete er die Tür zur Entwicklung der Zivilisation. In dieser Arbeit beschäftigen wir uns mit der Frage der „Prestige“-Sprachen, die auf der Grundlage der Macht der Gemeinschaft der Muttersprachler ihren Bereich weit über die Grenzen des eigenen Landes hinaus erweitern und so eine politische und wirtschaftliche Vormachtstellung schaffen, aber auch mit den Auswirkungen jener Sprachen auf die Dekonstruktion oder möglicherweise vollständige Ausrottung der Sprachen, die auf diese Weise an Einfluss verlieren, unmodern werden und sich die Frage der Notwendigkeit ihrer

DETERMINAÇÃO DAS DEFORMAÇÕES RESIDUAIS LONGITUDINAIS DECORRENTES DAS TENSÕES DE CRESCIMENTO EM Eucalyptus spp.

OpenAIRE

Rafael Beltrame

2010-01-01

O presente estudo foi desenvolvido com o objetivo de determinar as deformações residuais longitudinais (DRL), decorrentes das tensões de crescimento em árvores em pé e vivas de diferentes clones de Eucalyptus spp. Para tanto, foram selecionados 12 clones do gênero Eucalyptus com 9 anos de idade, por meio da área basal (G), sendo, estes, plantados em um espaçamento 3,0 x 2,7 m . Para as medições das variáveis do estudo, foram selecionadas 12 árvores de cada clone, onde foram medidas as vari...

O impacto das crenças e das percepções de diversidade na relação entre diversidade e eficácia do trabalho em equipa

OpenAIRE

Ferreira, Inês de Moura

2011-01-01

Mestrado em Psicologia Social e das Organizações Apesar das várias tipologias e abordagens para explicar e compreender os efeitos da diversidade no funcionamento e na eficácia do trabalho em equipa, os resultados das investigações empíricas têm-se revelado muitas vezes inconclusivos e contraditórios. O presente estudo pretende contribuir para uma melhor compreensão dos efeitos da diversidade no desempenho das equipas, não só pela forma alternativa de definir e operacionalizar a...

Das DNA-Puzzle

Science.gov (United States)

Kirchner, Stefan

Im Jahre 1953 wurde von James Watson und Francis Crick erstmalig der strukturelle Aufbau der sogenannten DNA (Desoxyribonukleinsäure) beschrieben, welche das Erbgut jedes Lebewesens enthält. Der wesentliche Teil des Erbguts wird dabei durch eine sehr lange Folge der vier Basen Adenin (A), Cytosin (C), Guanin (G) und Thymin (T) codiert. Seit einigen Jahren ist es möglich, die Folge der vier Basen zu einer gegebenen DNA zu bestimmen. Biologen bezeichnen diesen Vorgang als Sequenzierung.

Filosofia das ciências sociais: temas atuais

OpenAIRE

Kincaid, Harold

2014-01-01

A filosofia das ciências sociais, concebida da maneira adequada, tem algo a oferecer aos que praticam as ciências sociais. Os cientistas sociais adotam em suas pesquisas, ainda que de forma implícita, alguma filosofia de sua ciência. Para evitar impasses, é melhor explicitar essa filosofia e ser criticamente consciente dos seus méritos. A filosofia das ciências sociais, por sua vez, não pode ser praticada sem um envolvimento íntimo com a pesquisa social. O artigo esboça alguns desenvolvimento...

Das Bild behinderter Menschen in den Medien

OpenAIRE

Radtke, Peter

2006-01-01

„Das Bild von Behinderung und behinderten Menschen in den Medien“ - dieses Thema führt sehr leicht zur Schwarz-Weiß-Malerei. Bekanntlich fällt es schwer, es allen recht zu machen. So nimmt es nicht Wunder, dass sich Betroffene und ihre Angehörigen in den Medien sowohl quantitativ als auch qualitativ oftmals nicht angemessen repräsentiert fühlen. [...] In dieser Situation bilden die Medien die wichtigste und oft einzige Informationsquelle über das Leben und die Möglichkeiten von Menschen mit e...

Das Curriculum Health Technology Assessment (HTA, Version 2.0

Directory of Open Access Journals (Sweden)

Perleth, Matthias

2017-10-01

Full Text Available Health Technology Assessments (HTAs liefern für zahlreiche Entscheidungen im Gesundheitswesen relevante Informationen. Die Erstellung von HTA-Berichten erfordert gut ausgebildete, interdisziplinär arbeitende Spezialisten, die angemessene Interpretation und Umsetzung in Entscheidungen erfordert Verständnis seitens der Entscheidungsträger.Der Verein zur Förderung der Technologiebewertung im Gesundheitswesen (Health Technology Assessment e.V. und das Deutsche Netzwerk Evidenzbasierte Medizin e.V. haben bereits 2006 ein HTA-Curriculum entwickelt, das als Grundlage für HTA-Fortbildungskurse sowohl für Nutzer von HTA-Informationen wie auch für HTA-Autoren dient. Das Curriculum ist u.a. Grundlage für Fortbildungskurse an mehreren Universitäten. Aufgrund methodischer Weiterentwicklungen wurde nun eine Überarbeitung des Curriculums erforderlich. Das Curriculum greift auf Struktur und Inhalte international etablierter Studiengänge zurück, berücksichtigt aber auch die Besonderheiten der Regulation von Technologien und der Entscheidungsfindung in den Gesundheitssystemen der deutschsprachigen Länder. Es ist in insgesamt 10 Module untergliedert, die neben Grundlagen und Prinzipien von HTA u.a. auf die Statusbestimmung von Technologien, Prioritätensetzung, Wissens- und Informationsmanagement, Methodik der Erstellung von HTA-Berichten und Interessenkonflikte eingehen. Gegenüber der ursprünglichen Version wurden viele Inhalte präzisiert und Erfahrungen aus Lehrveranstaltungen, die das Curriculum umsetzen, wurden berücksichtigt.

Ambientes Colaborativos Virtuais: potencial das redes sociais. O caso das empresas do Algarve

Directory of Open Access Journals (Sweden)

Ana Belo

2013-12-01

Full Text Available O objetivo do presente artigo é analisar o potencial das redes sociais no desempenho das pequenas e médias empresas da região do Algarve, tendo sido efectuado um questionário para o efeito. O estudo empírico realizado revela que os dados recolhidos (de 70 empresas possuem boas qualidades psico-métricas. Procedeu-se a uma análise categórica de componentes principais, a qual identificou duas principais tipologias de objectivos nas redes sociais: redes sociais para interacção produto-cliente e pesquisa ou conhecimento; e redes sociais com potencial para o marketing. Uma análise suplementar - análise hierárquica de clusters (com recurso ao método de agrupamento de Ward - identificou três padrões de empresas consoante o seu grau de envolvimento em redes sociais: cluster Social Tec Grau 1; cluster Social Tec Grau 2 e cluster Social Tec Grau 3. Estas análises permitem validar uma metodologia sustentável para este tipo de avaliação.

Note on de Haas-van Alphen diamagnetism in thin, free-electron films

Directory of Open Access Journals (Sweden)

J. A. Grzesik

2012-03-01

Full Text Available We revisit the problem of de Haas-van Alphen (dHvA diamagnetic susceptibility oscillations in a thin, free-electron film trapped in a synthetic harmonic potential well. A treatment of this phenomenon at zero temperature was announced many years ago by Childers and Pincus (designated hereafter as CP, and we traverse initially much the same ground, but from a slightly different analytic perspective. That difference hinges around our use, in calculating the Helmholtz free energy F, of an inverse Laplace transform, Bromwich-type contour integral representation for the sharp distribution cutoff at Fermi level μ. The contour integral permits closed-form summation all at once over the discrete orbital Landau energy levels transverse to the magnetic field, and the energy associated with the in-plane canonical momenta ℏ k x and ℏ k z. Following such summation/integration, pole/residue pairs appear in the plane of complex transform variable s, a fourth-order pole at origin s = 0, and an infinite ladder, both up and down, of simple poles along the imaginary axis. The residue sum from the infinite pole ladder automatically engenders a Fourier series with period one in dimensionless variable μ/ ℏ ω (with effective angular frequency ω suitably defined, series which admits closed-form summation as a cubic polynomial within any given periodicity slot. Such periodicity corresponds to Landau levels slipping sequentially beneath Fermi level μ as the ambient magnetic field H declines in strength, and is manifested by the dHvA pulsations in diamagnetic susceptibility. The coëxisting steady contribution from the pole at origin has a similar cubic structure but is opposite in sign, inducing a competition whose outcome is a net magnetization that is merely quadratic in any given periodicity slot, modulated by a slow amplitude growth. Apart from some minor notes of passing discord, these simple algebraic structures confirm most of the CP formulae, and their

Avaliação das guias condilar e incisal em função da curva de compensação e da altura das cúspides - Releitura das Leis de Articulação de Hanau

OpenAIRE

Roger Nishyama

2011-01-01

Este estudo teve como objetivo avaliar a variação das guias sagitais (guia condilar e guia incisal), em função do plano de orientação (curvatura e inclinação) e da altura das cúspides, no movimento protrusivo mandibular, in vitro, buscando as relações entre esses fatores, tanto de forma analógica como digital. No estudo analógico foram avaliadas as inclinações das guias condilares, inclinações da guia incisal, proeminência da curva de compensação e inclinação do plano oclusal. Para isso foram...

Percepções de enfermeiros acerca das vulnerabilidades para DST/Aids diante das conexões do processo de adolescer

OpenAIRE

Silva, Ítalo Rodolfo; Escola de Enfermagem Anna Nery; Valadares, Glaucia Valente; Escola de Enfermagem Anna Nery; Gomes, Antonio Marcos Tosoli; Universidade do Estado do Rio de Janeiro; Santos, Nereida Lucia Palko dos; Escola de Enfermagem Anna Nery; Silva, Thiago Privado da; Escola de Enfermagem Anna Nery; Leite, Joséte Luzia; Escola de Enfermagem Anna Nery/UFRJ

2015-01-01

Objetivo: conhecer a percepção de enfermeiros acerca das vulnerabilidades para as DST/Aids diante das conexões do processo de adolescer.Método: pesquisa qualitativa, com 15 enfermeiros, em um núcleo de estudos da saúde do adolescente de um hospital universitário do Rio de Janeiro/Brasil. Utilizou-se como referenciais teórico e metodológico, respectivamente, a Teoria da Complexidade e a Teoria Fundamentada nos Dados. Técnica de coleta de dados: entrevistas semiestruturadas, realizadas de janei...

Pemetaan Kelembagaan dalam Kajian Lingkungan Hidup Strategis DAS Bengawan Solo Hulu

Directory of Open Access Journals (Sweden)

Sri Rum Giyarsih

2015-10-01

Full Text Available Fakta empiris memberikan pembuktian terhadap pentingnya pengembangan kelembagaan dalam rangka mencapai keberhasilan suatu program pembangunan, bahkan seringkali program pembangunan yang mengabaikan pengembangan kelembagaan berakhir dengan kegagalan. Pengembangan kelembagaan telah menjadi bagian dari strategi pembangunan tak terkecuali dalam Kajian Lingkungan Hidup Strategis di DAS Bengawan Solo Hulu. Sasaran yang ingin dicapai dari kegiatan pengembangan kelembagaan adalah tumbuhnya kelembagaan yang tangguh, dinamis, dan berdaya saing serta mandiri dalam melakukan pengelolaan lingkungan. Untuk mencapai hal ini maka perlu dilakukan pemetaan kelembagaan di DAS tersebut. Dari pemetaan kelembagaan yang ada di wilayah ini terdapat tiga lembaga yang dapat melakukan kegiatan Koordinasi, Intergrasi, Sinergitas, Sinkronisasi (KISS yaitu BKPRD (Badan Koordinasi Penataan Ruang Daerah, BP DAS (Badan Pengelolaan Daerah Aliran Sungai/Forum DAS, dan TKPSDA WS Bengawan Solo (Tim Koordinasi Pengelolaan Sumberdaya Air Wilayah Sungai Bengawan Solo. Di antara ketiga lembaga tersebut maka TKPSDA adalah lembaga yang dipercaya untuk melakukan Koordinasi, Intergrasi, Sinergitas, Sinkronisasi (KISS dalam pengelolaan lingkungan DAS Bengawan Solo Hulu.

Apontamentos acerca das relações entre corpo feminino e cidade

Directory of Open Access Journals (Sweden)

Denise Sales Vieira

2016-10-01

Full Text Available Este artigo tem como objetivo geral discorrer, de maneira introdutória, acerca das relações entre corpo feminino e cidade, e busca entender como o estudo dessas relações pode contribuir para o entendimento da vivência feminina das cidades. Com esses apontamentos, busco investigar como se deram as abordagens da oposição mente/corpo, e como essa oposição é determinante na forma como enxergamos o corpo feminino na cidade. Deixo algumas questões passíveis de aprofundamento: Por que estudar a história das mulheres a partir da constituição de seus corpos? Que elementos acerca da história das mulheres, o corpo feminino, visto através das lentes da cidade, pode nos revelar? Há algo de específico acerca da constituição do corpo feminino que tem a ver com sua vivência da cidade?

Influência das fibras de aço e das adições minerais na fissuração de tirantes de concreto armado

Directory of Open Access Journals (Sweden)

L. A. Oliveira Júnior

Full Text Available Neste trabalho é investigada a influência das fibras de aço e das adições minerais (sílica ativa e cinza volante na fissuração de tirantes de concreto armado. Fibras de aço com gancho nas extremidades e relação de aspecto igual a 65 foram usadas nas frações volumétricas de 0,75%, 1,00% e 1,50%. Dezesseis tirantes de 800 mm de comprimento e seção transversal quadrada de 150 mm de lado reforçados com uma barra de aço CA-50 de 20 mm de diâmetro foram submetidos à tração axial para determinação das aberturas das fissuras. Os resultados mostraram que as fibras reduziram a abertura média de fissuras em até 75% e que as adições minerais melhoraram o comportamento do concreto na fissuração. As aberturas de fissuras foram comparadas aos valores sugeridos pelas recomendações das normas brasileira, americana e européia, que se mostraram inadequadas para estimar a abertura de fissuras em concretos reforçados com fibras.

A preliminary psychometric evaluation of Music in Dementia Assessment Scales (MiDAS).

Science.gov (United States)

McDermott, Orii; Orgeta, Vasiliki; Ridder, Hanne Mette; Orrell, Martin

2014-06-01

Music in Dementia Assessment Scales (MiDAS), an observational outcome measure for music therapy with people with moderate to severe dementia, was developed from qualitative data of focus groups and interviews. Expert and peer consultations were conducted at each stage of the scale development to maximize its content validity. This study aimed to evaluate the psychometric properties of MiDAS. Care home residents with dementia attended weekly group music therapy for up to ten sessions. Music therapists and care home staff were requested to complete weekly MiDAS ratings. The Quality of Life Scale (QoL-AD) was completed at three time-points. A total of 629 (staff = 306, therapist = 323) MiDAS forms were completed. The statistical analysis revealed that MiDAS has high therapist inter-rater reliability, low staff inter-rater reliability, adequate staff test-retest reliability, adequate concurrent validity, and good construct validity. High factor loadings between the five MiDAS Visual Analogue Scale (VAS) items, levels of Interest, Response, Initiation, Involvement, and Enjoyment, were found. This study indicates that MiDAS has good psychometric properties despite the small sample size. Future research with a larger sample size could provide a more in-depth psychometric evaluation, including further exploration of the underlying factors. MiDAS provides a measure of engagement with musical experience and offers insight into who is likely to benefit on other outcomes such as quality of life or reduction in psychiatric symptoms.

Das Kapital e Eu

Directory of Open Access Journals (Sweden)

David Schweickart

2017-11-01

Full Text Available A partir da sua própria biografia, o autor ensaia sobre sua interpretação de Das Kapital, de Karl Marx. Argumenta sobre a exploração capitalista, sobre o fetichismo e aponta para o problema central do capitalismo: a falta de controle dos concernidos sobre a produção de produtor úteis.

ANÁLISE DE RISCO DAS OPERAÇÕES DE MICROCRÉDITO

Directory of Open Access Journals (Sweden)

Eliana Marcia Martins Fittipaldi Torga

2017-08-01

Full Text Available No Brasil, o microcrédito tem sido aplicado para o combate à pobreza e estímulo ao crescimento e desenvolvimento econômico. É uma operação de crédito que constitui um dos temas relevantes estudados pela área da administração financeira. Esta pesquisa buscou investigar mediante a utilização das técnicas de duração e convexidade, qual é o risco das operações de microcrédito realizadas por bancos governamentais brasileiros e abordou o tema com relação á gestão de risco de crédito. Este estudo verificou que as oscilações nas taxas constituem um risco, que pode causar problemas nos resultados financeiros das Instituições de Microfinanças se os retornos obtidos no cumprimento das obrigações contratadas passarem a ser insuficientes. As parcerias institucionais com agências de desenvolvimento podem se constituir um importante fator para garantir a concessão de crédito. Sugerem-se novos estudos para a análise das regulamentações do setor, os métodos de concessão e a avaliação de risco das operações.

Das imagens do mundo ao mundo das imagens − as possibilidades da TV digital para a educação

Directory of Open Access Journals (Sweden)

Simone de Lucena Ferreira

2010-04-01

Full Text Available O uso de imagens foi uma das primeirasformas da comunicação humana quecomeçou com as garatujas nas cavernasno período da pré-história. O desenvolvimentode tecnologias, como a máquinafotográfica, o cinema e a televisãopermitiu que as imagens pudessem serregistradas e apresentadas a um maiornúmero de pessoas. As tecnologias digitaisdesenvolvidas a partir na metadedo século XX, possibilitaram mudançasna forma de agir, pensar, se relacionare estudar dos indivíduos. A TV digital éuma dessas tecnologias que poderátrazer grandes transformações sociaisa depender das escolhas políticas eeconômicas feitas por cada país. Nesteartigo, abordamos sobre as possibilidadese potencialidades na TV digital naeducação considerando o uso das redescolaborativas como importantes para aimplantação do Canal de Educação naTV digital.

Perfil sensorial e composição físico-química de cervejas provenientes de dois segmentos do mercado brasileiro Sensorial and physical-chemical evaluation of beers deriving from two segments of Brazilian market

Directory of Open Access Journals (Sweden)

F.B. Araújo

2003-08-01

Full Text Available Foram estudadas seis marcas de cervejas produzidas no Brasil, das quais as marcas 1, 2, 3 e 4 foram provenientes de microcervejarias e as 5 e 6 são líderes do mercado nacional, com o objetivo de avaliar sua qualidade pelas características físico-químicas e sensoriais. A marca 1 constituiu cerveja "ale", tipo Trigo; a 2, cerveja "lager", tipo Amber; e as demais foram cervejas "lager", tipo Pilsen. As marcas 1 e 2 apresentaram concentrações mais elevadas de ácidos voláteis e foram as que evidenciaram maior intensidade do gosto amargo. Observou-se que as marcas provenientes de microcervejarias foram as que apresentaram maior intensidade dos atributos sensoriais, devendo-se ressaltar que as marcas 1 e 2 foram as que apresentaram cor, aroma de levedura, aroma de fruta, aroma de papelão, sabor oxidado, gosto doce e aroma de diacetil mais intensos. As marcas que apresentaram, mediante análise físico-química, maior concentração de acetato de etila foram as que tiveram aroma de fruta perceptível pela equipe sensorial, não sendo este atributo detectado nas marcas 3, 4, 5 e 6. O aroma de solvente não foi detectado em nenhuma das marcas avaliadas, o que indica que a concentração de álcoois superiores estava abaixo do limiar sensorial de detecção. As marcas 3, 4 e 5 foram utilizadas para avaliar a aceitação do produto, não tendo sido verificada diferença significativa (p > 0,05 entre elas, que se situaram entre os termos hedônicos "gostei muito" e "gostei ligeiramente", o que contraria o esperado, já que as microcervejarias objetivam uma cerveja diferenciada e de maior atração para o consumidor.Six brands of beer produced in Brazil, of which brands 1, 2, 3 and 4 derived from small brewery and brands 5 and 6 were leaders of the national market, were studied to evaluate their quality through physical-chemical and sensorial characteristics. Brand 1 constitutes the "ale" Wheat type and brand 2 the "lager" Amber type. The other

Cyclotron resonance and De Haas-Van Alphen effect in (BEDT-TTF) sub 8 Hg sub 4 Cl sub 1 sub 2 (C sub 6 H sub 5 Cl) sub 2 organic conductor

CERN Document Server

Voskobojnikov, I B; Samarin, N A; Cluchanko, N E; Lyubovskaya, R N; Moshchalkov, V V

2002-01-01

Within 0.33-1.44 K temperature range at B <= 50 T magnetic field values one measured the De Haas-Van Alphen effect for (BEDT-TTF) sub 8 Hg sub 4 Cl sub 1 sub 2 (C sub 6 H sub 5 Cl) sub 2 organic quasi-two-dimensional conductor. Analysis of quantum oscillations with regard to data on cyclotron resonance derived for 40-120 GHz frequency interval enabled to determine that a complex spectrum of quantum oscillations was formed by alpha approx 256 T and beta approx 670-610 T fundamental frequencies as well as, by combination and multiple frequencies. It is shown that nature of temperature rearrangement of oscillation spectrum may be interpreted in terms of model taking account of occurrence of magnetic phase transition at T sub c approx 0.9 K and proximity of a fundamental frequency with m* = 1.48m sub 0 efficient mass to the spin dumping condition

Fontes de financiamento para planos de mobilidade urbana: a sistematização das janelas de oportunidade de financiamento geridas pelo Ministério das Cidades

OpenAIRE

Ruiz, Isadora

2015-01-01

O presente trabalho tem como objetivo a sistematização das janelas de oportunidade de financiamento de elaboração e implementação dos Planos de Mobilidade Urbana, atualmente geridas pelo Ministério das Cidades. Para tanto, foi primeiramente realizado um diagnóstico da Mobilidade Urbana no Brasil, desenvolvido o conceito de Plano de Mobilidade Urbana, bem como identificadas as janelas de oportunidade de financiamento. Em seguida, o trabalho descreve em detalhes cada uma das janelas de oportuni...

A moeda como um fator interferente na escolha locacional das empresas

Directory of Open Access Journals (Sweden)

Ana Tereza Lanna Figueiredo

2012-12-01

Full Text Available A literatura sobre economia regional, historicamente, conferiu pouco destaque à moeda e à sua capacidade de afetar a economia. Dentre as razões, pode-se apontar a postura ortodoxa assumida pelos economistas regionais como uma das principais. Se a moeda não impacta a economia real no âmbito nacional, certamente não irá desempenhar papel no contexto regional. A despeito da tendência de negligenciar a importância das variáveis monetárias no crescimento das regiões, alguns estudos sobre desenvolvimento regional vêm mostrando que a moeda não é neutra e produz impacto diferenciado no espaço. Entretanto, ainda que tais estudos tenham contribuído para o avanço na discussão regional, não foi elaborado um aparato conceitual que revele como a moeda influencia na decisão locacional das empresas. Este indagação servirá de eixo para o desenvolvimento das reflexões apresentadas no artigo.

Estudo das estratégias operacionais das empresas de tubos e conexões de PVC na indústria plástica joinvillense nos anos 90

OpenAIRE

Klug, Jonas Fernandes

2001-01-01

Dissertação (mestrado) - Universidade Federal de Santa Catarina, Centro Sócio-Econômico. Programa de Pós-Graduação em Economia Esta dissertação de mestrado, cujo título é Estudo das Estratégias Operacionais das Empresas de Tubos e Conexões de PVC na Indústria Plástica Joinvilense nos anos 90, focaliza determinados aspectos da competitividade industrial no atual contexto econômico, com base nos principais acontecimentos das décadas de 70, 80 e 90, a partir da problemática: O setor industria...

Das ATHENA-Projekt: [

Directory of Open Access Journals (Sweden)

Passenheim, Renate

2006-02-01

Full Text Available [english] Since the winter semester of 2002/03, the Medical Faculty of the University of Heidelberg has been using the electronic learning environment ATHENA. It is the "virtual bulletin board" for the exchange and provision of information on the study of medicine within the faculty. Since 2004/05, the platform has been operated using the open source system LRN. The system is used with the focus on document management. The use of the interactive learning contents and programme takes place as a web-based support of the required attendance classes and independent study. The tools available on the platform are used within the departments for the integration of computer-assisted examination concepts, and the conducting of online course evaluations. [german] Seit dem Wintersemester 2002/03 setzt die Medizinische Fakultät Heidelberg die elektronische Lernumgebung ATHENA ein. Sie ist das "Virtuelle Schwarze Brett" für den Austausch und die Bereitstellung von Informationen zum Medizinstudium an der Fakultät. Seit 2004/05 wird die Plattform mit dem Open-Source-System .LRN betrieben. Das System wird eingesetzt mit dem Schwerpunkt der Kurs- und Dokumentenverwaltung. Die Nutzung der interaktiven Lerninhalte und -programme erfolgt als webbasierte Unterstützung der Präsenzveranstaltungen sowie im Selbststudium. Die in der Plattform verfügbaren Tools werden in den Fachbereichen zur Integration computerunterstützter Prüfungskonzepte sowie zur Durchführung von Online-Kursevaluationen eingesetzt.

DISPOSITIVO DAS DROGAS E GOVERNO DA VIDA

Directory of Open Access Journals (Sweden)

Wanderson Vilton Silva

Full Text Available Resumo Na perspectiva da Psicologia Social em diálogo com as teorizações de Michel Foucault e Giorgio Agamben, o objetivo deste artigo é problematizar de que maneira as drogas são constituídas como explicação para assassinatos de moradores de rua, construindo práticas e discursos relacionados ao governo da vida e da morte nas cidades. O material que apresentamos consiste em textos midiáticos e documentos públicos elaborados entre julho de 2010 e novembro de 2012 abordando tais assassinatos. Analisamos como o dispositivo das drogas formula uma ambiguidade e uma complexidade importantes para o governo dos moradores de rua a partir da construção de oposições: criminoso ou em situação de vulnerabilidade social. Procuramos contribuir criticamente com políticas públicas que visem os diversos modos de existir na cidade, pensar os espaços urbanos, os modos de governo e os processos de subjetivação, considerando a análise da ambiguidade e da complexidade produzidas em torno do dispositivo das drogas.

Efeito de herbicidas e fungicidas nas curvas de progresso e quantificação de danos causados pela ferrugem asiática da soja Effect of herbicides and fungicides on progress curves and damage quantification caused by soybean rust

Directory of Open Access Journals (Sweden)

Guy Mitsuyuki Tsumanuma

2010-07-01

Full Text Available O fungo Phakopsora pachyrhizi Sydow & Sydow representa grande ameaça à sojicultura nas principais regiões produtoras do mundo, onde significativas perdas foram relatadas. Na quantificação de danos causados, muitas são as variáveis a serem estudadas, como área abaixo da curva de progresso da doença (AACPD, absorção de luz da área foliar sadia (HAA e duração da área foliar sadia (HAD, além das curvas de progresso da doença. Neste trabalho, objetivou-se verificar a influência de diferentes herbicidas e fungicidas no progresso da doença, bem como suas implicações nas variáveis referentes à área foliar sadia e à produtividade da cultura. Os tratamentos testados em duas cultivares ('MG/BR46 Conquista' e 'BRS Valiosa RR' foram: 1. Testemunha; 2. Testemunha com herbicidas; 3. Herbicidas e pyraclostrobin (V4 + pyraclostrobin + epoxiconazole (R2 e R5.1; 4. Herbicidas e pyraclostrobin (V4 + epoxiconazole (R2 e R5.1; e 5. Herbicidas (V4 + pyraclostrobin + epoxiconazole (R2 e R5.1. Os herbicidas utilizados em 'MG/BR-46 Conquista' foram sethoxydim, bentazon e chlorimuron-ethyl, sendo utilizado glyphosate na 'BRS Valiosa RR'. O modelo logístico foi o que melhor se adequou à severidade média das avaliações e à curva de progresso da doença. Para o terço inferior, posição do dossel mais propícia à doença, o modelo logístico com taxa variável foi o que mais se ajustou aos dados. A pulverização de pyraclostrobin + epoxiconazole reduziu a taxa de desenvolvimento de P. pachyrhizi em relação à epoxiconazole. A utilização da mistura influenciou as variáveis AACPD, HAA e HAD, sendo estas consideradas apropriadas para a quantificação dos danos provocados pela ferrugem asiática. Na 'MG/BR-46 Conquista', a ação dos herbicidas afetaram temporariamente a área foliar, atingindo indiretamente as variáveis HAA e HAD.Phakopsora pachyrhizi Sydow & Sydow is the worst threat for soybean crop in the most important growing

PENGELOLAAN DAS CITARUM BERKELANJUTAN

OpenAIRE

kurniasih, nia

2011-01-01

Sungai citarum merupakan sungai utama di DAS Citarum yang dimanfaatkan untuk berbagai keperluan, tidak hanya digunakan oleh 7 kabupaten dan 2 Kota di Jawa Barat tetapi juga sebagai sumber air baku air minum Kota Jakarta. Penurunan kualitas maupun kuantitas Sungai Citarum sudah sangat memprihatinkan, kondisi tersebut diakibatkan oleh kesadaran masyarakat dan pemerintah yang belu optimal. Peraturan-peraturan Pemerintah sudah ada tetapi pelaksanaan dilapangan belum maksimal dibarengi penegakan h...

ESTUDO DAS VARIÁVEIS OPERACIONAIS E CONJUNTURAIS SOBRE O MARKET VALUE DAS EMPRESAS DE CARNES E DERIVADOS NO BRASIL

Directory of Open Access Journals (Sweden)

Eduardo Pozzi Lucchesi

2015-06-01

Full Text Available O objetivo deste trabalho é identificar as variáveis relacionadas aos aspectos operacionais e conjunturais que influenciam o Market Value das empresas do segmento de carnes e derivados listadas na BM&FBovespa, no período de 2007 a 2013. O estudo foi elaborado sob a perspectiva de dois eixos teóricos. O primeiro foi uma análise das contribuições do Market Value como um indicador útil para determinação do valor justo de mercado criado aos acionistas e, portanto, constituindo uma base sólida para mensuração do desempenho das empresas. O segundo foi a Hipótese de Mercado Eficiente que considera a eficiência da informação ou o impacto de determinadas informações na precificação dos ativos. O modelo especificado produziu resultados que ratificaram algumas hipóteses da pesquisa, tanto na significância individual, quanto no sinal de algumas variáveis independentes. Além disso, o modelo apresentou significância global, dada pelo teste F, a 5%, com um coeficiente de determinação múltiplo ajustado de 9,22%.

Effect of increasing growth temperature on yeast fermentation ...

African Journals Online (AJOL)

The effect of increasing growth temperature on yeast fermentation was studied at approximately 5 oC intervals over a range of 18 – 37 oC, using one strain each of ale, lager and wine yeast. The ale and wine yeasts grew at all the temperatures tested, but lager yeast failed to grow at 37 oC. All these strains gave lower ...

Orogenias: das margens continentais ao interior remoto das placas, uma revisão no tema

Directory of Open Access Journals (Sweden)

Benjamim Bley de Brito Neves

2016-05-01

Full Text Available Esta síntese do conceito de orogenias abrange desde a Tectônica de Placas dos anos 1970, adendos e modelos "alternativos", que buscam explicar orogenias distantes das zonas de interação de placas. A análise crítica dos modelos originais resultou em adendos que incluem domínios proterozoicos e paleozoicos e observações sobre reologia e história termo-tectônica da litosfera. Os modelos alternativos explicam a orogênese por subdução local de litosfera continental, sem envolver litosfera oceânica. Nos anos 1990, houve notável avanço no estudo das causas da subsidência (tectônica formadora de bacias e estudos que contestam a rigidez das placas e propõem modelos de enfraquecimento devido à ação termal. Orogenias intracontinentais, entendidas como caso extremo da inversão de bacias, ocorrem em praticamente todos os continentes. Esforços gerados em zonas de interação de placas podem ser transmitidas continente adentro por milhares de quilômetros e gerar tectônica deformadora longe de suturas. Embora esteja ainda em estágio de fluxo, o conceito de orogenias intracontinentais ("telessuturais" vem se consolidando, embora não tenha sido incorporado a livros-texto. O histórico e o reexame do tema possibilitam classificar os orógenos segundo três variáveis principais: posição em relação às zonas de sutura, organização geométrico-geológica (em planta e nível de exumação.

Branding and Performance in the Global Beer Market

DEFF Research Database (Denmark)

Madsen, Erik Strøjer

The mass market for beers is served by a few global breweries in an oligopoly structure covering most of the world market. The homogeneity of their main lager beers are very high and produced at large scaled plants at low costs. However, the breweries spend large amounts of money to promote some...... of the lager beers as premium beers and at a high and increasing price premium. Based on a database with prices for standard and premium lager, the paper study the development in the consumption of different types of beers on the global market in recent years. We estimate the price premium on premium beers...... and relate it to the rapid change in the oligopoly structure of the market through the merger and acquisition activities....

The law concerning the environmental impact assessment. Vol. 1. Collection of regulations with an introduction to EIA law; Das Recht der Umweltvertraeglichkeitspruefung. Bd. 1. Vorschriftensammlung mit Einfuehrung in das UVP-Recht

Energy Technology Data Exchange (ETDEWEB)

Peters, H.J.

1995-12-31

The present book contains all regulations relevant to EIA in compact form: The EU EIA Directive; the Federal Law on the EIA; the Procedural Rules of Atomic Energy Law; the Ninth Ordinance on the Federal Emissions Control Law including the pertinent general administrative regulation; the Federal Mining Law; the Federal Building Law; the Federal Regional Planning Law; and the EIA laws of the Laender such as implementing regulations, the Land EIA Laws, and the Land Planning Laws. There is a basic introduction to EIA law preceding this collection of regulations and laws. (orig./HP) [Deutsch] Das Buch bietet alle UVP-Vorschriften in kompakter Form, die UVPRL der EU, das UVPG, die Atomrechtliche Verfahrensverordnung (AtVfV) und die 9. BImSchV einschliesslich der entsprechenden Allgemeinen Verwaltungsvorschrift sowie das BBergG, das BauGB, das ROG bis hin zum UVP-Recht der Laender wie DurchfuehrungsVO, LUVPG und Landesplanungsgesetzen. Vorangestellt ist diesen Vorschriften eine grundlegende Einfuehrung in das Recht des UVP. (orig./HP)

A CONTRIBUIÇÃO DAS UNIVERSIDADES ESTADUAIS (UEs PARA O ENSINO SUPERIOR NO BRASIL

Directory of Open Access Journals (Sweden)

Clécio Moreira Lopes

2015-07-01

  Analisa-se a participação das universidades estaduais no ensino superior do Brasil, comparando-as com as federais, municipais e privadas em termos do número de instituições, vagas, ingressantes, matrículas e concluintes antes e depois da Lei de Diretrizes e Bases da Educação Nacional. Pergunta-se: qual a contribuição para o ensino superior brasileiro e que efeitos as inovações da LDB provocaram no setor? Deseja-se dimensionar essa participação, comparando a parcela de contribuição das UEs com a dos demais segmentos antes das inovações da lei geral. Tomam-se por base os Censos do Ensino Superior realizados pelo INEP, analisando a proporção do segmento em relação ao total. Constatou-se que as estaduais são as primeiras instituições universitárias e que, salvo nas primeiras décadas, quando a federalização subtraiu algumas unidades, até 1996, ampliava sua participação com 20% das instituições, 15% dos ingressantes, 17% das matrículas, 19% de concluintes e  13% das vagas. Desde então, apesar dos acréscimos, tem reduzido sua fatia, tendo, em 2013, 19% das universidades, 5% das vagas, 8% dos ingressantes, 13% das matrículas e 14% dos concluintes, não acompanhando o crescimento das federais e, principalmente, das privadas que, favorecidas com as alterações na legislação, tornaram-se o maior segmento. Conclui-se, então, que a participação das universidades estaduais no ensino superior brasileiro tem experimentado ora ampliação, ora redução, mas sempre favorecendo o acesso ao ensino superior de grandes camadas da população brasileira.   Palavras-chave: Ensino superior. Educação brasileira. Universidades estaduais. Ensino superior estadual.

APLIKASI DATA CITRA SATELIT LANDSAT UNTUK PEMANTAUAN DINAMIKA PESISIR MUARA DAS BARITO DAN SEKITARNYA

Directory of Open Access Journals (Sweden)

Abdur Rahman

2016-06-01

Full Text Available Telah terjadi terjadi kerusakan habitat lingkungan mangrove, abrasi dan akresi yang menyebabkan semakin tingginya muka air  di sepanjang DAS Sungai Barito (DAS Martapura, DAS Alalak dan DAS Kuin, sebab erjadinya proses abrasi dan akresi  yang terjadi di sepanjang garis pantai, terutama DAS Martapura, DAS Alalak dan DAS Kuin. Klasifikasi pemanfaatan lahan dan konversinya serta perubahan pesisir berupa akresi dan abrasi di sepanjang pantai area penelitian di analisis dengan memanfaatkan informasi dari data citra satelit Landsat multi temporal yang di peroleh pada tanggal 29 Juni tahun 1985, dan 03 September 2006. Dominasi pemanfaatan lahan berupa HPH, pertambangan dan pemukiman dengan konversi lahan pada hutan untuk pemanfaatan lain memberikan dampak erosi yang cukup besar dengan ditunjukannya wilayah pesisir yang mengalami peningkatan akresi terutama pada bagian muara sungai (delta. Tren perubahan yang terlihat pada kawasan pesisir di area penelitian selama 21 tahun adalah abrasi sebesar 294,55 m2 di daerah Muara S. Martapura, 75,53 m2 di sekitar muara S. Alalak. Dan perubahan Abrasi sebesar 177,42 m2 , dan akresi sebesar 610,86 m2 di sekitar Muara S. Barito/Kuin. Have happened happened damage of environmental habitat of mangrove, and abrasi of akresi causing its excelsior of face irrigate alongside DAS River of Barito (DAS Martapura, DAS Alalak and of DAS Kuin, because the happening of process of abrasi and of akresi that happened alongside coastline, especially DAS Martapura, DAS Alalak and  DAS Kuin. Classification exploiting of farm and its conversion and also change of coastal area in the form of and akresi of abrasi alongside research area coast in analysis by exploiting information of satellite image data of Landsat temporal multi which in obtaining on 29 June year 1985, and 03 September 2006. Domination exploiting of farm in the form of HPH, settlement and mining with farm conversion at forest for other exploiting give big enough

From Piketty’s Capital to Marx’s das Kapital

DEFF Research Database (Denmark)

Larsen, Øjvind

2016-01-01

as the title Capital claims to be a follow up of Karl Marx’s Das Kapital for the twenty-first century. Piketty is similar to Marx in his ambition to give a large historical, or a world historical perspective on the significance of capitalist economy for the development of global society. Given this background...... it could be interesting to consider the relations between Piketty’s Capital and Marx’s Das Kapital....

Die Entdeckung des Higgs-Teilchens oder wie das Universum seine Masse bekam

CERN Document Server

2013-01-01

Im Oktober 2013 setzte der Nobelpreis für Peter Higgs und François Englert den vorläufigen Höhepunkt in der verrückten Geschichte um das sogenannte Gottesteilchen, das Higgs-Boson. Schon im Juli des Vorjahres hatten die Physiker weltweit gejubelt: Mehr als fünfzig Jahre nachdem Peter Higgs und andere Wissenschaftler die Existenz des Teilchens theoretisch begründet hatten, war es im gigantischen Teilchenbeschleuniger CERN gefunden worden. Jetzt erzählen Harald Lesch und seine Co-Autoren, warum sich rund um das Higgs-Teilchen so viele skurrile Missverständnisse und mediale Sensationen ranken. Gewohnt kurzweilig und gut verständlich enthüllen sie, wie aus dem verzweifelt gesuchten „gottverdammten Teilchen“ das Gottesteilchen wurde, dass der Urknall nicht simuliert werden kann und dass Schwarze Löcher nicht unbedingt alles verschlingende Monster sind. Dabei wird deutlich, dass die Suche nach den geheimnisvollen Kräften, die das Universum, unsere Erde und letztlich auch uns Menschen zusammenhalten...

Os conteúdos das visões da ayahuasca

OpenAIRE

Shanon,Benny

2003-01-01

Este artigo examina os conteúdos das alucinações visuais induzidas pela infusão psicotrópica ayahuasca. Ele faz parte de uma investigação fenomenológica mais ampla que busca estudar a ayahuasca de uma perspectiva psicológico-cognitiva. (Até agora, quase todos os estudos da ayahuasca partiram das ciências naturais ou da antropologia.) Análises comparativas quantitativas revelam que certos itens de conteúdo específico são especialmente prevalescentes em visões da ayahuasca e se reencontram em r...

Pressure-assisted electrokinetic injection for on-line enrichment in capillary electrophoresis-mass spectrometry: a sensitive method for measurement of ten haloacetic acids in drinking water.

Science.gov (United States)

Zhang, Huijuan; Zhu, Jiping; Aranda-Rodriguez, Rocio; Feng, Yong-Lai

2011-11-07

Haloacetic acids (HAAs) are by-products of the chlorination of drinking water containing natural organic matter and bromide. A simple and sensitive method has been developed for determination of ten HAAs in drinking water. The pressure-assisted electrokinetic injection (PAEKI), an on-line enrichment technique, was employed to introduce the sample into a capillary electrophoresis (CE)-electrospray ionization-tandem mass spectrometry system (ESI-MS/MS). HAAs were monitored in selected reaction monitoring mode. With 3 min of PAEKI time, the ten major HAAs (HAA10) in drinking water were enriched up to 20,000-fold into the capillary without compromising resolution. A simple solid phase clean-up method has been developed to eliminate the influence of ionic matrices from drinking water on PAEKI. Under conditions optimized for mass spectrometry, PAEKI and capillary electrophoresis, detection limits defined as three times ratio of signal to noise have been achieved in a range of 0.013-0.12 μg L(-1) for ten HAAs in water sample. The overall recoveries for all ten HAAs in drinking water samples were between 76 and 125%. Six HAAs including monochloro- (MCAA), dichloro- (DCAA), trichloro- (TCAA), monobromo- (MBAA), bromochloro- (BCAA), and bromodichloroacetic acids (BDCAA) were found in tap water samples collected. Crown Copyright © 2011. Published by Elsevier B.V. All rights reserved.

Metrópole de Risco : o caso da Vila Dique e do aterro sanitário da zona norte na poluição das águas superficiais e subterrâneas das bacias hidrográficas do Arroio da Areia e Passo das Pedras/Porto Alegre-RS

OpenAIRE

Adriano Lima Troleis

2009-01-01

O presente estudo investigou a influência da vila Dique o do Aterro Sanitário da Zona Norte, na qualidade das águas superficiais e subterrâneas, das bacias hidrográficas do arroio da Areia e Passo das Pedras, no município de Porto Alegre, Rio Grande do Sul, Brasil. A metodologia deste estudo envolveu duas estratégias de abordagem: teórico-conceitual e operacional. A teórica orientou-se pelos eixos de abordagem: qualidade das águas; processo de urbanização mundial, brasileiro e da cidade de Po...

Deciphering the hybridisation history leading to the Lager lineage based on the mosaic genomes of Saccharomyces bayanus strains NBRC1948 and CBS380.

Directory of Open Access Journals (Sweden)

Huu-Vang Nguyen

Full Text Available Saccharomyces bayanus is a yeast species described as one of the two parents of the hybrid brewing yeast S. pastorianus. Strains CBS380(T and NBRC1948 have been retained successively as pure-line representatives of S. bayanus. In the present study, sequence analyses confirmed and upgraded our previous finding: S. bayanus type strain CBS380(T harbours a mosaic genome. The genome of strain NBRC1948 was also revealed to be mosaic. Both genomes were characterized by amplification and sequencing of different markers, including genes involved in maltotriose utilization or genes detected by array-CGH mapping. Sequence comparisons with public Saccharomyces spp. nucleotide sequences revealed that the CBS380(T and NBRC1948 genomes are composed of: a predominant non-cerevisiae genetic background belonging to S. uvarum, a second unidentified species provisionally named S. lagerae, and several introgressed S. cerevisiae fragments. The largest cerevisiae-introgressed DNA common to both genomes totals 70kb in length and is distributed in three contigs, cA, cB and cC. These vary in terms of length and presence of MAL31 or MTY1 (maltotriose-transporter gene. In NBRC1948, two additional cerevisiae-contigs, cD and cE, totaling 12kb in length, as well as several smaller cerevisiae fragments were identified. All of these contigs were partially detected in the genomes of S. pastorianus lager strains CBS1503 (S. monacensis and CBS1513 (S. carlsbergensis explaining the noticeable common ability of S. bayanus and S. pastorianus to metabolize maltotriose. NBRC1948 was shown to be inter-fertile with S. uvarum CBS7001. The cross involving these two strains produced F1 segregants resembling the strains CBS380(T or NRRLY-1551. This demonstrates that these S. bayanus strains were the offspring of a cross between S. uvarum and a strain similar to NBRC1948. Phylogenies established with selected cerevisiae and non-cerevisiae genes allowed us to decipher the complex hybridisation

Simetria das medidas timpanométricas e as respostas das emissões otoacústicas transientes em neonatos

Directory of Open Access Journals (Sweden)

Liliane Aparecida Fagundes Silva

2014-12-01

Full Text Available OBJETIVO: verificar a ocorrência de simetria maior ou igual à 70%, entre as orelhas, comparando os resultados da timpanometria nas frequências de 226 e 1000Hz com as respostas das emissões otoacústicas em neonatos. MÉTODOS: foram avaliados 39 neonatos, em média com 60 horas de vida, sendo 20 do sexo feminino e 19 do sexo masculino. Cada recém-nascido foi submetido à avaliação timpanométrica com as sondas de 226 e 1000 Hz, e avaliação das emissões otoacústicas transientes em ambas as orelhas. Os resultados foram submetidos a testes estatísticos. RESULTADOS: na análise da amostra pode-se observar ocorrência de simetria <70% nas respostas das emissões otoacústicas em 74,4% do total de neonatos. Por outro lado, na timpanometria, houve uma maior ocorrência de simetria ≥ 70%, tanto para sonda de 226 quanto para 1000Hz (76,9% e 84,6%, respectivamente. No que diz respeito ao gênero e orelha, as diferenças encontradas em cada teste não foram significantes, embora tenha sido observada maior amplitude de respostas de emissões otoacústicas na orelha direita. CONCLUSÃO: os resultados sugerem haver simetria no sistema auditivo em sua porção mais periférica, e início de assimetrias a partir da cóclea.

Politische Bildung und das Web 2.0

Directory of Open Access Journals (Sweden)

Heike Schaumburg

2011-08-01

Full Text Available Aktuell erhält die Diskussion um die Rolle des Internet in der Politischen Bildung neuen Auftrieb durch die Entwicklung der sogenannten Web-2.0- Technologien, die im Vergleich zum Web 1.0 ein erheblich grösseres Potenzial zur Mitgestaltung politischer Inhalte und Prozesse und bzw. zur Partizipation bieten, aber auch neue Möglichkeiten der Kommunikation und Vernetzung eröffnen. In der vorliegenden Studie wird der Frage nachgegangen, inwieweit das Internet und speziell das Web 2.0 in der Lage sind, die in die Technik gesetzten Hoffnungen zu erfüllen. Dabei wird zunächst ausgelotet, welche Potenziale das Web 2.0 für die Politische Bildung mit Blick auf ihre didaktische Gestaltung bieten könnte. Im Anschluss daran wird auf der Basis einer Analyse des Internet-Angebots der traditionellen Anbieter Politischer Bildung (Bundes- und Landeszentralen für Politische Bildung, politische Stiftungen sowie von Internetportalen im Bereich Politische Bildung festgestellt, welche Verbreitung Web-2.0-Angebote gegenwärtig besitzen. Schliesslich wird auf der Grundlage einer Nutzerbefragung an knapp 300 Teilnehmern virtueller politischer Bildungsangebote einer politischen Stiftung der Frage nachgegangen, wie Web-2.0-Angebote in der Politischen Bildungsarbeit aus Nutzersicht beurteilt werden.

Clinical applications of Ga-67 DFO-DAS-fibrinogen

International Nuclear Information System (INIS)

Iio, Masahiro; Ohtake, Tohru; Nishikawa, Junichi; Watanabe, Toshiaki; Yasuhara, Hiroshi; Ohashi, Shigenobu; Takayama, Yutaka; Tada, Yusuke; Shirakawa, Motoaki

1987-01-01

Ga-67 DFO-DAS-fibrinogen scanning was performed in 15 patients to detect fresh arterial thrombus. Seven patients were preoperative cases of aortic aneurysm and eight were postoperative cases of graft bypass. Scanning was performed on the first and second days after the injection. Nine of 13 grafts in eight cases were visualized by 67 Ga-DFO-DAS-fibrinogen scan. Velour Dacron grafts were more strongly visualized compared with woven Dacron or Goatex. In three patients with aortic aneurysm in whom fresh thrombus was identified by operative findings, arterial thrombus was clearly visualized by 67 Ga-DFO-DAS-fibrinogen scan, whereas in three other patients with aortic aneurysm, thrombus was not visualized, although it was identified by other examinations. In one case, a marked accumulation was observed in the abdominal aorta, although no arterial thrombus was found at operation. This was thought to be an accumulation in a blood pool because it decreased on the second day. We think it important to observe the relative changes of accumulation. (author)

Dansk oversættelse af MiDAS, et redskab til assessment af musikterapi for personer med demens

DEFF Research Database (Denmark)

Ridder, Hanne Mette Ochsner; Lykkegaard, Chris; McDermott, Orii

2018-01-01

DAS explored which procedures is used for outcome measure translation and cultural adaptation, and based on this recommended a ten-step procedure. We applied this procedure in order to translate MiDAS and hereby develop the Danish MiDAS-DK. The Danish MiDAS version has been tested by more than 20 professionals......) musikterapeuten umiddelbart efter sessionen for at vurdere forandringer i selve sessionen. Der har været stor interesse for at anvende MiDAS i flere Europæiske lande, herunder Danmark. Derfor undersøgte udviklerne af MiDAS hvilke procedurer der anvendes til oversættelse og kulturel tilpasning af...... assessmentredskaber, og anbefalede på den baggrund en ti-trins procedure. Vi anvendte denne procedure til oversættelsen af MiDAS og således udviklingen af den danske MiDAS-DK. Den danske version af MiDAS er afprøvet af mere end 20 fagpersoner på baggrund af 296 udfyldte MiDAS-skemaer. Målet med artiklen er...

Segurança Alimentar no Quotidiano das Famílias Amarantinas

OpenAIRE

Machado, Célia Maria Brás

2012-01-01

Dissertação de Mestrado em Gestão Integrada da Qualidade, Ambiente e Segurança Os cidadãos têm “a expectativa de que os alimentos que consomem sejam seguros e adequados para o consumo. As doenças e os danos provocados por alimentos são, na melhor das hipóteses, desagradáveis, e, na pior das hipóteses, fatais (Codex Alimentarius - Higiene do Alimentos Textos Básicos, 2006, p.10). Este trabalho teve como principal objetivo avaliar os hábitos das famílias da cidade de Amarante, ...

Estudo comparativo entre algoritmos das transformadas discretas de Fourier e Wavelet

Directory of Open Access Journals (Sweden)

Wilson Hissamu Shirado

2015-11-01

Full Text Available Este trabalho apresenta um estudo comparativo das complexidades dos algoritmos das Transformadas Discretas de Fourier, Wavelet e Transformada Rápida de Fourier. As formalizações matemáticas e algumas características dos algoritmos são apresentadas, assim como alguns conceitos de complexidade assintótica. Por fim, é realizado um ensaio prático para comparação dos algoritmos, abrangendo questões como tempo de execução, vantagens e desvantagens de cada transformada assim como avaliações a respeito das diferentes resoluções tempo/frequência de cada algoritmo.

„Das Leben ist nur ein Spiegel“ – Schopenhauers kritischer Lebensbegriff

Directory of Open Access Journals (Sweden)

Matthias Kossler

2012-09-01

Full Text Available http://dx.doi.org/10.5007/1677-2954.2012v11nesp1p1   Schopenhauer gilt als Vorreiter oder erster Vertreter der Lebensphilosophie, wie sie später von Dilthey, Nietzsche, Bergson und anderen entfaltet wurde. Im Unterschied zur klassischen Lebensphilosophie und zu den an sie anknüpfenden ethischen Entwürfen wird das Leben bei Schopenhauer aber nicht als Zweck betrachtet, sondern als Mittel zu einem anderen Zweck, nämlich für die Ethik, die in der Verneinung des Willens zum Leben gipfelt. Schon in den frühesten handschriftlichen Aufzeichnungen verwendet Schopenhauer verschiedene Metaphern, um das Leben als Medium der ethischen Erkenntnis zu charakterisieren. Besonders häufig tritt dabei das Bild vom Leben als Spiegel auf, in dem der Mensch sein eigenes Wesen und damit auch das Wesen der Welt erblickt. Im Hauptwerk wird dann dieses Bild vom Begriff der Objektivation des Willens abgelöst. Insofern die höchste und deutlichste Objektivation des Willens der Lebenslauf des menschlichen Individuums darstellt, ist Schopenhauers Lebensbegriff eng mit seiner Charakterlehre verknüpft. In dem Beitrag wird das verwickelte Verhältnis von Leben, Erkennen und Ethik vor dem Hintergrund der proto-hermeneutischen Metaphysikkonzeption Schopenhauers anhand der Entwicklung der Spiegelmetapher betrachtet.

Aspectos sociotécnicos das TI & Relacionamento Humano & Sinergia

Directory of Open Access Journals (Sweden)

Sergio Vieira Holtz Filho

2008-06-01

Full Text Available As Tecnologias de Informação (TI estão entre os principais agentes de mudança sociais. Para gerir tais mudanças, uma miríade de áreas do conhecimento humano têm muito a contribuir para a abordagem dos aspectos sociotécnicos das TI e promover sinergia. Como uma organização empresarial atua no sentido de provocar mudanças no comportamento das pessoas, visando a melhoria contínua, esse processo de mudança provocada chama-se aprendizagem. Isto posto, neste artigo apresentaremos resultados observados em empresas em processo de reengenharia e submetidas a utilização de metodologias integradas (PDCA, Método Paulo Freire e Roteiro Integração de Equipes, abordando os aspectos sociotécnicos das TI & relacionamentos humanos pela praxe da pedagogia como elemento de sinergia.

Human Factors Interface with Systems Engineering for NASA Human Spaceflights

Science.gov (United States)

Wong, Douglas T.

2009-01-01

This paper summarizes the past and present successes of the Habitability and Human Factors Branch (HHFB) at NASA Johnson Space Center s Space Life Sciences Directorate (SLSD) in including the Human-As-A-System (HAAS) model in many NASA programs and what steps to be taken to integrate the Human-Centered Design Philosophy (HCDP) into NASA s Systems Engineering (SE) process. The HAAS model stresses systems are ultimately designed for the humans; the humans should therefore be considered as a system within the systems. Therefore, the model places strong emphasis on human factors engineering. Since 1987, the HHFB has been engaging with many major NASA programs with much success. The HHFB helped create the NASA Standard 3000 (a human factors engineering practice guide) and the Human Systems Integration Requirements document. These efforts resulted in the HAAS model being included in many NASA programs. As an example, the HAAS model has been successfully introduced into the programmatic and systems engineering structures of the International Space Station Program (ISSP). Success in the ISSP caused other NASA programs to recognize the importance of the HAAS concept. Also due to this success, the HHFB helped update NASA s Systems Engineering Handbook in December 2007 to include HAAS as a recommended practice. Nonetheless, the HAAS model has yet to become an integral part of the NASA SE process. Besides continuing in integrating HAAS into current and future NASA programs, the HHFB will investigate incorporating the Human-Centered Design Philosophy (HCDP) into the NASA SE Handbook. The HCDP goes further than the HAAS model by emphasizing a holistic and iterative human-centered systems design concept.

Copa do Mundo de 2014: Dados Estatísticos das quatro melhores equipes

OpenAIRE

Marques Junior, Nelson Kautzner

2015-01-01

O objetivo do estudo foi apresentar a estatística das quatro melhores seleções da Copa do Mundo de 2014. Foram coletados do site oficial da FIFA os dados estatísticos das quatro melhores seleções da Copa do Mundo de 2014. A Anova one way calculou a diferença dos resultados de performance das quatro melhores seleções da Copa do Mundo de 2014, com resultados aceitos com nível de significância de p≤0,05. O post hoc Tukey detectou a diferença das medidas aceitando um nível de significância de p≤0...

User Manual for the AZ-101 Data Acquisition System (AS-101 DAS)

Energy Technology Data Exchange (ETDEWEB)

BRAYTON, D.D.

2000-02-17

User manual for the TK AZ-101 Waste Retrieval System Data Acquisition System. The purpose of this document is to describe use of the AZ-101 Data Acquisition System (AZ-101 DAS). The AZ-101 DAS is provided to fulfill the requirements for data collection and monitoring as defined in Letters of Instruction (LOI) from Numatec Hanford Corporation (NHC) to Fluor Federal Services (FFS). For a complete description of the system, including design, please refer to the AZ-101 DAS System Description document, RPP-5572.

User Manual for the AZ-101 Data Acquisition System (AS-101 DAS)

International Nuclear Information System (INIS)

BRAYTON, D.D.

2000-01-01

User manual for the TK AZ-101 Waste Retrieval System Data Acquisition System. The purpose of this document is to describe use of the AZ-101 Data Acquisition System (AZ-101 DAS). The AZ-101 DAS is provided to fulfill the requirements for data collection and monitoring as defined in Letters of Instruction (LOI) from Numatec Hanford Corporation (NHC) to Fluor Federal Services (FFS). For a complete description of the system, including design, please refer to the AZ-101 DAS System Description document, RPP-5572

Haloacetic acids in the aquatic environment. Part I: macrophyte toxicity

International Nuclear Information System (INIS)

Hanson, Mark L.; Solomon, Keith R.

2004-01-01

Haloacetic acids (HAAs) are contaminants of aquatic ecosystems with numerous sources, both anthropogenic and natural. The toxicity of HAAs to aquatic plants is generally uncharacterized. Laboratory tests were conducted with three macrophytes (Lemna gibba, Myriophyllum sibiricum and Myriophyllum spicatum) to assess the toxicity of five HAAs. Myriophyllum spp. has been proposed as required test species for pesticide registration in North America, but few studies have been conducted under standard test conditions. The HAAs in the present experiments were monochloroacetic acid (MCA), dichloroacetic acid (DCA), trichloroacetic acid (TCA), trifluoroacetic acid (TFA) and chlorodifluoroacetic acid (CDFA). MCA was the most toxic to Myriophyllum spp. with EC 50 values ranging from 8 to 12.4 mg/l depending on the endpoint, followed by DCA (EC 50 range 62-722.5 mg/l), TCA (EC 50 range 49.5-1702.6 mg/l), CDFA (EC 50 range 105.3 to >10,000 mg/l) and with TFA (EC 50 range 222.1 to 10,000 mg/l) the least toxic. Generally, L. gibba was less sensitive to HAA toxicity than Myriophyllum spp., with the difference in toxicity between them approximately threefold. The range of toxicity within Myriophyllum spp. was normally less than twofold. Statistically, plant length and node number were the most sensitive endpoints as they had the lowest observed coefficients of variation, but they were not the most sensitive to HAA toxicity. Toxicological sensitivity of endpoints varied depending on the measure of effect chosen and the HAA, with morphological endpoints usually an order of magnitude more sensitive than pigments for all plant species. Overall, mass and root measures tended to be the most sensitive indicators of HAA toxicity. The data from this paper were subsequently used in an ecological risk assessment for HAAs and aquatic plants. The assessment found HAAs to be of low risk to aquatic macrophytes and the results are described in the second manuscript of this series

Participação das metaloproteinases da matriz na etiopatogenia dos cistos odontogênicos

OpenAIRE

Silveira,Éricka Janine Dantas da; Piva,Marta Rabello; Galvão,Hébel Cavalcanti; Souza,Lélia Batista de; Freitas,Roseana de Almeida

2007-01-01

Visando contribuir para um melhor entendimento do crescimento das lesões odontogênicas e do papel das metaloproteinases da matriz (MMPs) nesse processo, realizou-se uma análise da expressão imuno-histoquímica das MMPs -1, -2 e -9, em 15 cistos radiculares (CR), 10 cistos radiculares residuais (CRR), 10 cistos dentígeros (CD) e 10 ceratocistos odontogênicos (CO). Analisou-se, no epitélio e no mesênquima, a imunopositividade das lesões, atribuindo-se os escores: (-) ausência de marcação, (+) ma...

CONTEXTO EDUCACIONAL E AS CONTRIBUIÇÕES DA TEORIA DAS REPRESENTAÇÕES SOCIAIS

Directory of Open Access Journals (Sweden)

Célia Gomez Sardinha Silva

2016-10-01

Full Text Available O ambiente escolar é um espaço profícuo de interações sociais que se organiza de modo a mesclar diferentes representações, quer seja dos agentes da instituição escolar, dos membros da família ou das pessoas da comunidade. Diante disso, objetiva-se com este estudo básico, qualitativo e exploratório, caracterizado como estudo bibliográfico, refletir sobre os aspectos conceituais da Teoria das Representações Sociais no contexto educacional. Conclui-se, portanto que a Teoria das Representações Sociais, pode ajudar a compreender a realidade do contexto educacional, em suas múltiplas facetas, a partir das práticas que se desenvolvem frente às representações construídas.

Protección colectiva contra caídas para trabajadores de la construcción

OpenAIRE

Sulowski, A. C.

2014-01-01

Las normas de seguridad en la construcción requieren de protección para los trabajadores contra las caídas desde altura. Los Sistemas de Protección contra Caídas (FPS, por sus siglas en inglés) colectivos, en la mayoría de los casos, permiten que los trabajadores se muevan libremente sin usar un equipo de protección contra caídas individual. Los sistemas colectivos de prevención de caídas son preferibles a los sistemas de detención de caídas, estos últimos se emplean sólo si la prevención de...

Seltskond / Annika Haas

Index Scriptorium Estoniae

Haas, Annika

2007-01-01

Turundusagentuur PNG (loovjuhiks Jüri Peetson) ühendas tänuõhtu oma klientidele ja koostööpartneritele hispaania laulja Enrique Iglesiase esinemisega 1. dets. Tallinnas Saku Suurhalli restoranis Platoo

Seltskond / Annika Haas

Index Scriptorium Estoniae

Haas, Annika

2008-01-01

Eesti Kunstimuuseumi Kunstisõprade Seltsi eestvõttel tähistati 4. novembril 2008 Kumule Euroopa aasta muuseumi tiitli andmist. Ühel juuresolevatest fotodest president Toomas Hendrik Ilves koos Kumu kunstimuuseumi direktrissi Sirje Helme ja Eesti Kunstimuuseumi Kunstisõprade Seltsi juhatuse esimehe Enn Kunilaga

Seltskond / Annika Haas

Index Scriptorium Estoniae

Haas, Annika

2007-01-01

21. veebruaril 2007 tähistas Tiigrihüppe SA Tallinnas Olümpia hotelli konverentsikeskuses konverentsiga "Kogu tõde Tiigrihüppest" Tiigrihüppe programmi 10. aastapäeva. Kohal viibis ka programmi üks algatajaid Toomas Hendrik Ilves

Seltskond / Annika Haas

Index Scriptorium Estoniae

Haas, Annika

2009-01-01

Eesti Posti peakontori hoovis esitleti Indrek Kaingi kujundatud rahvusmustriga tenniseid. Esimesed eksklusiivsed kaks paari MULK-kirjaga papusid kingiti president Toomas Hendrik Ilvesele ning ettevõtte Skype presidendile Josh Silvermanile

Seltskond / Annika Haas

Index Scriptorium Estoniae

Haas, Annika

2006-01-01

Tallinna Ülikoolis toimunud ameerika kultuurantropoloogi Clifford Geertzi mälestusõhtust, kus esinesid rektor Rein Raud, Eesti Humanitaarinstituudi dotsent Lorenzo Cañás Bottos ja kultuuriteooria lektor Marek Tamm

Seltskond / Annika Haas

Index Scriptorium Estoniae

Haas, Annika

2008-01-01

8. aug. Tallinnas kinos Sõprus ja klubis Juuksur tähistati 30 aasta möödumist ansambli Joy Divison sünnist ja Anton Corbijni debüütfilmi "Control" jõudmist Eesti kinodesse (näidati dokumentaalfilmi "Joy Divison")

Seltskond / Annika Haas

Index Scriptorium Estoniae

Haas, Annika

2006-01-01

Inglise rocklaulja Gordon Matthew Sumneri raamatu "Sting. Murtud muusika" esitlusest Tallinnas Viru Keskuse Rahva Raamatu kaupluses ja kontserdist Saku Suurhallis Broken Musicu nimelise tuuri raames 28. juulil

Metabolism and Biomarkers of Heterocyclic Aromatic Amines in Molecular Epidemiology Studies: Lessons Learned from Aromatic Amines

Science.gov (United States)

2011-01-01

Aromatic amines and heterocyclic aromatic amines (HAAs) are structurally related classes of carcinogens that are formed during the combustion of tobacco or during the high-temperature cooking of meats. Both classes of procarcinogens undergo metabolic activation by N-hydroxylation of the exocyclic amine group, to produce a common proposed intermediate, the arylnitrenium ion, which is the critical metabolite implicated in toxicity and DNA damage. However, the biochemistry and chemical properties of these compounds are distinct and different biomarkers of aromatic amines and HAAs have been developed for human biomonitoring studies. Hemoglobin adducts have been extensively used as biomarkers to monitor occupational and environmental exposures to a number of aromatic amines; however, HAAs do not form hemoglobin adducts at appreciable levels and other biomarkers have been sought. A number of epidemiologic studies that have investigated dietary consumption of well-done meat in relation to various tumor sites reported a positive association between cancer risk and well-done meat consumption, although some studies have shown no associations between well-done meat and cancer risk. A major limiting factor in most epidemiological studies is the uncertainty in quantitative estimates of chronic exposure to HAAs and, thus, the association of HAAs formed in cooked meat and cancer risk has been difficult to establish. There is a critical need to establish long-term biomarkers of HAAs that can be implemented in molecular epidemioIogy studies. In this review article, we highlight and contrast the biochemistry of several prototypical carcinogenic aromatic amines and HAAs to which humans are chronically exposed. The biochemical properties and the impact of polymorphisms of the major xenobiotic-metabolizing enzymes on the biological effects of these chemicals are examined. Lastly, the analytical approaches that have been successfully employed to biomonitor aromatic amines and HAAs, and

Evaluation of thirteen haloacetic acids and ten trihalomethanes formation by peracetic acid and chlorine drinking water disinfection.

Science.gov (United States)

Xue, Runmiao; Shi, Honglan; Ma, Yinfa; Yang, John; Hua, Bin; Inniss, Enos C; Adams, Craig D; Eichholz, Todd

2017-12-01

Free chlorine is a commonly used disinfectant in drinking water treatment. However, disinfection by-products (DBPs) are formed during water disinfection. Haloacetic acids (HAAs) and trihalomethanes (THMs) are two major groups of DBPs. Iodo-HAAs and iodo-THMs (I-HAAs and I-THMs) are formed during the disinfection of the water containing high levels of iodide and are much more toxic than their chlorinated and brominated analogs. Peracetic acid (PAA) is a strong antimicrobial disinfectant that is expected to reduce the formation of HAAs and THMs during disinfection. In this study, the formations of thirteen HAAs and ten THMs, including the iodinated forms, have been investigated during PAA disinfection and chlorination as the comparison. The DBP formations under different iodide concentrations, pHs, and contact times were systematically investigated. Two types of commercial PAAs containing different concentrations of PAA and hydrogen peroxide (H 2 O 2 ) were studied. A solid-phase microextraction gas chromatography-mass spectrometry method was upgraded for THM analysis including I-THMs. HAAs were analyzed by following a recently developed high performance ion chromatography-tandem mass spectrometry method. Results show that the ratio of PAA and H 2 O 2 concentration significantly affect the formation of I-THMs and I-HAAs. During PAA disinfection with lower PAA than H 2 O 2 , no detectable levels of THMs and HAAs were observed. During PAA disinfection with higher PAA than H 2 O 2 , low levels of monoiodoacetic acid, diiodoacetic acid, and iodoform were formed, and these levels were enhanced with the increase of iodide concentration. No significant quantities of chloro- or bromo-THMs and HAAs were formed during PAA disinfection treatment. Copyright © 2017 Elsevier Ltd. All rights reserved.

From Bad to Worse: Anemia on Admission and Hospital-Acquired Anemia.

Science.gov (United States)

Koch, Colleen G; Li, Liang; Sun, Zhiyuan; Hixson, Eric D; Tang, Anne S; Phillips, Shannon C; Blackstone, Eugene H; Henderson, J Michael

2017-12-01

Anemia at hospitalization is often treated as an accompaniment to an underlying illness, without active investigation, despite its association with morbidity. Development of hospital-acquired anemia (HAA) has also been associated with increased risk for poor outcomes. Together, they may further heighten morbidity risk from bad to worse. The aims of this study were to (1) examine mortality, length of stay, and total charges in patients with present-on-admission (POA) anemia and (2) determine whether these are exacerbated by development of HAA. In this cohort investigation, from January 1, 2009, to August 31, 2011, a total of 44,483 patients with POA anemia were admitted to a single health system compared with a reference group of 48,640 without POA anemia or HAA. Data sources included the University HealthSystem Consortium database and electronic medical records. Risk-adjustment methods included logistic and linear regression models for mortality, length of stay, and total charges. Present-on-admission anemia was defined by administrative coding. Hospital-acquired anemia was determined by changes in hemoglobin values from the electronic medical record. Approximately one-half of the patients experienced worsening of anemia with development of HAA. Risk for death and resource use increased with increasing severity of HAA. Those who developed severe HAA had 2-fold greater odds for death; that is, mild POA anemia with development of severe HAA resulted in greater mortality (odds ratio, 2.57; 95% confidence interval, 2.08-3.18; P < 0.001), increased length of stay (2.23; 2.16-2.31; P < 0.001), and higher charges (2.09; 2.03-2.15; P < 0.001). Present-on-admission anemia is associated with increased mortality and resource use. This risk is further increased from bad to worse when patients develop HAA. Efforts to address POA anemia and HAA deserve attention.

The Das-Popowicz Moyal momentum algebra

International Nuclear Information System (INIS)

Boulahoual, A.; Sedra, M.B.

2002-08-01

We introduce in this short note some aspects of the Moyal momentum algebra that we call the Das-Popowicz Mm algebra. Our interest on this algebra is motivated by the central role that it can play in the formulation of integrable models and in higher conformal spin theories. (author)

A New Approach to Eliminate High Amplitude Artifacts in EEG Signals

Directory of Open Access Journals (Sweden)

Ana Rita Teixeira

2016-09-01

Full Text Available High amplitude artifacts represent a problem during EEG recordings in neuroscience research. Taking this into account, this paper proposes a method to identify high amplitude artifacts with no requirement for visual inspection, electrooscillogram (EOG reference channel or user assigned parameters. A potential solution to the high amplitude artifacts (HAA elimination is presented based on blind source separation methods. The assumption underlying the selection of components is that HAA are independent of the EEG signal and different HAA can be generated during the EEG recordings. Therefore, the number of components related to HAA is variable and depends on the processed signal, which means that the method is adaptable to the input signal. The results show, when removing the HAA artifacts, the delta band is distorted but all the other frequency bands are preserved. A case study with EEG signals recorded while participants performed on the Halstead Category Test (HCT is presented. After HAA removal, data analysis revealed, as expected, an error-related frontal ERP wave: the feedback-related negativity (FRN in response to feedback stimuli.

Speech motor coordination in Dutch-speaking children with DAS studied with EMMA

NARCIS (Netherlands)

Nijland, L.; Maassen, B.A.M.; Hulstijn, W.; Peters, H.F.M.

2004-01-01

Developmental apraxia of speech (DAS) is generally classified as a 'speech motor' disorder. Direct measurement of articulatory movement is, however, virtually non-existent. In the present study we investigated the coordination between articulators in children with DAS using kinematic measurements.

Sejas ādas kopšanas līdzekļi pusaudžu vecumā

OpenAIRE

Škute, Solvita

2014-01-01

Darbā tiek apskatīti pusaudži, kuri lieto sejas ādas kopšanas līdzekļus, lai novērstu sejas ādas problēmas. Tiek izklāstīts par sejas ādas slimībām, kā pareizi rīkoties un, kas jāievēro šādiem pacientiem. Uzmanība likta uz pacientiem, kuriem jau ir sejas ādas problēmas ilgāku laiku. Bakalaura darba tēma – "Sejas ādas kopšanas līdzekļi pusaudžu vecumā". Tēmas aktualitāti nosaka sejas ādas kopšanas līdzekļu efektivitāte. Darba mērķis ir noskaidrot jauniešu sejas ādas kopšanas līdzekļu pie...

Sobre a classificação gradual das preposições

Directory of Open Access Journals (Sweden)

Lou-Ann Kepla

2012-11-01

Full Text Available O presente artigo está ancorado na Neurolinguística de orientação enunciativo-discursiva. A demanda por uma proposta de classificação gradual (em oposição à tradicional classificação categorial das preposições surgiu quando nos propusemos a tarefa de descrever o funcionamento das preposições na fala de sujeitos que apresentam uma linguagem heterogênea. Nestes casos, as classificações correntes das preposições não se mostraram satisfatórias. Os motivos pelos quais preferimos uma classificação que dispõe as preposições numa escala de acordo com os seus graus de gramaticalização serão dispostos depois de feita uma revisão da literatura sobre as classificações das preposições. As classificações propostas por diferentes gramáticos são analisadas juntamente com aquelas adotadas por linguistas preocupados em descrever a linguagem agramática de sujeitos com afasia de produção.

Rapid screening of aflatoxin B1 in beer by fluorescence polarization immunoassay.

Science.gov (United States)

Beloglazova, N V; Eremin, S A

2015-09-01

This manuscript describes the development of a sensitive, fast and easily-performed fluorescence polarization immunoassay (FPIA) for the mycotoxin aflatoxin B1 (AFB1) in various beer samples, both lager and dark. The highest sensitivity was determined for six poly- and monoclonal antibodies selective towards aflatoxins. The sample pretreatment design was emphasized since beer samples are characterized by extremely diverse matrices. Herein, the choice of sorbent for effective removal of matrix interferences prior to analysis was crucial. The samples were diluted with a borate buffer solution containing 1% PEG 6000 and passed through the clean-up column packed with NH2-derivated silica. This sample pretreatment technique was perfectly suitable for the FPIA of lager beer samples, but for dark beer and ale it did not suffice. An artificial matrix was constructed to plot a calibration curve and quantify the results of the latter samples. The developed immunoassay was characterized by a limit of detection of 1 ng mL(-1). Apparent recovery values of 89-114% for lager and 80-125% for dark beer were established. The FPIA data for AFB1 was characterized by elevated linear regression coefficients, 0.9953 for spiked lager and 0.9895 for dark beer samples respectively. Copyright © 2015 Elsevier B.V. All rights reserved.

O mito do gaúcho em A casa das sete mulheres

Directory of Open Access Journals (Sweden)

Menger, Amanda da Silva

2011-01-01

Full Text Available O presente artigo, O mito do gaúcho em A Casa das Sete Mulheres, trata do mito do gaúcho. Aborda desde o seu conceito, a sua formação até a perpetuação. Para isso, o trabalho faz uma retomada histórica do gaúcho, entre o pária e o herói e a influência da História e das Tecnologias do Imaginário, teoria proposta por Juremir Machado da Silva (2003, para esta mudança. O artigo também trata da imagem do gaúcho apresentada pela minissérie A Casa das Sete Mulheres

Síndrome das unhas frágeis Brittle nail syndrome

Directory of Open Access Journals (Sweden)

Izelda Maria Carvalho Costa

2007-06-01

Full Text Available A síndrome das unhas frágeis é queixa comum, caracterizada por aumento da fragilidade das lâminas ungueais. Afeta quase 20% da população geral, sendo mais comum em mulheres. Clinicamente se manifesta com onicosquizia e onicorrexe - distúrbios nos fatores de adesão intercelular das unhas se manifestam como a primeira, ao passo que alterações da matriz apresentamse com onicorrexe. Mesmo sendo tão usual e afetando os pacientes de maneira importante em seu cotidiano, o tratamento das unhas frágeis avançou pouco nas últimas décadas e ainda se baseia principalmente no uso da biotina.Brittle nail syndrome is a common condition, characterized by increased fragility of the nail plates. It affects almost 20% of the population, being more usual in women. Clinical manifestations of brittle nails are onychoschizia and onychorexis - disorders of intercellular adhesive factors are expressed as the first, while disorders of the nail matrix manifest as onychorexis. Despite being so common and causing much more than only cosmetic problems to the patient, the treatment of brittle nails has had little improvement over the past decades and is still mainly based on the daily use of biotin.

Qual a relevância das celebridades na publicidade?

OpenAIRE

Xara-Brasil, Maria Rita de Aguiar

2013-01-01

Esta dissertação tem por objectivo, estudar a relevância das celebridades em publicidade. A Publicidade tem um papel muito importante na sociedade em que vivemos. Desde sempre que foi um tema que me despertou muito interesse, assim como, as estratégias nela inseridas. A presença de celebridades em anúncios publicitários é uma prática muito comum para promover produtos e marcas. Com esta investigação tenho por objectivo perceber qual a relevância das celebridades em anúncios ...

O Comportamento das Aves Poultry Behavior

Directory of Open Access Journals (Sweden)

EJ Campos

2000-08-01

Full Text Available Os estudos sobre o comportamento das aves, principalmente as galinhas, datam de 1912, quando o gênero Gallus passou a ser estudado com mais intensidade na área da Genética. Tais estudos eram simplesmente filosóficos até o início da década de 80, quando uma nova era da produção industrial avícola surgiu, objetivando um maior volume de produção econômica em todas as áreas de exploração. Esse objetivo reativou de maneira científica os estudos de comportamento das aves face à tecnologia de produção empregada nos sistemas de exploração, tornando-os mais acentuados já na década de 90, culminando com um simpósio internacional realizado nos Estados Unidos onde foram traçados os objetivos ou linhas de pesquisas na exploração avícola. O intuito era evitar problemas com os movimentos ambientalistas, traçando novos rumos para uma produção eficiente sem interferir no comportamento das aves já no início do novo milênio. Esta revisão, tem como objetivo principal uma análise científica e filosófica sobre o comportamento das aves em diversos métodos de exploração.Studies on poultry behavior initiated in 1972, at that time, fowls from Gallus domesticus species were the most important animal for the initial studies of Genetic. Since then, just the philosophical concepts where involved in those studies. However, at the beginning of 80 decade, these studies were intensified taking into account technological approaches for an economical industrial poultry production. Meanwhile, the reactions from activists involved in the behavior of the animal subjected to production became more strong at the beginning of 90's as well as those studies on chicken behavior. Finally, in 1998, an international symposium, promoted by chicken behavior scientists were held in the United States, in order to establish new methods of exploitation of poultry without interfering in its normal behavior, at the beginning of new millenium. The main

The data acquisition system (DAS) for the improved CERN SC

CERN Document Server

Beger, H; Fiebig, A; Schroot, H

1975-01-01

A digital data acquisition system (DAS) based on a minicomputer is described which registers the failure sequences in various equipment areas of the CERN synchrocyclotron (henceforward referred to as the SC). The avalanches of failure signals which occur from time to time are tapped from the alarm/security systems, time-resolved to 10 msec and recorded on a printer in order to aid SC failure diagnosis. The mechanisms of the DAS and its relation to the SC equipment are explained in some detail. All programs were constructed at assembler language level for speed and for ease of on-line program maintenance. The alarm sequences recorded have been of considerable help during the running in of the new radiofrequency system. Now that the new SC is operational, the DAS furnishes useful data from several equipment areas to the operators and engineers.

Schostakowitsch: Sinfonie Nr. 12 op. 112 (Das Jahr 1917) / Hans-Christian Dadelsen

Index Scriptorium Estoniae

Dadelsen, Hans-Christian

1991-01-01

Uuest heliplaadist "Schostakowitsch: Sinfonie Nr. 12 op. 112 (Das Jahr 1917). Hamlet-Suite op. 32a. Das goldene Zeitalter [The Age of Gold] (Suite) op. 22a. Göteborger Symphoniker, Neeme Järvi". DG CD 431 688-2 (WD:77'21") DDD

Interfaces naturais e o reconhecimento das línguas de sinais

Directory of Open Access Journals (Sweden)

Renato Kimura da Silva

2017-01-01

Full Text Available Interface é uma camada intermediária que está entre duas faces. No contexto computacional, podemos dizer que interface existe na intermediação interativa entre dois sujeitos, ou ainda entre sujeito e um programa. Ao longo dos anos, as interfaces têm evoluído constantemente: das linhas de texto monocromáticas aos mouses - com o conceito exploratório da interface gráfica - até as mais recentes interfaces naturais - ubíquas e que objetivam a transparência da interação. Nas novas interfaces, por meio do uso do corpo, o usuário interage com o computador, não sendo necessário aprender a interface. Seu uso é mais intuitivo, com a possibilidade de reconhecimento da voz, da face e dos gestos. O avanço tecnológico vai ao encontro das necessidades básicas do indivíduo, como a comunicação, tornando-se factível conceber novas tecnologias que beneficiam pessoas em diferentes esferas. A contribuição desse trabalho está em entender o cenário técnico que possibilita idealizar e criar interfaces naturais para o reconhecimento automático computacional dos sinais das Línguas de Sinais e considerável parte de sua gramática. Para tanto, essa pesquisa foi primeiramente pautada no estudo do desenvolvimento das interfaces computacionais e da sua estreita relação com os videogames, fundamentando-se nas contribuições de autores como Pierre Lévy, Sherry Turkle, Janet Murray e Louise Poissant. Em momento posterior, aproximamo-nos de autores como William Stokoe, Scott Liddell, Ray Birdwhistell, Lúcia Santaella e Winfried Nõth, a respeito de temas gerais e específicos que abarcam a multidisciplinaridade das Línguas de Sinais, suas gramáticas e aspectos semióticos. Por fim, foi realizado um levantamento do Estado da Arte das Interfaces Naturais voltadas ao Reconhecimento Automático das Línguas de Sinais, além do estudo de pesquisas notáveis relacionadas ao tema, apresentando possíveis caminhos futuros a serem trilhados por

Estudo do Mercado das Mantenedoras das Cultivares de Soja no Estado do Mato Grosso = Market study of Maintainers of Soybean Cultivars in Mato Grosso

Directory of Open Access Journals (Sweden)

Fernanda da Silva Freitas

2015-07-01

Full Text Available O presente trabalho analisa a estrutura de mercado e a competitividade das empresas mantenedoras de cultivares de sementes de soja. Após analisar propriamente dito, a estrutura de mercado, focou-se em analisar e classificar as estratégias utilizadas bem como a competitividade das empresas no Estado do Mato Grosso, por meio de estratégias e assim identificando os fatores determinantes na competição utilizando como ferramenta de mensuração de resultados o Índice de Hirschman–Herfindahl - IHH. A observação das análises nos remetem a um nível de concentração das empresas, bem como a uma tendência oligopolista e obviamente a um aumento de competição. = This paper analyzes the market structure and competitiveness of the sponsoring companies of cultivars of soybean seeds. After analyzing itself , the market structure , focused on analyzing and classifying the strategies used as well as the competitiveness of companies in the state of Mato Grosso , through strategies described and thus identifying the determining factors in the competition using as a results measurement tool the Herfindahl - Hirschman index (HHI. The observation of analyzes lead us to a concentration index of companies as well as oligopolistic trend and obviously the increased competition.

PRINCÍPIOS DAS ORGANIZAÇÕES FOCALIZADAS NA ESTRATÉGIA: O PROCESSO DE IMPLEMENTAÇÃO DAS ESTRATÉGIAS DO GOVERNO DO ESTADO DA BAHIA

Directory of Open Access Journals (Sweden)

Kátia Silene Lopes de Souza Albuquerque

2011-12-01

Full Text Available O objetivo principal desse artigo é analisar se no processo de implementação do gerenciamento das estratégias no Estado da Bahia, iniciado em 2007, foram observados os cinco princípios (padrão, que Kaplan e Norton (2001 denominaram de princípios das organizações focalizadas na estratégia. Com essa finalidade, foram seguidos os seguintes passos: (i foi feita uma pesquisa bibliográfica, a fim de identificar na literatura disponível assuntos que abordam o tema desse artigo; (ii foi feita uma pesquisa documental utilizando documentos como no plano do governo, plano plurianual 2008-2011, planejamentos estratégicos das secretarias; (iii foi realizada também uma entrevista com algumas pessoas envolvidas na implementação do novo modelo de gestão para o Estado da Bahia. Chegandose à conclusão que o Estado da Bahia tem avançado bastante na implementação das suas estratégias, de acordo com os princípios de Kaplan e Norton, portanto ainda será necessário que se percorra mais alguns passos para ser considerada uma organização focalizada na estratégia.

PRINCÍPIOS DAS ORGANIZAÇÕES FOCALIZADAS NA ESTRATÉGIA: O PROCESSO DE IMPLEMENTAÇÃO DAS ESTRATÉGIAS DO GOVERNO DO ESTADO DA BAHIA

Directory of Open Access Journals (Sweden)

Kátia Silene Lopes de Souza Albuquerque

2012-04-01

Full Text Available O objetivo principal desse artigo é analisar se no processo de implementação do gerenciamento das estratégias no Estado da Bahia, iniciado em 2007, foram observados os cinco princípios (padrão, que Kaplan e Norton (2001 denominaram de princípios das organizações focalizadas na estratégia. Com essa finalidade, foram seguidos os seguintes passos: (i foi feita uma pesquisa bibliográfica, a fim de identificar na literatura disponível assuntos que abordam o tema desse artigo; (ii foi feita uma pesquisa documental utilizando documentos como no plano do governo, plano plurianual 2008-2011, planejamentos estratégicos das secretarias; (iii foi realizada também uma entrevista com algumas pessoas envolvidas na implementação do novo modelo de gestão para o Estado da Bahia. Chegando-se à conclusão que o Estado da Bahia tem avançado bastante na implementação das suas estratégias, de acordo com os princípios de Kaplan e Norton, portanto ainda será necessário que se percorra mais alguns passos para ser considerada uma organização focalizada na estratégia.

Anodic dissolution of samarium in acetonitrile solution of acetylacetone

International Nuclear Information System (INIS)

Kostyuk, N.N.; Dik, T.A.; Trebnikov, A.G.; Shirokij, V.L.

2003-01-01

Electrochemical dissolution of metal samarium in acetonitrile medium in the presence of 0.1 M tetraethylammoniumbromide and 0.9 M acetylacetone (HAA) in argon atmosphere under a voltage of 3 V was considered for studying feasibility of electrochemical synthesis of samarium β-diketonates. Using IR and mass spectrometry, thermal and elementary analyses it was ascertained that, depending on cathode and anode areas ratio, anodic dissolution of samarium can give rise to formation of complexes of bi- and trivalent samarium featuring the composition Sm 4 (AA) 8 · 3HAA, Sm(AA) 3 · HAA and Sm(AA) 3 · 4HAA [ru

Moisture Forecast Bias Correction in GEOS DAS

Science.gov (United States)

Dee, D.

1999-01-01

Data assimilation methods rely on numerous assumptions about the errors involved in measuring and forecasting atmospheric fields. One of the more disturbing of these is that short-term model forecasts are assumed to be unbiased. In case of atmospheric moisture, for example, observational evidence shows that the systematic component of errors in forecasts and analyses is often of the same order of magnitude as the random component. we have implemented a sequential algorithm for estimating forecast moisture bias from rawinsonde data in the Goddard Earth Observing System Data Assimilation System (GEOS DAS). The algorithm is designed to remove the systematic component of analysis errors and can be easily incorporated in an existing statistical data assimilation system. We will present results of initial experiments that show a significant reduction of bias in the GEOS DAS moisture analyses.

Pyruvate remediation of cell stress and genotoxicity induced by haloacetic acid drinking water disinfection by-products.

Science.gov (United States)

Dad, Azra; Jeong, Clara H; Pals, Justin A; Wagner, Elizabeth D; Plewa, Michael J

2013-10-01

Monohaloacetic acids (monoHAAs) are a major class of drinking water disinfection by-products (DBPs) and are cytotoxic, genotoxic, mutagenic, and teratogenic. We propose a model of toxic action based on monoHAA-mediated inhibition of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a target cytosolic enzyme. This model predicts that GAPDH inhibition by the monoHAAs will lead to a severe reduction of cellular ATP levels and repress the generation of pyruvate. A loss of pyruvate will lead to mitochondrial stress and genomic DNA damage. We found a concentration-dependent reduction of ATP in Chinese hamster ovary cells after monoHAA treatment. ATP reduction per pmol monoHAA followed the pattern of iodoacetic acid (IAA) > bromoacetic acid (BAA) > chloroacetic acid (CAA), which is the pattern of potency observed with many toxicological endpoints. Exogenous supplementation with pyruvate enhanced ATP levels and attenuated monoHAA-induced genomic DNA damage as measured with single cell gel electrophoresis. These data were highly correlated with the SN 2 alkylating potentials of the monoHAAs and with the induction of toxicity. The results from this study strongly support the hypothesis that GAPDH inhibition and the possible subsequent generation of reactive oxygen species is linked with the cytotoxicity, genotoxicity, teratogenicity, and neurotoxicity of these DBPs. Copyright © 2013 Wiley Periodicals, Inc.

Thrombus scintigraphy with Ga-67 DFO-DAS-Fibrinogen, 2

International Nuclear Information System (INIS)

Kawasaki, Yukiko

1987-01-01

In our previous in vivo study 67 Ga DFO-DAS-Fibrinogen was assessed for its usefulness as a radiopharmaceutical for the detection of thrombin in experimental animals (Report 1). The present study was undertaken to appraise the diagnostic value of 67 Ga DFO-DAS-Fibrinogen in human disease, especially in relation to blood coagulability as well as to thrombolytic drug regimen being given, in an effort to investigate its clinical applicability. Involved in this study were 48 patients with thrombosis proven by X-ray CT and other examinations. Of these 48, 42 had arterial thrombosis (20 with aortic aneurysm including the dissecting form, 11 in postoperative condition following vascular surgery with a prosthesis, 9 with intracardiac thrombosis accompanying heart disease, and 1 each with occlusive arteriosclerosis and cerebral infarction) and 6 had venous thrombosis. The 67 Ga DFO-DAS-Fibrinogen test proved to be positive in 55 % of arterial thrombin and in 50 % of venous thrombin. It is interesting to note that as high a positivity rate as 80 % was obtained for aortic aneurysm, although the positivity rate was disappointingly low for left atrial thrombin. No distinct correlation was noted to exist between the degree of accumulation of the tracer in thrombotic lesions and any of factors conceivably of clinical releavance, i.e. time elapsing from onset till testing, thrombolytic medication being given, and hematological factors. 67 Ga DFO-DAS-Fibrinogen appeared to be a radiodiagnostic agent that could possibly indicate the existing activity status of thrombosis. (author)

Das polyzystische Ovarialsyndrom: Im Spannungsfeld von Hormonen und Stoffwechsel

Directory of Open Access Journals (Sweden)

Wehr E

2010-01-01

Full Text Available Das polyzystische Ovarialsyndrom (PCOS ist eine komplexe Erkrankung und betrifft mindestens 5–10 % aller Frauen. Es ist charakterisiert durch Hyperandrogenismus (klinisch und/oder biochemisch, Oligo- oder Anovulation und polyzystische Ovarien. In der Pathogenese spielt neben der Hyperandrogenämie und der abnormen Gonadotropinsekretion die Insulinresistenz eine zentrale Rolle. Ein genetischer Hintergrund des PCOS wird vermutet, neben verschiedenen Kandidatengenen werden auch genomweite Assoziationsstudien neue Kenntnisse bringen, um in Zukunft sowohl Diagnose als auch Therapie des PCOS zu vereinfachen. Das PCOS bringt ein hohes metabolisches Risiko mit sich, ca. die Hälfte aller betroffenen Frauen ist adipös, viele leiden an Insulinresistenz, Glukosetoleranzstörungen und Diabetes mellitus Typ 2. Weiters sind viele Frauen mit PCOS von unerfülltem Kinderwunsch, Hirsutismus, Akne und androgenetischer Alopezie betroffen. Vor allem Adipositas und Hirsutismus führen zu einer starken psychischen Belastung betroffener Frauen, das Suizidrisiko ist deutlich erhöht. Zur exakten Diagnose des PCOS bedarf es einer genauen Anamnese und körperlichen Untersuchung mit anthropometrischen Messungen und Hirsutismus-Score. Ein Hormonstatus mit Bestimmung von Androgenen ist unerlässlich, ein LHRH-Test kann weitere diagnostische Hinweise liefern. Weiters sollten zur metabolischen Abklärung ein oraler Glukosetoleranztest, eine Messung der Körperfettverteilung und die Bestimmung eines Lipidstatus erfolgen. Therapeutisch ist vor allem bei adipösen Frauen eine Lebensstilintervention am wichtigsten, zusätzlich kommen Insulinsensitizer und orale Kontrazeptiva zum Einsatz. Zusammenfassend ist das PCOS eine extrem häufige Erkrankung mit komplexen Folgen und bedarf einer konsequenten, interdisziplinären individuellen Therapie bei betroffenen Frauen.

As Muitas Arqueologias das Minas Gerais

Directory of Open Access Journals (Sweden)

André Prous

2013-12-01

Full Text Available Apresentamos uma história crítica das pesquisas em arqueologia - particularmente pré-histórica - realizadas em território mineiro desde o século XIX. Após a fase do pioneirismo (P. Lund, amadores diversos, missões internacionais estudam a região de Lagoa Santa no terceiro quarto do século XX, enquanto o Programa Nacional de Pesquisas Arqueológicas (PRONAPA inicia levantamentos no alto vale do rio São Francisco. Com a abertura de pesquisas mais sistemáticas pelo Instituto de Arqueologia Brasileira (IAB no Norte mineiro e a criação do Setor de Pesquisa da UFMG, na segunda metade dos anos de 1970, abre-se uma fase de pesquisas mais intensivas e regionais, tematicamente diversificadas. O início deste século XXI é marcado pela multiplicação das pesquisas preventivas e de resgate, a emergência de novos centros de pesquisa e a criação de cursos de formação de arqueólogos na UFMG. O Patrimônio pré-histórico de Minas Gerais é notável pela importância de preservação de materiais perecíveis, de restos esqueletais humanos de grande antiguidade, pela riqueza dos registros rupestres e a variedade regional das indústrias realizadas sobre matérias-primas muito diversas. A arqueologia histórica, cuja importância cresceu exponencialmente nos dois últimos decênios, é marcada pela importância dos vestígios da mineração de pedras e metais preciosos, dos assentamentos de escravos fugitivos e os remanescentes de fazendas antigas, cujo estudo se desenvolveu comparativamente mais que a arqueologia da urbanização e dos monumentos barrocos.

Evidenciação das Informações Ambientais das Empresas do Setor de Energia Elétrica do Brasil

Directory of Open Access Journals (Sweden)

Francineide Eleotério Pereira

2015-08-01

Full Text Available Nos últimos anos, a questão ambiental ganhou espaço no meio empresarial e tem proporcionado uma maior divulgação das externalidades ecológicas. Nesse sentido, o presente estudo objetiva identificar o nível de evidenciação ambiental nas demonstrações contábeis das empresas do setor de energia elétrica do Brasil, no ano de 2012. Para tanto, foram selecionadas as empresas brasileiras do setor de energia elétrica classificadas como 100 maiores empresas do Brasil de acordo com a Revista Exame. Desse contingente foram encontradas um total de 13 organizações, destas apenas 8 tiveram suas demonstrações divulgadas no site da BM&FBovespa. Assim, foi realizada uma análise das Notas Explicativas e Relatórios da Administração, levando em consideração a NBC-T 15, para identificar o nível de evidenciação ambiental destas empresas, por meio de um critério de classificação que variou entre ótimo, bom, regular e ruim. O software check list Word foi utilizado para realizar a análise de conteúdo. Os resultados evidenciam que as divulgações das informações de natureza ambiental não são identificadas nesses relatórios. As empresas com o nível mais satisfatório (regular, com 36,36% de evidenciação, foram Petrobrás, AES Eletropaulo, Cemig Distribuição e Copel, e as empresas com nível de evidenciação ruim, com 0% de evidenciação, foram Eletrobrás e Ligth Distribuição, denotando que neste segmento empresarial o nível de evidenciação ambiental ainda é frágil e necessita de regulamentação para maior transparência.

O efeito do chá verde no controlo das dislipidémias

OpenAIRE

Carvalho, Pedro Daniel de

2017-01-01

Dissertação para obtenção do grau de Mestre no Instituto Superior de Ciências da Saúde Egas Moniz A dislipidémia caracteriza-se pelos anormais níveis lipídicos no sangue, e constitui um dos principais factores de risco que conduzem às Doenças Cardiovasculares, uma das principais causas de morte a nível mundial. Apesar da eficácia das opções farmacológicas existentes para o tratamento das dislipidémias, as reacções adversas e contra-indicações associadas a estes fármacos fazem com que seja ...

Factores críticos de sucesso da governança das TI

OpenAIRE

Correia, Sandra Maria Almeida

2010-01-01

Mestrado em Gestão de Sistemas de Informação A governança das TI (GTI) é parte integrante da gestão empresarial. Consiste na liderança e na criação de estruturas e processos organizacionais que asseguram que elas sustentem e estendem as estratégias e os objectivos da organização. A identificação e controlo dos factores críticos de sucesso (FCS) da governança das TI podem ter um impacto significativo no sucesso das organizações. Para identificar os FCS, relativamente aos quais os gestores d...

A Governança Corporativa Influencia a Eficiência das Empresas Brasileiras?

Directory of Open Access Journals (Sweden)

Igor Bernardi Sonza

2014-05-01

Full Text Available O conflito de interesses entre executivos e proprietários é uma questão amplamente difundida na academia, já documentada em 1932 por Berle e Means, trazendo à tona o clássico conflito de interesses entre agente e principal discutido pela Teoria da Agência. A premissa por trás da governança corporativa é que as pessoas que estão dentro das corporações não necessariamente agem visando o melhor para os provedores de fundos. Partindo deste pressuposto, o trabalho em questão visa verificar a influência dos aspectos de governança corporativa na eficiência das empresas de capital aberto brasileiras. O estudo une técnicas de otimização estática através de Análise Envoltória de Dados (DEA para identificar a eficiência das empresas de capital aberto, com Dados em Painel para identificar a influência da governança corporativa na eficiência das empresas. Os dados foram coletados manualmente dos relatórios 20-F da Security Exchange Commission (SEC das empresas brasileiras que possuem American Depositary Receipts (ADRs, já que a base de dados não está disponível, no Brasil, de uma forma completa. Grande parte das hipóteses foi confirmada, evidenciando as condições particulares das finanças corporativas no Brasil no que tange a Governança Corporativa. A incipiência do mercado de capitais brasileiro é percebida em várias análises, ressaltando que o histórico do sistema corporativo brasileiro é um dos limitantes da eficiência das empresas. As condições que prevalecem são: (i alta sobreposição propriedade-direção; (ii conselhos de administração de baixa efetividade; (iii em grupos familiares, os papéis dos acionistas, dos conselhos e da direção não são bem definidos; (iv existe pouca clareza quanto à relação benefício-custo da boa governança; (v baixa eficácia dos conselhos de administração; e (vi indícios de conflitos de interesses, relativizados por incentivos explícitos e implícitos.

Avoiding pitfalls in the determination of halocarboxylic acids: the photochemistry of methylation.

Science.gov (United States)

Rubio, F J; Urbansky, E T; Magnuson, M L

2000-06-01

Haloethanoic (haloacetic) acids are formed during chlorination of drinking water and are regulated by the Environmental Protection Agency (EPA). These compounds are normally quantified by gas chromatography with electron capture detection (GC-ECD) as the methyl esters. EPA Method 552 uses diazomethane (CH2N2) for this purpose, but has only been validated by EPA for HAA6: chloro-, dichloro-, bromo-, dibromo-, bromochloro- and trichloroacetic acids. EPA Method 552.2 was developed and validated for all nine analytes (HAA9 = HAA6 + dibromochloro-, bromodichloro- and tribromoethanoic acids). Since the promulgation of Method 552.2, which uses acidic methanol, a debate has ensued over discrepancies observed by various laboratories when using diazomethane instead. In an effort to identify and eliminate potential sources for these discrepancies, a comparative study was undertaken for HAA9. Better accuracy and precision were observed for all HAA9 species by Method 552.2; recoveries were satisfactory in de-ionized and tap water. Method 552 remains satisfactory for HAA6. Systematic differences in instrumental response are observed for the two methods, but these are precise and may be accounted for using similarly treated standards and analyte-fortified (spiked) samples. That notwithstanding, Method 552 (CH2N2) was shown to be unsuitable for dibromochloro-, bromodichloro- and tribromoethanoic acids (HAA9-6). The primary problem appears to be a photoactivated reaction between diazomethane and the HAA9-6 analytes; however, side reactions were found to occur even in the dark. Analyte loss is most pronounced under typical laboratory lighting (white F40 fluorescent lamps + sunlight), but it is also observed under Philips gold F40 lamps (lambda > or = 520 nm), and in the dark.

Prevalence of mabDAS-1 positivity in biopsy specimens from the esophagogastric junction.

Science.gov (United States)

Rogge-Wolf, Claudia; Seldenrijk, Cornelis A; Das, Kiron M; Timmer, Robin; Breumelhof, Ronald; Smout, André J P M; Amenta, Peter S; Griffel, Louis H

2002-12-01

Intestinal metaplasia (IM) is a precursor for malignancies at the esophagogastric junction. A monoclonal antibody, mAbDAS-1, can probably identify cellular characteristics of IM before the appearance of goblet cells. The aim of this study was to examine the prevalence of mAbDAS-1 positivity in biopsies from the squamocolumnar junction (SCJ) and to correlate this positivity with the presence of IM and clinical findings. In 559 patients, reflux symptoms were scored, and the presence of reflux esophagitis and hiatus hernia was evaluated during endoscopy. Two biopsy specimens were obtained from the SCJ. In a subset of patients (n = 99), biopsies from the endoscopically defined cardiac region (2 cm distal to proximal margin of gastric folds) were available. Biopsy specimens were stained with hematoxylin and eosin, Alcian Blue, modified Giemsa, and mAbDAS-1. mAbDAS-1 positivity was observed in the SCJ biopsies of 201 of 486 (41.4%) patients without IM and in 64 of 73 (87.7%) patients with IM. Patients without IM but with antibody positivity showed similar histological characteristics as patients with IM at the SCJ. Biopsies of 123 of 559 patients (22%) revealed a columnar-cuboidal epithelium, which was found to be mAbDAS-1 positive in 64.2% (77 of 123). Tissue specimens from the cardiac region without IM stained positive in 14.2% (13 of 91), 12 of those also stained at the SCJ. In patients without IM, a high prevalence of mAbDAS-1 positivity was observed. Biopsies of these patients showed similar histological characteristics as patients with IM. Although not all patients exhibiting this reactivity may develop IM, mAbDAS-1 reactivity may help in the understanding of the histogenesis of IM at the SCJ.

PSICOGÊNESE E HISTÓRIA DAS CIÊNCIAS: ELEMENTOS PARA UMA EPISTEMOLOGIA CONSTRUTIVISTA

Directory of Open Access Journals (Sweden)

Roberta Chiesa Bartelmebs

Full Text Available O objetivo deste artigo é traçar um paralelo entre a obra Psicogênese e História das Ciências, de Piaget e García, com o ensino de ciências a partir de uma epistemologia construtivista, derivada essencialmente da epistemologia genética. A obra, publicada pela primeira vez em 1983, concretiza a síntese de suas investigações epistemológicas acerca do desenvolvimento das ciências através da história das ciências com o desenvolvimento da inteligência por meio da psicogênese. O objetivo do livro, no entanto, não é comparar a história das ciências com o desenvolvimento psicogenético dos sujeitos, mas compreender os mecanismos de evolução das ideias pré-científicas nas crianças através da epistemologia genética. Nesse sentido, os autores apresentam uma epistemologia construtivista, a qual, no nosso entendimento, pode servir de base para a compreensão do ensino de ciências, contribuindo com reflexões acerca dos processos de ensino e de aprendizagem em sala de aula.

O FUNCIONAMENTO DAS MÁQUINAS DE TORTURA: SOBRE A JUSTIÇA DAS PENAS DE PRISÃO. UMA ANÁLISE A PARTIR DO DOCUMENTÁRIO SEM/PENA

Directory of Open Access Journals (Sweden)

Camila Cardoso de Mello Prando

2015-10-01

Full Text Available O texto toma como obra de arte de referência o documentário “Sem Pena”, dirigido por Eugenio Puppo. A partir dos sentidos e provocações da obra e apropriando-me metodologicamente das perspectivas psicanalíticas sobre a análise das obras de arte e da perspectiva epistemológica feminista de produção de conhecimento analiso os sentidos não ordinários da pena. Formulo três perguntas determinadas pelos seguintes sentidos da palavra pena: autoria, escrita dos letrados e dó. As discussões que seguem a cada uma das perguntas servem para compreender a possibilidade de produção de justiça - no sentido desenvolvido por Derrida - nas decisões que determinam as penas de prisão.  

Quem são os migrantes das metrópoles? Uma análise comparativa das pessoas que entraram e saíram das regiões metropolitanas brasileiras

Directory of Open Access Journals (Sweden)

Fernando Braga

2017-06-01

Full Text Available A migração interna foi fator chave no crescimento metropolitano brasileiro impulsionado pela transição da economia nacional da base agrícola para a urbano-industrial. Nas três últimas décadas, contudo, vêm ocorrendo mudanças significativas na intensidade e direção dos fluxos populacionais, bem como no perfil dos migrantes. Além disso, os dados mais recentes mostram uma tendência de inversão de sinal do saldo migratório das regiões metropolitanas. Diante disso, esse artigo propõe analisar comparativamente os imigrantes e os emigrantes das 12 principais regiões metropolitanas do Brasil em dimensões demográficas e socioeconômicas a partir dos dados dos Censos Demográficos de 1991 e 2000, possibilitando uma reflexão sobre as mudanças recentes na mobilidade populacional brasileira e sua relação com o processo de formação da rede urbana.

Epidemiologia das infecções hematogênicas por Candida spp

Directory of Open Access Journals (Sweden)

Colombo Arnaldo Lopes

2003-01-01

Full Text Available O gênero Candida spp é responsável por cerca de 80% das infecções fúngicas no ambiente hospitalar e constitui causa relevante de infecções de corrente sanguínea. Nos Estados Unidos da América, Candida spp é a quarta causa mais comum de infecções de corrente sanguínea, respondendo por cerca de 8% dos casos das infecções documentadas neste sítio. Espécies não-albicans respondem hoje por ao menos 50% das infecções invasivas por Candida spp, apresentando peculiaridades de história natural e sensibilidade a antifúngicos. A mortalidade geral de fungemias por Candida spp é da ordem de 40 a 60%, tornado esta complicação infecciosa um grande desafio para os clínicos que trabalham em hospitais terciários em diferentes países.

A leitura das obras completas em contexto escolar no Quebec

Directory of Open Access Journals (Sweden)

Olivier Dezutter

2017-06-01

Full Text Available No Quebec, as recentes reformas curriculares testemunham as elevadas exigências quanto ao número de obras completas a serem lidas no período de formação pré-universitária, e dedicam uma grande liberdade aos professores para a seleção dos títulos. Fundamentamo-nos aqui sobre os resultados de uma vasta pesquisa para estabelecer a situação das exigências dos professores em matéria de leitura das obras, das finalidades associadas a esta prática e do corpus escolhido. Os professores do primário e do secundário visam ao desenvolvimento do prazer da leitura; aqueles do colegial, à constituição de uma cultura literária de base: a primeira centra-se na literatura quebequense enquanto a segunda leva em consideração o patrimônio francês.

Identification and evaluation of resistance to powdery mildew and yellow rust in a wheat mapping population.

Directory of Open Access Journals (Sweden)

Lijun Yang

Full Text Available Deployment of cultivars with genetic resistance is an effective approach to control the diseases of powdery mildew (PM and yellow rust (YR. Chinese wheat cultivar XK0106 exhibits high levels of resistance to both diseases, while cultivar E07901 has partial, adult plant resistance (APR. The aim of this study was to map resistance loci derived from the two cultivars and analyze their effects against PM and YR in a range of environments. A doubled haploid population (388 lines was used to develop a framework map consisting of 117 SSR markers, while a much higher density map using the 90K Illumina iSelect SNP array was produced with a subset of 80 randomly selected lines. Seedling resistance was characterized against a range of PM and YR isolates, while field scores in multiple environments were used to characterize APR. Composite interval mapping (CIM of seedling PM scores identified two QTLs (QPm.haas-6A and QPm.haas-2A, the former being located at the Pm21 locus. These QTLs were also significant in field scores, as were Qpm.haas-3A and QPm.haas-5A. QYr.haas-1B-1 and QYr.haas-2A were identified in field scores of YR and were located at the Yr24/26 and Yr17 chromosomal regions respectively. A second 1B QTL, QYr.haas-1B-2 was also identified. QPm.haas-2A and QYr.haas-1B-2 are likely to be new QTLs that have not been previously identified. Effects of the QTLs were further investigated in multiple environments through the testing of selected lines predicted to contain various QTL combinations. Significant additive interactions between the PM QTLs highlighted the ability to pyramid these loci to provide higher level of resistance. Interactions between the YR QTLs gave insights into the pathogen populations in the different locations as well as showing genetic interactions between these loci.

A DESIGUALDADE AMBIENTAL EM RIO DAS OSTRAS-RJ, BRASIL

Directory of Open Access Journals (Sweden)

Juliana Higa Bellini

2016-12-01

Full Text Available Este artigo analisou a desigualdade ambiental em Rio das Ostras-RJ por meio do mapeamento das condições adequadas de habitação, baseada nos índices de abastecimento de água, de esgotamento sanitário, de alfabetização, de renda, de disposição do lixo e de presença de vegetação, oriundos do Censo IBGE de 2010 e de imagens de satélite Cbers-2b e Landsat-5, de 2008. Os índices foram ponderados pelo método Analitic Hierarchy Process e agregados no software ArcGis 10.0, construindo o índice de desigualdade ambiental. O município de Rio das Ostras foi selecionado por apresentar um elevado crescimento populacional entre 2000 e 2010, seguido de um significativo crescimento econômico derivado da exploração de petróleo e gás na Bacia de Campos. Nesse sentido, tornou-se importante verificar se o crescimento populacional e econômico vinha acompanhando de condições de habitação adequadas para toda a população. O resultado expôs a presença de desigualdade ambiental em Rio das Ostras, afetando principalmente a população de menor renda, com maiores porcentagens de analfabetos e localizados no limite da área urbanizada e na área rural, cujas áreas apresentaram deficiência na oferta de serviços e infraestrutura. Concluiu-se que a distribuição condições adequadas de habitação avaliada por este trabalho não é homogênea e segue a lógica de valorização da terra urbana para o processo de especulação imobiliária em Rio das Ostras. A presença da desigualdade ambiental também representa dificuldades na garantia da sustentabilidade urbana, com diversas áreas desprovidas de condições de habitação em que, por isso, acabam por impactar o meio ambiente.

Padronização das atividades em centro cirúrgico oncológico segundo a Classificação das Intervenções de Enfermagem

Directory of Open Access Journals (Sweden)

Joao Francisco Possari

2013-06-01

Full Text Available Este estudo teve como objetivos identificar em um centro cirúrgico especializado em oncologia, as atividades de enfermagem realizadas no período transoperatório, classificar e validar as atividades em intervenções, segundo a Classificação das Intervenções de Enfermagem (NIC. O levantamento das atividades foi realizado por meio dos registros e da observação direta da assistência de enfermagem, nos quatro turnos de trabalho. As atividades foram classificadas em intervenções de enfermagem da NIC utilizando-se a técnica mapeamento cruzado. O elenco de intervenções foi validado por profissionais de enfermagem, em oficinas de trabalho. Identificaram-se 49 intervenções: 34 de cuidados diretos e 15 de cuidados indiretos. O reconhecimento das intervenções de enfermagem permite medir o tempo despendido na sua execução, variável fundamental para quantificar e qualificar a carga de trabalho dos profissionais de enfermagem.

Update of PPPL's DAS-1800

International Nuclear Information System (INIS)

Booth, K.H.

1976-01-01

Demand for real-time computer assistance of experiments at PPPL has increased in volume and complexity. The PPPL data acquisition system based on an IBM-1800 has been servicing three experimental devices, ST, FM, and ATC, often concurrently. The requirements of real-time computer support, the acquisition, archiving, analysis, and display of data for these devices, are described. A presentation of the current DAS-1800 system which supports two devices, FM and ATC, includes summaries of additional experiments serviced

"Doidas e putas”: usos das categorias travesti e transexual

Directory of Open Access Journals (Sweden)

Bruno Cesar Barbosa

Full Text Available Neste artigo discuto os usos das categorias travesti e transexual com base em trabalho de campo realizado entre 2008 e 2009 com participantes das reuniões denominadas Terças Trans. A questão central que norteou a análise foi como as diferentes pessoas observadas utilizavam categorias relacionadas a identidades sexuais e de gênero e como acionavam e articulavam diversas associações convencionais nesse processo para produzir sentidos e diferenças acerca destas categorias. Embora as convenções do discurso médico sejam referências centrais para a definição de corpos, subjetividades e identidades das pessoas pesquisadas, foi possível observar também uma variedade de reelaborações e deslocamentos de sentidos. Procuro desenvolver o argumento de que travesti e transexual são categorias performativas, e que tal performatividade não se esgota apenas em enunciados de gênero e sexualidade, mas também pode ser expressa por meio de articulações contingentes que remetem a diferenças de classe, cor/raça e geração.

UMA VISÃO GERAL SOBRE A INTERNET DAS COISAS

Directory of Open Access Journals (Sweden)

Gustavo Marin Suppi

2017-02-01

Full Text Available No decorrer dos anos, a tecnologia computacional tem evoluído, com os dispositivos móveis abriu um imenso leque de possibilidades de sistemas que visam facilitar a vida de toda a sociedade. Na Internet das Coisas, a conexão não se limita a esses dispositivos, mas a qualquer objeto no ambiente, desde torneiras até sinaleiras, onde formam uma estrutura de rede guiada por troca de informações, onde sensores captam informações do meio e enviam para dispositivos que as processam. Por meio de uma revisão de literatura, o objetivo foi coletar dados sobre essa nova infraestrutura, proporcionando ao leitor uma visão geral, expondo os principais pontos mencionados pelos autores dos artigos pesquisados. Concluiu-se que o objetivo da Internet das Coisas é de fato revolucionar o meio de como usamos a internet, desde a conectividade até a distribuição da informação, porém, para tal, será necessário fortes estudos em relação a segurança das informações obtidas dos usuários.

Disrupted lymphocyte homeostasis in hepatitis‐associated acquired aplastic anemia is associated with short telomeres

Science.gov (United States)

Babushok, Daria V.; Grignon, Anne‐Laure; Li, Yimei; Atienza, Jamie; Xie, Hongbo M.; Lam, Ho‐Sun; Hartung, Helge; Bessler, Monica

2016-01-01

Hepatitis‐associated aplastic anemia (HAA) is a variant of acquired aplastic anemia (AA) in which immune‐mediated bone marrow failure (BMF) develops following an acute episode of seronegative hepatitis. Dyskeratosis congenita (DC) is an inherited BMF syndrome characterized by the presence of short telomeres, mucocutaneous abnormalities, and cancer predisposition. While both conditions may cause BMF and hepatic impairment, therapeutic approaches are distinct, making it imperative to establish the correct diagnosis. In clinical practice, lymphocyte telomere lengths (TL) are used as a first‐line screen to rule out inherited telomeropathies before initiating treatment for AA. To evaluate the reliability of TL in the HAA population, we performed a retrospective analysis of TL in 10 consecutively enrolled HAA patients compared to 19 patients with idiopathic AA (IAA). HAA patients had significantly shorter telomeres than IAA patients (P = 0.009), including four patients with TL at or below the 1st percentile for age‐matched controls. HAA patients had no clinical features of DC and did not carry disease‐causing mutations in known genes associated with inherited telomere disorders. Instead, short TLs were significantly correlated with severe lymphopenia and skewed lymphocyte subsets, features characteristic of HAA. Our results indicate the importance of caution in the interpretation of TL measurements in HAA, because, in this patient population, short telomeres have limited specificity. Am. J. Hematol. 91:243–247, 2016. © 2015 The Authors. American Journal of Hematology Published by Wiley Periodicals, Inc. PMID:26615915

Effect of drinking water disinfection by-products in human peripheral blood lymphocytes and sperm.

Science.gov (United States)

Ali, Aftab; Kurzawa-Zegota, Malgorzata; Najafzadeh, Mojgan; Gopalan, Rajendran C; Plewa, Michael J; Anderson, Diana

2014-12-01

Drinking water disinfection by-products (DBPs) are generated by the chemical disinfection of water and may pose hazards to public health. Two major classes of DBPs are found in finished drinking water: haloacetic acids (HAAs) and trihalomethanes (THMs). HAAs are formed following disinfection with chlorine, which reacts with iodide and bromide in the water. Previously the HAAs were shown to be cytotoxic, genotoxic, mutagenic, teratogenic and carcinogenic. To determine the effect of HAAs in human somatic and germ cells and whether oxidative stress is involved in genotoxic action. In the present study both somatic and germ cells have been examined as peripheral blood lymphocytes and sperm. The effects of three HAA compounds: iodoacetic acid (IAA), bromoacetic acid (BAA) and chloroacetic acid (CAA) were investigated. After determining appropriate concentration responses, oxygen radical involvement with the antioxidants, butylated hydroxanisole (BHA) and the enzyme catalase, were investigated in the single cell gel electrophoresis (Comet) assay under alkaline conditions, >pH 13 and the micronucleus assay. In the Comet assay, BHA and catalase were able to reduce DNA damage in each cell type compared to HAA alone. In the micronucleus assay, micronuclei (MNi) were found in peripheral lymphocytes exposed to all three HAAs and catalase and BHA were in general, able to reduce MNi induction, suggesting oxygen radicals play a role in both assays. These observations are of concern to public health since both human somatic and germ cells show similar genotoxic responses. Copyright © 2014. Published by Elsevier B.V.

La prevención de caídas recurrentes en el paciente anciano

Directory of Open Access Journals (Sweden)

Miriam Bella Beorlegui

Full Text Available RESUMEN Las caídas son “acontecimientos involuntarios que hacen perder el equilibrio y dar con el cuerpo en la tierra u otra superficie firme que lo detenga”. Las caídas recurrentes (presencia de dos o más caídas en un año constituyen un problema frecuente en centros residenciales, y predisponen a las personas mayores a sufrir incapacidad, dependencia y múltiples enfermedades. La aplicación de medidas de prevención puede disminuir notablemente su incidencia y, por tanto, sus consecuencias. El objetivo de este trabajo es identificar qué intervenciones de enfermería pueden ayudar a prevenir caídas recurrentes en las personas mayores institucionalizadas, y minimizar el impacto emocional que ocasionan estos episodios. Para ello, se desarrolla un caso clínico y, tras el análisis de la evidencia científica, se proponen intervenciones para evitar la recurrencia de un episodio de caída y sus consecuencias. El análisis de este caso se estructura en valoración de riesgo de caídas recurrentes e intervenciones de prevención de las mismas. Y, a su vez, cada apartado se divide en aspectos físicos y emocionales. La literatura especializada refleja que la valoración del riesgo de caídas es clave para implantar un plan de cuidados. Conocer los factores de riesgo intrínsecos y extrínsecos ayudará a los profesionales a diseñar intervenciones de prevención. Asimismo, se ha identificado el impacto emocional que producen las caídas en los pacientes y se proponen algunas intervenciones para aliviarlo. Este trabajo refuerza la importancia de realizar una adecuada valoración de enfermería a las personas mayores en riesgo de sufrir caídas recurrentes, a través de diferentes instrumentos para detectar las áreas específicas de intervención. Se concluye con la necesidad de protocolizar esta valoración, tanto física como emocional, para poder individualizarla posteriormente con cada paciente.

VALIDASI DATA TRMM TERHADAP DATA CURAH HUJAN AKTUAL DI TIGA DAS DI INDONESIA

Directory of Open Access Journals (Sweden)

M. Djazim Syaifullah

2015-01-01

Full Text Available Validasi data TRMM telah dilakukan dengan data curah hujan di tiga DAS di wilayah Indonesia. Ketiga DAS tersebut adalah: DAS Citarum-Jawa Barat, DAS Sutami-Brantas Jawa Timur dan DAS Larona-Sulawesi Selatan. Dari analisis dua jenis tipe data TRMM NASA (3B42RT dan TRMM Jaxa (GSMap_NRT menunjukkan bahwa TRMM Jaxa lebih mendekati data pengamatan dibandingkan dengan TRMM NASA. Secara umum dari hasil analisis untuk ketiga DAS memperlihatkan bahwa nilai curah hujan TRMM Jaxa (GSMap_NRT mempunyai pola yang mengikuti curah hujan pengamatan (aktual meskipun nilainya cenderung di bawah perkiraan. Perbedaan ini salah satunya bisa diakibatkan karena pemasangan penakar hujan yang kurang representatif terhadap DAS sehingga rerata curah hujan wilayahnya kurang merepresentasikan DAS tersebut. Untuk plot scatter bulanan nilai korelasinya lebih baik dibandingkan dengan plot scatter harian (dari 0.13~0.14 meningkat menjadi 0.58~0.75 dan nilai RMSE menurun (dari rerata 11.6 mm/hari menjadi 7.6 mm/hari, sehingga analisis TRMM bulanan lebih merepresentasikan kondisi aktual.   TRMM data validation has been done with rainfall data in three watersheds of Indonesia. There are: Citarum (West Java, Sutami-Brantas (East Java and Larona (South Sulawesi. There are two types of TRMM data; TRMM NASA (3B42RT and TRMM Jaxa (GSMap_NRT. From the analysis of both types of the data indicate that the TRMM Jaxa closer to observed data. In general the results of analysis for all three catchments showed that the value of TRMM rainfall Jaxa (GSMap_NRT has better agreement to the pattern of observed rainfall data although it's value tend to under estimate. This difference could be caused due to the installation of the rain gauge less representative of catchment so that the average rainfall less territory represents the catchment. Scatter plot for the monthly data have better correlation coefficient than the daily plot (0.13~0.14 raise 0.58~0.75 and decreasing RMSE value (from average 11

ESTUDO FITOQUÍMICO E ANTIMICROBIANO DAS FOLHAS DE EUGENIA ASTRINGENS CAMBESS. (MYRTACEAE

Directory of Open Access Journals (Sweden)

Bruna Carminate

2017-02-01

Full Text Available O conhecimento sobre plantas medicinais simboliza muitas vezes o único recurso terapêutico de muitas comunidades e grupos étnicos. A tradição popular é a origem de valiosos conhecimentos acerca das plantas, muitas das observações populares sobre a utilização de plantas medicinais contribuem, de forma relevante, para a divulgação das virtudes terapêuticas vegetais. A E. astringens é uma espécie que apresenta casca e folhas aromáticas, adstringentes, anti-reumáticas e diuréticas. Apesar do uso medicinal já relatado, não existem muitos estudos quanto a atividade antimicrobiana. O objetivo do presente trabalho foi a realização da triagem fitoquímica e a avaliação da atividade antimicrobiana do extrato hidroalcoólico das folhas de Eugenia astringens Cambess. Foram encontrados taninos, fenóis, catequinas e ácidos orgânicos e o extrato apresentou atividade antibacteriana para todas as 8 cepas testadas.

GRAPHIC DESIGN INNOVATION AS BRAND IDENTITY FOR “MAHLZEIT N’DAS BROT” BREAD PACKAGING

Directory of Open Access Journals (Sweden)

Zulkarnain Zulkarnain

2015-10-01

Full Text Available Besides being useful for protecting food, packaging design also serves as a media campaign. So hopefully, Mahlzeit Bread n 'Das Brot can compete with other bakers and even can be a pioneer as an authentic German bread maker in Indonesia. This research was conducted by collecting information from the client (Mahlzeit n 'Das Brot owner. This information was used to obtain a verbal brand identity, then translated visually. The use of illustrations also becomes the most important visual images to present the image of Germany Elegant Vintage and privilege in explaining the products of Mahlzeit n 'Das Brot. The colors used are natural colors and traditionally the colors brown and green to indicate an authentic image of Mahlzeit n 'Das Brot.

Die Gestalten und das Gestalten der Welt

NARCIS (Netherlands)

Ierna, Carlo; Höfer, Ulf; Valent, Juta

2017-01-01

In seiner Kosmogonie bespricht Ehrenfels den Ursprung, die Entwicklung, und das endgültige Schicksal des Universums: die Gestalt der Welt. Einerseits ist sie ein Kosmos, ein Geschöpf des Ordnungsprinzips, andererseits ein Chaos, als Resultat des Prinzips des Zufalls und der Entropie. Diese beiden

MiDAS: the field guide to the microbes of activated sludge.

Science.gov (United States)

McIlroy, Simon Jon; Saunders, Aaron Marc; Albertsen, Mads; Nierychlo, Marta; McIlroy, Bianca; Hansen, Aviaja Anna; Karst, Søren Michael; Nielsen, Jeppe Lund; Nielsen, Per Halkjær

2015-01-01

The Microbial Database for Activated Sludge (MiDAS) field guide is a freely available online resource linking the identity of abundant and process critical microorganisms in activated sludge wastewater treatment systems to available data related to their functional importance. Phenotypic properties of some of these genera are described, but most are known only from sequence data. The MiDAS taxonomy is a manual curation of the SILVA taxonomy that proposes a name for all genus-level taxa observed to be abundant by large-scale 16 S rRNA gene amplicon sequencing of full-scale activated sludge communities. The taxonomy can be used to classify unknown sequences, and the online MiDAS field guide links the identity to the available information about their morphology, diversity, physiology and distribution. The use of a common taxonomy across the field will provide a solid foundation for the study of microbial ecology of the activated sludge process and related treatment processes. The online MiDAS field guide is a collaborative workspace intended to facilitate a better understanding of the ecology of activated sludge and related treatment processes--knowledge that will be an invaluable resource for the optimal design and operation of these systems. © The Author(s) 2015. Published by Oxford University Press.

Development of an indicator system for the German action plan to global climate change (DAS); Entwicklung eines Indikatorensystems fuer die Deutsche Anpassungsstrategie an den Klimawandel (DAS)

Energy Technology Data Exchange (ETDEWEB)

Schoenthaler, Konstanze; Andrian-Werburg, Stefan von [Bosch und Partner GmbH, Muenchen (Germany); Nickel, Darla [Ecologic gGmbH Institut fuer Internationale und Europaeische Umweltpolitik, Berlin (Germany)

2011-12-15

On 17th December 2008 the German Federal Cabinet adopted the German Strategy for Adaptation to Climate Change (DAS: Deutsche Anpassungsstrategie) (BUNDESREGIERUNG 2008). The DAS has created the framework for adapting to the consequences of climate change in Germany. First and foremost, the DAS contributes its guidelines at Federal level, to provide guidance for agents at other levels. The Strategy lays the foundation for a medium-term process. In conjunction with the individual Federal States and other groups representing various sectors of society, the Strategy provides a step-by-step assessment of the risks of climate change. Furthermore, it states the potential requirements for action, and defines the appropriate goals and potential adaptation measures to be developed and implemented in the process. The Strategy is divided into 13 action fields and two cross-sectional fields (=14+15). (1) Human health (2) Building sector (3) Water regime, water management, coastal and marine protection (4) Soil (5) Biological diversity (6) Agriculture (7) Woodland and forestry (8) Fishery (9) Energy industry (conversion, transport and supply) (10) Financial services industry (11) Transport, transport infrastructure (12) Trade and industry (13) Tourism industry (14) Spatial, regional and physical development planning (15) Civil protection. In due course, the Federal Environment Agency (UBA) will design a comprehensive set of tools to support and implement the DAS. This will be made available for download from www.anpassung.net. An integral part of this will be the 'Tatenbank' (www.tatenbank.anpassung.net), the 'Klimalotse' (www.klimalotse.anpassung.net), FISKA (special information system 'Adaptation') and an Indicator System to aid adaptation. The latter is one of the key tasks identified for the DAS. As far as the Indicator System is concerned, it has been decided to prepare a Report on Indicators for the challenges facing Germany and the

Tendências das mudanças da proteção social no Brasil e no Uruguai: a centralidade das redes mínimas na América Latina

Directory of Open Access Journals (Sweden)

Alejandra Pastorini

2014-06-01

Full Text Available http://dx.doi.org/10.1590/S1414-49802014000100006 O objetivo deste trabalho é compreender as alterações na lógica que orienta o trato das manifestações da questão social na atualidade, tomando como referência a realidade do Brasil e do Uruguai. Inicia-se pela análise das mudanças contemporâneas nas sociedades capitalistas, prestando especial atenção nas alterações dos princípios que estruturam a proteção social. Dessa forma, identifica-se algumas tendências das reformas nas políticas sociais nos governos progressistas que se consolidam na virada do século.

Estudo das ausências da equipe de enfermagem

Directory of Open Access Journals (Sweden)

Janaina Haidê Rodrigues Belem

1998-12-01

Full Text Available As ausências dos elementos da equipe de enfermagem comprometem a organização do trabalho causando sobrecarga dessa equipe, e queda na qualidade da assistência de enfermagem. O presente estudo caracteriza o tipo e distribuição das ausências da equipe de enfermagem em um hospital geral de grande porte, propondo um índice de Segurança Técnica para cobertura das ausências a partir da realidade investigada. Foram estudadas 8 tipos de ausências entre previstas e não previstas. O maior número de tipos de ausências encontradas foram aquelas referentes à ausências previstas, em seqüência encontramos licença maternidade representando o maior número de ausências não previstas.

Dialética das relações raciais

Directory of Open Access Journals (Sweden)

Octavio Ianni

2004-04-01

Full Text Available AS RELAÇÕES raciais estão enraizadas na vida social de indivíduos, grupos e classes sociais. As desigualdades sociais frequentemente se manifestam nos estereótipos e nas intolerâncias, polarizadas em torno de etnias, assim como gênero e outras diversidades sociais como as de gênero, religiosas e outras. Em síntese, a dinâmica das diversidades e das desigualdades "fabrica" continua e reiteradamente as intolerâncias e preconceitos.RACIAL relationships are rooted in the social life of individuals, groups and social classes. Social inequalities often manifest themselves in stereotypes and intolerance, polarized around ethnicities and other social diversities such as gender, religion etc. In brief, the dynamics of diversity and inequality continuously and reiteratively "manufactures" intolerance and bigotry.

The project Petersbogen at Leipzig; Das Projekt Petersbogen in Leipzig

Energy Technology Data Exchange (ETDEWEB)

Wichmann, R. [Ingenieurbuero Wichmann GmbH, Berlin (Germany)

2003-07-01

The 'Petersbogen' project at Leipzig will house the main station, the law department of Leipzig University, shops, and a big cinema. The versatile applications of the building required careful planning of the technical facilities. [German] Im Zentrum der geschichtstraechtigen Universitaetsstadt Leipzig wurde von den Architekten, die auch den dortigen Hauptbahnhof zu einem mondaenen Einkaufszentrum ausbauten, das Bauvorhaben ''Petersbogen'' realisiert. Das Gebaeude beherbergt neben den Ladenflaechen der Juridicum Passage, die juristische Fakultaet der Uni Leipzig und ein Kinozentrum. Entsprechend der vielseitigen Aufgaben des Gebaeudes war eine planungsintensive Haustechnik notwendig. (orig.)

Intimidades conjugais : das significações e percursos de intimidade à proximidade emocional

OpenAIRE

Santos, Cátia Vanessa da Costa

2010-01-01

Tese de mestrado, Psicologia (Secção de Psicologia Clínica e da Saúde - Núcleo de Psicologia Clínica Sistémica), Universidade de Lisboa, Faculdade de Psicologia, 2010 A intimidade é o conceito estrutural mais complexo das relações conjugais (Costa, 2005), pelo que a sua compreensão é vital para o conhecimento do casal, numa perspectiva de prevenção e melhoria das relações íntimas. Nesta investigação, pretendeu-se estudar as associações que se estabelecem entre três especificidades das rela...

O conceito de espaço na epidemiologia das doenças infecciosas

Directory of Open Access Journals (Sweden)

Silva Luiz Jacintho da

1997-01-01

Full Text Available Análise teórica da utilização do conceito de espaço na epidemiologia das doenças infecciosas. Faz-se uma breve retrospectiva do uso de diferentes conceituações de espaço e de suas implicações. Ênfase é dada à teoria dos focos naturais de Pavlovsky e às interações entre a epidemiologia e a geografia. O problema atual das infecções emergentes é visto como determinante da necessidade de se intensificarem as discussões sobre este conceito na epidemiologia das doenças infecciosas.

O conceito de espaço na epidemiologia das doenças infecciosas

Directory of Open Access Journals (Sweden)

Luiz Jacintho da Silva

Full Text Available Análise teórica da utilização do conceito de espaço na epidemiologia das doenças infecciosas. Faz-se uma breve retrospectiva do uso de diferentes conceituações de espaço e de suas implicações. Ênfase é dada à teoria dos focos naturais de Pavlovsky e às interações entre a epidemiologia e a geografia. O problema atual das infecções emergentes é visto como determinante da necessidade de se intensificarem as discussões sobre este conceito na epidemiologia das doenças infecciosas.

Circuito elétrico auxiliar para intubação das vias lacrimais

OpenAIRE

Fernandes,José Byron Vicente Dias; Matayoshi,Suzana; Komatsu,Wilson; Kikuta,Henrique S.; Moura,Eurípedes da Mota

2000-01-01

Objetivo: Apresentam num circuito elétrico auxiliar para a intubação de vias lacrimais. Método: Descreve-se o dispositivo e sua utilização em 40 pacientes com obstrução congênita ou traumática das vias lacrimais. Resultados: O estudo das características elétricas do aparelho mostrou suas vantagens em relação a outros dispositivos citados na literatura. O uso do aparelho facilitou a recuperação das sondas de Crawford em todos os pacientes. Conclusão: O CAI mostrou-se eficiente e seguro sendo q...

A estrutura de capital das maiores empresas brasileiras: análise empírica das teorias de pecking order e trade-off, usando panel data.

Directory of Open Access Journals (Sweden)

Carlos Alberto Correa

2013-08-01

Full Text Available Pesquisas sobre estrutura de capital das empresas são consideradas dentre as mais relevantes na área de finanças. Diversas abordagens teóricas têm sido discutidas e testadas na literatura financeira. Este estudo buscou analisar o nível de endividamento das maiores empresas brasileiras, à luz das duas principais teorias que versam sobre o assunto, a teoria de Pecking Order e a teoria de trade--off, testando seus determinantes. A teoria do Pecking Order sugere a existência de uma hierarquia no uso de fontes de recursos, enquanto a teoria de trade-off considera a existência de uma estrutura meta de capital que seria perseguida pela empresa. O estudo é uma adaptação do artigo de Gaud et al. (2005, cujo trabalho serviu como base e principal referência para a escolha das principais variáveis e dos testes econométricos realizados. Tal como Gaud et al. (2005, desenvolvemos as análises estatísticas utilizando a metodologia de Panel Data, que considera os dados da amostra em corte transversal e longitudinal. Além de testes estáticos, foram feitos testes dinâmicos, com o objetivo de analisar o processo de ajuste da estrutura de capital ao longo do tempo, em direção a um suposto nível-alvo ótimo. Os resultados demonstraram relação negativa entre o nível de endividamento das empresas e o grau de tangibilidade dos ativos e a rentabilidade, bem como relação positiva do endividamento com o risco. Demonstraram ainda que empresas de capital estrangeiro são mais endividadas que empresas nacionais. De um modo geral, os resultados sugerem que a teoria de Pecking Order é mais consistente do que a teoria de trade-off para explicar a estrutura de capital das companhias abertas brasileiras. Em especial, destacamos a relação negativa entre endividamento e rentabilidade, confirmando vários outros resultados de pesquisa obtidos na realidade brasileira. A análise dinâmica demonstrou baixa velocidade do processo de ajuste da estrutura de

Efeito da poda de raizes sobre o crescimento das mudas de eucalipto.

Directory of Open Access Journals (Sweden)

Teresa Aparecida Soares de Freitas

2009-09-01

Full Text Available Normal 0 21 MicrosoftInternetExplorer4 O trabalho teve como objetivo avaliar o efeito das podas no sistema radicial de mudas de Eucalyptus camaldulensis, produzidas em blocos. No viveiro, foram testados três tratamentos (T1: sem poda do sistema radicial; T2: 1 poda do sistema radicial; T3: duas podas do sistema radicial, disposto em DIC, com nove repetições, sendo cada repetição composta por 96 mudas. Parte dessas mudas foi levada para o campo para avaliação do efeito da poda das raízes após o plantio no campo. Foram dispostas em quatro blocos casualizados, com 49 mudas por parcela. O substrato utilizado para produção de mudas foi a mistura de plantmax florestal (60% e fibra de coco de granulometria mista (40%, sendo adicionados 8 g de osmocote (19-06-10 por quilo do substrato. As podas das raízes na fase de viveiro foram realizadas aos 80 e 90 dias após a semeadura, com auxilio de uma lâmina afiada. As mudas foram avaliadas aos 100 dias após a semeadura, quanto à altura da parte aérea, diâmetro do colo, massa seca da parte aérea, comprimento e diâmetro das raízes. No campo as mudas foram avaliadas quanto a altura e diâmetro ao 1, 3, 5, 7 e 9 meses após plantio. No viveiro, mesmo não havendo diferença no crescimento em altura e diâmetro da parte aérea das mudas entre os tratamentos, aquelas que não sofreram poda de suas raízes (T1 apresentaram menor produção de massa seca da parte aérea, representada pelas folhas. Já para o sistema radicial, quando foram aplicadas duas podas durante o ciclo de produção, as mudas apresentaram maior comprimento e diâmetro de raízes produzidas. Não houve diferença no crescimento das mudas após plantio no campo, no entanto, a condição climática na época de implantação e condução do experimento, além do sítio favorável ao desenvolvimento das mudas pode ter contribuído para esse resultado, sendo necessária condução de novo experimento, para avaliar o efeito das

Dansk oversættelse af MiDAS, et redskab til assessment af musikterapi for personer med demens

DEFF Research Database (Denmark)

Ridder, Hanne Mette Ochsner; Lykkegaard, Chris; McDermott, Orii

2018-01-01

Music in Dementia Assessment Scales, MiDAS, er udviklet til at vurdere ændringer i trivsel hos borgere med demens som har deltaget i musikterapi. Målingen udføres af 1) personale før og efter musikterapien for at vurdere om der er en indflydelse i hverdagssituationer efterfølgende, eller af 2......) musikterapeuten umiddelbart efter sessionen for at vurdere forandringer i selve sessionen. Der har været stor interesse for at anvende MiDAS i flere Europæiske lande, herunder Danmark. Derfor undersøgte udviklerne af MiDAS hvilke procedurer der anvendes til oversættelse og kulturel tilpasning af...... assessmentredskaber, og anbefalede på den baggrund en ti-trins procedure. Vi anvendte denne procedure til oversættelsen af MiDAS og således udviklingen af den danske MiDAS-DK. Den danske version af MiDAS er afprøvet af mere end 20 fagpersoner på baggrund af 296 udfyldte MiDAS-skemaer. Målet med artiklen er...

2015 - das Jahr der RDA - ein erster Statusbericht

Directory of Open Access Journals (Sweden)

Inge Neuböck

2015-06-01

geben. Manchmal bin ich selbst erstaunt, wieviel eine so kleine Gruppe bewegen kann – Motor dazu ist das wirklich intensive Interesse und die Freude an der Mitarbeit von etwas Neuem bei jedem einzelnen Mitglied der AGs...

Uma proposta de taxonomia para a categorização das falhas no ambiente das cadeias de suprimentos

Directory of Open Access Journals (Sweden)

Mauricio Plaza-Carvajal

2017-09-01

Full Text Available A questão informacional permeia as mais diversas áreas do conhecimento. Em relação ao ambiente industrial, elevados custos são imputados à indústria em virtude de deficiências no ciclo informacional e no de mercadorias. Falhas ocasionam interrupções e rupturas nesses ciclos, reduzindo a competitividade das organizações. O trabalho debruça-se sobre a possibilidade de categorizar essas falhas na cadeia de suprimentos. O objetivo principal é, a partir de um olhar da Ciência da Informação (CI, propor uma taxonomia para as falhas existentes, tendo por base os seguintes objetivos: (i identificar as principais falhas nas cadeias de suprimentos evidenciadas na literatura; (ii posicionar cada falha dentro do fluxo logístico e informacional, e (iii agrupar, organizar e hierarquizar essas falhas. Trata-se uma pesquisa bibliográfica, exploratória e qualitativa. Os resultados obtidos permitem afirmar que existem diversas similaridades nos termos que definem os locais e a origem das ocorrências de falhas, assim como, a percepção de que, com base na taxonomia proposta, há elevados riscos de interrupções e rupturas na cadeia de suprimentos. Finalmente, com o trabalho, espera-se contribuir com a ampliação da compreensão das falhas que acometem diversas organizações e, igualmente, com a geração de conhecimento para discussões futuras que envolvam as cadeias de suprimentos e a Ciência da Informação. Há um vasto espaço de colaboração no que tange à questão informacional na cadeia de suprimentos, que ainda não está devidamente preenchido pela CI. Neste sentido, este trabalho pretende, também, contribuir para diminuir um pouco tal lacuna.

Morphological diversity of fish along the rio das Velhas, Minas Gerais, Brazil

Directory of Open Access Journals (Sweden)

Nara Tadini Junqueira

2012-01-01

Full Text Available The rio das Velhas, located in central Minas Gerais State (Brazil, is a major tributary of the rio São Francisco. Despite several anthropogenic pressures, this basin supports more than 115 fish species. The aim of this study was to compare the morphological space occupied by fish assemblages in four regions (headwaters, upper, middle, and lower course along the channel of the rio das Velhas. We try to answer the following question: Is there a change in the morphological organization of the fish along the longitudinal gradient of the river? Individuals from 67 species, collected at several sites in the basin from 1999 to 2008, were measured for 11 morphological attributes related to swimming behavior and habitat use. Through the graphs, the first two dimensions of the PCA suggest that the morphological volume occupied by the headwaters region is smaller than the other sections, because of the low richness of the site. However, morphological hypervolumes of the four reaches analyzed by Euclidean distances were not statistically different. The results indicated that only the density of morphological types increases along the rio das Velhas, and there is no difference between the headwaters and upper courses. Therefore, in order to use functional groups related to the morphology of the species as tools to take measures for the conservation and revitalization of the rio das Velhas, it is necessary analyze the density of species within these groups, as well as their composition.O rio das Velhas, localizado na região central do estado de Minas Gerais (Brasil, é o mais extenso tributário do rio São Francisco. Apesar dos inúmeros impactos antrópicos que sofre, sua bacia abriga uma rica ictiofauna, com mais de 115 espécies conhecidas. O objetivo deste estudo foi comparar o espaço morfológico ocupado pelas assembleias de peixes em quatro regiões (cabeceira, alto curso, médio curso e baixo curso ao longo da calha do rio das Velhas. Procuramos

Das Archiv der Familie Szwojnicki aus Borkłojnie

Directory of Open Access Journals (Sweden)

Andrzej Mycio

2017-11-01

Full Text Available 2004 erwarb die Universitätsbibliothek in Thorn einen kleinen Bestand, das Privatarchiv der Familie Szwojnicki, die bis zum Zweiten Weltkrieg ihre Landgüter in Borkłojnie in der Republik Litauen inne hatte. Die von den nacheinander folgenden Familienvertretern gesammelten Materialien, die sich bis zum heutigen Tag bewährten, erlauben die wichtigsten Schicksale dieser Familie wiederherzustellen. Die Szwojnickis waren eine Familie der Landesbeamten. Im 19. Jahrhundert waren ihre Landgüter in Borkłojnie ein Hort, wo die polnischen Truppen während des Januaraufstandes unterstützt, geschützt und versorgt wurden. Die Landgüter wurden von 1897 bis zum Ende des Zweiten Weltkrieges von Zygmunt Szwojnicki verwaltet. In der Zwischenkriegszeit bemühte er sich aktiv um die Bewahrung der nationalen Identität der in der Republik Litauen lebenden Polen. 1946 wurde er zusammen mit anderen Polen in den polnischen Staat umgesiedelt. Das ganze Familienarchiv Szwojnickis ist einer der kleineren Archivbestände, die in der Universitätsbibliothek in Thorn aufbewahrt werden. Dazu gehörten insgesamt 12 Inventareinheiten. Das älteste Dokument in diesem Bestand stammt aus dem Jahr 1531, das jüngste aus dem Jahr 1946. Die erhaltenen Archivalien entstanden also innerhalb von über 400 Jahren. Sie schildern die Schicksale der Familie Szwojnicki und ihrer Landgüter in Borkłojnie. Der Archivbestand der Familie Szwojnicki ist ein typisches Beispiel von Familienakten des nicht so wohlhabenden polnischen Adels, der die Gebiete Litauens bewohnte. Es bewährten sich vor allem die Urkunden, die von den Ansprüchen der Familie auf den Adelstitel sowie auf die Landgüter zeugen, darüber hinaus: Matrikelakten, Testamente, Finanzurkunden sowie biografische Materialien in Bezug auf den letzten Eigentümer Zygmunt Szwojnicki.

Recortando e colando as imagens da vida cotidiana do trabalho e da cultura lúdica das meninas-mulheres e das mulheres-meninas da Zona da Mata Canavieira Pernambucana

Directory of Open Access Journals (Sweden)

MAURÍCIO ROBERTO DA SILVA

Full Text Available Este texto trata de diversos aspectos macro e microssociais da vida cotidiana das meninas-mulheres e das mulheres-meninas da Zona na Mata Canavieira Pernambucana. Procura mostrar, por um lado, a alienação e o conformismo que se expressam na dura e perversa vida de trabalho precoce, dupla jornada de trabalho e trabalho doméstico dessas meninas e mulheres. Por outro lado, valoriza outros aspectos relacionados à transgressão e resistência da cultura lúdica construídas em surdina na vida cotidiana, para além da alienação e do conformismo, a saber: o lazer/lúdico construído à revelia do sistema patriarcal e do projeto de estranhamento do trabalho capitalista no mundo rural.

Recortando e colando as imagens da vida cotidiana do trabalho e da cultura lúdica das meninas-mulheres e das mulheres-meninas da Zona da Mata Canavieira Pernambucana

Directory of Open Access Journals (Sweden)

SILVA MAURÍCIO ROBERTO DA

2002-01-01

Full Text Available Este texto trata de diversos aspectos macro e microssociais da vida cotidiana das meninas-mulheres e das mulheres-meninas da Zona na Mata Canavieira Pernambucana. Procura mostrar, por um lado, a alienação e o conformismo que se expressam na dura e perversa vida de trabalho precoce, dupla jornada de trabalho e trabalho doméstico dessas meninas e mulheres. Por outro lado, valoriza outros aspectos relacionados à transgressão e resistência da cultura lúdica construídas em surdina na vida cotidiana, para além da alienação e do conformismo, a saber: o lazer/lúdico construído à revelia do sistema patriarcal e do projeto de estranhamento do trabalho capitalista no mundo rural.

O impacto da liquidez nos retornos esperados das debêntures brasileiras

Directory of Open Access Journals (Sweden)

Bruno Hofheinz Giacomoni

2013-03-01

Full Text Available Neste trabalho, teve-se como objetivo identificar o impacto do risco de liquidez nos retornos excedentes esperados das debêntures no mercado secundário brasileiro. Foram realizadas análises de regressão em painel desbalanceado com dados semestrais de 101 debêntures ao longo de oito semestres (primeiro semestre de 2006 ao segundo semestre de 2009, totalizando 382 observações. Sete proxies (spread de compra e venda, %zero returns, idade, volume de emissão, valor nominal de emissão, quantidade emitida e %tempo foram utilizadas para testar o impacto do risco de liquidez nos yield spreads das debêntures. O yield spread foi controlado por até dez outras variáveis determinantes que não a liquidez (fator de juros, fator de crédito, taxa livre de risco, rating, duration, quatro variáveis contábeis e volatilidade de equity. A hipótese nula de que não há prêmio de liquidez para o mercado secundário de debêntures no Brasil foi rejeitada apenas para três das sete proxies (spread de compra e venda, valor nominal de emissão e quantidade emitida. Os prêmios encontrados são bastante baixos (1,9 basis point para cada 100 basis point de incremento no spread de compra e venda, 0,5 basis point para um aumento de 1% no valor do valor nominal de emissão e 0,17 basis point para cada menos 1.000 debêntures emitidas. De qualquer forma, houve perda na eficiência das proxies de liquidez após correção das autocorrelações e potenciais endogeneidades, seja por meio da inclusão de efeitos fixos, da análise de primeiras diferenças ou da utilização de um sistema de três equações. Esses resultados apontam para a suspeita de que o risco de liquidez não é um fator importante na composição das expectativas dos investidores no mercado secundário de debêntures.

Integrated project: Microbiological and physiological studies on the presence of residual concentrations in mineral-oil-contaminated soils after rehabilitation. Final report. Pt. 2; Mikrobiologische und physiologische Untersuchungen zur Frage der Restkonzentration bei der Sanierung mineraloelkontaminierter Boeden. Abschlussbericht. T. 2

Energy Technology Data Exchange (ETDEWEB)

Miethe, D.; Riis, V.; Stimming, M.

1996-01-04

der Metabolisierbarkeit und die Aufklaerung der Ursachen fuer das Verbleiben dieser Reste. In ihrer Abbaubarkeit unterscheiden sich die untersuchten Mineraloele und Restfraktionen deutlich. Mittlere Destillate koennen problemlos mit adaptierten Konsortien zu 95-97% abgebaut werden. Bei hoehersiedenden Mineraloelen (Kp>400 C) betraegt der Abbaugrad ca. 60%. Abbaugrade von 40-60% weisen die Extrakte aus Altlasten auf. Der unvollstaendige mikrobielle Abbau von Mineraloelen ist hauptsaechlich strukturbedingt. Es verbleiben chemisch und thermisch aeusserst stabile Kohlenwasserstoffe (vorwiegend aliphatische und aromatische kondensierte Ringsysteme), die nicht oder sehr schwer metabolisierbar sind. In Boeden/Altlasten spielt auch die matrixbedingte Nichtverfuegbarkeit eine wesentliche Rolle und erhoeht den Anteil des Restes. Nach Untersuchung und Darlegung der Ursachen fuer den unvollstaendigen Abbau steht die Aufgabe der Minimierung der Restkonzentrationen beim Mineraloelabbau. Sowohl spezielle Tenside als auch Hilfssubstrate koennten den Weg zeigen. Projekte dazu sind beim BMBF eingereicht. (orig.)

Dereplication, Aggregation and Scoring Tool (DAS Tool) v1.0

Energy Technology Data Exchange (ETDEWEB)

2017-03-01

Communities of uncultivated microbes are critical to ecosystem function and microorganism health, and a key objective of metagenomic studies is to analyze organism-specific metabolic pathways and reconstruct community interaction networks. This requires accurate assignment of genes to genomes, yet existing binning methods often fail to predict a reasonable number of genomes and report many bins of low quality and completeness. Furthermore, the performance of existing algorithms varies between samples and biotypes. Here, we present a dereplication, aggregation and scoring strategy, DAS Tool, that combines the strengths of a flexible set of established binning algorithms. DAS Tools applied to a constructed community generated more accurate bins than any automated method. Further, when applied to samples of different complexity, including soil, natural oil seeps, and the human gut, DAS Tool recovered substantially more near-complete genomes than any single binning method alone. Included were three genomes from a novel lineage . The ability to reconstruct many near-complete genomes from metagenomics data will greatly advance genome-centric analyses of ecosystems.

Prevalence of mabDAS-1 positivity in biopsy specimens from the esophagogastric junction

NARCIS (Netherlands)

Rogge-Wolf, Claudia; Seldenrijk, Cornelis A.; Das, Kiron M.; Timmer, Robin; Breumelhof, Ronald; Smout, André J. P. M.; Amenta, Peter S.; Griffel, Louis H.

2002-01-01

OBJECTIVE: Intestinal metaplasia (IM) is a precursor for malignancies at the esophagogastric junction. A monoclonal antibody, mAbDAS-1, can probably identify cellular characteristics of IM before the appearance of goblet cells. The aim of this study was to examine the prevalence of mAbDAS-1

Análisis del riesgo de caídas en ancianos institucionalizados mediante escalas de marcha y equilibrio

OpenAIRE

Martínez Carrasco, Ángel

2016-01-01

Introducción: Las caídas en la población mayor son un problema con graves consecuencias personales y elevados costes sociosanitarios. Las alteraciones del equilibrio se consideran riesgo de caídas en esta población. Objetivos: Determinar las pruebas de equilibrio más precisas para predecir el riesgo de sufrir caídas, cuantificar las caídas producidas durante doce meses de seguimiento y describir la incidencia y los factores de riesgo de caídas en personas que viven en residencias de mayo...

Implementing Data Acquisition Systems DAS1 and DAS2 at Cernavoda Full-Scope Simulator Main Control Room based on the SIEN2007 solution

International Nuclear Information System (INIS)

Ionescu, Ana Maria; Tutuianu, Bogdan; Ionescu, Teodor

2009-01-01

Modern personnel training, re-training and licensing is a guarantee of NPP's safe reliable operation. Cernavoda NPP personnel training system is the main objective of its specialized department built up as Training Center (TC), directly supervised by Administration of the National Nuclearelectrica Society (SNN) and National Regulatory Body for Nuclear Activities (CNCAN). It was implemented to ensure the abilities, skills and knowledge required by the safe reliable operation of the nuclear reactor by the Main Control Room (MCR) operators. This objective was reached through training lessons taught and tested on the Full Scope Simulator (FSS), the TC's main training tool, a replica of the MCR of the real plant. Its description is the subject of this paper. The TC's FSS includes a computer network equipped with a software connected to the specialized program DATAPATH supplied for Cernavoda FSS by the FSS provider, delivered by L-3/ MAPPS. An alternative to DATAPATH Communication of the L 3/MAPPS Simulation System, developed by Cernavoda Full Scope Simulator Staff, was presented in the previous edition of the symposium (see the SIEN 2007 paper). This original solution is now already applied in order to connect to simulation process Data Acquisition Systems DAS1 and DAS2, two new systems already installed in the real MCR but not included by the Cernavoda FSS initial design. Communication between simulation software and DAS1 and DAS2, considered to be simple receivers of simulated data both as much alike as the two DASs from real plant, is performed in parallel with DATAPATH in a safe mode and without affecting simulation process. This paperwork presents the above mentioned application of this communication solution, developed by the Cernavoda NPP Full Scope Simulator Staff with details about the hardware/software solutions and their performance, training impact, cost and benefits. (authors)

GenExp: an interactive web-based genomic DAS client with client-side data rendering.

Directory of Open Access Journals (Sweden)

Bernat Gel Moreno

Full Text Available BACKGROUND: The Distributed Annotation System (DAS offers a standard protocol for sharing and integrating annotations on biological sequences. There are more than 1000 DAS sources available and the number is steadily increasing. Clients are an essential part of the DAS system and integrate data from several independent sources in order to create a useful representation to the user. While web-based DAS clients exist, most of them do not have direct interaction capabilities such as dragging and zooming with the mouse. RESULTS: Here we present GenExp, a web based and fully interactive visual DAS client. GenExp is a genome oriented DAS client capable of creating informative representations of genomic data zooming out from base level to complete chromosomes. It proposes a novel approach to genomic data rendering and uses the latest HTML5 web technologies to create the data representation inside the client browser. Thanks to client-side rendering most position changes do not need a network request to the server and so responses to zooming and panning are almost immediate. In GenExp it is possible to explore the genome intuitively moving it with the mouse just like geographical map applications. Additionally, in GenExp it is possible to have more than one data viewer at the same time and to save the current state of the application to revisit it later on. CONCLUSIONS: GenExp is a new interactive web-based client for DAS and addresses some of the short-comings of the existing clients. It uses client-side data rendering techniques resulting in easier genome browsing and exploration. GenExp is open source under the GPL license and it is freely available at http://gralggen.lsi.upc.edu/recerca/genexp.

Recovery from Hospital-Acquired Anemia after Acute Myocardial Infarction and Effect on Outcomes

OpenAIRE

Salisbury, Adam C.; Kosiborod, Mikhail; Amin, Amit P.; Reid, Kimberly J.; Alexander, Karen P.; Spertus, John A.; Masoudi, Frederick A.

2011-01-01

New onset, hospital-acquired anemia (HAA) during acute myocardial infarction (AMI) is independently associated with poor outcomes. Patterns of recovery from HAA after AMI and their association with mortality and health status are unknown. In the prospective 24-center TRIUMPH registry, we identified 530 AMI patients with HAA (defined as normal hemoglobin at admission with development of anemia by discharge) who had repeat, protocol-driven hemoglobin measurement 1 month after discharge. The 1-m...

A perspectiva das crianças sobre questões de gênero na escola

Directory of Open Access Journals (Sweden)

Freire, Sandra Ferraz de Castillo Dourado

2009-01-01

Full Text Available Investigamos as concepções das crianças sobre as relações de gênero e sobre as funções da avaliação na experiência escolar. Com base na abordagem sociocultural construtivista, objetivamos identificar aspectos semióticos de ordem da cultura na narrativa das crianças de forma a compreender a construção as relações de gênero na escolarização. Observamos duas sessões de grupo focal, uma com quatro meninos e outra com cinco meninas de quarta série. Utilizamos uma metodologia qualitativa interpretativa para análise das interações comunicativas. Verificamos que as relações de poder entre os gêneros aparecem já com bastante clareza na narrativa das crianças mediante articulação da cultura coletiva, como a naturalização da violência, a associação do universo feminino à esfera doméstica e do universo masculino à esfera pública e a negociação recíproca das posições assimétricas de controle e vitimização. Entretanto, verificamos que essa relação aparece apenas em parte quando se referem ao contexto escolar, à situações de aprendizagem e avaliação, narrando experiências de igualdade de tratamento e expectativas, especialmente por parte das professoras

Violência e sofrimento social: a resistência feminina na obra de Veena Das Violence and Social Suffering: women's resistance in Veena Das' works

Directory of Open Access Journals (Sweden)

João Eduardo Coin de Carvalho

2008-09-01

Full Text Available O sofrimento social vem sendo discutido por pesquisadores brasileiros em diferentes contextos, normalmente associado às populações socialmente excluídas, vítimas de violência e da miséria crônica, com atenção especial para sua repercussão nos corpos de mulheres e crianças. Neste trabalho discute-se o conceito de sofrimento social, que tem como referência a Antropologia Médica a partir dos trabalhos da antropóloga indiana Veena Das, buscando diálogo com questões de gênero e saúde em nosso meio. A importância dessas concepções é investigada nos trabalhos de Das sobre a resistência do feminino no imaginário e no cotidiano, nos quais esta resistência aos discursos hegemônicos em meio à violência e ao sofrimento social se apresenta de maneira sutil nos usos cotidianos dos corpos. Concluindo, a posição sobre a resistência feminina na perspectiva de Veena Das pode ser útil para estudos e intervenções no campo da saúde, realizados com mulheres brasileiras de populações em situação de miséria crônica em contextos de sofrimento e exclusão social. A escuta de mulheres jovens e pobres a respeito da maneira como (não dirigem seus destinos e elaboram projetos de vida, aponta para a possibilidade de investigar fenômenos que remetem aos mesmos cenários descritos por Das. A busca de sua inserção em movimentos imaginários que se materializam em suas falas e nos usos e cuidados com seus corpos pode ser decisiva para, em contextos de promoção de saúde, dar entendimento e intervir sobre processos que parecem sem sentido, mas que guardam na sua incompletude e incerteza a marca indelével do humano.Social suffering has been studied in several circumstances by Brazilian researchers, usually associated with socially excluded people who are victims of violence and chronic poverty. Special attention has been given to its effects on women's and children's bodies. In this work, we deal with the Medical Anthropology concept

Effect of cooking methods on the formation of heterocyclic aromatic amines in chicken and duck breast.

Science.gov (United States)

Liao, G Z; Wang, G Y; Xu, X L; Zhou, G H

2010-05-01

Heterocyclic aromatic amines (HAAs), potent mutagens/carcinogens, are pyrolysis formed during the cooking of meat and fish. In the present study, the effects of various cooking methods, pan-frying, deep-frying, charcoal grilling and roasting on the formation of HAAs in chicken breast and duck breast were studied. The various HAAs formed during cooking were isolated by solid-phase extraction and analyzed by high-performance liquid chromatography (HPLC). Results showed that chicken breast cooked by charcoal grilling contained the highest content of total HAAs, as high as 112 ng/g, followed by pan-fried duck breast (53.3 ng/g), charcoal grilled duck breast (32 ng/g), pan-fried chicken breast (27.4 ng/g), deep-fried chicken breast (21.3 ng/g), deep-fried duck breast (14 ng/g), roasted duck breast (7 ng/g) and roasted chicken breast (4 ng/g). For individual HAA, the most abundant HAA was 9H-pyrido-[4,3-b]indole (Norharman), which was detected in charcoal grilled chicken breast at content as high as 32.2 ng/g, followed by 1-methyl-9H-pyrido[4,3-b] indole (Harman) and 2-amino-1-methyl-6-phenylimidazo[4,5-f]pyridine(PhIP) at 32 and 31.1 ng/g in charcoal grilled chicken breast, respectively. The content of PhIP in pan-fried duck and chicken breast were 22 and 18.3 ng/g, respectively. Generally, the type and content of HAAs in cooked poultry meat varies with cooking method and cooking conditions. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

CONSIDERAÇÕES A RESPEITO DA DISTRIBUIÇÃO DAS PLANÍCIES FLUVIAIS DO RIO MOGI GUAÇU

Directory of Open Access Journals (Sweden)

Márcio Henrique de Campos Zancopé

2006-11-01

Full Text Available Este artigo apresenta a distribuição das larguras das planícies fluviais do Rio Mogi Guaçu, localizado na Região NE do Estado de São Paulo (SE Brasileiro e sua relação com a distribuição das estruturas geológicas e litologias da bacia hidrográfica. As larguras das planícies do Rio Mogi Guaçu são ajustadas para escoar sobre estruturas geológicas e litologias diferentes. Em sistemas fluviais como o Rio Mogi Guaçu, a distribuição das planícies e suas dimensões no perfil longitudinal sofrem influência das estruturas geológicas e litologias, por meio das modificações nas características do transporte da carga detrítica, do gradiente e do nível de base, bem como do ajuste ás magnitudes e frequências dos fluxos.

'Lager, lager shouting': the role of music and DJs in nightclub disorder control.

Science.gov (United States)

Forsyth, Alasdair J M

2009-01-01

This paper explores how music and music genre can govern the nightlife experience, specifically how a nightclub's music policy can impact on clientele, health behaviours, bar sales and levels of disorder. Participant observations were conducted in sample of eight city centre nightclubs in Glasgow, Scotland. Music policy was found to influence nightclubs' clientele and their behaviours, for example in relation to differences in levels of alcohol or illegal drug use, sexual activity and violence between venues. Further, within individual venues, music policy was also observed operating as a crowd control tool, with for example such entertainment being used in alcohol marketing, in 'soft policing' and in the temporal management of patrons' movements. This research acknowledges the centrality of the DJ in implementing these controls. It is clear that music is a central component of the Nighttime Economy. Despite this, to date music has tended to play 'second fiddle' to sex and drugs within Club Health research. From this research it is recommended that music policy be incorporated into responsible bar server training packages.

Performance of broiler chickens fed diets containing DAS-68416-4 soybean meal.

Science.gov (United States)

Herman, Rod A; Dunville, Christina M; Juberg, Daland R; Fletcher, Dale W; Cromwell, Gary L

2011-01-01

Broiler chickens are a fast growing monogastric animal commonly used to evaluate the equivalence between transgenic and non-transgenic grains as part of the human safety assessment process. While commonly viewed like other livestock feeding trials, such studies are performed with transgenic crops with input traits (that are not designed to improve nutrition) to aid regulatory authorities in evaluating safety. Studies of this type are actually more similar to toxicology studies in purpose, with sensitive endpoints like growth used to detect metabolic perturbations. DAS-68416-4 soybean expresses the aryloxyalkanoate dioxygenase-12 (AAD-12) enzyme which inactivates 2,4-diclorophenoxyacetic acid (2,4-D) and provides DAS-68416-4 soybeans tolerance to this herbicide. DAS-68416-4 also expresses the phosphinothricin acetyltransferase (PAT) enzyme from Streptomyces viridochromogenes which confers tolerance to glufosinate-ammonium herbicides. A 6-week broiler study was conducted with diets containing toasted DAS-68416-4 soybean meal (40, 36, and 32% in starter, grower and finisher diets, respectively) to evaluate nutritional wholesomeness and safety compared with conventional comparators. Toasting soybean meal is required to inactivate endogenous antinutrients making soybean suitable for consumption by monogastric animals like broiler chickens. Toasting was found to denature both the AAD-12 and PAT proteins rendering them non-detectable by enzyme linked immunosorbent assays. Broiler growth and performance parameters were measured over a 6-week period of exposure to diets containing different sources of toasted soybean meal, and results indicate that DAS-68416-4 soybean is nutritionally equivalent to non-transgenic soybean.

Preditores das atitudes negativas face ao envelhecimento e face à sexualidade na terceira idade

OpenAIRE

Pereira, Diane; Ponte, Filomena; Costa, Eleonora

2018-01-01

Este estudo analisou as diferenças entre jovens e idosos ao nível das atitudes e dos conhecimentos face ao envelhecimento e face à sexualidade na terceira idade, a relação entre as variáveis em estudo, e os preditores das atitudes negativas face ao envelhecimento e das atitudes negativas face à sexualidade na terceira idade. Cento e cinquenta e três jovens universitários e 42 idosos participaram no estudo. Os resultados indicaram que os jovens apresentam um menor nível de conhecimentos acerca...

Datta-Das-type spin-field-effect transistor in the nonballistic regime

OpenAIRE

Ohno, Munekazu; Yoh, Kanji

2008-01-01

We analyzed the applicability of original Datta-Das proposal for spin-field-effect transistor (spin-FET) to nonballistic regime based on semiempirical Monte Carlo simulation for spin transport. It is demonstrated that the spin helix state in two-dimensional electron gas system is sufficiently robust against D'yakonov-Perel' spin relaxation to allow an operation of Datta-Das-type spin-FET in the nonballistic transport regime. It is also shown that the spin diffusion length of the spin helix st...

Das Selenoproteom des Malariaerregers Plasmodium falciparum

OpenAIRE

Röseler, Anne

2010-01-01

Die Protozoen des Genus Plasmodium verursachen weltweit rund 247 Millionen Malariafälle jedes Jahr. Da der Malariaparasit schnell und effektiv Resistenzen gegen neue Antimalaria-Medikamente entwickelt, ist es notwendig, stets innovative Wirkstoffe zu finden. Dabei spielen das Verständnis der grundlegenden Stoffwechselfunktionen und die Entdeckung neuer potenzieller drug targets wichtige Rollen in der präklinischen Forschung. Während ihrer Lebensphasen in menschlichen Erythrozyten und dem ...

Das Reflektierende Team

DEFF Research Database (Denmark)

Gaarden, Marianne; Lorensen, Marlene Ringgaard

2015-01-01

Jüngere empirische Forschung dazu, wie Predigthörende Predigten wahrnehmen und mit ihnen interagieren, deutet darauf hin, dass Predigende als Gesprächspartner und als theologischer Spiegel der Gemeinde wahrgenommen werden. Die Gemeinde gelangt im Dialog mit den Worten der Predigt zu eigenen...... Bedeutungszuschreibungen. Marianne Gaardens Forschung zeigt, dass zwischen Predigenden und Hörenden ein ›dritter Raum‹ entsteht, wie sie das nennt. Dabei handelt es sich um einen liminalen, rituell konturierten Raum, in dem Hörende Predigtelemente rezipieren und in ihre eigenen gelebten Erfahrungen einbauen. Komplementär...... die Wahrnehmung der Predigt als eines dialogischen Geschehens – und zwar von der Predigtvorbereitung über die Interaktion mit Hörenden und anschließende Rückmeldungen bis hin zu Umarbeitungen und Überlegungen für die nächsten Predigt. Die Methode geht davon aus, dass einzelne Subjekte Teil einer...

A China na ordem ambiental internacional das mudanças climáticas

Directory of Open Access Journals (Sweden)

HELENA MARGARIDO MOREIRA

Full Text Available resumo As mudanças climáticas são consideradas um dos grandes desafios globais do século XXI. A China, como ator global e principal emissor de gases de efeito estufa, é um país-chave na política climática internacional. Sua posição é fundamental para o desenho do acordo futuro que substituirá o Protocolo de Kyoto e que regulará a ação humana sobre o sistema climático terrestre, dando continuidade ao conjunto de decisões internacionais que formam a ordem ambiental internacional das mudanças climáticas. Atendo-se à defesa do princípio das "responsabilidades comuns, porém diferenciadas", a China vem construindo seu posicionamento como um dos protagonistas dessa ordem desde o seu início, com a assinatura da Convenção do Clima em 1992. Este artigo parte do argumento de que a postura chinesa nas negociações internacionais sobre mudanças climáticas, apesar de muito participativa e fundamental para o encaminhamento das decisões globais sobre o tema, é definida em termos do interesse desenvolvimentista do Estado chinês. Durante as negociações das Conferências analisadas, a China agiu como liderança do G77 e em defesa dos seus próprios interesses, buscando garantir as responsabilidades diferenciadas e a classificação da China como país em desenvolvimento, evitando comprometer seus objetivos domésticos de desenvolvimento econômico. A última Conferência do Clima, em Lima, 2014, manteve o princípio das responsabilidades diferenciadas reforçando o interesse chinês, ainda que tenha estabelecido que todos os países apresentem metas voluntárias de redução das emissões.

Das Widerspenstige bändigen

OpenAIRE

Ittner, Helmut

2016-01-01

Dem Handeln von Lehrkräften wird in der schulischen Praxis wie in der wissenschaftlichen Literatur ein wesentlicher Einfluss auf die Qualität von schulischem Unterricht zugesprochen. Auch wenn umfangreiche normative Vorstellungen über ein gutes Lehr-Handeln bestehen, so gibt es wenig Erkenntnis darüber, welche Gründe Lehrkräfte für ihr pädagogisches Handeln haben. Das Handeln von Lehrkräften kann nur dann adäquat erfasst werden, wenn Bildung einerseits als Weitergabe von Kultur an die nachfol...

Das politische Internet - Möglichkeiten und Grenzen

Directory of Open Access Journals (Sweden)

Heinz Moser

2011-11-01

Full Text Available Das Internet und die Möglichkeiten, die sich mit Social Communities wie Facebook für die Zukunft einer stärker partizipativ ausgerichteten Demokratie ergeben, beschäftigt die politischen Debatten immer häufiger. Der Buchstaben «e» spiegelt dabei die Verheissungen dieser neuen Politik: e-Government, e-Participation und e- Demokratie sind Begriffe, die zu klären und daraufhin zu untersuchen sind, inwieweit die Bürgerpartizipation dadurch bei der jungen Generation eine neue Qualität erhält. Nachdem die digitalen Medien nicht nur in der arabischen Welt jüngere Menschen politisch zu mobilisieren imstande sind, stellt sich die Frage, ob sich mit diesen neuen Mitteln partizipative Interessen jenseits der etablierten Institutionen der Politik auf neue Weise artikulieren können – dies nicht zuletzt auch über Veränderungen in der Sphäre des Politischen selbst. Der vorliegende Aufsatz nimmt die Diskussion um das politische Internet auf und illustriert die damit verbundenen Fragestellungen im Rahmen einer empirischen Untersuchung zu politischen Gruppen aus der Schweiz, die sich auf Facebook gebildet haben.

OCORRÊNCIA E DURAÇÃO DAS TEMPERATURAS MÍNIMAS DIÁRIAS DO AR PREJUDICIAIS À FECUNDAÇÃO DAS FLORES DO ARROZ EM SANTA MARIA. RS. III: PROBABILIDADES DE OCORRÊNCIA DA DURAÇÃO DAS TEMPERATURAS BAIXAS

Directory of Open Access Journals (Sweden)

Flávio Miguel Schneider

1992-04-01

Full Text Available Utilizando os valores das temperaturas mínimas, máximas e das 21 h, hora local, dos meses de dezembro, janeiro, fevereiro e março registradas na Estação Climatológica Principal de Santa Maria, RS, determinaram-se as probabilidades de ocorrência da duração máxima de horas com temperatura do ar ≤ 10, 11, 12, 13, 14, 15, 16 e 17,0°C e de seqüências de dias consecutivos com no mínimo uma hora de duração com temperatura do ar ≤ 15, 16 e 17,0°C. Essas probabilidades foram obtidas para cada decêndio dos meses estudados. Os resultados evidenciam que o risco de ocorrência de temperaturas prejudiciais à fecundação das flores da cultura do arroz é bem menor no 2° e 3° decêndio do mês de fevereiro. Deve-se, portanto, semear e/ou escolher ciclo de cultivar de arroz que possibilite que a fase de floração ocorra durante o 2° e 3° decêndio do mês de fevereiro.

Poznaniu predchádza porozumenie (Der Erkenntnis geht das Verständnis voran

Directory of Open Access Journals (Sweden)

Jana Tomašovičová

2007-12-01

Full Text Available In diesem Beitrag deuten wir nach der Parmenides Inspiration zwei Wege der menschlichen Wanderung zur Wahrheit an. In Denkensgeschichte war ein Weg der begründeten Erkenntnis bevorzugt, auf dem wir gerade das aussuchen, was als haltbar im Änderungsprozess überdauert. Auf diesem Weg können wir ein souveränes denkendes Subjekt treffen, das wegen seiner Rationalität ein fester Grund beim Erkennen der Welt geworden ist. Am Anfang des 20. Jahrhunderts hat Martin Heidegger darauf hingewiesen, dass im altäglichen Leben unserer Erkenntnis das Verständnis dessen vorangeht, was wir besorgen. Heidegger hat also einen anderen Weg auserwählt, auf dem er bemerkt, dass für einen Mensch eher als seine Rationalität das Abfinden mit seiner faktischen Existenz charakteristisch ist. Heideggers Dasein ist nicht mehr ein Souverän, sondern eine Existenz, die sich um Seinsverständnis bemüht. Ungefähr ab 1930 finden wir eine Kehre im Heideggers Denken. Er sucht einen neuen Weg, auf dem er eine Ek-sistenz vorstellen will.

Reflexões sobre o estatuto epistemológico das CSH: uma revisão das categorias verdade, sujeito e subjetividade

Directory of Open Access Journals (Sweden)

Pamella Rochelle Oliveira

2015-12-01

Full Text Available O presente ensaio teórico tem como objetivo discutir o conceito de verdade com ênfase nas obras de Friedrich Nietzsche e Michel Foucault, percebendo a temática como um dos conceitos chaves para se pensar o estatuto epistemológico das Ciências Sociais e Humanas (CSH na atualidade, já que o mesmo se faz intrinsicamente ligado a condições de possibilidades dadas, incidindo por sua vez na questão da produção de subjetividades, bem como do próprio sujeito, na medida em que estes são produzidos a partir e numa teia de relações invisíveis pautada em jogos de verdades e relações de poder. Para tanto, optamos num primeiro momento por realizar uma breve discussão acerca dos principais conflitos epistemológicos no campo das CSH, entre eles a antiga dualidade entre individuo x social, bem como a questão de causa e feito.

Das fantasias vazias ao referencial discursivo

Directory of Open Access Journals (Sweden)

Ricardo Salztrager

2008-06-01

Full Text Available Pretende-se analisar o estatuto de uma modalidade peculiar de fantasmatização para a qual propomos o nome de 'fantasias vazias'. No campo das fantasias vazias, a ambigüidade e a polissemia das palavras são postas de lado e seus enunciados se tornam absolutos e unívocos, de modo a anularem quaisquer possibilidades metafóricas ou simbólicas. Investigamos os limites que as fantasias em questão impõem à teoria do significante, propondo, em seguida, concebê-las como uma escritura balizada por uma série de elementos que denominamos 'referenciais discursivos'.From empty fantasies to dissertational reference. The purpose of the article is to analyze the state of a peculiar modality of fantasizing which we have named empty fantasies. Thus, in the field of empty fantasies, the ambiguity and the multiple meaning of the words are put aside and, for that reason, their statement becomes obsolete and univocal, in a way that they eliminate any metaphoric or symbolic possibilities. We investigate the limits that those fantasies impose to the theory of the signifier, proposing, then, to conceive them as a writing delimitated by a series of elements that we have called discourse references.

Análise sociométrica da rede de relacionamento das bibliotecas que constituem o Consórcio das Universidades Federais do Sul-Sudeste de Minas Gerais

Directory of Open Access Journals (Sweden)

Nivaldo Oliveira

Full Text Available O objetivo deste trabalho foi identificar a estrutura da rede de relacionamentos das Bibliotecas que constituem o Consórcio das Universidades Federais do Sul-Sudeste de Minas Gerais e verificar quais instituições se mostram mais centrais na estrutura de relacionamentos. Para isto, foi adotada a metodologia de estudo de caso, considerando abordagens qualitativas (aspectos relacionais e quantitativas (indicadores estruturais, com auxílio dos softwares Ucinet® e Netdraw®, para a elaboração das matrizes sociométricas, proporcionando análises de centralidade de cada ator na rede, a presença de laços fracos/fortes e a existência de buracos estruturais na rede. Como resultado de pesquisa, foi evidenciada grande centralidade da UFJF e UFV, o que representa uma posição favorável para a busca e trocas de informações com melhores condições para gerar inovação na rede.

A imagem das adolescentes na web: a busca pela corporeidade espetacular

OpenAIRE

Almeida, Mariane Tojeira Cara

2013-01-01

Desde meados do século XX, as adolescentes utilizam os recursos da comunicação interpessoal mediada com fins de sociabilidade, tendo como primeiro meio o telefone fixo, que perdurou até o final dos anos 1990. No início do século XXI, com o advento das redes sociais, a invisibilidade corporal da telefonia fixa foi suplantada pela extra-visibilidade das fotografias digitais postadas em páginas pessoais. Trata-se de imagens detalhadamente trabalhadas para apresentarem uma corpo...

Das Prinzip Bewegung - Herz und Gehirn als Metaphern des menschlichen Lebens

Science.gov (United States)

Otis, Laura

In diesem Jahr, in dem wir Charles Darwins gedenken, möchte ich etwas riskieren und eine Frage erörtern, die für die Literatur ebenso wie für die Biologie zentral ist: Was ist das Leben? Die Antwort auf diese Frage finden wir nicht in der Bibliothek und nicht im Labor, zumindest nicht an diesen erkenntnisproduzierenden Stellen allein. Als Literaturwissenschaftlerin und ehemalige Naturwissenschaftlerin glaube ich, dass wir das Leben nur verstehen werden, wenn wir seinen Wirkungen überall nachforschen, inklusive in der Literatur.

Review Essay: Das dialogische Selbst zwischen simultaner Pluralität und Halt verleihenden Sprachpraktiken

Directory of Open Access Journals (Sweden)

Marie-Cécile Bertau

2015-09-01

Full Text Available "Das dialogische Selbst" von Frank-M. STAEMMLER ist ein wichtiger Beitrag zu einem dialogischen Menschenbild, das von verschiedenen Seiten als Alternative zur methodologischen Individualismus formuliert wird. Der Zusammenhang zwischen einer dialogischen Theorie des Selbst und konkreten therapeutischen Techniken wird einleuchtend hergestellt; klar wird dabei, dass dialogisches Denken eine Herausforderung an tradierte Denkmuster ist. Es sabotiert die Denkfigur der "abgelösten Vorgängigkeit" (BERTAU 2015 (von "Ich", "Selbst" zugunsten des je tatsächlichen Geschehens. Allerdings können Pluralität und Dynamik, Performativität und Gegenwärtigkeit des Geschehens ihrerseits nicht beliebig sein und bloß emergent, sie erfahren vielmehr eine Struktur, ohne die sie nicht (wieder- erkennbar wären. Wie das Verhältnis von Geschehen und Struktur zu denken ist, scheint mir eine der Kernfragen des dialogischen Denkens zu sein. Nach einer formalen Betrachtung und inhaltlichen Übersicht des Buchs diskutiere ich diese Frage entlang STAEMMLERs eigenen Ideen über zwei Themen: Pluralität und Sprache. Das Verhältnis von Geschehen und Struktur ist demnach über die sprachliche Form in der Zeit, über die Zeit, zu denken. Angeredetwerden von einem "Du", das immer auch das allgemeine "Man" (oder "Wir" stellvertritt, verleiht dem "Ich" als dialogischem Selbst Stabilität in der Vielfalt. Der Schritt zur Öffnung der Intersubjektivität ins Öffentliche wird damit als notwendiges Moment zur Überwindung des Individualismus angesehen. URN: http://nbn-resolving.de/urn:nbn:de:0114-fqs1503298

DasR is a pleiotropic regulator required for antibiotic production, pigment biosynthesis, and morphological development in Saccharopolyspora erythraea.

Science.gov (United States)

Liao, Cheng-Heng; Xu, Ya; Rigali, Sébastien; Ye, Bang-Ce

2015-12-01

The GntR-family transcription regulator, DasR, was previously identified as pleiotropic, controlling the primary amino sugar N-acetylglucosamine (GlcNAc) and chitin metabolism in Saccharopolyspora erythraea and Streptomyces coelicolor. Due to the remarkable regulatory impact of DasR on antibiotic production and development in the model strain of S. coelicolor, we here identified and characterized the role of DasR to secondary metabolite production and morphological development in industrial erythromycin-producing S. erythraea. The physiological studies have shown that a constructed deletion of dasR in S. erythraea resulted in antibiotic, pigment, and aerial hyphae production deficit in a nutrient-rich condition. DNA microarray assay, combined with quantitative real-time reverse transcription PCR (qRT-PCR), confirmed these results by showing the downregulation of the genes relating to secondary metabolite production in the dasR null mutant. Notably, electrophoretic mobility shift assays (EMSA) showed DasR as being the first identified regulator that directly regulates the pigment biosynthesis rpp gene cluster. In addition, further studies indicated that GlcNAc, the major nutrient signal of DasR-responsed regulation, blocked secondary metabolite production and morphological development. The effects of GlcNAc were shown to be caused by DasR mediation. These findings demonstrated that DasR is an important pleiotropic regulator for both secondary metabolism and morphological development in S. erythraea, providing new insights for the genetic engineering of S. erythraea with increased erythromycin production.

Negociações sociais para melhoria das condições de trabalho no setor de teleatendimento: o descompasso entre a posição das empresas e a realidade do trabalho

Directory of Open Access Journals (Sweden)

Airton Marinho Silva

2005-12-01

Full Text Available Estudou-se a interação entre empresas de teleatendimento ("telemarketing", órgãos públicos interessados em saúde dos trabalhadores, assessorados por pesquisadores universitários, e entidade sindical de telefonistas, apresentando o descompasso entre as medidas tomadas pelas empresas para enfrentar os problemas de saúde dos trabalhadores e a realidade do trabalho. Partindo das manifestações desses atores em inquérito do Ministério Público do Trabalho e de estudos bibliográficos sobre o adoecimento de teleatendentes, analisam-se as posições das empresas em relação aos riscos gerados pelo trabalho em teleatendimento. Conclui-se, baseando-se nas manifestações empresariais, que existe uma posição de negação dos fatores de risco para adoecimento ocupacional dos teleatendentes e, ao mesmo tempo, de enfrentamento das exigências do setor público de proteção ao trabalho, evidenciando insuficiência das ações dos trabalhadores e limites do poder público nesse campo.

Bromine incorporation into five DBP classes upon chlorination of water with extremely low SUVA values.

Science.gov (United States)

Hong, Huachang; Yan, Xiaoqing; Song, Xuhui; Qin, Yanyan; Sun, Hongjie; Lin, Hongjun; Chen, Jianrong; Liang, Yan

2017-07-15

The main objective of this study was to assess the effects of disinfection conditions on bromine incorporation into disinfection by-products (DBPs) during chlorination of water with low specific UV absorbance (SUVA). Five classes of DBPs were included: trihalomethanes (THMs), dihaloacetic acids (di-HAAs), trihaloacetic acids (tri-HAAs), dihaloacetonitriles (DHANs) and trihalonitromethanes (THNMs). Results showed that the bromine utilization in DBPs formation was positive related with reaction time, pH and temperature. On the other hand, the bromine substitution factors (BSFs) of DBPs were generally increased with pH (except tri-HAAs) and bromide concentration, but decreased with the reaction time, temperature and chlorine dose. Moreover, the BSFs values varied with DBP classes with the ranking being as following: THNMs≫DHANs≫tri-HAAs>THM≈di-HAAs. These results were mostly similar with the references, yet the pH effect on BSFs as well as the rank of BSFs for different DBP classes may differ with the specific UV absorbance of organic matter. Copyright © 2017 Elsevier B.V. All rights reserved.

O RETORNO POR EMPREGADO COMO INDICADOR DE DESEMPENHO DAS EMPRESAS

Directory of Open Access Journals (Sweden)

Francisca Soraia Ferreira Leite

2013-12-01

Full Text Available Com as transformações no ambiente de negócios, os ativos intangíveis, potencialmente gerados pelo capital intelectual, ganharam importância. Este estudo tem como objetivo analisar e testar uma métrica alternativa de avaliação de desempenho que leva em conta os recursos humanos da empresa: o Retorno por Empregado (RE. Uma pesquisa exploratória foi realizada através do estudo de caso de três empresas com ações negociadas na BM&FBOVESPA no período 2006-2009. A partir das demonstrações financeiras das empresas, foram medidos seus desempenhos pelas métricas tradicionais, Retorno sobre Ativo e Retorno sobre Patrimônio Líquido, e pelo RE. O valor das ações de cada empresa foi usado como referência para criação de valor. Um estudo empírico complementar apontou que a correlação entre o RE e o preço das ações foi mais alta e significativa do que a correlação entre os indicadores tradicionais para a empresa mais intensiva em capital intelectual. Para as empresas intensivas em capital físico e em mão de obra, os indicadores de desempenho tradicionais apresentaram correlação mais alta. Sugere-se que a métrica alternativa seja um importante índice para empresas intensivas em capital intelectual. Reforça-se que tal medida de desempenho corporativo, que incorpora o efeito da força de trabalho intelectual, é uma contribuição importante à literatura sobre intangíveis.

Transferential Memory Spaces in Gisela Heidenreich’s Das endlose Jahr

Directory of Open Access Journals (Sweden)

Amila Becirbegovic

2018-03-01

Full Text Available What does it mean to be German after Hitler and National Socialism? Gisela Heidenreich’s memoir Das endlose Jahr: Die langsame Entdeckung der eigenen Biographie—ein Lebensborn Schicksal (The Endless Year: The Slow Discovery of My Own Biography—A Lebensborn Destiny, 2002, highlights the dependence on physical markers and monuments in understanding one’s place in history. Heidenreich discovers her origin as a Lebensborn child through family secrets, but it is not until she traverses the landscape of her past that she truly begins to understand her place within history. I argue that, along with family photographs and narratives, places play an integral role in the identity process through the metaphor of the palimpsest. In Heidenreich’s memoir, the German notion of Heimat reveals itself as a process, rather than a static and immovable space. Das endlose Jahr addresses the interplay between memory, places, and space through Heidenreich’s complex relationship with her mother, and her ambivalent sense of belonging through the palimpsest markers that remain. At its core, Das endlose Jahr is a memoir about the search for Heimat in all the wrong places.

pH modulates arsenic toxicity in Bacillus licheniformis DAS-2.

Science.gov (United States)

Tripti, K; Shardendu

2016-08-01

The toxic characteristics of arsenic species, As(V) and As(III) result in ecological risks. Arsenic tolerant bacterium was isolated and identified as the Bacillus licheniformis DAS-2 through 16SrDNA sequencing. B. licheniformis DAS-2 was efficient to tolerate and remove both the As(V)[MIC 8mM] and As(III)[MIC 6mM] from the growth medium. The potential for the removal/uptake of arsenic from the 3, 5 and 7mM As(V) enriched growth media was 100%, 60% and 35% respectively and from the 1, 3 and 5mM As(III) enrichment it was 100%, 99% and 58% respectively at neutral pH. 80% of uptake As(V) was reduced to As(III) in 3mM As(V) enrichment which was gradually decreased to only 17% at 7mM As(V) enrichment at neutral pH. The arsenic toxicity in B. licheniformis DAS-2 was found modulated by pH and was examined through alteration in growth, uptake/removal, reduction and measurement of chemical toxicity. Copyright © 2016 Elsevier Inc. All rights reserved.

Responsabilidade Social das empresas: a contraface da sociedade civil e da cidadania

Directory of Open Access Journals (Sweden)

Simionatto, Ivete

2006-01-01

Full Text Available O artigo tem como objeto o estudo das mudanças que vêm ocorrendo nas relações entre Estado e sociedade civil e sua manifestação específica nas propostas articuladas em torno da responsabilidade social das empresas. Parte-se da hipótese de que estas práticas vêm contribuindo para a formação de consensos que fortalecem a hegemonia do capital na atualidade, mediante a redução do papel do Estado e o fortalecimento da esfera privada como setor de regulação social. Este cenário indica mudanças nas relações entre Estado e sociedade civil, uma vez que a responsabilidade social das empresas manifesta-se como uma nova proposta de sociabilidade e de resposta às expressões da questão social. Por fim, identifica-se que os serviços sociais oferecidos através da responsabilidade social fortalecem o campo do voluntariado, da solidariedade e das instituições do terceiro setor, precarizam o trabalho do Assistente Social com rebatimentos na esfera da cidadania e dos demais valores e princípios que sustentam o projeto ético-político da profissão

Teias de um Observatório para a saúde das populações do campo, da floresta e das águas no Brasil

Directory of Open Access Journals (Sweden)

Fernando Ferreira CARNEIRO

2014-06-01

Full Text Available A Política Nacional de Saúde Integral das Populações do Campo, da Floresta e das Águas reconhece a dívida histórica do Estado brasileiro com a saúde dessas populações, apresenta a necessidade de superação do modelo de desenvolvimento econômico e social na busca de relações homem–natureza responsáveis e promotoras da saúde. Como fruto da implantação dessa política, pensando no seu monitoramento e avaliação, estruturou-se em 2012 um Observatório denominado OBTEIA. Objetiva-se apresentar a experiência desse Observatório, focando o seu processo metodológico e nos principais resultados. Este Observatório vem sendo estruturado a partir da criação de uma Teia de Saberes e Práticas, que envolve movimentos sociais, academia e gestoras(es/trabalhadoras(es do Sistema Único de Saúde. O foco das ações tem sido o de visibilizar essa população por meio de um portal interativo na internet (www.saudecampofloresta.unb.br, coleta e processamento de informações, notícias, estudos, vídeos, cadernos, bem como promover o debate acerca de referenciais críticos e métodos de pesquisa coerentes com o modo de viver dessas populações. Essa experiência vem possibilitando o envolvimento de distintos grupos e seu reconhecimento político dessa ferramenta como estratégia de fortalecimento e melhoria da produção de informações capazes de disparar ações e decisões focadas nas populações do campo, da floresta e das águas.

Estratégias e instrumentos de redução das desigualdades regionais: um breve levantamento das políticas regionais em marcha na última década

Directory of Open Access Journals (Sweden)

Carolina Simões Galvanese

2015-01-01

Full Text Available As desigualdades regionais foram, durante muito tempo, alvo de iniciativas governamentais voltadas a seu enfrentamento. Contudo, os debates internacionais vêm apontando, nos últimos anos, uma alteração no foco das políticas regionais: de uma lógica redistributiva de apoio a regiões atrasadas para uma lógica de aprimoramento da competitividade econômica de regiões avançadas nos mercados globais. O presente artigo apresenta o início de um levantamento bibliográfico sobre as políticas em marcha, buscando entender em que medida, no amplo leque de estratégias existentes, essa mudança de orientação das intervenções públicas vem acontecendo em diferentes países e quais os seus limites, diante do aprofundamento recente das desigualdades regionais em grande parte dos casos observados.

Samuel Barnsley Pessoa e os determinantes sociais das endemias rurais

Directory of Open Access Journals (Sweden)

Gilberto Hochman

2015-02-01

Full Text Available O artigo analisa os principais aspectos da trajetória, das ideias e da atuação acadêmica e política de Samuel Barnsley Pessoa (1898-1976. Indica que a atuação de Samuel Pessoa deve ser compreendida também a partir da sua militância comunista e ressalta que uma das contribuições originais de seus trabalhos foi o estabelecimento da relação entre estrutura agrária e endemias rurais, entre latifúndio e doença e a adesão a um projeto de transformação da sociedade brasileira.

Agroecologia: Potencializando os papéis das mulheres rurais

Directory of Open Access Journals (Sweden)

Fabiana da Silva Andersson

2017-04-01

Full Text Available O artigo analisa se e como a agroecologia potencializa os papéis das mulheres rurais, em sua maioria agricultoras, dos municípios de Arroio do Padre e São Lourenço do Sul (RS. Através da realização de entrevistas em profundidade e da observação participante, o artigo analisa as percepções dessas mulheres a respeito das realidades por elas vivenciadas tanto no âmbito produtivo (lavoura como reprodutivo (doméstico. É importante destacar que, em Arroio do Padre, há um processo incipiente de “agroecologização”, ou seja, as unidades familiares encontram-se nos níveis iniciais da transição agroecológica. Já em São Lourenço do Sul, observou-se que essas mulheres atuam na agroecologia há mais de 40 anos. Estas distintas trajetórias conferem percepções de mundo diferenciadas entre os dois contextos sociais. Enquanto para as interlocutoras de Arroio do Padre a agroecologia pouco interfere em suas escolhas dentro e fora de casa, já para as entrevistadas de São Lourenço do Sul é essencial no repensar das relações estabelecidas no lar e no seu entorno, especialmente nos assuntos que tangem aos mercados e a sua valorização enquanto “agricultora”.

Establishment of feeder-free culture system for human induced pluripotent stem cell on DAS nanocrystalline graphene

Science.gov (United States)

Lee, Hyunah; Nam, Donggyu; Choi, Jae-Kyung; Araúzo-Bravo, Marcos J.; Kwon, Soon-Yong; Zaehres, Holm; Lee, Taehee; Park, Chan Young; Kang, Hyun-Wook; Schöler, Hans R.; Kim, Jeong Beom

2016-02-01

The maintenance of undifferentiated human pluripotent stem cells (hPSC) under xeno-free condition requires the use of human feeder cells or extracellular matrix (ECM) coating. However, human-derived sources may cause human pathogen contamination by viral or non-viral agents to the patients. Here we demonstrate feeder-free and xeno-free culture system for hPSC expansion using diffusion assisted synthesis-grown nanocrystalline graphene (DAS-NG), a synthetic non-biological nanomaterial which completely rule out the concern of human pathogen contamination. DAS-NG exhibited advanced biocompatibilities including surface nanoroughness, oxygen containing functional groups and hydrophilicity. hPSC cultured on DAS-NG could maintain pluripotency in vitro and in vivo, and especially cell adhesion-related gene expression profile was comparable to those of cultured on feeders, while hPSC cultured without DAS-NG differentiated spontaneously with high expression of somatic cell-enriched adhesion genes. This feeder-free and xeno-free culture method using DAS-NG will facilitate the generation of clinical-grade hPSC.

O jardim das imagens, a inf?ncia e suas flautas sagradas

OpenAIRE

Barreto, Maria das Gra?as de Carvalho

2012-01-01

A pesquisa visa analisar as express?es infantis configuradas nos desenhos. A perspectiva ? compreender os processos de constru??o simb?lica nas dimens?es culturais e subjetivas. Os desenhos s?o vistos como: formas particulares de inscri??o das culturas da inf?ncia; meios de comunica??o das crian?as com os seus pares e com os adultos; formas de representa??o de seus saberes e concep??es de mundo; e, tamb?m, como express?o de sua imagina??o criativa e de sua sensibilidade est?tica. Nessa dire??...

Estudo comparativo entre algoritmos das transformadas discretas de Fourier e Wavelet

OpenAIRE

Wilson Hissamu Shirado; Márcio de Abreu Moreira; Jandira Guenka Palma; Sylvio Barbon Júnior

2015-01-01

Este trabalho apresenta um estudo comparativo das complexidades dos algoritmos das Transformadas Discretas de Fourier, Wavelet e Transformada Rápida de Fourier. As formalizações matemáticas e algumas características dos algoritmos são apresentadas, assim como alguns conceitos de complexidade assintótica. Por fim, é realizado um ensaio prático para comparação dos algoritmos, abrangendo questões como tempo de execução, vantagens e desvantagens de cada transformada assim como avaliações a respei...

Formation of heterocyclic amines in Chinese marinated meat: effects of animal species and ingredients (rock candy, soy sauce and rice wine).

Science.gov (United States)

Wang, Pan; Hong, Yanting; Ke, Weixin; Hu, Xiaosong; Chen, Fang

2017-09-01

Heterocyclic aromatic amines (HAAs) are one type of neo-formed contaminants in protein-rich foods during heat processing. Recently, accumulative studies have focused on the formation of HAs in Western foods. However, there is little knowledge about the occurrence of HAAs in traditional Chinese foods. The objective of this study was to determinate the contents of main HAs in traditional marinated meat products by UPLC-MS/MS, and to investigate the effects of animal species and the ingredients (soy sauce, rock candy, and rice wine) on the formation of HAAs in marinated meats. Five HAs - 2-amino-3-methylimidazo[4,5-f]-quinolone (IQ), 2-amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MeIQx), 2-amino-3,4-dimethylimidazo[4,5-f]quinoxaline (MeIQ), 9H-pyrido[3,4-b]indole (Norharman) and l-methyl-9H-pyrido[3,4-b]indole (Harman) - were detected in 12 marinated meats, but 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) was only found in three chicken marinates. The animal species and ingredients (soy sauce, rock candy and rice wine) have significant influence on the formation of HAAs in meat marinates. Beef had the highest content of total HAAs compared with pork, mutton and chicken. Meanwhile, soy sauce contributed to the formation of HAAs more greatly than rock candy, soy sauce, and rice wine. Choice of raw materials and optimisation of ingredients recipe should be become a critical point to control the HAAs formation in marinated meats. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

Das Alter ist der wichtigste Risikofaktor der postoperativen erektilen Dysfunktion nach radikaler nerverhaltender Prostatektomie

Directory of Open Access Journals (Sweden)

Gruschka M

2009-01-01

Full Text Available Die radikale Prostatektomie ohne Nerverhalt geht mit Impotenz einher. Bei nerverhaltendem Vorgehen kann das Risiko der erektilen Dysfunktion gesenkt, aber nicht ausgeschlossen werden. Die präoperative Beratung der Patienten erfordert bei nerverhaltender Prostatektomie die Kenntnis der Faktoren, die Einfluss auf die postoperative Potenz haben. Patienten & Methoden: 110 Patienten antworteten 24 Monate nach radikaler perinealer nerverhaltender Prostatektomie auf einen per Post übermittelten Fragebogen. Die Patienten wurden, entsprechend dem Erection Hardness Score, nach der Rigidität ihrer Erektionen befragt. Überwiegend erfolgte der Nerverhalt unilateral (104/110. Verschiedene potenzielle Risikofaktoren (Alter, Qualität der präoperativen Erektion, Serum-PSA, Gleason-Score, Tumorvolumen, Prostatavolumen, adjuvante Strahlentherapie, ASA-Score, Chronic Disease Score [CDS], arterielle Hypertonie, Hypercholesterinämie, Diabetes mellitus, KHK, Nikotinkonsum wurden univariat mit der postoperativ erzielten Potenz korreliert. Multivariat wurden dann jene Parameter untersucht, die in der univariaten Analyse einen signifikanten (p ≤ 0,05 oder einen tendenziellen Zusammenhang (p ≤ 0,2 mit der postoperativen erektilen Funktion aufwiesen. Ergebnisse:Das Alter (p 0,001 und der ASAScore (p = 0,018 waren in der univariaten Analyse negative Prädiktoren der postoperativen Potenz. In der multivariaten Analyse war lediglich das Alter (p = 0,028 von signifikanter Bedeutung. Mit jedem Lebensjahr der Männer steigt das Risiko einer um eine Stufe im EHS schlechteren Erektion um das 1,128-Fache an. Bei einem Altersunterschied von 10 Jahren ist das Risiko eines postoperativ schlechteren Erektionsvermögens um den Faktor 3,334 erhöht, bei einem um 20 Jahre höheren Alter beträgt dieser Faktor 11,121. Diskussion & Praxisrelevanz: Das Lebensalter der Patienten wurde im Einklang mit der Literatur als signifikanter Faktor für die postoperative Potenz identifiziert

Manuscritos freudianos inéditos: das ich und das es

Directory of Open Access Journals (Sweden)

Juan Carlos Cosentino

2013-04-01

Full Text Available Apresentamos aqui uma leitura crítica e comparada entre o rascunho e a forma final de O ego e o id, no momento em que nasce uma dissimetria entre o inconsciente reprimido e o material inconsciente que permanece não reconhecido. Partimos do capítulo "Os dois tipos de pulsão". O próprio Freud nos lembra que as questões aí levantadas retomam pensamentos iniciados em 1920. A partir da redefinição do Inconsciente e, mais tarde, com a reformulação da ideia de pulsão de morte, tais considerações permanecem mais perto da psicanálise que do texto Além.... Não obstante, o que denomina "nossa especulação" retorna nas conclusões do capítulo IV sobre o pressuposto da pulsão de morte. Com a irrupção do não-ligado, quais são os propósitos da pulsão de morte, em 1923, quando esta tem as mãos livres? Em 1924, constata que não-toda a pulsão está inscrita na representação. Intervém o silêncio da pulsão: essa fronteira, onde o id fala, o id goza e nada sabe.Freudian unpublished manuscripts: das Ich und das Es. This is a critical and comparative reading of the manuscripts of The Ego and the Id. We can read in this work a dissymmetry between the repressed unconscious and the material that remains unknown. We depart from chapter IV, "The two kinds of Drives". As Freud announces, the matters he displays resume thoughts from his writings of 1920. So, starting with the redefinition of Ucs and afterwards, with the reformulation of the idea of Todestrieb, they remain much closer to psychoanalysis than Beyond the pleasure principle. But what he calls, "our speculation" returns in the conclusions of chapter IV about the assumption of the Todestrieb. With the breaking through of the not bound: what are the purposes the Todestrieb serves, when, as he says in 1923, it has its hands free? In 1924 he confirms that not-all the drive is inscribed in the representation. The silence of the drive intervenes: this border, where id speaks, id enjoys

Pregnancy loss and eye malformations in offspring of F344 rats following gestational exposure to mixtures of regulated trihalomethanes and haloacetic acids

Science.gov (United States)

Chlorination of drinking water results in the formation of hundreds of disinfection byproducts (DBPs), the most prevalent are trihalomethanes (THMs) and haloacetic acids (HAAs). Four THMs (chloroform, bromodichloromethane, chlorodibromomethane, bromoform) and five HAAs (chloroac...

Cabaret Voltaire ja "Kabaret das Lust" / Marko Raat

Index Scriptorium Estoniae

Raat, Marko, 1973-

2000-01-01

Prantsuse režissööri Catherine Breillatþ "Romanss" ja pornograafia mõiste ning Andres Maimiku, Arbo Tammiksaare, Juhan Ulfsaki Kabaret das Lust kava "Elu mõte" ja selle raames näidatud Tammiksaare-Maimiku mängufilmi sugemetega dokumentaalfilm "Macbeth" : loominguline ühendus "Suits"

Rebentação das ondas e o transporte de sedimentos. O projecto BRISA

OpenAIRE

Fortes, C. J. E. M.; Ferreira, Ó.; Silva, P. A.; Neves, D. R.; Rocha, M.; Santos, J. A.; Pinheiro, L.; Didier, E.; Endres, L.; Bezerra, M.; Abreu, T.; Zózimo, A. C.; Sancho, F. E.; Moura, T.; Okamoto, T.

2011-01-01

Nesta comunicação descreve-se o projecto BRISA (Interacção entre a rebentação das ondas e o transporte de sedimentos) que tem como objectivo contribuir para a compreensão e modelação numérica dos fenómenos de rebentação das ondas e do transporte de sedimentos em zonas costeiras. Para este efeito, o projecto envolve a modelação numérica e experimental e a recolha de dados de campo relativos à hidrodinâmica da rebentação das ondas e ao transporte de sedimentos. Neste trabalho ...

CONTROLE QUÍMICO E CULTURAL DAS PLANTAS DANINHAS NA VIDEIRA 'NIAGARA ROSADA'

Directory of Open Access Journals (Sweden)

PAULO EDISON MARTINS

1997-01-01

Full Text Available Estudou-se o controle das plantas daninhas e a seletividade dos herbicidas diclobenil, diuron e simazine à cultura da videira `Niagara Rosada', procurando-se separar os efeitos da cobertura morta sobre os fatores de produção e o teor de sólidos solúveis do suco da uva. O delineamento experimental utilizado foi de blocos ao acaso com quatro repetições. Verificou-se que os herbicidas diuron (2,0 kg/ha, simazine (2,4 kg/ha e diclobenil (3,04; 4,05 e 5,06 kg/ha foram seletivos à cultura da videira e eficientes no controle das plantas daninhas capim-colchão (Digitaria horizontalis Willd., caruru (Amaranthus hibridus L., guanxuma (Sida spp. e picão-preto (Bidens pilosa L.. A cobertura vegetal de capim-gordura (Melinis minutiflora L. foi eficiente no controle das plantas daninhas.

Actas do 1º Encontro do Mel das Arribas do Douro - ArribasMel 2004

OpenAIRE

Marcos, Adérito

2004-01-01

1º Encontro do Mel das Arribas do Douro - ArribasMel 2004, Solar dos Marcos, Bemposta, Mogadouro, 27 Março 2004 Livro de resumos do 1º Encontro do Mel das Arribas do Douro - ArribasMel 2004, realizado no Solar dos Marcos, Bemposta, Mogadouro, 27 de Março 2004.

ESTUDO COMPARATIVO DA COMPETITIVIDADE DAS EMPRESAS DE MÁQUINAS FERRAMENTAS BRASILEIRAS: ANÁLISE MULTICRITÉRIOS

OpenAIRE

Sanches, João Carlos Santiago

2007-01-01

O principal objetivo desta dissertação foi analisar por meio de estudo comparativo, o posicionamento competitivo de três máquinas ferramentas multitarefas. As hipóteses iniciais partiram das seguintes suposições: a) a indústria nacional de máquinas ferramentas esta sendo penalizada pela política industrial praticada pelo governo federal; e b) a importância relativa atribuída aos elementos multicriteriais das especificações das máquinas nacionais quando demonstram tendências elevadas, nem semp...

Epidemiologia e etiologia das dermatofitoses em Goiânia, GO, Brasil

Directory of Open Access Journals (Sweden)

Costa Milce

2002-01-01

Full Text Available Os dermatófitos são um grupo de fungos taxonomicamente relacionados que têm a capacidade de invadir os tecidos queratinizados (pele, pêlo e unha dos homens e animais produzindo infecções denominadas dermatofitoses. Com o intuito de avaliar a epidemiologia e etiologia das infecções causadas por estes fungos em Goiânia, GO, foram examinadas no Laboratório de Micologia do Instituto de Patologia Tropical e Saúde Pública da Universidade Federal de Goiás, de janeiro a dezembro de 1999, 1.955 amostras de indivíduos com suspeita clínica de dermatofitoses. Foram isolados 445 (22,8% cepas de dermatófitos e identificados principalmente Trichophyton rubrum (49,4%, Trichophyton mentagrophytes (30,8% e Microsporum canis (12,6%. Quanto à localização das lesões, os membros inferiores, unhas dos pés e couro cabeludo foram as regiões mais acometidas. Neste estudo foram avaliados dados correlacionados a sexo, faixa etária, local das lesões e agente etiológico.

NECESSIDADES BÁSICAS DAS ESPOSAS DE PACIENTES INFARTADOS, NA FASE AGUDA DO TRATAMENTO

Directory of Open Access Journals (Sweden)

Edna Ikumi Umebayashi Takahashi

Full Text Available Trata-se de um estudo exploratório que teve por finalidade identificar as necessidades básicas das esposas de pacientes infartados, na fase aguda do tratamento. Foi utilizado como referencial para análise os conceitos de Necessidades Básicas de Maslow. Os resultados permitiram identificar como principais necessidades afetadas das esposas: segurança, amor e gregária, estima.

Hepatic artery aneurysms (HAAs)

International Nuclear Information System (INIS)

Nosratini, H.

2004-01-01

The hepatic artery aneurysms are rare, especially in interahepatic branches, The frequency consists of 75-80% extrahepatic and 20-25% intrahepatic. Catheterization is achieved usually from common femoral artery, other methods implemented in the case of unsuccessful catheterization from femoral artery, are translumbar and brachial catheterization. The study consist of 565 patients that were referred to the angiography ward, During seven years of assessment, five cases of hepatic artery aneurysm were found; this is a rare condition reported in the English literature. In the literature as well as in this case report the hepatic artery aneurysms are rare. In reported series the extrahepatic artery aneurysms are found more often than in the intrahepatic artery aneurysm but in this case report intrahepatic artery aneurysms are more than extrahepatic one. (author)

RANCIÈRE: A POLÍTICA DAS IMAGENS

Directory of Open Access Journals (Sweden)

Pedro Hussak van Velthen Ramos

2015-07-01

Full Text Available Este artigo mostra os desdobramentos das reflexões deJacques Rancière em torno da relação entre política e estética nodomínio específico da imagem. Trata-se de mostrar em que sentidoas imagens se articulam politicamente em sua circulação social. Nasduas primeiras partes, expõe-se a crítica de Rancière a dois modosde se colocar a relação entre imagem e política: por um lado, a ideiade que a própria imagem seria nociva à política; por outro, aconsideração de que o elemento político da imagem estaria noconteúdo que ela apresenta. Por fim, pretende-se mostrar que, parao pensador francês, a politicidade das imagens deve ser encontradaem um regime determinado de articulações de seus elementos efunções que ele chama de “regime de imagéité”. Como conclusão,serão discutidas as consequências da passagem de um regime aoutro, a saber, do regime representativo ao regime estético.

AVALIAÇÃO DAS CONDIÇÕES DE PASTAGENS NO CERRADO BRASILEIRO POR MEIO DE GEOTECNOLOGIAS

Directory of Open Access Journals (Sweden)

Ricardo Guimarães Andrade

2017-05-01

importante parâmetro biofísico para aplicação de metodologias de avaliação das condições das pastagens do bioma Cerrado e corroboram para análises de inteligência territorial estratégica voltadas para o planejamento e a implementação de ações público-privadas de recuperação do potencial produtivo das áreas de pastagens em escala municipal.

Estudo comparativo da estrutura de capital e das características de financiamento das empresas do setor químico brasileiro - doi: 10.4025/enfoque.v31i2.16145

Directory of Open Access Journals (Sweden)

Nadia Bussolan Cintra

2012-08-01

Full Text Available Considerando características específicas do mercado brasileiro, como a presença dos bancos de desenvolvimento e seu impacto na oferta de crédito, este trabalho tem por objetivo analisar a estrutura de capital e as características de financiamento das empresas do setor químico brasileiro de 1999 a 2008. Por meio de uma abordagem empírico-analítica, primeiramente, o financiamento das empresas estudadas é classificado de acordo com a moeda (nacional ou estrangeira e suas características (linhas diferenciadas ou de mercado. Em seguida, utilizando-se a análise de dados em painel, investigou-se a relação entre o nível de endividamento e as variáveis clássicas indicadas pela literatura. Os resultados indicam que (i as linhas nacionais diferenciadas de financiamento e as de mercado em moeda estrangeira contribuíram significativamente para o financiamento das empresas do setor, que trabalhou com endividamento total em torno de 24%, prevalecendo o endividamento de longo prazo; e (ii as variáveis tamanho, tangibilidade dos ativos, intangibilidade, rentabilidade e risco também são significativas para explicar o nível de endividamento das empresas analisadas.

MiDAS Field Guide – a Comprehensive Online Source of Information About the Microbes of Activated Sludge

DEFF Research Database (Denmark)

Nierychlo, Marta; McIlroy, Simon Jon; Saunders, Aaron Marc

this information in MiDAS field guide (www.midasfieldguide.org). MiDAS taxonomy gives a solid foundation for the study of microbial ecology of the wastewater treatment processes. The online MiDAS field guide links the identity of genera that are important for the wastewater treatment process to details about...... guide to the microbes of activated sludge by comparing microbial community composition in 32 WWTPs located worldwide. This will facilitate a better understanding of the ecology of the ecosystem of activated sludge. Reference: McIlroy et al. MiDAS: the field guide to the microbes of activated sludge...... on a survey of 25 full-scale Danish wastewater treatment plants over 6 years and using MiDAS taxonomy, we have collected more than 150 key organisms in activated sludge wastewater treatment systems, linked their identity with available information on their function and distribution and included...

Cobertura plástica e densidade de plantio na qualidade das frutas de Physalis peruviana L.

Directory of Open Access Journals (Sweden)

Pedro Henrique Abreu Moura

2016-06-01

Full Text Available RESUMO Physalis peruviana L. é uma espécie pertencente à família Solanaceae, que vem sendo incorporada em plantios de pequenas frutas, com alto potencial produtivo para regiões subtropicais. Objetivou-se, com este trabalho, avaliar a qualidade das frutas de P. peruviana L., produzidas com ou sem cobertura plástica sobre o dossel das plantas e em duas densidades de plantio (0,5 e 1,0 m entre plantas, sendo de 3,0 m o espaçamento entre linhas. O delineamento experimental adotado foi em blocos ao acaso, em esquema fatorial 2 x 2, com seis blocos e dez plantas por parcela. Foram avaliadas as características qualitativas das frutas, como coloração, quantidade de antocianinas totais, vitamina C, cinzas, sólidos solúveis totais, sacarose, glicose, açúcares totais, acidez titulável, firmeza e umidade. A maior densidade de plantio e o plantio sem cobertura plástica sobre o dossel das plantas resultaram em melhor qualidade das frutas de P. peruviana L.

Adding Flavor to Beverages with Non-Conventional Yeasts

Directory of Open Access Journals (Sweden)

Davide Ravasio

2018-02-01

Full Text Available Fungi produce a variety of volatile organic compounds (VOCs during their primary and secondary metabolism. In the beverage industry, these volatiles contribute to the the flavor and aroma profile of the final products. We evaluated the fermentation ability and aroma profiles of non-conventional yeasts that have been associated with various food sources. A total of 60 strains were analyzed with regard to their fermentation and flavor profile. Species belonging to the genera Candida, Pichia and Wickerhamomyces separated best from lager yeast strains according to a principal component analysis taking alcohol and ester production into account. The speed of fermentation and sugar utilization were analysed for these strains. Volatile aroma-compound formation was assayed via gas chromatography. Several strains produced substantially higher amounts of aroma alcohols and esters compared to the lager yeast strain Weihenstephan 34/70. Consequently, co-fermentation of this lager yeast strain with a Wickerhamomyces anomalus strain generated an increased fruity-flavour profile. This demonstrates that mixed fermentations utilizing non-Saccharomyces cerevisiae biodiversity can enhance the flavour profiles of fermented beverages.

VALOR E PRÁTICAS DE GOVERNANÇA CORPORATIVA DAS EMPRESAS LISTADAS NA BM&FBOVESPA

Directory of Open Access Journals (Sweden)

Carla Caroline dos Santos Silva

2015-07-01

Full Text Available Este estudo teve o objetivo de verificar a relevância das práticas diferenciadas de governança corporativa da BM&FBOVESPA na explicação das variações do valor das empresas. A partir de uma revisão de literatura acerca do value relevance da informação financeira e das práticas diferenciadas de governança corporativa exigidas pela BM&FBOVESPA, foram analisadas as empresas do Índice Brasil (IBrX no período de 2010 a 2012. Seus dados foram extraídos dos relatórios de administração e formulários de referência das empresas e na base de dados do Economatica. Por meio de uma análise de regressão foi possível observar que 6 das 13 práticas de governança foram significativas na explicação do valor. As práticas que se destacaram negativamente foram: (i esforço de dispersão acionária, (iilimitação de voto inferior, quórum qualificado e “cláusulas pétreas” e (iii mínimo de 5 membros no conselho (com 20% independentes. Positivamente se destacaram: (iv demonstrações financeiras traduzidas para o inglês, (v oferta pública de aquisição de ações no mínimo pelo valor econômico e (vi adesão à câmara de arbitragem. Como principais contribuições deste estudo se destacam as evidências de value relevance dessas práticas, em que três indicam relação inversa com o valor, denotando que podem não estar adequadas aos fins da criação de valor aos acionistas.

Das COSO Enterprise Risk Management-Framework

OpenAIRE

Ruud, Flemming; Reichert, Felix

2007-01-01

Der Verwaltungsrat und die Geschäftsleitung tragen die Verantwortung, ein Internes Kontrollsystem (IKS) im Unternehmen auszugestalten. Ab dem Geschäftsjahr 2008 wird die Existenz eines IKS durch den externen Revisor geprüft (Art. 728a, 728b revOR). Auch sind im Anhang Angaben über die Durchführung einer Risikobeurteilung zu publizieren (Art. 663b revOR). Das Enterprise-Risk-Management-Framework von COSO (COSO ERM) kann als Führungsinstrument helfen, wichtige Chancen und Risiken zu erkennen...

Plantas medicinais e seus usos pelos sitiantes da Reserva Rio das Pedras, Mangaratiba, RJ, Brasil Medicinal plants and its uses by the ranchers from the Rio das Pedras Reserve, Mangaratiba, RJ, Brazil

Directory of Open Access Journals (Sweden)

Maria Franco Trindade Medeiros

2004-06-01

Full Text Available Os sitiantes que residem na Reserva Rio das Pedras, localizada no município de Mangaratiba, Estado do Rio de Janeiro, têm origem nos meeiros que trabalhavam nas plantações de banana da antiga fazenda Goiabal. Atualmente, esta fazenda corresponde ao Club Méditerranée, na cota próxima ao oceano Atlântico e à Reserva Rio das Pedras, acima da Rodovia Rio/Santos (BR-101, sendo um remanescente de Floresta Ombrófila Densa no Estado. O objetivo deste estudo foi resgatar informações sobre o uso de plantas medicinais pelos sitiantes que ainda residem nesta Reserva. Através de entrevistas estruturadas e semi-estruturadas aplicadas junto à comunidade, pôde-se fazer um levantamento das plantas presentes ao redor das casas dos mesmos. Ao todo foram citadas 36 espécies medicinais, distribuídas em 34 gêneros e 25 famílias. Estas espécies estão relacionadas a 28 usos medicinais, organizados em sete categorias. Predominaram espécies de plantas herbáceas (21 spp. seguidas das arbustivas (oito spp. e arbóreas (cinco spp.. Constatou-se que a folha foi a parte mais utilizada e o modo de preparo do remédio foi o decocto. Quantificou-se o número de citações por informante para cada táxon, possibilitando a indicação das espécies mais utilizadas na área, como a erva-de-santa-maria (Chenopodium ambrosioides L. e a pitanga (Eugenia uniflora L..The ranchers who live in Rio das Pedras Reserve, which lies in Mangaratiba County, State of Rio da Janeiro, came from sharecroppers who worked at the banana plantation of the farmer Goiabal farm. Nowadays, that farm corresponds to the Méditerranée Club in the area next to the Atlantic Ocean and to Rio das Pedras Reservation, above the Rio/Santos highway (BR-101, it is a remainder of the Dense Ombrophylous Forest in the State. The aim of this study was to collect information about the use of medicinal plants by the ranchers who still live in that Reservation. A survey of the plants, which could be

Die prädikatsergänzung (das prädikatsattribut in der Slovenischen Syntax

Directory of Open Access Journals (Sweden)

Breda Pogorelec

1972-12-01

Full Text Available In der vorliegenden Abhandlung wird die erwähnte Problematik in der slovenischen grammatischen -Überlieferung behandelt und mit interessanten Ergebnissen vor allem der tschechischen Sprachtheorie ergänzt, es wird der Terminus Prädikatsergänzung gegenüber dem Terminus Prädikatsattribut begründet; auf dieser Grundlage werden auch die bisher behandelten Arten von Prädikatsergänzungen mit neuen ergänzt. Dabei findet wenn nur möglich das einfache Transformationsverfahren Verwendung, das die Veranschaulichung der stufenweisen Determinierung durch das Prädikatsattribut ermöglicht. Das Material entstammt vorwiegend der Sprache der Kunst, der Grund dafür ist vor allem in der Tatsache zu suchen, daß in dieser Sprache dieser Form die Rolle eines natürlichen Kondensators zufällt, weshalb sie verhältnismäßig häufig vorkommt. Die Abhandlung befaßt sich eingehender auch mit dem Problem der Wortfolge und berührt auch die graphische Darstellung der bei der Prädikatsergänzung üblichen Pausen.

Impacto das Competências de Equipes sobre o Desempenho

Directory of Open Access Journals (Sweden)

Katia Puente-Palacios

2018-03-01

Full Text Available Resumo As competências para o trabalho têm sido tradicionalmente compreendidas como atributos de indivíduos; entretanto, estudos mais recentes tornam pertinente defender a sua ocorrência como atributos coletivos. O objetivo deste estudo foi demonstrar que competências individuais podem transformar-se em competências coletivas e, nesse nível, predizer o desempenho da equipe. A testagem empírica foi realizada em 51 aeródromos brasileiros, totalizando 106 equipes (entre 3 e 32 integrantes. Instrumentos respondidos pelos membros focaram nas competências enquanto os respondidos pelos lideres indagaram sobre o desempenho das equipes. Os resultados revelaram que as competências coletivas explicam aproximadamente 20% do desempenho das equipes. Disso depreende-se que as competências podem se manifestar como atributos coletivos que predizem resultados de equipes de trabalho.

A cruzada antipedofilia e a criminalização das fantasias sexuais

Directory of Open Access Journals (Sweden)

Laura Lowenkron

Full Text Available Partindo do pressuposto de que as categorias classificatórias utilizadas na construção de "problemas sociais" influenciam nas formas de compreensão e gestão dos mesmos, o artigo analisa como o enfrentamento à violência sexual contra crianças a partir da noção de "pedofilia" e com o enfoque na pornografia infantil na internet produz um borramento das fronteiras entre atos e fantasias sexuais, produzindo um deslocamento da atenção política das desigualdades de poder para a ameaça das perversões. O material de análise é baseado em discussões legislativas realizadas no âmbito da Comissão Parlamentar de Inquérito da Pedofilia, do Senado Federal brasileiro, e em um dos inquéritos consultados durante pesquisa etnográfica na Polícia Federal. Por fim, são discutidos alguns dos efeitos da "cruzada antipedofilia".

Das Regulativ der Wahrscheinlichkeit. Zur Funktion literarischer Fiktionalität im 18. Jahrhundert

OpenAIRE

Görner, Florian

2011-01-01

Das Hauptproblem eines tragenden literarischen Experimentbegriffs ist das ihm häufig vorgeworfene Problem der angeblich mangelnden Verankerung in der Realität. Der Vorwurf dieses Mankos gründet in der Gegenüberstellung von literarischem und naturwissenschaftlichem Experiment; ist für letzteres eines der wichtigsten geforderten Kriterien die Reproduzierbarkeit der Ergebnisse, wird dem literarischen Experiment von seinen Kritikern eine Beliebigkeit seiner Ergebnisse unterstellt, welche aus der ...

Preferential induction of the AhR gene battery in HepaRG cells after a single or repeated exposure to heterocyclic aromatic amines

International Nuclear Information System (INIS)

Dumont, Julie; Josse, Rozenn; Lambert, Carine; Antherieu, Sebastien; Laurent, Veronique; Loyer, Pascal; Robin, Marie-Anne; Guillouzo, Andre

2010-01-01

2-Amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) and 2-amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MeIQx) are two of the most common heterocyclic aromatic amines (HAA) produced during cooking of meat, fish and poultry. Both HAA produce different tumor profiles in rodents and are suspected to be carcinogenic in humans. In order to better understand the molecular basis of HAA toxicity, we have analyzed gene expression profiles in the metabolically competent human HepaRG cells using pangenomic oligonucleotide microarrays, after either a single (24-h) or a repeated (28-day) exposure to 10 μM PhIP or MeIQx. The most responsive genes to both HAA were downstream targets of the arylhydrocarbon receptor (AhR): CYP1A1 and CYP1A2 after both time points and CYP1B1 and ALDH3A1 after 28 days. Accordingly, CYP1A1/1A2 induction in HAA-treated HepaRG cells was prevented by chemical inhibition or small interference RNA-mediated down-regulation of the AhR. Consistently, HAA induced activity of the CYP1A1 promoter, which contains a consensus AhR-related xenobiotic-responsive element (XRE). In addition, several other genes exhibited both time-dependent and compound-specific expression changes with, however, a smaller magnitude than previously reported for the prototypical AhR target genes. These changes concerned genes mainly related to cell growth and proliferation, apoptosis, and cancer. In conclusion, these results identify the AhR gene battery as the preferential target of PhIP and MeIQx in HepaRG cells and further support the hypothesis that intake of HAA in diet might increase human cancer risk.

Trace Analysis of Mutagenic Heterocyclic Aromatic Amines in Cigarette Smoke Condensate and its Base Fractions via Silylation-GC-MS

Directory of Open Access Journals (Sweden)

Liu S

2014-12-01

Full Text Available Among the more than 5000 chemicals reported in cigarette smoke condensate (CSC, heterocyclic aromatic amines (HAAs are considered to be a contributor to observed biological activity. HAAs are non-volatile and are reported at ppb levels in CSC. A new method for HAA analysis at the trace level is reported here. N, O-Bis(trimethylsilyl trifluoroacetamide (BSTFA containing 1% trimethylchlorosilane was employed to derivatize amino groups by heating the reagent containing a sample of CSC at 80 °C for 30 min followed by analysis employing gas chromatography-mass spectroscopy (GC-MS in the selected-ion-monitoring (SIM mode. This derivatization method afforded symmetrical peak shapes on a ZB-50 stationary phase and achieved instrumental limits of quantification (LOQ at 10:1 S/N from -1 ng/mL for AαC to120 ng/mL for Glu-P-1. The chemical identity of each derivative was confirmed by comparison of retention time and mass spectra of standards. The latter were characterized by the following ions: M·+ or [M-1]+, [M-15]+, and m/z 73 (i.e., trimethylsilyl. CSC and its base sub-fractions were studied using the GC-MS method. Ten HAAs were screened and five were quantified in cigarette smoke condensate, while 2-5 HAAs were quantified in each of three base sub-fractions. Values obtained with the new procedure agree well with values reported in the literature and with results obtained from a commercial laboratory via a different analytical method. The potential contribution of each HAA to the overall mutagenic activity observed for CSC and its base fractions is discussed. When considered together, HAAs account for only a small portion (-7.8% of the observed mutagenicity of the CSC.

Reducing effect of artichoke extract on heterocyclic aromatic amine formation in beef and chicken breast meat.

Science.gov (United States)

Tengilimoglu-Metin, Mercan Merve; Kizil, Mevlude

2017-12-01

The aim of this study was to investigate the inhibitory effect of different levels of artichoke extract (0, 0.5, and 1.0%) on the formation of heterocyclic aromatic amines (HAAs) in beef and chicken breast meat cooked by either pan-frying or oven-roasting. All meat samples were cooked at three different temperatures (150, 200, and 250°C) and the levels of 12 HAAs (IQ, IQx, MeIQ, MeIQx, 4,8-DiMeIQx, 7,8-DiMeIQx, PhIP, harman, norharman, AαC, MeAαC, and Trp-P-2) were assessed. The total HAA content in beef and chicken breast ranged from not detectable to 49.26ng/g, and not detectable to 83.06ng/g, respectively. The inhibitory effects of 0.5 and 1.0% artichoke extracts on total HAAs levels were found to be 6-46% and 25-98% in beef, and 5-97% and 14-95% in chicken breast, respectively. The present study showed that artichoke extracts could mitigate HAA formation especially in oven-roasted beef and chicken breast meat. Copyright © 2017 Elsevier Ltd. All rights reserved.

Effect of the chlorinated washing of minimally processed vegetables on the generation of haloacetic acids.

Science.gov (United States)

Cardador, Maria Jose; Gallego, Mercedes

2012-07-25

Chlorine solutions are usually used to sanitize fruit and vegetables in the fresh-cut industry due to their efficacy, low cost, and simple use. However, disinfection byproducts such as haloacetic acids (HAAs) can be formed during this process, which can remain on minimally processed vegetables (MPVs). These compounds are toxic and/or carcinogenic and have been associated with human health risks; therefore, the U.S. Environmental Protection Agency has set a maximum contaminant level for five HAAs at 60 μg/L in drinking water. This paper describes the first method to determine the nine HAAs that can be present in MPV samples, with static headspace coupled with gas chromatography-mass spectrometry where the leaching and derivatization of the HAAs are carried out in a single step. The proposed method is sensitive, with limits of detection between 0.1 and 2.4 μg/kg and an average relative standard deviation of ∼8%. From the samples analyzed, we can conclude that about 23% of them contain at least two HAAs (<0.4-24 μg/kg), which showed that these compounds are formed during washing and then remain on the final product.

Synthesis of high-quality diesel with furfural and 2-methylfuran from hemicellulose.

Science.gov (United States)

Li, Guangyi; Li, Ning; Wang, Zhiqiang; Li, Changzhi; Wang, Aiqin; Wang, Xiaodong; Cong, Yu; Zhang, Tao

2012-10-01

Hydroxyalkylation-alkylation (HAA) coupled with hydrodeoxygenation is a promising route for the synthesis of renewable high-quality diesel or jet fuel. In this work, a series of solid-acid catalysts were firstly used for HAA between lignocellulose-derived furan and carbonyl compounds. Among the investigated catalysts, Nafion-212 resin demonstrated the highest activity and stability. Owing to the high activity of the reactants and the advantage in industrial integration, the HAA of 2-methylfuran (2-MF) and furfural can be considered as a prospective route in future applications. Catalyst loading, reaction temperature, and time had evident effects on the HAA of 2-MF and furfural over Nafion-212 resin. Finally, the HAA product of 2-MF and furfural was hydrogenated over a Pd/C catalyst and hydrodeoxygenated over Pt-loaded solid-acid catalysts. Pt/zirconium phosphate (Pt/ZrP) was found to be the best catalyst for hydrodeoxygenation. Over the 4 % Pt/ZrP catalyst, a 94 % carbon yield of diesel and 75 % carbon yield of C15 hydrocarbons (with 6-butylundecane as the major component) was achieved. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Cooking does not decrease hydrophilic antioxidant capacity of wild blueberries.

Science.gov (United States)

Murphy, Rebecca Ree; Renfroe, Michael H; Brevard, Patricia Bowling; Lee, Robert E; Gloeckner, Janet W

2009-01-01

The present study examined the effects of domestic cooking methods on the hydrophilic antioxidant activity (HAA) of wild blueberries. Baked, microwaved, simmered, and pan-fried frozen wild blueberries, and a thawed uncooked control, were analyzed for HAA using an ABTS/H(2)O(2)/HRP decoloration method. All cooking treatments were derived from recipes using wild blueberries, and were performed in triplicate. A randomized block design was used to determine whether there were statistical differences in antioxidant content after cooking and between each of the trials. There were no statistically significant decreases after cooking the thawed berries. On both a fresh weight and a dry weight basis, pan-fried blueberries had significantly higher HAA than baked, simmered, and control blueberries (Pcooked berries retained significant HAA. Cooked wild blueberries can be recommended as a good source of dietary antioxidants.

Gastroprotective Effects of DAS-77 (a Phytomedicine) in Ulcer ...

African Journals Online (AJOL)

Purpose: DAS-77 is a phytomedicine that contains the dried bark of Mangifera indica and root of Carica ... epithelial defense and repair (e.g. ... indica) and dried root of pawpaw tree (Carica .... was done without causing any damage to its ...

Avaliação da limitação das atividades diárias e qualidade de vida de pacientes com hanseníase submetidos à cirurgia de neurólise para tratamento das neurites

OpenAIRE

Reis,Felipe José Jandre dos; Gomes,Maria Kátia; Cunha,Antonio José Ledo Alves da

2013-01-01

A neurólise é indicada para reduzir o ­sofrimento neural e impedir a instalação de sequelas e incapacidades em pacientes com hanseníase. O objetivo deste estudo foi verificar o grau de limitação das atividades e a qualidade de vida de pacientes com hanseníase submetidos a neurólise para tratamento das neurites. Participaram do estudo os pacientes submetidos à neurólise no período de 1998 a 2011. Foram coletadas informações sociodemográficas e clínicas, limitações das atividades (SALSA) e a qu...

Table 1. Real-time qRT-PCR verification of eight DEGs. Gene ...

Indian Academy of Sciences (India)

(TCA)8. GGGTCCGAGTGCCTTAATTT. TGTGGGATGTGTTGTGTGTG 60.32 59.88. HAAS VR 415 BMK.5319. (T)13. GATTCACGTGTGCCATCATC TGGACAATTCATTCAAAAAGAAAA 59.93 59.87 372. HAAS_VR_417 BMK.5329. (AG)6. ATCCCGGGGTGAAAAATAAA AGAAATGGTGCAATGGGTTC 60.36 59.80 157. (GAC)5 ...

Moscas-das-frutas (Diptera: Tephritidae em um pomar de goiabeira, no semiárido brasileiro

Directory of Open Access Journals (Sweden)

Elton Lucio Araujo

2013-06-01

Full Text Available As moscas-das-frutas (Diptera: Tephritidae são pragas-chave na cultura da goiabeira Psidium guajava L., com predominância de diferentes espécies de acordo com a região produtora no Brasil. Os objetivos do presente trabalho foram conhecer a diversidade e analisar parâmetros faunísticos das moscas-das-frutas obtidas em um pomar de goiabeira, no município de Cruzeta, Rio Grande do Norte, situado no semiárido brasileiro. As moscas-das-frutas foram coletadas semanalmente, com auxílio de armadilhas McPhail, tendo como atrativo proteína hidrolisada a 5% v/v. Foram registradas cinco espécies no pomar estudado: Ceratitis capitata (Wied., Anastrepha zenildae Zucchi, Anastrepha sororcula Zucchi, Anastrepha obliqua (Macquart e Anastrepha dissimilis Stone. Ceratitis capitata foi a espécie mais frequente, constante e dominante, considerada como uma praga invasiva, potencial em pomares de goiabeira no semiárido brasileiro.

New epoxide polymers generated by metal organic catalysts (chelates) and their application in composite structures. Pt. 2. Final report; Neue Epoxidpolymere durch Metallorgano-Katalysatoren und ihr Einsatz in Faserverbundstrukturen. T. 2. Abschlussbericht

Energy Technology Data Exchange (ETDEWEB)

Merz, T.; Raeckers, B.

1999-08-01

Epoxy resins cured by catalysts based on chelate compound can offer an additional potential concerning storage and heat stability, toughness and curing characteristic. To prove these advantages and to prepare a serial application was target of the project, by which physico-chemical investigations, determination of mechanical properties and component tests were used. Besides an improvement of storage time and a minimized curing cycle a satisfactory processing behaviour and mechanical properties approaching currently used aircraft materials became evident. Serial production of fibre reinforced components for automotive industry is basically possible, because all requirements concerning costs, performance and station time were met. The results can also be used for new applications in other technical fields like apparatus construction or sporting goods industry. (orig.) [German] Mittels Metallorganokatalysatoren gehaertete Epoxidharze versprechen gegenueber herkoemmlichen Systemen zusaetzliche Potentiale hinsichtlich Lager- und Waermestabilitaet sowie Zaehigkeit und Haertungscharakteristik. Diese nachzuweisen und eine zukuenftige Serienanwendung vorzubereiten war Ziel des Projektes, wozu physico-chemische Untersuchungen, mechanische Kennwertermittlungen und Bauteilversuche dienten. Neben verbesserter Lagerstabilitaet und minimierten Haertungszyklen konnten gute Verarbeitungseingeschaften und ein Leistungsprofil nachgewiesen werden, das nahe an das heutiger Luftfahrtwerkstoffe heranreicht. Die Serienherstellung von Faserverbundbauteilen im Automobilbau ist prinzipiell moeglich, da durch die entwickelten Katalysatoren alle Vorgaben hinsichtlich Kosten, Leistungsfaehigkeit und Taktzeiten erreicht werden konnten. Hierdurch koennen sich auch fuer andere Bereiche (z.B. Geraetebau, Sportartikelindustrie) neue Anwendungsmoeglichkeiten eroeffnen. (orig.)

New epoxide polymers generated by metal organic catalysts (chelates) and their application in composite structures. Pt. 1. Final report; Neue Epoxidpolymere durch Metallorgano-Katalysatoren und ihr Einsatz in Faserverbundstrukturen. T. 1. Abschlussbericht

Energy Technology Data Exchange (ETDEWEB)

Merz, T.; Raeckers, B.; Boettcher, A.; Haessler, R.; Renner, M.; Schmidtke, K.

1999-08-01

Epoxy resins cured by catalysts based on chelate compound can offer an additional potential concerning storage and heat stability, toughness and curing characteristic. To prove these advantages and to prepare a serial application was target of the project, by which physico-chemical investigations, determination of mechanical properties and component tests were used. Besides an improvement of storage time and a minimized curing cycle a satisfactory processing behaviour and mechanical properties approaching currently used aircraft materials became evident. Serial production of fibre reinforced components for automotive industry is basically possible, because all requirements concerning costs, performance and station time were met. The results can also be used for new applications in other technical fields like apparatus construction or sporting goods industry. (orig.) [German] Mittels Metallorganokatalysatoren gehaertete Epoxidharze versprechen gegenueber herkoemmlichen Systemen zusaetzliche Potentiale hinsichtlich Lager- und Waermestabilitaet sowie Zaehigkeit und Haertungscharakteristik. Diese nachzuweisen und eine zukuenftige Serienanwendung vorzubereiten war Ziel des Projektes, wozu physico-chemische Untersuchungen, mechanische Kennwertermittlungen und Bauteilversuche dienten. Neben verbesserter Lagerstabilitaet und minimierten Haertungszyklen konnten gute Verarbeitungseingeschaften und ein Leistungsprofil nachgewiesen werden, das nahe an das heutiger Luftfahrtwerkstoffe heranreicht. Die Serienherstellung von Faserverbundbauteilen im Automobilbau ist prinzipiell moeglich, da durch die entwickelten Katalysatoren alle Vorgaben hinsichtlich Kosten, Leistungsfaehigkeit und Taktzeiten erreicht werden konnten. Hierdurch koennen sich auch fuer andere Bereiche (z.B. Geraetebau, Sportartikelindustrie) neue Anwendungsmoeglichkeiten eroeffnen. (orig.)

Das vizinhanças entre o feminino e a loucura

Directory of Open Access Journals (Sweden)

Elizabeth Cristina Landi

Full Text Available O tema da loucura feminina se apresenta frequentemente na clínica psicanalítica por meio de sujeitos neuróticos. Questiona-se neste artigo as proximidades entre psicose e a loucura que se apresenta no discurso das mulheres neuróticas. As identificações iniciais, por meio das quais a criança se aliena ao desejo do Outro, determinam certa loucura, não restrita apenas aos psicóticos. Para um sujeito do sexo feminino, que passa pelo tortuoso processo de tornar-se mulher, a loucura é uma possibilidade, pois uma mulher, por encontrar-se dividida entre o gozo masculino e o feminino, se aproxima da loucura, mas é não louca-de-todo.

Perfil das pacientes submetidas a gluteoplastia

OpenAIRE

José Horácio Costa Aboudib Júnior

2014-01-01

Durante nossas frequentes apresentações em cursos, congressos e jornadas e mesmo em nossas publicações, existiam constantes perguntas sobre o perfil dessas pacientes. O crescente interesse da mídia e das pacientes a este respeito e também a crescente procura pela cirurgia nos estimulou a realizar este trabalho. Segundo dados da Sociedade Brasileira de Cirurgia Plástica (SBPC) e da American Society of Plastic Surgery (ASPS), referem que 20.000 pacientes foram submetidas a esta cirurgia. Em 201...

Dauerhafter Zugriff auf digitale Publikationen – das DFG-Projekt NatHosting

Directory of Open Access Journals (Sweden)

Hildegard Schäffler

2015-12-01

Full Text Available Das Arbeiten mit digitalen Veröffentlichungen und Daten in Forschung, Lehre und Studium erfordert eine kontinuierliche und möglichst störungsfreie Verfügbarkeit dieser Inhalte. Bei Publikationen, die von wissenschaftlichen Fachverlagen lizenzpflichtig vertrieben werden, können verschiedene Typen von Störungsfällen wie temporäre oder längerfristige Ausfälle von Verlagsservern, der Transfer von Zeitschriftentiteln zu anderen Verlagen, das komplette Ausscheiden von Verlagen aus dem Markt oder die Abbestellung der elektronischen Ressourcen durch die lizenznehmende Einrichtung zu Zugriffsunterbrechungen führen. Das DFG-Projekt „Nationales Hosting elektronischer Ressourcen“ (NatHosting untersucht, wie unter Berücksichtigung bereits existierender Lösungsansätze eine nationale Strategie zur Absicherung des dauerhaften Zugriffs auf digitale Publikationen entwickelt werden kann. Das vom Projekt erarbeitete Lösungskonzept umfasst eine zweigleisige Strategie der Teilnahme eines nationalen Konsortiums bei Portico bei gleichzeitigem Aufbau eines „Private LOCKSS Networks“ für die durch Portico nicht abgedeckten Inhalte. Weitere Komponenten sind der Aufbau eines rechnergestützten Rechtemanagements und die Einrichtung einer „Hosting-Agentur“ mit Koordinationsaufgaben für das nationale Hosting. In order to work with digital publications and data in a reliable and sustainable way, researchers need to be sure that access to and immediate availability of the content is provided continuously and free of faults. An interruption of access to licensed content can occur for various reasons such as temporary or long-term breakdown of publishers’ servers, the transfer of journals to another publisher, the withdrawal of publishers from the market or the termination of electronic resource subscriptions by the licensee. Against the background of existing solutions, the project NatHosting (National Hosting of Electronic Resources aims at

Concepções de educadores sobre a agressividade das crianças

Directory of Open Access Journals (Sweden)

Iza Rodrigues da LUZ

2016-01-01

Full Text Available Este trabalho apresenta um estudo baseado em idéias de Winnicott sobre a agressividade. O estudo foi realizado em uma escola pública municipal de Belo Horizonte, no estado de Minas Gerais, no Brasil, com o objetivo de compreender as concepções de 7 educadores sobre a agressividade das crianças. A análise das entrevistas evidenciou concepções que relacionavam os comportamentos agressivos ao ambiente familiar das crianças sem incluir referências ao ambiente escolar na manifestação desses comportamentos. Assim, este trabalho indica a necessidade de reflexões mais sistemáticas sobre o papel da escola e dos educadores no desenvolvimento socioafetivo das crianças. Palavras-chave: agressividade, educadores, crianças. This work presents a study based on Winnicott’s ideas on aggressiviness. The study was carried in a public municipal school in Belo Horizonte in the state of Minas Gerais in Brazil, whose purpose was to understand 7 educators’ conceptions about children´s aggressiviness. The analysis of the interviews showed conceptions of aggressiviness that relate children’s behavior to their family environment only. There were no reflections on the school environment in the manifestation of the children’s aggressive behavior. Thus, this work indicates a need for more systematic reflections on the role of the school and attitudes by the educators in the social-emotional development of children. Keywords: aggressiviness, educators, children.

Morphological diversity of fish along the rio das Velhas, Minas Gerais, Brazil

Directory of Open Access Journals (Sweden)

Nara Tadini Junqueira

Full Text Available The rio das Velhas, located in central Minas Gerais State (Brazil, is a major tributary of the rio São Francisco. Despite several anthropogenic pressures, this basin supports more than 115 fish species. The aim of this study was to compare the morphological space occupied by fish assemblages in four regions (headwaters, upper, middle, and lower course along the channel of the rio das Velhas. We try to answer the following question: Is there a change in the morphological organization of the fish along the longitudinal gradient of the river? Individuals from 67 species, collected at several sites in the basin from 1999 to 2008, were measured for 11 morphological attributes related to swimming behavior and habitat use. Through the graphs, the first two dimensions of the PCA suggest that the morphological volume occupied by the headwaters region is smaller than the other sections, because of the low richness of the site. However, morphological hypervolumes of the four reaches analyzed by Euclidean distances were not statistically different. The results indicated that only the density of morphological types increases along the rio das Velhas, and there is no difference between the headwaters and upper courses. Therefore, in order to use functional groups related to the morphology of the species as tools to take measures for the conservation and revitalization of the rio das Velhas, it is necessary analyze the density of species within these groups, as well as their composition.

Entrprise Risk Management : Das COSO-ERM-Framework

OpenAIRE

Ruud, Flemming; Sommer, Katerina

2006-01-01

Das Enterprise Risk Management (ERM) ist ein wichtiges Element der Corporate Governance. Es kann Unternehmen bei der Zielerreichung unterstützen, indem es hilft, Chancen und Risiken zu erkennen und geeignete Massnahmen zu ergreifen. Die Weiterentwicklung des Internal-Control-Framework zu einem Enterprise-Risk-Management-Framework, dessen Grund sätze, Ziele und Komponenten, dessen Nutzen und Grenzen sowie die Unterschiede zum ursprünglichen COSO-ICFramework ist Gegenstand dieses Artikels.

Reproductive toxicity of a mixture of regulated drinking-water disinfection by-products in a multigenerational rat bioassay

Science.gov (United States)

BACKGROUND:Trihalomethanes (THMs) and haloaretic acids (HAAs) are regulated disinfection by-products (DBPs); their joint reproductive toxicity in drinking water is unknown.OBJECTIVE: We aimed to evaluate a drinking water mixture of the four regulated THMs and five regulated HAAs ...

Mapeamento das competências gerenciais necessárias aos gerentes das unidades de informação dos tribunais superiores do poder judiciário brasileiro

Directory of Open Access Journals (Sweden)

Larissa Amorim Catunda Sampaio

2015-06-01

Full Text Available O objetivo da pesquisa foi mapear as competências gerenciais necessárias aos gerentes das unidades de informação (UI dos Tribunais Superiores do Poder Judiciário Brasileiro. Para o embasamento teórico, o enfoque sistêmico foi utilizado como base para a compreensão do ambiente organizacional em que as UIs atuavam, ao considerar o sistema organizacional maior (Poder Judiciário, os sistemas organizacionais intermediários (Tribunais Superiores e os sistemas organizacionais específicos (UI. A abordagem foi qualitativa e também quantitativa para complementação da análise dos dados coletados. A pesquisa de campo foi divida em duas partes. A primeira visava analisar os sistemas organizacionais para descrever o contexto ambiental, definir as características das UIs e identificar as competências organizacionais das UI e as competências gerenciais necessárias ao cumprimento de suas competências organizacionais. As técnicas utilizadas na primeira parte da pesquisa de campo foram análise documental, observação de websites e entrevistas para coletar junto aos gerentes os dados sobre as competências gerenciais que eles possuíam e julgavam necessárias. Na segunda parte foram validadas as competências gerenciais identificadas na primeira etapa da pesquisa de campo, por meio de questionários enviados a especialistas selecionados segundo critérios pré-determinados. As competências identificadas foram classificadas de acordo com os conhecimentos, habilidades e atitudes dos gerentes. Um total de 92 sentenças de competência gerencial foi validado pelos especialistas como necessárias aos gerentes das UI dos Tribunais Superiores, o que possibilitou o mapeamento final. Por fim, foram apresentadas a conclusão e as recomendações e sugestões para estudos futuros.

Gestão por processo e autonomia das equipes de trabalho

OpenAIRE

Laureto, José

2003-01-01

Dissertação (mestrado) - Universidade Federal de Santa Catarina, Centro Tecnológico. Programa de Pós-Graduação em Engenharia de Produção. Este estudo teve por objetivo avaliar a autonomia de ação das equipes de processo para o atendimento das demandas dos clientes, com base na abordagem da organização orientada para processos. O alcance desse objetivo geral impôs o desenvolvimento de três outros específicos: 1) caracterização da organização e descrição do seu modelo de gestão; 2) descrição...

Prevalencia de caídas en ancianos de la comunidad: factores asociados

OpenAIRE

Castro Martín, Estrella

2011-01-01

Objetivo. Conocer la prevalencia de caídas en personas mayores, sus características, consecuencias y factores asociados.Diseño. Estudio descriptivo transversal por entrevista personal. Emplazamiento. Tres Zonas Básicas de Salud de Córdoba. Participantes. 362 personas de 70 ó mas años, residentes en la comunidad, elegidas por muestreo polietápico. Mediciones. Se realizó una valoración consistente en el estudio de las caídas con un cuestionario específico de la OMS, y de su calidad de vida, con...

A preliminary psychometric evaluation of Music in Dementia Assessment Scales (MiDAS)

DEFF Research Database (Denmark)

McDermott, Orii; Orgeta, Vasiliki; Ridder, Hanne Mette Ochsner

2014-01-01

despite the small sample size. Future research with a larger sample size could provide a more in-depth psychometric evaluation, including further exploration of the underlying factors. MiDAS provides a measure of engagement with musical experience and offers insight into who is likely to benefit on other......Background: Music in Dementia Assessment Scales (MiDAS), an observational outcome measure for music therapy with people with moderate to severe dementia, was developed from qualitative data of focus groups and interviews. Expert and peer consultations were conducted at each stage of the scale...

Waste free drilling; Das abfallfreie Bohrkonzept

Energy Technology Data Exchange (ETDEWEB)

Hofstaetter, H. [Rohoel-Aufsuchungs AG, Wien (Austria)

2001-07-01

After several years of preparatory research and in cooperation with several universities and organisations, Rohloel-Aufsuchungs AG were successful in recycling not only the flushings but also the cuttings of the drilling process, i.e. there is no need for dumping the residues. This is important as the regional authorities in that region are highly reluctant to grant permits for constructing new landfills, owing to the fact that it is a region of freshwater reserves for a large part of Europe and also a region much frequented by tourists. The 'waste-free drilling concept' has been applied for almost one year now. Further optimisation measures are projected. [German] Der Rohoel-Aufsuchungs AG ist es nach mehrjaehrigen Vorarbeiten gemeinsam mit verschiedenen Universitaeten und Institutionen gelungen, nicht nur die gesamte Bohrspuelung sondern auch die im Zuge des Bohrprozesses anfallenden Cuttings einer vollstaendigen Wiederverwertung zuzufuehren: Durch eine triviale Veraenderung des Spuelungschemismus, die den vollstaendigen Ersatz von Kaliumchlorid durch Kaliumkarbonate vorsieht, konnte das Bohrklein vom ''Abfall'' zum ''Wirtschaftsgut'' augewertet werden. Mit diesem entscheidenden Schritt wird der Bau neuer Borschlammdeponien ueberfluessig, deren behoerdliche Genehmigung ohnehin als unwahrscheinlich angesehen werden muss, zumal in dieser Region Grundwasserreserven fuer einen Teil Europas liegen und der Tourismus zur Haupteinnahmequelle dieses Gebietes zaehlt. Das ''abfallfreie Bohrkonzept'' wird bei der Rohoel-Aufsuchungs AG seit nahezu einem Jahr erfolgreich umgesetzt. Weitere Optimierungsschritte sind noch geplant. (orig.)

A circulação das teorias feministas e os desafios da tradução

Directory of Open Access Journals (Sweden)

Claudia de Lima Costa

2013-11-01

Full Text Available http://dx.doi.org/10.1590/S0104-026X2013000200009 Neste ensaio exploramos as especificidades das viagens e traduções das teoriasfeministas a partir das mediações exercidas pelas revistas e periódicos científicos. Discutimoscomo um cânone feminista é construído por um mercado de citação transnacional e concluímoscom alguns exemplos de como abrir espaços nas publicações para outros saberes feministasa partir de práticas contratradutórias.

Is DAS28-CRP with three and four variables interchangeable in individual patients selected for biological treatment in daily clinical practice?

DEFF Research Database (Denmark)

Madsen, Ole Rintek

2011-01-01

DAS28 is a widely used composite score for the assessment of disease activity in patients with rheumatoid arthritis (RA) and is often used as a treatment decision tool in the daily clinic. Different versions of DAS28 are available. DAS28-CRP(3) is calculated based on three variables: swollen...... and tender joint counts and CRP. DAS28-CRP(4) also includes patient global assessment. Thresholds for low and high disease activity are the same for the two scores. Based on the Bland-Altman method, the interchangeability between DAS28-CRP with three and four variables was examined in 319 RA patients...... selected for initiating biological treatment. Data were extracted from the Danish registry for biological treatment in rheumatology (DANBIO). Multiple regression analysis was used to assess the predictability of the DAS28 scores by several measures of disease activity. The overall mean DAS28-CRP was 4...

Successful pipeline installation for Parque das Conchas development; Subsea installation

Energy Technology Data Exchange (ETDEWEB)

Bartz, Cesar

2010-07-01

Subsea 7 has successfully delivered again in Brazilian deep-waters. The subsea engineering and construction company has recently completed pipeline installation activities for the Parque das Conchas (BC-10) development, offshore Brazil. (AG)

O papel das marcas nas dinâmicas sociais online: análise da presença das marcas concorrentes Pepsi e Coca-Cola, no facebook em Portugal

OpenAIRE

Mariano, Ana Filipa Costa

2016-01-01

presente dissertação pretende analisar a presença das marcas de grande consumo na rede social Facebook em Portugal, tendo por base o case study das marcas concorrentes Pepsi e Coca-Cola enquanto representantes do setor. A presença de marcas nas redes sociais é um tema atual, que levanta questões quanto à sua relevância e aceitação pelos utilizadores. Esta investigação permite-nos perceber a forma como os consumidores vêm esta situação, assim como, compreender quais as motivações que os lev...

Coronavírus em codornas: ocorrência, diversidade molecular e estudo do papel epidemiológico das codornas como reservatório para a bronquite infecciosa das galinhas

OpenAIRE

Carolina Torres Alejo

2012-01-01

Este estudo teve como objetivo pesquisar a ocorrência e diversidade molecular de coronavírus aviários em codornas e galinhas criadas nas mesmas propriedades e determinar o papel epidemiológico das codornas na bronquite infecciosa das galinhas (BIG). Para isso, foram coletados em granjas localizadas no estado de São Paulo e Espírito Santo pools de aparelho reprodutivo, pulmões, rins, traquéia e conteúdo entérico de codornas e galinhas com histórico de manifestações clínicas compatíveis com BIG...

Contribuições das teorias institucionais para o estudo de subsidiárias de corporações multinacionais

Directory of Open Access Journals (Sweden)

Takeyoshi Imasato

Full Text Available Este ensaio destaca, inicialmente, as contribuições dos Estudos Organizacionais para o entendimento das corporações multinacionais. Em decorrência da capacidade de influenciar os demais atores nos âmbitos local, nacional, regional, internacional e transnacional, as multinacionais desafiam as abordagens tradicionais de estudos organizacionais seguidas por pesquisadores da área de Gestão Internacional. A seguir, o ensaio explora as possibilidades e os limites das abordagens de teoria institucional para o entendimento das subsidiárias de corporações multinacionais. Esse aporte teórico pode auxiliar tanto no estudo dessas empresas quanto da natureza das diferenças entre as instituições nos diversos países de operação, por possibilitarem a análise simultânea de múltiplos contextos institucionais simultaneamente. Como resultado, o ensaio contribui para o desenvolvimento teórico das interfaces entre as áreas de Estudos Organizacionais e de Gestão Internacional, principalmente, no que se refere às investigações que enfatizem o papel estratégico das subsidiárias.

Psicose e esquizofrenia: efeitos das mudanças nas classificações psiquiátricas sobre a abordagem clínica e teórica das doenças mentais

Directory of Open Access Journals (Sweden)

Fernando Tenório

Full Text Available Resumo Abordam-se as mudanças nos sistemas de classificação diagnóstica das doenças mentais, em especial o enfraquecimento conceitual da categoria “psicose” e a dominância da esquizofrenia como psicose única. As classificações atuais priorizam uma abordagem fisicalista da patologia mental. Ocorrem, então, a medicalização das condições antes associadas à neurose e à subjetividade; a localização de quadros antes reconhecidos como psicóticos na rubrica dos transtornos de personalidade; e a redução da psicose à esquizofrenia, abordada como deficit das funções psíquicas. Aponta-se a validade clínica e operatória da noção de “psicose” como categoria nosográfica que permite abordagem mais complexa da “esquizofrenia”, última noção, na psiquiatria, com o peso simbólico da loucura.

LITERATURA INDÍGENA CONTEMPORÂNEA: O ENCONTRO DAS FORMAS E DOS CONTEÚDOS NA POESIA E PROSA DO I SARAU DAS POÉTICAS INDÍGENAS

Directory of Open Access Journals (Sweden)

DEBORAH GOLDEMBERG

2010-06-01

Full Text Available RESUMO: Analisando as formas e conteúdos das apresentações dos índios e escritores indígenas contemporâneos no I Sarau das Poéticas Indígenas, este artigo trata da dificuldade de abordagens mais tradicionais da teoria dos gêneros em abarcar as narrativas indígenas e analisa como esta “crise” contribui para a ampliação das abordagens ocidentais e hierárquicas. Num palco aberto para a expressão contemporânea indígena, que é o Sarau, são os conceitos de performance e estórias contadas, com função social de manutenção datradição, aprendizado continuado e transformação, que melhor definem esta expressão indígena. ABSTRACT: By analyzing the forms and contents of the presentations made by indigenous performers and writers at the I Literary Party of Indigenous Poetics, this article exposes the challenges faced by traditional genre theories in tackling indigenous narratives and analyses how this “crisis” contributes to widening hierarchical and Western biased conceptions. On a stage open to contemporary indigenous expression, as is the literary party, the concepts ofperformance and storytelling, with the social function of maintaining tradition, continuous learning and transformation, better define this indigenous expression.

BREXIT: o chá das cinco serve-se em Bruxelas à mesa das negociações

OpenAIRE

Xavier, Ana Isabel

2017-01-01

A 23 de Janeiro de 2013 David Cameron faz uma promessa: se saísse vencedor das eleições de 2015 referendaria a permanência do Reino Unido na União Europeia. A promessa não só foi cumprida como politicamente legitimada por uma maioria absoluta. Mais tarde, diria também que, caso perdesse o referendo, não abandonaria Downing Street e acionaria de imediato o art. 50 do Tratado de Lisboa, responsabilizando-se direta e pessoalmente pelas negociações com as instituições europeias. Cameron sabia que...

Necessidades básicas das esposas de pacientes infartados na fase aguda do tratamento

Directory of Open Access Journals (Sweden)

Edna Ikumi Umebayashi Takahashi

1990-12-01

Full Text Available Trata-se de um estudo exploratório que teve por finalidade as necessidades básicas das esposas de pacientes infartados, na fase aguda do tratamento. Foi utlizado como referencial para análise os conceitos de Nacessidades Básicas de MASLOW. Os resultados permitiram identificar como principais necessidades afetadas das esposas: segurança, amor e gregária, estima.

Necessidades básicas das esposas de pacientes infartados na fase aguda do tratamento

Directory of Open Access Journals (Sweden)

Edna Ikumi Umebayashi Takahashi

Full Text Available Trata-se de um estudo exploratório que teve por finalidade as necessidades básicas das esposas de pacientes infartados, na fase aguda do tratamento. Foi utlizado como referencial para análise os conceitos de Nacessidades Básicas de MASLOW. Os resultados permitiram identificar como principais necessidades afetadas das esposas: segurança, amor e gregária, estima.

Enterprise Risk Management : Das COSO-ERM-Framework

OpenAIRE

Ruud, Flemming; Sommer, Katerina

2006-01-01

Das Enterprise Risk Management (ERM) ist ein wichtiges Element der Corporate Governance. Es kann Unternehmen bei der Zielerreichung unterstützen, indem es hilft, Chancen und Risiken zu erkennen und geeignete Massnahmen zu ergreifen. Die Weiterentwicklung des Internal-Control-Framework zu einem Enterprise-Risk-Management-Framework, dessen Grund sätze, Ziele und Komponenten, dessen Nutzen und Grenzen sowie die Unterschiede zum ursprünglichen COSO-ICFramework ist Gegenstand dieser Ausführunge...

Das CARNOTsche Paradigma und seine erkenntnistheoretischen Implikationen

Science.gov (United States)

Schöpf, Hans-Georg

Der vorliegende historisch-kritische Essay führt die Eigentümlichkeiten der klassischen phänomenologischen Thermodynamik auf das von CARNOT geschaffene Paradigma zurück und greift einige damit zusammenhängende Fragen auf.Translated AbstractCARNOT's Paradigm and its Epistemological ImplicationsThe present historic-critical essay traces the pecularities of classical phenomenological thermodynamics back to the paradigm, created by CARNOT, and takes up some questions to which this paradigm gives rise.

O PAPEL DAS CAPTURAS FLUVIAIS NA MORFODINÂMICA DAS BORDAS INTERPLANÁLTICAS DO SUDESTE DO BRASIL

Directory of Open Access Journals (Sweden)

Luis Felipe Soares Cherem

2014-04-01

Full Text Available No sudeste do Brasil, principalmente no Estado de Minas Gerais, são observados planaltos escalonados drenados por diferentes bacias hidrográficas, muitas vezes separadas entre si por nítidos degraus morfológicos resultantes da diferença no potencial erosivo de suas cabeceiras de drenagem, como resposta à tectônica distensiva cenozoica. Adicionalmente, capturas fluviais que condicionam a rede de drenagem a buscar um novo perfil de equilíbrio e alteram a morfologia dos canais envolvidos (captor, capturado, decaptado e afluentes diretos são frequentes. Esse artigo apresenta o papel de três grandes capturas fluviais (Capturas de São Vicente de Paula, de Carandaí e de Vilas-Boas na morfodinâmica de três bordas interplanálticas entre as quatro mais importantes bacias hidrográficas do sudeste do Brasil: são Francisco, Doce, Paraná e Paraíba do Sul.  A análise inicial com base em material cartográfico (cartas topográficas, geológicas e geomorfológicas e os trabalhos de campo, com descrição dos canais envolvidos mostraram que as três capturas analisadas apresentam características diferentes: 1 em Vilas-Boas a crista da escarpa se encontra na posição original e as alterações na paisagem se limitam aos vales, com incisão de 2,5m, até 1 km à montante do ponto de captura; 2 em Carandaí a crista da escarpa já se encontra recuada a cerca de 1,5 km do ponto de captura, que foi rebaixado em100 m, e as alterações atingem os 3 km de distância desse ponto; e 3 em São Vicente a crista da escarpa já se encontra recuada a cerca de 3,5 km do ponto de captura, que foi rebaixado em 250m (atingindo o planalto inferior e as alterações atingem 8km de distância desse ponto.   Estes resultados demonstram a influência das capturas fluviais na morfodinâmica das bordas interplanálticas do sudeste do Brasil. As capturas aceleram a morfodinâmica do processo de recuo das escarpas, onde as áreas capturadas são dissecadas e

EFEITOS DAS IFRS NO CONSERVADORISMO CONTÁBIL: UM ESTUDO EM COMPANHIAS ABERTAS DOS PAÍSES MEMBROS DO GLENIF

Directory of Open Access Journals (Sweden)

Antônio Carlos Brunozi Júnior

2015-12-01

Full Text Available É compreensível que devido a relevância dos relatórios contábeis e sua maior importância com a adoção das IFRS haja nas empresas uma preocupação com os fatores que causam interferência na sua qualidade, bem como, com os critérios utilizados na sua formação, consistência e avaliação. Dentre os fatores que exercem influencia na qualidade das informações contábeis está o conservadorismo, definido por Basu (1997 como um reconhecimento assimétrico das perdas em relação aos ganhos, se refletem as más notícias mais rapidamente do que as boas notícias. Considerando este contexto, o presente estudo tem o objetivo de avaliar as magnitudes das influências das IFRS nos níveis de conservadorismo contábil das práticas adotadas nos países membros do GLENIF, mais especificadamente, Argentina, Brasil, Chile, Colômbia, México e Peru no período de 2003 a 2013. Com uma amostra de 513 empresas e 5643 observações, aplicou-se por meio de dados em painel a equação original de Basu (1997 e, posteriormente, incluiu-se uma variável dummy considerando os efeitos da adoção das IFRS no conservadorismo. Os resultados indicaram que, mesmo com a adoção das IFRS notou-se no Brasil e no México a presença de práticas conservadoristas. Na Argentina constatou-se situação contrária, as IFRS amenizaram o conservadorismo nas empresas do país. Já no Chile, Colômbia e Peru os resultados não significativos foram insuficientes para indicarem a presença de conservadorismo após a adoção das IFRS.

Análise do uso das redes sociais em bibliotecas universitárias brasileiras

Directory of Open Access Journals (Sweden)

Adriana Ribeiro

2014-09-01

Full Text Available As redes sociais são hoje ferramentas que permitem às instituições maior interatividade e comunicação na relação empresa/cliente. Nesse sentido, as bibliotecas estão buscando se modernizar e cada vez mais utilizar a tecnologia a seu favor. Este estudo procurou analisar o uso das redes sociais por bibliotecas universitárias públicas brasileiras na prestação de serviços a seus clientes. Para isso, uma pesquisa do tipo survey foi realizada, de caráter exploratório-descritivo, usando-se um questionário on-line. A unidade de observação foram os gestores das bibliotecas, com a proposta de se descobrir como as redes sociais estão sendo exploradas para a prestação de serviços. Dentre um universo de pesquisa de cinquenta e nove bibliotecas, obteve-se uma amostra de trinta e uma. Os dados, coletados e tratados pelo software Encuestafacil, demonstraram que as bibliotecas estão seguindo a tendência de automatização e virtualização de produtos e serviços. A maioria das bibliotecas está utilizando ao menos um dos recursos da Web 2.0, avaliando como positivo o uso dos mesmos e apontando a agilidade, a interatividade e a comunicação como melhorias obtidas com o uso das redes sociais. Com base nos resultados foi proposta uma classificação das bibliotecas tendo como referência o uso das novas tecnologias, obtendo-se quatro grupos. Constatou-se que o maior grupo oferece os serviços na web em um período que varia entre um e três anos, possui um maior leque de oferta de serviços, mas que ainda não fazem a atualização diária de seus perfis nas redes sociais. Por fim, sugestões para novos estudos foram feitas.

Bingo das Ervilhas

Directory of Open Access Journals (Sweden)

Luciana Bonato Lovato

2016-12-01

Full Text Available Este artigo analisa a utilização de um jogo didático sobre conteúdos de Genética ministrados no Ensino Fundamental. O material utilizado foi elaborado a partir da literatura existente e trabalhado sob a forma de uma oficina ministrada a professores de Ensino Fundamental e Médio de escolas de abrangência da 4a. Coordenadoria Regional de Educação do Rio Grande do Sul. A oferta desta oficina partiu do pressuposto de que os jogos educacionais são uma importante estratégia no processo de ensino-aprendizagem por se tratarem de uma ferramenta facilitadora nas aulas de Ciências, uma vez que contribuem para a aprendizagem de conceitos e termos complexos de maneira lúdica e estimulam o desenvolvimento das competências dos educandos. Todos os participantes consideraram que a oficina realizada contribuirá para sua prática docente, e acreditam que os jogos didáticos oferecem experiências de aprendizado que contribuem para construção do conhecimento.

The SeaDAS Processing and Analysis System: SeaWiFS, MODIS, and Beyond

Science.gov (United States)

MacDonald, M. D.; Ruebens, M.; Wang, L.; Franz, B. A.

2005-12-01

The SeaWiFS Data Analysis System (SeaDAS) is a comprehensive software package for the processing, display, and analysis of ocean data from a variety of satellite sensors. Continuous development and user support by programmers and scientists for more than a decade has helped to make SeaDAS the most widely used software package in the world for ocean color applications, with a growing base of users from the land and sea surface temperature community. Full processing support for past (CZCS, OCTS, MOS) and present (SeaWiFS, MODIS) sensors, and anticipated support for future missions such as NPP/VIIRS, enables end users to reproduce the standard ocean archive product suite distributed by NASA's Ocean Biology Processing Group (OBPG), as well as a variety of evaluation and intermediate ocean, land, and atmospheric products. Availability of the processing algorithm source codes and a software build environment also provide users with the tools to implement custom algorithms. Recent SeaDAS enhancements include synchronization of MODIS processing with the latest code and calibration updates from the MODIS Calibration Support Team (MCST), support for all levels of MODIS processing including Direct Broadcast, a port to the Macintosh OS X operating system, release of the display/analysis-only SeaDAS-Lite, and an extremely active web-based user support forum.

REPUTAÇÃO E QUALIDADE DA GOVERNANÇA CORPORATIVA DAS COMPANHIAS ABERTAS BRASILEIRAS

Directory of Open Access Journals (Sweden)

Leticia Cesar de Lima

2015-06-01

Full Text Available Considerando o inter-relacionamento das temáticas reputação, responsabilidade social e governança corporativa, definiu-se como objetivo da pesquisa analisar a relação entre a reputação corporativa, sob a ótica da sustentabilidade, e a qualidade da governança corporativa das maiores companhias abertas do Brasil. De natureza quantitativa, o estudo descritivo analisou Formulários de Referência e Relatórios Anuais de 2011, e informações dos websites das 100 empresas da amostra. As empresas foram segregadas em dois grupos (1: Com Reputação e 2: Sem Reputação, a partir da participação ou não no ranking das empresas mais sustentáveis segundo a mídia, proxy para reputação. Para a avaliação da associação entre reputação e governança foram utilizados os testes do qui-quadrado de Pearson e de Mann-Whitney. Fundamentado nos resultados dos testes aplicados na amostra, nenhuma evidência pode ser inferida sobre a relação entre a reputação e a qualidade da governança corporativa, contrariando as indicações da literatura corrente sobre o assunto.

Minimização da erosão em função do tamanho e localização das áreas de floresta no contexto do programa "conservador das águas"

Directory of Open Access Journals (Sweden)

Cornélio Alberto Zolin

2011-12-01

Full Text Available Com os crescentes conflitos de uso da água no Brasil, a implantação de políticas para a mitigação desses problemas tornou-se crucial. Nesse sentido, o conceito de Pagamentos por Serviços Ambientais (PSA tem se difundido ao redor do mundo e, consequentemente, no Brasil. O município de Extrema, em Minas Gerais, implantou a primeira iniciativa municipal brasileira de PSA, conhecida como programa "Conservador das Águas". Neste trabalho, objetivou-se avaliar a perda de solo na sub-bacia das Posses, onde se iniciou o programa "Conservador das Águas", visando determinar a potencialidade que o conceito adotado nesse programa terá para a conservação do solo e otimizar o provimento desse serviço ambiental em função do tamanho e da localização da área de floresta. Quatorze diferentes cenários de uso e cobertura do solo foram analisados, utilizando-se um Sistema de Informações Geográficas e a Revised Universal Soil Loss Equation. A expectativa de perda de solo na sub-bacia das Posses antes e após a implementação do programa "Conservador das Águas" foi de 30,63 e 7,06 Mg ha-1 ano-1, respectivamente. A otimização da conservação do solo pode ser feita adotando-se práticas conservacionistas na pastagem e alocando-se a área de floresta de maneira mais otimizada.

Sensibilidade as catecolaminas dos atrios direitos das ratas : influencia das fases do ciclo estral e do "stress"

OpenAIRE

Monica Luiza Viegas Rodrigues

1993-01-01

Resumo: Os objetivos deste trabalho foram: analisar a sensibilidade ao efeito cronotrópico da isoprenalina, noradrenalina e adrenalina de átrios direitos isolados de ratas normais, em cada uma das fases do ciclo estral, ou após 50 minutos de natação, durante o estro ou o diestro; correlacionar as alterações de sensibilidade com as fases do ciclo estral e/ou com os níveis plasmáticos de corticosterona. Utilizamos ratas adultas, Wistar, normais, sedentárias, ou imediatamente após 50 min de nata...

Governo das sociedades, custos de agência e crise financeira: que relação?

Directory of Open Access Journals (Sweden)

Catarina Alexandra Alves Fernandes

2014-03-01

Full Text Available O debate sobre o governo das sociedades tem ganhado crescente relevo nos meios acadêmico e empresarial desde o fim da década de 1980. Esse maior destaque foi originado por diversos fatores, dos quais se salientam a crise na Ásia, os escândalos financeiros que assolaram grandes empresas cotadas norte-americanas e algumas empresas de auditoria e, mais recentemente, a crise financeira mundial. Embora há muito defendida a necessidade de aperfeiçoar os instrumentos existentes e de descobrir novos mecanismos, de modo a encontrar um sistema de governo das sociedades que minimize os custos de agência, a crise financeira mundial com origem nos EUA veio dar-lhe novo “fôlego”. E, agora, com especial ênfase na banca. Falhas no governo das sociedades, em particular no setor bancário, têm sido apontadas como culpadas pela crise financeira global iniciada em 2007, só comparável à Grande Depressão. Assim, este artigo pretende, em primeiro lugar, apresentar uma caracterização genérica dos mecanismos de governo das sociedades, integrando no estudo os denominados custos de agência e, em seguida, analisar tais mecanismos no setor bancário, estabelecendo uma relação entre eles e a crise financeira. A pesquisa efetuada permite demonstrar a importância dos instrumentos de governo das sociedades na minimização dos custos de agência, nomeadamente no contexto da crise financeira. Ainda que o setor bancário tenha as suas especificidades, a investigação feita indica que existe uma relação entre aqueles instrumentos e a performance dos bancos e que fragilidades no governo das sociedades determinaram em larga medida a crise financeira. 

Relação entre o investimento social corporativo e o valor das empresas brasileiras

Directory of Open Access Journals (Sweden)

Annor da Silva Junior

2010-08-01

Full Text Available Este estudo tem por objetivo investigar a existência de relação entre os investimentos sociais corporativos e o valor das empresas listadas na Bolsa de Valores de São Paulo (Bovespa e que publicam balanço social no Instituto Brasileiro de Análises Sociais e Econômicas (Ibase, mais especificamente, identificando se empresas que investem sistematicamente em responsabilidade social têm seu valor potencializado ou diminuído. Os resultados encontrados não evidenciaram que investimentos em práticas de responsabilidade social acarretam um melhor ou pior desempenho no valor de mercado das empresas. Encontrou-se relação não significativa entre a variável de controle tamanho da empresa e o q de Tobin em empresas com investimentos sociais corporativos. Encontrou-se relação negativa entre alguns setores de mercado e o valor das empresas representados pelo q de Tobin. Foi confirmado por esta pesquisa a relação positiva entre o tamanho das empresas e o valor dos investimentos sociais corporativos.

EDUCAÇÃO DAS RELAÇÕES ÉTNICO-RACIAIS NA EDUCAÇÃO INFANTIL

Directory of Open Access Journals (Sweden)

Daniela da Costa Britto Pereira Lima

2017-04-01

Full Text Available Este trabalho foi desenvolvido com o objetivo de compreender e analisar as repercussões da implementação das leis n°10.639/03 e n°11.645/08 em ações pedagógicas desenvolvidas e registradas em instituições de Educação Infantil numa Rede Municipal de Educação. Desta forma, realizou-se pesquisa qualitativa do tipo bibliográfica e documental. Apresentou-se o percurso histórico e legal da educação infantil e das relações étnico-raciais para analisar sistematizações de projetos institucionais, projetos de trabalho e relatórios mensais das instituições participantes da pesquisa. Os dados analisados mostraram que as instituições têm realizado progressos na promoção da educação das relações étnico-raciais, porém, sinalizam a necessidade de formação para que os profissionais possam qualificar ainda mais as ações pedagógicas realizadas.

O livro das pequenas coisas

Directory of Open Access Journals (Sweden)

Alckmar Santos

2016-12-01

Full Text Available http://dx.doi.org/10.5007/1807-9288.2016v12n2p209 O livro das pequenas coisas foi produzido a partir da oficina “Criação poética digital” ministrada pelo coletivo formado por Nupill, 1maginári0: poéticas computacionais e Ateliê Ciclope de arte e publicação digital durante o VI Simpósio Internacional e VIII Simpósio Nacional de Literatura e Informática, realizado na Universidade de Passo Fundo entre os dias 9 e 11 de novembro de 2016. Atualmente está disponível na internete em http://ciclope.com.br/livrocoisas/.

Atresia das vias biliares extra-hepáticas: conhecimentos atuais e perspectivas futuras

OpenAIRE

Carvalho,Elisa de; Ivantes,Cláudia Alexandra Pontes; Bezerra,Jorge A.

2007-01-01

OBJETIVOS: Apresentar uma revisão atualizada sobre atresia das vias biliares extra-hepáticas, com ênfase em etiopatogenia, abordagens diagnósticas e terapêuticas e prognóstico. FONTES DOS DADOS: Foram selecionadas pelos sites de busca médica (MEDLINE e PubMed) pesquisas relacionadas à atresia biliar, utilizando as seguintes palavras-chave: biliary atresia,etiopathogenesis, diagnosis, treatment, prognosis, children. SÍNTESE DOS DADOS A atresia das vias biliares extra-hepáticas é a principal in...

Wage-led ou profit-led? Análise das estratégias de crescimento das economias sob o regime de metas de inflação, câmbio flexível, mobilidade de capitais e endividamento externo

Directory of Open Access Journals (Sweden)

Flávio A. C. Basilio

2015-04-01

Full Text Available Neste artigo apresentamos um modelo macrodinâmico de inspiração pós-keynesiana com o objetivo de analisar os efeitos da abertura da conta de capitais sobre a performance macroeconômica das economias em desenvolvimento. Neste particular, os exercícios de estática comparativa mostram que um aumento do endividamento externo pode ter efeitos benéficos para a economia no curto prazo, uma vez que induz o aumento do grau de utilização da capacidade produtiva e da taxa de crescimento do estoque de capital. No entanto, a dinâmica de longo prazo mostra que, sob certas condições, o acesso ao mercado internacional de capitais pode gerar trajetórias explosivas para o sistema econômico, notadamente em um contexto em que a política monetária é conduzida com base em um regime de metas de inflação. Além disso, demonstra-se que uma redução da meta de inflação perseguida pelo Banco Central, dentro do contexto de abertura da conta de capitais e de captação externa por parte das empresas, pode gerar um aumento permanente da taxa real de juros, bem como um aumento do próprio custo do endividamento externo da economia contribuindo, assim, para uma maior fragilidade externa. Ademais, analisou-se a consistência das estratégias de crescimento das economias desenvolvidas e em desenvolvimento. No geral, os resultados encontrados mostram a validade da Lei de Thirlwall, de modo que o regime de crescimento das economias depende, em última análise, das restrições impostas pelas elasticidades-renda das importações e exportações.

Memórias de tradução distribuídas

OpenAIRE

Simões, Alberto; Almeida, J. J.; Gómez Guinovart, Xavier

2004-01-01

Neste documento apresenta-se o conceito de memórias de tradução distribuídas, discutindo-se o seu interesse na área da tradução, bem como as vantagens que uma ferramenta de tradução pode tirar do seu uso. É apresentada uma possível implementação de memórias de tradução distribuídas usando WebServices numa arquitectura de cooperativismo. São definidos as mensagens (API) que um serviço deste género deve implementar para que uma ferramenta de tradução possa tirar partido da colaboração entre tra...

Geological and geophysical characterization of the Rio das Velhas greenstone belt

International Nuclear Information System (INIS)

Araujo Vieira, Marcelo de; Silva, Sergio Lima da

1995-01-01

In order to obtain larger information about the high potentiality of the Greenstone belt Rio das Velhas, it has been, nowadays, the object of various geological research works, among then, the Detailed Geophysical Airborne Survey of the Rio das Velhas Project (DNPM/Mining Companies Partnership) and the Geological Mapping in the scale of 1:25.000 (DNPM/CPRM). Such initiatives have brought, by themselves, valuable contributions for better knowledge of the region. In this context, this study shows a proposal of integration of geological and geophysical data, as much quantitative as qualitative, with the aim at the maximum advantage of the obtained data for the next prospecting and geological mapping works. (author). 6 refs., 2 figs., 1 tab

Geração de energia a partir das ondas do mar

OpenAIRE

Grilo, Diogo Dinis

2013-01-01

Dado o aumento do consumo de energia e a necessidade de reduzir as emissões de poluentes para a atmosfera, o presente trabalho visa propor uma solução de produção de energia limpa a partir das ondas do mar. O objetivo desta dissertação é criar um sistema alternativo de conversão da energia cinética proveniente das ondas do mar em energia elétrica, tendo como ponto de partida o projeto do sistema pendular SEAREV. Numa primeira fase foi realizada uma análise dos sistemas de co...

Das neuroses atuais às neuroses traumáticas: continuidade e ruptura

OpenAIRE

Cardoso,Marta Rezende

2011-01-01

Analisamos as vicissitudes da neurose traumática, partindo das contribuições de Freud. Propomos uma linha de continuidade - considerando também os pontos de ruptura - entre as neuroses traumáticas e as neuroses atuais, a partir de uma releitura da dimensão de "atual" em Freud, articulada com a de compulsão à repetição. Ampliamos a compreensão das neuroses traumáticas por meio da ideia da formação de enclaves no espaço psíquico, exterioridade interna radical que tende a se fazer sempre atual p...

Hybride Lernarrangements in der universitären Weiterbildung. Das Beispiel Educational Media

Directory of Open Access Journals (Sweden)

Claudia de Witt

2003-11-01

Full Text Available Der Artikel beschreibt eine hybride Lernform, in der Online-Lernphasen mit Präsenzphasen kombiniert werden. "Educational Media" ist ein weiterbildender Masterstudiengang an der Universität Essen-Duisburg, der technische und didaktische Kenntnisse zur Medienerziehung vermittelt. Nach einer Bedarfs- und Zielgruppenanalyse wurde ein Curriculum entwickelt, das hier vorgestellt wird. Während in der Anfangszeit Präsenzphasen und Gruppenelemente (Chatforen besonders wichtig sind, steigt in späteren Phasen das Bedürfnis nach selbstgesteuerten Lernperioden. Eine intensive persönliche Betreuung durch Tutoren sowie die Anbindung an die Institution steigern die Motivation und verringern die Abbrecherquote.

Chlorination and chloramination of aminophenols in aqueous solution: oxidant demand and by-product formation.

Science.gov (United States)

Mehrez, O Abou; Dossier-Berne, F; Legube, B

2015-01-01

Chlorination and monochloramination of aminophenols (AP) were carried out in aqueous solution at 25°C and at pH 8.5. Oxidant demand and disinfection by-product formation were determined in excess of oxidant. Experiments have shown that chlorine consumption of AP was 40-60% higher than monochloramine consumption. Compared with monochloramination, chlorination of AP formed more chloroform and haloacetic acids (HAA). Dichloroacetic acid was the major species of HAA. Chloroform and HAA represented, respectively, only 1-8% and 14-15% of adsorbable organic halides (AOX) by monochloramination but up to 29% and 39% of AOX by chlorination.

Gefährlicher Trend : Smartphone im Strassenverkehr : auch zu Fuss ist das Ablenkungspotenzial sehr gross.

NARCIS (Netherlands)

2016-01-01

Viele Menschen, die sich zu Fuß im Straßenverkehr bewegen, nutzen dabei das Smartphone. Dies ist das Ergebnis einer Erhebung von DEKRA in sechs europäischen Hauptstädten. Von den rund 14.000 erfassten Personen nutzten fast 17 Prozent ihr Handy — für Textnachrichten, zum Telefonieren oder Musikhören.

Hazard assessment of three haloacetic acids, as byproducts of water disinfection, in human urothelial cells.

Science.gov (United States)

Marsà, Alicia; Cortés, Constanza; Hernández, Alba; Marcos, Ricard

2018-04-07

Disinfection by-products (DBPs) are compounds produced in the raw water disinfection processes. Although increased cancer incidence has been associated with exposure to this complex mixture, the carcinogenic potential of individual DBPs remains not well known; thus, further studies are required. Haloacetic acids (HAAs) constitute an important group among DBPs. In this study, we have assessed the in vitro carcinogenic potential of three HAAs namely chloro-, bromo-, and iodoacetic acids. Using a long-term (8 weeks) and sub-toxic doses exposure scenario, different in vitro transformation markers were evaluated using a human urothelial cell line (T24). Our results indicate that long-term exposure to low doses of HAAs did not reproduce the genotoxic effects observed in acute treatments, where oxidative DNA damage was induced. No changes in the transformation endpoints analyzed were observed, as implied by the absence of significant morphological, cell growth rate and anchorage-independent cell growth pattern modifications. Interestingly, HAA-long-term exposed cells developed resistance to oxidative stress damage, what would explain the observed differences between acute and long-term exposure conditions. Accordingly, data obtained under long-term exposure to sub-toxic doses of HAAs could be more accurate, in terms of risk assessment, than under acute exposure scenarios. Copyright © 2018. Published by Elsevier Inc.

Macht auf das Tor! - Opens the gate!

Directory of Open Access Journals (Sweden)

Claudemir de Quadros

2011-09-01

Full Text Available Macht auf das Tor! (Abra o portão foi publicado, possivelmente, na primeira metade do século 20. Editado por Max Dirkschneider, Raimund Heuler e Felix Oberborbeck, apresenta músicas, rimas, piadas, jogos e canções.A edição apresentada nesse espaço é de um livro que pertence à família de Carolina Drebes, estudante do curso de Pedagogia do Centro Universitário Franciscano, Santa Maria/RS.

Marx e Foucault: Um estudo sobre o papel da violência, das leis, do Estado e das normas na construção do operário disciplinado

Directory of Open Access Journals (Sweden)

Flávia Schilling

1997-06-01

Full Text Available Trata-se de um ensaio que apresenta uma leitura do Cap. XXIV do livro O Capital de Karl Marx, que tem como tema a chamada "acumulação primitiva" na formação do capitalismo. Deste texto recolhi as sugestões de Marx a respeito do papel da violência, da relação entre a violência, as leis e o Estado na construção desse "produto artificial da história moderna", o operário assalariado. Prolongo a análise marxista sobre estas relações com as propostas de Foucault sobre o papel das disciplinas e das normas

ANALISIS PERUBAHAN PENGGUNAAN LAHAN DAN DAMPAKNYA TERHADAP HASIL AIR DI DAS CISADANE HULU

Directory of Open Access Journals (Sweden)

Nilda Nilda

2015-08-01

Full Text Available Air merupakan salah satu kebutuhan dasar yang sangat penting bagi manusia. Terdapat beberapa faktor utama penyebab perubahan sumber daya air, diantaranya adalah perubahan penutupandan pengelolaan lahan yang meningkatkan kekedapan lahan.Salah satu tujuan pengelolaan DAS adalah mencapai kondisi tata air optimal yang dapat dikenali dari sifat aliran sungai. Penelitian ini bertujuan untuk: (1 mengetahui distribusi perubahan penggunaan lahan yang terjadi di wilayah DAS Cisadane Hulu dari tahun 2003 sampai 2010; (2 mengetahui perubahan hasil air akibat distribusi perubahan penggunaan lahan. Daerah kajian penelitian adalah DAS Cisadane Hulu dengan luasan sekitar 22.288,01 ha. Penelitian dilakukan melalui dua tahap yaitu analisis perubahan penggnaan lahan dan prediksi aliran dengan model HEC-HMS. Dalam penelitian ini digunakan peta pengunaan lahan dari BIG (Badan Informasi Geospasial tahun 2003 dan Peta Penggunaan Lahan tahun 2010 hasil interpretasi Citra ALOS. Selanjutnya kedua peta tersebut dianalisis dengan metoda tabel silang (cross tabel untuk memperoleh data perubahan penggunaan lahan dari setiap kelas penggunaannya. Kedua data series penggunaan lahan ini digunakan sebagai input pada model prediksi debit aliran HEC-HMS. Selanjutnya dibangun juga skenario-skenario untuk melihat dampak perubahan lahan terhadap debit aliran di DAS Cisadane Hulu. Metode bilangan kurva (SCS-CN dipilih untuk menghitung besar curah hujan efektif, yaitu dari pengurangan curah hujan bruto dengan berbagai bentuk kehilangan air (loss. Transformasi dari curah hujan efektif menjadi hidrograf aliran langsung (direct runoff diperoleh dengan menggunakan metode hidrograf satuan SCS Curve Number. Selama kurun waktu 2003 – 2010 terjadi perubahan penggunaan lahan di DAS Cisadane Hulu. Luas Hutan bertambah 223,78 ha, pemukiman 214,78 ha, rumput/tanah kosong 85, 73 ha, dan gedung 12, 64 ha. Terjadi penguarangan luas semak belukar 225,64 ha, tegalan/ladang 145,92 ha, sawah irigasi 124

Das Minderheitenrecht europäischer Staaten. Teil 2 / Carmen Schmidt

Index Scriptorium Estoniae

Schmidt, Carmen, 1956-

1996-01-01

Raamatuarvustus: Das Minderheitenrecht europäischer Staaten. Teil 2 / herausgegeben von Jochen Abr. Frowein, Rainer Hofmann, Stefan Oeter ; Max-Planck-Institut für ausländisches öffentliches Recht und Völkerrecht. Berlin [etc.] : Springer-Verlag, 1994

Burocratas da linha de frente: executores e fazedores das políticas públicas

Directory of Open Access Journals (Sweden)

Antonio Oliveira

2012-12-01

Full Text Available A relação entre implementação das políticas, organização e burocracia é relevante porque ela ilumina a face de um problema crucial: o porquê de políticas serem bem-sucedidas ou fracassarem. As análises dessa relação indicam que o poder discricionário dos burocratas do nível da rua é um fator decisivo na distribuição de bens e serviços públicos; portanto, a ação desses agentes é uma variável relevante para o sucesso das políticas. Este artigo pretende discutir a discricionariedade dos burocratas do baixo escalão na aplicação das políticas públicas, usando como referência os argumentos apresentados na literatura especializada da implementação, da burocracia e da organização. A conclusão assinala questões que são importantes para o controle do poder discricionário dos agentes públicos, sublinhando que essa discrição é condição necessária à execução das políticas, mas que ela ameaça a accountability e a responsiveness.

Percepções Docentes sobre o Ensino das Relações Étnico-Raciais através das Danças Circulares.

Directory of Open Access Journals (Sweden)

Gisele Maria Rodrigues Machado

2018-02-01

Full Text Available Educar para as relações étnico-raciais significa viabilizar para todos(as os(as estudantes e professores(as, independentemente de sua etnia, conhecimentos sobre a história e cultura africana e afro-brasileira pois sabemos o quanto a invisibilidade destas interfere na construção de representações sobre o negro no Brasil. Este estudo propõe uma ação pedagógica voltada para o cumprimento da lei 10.639/03 utilizando a metodologia das danças circulares na formação continuada de professores(as a partir dos valores civilizatórios afro-brasileiros, como: cooperativismo, circularidade, ludicidade, territorialidade, oralidade, religiosidade, ancestralidade, memória e energia vital. As danças circulares proporcionam momentos de cooperação, descontração e introspecção através da prática das danças de diversos povos. De acordo com os dados narrativos de 10 professores(as  que participaram da formação continuada   “Danças Circulares na formação de professores(as para as relações étnico-raciais”, observou-se que as questões sobre racismo, intolerância religiosa e  discriminação são as dúvidas e tensões mais frequentes enfrentadas em sala de aula. A utilização das danças circulares para discutir e problematizar estas temáticas foi considerada pelos(as  docentes como uma aprendizagem através do movimento, da oralidade, do acolhimento da roda, ou seja, uma atividade leve e alegre na qual é possível refletir, conhecer, ressignificar e respeitar a diversidade étnico-racial.

A encruzilhada brasileira na ordem ambiental internacional das mudanças climáticas

Directory of Open Access Journals (Sweden)

Carolina Gamba

2013-01-01

Full Text Available Este artigo apresenta um relato sobre a Décima Oitava Conferência das Partes da Convenção-Quadro das Nações Unidas sobre Mudança do Clima (COP-18, realizada entre os dias 26 de novembro e 7 de dezembro de 2012, em Doha, no Emirado do Qatar. Além disso, analisa as posições brasileiras no encontro. Para tal, baseia-se em informações obtidas no evento para analisar as posições brasileiras nas negociações da ordem ambiental internacional das mudanças climáticas. O artigo conclui que o Brasil está em uma encruzilhada: permanecer junto ao grupo G77 + China ou liderar as negociações, com os ônus que ela apresenta, diante de sua posição no sistema internacional.

Audit Committee: Um Estudo das Características das Empresas Listadas na BM&FBOVESPA

Directory of Open Access Journals (Sweden)

Milena Araújo Rego Amorim

2017-01-01

Full Text Available Objetivo: O objetivo deste estudo foi comparar as características dos comitês de auditoria de 65 empresas listadas na BM&FBovespa nos anos de 2014 e 2015, com as obtidas anteriormente nos anos de 2012 e 2013. Fundamento: O comitê de auditoria pode ser considerado um instrumento da governança corporativa, sendo formado por membros do conselho de administração, e sua composição deverá ser representada por membros independentes e especialistas na área da contabilidade ou financeira. Método: Foram investigadas a expertise, a independência e o tamanho, sendo realizado um estudo descritivo, com abordagem quantitativa e pesquisa documental. Resultados: Foi possível identificar que, em 2014, as áreas mais significativas foram engenharia, economia, administração e contabilidade, havendo poucas variações no ano de 2015. Quanto à independência dos membros, a maioria das empresas cumpriu com as boas práticas de governança corporativa, sendo que em 2014 aproximadamente 14% das empresas não atenderam a este requisito. Com mediana de 3,0 membros e médias de 3,22 em 2014 e 3,20 membros em 2015, cumpriram-se, em sua maioria, as recomendações da Comissão de Valores Mobiliários contidas na instrução n° 509, na Lei Sarbanes-Oxley e na Resolução BACEN nº 3.198/04. No que se refere ao tamanho, os resultados mostram que 49 empresas, nos anos referenciados, continham três ou mais membros em seus comitês, correspondendo, respectivamente, a 75,3% e 74,3%. Contribuições: Verificou-se que os comitês de auditoria não se apresentam de forma homogênea nas empresas e, mesmo com as recomendações de órgãos internos e da Lei Sarbanes-Oxley, apresentam-se de formas diversas.

Integrated analysis for genotypic adaptation in rice | Das | African ...

African Journals Online (AJOL)

Integrated analysis for genotypic adaptation in rice. S Das, RC Misra, MC Pattnaik, SK Sinha. Abstract. Development of varieties with high yield potential coupled with wide adaptability is an important plant breeding objective. The presence of genotype by environment (GxE) interaction plays a crucial role in determining the ...

Para politizar o mundo das coisas

Directory of Open Access Journals (Sweden)

Thiago Machado Balbi

2014-12-01

Full Text Available To politicize the world of things – This review presents A comunicação das coisas: teoria ator-rede e cibercultura [The communication of things: Actor-network theory and cyberculture], by André Lemos, raising its key aspects. In a constant dialogue with Bruno Latour's theory, and other like-minded authors, Lemos offers to Brazilian readers more than a book about cyberculture, but a deep reflection about communication and hybridization between people and things, namely, humans and non-humans, dealing with the political, ethical and pedagogical consequences of the hybrids in society.

As lições das coisas

OpenAIRE

Pimentel, Álamo

2015-01-01

Os museus constituem espaços para o ensino de antropologia. A partir de um projeto didático de antropologia da educação em um museu de antropologia de uma universidade pública brasileira, emergem importantes significados para a experiência do estranhamento etnográfico com os objetos da exposição permanente. Mediante uma análise de relatórios de visita produzidos pelos estudantes, o autor apresenta os diferentes arranjos discursivos que compõem os acervos da exposição e revela, a partir das co...

Associations Between Disinfection By-Product Exposures and Craniofacial Birth Defects.

Science.gov (United States)

Kaufman, John A; Wright, J Michael; Evans, Amanda; Rivera-Núñez, Zorimar; Meyer, Amy; Narotsky, Michael G

2018-02-01

The aim of this study was to examine associations between craniofacial birth defects (CFDs) and disinfection by-product (DBP) exposures, including the sum of four trihalomethanes (THM4) and five haloacetic acids (HAA5) (ie, DBP9). We calculated first trimester adjusted odds ratios (aORs) for different DBPs in a matched case-control study of 366 CFD cases in Massachusetts towns with complete 1999 to 2004 THM and HAA data. We detected elevated aORs for cleft palate with DBP9 (highest quintile aOR = 3.52; 95% CI: 1.07, 11.60), HAA5, trichloroacetic acid (TCAA), and dichloroacetic acid. We detected elevated aORs for eye defects with TCAA and chloroform. This is the first epidemiological study of DBPs to examine eye and ear defects, as well as HAAs and CFDs. The associations for cleft palate and eye defects highlight the importance of examining specific defects and DBPs beyond THM4.

Effect of Pre-ozonation on Haloacetic Acids Formation in Ganga River Water at Kanpur, India

Science.gov (United States)

Naladala, Nagasrinivasa Rao; Singh, Rambabu; Katiyar, Kumud Lata Devi; Bose, Purnendu; Dutta, Venkatesh

2017-11-01

Almost all natural water bodies which are considered to be sustainable sources of drinking water contain organic matter in dissolved form and pathogens. This dissolved organic matter and pathogens cannot be removed effectively through traditional filtering processes in drinking water treatment plants. Chlorination of such water for disinfection results in large amounts of disinfection by-products (DBPs), mainly trihalomethanes and haloacetic acids (HAAs), which showed many health effects like cancer and reproductive problems in lab animals and in human beings as well. Complete removal of dissolved organic carbon (DOC), which is a precursor compound for HAAs formation, is impossible from a practical point of view; hence, it will be better if DOC activity towards DBPs formation can be reduced via some process. The present article describes the process of pre-ozonating post-coagulated Ganga River water at Kanpur in a continuous flow mode and its effect on HAAs formation. Nearly 58% reduction in HAAs formation was observed during this study at higher doses of ozone.

Das Konzept des 'Medialen Habitus'

Directory of Open Access Journals (Sweden)

Sven Kommer

2013-12-01

Full Text Available Sven Kommer fragt in seinem Beitrag, inwieweit das Habitus-Konzept als Erklärungsmuster für die beobachtbare Zementierung sozialer Ungleichheit im Schulsystem greift. Dabei konstatiert der Beitrag, dass alle an der Weiterschreibung des Habitus-Konzepts beteiligten AutorInnen sich darin einig sind, dass es wichtige Beiträge für die Selbst-Aufklärung einer weitestgehend mediatisierten Gesellschaft leistet. Der Artikel geht dabei – auch angesichts der PISA-Studien – von dem empirischen Befund aus, dass die individuelle Ausprägung der Medienkompetenz aufs engste mit den Ressourcen des Elternhauses verbunden ist und sich dabei die elterlichen Formen der Medienerziehung unübersehbar mit den aktuellen medialen Handlungspraxen verbinden. Dieser Befund deckt sich auf weite Strecken auch mit den Ergebnissen der Bildungssoziologie Pierre Bourdieus, weshalb die Diskussionen zum medialen Habitus im Rahmen dieser Ausführungen auch mit empirischen Argumenten unterfüttert werden. Ganz in diesem Sinne arbeitet der Artikel auch heraus, dass die aus dem Kontext der Cultural Studies stammenden Thesen zur Nivellierung kultureller Milieu-Unterschiede wenig empirisch fundiert sind. Der Artikel betont dahingehend, dass hier eine unreflektierte Infiltration durch genuin neoliberales Gedankengut vorliegt, da mit ihr auch die Annahme einer "freien Wahl" von Lebensweg, Milieuzugehörigkeit oder Gender verbunden werden kann. Dabei wir auch eingehend der "Clash of Habitus" diskutiert, der zwischen Lehrenden und Lernenden stattfindet und das Augenmerk ein Mal mehr auf die Tatsache lenkt, das unser Bildungssystem auf dieser pädagogisch relevanten Ebene durch soziale Ungleichheiten gekennzeichnet ist. In his essay, Sven Kommer questions whether the notion of habitus is suitable to support the understanding of the obvious consolidation of inequality in the school system. He shows that all authors active in the continued use of the notion of habitus agree that it

Novel pandemic influenza A(H1N1 viruses are potently inhibited by DAS181, a sialidase fusion protein.

Directory of Open Access Journals (Sweden)

Gallen B Triana-Baltzer

2009-11-01

Full Text Available The recent emergence of a novel pandemic influenza A(H1N1 strain in humans exemplifies the rapid and unpredictable nature of influenza virus evolution and the need for effective therapeutics and vaccines to control such outbreaks. However, resistance to antivirals can be a formidable problem as evidenced by the currently widespread oseltamivir- and adamantane-resistant seasonal influenza A viruses (IFV. Additional antiviral approaches with novel mechanisms of action are needed to combat novel and resistant influenza strains. DAS181 (Fludase is a sialidase fusion protein in early clinical development with in vitro and in vivo preclinical activity against a variety of seasonal influenza strains and highly pathogenic avian influenza strains (A/H5N1. Here, we use in vitro, ex vivo, and in vivo models to evaluate the activity of DAS181 against several pandemic influenza A(H1N1 viruses.The activity of DAS181 against several pandemic influenza A(H1N1 virus isolates was examined in MDCK cells, differentiated primary human respiratory tract culture, ex-vivo human bronchi tissue and mice. DAS181 efficiently inhibited viral replication in each of these models and against all tested pandemic influenza A(H1N1 strains. DAS181 treatment also protected mice from pandemic influenza A(H1N1-induced pathogenesis. Furthermore, DAS181 antiviral activity against pandemic influenza A(H1N1 strains was comparable to that observed against seasonal influenza virus including the H274Y oseltamivir-resistant influenza virus.The sialidase fusion protein DAS181 exhibits potent inhibitory activity against pandemic influenza A(H1N1 viruses. As inhibition was also observed with oseltamivir-resistant IFV (H274Y, DAS181 may be active against the antigenically novel pandemic influenza A(H1N1 virus should it acquire the H274Y mutation. Based on these and previous results demonstrating DAS181 broad-spectrum anti-IFV activity, DAS181 represents a potential therapeutic agent for

ANÁLISE DAS FINALIZAÇÕES NA FASE ELIMINATÓRIA DA COPA DO MUNDO 2014

Directory of Open Access Journals (Sweden)

Augusto Caron

2015-04-01

Full Text Available O Futebol mudou muito em relação há algumas décadas atrás, vem sendo cada vez mais motivo de estudos para aprimoramentos técnicos, táticos e físicos. Nota-se muitas maneiras diferentes de jogar, devido a culturas, escolas e estilos. Esse estudo contém grande importância para os profissionais do futebol e pesquisadores, pois trata de um tema atual e avaliou partidas com inúmeras peculiaridades táticas e técnicas.Objetivo: O objetivo do presente estudo foi uma análise das finalizações das equipes classificadas para a fase eliminatória da Copa do Mundo 2014 (das oitavas de final até a final

A informação e suas tecnologias: uma análise descritiva e correlativa das ementas das disciplinas de informática em cursos de bacharelado em secretariado executivo de instituições públicas de ensino superior no Brasil

Directory of Open Access Journals (Sweden)

Maricilene Isaira Baia do Nascimento

2013-12-01

Full Text Available A pesquisa objetiva analisar descritiva e correlativamente as ementas das disciplinas de informática ofertadas em cursos de bacharelado em Secretariado Executivo de Instituições públicas de Ensino Superior -IES de diferentes regiões do Brasil, evidenciando a organização pela qual a disciplina está sendo ofertada nessas IES, bem como identificando as similaridades e peculiaridades que elas apresentam na organização da referida disciplina. Foram utilizadas ferramentas da estatística descritiva (medidas de localização, de dispersão e de forma de distribuição e da correlação, em destaque para a correlação de Pearson, na realização da exploração dos dados, para os quais se adotaram as seguintes etapas: a identificação das Instituições de Ensino Superior públicas no Brasil que ofertam os cursos de bacharelado em Secretariado Executivo, por meio do portal e-MEC; b coleta das matrizes curriculares e dos projetos políticos pedagógicos as ementas das disciplinas ofertadas nos cursos de secretariado; c identificação das ementas das disciplinas de informática e d categorização das “áreas” da disciplina conforme observado nas ementas em questão. Participaram da pesquisa dez IES, a partir das quais foi possível observar o panorama de como está sendo construída a oferta de profissionais de Secretariado Executivo com habilidades na área de tecnologia da informação para o mercado de trabalho, e, também, o método adotado possibilitou diagnosticar as similaridades e peculiaridades na organização da oferta da disciplina de informática nos cursos de bacharelado em Secretariado Executivo nas diferentes Instituições pesquisadas, de diferentes regiões brasileiras.

Efficient Delivery and Visualization of Long Time-Series Datasets Using Das2 Tools

Science.gov (United States)

Piker, C.; Granroth, L.; Faden, J.; Kurth, W. S.

2017-12-01

For over 14 years the University of Iowa Radio and Plasma Wave Group has utilized a network transparent data streaming and visualization system for most daily data review and collaboration activities. This system, called Das2, was originally designed in support of the Cassini Radio and Plasma Wave Science (RPWS) investigation, but is now relied on for daily review and analysis of Voyager, Polar, Cluster, Mars Express, Juno and other mission results. In light of current efforts to promote automatic data distribution in space physics it seems prudent to provide an overview of our open source Das2 programs and interface definitions to the wider community and to recount lessons learned. This submission will provide an overview of interfaces that define the system, describe the relationship between the Das2 effort and Autoplot and will examine handling Cassini RPWS Wideband waveforms and dynamic spectra as examples of dealing with long time-series data sets. In addition, the advantages and limitations of the current Das2 tool set will be discussed, as well as lessons learned that are applicable to other data sharing initiatives. Finally, plans for future developments including improved catalogs to support 'no-software' data sources and redundant multi-server fail over, as well as new adapters for CSV (Comma Separated Values) and JSON (Javascript Object Notation) output to support Cassini closeout and the HAPI (Heliophysics Application Programming Interface) initiative are outlined.

Histórico das hepatites virais History of viral hepatitis

Directory of Open Access Journals (Sweden)

José Carlos Ferraz da Fonseca

2010-06-01

Full Text Available INTRODUÇÃO: A história das hepatites virais remonta milhares de anos e é fascinante. Quando o ser humano sofreu pela primeira vez a invasão do seu organismo por tais agentes, iniciou-se um ciclo natural e repetitivo capaz de infectar bilhões de seres humanos, dizimar e sequelar milhares de vida. MÉTODOS: Este artigo rever informações científicas disponíveis sobre o histórico das hepatites virais. Todas as informações foram obtidas através de extensa revisão bibliográfica, compreendendo artigos originais e de revisão e consultas na rede internet. RESULTADOS: Existem relatos de surtos de icterícia epidêmica na China há mais de 5.000 anos e na Babilônia, há mais de 2.500 anos. A história catastrófica das grandes epidemias ou pandemias ictéricas são conhecidas e geralmente estão associadas às grandes guerras. Na guerra da Secessão Americana, 40 mil casos ocorreram entre militares da União. Em 1885, um surto de icterícia catarral acometeu 191 trabalhadores do estaleiro de Bremen (Alemanha após vacinação contra varíola. Em 1942, 28.585 soldados contraíram hepatite após inoculação da vacina contra a febre amarela. O número de casos de hepatite durante a Segunda Grande Guerra foi estimado em 16 milhões. Somente no século XX, foram identificados os principais agentes causadores das hepatites virais. O vírus da hepatite B foi o primeiro a ser descoberto. CONCLUSÕES: Neste artigo, a revisão da história das grandes epidemias ocasionadas pelos vírus das hepatites e a descoberta desses agentes revelam singulares peculiaridades, citando como exemplo, a descoberta acidental ou por acaso dos vírus da hepatite B e D.INTRODUCTION: The history of viral hepatitis goes back thousands of years and is a fascinating one. When humans were first infected by such agents, a natural repetitive cycle began, with the capacity to infect billions of humans, thus decimating the population and causing sequelae in thousands of lives

Artérias das glândulas adrenais em avestruzes (Struthio camelus

Directory of Open Access Journals (Sweden)

Angelita das Graças de Oliveira Honorato

2011-10-01

Full Text Available http://dx.doi.org/10.5007/2175-7925.2012v25n1p125 O crescimento da criação racional de avestruz e seus subprodutos têm despertado interesse dos pesquisadores em ampliar os estudos com esse animal. Assim, áreas de pesquisa básicas, como a morfologia, tornam-se necessárias para dar subsídios às áreas aplicadas. Com o intuito de contribuir com o conhecimento referente aos arranjos vasculares das glândulas adrenais, utilizaram-se 30 avestruzes (Struthio camelus, de quatro dias de vida, tendo seus contingentes arteriais marcados com solução aquosa corada de Neoprene Látex “450” a 50% e fixados em solução diluída de formol a 10%. A cavidade celomática foi exposta para a identificação das referidas glândulas, que são órgãos pares e encontram-se recobertas por tecido conjuntivo frouxo, disposto simetricamente nos dois antímeros, lateralmente à aorta descendente, caudalmente aos pulmões e cranio-medialmente aos lobos craniais dos rins. O aporte sanguíneo arterial, em ambos os antímeros, é proveniente das artérias adrenais direita e esquerda, dos ramos das artérias renais craniais direita e esquerda e dos ramos diretos da aorta descendente. Independentemente da origem, os números de ramos destinados às glândulas adrenais variaram de um a dois e de um a três respectivamente para os antímeros esquerdo e direito.

O ensino das relações internacionais no Brasil: problemas e perspectivas

Directory of Open Access Journals (Sweden)

Miyamoto Shiguenoli

2003-01-01

Full Text Available Em função das grandes transformações verificadas no mundo, na última década, ocorreu um rápido aumento na quantidade de cursos de Relações Internacionais (RI no Brasil. Atualmente, há quase sessenta cursos em funcionamento. Percebe-se, todavia, é que nem sempre se asseguram condições adequadas para o funcionamento desses cursos. Deficiências podem ser observadas não só no corpo docente, como também nas bibliotecas, que muitas vezes não dispõem de acervo suficiente para atender às demandas das disciplinas ministradas. Juntamente com esses problemas, os egressos dos cursos de RI têm manifestado preocupações com sua inserção no mercado de trabalho, apesar de se encontrarem em uma área em plena expansão, e terem uma formação múltipla que os torna altamente competitivos. Neste artigo analisamos as condições sociais que criam a demanda pelo estudo das Relações Internacionais no Brasil, bem como as exigências legais e institucionais para o bom funcionamento dos cursos de graduação nessa área.

Das ovarielle Überstimulationssyndrom (OHSS

Directory of Open Access Journals (Sweden)

Sander T

2011-01-01

Full Text Available Das ovarielle Überstimulationssyndrom (OHSS ist eine relativ häufige Komplikation bei der künstlichen Befruchtung bzw. bei einer ovariellen Stimulationsbehandlung. Es wird über die Pathophysiologie berichtet, die durch eine erhöhte Gefäßpermeabilität mit einer Flüssigkeitsverschiebung in den extravasalen Raum bedingt ist, vermutlich getriggert durch den vaskulären endothelialen Wachstumsfaktor (VEGF. Junge Frauen mit hyperandrogenämischen Zyklusstörungen und polyzystischem Ovarsyndrom (PCOS haben ein erhöhtes Risiko und eine Ovulationsinduktion mit HCG (humanem Choriongonadotropin sollte vermieden werden. Erscheinungsbild, Präventionsmaßnahmen und Therapie werden mit dem Ziel erläutert, die Komplikationsrate niedrig und die Schwangerschaftsrate so hoch wie möglich zu halten.

O estudo mineralógico das cinzas volantes brasileiras: origem, caracteristicas e qualidade

OpenAIRE

Yushiro Kihara

1983-01-01

As cinzas volantes são resíduos fundamentalmente sílico-aluminosos, finamente divididos, provenientes da combustão do carvão mineral pulverizado, utilizado em usinas termelétricas. São considerados materiais pozolânicos, à semelhança das cinzas vulcânicas ácidas, por apresentarem capacidade de reação com a cal, em presença de água, originando a formação de compostos novos com propriedades aglomerantes. Estudaram-se 31 amostras de cinzas volantes das cinco principais termelétricas brasileiras ...

Metabolismo Lipídico e Diagnóstico das Dislipidemias Primárias

OpenAIRE

Marques da Silva, P

2015-01-01

O tratamento das dislipidemias é um imperativo ético na abordagem do doente em risco cardiovascular. O conhecimento do metabolismo das lipoproteínas, a expressão fenotípica de uma dislipidemia e a compreensão dos processos e elementos fisiopatológicos relacionados constituem a base de uma estratégia fundamentada e racional no doente em risco. A abordagem de um indivíduo com dislipidemia passa por um diagnóstico criterioso, de base laboratorial. Com uma clínica e uma semiologia escassa, mas...

Transferência de nervos (neurotizações no tratamento das lesões traumáticas do plexo braquial

Directory of Open Access Journals (Sweden)

Edie Benedito Caetano

2016-11-01

Full Text Available As lesões por avulsão das raízes do plexo braquial usualmente são causadas por acidentes de automóveis e motocicletas. Suas consequências são devastadoras e representam um desafio aos cirurgiões que tratam de tais pacientes. É de fundamental importância o intervalo entre a lesão e o tratamento definitivo. O tratamento das lesões por avulsão do plexo braquial envolve a utilização de neurólises, sutura direta das extremidades do nervo, enxertos de nervos e procedimentos de neurotizações. Vários nervos têm sido utilizados como doadores nas neurotizações. Geralmente, existem dois tipos de doadores: extraplexual (nervos intercostal, acessório e frênico, ramos motores do plexo cervical e raiz C7 contralateral e intraplexual (coto proximal das raízes ou ramos motores colaterais de nervos do plexo braquial que foram preservados. A neurotização intraplexual representa a forma clássica das transferências nervosas.

Safety evaluation of genetically modified DAS-40278-9 maize in a subchronic rodent feeding study.

Science.gov (United States)

Zou, Shiying; Lang, Tianqi; Liu, Xu; Huang, Kunlun; He, Xiaoyun

2018-07-01

Genetically modified (GM) maize, DAS-40278-9, expresses the aryloxyalkanoate dioxygenase-1 (AAD-1) protein, which confers tolerance to 2,4-dichlorophenoxyacetic acid (2,4-D) and aryloxyphenoxypropionate (AOPP) herbicides. The aad-1 gene, which expresses the AAD-1 protein, was derived from Gram-negative soil bacterium, Sphingobium herbicidovorans. A 90-day sub-chronic toxicity study was conducted on rats as a component of the safety evaluation of DAS-40278-9 maize. Rats were given formulated diets containing maize grain from DAS-40278-9 or a non-GM near isogenic control comparator at an incorporation rate of 12.5%, 25%, or 50% (w/w), respectively for 90 days. In addition, another group of rats was fed a basic rodent diet. Animals were evaluated by cage-side and hand-held detailed clinical observations, ophthalmic examinations, body weights/body weight gains, feed consumption, hematology, serum chemistry, selected organ weights, and gross and histopathological examinations. Under the condition of this study, DAS-40278-9 maize did not cause any treatment-related effects in rats compared with rats fed diets containing non-GM maize. Copyright © 2018 Elsevier Inc. All rights reserved.

Das neuroses atuais às neuroses traumáticas: continuidade e ruptura

Directory of Open Access Journals (Sweden)

Marta Rezende Cardoso

2011-03-01

Full Text Available Analisamos as vicissitudes da neurose traumática, partindo das contribuições de Freud. Propomos uma linha de continuidade - considerando também os pontos de ruptura - entre as neuroses traumáticas e as neuroses atuais, a partir de uma releitura da dimensão de "atual" em Freud, articulada com a de compulsão à repetição. Ampliamos a compreensão das neuroses traumáticas por meio da ideia da formação de enclaves no espaço psíquico, exterioridade interna radical que tende a se fazer sempre atual por sua repetição compulsiva.

CONCENTRAÇÃO DAS EXPORTAÇÕES E VULNERABILIDADE NO NORDESTE BRASILEIRO

OpenAIRE

Carvalho, Eveline Barbosa; Alves, Rodrigo Saboya Castro

2006-01-01

Esta pesquisa objetiva avaliar o grau de concentração das exportações nordestinas por produto e país de destino no período compreendido entre 1996 a 2004 e seus efeitos para a região. Como objetivos específicos, tem-se a identificação dos destinos das exportações dos principais produtos da pauta de exportação nordestina, analisando à luz do referencial teórico, as possíveis conseqüências que um elevado grau de concentração pode propiciar. Trata-se de pesquisa aplicada e quantitativa que propõ...

Das bruxas, dos índios, dos negros e dos jovens da Febem

OpenAIRE

Sylvia Leser de Mello

2001-01-01

Este artigo visa discutir os temas Pesquisa e Direitos Humanos, partindo da definição do que pretende a Ciência, suas limitações e momentos seus a serviço de condenações de bruxas e ateus. Trata-se de levantar a questão da 'parcialidade' da Ciência e das formas de exclusão que ela ajudou a gerar e manter face aos criminosos, aos loucos, aos negros e, sem dúvida, aos jovens das camadas populares que são institucionalizados na FEBEM. E, na tentativa de resistência a se deixar levar pelo que de ...

Revision of an automated microseismic location algorithm for DAS - 3C geophone hybrid array

Science.gov (United States)

Mizuno, T.; LeCalvez, J.; Raymer, D.

2017-12-01

Application of distributed acoustic sensing (DAS) has been studied in several areas in seismology. One of the areas is microseismic reservoir monitoring (e.g., Molteni et al., 2017, First Break). Considering the present limitations of DAS, which include relatively low signal-to-noise ratio (SNR) and no 3C polarization measurements, a DAS - 3C geophone hybrid array is a practical option when using a single monitoring well. Considering the large volume of data from distributed sensing, microseismic event detection and location using a source scanning type algorithm is a reasonable choice, especially for real-time monitoring. The algorithm must handle both strain rate along the borehole axis for DAS and particle velocity for 3C geophones. Only a small quantity of large SNR events will be detected throughout a large aperture encompassing the hybrid array; therefore, the aperture is to be optimized dynamically to eliminate noisy channels for a majority of events. For such hybrid array, coalescence microseismic mapping (CMM) (Drew et al., 2005, SPE) was revised. CMM forms a likelihood function of location of event and its origin time. At each receiver, a time function of event arrival likelihood is inferred using an SNR function, and it is migrated to time and space to determine hypocenter and origin time likelihood. This algorithm was revised to dynamically optimize such a hybrid array by identifying receivers where a microseismic signal is possibly detected and using only those receivers to compute the likelihood function. Currently, peak SNR is used to select receivers. To prevent false results due to small aperture, a minimum aperture threshold is employed. The algorithm refines location likelihood using 3C geophone polarization. We tested this algorithm using a ray-based synthetic dataset. Leaney (2014, PhD thesis, UBC) is used to compute particle velocity at receivers. Strain rate along the borehole axis is computed from particle velocity as DAS microseismic

Análise microscópica da resistência do arroz à queima das bainhas mediada pelo silício

Directory of Open Access Journals (Sweden)

Daniel Augusto Schurt

2015-03-01

Full Text Available A queima das bainhas, causada pelo fungo Rhizoctonia solani Kühn, é uma das mais importantes e destrutivas doenças que afetam a produção de arroz no mundo. Embora o silício (Si seja capaz de reduzir a intensidade da queima das bainhas, os mecanismos de resistência mediados por esse elemento permanecem desconhecidos. Assim, este trabalho teve como objetivo investigar a nível microscópico o efeito do Si na resistência do arroz à infecção por R. solani. Plantas de arroz das cultivares BR-Irga-409 e Labelle foram cultivadas em solução nutritiva contendo 0 ou 2 mM de Si e inoculadas no estádio de máximo perfilhamento utilizando-se pedaços de palito de dente colonizados por R. solani. Ambos cultivares supridas com Si apresentaram intensa e homogênea deposição de Si nos tecidos das bainhas colonizados por R. solani. A maior concentração de Si nas bainhas de plantas de arroz de ambas cultivares contribuiu para reduzir os sintomas da queima das bainhas. Com o auxílio da microscopia de luz e da microscopia eletrônica de varredura, observou-se menor crescimento micelial do fungo sobre as bainhas foliares das plantas de ambas cultivares que foram supridas com Si. Secções das bainhas de plantas de ambos cultivares supridas com Si exibiram intensa autofluorescência nos tecidos próximos a regiões necrosadas devido a colonização por R. solani. Em conclusão, o suprimento de Si às plantas de arroz desempenhou um papel importante na redução dos sintomas da queima das bainhas.

Haloacetic acids in the aquatic environment. Part II: ecological risk assessment

International Nuclear Information System (INIS)

Hanson, Mark L.; Solomon, Keith R.

2004-01-01

Haloacetic acids (HAAs) are environmental contaminants found in aquatic ecosystems throughout the world as a result of both anthropogenic and natural production. The ecological risk posed by these compounds to organisms in freshwater environments, with a specific focus on aquatic macrophytes, was characterized. The plants evaluated were Lemna gibba, Myriophyllum spicatum and M. sibiricum and the HAAs screened were monochloroacetic acid (MCA), dichloroacetic acid (DCA), trichloroacetic acid (TCA), trifluoroacetic acid (TFA) and chlorodifluoroacetic acid (CDFA). Laboratory toxicity data formed the basis of the risk assessment, but field studies were also utilized. The estimated risk was calculated using hazard quotients (HQ), as well as effect measure distributions (EMD) in a modified probabilistic ecological risk assessment. EMDs were used to estimate HAA thresholds of toxicity for use in HQ assessments. This threshold was found to be a more sensitive measure of low toxicity than the no observed effect concentrations (NOEC) or the effective concentration (EC 10 ). Using both deterministic and probabilistic methods, it was found that HAAs do not pose a significant risk to freshwater macrophytes at current environmental concentrations in Canada, Europe or Africa for both single compound and mixture exposures. Still, HAAs are generally found as mixtures and their potential interactions are not fully understood, rendering this phase of the assessment uncertain and justifying further effects characterization. TCA in some environments poses a slight risk to phytoplankton and future concentrations of TFA and CDFA are likely to increase due to their recalcitrant nature, warranting continued environmental surveillance of HAAs. - Current environmental concentrations of haloacetic acids do not pose a risk to aquatic macrophytes, but could impact plankton

Simultaneous determination of 9 heterocyclic aromatic amines in pork products by liquid chromatography coupled with triple quadrupole tandem mass spectrometry

Science.gov (United States)

Shen, X. C.; Zhang, Y. L.; Cui, Y. Q.; Xu, L. Y.; Li, X.; Qi, J. H.

2017-07-01

Heterocyclic aromatic amines (HAAs) are potent mutagens that formed at high temperature in cooked, protein-rich food. Owing to their frequent intake, an accurate method is essential to access human health risk of HAAs exposure through detecting these compounds in various heat-treated meat products. In this study, a liquid chromatography-electrospray tandem mass spectrometry (LC--ESI-MS/MS) method was developed to perform the determination of 9 mutagenic heterocyclic amines (HAAs) in meat samples with multiple reaction monitoring (MRM) mode. Ultrasound assisted extraction and diatomaceous earth was employed to extract HAAs from food samples, and the analytes were purified and enriched using tandem solid phase extraction, with propyl sulfonic acid coupled to a C18 cartridge. Two parameters, extraction time and eluent, were carefully optimized to improve the extraction and purification efficiency. The LC separation was carried out using a Zorbax SB-C18 (3.5 μm particle size, 2.1 × 150 mm i.d.) column and optimized some parameters, such as pH, concentration and volume. Under the optimal experimental conditions, recoveries ranged from 52.97% to 97.11% with good quality parameters: limit of detection values between 0.02 and 0.24 ng mL-1, linearity (R2>0.998), and run-to-run and day-to-day precisions lower than 9.81% achieved. To evaluate the performance of the method in high throughput analysis of complex meat samples, the LC-MS/MS method was applied to the analysis of HAAs in three food samples, and the results demonstrated that the method can be used for the trace determination of HAAs in pork samples.

Influências das Fusões e Aquisições no Valor de Mercado das Instituições Bancárias Adquirentes

Directory of Open Access Journals (Sweden)

Gabriel Rodrigo Gomes Pessanha

2014-12-01

Full Text Available Historicamente, é possível observar que as estratégias de fusões e aquisições (F&A reformularam uma série de organizações. Inúmeras pesquisas são realizadas na tentativa de explicar e compreender os motivos, pelos quais as organizações optam pelas estratégias de F&A. Tendo em vista o volume de transações de F&A envolvendo empresas brasileiras no setor bancário, torna-se relevante verificar os impactos ocorridos em empresas que participaram desses processos, buscando-se entender a importância dessa estratégia de crescimento nos resultados das instituições financeiras. Sendo assim, o principal objetivo deste trabalho é verificar se houve criação de valor (maximização da riqueza dos acionistas ou destruição de valor (redução da riqueza dos acionistas de empresas adquirentes no curto prazo. Utilizou-se a metodologia de estudo de eventos para avaliar o comportamento do retorno das ações mediante o anúncio de F&A em instituições bancárias no período de 1994 a 2009. Os resultados demonstraram que o primeiro dia após o anúncio das F&A apresenta um retorno anormal positivo, porém não significativo estatisticamente. O retorno acumulado começa a entrar em declínio após a data zero (ocorrência do evento, porém estes retornos também não apresentaram significância estatística. Com base nos resultados dos testes realizados, conclui-se que as fusões e aquisições de bancos estudadas não proporcionaram retornos anormais positivos para os seus acionistas. Estes resultados estão coerentes com a maioria dos estudos realizados neste segmento em outros países.

DÉFICIT HÍDRICO E OS PROCESSOS MORFOLÓGICO E FISIOLÓGICO DAS PLANTAS

Directory of Open Access Journals (Sweden)

Reginaldo Ferreira Santos

1998-12-01

Full Text Available RESUMO Esta breve revisão de literatura tem como objetivo abordar alguns aspectos dos fatores morfológicos e fisiológicos que, direta ou indiretamente, influenciam na habilidade das plantas em adaptar-se a diferentes condições de déficit hídrico durante seu crescimento e desenvolvimento. A sensibilidade do desenvolvimento das folhas ao déficit hídrico pode mudar no transcorrer do dia ou nas diferentes estações do ano, porém a limitação de expansão na área foliar pode ser considerada como uma primeira reação das plantas a esse déficit. Plantas cultivadas sob condições adequadas de suprimento hídrico são, normalmente, menos resistentes ao déficit hídrico e, quando da ocorrência rápida do déficit hídrico, os mecanismos morfofisiológicos são severamente afetados, pois a planta necessitaria adaptar-se rapidamente a esta situação de déficit; entretanto, quando o déficit hídrico ocorre gradualmente e/ou no início do ciclo, mais facilmente ocorre a adaptação das plantas. A tolerância da planta ao déficit hídrico parece ser um importante mecanismo de resistência para manter o processo produtivo em condições de baixa disponibilidade de água às plantas. "Por isso, a importância de se abordar alguns aspectos dos fatores morfológicos e fisiológicos que influenciam a habilidade das plantas na adaptação a situações de déficit hídrico."

Triatoma rubrovaria (Blanchard 1843: tábua de vida das ninfas, duração das formas e oviposição das fêmeas Triatoma rubrovaria (Blanchard 1843: life table of nymphs, duration of the forms and posture of the females

Directory of Open Access Journals (Sweden)

Vera Lúcia Cortiço Corrêa Rodrigues

2005-05-01

Full Text Available Os autores acompanharam a evolução de 150 ovos de Triatoma rubrovaria o que permitiu a construção de uma tábua de sobrevida das ninfas. A forma alada foi atingida por 94,64% dos exemplares, sendo 79 deles machos e 65 fêmeas. O tempo médio dos alados machos foi de 115 dias e das fêmeas, 99 dias. Parte desses exemplares formaram 30 casais, mantidos isolados, o que possibilitou o levantamento da postura de cada fêmea. Outro lote, também formado por 30 machos e 30 fêmeas, foi mantido em um único cristalizador de vidro, o que permitiu constatar sua maior postura (7.832 ovos em relação aquela das fêmeas acasaladas por único macho (5.167. O bom desenvolvimento dos exemplares no processo de evolução e de reprodução da espécie, nas condições do experimento, mostrou a boa capacidade de manutenção das colônias do Triatoma rubrovaria, em condições de laboratório.The authors followed the development of 150 eggs of Triatoma rubrovaria to enable the construction of a life table for the nymphs. The winged form was reached by 94.64% of the individuals, of which 79 were males and 65 females. The mean lifetime of the males was 115 days and 99 days for the females. Part of this group was divided into 30 couples and kept separated to facilitate the count of egg laying by each female. Another lot was also formed of 30 males and 30 females but these were housed together in a glass crystallizer that allowed the observation of a larger number of eggs laid (7,832 eggs in relationship to that of the females with only one male (total 5,167 eggs. The good development of the individuals and reproduction of the species in the experimental conditions demonstrated the capacity to maintain colonies of Triatoma rubrovaria in laboratory conditions.

Análise cladística das abelhas do gênero Megalopta Smith, 1853 (APIDAE: Halictinae, Augochlorini) e revisão taxonômica das espécies brasileiras

OpenAIRE

Santos, Leandro Mattos

2010-01-01

Resumo: Megalopta (Smith, 1853) é um gênero de abelhas crepusculares e/ou noturnas, com distribuição neotropical. Estas abelhas nidificam em ramos e galhos em decomposição e podem apresentar hábito social facultativo. O gênero possui vinte e sete espécies descritas e na maioria das vezes são consideradas de difícil identificação principalmente por causa de polimorfismos, descobertos após a descrição da maioria das espécies. Além disto, gêneros e subgêneros em sinonímias foram propostos ao lon...

O uso das redes sociais virtuais nos processos de recrutamento e seleção

Directory of Open Access Journals (Sweden)

Tatiana Martins Almeri

2013-07-01

Full Text Available Este artigo tem por objetivo estudar o comportamento dos usuários das redes sociais virtuais com base na visão das agências de emprego, analisando suas atitudes, comportamentos e atributos pessoais, para depois poder traçar um perfil de comportamento adequado para estes ao usarem as redes sociais virtuais. Por ser um assunto atual esta pesquisa representa um apoio inovador à sociedade em geral que buscar promover sua imagem pessoal e profissional de maneira positiva e idônea, lhes fornecendo dados relevantes, embasados numa pesquisa científica sobre como alcançar esta exposição de modo saudável, agregando valor à sua postura profissional. A principal metodologia utilizada foi a pesquisa descritiva de opinião, feita através de um questionário enviado para as agências de emprego onde o foco era buscar as características de comportamento e atitudes observadas pelos profissionais da área nas páginas das redes sociais virtuais dos candidatos em potencial. Como resultado deste trabalho pode-se concluir que a utilização da internet nos processos de recrutamento e seleção é muito expressiva e a consulta das redes sociais virtuais de candidatos foi uma prática adotada por 100% das agências de emprego entrevistadas, por ser um trabalho prático, sem maiores custos e capaz de reduzir o tempo no processo de recrutamento e seleção, além de fornecer informações reais sobre o perfil do candidato. A principal contribuição desta pesquisa foi que, embasado no resultado geral do questionário aplicado, foi possível estabelecer um perfil padrão de comportamento ao usuário das redes sociais virtuais que quando seguido pode contribuir de maneira efetiva para a divulgação positiva da imagem profissional e pessoal deste em um processo de recrutamento e seleção.

Sustentabilidade financeira das instituições de microfinanças brasileiras: análise das cooperativas de crédito singulares

Directory of Open Access Journals (Sweden)

Edison Luiz Leismann

2010-12-01

Full Text Available Este trabalho tem por objetivo analisar a sustentabilidade financeira das Cooperativas de Crédito Singulares do Brasil. A análise dos dados financeiros das cooperativas de crédito, Sociedades de Crédito ao Microempreendedor (SCM e crédito mútuo compõem o objeto de estudo. A análise foi realizada a partir dos dados de 31/12/2007 disponibilizados pelo Banco Central de 1.439 instituições. Com dados adicionais de 31 instituições liquidadas entre 2003 e 2006, totalizaram-se 1.470 instituições analisadas. Com os valores originais, o banco de dados foi dividido aleatoriamente em duas partes, cada qual com 735 instituições, sendo o primeiro denominado de amostra de desenvolvimento e o segundo, de amostra de validação. A avaliação principal foi feita a partir da Análise Discriminante com os dados obtidos e com padronização. Outras abordagens foram desenvolvidas e comparadas. Os resultados mostram que a segunda abordagem, com padronização e subdivisão das instituições por tamanho (valor do ativo permite obter resultados mais aprimorados, com Correlação Canônica de 0,994, mostrando que a variável dependente pode ser explicada em 98,8% pelas variáveis independentes. Desta forma, as análises mostram a funcionalidade dessas abordagens como instrumento de classificação, servindo como mecanismo de auxílio aos órgãos reguladores e Cooperativas Centrais no acompanhamento das unidades singulares.This work aims to analyze the financial sustainability of Single Credit Cooperatives of Brazil. The analysis of financial data from credit cooperatives, credit societies of Small Entrepreneur (SCM and credit make up the mutual object of study. The analysis was performed from the data available from 2007/12/31 by the Central Bank of Brazil of 1,439 institutions. We used indicators of financial structure, assets and the statements of results of those institutions. With additional data from 31 institutions presented between 2003 and 2006

From Piketty’s Capital to Marx’s das Kapital

Directory of Open Access Journals (Sweden)

Øjvind Larsen

2016-11-01

Full Text Available Thomas Piketty’s book Capital in the Twenty-First Century has created a very new platform for a discussion of the global economy. There is possibly no other book on economy which has been published in so many languages, printed in so many copies, and has found its way to such a varied global public. Piketty’s Capital has been discussed in many high ranked academic journals, and at the same time, it has come out to a broader audience with advertisements in places like the underground public transportation in metropolises around the world. The title of the book is also very ambitious in so far as the title Capital claims to be a follow up of Karl Marx’s Das Kapital for the twenty-first century. Piketty is similar to Marx in his ambition to give a large historical, or a world historical perspective on the significance of capitalist economy for the development of global society. Given this background it could be interesting to consider the relations between Piketty’s Capital and Marx’s Das Kapital.

Einfluss des Internets auf das Informations-, Einkaufs- und Verkehrsverhalten

Science.gov (United States)

Nerlich, Mark R.; Schiffner, Felix; Vogt, Walter

Mit Daten aus eigenen Erhebungen können das einkaufsbezogene Informations- und Einkaufsverhalten im Zusammenhang mit den verkehrlichen Aspekten (Distanzen, Verkehrsmittel, Wegekopplungen) dargestellt werden. Die Differenzierung in die drei Produktkategorien des täglichen, mittelfristigen und des langfristigen Bedarfs berücksichtigt in erster Linie die Wertigkeit eines Gutes, die seine Erwerbshäufigkeit unmittelbar bestimmt. Der Einsatz moderner IKT wie das Internet eröffnet dem Endverbraucher neue Möglichkeiten bei Information und Einkauf. Die verkehrliche Relevanz von Online-Shopping wird deutlich, wenn man berücksichtigt, dass im Mittel rund 17% aller Online-Einkäufe, die die Probanden durchgeführt haben, Einkäufe in Ladengeschäften ersetzen. Dies gilt in verstärktem Maße für Online-Informationen: etwa die Hälfte hätte alternativ im stationären Einzelhandel stattgefunden. Da der Erwerb von Gütern des täglichen Bedarfs häufig nahräumlich und in relevantem Anteil nicht-motorisiert erfolgen kann, sind in diesem Segment - im Gegensatz zum mittel- und langfristigen Bedarf - nur geringe Substitutionseffekte zu beobachten.

Aportes para uma compreensão das Relações Internacionais em Marx

Directory of Open Access Journals (Sweden)

Regiany Melo

2017-02-01

Full Text Available Na obra Contribuição à crítica da economia política, Marx inicia um projeto de análise da anatomia da sociedade civil (aprofundada, posteriormente, em O Capital que, para ele, manifesta-se na história a partir da expansão do sistema econômico associado intrinsecamente ao desenvolvimento do Estado moderno. Seu objetivo é compreender o desenvolvimento social e histórico do capital através do exame da mercadoria, por intermédio de sua teoria do valor e de sua teoria monetária. Desse modo, podemos observar, através da formulação de suas teorias, como ocorre o intercâmbio das mercadorias entre mercados consumidores (economia, e consequentemente, entre os Estados burgueses (política. Assim, a partir da dimensão da economia política, podemos vislumbrar alguns aportes para uma compreensão das Relações Internacionais em Marx no nível das relações entre os Mercados Mundiais.

Polissemias da desigualdade no Livro V das Ordenações Filipinas: o escravo integrado

Directory of Open Access Journals (Sweden)

Ricardo Alexandre FERREIRA

2015-12-01

Full Text Available Resumo O presente artigo problematiza um dos pontos centrais da crítica dirigida por diferentes integrantes do chamado movimento das Luzes ao mundo do Antigo Regime. Trata-se da noção, já abordada pela historiografia especializada, de "desigualdade perante a lei", compreendida como atributo intrínseco e negativo de diferentes Estados europeus até o final do Setecentos. Parte-se aqui do pressuposto de que é imprescindível ao trabalho do historiador interessado no estudo das formas de exercício da justiça compreender os significados conferidos a conceitos e estatutos jurídicos dentro dos limites das épocas e lugares em que foram elaborados e utilizados cotidianamente pelos contemporâneos. Especificamente, pretende-se, a partir da análise dos dispositivos legais presentes no Livro V do Código Filipino, ou, Ordenações e Leis do Reino de Portugal - compilação de 1603 que no Brasil continuou, em grande medida, vigente até 1830 -, realizar um estudo das ambivalências e simultaneidades de sentido presentes nas penas impostas a pessoas de diferentes qualidades ou condições que integraram o Estado Português entre os séculos XVII e XVIII, com especial enfoque nas punições previstas exclusivamente aos escravos, tidos simultaneamente como coisas e pessoas.

Cultura das séries: forma, contexto e consumo de ficção seriada na contemporaneidade

Directory of Open Access Journals (Sweden)

Marcel Vieira Barreto Silva

2014-06-01

Full Text Available Nos últimos anos, tem aumentado o interesse acadêmico em torno das séries de televisão, especialmente - mas não somente -, as de origem norte-americana. Há toda uma literatura recente que avalia a presença das séries de TV em diversas matrizes nacionais (EUA, Itália, França, Reino Unido, etc., analisando a produção, circulação e recepção dos programas. Neste artigo, vamos propor a existência de uma cultura das séries, a partir de três condições centrais: a sofisticação das formas narrativas, o contexto tecnológico que permite uma ampla circulação digital (on-line ou não e os novos modos de consumo, participação e crítica textual. Com isso, as séries fomentam interesses que não se restringem ao envolvimento de comunidades de fãs com obras específicas, mas também indicam a formação de um repertório histórico em torno desses programas, de uma telefilia transnacional, de uma cultura das séries.

Origens das formas budistas

Directory of Open Access Journals (Sweden)

Fernando Carlos Chamas

Full Text Available RESUMO As características de uma imagem de Buda são o resultado do processo milenar que uniu três fatores: as mitologias orientais mais antigas que o budismo, sua capacidade de se adequar às crenças locais e as suas próprias reinterpretações. Após o surgimento das primeiras estátuas que representavam o Buda histórico, o ideal de beleza para um ser que alcançou a Iluminação baseou-se nas antigas "ciências" orientais, predominantemente mentais e de energias sutis. Enquanto a estética ocidental discutia as idealizações da arte com racionalidade, ignorando um oriente "pagão e supersticioso", as imagens budistas personificavam estados mentais que o ocidente só cogitaria na sua modernidade. A arte budista transmite o legado ancestral e imutável de chaves místicas da consciência e do equilíbrio..

Evaluasi perubahan penutupan lahan di DAS Babalan

OpenAIRE

Restiana, Inda

2015-01-01

Evaluation of land use changes was conducted at DAS Babalan. The research was conducted since July 2012 until December 2012. The purpose of this research are to assess changes in forest land into oil palm land, mapping land suitability classes for palm oil and to know the quality of forest land and land oil palm. Method to assess changes in the land area is done by utilizing remote sensing and geographic information systems (GIS). assessing the changes was conducted by overlayed land use maps...

Serviços bibliotecários para dispositivos móveis: O caso das bibliotecas vinculadas ao Conselho Nacional para Assuntos Bibliotecários das Instituições de Educação Superior do México

Directory of Open Access Journals (Sweden)

Eugenia de los Ángeles Ortega Martínez

2016-11-01

Full Text Available Objetivo: Analisar quais são os serviços bibliotecários e as aplicações (apps que se estão utilizando dentro das bibliotecas acadêmicas das Instituições de Educação Superior vinculadas ao Conselho Nacional para Assuntos Bibliotecários das Instituições de Educação Superior (CONPAB-IES, A. C. de México. Método: Foi realizado uma revisão da literatura em bancos de dados e revistas especializadas em Biblioteconomia e Ciências da Informação com ajuda dos recursos digitais da Direção Geral de Bibliotecas da Universidade Nacional Autônoma de México. Resultados e conclusões: O desenvolvimento de apps e serviços bibliotecários dispositivos móveis em bibliotecas acadêmicas das Instituições de Educação Superior,vinculadas ao CONPAB-IES, A. C., mostra uma tendência pelo desenvolvimento de coleções digitais em formatos amigaveis para PC e laptop, a diferença dos smartphones e tablets.

Alternativas técnicas para o controle das alterações dimensionais das resinas acrílicas em prótese total Alternative tecniques for the control of the dimensional alterations in the acrylic resins of the complete dentures

Directory of Open Access Journals (Sweden)

Tomas GOMEZ

1998-04-01

Full Text Available Os autores propõem uma nova técnica para diminuição dos problemas provenientes das alterações dimensionais das resinas acrílicas utilizadas na confecção das próteses totais. Com essa proposta, conseguiu-se praticamente eliminar essas alterações dimensionais tão prejudiciais às próteses totais.The authors present a new metodology aiming to reduce the dimensional alterations of acrylic resins used for total prosthesis in order to eliminate the dimensional alterations, achiving better total prothesis and decreasing problems for patients.

Existe Diferença no Desempenho Financeiro das Cooperativas Centrais de Crédito no Brasil?

Directory of Open Access Journals (Sweden)

Paulo Henrique Magalhães de Oliveira

2014-08-01

Full Text Available As demonstrações contábeis têm por objetivo apresentar informações que viabilizem a compreensão dos fatos ocorridos nas entidades e, assim, auxiliam a tomada de decisões dos agentes econômicos. Neste contexto, a avaliação da estrutura financeira das cooperativas centrais de crédito, que são responsáveis por auxiliar a gestão das cooperativas singulares, pode fornecer subsídios às políticas e intervenções por parte do Banco Central, além de auxiliar gestores e agentes econômicos que operam com estas instituições, uma vez que a procura por serviços prestados pelas cooperativas de crédito vem aumentando de forma significativa, principalmente pelo fato de oferecerem taxas de juros e custos de serviços sensivelmente mais baixos quando comparados aos praticadas pelo sistema bancário. Nesse sentido, o presente estudo teve como objetivo avaliar a situação financeira das 14 cooperativas centrais de crédito filiadas ao SICOOB utilizando a metodologia PEARLS. Os estudos sobre as cooperativas de crédito no Brasil focam nas cooperativas singulares e, até o presente momento, não se verificou na literatura uma análise financeira das cooperativas centrais por meio do sistema PEARLS. A presente pesquisa pode ser caracterizada como descritiva, pois apresenta as características econômico-financeiras das cooperativas centrais a partir das demonstrações financeiras cedidas pelo Banco Central do Brasil. Os resultados indicam o destaque de uma cooperativa central de crédito que sobressaiu positivamente em relação às demais, e uma negativamente, que merece uma análise minuciosa do processo de gestão. Adicionalmente, os resultados demonstraram a viabilidade das cooperativas centrais de crédito implementarem o sistema PEARLS como ferramenta de auxílio à gestão que é, nos dias de hoje, um dos grandes desafios para o sistema cooperativista de crédito.

Fatores influenciadores do processo de compra das consumidoras de moda íntima de Fortaleza

OpenAIRE

Façanha, Karine Forte

2016-01-01

A compreensão dos fatores influenciadores do comportamento de compra do consumidor é muito importante para o sucesso das empresas, elevando a competência delas para lidar com a intensa concorrência a que estão submetidas. Nesse sentido, este estudo tem por objetivo analisar os fatores que influenciam o comportamento de compra das consumidoras varejistas de lingerie na cidade de Fortaleza e avaliar agrupamentos dessas consumidoras de acordo com as características demográficas. Os influenciador...

Efeito diabetogênico das drogas anti-retrovirais em ratas Wistar prenhes

Directory of Open Access Journals (Sweden)

Figueiró-Filho Ernesto Antonio

2004-01-01

Full Text Available OBJETIVO: estudar a ação diabetogênica de drogas anti-retrovirais em ratas prenhes e o prognóstico perinatal das crias. MÉTODOS: estudo com ratas fêmeas prenhes adultas da raça Wistar, pesando entre 200-230 g. Foram testadas a azidotimidina (AZT, lamivudina (3TC e nelfinavir (NFV, cujas dosagens foram padronizadas em 10 vezes a dose utilizada em gestantes, proporcionalmente ao peso dos animais. Foram avaliados sete grupos, incluindo o controle, contendo 10 ratas por grupo. O início do experimento foi o dia zero da prenhez e as cesarianas realizadas no 21º dia, após decapitação, sendo os fetos contados e pesados. Procedeu-se a dosagens de glicemia, insulina, glucagon e lactato no 21º dia. Avaliou-se também o peso do tecido adiposo retroperitoneal. Os dados foram analisados utilizando-se o teste t de Student para a análise estatística. RESULTADOS: os grupos tratados com 3TC, AZT + 3TC e AZT + 3TC + NFV demonstraram alterações com a redução das médias de ganho de peso materno diário, do peso da gordura retroperitoneal e peso das crias (grupo controle: 6,2 g; grupos contendo 3TC: 4,1 a 5,6 g, bem como dos valores de lactato (grupo controle: 5,8 mmol/mL; grupos contendo 3TC: 3,2 a 3,7 mmol/mL, quando comparados ao controle. Todos os grupos tratados com drogas anti-retrovirais apresentaram redução significativa do número de fetos por ninhada (grupo controle: 14,7; grupos medicamentos: 11,1 a 12,7 e dos valores séricos de insulinemia (grupo controle: 6,2 µUI/mL; grupos medicamentos: 2,1 a 2,7 µUI/mL e elevação da glucagonemia (grupo controle: 88,2 pg/mL; grupos medicamentos: 99,7 a 120,7 pg/mL. Não houve diferenças estatisticamente significantes entre o grupo controle e tratados nos valores de glicemia. CONCLUSÕES: o uso de anti-retrovirais em ratas prenhes causa interferência no metabolismo glicídico dos animais durante o período de prenhez, provocando significativa redução do número das crias. Observou-se que o

A extrapolação das relações virtuais em Black mirror

Directory of Open Access Journals (Sweden)

Marcelo Santos da Rosa

2017-07-01

Full Text Available A contemporaneidade está permeada e norteada pela volatilidade das relações virtuais, que fazem com que as relações humanas, sociais e pessoais se transformam a todo instante. O sucesso da série britânica Black Mirror (2011-presente está relacionado à maneira inovadora e surpreendente de sua narrativa em abordar o cotidiano dessas transformações, acompanhando a trajetória de personagens que estão imersas em ambientes e relações mediadas pelas relações tecnológicas. Nos episódios “Be Right Back” (2013 e “Nosedive” (2016, há personagens profundamente marcadas por relações humanas em redes sociais – a primeira consegue contatar o marido morto por meio das marcas deixadas por este em suas redes, enquanto a segunda vive em um mundo alienado por relações virtuais que determinam o caráter de seus usuários pessoalmente. Neste trabalho, buscamos relacionar as vivências dessas personagens com a realidade atual, na perspectiva de entender como as relações virtuais impactam o modo de vida das pessoas e a que isso pode levar. As reflexões despertadas pela série, que problematiza e extrapola o que se conhece hoje por rede ou conexão social e expande-se para suas implicações na vida das personagens, serão discutidas a partir de teorias da cibercultura (SANTAELLA; LEMOS, e de suas articulações com questões como virtualidade e imersão interativa.

Poder e identidade grupal: um estudo em corporações musicais da região das vertentes

Directory of Open Access Journals (Sweden)

Marcos Vieira-Silva

2013-01-01

Full Text Available A investigação produzida buscou compreender a constituição histórica das formações identitárias e suas articulações com as relações de poder, no desempenho das atividades cotidianas de três corporações musicais mineiras. Percebeu-se que o processo identitário dos músicos é permeado pelo prestígio e valor que a tradição musical imprime na região. As diferenciações na produção de identidades individuais e coletivas podem exercer influências nas relações de poder inter e intragrupais. Também, as diversas formas de estabelecimento das relações de poder entre os agentes exercem influências no desenvolvimento do processo grupal e na atividade musical. Atividade, esta, que legitima tanto as identidades coletivas quanto as individuais, mantendo a vida musical da Região das Vertentes viva e intensa através dos tempos.

Targeting 2.5 versus 4 g/kg/day of amino acids for extremely low birth weight infants: a randomized clinical trial.

Science.gov (United States)

Burattini, Ilaria; Bellagamba, Maria Paola; Spagnoli, Cristina; D'Ascenzo, Rita; Mazzoni, Nadia; Peretti, Anna; Cogo, Paola E; Carnielli, Virgilio P

2013-11-01

To compare the effect of 2.5 vs 4 g/kg/d of amino acid (AA) in parenteral nutrition of extremely low birth weight infants on metabolic tolerance, short-term growth, and neurodevelopment. One hundred thirty-one infants with birth weight between 500 and 1249 g were randomized to 2.5 (standard AA [SAA] group) or 4 (high AA [HAA] group) g/kg/d AA intake, with equal nonprotein energy. The primary outcome was body size at 36 weeks. One hundred thirty-one patients were randomized and 114 analyzed (58 SAA group and 56 HAA group). Study groups had similar demographics and clinical characteristics. Elevated blood urea (BU >70 mg/dL = BU nitrogen >32.6 mg/dL) occurred in 24% vs 59% (P = .000) and hyperglycemia (>175 mg/dL) in 34% vs 11% (P = .003) of the SAA and HAA patients, respectively. Body weight, length, and head circumference at 36 weeks and 2 years were similar between groups. Bayley Scales of Infant and Toddler Development, Third Edition score was 94 ± 13 in the SAA group and 97 ± 15 in the HAA group (P = .35). The HAA group had higher BU levels and better glucose control. An extra 8 g/kg of AA over the first 10 days of life did not improve growth and neurodevelopment. Copyright © 2013 Mosby, Inc. All rights reserved.

O impacto das competências de marketing na definição de estratégia e as suas implicações na performance das empresas : um estudo em PME?s familiares portuguesas

OpenAIRE

Santos, Ana Catarina Damas dos

2012-01-01

Dissertação de mestrado em Marketing (Marketing Estratégico), apresentada à Faculdade de Economia da Universidade de Coimbra, sob a orientação de Arnaldo Coelho e Afonso Zinga. Este estudo tem como objectivo contribuir para o aprofundar do estudo das competências de marketing, investigando especificamente quais os factores que as influenciam, quais os reais impactos das competências na estratégia e quais as implicações na performance. Para testar estas premissas seleccionaram-se empresa...

A CRISE DAS IDENTIDADES NA AMÉRICA LATINA

Directory of Open Access Journals (Sweden)

Jonas Silva Abreu

2013-12-01

Full Text Available Em 1995, foi publicado o livro “Consumidores e Cidadãos” de Nestor Garcia Canclini. O livro trazia como tema a globalização e o consumo como agentes das transformações ocorridas no processo de elaboração das identidades coletivas no espaço latinoamericano. Tendo este texto como marco histórico-reflexivo, o objetivo do artigo é decifrar quais identidades foram produzidas no continente e entender a construção e negociação destes valores. Com o auxílio de outras obras, as identidades serão descritas tanto no contexto tradicional da modernidade constatadas na formação dos estados, nações e partidos políticos, mas também na ambiência multicultural da pós-modernidade que se fazem presentes nos discursos étnicos, atitudes religiosas e movimentos sociais em diferentes subgrupos. O trabalho pressupõe ainda que rádio, cinema, televisão e mais recentemente as redes de tecnologia e cultura transnacionais são meios que ajudaram a construir e alterar as identidades na região, além de elaborarem imagens e discursos sobre elas.

A CRISE DAS IDENTIDADES NA AMÉRICA LATINA

Directory of Open Access Journals (Sweden)

Jonas Silva Abreu

2014-07-01

Full Text Available Em 1995, foi publicado o livro “Consumidores e Cidadãos” de Nestor Garcia Canclini. O livro trazia como tema a globalização e o consumo como agentes das transformações ocorridas no processo de elaboração das identidades coletivas no espaço latinoamericano. Tendo este texto como marco histórico-reflexivo, o objetivo do artigo é decifrar quais identidades foram produzidas no continente e entender a construção e negociação destes valores. Com o auxílio de outras obras, as identidades serão descritas tanto no contexto tradicional da modernidade constatadas na formação dos estados, nações e partidos políticos, mas também na ambiência multicultural da pós-modernidade que se fazem presentes nos discursos étnicos, atitudes religiosas e movimentos sociais em diferentes subgrupos. O trabalho pressupõe ainda que rádio, cinema, televisão e mais recentemente as redes de tecnologia e cultura transnacionais são meios que ajudaram a construir e alterar as identidades na região, além de elaborarem imagens e discursos sobre elas.

Eficácia das sentenças na jurisdição constitucional

OpenAIRE

Teori Albino Zavascki

2000-01-01

Trata-se de estudo sobre a eficácia das sentenças proferidas no âmbito da jurisdição constitucional, que compreende a atividade jurisdicional em matéria de interpretação e aplicação da Constituição. Enfoca-se o tema pela perspectiva do sistema brasileiro de guarda da Constituição e, mais especificamente, do sistema de controle da constitucionalidade dos preceitos normativos. Na primeira parte são enfrentadas as questões relacionadas com a eficácia das sentenças proferidas pelo Supremo Tribuna...

Evaluación del riesgo de caídas en las personas mayores: ¿cómo hacerlo?

Directory of Open Access Journals (Sweden)

Lucélia Terra Jonas

Full Text Available Este artículo de reflexión es fruto de cuestionamientos sobre la evaluación del riesgo de caídas en personas ancianas y sobre los instrumentos disponibles para su medición. Tiene como propósito reflejar la necesidad de elaborar un instrumento evaluativo del riesgo de caídas en personas ancianas. Dicho instrumento podrá facilitar la identificación de los factores de riesgo de caídas y, a partir de ello, la propuesta de intervenciones efectivas en la prevención de caídas en personas ancianas, con el objetivo de preservar su calidad de vida, el mantenimiento de su seguridad, la no institucionalización y, en consecuencia, la reducción de costos para la atención secundaria y terciaria.

[Heinz von zur Mühlen. Das Bürgertum Fordert Blut. Ein Bolschewistiches Flugblatt von 1918] / Paul Kaegbein

Index Scriptorium Estoniae

Kaegbein, Paul

2007-01-01

Arvustus: Heinz von zur Mühlen. Das Bürgertum Fordert Blut. Ein Bolschewistiches Flugblatt von 1918. In : Ostseeprovinzen, baltische Staaten und das Nationale. Münster : LIT, 2005, lk. 403-414. 1918. aastast pärit lendlehest, mille käekirja järgi otsustades on kirjutanud Viktor Kingissepp

Culturas das Ciências Naturais Cultures of Natural Sciences

Directory of Open Access Journals (Sweden)

Maria Margaret Lopes

2005-12-01

Full Text Available Este artigo apresenta subsídios para o ensino de História das Ciências, considerando particularmente o campo da História da História Natural e das Ciências Naturais. Sem ser uma revisão completa da historiografia desses campos de conhecimento sobre o mundo natural, retoma alguns traços gerais desses longos processos de definição de campos disciplinares que se configuram desde a Renascença até o final do século XVIII. Considera diversas tradições culturais e historiográficas que contribuíram para os nossos entendimentos atuais, de como a História Natural do Renascimento foi abandonando seus antigos quadros conceituais, assumindo novas práticas e se constituindo nas tradições da História Natural do século XVIII. Comenta esses processos, em que tanto a Botânica, a Zoologia, a Mineralogia se individualizam como áreas de conhecimentos apoiadas em práticas locais e coleções globais, indo além de sua subordinação à utilidade médica; bem como suas organizações em áreas de conhecimento, por começarem a se colocar questões relativas à origem e à historicidade dos seres e processos naturais, dados os avanços das temáticas classificatórias e das discussões envolvendo temporalidades.This paper provides insights into the teaching of the History of Science, especially the field of the History of Natural History and Natural Sciences. Although not claiming to be a complete historiographic review of these areas of knowledge about the natural world, it outlines the general traits of the long process of definition of disciplines that were shaped from the Renaissance to the end of the XVIII century. It encompasses various cultural and historiographic traditions that contributed to our present understanding of how Renaissance Natural History abandoned its ancient conceptual frameworks and assumed new practices and shaped itself in the tradition of XVIII century Natural History. The paper comments on these processes by which

Teaching Foreign Cultural Literacy with Margarethe von Trotta's "Das Versprechen"

Science.gov (United States)

Kuttenberg, Eva

2003-01-01

This article describes model units for an in-depth cultural analysis of "Das Versprechen" in undergraduate college courses including intermediate German, German culture and civilization, advanced conversation and composition, and film. Practical suggestions for pre-viewing, viewing, and post-viewing activities as well as assessment in…

3.10/49 B. GERHARD VON RAD, Das ersfe BucA Mose, Xap. 1-12:9 ...

African Journals Online (AJOL)

Test

3.10/49. B. GERHARD VON RAD, Das ersfe BucA Mose, Xap. 1-12:9. Das Alte. Testament Deutsch, Neues Göttinger Bibelwerk, Nr. 2. Göttingen,. Vandenhoeck und Ruprecht, 1949, 136 bis. Prys 5.40 DM, geb. 7.90 DM. Met hierdie „Teilband" begin 'n besonder welkome verklaring van die Ou Testament in die Duitse taal, ...

O CICLO DAS ÁGUAS DE MOACYR SCLIAR À LUZ DA HERMENÊUTICA SIMBÓLICA O CICLO DAS ÁGUAS BY MOACYR SCLIAR IN THE LIGHT OF SYMBOLIC HERMENEUTICS

Directory of Open Access Journals (Sweden)

Suzana Yolanda Lenhardt Machado Cánovas

2011-02-01

Full Text Available Este trabalho tem como objetivo estudar as imagens da água na narrativa O ciclo das águas, de Moacyr Scliar. Buscamos comprovar que o texto apresenta componentes míticos análogos aos das sociedades primitivas e arcaicas, ainda que pertença a um contexto realista. Isso permite que o aproximemos de poemas e relatos antigos. Mas como a obra de Scliar pertence a um mundo desprovido de significação religiosa, é frequente a desconstrução dos mitos, fato que é responsável pela natureza parodística do texto. Utilizamos concepções de Mircea Eliade, Northrop Frye e José Lorite Mena.This article aims at studying the cyclical images of water in the novel O ciclo das Águas, by Moacyr Scliar. We intend to prove that, even though the work belongs to a realistic context, it presents mythical components similar to primitive and archaic societies, which allows us to approach the novel to poems and ancient reports. However, as the novel by Scliar belongs to a world without religious meaning, it is frequent to observe the deconstruction of myths, which is responsible for the parody intrinsic to the text.

A TRANSIÇÃO PARA A GESTÃO UNIVERSITÁRIA: O SIGNIFICADO DAS RELAÇÕES INTERPESSOAIS

Directory of Open Access Journals (Sweden)

Fabiula Meneguete Vides da Silva

2012-12-01

Full Text Available Busca-se, neste trabalho, compreender o significado das relações interpessoais estabelecidas no processo de transição do contribuidor individual (professor para gestor (reitor ou pró-reitor em universidades. A abordagem fenomenológico-hermenêutica de van Manen (1990 foi utilizada, a fi m de retomar os principais temas desta experiência. Seis ex-gestores universitários emprestaram suas experiências vivenciadas em universidades pertencentes à Associação Catarinense das Fundações Educacionais (ACAFE, por meio das entrevistas em três tempos, preconizadas por Seidman (1998, realizadas entre maio de 2009 e março de 2010. Recorrendo às entrevistas transcritas, foi possível resgatar três grandes temas centrais, que representam os relacionamentos interpessoais que os professores entrevistados viveram como reitores e pró-reitores: as relações profi ssionais, o relacionamento com os alunos e as relações familiares, sentindo apoio e cobrança. Os dados revelados, por meio das experiências dos ex-gestores, embora estejam circunscritos a um universo restrito, revelam temas úteis para a compreensão das relações interpessoais vivenciadas durante a transição de professores para gestores universitários, trazendo, assim, contribuições para pensarmos em políticas de recursos humanos.

[Deutschland, Russland und das Baltikum] / Bogus̮aw Dyba{250}

Index Scriptorium Estoniae

Dyba{250}, Bogus̮aw

2006-01-01

Rets. rmt.: Deutschland, Russland und das Baltikum. Beiträge zu einer Geschichte wechselvoller Beziehungen. Festschrift zum 85. Geburtstag von Peter Krupnikow, hrsg. v. Florian Anton und Leonid Luks (=Schriften des Zentralinstituts für Mittel- und Osteuropastudien. Bd.7), Böhlau Verlag, Köln-Weimar-Wien, 2005

Angiotomografia coronariana multislice na avaliação da origem anômala das artérias coronarianas

Directory of Open Access Journals (Sweden)

Daniel Rocha Rabelo

2012-03-01

Full Text Available Fundamento: A origem anômala das artérias coronarianas é uma entidade relativamente rara, podendo se apresentar de várias formas clínicas e evoluir de forma adversa. A angiotomografia multislice das artérias coronarianas vem ganhando espaço na prática clínica diária, representando importante método propedêutico, com grande potencial na avaliação anatômica dessas artérias. Objetivo: O objetivo deste estudo é descrever os achados angiotomográficos e a evolução de pacientes com origem anômala das artérias coronarianas. Métodos: Durante o período de janeiro de 2008 a março de 2011, foram avaliados consecutivamente 404 pacientes encaminhados para realização de angiotomografia das coronárias por diversos motivos, com tempo médio de seguimento de 21 meses. Resultados: Nove pacientes (2,2% apresentaram origem anômala das artérias coronárias, sendo quatro com origem anômala da artéria circunflexa (Cx em Coronária Direita (CD, dois com origem anômala da CD (um com origem de CD em Cx, e um com origem de CD em seio coronariano esquerdo, um paciente com tronco coronariano único (descendente anterior e Cx saindo do seio coronariano esquerdo, um com trajeto anômalo do tronco da coronária esquerda entre aorta e artéria pulmonar e um paciente apresentando tronco coronariano esquerdo originando-se do seio coronariano direito. Dos pacientes avaliados, um paciente recebeu um cardiodesfibrilador implantável; um paciente evoluiu com morte súbita durante internação hospitalar; e os outros não tiveram intercorrências. Conclusão: A angiotomografia multislice das coronárias representa método propedêutico minimamente invasivo que possibilita detectar a origem, o curso e terminação das anomalias de origem das artérias coronarianas com excelente acurácia, possibilitando o correto diagnóstico e auxiliando no planejamento terapêutico.

Das Eismeer – Caspar David Friedrich and the North

Directory of Open Access Journals (Sweden)

Nina Hinrichs

2008-02-01

1840 created the work of art Das Eismeer in the years 1823/24. Besides his painting Mönch am Meer it is his most radical painting. It depicts a dramatic and grim subject: A shipwreck in the Arctic Sea. According to different cultural, historical and social contexts there have been many different interpretations of his painting since it was produced.

Variáveis fundamentalistas e os retornos das ações

Directory of Open Access Journals (Sweden)

Newton C. A. da Costa Jr.

2000-01-01

Full Text Available O objetivo deste artigo é verificar a influência de três variáveis fundamentalistas (valor de mercado, índice preço/lucro e índice valor patrimonial/preço, além do coeficiente beta, na explicação da rentabilidade média das ações negociadas à vista na Bolsa de Valores de São Paulo, durante o período de março de 1987 a fevereiro de 1996. Utilizou-se o método SUR na estimação dos coeficientes das regressões múltiplas. No período analisado, pôde-se constatar que existiu uma influência significativa destas variáveis no apreçamento das ações. Contudo, beta continuou sendo a principal variável na explicação da relação risco-retorno.This paper examines the influence of three fundamental variables (market capitalization, price-earnings ratio, and book-to-market ratio, and the CAPM beta in the explanation of the average returns of the stocks traded in São Paulo Stock Exchange during the period of March 1987 to February 1996. Multiple regression coefficients were estimated using SUR methodology. The results showed that the fundamental variables can explain a significant part of the cross-sectional returns. However, beta continues to play a significant role in the explanation of the risk-return relationship.

Representação Social das Vivências de Estudantes no Curso de Medicina

Directory of Open Access Journals (Sweden)

Abrão Georges Restom

Full Text Available RESUMO A medicina atua com a prevenção e a cura das doenças humanas num sentido amplo. Uma formação com enfoque em problemas permite ao estudante um poder de análise dos componentes das situações de saúde. O Programa de Integração em Saúde da Comunidade (Pisco prevê levar estudantes e professores para a vivência da prática voltada à integralidade das ações, valorizando a prevenção e a promoção à saúde. O objetivo deste estudo foi analisar as vivências dos estudantes de Medicina no processo de avaliação das atividades do Pisco do primeiro ao quarto ano do curso e a sua relação com o projeto pedagógico do curso. Foi realizado um estudo descritivo quali-quantitativo. Foram produzidos registros escritos pelos estudantes ao final de cada encontro, de março de 2008 a dezembro de 2011, posteriormente analisados por meio do Discurso do Sujeito e pelo software QualiQuantiSoft®. Os resultados mostram diminuição do número de registros a partir da quinta etapa, pois a partir dela os alunos iniciam vivências em ambientes diferentes de prática médica e, assim, passam a desvalorizar as atividades no Programa de Saúde da Família.

Análise dos stakeholders das empresas industriais do estado de São Paulo

Directory of Open Access Journals (Sweden)

Flavio Hourneaux Junior

2014-03-01

Full Text Available Neste estudo, pretende-se analisar as relações entre as empresas industriais do estado de São Paulo e seus stakeholders, tendo como base conceitual a Teoria dos Stakeholders. A pesquisa, descritiva e quantitativa, parte de três atributos - poder, legitimidade e urgência - que definem a relação ou influência entre cada stakeholder e a organização. O levantamento de dados foi conduzido por meio de uma pesquisa do tipo survey eletrônica, com o uso de um questionário enviado a associados do Centro das Indústrias do Estado de São Paulo. A amostragem adotada foi intencional e não probabilística, obtendo-se uma amostra com 149 respostas válidas. Apesar das restrições metodológicas, os resultados indicam que os stakeholders são vistos pelos respondentes de formas diversas, o que tornaria viável a diferenciação de tratamento e de priorização estratégica dos stakeholders por parte das organizações, com predomínio dos clientes e consumidores sobre os demais. Por meio de uma análise fatorial, agruparam-se as 11 classes de stakeholders analisadas em 3 categorias - relacionamento direto com o negócio, relacionamento indireto com o negócio e propriedade do negócio -, diferentes das classificações propostas em estudos anteriores.

I/O Parallelization for the Goddard Earth Observing System Data Assimilation System (GEOS DAS)

Science.gov (United States)

Lucchesi, Rob; Sawyer, W.; Takacs, L. L.; Lyster, P.; Zero, J.

1998-01-01

The National Aeronautics and Space Administration (NASA) Data Assimilation Office (DAO) at the Goddard Space Flight Center (GSFC) has developed the GEOS DAS, a data assimilation system that provides production support for NASA missions and will support NASA's Earth Observing System (EOS) in the coming years. The GEOS DAS will be used to provide background fields of meteorological quantities to EOS satellite instrument teams for use in their data algorithms as well as providing assimilated data sets for climate studies on decadal time scales. The DAO has been involved in prototyping parallel implementations of the GEOS DAS for a number of years and is now embarking on an effort to convert the production version from shared-memory parallelism to distributed-memory parallelism using the portable Message-Passing Interface (MPI). The GEOS DAS consists of two main components, an atmospheric General Circulation Model (GCM) and a Physical-space Statistical Analysis System (PSAS). The GCM operates on data that are stored on a regular grid while PSAS works with observational data that are scattered irregularly throughout the atmosphere. As a result, the two components have different data decompositions. The GCM is decomposed horizontally as a checkerboard with all vertical levels of each box existing on the same processing element(PE). The dynamical core of the GCM can also operate on a rotated grid, which requires communication-intensive grid transformations during GCM integration. PSAS groups observations on PEs in a more irregular and dynamic fashion.

Incorporating Parallel Computing into the Goddard Earth Observing System Data Assimilation System (GEOS DAS)

Science.gov (United States)

Larson, Jay W.

1998-01-01

Atmospheric data assimilation is a method of combining actual observations with model forecasts to produce a more accurate description of the earth system than the observations or forecast alone can provide. The output of data assimilation, sometimes called the analysis, are regular, gridded datasets of observed and unobserved variables. Analysis plays a key role in numerical weather prediction and is becoming increasingly important for climate research. These applications, and the need for timely validation of scientific enhancements to the data assimilation system pose computational demands that are best met by distributed parallel software. The mission of the NASA Data Assimilation Office (DAO) is to provide datasets for climate research and to support NASA satellite and aircraft missions. The system used to create these datasets is the Goddard Earth Observing System Data Assimilation System (GEOS DAS). The core components of the the GEOS DAS are: the GEOS General Circulation Model (GCM), the Physical-space Statistical Analysis System (PSAS), the Observer, the on-line Quality Control (QC) system, the Coupler (which feeds analysis increments back to the GCM), and an I/O package for processing the large amounts of data the system produces (which will be described in another presentation in this session). The discussion will center on the following issues: the computational complexity for the whole GEOS DAS, assessment of the performance of the individual elements of GEOS DAS, and parallelization strategy for some of the components of the system.

Genotoxicity and induction of DNA damage responsive genes by food-borne heterocyclic aromatic amines in human hepatoma HepG2 cells.

Science.gov (United States)

Pezdirc, Marko; Žegura, Bojana; Filipič, Metka

2013-09-01

Heterocyclic aromatic amines (HAAs) are potential human carcinogens formed in well-done meats and fish. The most abundant are 2-Amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP), 2-Amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MeIQx), 2-Amino-3,4,8-trimethyl-3H-imidazo[4,5-f]quinoxaline (4,8-DiMeIQx) and 2-Amino-3-methyl-3H-imidazo[4,5-f]quinoline (IQ). HAAs exert genotoxic activity after metabolic transformation by CYP1A enzymes, that is well characterized, however the genomic and intervening responses are not well explored. We have examined cellular and genomic responses of human hepatoma HepG2 cells after 24h exposure to HAAs. Comet assay revealed increase in formation of DNA strand breaks by PhIP, MeIQx and IQ but not 4,8-DiMeIQx, whereas increased formation of micronuclei was not observed. The four HAAs up-regulated expression of genes encoding metabolic enzymes CYP1A1, CYP1A2 and UGT1A1 and expression of TP53 and its downstream regulated genes CDKN1A, GADD45α and BAX. Consistent with the up-regulation of CDKN1A and GADD45α the cell-cycle analysis showed arrest in S-phase by PhIP and IQ, and in G1-phase by 4,8-DiMeIQx and MeIQx. The results indicate that upon exposure to HAAs the cells respond with the cell-cycle arrest, which enables cells to repair the damage or eliminate them by apoptosis. However, elevated expression of BCL2 and down-regulation of BAX may indicate that HAAs could suppress apoptosis meaning higher probability of damaged cells to survive and mutate. Copyright © 2013 Elsevier Ltd. All rights reserved.

Quantitative evaluation of interstitial pneumonia using 3D-curved high-resolution CT imaging parallel to the chest wall: A pilot study.

Directory of Open Access Journals (Sweden)

Hiroyasu Umakoshi

Full Text Available To quantify the imaging findings of patients with interstitial pneumonia (IP and emphysema using three-dimensional curved high-resolution computed tomography (3D-cHRCT at a constant depth from the chest wall, and compare the results to visual assessment of IP and each patient's diffusing capacity of the lungs for carbon monoxide (DLco.We retrospectively reviewed the axial CT findings and pulmonary function test results of 95 patients with lung cancer (72 men and 23 women, aged 45-84 years with or without IP, as follows: non-IP (n = 47, mild IP (n = 31, and moderate IP (n = 17. The 3D-cHRCT images of the lung at a 1-cm depth from the chest wall were reconstructed automatically using original software; total area (TA, high-attenuation area (HAA >-500 HU, and low-attenuation area (LAA <-950 HU were calculated on a workstation. The %HAA and %LAA were calculated as follows: [Formula: see text], and [Formula: see text].The %HAA and %LAA respective values were 3.2±0.9 and 27.7±8.2, 3.9±1.2 and 27.6±5.9, and 6.9±2.2 and 25.4±8.7 in non-IP, mild IP, and moderate IP patients, respectively. There were significant differences in %HAA between the 3 groups of patients (P<0.001, but no differences in %LAA (P = 0.558. Multiple linear regression analysis revealed that %HAA and %LAA were negatively correlated with predicted DLco (standard partial regression coefficient [b*] = -0.453, P<0.001; b* = -0.447, P<0.001, respectively.The %HAA and %LAA values computed using 3D-cHRCT were significantly correlated with DLco and may be important quantitative parameters for both IP and emphysema.

Antioxidant Properties of Kynurenines: Density Functional Theory Calculations

Science.gov (United States)

2016-01-01

Kynurenines, the main products of tryptophan catabolism, possess both prooxidant and anioxidant effects. Having multiple neuroactive properties, kynurenines are implicated in the development of neurological and cognitive disorders, such as Alzheimer's, Parkinson's, and Huntington's diseases. Autoxidation of 3-hydroxykynurenine (3HOK) and its derivatives, 3-hydroxyanthranilic acid (3HAA) and xanthommatin (XAN), leads to the hyperproduction of reactive oxygen species (ROS) which damage cell structures. At the same time, 3HOK and 3HAA have been shown to be powerful ROS scavengers. Their ability to quench free radicals is believed to result from the presence of the aromatic hydroxyl group which is able to easily abstract an electron and H-atom. In this study, the redox properties for kynurenines and several natural and synthetic antioxidants have been calculated at different levels of density functional theory in the gas phase and water solution. Hydroxyl bond dissociation enthalpy (BDE) and ionization potential (IP) for 3HOK and 3HAA appear to be lower than for xanthurenic acid (XAA), several phenolic antioxidants, and ascorbic acid. BDE and IP for the compounds with aromatic hydroxyl group are lower than for their precursors without hydroxyl group. The reaction rate for H donation to *O-atom of phenoxyl radical (Ph-O*) and methyl peroxy radical (Met-OO*) decreases in the following rankings: 3HOK ~ 3HAA > XAAOXO > XAAENOL. The enthalpy absolute value for Met-OO* addition to the aromatic ring of the antioxidant radical increases in the following rankings: 3HAA* < 3HOK* < XAAOXO* < XAAENOL*. Thus, the high free radical scavenging activity of 3HAA and 3HOK can be explained by the easiness of H-atom abstraction and transfer to O-atom of the free radical, rather than by Met-OO* addition to the kynurenine radical. PMID:27861556

Identificação, mensuração e caracterização das perdas por transporte em processos construtivos

Directory of Open Access Journals (Sweden)

Cristina Toca Pérez

Full Text Available Resumo Este artigo tem como objetivo apresentar o processo de identificação, mensuração e caracterização das perdas por transporte nos fluxos físicos de processos construtivos, considerando suas incidências, tempos, causas e consequências. A abordagem metodológica adotada foi Design Science Research, desenvolvida a partir de dois estudos de caso em processos ainda poucos empregados no Brasil, quais sejam, revestimento com argamassa projetada e Light Steel Frame. Esses estudos foram conduzidos a partir das etapas de identificação dos fluxos físicos, identificação da distribuição dos tempos dos trabalhadores e caracterização das perdas por transporte. Múltiplas fontes de evidências, ferramentas e técnicas foram utilizadas para a organização dos eventos de perda por transporte, associados a suas causas e consequências. Os resultados obtidos indicaram que a maior parte das perdas por transporte foram ocasionadas por problemas de mobilidade dentro do canteiro. Problemas causados pela falta de equipamentos apropriados foram os que mais perda de tempo ocasionaram. A redução das condições de segurança e a necessidade de um novo transporte foram as principais consequências observadas. As principais contribuições deste estudo estão relacionadas ao maior entendimento da natureza das perdas por transporte, à adoção de ferramentas e indicadores para a caracterização das perdas por transporte do ponto de vista de sua incidência e tempos, bem como uma proposta de classificação das principais causas e consequências para a caracterização dessas perdas.

Potentially bioavailable natural organic carbon and hydrolyzable amino acids in aquifer sediments

Science.gov (United States)

Thomas, Lashun K.; Widdowson, Mark A.; Novak, John T.; Chapelle, Francis H.; Benner, Ronald; Kaiser, Karl

2012-01-01

This study evaluated the relationship between concentrations of operationally defined potentially bioavailable organic -carbon (PBOC) and hydrolyzable amino acids (HAAs) in sediments collected from a diverse range of chloroethene--contaminated sites. Concentrations of PBOC and HAA were measured using aquifer sediment samples collected at six selected study sites. Average concentrations of total HAA and PBOC ranged from 1.96 ± 1.53 to 20.1 ± 25.6 mg/kg and 4.72 ± 0.72 to 443 ± 65.4 mg/kg, respectively. Results demonstrated a statistically significant positive relationship between concentrations of PBOC and total HAA present in the aquifer sediment (p amino acids are known to be readily biodegradable carbon compounds, this relationship suggests that the sequential chemical extraction procedure used to measure PBOC is a useful indicator of bioavailable carbon in aquifer sediments. This, in turn, is consistent with the interpretation that PBOC measurements can be used for estimating the amount of natural organic carbon available for driving the reductive dechlorination of chloroethenes in groundwater systems.

Genotoxicity of drinking water treated with different disinfectants and effects of disinfection conditions detected by umu-test.

Science.gov (United States)

Nie, Xuebiao; Liu, Wenjun; Zhang, Liping; Liu, Qing

2017-06-01

The genotoxicity of drinking water treated with 6 disinfection methods and the effects of disinfection conditions were investigated using the umu-test. The pretreatment procedure of samples for the umu-test was optimized for drinking water analysis. The results of the umu-test were in good correlation with those of the Ames-test. The genotoxicity and production of haloacetic acids (HAAs) were the highest for chlorinated samples. UV+chloramination is the safest disinfection method from the aspects of genotoxicity, HAA production and inactivation effects. For chloramination, the effects of the mass ratio of Cl 2 to N of chloramine on genotoxicity were also studied. The changes of genotoxicity were different from those of HAA production, which implied that HAA production cannot represent the genotoxic potential of water. The genotoxicity per chlorine decay of chlorination and chloramination had similar trends, indicating that the reaction of organic matters and chlorine made a great contribution to the genotoxicity. The results of this study are of engineering significance for optimizing the operation of waterworks. Copyright © 2016. Published by Elsevier B.V.

Visions for the car of the future; Visionen fuer das Automobil der Zukunft

Energy Technology Data Exchange (ETDEWEB)

Leschke, H. [DaimlerChrysler AG, Sindelfingen (Germany)

2000-07-01

The car is 115 years old. Where is it heading on its journey through time which has - up until now - been more evolutionary than revolutionary? The criterion will be to achieve advantages for our customers, and we must channel all our efforts into doing so. 'Emotional' - and therefore 'irrational' feelings - stand in opposition to this rational criterion. A car must please, otherwise it simply will not sell. And let us not forget the 'brand-specific' aspect of car design, which is perceived in a very emotional way. Our profession - and therefore our professionalism too - must see to it that the laws of aesthetics remain on a comprehensible scale, but must develop further from the point of view of different cultures, their development thus far and a general global rapprochement. Design is allowed to provoke, to intrigue our customers; it must arouse emotions. Both emotion and provocation lead to polarity. On balance: there will be something for everyone, a variety of different concepts and designs as a way of portraying one's own individuality in a motoring medley. The basic prerequisite: we should still find driving a car fun - even in the year 2000. (orig.) [German] Das Automobil ist 115 Jahre alt. Wohin geht seine bisherige, eher evolutionaere als revolutionaere Reise? Kundennutzen wird das Kriterium sein, dem sich all unser Tun stellen muss. Diesem rationalen Kriterium steht das 'Emotionale' und damit eher 'Irrationale' gegenueber. Ein Automobil muss gefallen, sonst wird es nicht gekauft. Vergessen wir nicht das sehr emotional wahrgenommene 'Markenspezifische' Automobil-Design. Unsere Profession, und damit auch unsere Professionalitaet, muessen Sorge tragen, dass die Gesetze der Aesthetik in einem nachvollziehbaren Rahmen bleiben, sich aber unter dem Aspekt der unterschiedlichen Kulturen, deren bisheriger Entwicklung und weltweiten Annaeherung weiterentwickeln muessen. Design darf provozieren