Characterization of a Madin-Darby canine kidney cell line stably expressing TRPV5.
Dekker, E. den; Schoeber, J.P.H.; Topala, C.N.; Graaf, S.F.J. van de; Hoenderop, J.G.J.; Bindels, R.J.M.
2005-01-01
To provide a cell model for studying specifically the regulation of Ca2+ entry by the epithelial calcium channel transient receptor potential-vanilloid-5 (TRPV5), green fluorescent protein (GFP)-tagged TRPV5 was expressed stably in Madin-Darby canine kidney type I (MDCK) cells. The localization of
Cyclooxygenase expression in canine platelets and Madin-Darby canine kidney cells.
Kay-Mugford, P A; Benn, S J; LaMarre, J; Conlon, P D
2000-12-01
To examine cyclooxygenase (COX) expression in canine platelets and Madin-Darby canine kidney (MDCK) cells in culture. Canine platelets and MDCK cells. Total RNA was recovered from isolated canine platelets and MDCK cells. Northern blot analysis and reverse transcription-polymerase chain reaction (RT-PCR), using complementary DNA probes and primers designed from the human COX sequences, were used to determine COX-1 and -2 (cyclooxygenase isoforms 1 and 2) messenger RNA (mRNA) expression. Following northern blot analysis, canine platelets were found to express only the 2.8-kb COX-1 transcript; COX-2 was not detected. Canine MDCK cells expressed the 4.5-kb COX-2 transcript, in addition to the 2.8-kb COX-1 transcript. A single DNA band of 270 base pairs was identified following gel electrophoresis of the product obtained from RT-PCR of mRNA from canine platelets. Sequencing revealed that this PCR product was 90% homologous to a portion of the human COX-1 gene (Genbank M59979). Detection of COX-1 by RT-PCR of RNA obtained from canine platelets is a novel finding. The 90% homology of the PCR product with the human sequence suggests strong conservation between the canine and human COX-1 gene. Cloning and sequencing of the canine gene will be required to fully characterize homologous regions. Because of the importance of COX in the inflammatory process and as a potential target of currently available nonsteroidal anti-inflammatory drugs (NSAID), a better understanding of canine COX may improve our ability to use NSAID appropriately, achieve efficacy, and avoid potential adverse drug effects in dogs.
Changes in ceramide metabolism are essential in Madin-Darby canine kidney cell differentiation.
Pescio, Lucila Gisele; Santacreu, Bruno Jaime; Lopez, Vanina Gisela; Paván, Carlos Humberto; Romero, Daniela Judith; Favale, Nicolás Octavio; Sterin-Speziale, Norma Beatriz
2017-07-01
Ceramides (Cers) and complex sphingolipids with defined acyl chain lengths play important roles in numerous cell processes. Six Cer synthase (CerS) isoenzymes (CerS1-6) are the key enzymes responsible for the production of the diversity of molecular species. In this study, we investigated the changes in sphingolipid metabolism during the differentiation of Madin-Darby canine kidney (MDCK) cells. By MALDI TOF TOF MS, we analyzed the molecular species of Cer, glucosylceramide (GlcCer), lactosylceramide (LacCer), and SM in nondifferentiated and differentiated cells (cultured under hypertonicity). The molecular species detected were the same, but cells subjected to hypertonicity presented higher levels of C24:1 Cer, C24:1 GlcCer, C24:1 SM, and C16:0 LacCer. Consistently with the molecular species, MDCK cells expressed CerS2, CerS4, and CerS6, but with no differences during cell differentiation. We next evaluated the different synthesis pathways with sphingolipid inhibitors and found that cells subjected to hypertonicity in the presence of amitriptyline, an inhibitor of acid sphingomyelinase, showed decreased radiolabeled incorporation in LacCer and cells did not develop a mature apical membrane. These results suggest that hypertonicity induces the endolysosomal degradation of SM, generating the Cer used as substrate for the synthesis of specific molecular species of glycosphingolipids that are essential for MDCK cell differentiation. Copyright © 2017 by the American Society for Biochemistry and Molecular Biology, Inc.
International Nuclear Information System (INIS)
Cho, M.J.; Adson, A.; Kezdy, F.J.
1990-01-01
Transport of 14C-labeled acetic, propionic (PA), butyric, valeric, heptanoic (HA), and octanoic (OA) acids across the Madin Darby canine kidney (MDCK) epithelial cell monolayer grown on a porous polycarbonate membrane was studied in Hanks' balanced salt solution (HBSS) at 37 degrees C in both apical-to-basolateral and basolateral-to-apical directions. At micromolar concentrations of solutes, metabolic decomposition was significant as evidenced by [14C]CO2 production during the OA transport. The apparent permeability (Pe) indicates that as lipophilicity increases, diffusion across the unstirred boundary layer becomes rate limiting. In support of this notion, transport of OA and HA was enhanced by agitation, showed an activation energy of 3.7 kcal/mol for OA, and resulted in identical Pe values for both transport directions. Analysis of Pe changes with varying alkyl chain length resulted in a delta G of -0.68 +/- 0.09 kcal/mol for -CH2-group transfer from an aqueous phase to the MDCK cells. When the intercellular tight junctions were opened by the divalent chelator EGTA in Ca2+/Mg2(+)-free HBSS, transport of the fluid-phase marker Lucifer yellow greatly increased because of paracellular leakage. PA transport also showed a significant increase, but OA transport was independent of EGTA. Although albumin also undergoes paracellular transport in the presence of EGTA and OA binds strongly to albumin, OA transport in EGTA solution was unchanged by albumin. These observations indicate that transmembrane transport is the major mechanism for lipophilic substances. The present study, together with earlier work on the transport of polar substances, shows that the MDCK cell monolayer is an excellent model of the transepithelial transport barrier
Brinster, Lauren R; Omeir, Romelda L; Foseh, Gideon S; Macauley, Juliete N; Snoy, Philip J; Beren, Joel J; Teferedegne, Belete; Peden, Keith; Lewis, Andrew M
2013-08-01
Tumors that formed in newborn nude mice that were inoculated with 10(7) Madin-Darby canine kidney (MDCK) cells were associated with a failure-to-thrive (FTT) syndrome consisting of growth retardation, lethargy, weakness, and dehydration. Scoliosis developed in 41% of affected pups. Pups were symptomatic by week 2; severely affected pups became moribund and required euthanasia within 3 to 4 wk. Mice with FTT were classified into categories of mild, moderate, and severe disease by comparing their weight with that of age-matched normal nude mice. The MDCK-induced tumors were adenocarcinomas that invaded adjacent muscle, connective tissue, and bone; 6 of the 26 pups examined had lung metastases. The induction of FTT did not correlate with cell-line aggressiveness as estimated by histopathology or the efficiency of tumor formation (tumor-forming dose 50% endpoint range = 10(2.8) to 10(7.5)); however, tumor invasion of the paravertebral muscles likely contributed to the scoliosis noted. In contrast to the effect of MDCK cells, tumor formation observed in newborn mice inoculated with highly tumorigenic, human-tumor-derived cell lines was not associated with FTT development. We suggest that tumor formation and FTT are characteristics of these MDCK cell inocula and that FTT represents a new syndrome that may be similar to the cachexia that develops in humans with cancer or other diseases.
Directory of Open Access Journals (Sweden)
Balvinder S. Vig
2012-06-01
Full Text Available The expression levels of genes involved in drug and nutrient absorption were evaluated in the Madin-Darby Canine Kidney (MDCK in vitro drug absorption model. MDCK cells were grown on plastic surfaces (for 3 days or on Transwell® membranes (for 3, 5, 7, and 9 days. The expression profile of genes including ABC transporters, SLC transporters, and cytochrome P450 (CYP enzymes was determined using the Affymetrix® Canine GeneChip®. Expression of genes whose probe sets passed a stringent confirmation process was examined. Expression of a few transporter (MDR1, PEPT1 and PEPT2 genes in MDCK cells was confirmed by RT-PCR. The overall gene expression profile was strongly influenced by the type of support the cells were grown on. After 3 days of growth, expression of 28% of the genes was statistically different (1.5-fold cutoff, p < 0.05 between the cells grown on plastic and Transwell® membranes. When cells were differentiated on Transwell® membranes, large changes in gene expression profile were observed during the early stages, which then stabilized after 5–7 days. Only a small number of genes encoding drug absorption related SLC, ABC, and CYP were detected in MDCK cells, and most of them exhibited low hybridization signals. Results from this study provide valuable reference information on endogenous gene expression in MDCK cells that could assist in design of drug-transporter and/or drug-enzyme interaction studies, and help interpret the contributions of various transporters and metabolic enzymes in studies with MDCK cells.
Directory of Open Access Journals (Sweden)
Sheng-Nan Wu
2015-01-01
Full Text Available The nitrogen-containing bisphosphonates used for management of the patients with osteoporosis were reported to influence the function of renal tubular cells. However, how nitrogen-containing bisphosphates exert any effects on ion currents remains controversial. The effects of ibandronate (Iban, a nitrogen-containing bisphosphonate, on ionic channels, including two types of Ca2+-activated K+ (KCa channels, namely, large-conductance KCa (BKCa and intermediate-conductance KCa (IKCa channels, were investigated in Madin–Darby canine kidney (MDCK cells. In whole-cell current recordings, Iban suppressed the amplitude of voltage-gated K+ current elicited by long ramp pulse. Addition of Iban caused a reduction of BKCa channels accompanied by a right shift in the activation curve of BKCa channels, despite no change in single-channel conductance. Ca2+ sensitivity of these channels was modified in the presence of this compound; however, the magnitude of Iban-mediated decrease in BKCa-channel activity under membrane stretch with different negative pressure remained unchanged. Iban suppressed the probability of BKCa-channel openings linked primarily to a shortening in the slow component of mean open time in these channels. The dissociation constant needed for Iban-mediated suppression of mean open time in MDCK cells was 12.2 μM. Additionally, cell exposure to Iban suppressed the activity of IKCa channels, and DC-EBIO or 9-phenanthrol effectively reversed its suppression. Under current-clamp configuration, Iban depolarized the cells and DC-EBIO or PF573228 reversed its depolarizing effect. Taken together, the inhibitory action of Iban on KCa-channel activity may contribute to the underlying mechanism of pharmacological or toxicological actions of Iban and its structurally similar bisphosphonates on renal tubular cells occurring in vivo.
Metabolic flux profiling of MDCK cells during growth and canine adenovirus vector production
Nuno Carinhas; Daniel A. M. Pais; Alexey Koshkin; Paulo Fernandes; Ana S. Coroadinha; Manuel J. T. Carrondo; Paula M. Alves; Ana P. Teixeira
2016-01-01
Canine adenovirus vector type 2 (CAV2) represents an alternative to human adenovirus vectors for certain gene therapy applications, particularly neurodegenerative diseases. However, more efficient production processes, assisted by a greater understanding of the effect of infection on producer cells, are required. Combining [1,2-13C]glucose and [U-13C]glutamine, we apply for the first time 13C-Metabolic flux analysis (13C-MFA) to study E1-transformed Madin-Darby Canine Kidney (MDCK) cells meta...
Pan, Sung-Ching; Kung, Hsiang-Chi; Kao, Tsui-Mai; Wu, Hsio; Dong, Shao-Xing; Hu, Mei-Hua; Chou, Ai-Hsiang; Chong, Pele; Hsieh, Szu-Min; Chang, Shan-Chwen
2013-12-01
Avian H5N1 influenza has caused human infections globally and has a high mortality rate. Rapid production of effective vaccines is needed. A phase 1, randomized, observer-blinded clinical trial was conducted to examine the safety and immunogenicity of an inactivated whole virion vaccine against the influenza A/H5N1 virus produced from the Madin-Darby canine kidney (MDCK) cell line. Participants were randomized to four groups and administered two intramuscular doses of vaccine containing 3 μg hemagglutinin (HA), 3 μg HA with 300 μg aluminum phosphate (AlPO4), 6 μg HA, and 6 μg HA with 300 μg AlPO4, respectively, at two visits, 21 days apart. Serum hemagglutination inhibition (HAI) and neutralizing antibody levels were determined at baseline and on Days 21 and 42. Sixty healthy individuals were enrolled. The neutralization assay showed a significant immune response in the 6 μg with ALPO4 group on Day 42 compared to pre-vaccination levels (11.32±9.77 vs. 4.00±0, p=0.02). The adjuvant effect in neutralization assay was also significant on Day 42 in the 6 μg group (4.52±1.94 without adjuvant vs. 11.32±9.77 with adjuvant, p=0.02). HAI assay also showed an aluminum adjuvant-induced increasing trend in HAI geometric mean titer on Day 42 in the 3 μg and 6 μg groups (6.02 versus 8.20, p=0.05 and 5.74 versus 8.21, p=0.14). The most frequent adverse event was local pain (20% to 60%). There were no vaccine-related severe adverse effects. MDCK cell line-derived H5N1 vaccine was well tolerated. It is necessary to investigate further the immunogenicity of higher antigen doses and the role of aluminum adjuvant in augmenting the effect of the vaccine. Copyright © 2012. Published by Elsevier B.V.
International Nuclear Information System (INIS)
Slivka, S.R.; Insel, P.A.
1987-01-01
alpha 1-Adrenergic receptors mediate two effects on phospholipid metabolism in Madin-Darby canine kidney (MDCK-D1) cells: hydrolysis of phosphoinositides and arachidonic acid release with generation of prostaglandin E2 (PGE2). The similarity in concentration dependence for the agonist (-)-epinephrine in eliciting these two responses implies that they are mediated by a single population of alpha 1-adrenergic receptors. However, we find that the kinetics of the two responses are quite different, PGE2 production occurring more rapidly and transiently than the hydrolysis of phosphoinositides. The antibiotic neomycin selectively decreases alpha 1-receptor-mediated phosphatidylinositol 4,5-bisphosphate hydrolysis without decreasing alpha 1-receptor-mediated arachidonic acid release and PGE2 generation. In addition, receptor-mediated inositol trisphosphate formation is independent of extracellular calcium, whereas release of labeled arachidonic acid is largely calcium-dependent. Moreover, based on studies obtained with labeled arachidonic acid, receptor-mediated generation of arachidonic acid cannot be accounted for by breakdown of phosphatidylinositol monophosphate, phosphatidylinositol bisphosphate, or phosphatidic acid. Further studies indicate that epinephrine produces changes in formation or turnover of several classes of membrane phospholipids in MDCK cells. We conclude that alpha 1-adrenergic receptors in MDCK cells appear to regulate phospholipid metabolism by the parallel activation of phospholipase C and phospholipase A2. This parallel activation of phospholipases contrasts with models described in other systems which imply sequential activation of phospholipase C and diacylglycerol lipase or phospholipase A2
Zhang, Kao; Jin, Huijun; Zhong, Fei; Li, Xiujin; Neng, Changai; Chen, Huihui; Li, Wenyan; Wen, Jiexia
2012-11-04
To construct recombinant adenovirus containing canine interferon-gamma (cIFN-gamma) gene and to investigate its antiviral activity against canine parvovirus in Madin-Darby canine kidney cells (MDCK). [Methods] The cIFN-gamma gene was inserted into adenovirus shuttle plasmid to construct pShuttle3-cIFN-gamma expression vector, from which the cIFN-gamma expression cassette was transferred into the adenovirus genomic plasmid pAdeno-X by specific restriction sites to generate recombinant adenovirus genomic plasmid pAd-cIFN-gamma. The pAd-cIFN-gamma plasmid was linearized by digestion and transfected into human embryonic kidney (HEK) 293T cells to generate the replication-defective cIFN-gamma recombinant adenovirus (Ad-cIFN-gamma). To analyze its anti-canine parvovirus activity, the MDCK cells were pre-infected by Ad-cIFN-gamma recombinant adenovirus, and then infected by canine parvovirus. The antiviral activity of the Ad-cIFN-gamma recombinant adenovirus against parvovirus was analyzed. The recombinant adenovirus containing cIFN-gamma gene was constructed by the ligation method. The recombinant adenovirus could mediates recombinant cIFN-gamma secretory expression in MDCK cells. The Ad-cIFN-gamma recombinant adenovirus could significantly inhibit canine parvovirus replication in MDCK cells pre-infected with the recombinant adenovirus. These results indicate that the Ad-cIFN-gamma recombinant adenovirus has the potent antiviral activity against canine parvovirus. The Ad-cIFN-gamma recombinant adenovirus was successfully constructed by the ligation method and possessed a powerful antiviral activity against canine parvovirus.
First detection of canine parvovirus type 2b from diarrheic dogs in Himachal Pradesh
DEFF Research Database (Denmark)
Sharma, Shalini; Dhar, Prasenjit; Thakur, Aneesh
2016-01-01
AIM: The present study was conducted to detect the presence of canine parvovirus (CPV) among diarrheic dogs in Himachal Pradesh and to identify the most prevalent antigenic variant of CPV based on molecular typing and sequence analysis of VP2 gene. MATERIALS AND METHODS: A total of 102 fecal...... for the detection of CPV-2c. CPV-2b isolate was cultured on Madin-Darby canine kidney (MDCK) cell lines and sequenced using VP2 structural protein gene. Multiple alignment and phylogenetic analysis was done using ClustalW and MEGA6 and inferred using the Neighbor-Joining method. RESULTS: No sample was found...
The Functional Effect of an Amphiregulin Autocrine Loop on Inflammatory Breast Cancer Progression
2008-03-01
Darby canine kidney cells (15). Also, using targeted knockout mice, Luetteke et al. reported that specific loss of AR, but not EGF or TGF-a, severely...due to relocalization of E-cadherin in Madin-Darby canine kidney cells (15). Our laboratory has also discovered that AR signaling differs from EGF...growth factor induction of matrix metalloproteinases and their inhibitors in osteosarcoma cells is modulated by the metastasis associated protein CAPL
Pretranslational regulation of Na-K-ATPase in cultured canine kidney cells by low K
Energy Technology Data Exchange (ETDEWEB)
Bowen, J.W.; McDonough, A.
1987-02-01
Long-term upregulation of the sodium pump (Na-K-adenosine triphosphatase (Na-K-ATPase)) entails an increase in the number of enzyme molecules. The authors incubated Madin-Darby canine kidney (MDCK) cells in low K medium and studied the time course and magnitude of change in the relative abundance of the two Na-K-ATPase subunits ( and US ), in the synthesis rate of the subunits, and in the relative abundance of - and US -mRNA. When cells were incubated in medium containing 0.25 mM K , intracellular Na increased. The relative abundance of Na-K-ATPase subunits, measured with ( SVI)-labelled immunoblots of cell homogenates, increases such that after 24 h was 1.71 +/- 0.33 and US was 1.67 +/- 0.22 times control. After 8 h of K depletion, -synthesis rate, measured by immunoprecipitation of pulse-labelled cells, increased to 2.30 +/- 0.50 and beta increased to 2.07 +/- 0.42 times control. The - and US -subunit mRNA abundance, measured by hybridizing - and US -cDNA probes to total RNA, increased within 30 min to 1.93 +/- 0.24 and 2.29 +/- 0.64 times control, respectively. They conclude that regulatory adjustments of Na-K-ATPase abundance involve an increase in translation after a rapid and coordinate increase in the concentrations of - and US -subunit mRNA.
The Use of Orthogonal Polarizations in Microwave Imagery of Isolated Canine Kidney
Larsen, L. E.; Jacobi, J. H.
1980-06-01
A method of imaging biological targets using microwave radiation at a frequency of 4 GHz is presented. Linearly polarized radiation is transmitted through an isolated canine kidney and received with co-polarized and cross-polarized antennas. Images are displayed as the spatial variation of the magnitude of the transmission scattering parameter S21 for each mode of polarization. The relationship between the spatial variation of the magnitude of S21 and canine renal anatomy is discussed. It is shown that within the kidney the cross-polarized image tends to emphasize linear or piecewise linear structures, whereas the co-polarized image balances renal cortical lobulations.
Directory of Open Access Journals (Sweden)
Ding Zhang
Full Text Available Cadmium ions (Cd2+ have been reported to accumulate in bovine tissues, although Cd2+ cytotoxicity has not been investigated thoroughly in this species. Zinc ions (Zn2+ have been shown to antagonize the toxic effects of heavy metals such as Cd2+ in some systems. The present study investigated Cd2+ cytotoxicity in Madin-Darby bovine kidney (MDBK epithelial cells, and explored whether this was modified by Zn2+. Exposure to Cd2+ led to a dose- and time-dependent increase in apoptotic cell death, with increased intracellular levels of reactive oxygen species and mitochondrial damage. Zn2+ supplementation alleviated Cd2+-induced cytotoxicity and this protective effect was more obvious when cells were exposed to a lower concentration of Cd2+ (10 μM, as compared to 50 μM Cd2+. This indicated that high levels of Cd2+ accumulation might induce irreversible damage in bovine kidney cells. Metallothioneins (MTs are metal-binding proteins that play an essential role in heavy metal ion detoxification. We found that co-exposure to Zn2+ and Cd2+ synergistically enhanced RNA and protein expression of MT-1, MT-2, and the metal-regulatory transcription factor 1 in MDBK cells. Notably, addition of Zn2+ reduced the amounts of cytosolic Cd2+ detected following MDBK exposure to 10 μM Cd2+. These findings revealed a protective role of Zn2+ in counteracting Cd2+ uptake and toxicity in MDBK cells, indicating that this approach may provide a means to protect livestock from excessive Cd2+ accumulation.
Metabolic flux profiling of MDCK cells during growth and canine adenovirus vector production.
Carinhas, Nuno; Pais, Daniel A M; Koshkin, Alexey; Fernandes, Paulo; Coroadinha, Ana S; Carrondo, Manuel J T; Alves, Paula M; Teixeira, Ana P
2016-03-23
Canine adenovirus vector type 2 (CAV2) represents an alternative to human adenovirus vectors for certain gene therapy applications, particularly neurodegenerative diseases. However, more efficient production processes, assisted by a greater understanding of the effect of infection on producer cells, are required. Combining [1,2-(13)C]glucose and [U-(13)C]glutamine, we apply for the first time (13)C-Metabolic flux analysis ((13)C-MFA) to study E1-transformed Madin-Darby Canine Kidney (MDCK) cells metabolism during growth and CAV2 production. MDCK cells displayed a marked glycolytic and ammoniagenic metabolism, and (13)C data revealed a large fraction of glutamine-derived labelling in TCA cycle intermediates, emphasizing the role of glutamine anaplerosis. (13)C-MFA demonstrated the importance of pyruvate cycling in balancing glycolytic and TCA cycle activities, as well as occurrence of reductive alphaketoglutarate (AKG) carboxylation. By turn, CAV2 infection significantly upregulated fluxes through most central metabolism, including glycolysis, pentose-phosphate pathway, glutamine anaplerosis and, more prominently, reductive AKG carboxylation and cytosolic acetyl-coenzyme A formation, suggestive of increased lipogenesis. Based on these results, we suggest culture supplementation strategies to stimulate nucleic acid and lipid biosynthesis for improved canine adenoviral vector production.
Drug-permeability and transporter assays in Caco-2 and MDCK cell lines.
Volpe, Donna A
2011-12-01
The human colon adenocarcinoma Caco-2 and Madin-Darby canine kidney epithelial cell lines provide in vitro tools to assess a drug's permeability and transporter interactions during discovery and development. The cells, when cultured on semiporous filters, form confluent monolayers that model the intestinal epithelial barrier for permeability, transporter and drug-interaction assays. The applications of these assays in pharmaceutical research include qualitative prediction and ranking of absorption, determining mechanism(s) of permeability, formulation effects on drug permeability, and the potential for transporter-mediated drug-drug interactions. This review focuses on recent examples of Caco-2 and Madin-Darby canine kidney cells assays for drug permeability including transfected and knock-down cells, miniaturization and automation, and assay combinations to better understand and predict intestinal drug absorption.
Urine neutrophil gelatinase-associated lipocalin (NGAL as a biomarker for acute canine kidney injury
Directory of Open Access Journals (Sweden)
Lee Ya-Jane
2012-12-01
Full Text Available Abstract Background Biomarkers for the early prediction of canine acute kidney injury (AKI are clinically important. Recently, neutrophil gelatinase-associated lipocalin (NGAL was found to be a sensitive biomarker for the prediction of human AKI at a very early stage and the development of AKI after surgery. However, NGAL has not yet been studied with respect to dog kidney diseases. The application of NGAL canine AKI was investigated in this study. Results The canine NGAL gene was successfully cloned and expressed. Polyclonal antibodies against canine NGAL were generated and used to develop an ELISA for measuring NGAL protein in serum and urine samples that were collected from 39 dogs at different time points after surgery. AKI was defined by the standard method, namely a serum creatinine increase of greater than or equal to 26.5 μmol/L from baseline within 48 h. At 12 h after surgery, compared to the group without AKI (12 dogs, the NGAL level in the urine of seven dogs with AKI was significantly increased (median 178.4 pg/mL vs. 88.0 pg/mL, and this difference was sustained to 72 h. Conclusion As the increase in NGAL occurred much earlier than the increase in serum creatinine, urine NGAL seems to be able to serve as a sensitive and specific biomarker for the prediction of AKI in dogs.
A rapid method for immunotitration of influenza viruses using flow cytometry
Lonsdale, R.; Pau, M. G.; Oerlemans, M.; Ophorst, C.; Vooys, A.; Havenga, M.; Goudsmit, J.; Uytdehaag, F.; Marzio, G.
2003-01-01
Reliable assays for accurate titration of influenza virus in infectious samples are pivotal to both influenza research and vaccine development. A titration assay adopted commonly for this purpose is the plaque assay on Madin-Darby canine kidney (MDCK) cells, despite it being time and labour
Targeting of SNAP-23 and SNAP-25 in polarized epithelial cells
Low, SH; Roche, PA; Anderson, HA; van Ijzendoorn, SCD; Zhang, M; Mostov, KE; Weimbs, T
1998-01-01
SNAP-23 is the ubiquitously expressed homologue of the neuronal SNAP-25, which functions in synaptic vesicle fusion, We have investigated the subcellular localization of SNAP-23 in polarized epithelial cells, In hepatocyte-derived HepG2 cells and in Madin-Darby canine kidney (MDCK) cells, the
Directory of Open Access Journals (Sweden)
Lushan Yu
2013-03-01
Full Text Available Three series of 3-(2-aminoheterocycle-4-benzyloxyphenylbenzamide derivatives, 2-aminooxazoles, 2-aminothiazoles, and 2-amino-6H-1,3,4-thiadizines were designed, synthesized and evaluated as β-secretase (BACE-1 inhibitors. Preliminary structure-activity relationships revealed that the existence of a 2-amino-6H-1,3,4-thiadizine moiety and α-naphthyl group were favorable for BACE-1 inhibition. Among the synthesized compounds, 5e exhibited the most potent BACE-1 inhibitory activity, with an IC50 value of 9.9 μΜ and it exhibited high brain uptake potential in Madin-Darby anine kidney cell lines (MDCK and a Madin-Darby canine kidney-multidrug resistance 1 (MDCK-MDR1 model.
Shangguan, Shihao; Wang, Fei; Liao, Yong; Yu, Haiping; Li, Jia; Huang, Wenhai; Hu, Haihong; Yu, Lushan; Hu, Yongzhou; Sheng, Rong
2013-03-20
Three series of 3-(2-aminoheterocycle)-4-benzyloxyphenylbenzamide derivatives, 2-aminooxazoles, 2-aminothiazoles, and 2-amino-6H-1,3,4-thiadizines were designed, synthesized and evaluated as β-secretase (BACE-1) inhibitors. Preliminary structure-activity relationships revealed that the existence of a 2-amino-6H-1,3,4-thiadizine moiety and α-naphthyl group were favorable for BACE-1 inhibition. Among the synthesized compounds, 5e exhibited the most potent BACE-1 inhibitory activity, with an IC50 value of 9.9 μΜ and it exhibited high brain uptake potential in Madin-Darby anine kidney cell lines (MDCK) and a Madin-Darby canine kidney-multidrug resistance 1 (MDCK-MDR1) model.
John Nelson Darby: His Contributions to Evangelical Christian Higher Education
Sutherland, Winston Terrance
2010-01-01
The study reported in this article focused on the contributions of John Nelson Derby to biblical hermeneutics and contemporary eschatological thought. Darby continues to exert a great influence on Christianity, particularly conservative evangelical Christianity. This research provides a discussion of Darby's contributions to contemporary…
Mouse Model for Aerosol Infection of Influenza (Postprint)
2011-12-01
quantified by cell culture end- point–dilution assays performed using Madin–Darby canine kidney (MDCK) cells and calculated using the Spearman–Kärber...viduals with underlying conditions such as obesity and or diabetes (Jhung et al. 2011). Influenza A (H1N1) virus selected for this study was chosen based on
John Nelson Darby: Scholarship that Influenced the Bible College Movement
Sutherland, Winston Terrance
2010-01-01
The study reported in this article focused on the scholastic life of John Nelson Darby and his contributions to the Bible college movement. Darby continues to exert a great influence on Christianity, particularly conservative evangelical Christianity. This research provides a discussion of the forces that conspired to shape the direction of…
Directory of Open Access Journals (Sweden)
Kristina Thamm
Full Text Available The pentaspan membrane glycoprotein prominin-1 (CD133 is widely used in medicine as a cell surface marker of stem and cancer stem cells. It has opened new avenues in stem cell-based regenerative therapy and oncology. This molecule is largely used with human samples or the mouse model, and consequently most biological tools including antibodies are directed against human and murine prominin-1. Although the general structure of prominin-1 including its membrane topology is conserved throughout the animal kingdom, its primary sequence is poorly conserved. Thus, it is unclear if anti-human and -mouse prominin-1 antibodies cross-react with their orthologs in other species, especially dog. Answering this issue is imperative in light of the growing number of studies using canine prominin-1 as an antigenic marker. Here, we address this issue by cloning the canine prominin-1 and use its overexpression as a green fluorescent protein fusion protein in Madin-Darby canine kidney cells to determine its immunoreactivity with antibodies against human or mouse prominin-1. We used immunocytochemistry, flow cytometry and immunoblotting techniques and surprisingly found no cross-species immunoreactivity. These results raise some caution in data interpretation when anti-prominin-1 antibodies are used in interspecies studies.
cfa-miR-143 Promotes Apoptosis via the p53 Pathway in Canine Influenza Virus H3N2-Infected Cells.
Zhou, Pei; Tu, Liqing; Lin, Xi; Hao, Xiangqi; Zheng, Qingxu; Zeng, Weijie; Zhang, Xin; Zheng, Yun; Wang, Lifang; Li, Shoujun
2017-11-25
MicroRNAs regulate multiple aspects of the host response to viral infection. This study verified that the expression of cfa-miR-143 was upregulated in vivo and in vitro by canine influenza virus (CIV) H3N2 infection. To understand the role of cfa-miR-143 in CIV-infected cells, the target gene of cfa-miR-143 was identified and assessed for correlations with proteins involved in the apoptosis pathway. A dual luciferase reporter assay showed that cfa-miR-143 targets insulin-like growth factor binding protein 5 (Igfbp5). Furthermore, a miRNA agomir and antagomir of cfa-miR-143 caused the downregulation and upregulation of Igfbp5, respectively, in CIV-infected madin-darby canine kidney (MDCK) cells. This study demonstrated that cfa-miR-143 stimulated p53 and caspase3 activation and induced apoptosis via the p53 pathway in CIV H3N2-infected cells. In conclusion, CIV H3N2 induced the upregulation of cfa-miR-143, which contributes to apoptosis via indirectly activating the p53-caspase3 pathway.
DEFF Research Database (Denmark)
Erickson, A C; Couchman, J R
2001-01-01
Multiple proteoglycans (PGs) are present in all basement membranes (BM) and may contribute to their structure and function, but their effects on cell behavior are not well understood. Their postulated functions include: a structural role in maintaining tissue histoarchitecture, or aid in selective...... filtration processes; sequestration of growth factors; and regulation of cellular differentiation. Furthermore, expression PGs has been found to vary in several disease states. In order to elucidate the role of PGs in the BM, a well-characterized model of polarized epithelium, Madin-Darby canine kidney (MDCK...... core proteins or CS stubs generated by cABC treatment, revealed that both basement membrane and interstitial PGs are secreted by MDCK cells. HSPGs expressed by MDCK cells are perlecan, agrin, and collagen XVIII. Various CSPG core proteins are made by MDCK cells and have been identified as biglycan...
78 FR 38287 - Bitterroot National Forest, Darby Ranger District, Como Forest Health Project
2013-06-26
... DEPARTMENT OF AGRICULTURE Forest Service Bitterroot National Forest, Darby Ranger District, Como Forest Health Project AGENCY: Forest Service. ACTION: Notice; Correction. SUMMARY: The Department of Agriculture (USDA), Forest Service, Bitterroot National Forest, Darby Ranger District published a document in...
Directory of Open Access Journals (Sweden)
Jizong Li
2018-03-01
Full Text Available Caprine parainfluenza virus type 3 (CPIV3 is a newly emerging pathogenic respiratory agent infecting both young and adult goats, and it was identified in eastern China in 2013. Cellular microRNAs (miRNAs have been reported to be important modulators of the intricate virus-host interactions. In order to elucidate the role of miRNAs in madin-darby bovine kidney (MDBK cells during CPIV3 infection. In this study, we performed high-throughput sequencing technology to analyze small RNA libraries in CPIV3-infected and mock-infected MDBK cells. The results showed that a total of 249 known and 152 novel candidate miRNAs were differentially expressed in MDBK cells after CPIV3 infection, and 22,981 and 22,572 target genes were predicted, respectively. In addition, RT-qPCR assay was used to further confirm the expression patterns of 13 of these differentially expressed miRNAs and their mRNA targets. Functional annotation analysis showed these up- and downregulated target genes were mainly involved in MAPK signaling pathway, Jak-STAT signaling pathway, Toll-like receptor signaling pathway, p53 signaling pathway, focal adhesion, NF-kappa B signaling pathway, and apoptosis, et al. To our knowledge, this is the first report of the comparative expression of miRNAs in MDBK cells after CPIV3 infection. Our finding provides information concerning miRNAs expression profile in response to CPIV3 infection, and offers clues for identifying potential candidates for antiviral therapies against CPIV3.
VAMP7 modulates ciliary biogenesis in kidney cells.
Directory of Open Access Journals (Sweden)
Christina M Szalinski
Full Text Available Epithelial cells elaborate specialized domains that have distinct protein and lipid compositions, including the apical and basolateral surfaces and primary cilia. Maintaining the identity of these domains is required for proper cell function, and requires the efficient and selective SNARE-mediated fusion of vesicles containing newly synthesized and recycling proteins with the proper target membrane. Multiple pathways exist to deliver newly synthesized proteins to the apical surface of kidney cells, and the post-Golgi SNAREs, or VAMPs, involved in these distinct pathways have not been identified. VAMP7 has been implicated in apical protein delivery in other cell types, and we hypothesized that this SNARE would have differential effects on the trafficking of apical proteins known to take distinct routes to the apical surface in kidney cells. VAMP7 expressed in polarized Madin Darby canine kidney cells colocalized primarily with LAMP2-positive compartments, and siRNA-mediated knockdown modulated lysosome size, consistent with the known function of VAMP7 in lysosomal delivery. Surprisingly, VAMP7 knockdown had no effect on apical delivery of numerous cargoes tested, but did decrease the length and frequency of primary cilia. Additionally, VAMP7 knockdown disrupted cystogenesis in cells grown in a three-dimensional basement membrane matrix. The effects of VAMP7 depletion on ciliogenesis and cystogenesis are not directly linked to the disruption of lysosomal function, as cilia lengths and cyst morphology were unaffected in an MDCK lysosomal storage disorder model. Together, our data suggest that VAMP7 plays an essential role in ciliogenesis and lumen formation. To our knowledge, this is the first study implicating an R-SNARE in ciliogenesis and cystogenesis.
Gartzke, Dominik; Delzer, Jürgen; Laplanche, Loic; Uchida, Yasuo; Hoshi, Yutaro; Tachikawa, Masanori; Terasaki, Tetsuya; Sydor, Jens; Fricker, Gert
2015-06-01
To investigate whether it is possible to specifically suppress the expression and function of endogenous canine P-glycoprotein (cPgp) in Madin-Darby canine kidney type II cells (MDCKII) transfected with hPGP and breast cancer resistance protein (hBCRP) by zinc finger nuclease (ZFN) producing sequence specific DNA double strand breaks. Wild-type, hPGP-transfected, and hBCRP-transfected MDCKII cells were transfected with ZFN targeting for cPgp. Net efflux ratios (NER) of Pgp and Bcrp substrates were determined by dividing efflux ratios (basal-to-apical / apical-to-basal) in over-expressing cell monolayers by those in wild-type ones. From ZFN-transfected cells, cell populations (ko-cells) showing knockout of cPgp were selected based on genotyping by PCR. qRT-PCR analysis showed the significant knock-downs of cPgp and interestingly also cMrp2 expressions. Specific knock-downs of protein expression for cPgp were shown by western blotting and quantitative targeted absolute proteomics. Endogenous canine Bcrp proteins were not detected. For PGP-transfected cells, NERs of 5 Pgp substrates in ko-cells were significantly greater than those in parental cells not transfected with ZFN. Similar result was obtained for BCRP-transfected cells with a dual Pgp and Bcrp substrate. Specific efflux mediated by hPGP or hBCRP can be determined with MDCKII cells where cPgp has been knocked out by ZFN.
Replacement of the cytoplasmic domain alters sorting of a viral glycoprotein in polarized cells.
Puddington, L; Woodgett, C; Rose, J K
1987-01-01
The envelope glycoprotein (G protein) of vesicular stomatitis virus (VSV) is transported to the basolateral plasma membrane of polarized epithelial cells, whereas the hemagglutinin glycoprotein (HA protein) of influenza virus is transported to the apical plasma membrane. To determine if the cytoplasmic domain of VSV G protein might be important in directing G protein to the basolateral membrane, we derived polarized Madin-Darby canine kidney cell lines expressing G protein or G protein with i...
Kaur, Gurpreet; Chandra, Mudit; Dwivedi, P N; Sharma, N S
2015-01-01
The aim of this study was to isolate Canine parvovirus (CPV) from suspected dogs on madin darby canine kidney (MDCK) cell line and its confirmation by polymerase chain reaction (PCR) and nested PCR (NPCR). Further, VP2 gene of the CPV isolates was amplified and sequenced to determine prevailing antigenic type. A total of 60 rectal swabs were collected from dogs showing signs of gastroenteritis, processed and subjected to isolation in MDCK cell line. The samples showing cytopathic effects (CPE) were confirmed by PCR and NPCR. These samples were subjected to PCR for amplification of VP2 gene of CPV, sequenced and analyzed to study the prevailing antigenic types of CPV. Out of the 60 samples subjected to isolation in MDCK cell line five samples showed CPE in the form of rounding of cells, clumping of cells and finally detachment of the cells. When these samples and the two commercially available vaccines were subjected to PCR for amplification of VP2 gene, a 1710 bp product was amplified. The sequence analysis revealed that the vaccines belonged to the CPV-2 type and the samples were of CPV-2b type. It can be concluded from the present study that out of a total of 60 samples 5 samples exhibited CPE as observed in MDCK cell line. Sequence analysis of the VP2 gene among the samples and vaccine strains revealed that samples belonged to CPV-2b type and vaccines belonging to CPV-2.
2009-12-01
Madin–Darby canine kidney (MDCK) cells to measure a median tissue culture infectious dose (TCID50). Finally, the availability of a human vaccine ...of the Ft live vaccine strain (LVS) is much milder and LVS produces symptoms of infection in mice, so this organism appeared at the outset to provide...MS2 at t = 30 minutes. Accordingly, we tripled the rate of delivery and increased the flowrate through the test rig to 11.3 LPM. The validation test
Energy Technology Data Exchange (ETDEWEB)
Shin, Byung Seok; Ahn, Moon Sang [Chungnam National University Hospital, Daejeon (Korea, Republic of); Park, Mi Hyun [Dept. of Radiology, Dankook University Hospital, Cheonan (Korea, Republic of); Jeon, Gyeong Sik [Dept. of Radiology, CHA Bundang Medical Center, CHA University College of Medicine, Seongnam (Korea, Republic of); Lee, Byung Mo [Dept. of Surgery, Paik Hospital, Inje University College of Medicine, Seoul (Korea, Republic of); Lee, Ki Chang [Dept. of Veterinary Radiology, Chonbuk National University College of VeterinaryMedicine, Seoul (Korea, Republic of); Kim, Ho Jun [Dept. of Radiology, Konyang University Hospital, Daejeon (Korea, Republic of); Ohm, Joon Young [Dept. of Radiology, Bucheon St. Mary Hospital, The Catholic University of Korea College of Medicine, Bucheon (Korea, Republic of)
2012-04-15
To compare the ablation zone after radiofrequency ablation (RFA) with saturated saline preinjection and renal artery occlusion in canine kidneys. RFA was induced in the kidneys of six mongrel dogs. A total of 24 ablation zones were induced using a 1-cm tip internally cooled needle electrode in three groups: RFA (Control group), RFA with 0.5 mL saturated saline preinjection (SS group), and RFA with renal artery occlusion by atraumatic vascular clamp (Occlusion group). Ablation zone diameters were measured along transverse and longitudinal sections of the needle axis, and volumes were calculated. Temperature, applied voltage, current, and impedance during RFA were recorded automatically. The RFA zone volume was the largest in the SS group (1.33 {+-} 0.34 cm{sup 3}), followed by the Occlusion group (1.07 {+-} 0.38 cm{sup 3}) and then the Control group (0.62 {+-} 0.09 cm{sup 3}). Volumes for the SS and Occlusion groups were significantly larger than those for the Control group (p = 0.001, p = 0.012). There was no significant difference in volumes between the SS and Occlusion groups (p = 0.178). Saturated saline preinjection is as effective as renal arterial occlusion for expanding the ablation zone. RFA with saturated saline preinjection could help to treat large renal tumors.
International Nuclear Information System (INIS)
Shin, Byung Seok; Ahn, Moon Sang; Park, Mi Hyun; Jeon, Gyeong Sik; Lee, Byung Mo; Lee, Ki Chang; Kim, Ho Jun; Ohm, Joon Young
2012-01-01
To compare the ablation zone after radiofrequency ablation (RFA) with saturated saline preinjection and renal artery occlusion in canine kidneys. RFA was induced in the kidneys of six mongrel dogs. A total of 24 ablation zones were induced using a 1-cm tip internally cooled needle electrode in three groups: RFA (Control group), RFA with 0.5 mL saturated saline preinjection (SS group), and RFA with renal artery occlusion by atraumatic vascular clamp (Occlusion group). Ablation zone diameters were measured along transverse and longitudinal sections of the needle axis, and volumes were calculated. Temperature, applied voltage, current, and impedance during RFA were recorded automatically. The RFA zone volume was the largest in the SS group (1.33 ± 0.34 cm 3 ), followed by the Occlusion group (1.07 ± 0.38 cm 3 ) and then the Control group (0.62 ± 0.09 cm 3 ). Volumes for the SS and Occlusion groups were significantly larger than those for the Control group (p = 0.001, p = 0.012). There was no significant difference in volumes between the SS and Occlusion groups (p = 0.178). Saturated saline preinjection is as effective as renal arterial occlusion for expanding the ablation zone. RFA with saturated saline preinjection could help to treat large renal tumors.
Echobiometrics kidney and renal artery triplex doppler of canine fetuses
Directory of Open Access Journals (Sweden)
M.A.R. Feliciano
2014-04-01
Full Text Available The aim of this study was to assess the sogographic parameters and biometry of canine fetal kidneys using the B mode, and to determinate the vascular index of the fetal renal arteries using the Doppler Triplex. Twenty four Shi-tzu and Pug, weighting between 4 and 10kg, aging between 4 and 6 years old were evaluated. The B mode, the fetal renal echobiometry and regularity of the renal surface, echotexture and cortex:medular ratio were evaluated during the 5th, 6th, 7th and 8th weeks of pregnancy. At the same time point of the B mode evaluation, the Doppler Triplex was carried out to assess the sistolic peak velocity (SPV, end diastolic velocity (EDV, vascular resistive (RI and pulsatility index (PI. B mode revealed no fetal renal abnormalities and echobiometry showed important measurements during fetal development (P0.05. B mode and Doppler Triplex were important tools for the assessment of fetal renal development, using echobiometry and renal arterial index in canie fetuses.
Antiviral activity of maca (Lepidium meyenii) against human influenza virus
Del Valle Mendoza, Juana; Pumarola, Tomas; Alzamora Gonzales, Libertad; Valle Mendoza, Luis Javier del
2014-01-01
Objective To investigate antiviral activity of maca to reduce viral load in Madin-Darby canine kidney (MDCK) cells infected with influenza type A and B viruses (Flu-A and Flu-B, respectively). Methods Maca were extracted with methanol (1:2, v/v). The cell viability and toxicity of the extracts were evaluated on MDCK cells using method MTT assay. Antiviral activity of compounds against Flu-A and Flu-B viruses was assayed using a test for determining the inhibition of the cytopathic ...
Canine adenovirus type 1 in a fennec fox (Vulpes zerda).
Choi, Jeong-Won; Lee, Hyun-Kyoung; Kim, Seong-Hee; Kim, Yeon-Hee; Lee, Kyoung-Ki; Lee, Myoung-Heon; Oem, Jae-Ku
2014-12-01
A 10-mo-old female fennec fox (Vulpes zerda) with drooling suddenly died and was examined postmortem. Histologic examination of different tissue samples was performed. Vacuolar degeneration and diffuse fatty change were observed in the liver. Several diagnostic methods were used to screen for canine parvovirus, canine distemper virus, canine influenza virus, canine coronavirus, canine parainfluenza virus, and canine adenovirus (CAdV). Only CAdV type 1 (CAdV-1) was detected in several organs (liver, lung, brain, kidney, spleen, and heart), and other viruses were not found. CAdV-1 was confirmed by virus isolation and nucleotide sequencing.
Directory of Open Access Journals (Sweden)
Gurpreet Kaur
2015-01-01
Full Text Available Aim: The aim of this study was to isolate Canine parvovirus (CPV from suspected dogs on madin darby canine kidney (MDCK cell line and its confirmation by polymerase chain reaction (PCR and nested PCR (NPCR. Further, VP2 gene of the CPV isolates was amplified and sequenced to determine prevailing antigenic type. Materials and Methods: A total of 60 rectal swabs were collected from dogs showing signs of gastroenteritis, processed and subjected to isolation in MDCK cell line. The samples showing cytopathic effects (CPE were confirmed by PCR and NPCR. These samples were subjected to PCR for amplification of VP2 gene of CPV, sequenced and analyzed to study the prevailing antigenic types of CPV. Results: Out of the 60 samples subjected to isolation in MDCK cell line five samples showed CPE in the form of rounding of cells, clumping of cells and finally detachment of the cells. When these samples and the two commercially available vaccines were subjected to PCR for amplification of VP2 gene, a 1710 bp product was amplified. The sequence analysis revealed that the vaccines belonged to the CPV-2 type and the samples were of CPV-2b type. Conclusion: It can be concluded from the present study that out of a total of 60 samples 5 samples exhibited CPE as observed in MDCK cell line. Sequence analysis of the VP2 gene among the samples and vaccine strains revealed that samples belonged to CPV-2b type and vaccines belonging to CPV-2.
Li, Xiu-Zhen; Lv, Lin; Zhang, Xu; Anchang, Kenneth Yongabi; Abdullahi, Auwalu Yusuf; Tu, Liqing; Wang, Xiaohu; Xia, Lijun; Zhang, Xiu-Xiang; Feng, Weili; Lu, Chunxia; Li, Shoujun; Yuan, Zi-Guo
2016-11-01
We previously demonstrated that the survival time of BALB/c mice challenged with Toxoplasma gondii RH strain was prolonged by immunising the mice with a eukaryotic vector expressing the protein ROP16 of T. gondii. Building upon previous findings, we are exploring improved vaccination strategies to enhance protection. In this work, a novel recombinant canine adenovirus type 2 expressing ROP16 (CAV-2-ROP16) of T. gondii was constructed and identified to express ROP16 in Madin-Darby canine kidney cells (MDCK) cells by western blot (WB) and indirect immunofluorescence (IFA) assays. Intramuscular immunisation of BALB/c mice with CAV-2-ROP16 was performed to evaluate the humoral and cellular immune responses. This vaccination triggered significant humoral and cellular responses, including ROP16-stimulated lymphoproliferation (P0.05), revealing that a predominant Th1-type response had developed. The cell-mediated cytotoxic activity with high levels of IFN-γ and TNF-α was significantly increased in both CD4 + and CD8 + T-cell compartments in the mice immunised with CAV-2-ROP16 (Pdays post infection compared with control mice that all died within seven days (Pvaccination until now. Our work presents the successful use of recombinant virus CAV-2-ROP16 in vaccination protocols to protect against intraperitoneal challenge with the virulent RH strain of T. gondii. This system was shown to be extremely efficient in eliciting humoral and cellular immune responses that led to a significant improvement in survival time in mice. Copyright © 2016 Elsevier B.V. All rights reserved.
Povey, C.
1982-01-01
A parvovirus of canine origin, cultured in a feline kidney cell line, was inactivated with formalin. Three pilot serials were produced and three forms of finished vaccine (nonadjuvanted, single adjuvanted and double adjuvanted) were tested in vaccination and challenge trials. A comparison was also made with two inactivated feline panleukopenia virus vaccines, one of which has official approval for use in dogs. The inactivated canine vaccine in nonadjuvanted, adjuvanted or double adjuvanted fo...
International Nuclear Information System (INIS)
Daoud, Jamal; Tabrizian, Maryam; Asami, Koji; Rosenberg, Lawrence
2012-01-01
In this study, we introduce a cellular differentiation cellular model based on dielectric spectroscopy that characterizes epithelial differentiation processes. Non-invasive cellular monitoring was achieved within a three-dimensional microenvironment consisting of a cell-containing collagen I gel seeded onto microfabricated scaffolds. In this proof-of-concept investigation, Madin–Darby canine kidney cells were cultured within microfabricated, geometrically controlled scaffolds and allowed us to differentiate to hollow cyst-like structures. This transformation within the three-dimensional environment is monitored and characterized through dielectric spectroscopy while maintaining cell culture in vitro. (paper)
AMP-activated protein kinase downregulates Kv7.1 cell surface expression
DEFF Research Database (Denmark)
Andersen, Martin N; Krzystanek, Katarzyna; Jespersen, Thomas
2012-01-01
in response to polarization of the epithelial Madin-Darby canine kidney (MDCK) cell line and that this was mediated by activation of protein kinase C (PKC). In this study, the pathway downstream of PKC, which leads to internalization of Kv7.1 upon cell polarization, is elucidated. We show by confocal...... microscopy that Kv7.1 is endocytosed upon initiation of the polarization process and sent for degradation by the lysosomal pathway. The internalization could be mimicked by pharmacological activation of the AMP-activated protein kinase (AMPK) using three different AMPK activators. We demonstrate...
Risk and performances: financial performance of sime darby berhad
W.Hussin, Wan Nur Imani
2017-01-01
The aim of this study are used to investigate the relationship between company performance and the profitability of the company. Firm organisation that used to identify this relationship is Sime Darby Berhad. In this study, the factors that indicate to profitability such as return on asset (ROA), return on equity (ROE), return on investment (ROI), average collection period (ACP), leverage, remuneration, liquidity, operational etc. Financial instrument merely related to financial performance o...
Membrane lipidome of an epithelial cell line
DEFF Research Database (Denmark)
Sampaio, Julio L; Gerl, Mathias J; Klose, Christian
2011-01-01
Tissue differentiation is an important process that involves major cellular membrane remodeling. We used Madin-Darby canine kidney cells as a model for epithelium formation and investigated the remodeling of the total cell membrane lipidome during the transition from a nonpolarized morphology...... to an epithelial morphology and vice versa. To achieve this, we developed a shotgun-based lipidomics workflow that enabled the absolute quantification of mammalian membrane lipidomes with minimal sample processing from low sample amounts. Epithelial morphogenesis was accompanied by a major shift from sphingomyelin...... to generate an apical membrane domain that serves as a protective barrier for the epithelial sheet....
Antiviral potential of a diterpenoid compound sugiol from Metasequoia glyptostroboides.
Bajpai, Vivek K; Kim, Na-Hyung; Kim, Kangmin; Kang, Sun Chul
2016-05-01
This research reports first time antiviral activity of sugiol, a diterpenoid isolated from Metasequoia glyptostroboides in terms of its ability to inhibit in vitro growth of H1N1 influenza virus. Antiviral potential of sugiol was evaluated through hcytopathogenic reduction assay using Madin-Darby canine kidney (MDCK) cell line. Sugiol (500 μg/ml) was found to exhibit considerable anti-cytopathic effect on MDCK cell line confirming its antiviral efficacy against H1N1 influenza virus. These findings strongly reinforce the suggestion that sugiol could be a candidate of choice in combinational regimen with potential antiviral efficacy.
Moderate plasma activated media suppresses proliferation and migration of MDCK epithelial cells
International Nuclear Information System (INIS)
Mohades, Soheila; Laroussi, Mounir; Maruthamuthu, Venkat
2017-01-01
Low-temperature plasma has been shown to have diverse biomedical uses, including its applications in cancer and wound healing. One recent approach in treating mammalian cells with plasma is through the use of plasma activated media (PAM), which is produced by exposing cell culture media to plasma. While the adverse effects of PAM treatment on cancerous epithelial cell lines have been recently studied, much less is known about the interaction of PAM with normal epithelial cells. In this paper, non-cancerous canine kidney MDCK (Madin-Darby Canine Kidney) epithelial cells were treated by PAM and time-lapse microscopy was used to directly monitor their proliferation and random migration upon treatment. While longer durations of PAM treatment led to cell death, we found that moderate levels of PAM treatment inhibited proliferation in these epithelial cells. We also found that PAM treatment reduced random cell migration within epithelial islands. Immunofluorescence staining showed that while there were no major changes in the actin/adhesion apparatus, there was a significant change in the nuclear localization of proliferation marker Ki-67, consistent with our time-lapse results. (paper)
Guanine nucleotide regulation of α1-adrenergic receptors of muscle and kidney eptihelial cells
International Nuclear Information System (INIS)
Terman, B.I.; Hughes, R.J.; Slivka, S.R.; Insel, P.A.
1986-01-01
The authors have examined the effect of guanine nucleotides on the interaction of adrenergic agents with α 1 -adrenergic receptors of two cell lines, the Madin-Darby Canine Kidney (MDCK) and BC3H-1 muscle cells. While gaunylylimidodiphosphoate (Gpp(NH)p) had no effect on the affinity or the total number of [ -3 H]prazosin binding sites in membranes prepared from these cells, the nucleotide decreased the apparent affinity of the agonist epinephrine in competing for [ 3 H]prazosin binding sites in both cell types. The EC 50 of Gpp(NH)p was ∼100 μM, and a maximal effect was seen at 500 μM. In contrast, 100 μM Gpp(NH)p yielding maximal shifts in binding of epinephrine to β-adrenergic receptors in BC3H-1 cell membranes. Guanine nucleotides were significantly more effective than adenine nucleotides in shifting agonist affinity for the α 1 -receptor and Mg ++ was required to observe a maximal effect. α 1 -receptor agonists activated phosphatidylinositol (PI) hydrolysis in both cell types, but have no direct effect on membrane adenylate cyclase activity. In intact BC3H-1 cells, α 1 -agonists inhibited β-adrenergic cAMP production, an effect which appears in preliminary studies not to result from enhanced phosphodieterase activity. These results show that agonist binding to α 1 -adrenergic receptors in mammalian kidney and muscle cells is regulated by guanine nucleotides. This regulation and inturn transmembrane signalling (PI hydrolysis) by these receptors appear to involve a guanine nucleotide binding (G) protein, which may be different than G/sub s/ and G/sub i/
Severe canine distemper outbreak in unvaccinated dogs in Mozambique
Directory of Open Access Journals (Sweden)
Julieta Zacarias
2016-07-01
Full Text Available Although significant animal suffering caused by preventable diseases is frequently seen in developing countries, reports of this are scarce. This report describes avoidable animal suffering owing to a suspected canine distemper (CD outbreak in unvaccinated dogs owned by low-income families in Mozambique that killed approximately 200 animals. Affected dogs exhibited clinical signs, and gross and microscopic lesions compatible with CD. Immunohistochemical staining confirmed the presence of canine distemper virus (CDV in the kidney of one dog from the cohort. This brief communication again illustrates that large outbreaks of CDV in unvaccinated dogs occur and that large-scale avoidable suffering and threats to the health of dogs and wild canines continue. Mass vaccination supported by government and non-government organisations is recommended. Keywords: Canine distemper; dogs; outbreak; animal welfare; Mozambique
First detection of canine parvovirus type 2b from diarrheic dogs in Himachal Pradesh
Directory of Open Access Journals (Sweden)
Shalini Sharma
2016-09-01
Full Text Available Aim: The present study was conducted to detect the presence of canine parvovirus (CPV among diarrheic dogs in Himachal Pradesh and to identify the most prevalent antigenic variant of CPV based on molecular typing and sequence analysis of VP2 gene. Materials and Methods: A total of 102 fecal samples were collected from clinical cases of diarrhea or hemorrhagic gastroenteritis from CPV vaccinated or non-vaccinated dogs. Samples were tested using CPV-specific polymerase chain reaction (PCR targeting VP2 gene, multiplex PCR for detection of CPV-2a and CPV-2b antigenic variants, and a PCR for the detection of CPV-2c. CPV-2b isolate was cultured on Madin-Darby canine kidney (MDCK cell lines and sequenced using VP2 structural protein gene. Multiple alignment and phylogenetic analysis was done using ClustalW and MEGA6 and inferred using the Neighbor-Joining method. Results: No sample was found positive for the original CPV strain usually present in the vaccine. However, about 50% (52 out of 102 of the samples were found to be positive with CPV-2ab PCR assay that detects newer variants of CPV circulating in the field. In addition, multiplex PCR assay that identifies both CPV-2ab and CPV-2b revealed that CPV-2b was the major antigenic variant present in the affected dogs. A PCR positive isolate of CPV-2b was adapted to grow in MDCK cells and produced characteristic cytopathic effect after 5th passage. Multiple sequence alignment of VP2 structural gene of CPV-2b isolate (Accession number HG004610 used in the study was found to be similar to other sequenced isolates in NCBI sequence database and showed 98-99% homology. Conclusion: This study reports the first detection of CPV-2b in dogs with hemorrhagic gastroenteritis in Himachal Pradesh and absence of other antigenic types of CPV. Further, CPV-specific PCR assay can be used for rapid confirmation of circulating virus strains under field conditions.
First detection of canine parvovirus type 2b from diarrheic dogs in Himachal Pradesh.
Sharma, Shalini; Dhar, Prasenjit; Thakur, Aneesh; Sharma, Vivek; Sharma, Mandeep
2016-09-01
The present study was conducted to detect the presence of canine parvovirus (CPV) among diarrheic dogs in Himachal Pradesh and to identify the most prevalent antigenic variant of CPV based on molecular typing and sequence analysis of VP2 gene. A total of 102 fecal samples were collected from clinical cases of diarrhea or hemorrhagic gastroenteritis from CPV vaccinated or non-vaccinated dogs. Samples were tested using CPV-specific polymerase chain reaction (PCR) targeting VP2 gene, multiplex PCR for detection of CPV-2a and CPV-2b antigenic variants, and a PCR for the detection of CPV-2c. CPV-2b isolate was cultured on Madin-Darby canine kidney (MDCK) cell lines and sequenced using VP2 structural protein gene. Multiple alignment and phylogenetic analysis was done using ClustalW and MEGA6 and inferred using the Neighbor-Joining method. No sample was found positive for the original CPV strain usually present in the vaccine. However, about 50% (52 out of 102) of the samples were found to be positive with CPV-2ab PCR assay that detects newer variants of CPV circulating in the field. In addition, multiplex PCR assay that identifies both CPV-2ab and CPV-2b revealed that CPV-2b was the major antigenic variant present in the affected dogs. A PCR positive isolate of CPV-2b was adapted to grow in MDCK cells and produced characteristic cytopathic effect after 5 th passage. Multiple sequence alignment of VP2 structural gene of CPV-2b isolate (Accession number HG004610) used in the study was found to be similar to other sequenced isolates in NCBI sequence database and showed 98-99% homology. This study reports the first detection of CPV-2b in dogs with hemorrhagic gastroenteritis in Himachal Pradesh and absence of other antigenic types of CPV. Further, CPV-specific PCR assay can be used for rapid confirmation of circulating virus strains under field conditions.
Ahmad Rizal Mohd Yusof; Zarina Othman; A.B. Shamsul; Mohamed Abu Bakar Kassim
2014-01-01
Liberia has initiated a paradigm shift to develop its agriculture sector through Foreign Direct Investment (FDI). An investment from Sime Darby Plantations has created social impact towards the local, culture and land use. Center for International Conflict Resolution or CICR has seen these problems as a threat to social development in Liberia. Eleven recommendations have been delivered to Sime Darby as a solution to cater all problems that should conserve the local, culture and the land use. ...
Antiviral effect of lithium chloride on infection of cells by canine parvovirus.
Zhou, Pei; Fu, Xinliang; Yan, Zhongshan; Fang, Bo; Huang, San; Fu, Cheng; Hong, Malin; Li, Shoujun
2015-11-01
Canine parvovirus type 2 causes significant viral disease in dogs, with high morbidity, high infectivity, and high mortality. Lithium chloride is a potential antiviral drug for viruses. We determined the antiviral effect of Lithium Chloride on canine parvovirus type 2 in feline kidney cells. The viral DNA and proteins of canine parvovirus were suppressed in a dose-dependent manner by lithium chloride. Further investigation verified that viral entry into cells was inhibited in a dose-dependent manner by lithium chloride. These results indicated that lithium chloride could be a potential antiviral drug for curing dogs with canine parvovirus infection. The specific steps of canine parvovirus entry into cells that are affected by lithium chloride and its antiviral effect in vivo should be explored in future studies.
Povey, C.
1982-01-01
A parvovirus of canine origin, cultured in a feline kidney cell line, was inactivated with formalin. Three pilot serials were produced and three forms of finished vaccine (nonadjuvanted, single adjuvanted and double adjuvanted) were tested in vaccination and challenge trials. A comparison was also made with two inactivated feline panleukopenia virus vaccines, one of which has official approval for use in dogs. The inactivated canine vaccine in nonadjuvanted, adjuvanted or double adjuvanted form was immunogenic in 20 of 20 vaccinated dogs. The double adjuvanted vaccine is selected as the one of choice on the basis of best and most persistent seriological response. PMID:7039811
Severe canine distemper outbreak in unvaccinated dogs in Mozambique.
Zacarias, Julieta; Dimande, Alberto; Achá, Sara; Dias, Paula T; Leonel, Elisa M; Messa, Aurora; Macucule, Baltazar; Júnior, José L; Bila, Custódio G
2016-07-15
Although significant animal suffering caused by preventable diseases is frequently seen in developing countries, reports of this are scarce. This report describes avoidable animal suffering owing to a suspected canine distemper (CD) outbreak in unvaccinated dogs owned by low-income families in Mozambique that killed approximately 200 animals. Affected dogs exhibited clinical signs, and gross and microscopic lesions compatible with CD. Immunohistochemical staining confirmed the presence of canine distemper virus (CDV) in the kidney of one dog from the cohort. This brief communication again illustrates that large outbreaks of CDV in unvaccinated dogs occur and that large-scale avoidable suffering and threats to the health of dogs and wild canines continue. Mass vaccination supported by government and non-government organisations is recommended.
JOB BEHAVIORAL FACTORS AND TURNOVER INTENTION: EVIDENCE FROM SIME DARBY PROPERTY LIMITED
Amran Awang; Abdul Razak Amir; Wirda Osman
2013-01-01
Some job behavioral factors are utilized to examine their relationship with turnover intention among 201 employees in Sime Darby Property (Malaysia) Limited. Job satisfaction, job stress, organizational commitment, job enrichment and person-organization fit are the job behavioral factors selected for the study. The variables used in the study justify the reliability scores consistent with indicators in previous studies. Research methodology justifies the quantitative requirements ...
ABC transporters affect the elimination and toxicity of CdTe quantum dots in liver and kidney cells
Energy Technology Data Exchange (ETDEWEB)
Chen, Mingli; Yin, Huancai; Bai, Pengli [CAS Key Lab of Bio-Medical Diagnostics, Suzhou Institute of Biomedical Engineering and Technology, Chinese Academy of Sciences, Suzhou, Jiangsu 215163 (China); Miao, Peng [CAS Key Lab of Bio-Medical Diagnostics, Suzhou Institute of Biomedical Engineering and Technology, Chinese Academy of Sciences, Suzhou, Jiangsu 215163 (China); University of Chinese Academy of Sciences, Beijing 100049 (China); Deng, Xudong [Department of Chemical Engineering, McMaster University, Hamilton, Ontario, L8S 4L7 (Canada); Xu, Yingxue [CAS Key Lab of Bio-Medical Diagnostics, Suzhou Institute of Biomedical Engineering and Technology, Chinese Academy of Sciences, Suzhou, Jiangsu 215163 (China); University of Chinese Academy of Sciences, Beijing 100049 (China); Hu, Jun [CAS Key Lab of Bio-Medical Diagnostics, Suzhou Institute of Biomedical Engineering and Technology, Chinese Academy of Sciences, Suzhou, Jiangsu 215163 (China); Yin, Jian, E-mail: yinj@sibet.ac.cn [CAS Key Lab of Bio-Medical Diagnostics, Suzhou Institute of Biomedical Engineering and Technology, Chinese Academy of Sciences, Suzhou, Jiangsu 215163 (China)
2016-07-15
This paper aimed to investigate the role of adenosine triphosphate-binding cassette (ABC) transporters on the efflux and the toxicity of nanoparticles in liver and kidney cells. In this study, we synthesized CdTe quantum dots (QDs) that were monodispersed and emitted green fluorescence (maximum peak at 530 nm). Such QDs tended to accumulate in human hepatocellular carcinoma cells (HepG2), human kidney cells 2 (HK-2), and Madin-Darby canine kidney (MDCK) cells, and cause significant toxicity in all the three cell lines. Using specific inhibitors and inducers of P-glycoprotein (Pgp) and multidrug resistance associated proteins (Mrps), the cellular accumulation and subsequent toxicity of QDs in HepG2 and HK-2 cells were significantly affected, while only slight changes appeared in MDCK cells, corresponding well with the functional expressions of ABC transporters in cells. Moreover, treatment of QDs caused concentration- and time- dependent induction of ABC transporters in HepG2 and HK-2 cells, but such phenomenon was barely found in MDCK cells. Furthermore, the effects of CdTe QDs on ABC transporters were found to be greater than those of CdCl{sub 2} at equivalent concentrations of cadmium, indicating that the effects of QDs should be a combination of free Cd{sup 2+} and specific properties of QDs. Overall, these results indicated a strong dependence between the functional expressions of ABC transporters and the efflux of QDs, which could be an important reason for the modulation of QDs toxicity by ABC transporters. - Highlights: • ABC transporters contributed actively to the cellular efflux of CdTe quantum dots. • ABC transporters affected the cellular toxicity of CdTe quantum dots. • Treatment of CdTe quantum dots induced the gene expression of ABC transporters. • Free Cd{sup 2+} should be partially involved in the effects of QDs on ABC transporters. • Cellular efflux of quantum dots could be an important modulator for its toxicity.
Compartmentalization of prostaglandins in the canine kidney
International Nuclear Information System (INIS)
Morgan-Boyd, R.L.
1986-01-01
The kidney has been shown to synthesize all of the naturally occurring major prostaglandins which may be restricted to a discrete part of the kidney where their actions are physiologically important, such as the vascular compartment and the tubular compartment. In order to examine this concept of compartmentalization, the authors conducted a series of experiments to determine whether PGl 2 , measured as 6-keto-pGF/sub 1α/, produced in the kidney is restricted to the renal vascular compartment or whether it also has access to the tubular compartment. Experiments were performed in the pentobarbital-anesthetized dog. Increasing pre-glomerular levels of 6-keto-PFG/sub 1α/ caused marked increases in both the urinary excretion and the renal venous outflow to 6-keto-PGF/sub 1α/. When 3 H-6-keto-PGF/sub 1α/ was co-infused with inulin into the renal artery, 33% of the radioactivity and 23% of the inulin was recovered on first pass. With infusion of 3 H-PGl 2 and inulin, 20% of the radioactivity and 28% of the inulin reached the urine on first pass. Radioactive PGl 2 appeared to be less filterable at the glomeruli than either 3 H-6-keto-PGF/sub 1α/ or inulin. In the final set of experiments, in which dogs were prepared for a ureteral stopped-flow study, the PGE 2 /U/P/sub In/ ratio a peak was observed proximal to the Na + plateau but distal to the Na+ nadir. In light of the results from the stopped-flow study and the intrarenal infusion studies, they conclude that PGE 2 synthesized in the kidney enters both the renal and tubular compartments. In contrast, they find that 6-keto-PGF/sub 1α/ of renal origin enters only the renal origin enters only the renal vascular compartment and not the tubular compartment
Trivalent MDCK cell culture-derived influenza vaccine Optaflu (Novartis Vaccines).
Doroshenko, Alexander; Halperin, Scott A
2009-06-01
Annual influenza epidemics continue to have a considerable impact in both developed and developing countries. Vaccination remains the principal measure to prevent seasonal influenza and reduce associated morbidity and mortality. The WHO recommends using established mammalian cell culture lines as an alternative to egg-based substrates in the manufacture of influenza vaccine. In June 2007, the EMEA approved Optaflu, a Madin Darby canine kidney cell culture-derived influenza vaccine manufactured by Novartis Vaccines. This review examines the advantages and disadvantages of cell culture-based technology for influenza vaccine production, compares immunogenicity and safety data for Optaflu with that of currently marketed conventional egg-based influenza vaccines, and considers the prospects for wider use of cell culture-based influenza vaccines.
A compendium of canine normal tissue gene expression.
Directory of Open Access Journals (Sweden)
Joseph Briggs
Full Text Available BACKGROUND: Our understanding of disease is increasingly informed by changes in gene expression between normal and abnormal tissues. The release of the canine genome sequence in 2005 provided an opportunity to better understand human health and disease using the dog as clinically relevant model. Accordingly, we now present the first genome-wide, canine normal tissue gene expression compendium with corresponding human cross-species analysis. METHODOLOGY/PRINCIPAL FINDINGS: The Affymetrix platform was utilized to catalogue gene expression signatures of 10 normal canine tissues including: liver, kidney, heart, lung, cerebrum, lymph node, spleen, jejunum, pancreas and skeletal muscle. The quality of the database was assessed in several ways. Organ defining gene sets were identified for each tissue and functional enrichment analysis revealed themes consistent with known physio-anatomic functions for each organ. In addition, a comparison of orthologous gene expression between matched canine and human normal tissues uncovered remarkable similarity. To demonstrate the utility of this dataset, novel canine gene annotations were established based on comparative analysis of dog and human tissue selective gene expression and manual curation of canine probeset mapping. Public access, using infrastructure identical to that currently in use for human normal tissues, has been established and allows for additional comparisons across species. CONCLUSIONS/SIGNIFICANCE: These data advance our understanding of the canine genome through a comprehensive analysis of gene expression in a diverse set of tissues, contributing to improved functional annotation that has been lacking. Importantly, it will be used to inform future studies of disease in the dog as a model for human translational research and provides a novel resource to the community at large.
Sun, Xiaoou; Wiesner, Burkhard; Lorenz, Dorothea; Papsdorf, Gisela; Pankow, Kristin; Wang, Po; Dietrich, Nils; Siems, Wolf-Eberhard; Maul, Björn
2008-12-01
Angiotensin-converting enzyme (ACE) demonstrates, besides its typical dipeptidyl-carboxypeptidase activity, several unusual functions. Here, we demonstrate with molecular, biochemical, and cellular techniques that the somatic wild-type murine ACE (mACE), stably transfected in Chinese Hamster Ovary (CHO) or Madin-Darby Canine Kidney (MDCK) cells, interacts with endogenous membranal co-localized carboxypeptidase M (CPM). CPM belongs to the group of glycosylphosphatidylinositol (GPI)-anchored proteins. Here we report that ACE, completely independent of its known dipeptidase activities, has GPI-targeted properties. Our results indicate that the spatial proximity between mACE and the endogenous CPM enables an ACE-evoked release of CPM. These results are discussed with respect to the recently proposed GPI-ase activity and function of sperm-bound ACE.
Overview of measles and mumps vaccine: origin, present, and future of vaccine production.
Betáková, T; Svetlíková, D; Gocník, M
2013-01-01
Measles and mumps are common viral childhood diseases that can cause serious complications. Vaccination remains the most efficient way to control the spread of these viruses. The manufacturing capability for viral vaccines produced in embryonated hen eggs and conventional/classical cell substrates, such as chicken embryo fibroblast or primary dog kidney cell substrates, is no longer sufficient. This limitation can be overcome by utilizing other recognized cell substrates such as Madin Darby Canine Kidney (MDCK), Chinese Hamster Ovary (CHO), Vero (monkey origin) cells, MRC-5 (human diploid) or as an alternative, introducing new cell substrates of human or avian origin. A very important factor in vaccine production is the safety and immunogenicity of the final vaccine, where the proper choice of cell substrate used for virus propagation is made. All substrates used in vaccine production must be fully characterized to avoid the contamination of hidden unknown pathogens which is difficult to achieve in primary cell substrates.
Eimeria tenella: in vitro development in irradiated bovine kidney cells
Energy Technology Data Exchange (ETDEWEB)
Crane, M.St.J.; Schmatz, D.M.; Stevens, S.; Habbersett, M.C.; Murray, P.K. (Merck Sharp and Dohme Research Labs., Rahway, NJ (USA))
1984-06-01
The initial infection and first-generation development of Eimeria tenella was quantified using a cloned MDBK (Madin-Darby Bovine Kidney) cell line, irradiated with gamma radiation prior to infection, as the host cell. Irradiated cell cultures were found to be more susceptible to infection and had a greater capacity to support parasite development than non-irradiated cultures. It was suggested that the larger proportion of cells in the G/sub 2/ phase of the cell cycle, the larger individual cell size and the inhibition of cell division in the irradiated cultures were all factors contributing to the increased susceptibility to infection and capacity to support parasite growth and development. The application of this technique (host cell irradiation) to the cultivation of other intracellular, protozoan parasites is discussed.
Eimeria tenella: in vitro development in irradiated bovine kidney cells
International Nuclear Information System (INIS)
Crane, M. St.J.; Schmatz, D.M.; Stevens, S.; Habbersett, M.C.; Murray, P.K.
1984-01-01
The initial infection and first-generation development of Eimeria tenella was quantified using a cloned MDBK (Madin-Darby Bovine Kidney) cell line, irradiated with gamma radiation prior to infection, as the host cell. Irradiated cell cultures were found to be more susceptible to infection and had a greater capacity to support parasite development than non-irradiated cultures. It was suggested that the larger proportion of cells in the G 2 phase of the cell cycle, the larger individual cell size and the inhibition of cell division in the irradiated cultures were all factors contributing to the increased susceptibility to infection and capacity to support parasite growth and development. The application of this technique (host cell irradiation) to the cultivation of other intracellular, protozoan parasites is discussed. (author)
Kv7.1 surface expression is regulated by epithelial cell polarization
DEFF Research Database (Denmark)
Andersen, Martin N; Olesen, Søren-Peter; Rasmussen, Hanne Borger
2011-01-01
The potassium channel K(V)7.1 is expressed in the heart where it contributes to the repolarization of the cardiac action potential. In addition, K(V)7.1 is expressed in epithelial tissues where it plays a role in salt and water transport. Mutations in the kcnq1 gene can lead to long QT syndrome...... and deafness, and several mutations have been described as trafficking mutations. To learn more about the basic mechanisms that regulate K(V)7.1 surface expression, we have investigated the trafficking of K(V)7.1 during the polarization process of the epithelial cell line Madin-Darby Canine Kidney (MDCK) using...... is regulated by signaling mechanisms involved in epithelial cell polarization in particular signaling cascades involving protein kinase C and PI3K....
Morris, Brian J; Wamai, Richard G; Krieger, John N; Banerjee, Joya; Klausner, Jeffrey D
2017-10-01
An article by Darby disparaging male circumcision (MC) for syphilis prevention in Victorian times (1837-1901) and voluntary medical MC programs for HIV prevention in recent times ignores contemporary scientific evidence. It is one-sided and cites outlier studies as well as claims by MC opponents that support the author's thesis, but ignores high quality randomised controlled trials and meta-analyses. While we agree with Darby that risky behaviours contribute to syphilis and HIV epidemics, there is now compelling evidence that MC helps reduce both syphilis and HIV infections. Although some motivations for MC in Victorian times were misguided, others, such as protection against syphilis, penile cancer, phimosis, balanitis and poor hygiene have stood the test of time. In the absence of a cure or effective prophylactic vaccine for HIV, MC should help lower heterosexually acquired HIV, especially when coupled with other interventions such as condoms and behaviour. This should save lives, as well as reducing costs and suffering. In contrast to Darby, our evaluation of the evidence leads us to conclude that MC would likely have helped reduce syphilis in Victorian times and, in the current era, will help lower both syphilis and HIV, so improving global public health.
Altered dynamics of a lipid raft associated protein in a kidney model of Fabry disease.
Labilloy, Anatália; Youker, Robert T; Bruns, Jennifer R; Kukic, Ira; Kiselyov, Kirill; Halfter, Willi; Finegold, David; do Monte, Semiramis Jamil Hadad; Weisz, Ora A
2014-02-01
Accumulation of globotriaosylceramide (Gb3) and other neutral glycosphingolipids with galactosyl residues is the hallmark of Fabry disease, a lysosomal storage disorder caused by deficiency of the enzyme alpha-galactosidase A (α-gal A). These lipids are incorporated into the plasma membrane and intracellular membranes, with a preference for lipid rafts. Disruption of raft mediated cell processes is implicated in the pathogenesis of several human diseases, but little is known about the effects of the accumulation of glycosphingolipids on raft dynamics in the context of Fabry disease. Using siRNA technology, we have generated a polarized renal epithelial cell model of Fabry disease in Madin-Darby canine kidney cells. These cells present increased levels of Gb3 and enlarged lysosomes, and progressively accumulate zebra bodies. The polarized delivery of both raft-associated and raft-independent proteins was unaffected by α-gal A knockdown, suggesting that accumulation of Gb3 does not disrupt biosynthetic trafficking pathways. To assess the effect of α-gal A silencing on lipid raft dynamics, we employed number and brightness (N&B) analysis to measure the oligomeric status and mobility of the model glycosylphosphatidylinositol (GPI)-anchored protein GFP-GPI. We observed a significant increase in the oligomeric size of antibody-induced clusters of GFP-GPI at the plasma membrane of α-gal A silenced cells compared with control cells. Our results suggest that the interaction of GFP-GPI with lipid rafts may be altered in the presence of accumulated Gb3. The implications of our results with respect to the pathogenesis of Fabry disease are discussed. © 2013 Elsevier Inc. All rights reserved.
MREIT conductivity imaging of the postmortem canine abdomen using CoReHA
International Nuclear Information System (INIS)
Jeon, Kiwan; Lee, Chang-Ock; Minhas, Atul S; Kim, Young Tae; Jeong, Woo Chul; Kim, Hyung Joong; Woo, Eung Je; Kang, Byeong Teck; Park, Hee Myung; Seo, Jin Keun
2009-01-01
Magnetic resonance electrical impedance tomography (MREIT) is a new bio-imaging modality providing cross-sectional conductivity images from measurements of internal magnetic flux densities produced by externally injected currents. Recent experimental results of postmortem and in vivo imaging of the canine brain demonstrated its feasibility by showing conductivity images with meaningful contrast among different brain tissues. MREIT image reconstructions involve a series of data processing steps such as k-space data handling, phase unwrapping, image segmentation, meshing, modelling, finite element computation, denoising and so on. To facilitate experimental studies, we need a software tool that automates these data processing steps. In this paper, we summarize such an MREIT software package called CoReHA (conductivity reconstructor using harmonic algorithms). Performing imaging experiments of the postmortem canine abdomen, we demonstrate how CoReHA can be utilized in MREIT. The abdomen with a relatively large field of view and various organs imposes new technical challenges when it is chosen as an imaging domain. Summarizing a few improvements in the experimental MREIT technique, we report our first conductivity images of the postmortem canine abdomen. Illustrating reconstructed conductivity images, we discuss how they discern different organs including the kidney, spleen, stomach and small intestine. We elaborate, as an example, that conductivity images of the kidney show clear contrast among cortex, internal medulla, renal pelvis and urethra. We end this paper with a brief discussion on future work using different animal models
Nomura, Naohiro; Kamiya, Kazusaku; Ikeda, Katsuhisa; Yui, Naofumi; Chiga, Motoko; Sohara, Eisei; Rai, Tatemitu; Sakaki, Sei; Uchida, Shinich
2013-11-22
Mutations of BSND, which encodes barttin, cause Bartter syndrome type IV. This disease is characterized by salt and fluid loss, hypokalemia, metabolic alkalosis, and sensorineural hearing impairment. Barttin is the β-subunit of the ClC-K chloride channel, which recruits it to the plasma membranes, and the ClC-K/barttin complex contributes to transepithelial chloride transport in the kidney and inner ear. The retention of mutant forms of barttin in the endoplasmic reticulum (ER) is etiologically linked to Bartter syndrome type IV. Here, we report that treatment with 17-allylamino-17-demethoxygeldanamycin (17-AAG), an Hsp90 inhibitor, enhanced the plasma membrane expression of mutant barttins (R8L and G47R) in Madin-Darby canine kidney cells. Administration of 17-AAG to Bsnd(R8L/R8L) knock-in mice elevated the plasma membrane expression of R8L in the kidney and inner ear, thereby mitigating hypokalemia, metabolic alkalosis, and hearing loss. These results suggest that drugs that rescue ER-retained mutant barttin may be useful for treating patients with Bartter syndrome type IV. Copyright © 2013 Elsevier Inc. All rights reserved.
Blixenkrone-Møller, M
1989-09-01
Using an indirect immunofluorescence technique, the distribution of viral antigen in various tissues and blood mononuclear leukocytes was studied in wild mink, either vaccinated with an attenuated vaccine strain of canine distemper virus (CDV) or experimentally inoculated with the virulent Snyder-Hill strain of CDV. Viral antigen was detected in cells of the lymphoid system 6 to 12 days after vaccination. From 2 to 3 days after inoculation with the virulent strain, CDV antigen was demonstrated in cells of the lymphoid system and, during the incubation period, the antigen had spread to the epithelia and brain at days 6 and 12, respectively. In clinical cases of acute fatal canine distemper, the viral antigen was detected in a wide variety of tissues, including the cells of the lymphoid system, epithelial cells of skin, mucous membranes, lung, kidney, and cells of the CNS. The diagnostic importance of CDV antigen detection is discussed on the basis of these findings.
Yhee, J Y; Yu, C H; Kim, J H; Im, K S; Kim, N H; Brodersen, B W; Doster, A R; Sur, J-H
2012-01-01
The aim of the present study was to determine the distribution and characteristics of microvessels in various histological types of canine renal cell carcinoma (RCC). The study compared microvessel density (MVD) and distribution of blood vessels according to histological type and evaluated the presence of angiogenesis-related proteins. Nine archival samples of canine RCC were studied. MVD was calculated as the mean number of blood vessels per mm(2). The diameter of blood vessels was calculated by determining either the length of the long axis of blood vessels (diameter(max)) or the mean distance from the centre of each blood vessel to the tunica adventia (diameter(mean)). A significant difference in MVD was evident between RCCs and normal kidneys (46.6 ± 28.0 versus 8.4 ± 2.2 microvessels/mm(2)). Diameter(max) in canine RCCs (34.1 ± 14.7 μm) was also significantly different from normal canine kidney (23.2 ± 3.4 μm). Vascular endothelial growth factor (VEGF) was expressed by tumour cells and vascular endothelial cells and tumour necrosis factor (TNF)-α expression was observed in vascular endothelial cells in both neoplastic and normal kidney. Although VEGF is involved in angiogenesis and correlates with tumour stage of development, no correlation was found between VEGF expression and MVD. Tumour-associated macrophages expressing TNF-α and hypoxia inducible factor 1α were identified in peritumoural tissue and may play an important role in angiogenesis. Copyright © 2011 Elsevier Ltd. All rights reserved.
Mondritzki, Thomas; Steinbach, Sarah M L; Boehme, Philip; Hoffmann, Jessica; Kullmann, Maximilian; Schock-Kusch, Daniel; Vogel, Julia; Kolkhof, Peter; Sandner, Peter; Bischoff, Erwin; Hüser, Jörg; Dinh, Wilfried; Truebel, Hubert
Quantitative assessment of renal function by measurement of glomerular filtration rate (GFR) is an important part of safety and efficacy evaluation in preclinical drug development. Existing methods are often time consuming, imprecise and associated with animal burden. Here we describe the comparison between GFR determinations with sinistrin (PS-GFR) and fluorescence-labelled sinistrin-application and its transcutaneous detection (TD-GFR) in a large animal model of chronic kidney disease (CKD). TD-GFR measurements compared to a standard method using i.v. sinistrin were performed in a canine model. Animals were treated with one-sided renal wrapping (RW) followed by renal artery occlusion (RO). Biomarker and remote hemodynamic measurements were performed. Plasma sinistrin in comparison to transcutaneous derived GFR data were determined during healthy conditions, after RW and RW+RO. RW alone did not led to any significant changes in renal function, neither with PS-GFR nor TD-GFR. Additional RO showed a rise in blood pressure (+68.0mmHg), plasma urea (+28.8mmol/l), creatinine (+224,4μmol/l) and symmetric dimethylarginine (SDMA™; +12.6μg/dl). Plasma sinistrin derived data confirmed the expected drop (-44.7%, p<0.0001) in GFR. The calculated transcutaneous determined Fluorescein Isothiocyanate (FITC)-sinistrin GFR showed no differences to plasma sinistrin GFR at all times. Both methods were equaly sensitive to diagnose renal dysfunction in the affected animals. Renal function assessment using TD-GFR is a valid method to improve preclinical drug discovery and development. Furthermore, TD-GFR method offers advantages in terms of reduced need for blood sampling and thus decreasing animal burden compared to standard procedures. Copyright © 2017 Elsevier Inc. All rights reserved.
Wagoner, M P; Yang, Y; McDuffie, J E; Klapczynski, M; Buck, W; Cheatham, L; Eisinger, D; Sace, F; Lynch, K M; Sonee, M; Ma, J-Y; Chen, Y; Marshall, K; Damour, M; Stephen, L; Dragan, Y P; Fikes, J; Snook, S; Kinter, L B
2017-01-01
Urinary protein biomarkers and metabolomic markers have been leveraged to detect acute Drug Induced Kidney Injury (DIKI) in rats; however, the utility of these indicators to enable early detection of DIKI in canine models has not been well documented. Therefore, we evaluated temporal changes in biomarkers and metabolites in urine from male and female beagle dogs. Gentamicin- induced kidney lesions in male dogs were characterized by moderate to severe tubular epithelial cell degeneration/necrosis, epithelial cell regeneration and dilation; and a unique urinebased metabolomic fingerprint. These metabolite changes included time and treatment-dependent increases in lactate, taurine, glucose, lactate, alanine, and citrate as well as 9 other known metabolites. As early as 3 days post dose, gentamicin induced increases in urinary albumin, clusterin, neutrophil gelatinase associated protein (NGAL) and total protein concentrations. Urinary albumin, clusterin, and NGAL showed earlier and more robust elevations than traditional kidney safety biomarkers, blood urea nitrogen and serum creatinine. Elevations in urinary kidney injury molecule 1 (KIM-1) were less reliable for detection of gentamicin nephrotoxicity in dogs based on values generated utilizing multiple first-generation, canine-specific KIM-1 immunoassays. The metabolic fingerprint was further evaluated in male and female dogs that received Compound A which induced slightly reversible renal tubular alterations characterized as degeneration/necrosis and concurrent significant increases in urinary taurine amongst other markers. These data support further investigations to demonstrate the value of urinary metabolites, albumin, clusterin, NGAL and taurine as promising markers to enable early detection of DIKI in dogs. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Histologic features of harvested canine kidneys preserved in four ...
African Journals Online (AJOL)
Endless efforts are required in the investigation of the best organ preservative. Normal Saline, 5% dextrose, Darrows and Ringers' Lactate were used as preservatives with the view to investigate the prospect of kidney survival in these solutions post harvest at the Veterinary Teaching Hospital, Ahmadu Bello University-Zaria.
Liu, Dafei; Liu, Fei; Guo, Dongchun; Hu, Xiaoliang; Li, Zhijie; Li, Zhigang; Ma, Jianzhang; Liu, Chunguo
2018-01-23
To rapidly distinguish Canine distemper virus (CDV), canine parvovirus (CPV), and canine kobuvirus (CaKoV) in practice, a one-step multiplex PCR/RT-PCR assay was developed, with detection limits of 10 2.1 TCID 50 for CDV, 10 1.9 TCID 50 for CPV and 10 3 copies for CaKoV. This method did not amplify nonspecific DNA or RNA from other canine viruses. Therefore, the assay provides a sensitive tool for the rapid clinical detection and epidemiological surveillance of CDV, CPV and CaKoV in dogs.
Directory of Open Access Journals (Sweden)
Mostfa Shahabi
2017-09-01
Full Text Available Introduction: Canine impaction is a common occurrence. In this study, we sought to investigate the root anatomy and length of impacted canines and lateral incisor adjacent to impacted maxillary canine. Materials and Methods: In this retrospective study, three-dimensional tomographic imaging was performed on 26 patients with unilateral maxillary canine impaction. In this study, we evaluated root length and anatomy of impacted canines, in terms of resorption intensity and curvature, with Planmeca Romexis Viewer 4.0. Furthermore, crown shape as well as root length and anatomy of the lateral incisors adjacent to impacted canines were investigated and compared with the other side on the dental arch, where canine eruption was normal. Results: Root length of impacted canines was significantly lower than that of normal canines (P=0.011. There were no significant differences between root length of lateral incisors adjacent to impacted canines and root length of lateral incisors adjacent to normal canines (P=0.221. Moreover, the resorption intensity of the adjacent lateral incisors was higher than that of the impacted canines. No significant differences were noted in root resorption intensity between the lateral incisors adjacent to the imacted canines and the lateral incisors adjacent to normal canines (P=0.36. In addition, resorption intensity was significantly higher in impacted canines than in normal canines (P=0.024. Root anatomy of impacted canines was not significantly different from that of normal canines (P=0.055. The crown shape of the lateral incisors adjacent to impacted canines was not significantly different from that of the lateral incisors adjacent to normal canines (P=0.052. Conclusion: Impaction can probably affect root length and canine resorption severity. However, root and crown shape of lateral incisors cannot always be associated with canine impaction.
Dog kidney: anatomical relationships between intrarenal arteries and kidney collecting system.
Marques-Sampaio, Beatriz P S; Pereira-Sampaio, Marco A; Henry, Robert W; Favorito, Luciano A; Sampaio, Francisco J B
2007-08-01
The detailed findings of canine intrarenal anatomy (collecting system and arteries) are presented. Ninety-five three-dimensional endocasts of the kidney collecting system together with the intrarenal arteries were prepared using standard injection-corrosion techniques and were studied. A single renal artery was observed in 88.4% of the casts. The renal artery divided into a dorsal and a ventral branch. Using the branching pattern of the ventral and dorsal divisions of the renal artery, the vessels were classified in type I or type II. Type I presented a cranial and a caudal artery, whereas type II presented a mesorenal and a caudal artery. Cranial branches of dorsal and ventral arteries supplied the cranial pole in 90.5% of the specimens. Caudal branches of the dorsal and the ventral divisions of the renal artery irrigated both the caudal pole and the mid-zone of the kidney in 95.8% and 98.9% of the cases, respectively. In all casts, caudal branches of both dorsal and ventral arteries supplied the caudal pole. Therefore, the caudal branches of the ventral and dorsal divisions of the renal artery are of utmost importance in the kidney arterial supply. Although many results of renal and intrarenal anatomy in dogs may not be completely transposed to humans, the anatomical relationship between arteries and the collecting system in the cranial pole of the dog kidney is similar to those in man. This fact supports the use of the dog as an animal model for urologic procedures at the cranial pole. (c) 2007 Wiley-Liss, Inc.
Cytoplasmic Dynein Regulation by Subunit Heterogeneity and Its Role in Apical Transport
Tai, Andrew W.; Chuang, Jen-Zen; Sung, Ching-Hwa
2001-01-01
Despite the existence of multiple subunit isoforms for the microtubule motor cytoplasmic dynein, it has not yet been directly shown that dynein complexes with different compositions exhibit different properties. The 14-kD dynein light chain Tctex-1, but not its homologue RP3, binds directly to rhodopsin's cytoplasmic COOH-terminal tail, which encodes an apical targeting determinant in polarized epithelial Madin-Darby canine kidney (MDCK) cells. We demonstrate that Tctex-1 and RP3 compete for binding to dynein intermediate chain and that overexpressed RP3 displaces endogenous Tctex-1 from dynein complexes in MDCK cells. Furthermore, replacement of Tctex-1 by RP3 selectively disrupts the translocation of rhodopsin to the MDCK apical surface. These results directly show that cytoplasmic dynein function can be regulated by its subunit composition and that cytoplasmic dynein is essential for at least one mode of apical transport in polarized epithelia. PMID:11425878
Regulation of Kv1.4 potassium channels by PKC and AMPK kinases
DEFF Research Database (Denmark)
Andersen, Martin Nybo; Skibsbye, Lasse; Saljic, Arnela
2018-01-01
around the ubiquitin ligase Nedd4-2. In the present study we examined whether Kv1.4, constituting the cardiac Ito,s current, is subject to similar regulation. In the epithelial Madin-Darby Canine Kidney (MDCK) cell line, which constitutes a highly reproducible model system for addressing membrane...... targeting, we find, by confocal microscopy, that Kv1.4 cell surface expression is downregulated by activation of protein kinase C (PKC) and AMP-activated protein kinase (AMPK). In contrast, manipulating the activities of phosphatidylinositol-4,5-bisphosphate 3-kinase (PI3K) and serum and glucocorticoid......-regulated kinase 1 (SGK1) were without effect on channel localization. The PKC and AMPK-mediated downregulation of Kv1.4 membrane surface localization was confirmed by two-electrode voltage clamp in Xenopus laevis oocytes, where pharmacological activation of PKC and AMPK reduced Kv1.4 current levels. We further...
Long-term effectiveness of canine-to-canine bonded flexible spiral wire lingual retainers
Renkema, Anne-Marie; Renkema, Alianne; Bronkhorst, Ewald; Katsaros, Christos
Introduction: The flexible spiral wire (FSW) canine-to-canine lingual retainer bonded to all 6 anterior teeth is a frequently used type of mandibular fixed retainer. This study aimed to assess the long-term effectiveness of FSW canine-to-canine lingual retainers in maintaining the alignment of the
Long-term effectiveness of canine-to-canine bonded flexible spiral wire lingual retainers
Renkema, A.M.; Bronkhorst, E.M.; Katsaros, C.
2011-01-01
INTRODUCTION: The flexible spiral wire (FSW) canine-to-canine lingual retainer bonded to all 6 anterior teeth is a frequently used type of mandibular fixed retainer. This study aimed to assess the long-term effectiveness of FSW canine-to-canine lingual retainers in maintaining the alignment of the
Amiloride interacts with renal α- and β-adrenergic receptors
International Nuclear Information System (INIS)
Howard, M.J.; Mullen, M.D.; Insel, P.A.
1987-01-01
The authors have used radioligand binding techniques to assess whether amiloride and certain analogues of amiloride (ethylisopropyl amiloride and benzamil) can bind to adrenergic receptors in the kidney. They found that amiloride could compete for [ 3 H]rauwolscine (α 2 -adrenergic receptors), [ 3 H]prazosin (α 1 -adrenergic receptors), and [ 125 I]iodocyanopindolol (β-adrenergic receptors) binding in rat renal cortical membranes with inhibitor constants of 13.6 /plus minus/ 5.7, 24.4 /plus minus/ 7.4, and 8.36 /plus minus/ 13.5 μM, respectively. Ethylisopropyl amiloride and benzamil were from 2- to 25-fold more potent than amiloride in competing for radioligand binding sites in studies with these membranes. In addition, amiloride and the two analogues competed for [ 3 H]prazosin sites on intact Madin-Darby canine kidney cells and amiloride blocked epinephrine-stimulated prostaglandin E 2 production in these cells. They conclude that amiloride competes for binding to several classes of renal adrenergic receptors with a rank order of potency of α 2 > α 1 > β. Binding to, and antagonism of, adrenergic receptors occurs at concentrations of amiloride that are lower than previously observed nonspecific interactions of this agent
A rapid method for establishment of a reverse genetics system for canine parvovirus.
Yu, Yongle; Su, Jun; Wang, Jigui; Xi, Ji; Mao, Yaping; Hou, Qiang; Zhang, Xiaomei; Liu, Weiquan
2017-12-01
Canine parvovirus (CPV) is an important and highly prevalent pathogen of dogs that causes acute hemorrhagic enteritis disease. Here, we describe a rapid method for the construction and characterization of a full-length infectious clone (rCPV) of CPV. Feline kidney (F81) cells were transfected with rCPV incorporating an engineered EcoR I site that served as a genetic marker. The rescued virus was indistinguishable from that of wild-type virus in its biological properties.
Attenuation changes of the normal and ischemic canine kidney
International Nuclear Information System (INIS)
Jaschke, W.; Lipton, M.J.; Boyd, D.P.; Cann, C.; Strauss, L.; Sievers, R.S.; California Univ., San Francisco
1985-01-01
The potential of CT scanning to explore total and regional renal blood flow was evaluated in a dog model with unilateral renal artery stenosis (n=7, reduction of renal blood flow: 32-75% of base line flow). Attenuation versus time curves were generated for the renal cortex and medulla, as well as for the aorta and renal vein. A fast CT scanner was used which allowed for up to 24 scans/minute at the same level (slice thickness: 10 mm). A total of 10 ml contrast medim was injected into a peripheral vein for each scan series taken. During baseline conditions, the curve of the renal cortex and medulla demonstrated 2 peaks. The first peak was mainly related to early vascular enhancement, whereas the second peak corresponded mainly to the appearance of contrast medium in the distal convolutes and collecting ducts. Ischemia of the kidney resulted in a reduction of the first peak and a flattening of the leading edge slope. Transport of contrast medium through the extravascular compartments of the kidney was delayed during ischemia. Relative renal blood flow was obtained from the CT data by dividing peak enhancement by rise-time as assessed from the cortical curve. All measurements were related to baseline flow and validated by flow measurements using radioactive labeled microspheres (n=5). Correlation was found to be r=0.97. (orig.)
International Nuclear Information System (INIS)
Rozenblatt, S.; Eizenberg, O.; Englund, G.; Bellini, W.J.
1985-01-01
Double-stranded cDNA synthesized from total polyadenylate-containing mRNA, extracted from monkey kidney cells infected with canine distemper virus (CDV), has been cloned into the PstI site of Escherichia coli plasmid pBR322. Clones containing canine distemper virus DNA were identified by hybridization to a canine distemper virus-specific, 32 P-labeled cDNA. Four specific clones containing different classes of sequences have been identified. The cloned plasmids contain inserts of 800 (clone 44-80), 960 (clone 74-16), 1700 (clone 364), and 950 (clone 40-9) base pairs. The sizes of the mRNA species complementary to these inserts are 1500, 1850, 1850 and 2500 nucleotides, respectively, as determined by the Northern technique. Three of the cloned DNA fragments were further identified as the reverse transcripts of the mRNA coding for the matrix, phosphoprotein, and nucleocapsid protein of CDV
Energy Technology Data Exchange (ETDEWEB)
Rozenblatt, S.; Eizenberg, O.; Englund, G.; Bellini, W.J.
1985-02-01
Double-stranded cDNA synthesized from total polyadenylate-containing mRNA, extracted from monkey kidney cells infected with canine distemper virus (CDV), has been cloned into the PstI site of Escherichia coli plasmid pBR322. Clones containing canine distemper virus DNA were identified by hybridization to a canine distemper virus-specific, /sup 32/P-labeled cDNA. Four specific clones containing different classes of sequences have been identified. The cloned plasmids contain inserts of 800 (clone 44-80), 960 (clone 74-16), 1700 (clone 364), and 950 (clone 40-9) base pairs. The sizes of the mRNA species complementary to these inserts are 1500, 1850, 1850 and 2500 nucleotides, respectively, as determined by the Northern technique. Three of the cloned DNA fragments were further identified as the reverse transcripts of the mRNA coding for the matrix, phosphoprotein, and nucleocapsid protein of CDV.
Characterization of an Isolated Kidney's Vasculature for Use in Bio-Thermal Modeling
Payne, Allison H.; Parker, Dennis L.; Moellmer, Jeff; Roemer, Robert B.; Clifford, Sarah
2007-05-01
Accurate bio-thermal modeling requires site-specific modeling of discrete vascular anatomy. Presented herewith are several steps that have been developed to describe the vessel network of isolated canine and bovine kidneys. These perfused, isolated kidneys provide an environment to repeatedly test and improve acquisition methods to visualize the vascular anatomy, as well as providing a method to experimentally validate discrete vasculature thermal models. The organs are preserved using a previously developed methodology that keeps the vasculature intact, allowing for the organ to be perfused. It also allows for the repeated fixation and re-hydration of the same organ, permitting the comparison of various methods and models. The organ extraction, alcohol preservation, and perfusion of the organ are described. The vessel locations were obtained through a high-resolution time-of-flight (TOF) magnetic resonance angiography (MRA) technique. Sequential improvements of both the experimental setup used for this acquisition, as well as MR sequence development are presented. The improvements in MR acquisition and experimental setup improved the number of vessels seen in both the raw data and segmented images by 50%. An automatic vessel centerline extraction algorithm describes both vessel location and genealogy. Centerline descriptions also allows for vessel diameter and flow rate determination, providing valuable input parameters for the discrete vascular thermal model. Characterized vessels networks of both canine and bovine kidneys are presented. While these tools have been developed in an ex vivo environment, all steps can be applied to in vivo applications.
Mostfa Shahabi; Maryam Omidkhoda; Seyedeh Haniyeh Omidi; Seyed Hosein Hoseini Zarch
2017-01-01
Introduction: Canine impaction is a common occurrence. In this study, we sought to investigate the root anatomy and length of impacted canines and lateral incisor adjacent to impacted maxillary canine. Materials and Methods: In this retrospective study, three-dimensional tomographic imaging was performed on 26 patients with unilateral maxillary canine impaction. In this study, we evaluated root length and anatomy of impacted canines, in terms of resorption intensity and curvature, with Planme...
Identification of reassortant pandemic H1N1 influenza virus in Korean pigs.
Han, Jae Yeon; Park, Sung Jun; Kim, Hye Kwon; Rho, Semi; Nguyen, Giap Van; Song, Daesub; Kang, Bo Kyu; Moon, Hyung Jun; Yeom, Min Joo; Park, Bong Kyun
2012-05-01
Since the 2009 pandemic human H1N1 influenza A virus emerged in April 2009, novel reassortant strains have been identified throughout the world. This paper describes the detection and isolation of reassortant strains associated with human pandemic influenza H1N1 and swine influenza H1N2 (SIV) viruses in swine populations in South Korea. Two influenza H1N2 reassortants were detected, and subtyped by PCR. The strains were isolated using Madin- Darby canine kidney (MDCK) cells, and genetically characterized by phylogenetic analysis for genetic diversity. They consisted of human, avian, and swine virus genes that were originated from the 2009 pandemic H1N1 virus and a neuraminidase (NA) gene from H1N2 SIV previously isolated in North America. This identification of reassortment events in swine farms raises concern that reassortant strains may continuously circulate within swine populations, calling for the further study and surveillance of pandemic H1N1 among swine.
DEFF Research Database (Denmark)
Andersen, Martin Nybo; Hefting, Louise Leth; Steffensen, Annette Buur
2015-01-01
The potassium channel Kv7.1 plays critical physiological roles in both heart and epithelial tissues. In heart, Kv7.1 and the accessory subunit KCNE1 forms the IKs current, which is enhanced by PKA mediated phosphorylation. The observed current increase requires both phosphorylation of Kv7.......1 and the presence of KCNE1. However, PKA also stimulates Kv7.1 currents in epithelial tissues, such as colon, where the channel does not co-assemble with KCNE1. Here, we demonstrate that PKA activity significantly impacts the subcellular localization of Kv7.1 in Madin Darby Canine Kidney cells. While PKA inhibition...... reduced the fraction of channels at the cell surface, PKA activation increased it. We show that PKA inhibition lead to intracellular accumulation of Kv7.1 in late endosomes/lysosomes. By mass spectroscopy we identified eight phosphorylated residues on Kv7.1, however, none appeared to play a role...
Directory of Open Access Journals (Sweden)
Tatsuru Togo
2017-12-01
Full Text Available Disruption of cellular plasma membranes is a common event in many animal tissues, and the membranes are usually rapidly resealed. Moreover, repeated membrane disruptions within a single cell reseal faster than the initial wound in a protein kinase A (PKA- and protein kinase C (PKC-dependent manner. In addition to wounded cells, recent studies have demonstrated that wounding of Madin-Darby canine kidney (MDCK cells potentiates membrane resealing in neighboring cells in the short-term by purinergic signaling, and in the long-term by nitric oxide/protein kinase G signaling. In the present study, real-time imaging showed that cell membrane disruption stimulated cAMP synthesis and Ca2+ mobilization from intracellular stores by purinergic signaling in neighboring MDCK cells. Furthermore, inhibition of PKA and PKC suppressed the ATP-mediated short-term potentiation of membrane resealing in neighboring cells. These results suggest that cell membrane disruption stimulates PKA and PKC via purinergic signaling to potentiate cell membrane resealing in neighboring MDCK cells.
The hypertonic environment differentially regulates wild-type CFTR and TNR-CFTR chloride channels.
Lassance-Soares, Roberta M; Cheng, Jie; Krasnov, Kristina; Cebotaru, Liudmila; Cutting, Garry R; Souza-Menezes, Jackson; Morales, Marcelo M; Guggino, William B
2010-01-01
This study tested the hypotheses that the hypertonic environment of the renal medulla regulates the expression of cystic fibrosis transmembrane conductance regulator protein (CFTR) and its natural splice variant, TNR-CFTR. To accomplish this, Madin-Darby canine kidney (MDCK) stable cell lines expressing TNR-CFTR or CFTR were used. The cells were treated with hypertonic medium made with either NaCl or urea or sucrose (480 mOsm/kg or 560 mOsm/kg) to mimic the tonicity of the renal medulla environment. Western blot data showed that CFTR and TNR-CFTR total cell protein is increased by hypertonic medium, but using the surface biotinylation technique, only CFTR was found to be increased in cell plasma membrane. Confocal microscopy showed TNR-CFTR localization primarily at the endoplasmic reticulum and plasma membrane. In conclusion, CFTR and TNR-CFTR have different patterns of distribution in MDCK cells and they are modulated by a hypertonic environment, suggesting their physiological importance in renal medulla. Copyright © 2010 S. Karger AG, Basel.
A Transporter of Ibuprofen is Upregulated in MDCK I Cells under Hyperosmotic Culture Conditions
DEFF Research Database (Denmark)
Nielsen, Carsten Uhd; Rasmussen, Rune N; Mo, Junying
2016-01-01
Ibuprofen is a widely used drug. It has been identified as an inhibitor of several transporters, but it is not clear if ibuprofen is a substrate of any transporter itself. In the present work, we have characterized a transporter of ibuprofen, which is upregulated by hyperosmotic culture conditions...... in Madin-Darby canine kidney I (MDCK I) renal cells. [(3)H]-Ibuprofen uptake rate was measured in MDCK I cell cultured under normal (300 mOsm) and hyperosmotic (500 mOsm) conditions. Hyperosmotic conditions were obtained by supplementing urea, NaCl, mannitol, or raffinose to culture medium. The effect...... of increased osmolarity was investigated for different incubation times. [(3)H]-Ibuprofen uptake in MDCK I cells was upregulated by hyperosmotic culture condition, and was saturable with a Km value of 0.37 ± 0.08 μM and a Vmax of 233.1 ± 17.2 pmol· cm(-2)· min(-1). Racemic [(3)H]-ibuprofen uptake could...
DEFF Research Database (Denmark)
Hillström, Anna; Hagman, Ragnvi; Tvedten, Harold
2014-01-01
BACKGROUND: Measurement of C-reactive protein (CRP) is used for diagnosing and monitoring systemic inflammatory disease in canine patients. An automated human immunoturbidimetric assay has been validated for measuring canine CRP, but cross-reactivity with canine CRP is unpredictable. OBJECTIVE......: The purpose of the study was to validate a new automated canine-specific immunoturbidimetric CRP method (Gentian cCRP). METHODS: Studies of imprecision, accuracy, prozone effect, interference, limit of quantification, and stability under different storage conditions were performed. The new method was compared...... with a human CRP assay previously validated for canine CRP determination. Samples from 40 healthy dogs were analyzed to establish a reference interval. RESULTS: Total imprecision was
Directory of Open Access Journals (Sweden)
Ahmad, S.Z.
2008-01-01
Full Text Available There is limited empirical research on the internationalisation processes, strategies and operations of Asian multinational corporations (MNCs, particularly MNC’s based in Malaysia. The emergence and development of an MNC from this developing country represents a significant addition to the literature on this topic which augments and supplements the information already available with regard to nascent MNCs from Asian Newly Industrialised Countries (NIC’s. Drawing on primary data from in-depth interviews with 12 key executives from Sime Darby Berhad (SDB, a developing Malaysian-based MNC, this paper will examine and investigate the firm’s internationalisation process, its characteristics and strategies, including motivations, patterns, and sources of competitive advantage. The empirical findings, limitations and areas for further research are discussed.
Larson, L J; Schultz, R D
2007-01-01
A group of client-owned dogs and a group of dogs at a commercial kennel were evaluated for duration of antibody responses against canine parvovirus type 2 (CPV-2) and canine adenovirus type 1 (CAV-1) after receiving a combination vaccine containing recombinant canarypox-vectored canine distemper virus (CDV) and modified-live CPV-2, CAV-2, and canine parainfluenza virus, with (C6) or without (C4) two serovars of Leptospira (Recombitek C4 or C6, Merial). Duration of antibody, which correlates with protective immunity, was found to be at least 36 months in both groups. Recombitek combination vaccines can confidently be given every 3 years with assurance of protection in immunocompetent dogs against CPV-2 and CAV-1 as well as CDV. This allows this combination vaccine, like other, similar modified- live virus combination products containing CDV, CAV-2, and CPV-2, to be administered in accordance with the recommendations of the American Animal Hospital Association Canine Vaccine Task Force.
Directory of Open Access Journals (Sweden)
Anna McRee
2014-09-01
Full Text Available Domestic dogs are common amongst communities in sub-Saharan Africa and may serve as important reservoirs for infectious agents that may cause diseases in wildlife. Two agents of concern are canine parvovirus (CPV and canine distemper virus (CDV, which may infect and cause disease in large carnivore species such as African wild dogs and African lions, respectively. The impact of domestic dogs and their diseases on wildlife conservation is increasing in Zimbabwe, necessitating thorough assessment and implementation of control measures. In this study, domestic dogs in north-western Zimbabwe were evaluated for antibodies to CDV, CPV, and canine adenovirus (CAV. These dogs were communal and had no vaccination history. Two hundred and twenty-five blood samples were collected and tested using a commercial enzyme-linked immunosorbent assay (ELISA for antibodies to CPV, CDV, and CAV. Of these dogs, 75 (34% had detectable antibodies to CDV, whilst 191 (84% had antibodies to CPV. Antibodies to canine adenovirus were present in 28 (13% dogs. Canine parvovirus had high prevalence in all six geographic areas tested. These results indicate that CPV is circulating widely amongst domestic dogs in the region. In addition, CDV is present at high levels. Both pathogens can infect wildlife species. Efforts for conservation of large carnivores in Zimbabwe must address the role of domestic dogs in disease transmission.
McRee, Anna; Wilkes, Rebecca P; Dawson, Jessica; Parry, Roger; Foggin, Chris; Adams, Hayley; Odoi, Agricola; Kennedy, Melissa A
2014-09-05
Domestic dogs are common amongst communities in sub-Saharan Africa and may serve as important reservoirs for infectious agents that may cause diseases in wildlife. Two agents of concern are canine parvovirus (CPV) and canine distemper virus (CDV), which may infect and cause disease in large carnivore species such as African wild dogs and African lions, respectively. The impact of domestic dogs and their diseases on wildlife conservation is increasing in Zimbabwe, necessitating thorough assessment and implementation of control measures. In this study, domestic dogs in north-western Zimbabwe were evaluated for antibodies to CDV, CPV, and canine adenovirus (CAV). These dogs were communal and had no vaccination history. Two hundred and twenty-five blood samples were collected and tested using a commercial enzyme-linked immunosorbent assay (ELISA) for antibodies to CPV, CDV, and CAV. Of these dogs, 75 (34%) had detectable antibodies to CDV, whilst 191 (84%) had antibodies to CPV. Antibodies to canine adenovirus were present in 28 (13%) dogs. Canine parvovirus had high prevalence in all six geographic areas tested. These results indicate that CPV is circulating widely amongst domestic dogs in the region. In addition, CDV is present at high levels. Both pathogens can infect wildlife species. Efforts for conservation of large carnivores in Zimbabwe must address the role of domestic dogs in disease transmission.
Webb, Craig; Twedt, David C
2003-09-01
Gastritis--inflammation of the stomach--is a frequently cited differential yet rarely characterized diagnosis in cases of canine anorexia and vomiting. Although the list of rule-outs for acute or chronic gastritis is extensive, a review of the veterinary literature reveals fewer than 15 articles that have focused on clinical cases of canine gastritis over the last 25 years. The dog frequently appears in the human literature as an experimentally manipulated model for the study of endoscopic techniques or the effect of medications on gastric mucosa. In the veterinary patient, cases of acute gastritis are rarely pursued with the complete diagnostic armamentarium, and cases of chronic gastritis are rarely found to occur as an entity isolated from the rest of the gastrointestinal tract. This article focuses on those findings most clinically relevant to cases of canine gastritis in veterinary medicine.
Varied clinico-radiological presentations of transmigrated canines
Directory of Open Access Journals (Sweden)
Ishita Gupta
2015-01-01
Full Text Available Canine is one of the most commonly impacted teeth in the dental arch. An unerupted permanent canine crossing the midline is called transmigration and is an unusual event. We report nine cases of impacted canine transmigration. Maxillary canine transmigration, bilateral transmigration, and transmigration associated with odontoma are rare presentations. This article discusses the varied clinico-radiologic presentations, etiology, and treatment options of transmigration. It also emphasizes the importance of panoramic radiographs for evaluation of over-retained deciduous canines or missing permanent canines.
Directory of Open Access Journals (Sweden)
Jonna Nykky
2010-06-01
Full Text Available Jonna Nykky, Jenni E Tuusa, Sanna Kirjavainen, Matti Vuento, Leona GilbertNanoscience Center and Department of Biological and Environmental Science, University of Jyväskylä, FinlandAbstract: Viruses have great potential as nanotools in medicine for gene transfer, targeted gene delivery, and oncolytic cancer virotherapy. Here we have studied cell death mechanisms of canine parvovirus (CPV to increase the knowledge on the CPV life cycle in order to facilitate the development of better parvovirus vectors. Morphological studies of CPV-infected Norden laboratory feline kidney (NLFK cells and canine fibroma cells (A72 displayed characteristic apoptotic events. Apoptosis was further confirmed by activation of caspases and cellular DNA damage. However, results from annexin V-propidium iodide (PI labeling and membrane polarization assays indicated disruption of the plasma membrane uncommon to apoptosis. These results provide evidence that secondary necrosis followed apoptosis. In addition, two human cancer cell lines were found to be infected by CPV. This necrotic event over apoptotic cell death and infection in human cells provide insightful information when developing CPV as a nanotool for cancer treatments.Keywords: canine parvovirus, apoptosis, necrosis, nanoparticle, virotherapy
Development of the canine tooth in the beagle
International Nuclear Information System (INIS)
Amimoto, A.; Iwamoto, S.; Hachimura, H.; Miyamoto, T.; Murata, T.; Taura, Y.; Nakama, S.; Hayashi, K.
1993-01-01
The growth of the crown and root in the canine tooth of beagle dogs were observed macroscopically and radiographically, and changes of occlusion with age were investigated. Completion of growth in the crown of the canine tooth was observed in both mandible and maxilla, and its eruption was accompanied by development of the dental root. The permanent canine erupted on the lingual side of deciduous canine in the mandible, and on the mesial side of the deciduous canine in the maxilla. Movement of the permanent canine to normal occlusal position(buccal direction in mandibular canine, and distal direction in maxillary canine)was followed by the loss of the deciduous canine. Coexistence of the permanent and deciduous canines occurred for about 2.4 weeks in the maxilla and about 1.4 weeks in the mandible, on average. Macroscopically, the growth of the permanent canine was completed by 33 weeks of age in the mandible and about 34 weeks of age in the maxilla. The mature root of the permanent canine was recognized radiographically at about 43 weeks of age in the mandible and 47 weeks of age in the maxilla
Ontogeny of canine dimorphism in extant hominoids.
Schwartz, G T; Dean, C
2001-07-01
Many behavioral and ecological factors influence the degree of expression of canine dimorphism for different reasons. Regardless of its socioecological importance, we know virtually nothing about the processes responsible for the development of canine dimorphism. Our aim here is to describe the developmental process(es) regulating canine dimorphism in extant hominoids, using histological markers of tooth growth. Teeth preserve a permanent record of their ontogeny in the form of short- and long-period incremental markings in both enamel and dentine. We selected 52 histological sections of sexed hominoid canine teeth from a total sample of 115, from which we calculated the time and rate of cuspal enamel formation and the rate at which ameloblasts differentiate along the future enamel-dentine junction (EDJ) to the end of crown formation. Thus, we were able to reconstruct longitudinal growth curves for height attainment in male and female hominoid canines. Male hominoids consistently take longer to form canine crowns than do females (although not significantly so for our sample of Homo). Male orangutans and gorillas occasionally take up to twice as long as females to complete enamel formation. The mean ranges of female canine crown formation times are similar in Pan, Gorilla, and Pongo. Interspecific differences between female Pan canine crown heights and those of Gorilla and Pongo, which are taller, result from differences in rates of growth. Differences in canine crown heights between male Pan and the taller, more dimorphic male Gorilla and Pongo canines result both from differences in total time taken to form enamel and from faster rates of growth in Gorilla and Pongo. Although modern human canines do not emerge as significantly dimorphic in this study, it is well-known that sexual dimorphism in canine crown height exists. Larger samples of sexed modern human canines are therefore needed to identify clearly what underlies this. Copyright 2001 Wiley-Liss, Inc.
Power Doppler Imaging in Acute Renal Vein Occlusion and Recanalization: a Canine Model
Energy Technology Data Exchange (ETDEWEB)
Yoo, So-Young; Kim, In-One; Kim, Young-Il; Lee, Kyoung Ho; Lee, Min Woo; Youn, Byung Jae; Kim, Woo Sun; Yeon, Kyung Mo [Seoul National University College of Medicine, Seoul (Korea, Republic of)
2008-04-15
Objective : To evaluate the dynamic changes of the power Doppler (PD) in acute renal vein occlusion and recanalization in a canine model. Materials and Methods : We performed a PD of the kidney during graded renal vein occlusion and recanalization induced by balloon inflation and deflation in nine dogs. The PD images were transferred to a personal computer, and the PD signals were quantified. Result : We observed the temporal change of the PD signal during renal vein occlusion and recanalization, with a decrease in the PD signal during occlusion and an increase during recanalization. The mean PD signal decreased gradually as the renal vein was occluded, and conversely increased gradually with sequential relief of occlusion. The sequential change of the mean value of the PD signal was statistically significant. Conclusion : The PD can detect a change in renal blood flow during acute renal vein occlusion and recanalization in a canine model. The PD may be used as a helpful tool for the early detection of acute renal vein thrombosis and the monitoring of renal perfusion.
Power Doppler Imaging in Acute Renal Vein Occlusion and Recanalization: a Canine Model
International Nuclear Information System (INIS)
Yoo, So-Young; Kim, In-One; Kim, Young-Il; Lee, Kyoung Ho; Lee, Min Woo; Youn, Byung Jae; Kim, Woo Sun; Yeon, Kyung Mo
2008-01-01
Objective : To evaluate the dynamic changes of the power Doppler (PD) in acute renal vein occlusion and recanalization in a canine model. Materials and Methods : We performed a PD of the kidney during graded renal vein occlusion and recanalization induced by balloon inflation and deflation in nine dogs. The PD images were transferred to a personal computer, and the PD signals were quantified. Result : We observed the temporal change of the PD signal during renal vein occlusion and recanalization, with a decrease in the PD signal during occlusion and an increase during recanalization. The mean PD signal decreased gradually as the renal vein was occluded, and conversely increased gradually with sequential relief of occlusion. The sequential change of the mean value of the PD signal was statistically significant. Conclusion : The PD can detect a change in renal blood flow during acute renal vein occlusion and recanalization in a canine model. The PD may be used as a helpful tool for the early detection of acute renal vein thrombosis and the monitoring of renal perfusion
Gore, Thomas C; Lakshmanan, Nallakannu; Duncan, Karen L; Coyne, Michael J; Lum, Melissa A; Sterner, Frank J
2005-01-01
A challenge-of-immunity study was conducted to demonstrate immunity in dogs 3 years after their second vaccination with a new multivalent, modified-live vaccine containing canine adenovirus type 2 (CAV-2), canine parvovirus (CPV), and canine distemper virus (CDV). Twenty-three seronegative pups were vaccinated at 7 and 11 weeks of age. Eighteen seronegative pups, randomized into groups of six dogs, served as challenge controls. Dogs were kept in strict isolation for 3 years following the vaccination and then challenged sequentially with virulent canine adenovirus type 1 (CAV-1), CPV, and CDV. For each viral challenge, a separate group of six control dogs was also challenged. Clinical signs of CAV-1, CPV, and CDV infections were prevented in 100% of vaccinated dogs, demonstrating that the multivalent, modified-live test vaccine provided protection against virulent CAV-1, CPV, and CDV challenge in dogs 7 weeks of age or older for a minimum of 3 years following second vaccination.
Directory of Open Access Journals (Sweden)
Biswajit R. Dash
2018-04-01
Full Text Available Aim: The study aimed to detect the prevalence of Leptospira spp. in kidney tissues collected during necropsy and to establish its association with renal lesions in dogs of Mumbai region. Materials and Methods: Kidney tissues from 40 dogs were collected during necropsy after gross examination and then fixed in neutral buffered formalin and Bouin's fluid for histopathology and histochemistry, respectively. Kidney tissues were also collected for the detection of Leptospira spp. by polymerase chain reaction (PCR in a sterile container and stored at -80°C until further processing. Results: Of 40 cases studied, 13 (32.5% cases showed lesions of nephritis of varying histotype and severity. Glomerulonephritis was reported as the most common type of nephritis in 9 (69.23% cases, and interstitial nephritis was recorded in 4 (30.76% cases. Chronic and acute interstitial nephritis was observed in two cases each. Renal failure as a cause of death was found in 7 (17.5% dogs. Of a total of 40 cases, 9 were found positive for pathogenic Leptospira spp. genome by PCR. However, of nine PCR-positive cases, only four cases showed lesions in kidneys as glomerulonephritis and interstitial nephritis in two cases each. The rest five cases positive for Leptospira spp. by PCR did not show any appreciable lesions in the kidneys. Conclusion: Leptospiral DNA was detected in 9 (22.5% cases by PCR. Of these nine cases, only four cases showed renal lesions. Other five cases which were positive for Leptospira spp. by PCR did not show any appreciable gross and microscopic lesions in the kidneys which might be carriers for Leptospira spp. Considering variable reports on types of nephritis in Leptospira spp. infection and also the prevalence of non-pathogenic Leptospira spp., it is important to conduct an extensive study on the prevalence of Leptospira spp. and its association with renal lesions involving batteries of tests.
Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Orito, Kensuke; Lynch, Jonathan; Tsuchiya, Ryo; Sahara, Hiroeki
2012-08-01
Domesticated adult dogs with antibody titer classified as below 'high' to one or more of canine distemper virus (CDV), canine parvovirus type-2 (CPV-2) and canine adenovirus type-1 (CAdV-1) were then given an additional inoculation, and the effectiveness of this booster evaluated 2 months later. Consequently, CDV and CAdV-1 antibody titer experienced a significant increase, but the same effect was not observed in the antibody titer of CPV-2. These findings suggest that with additional inoculation, a booster effect may be expected in increasing antibody titers for CDV and CAdV-1, but it is unlikely to give an increase in CPV-2 antibody titer. © 2012 The Societies and Blackwell Publishing Asia Pty Ltd.
Bilateral supernumerary primary maxillary canines
Directory of Open Access Journals (Sweden)
Santanu Mukhopadhyay
2018-01-01
Full Text Available Supernumerary teeth are more common in the permanent than in primary dentition. In the primary dentition, the anomaly is most frequently observed in the maxillary lateral incisor region, followed by the maxillary midline where they are termed as mesiodens. Supernumerary teeth in the primary canine region are rare. This paper describes a rare case of nonsyndromic supernumerary primary maxillary canine distributed bilaterally in a 4-year-old boy. Both the supernumeraries resembled size and shape of normal primary canine. The right supplemental canine is high labially placed, whereas the left one is seen normally aligned in the dental arch distal to lateral incisor. One of the most significant sequelae of primary supernumerary teeth is their duplication in the permanent series. Radiographic examination of supernumerary primary canine did not indicate any such anomaly in the permanent dentition. The patient was kept under observation.
9 CFR 113.306 - Canine Distemper Vaccine.
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine. 113.306... Virus Vaccines § 113.306 Canine Distemper Vaccine. Canine Distemper Vaccine shall be prepared from virus... distemper virus, each of five canine distemper susceptible ferrets shall be injected with a sample of the...
J. Van Heerden; J. Bingham; M. Van Vuuren; R.E.J. Burroughs; E. Stylianides
2002-01-01
Wild dogs Lycaon pictus (n = 8) were vaccinated 4 times against canine distemper (n = 8) (initially with inactivated and subsequently with live attenuated strains of canine distemper) and canine parvovirus infection (n = 8) over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use ...
Characterization of the canine urinary proteome.
Brandt, Laura E; Ehrhart, E J; Scherman, Hataichanok; Olver, Christine S; Bohn, Andrea A; Prenni, Jessica E
2014-06-01
Urine is an attractive biofluid for biomarker discovery as it is easy and minimally invasive to obtain. While numerous studies have focused on the characterization of human urine, much less research has focused on canine urine. The objectives of this study were to characterize the universal canine urinary proteome (both soluble and exosomal), to determine the overlap between the canine proteome and a representative human urinary proteome study, to generate a resource for future canine studies, and to determine the suitability of the dog as a large animal model for human diseases. The soluble and exosomal fractions of normal canine urine were characterized using liquid chromatography tandem mass spectrometry (LC-MS/MS). Biological Networks Gene Ontology (BiNGO) software was utilized to assign the canine urinary proteome to respective Gene Ontology categories, such as Cellular Component, Molecular Function, and Biological Process. Over 500 proteins were confidently identified in normal canine urine. Gene Ontology analysis revealed that exosomal proteins were largely derived from an intracellular location, while soluble proteins included both extracellular and membrane proteins. Exosome proteins were assigned to metabolic processes and localization, while soluble proteins were primarily annotated to specific localization processes. Several proteins identified in normal canine urine have previously been identified in human urine where these proteins are related to various extrarenal and renal diseases. The results of this study illustrate the potential of the dog as an animal model for human disease states and provide the framework for future studies of canine renal diseases. © 2014 American Society for Veterinary Clinical Pathology and European Society for Veterinary Clinical Pathology.
Meyer, F R L; Steinborn, R; Grausgruber, H; Wolfesberger, B; Walter, I
2015-10-01
The discovery of expression of the erythropoietin receptor (EPO-R) on neoplastic cells has led to concerns about the safety of treating anaemic cancer patients with EPO. In addition to its endocrine function, the receptor may play a role in tumour progression through an autocrine mechanism. In this study, the expression of EPO, EPO-R and platelet-derived growth factor BB (PDGF-BB) was analysed in five feline and 13 canine osteosarcomas using immunohistochemistry (IHC) and reverse transcription polymerase chain reaction (RT-PCR). EPO expression was positive in all tumours by IHC, but EPO mRNA was only detected in 38% of the canine and 40% of the feline samples. EPO-R was expressed in all samples by quantitative RT-PCR (RT-qPCR) and IHC. EPO-R mRNA was expressed at higher levels in all feline tumours, tumour cell lines, and kidney when compared to canine tissues. PDGF-BB expression was variable by IHC, but mRNA was detected in all samples. To assess the functionality of the EPO-R on tumour cells, the proliferation of canine and feline osteosarcoma cell lines was evaluated after EPO administration using an alamarBlue assay and Ki67 immunostaining. All primary cell lines responded to EPO treatment in at least one of the performed assays, but the effect on proliferation was very low indicating only a weak responsiveness of EPO-R. In conclusion, since EPO and its receptor are expressed by canine and feline osteosarcomas, an autocrine or paracrine tumour progression mechanism cannot be excluded, although in vitro data suggest a minimal role of EPO-R in osteosarcoma cell proliferation. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.
Mitchell, S A; Zwijnenberg, R J; Huang, J; Hodge, A; Day, M J
2012-12-01
To determine whether client-owned dogs in Australia, last vaccinated with Canvac(®) vaccines containing canine parvovirus-type 2 (CPV-2), canine distemper virus (CDV), canine adenovirus type 2 (CAV-2) ± canine parainfluenza virus (CPiV) at least 18 months ago, were seropositive or responded serologically to revaccination. A total of 235 dogs were recruited from 23 veterinary clinics, representing a variety of breeds, ages and time since last vaccination (TSLV: range 1.5-9 years, mean 2.8 years). Dogs had a blood sample taken and were revaccinated on day 0. A second blood sample was taken 7-14 days later. Blood samples were assessed for antibody titres to CPV-2 (by haemagglutination inhibition) and CDV, CAV type 1 (CAV-1) and CPiV (by virus neutralisation). Dogs with a day 0 titre >10 or a four-fold increase in titre following revaccination were considered to be serological responders. The overall percentage of dogs classified as serological responders was 98.7% for CPV-2, 96.6% for CDV, 99.6% for CAV-1 and 90.3% for CPiV. These results suggest that the duration of serological response induced by modified-live vaccines against CPV-2, CDV, CAV-1 and CPiV, including Canvac(®) vaccines, is beyond 18 months and may extend up to 9 years. Accordingly, these vaccines may be considered for use in extended revaccination interval protocols as recommended by current canine vaccine guidelines. © 2012 The Authors. Australian Veterinary Journal © 2012 Australian Veterinary Association.
Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Orito, Kensuke; Lynch, Jonathan; Sahara, Hiroeki
2011-09-01
Serum antibody titers for canine parvovirus type-2 (CPV-2), canine distemper virus (CDV) and canine adenovirus type-1 (CAV-1) were investigated in 1031 healthy adult household dogs (2 to 18 years old) given an annual inoculation in the previous 11 to 13 months. The number of dogs retaining significant titers of antibodies against CPV-2, CDV, and CAV-1 were 888 (86%), 744 (72%), and 732 (71%), respectively. There were no differences between males and females in antibody titers against the 3 viruses. Antibody titer for CPV-2 was significantly higher in younger dogs than in older dogs, CDV antibody was significantly higher in older dogs than in younger dogs, and CAV titer was not associated with age.
Isotropic actomyosin dynamics promote organization of the apical cell cortex in epithelial cells.
Klingner, Christoph; Cherian, Anoop V; Fels, Johannes; Diesinger, Philipp M; Aufschnaiter, Roland; Maghelli, Nicola; Keil, Thomas; Beck, Gisela; Tolić-Nørrelykke, Iva M; Bathe, Mark; Wedlich-Soldner, Roland
2014-10-13
Although cortical actin plays an important role in cellular mechanics and morphogenesis, there is surprisingly little information on cortex organization at the apical surface of cells. In this paper, we characterize organization and dynamics of microvilli (MV) and a previously unappreciated actomyosin network at the apical surface of Madin-Darby canine kidney cells. In contrast to short and static MV in confluent cells, the apical surfaces of nonconfluent epithelial cells (ECs) form highly dynamic protrusions, which are often oriented along the plane of the membrane. These dynamic MV exhibit complex and spatially correlated reorganization, which is dependent on myosin II activity. Surprisingly, myosin II is organized into an extensive network of filaments spanning the entire apical membrane in nonconfluent ECs. Dynamic MV, myosin filaments, and their associated actin filaments form an interconnected, prestressed network. Interestingly, this network regulates lateral mobility of apical membrane probes such as integrins or epidermal growth factor receptors, suggesting that coordinated actomyosin dynamics contributes to apical cell membrane organization. © 2014 Klingner et al.
Manni, Marco M; Sot, Jesús; Goñi, Félix M
2015-03-01
Epsilon-toxin (ETX) is a powerful toxin produced by some strains of Clostridium perfringens (classified as types B and D) that is responsible for enterotoxemia in animals. ETX forms pores through the plasma membrane of eukaryotic cells, consisting of a β-barrel of 14 amphipathic β-strands. ETX shows a high specificity for certain cell lines, of which Madin-Darby canine kidney (MDCK) is the first sensitive cell line identified and the most studied one. The aim of this study was to establish the role of lipids in the toxicity caused by ETX and the correlation of its activity in model and biological membranes. In MDCK cells, using cell counting and confocal microscopy, we have observed that the toxin causes cell death mediated by toxin binding to plasma membrane. Moreover, ETX binds and permeabilizes the membranes of giant plasma membrane vesicles (GPMV). However, little effect is observed on protein-free vesicles. The data suggest the essential role of a protein receptor for the toxin in cell membranes. Copyright © 2014 Elsevier B.V. All rights reserved.
Glycolysis is governed by growth regime and simple enzyme regulation in adherent MDCK cells.
Rehberg, Markus; Ritter, Joachim B; Reichl, Udo
2014-10-01
Due to its vital importance in the supply of cellular pathways with energy and precursors, glycolysis has been studied for several decades regarding its capacity and regulation. For a systems-level understanding of the Madin-Darby canine kidney (MDCK) cell metabolism, we couple a segregated cell growth model published earlier with a structured model of glycolysis, which is based on relatively simple kinetics for enzymatic reactions of glycolysis, to explain the pathway dynamics under various cultivation conditions. The structured model takes into account in vitro enzyme activities, and links glycolysis with pentose phosphate pathway and glycogenesis. Using a single parameterization, metabolite pool dynamics during cell cultivation, glucose limitation and glucose pulse experiments can be consistently reproduced by considering the cultivation history of the cells. Growth phase-dependent glucose uptake together with cell-specific volume changes generate high intracellular metabolite pools and flux rates to satisfy the cellular demand during growth. Under glucose limitation, the coordinated control of glycolytic enzymes re-adjusts the glycolytic flux to prevent the depletion of glycolytic intermediates. Finally, the model's predictive power supports the design of more efficient bioprocesses.
The effect of isochoric freezing on mammalian cells in an extracellular phosphate buffered solution.
Preciado, J; Rubinsky, B
2018-04-20
Isochoric (constant volume) freezing has been recently suggested as a new method for cell and organ preservation. As a first step in studying the effect of isochoric freezing on mammalian cells, Madin-Darby canine kidney epithelial cells (MDCK), were frozen in an isochoric system, in a simple extracellular phosphate buffered solution to -10 °C (96.5 MPa), - 15 °C (162 MPa) and -20 °C (205 MPa) for 60 and 120 min. Cell membrane integrity and cell metabolism were studied with a Live/Dead cell vitality assay and flow cytometry. We found that cell survival decreases with an increase in pressure (lower temperatures) and time of exposure. For example, 60% of cells survived 60 min at - 10 °C and only 18% survived 120 min at this temperature. Negligible survival was measured at - 20 °C. This study may serve as the baseline towards further research on techniques to optimize the effects of isochoric freezing on living biological matter. Copyright © 2018. Published by Elsevier Inc.
Synthetic generation of influenza vaccine viruses for rapid response to pandemics.
Dormitzer, Philip R; Suphaphiphat, Pirada; Gibson, Daniel G; Wentworth, David E; Stockwell, Timothy B; Algire, Mikkel A; Alperovich, Nina; Barro, Mario; Brown, David M; Craig, Stewart; Dattilo, Brian M; Denisova, Evgeniya A; De Souza, Ivna; Eickmann, Markus; Dugan, Vivien G; Ferrari, Annette; Gomila, Raul C; Han, Liqun; Judge, Casey; Mane, Sarthak; Matrosovich, Mikhail; Merryman, Chuck; Palladino, Giuseppe; Palmer, Gene A; Spencer, Terika; Strecker, Thomas; Trusheim, Heidi; Uhlendorff, Jennifer; Wen, Yingxia; Yee, Anthony C; Zaveri, Jayshree; Zhou, Bin; Becker, Stephan; Donabedian, Armen; Mason, Peter W; Glass, John I; Rappuoli, Rino; Venter, J Craig
2013-05-15
During the 2009 H1N1 influenza pandemic, vaccines for the virus became available in large quantities only after human infections peaked. To accelerate vaccine availability for future pandemics, we developed a synthetic approach that very rapidly generated vaccine viruses from sequence data. Beginning with hemagglutinin (HA) and neuraminidase (NA) gene sequences, we combined an enzymatic, cell-free gene assembly technique with enzymatic error correction to allow rapid, accurate gene synthesis. We then used these synthetic HA and NA genes to transfect Madin-Darby canine kidney (MDCK) cells that were qualified for vaccine manufacture with viral RNA expression constructs encoding HA and NA and plasmid DNAs encoding viral backbone genes. Viruses for use in vaccines were rescued from these MDCK cells. We performed this rescue with improved vaccine virus backbones, increasing the yield of the essential vaccine antigen, HA. Generation of synthetic vaccine seeds, together with more efficient vaccine release assays, would accelerate responses to influenza pandemics through a system of instantaneous electronic data exchange followed by real-time, geographically dispersed vaccine production.
Alves, Daiane S; Farr, Glen A; Seo-Mayer, Patricia; Caplan, Michael J
2010-12-01
The Na(+),K(+)-ATPase is the major active transport protein found in the plasma membranes of most epithelial cell types. The regulation of Na(+),K(+)-ATPase activity involves a variety of mechanisms, including regulated endocytosis and recycling. Our efforts to identify novel Na(+),K(+)-ATPase binding partners revealed a direct association between the Na(+),K(+)-ATPase and AS160, a Rab-GTPase-activating protein. In COS cells, coexpression of AS160 and Na(+),K(+)-ATPase led to the intracellular retention of the sodium pump. We find that AS160 interacts with the large cytoplasmic NP domain of the α-subunit of the Na(+),K(+)-ATPase. Inhibition of the activity of the adenosine monophosphate-stimulated protein kinase (AMPK) in Madin-Darby canine kidney cells through treatment with Compound C induces Na(+),K(+)-ATPase endocytosis. This effect of Compound C is prevented through the short hairpin RNA-mediated knockdown of AS160, demonstrating that AMPK and AS160 participate in a common pathway to modulate the cell surface expression of the Na(+),K(+)-ATPase.
Receptor for advanced glycation end-products is a marker of type I lung alveolar cells.
Shirasawa, Madoka; Fujiwara, Naoyuki; Hirabayashi, Susumu; Ohno, Hideki; Iida, Junko; Makita, Koshi; Hata, Yutaka
2004-02-01
Lung alveolar epithelial cells are comprised of type I (ATI) and type II (ATII) cells. ATI cells are polarized, although they have very flat morphology. The identification of marker proteins for apical and basolateral membranes of ATI cells is important to investigate into the differentiation of ATI cells. In this paper, we characterized receptor for advanced glycation end-products (RAGE) as a marker for ATI cells. RAGE was localized on basolateral membranes of ATI cells in the immunoelectron microscopy and its expression was enhanced in a parallel manner to the differentiation of ATI cells in vivo and in primary cultures of ATII cells. RAGE and T1 alpha, a well-known ATI marker protein, were targeted to basolateral and apical membranes, respectively, when expressed in polarized Madine Darby canine kidney cells. Moreover, RAGE was expressed in ATI cells after T1 alpha in vivo and in ex in vivo organ cultures. In conclusion, RAGE is a marker for basolateral membranes of well-differentiated ATI cells. ATI cells require some signal provided by the in vivo environment to express RAGE.
AMP-activated protein kinase induces actin cytoskeleton reorganization in epithelial cells
International Nuclear Information System (INIS)
Miranda, Lisa; Carpentier, Sarah; Platek, Anna; Hussain, Nusrat; Gueuning, Marie-Agnes; Vertommen, Didier; Ozkan, Yurda; Sid, Brice; Hue, Louis; Courtoy, Pierre J.; Rider, Mark H.; Horman, Sandrine
2010-01-01
AMP-activated protein kinase (AMPK), a known regulator of cellular and systemic energy balance, is now recognized to control cell division, cell polarity and cell migration, all of which depend on the actin cytoskeleton. Here we report the effects of A769662, a pharmacological activator of AMPK, on cytoskeletal organization and signalling in epithelial Madin-Darby canine kidney (MDCK) cells. We show that AMPK activation induced shortening or radiation of stress fibers, uncoupling from paxillin and predominance of cortical F-actin. In parallel, Rho-kinase downstream targets, namely myosin regulatory light chain and cofilin, were phosphorylated. These effects resembled the morphological changes in MDCK cells exposed to hyperosmotic shock, which led to Ca 2+ -dependent AMPK activation via calmodulin-dependent protein kinase kinase-β(CaMKKβ), a known upstream kinase of AMPK. Indeed, hypertonicity-induced AMPK activation was markedly reduced by the STO-609 CaMKKβ inhibitor, as was the increase in MLC and cofilin phosphorylation. We suggest that AMPK links osmotic stress to the reorganization of the actin cytoskeleton.
Imjeti, Naga Salaija; Lebreton, Stéphanie; Paladino, Simona; de la Fuente, Erwin; Gonzalez, Alfonso; Zurzolo, Chiara
2011-12-01
Sorting of glycosylphosphatidyl-inositol--anchored proteins (GPI-APs) in polarized epithelial cells is not fully understood. Oligomerization in the Golgi complex has emerged as the crucial event driving apical segregation of GPI-APs in two different kind of epithelial cells, Madin-Darby canine kidney (MDCK) and Fisher rat thyroid (FRT) cells, but whether the mechanism is conserved is unknown. In MDCK cells cholesterol promotes GPI-AP oligomerization, as well as apical sorting of GPI-APs. Here we show that FRT cells lack this cholesterol-driven oligomerization as apical sorting mechanism. In these cells both apical and basolateral GPI-APs display restricted diffusion in the Golgi likely due to a cholesterol-enriched membrane environment. It is striking that N-glycosylation is the critical event for oligomerization and apical sorting of GPI-APs in FRT cells but not in MDCK cells. Our data indicate that at least two mechanisms exist to determine oligomerization in the Golgi leading to apical sorting of GPI-APs. One depends on cholesterol, and the other depends on N-glycosylation and is insensitive to cholesterol addition or depletion.
The Hippo-YAP Pathway Regulates 3D Organ Formation and Homeostasis.
Ishihara, Erika; Nishina, Hiroshi
2018-04-17
The vertebrate body shape is formed by the specific sizes and shapes of its resident tissues and organs, whose alignments are essential for proper functioning. To maintain tissue and organ shape, and thereby function, it is necessary to remove senescent, transformed, and/or damaged cells, which impair function and can lead to tumorigenesis. However, the molecular mechanisms underlying three-dimensional (3D) organ formation and homeostasis are not fully clear. Yes-associated protein (YAP) is a transcriptional co-activator that is involved in organ size control and tumorigenesis. Recently, we reported that YAP is essential for proper 3D body shape through regulation of cell tension by using a unique medaka fish mutant, hirame ( hir ). In Madin–Darby canine kidney (MDCK) epithelial cells, active YAP-transformed cells are eliminated apically when surrounded by normal cells. Furthermore, in a mosaic mouse model, active YAP-expressing damaged hepatocytes undergo apoptosis and are eliminated from the liver. Thus, YAP functions in quantitative and quality control in organogenesis. In this review, we describe the various roles of YAP in vertebrates, including in the initiation of liver cancer.
MEMS-based dynamic cell-to-cell culture platforms using electrochemical surface modifications
International Nuclear Information System (INIS)
Chang, Jiyoung; Lin, Liwei; Yoon, Sang-Hee; Mofrad, Mohammad R K
2011-01-01
MEMS-based biological platforms with the capability of both spatial placements and time releases of living cells for cell-to-cell culture experiments have been designed and demonstrated utilizing electrochemical surface modification effects. The spatial placement is accomplished by electrochemical surface modification of substrate surfaces to be either adhesive or non-adhesive for living cells. The time control is achieved by the electrical activation of the selective indium tin oxide co-culture electrode to allow the migration of living cells onto the electrode to start the cell-to-cell culture studies. Prototype devices have a three-electrode design with an electrode size of 50 × 50 µm 2 and the separation gaps of 2 µm between them. An electrical voltage of −1.5 V has been used to activate the electrodes independently and sequentially to demonstrate the dynamic cell-to-cell culture experiments of NIH 3T3 fibroblast and Madin Darby canine kidney cells. As such, this MEMS platform could be a basic yet versatile tool to characterize transient cell-to-cell interactions
Renal capsule for augmentation cystoplasty in canine model: a favorable biomaterial?
Directory of Open Access Journals (Sweden)
Mehdi Salehipour
2016-04-01
Full Text Available ABSTRACT Purpose: To evaluate effectiveness of canine renal capsule for augmentation cystoplasty. Materials and Methods: Ten adult dogs participated in this study. After induction of anesthesia each animal underwent bed side urodynamic study, bladder capacity and bladder pressure was recorded. Then via mid line incision abdominal cavity was entered, right kidney was identified and its capsule was dissected. Bladder augmentation was done by anastomosing the renal capsule to the bladder. After 6 months bed side urodynamic study was performed again and changes in bladder volume and pressure were recorded. Then the animals were sacrificed and the augmented bladders were sent for histopathology evaluation. Results: Mean maximum anatomic bladder capacity before cystoplasty was 334.00±11.40cc which increased to 488.00±14.83cc post-operatively (p=0.039. Mean anatomic bladder pressure before cystoplasty was 19.00±1.58cmH2O which decreased to 12.60±1.14cmH2O post-operatively (p=0.039. Histopathology evaluation revealed epithelialization of the renal capsule with urothelium without evidence of fibrosis, collagen deposits or contracture. Conclusions: Our data shows that renal capsule is a favorable biomaterial for bladder augmentation in a canine model.
Directory of Open Access Journals (Sweden)
Maria T.S. Frade
2015-02-01
Full Text Available Infections by free-living amoebae can cause systemic disease in animals and humans. We describe the epidemiological, clinical and pathological aspects of disseminated acanthamoebiasis associated with canine distemper in three dogs of the semiarid region of Paraíba, Northeastern Brazil. Affected dogs developed progressive neurological and respiratory signs that progressed to death within in two to 20 days. Gross lesions were irregular and with yellow-reddish nodules randomly distributed in the lungs, heart, kidneys, spleen, lymph nodes, adrenals, and intestine. One dog had foci of malacia in the parietal cortex and another one in nucleus of brain basis. Histologically, pyogranulomas with areas of necrosis and hemorrhage in all organs affected were observed, associated with myriads of intralesional amoebic trophozoites. All three cases were concomitant canine distemper, that possibly triggered immunosuppression in the dogs. The diagnosis was performed through microscopic findings of infection by free-living amoebae and confirmed Acanthamoeba sp. by immunohistochemistry
New and emerging pathogens in canine infectious respiratory disease.
Priestnall, S L; Mitchell, J A; Walker, C A; Erles, K; Brownlie, J
2014-03-01
Canine infectious respiratory disease is a common, worldwide disease syndrome of multifactorial etiology. This review presents a summary of 6 viruses (canine respiratory coronavirus, canine pneumovirus, canine influenza virus, pantropic canine coronavirus, canine bocavirus, and canine hepacivirus) and 2 bacteria (Streptococcus zooepidemicus and Mycoplasma cynos) that have been associated with respiratory disease in dogs. For some pathogens a causal role is clear, whereas for others, ongoing research aims to uncover their pathogenesis and contribution to this complex syndrome. Etiology, clinical disease, pathogenesis, and epidemiology are described for each pathogen, with an emphasis on recent discoveries or novel findings.
Genetics of Human and Canine Dilated Cardiomyopathy.
Simpson, Siobhan; Edwards, Jennifer; Ferguson-Mignan, Thomas F N; Cobb, Malcolm; Mongan, Nigel P; Rutland, Catrin S
2015-01-01
Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM) accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In this review the aetiology, epidemiology, and clinical characteristics of canine DCM are examined, along with highlighting possible different subtypes of canine DCM and their potential relevance to human DCM. Finally the current position of genetic research into canine and human DCM, including the genetic loci, is identified and the reasons many studies may have failed to find a genetic association with canine DCM are reviewed.
9 CFR 113.202 - Canine Hepatitis and Canine Adenovirus Type 2 Vaccine, Killed Virus.
2010-01-01
... Type 2 Vaccine, Killed Virus. 113.202 Section 113.202 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Killed Virus Vaccines § 113.202 Canine Hepatitis and Canine...
Papīra darbi ka domāšanas veicinātāji pirmsskolā
Jevdokimova, Jūlija
2017-01-01
Jūlija J. (2017.) “Papīra darbi kā domāšanas veicinātāji pirmsskolā”. Kvalifikācijas darbs. Rīga: Latvijas Universitātes Pedagoģijas, psiholoģijas un mākslas fakultāte, 90 lpp, 16 att., 4 tab., bibl. 18 nos., latviešu, angļu val. Darbs sastāv no ievada, 5 nodaļām, secinājumiem un 16 pielikumiem. Autors ir vairākus mēnešus izgājis praksi pirmsskolas pedagoga amatā. Darbā ir veikts pētījums par domāšanas attīstību rokdarbu nodarbībās, veicot papīra darbus Darba mērķis ir izzināt un atklāt bēr...
Directory of Open Access Journals (Sweden)
J. Van Heerden
2002-07-01
Full Text Available Wild dogs Lycaon pictus (n = 8 were vaccinated 4 times against canine distemper (n = 8 (initially with inactivated and subsequently with live attenuated strains of canine distemper and canine parvovirus infection (n = 8 over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use in domestic dogs, were used. None of the vaccinated dogs showed any untoward clinical signs. The inactivated canine distemper vaccine did not result in seroconversion whereas the attenuated live vaccine resulted in seroconversion in all wild dogs. Presumably protective concentrations of antibodies to canine distemper virus were present in all wild dogs for at least 451 days. Canine parvovirus haemagglutination inhibition titres were present in all wild dogs prior to the administration of vaccine and protective concentrations persisted for at least 451 days. Vaccination against parvovirus infection resulted in a temporary increase in canine parvovirus haemagglutination inhibition titres in most dogs. Administration of both inactivated parenteral and live oral rabies vaccine initially resulted in seroconversion in 7 of 8 dogs. These titres, however, dropped to very low concentrations within 100 days. Booster administrations resulted in increased antibody concentrations in all dogs. It was concluded that the vaccines were safe to use in healthy subadult wild dogs and that a vaccination protocol in free-ranging wild dogs should at least incorporate booster vaccinations against rabies 3-6 months after the first inoculation.
van Heerden, J; Bingham, J; van Vuuren, M; Burroughs, R E J; Stylianides, E
2002-03-01
Wild dogs Lycaon pictuis (n = 8) were vaccinated 4 times against canine distemper (n = 8) (initially with inactivated and subsequently with live attenuated strains of canine distemper) and canine parvovirus infection (n = 8) over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use in domestic dogs, were used. None of the vaccinated dogs showed any untoward clinical signs. The inactivated canine distemper vaccine did not result in seroconversion whereas the attenuated live vaccine resulted in seroconversion in all wild dogs. Presumably protective concentrations of antibodies to canine distemper virus were present in all wild dogs for at least 451 days. Canine parvovirus haemagglutination inhibition titres were present in all wild dogs prior to the administration of vaccine and protective concentrations persisted for at least 451 days. Vaccination against parvovirus infection resulted in a temporary increase in canine parvovirus haemagglutination inhibition titres in most dogs. Administration of both inactivated parenteral and live oral rabies vaccine initially resulted in seroconversion in 7 of 8 dogs. These titres, however, dropped to very low concentrations within 100 days. Booster administrations resulted in increased antibody concentrations in all dogs. It was concluded that the vaccines were safe to use in healthy subadult wild dogs and that a vaccination protocol in free-ranging wild dogs should at least incorporate booster vaccinations against rabies 3-6 months after the first inoculation.
9 CFR 113.317 - Parvovirus Vaccine (Canine).
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Parvovirus Vaccine (Canine). 113.317... Virus Vaccines § 113.317 Parvovirus Vaccine (Canine). Parvovirus Vaccine recommended for use in dogs... from each dog shall be individually tested for neutralizing antibody against canine parvovirus to...
Liu, P C; Chen, C A; Chen, C M; Yen, C H; Lee, M H; Chuang, C K; Tu, C F; Su, B L
2016-11-01
The clinical feasibility of passive immunotherapy has not been demonstrated in dogs naturally infected with canine distemper. In this study, porcine anti-canine distemper virus IgG and F(ab') 2 antibody fragments were used to treat infected puppies. A total of 41 naturally infected puppies (age Äsix months) exhibiting severe respiratory signs, but lacking neurological signs, were enrolled in the study. Twenty-five puppies were treated with a combination of IgG or F(ab') 2 antibody fragments (Group 1) and supportive therapy and 16 puppies received routine supportive care only (Group 2). The survival rate of dogs in Group 1 (19/25; 76%) was significantly higher than that in Group 2 (5/16; 31·3%) (Pdistemper virus antibodies improved survival in puppies affected with canine distemper with minimal adverse effects. Therefore, this therapy could be considered for treatment of endangered animal species infected with canine distemper virus. © 2016 British Small Animal Veterinary Association.
Genetics of Human and Canine Dilated Cardiomyopathy
Directory of Open Access Journals (Sweden)
Siobhan Simpson
2015-01-01
Full Text Available Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In this review the aetiology, epidemiology, and clinical characteristics of canine DCM are examined, along with highlighting possible different subtypes of canine DCM and their potential relevance to human DCM. Finally the current position of genetic research into canine and human DCM, including the genetic loci, is identified and the reasons many studies may have failed to find a genetic association with canine DCM are reviewed.
Borah, Ballav M; Halter, Timothy J; Xie, Baoquan; Henneman, Zachary J; Siudzinski, Thomas R; Harris, Stephen; Elliott, Matthew; Nancollas, George H
2014-07-01
This work identifies carbonated hydroxyapatite (CAP) as the primary component of canine dental calculus, and corrects the long held belief that canine dental calculus is primarily CaCO3 (calcite). CAP is known to be the principal crystalline component of human dental calculus, suggesting that there are previously unknown similarities in the calcification that occurs in these two unique oral environments. In vitro kinetic experiments mimicking the inorganic components of canine saliva have examined the mechanisms of dental calculus formation. The solutions were prepared so as to mimic the inorganic components of canine saliva; phosphate, carbonate, and magnesium ion concentrations were varied individually to investigate the roll of these ions in controlling the nature of the phases that is nucleated. To date, the inorganic components of the canine oral systems have not been investigated at concentrations that mimic those in vivo. The mineral composition of the synthetic calculi grown under these conditions closely resembled samples excised from canines. This finding adds new information about calculus formation in humans and canines, and their sensitivity to chemicals used to treat these conditions. Copyright © 2014 Elsevier Inc. All rights reserved.
Role of canine circovirus in dogs with acute haemorrhagic diarrhoea.
Anderson, A; Hartmann, K; Leutenegger, C M; Proksch, A L; Mueller, R S; Unterer, S
2017-06-03
Canine circovirus (CanineCV) has been detected in some dogs with severe haemorrhagic diarrhoea, but its pathogenic role is unclear. This study evaluated a suspected association between the presence of CanineCV and acute haemorrhagic diarrhoea syndrome (AHDS) in dogs. The prevalence of CanineCV in dogs with AHDS was compared with that in healthy dogs and those infected with canine parvovirus (CPV). Additionally, time to recovery and mortality rate were compared between CanineCV-positive and CanineCV-negative dogs. Faecal samples of dogs with AHDS (n=55), healthy dogs (n=66) and dogs infected with CPV (n=54) were examined by two real-time TaqMan PCR assays targeting the replicase and capsid genes of CanineCV. CanineCV was detected in faecal samples of two dogs with AHDS, three healthy controls and seven dogs infected with CPV. Among the three groups, there was no significant difference in prevalence of CanineCV. CPV-infected animals that were coinfected with CanineCV had a significantly higher mortality rate compared with those negative for CanineCV. CanineCV does not appear to be the primary causative agent of AHDS in dogs, but might play a role as a negative co-factor in disease outcome in dogs with CPV infection. British Veterinary Association.
Reliability of mandibular canines as indicators for sexual dichotomy.
Hosmani, Jagadish V; Nayak, Ramakant S; Kotrashetti, Vijayalakshmi S; S, Pradeep; Babji, Deepa
2013-02-01
Amongst the various calcified structures in the human body, teeth have gained lot of popularity in estimating the sex of an individual as they are highly resistant to destruction and decomposition. Using permanent mandibular canines many researchers have predicted a high level of accuracy in identifying the sex correctly. The purpose of our study was to gauge the effectiveness of mandibular canines in discerning sex. Fifty dental casts each of males and females were utilized for the study. Mesio-distal dimension and inter-canine distance of mandibular right and left canine was recorded using digital vernier caliper and mandibular canine index was calculated. The mean value of mesio-distal dimensions of right and left mandibular canine was slightly greater in males compared to females. The mandibular canine index was equal in both sexes. Inter-canine distance was marginally higher in males compared to females. Despite of higher values in males none of the parameters were statistically significant. The results herein bolster contemporary studies that mesio-distal dimensions of mandibular canines and mandibular canine index do not reflect sexual dimorphism and that its application should be discontinued in sex prediction among Indian populations. How to cite this article: Hosmani J V, Nayak R S, Kotrashetti V S, Pradeep S, Babji D. Reliability of Mandibular Canines as Indicators for Sexual Dichotomy. J Int Oral Health 2013; 5(1):1-7.
Approaches to canine health surveillance.
O'Neill, Dan G; Church, David B; McGreevy, Paul D; Thomson, Peter C; Brodbelt, Dave C
2014-01-01
Effective canine health surveillance systems can be used to monitor disease in the general population, prioritise disorders for strategic control and focus clinical research, and to evaluate the success of these measures. The key attributes for optimal data collection systems that support canine disease surveillance are representativeness of the general population, validity of disorder data and sustainability. Limitations in these areas present as selection bias, misclassification bias and discontinuation of the system respectively. Canine health data sources are reviewed to identify their strengths and weaknesses for supporting effective canine health surveillance. Insurance data benefit from large and well-defined denominator populations but are limited by selection bias relating to the clinical events claimed and animals covered. Veterinary referral clinical data offer good reliability for diagnoses but are limited by referral bias for the disorders and animals included. Primary-care practice data have the advantage of excellent representation of the general dog population and recording at the point of care by veterinary professionals but may encounter misclassification problems and technical difficulties related to management and analysis of large datasets. Questionnaire surveys offer speed and low cost but may suffer from low response rates, poor data validation, recall bias and ill-defined denominator population information. Canine health scheme data benefit from well-characterised disorder and animal data but reflect selection bias during the voluntary submissions process. Formal UK passive surveillance systems are limited by chronic under-reporting and selection bias. It is concluded that active collection systems using secondary health data provide the optimal resource for canine health surveillance.
Al-Ainawi, Khaled I; Al-Mdalal, Yaser; Hajeer, Mohammad Y
2016-01-01
New studies have been published and aimed to retract canines by means of distraction osteogenesis to reduce treatment time. Although a great care has been given to achieve a bodily movement of the canines, a significant amount of tipping of the canines has been observed. This trial aimed to assess the effect of applying a modified distractor on canine angulation. The sample of the study consisted of 14 canines in seven patients (16-25 years). After the osteotomy procedure, two distractors were applied (one distractor on each side). After 5 days of a latency period, the two distractors were activated at a rate of 1 mm/day. There was a significant difference between the two distractors regarding the time required to retract the canines (p = 0.008) and the observed change in canine angulation following retraction (p = 0.028). The change in the overjet and the mandibular plane angle was statistically insignificant. Eight out of 14 distracted canines reacted positively to the pulp vitality tester after 3 months of completion of distraction. There was no clinical sign of discoloration or pulpal pain in any canine. Within the limits of this study, the modified distractor caused a bodily movement of the canine with a minimal tipping. Further research is required on a long-term basis on a larger group of patients to gain more insight on the observed changes.
Platelets Inhibit Migration of Canine Osteosarcoma Cells.
Bulla, S C; Badial, P R; Silva, R C; Lunsford, K; Bulla, C
2017-01-01
The interaction between platelets and tumour cells is important for tumour growth and metastasis. Thrombocytopenia or antiplatelet treatment negatively impact on cancer metastasis, demonstrating potentially important roles for platelets in tumour progression. To our knowledge, there is no information regarding the role of platelets in cancer progression in dogs. This study was designed to test whether canine platelets affected the migratory behaviour of three canine osteosarcoma cell lines and to give insights of molecular mechanisms. Intact platelets, platelet lysate and platelet releasate inhibited the migration of canine osteosarcoma cell lines. Addition of blood leucocytes to the platelet samples did not alter the inhibitory effect on migration. Platelet treatment also significantly downregulated the transcriptional levels of SNAI2 and TWIST1 genes. The interaction between canine platelets or molecules released during platelet activation and these tumour cell lines inhibits their migration, which suggests that canine platelets might antagonize metastasis of canine osteosarcoma. This effect is probably due to, at least in part, downregulation of genes related to epithelial-mesenchymal transition. Copyright © 2016. Published by Elsevier Ltd.
9 CFR 113.201 - Canine Distemper Vaccine, Killed Virus.
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine, Killed Virus... REQUIREMENTS Killed Virus Vaccines § 113.201 Canine Distemper Vaccine, Killed Virus. Canine Distemper Vaccine... canine distemper susceptible dogs (20 vaccinates and 5 controls) shall be used as test animals. Blood...
Wang, Xijun; Feng, Na; Ge, Jinying; Shuai, Lei; Peng, Liyan; Gao, Yuwei; Yang, Songtao; Xia, Xianzhu; Bu, Zhigao
2012-07-20
Effective, safe, and affordable rabies vaccines are still being sought. Attenuated live vaccine has been widely used to protect carnivores from canine distemper. In this study, we generated a recombinant canine distemper virus (CDV) vaccine strain, rCDV-RVG, expressing the rabies virus glycoprotein (RVG) by using reverse genetics. The recombinant virus rCDV-RVG retained growth properties similar to those of vector CDV in Vero cell culture. Animal studies demonstrated that rCDV-RVG was safe in mice and dogs. Mice inoculated intracerebrally or intramuscularly with rCDV-RVG showed no apparent signs of disease and developed a strong rabies virus (RABV) neutralizing antibody response, which completely protected mice from challenge with a lethal dose of street virus. Canine studies showed that vaccination with rCDV-RVG induced strong and long-lasting virus neutralizing antibody responses to RABV and CDV. This is the first study demonstrating that recombinant CDV has the potential to serve as bivalent live vaccine against rabies and canine distemper in animals. Copyright © 2012 Elsevier Ltd. All rights reserved.
Military Working Dogs and Canine Ehrlichiosis (Tropical Canine Pancytopenia) in the Vietnam War
1981-06-05
anemia, dermatitis, edema of the limbs and scrotum, and petechial hemorrhages on the penis (116). Hematologic findings included a leucopenia with...idiopathic hemorrhagic disease, and canine hemorrhagic fever (116). Attempts to identity the cause of tropical canine pancytopenia continued in 1969...Following inoculation with infective blood, signs of acute disease appear within 7-10 days and consfst of fever , serous nasal and ocular discharges
Headley, Selwyn Arlington; Alfieri, Amauri Alcindo; Fritzen, Juliana Torres Tomazi; Garcia, João Luis; Weissenböck, Herbert; da Silva, Ana Paula; Bodnar, Livia; Okano, Werner; Alfieri, Alice Fernandes
2013-01-01
The concomitant infections of Canine distemper virus (CDV), Canine adenovirus A types 1 (CAdV-1) and 2 (CAdV-2), Canine parvovirus type 2 (CPV-2), and Toxoplasma gondii are described in a 43-day-old mixed-breed puppy. Clinically, there were convulsions and blindness with spontaneous death; 14 siblings of this puppy, born to a 10-month-old dam, which was seropositive (titer: 1,024) for T. gondii, also died. Necropsy revealed unilateral corneal edema (blue eye), depletion of intestinal lymphoid tissue, non-collapsible lungs, congestion of meningeal vessels, and a pale area in the myocardium. Histopathology demonstrated necrotizing myocarditis associated with intralesional apicomplexan protozoa; necrotizing and chronic hepatitis associated with rare intranuclear inclusion bodies within hepatocytes; necrotizing bronchitis and bronchiolitis; interstitial pneumonia associated with eosinophilic intracytoplasmic inclusion bodies within epithelial cells; atrophy and fusion of intestinal villi with cryptal necrosis; and white matter demyelination of the cerebrum and cerebellum associated with intranuclear inclusion bodies within astrocytes. Polymerase chain reaction (PCR) amplified the partial fragments (bp) of the CDV N gene (290 bp), CPV-2c VP2 capsid protein gene (583 bp), and CAdV-1 (508 bp) and CAdV-2 (1,030 bp) E gene from urine and tissue samples. The PCR assays demonstrated that the apicomplexan protozoa observed within several organs contained DNA specific for T. gondii; genotyping revealed T. gondii type III. The findings support the characterization of concomitant infections of CDV, CAdV-1, CAdV-2, CPV-2, and T. gondii in this puppy. Further, seroreactivity to T. gondii of the dam in association with the systemic disease observed in the puppy described herein is suggestive of congenital toxoplasmosis.
To further investigate the potential role of '-tocopherol in maintaining immuno-homeostasis in bovine cells (Madin-Darby bovine kidney epithelial cell line), we undertook in vitro experiments using recombinant TNF-a as an immuno-stimulant to simulate inflammation response in cells with and without '...
Directory of Open Access Journals (Sweden)
Mehdi Mohebali
2016-10-01
Full Text Available Background: Although many studies had been conducted on various aspects of canine visceral leishmaniasis (CVL in domestic dogs in the endemic areas of Iran, investigations on CVL in wild canines are rare.Methods: This is a cross-sectional study was conducted from December 2012 to 2013 in northeast of Iran where human VL is endemic. Wild canines were trapped around the areas where human VL cases had been previously identified. Wild canines were collected and examined both clinically and serologically using direct agglutination test (DAT. Microscopically examinations were performed in all the seropositive wild canines for the presence of the amastigote form of Leishmania spp. Some Leishmania sp. which had been isolated from the spleens of wild canines, were examined analyzed by conventional PCR and sequencing techniques using α-tubulin and GAPDH genes.Results: Altogether, 84 wild canines including foxes (Vulpes vulpes, n=21, Jackals (Canis aureus, n=60 and wolves (Canis lupus, n=3 were collected. Four foxes and seven jackals showed anti-Leishmania infantum antibodies with titers of 1:320–1:20480 in DAT. Furthermore, one fox and one jackal were parasitologically (microscopy and culture positive and L. infantum was confirmed by sequence analysis.Conclusion: The present study showed that sylvatic cycle of L. infantum had been established in the studied endemic areas of VL in northeastern Iran.
Clinical and Statistical Study on Canine Impaction
Directory of Open Access Journals (Sweden)
Adina-Simona Coșarcă
2013-08-01
Full Text Available Aim: The aim of this study was to perform a clinical and statistical research on permanent impacted canine patients among those with dental impaction referred to and treated at the Oral and Maxillo-Facial Surgery Clinic of Tîrgu Mureș, over a four years period (2009-2012. Materials and methods: The study included 858 patients having dental impaction, and upon clinical records, different parameters, like frequency, gender, age, quadrant involvement, patient residence, associated complications, referring specialist and type of treatment, related to canine impaction, were assessed. Results: The study revealed: about 10% frequency of canine impaction among dental impactions; more frequent in women, in the first quadrant (tooth 13; most cases diagnosed between the age of 10-19 years; patients under 20 were referred by an orthodontist, those over 20 by a dentist; surgical exposure was more often performed than odontectomy. Conclusions: Canine impaction is the second-most frequent dental impaction in dental arch after third molars; it occurs especially in women. Due to its important role, canine recovery within dental arch is a goal to be achieved, whenever possible. Therefore, diagnose and treatment of canine impaction requires an interdisciplinary approach (surgical and orthodontic
Podoplanin Expression in Canine Melanoma.
Ogasawara, Satoshi; Honma, Ryusuke; Kaneko, Mika K; Fujii, Yuki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari
2016-12-01
A type I transmembrane protein, podoplanin (PDPN), is expressed in several normal cells such as lymphatic endothelial cells or pulmonary type I alveolar cells. We recently demonstrated that anticanine PDPN monoclonal antibody (mAb), PMab-38, recognizes canine PDPN of squamous cell carcinomas, but does not react with lymphatic endothelial cells. Herein, we investigated whether PMab-38 reacts with canine melanoma. PMab-38 reacted with 90% of melanoma cells (9/10 cases) using immunohistochemistry. Of interest, PMab-38 stained the lymphatic endothelial cells and cancer-associated fibroblasts in melanoma tissues, although it did not stain any lymphatic endothelial cells in normal tissues. PMab-38 could be useful for uncovering the function of PDPN in canine melanomas.
Comazzi, S; Avery, P R; Garden, O A; Riondato, F; Rütgen, B; Vernau, W
2017-09-01
Flow cytometry (FC) is assuming increasing importance in diagnosis in veterinary oncology. The European Canine Lymphoma Network (ECLN) is an international cooperation of different institutions working on canine lymphoma diagnosis and therapy. The ECLN panel of experts on FC has defined the issue of reporting FC on canine lymphoma and leukemia as their first hot topic, since a standardized report that includes all the important information is still lacking in veterinary medicine. The flow cytometry panel of the ECLN started a consensus initiative using the Delphi approach. Clinicians were considered the main target of FC reports. A panel of experts in FC was interrogated about the important information needed from a report. Using the feedback from clinicians and subsequent discussion, a list of information to be included in the report was made, with four different levels of recommendation. The final report should include both a quantitative part and a qualitative or descriptive part with interpretation of the salient results. Other items discussed included the necessity of reporting data regarding the quality of samples, use of absolute numbers of positive cells, cutoff values, the intensity of fluorescence, and possible aberrant patterns of antigen expression useful from a clinical point of view. The consensus initiative is a first step toward standardization of diagnostic approach to canine hematopoietic neoplasms among different institutions and countries. This harmonization will improve communication and patient care and also facilitate the multicenter studies necessary to further our knowledge of canine hematopoietic neoplasms. © 2016 International Clinical Cytometry Society. © 2016 International Clinical Cytometry Society.
Vaccines for canine leishmaniasis
Directory of Open Access Journals (Sweden)
Clarisa B. Palatnik-De-Sousa
2012-04-01
Full Text Available Leishmaniasis is the third most important vector-borne disease worldwide. Visceral leishmaniasis (VL is a severe and frequently lethal protozoan disease of increasing incidence and severity due to infected human and dog migration, new geographical distribution of the insect due to global-warming, co-infection with immunosuppressive diseases and poverty. The disease is an anthroponosis in India and Central Africa and a canid zoonosis (ZVL in the Americas, the Middle East, Central Asia, China and the Mediterranean. The ZVL epidemic has been controlled by one or more measures including the culling of infected dogs, treatment of human cases and insecticidal treatment of homes and dogs. However, the use of vaccines is considered the most cost-effective control tool for human and canine disease. Since the severity of the disease is related to the generation of T-cell immunosuppression, effective vaccines should be capable of sustaining or enhancing the T-cell immunity. In this review we summarize the clinical and parasitological characteristics of ZVL with special focus on the cellular and humoral canine immune response and review state-of-the-art vaccine development against human and canine visceral leishmaniasis. Experimental vaccination against leishmaniasis has evolved from the practice of leishmanization with living parasites to vaccination with crude lysates, native parasite extracts to recombinant and DNA vaccination. Although more than 30 defined vaccines have been studied in laboratory models no human formulation has been licensed so far; however three second-generation canine vaccines have already been registered. As expected for a zoonotic disease, the recent preventive vaccination of dogs in Brazil has led to a reduction in the incidence of canine and human disease. The recent identification of several Leishmania proteins with T-cell epitopes anticipates development of a multiprotein vaccine that will be capable of protecting both humans
Noguchi, S; Mori, T; Hoshino, Y; Yamada, N; Maruo, K; Akao, Y
2013-06-01
Malignant melanoma (MM) is one of the most aggressive cancers in dogs and in humans. However, the molecular mechanisms of its development and progression remain unclear. Presently, we examined the expression profile of microRNAs (miRs) in canine oral MM tissues and paired normal oral mucosa tissues by using the microRNA-microarray assay and quantitative RT-PCR. Importantly, a decreased expression of miR-203 was significantly associated with a shorter survival time. Also, miR-203 and -205 were markedly down-regulated in canine and human MM cell lines tested. Furthermore, the ectopic expression of miR-205 had a significant inhibitory effect on the cell growth of canine and human melanoma cells tested by targeting erbb3. Our data suggest that miR-203 is a new prognostic factor in canine oral MMs and that miR-205 functions as a tumour suppressor by targeting erbb3 in both canine and human MM cells. © 2011 John Wiley & Sons Ltd.
Production and purification of non replicative canine adenovirus type 2 derived vectors.
Szelechowski, Marion; Bergeron, Corinne; Gonzalez-Dunia, Daniel; Klonjkowski, Bernard
2013-12-03
Adenovirus (Ad) derived vectors have been widely used for short or long-term gene transfer, both for gene therapy and vaccine applications. Because of the frequent pre-existing immunity against the classically used human adenovirus type 5, canine adenovirus type 2 (CAV2) has been proposed as an alternative vector for human gene transfer. The well-characterized biology of CAV2, together with its ease of genetic manipulation, offer major advantages, notably for gene transfer into the central nervous system, or for inducing a wide range of protective immune responses, from humoral to cellular immunity. Nowadays, CAV2 represents one of the most appealing nonhuman adenovirus for use as a vaccine vector. This protocol describes a simple method to construct, produce and titer recombinant CAV2 vectors. After cloning the expression cassette of the gene of interest into a shuttle plasmid, the recombinant genomic plasmid is obtained by homologous recombination in the E. coli BJ5183 bacterial strain. The resulting genomic plasmid is then transfected into canine kidney cells expressing the complementing CAV2-E1 genes (DK-E1). A viral amplification enables the production of a large viral stock, which is purified by ultracentrifugation through cesium chloride gradients and desalted by dialysis. The resulting viral suspension routinely has a titer of over 10(10) infectious particles per ml and can be directly administrated in vivo.
Tumor-promoting phorbol esters effect alkalinization of canine renal proximal tubular cells
International Nuclear Information System (INIS)
Mellas, J.; Hammerman, M.R.
1986-01-01
We have demonstrated the presence of specific receptors for tumor-promoting phorbol esters in the plasma membrane of the canine renal proximal tubular cell. These compounds affect proximal tubular metabolism in vitro. For example, we have shown that they inhibit gluconeogenesis in canine renal proximal tubular segments. Tumor-promoting phorbol esters have been shown to effect alkalinization of non-renal cells, by enhancing Na + -H + exchange across the plasma membrane. To determine whether the actions of tumor-promoting phorbol esters in proximal tubular segments might be mediated by a similar process, we incubated suspensions of segments from dog kidney with these compounds and measured changes in intracellular pH using [ 14 C]-5,5-dimethoxazoladine-2-4-dione (DMO) and flow dialysis. Incubation of segments with phorbol 12,13 dibutyrate, but not inactive phorbol ester, 4 γ phorbol, effected alkalinization of cells within the segments in a concentration-dependent manner. Alkalinization was dependent upon the presence of extracellular [Na + ] > intracellular [Na + ], was prevented by amiloride and was demonstrable in the presence of SITS. Our findings suggest that tumor-promoting esters stimulate the Na + -H + exchanger known to be present in the brush border membrane of the renal proximal tubular cell. It is possible that the stimulation reflects a mechanism by which phorbol esters affect metabolic processes in these cells
Canine distemper virus infection in fennec fox (Vulpes zerda).
Woo, Gye-Hyeong; Jho, Yeon-Sook; Bak, Eun-Jung
2010-08-01
Fifteen 8-month-old fennec foxes imported from Sudan showed fever, mucopurulent ocular discharge, diarrhea, severe emaciation, seizures, and generalized ataxia, and died. Three of the 15 animals were presented for diagnostic investigation. Severe dehydration, brain congestion, and gastric ulcers were observed in all animals. In one animal, the lungs had failed to collapse and were multifocally dark red in appearance. Histopathologically, there were lymphohistiocytic meningoencephalitis with malacia, mild interstitial pneumonia, lymphoid depletion of lymphoid tissues and organs, and intestinal villous atrophy with intralesional coccidia. There were many intracytoplasmic and/or intranuclear inclusion bodies in the epithelial cells of the medullary velum, lungs, liver, kidneys, trachea, pancreas, stomach, gall bladder, urinary bladder, and ureters, and in macrophages of malacia foci and lymphocytes and macrophages of lymphoid organs. Additionally, intestinal coccidia were confirmed to be Isospora species by a fecal test. To our knowledge, this is the first report of canine distemper with intestinal coccidiosis in fennec fox.
Antiviral activity of maca (Lepidium meyenii) against human influenza virus.
Del Valle Mendoza, Juana; Pumarola, Tomàs; Gonzales, Libertad Alzamora; Del Valle, Luis J
2014-09-01
To investigate antiviral activity of maca to reduce viral load in Madin-Darby canine kidney (MDCK) cells infected with influenza type A and B viruses (Flu-A and Flu-B, respectively). Maca were extracted with methanol (1:2, v/v). The cell viability and toxicity of the extracts were evaluated on MDCK cells using method MTT assay. Antiviral activity of compounds against Flu-A and Flu-B viruses was assayed using a test for determining the inhibition of the cytopathic effect on cell culture and multiplex RT-PCR. The methanol extract of maca showed low cytotoxicity and inhibited influenza-induced cytopathic effect significantly, while viral load was reduced via inhibition of viral growth in MDCK infected cells. Maca contains potent inhibitors of Flu-A and Flu-B with a selectivity index [cytotoxic concentration 50%/IC50] of 157.4 and 110.5, respectively. In vitro assays demonstrated that maca has antiviral activity not only against Flu-A (like most antiviral agents) but also Flu-B viruses, providing remarkable therapeutic benefits. Copyright © 2014 Hainan Medical College. Published by Elsevier B.V. All rights reserved.
Investigate The Role Of Cells To Cell Adhesion During Wound Healing
Montes, D. R.; Rodriguez, A. J.; Uyoh, E.; Antwi, P.; Olusegun, S.; Murray, P.
2017-12-01
Improvements in wound healing can save living organism and cut misery in health care centers and on the military battlefield. Microscopic examination of how Madin-Darby Canine Kidney (MDCK) epithelial cells respond to wounds under various treatments that block general calcium absorption and e-cadherin mechanics may yield novel wound treatment insights. We used MDCK cells as our tissue model for this experiment.Each tissue was grown on mattek dishes at high, middle, and low densities. Next, we incubated the tissue at 37 degrees celsius overnight. The next day, we wounded the MDCK tissue by scratching them with a 21G1 ½(38.1 mm) syringe needle. Before the scratch we took an image of the tissues. With the tissue wound we made a time-lapse movie of about 3 hours long with a interval of 1 min. Afterward, we compared each MDCK tissue by adding a calcium chelator named EGTA. As so, this will sequester calcium use as well to block e-cadherin mechanics. We then looked at the relationship between a wounded tissue and a healthy tissue. As such, wound dynamics can be observed. We asked ourselves, will EGTA prevent wound closure?
Toret, Christopher P.; D’Ambrosio, Michael V.; Vale, Ronald D.; Simon, Michael A.
2014-01-01
Cadherins and associated catenins provide an important structural interface between neighboring cells, the actin cytoskeleton, and intracellular signaling pathways in a variety of cell types throughout the Metazoa. However, the full inventory of the proteins and pathways required for cadherin-mediated adhesion has not been established. To this end, we completed a genome-wide (∼14,000 genes) ribonucleic acid interference (RNAi) screen that targeted Ca2+-dependent adhesion in DE-cadherin–expressing Drosophila melanogaster S2 cells in suspension culture. This novel screen eliminated Ca2+-independent cell–cell adhesion, integrin-based adhesion, cell spreading, and cell migration. We identified 17 interconnected regulatory hubs, based on protein functions and protein–protein interactions that regulate the levels of the core cadherin–catenin complex and coordinate cadherin-mediated cell–cell adhesion. Representative proteins from these hubs were analyzed further in Drosophila oogenesis, using targeted germline RNAi, and adhesion was analyzed in Madin–Darby canine kidney mammalian epithelial cell–cell adhesion. These experiments reveal roles for a diversity of cellular pathways that are required for cadherin function in Metazoa, including cytoskeleton organization, cell–substrate interactions, and nuclear and cytoplasmic signaling. PMID:24446484
Interactions of pharmacologically active snake venom sPLA2 with different cell lines
Doumanov, Jordan; Mladenova, Kirilka; Aleksandrov, Radoslav; Danovski, Georgi; Petrova, Svetla
2014-01-01
Secreted Phospholipases A2 (sPLA2s) represent a large family of structurally related enzymes, which target different tissues and organs and induce numerous pharmacological effects based on their catalytic specificity – hydrolysis of the sn-2 ester bond of glycerophospholipids. The neurotoxin vipoxin, isolated from the venom of Vipera ammodytes meriodionalis, is a heterodimeric postsynaptic ionic complex composed of two protein subunits – a basic and toxic His48 sPLA2 enzyme and an acidic, enzymatically inactive and non-toxic component. In this paper, for the first time, we demonstrate that vipoxin sPLA2 enzyme affects cell integrity and viability of four cell types and causes different cell responses. The most dramatic local tissue effects were observed with RPE-1 (retinal pigment epithelial) cells followed by A549 (adenocarcinomic human alveolar epithelial) cells and MDCK (Madin-Darby Canine Kidney epithelial) cells. Products of the enzymatic reaction, lysophospholipids and unsaturated free fatty acids, act as lipid mediators that can induce membrane damaging or can stimulate cell proliferation. Our preliminary results on the cytotoxic effect of vipoxin sPLA2 on A549 cells are promising in searching of its eventual anticancer potential. PMID:26019578
Preparation of Single Cells for Imaging Mass Spectrometry
Energy Technology Data Exchange (ETDEWEB)
Berman, E S; Fortson, S L; Kulp, K S; Checchi, K D; Wu, L; Felton, J S; Wu, K J
2007-10-24
Characterizing chemical changes within single cells is important for determining fundamental mechanisms of biological processes that will lead to new biological insights and improved disease understanding. Imaging biological systems with mass spectrometry (MS) has gained popularity in recent years as a method for creating precise chemical maps of biological samples. In order to obtain high-quality mass spectral images that provide relevant molecular information about individual cells, samples must be prepared so that salts and other cell-culture components are removed from the cell surface and the cell contents are rendered accessible to the desorption beam. We have designed a cellular preparation protocol for imaging MS that preserves the cellular contents for investigation and removes the majority of the interfering species from the extracellular matrix. Using this method, we obtain excellent imaging results and reproducibility in three diverse cell types: MCF7 human breast cancer cells, Madin-Darby canine kidney (MDCK) cells, and NIH/3T3 mouse fibroblasts. This preparation technique allows routine imaging MS analysis of cultured cells, allowing for any number of experiments aimed at furthering scientific understanding of molecular processes within individual cells.
Susceptibility of influenza viruses circulating in Western Saudi Arabia to neuraminidase inhibitors
Directory of Open Access Journals (Sweden)
Ahmed M. Tolah
2016-04-01
Full Text Available Objectives: To investigate the sensitivity of circulating influenza viruses in Western Saudi Arabia to neuraminidase inhibitors (NAIs; mainly, zanamivir and oseltamivir. Methods: Respiratory samples were collected from patients presenting with respiratory symptoms to King Abdulaziz University Hospital, Jeddah, Kingdom of Saudi Arabia (KSA between September 2013 and October 2014. All samples were tested prospectively by real-time reverse-transcription polymerase chain reaction for influenza A and B viruses. Positive samples were then inoculated on Madin-Darby Canine Kidney (MDCK cells and isolated viruses were examined for their sensitivity to NAIs using fluorescent neuraminidase inhibition assay. Results: Out of 406 tested samples, 25 samples (6.2% were positive for influenza A/pdmH1N1 virus, one sample (0.25% was positive for influenza A/H3N2 virus, and 7 samples (1.7% were positive for influenza B Yamagata-like virus. Screening of isolated influenza A and B viruses (9 out of 33 for their sensitivity to NAIs showed no significant resistance to available NAIs. Conclusion: Our results show that circulating influenza viruses in Jeddah are still sensitive to NAIs.
Yamaguchi, Naoya; Mizutani, Takeomi; Kawabata, Kazushige; Haga, Hisashi
2015-01-07
Collective cell migration plays a crucial role in several biological processes, such as embryonic development, wound healing, and cancer metastasis. Here, we focused on collectively migrating Madin-Darby Canine Kidney (MDCK) epithelial cells that follow a leader cell on a collagen gel to clarify the mechanism of collective cell migration. First, we removed a leader cell from the migrating collective with a micromanipulator. This then caused disruption of the cohesive migration of cells that followed in movement, called "follower" cells, which showed the importance of leader cells. Next, we observed localization of active Rac, integrin β1, and PI3K. These molecules were clearly localized in the leading edge of leader cells, but not in follower cells. Live cell imaging using active Rac and active PI3K indicators was performed to elucidate the relationship between Rac, integrin β1, and PI3K. Finally, we demonstrated that the inhibition of these molecules resulted in the disruption of collective migration. Our findings not only demonstrated the significance of a leader cell in collective cell migration, but also showed that Rac, integrin β1, and PI3K are upregulated in leader cells and drive collective cell migration.
Effects of Hydrostatic Pressure on Carcinogenic Properties of Epithelia.
Tokuda, Shinsaku; Kim, Young Hak; Matsumoto, Hisako; Muro, Shigeo; Hirai, Toyohiro; Mishima, Michiaki; Furuse, Mikio
2015-01-01
The relationship between chronic inflammation and cancer is well known. The inflammation increases the permeability of blood vessels and consequently elevates pressure in the interstitial tissues. However, there have been only a few reports on the effects of hydrostatic pressure on cultured cells, and the relationship between elevated hydrostatic pressure and cell properties related to malignant tumors is less well understood. Therefore, we investigated the effects of hydrostatic pressure on the cultured epithelial cells seeded on permeable filters. Surprisingly, hydrostatic pressure from basal to apical side induced epithelial stratification in Madin-Darby canine kidney (MDCK) I and Caco-2 cells, and cavities with microvilli and tight junctions around their surfaces were formed within the multi-layered epithelia. The hydrostatic pressure gradient also promoted cell proliferation, suppressed cell apoptosis, and increased transepithelial ion permeability. The inhibition of protein kinase A (PKA) promoted epithelial stratification by the hydrostatic pressure whereas the activation of PKA led to suppressed epithelial stratification. These results indicate the role of the hydrostatic pressure gradient in the regulation of various epithelial cell functions. The findings in this study may provide clues for the development of a novel strategy for the treatment of the carcinoma.
Lamglait, Benjamin; Vandenbunder-Beltrame, Marielle
2017-09-01
Symmetric dimethylarginine (SDMA) has been shown to be a valuable biomarker for early detection of chronic kidney disease (CKD) in canine and feline patients. Recognition of early (subclinical) kidney disease would be of value in cheetahs (Acinonyx jubatus) as prevalence of CKD is relatively high in this species in captivity. Fifty-eight banked serum and plasma samples from seven adult cheetahs that died of CKD were analyzed for creatinine, urea, and SDMA. A marked increase in SDMA was noted on five of the tested cheetahs earlier than the rise of serum creatinine and urea (estimated 8-35 mo; mean 21.4 mo; median 22 mo). SDMA appears as an early biomarker to evaluate renal function for the diagnosis of CKD in cheetahs regardless of the cause of this disease.
Surgical Procedures and Clinical Considerations for Impacted Canines: A Literature Review
Directory of Open Access Journals (Sweden)
Parviz Torkzaban
2016-09-01
Full Text Available Impaction of canine teeth is a clinical problem whose treatment usually requires an interdisciplinary approach. After the maxillary third molar, the maxillary canine is the second-most commonly impacted tooth, with an incidence of 1% - 2.5%. Maxillary canines are more common in females than males. This study reviews the surgical treatments and orthodontic considerations for impacted canines exposure reported in previous studies. The clinician should be aware of variations in the surgical management of labially and palatally impacted canines, as well as the most common methods of canine in orthodontic application, and the implications of canine extraction. The different factors that affect these decisions are discussed.
9 CFR 113.214 - Parvovirus Vaccine, Killed Virus (Canine).
2010-01-01
... REQUIREMENTS Killed Virus Vaccines § 113.214 Parvovirus Vaccine, Killed Virus (Canine). Parvovirus Vaccine... antibody against canine parvovirus to determine susceptibility. A constant virus-varying serum... vaccinates and the controls shall be challenged with virulent canine parvovirus furnished or approved by...
Orthodontic Traction of Impacted Canine Using Cantilever
Directory of Open Access Journals (Sweden)
Cláudia Nakandakari
2016-01-01
Full Text Available The impaction of the maxillary canines causes relevant aesthetic and functional problems. The multidisciplinary approach to the proper planning and execution of orthodontic traction of the element in question is essential. Many strategies are cited in the literature; among them is the good biomechanical control in order to avoid possible side effects. The aim of this paper is to present a case report in which a superior canine impacted by palatine was pulled out with the aid of the cantilever on the Segmented Arch Technique (SAT concept. A 14.7-year-old female patient appeared at clinic complaining about the absence of the upper right permanent canine. The proposed treatment prioritized the traction of the upper right canine without changing the occlusion and aesthetics. For this, it only installed the upper fixed appliance (Roth with slot 0.018, opting for SAT in order to minimize unwanted side effects. The use of cantilever to the traction of the upper right canine has enabled an efficient and predictable outcome, because it is of statically determined mechanics.
Transmigration of mandibular canine – case report
International Nuclear Information System (INIS)
Gruszka, Katarzyna; Różyło, T. Katarzyna; Różyło-Kalinowska, Ingrid; Denkiewicz, Katarzyna; Masłowska, Klaudia
2014-01-01
Transmigration is a phenomenon of movement of an unerupted tooth in the bone across the midline. This anomaly is not often found. Transmigration is more prevalent in females than in males, and more often encountered in the mandible than maxilla, it affects mostly canines. The aim of this study was to present a case report of a mandibular canine transmigration in a patient aged 12. Intraoral examination determined hypodontia of right second premolar and delayed eruption of left second premolar in maxilla, as well as persistent deciduous teeth: right second molar, left canine and second molar. The patient was referred for a Cone-Beam CT examination, which allowed precise visualization of the transmigrating canine as well as ruled out resorption of roots of mandibular incisors. The treatment with a maxillary fixed orthodontic appliance was finished after obtaining a satisfactory result. Proper alignment of the incisors in the anterior-posterior plane and correct midline position were accepted by the patient. Transmigrating canine after consultation with the surgeon was designed to further radiological observation
Canine Parvovirus: Current Perspective
Nandi, S.; Kumar, Manoj
2010-01-01
Canine parvovirus 2 (CPV-2) has been considered to be an important pathogen of domestic and wild canids and has spread worldwide since its emergence in 1978. It has been reported from Asia, Australia, New Zealand, the Americas and Europe. Two distinct parvoviruses are now known to infect dogs—the pathogenic CPV-2 and CPV-1 or the minute virus of canine (MVC). CPV-2, the causative agent of acute hemorrhagic enteritis and myocarditis in dogs, is one of the most important pathogenic viruses with...
Genotyping and pathobiologic characterization of canine parvovirus circulating in Nanjing, China.
Zhao, Yanbing; Lin, Yan; Zeng, Xujian; Lu, Chengping; Hou, Jiafa
2013-08-29
Canine parvovirus (CPV) is an important pathogen that causes acute enteric disease in dogs. It has mutated and spread throughout the world in dog populations. We provide an update on the molecular characterization of CPV that circulated in Nanjing, a provincial capital in China between 2009 and 2012. Seventy rectal swab samples were collected from the dogs diagnosed with CPV infection in 8 animal hospitals of Nanjing. Sequence analysis of VP2 genes of 31 samples revealed that 29 viral strains belonged to CPV-2a subtype, while other two strains were classified into CPV-2b. To investigate the pathogenicity of the prevalent virus, we isolated CPV-2a and performed the animal experiment. Nine beagles were inoculated with 105.86 of 50% tissue culture infectious doses (TCID50) of the virus. All the experimentally infected beagles exhibited mild to moderate mucoid or watery diarrhea on day 4 post-infection (p.i.). On day 9 p.i., characteristic histopathological lesions were clearly observed in multiple organs of infected dogs, including liver, spleen, kidney, brain and all segments of the small and large intestines, while viral DNA and antigen staining could be detected in the sampled tissues. It is notable that canine parvovirus was isolated in one from two brain samples processed. Our results indicated that CPV-2a is the predominant subtype in Nanjing of China. And this virus caused extensive lesions in a variety of tissues, including the brain.
Evaluation of P16 expression in canine appendicular osteosarcoma.
Murphy, B G; Mok, M Y; York, D; Rebhun, R; Woolard, K D; Hillman, C; Dickinson, P; Skorupski, K
2017-06-20
Osteosarcoma (OSA) is a common malignant bone tumor of large breed dogs that occurs at predictable anatomic sites. At the time of initial diagnosis, most affected dogs have occult pulmonary metastases. Even with aggressive surgical treatment combined with chemotherapy, the majority of dogs diagnosed with OSA live less than 1 year from the time of diagnosis. The ability to identify canine OSA cases most responsive to treatment is needed. In humans, OSA is also an aggressive tumor that is histologically and molecularly similar to canine OSA. The expression of the tumor suppressor gene product P16 by human OSA tissue has been linked to a favorable response to chemotherapy. We identified an antibody that binds canine P16 and developed a canine OSA tissue microarray in order to test the hypothesis that P16 expression by canine OSA tissue is predictive of clinical outcome following amputation and chemotherapy. Although statistical significance was not reached, a trend was identified between the lack of canine OSA P16 expression and a shorter disease free interval. The identification of a molecular marker for canine OSA is an important goal and the results reported here justify a larger study.
Cone beam computed tomography findings of impacted upper canines
Energy Technology Data Exchange (ETDEWEB)
Da Silva Santos, Ludmilla Mota [Dept. of Endodontics, Aracatuba Dental School, Paulista State University, Aracatuba(Brazil); Bastos, Luana Costa; Da Silva, Silvio Jose Albergaria; Campos, Paulo Sergio Flores [School of Dentistry, Federal University of Bahia, Salvador (Brazil); Oliveira Santos, Christiano [Dept. of Stomatology, Oral Public Health, and Forensic Dentistry, School of Dentistry, University of Sao Paulo, Ribeirao Preto (Brazil); Neves, Frederico Sampaio [Dept. of Oral Diagnosis, Piracicaba Dental School, State University of Campinas, Piracicaba (Brazil)
2014-12-15
To describe the features of impacted upper canines and their relationship with adjacent structures through three-dimensional cone-beam computed tomography (CBCT) images. Using the CBCT scans of 79 upper impacted canines, we evaluated the following parameters: gender, unilateral/bilateral occurrence, location, presence and degree of root resorption of adjacent teeth (mild, moderate, or severe), root dilaceration, dental follicle width, and presence of other associated local conditions. Most of the impacted canines were observed in females (56 cases), unilaterally (51 cases), and at a palatine location (53 cases). Root resorption in adjacent teeth and root dilaceration were observed in 55 and 47 impacted canines, respectively. In most of the cases, the width of the dental follicle of the canine was normal; it was abnormally wide in 20 cases. A statistically significant association was observed for all variables, except for root dilaceration (p=0.115) and the side of impaction (p=0.260). Root resorption of adjacent teeth was present in most cases of canine impaction, mostly affecting adjacent lateral incisors to a mild degree. A wide dental follicle of impacted canines was not associated with a higher incidence of external root resorption of adjacent teeth.
Cone beam computed tomography findings of impacted upper canines
International Nuclear Information System (INIS)
Da Silva Santos, Ludmilla Mota; Bastos, Luana Costa; Da Silva, Silvio Jose Albergaria; Campos, Paulo Sergio Flores; Oliveira Santos, Christiano; Neves, Frederico Sampaio
2014-01-01
To describe the features of impacted upper canines and their relationship with adjacent structures through three-dimensional cone-beam computed tomography (CBCT) images. Using the CBCT scans of 79 upper impacted canines, we evaluated the following parameters: gender, unilateral/bilateral occurrence, location, presence and degree of root resorption of adjacent teeth (mild, moderate, or severe), root dilaceration, dental follicle width, and presence of other associated local conditions. Most of the impacted canines were observed in females (56 cases), unilaterally (51 cases), and at a palatine location (53 cases). Root resorption in adjacent teeth and root dilaceration were observed in 55 and 47 impacted canines, respectively. In most of the cases, the width of the dental follicle of the canine was normal; it was abnormally wide in 20 cases. A statistically significant association was observed for all variables, except for root dilaceration (p=0.115) and the side of impaction (p=0.260). Root resorption of adjacent teeth was present in most cases of canine impaction, mostly affecting adjacent lateral incisors to a mild degree. A wide dental follicle of impacted canines was not associated with a higher incidence of external root resorption of adjacent teeth.
International Nuclear Information System (INIS)
Rohaya Megat Abdul Wahab; Albira Sintian; Zaidah Zainal Arifin; Zaidah Zainal Ariffin; Shahrul Hisham Zainal Ariffin
2015-01-01
Alkaline phosphatase (ALP), tartrate-resistant acid phosphatase (TRAP) and aspartate aminotransferase (AST) activities were studied as bio markers of canine movement. Root resorption was also evaluated in canines subjected to the orthodontic forces. Nineteen subjects randomly received 100 and 150 g force using self-ligating brackets (SLB) either on the right or left site of maxillary arch. Gingival crevicular fluid samples were collected at distal sites of canines for five consecutive weeks. The activities of ALP, TRAP and AST were assayed and measured spectrophotometrically. Canine movement was measured for five consecutive weeks while root resorption was monitored at baseline, week 0 and week 5 using periapical radiographs. In 100 g group, TRAP activity significantly increased in week 3-5 when compared to TRAP baseline activity. However, ALP and AST activities slightly increased. In 150 g group, ALP and TRAP activities slightly increased when compared with their baseline activities. However, AST significantly increased in week 5. Canine movement and root resorption were not significantly different (p<0.05) in both groups. A force of 100 and 150 g slightly increased the bone modeling process and resulted in similar canine movement and root resorption. Therefore, 100 g force could be an optimum force for canine retraction and is preferable (compared with 150 g force) in canine retraction using SLB. (author)
International Nuclear Information System (INIS)
Severson, Eric A.; Kwon, Mike; Hilgarth, Roland S.; Parkos, Charles A.; Nusrat, Asma
2010-01-01
The Apical Junctional Complex (AJC) encompassing the tight junction (TJ) and adherens junction (AJ) plays a pivotal role in regulating epithelial barrier function and epithelial cell proliferative processes through signaling events that remain poorly characterized. A potential regulator of AJC protein expression is Glycogen Synthase Kinase-3 (GSK-3). GSK-3 is a constitutively active kinase that is repressed during epithelial-mesenchymal transition (EMT). In the present study, we report that GSK-3 activity regulates the structure and function of the AJC in polarized model intestinal (SK-CO15) and kidney (Madin-Darby Canine Kidney (MDCK)) epithelial cells. Reduction of GSK-3 activity, either by small molecule inhibitors or siRNA targeting GSK-3 alpha and beta mRNA, resulted in increased permeability to both ions and bulk solutes. Immunofluorescence labeling and immunoblot analyses revealed that the barrier defects correlated with decreased protein expression of AJC transmembrane proteins Occludin, Claudin-1 and E-cadherin without influencing other TJ proteins, Zonula Occludens-1 (ZO-1) and Junctional Adhesion Molecule A (JAM-A). The decrease in Occludin and E-cadherin protein expression correlated with downregulation of the corresponding mRNA levels for these respective proteins following GSK-3 inhibition. These observations implicate an important role of GSK-3 in the regulation of the structure and function of the AJC that is mediated by differential modulation of mRNA transcription of key AJC proteins, Occludin, Claudin-1 and E-cadherin.
Energy Technology Data Exchange (ETDEWEB)
Severson, Eric A.; Kwon, Mike; Hilgarth, Roland S.; Parkos, Charles A. [Epithelial Pathobiology Research Unit, Dept. of Pathology, Emory University, Atlanta, GA 30322 (United States); Nusrat, Asma, E-mail: anusrat@emory.edu [Epithelial Pathobiology Research Unit, Dept. of Pathology, Emory University, Atlanta, GA 30322 (United States)
2010-07-02
The Apical Junctional Complex (AJC) encompassing the tight junction (TJ) and adherens junction (AJ) plays a pivotal role in regulating epithelial barrier function and epithelial cell proliferative processes through signaling events that remain poorly characterized. A potential regulator of AJC protein expression is Glycogen Synthase Kinase-3 (GSK-3). GSK-3 is a constitutively active kinase that is repressed during epithelial-mesenchymal transition (EMT). In the present study, we report that GSK-3 activity regulates the structure and function of the AJC in polarized model intestinal (SK-CO15) and kidney (Madin-Darby Canine Kidney (MDCK)) epithelial cells. Reduction of GSK-3 activity, either by small molecule inhibitors or siRNA targeting GSK-3 alpha and beta mRNA, resulted in increased permeability to both ions and bulk solutes. Immunofluorescence labeling and immunoblot analyses revealed that the barrier defects correlated with decreased protein expression of AJC transmembrane proteins Occludin, Claudin-1 and E-cadherin without influencing other TJ proteins, Zonula Occludens-1 (ZO-1) and Junctional Adhesion Molecule A (JAM-A). The decrease in Occludin and E-cadherin protein expression correlated with downregulation of the corresponding mRNA levels for these respective proteins following GSK-3 inhibition. These observations implicate an important role of GSK-3 in the regulation of the structure and function of the AJC that is mediated by differential modulation of mRNA transcription of key AJC proteins, Occludin, Claudin-1 and E-cadherin.
Two interceptive approaches to palatally displaced canines: a prospective longitudinal study.
Leonardi, Maria; Armi, Pamela; Franchi, Lorenzo; Baccetti, Tiziano
2004-10-01
This study evaluated the effectiveness of two interceptive approaches to palatally displaced canines (PDCs), ie, extraction of the deciduous canines alone and in association with the use of a cervical pull headgear. The prospective longitudinal design of the investigation included 46 subjects with PDC (62 maxillary canines) who were randomly assigned to one of three groups (1) a group that underwent the extraction of the deciduous canine only, (2) a group that received in addition the use of a cervical pull headgear, and (3) an untreated control group. Panoramic radiographs were evaluated at initial observation (T1) and after an average period of 18 months (T2). Cervical vertebral maturation was assessed on lateral cephalograms at T1. Successful or unsuccessful canine eruption was assessed 48 months after T1. The between-group statistical comparisons were performed on the T1-T2 changes in the diagnostic parameters on panoramic radiographs, the prevalence rates of successful canine eruption, and the amount of time for canine eruption. The removal of the deciduous canine as an isolated measure to intercept palatal displacement of maxillary canines showed a prevalence rate of 50% success, which was not significantly greater than the success rate in untreated controls. The use of a headgear in addition to the extraction of the deciduous canine induced successful eruption in 80% of the cases, with a significant improvement in the measures for intraosseous canine position. There was no significant difference between the two interceptive approaches in the time required for canine eruption.
Canine visceral leishmaniasis as a systemic fibrotic disease
Silva, Lucelia C; Castro, Rodrigo S; Figueiredo, Maria M; Michalick, Marilene S M; Tafuri, Washington L; Tafuri, Wagner L
2013-01-01
We propose that canine visceral leishmaniasis (CVL) is a systemic fibrotic disease, as evidenced by the wide distribution of fibrosis that we have found in the dogs suffering from chronic condition. The inflammatory cells apparently direct fibrosis formation. Twenty-four cases (symptomatic dogs) were identified from a total of one hundred and five cases that had been naturally infected with Leishmania chagasi and had been documented during an epidemiological survey of CVL carried out by the metropolitan area of the municipality of Belo Horizonte, MG, Brazil. The histological criterion was intralobular liver fibrosis, as has been described previously in dogs with visceral leishmaniasis. In addition to the findings in the liver, here we describe and quantify conspicuous and systemic deposition of collagen in other organs, including spleen, cervical lymph nodes, lung and kidney of all the infected symptomatic dogs. Thus we report that there is a systematic fibrotic picture in these animals, where inflammatory cells appear to direct fibrosis in all organs that have been studied. Therefore we propose that CVL is a systemic fibrotic disease. PMID:23419132
Skeletal maturity assessment using mandibular canine calcification stages
Directory of Open Access Journals (Sweden)
Vildana Džemidžić
2016-11-01
Full Text Available Objective. The aims of this study were: to investigate the relationship between mandibular canine calcification stages and skeletal maturity; and to evaluate whether the mandibular canine calcification stages may be used as a reliable diagnostic tool for skeletal maturity assessment. Materials and methods. This study included 151 subjects: 81 females and 70 males, with ages ranging from 9 to 16 years (mean age: 12.29±1.86 years. The inclusion criteria for subjects were as follows: age between 9 and 16 years; good general health without any hormonal, nutritional, growth or dental development problems. Subjects who were undergoing or had previously received orthodontic treatment were not included in this study. The calcification stages of the left permanent mandibular canine were assessed according to the method of Demirjian, on panoramic radiographs. Assessment of skeletal maturity was carried out using the cervical vertebral maturation index (CVMI, as proposed by the Hassel-Farman method, on lateral cephalograms. The correlation between the calcification stages of mandibular canine and skeletal maturity was estimated separately for male and female subjects. Results. Correlation coefficients between calcification stages of mandibular canine and skeletal maturity were 0.895 for male and 0.701 for female subjects. Conclusions. A significant correlation was found between the calcification stages of the mandibular canine and skeletal maturity. The calcification stages of the mandibular canine show a satisfactory diagnostic performance only for assessment of pre-pubertal growth phase.
A new method for rapid Canine retraction
Directory of Open Access Journals (Sweden)
"Khavari A
2001-06-01
Full Text Available Distraction osteogenesis method (Do in bone lengthening and rapid midpalatal expansion have shown the great ability of osteognic tissues for rapid bone formation under distraction force and special protocol with optimum rate of one millimeter per day. Periodontal membrane of teeth (PDM is the extension of periostium in the alveolar socked. Orthodontic force distracts PDM fibers in the tension side and then bone formation will begin.Objects: Rapid retraction of canine tooth into extraction space of first premolar by DO protocol in order to show the ability of the PDM in rapid bone formation. The other objective was reducing total orthodontic treatment time of extraction cases.Patients and Methods: Tweleve maxillary canines in six patients were retracted rapidly in three weeks by a custom-made tooth-born appliance. Radiographic records were taken to evaluate the effects of heavy applied force on canine and anchorage teeth.Results: Average retraction was 7.05 mm in three weeks (2.35 mm/week. Canines rotated distal- in by mean 3.5 degrees.Anchorage loss was from 0 to 0.8 mm with average of 0.3 mm.Root resorption of canines was negligible, and was not significant clinically. Periodontium was normal after rapid retraction. No hazard for pulp vitality was observed.Discussion: PDM responded well to heavy distraction force by Do protocol. Rapid canine retraction seems to be a safe method and can considerabely reduce orthodontic time.
Elastography of the normal canine liver, spleen and kidneys.
Holdsworth, Andrew; Bradley, Kate; Birch, Sally; Browne, William J; Barberet, Virginie
2014-01-01
Elastography is a simple, expedient and noninvasive technique that may be used to assess the elasticity or stiffness of a tissue, in conjunction with traditional B-mode ultrasonography. Quantitative assessment of tissue stiffness can be made which involves measurement of the shear wave velocity within the tissue of interest. The goal of this study was to assess the feasibility of elastography for clinical use in the abdomen of conscious small animals and to investigate factors that affect shear wave velocity measurement. Elastography was performed on the liver, spleen, and kidneys of 15 dogs at predefined depths within the parenchyma. Breed, age, gender, neuter status, and weight were documented for each animal. Depth at which measurements were taken had a significant negative relationship with the shear wave velocity value obtained. Individual dog effects, such as weight and gender, also appeared to have a significant effect on the shear wave velocity measurement for specific organs; weight had a significant positive effect on the shear wave velocity for each of the organs examined, whereas the effect of gender was inconsistent between organs (having a positive effect for the liver and a negative effect for the spleen). It is hoped that these results may act as a baseline to guide further work into the field of elastography in companion animals. © 2014 American College of Veterinary Radiology.
Headley,Selwyn Arlington; Saito,Taís Berelli
2003-01-01
Simultaneous infection of canine distemper virus and canine parvovirus associated with distemper myocardial degeneration and necrosis is described in a pup. The dog demonstrated myoclonus, nystagmus, enamel hypoplasia, abdominal pustules, and bilateral corneal ulceration clinically. Demyelinating encephalitis, myocardial degeneration and necrosis with mineralization, and necrosis, hemorrhage and fusion of intestinal villi were observed. The lesions observed in this dog are characteristic of a...
Establishment of optimized MDCK cell lines for reliable efflux transport studies.
Gartzke, Dominik; Fricker, Gert
2014-04-01
Madin-Darby canine kidney (MDCK) cells transfected with human MDR1 gene (MDCK-MDR1) encoding for P-glycoprotein (hPgp, ABCB1) are widely used for transport studies to identify drug candidates as substrates of this efflux protein. Therefore, it is necessary to rely on constant and comparable expression levels of Pgp to avoid false negative or positive results. We generated a cell line with homogenously high and stable expression of hPgp through sorting single clones from a MDCK-MDR1 cell pool using fluorescence-activated cell sorting (FACS). To obtain control cell lines for evaluation of cross-interactions with endogenous canine Pgp (cPgp) wild-type cells were sorted with a low expression pattern of cPgp in comparison with the MDCK-MDR1. Expression of other transporters was also characterized in both cell lines by quantitative real-time PCR and Western blot. Pgp function was investigated applying the Calcein-AM assay as well as bidirectional transport assays using (3) H-Digoxin, (3) H-Vinblastine, and (3) H-Quinidine as substrates. Generated MDCK-MDR1 cell lines showed high expression of hPgp. Control MDCK-WT cells were optimized in showing a comparable expression level of cPgp in comparison with MDCK-MDR1 cell lines. Generated cell lines showed higher and more selective Pgp transport compared with parental cells. Therefore, they provide a significant improvement in the performance of efflux studies yielding more reliable results. © 2014 Wiley Periodicals, Inc. and the American Pharmacists Association.
Moreira, Étori Aguiar; Locher, Samira; Kolesnikova, Larissa; Bolte, Hardin; Aydillo, Teresa; García-Sastre, Adolfo; Schwemmle, Martin; Zimmer, Gert
2016-10-24
Two novel influenza A-like viral genome sequences have recently been identified in Central and South American fruit bats and provisionally designated "HL17NL10" and "HL18NL11." All efforts to isolate infectious virus from bats or to generate these viruses by reverse genetics have failed to date. Recombinant vesicular stomatitis virus (VSV) encoding the hemagglutinin-like envelope glycoproteins HL17 or HL18 in place of the VSV glycoprotein were generated to identify cell lines that are susceptible to bat influenza A-like virus entry. More than 30 cell lines derived from various species were screened but only a few cell lines were found to be susceptible, including Madin-Darby canine kidney type II (MDCK II) cells. The identification of cell lines susceptible to VSV chimeras allowed us to recover recombinant HL17NL10 and HL18NL11 viruses from synthetic DNA. Both influenza A-like viruses established a productive infection in MDCK II cells; however, HL18NL11 replicated more efficiently than HL17NL10 in this cell line. Unlike conventional influenza A viruses, bat influenza A-like viruses started the infection preferentially at the basolateral membrane of polarized MDCK II cells; however, similar to conventional influenza A viruses, bat influenza A-like viruses were released primarily from the apical site. The ability of HL18NL11 or HL17NL10 viruses to infect canine and human cells might reflect a zoonotic potential of these recently identified bat viruses.
Novel canine circovirus strains from Thailand: Evidence for genetic recombination.
Piewbang, Chutchai; Jo, Wendy K; Puff, Christina; van der Vries, Erhard; Kesdangsakonwut, Sawang; Rungsipipat, Anudep; Kruppa, Jochen; Jung, Klaus; Baumgärtner, Wolfgang; Techangamsuwan, Somporn; Ludlow, Martin; Osterhaus, Albert D M E
2018-05-14
Canine circoviruses (CanineCV's), belonging to the genus Circovirus of the Circoviridae family, were detected by next generation sequencing in samples from Thai dogs with respiratory symptoms. Genetic characterization and phylogenetic analysis of nearly complete CanineCV genomes suggested that natural recombination had occurred among different lineages of CanineCV's. Similarity plot and bootscaning analyses indicated that American and Chinese viruses had served as major and minor parental viruses, respectively. Positions of recombination breakpoints were estimated using maximum-likelihood frameworks with statistical significant testing. The putative recombination event was located in the Replicase gene, intersecting with open reading frame-3. Analysis of nucleotide changes confirmed the origin of the recombination event. This is the first description of naturally occurring recombinant CanineCV's that have resulted in the circulation of newly emerging CanineCV lineages.
Podoplanin Expression in Canine Melanoma
Ogasawara, Satoshi; Honma, Ryusuke; Kaneko, Mika K.; Fujii, Yuki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari
2016-01-01
A type I transmembrane protein, podoplanin (PDPN), is expressed in several normal cells such as lymphatic endothelial cells or pulmonary type I alveolar cells. We recently demonstrated that anticanine PDPN monoclonal antibody (mAb), PMab-38, recognizes canine PDPN of squamous cell carcinomas, but does not react with lymphatic endothelial cells. Herein, we investigated whether PMab-38 reacts with canine melanoma. PMab-38 reacted with 90% of melanoma cells (9/10 cases) using immunohistochemistr...
Finite element analysis of rapid canine retraction through reducing resistance and distraction
Directory of Open Access Journals (Sweden)
Junjie XUE
2014-01-01
Full Text Available Objective: The aims of this study were to compare different surgical approaches to rapid canine retraction by designing and selecting the most effective method of reducing resistance by a three-dimensional finite element analysis. Material and Methods: Three-dimensional finite element models of different approaches to rapid canine retraction by reducing resistance and distraction were established, including maxillary teeth, periodontal ligament, and alveolar. The models were designed to dissect the periodontal ligament, root, and alveolar separately. A 1.5 N force vector was loaded bilaterally to the center of the crown between first molar and canine, to retract the canine distally. The value of total deformation was used to assess the initial displacement of the canine and molar at the beginning of force loading. Stress intensity and force distribution were analyzed and evaluated by Ansys 13.0 through comparison of equivalent (von Mises stress and maximum shear stress. Results: The maximum value of total deformation with the three kinds of models occurred in the distal part of the canine crown and gradually reduced from the crown to the apex of the canine; compared with the canines in model 3 and model 1, the canine in model 2 had the maximum value of displacement, up to 1.9812 mm. The lowest equivalent (von Mises stress and the lowest maximum shear stress were concentrated mainly on the distal side of the canine root in model 2. The distribution of equivalent (von Mises stress and maximum shear stress on the PDL of the canine in the three models was highly concentrated on the distal edge of the canine cervix. . Conclusions: Removal of the bone in the pathway of canine retraction results in low stress intensity for canine movement. Periodontal distraction aided by surgical undermining of the interseptal bone would reduce resistance and effectively accelerate the speed of canine retraction.
Directory of Open Access Journals (Sweden)
Chaowalit Yuajit
Full Text Available Cyst enlargement in polycystic kidney disease (PKD involves cAMP-activated proliferation of cyst-lining epithelial cells and transepithelial fluid secretion into the cyst lumen via cystic fibrosis transmembrane conductance regulator (CFTR chloride channel. This study aimed to investigate an inhibitory effect and detailed mechanisms of steviol and its derivatives on cyst growth using a cyst model in Madin-Darby canine kidney (MDCK cells. Among 4 steviol-related compounds tested, steviol was found to be the most potent at inhibiting MDCK cyst growth. Steviol inhibition of cyst growth was dose-dependent; steviol (100 microM reversibly inhibited cyst formation and cyst growth by 72.53.6% and 38.2±8.5%, respectively. Steviol at doses up to 200 microM had no effect on MDCK cell viability, proliferation and apoptosis. However, steviol acutely inhibited forskolin-stimulated apical chloride current in MDCK epithelia, measured with the Ussing chamber technique, in a dose-dependent manner. Prolonged treatment (24 h with steviol (100 microM also strongly inhibited forskolin-stimulated apical chloride current, in part by reducing CFTR protein expression in MDCK cells. Interestingly, proteasome inhibitor, MG-132, abolished the effect of steviol on CFTR protein expression. Immunofluorescence studies demonstrated that prolonged treatment (24 h with steviol (100 microM markedly reduced CFTR expression at the plasma membrane. Taken together, the data suggest that steviol retards MDCK cyst progression in two ways: first by directly inhibiting CFTR chloride channel activity and second by reducing CFTR expression, in part, by promoting proteasomal degradation of CFTR. Steviol and related compounds therefore represent drug candidates for treatment of polycystic kidney disease.
Canine scent detection of canine cancer: a feasibility study
Directory of Open Access Journals (Sweden)
Dorman DC
2017-10-01
Full Text Available David C Dorman,1 Melanie L Foster,2 Katherine E Fernhoff,1 Paul R Hess2 1Department of Molecular and Biomedical Sciences, 2Department of Clinical Sciences, College of Veterinary Medicine, North Carolina State University, Raleigh, NC, USA Abstract: The scent detection prowess of dogs has prompted interest in their ability to detect cancer. The purpose of this study was to determine whether dogs could use olfactory cues to discriminate urine samples collected from dogs that did or did not have urinary tract transitional cell carcinoma (TCC, at a rate greater than chance. Dogs with previous scent training (n=4 were initially trained to distinguish between a single control and a single TCC-positive urine sample. All dogs acquired this task (mean =15±7.9 sessions; 20 trials/session. The next training phase used four additional control urine samples (n=5 while maintaining the one original TCC-positive urine sample. All dogs quickly acquired this task (mean =5.3±1.5 sessions. The last training phase used multiple control (n=4 and TCC-positive (n=6 urine samples to promote categorical training by the dogs. Only one dog was able to correctly distinguish multiple combinations of TCC-positive and control urine samples suggesting that it mastered categorical learning. The final study phase evaluated whether this dog would generalize this behavior to novel urine samples. However, during double-blind tests using two novel TCC-positive and six novel TCC-negative urine samples, this dog did not indicate canine TCC-positive cancer samples more frequently than expected by chance. Our study illustrates the need to consider canine olfactory memory and the use of double-blind methods to avoid erroneous conclusions regarding the ability of dogs to alert on specimens from canine cancer patients. Our results also suggest that sample storage, confounding odors, and other factors need to be considered in the design of future studies that evaluate the detection of
Bergman, J G H E; Muniz, M; Sutton, D; Fensome, R; Ling, F; Paul, G
2006-11-25
The results of vaccinating two groups of puppies with commercial vaccines, both of which claimed to provide adequate protection with a final vaccination at 10 weeks of age, were compared. Groups of 19 and 20 puppies with similar titres of maternally derived antibodies against canine parvovirus (cpv), canine distemper virus (cdv) and canine adenovirus type 2 (cav-2) at four weeks of age were vaccinated at six and 10 weeks of age and their responses to each vaccination were measured by comparing the titres against cpv, cdv and cav-2 in the serum samples taken immediately before the vaccination and four weeks later. After the vaccination at six weeks of age, all 19 of the puppies in group 1 had responded to cpv and cdv, and 14 had responded to cav-2; in group 2, 17 of the 20 had responded to cpv, 19 to cdv and 15 to cav-2. In both groups the puppies that did not respond to the first vaccination had responded serologically to cpv, cdv and cav-2 at 10 weeks of age.
DEFF Research Database (Denmark)
Kristensen, Torsten; Sarin, C J; Hunter, T
1986-01-01
An amplified Okayama-Berg plasmid cDNA library was constructed from total poly(A)+ RNA isolated from the Madin-Darby bovine kidney cell line MDBK. This library was screened with a partial murine calpactin I heavy chain (p36) cDNA clone, the identification of which was based on bovine p36 tryptic ...
Abdelmagid, Omar Y; Larson, Laurie; Payne, Laurie; Tubbs, Anna; Wasmoen, Terri; Schultz, Ronald
2004-01-01
The results of this study confirmed that dogs vaccinated subcutaneously with a commercially available multivalent vaccine containing modified-live canine distemper virus, canine adenovirus type 2, canine parvovirus type 2b, and canine parainfluenza virus antigens were protected against sequential experimental challenge 55 to 57 months after initial vaccination given at 7 to 8 weeks of age. All 10 vaccinates were protected against clinical diseases and mortality following parvovirus and infectious canine hepatitis experimental infections. All vaccinates were protected against mortality and 90% against clinical disease following distemper challenge. These data support at least a 4-year duration of immunity for these three "core" fractions in the combination vaccine.
Elshafae, Said M; Hassan, Bardes B; Supsavhad, Wachiraphan; Dirksen, Wessel P; Camiener, Rachael Y; Ding, Haiming; Tweedle, Michael F; Rosol, Thomas J
2016-06-01
The gastrin-releasing peptide receptor (GRPr) is upregulated in early and late-stage human prostate cancer (PCa) and other solid tumors of the mammary gland, lung, head and neck, colon, uterus, ovary, and kidney. However, little is known about its role in prostate cancer. This study examined the effects of a heterologous GRPr agonist, bombesin (BBN), on growth, motility, morphology, gene expression, and tumor phenotype of an osteoblastic canine prostate cancer cell line (Ace-1) in vitro and in vivo. The Ace-1 cells were stably transfected with the human GRPr and tumor cells were grown in vitro and as subcutaneous and intratibial tumors in nude mice. The effect of BBN was measured on cell proliferation, cell migration, tumor growth (using bioluminescence), tumor cell morphology, bone tumor phenotype, and epithelial-mesenchymal transition (EMT) and metastasis gene expression (quantitative RT-PCR). GRPr mRNA expression was measured in primary canine prostate cancers and normal prostate glands. Bombesin (BBN) increased tumor cell proliferation and migration in vitro and tumor growth and invasion in vivo. BBN upregulated epithelial-to-mesenchymal transition (EMT) markers (TWIST, SNAIL, and SLUG mRNA) and downregulated epithelial markers (E-cadherin and β-catenin mRNA), and modified tumor cell morphology to a spindle cell phenotype. Blockade of GRPr upregulated E-cadherin and downregulated VIMENTIN and SNAIL mRNA. BBN altered the in vivo tumor phenotype in bone from an osteoblastic to osteolytic phenotype. Primary canine prostate cancers had increased GRPr mRNA expression compared to normal prostates. These data demonstrated that the GRPr is important in prostate cancer growth and progression and targeting GRPr may be a promising strategy for treatment of prostate cancer. Prostate 76:796-809, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
A rare case of canine anomaly - a possible algorithm for treating it.
Vaida, Ligia; Todor, Bianca Ioana; Corega, Claudia; Băciuţ, Mihaela; Băciuţ, Grigore
2014-01-01
Canine transmigration is a very rare dental anomaly in which an unerupted mandibular canine migrates, crossing the mandibular midline. This unusual condition is most often diagnosed by chance during a routine X-ray examination. The most common clinical signs announcing the presence of this anomaly are over-retention of the deciduous canine and the absence of permanent canine from the dental arch after its physiological period of eruption. In this paper, we present a clinical case, 10-year-old boy, who was diagnosed with mandibular right canine transmigration at three years after the start of orthodontic treatment, during which we were expecting the eruption of mandibular canines. The orthopantomograph revealed the mandibular right canine to be in a horizontal position under the apices of the incisors - type 2 transmigration pattern classified by Mupparapu (2002). Based on cone-beam computer tomography examination, we recommended a surgical exposure of the canine and orthodontic alignment. Due to the risk of root resorption of the mandibular right lateral incisor during orthodontic movement phase of canine transmigrated to the dental arch, we decided to align the mandibular right canine in a transposition, between the two mandibular right incisors. Then we resorted to adapting the mandibular right lateral incisor coronary morphology to simulate a canine and also to reshaping the canine coronary morphology to resemble a lateral incisor. This therapeutic approach allowed us to restore morphologically and functionally the mandibular dento-alveolar arch, preserving the entire dental system.
Development and Characterization of Canine Distemper Virus Monoclonal Antibodies.
Liu, Yuxiu; Hao, Liying; Li, Xiangdong; Wang, Linxiao; Zhang, Jianpo; Deng, Junhua; Tian, Kegong
2017-06-01
Five canine distemper virus monoclonal antibodies were developed by immunizing BALB/c mice with a traditional vaccine strain Snyder Hill. Among these monoclonal antibodies, four antibodies recognized both field and vaccine strains of canine distemper virus without neutralizing ability. One monoclonal antibody, 1A4, against hemagglutinin protein of canine distemper virus was found to react only with vaccine strain virus but not field isolates, and showed neutralizing activity to vaccine strain virus. These monoclonal antibodies could be very useful tools in the study of the pathogenesis of canine distemper virus and the development of diagnostic reagents.
Surgical considerations and management of bilateral labially impacted canines
Directory of Open Access Journals (Sweden)
Yu-Shan Huang
2016-06-01
Full Text Available Canines are among the most commonly impacted teeth. When a canine is positioned labially, the untoward soft-tissue responses following surgical exposure may cause unfavorable esthetic outcomes. Therefore, decision making as to the choice of a proper surgical technique to uncover labially impacted teeth is critical. This case presentation describes two different surgical approaches for two maxillary impacted canines in a 12-year-old girl. A sequential approach included a first stage of surgical exposure using apically positioned flaps and orthodontic extrusion of both impacted teeth. A successive laterally positioned flap was used for the left maxillary canine to achieve a harmonious soft-tissue contour. In this case, close monitoring and cooperation during the various treatment phases led to proper canine positioning and a successful esthetic result, with good periodontal health and functional occlusion.
Immunohistochemical Characterization of Canine Lymphomas
Directory of Open Access Journals (Sweden)
Roxana CORA
2017-11-01
Full Text Available Lymphomas occur by clonal expansion of lymphoid cells and have distinctive morphological and immunophenotypic features. Determination of canine lymphoma immunophenotype is useful for accurate prognosis and further therapy. In the suggested study, we performed an immunohistochemical evaluation of some cases with canine lymphoma diagnosed in the Department of Pathology (Faculty of Veterinary Medicine, Cluj-Napoca, Romania, in order to characterize them. The investigation included 39 dogs diagnosed with different anatomical forms of lymphoma, following necropsy analysis or assessment of biopsies. The diagnosis of lymphoma was confirmed by necropsy and histopathology (Hematoxylin-eosin stain examinations. The collected specimens were analyzed by immunohistochemistry technique (automatic method using the following antibodies: CD3, CD20, CD21 and CD79a. The analyzed neoplasms were characterized as follows: about 64.10% of cases were diagnosed as B-cell lymphomas, 33.34% of cases as T-cell lymphomas, whereas 2.56% of cases were null cell type lymphomas (neither B nor T. Most of multicentric (80%, mediastinal (60% and primary central nervous system lymphomas (100% had B immunophenotype, while the majority of cutaneous (80% and digestive (100% lymphomas had T immunophenotype. Immunohistochemical description of canine lymphomas can deliver some major details concerning their behavior and malignancy. Additionally, vital prognosis and efficacy of some therapeutic protocols are relying on the immunohistochemical features of canine lymphoma.
Stem Cell-Associated Marker Expression in Canine Hair Follicles.
Gerhards, Nora M; Sayar, Beyza S; Origgi, Francesco C; Galichet, Arnaud; Müller, Eliane J; Welle, Monika M; Wiener, Dominique J
2016-03-01
Functional hair follicle (HF) stem cells (SCs) are crucial to maintain the constant recurring growth of hair. In mice and humans, SC subpopulations with different biomarker expression profiles have been identified in discrete anatomic compartments of the HF. The rare studies investigating canine HF SCs have shown similarities in biomarker expression profiles to that of mouse and human SCs. The aim of our study was to broaden the current repertoire of SC-associated markers and their expression patterns in the dog. We combined analyses on the expression levels of CD34, K15, Sox9, CD200, Nestin, LGR5 and LGR6 in canine skin using RT-qPCR, the corresponding proteins in dog skin lysates, and their expression patterns in canine HFs using immunohistochemistry. Using validated antibodies, we were able to define the location of CD34, Sox9, Keratin15, LGR5 and Nestin in canine HFs and confirm that all tested biomarkers are expressed in canine skin. Our results show similarities between the expression profile of canine, human and mouse HF SC markers. This repertoire of biomarkers will allow us to conduct functional studies and investigate alterations in the canine SC compartment of different diseases, like alopecia or skin cancer with the possibility to extend relevant findings to human patients. © 2016 The Histochemical Society.
Chlamydia in canine or feline coronary arteriosclerotic lesions
Directory of Open Access Journals (Sweden)
Grabarevic Zeljko
2011-09-01
Full Text Available Abstract Background There are numerous reports linking Chlamydia infection to human coronary atherosclerosis. However, there is a lack of data regarding this correlation in dogs and cats, and there are no reports investigating coronary arteriosclerosis and Chlamydia in these species. The aim of the present study was to examine whether there is a correlation between canine and feline spontaneous atherosclerosis or arteriosclerosis and the presence of Chlamydia. Archived histopathological samples of dogs (n = 16 and cats (n = 13 with findings of atherosclerosis or arteriosclerosis in heart tissue were examined for the presence of Chlamydiaceae using real-time PCR, ArrayTube Microarray and immunohistochemistry. Additionally, arteriosclerotic lesions of all cases were histologically classified and graded. Results Both canine atherosclerotic cases, and all 14 canine arteriosclerotic cases were negative for Chlamydia. Only one of the 13 arteriosclerotic feline cases was positive for Chlamydia by real-time PCR, revealing C. abortus by ArrayTube Microarray. To our knowledge, this is the first description of C. abortus in a cat. Overall, the type and grade of canine and feline arteriosclerotic lesions revealed similarities, and were predominantly moderate and hyperplastic. Conclusions These findings suggest that there is no obvious correlation between canine and feline coronary arteriosclerosis and the presence of Chlamydia. In order to draw final conclusions about the correlation between Chlamydia and canine atherosclerosis, examination of more samples is required.
Chlamydia in canine or feline coronary arteriosclerotic lesions.
Sostaric-Zuckermann, Ivan C; Borel, Nicole; Kaiser, Carmen; Grabarevic, Zeljko; Pospischil, Andreas
2011-09-09
There are numerous reports linking Chlamydia infection to human coronary atherosclerosis. However, there is a lack of data regarding this correlation in dogs and cats, and there are no reports investigating coronary arteriosclerosis and Chlamydia in these species. The aim of the present study was to examine whether there is a correlation between canine and feline spontaneous atherosclerosis or arteriosclerosis and the presence of Chlamydia. Archived histopathological samples of dogs (n = 16) and cats (n = 13) with findings of atherosclerosis or arteriosclerosis in heart tissue were examined for the presence of Chlamydiaceae using real-time PCR, ArrayTube Microarray and immunohistochemistry. Additionally, arteriosclerotic lesions of all cases were histologically classified and graded. Both canine atherosclerotic cases, and all 14 canine arteriosclerotic cases were negative for Chlamydia. Only one of the 13 arteriosclerotic feline cases was positive for Chlamydia by real-time PCR, revealing C. abortus by ArrayTube Microarray. To our knowledge, this is the first description of C. abortus in a cat. Overall, the type and grade of canine and feline arteriosclerotic lesions revealed similarities, and were predominantly moderate and hyperplastic. These findings suggest that there is no obvious correlation between canine and feline coronary arteriosclerosis and the presence of Chlamydia. In order to draw final conclusions about the correlation between Chlamydia and canine atherosclerosis, examination of more samples is required.
A novel bocavirus in canine liver
Directory of Open Access Journals (Sweden)
Li Linlin
2013-02-01
Full Text Available Abstract Background Bocaviruses are classified as a genus within the Parvoviridae family of single-stranded DNA viruses and are pathogenic in some mammalian species. Two species have been previously reported in dogs, minute virus of canines (MVC, associated with neonatal diseases and fertility disorders; and Canine bocavirus (CBoV, associated with respiratory disease. Findings In this study using deep sequencing of enriched viral particles from the liver of a dog with severe hemorrhagic gastroenteritis, necrotizing vasculitis, granulomatous lymphadenitis and anuric renal failure, we identified and characterized a novel bocavirus we named Canine bocavirus 3 (CnBoV3. The three major ORFs of CnBoV3 (NS1, NP1 and VP1 shared less than 60% aa identity with those of other bocaviruses qualifying it as a novel species based on ICTV criteria. Inverse PCR showed the presence of concatemerized or circular forms of the genome in liver. Conclusions We genetically characterized a bocavirus in a dog liver that is highly distinct from prior canine bocaviruses found in respiratory and fecal samples. Its role in this animal’s complex disease remains to be determined.
Genomic instability and telomere fusion of canine osteosarcoma cells.
Directory of Open Access Journals (Sweden)
Junko Maeda
Full Text Available Canine osteosarcoma (OSA is known to present with highly variable and chaotic karyotypes, including hypodiploidy, hyperdiploidy, and increased numbers of metacentric chromosomes. The spectrum of genomic instabilities in canine OSA has significantly augmented the difficulty in clearly defining the biological and clinical significance of the observed cytogenetic abnormalities. In this study, eight canine OSA cell lines were used to investigate telomere fusions by fluorescence in situ hybridization (FISH using a peptide nucleotide acid probe. We characterized each cell line by classical cytogenetic studies and cellular phenotypes including telomere associated factors and then evaluated correlations from this data. All eight canine OSA cell lines displayed increased abnormal metacentric chromosomes and exhibited numerous telomere fusions and interstitial telomeric signals. Also, as evidence of unstable telomeres, colocalization of γ-H2AX and telomere signals in interphase cells was observed. Each cell line was characterized by a combination of data representing cellular doubling time, DNA content, chromosome number, metacentric chromosome frequency, telomere signal level, cellular radiosensitivity, and DNA-PKcs protein expression level. We have also studied primary cultures from 10 spontaneous canine OSAs. Based on the observation of telomere aberrations in those primary cell cultures, we are reasonably certain that our observations in cell lines are not an artifact of prolonged culture. A correlation between telomere fusions and the other characteristics analyzed in our study could not be identified. However, it is important to note that all of the canine OSA samples exhibiting telomere fusion utilized in our study were telomerase positive. Pending further research regarding telomerase negative canine OSA cell lines, our findings may suggest telomere fusions can potentially serve as a novel marker for canine OSA.
Survivin inhibition via EZN-3042 in canine lymphoma and osteosarcoma.
Shoeneman, J K; Ehrhart, E J; Charles, J B; Thamm, D H
2016-06-01
Canine lymphoma (LSA) and osteosarcoma (OS) have high mortality rates and remain in need of more effective therapeutic approaches. Survivin, an inhibitor of apoptosis (IAP) family member protein that inhibits apoptosis and drives cell proliferation, is commonly elevated in human and canine cancer. Survivin expression is a negative prognostic factor in dogs with LSA and OS, and canine LSA and OS cell lines express high levels of survivin. In this study, we demonstrate that survivin downregulation in canine LSA and OS cells using a clinically applicable locked nucleic acid antisense oligonucleotide (EZN-3042, Enzon Pharmaceuticals, Piscataway Township, NJ, USA) inhibits growth, induces apoptosis and enhances chemosensitivity in vitro, and inhibits survivin transcription and protein production in orthotopic canine OS xenografts. Our findings strongly suggest that survivin-directed therapies might be effective in treatment of canine LSA and OS and support evaluation of EZN-3042 in dogs with cancer. © 2014 John Wiley & Sons Ltd.
Canine index – A tool for sex determination
Directory of Open Access Journals (Sweden)
Shankar M. Bakkannavar
2015-12-01
Full Text Available Teeth are most useful tools in victim identification in the living as well as the dead in the field of forensic investigations. Their ability to survive in situations like mass disasters makes them constructive devices. Many authors have measured crowns of teeth in both males and females and found certain variations. Canines, reported to survive in air crash and hurricane disasters, are perhaps the most stable teeth in the oral cavity because of the labiolingual thickness of the crown and the root anchorage in the alveolar process of jaws. Measurement of mesiodistal width of the mandibular canines and inter-canine distance of the mandible provides good evidence of sex identification due to dimorphism. This study was undertaken to evaluate the effectiveness of canine index (CI in the determination of sex.
Cytotoxic Activity of the Leaf and Stem Extracts of Hibiscus rosa ...
African Journals Online (AJOL)
Methods: The crude petroleum ether, ethyl acetate and methanol extracts of the leaf and stem of Hibiscus rosa sinensis were prepared using cold extraction method. The in vitro cytotoxic activity of the extracts (20 - 100 μg/ml) was evaluated on leukaemic cancer cell line (K-562) and Mardin-Darby kidney cell line (MDBK) ...
Immunohistochemical Expression of FXR1 in Canine Normal Tissues and Melanomas.
Nordio, Laura; Marques, Andreia T; Lecchi, Cristina; Luciano, Alberto M; Stefanello, Damiano; Giudice, Chiara
2018-04-01
Fragile X mental retardation-related protein 1 (FXR1) is a cytoplasmic RNA-binding protein highly conserved among vertebrates. It has been studied for its role in muscle development, inflammation, and tumorigenesis, being related, for example, to metastasizing behavior in human and canine uveal melanoma. Anti-FXR1 antibodies have never been validated in the canine species. To investigate FXR1 expression in canine melanocytic tumors, the present study tested two commercially available polyclonal anti-human FXR1 antibodies, raised in goat and rabbit, respectively. The cross-reactivity of the anti-FXR1 antibodies was assessed by Western blot analysis, and the protein was localized by IHC in a set of normal canine tissues and in canine melanocytic tumors (10 uveal and 10 oral). Western blot results demonstrated that the antibody raised in rabbit specifically recognized the canine FXR1, while the antibody raised in goat did not cross-react with this canine protein. FXR1 protein was immunodetected using rabbit anti-FXR1 antibody, in canine normal tissues with different levels of intensity and distribution. It was also detected in 10/10 uveal and 9/10 oral melanocytic tumors. The present study validated for the first time the use of anti-FXR1 antibody in dogs and highlighted different FXR1 protein expression in canine melanocytic tumors, the significance of which is undergoing further investigations.
Rate of retraction of anterior teeth after canine distraction
Directory of Open Access Journals (Sweden)
Litesh Singla
2017-01-01
Full Text Available Background and Objectives: Orthodontists have always strived to develop a new technique to reduce the treatment time with minimal patient cooperation. Canine distraction was introduced as an alternative technique for canine retraction in a minimum possible period of 3 weeks, thus avoiding taxing the anchorage by molars since the canines are retracted within the lag phase of molars. It has been proved by numerous studies that the bone mesial to canine after rapid canine distraction through the extraction socket is a new and immature. The objectives of this study were to evaluate the rate of retraction of anterior teeth, the time taken, and anchorage loss during the retraction of anterior teeth into this newly organized bone. Methods: Six orthodontic patients who required first premolar extractions were selected. Undermining of the interseptal bone distal to the canine was done, and canines were retracted into the extraction space of the first premolar, using a custom-made tooth borne intraoral distraction screw, following which the incisors were retracted into the newly formed bone using closing loops. The patients were called at weekly intervals to measure the amount of space left between canine and lateral incisor, and the rate of retraction was calculated after space was closed. Results: The present study showed that the rate of retraction of mandibular and maxillary teeth was 0.74 ± 0.39 mm and 0.73 ± 0.15 mm/week, respectively. The anchorage loss was found to be 1.83 ± 0.29 mm and 2.08 ± 0.38 mm in mandibular and maxillary arches, respectively. The time taken to retract the incisors was found to be 40.3 ± 1.5 and 41.7 ± 0.6 days for mandibular and maxillary arches, respectively. Interpretation and Conclusion: Retraction of incisors is faster in both maxillary and mandibular arches when the incisors are retracted immediately into the immature bone created after canine distraction.
Canine tooth size and fitness in male mandrills (Mandrillus sphinx).
Leigh, Steven R; Setchell, Joanna M; Charpentier, Marie; Knapp, Leslie A; Wickings, E Jean
2008-07-01
Sexual selection theory explains the evolution of exaggerated male morphologies and weaponry, but the fitness consequences of developmental and age-related changes in these features remain poorly understood. This long-term study of mandrill monkeys (Mandrillus sphinx) demonstrates how age-related changes in canine tooth weaponry and adult canine size correlate closely with male lifetime reproductive success. Combining long-term demographic and morphometric data reveals that male fitness covaries simply and directly with canine ontogeny, adult maximum size, and wear. However, fitness is largely independent of other somatometrics. Male mandrills sire offspring almost exclusively when their canines exceed approximately 30 mm, or two-thirds of average adult value (45 mm). Moreover, sires have larger canines than nonsires. The tooth diminishes through wear as animals age, corresponding with, and perhaps influencing, reproductive senescence. These factors combine to constrain male reproductive opportunities to a brief timespan, defined by the period of maximum canine length. Sexually-selected weaponry, especially when it is nonrenewable like the primate canine tooth, is intimately tied to the male life course. Our analyses of this extremely dimorphic species indicate that sexual selection is closely intertwined with growth, development, and aging, pointing to new directions for sexual selection theory. Moreover, the primate canine tooth has potential as a simple mammalian system for testing genetically-based models of aging. Finally, the tooth may record details of life histories in fossil primates, especially when sexual selection has played a role in the evolution of dimorphism.
Transmigration of Mandibular Canine: Report of Four Cases and Review of Literature
Directory of Open Access Journals (Sweden)
Gaurav Sharma
2011-01-01
Full Text Available Transmigration of canine is a rare phenomenon. The prevalence of transmigration of mandibular canine has been found to be only 0.14%–0.31%. The treatment of impacted transmigrated canine is very complicated if it is diagnosed at a later stage. We report 4 cases of transmigration of mandibular canine and review the literature regarding the etiology and treatment. Panoramic radiograph should be taken during the mixed dentition period if the mandibular canine has not erupted from more than one year from its normal chronological age of eruption as intraoral periapical radiograph examination will not always detect an impacted or transmigrated canine.
Asymmetry in development (mineralisation of permanent mandibular canine roots
Directory of Open Access Journals (Sweden)
Burić Mirjana V.
2012-01-01
Full Text Available Introduction. The development of the teeth is closely associated with the proper and unobstructed physical and psychological development of the child. Aim. To determine the existence of asymmetry in the development of the roots of the lower permanent canine teeth in different age groups of children of both sexes. Material and methods. The study was conducted on 523 ortopantomograms (253 boys and 270 girls of orthodontic patients aged 6 to 14 years of the Dental Clinic in Niš. We analyzed the development of asymmetry in the lower permanent canine root, using the method of Gleiser and Hunt, or the modification by Tijanić (1981. Results. It was found that asymmetry in the development of the root in both sexes of the lower canine teeth was present in 20 patients (3.82%, 10 boys (3.95% and 10 girls (3.70%. The difference is in the range of one stage. Asymmetric development of the roots of the lower incisors in girls and boys usually present in the 7th and 8th stages (60% in girls and in 50% in boys. In 90% of girls in developing asymmetry the root of the lower canine is present in a single stage, and in 10% of girls it presents within three stages. Asymmetric development of the root of the lower canine is the most common in the 7th and 8th stages of development (55%. Conclusion. Asymmetric root development of permanent lower canines was found in 3.82% of patients. More than half of respondents (55% had asymmetrical canine root development stage in half and three quarters of the total root length. The results of this study indicate that the canine is the tooth with very little variations in its development.
Orthodontic management of buccally erupted ectopic canine with two case reports
Directory of Open Access Journals (Sweden)
Avesh Sachan
2012-01-01
Full Text Available Ectopic canine teeth develop displaced from their normal position. Any permanent tooth can be ectopic, and the cause may be both genetic and environmental. Orthodontic treatment is justified because ectopic canine teeth can migrate in the jaw bone and may damage the adjacent teeth roots and bone. Orthodontic treatment is also justifiable for aesthetic reasons. Diagnosis and treatment of ectopically erupting permanent maxillary canines requires timely management by the orthodontist. Internal or external root resorption of teeth adjacent to the ectopic canine is the most common sequel. Malocclusion with severe crowding is difficult to treat without extraction. Non-extraction treatment of ectopic canines can compromise the patient′s profile. This article represents two cases of extraction treatment approach for buccally displaced or ectopic canine in a patient with severe crowding in the mandibular arch.
Retrospective radiation dosimetry using electron paramagnetic resonance in canine dental enamel
International Nuclear Information System (INIS)
Khan, Rao F.H.; Pekar, J.; Rink, W.J.; Boreham, D.R.
2005-01-01
Electron paramagnetic resonance (EPR) biodosimetry of human tooth enamel has been widely used for measuring radiation doses in various scenarios. We have now developed EPR dosimetry in tooth enamel extracted from canines. Molars and incisors from canines were cleaned by processing in supersaturated aqueous potassium hydroxide solution. The dosimetric signal in canine tooth enamel was found to increase linearly as a function of laboratory added dose from 0.44±0.02 to 4.42±0.22 Gy. The gamma radiation sensitivity of the canine molar enamel was found to be comparable to that of human tooth enamel. The dosimetric signal in canine enamel has been found to be stable up to at least 6 weeks after in vitro irradiation. A dosimetric signal variation of 10-25% was observed for canines ranging from in age 3 years to 16 year old
Canine parvovirus: current perspective.
Nandi, S; Kumar, Manoj
2010-06-01
Canine parvovirus 2 (CPV-2) has been considered to be an important pathogen of domestic and wild canids and has spread worldwide since its emergence in 1978. It has been reported from Asia, Australia, New Zealand, the Americas and Europe. Two distinct parvoviruses are now known to infect dogs-the pathogenic CPV-2 and CPV-1 or the minute virus of canine (MVC). CPV-2, the causative agent of acute hemorrhagic enteritis and myocarditis in dogs, is one of the most important pathogenic viruses with high morbidity (100%) and frequent mortality up to 10% in adult dogs and 91% in pups. The disease condition has been complicated further due to emergence of a number of variants namely CPV-2a, CPV-2b and CPV-2c over the years and involvement of domestic and wild canines. There are a number of different serological and molecular tests available for prompt, specific and accurate diagnosis of the disease. Further, both live attenuated and inactivated vaccines are available to control the disease in animals. Besides, new generation vaccines namely recombinant vaccine, peptide vaccine and DNA vaccine are in different stages of development and offer hope for better management of the disease in canines. However, new generation vaccines have not been issued license to be used in the field condition. Again, the presence of maternal antibodies often interferes with the active immunization with live attenuated vaccine and there always exists a window of susceptibility in spite of following proper immunization regimen. Lastly, judicious use of the vaccines in pet dogs, stray dogs and wild canids keeping in mind the new variants of the CPV-2 along with the proper sanitation and disinfection practices must be implemented for the successful control the disease.
Consequences of crown shortening canine teeth in Greenland sled dogs
DEFF Research Database (Denmark)
Kortegaard, H E; Anthony Knudsen, T; Dahl, S
2015-01-01
OBJECTIVES: To evaluate the consequences of crown shortening, focusing on the prevalence of pulp exposure and periapical pathology in Greenland sled dogs that had had their canine crowns shortened at an early age. METHODS: Five cadaver heads and 54 sled dogs underwent an oral examination for dental...... fractures and pulp exposure of canines. All canines were radiographed and evaluated for periapical pathology. RESULTS: The prevalence of canine pulp exposure in 12 (5 heads and 7 dogs) crown shortened dogs was 91 · 7%, and 21 · 3% in 47 not-crown shortened dogs. A significant (P pulp...... exposure of the canines in the crown shortened group compared to the not-crown shortened group was seen with a relative risk of 4 · 3 on a dog basis and a relative risk of 12 · 2 on a tooth basis. In dogs with pulp exposure of canines (n = 51) the prevalence of periapical pathology was 82 · 4%, but only 0...
Dental anomalies associated with buccally- and palatally-impacted maxillary canines.
Sajnani, Anand K; King, Nigel M
2014-08-01
The aim of the present study was to determine the association of both buccally- and palatally-impacted canines with other dental anomalies. This retrospective study was conducted on a population of 533 southern Chinese children and adolescents who had impacted maxillary canines that had been treated in the Paediatric Dentistry and Orthodontics Clinic, Prince Philip Dental Hospital, The University of Hong Kong, Hong Kong. Descriptions of the impacted canine and other associated anomalies were obtained from the case notes and radiographs. Clinical photographs and study casts were used, where available. A total of 253 (47.5%) patients with impacted maxillary canines were diagnosed with other dental anomalies. Microdontia was the most frequently-occurring anomaly reported in these patients, with the maxillary lateral incisor the most commonly affected tooth. Other odontogenic anomalies that were associated with both buccally- and palatally-impacted canines included hypodontia, supernumerary teeth, transposition of other teeth, enamel hypoplasia, other impacted teeth, and dens invaginatus. Both buccally- and palatally-impacted canines were found to be associated with other odontogenic anomalies. © 2013 Wiley Publishing Asia Pty Ltd.
SURVEILLANCE FOR ANTIBODIES AGAINST SIX CANINE VIRUSES IN WILD RACCOONS (PROCYON LOTOR) IN JAPAN.
Aoki, Emiko; Soma, Takehisa; Yokoyama, Mayumi; Matsubayashi, Makoto; Sasai, Kazumi
2017-10-01
Raccoons (Procyon lotor) are found worldwide. They are frequently seen in crowded inner cities as well as in forests or wooded areas, often living in proximity to humans and their pets. We examined sera from 100 wild raccoons in Japan for antibodies to six canine viruses with veterinary significance to assess their potential as reservoirs. We also aimed to understand the distribution of potentially infected wildlife. We found that 7% of samples were seropositive for canine distemper virus (CDV), 10% for canine parvovirus type 2, 2% for canine adenovirus type 1, 6% for canine adenovirus type 2, and 7% for canine coronavirus. No samples were found to be seropositive for canine parainfluenza virus. Seropositivity rates for canine distemper virus and canine parvovirus type 2 were significantly different between areas, and younger raccoons (Canis lupus familiaris), our results suggest that they can act as reservoirs for some of these important canine viruses and might be involved in viral transmission. Further study should include isolation and analysis of canine viruses in wild raccoons from a wider area.
Overexpression of vimentin in canine prostatic carcinoma
DEFF Research Database (Denmark)
Rodrigues, M M P; Rema, A; Gärtner, F
2011-01-01
Canine prostatic tumours exhibit similarities to those of man and may represent a useful model system to explore the mechanisms of cancer progression. Tumour progression to malignancy requires a change from an epithelial phenotype to a fibroblastic or mesenchymal phenotype. Vimentin expression...... is associated with the invasive phenotype of human prostate cancer cells. The aim of the present study was to characterize immunohistochemically the expression of vimentin by canine prostatic carcinomas. Primary carcinomas and metastatic tumour foci both showed vimentin expression. This finding suggests...... that the acquisition of the epithelial-mesenchymal transition phenotype in canine prostatic carcinoma may be characterized by the presence of mesenchymal intermediate filament (vimentin) that could lead to a higher likelihood of metastasis....
Vaccines for Canine Leishmaniasis
Directory of Open Access Journals (Sweden)
Faeze Foroughi-Parvar
2014-01-01
Full Text Available Leishmania infantum is the obligatory intracellular parasite of mammalian macrophages and causes zoonotic visceral leishmaniasis (ZVL. The presence of infected dogs as the main reservoir host of ZVL is regarded as the most important potential risk for human infection. Thus the prevention of canine visceral leishmaniasis (CVL is essential to stop the current increase of the Mediterranean visceral leishmaniasis. Recently considerable advances in achieving protective immunization of dogs and several important attempts for achieving an effective vaccine against CVL lead to attracting the scientists trust in its important role for eradication of ZVL. This paper highlights the recent advances in vaccination against canine visceral leishmaniasis from 2007 until now.
Upper canine inclination influences the aesthetics of a smile.
Bothung, C; Fischer, K; Schiffer, H; Springer, I; Wolfart, S
2015-02-01
This current study investigated which angle of canine inclination (angle between canine tooth axis (CA-line) and the line between the lateral canthus and the ipsilateral labial angle (EM-line)) is perceived to be most attractive in a smile. The second objective was to determine whether laymen and dental experts share the same opinion. A Q-sort assessment was performed with 48 posed smile photographs to obtain two models of neutral facial attractiveness. Two sets of images (1 male model set, 1 female model set), each containing seven images with incrementally altered canine and posterior teeth inclinations, were generated. The images were ranked for attractiveness by three groups (61 laymen, 59 orthodontists, 60 dentists). The images with 0° inclination, that is CA-line (maxillary canine axis) parallel to EM-line (the line formed by the lateral canthus and the ipsilateral corner of the mouth) (male model set: 54·4%; female model set: 38·9%), or -5° (inward) inclination (male model set: 20%; female model set: 29·4%) were perceived to be most attractive within each set. Images showing inward canine inclinations were regarded to be more attractive than those with outward inclinations. Dental experts and laymen were in accordance with the aesthetics. Smiles were perceived to be most attractive when the upper canine tooth axis was parallel to the EM-line. In reconstructive or orthodontic therapy, it is thus important to incline canines more inwardly than outwardly. © 2014 John Wiley & Sons Ltd.
Treatment modalities of palatal impacted canines
Dimova, Cena; Papakoca, Kiro; Ristoska, Sonja; Kovacevska, Ivona
2012-01-01
Introduction: The orthodontic treatment of impacted maxillary canine remains a challenge to today’s clinicians. The treatment of this clinical entity usually involves surgical exposure of the impacted tooth, followed by orthodontic traction to guide and align it into the dental arch. The impacted palatal canine requires a combination of both treatment modalities: orthodontic management and oral surgical treatment. Two types of approach are commonly used: simple exposure, or exposure with brac...
Oz, A Z; Ciger, S
2018-03-01
The aim of the present study was to evaluate the changes of incisor root resorption associated with impacted maxillary canines and health of periodontal tissues around maxillary canines erupted with orthodontic treatment. Twenty patients with a unilateral palatally impacted maxillary canine were included in the study. Cone-beam computed tomography images taken before and after orthodontic treatment were compared with the contralateral canines serving as control teeth. Root resorption was present in 10% of central and 40% of lateral incisors before treatment. After treatment, the incidence of resorption decreased. The thickness of the buccal bone surrounding the impacted canines was similar to that surrounding the contralateral canines, except in the apical area. Periodontal pocket depth and alveolar bone loss were greater for the impacted canine teeth than for the contralateral canines. Incisor root resorption associated with impacted canine teeth showed signs of repair after orthodontic treatment. Slight differences related to periodontal health were found between the previously impacted teeth and contralateral canine teeth.
Comprehensive characterization of commercially available canine training aids.
Tipple, Christopher A; Caldwell, Patricia T; Kile, Brian M; Beussman, Douglas J; Rushing, Blake; Mitchell, Natalie J; Whitchurch, Christian J; Grime, Martin; Stockham, Rex; Eckenrode, Brian A
2014-09-01
Effective and reliable training aids for victim recovery canine teams is essential for law enforcement and investigative purposes. Without adequate training aids, the rate of recovery for sub surface or surface human remains deposition using canine teams may be adversely affected and result in confusing information. The composition of three commercially available canine training aids that purportedly generate volatile components responsible for the odor of human decomposition is relatively simple and not closely related to those compounds experimentally determined to be present at the site of surface or sub-surface human remains. In this study, these different commercial formulations were chemically characterized using six different sampling approaches, including two applications of direct liquid injection, solid-phase microextraction (SPME), purge and trap, ambient preconcentration/thermal desorption, and cryogenic preconcentration/thermal desorption. Direct liquid injections resulted in the fewest number of detected compounds, while a cryogen based thermal desorption method detected the greatest number of compounds in each formulation. Based solely upon the direct liquid injection analysis, Pseudo™ Scent I was composed of approximately 29±4% and 71±5% of 2-pyrrolidinone and 4-aminobutanoic acid, respectively. This same analysis showed that Pseudo™ Scent II was composed of approximately 11±1, 11±1, 24±5, and 54±7% of putrescine, cadaverine, 2-pyrrolidinone, and 4-aminobutanoic acid, respectively. Headspace analysis was conducted to more closely simulate the process whereby a canine's nose would capture a volatiles profile. More compounds were detected using the headspace sampling method; however, the vast majority was not consistent with current data on human decomposition. Additionally, the three formulations were tested in outdoor and indoor scenarios by a double-blinded canine team, using a certified and specifically trained victim recovery canine
Mājas darbi angļu valodas stundās profesionālās vidusskolas skolēnu leksikas pilveidei
Zemskova, Nataļja
2010-01-01
Diplomdarbs tika izstrādāts, lai noskaidrotu, kā dažādi mājas darbi var pilnveidot studentu vārdu krājumu angļu valodas stundās profesionālajās vidusskolās. Mājasdarbi ir skolotāju un skolēnu ikdienas rutīna. Skolotājiem ir dažāda attieksme pret mājasdarbiem, bet skolēni sūdzas, ka mājasdarbi ir garlaicīgi un bezjēdzīgi. Diplomdarba mērķis bija izpētīt, kā skolēni var bagātināt savu profesionālo vārdu krājumu, pildot angļu valodas mājasdarbu profesionālajā vidusskolā. La...
Rika-Heke, Tamara; Kelman, Mark; Ward, Michael P
2015-07-01
The aim of this study was to describe the association between climate, weather and the occurrence of canine tick paralysis, feline tick paralysis and canine parvovirus in Australia. The Southern Oscillation Index (SOI) and monthly average rainfall (mm) data were used as indices for climate and weather, respectively. Case data were extracted from a voluntary national companion animal disease surveillance resource. Climate and weather data were obtained from the Australian Government Bureau of Meteorology. During the 4-year study period (January 2010-December 2013), a total of 4742 canine parvovirus cases and 8417 tick paralysis cases were reported. No significant (P ≥ 0.05) correlations were found between the SOI and parvovirus, canine tick paralysis or feline tick paralysis. A significant (P parvovirus occurrence and rainfall in the same month (0.28), and significant negative cross-correlations (-0.26 to -0.36) between parvovirus occurrence and rainfall 4-6 months previously. Significant (P canine tick paralysis occurrence and rainfall 1-3 months previously, and significant positive cross-correlations (0.29-0.47) between canine tick paralysis occurrence and rainfall 7-10 months previously. Significant positive cross-correlations (0.37-0.68) were found between cases of feline tick paralysis and rainfall 6-10 months previously. These findings may offer a useful tool for the management and prevention of tick paralysis and canine parvovirus, by providing an evidence base supporting the recommendations of veterinarians to clients thus reducing the impact of these diseases. Copyright © 2015 Elsevier Ltd. All rights reserved.
Evaluation of post-vaccination immunity to canine distemper and ...
African Journals Online (AJOL)
SERVER
2007-08-20
Aug 20, 2007 ... Key words: Immunoblot ELISA, post-vaccination immunity, canine distemper, parvoviruses. INTRODUCTION. Canine ..... NGOs and other government agencies to fund and intensify ... Vaccination Programs for Dogs. In: recent ...
Canine as a biomedical research model: immunological, hematological, and oncological aspects
International Nuclear Information System (INIS)
Shifrine, M.; Wilson, F.D.
1980-01-01
The canine has been used as a biomedical research model in radiation studies by a number of laboratories supported primarily by the US Department of Energy and its predecessors. These studies were unique in that they covered the life spans of the canines and permitted the collection of data from birth to death under controlled conditions. Since these were multiparametric studies, an extensive data base has been established, not the least of which are normative values covering all biologic systems, including immunohematology. The canine model has also been extensively used by other groups, such as transplantation biologists. The virtues of the canine as a model in these and many other endeavors are becoming increasingly more apparent with the passing of time. One of the primary goals of this volume was to compile the knowledge and experience of researchers using the canine model and to focus their expertise on furthering the use of the canine for studies in immunology, hematology, and oncology. We have attempted to present some of the contemporary, diverse uses of the canine in biomedical research, emphasizing immunologic endpoints, and also to present in detail some of the latest technology used in such studies
... always take your medicine as directed. Alternative Names Renal transplant; Transplant - kidney Patient Instructions Kidney removal - discharge Images Kidney anatomy Kidney - blood and urine flow Kidneys Kidney transplant - ...
Bagshaw, Clarence; Isdell, Allen E; Thiruvaiyaru, Dharma S; Brisbin, I Lehr; Sanchez, Susan
2014-06-01
More than thirty years have passed since canine parvovirus (CPV) emerged as a significant pathogen and it continues to pose a severe threat to world canine populations. Published information suggests that flies (Diptera) may play a role in spreading this virus; however, they have not been studied extensively and the degree of their involvement is not known. This investigation was directed toward evaluating the vector capacity of such flies and determining their potential role in the transmission and ecology of CPV. Molecular diagnostic methods were used in this cross-sectional study to detect the presence of CPV in flies trapped at thirty-eight canine facilities. The flies involved were identified as belonging to the house fly (Mucidae), flesh fly (Sarcophagidae) and blow/bottle fly (Calliphoridae) families. A primary surveillance location (PSL) was established at a canine facility in south-central South Carolina, USA, to identify fly-virus interaction within the canine facility environment. Flies trapped at this location were pooled monthly and assayed for CPV using polymerase chain reaction (PCR) methods. These insects were found to be positive for CPV every month from February through the end of November 2011. Fly vector behavior and seasonality were documented and potential environmental risk factors were evaluated. Statistical analyses were conducted to compare the mean numbers of each of the three fly families captured, and after determining fly CPV status (positive or negative), it was determined whether there were significant relationships between numbers of flies captured, seasonal numbers of CPV cases, temperature and rainfall. Flies were also sampled at thirty-seven additional canine facility surveillance locations (ASL) and at four non-canine animal industry locations serving as negative field controls. Canine facility risk factors were identified and evaluated. Statistical analyses were conducted on the number of CPV cases reported within the past year
Directory of Open Access Journals (Sweden)
Sophia Pfahler
Full Text Available A genome-wide association study for canine hip dysplasia (CHD and canine elbow dysplasia (CED using the Illumina canine high density bead chip had been performed for 174 Bernese mountain dogs. General and mixed linear model analysis identified two different regions with single nucleotide polymorphisms (SNPs on dog chromosome (CFA 14 significantly associated with CHD and a further significantly CHD-associated region on CFA37. For CED, four SNPs on CFA11 and 27 were significantly associated. The identified SNPs of four associated regions included nearby candidate genes. These possible positional candidates were the genes PON2 on CFA14 and FN1 on CFA37 for CHD and the genes LMNB1 on CFA11 and WNT10B on CFA27 for CED.
Feeding ecology and morphology of the upper canines in bears (carnivora: Ursidae).
Christiansen, Per
2008-07-01
The morphology and mechanical strength of the upper canines in all eight extant species of ursids is analyzed, and the findings are discussed in relation to feeding ecology. Ursids have proportionally smaller canines than other large carnivores with a specialized feeding ecology, such as large felids, and the upper canine morphology is both canid-like and felid-like. The giant panda is the most divergent species, and its short, blunt, and cone-like canines appear well adapted for tearing into bamboo. The almost equally herbivorous spectacled bear has a less derived canine morphology. The large canines of the sun bear are divergent from other ursine ursids, and may be an adaptation for tearing open tree trunks in search of insects. Discriminant Analysis is successful in separating ursid species on the basis of canine morphology, but the canines of ursine ursids, and also of the spectacled bear, show greater resemblance among the species than the marked differences in feeding ecology would suggest. This could be in part due to a short evolutionary history, and in part due to canines not having been subjected to much evolutionary selection as has been the case among other large carnivores, such as large felids. Ursids are probably evolutionarily and ecologically successful due to physical size and strength rather than a derived craniodental anatomy. Copyright 2008 Wiley-Liss, Inc.
Canine length in wild male baboons: maturation, aging and social dominance rank.
Directory of Open Access Journals (Sweden)
Jordi Galbany
Full Text Available Canines represent an essential component of the dentition for any heterodont mammal. In primates, like many other mammals, canines are frequently used as weapons. Hence, tooth size and wear may have significant implications for fighting ability, and consequently for social dominance rank, reproductive success, and fitness. We evaluated sources of variance in canine growth and length in a well-studied wild primate population because of the potential importance of canines for male reproductive success in many primates. Specifically, we measured maxillary canine length in 80 wild male baboons (aged 5.04-20.45 years from the Amboseli ecosystem in southern Kenya, and examined its relationship with maturation, age, and social dominance rank. In our analysis of maturation, we compared food-enhanced baboons (those that fed part time at a refuse pit associated with a tourist lodge with wild-feeding males, and found that food-enhanced males achieved long canines earlier than wild-feeding males. Among adult males, canine length decreased with age because of tooth wear. We found some evidence that, after controlling for age, longer canines were associated with higher adult dominance rank (accounting for 9% of the variance in rank, but only among relatively high-ranking males. This result supports the idea that social rank, and thus reproductive success and fitness, may depend in part on fighting ability mediated by canine size.
Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Saito, Miyoko; Lynch, Jonathan; Sahara, Hiroeki
2012-10-01
The objective of this study was to determine whether post-vaccination antibody titers vary according to body weight in adult dogs. Antibody titers against canine parvovirus type 2 (CPV-2), canine distemper virus (CDV), and canine adenovirus type 1 (CAdV-1) were measured for 978 domestic adult dogs from 2 to 6 y of age. The dogs had been vaccinated approximately 12 mo earlier with a commercial combination vaccine. The dogs were divided into groups according to their weight. It was found that mean antibody titers in all weight groups were sufficient to prevent infection. Intergroup comparison, however, revealed that CPV-2 antibody titers were significantly higher in the Super Light ( 20 kg) groups and were also significantly higher in the Light (5 to 9.9 kg) group than in the Heavy group. Antibody titers against CDV were significantly higher in the Super Light, Light, and Medium groups than in the Heavy group. There were no significant differences among the groups for the CAdV-1 antibody titers.
IQGAP1 is an oncogenic target in canine melanoma.
Directory of Open Access Journals (Sweden)
Becky H Lee
Full Text Available Canine oral mucosal melanoma is an aggressive malignant neoplasm and is characterized by local infiltration and a high metastatic potential. The disease progression is similar to that of human oral melanomas. Whereas human cutaneous melanoma is primarily driven by activating mutations in Braf (60% or Nras (20%, human mucosal melanoma harbors these mutations much less frequently. This makes therapeutic targeting and research modeling of the oral form potentially different from that of the cutaneous form in humans. Similarly, research has found only rare Nras mutations and no activating Braf mutations in canine oral melanomas, but they are still reliant on MAPK signaling. IQGAP1 is a signaling scaffold that regulates oncogenic ERK1/2 MAPK signaling in human Ras- and Raf- driven cancers, including melanomas. To investigate whether IQGAP1 is a potential target in canine melanoma, we examined the expression and localization of IQGAP1 in primary canine melanomas and canine oral melanoma cell lines obtained from the University of California-Davis. Using CRISPR/Cas9 knockout of IQGAP1, we examined effects on downstream ERK1/2 pathway activity and assayed proliferation of cell lines when treated with a peptide that blocks the interaction between IQGAP1 and ERK1/2. We observed that canine IQGAP1 is expressed and localizes to a similar extent in both human and canine melanoma by qPCR, Western blot, and immunofluorescence. Deletion of IQGAP1 reduces MAPK pathway activation in cell lines, similar to effects seen in human BrafV600E cell lines. Additionally, we demonstrated reduced proliferation when these cells are treated with a blocking peptide in vitro.
Expression and function of survivin in canine osteosarcoma.
Shoeneman, Jenette K; Ehrhart, E J; Eickhoff, Jens C; Charles, J B; Powers, Barbara E; Thamm, Douglas H
2012-01-01
Osteosarcoma has a high mortality rate and remains in need of more effective therapeutic approaches. Survivin is an inhibitor of apoptosis family member protein that blocks apoptosis and drives proliferation in human cancer cells where it is commonly elevated. In this study, we illustrate the superiority of a canine osteosarcoma model as a translational tool for evaluating survivin-directed therapies, owing to the striking similarities in gross and microscopic appearance, biologic behavior, gene expression, and signaling pathway alterations. Elevated survivin expression in primary canine osteosarcoma tissue correlated with increased histologic grade and mitotic index and a decreased disease-free interval (DFI). Survivin attenuation in canine osteosarcoma cells inhibited cell-cycle progression, increased apoptosis, mitotic arrest, and chemosensitivity, and cooperated with chemotherapy to significantly improve in vivo tumor control. Our findings illustrate the utility of a canine system to more accurately model human osteosarcoma and strongly suggest that survivin-directed therapies might be highly effective in its treatment. ©2011 AACR.
American Canine Hepatozoonosis
Ewing, S. A.; Panciera, R. J.
2003-01-01
American canine hepatozoonosis (ACH) is a tick-borne disease that is spreading in the southeastern and south-central United States. Characterized by marked leukocytosis and periosteal bone proliferation, ACH is very debilitating and often fatal. Dogs acquire infection by ingesting nymphal or adult Gulf Coast ticks (Amblyomma maculatum) that, in a previous life stage, ingested the parasite in a blood meal taken from some vertebrate intermediate host. ACH is caused by the apicomplexan Hepatozoon americanum and has been differentiated from Old World canine hepatozoonosis caused by H. canis. Unlike H. canis, which is transmitted by the ubiquitous brown dog tick (Rhipicephalus sanguineus), H. americanum is essentially an accidental parasite of dogs, for which Gulf Coast ticks are not favored hosts. The geographic portrait of the disease parallels the known distribution of the Gulf Coast tick, which has expanded in recent years. Thus, the endemic cycle of H. americanum involves A. maculatum as definitive host and some vertebrate intermediate host(s) yet to be identified. Although coyotes (Canis latrans) are known to be infected, it is not known how important this host is in maintaining the endemic cycle. This review covers the biology of the parasite and of the tick that transmits it and contrasts ACH with classical canine hepatozoonosis. Clinical aspects of the disease are discussed, including diagnosis and treatment, and puzzling epidemiologic issues are examined. Brief consideration is given to the potential for ACH to be used as a model for study of angiogenesis and of hypertrophic osteoarthropathy. PMID:14557294
National clinical guidelines for management of the palatally ectopic maxillary canine.
Husain, J; Burden, D; McSherry, P; Morris, D; Allen, M
2012-08-01
This review summarises updated clinical guidelines produced by the Clinical Standards Committee of the Faculty of Dental Surgery, Royal College of Surgeons of England (FDSRCS). This guideline on the management of the palatally ectopic maxillary canine illustrates the information contained in the recently updated online version. The timely recognition of ectopic canines is important for the overall management of the dentition. This review illustrates five management strategies for ectopic permanent canines: interceptive treatment by extraction of the deciduous canine, surgical exposure and orthodontic alignment, surgical removal of the palatally ectopic permanent canine, auto-transplantation and no active treatment/leave and observe. The current available evidence for each of these management options has been evaluated and awarded a grade used by the Scottish Intercollegiate Guidelines Network.
Orthodontic-surgical treatment of four impacted canines in an adult patient: A case report.
Pavlović, Jasna; Tabaković, Saša Z; Simić, Sanja; Vujačić, Amila; Vukićević, Vladanka
2016-07-01
Full impaction of canines, in both jaws, is a rare phenomenon. It is usually coupled with the persistence of deciduous canines, or any other irregularity in the dental arch. Panoramic radiograph of a 24-year-old female patient showed bilateral canine impaction in both jaws. Due to vestibular, apical and medial position of canines in the upper jaw, the surgical approach implied the apically positioned flap technique. The position of impacted mandibular canines was vertical with more coronal position relative to the upper canines, thus requiring a closed eruption technique. Inadequate position of impacted canines in the bone fully justifies the use of orthodontic-surgical treatment.
Extreme Beta-Cell Deficiency in Pancreata of Dogs with Canine Diabetes.
Directory of Open Access Journals (Sweden)
Emily J Shields
Full Text Available The pathophysiology of canine diabetes remains poorly understood, in part due to enigmatic clinical features and the lack of detailed histopathology studies. Canine diabetes, similar to human type 1 diabetes, is frequently associated with diabetic ketoacidosis at onset or after insulin omission. However, notable differences exist. Whereas human type 1 diabetes often occurs in children, canine diabetes is typically described in middle age to elderly dogs. Many competing theories have been proposed regarding the underlying cause of canine diabetes, from pancreatic atrophy to chronic pancreatitis to autoimmune mediated β-cell destruction. It remains unclear to what extent β-cell loss contributes to canine diabetes, as precise quantifications of islet morphometry have not been performed. We used high-throughput microscopy and automated image processing to characterize islet histology in a large collection of pancreata of diabetic dogs. Diabetic pancreata displayed a profound reduction in β-cells and islet endocrine cells. Unlike humans, canine non-diabetic islets are largely comprised of β-cells. Very few β-cells remained in islets of diabetic dogs, even in pancreata from new onset cases. Similarly, total islet endocrine cell number was sharply reduced in diabetic dogs. No compensatory proliferation or lymphocyte infiltration was detected. The majority of pancreata had no evidence of pancreatitis. Thus, canine diabetes is associated with extreme β-cell deficiency in both new and longstanding disease. The β-cell predominant composition of canine islets and the near-total absence of β-cells in new onset elderly diabetic dogs strongly implies that similar to human type 1 diabetes, β-cell loss underlies the pathophysiology of canine diabetes.
Management of an Unusual Ectopic Eruption of Maxillary Canine.
Aileni, Kaladhar Reddy; Rachala, Madhukar Reddy; Prathima, Chintakunta Reddy; Naveen, Pitalla Kumar; Soujanya, Donthula
2017-05-01
Transposition of teeth is a rare condition, with a prevalence of 0.3-0.4% in general population. They are more commonly observed in females, and may occur unilaterally/bilaterally with greater frequency of left side occurrence in unilateral transposition cases. A 17-year-old female patient reported with the chief complaint of unaesthetic smile. On clinical examination the patient was diagnosed with Angle's class I malocclusion with an ectopically erupted maxillary left canine labial to the left central incisor with retained deciduous canine. The treatment plan decided was to extract the retained deciduous canine, level and align the ectopic canine using an R-loop. The treatment for the patient was finished in 14 months and was retained using a fixed lingual retainer in the upper and lower arches.
Functional and morphologic damage in the neonatally irradiated canine kidney
International Nuclear Information System (INIS)
Peneyra, R.S.; Jaenke, R.S.
1985-01-01
Perinatal irradiation of the developing kidney results in progressive glomerulosclerosis (PGS) and renal failure. This syndrome may result from direct radiation damage to mature deep cortical nephrons and/or nephron functional adaptations resulting from outer cortical nephron ablation. Beagle dogs received single, whole-body exposures (330 R) to 60 Co gamma radiation at 4 days of age (IR4) to study the combined effects of direct radiation damage and nephron loss, or at 30 days of age (IR30) to study the effects of renal irradiation alone. To study the effects of nephron loss alone, dogs underwent unilateral nephrectomy (UN4) or superficial hyperthermic renal ablation (HY4) at 4 days of age. Nephron loss due to irradiation (IR4) and partial renal ablation (UN4 and HY4) was associated with compensatory nephron hypertrophy and increased single nephron glomerular filtration rate (SNGFR), while irradiation at 30 days resulted in transitory decreased SNGFR. Similar degrees of PGS occurred in IR4 dogs which experienced both irradiation and loss of nephrons and UN4 and HY4 dogs which experienced only loss of nephrons. PGS of lesser severity also occurred in IR30 dogs. These findings indicate that PGS associated with perinatal renal irradiation results from direct radiation damage to deep cortical nephrons and compensatory functional changes occurring in response to loss of renal mass
Cardiac involvement in canine babesiosis : review article
Directory of Open Access Journals (Sweden)
R.G. Lobetti
2005-06-01
Full Text Available Cardiac dysfunction in canine babesiosis has traditionally been regarded as a rare complication, with the majority of lesions reported as incidental findings at post-mortem examination. Recent studies have, however, demonstrated cardiac lesions in canine babesiosis. Cardiac troponins, especially troponin I, are sensitive markers of myocardial injury in canine babesiosis, and the magnitude of elevation of plasma troponin I concentrations appears to be proportional to the severity of the disease. ECG changes in babesiosis are similar to the pattern described for myocarditis and myocardial ischaemia and together with histopathological findings indicate that the heart suffers from the same pathological processes described in other organs in canine babesiosis, namely inflammation and hypoxia. The clinical application of the ECG appears to be limited and thus cardiovascular assessment should be based on functional monitoring rather than an ECG tracing. On cardiac histopathology from dogs that succumbed to babesiosis, haemorrhage, necrosis, inflammation and fibrin microthrombi in the myocardium were documented, all of which would have resulted in ECG changes and elevations in cardiac troponin. Myocardial damage causes left ventricular failure, which will result in hypotension and an expansion of the plasma volume due to homeostatic mechanisms.
The Ondersteport Canine distemper virus strain and measles ...
African Journals Online (AJOL)
Three groups of dogs aged three months each were used in an experiment to assess efficacy of imported Canine distemper vaccine (Ondersteport strain) and measles vaccine in protecting Nigerian dogs against local isolates of Canine distemper virus. Each group consisted of four randomly selected puppies. One group ...
Management of an impacted and transposed maxillary canine
Directory of Open Access Journals (Sweden)
Deepti A
2010-03-01
Full Text Available Maxillary canine-lateral incisor transposition is a relatively rare anomaly, with both dental and facial esthetic implications. This is a case report of a maxillary canine-lateral incisor transposition that was successfully treated by surgical-orthodontic treatment followed by esthetic reshaping of the involved teeth.
Canine treatment with SnET2 for photodynamic therapy
Frazier, Donita L.; Milligan, Andrew J.; Vo-Dinh, Tuan; Morgan, Alan R.; Overholt, Bergein F.
1990-07-01
Photodynamic therapy is a treatment technique that utilizes the photoactived species of a drug to destroy tumor tissue. To be successful, the drug must localize in tumor tissue preferentially over normal tissue and must be activated by light of a specific wavelength. Currently the only drug to be approved for clinical use is Heinatoporphyrin Derivative (HpD) although a series of new drugs are being developed for use in the near future. One of the drugs belongs to a class called purpurins which display absorp-' tions between 630-711 nm. Along with several other investigators, we are currently exploring the characteristics of a specific purpurin (SnET2) in normal and tumorous canine tissue. The use of this compound has demonstrated increased tumor control rates in spontaneous dog tumors. Preliminary pharmacokinetic studies have been performed on 6 normal beagle dogs. SnET2 (2 mg/kg) was injected intravenously over 10 minutes and blood was collected at 5, 15, 30, 45 minutes and at 1, 2, 4, 8, 12 and 24 hours following administration for determination of drug concentration and calculation of pharinacokinetic parameters. Skin biopsies were collected at 1, 4, 8, 12 and 24 hours. Dogs were euthanized at 24 hours and tissues (liver, kidney muscle, esophagus, stomach, duodenum, jejunum, ileura, colon, adrenal gland, thyroid, heart, lung, urinary bladder, prostate, pancreas, eye, brain) were collected for drug raeasurement. Drug was shown to persist in liver and kidney for a prolonged period of time coiapared to other tissues. Knowledge of the pharmacokinetic properties of the drug will greatly add to the ability to treat patients with effective protocols.
Upadhyay, B P; Ghimire, P; Tashiro, M; Banjara, M R
Background Seasonal influenza is one of the increasing public health burdens in Nepal. Objective The objective of this study was to isolate and characterize the influenza virus type and subtypes of Nepal. Method A total of 1536 throat swab specimens were collected from January to December 2012. Total ribonucleic acid was extracted using Qiagen viral nucleic acid extraction kit and polymerase chain reaction assay was performed following the US; CDC Real-time PCR protocol. Ten percent of positive specimens were inoculated onto Madin-Darby Canine Kidney cells. Isolates were characterized by using reference ferret antisera. Result Of the total specimens (n=1536), influenza virus type A was detected in 196 (22%) cases; of which 194 (99%) were influenza A (H1N1) pdm09 and 2 (1 %) were influenza A/H3 subtype. Influenza B was detected in 684 (76.9%) cases. Influenza A (H1N1) pdm09, A/H3 and influenza B virus were antigenically similar to the recommended influenza virus vaccine candidate of the year 2012. Although sporadic cases of influenza were observed throughout the year, peak was observed during July to November. Conclusion Similar to other tropical countries, A (H1N1) pdm09, A/H3 and influenza B viruses were co-circulated in Nepal.
Urra, Javier; Sandoval, Moisés; Cornejo, Isabel; Barros, L Felipe; Sepúlveda, Francisco V; Cid, L Pablo
2008-10-01
Extracellular pH, especially in relatively inaccessible microdomains between cells, affects transport membrane protein activity and might have an intercellular signaling role. We have developed a genetically encoded extracellular pH sensor capable of detecting pH changes in basolateral spaces of epithelial cells. It consists of a chimerical membrane protein displaying concatenated enhanced variants of cyan fluorescence protein (ECFP) and yellow fluorescence protein (EYFP) at the external aspect of the cell surface. The construct, termed pHCECSensor01, was targeted to basolateral membranes of Madin-Darby canine kidney (MDCK) cells by means of a sequence derived from the aquaporin AQP4. The fusion of pH-sensitive EYFP with pH-insensitive ECFP allows ratiometric pH measurements. The titration curve of pHCECSensor01 in vivo had a pK (a) value of 6.5 +/- 0.04. Only minor effects of extracellular chloride on pHCECSensor01 were observed around the physiological concentrations of this anion. In MDCK cells, the sensor was able to detect changes in pH secondary to H(+) efflux into the basolateral spaces elicited by an ammonium prepulse or lactate load. This genetically encoded sensor has the potential to serve as a noninvasive tool for monitoring changes in extracellular pH microdomains in epithelial and other tissues in vivo.
Radiolabelling and PET brain imaging of the α1-adrenoceptor antagonist Lu AE43936
International Nuclear Information System (INIS)
Risgaard, Rune; Ettrup, Anders; Balle, Thomas; Dyssegaard, Agnete; Hansen, Hanne Demant; Lehel, Szabolcs; Madsen, Jacob; Pedersen, Henrik; Püschl, Ask; Badolo, Lassina; Bang-Andersen, Benny; Knudsen, Gitte Moos; Kristensen, Jesper Langgaard
2013-01-01
Cerebral α 1 -adrenoceptors are a common target for many antipsychotic drugs. Thus, access to positron emission tomography (PET) brain imaging of α 1 -adrenoceptors could make important contributions to the understanding of psychotic disorders as well as to the pharmacokinetics and occupancy of drugs targeting the α 1 -adrenoceptors. However, so far no suitable PET radioligand has been developed for brain imaging of α 1 -adrenoceptors. Here, we report the synthesis of both enantiomers of the desmethyl precursors of the high affinity α 1 -adrenoceptor ligand Lu AE43936 (). The two enantiomers of were subsequently [ 11 C] radiolabelled and evaluated for brain uptake and binding by PET imaging in Danish Landrace pigs. (S)-[ 11 C]- and (R)-[ 11 C]- showed very limited brain uptake. Pre-treatment with cyclosporine A (CsA) resulted in a large increase in brain uptake, indicating that (R)-[ 11 C]- is a substrate for active efflux-transporters. This was confirmed in Madin Darby canine kidney (MDCK) cells overexpressing permeability glycoprotein (Pgp). In conclusion, the limited brain uptake of both (S)-[ 11 C]- and (R)-[ 11 C]- in the pig brain necessitates the search for alternative radioligands for in vivo PET brain imaging of α 1 -adrenoceptors.
Martello, Federico; Tocchio, Alessandro; Tamplenizza, Margherita; Gerges, Irini; Pistis, Valentina; Recenti, Rossella; Bortolin, Monica; Del Fabbro, Massimo; Argentiere, Simona; Milani, Paolo; Lenardi, Cristina
2014-03-01
Poly(amido-amine) (PAA) hydrogels containing the 2,2-bisacrylamidoacetic acid-4-amminobutyl guanidine monomeric unit have a known ability to enhance cellular adhesion by interacting with the arginin-glycin-aspartic acid (RGD)-binding αVβ3 integrin, expressed by a wide number of cell types. Scientific interest in this class of materials has traditionally been hampered by their poor mechanical properties and restricted range of degradation rate. Here we present the design of novel biocompatible, RGD-mimic PAA-based hydrogels with wide and tunable degradation rates as well as improved mechanical and biological properties for biomedical applications. This is achieved by radical polymerization of acrylamide-terminated PAA oligomers in both the presence and absence of 2-hydroxyethylmethacrylate. The degradation rate is found to be precisely tunable by adjusting the PAA oligomer molecular weight and acrylic co-monomer concentration in the starting reaction mixture. Cell adhesion and proliferation tests on Madin-Darby canine kidney epithelial cells show that PAA-based hydrogels have the capacity to promote cell adhesion up to 200% compared to the control. Mechanical tests show higher compressive strength of acrylic chain containing hydrogels compared to traditional PAA hydrogels. Copyright © 2013 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Ladino, C.A.
1988-01-01
The antitumor agent Hadacidin (H), N-formyl-hydroxyamino-acetic acid, reversibly inhibited the multiplication of clone 4 Madin-Darby canine kidney (MDCK) cells at a 4 mM concentration within 24-48 hours. Treated cells were arrested in the S phase of the cell cycle. Accompanying this action was a 16-fold increase in the area occupied b the cells and a refractoriness to trypsin treatment. To test whether this effect was due to an increase in tight junction integrity, electrical resistance (TER) was measured across H-treated monolayers. Addition of H at the onset of junction formation reversibly prevented the development of TER. ATP and cAMP levels were decreased by H, as well as the rate of [ 3 H]-leucine incorporation into protein. When 1 mM dibutyryl-cAMP (d.cAMP) and theophylline were added, H had no effect on cell division or protein synthesis, and TER was partially restored. The addition of 1 mM d.cAMP and 1 mM theophylline to control cultures decreased TER, indicating a biphasic effect on TER development/maintenance. In a separate study, the effect of sterol depletion on tight junctions formation/maintenance in wild-type MDCK cells was investigated
Castillon, Guillaume Alain; Michon, Laetitia; Watanabe, Reika
2013-06-01
Most glycosylphosphatidylinositol-anchored proteins (GPI-APs) are located at the apical surface of epithelial cells. The apical delivery of GPI-APs is believed to result from their association with lipid rafts. We find that overexpression of C-terminally tagged PGAP3 caused predominant production of lysoGPI-APs, an intermediate precursor in the GPI lipid remodeling process in Madin-Darby canine kidney cells. In these cells, produced lysoGPI-APs are not incorporated into detergent-resistant membranes (DRMs) but still are delivered apically, suggesting that GPI-AP association with DRMs is not necessary for apical targeting. In contrast, apical transport of both fully remodeled and lyso forms of GPI-APs is dependent on N-glycosylation, confirming a general role of N-glycans in apical protein transport. We also find that depletion of cholesterol causes apical-to-basolateral retargeting not only of fully remodeled GPI-APs, but also of lysoGPI-APs, as well as endogenous soluble and transmembrane proteins that would normally be targeted to the apical membrane. These findings confirm the essential role for cholesterol in the apical protein targeting and further demonstrate that the mechanism of cholesterol-dependent apical sorting is not related to DRM association of GPI-APs.
Aspects and clinical procedures of eruptive changes of permanent upper canines
Directory of Open Access Journals (Sweden)
Sheila Marcia Francisco
2012-04-01
Full Text Available INTRODUCTION: Even though the upper canine is the tooth that presents most eruption anomalies, after the third molars, canine retention prevalence in the population is quite low. Local, physiologic and pathologic factors can provide difficulties for the tooth eruptive process. The correct diagnosis in trying to prevent upper canine retention with ectopic eruption is fundamental to choose the ideal treatment, which can be performed by various methods. OBJECTIVE: The present paper has the purpose of approaching aspects related to impacted upper permanent canines by a literature review, including localization and treatment conducts.
A randomized clinical study of two interceptive approaches to palatally displaced canines.
Baccetti, Tiziano; Leonardi, Maria; Armi, Pamela
2008-08-01
This study evaluated the effectiveness of two interceptive approaches to palatally displaced canines (PDC), i.e. extraction of the primary canines alone or in association with the use of a cervical-pull headgear. The randomized prospective design comprised 75 subjects with PDC (92 maxillary canines) who were randomly assigned to three groups: extraction of the primary canine only (EG), extraction of the primary canine and cervical-pull headgear (EHG), and an untreated control group (CG). Panoramic radiographs were evaluated at the time of initial observation (T1) and after an average period of 18 months (T2). At T2, an evaluation of the success of canine eruption was undertaken. Between-group statistical comparisons, Kruskal-Wallis test with Bonferroni correction, were performed on the T1-T2 changes of the diagnostic parameters on panoramic radiographs and the prevalence rates of success in canine eruption. A superimposition study on lateral cephalograms at T1 and T2 was carried out to evaluate the changes in the sagittal position of the upper molars in the three groups. The removal of the primary canine as an isolated measure to intercept palatal displacement of maxillary canines showed a success rate of 65.2 per cent, which was significantly greater than that in the untreated controls (36 per cent). The additional use of a headgear resulted in successful eruption in 87.5 per cent of the subjects, with a significant improvement in the measurements for intraosseous canine position. The cephalometric superimposition study showed a significant mesial movement of the upper first molars in the CG and EG when compared with the EHG.
International Nuclear Information System (INIS)
Meyers, K.M.; Boehme, M.; Inbar, O.
1982-01-01
Endotoxin from Escherichia coli O127:B8, Salmonella abortus-equi and S minnesota induced clumping of some canine platelets (PLT) at a final endotoxin concentration of 1 microgram/ml. Endotoxin-induced clumping of canine PLT was independent of PLT energy-requiring processes, because clumping was observed with canine PLT incubated with 2-deoxy-D-glucose and antimycin A. The PLT responded to adenosine diphosphate before, but not after, incubation with the metabolic inhibitors. Endotoxin induced a slight and inconsistant clumping of bovine and equine PLT at high (mg/ml) endotoxin concentration. High-affinity binding sites could not be demonstrated on canine, bovine, and equine PLT, using 125 I-labeled E coli O127:B8 endotoxin. Nonspecific binding was observed and appeared to be due primarily to an extraneous coat on the PLT surface that was removed by gel filtration. The endotoxin that was bound to PLT did not appear to modify PLT function. An attempt to identify plasma proteins that bound physiologically relevant amounts of endotoxin was not successful. The significance of the endotoxin-induced clumping or lack of it on the pathophysiology of endotoxemia is discussed
Morphology of palatally impacted canines: A case-controlled cone-beam volumetric tomography study.
Hettiarachchi, Pilana Vithanage Kalani Shihanika; Olive, Richard John; Monsour, Paul
2017-02-01
The aim of this study was to investigate the relationships between an apical curvature or a hook and the crown/root ratio in subjects with and without palatally impacted maxillary canines. An experimental group of 44 patients (17 boys, 27 girls; mean age, 13.6 years) with 59 palatally impacted maxillary canines was selected from the records of patients referred to a radiology practice for cone-beam imaging. If a patient had bilateral palatally impacted canines, 1 canine was randomly selected for analysis. The palatally impacted canine group was matched for age and sex with 49 normal subjects (25 boys, 24 girls; mean age, 13.2 years) with 98 canines. Cone-beam DICOM files were imported into In Vivo imaging software (version 5.3; Anatomage, San Jose, Calif) for analysis. The angulations and linear variables of the maxillary canines were measured by using the software measurement tools. Chi-square and independent t tests were used to test for differences between the groups. The presence of a hook at the apical third and other root curvature were significantly different between the 2 groups (P <0.001 and P <0.05, respectively). Of the 44 palatally impacted canines, 16 (36.4%) had an apical hook and only 1 canine in the control group had an apical hook (1.0%). The mean root length of the palatally impacted canines was 2.66 mm shorter (P <0.001), and the mean crown/root ratio was significantly greater for the palatally impacted canines compared with the nonimpacted group (P <0.001). Palatally impacted canines have a greater tendency to develop apical hooks and are less likely to develop other root curvatures than are nonimpacted canines. Also, they have shorter roots resulting in larger crown/root ratios compared with the control group. Copyright © 2017 American Association of Orthodontists. Published by Elsevier Inc. All rights reserved.
Canine detection of free-ranging brown treesnakes on Guam
Savidge, J.A.; Stanford, J.W.; Reed, R.N.; Haddock, G.R.; Adams, A.A.Y.
2011-01-01
We investigated canine teams (dogs and their handlers) on Guam as a potential tool for finding invasive brown treesnakes (Boiga irregularis) in the wild. Canine teams searched a 40 ?? 40 m forested area for a snake that had consumed a dead mouse containing a radio-transmitter. To avoid tainting the target or target area with human scent, no snake was handled or closely approached prior to searches. Trials were conducted during the morning when these nocturnal snakes were usually hidden in refugia. A radiotracker knew the snake's location, but dog handlers and search navigators did not. Of 85 trials conducted over four months, the two canine teams had an average success rate of 35% of correctly defining an area ??? 5 ?? 5 m that contained the transmittered snake; the team with more experience prior to the trials had a success rate of 44% compared with 26% for the less experienced team. Canine teams also found 11 shed skins from wild snakes. Although dogs alerted outside the vicinity of transmittered snakes, only one wild, non-transmittered snake was found during the trials, possibly reflecting the difficulty humans have in locating non-transmittered brown treesnakes in refugia. We evaluated success at finding snakes as a function of canine team, number of prior trials (i.e. experience gained during the trials), recent canine success at finding a target snake, various environmental conditions, snake perch height, and snake characteristics (snout-vent length and sex). Success rate increased over the course of the trials. Canine team success also increased with increasing average humidity and decreased with increasing average wind speed. Our results suggest dogs could be useful at detecting brown treesnakes in refugia, particularly when compared to daytime visual searches by humans, but techniques are needed to help humans find and extract snakes once a dog has alerted. ?? New Zealand Ecological Society.
Cryopreservation of microencapsulated canine sperm.
Shah, Shambhu; Otsuki, Tsubasa; Fujimura, Chika; Yamamoto, Naoki; Yamashita, Yasuhisa; Higaki, Shogo; Hishinuma, Mitsugu
2011-03-01
The objective was to develop a method for cryopreserving microencapsulated canine sperm. Pooled ejaculates from three beagle dogs were extended in egg yolk tris extender and encapsulated using alginate and poly-L-lysine at room temperature. The microcapsules were cooled at 4 °C, immersed in pre-cooled extender (equivalent in volume to the microcapsules) to reach final concentration of 7% (v/v) glycerol and 0.75% (v/v) Equex STM paste, and equilibrated for 5, 30 and 60 min at 4 °C. Thereafter, microcapsules were loaded into 0.5 mL plastic straws and frozen in liquid nitrogen. In Experiment 1, characteristics of microencapsulated canine sperm were evaluated after glycerol addition at 4 °C. Glycerol exposure for 5, 30 and 60 min did not significantly affect progressive motility, viability, or acrosomal integrity of microencapsulated sperm compared with pre-cooled unencapsulated sperm (control). In Experiment 2, characteristics of frozen-thawed canine microencapsulated sperm were evaluated at 0, 3, 6, and 9 h of culture at 38.5 °C. Pre-freeze glycerol exposure for 5, 30, and 60 min at 4 °C did not influence post-thaw quality in unencapsulated sperm. Post-thaw motility and acrosomal integrity of microencapsulated sperm decreased more than those of unencapsulated sperm (P < 0.05) following glycerol exposure for 5 min. However, motility, viability and acrosomal integrity of microencapsulated sperm after 30 and 60 min glycerol exposure were higher than unencapsulated sperm cultured for 6 or 9 h (P < 0.05). In conclusion, since microencapsulated canine sperm were successfully cryopreserved, this could be a viable alternative to convention sperm cryopreservation in this species. Copyright © 2011 Elsevier Inc. All rights reserved.
Lakshmanan, Nallakannu; Gore, Thomas C; Duncan, Karen L; Coyne, Michael J; Lum, Melissa A; Sterner, Frank J
2006-01-01
Thirty-two seronegative pups were vaccinated at 8 weeks of age with modified-live canine distemper virus (CDV), canine adenovirus type-2 (CAV-2), and canine parvovirus (CPV) vaccine and at 12 weeks with a modified-live CDV, CAV-2, CPV, and killed rabies virus vaccine. An additional 31 seronegative pups served as age-matched, nonvaccinated controls. All test dogs were strictly isolated for 3 years after receiving the second vaccination and then were challenged with virulent rabies virus. Clinical signs of rabies were prevented in 28 (88%) of the 32 vaccinated dogs. In contrast, 97% (30 of 31) of the control dogs died of rabies infection. These study results indicated that no immunogenic interference occurred between the modified-live vaccine components and the killed rabies virus component. Furthermore, these results indicated that the rabies component in the test vaccine provided protection against virulent rabies challenge in dogs 12 weeks of age or older for a minimum of 3 years following vaccination.
Management of impacted all canines with surgical exposure and alignment by orthodontic treatment
Directory of Open Access Journals (Sweden)
Radha Katiyar
2013-01-01
Full Text Available Canine impaction is a dental problem very often encountered in orthodontic practice. After the third molar, the canine is the most frequently impacted tooth. Bringing the impacted canine into a normal position is important for functional occlusion and the final esthetics of the orthodontic treatment. This article illustrates a peculiar case, in which all four permanent canines maintained their unerupted status at age of 16 years. All four impacted canines were surgically exposed, attachment bonded, traction given with K-9 spring and ideally positioned with fixed orthodontic mechanotherapy.
FLT3 mutations in canine acute lymphocytic leukemia
International Nuclear Information System (INIS)
Suter, Steven E; Small, George W; Seiser, Eric L; Thomas, Rachael; Breen, Matthew; Richards, Kristy L
2011-01-01
FMS-like tyrosine kinase 3 (FLT3) is a commonly mutated protein in a variety of human acute leukemias. Mutations leading to constitutively active FLT3, including internal tandem duplications of the juxtamembrane domain (ITD), result in continuous cellular proliferation, resistance to apoptotic cell death, and a poorer prognosis. A better understanding of the molecular consequences of FLT3 activation would allow improved therapeutic strategies in these patients. Canine lymphoproliferative diseases, including lymphoma and acute leukemias, share evolutionarily conserved chromosomal aberrations and exhibit conserved mutations within key oncogenes when compared to their human counterparts. A small percentage of canine acute lymphocytic leukemias (ALL) also exhibit FLT3 ITD mutations. We molecularly characterized FLT3 mutations in two dogs and one cell line, by DNA sequencing, gene expression analysis via quantitative real-time PCR, and sensitivity to the FLT3 inhibitor lestaurtinib via in vitro proliferation assays. FLT 3 and downstream mediators of FLT3 activation were assessed by Western blotting. The canine B-cell leukemia cell line, GL-1, and neoplastic cells from 2/7 dogs diagnosed cytologically with ALL were found to have FLT3 ITD mutations and FLT3 mRNA up-regulation. Lestaurtinib, a small molecule FLT3 inhibitor, significantly inhibited the growth of GL-1 cells, while not affecting the growth of two other canine lymphoid cell lines without the FLT3 mutation. Finally, western blots were used to confirm the conserved downstream mediators of FLT3 activating mutations. These results show that ALL and FLT3 biology is conserved between canine and human patients, supporting the notion that canine ALL, in conjunction with the GL-1 cell line, will be useful in the development of a relevant large animal model to aid in the study of human FLT3 mutant leukemias
Vaccine-induced canine distemper in a lesser panda.
Bush, M; Montali, R J; Brownstein, D; James, A E; Appel, M J
1976-11-01
A fatal disease occurred in a lesser panda (Ailurus fulgens) 2 weeks after vaccination with modified live distemper vaccine. The disease clinically resembled canine distemper. Pathologically there was giant cell pneumonia, with canine distemper viral inclusion bodies in pulmonary and digestive tract epithelium. Viral isolates were indicative of an attenuated strain rather than virulent types.
Alpha-1-antitrypsin studies: canine serum and canine surfactant protein
International Nuclear Information System (INIS)
Tuttle, W.C.; Slauson, D.O.; Dahlstrom, M.; Gorman, C.
1974-01-01
Canine serum alpha-1-antitrypsin was isolated by gel filtration and affinity chromatography and characterized by polyacrylamide gel electrophoresis and immunoelectrophoresis. Measurement of the trypsin inhibitory capacity of the separated protein indicated a ninefold concentration of functional trypsin inhibitor during the isolation procedure. Electrophoresis demonstrated the presence of a single protein with alpha-globulin mobility and a molecular weight near that of human alpha-1-antitrypsin. The trypsin inhibitory capacity of pulmonary surfactant protein from five Beagle dogs was measured, related to total surfactant protein concentration, and compared with similar measurements on whole serum from the same animals. Results indicated a variable concentration of trypsin inhibitor in the canine pulmonary surfactant protein. However, the concentration in the surfactant protein was always significantly higher than that in the corresponding serum sample. Preliminary experiments designed to separate the trypsin inhibitory fraction(s) from the other surfactant proteins by gel filtration chromatography indicated that the trypsin inhibitor was probably a single protein with a molecular weight near that of alpha-1-antitrypsin. (U.S.)
Canine hip dysplasia: significance of early bony spurring
International Nuclear Information System (INIS)
Morgan, J.P.
1987-01-01
It is the purpose of this study to call attention to new bone production that often occurs early in the sequence of pathological changes associated with canine hip dysplasia. New bone production extending to bony remodeling, as well as femoral head subluxation, both occur in the sequence of pathologic changes associated with canine hip dysplasia. Subluxation is considered primary, while osteoarthrosis is a secondary feature, and both are used in the diagnosis of canine hip dysplasia. This report concerns the significance of the presence of a solitary bony osteophyte, or spur, that is frequently evident on the caudal aspect of the femoral neck as viewed on the conventional ventrodorsal projection. This report utilizes findings from pelvic radiographs of 605 dogs (five breeds). There was a greater frequency (54%)of this bony change in cases diagnosed radiographically as dysplastic than in cases diagnosed as normal(15%).Thus, it is suggested that this minimal radiographic change can be used as an indicator of early canine hip dysplasia, especially in the absence of subluxation of the femoral head
Radiographic assessment of dental anomalies in patients with ectopic maxillary canines
DEFF Research Database (Denmark)
Sørensen, Helle Budtz; Artmann, Lone; Larsen, Helle Juul
2008-01-01
dental deviations in cases with either palatal or labial ectopic canines. Design. Panoramic and intra-oral radiographs from 50 patients with palatally located (38 females and 12 males) and 19 patients with labially located ectopic canines (11 females and 8 males), aged 10 years, 2 months-18 years, 1...... month, were analysed. Dental deviations registered were crown and root malformations, agenesis, and eruption deviations. Registrations were performed in the maxillary incisor field and in the dentition in general. Results. The study documented that palatally as well as labially located ectopic canines...... can occur in dentitions without other dental deviations. Dental deviations occurred in approximately two-thirds of all cases, more often in females and in cases with palatally located canines. More than half of the females with palatally located canines had deviations in the maxillary incisors...
Canine Babesiosis in China Caused by Babesia gibsoni: A Molecular Approach.
Directory of Open Access Journals (Sweden)
Da-Wei Yao
2014-06-01
Full Text Available To provide a point of reference to study the epidemiology and clinical expression of canine babesiosis in China.A total of 30 dogs infected with canine babesiosis were evaluated by mean of clinical history, physical examination, hematological, restriction fragment length polymorphism of PCR products (PCR-RFLP and sequencing analysis.The most prevalent clinical abnormalities were lethargy (100%, anorexia (100%, pale or icteric mucous membranes (80%, fever (70% and dark urine (70%. Hematology parameters revealed that anemia and thrombocytopenia were the major abnormalities in blood of dogs infected with canine babesia. The results of PCR-RFLP and sequencing analysis indicated that B. gibsoni was the main species responsible for canine babesiosis cases at the time of the study in Nanjing, China.The results provide valuable information for better understanding of the epidemiology of canine babesiosis in China.
The expression and serological reactivity of recombinant canine herpesvirus 1 glycoprotein D
Directory of Open Access Journals (Sweden)
Markéta Vaňková
2016-01-01
Full Text Available The aim of this work was to express recombinant glycoprotein D of canine herpesvirus 1 in bacterial cells and to evaluate its diagnostic sensitivity and specificity when compared to traditional serological methods. The gene fragment coding glycoprotein D of canine herpesvirus 1 was amplified by polymerase chain reaction, cloned into plasmid vector and expressed in Escherichia coli cells. Recombinant protein was then purified and used as an antigen in immunoblot for a detection of canine herpesvirus 1 specific antibodies. Antibody testing was performed on the panel of 100 canine sera by immunoblot with recombinant glycoprotein D as antigen and compared with indirect immunofluorescence assay. Serum samples were collected from 83 dogs with no history of canine herpesvirus 1 or reproductive disorders, and from 17 dogs from breeding kennels with a history of canine herpesvirus 1 related reproductive disorders. Sensitivity of glycoprotein D based immunoblot was 89.2% and specificity was 93%. Kappa value was calculated to be 0.8 between immunoblot and indirect immunofluorescence assay. Antibodies against canine herpesvirus 1 infection were detected in 33% of samples by immunoblot assay. Our study confirms that recombinant glycoprotein D expressed in bacterial cells could be used as a suitable and sensitive antigen for immunological tests and that herpesvirus infection seems to be common among the canine population in the Czech Republic.
Orthodontic-surgical treatment of bilateral maxillary canine impaction
Directory of Open Access Journals (Sweden)
Sumitra
2012-01-01
Full Text Available A 13-year-old female patient reported with the chief complaint of irregular front teeth. She had a skeletal Class III and Angle′s Class I malocclusion with hyperdivergent growth pattern and bilateral impaction of maxillary canines. Surgical exposure of the impacted teeth and orthodontic alignment was planned. The surgical exposure was done by a minimally invasive modified window technique. Orthodontic treatment of impacted canines without causing significant morbidity to the adjacent teeth and periodontium is a challenge. The bilaterally impacted maxillary canines were successfully aligned and leveled. The depth of the gingival sulcus and clinical crown heights of disimpacted teeth were normal post-treatment and after 1 year of retention.
Prostate histotripsy for BPH: initial canine results
Roberts, William W.; Hall, Timothy L.; Hempel, Christopher R.; Cain, Charles A.
2009-02-01
Histotripsy is an extracorporeal ablative technology that utilizes microsecond pulses of intense ultrasound (< 1% duty cycle) to produce nonthermal, mechanical fractionation of targeted tissue. We have previously demonstrated the feasibility of histotripsy prostate ablation. In this study we sought to assess the chronic tissue response, tolerability and safety of histotripsy in a chronic in vivo canine model. Five acute and thirteen chronic canine subjects were anesthetized and treated with histotripsy targeting the prostate. Pulses consisted of 3 cycle bursts of 750 kHz ultrasound at a repetition rate of 300 Hz delivered transabdominally from a highly focused 15 cm aperture array. Transrectal ultrasound imaging provided accurate targeting and real-time monitoring of histotripsy treatment. Prostates were harvested at 0, 7, 28, or 56 days after treatment. Consistent mechanical tissue fractionation and debulking of prostate tissue was seen acutely and at delayed time points without collateral injury. Urothelialization of the treatment cavity was apparent 28 days after treatment. Canine subjects tolerated histotripsy with minimal hematuria or discomfort. Only mild transient lab abnormalities were noted. Histotripsy is a promising non-invasive therapy for prostate tissue fractionation and debulking that appears safe and well tolerated without systemic side effects in the canine model.
Difficulties in estimating the human burden of canine rabies.
Taylor, Louise H; Hampson, Katie; Fahrion, Anna; Abela-Ridder, Bernadette; Nel, Louis H
2017-01-01
Current passive surveillance data for canine rabies, particularly for the regions where the burden is highest, are inadequate for appropriate decision making on control efforts. Poor enforcement of existing legislation and poor implementation of international guidance reduce the effectiveness of surveillance systems, but another set of problems relates to the fact that canine rabies is an untreatable condition which affects very poor sectors of society. This results in an unknown, but potentially large proportion of rabies victims dying outside the health system, deaths that are unlikely to be recorded by surveillance systems based on health center records. This article critically evaluates the potential sources of information on the number of human deaths attributable to canine rabies, and how we might improve the estimates required to move towards the goal of global canine rabies elimination. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.
Zuffa, T
1987-10-01
The growth characteristics were studied in the attenuated strains of canine parvovirus CPVA-BN 80/82, mink enteritis virus MEVA-BN 63/82 and feline panleucopenia virus FPVA-BN 110/83 on the stable feline kidney cell line FE, and in the attenuated canine distemper virus CDV-F-BN 10/83 on chicken embryo cell cultures (KEB) and cultures of the stable cell line VERO. When the FE cultures were infected with different parvoviruses in cell suspension at MOI 2-4 TKID50 per cell, the first multiplication of the intracellular virus was recorded 20 hours p. i. In the canine parvovirus, the content of intracellular and extracellular virus continued increasing parallelly until the fourth day; then, from the fourth to the sixth day, the content of extracellular virus still increased whereas that of intracellular virus fell rapidly. In the case of the mink enteritis virus the release of the virus into the culture medium continued parallelly with the production of the cellular virus until the sixth day. In the case of the feline panleucopenia virus the values concerning free virus and virus bound to cells were lower, starting from the second day p. i. When KEB or VERO cultures were infected in cell suspension with the canine distemper virus at MOI about 0.004 per 1 cell, the replicated intracellular virus was first recorded in the KEB cultures five hours after infection but in the VERO cultures only 20 hours after infection, with a timely release of the virus into the culture medium in both kinds of tissue. In the KEB and VERO cultures the highest values of infection titres were recorded on the fourth day p. i., the course of virus multiplication on the cells being parallel with its release into the culture medium.
Energy Technology Data Exchange (ETDEWEB)
Meyers, K.M.; Boehme, M.; Inbar, O.
1982-10-01
Endotoxin from Escherichia coli O127:B8, Salmonella abortus-equi and S minnesota induced clumping of some canine platelets (PLT) at a final endotoxin concentration of 1 microgram/ml. Endotoxin-induced clumping of canine PLT was independent of PLT energy-requiring processes, because clumping was observed with canine PLT incubated with 2-deoxy-D-glucose and antimycin A. The PLT responded to adenosine diphosphate before, but not after, incubation with the metabolic inhibitors. Endotoxin induced a slight and inconsistant clumping of bovine and equine PLT at high (mg/ml) endotoxin concentration. High-affinity binding sites could not be demonstrated on canine, bovine, and equine PLT, using /sup 125/I-labeled E coli O127:B8 endotoxin. Nonspecific binding was observed and appeared to be due primarily to an extraneous coat on the PLT surface that was removed by gel filtration. The endotoxin that was bound to PLT did not appear to modify PLT function. An attempt to identify plasma proteins that bound physiologically relevant amounts of endotoxin was not successful. The significance of the endotoxin-induced clumping or lack of it on the pathophysiology of endotoxemia is discussed.
Lotspeich, Erica; Kitts, Kelley; Goodpaster, John
2012-07-10
It is a common misconception that the amount of explosive is the chief contributor to the quantity of vapor that is available to trained canines. In fact, this quantity (known as odor availability) depends not only on the amount of explosive material, but also the container volume, explosive vapor pressure and temperature. In order to better understand odor availability, headspace experiments were conducted and the results were compared to theory. The vapor-phase concentrations of three liquid explosives (nitromethane, nitroethane and nitropropane) were predicted using the Ideal Gas Law for containers of various volumes that are in use for canine testing. These predictions were verified through experiments that varied the amount of sample, the container size, and the temperature. These results demonstrated that the amount of sample that is needed to saturate different sized containers is small, predictable and agrees well with theory. In general, and as expected, once the headspace of a container is saturated, any subsequent increase in sample volume will not result in the release of more vapors. The ability of canines to recognize and alert to differing amounts of nitromethane has also been studied. In particular, it was found that the response of trained canines is independent of the amount of nitromethane present, provided it is a sufficient quantity to saturate the container in which it is held. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.
Chandran, Dev; Shahana, Pallichera Vijayan; Rani, Gudavelli Sudha; Sugumar, Parthasarthy; Shankar, Chinchkar Ramchandra; Srinivasan, Villuppanoor Alwar
2009-12-10
Expression of Physalis mottle tymovirus coat protein in Escherichia coli was earlier shown to self-assemble into empty capsids that were nearly identical to the capsids formed in vivo. Amino acid substitutions were made at the N-terminus of wild-type Physalis mottle virus coat protein with neutralizing epitopes of Canine parvovirus containing the antigenic sites 1-2, 4 and 6-7 and T-cell epitope of the fusion protein of Canine distemper virus in various combinations to yield PhMV1, PhMV2, PhMV3, PhMV4 and PhMV5. These constructs were cloned and expressed in E. coli. The chimeric proteins self-assembled into chimeric tymovirus-like particles (TVLPs) as determined by electron microscopy. The TVLPs were purified by ultracentrifugation and injected into guinea pigs and dogs to determine their immunogenicity. Initial immunogenicity studies in guinea pigs indicated that PhMV3 gave a higher response in comparison to the other TVLPs for both CPV and CDV and hence all further experiments in dogs were done with PhMV3. HI was done against different isolates obtained from various parts of the country. Protective titres indicated the broad spectrum of the vaccine. In conclusion the study indicated that the above chimeric VLP based vaccine could be used in dogs to generate a protective immune response against diseases caused by both Canine parvo and Canine distemper virus.
Intranasal vaccine trial for canine infectious tracheobronchitis (kennel cough).
Glickman, L T; Appel, M J
1981-08-01
Two field trials were conducted during periods of endemic (summer) and epizootic (winter) canine infectious tracheobronchitis activity to evaluate the efficacy of three intranasal vaccines in a closed commercial beagle breeding kennel. A trivalent vaccine containing Bordetella bronchiseptica, canine parainfluenza, and canine adenovirus-2 was administered at 3 weeks of age. The vaccine was 71.2% and 81.8% effective in decreasing the incidence of coughing during the winter and summer trials, respectively. The number of deaths was lower in each of the vaccine groups than in the placebo groups. No adverse reactions were observed with any of the intranasal vaccines.
Current practices and research updates on diabetes mellitus in canine
Directory of Open Access Journals (Sweden)
Pankaj Kumar
2014-11-01
Full Text Available Diabetes has evidence in ancient literatures, though recently is being considered as one amongst the most emerging disease condition in both human and companion animals. Diabetes mellitus is one of the common endocrinopathy of dog characterized by hyperglycemia, glycosuria and weight loss. Reports suggests high fraction of canine population suffer with diabetes world over. Studies in different veterinary hospitals of United States suggest increase in cases of canine diabetes and decrease in case fatality rate over time. Increase in cases of canine diabetes worldwide is attributed to awareness amongst pet owners, better veterinary health facilities, breed preferences by dog owners, increase dependence on commercial feeds, obesity, etc. Diabetes in most dogs is immune mediated and insulin dependent. Breed predisposition in canine is attributed to dog leukocyte antigen gene pool encoding form major histocompatibility complex-II molecules, however research is still underway. Diagnosis of diabetes still relies on blood sugar evaluation for screening of canine population, though many other diagnostic methods have shown promising benefits including measurement of fructosamine and glycated haemoglobin. Management of diabetes in dog is based on insulin therapy, diet modification and exercise. Use of oral anti-diabetics drugs in canine is limited though experimental studies have shown promising results. Alternative therapies have been explored, but only a few approaches have shown promise for clinical application.
Eruption of the maxillary canines in relation to skeletal maturity.
Baccetti, Tiziano; Franchi, Lorenzo; De Lisa, Simona; Giuntini, Veronica
2008-05-01
Our aim in this study was to assess the relationship between the eruption of the permanent maxillary canines and skeletal maturity in subjects with different skeletal relationships in the sagittal and vertical planes. A sample of 152 subjects (63 boys, 89 girls) with erupting permanent maxillary canines was analyzed. On the lateral cephalograms, the stage of cervical vertebral maturation was assessed. Then the subjects were divided into prepeak (before the pubertal growth spurt, cervical stage [CS]1 and CS2), peak (during the pubertal growth spurt, CS3 and CS4), and postpeak (after the pubertal growth spurt, CS5 and CS6) groups. Skeletal relationships in the sagittal and vertical planes were evaluated, and relationships to timing of canine eruption were tested statistically. The prepeak group comprised 86 subjects, the peak group 66 subjects, and the postpeak group 0 subjects. The differences in prevalence rates between either the prepeak or peak groups and the postpeak group were statistically significant (P < 0.001). The prevalence rate for hyperdivergent subjects showing eruption of the permanent maxillary canine in the prepeak group (37.2%) was significantly higher than in the reference orthodontic population (21%). The eruption of the permanent maxillary canine can occur at any stage in skeletal maturation before the end the pubertal growth spurt (CS1-CS4), with hyperdivergent subjects more frequently having prepubertal canine eruption.
Citizen science: a new direction in canine behavior research.
Hecht, Julie; Spicer Rice, Eleanor
2015-01-01
Researchers increasingly rely on members of the public to contribute to scientific projects-from collecting or identifying, to analyzing and disseminating data. The "citizen science" model proves useful to many thematically distinctive fields, like ornithology, astronomy, and phenology. The recent formalization of citizen science projects addresses technical issues related to volunteer participation--like data quality--so that citizen scientists can make longstanding, meaningful contributions to scientific projects. Since the late 1990s, canine science research has relied with greater frequency on the participation of the general public, particularly dog owners. These researchers do not typically consider the methods and technical issues that those conducting citizen science projects embrace and continue to investigate. As more canine science studies rely on public input, an in-depth knowledge of the benefits and challenges of citizen science can help produce relevant, high-quality data while increasing the general public's understanding of canine behavior and cognition as well as the scientific process. We examine the benefits and challenges of current citizen science models in an effort to enhance canine citizen science project preparation, execution, and dissemination. This article is part of a Special Issue entitled: Canine Behavior. Copyright © 2014 Elsevier B.V. All rights reserved.
... Solitary Kidney Your Kidneys & How They Work Simple Kidney Cysts What are simple kidney cysts? Simple kidney cysts are abnormal, fluid-filled ... that form in the kidneys. What are the kidneys and what do they do? The kidneys are ...
Dehghani, Mahdieh; Shadkam, Elaheh; Ahrari, Farzaneh; Dehghani, Mahboobe
2018-04-01
Age estimation in adults is an important issue in forensic science. This study aimed to estimate the chronological age of Iranians by means of pulp/tooth area ratio (AR) of canines in digital panoramic radiographs. The sample consisted of panoramic radiographs of 271 male and female subjects aged 16-64 years. The pulp/tooth area ratio (AR) of upper and lower canines was calculated by AutoCAD software. Data were subjected to correlation and regression analysis. There was a significant and inverse correlation between age and pulp/tooth area ratio of upper and lower canines (r=-0.794 for upper canine and r=-0.282 for lower canine; p-value<0.001). Linear regression equations were derived separately for upper, lower and both canines. The mean difference between actual and estimated age using upper canine was 6.07±1.7. The results showed that the pulp/tooth area ratios of canines are a reliable method for age estimation in Iranians. The pulp/tooth area ratio of upper canine was better correlated with chronological age than that of lower canine. Copyright © 2018 Elsevier B.V. All rights reserved.
Ultrasonographic evaluation of the canine shoulder.
Long, C D; Nyland, T G
1999-01-01
The aim of this study was to determine the normal ultrasonographic anatomy of the canine shoulder. Fourteen shoulders from 7 clinically normal mid-sized dogs were radiographed and imaged using high frequency ultrasound. Each shoulder was isolated postmortem, and the ultrasonographic and gross anatomy was studied during dissection. The ultrasonographic appearance of the shoulder specimens was similar to that found in the live dogs. Twenty-four shoulders isolated postmortem from 12 variably sized dogs were also used to characterize the normal ultrasound anatomy over a range of sizes. Important anatomic structures that could be consistently evaluated were the biceps tendon and bursa, the bicipital groove surface, the supraspinatous tendon, the infraspinatous tendon, the teres minor tendon, and the caudal aspect of the humeral head. Results of ultrasonographic examination of 4 dogs with shoulder lameness are described to illustrate some applications of canine shoulder ultrasonography in the evaluation of the canine shoulder. In these dogs, ultrasound was a valuable tool to evaluate effusion and synovial proliferation within the bicipital bursa, supraspinatous and biceps tendinitis, biceps tendon strain, and dystrophic calcification.
Directory of Open Access Journals (Sweden)
Kanu Priya Aggarwal
Full Text Available BACKGROUND: The increasing number of patients suffering from urolithiasis represents one of the major challenges which nephrologists face worldwide today. For enhancing therapeutic outcomes of this disease, the pathogenic basis for the formation of renal stones is the need of hour. Proteins are found as major component in human renal stone matrix and are considered to have a potential role in crystal-membrane interaction, crystal growth and stone formation but their role in urolithiasis still remains obscure. METHODS: Proteins were isolated from the matrix of human CaOx containing kidney stones. Proteins having MW>3 kDa were subjected to anion exchange chromatography followed by molecular-sieve chromatography. The effect of these purified proteins was tested against CaOx nucleation and growth and on oxalate injured Madin-Darby Canine Kidney (MDCK renal epithelial cells for their activity. Proteins were identified by Matrix-assisted laser desorption/ionization-time of flight (MALDI-TOF MS followed by database search with MASCOT server. In silico molecular interaction studies with CaOx crystals were also investigated. RESULTS: Five proteins were identified from the matrix of calcium oxalate kidney stones by MALDI-TOF MS followed by database search with MASCOT server with the competence to control the stone formation process. Out of which two proteins were promoters, two were inhibitors and one protein had a dual activity of both inhibition and promotion towards CaOx nucleation and growth. Further molecular modelling calculations revealed the mode of interaction of these proteins with CaOx at the molecular level. CONCLUSIONS: We identified and characterized Ethanolamine-phosphate cytidylyltransferase, Ras GTPase-activating-like protein, UDP-glucose:glycoprotein glucosyltransferase 2, RIMS-binding protein 3A, Macrophage-capping protein as novel proteins from the matrix of human calcium oxalate stone which play a critical role in kidney stone
The Comparative Diagnostic Features of Canine and Human Lymphoma
Directory of Open Access Journals (Sweden)
Davis M. Seelig
2016-06-01
Full Text Available The non-Hodgkin lymphomas (NHLs are a heterogeneous family of lymphoid malignancies that are among the most common neoplasms of both dogs and humans. Owing to shared molecular, signaling, incidence, and pathologic features, there is a strong framework supporting the utilization of canine lymphoma as a comparative, large animal model of human NHL. In alignment with the biologic similarities, the current approach towards the diagnosis and classification of canine lymphoma is based upon the human World Health Organization guidelines. While this approach has contributed to an increasing appreciation of the potential biological scope of canine lymphoma, it has also become apparent that the most appropriate diagnostic philosophy must be multimodal, namely by requiring knowledge of microscopic, immunophenotypic, and clinical features before establishing a final disease diagnosis. This review seeks to illustrate the comparative similarities and differences in the diagnosis of canine lymphoma through the presentation of the microscopic and immunophenotypic features of its most common forms.
The Comparative Diagnostic Features of Canine and Human Lymphoma.
Seelig, Davis M; Avery, Anne C; Ehrhart, E J; Linden, Michael A
2016-06-01
The non-Hodgkin lymphomas (NHLs) are a heterogeneous family of lymphoid malignancies that are among the most common neoplasms of both dogs and humans. Owing to shared molecular, signaling, incidence, and pathologic features, there is a strong framework supporting the utilization of canine lymphoma as a comparative, large animal model of human NHL. In alignment with the biologic similarities, the current approach towards the diagnosis and classification of canine lymphoma is based upon the human World Health Organization guidelines. While this approach has contributed to an increasing appreciation of the potential biological scope of canine lymphoma, it has also become apparent that the most appropriate diagnostic philosophy must be multimodal, namely by requiring knowledge of microscopic, immunophenotypic, and clinical features before establishing a final disease diagnosis. This review seeks to illustrate the comparative similarities and differences in the diagnosis of canine lymphoma through the presentation of the microscopic and immunophenotypic features of its most common forms.
Histopathological retrospective study of canine renal disease in Korea, 2003~2008
Yhee, Ji-Young; Yu, Chi-Ho; Kim, Jong-Hyuk; Im, Keum-Soon; Chon, Seung-Ki
2010-01-01
Renal disease includes conditions affecting the glomeruli, tubules, interstitium, pelvis, and vasculature. Diseases of the kidney include glomerular diseases, diseases of the tubules and interstitium, diseases of renal pelvis, and developmental abnormalities. Renal tissue samples (n = 70) submitted to the Department of Veterinary Pathology of Konkuk University from 2003 to 2008 were included in this study. Tissue histopathology was performed using light microscopy with hematoxylin and eosin stains. Masson's trichrome, Congo Red, and Warthin starry silver staining were applied in several individual cases. Glomerular diseases (22.9%), tubulointerstitial diseases (8.6%), neoplastic diseases (8.6%), conditions secondary to urinary obstruction (24.3%), and other diseases (35.7%) were identified. Glomerulonephritis (GN) cases were classified as acute proliferative GN (5.7%), membranous GN (4.3%), membranoproliferative GN (4.3%), focal segmental GN (2.9%), and other GN (4.2%). The proportion of canine GN cases presently identified was not as high as the proportions identified in human studies. Conversely, urinary obstruction and end-stage renal disease cases were relatively higher in dogs than in human populations. PMID:21113095
Directory of Open Access Journals (Sweden)
Shalini Gupta
2014-01-01
Full Text Available Aim: To investigate whether sexual dimorphism can be established by odontometric study of permanent maxillary canine teeth as well as inter-canine width in north Indian population. Study Design: The study was carried out at department of oral and maxillofacial pathology, King George′s Medical University, Lucknow, India on students and patients reporting at OPD. Out of total 180 subjects examined 90 subjects were female and 90 were male. Impressions of the upper arch were made using alginate and casts poured in dental stone. The mesiodistal diameter (MD of the crown of permanent maxillary canine both on right and left sides and inter-canine width were measured. From these measurements, maxillary canine index was calculated. The percentage of sexual dimorphism (SD was assessed for all the parameters. Results: In the present study, the MD of maxillary canine for both right (P = 0.001 and left side (P = 0.005 was significantly higher among male subjects than females, Similar observation was found for inter-canine width too (P = 0.0001. However, the maxillary canine index for right and left was almost similar (P > 0.05 for both male and female subjects. The SD in right and left MDs of maxillary canine was 4.2% and 3.6% respectively. For, inter-canine width it was maximum (13.7%. However, SD in right and left canine index showed negative values (−2.1% and -0.9% respectively. Conclusion: There was SD in MD and inter-canine width of permanent maxillary canine teeth. SD was more on right permanent maxillary canine teeth than left permanent maxillary canine.
[Nonsurgical endodontic treatment of an invaginated canine].
Fernández Guerrero, F; Miñana Laliga, R; Bullon Fernandez, P
1989-01-01
We present a case of a maxillary canine with a dens invaginatus treated successfully. The patient had pain, swelling and a sinus tract coming from the inmature apex of the canine. The canals were enlarged and cleaned and the main canal was filled with Calcium Hydroxide to allow the root development. Seven months later, the patient was asymptomatic and the tooth was obturated with guttapercha. One year later it was confirm the success in the treatment.
Canine babesiosis: from molecular taxonomy to control
Directory of Open Access Journals (Sweden)
Irwin Peter J
2009-03-01
Full Text Available Abstract Canine babesiosis is a clinically significant emerging vector-borne disease caused by protozoan haemoparasites. This review article considers recent literature pertaining to the taxonomic classification of Babesia and Theileria species affecting dogs and the geographical distribution of these parasites. The diagnosis of canine babesiosis by traditional, molecular and serological methods is reviewed, together with recent advances in our understanding of the pathophysiology of piroplasmosis, and of the treatment and prevention of this disease.
Genetic characterization of canine influenza A virus (H3N2) in Thailand.
Bunpapong, Napawan; Nonthabenjawan, Nutthawan; Chaiwong, Supassama; Tangwangvivat, Ratanaporn; Boonyapisitsopa, Supanat; Jairak, Waleemas; Tuanudom, Ranida; Prakairungnamthip, Duangduean; Suradhat, Sanipa; Thanawongnuwech, Roongroje; Amonsin, Alongkorn
2014-02-01
In January 2012, several clinical cases of dogs with flu-like symptoms, including coughing, sneezing, nasal discharge, and fever, were reported in a small-animal hospital located in Bangkok, Thailand. One influenza A virus was identified and characterized as an avian-like influenza virus H3N2. The virus was named A/canine/Thailand/CU-DC5299/12. A phylogenetic analysis indicated that the canine virus belonged to an avian Eurasian lineage and was genetically related to the canine influenza viruses H3N2 from China and Korea. This canine virus displays a unique genetic signature with two amino acid insertions in the NA protein, which is similar to the canine influenza viruses from eastern China (Zhejiang and Jiangsu). This study constitutes the first report of H3N2 canine influenza virus infection in a small-animal hospital in Thailand.
Glucosamine and chondroitin use in canines for osteoarthritis: A ...
African Journals Online (AJOL)
Osteoarthritis is a slowly progressive and debilitating disease that affects canines of all breeds. Pain and decreased mobility resulting from osteoarthritis often have a negative impact on the affected canine's quality of life, level of comfort, daily functioning, activity, behaviour, and client-pet companionship. Despite limited and ...
A case of unusual root morphology: Maxillary canine with two roots
Directory of Open Access Journals (Sweden)
Nagesh Bolla
2009-01-01
Full Text Available The case describes a 3 months follow-up of the treatment of a maxillary canine with two roots. Clinical examination revealed a maxillary canine with a large carious lesion and an exaggerated response to cold thermal tests. Radiographic examination revealed a large distal carious lesion that appeared to invade the pulp chamber. The radiograph also revealed what appeared to be an extra root in this permanent maxillary canine.
Purification and partial characterization of canine S100A12.
Heilmann, Romy M; Suchodolski, Jan S; Steiner, Jörg M
2010-12-01
Canine S100A12 (cS100A12) is a calcium-binding protein of the S100 superfamily of EF-hand proteins, and its expression is restricted to neutrophils and monocytes. Interaction of S100A12 with the receptor for advanced glycation end products (RAGE) has been suggested to play a central role in inflammation. Moreover, S100A12 has been shown to represent a sensitive and specific marker for gastrointestinal inflammation in humans. Only human, porcine, bovine, and rabbit S100A12 have been purified to date, and an immunoassay for the quantification of S100A12 is available only for humans. Therefore, the aim of this study was to develop a protocol for the purification of S100A12 and to partially characterize this protein in the dog (Canis lupus familiaris) as a prelude to the development of an immunologic method for its detection and quantification in canine serum and fecal specimens. Leukocytes were isolated from canine whole blood by dextran sedimentation, and canine S100A12 was extracted from the cytosol fraction of these cells. Further purification of cS100A12 comprised of ammonium sulfate precipitation, hydrophobic interaction chromatography, and strong cation- and anion-exchange column chromatography. Canine S100A12 was successfully purified from canine whole blood. The relative molecular mass of the protein was estimated at 10,379.5 and isoelectric focusing revealed an isoelectric point of 6.0. The approximate specific absorbance of cS100A12 at 280 nm was determined to be 1.78 for a 1 mg/ml solution. The N-terminal AA sequence of the first 15 residues of cS100A12 was Thr-Lys-Leu-Glu-Asp-His-X-Glu-Gly-Ile-Val-Asp-Val-Phe-His, and revealed 100% identity with the predicted protein sequence available through the canine genome project. Sequence homology for the 14 N-terminal residues identified for cS100A12 with those of feline, bovine, porcine, and human S100A12 was 78.6%. We conclude that canine S100A12 can be successfully purified from canine whole blood using the
... our e-newsletter! Aging & Health A to Z Kidney Problems Basic Facts & Information The kidneys are two ... kidney (renal) diseases are called nephrologists . What are Kidney Diseases? For about one-third of older people, ...
Guarnieri, R; Cavallini, C; Vernucci, R; Vichi, M; Leonardi, R; Barbato, E
2016-11-01
The prevalence of impacted maxillary canine is reported to be between 1% and 3%. The lack of monitoring and the delay in the treatment of the impacted canine can cause different complications such as: displacement of adjacent teeth, loss of vitality of neighbouring teeth, shortening of the dental arch, follicular cysts, canine ankylosis, recurrent infections, recurrent pain, internal resorption of the canine and the adjacent teeth, external resorption of the canine and the adjacent teeth, combination of these factors. An appropriate diagnosis, accurate predictive analysis and early intervention are likely to prevent such undesirable effects. The objective is to evaluate, by means of a retrospective observational study, the possibility of carrying out a predictive analysis of root resorption adjacent to the impacted canines by means of orthopantomographs, so as to limit the prescription of additional 3D radiography. 120 subjects with unilateral or bilateral maxillary impacted canine were examined and 50 patients with 69 impacted maxillary canine (22 male, 28 female; mean age: 11.7 years) satisfied the inclusion criteria of the study. These patients were subjected to a basic clinical and radiographic investigation (orthopantomographs and computerized tomography). All panoramic films were viewed under standardized conditions for the evaluation of two main variables: maxillary canine angulations (a, b, g angles) and the overlapping between the impacted teeth and the lateral incisor (Analysis of Lindauer). Binary logistic regression was used to estimate the likelihood of resorbed lateral incisors depending on sector location and angle measurements. Results indicated that b angle has the greatest influence on the prediction of root resorption (predictive value of b angle = 76%). If β angle <18° and Lindauer = I, the probability of resorption is 0.06. Evaluation of b angle and superimposition lateral incisor/impacted canine analysed on orthopantomographs could be one of
Efficient adenovector CD40 ligand immunotherapy of canine malignant melanoma.
von Euler, Henrik; Sadeghi, Arian; Carlsson, Björn; Rivera, Patricio; Loskog, Angelica; Segall, Thomas; Korsgren, Olle; Tötterman, Thomas H
2008-05-01
Cutaneous canine melanomas are usually benign in contrast to human malignant melanoma. However, the canine oropharyngeal, uveal, and mucocutaneous neoplasms are aggressive and have metastatic potential. Surgery and to a lesser extent radiotherapy and chemotherapy are widely adopted treatments but are seldom curative in advanced stages. The similarities between human and canine melanoma make spontaneous canine melanoma an excellent disease model for exploring novel therapies. Herein, we report the first 2 adenovector CD40L immunogene (AdCD40L) treatments of aggressive canine malignant melanoma. Case no. 1 was an advanced stage III oral melanoma that was cured from malignant melanoma with 2 intratumor AdCD40L injections before cytoreductive surgery. After treatment, the tumor tissue was infiltrated with T lymphocytes and B lymphocytes suggesting immune activation. This dog survived 401 days after the first round of gene therapy and was free of melanoma at autopsy. Case no. 2 had a conjunctival malignant melanoma with a rapid progression. This case was treated with 6 AdCD40L injections over 60 days. One hundred and twenty days after start of gene therapy and 60 days after the last injection, the tumor had regressed dramatically, and the dog had a minimal tumor mass and no signs of progression or metastasis. Our results indicate that AdCD40L immunogene therapy is beneficial in canine malignant melanoma and could be considered for human malignant melanoma as well.
Kidney recipients experiences before during and after kidney transplantation
DEFF Research Database (Denmark)
Nielsen, Charlotte
Background Kidney transplantation is considered to be the best treatment for terminal renal insufficiency. Kidney transplant patients report higher quality of life because they avoid regular dialysis treatment that causes side effects, complications, restrictions and limitations in their daily...... and after the kidney transplant, through outpatient visits and during possible hospitalization, which can occur due to complications or disease progression. Objective To explore the coherence of the kidney transplant process in order to explain the lived experiences of kidney recipients before, during...... and after kidney transplantation. Method Participant observation and semi-structured individual interviews was conducted with kidney recipients before, during and after kidney transplantation. Data analysis is inspired by Ricoeur's interpretation theory on three levels: Naive reading; structural analysis...
Orthodontic Traction of Impacted Canine Using Cantilever
Nakandakari, Cláudia; Gonçalves, João Roberto; Cassano, Daniel Serra; Raveli, Taísa Boamorte; Bianchi, Jonas; Raveli, Dirceu Barnabé
2016-01-01
The impaction of the maxillary canines causes relevant aesthetic and functional problems. The multidisciplinary approach to the proper planning and execution of orthodontic traction of the element in question is essential. Many strategies are cited in the literature; among them is the good biomechanical control in order to avoid possible side effects. The aim of this paper is to present a case report in which a superior canine impacted by palatine was pulled out with the aid of the cantilever...
Scerri, Erica Sultana; McDonald, Fraser; Camilleri, Simon
2016-02-01
To compare the developmental dental anomalies associated with maxillary canine-first premolar (MxCP1) transposition and those of palatally displaced canine (PDC) with each other and with the background prevalence in the Maltese population in order to elucidate whether the two conditions have similar or differing genetic backgrounds. Dental records of 477 subjects with PDC, 57 subjects with MxCP1, and a control group of 500 subjects with no history of a PDC or tooth transposition were compared for canine eruption anomalies and hypodontia. A high frequency of bilateral occurrence was present for both canine malpositions and when unilateral, a trend to right-sided occurrence was evident. The occurrence of transpositions in the PDC group and of PDC in the MxCP1 group was higher than expected. The prevalence of incisor hypodontia was significantly higher in subjects with PDC and MxCP1, as compared to the control group. The size of the MxCP1 group is relatively small. The study population is a small isolated Caucasian population and the results may not be applicable to other populations. There is no significant difference between the MxCP1 and PDC groups in the prevalence or distribution of hypodontia and each of these groups exhibits a higher prevalence of the other canine anomaly. These findings support the theory that PDC and MxCP1 form part of a group of interrelated dental anomalies that share a common genetic basis. © The Author 2015. Published by Oxford University Press on behalf of the European Orthodontic Society. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Detection of canine pneumovirus in dogs with canine infectious respiratory disease.
Mitchell, Judy A; Cardwell, Jacqueline M; Renshaw, Randall W; Dubovi, Edward J; Brownlie, Joe
2013-12-01
Canine pneumovirus (CnPnV) was recently identified during a retrospective survey of kenneled dogs in the United States. In this study, archived samples from pet and kenneled dogs in the United Kingdom were screened for CnPnV to explore the relationship between exposure to CnPnV and the development of canine infectious respiratory disease (CIRD). Within the pet dog population, CnPnV-seropositive dogs were detected throughout the United Kingdom and Republic of Ireland, with an overall estimated seroprevalence of 50% (n = 314/625 dogs). In the kennel population, there was a significant increase in seroprevalence, from 26% (n = 56/215 dogs) on the day of entry to 93.5% (n = 201/215 dogs) after 21 days (P respiratory disease than those that did not seroconvert (P respiratory disease than immunologically naive dogs (P respiratory signs and histopathological changes and in dogs housed for 8 to 14 days, which coincided with a significant increase in the risk of developing respiratory disease compared to the risk of those housed 1 to 7 days (P disease prevention strategy.
Directory of Open Access Journals (Sweden)
Patil Sandeep S
2012-01-01
Full Text Available Abstract Oncolytic viruses refer to those that are able to eliminate malignancies by direct targeting and lysis of cancer cells, leaving non-cancerous tissues unharmed. Several oncolytic viruses including adenovirus strains, canine distemper virus and vaccinia virus strains have been used for canine cancer therapy in preclinical studies. However, in contrast to human studies, clinical trials with oncolytic viruses for canine cancer patients have not been reported. An 'ideal' virus has yet to be identified. This review is focused on the prospective use of oncolytic viruses in the treatment of canine tumors - a knowledge that will undoubtedly contribute to the development of oncolytic viral agents for canine cancer therapy in the future.
... Staying Safe Videos for Educators Search English Español Kidney Disease KidsHealth / For Teens / Kidney Disease What's in ... Coping With Kidney Conditions Print What Do the Kidneys Do? You might never think much about some ...
Wilmes, Benedict; Drescher, Dieter
2009-05-01
In the course of a clinical pilot study we tested the vertical periodontal ligament (V-PDL) distraction as a means of aligning ankylosed upper canines. The objective of this study was to analyze the appropriateness und effectiveness of this method. The ankylosed upper canines of five female patients aged between 16 und 19 years were surgically exposed, luxated, and after a latency period of 5 to 7 days, distracted at a rate of 0.5 mm per day. The installed distractors were borne by the periodontal-mucosa, the periodontal-mucosa and the bone, or by the bone exclusively. We evaluated the distraction distance and time and degree of hard and soft tissue generation present in the region surrounding the distracted teeth. All canines were aligned after a mean distraction period of 43.2 days (+/- 3.6 days). The mean distraction distance was 10.8 mm. Three canines had defects at the cemento-enamel junction, and one canine had to be extracted due to a large defect at the root. Vertical PDL distraction is a minimally-invasive therapy to align ankylosed impacted canines. Even if the long-term prognosis of distracted canines with defects is uncertain, the patient benefits from the vertical PDL distraction because both hard and soft tissues are generated in the vicinity of the distracted canine.
Possible mechanism for species difference on the toxicity of pivalic acid between dogs and rats
International Nuclear Information System (INIS)
Yamaguchi, Toshiro; Nakajima, Yoshitsugu; Nakamura, Yutaka
2006-01-01
In a high dose toxicity study of pivalic acid (PA), PA caused skeletal muscle disorder in dog, and a significant increase of pivaloyl carnitine (PC) was observed in canine muscle, but not in rat muscle. In order to understand species difference of the toxicity of PA, we compared the in vitro metabolism of PA among dog, rat and rabbit, especially focussing on the carnitine conjugate. Canine muscle showed low, but significant carnitine conjugating activity, while that of rat was negligible. Canine kidney mitochondria had significant activity in the pivaloyl CoA synthesis (7 nmol/mg protein/h), but muscle mitochondria showed only trace activity. Both kidney and muscle mitochondria displayed similar carnitine acyltransferase activity (2-3 nmol/mg protein/h) towards pivaloyl CoA. On the other hand, with respect to the activity of carnitine acyltransferase in the reverse direction using PC as substrate, canine muscle mitochondria showed higher activity than that of kidney mitochondria. This means that PC is not the final stable metabolite, but is converted easily to pivaloyl CoA in canine muscle. These results suggest one of the possible mechanisms for canine selective muscle disorder to be as follows. Only canine muscle can metabolize PA to its carnitine conjugate slowly, but significantly. In canine muscle, PC is not the final stable metabolite; it is easily converted to pivaloyl CoA. As carnitine conjugation is thought to be the only detoxification metabolic route in canine muscle, under certain circumstances such as carnitine deficiency, the risk of exposure with toxic pivaloyl CoA might increase and the CoASH pool in canine muscle might be exhausted, resulting in toxicity in canine muscle
Genetics of Human and Canine Dilated Cardiomyopathy
Siobhan Simpson; Jennifer Edwards; Thomas F. N. Ferguson-Mignan; Malcolm Cobb; Nigel P. Mongan; Catrin S. Rutland
2015-01-01
Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM) accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In th...
A kidney stone is a solid piece of material that forms in a kidney. Kidney stones may be the size of sand or ... A kidney stone is a solid piece of material that forms in a kidney. Kidney stones may be the ...
Orthodontic treatment of a complete transposed impacted maxillary canine
Directory of Open Access Journals (Sweden)
Pi-Huei Liu
2015-03-01
Full Text Available Tooth transposition is a positional interchange of two adjacent teeth. Transposition most often occurs at maxillary canine. Moving transposed teeth to their normal positions is challenging because this requires bodily movement and translation of one tooth to pass another. This procedure may cause damage to the teeth or supporting structures. We report a case of complete transposition of maxillary canine and lateral incisor. Transposed teeth were successfully moved orthodontically to their normal positions. Multiple mechanics were meticulously applied to achieve complete correction of the tooth positions and to minimize root resorption and/or periodontal defects of canine and lateral incisors. Factors concerning treatment planning for transposed teeth are discussed.
Tooth fractures in canine clinical practice
International Nuclear Information System (INIS)
Capik, I.; Ledecky, V.; Sevcik, A.
2001-01-01
Tooth fractures constitute a considerable fraction of all tooth diseases. Out of the 5,370 dogs treated during four years, 492 were presented with dental problems and 28.3 % of the latter were treated for tooth fractures. Canines were the most frequently affected teeth (38.8 %), followed by premolars (33.1 %), incisors (25.9 %), and molars (2.2 %), 55.4 % of the patients with canine and incisor fractures being large breed dogs. Fractures of premolars (mostly of 108, 208) were divided evenly irrespective of breed or body size. Nonsurgical endodontic treatment yielded good therapeutic results in most cases, but repeated treatment was necessary in some patients
Canine faecal contamination and parasitic risk in the city of Naples (southern Italy
Directory of Open Access Journals (Sweden)
Veneziano Vincenzo
2006-09-01
Full Text Available Abstract Background Dogs are associated with more than 60 zoonotic diseases among which, parasitosis and, in particular, helminthosis, can pose serious public-health concerns worldwide. Many canine gastrointestinal parasites eliminate their dispersion elements (eggs, larvae, oocysts by the faecal route. The quantity of canine faeces deposited on public and private property in cities worldwide is both a perennial nuisance and an important health issue. Public sites such as playgrounds, parks, gardens, public squares and sandpits may be an important source of human infection. The aim of this study was to evaluate the extent of both canine faecal contamination in the city of Naples (southern Italy, and presence of canine parasitic elements, with particular regard to those which are potential agents of zoonosis. A regular grid of sub-areas (1 km × 700 m was overlaid on the city map using a Geographical Information System (GIS. In each sub-area the straightest 1 km transect was drawn and digitalized on-screen in the GIS. Between February and May 2005 canine faeces were counted along the 1 km transects in 143 sub-areas, and 415 canine faecal samples were collected and submitted to coprological examinations. Negative binomial regression models and Gaussian random effects models were used to analyze the association between faeces count and human population density taking into account for extraPoisson variability. Logistic regression model was used to evaluate the association between positivity to parasitic elements and number of canine faeces. Results Out of the 143 studied sub-areas, 141 (98.6% contained canine faeces. There was a strong spatial gradient with 48% of the total variability accounted by between neighbourhood variability; a positive association between the number of faeces and the human population density was found. Seventy (over 415, 16.9% canine faecal samples were positive for parasitic elements. There was no association between
Current state of knowledge: the canine gastrointestinal microbiome.
Hooda, Seema; Minamoto, Yasushi; Suchodolski, Jan S; Swanson, Kelly S
2012-06-01
Gastrointestinal (GI) microbes have important roles in the nutritional, immunological, and physiologic processes of the host. Traditional cultivation techniques have revealed bacterial density ranges from 10(4) to 10(5) colony forming units (CFU)/g in the stomach, from 10(5) to 10(7) CFU/g in the small intestine, and from 10(9) to 10(11) CFU/g in the colon of healthy dogs. As a small number of bacterial species can be grown and studied in culture, however, progress was limited until the recent emergence of DNA-based techniques. In recent years, DNA sequencing technology and bioinformatics have allowed for better phylogenetic and functional/metabolic characterization of the canine gut microbiome. Predominant phyla include Firmicutes, Bacteroidetes, Fusobacteria, Proteobacteria, and Actinobacteria. Studies using 16S ribosomal RNA (rRNA) gene pyrosequencing have demonstrated spatial differences along the GI tract and among microbes adhered to the GI mucosa compared to those in intestinal contents or feces. Similar to humans, GI microbiome dysbiosis is common in canine GI diseases such as chronic diarrhea and inflammatory bowel diseases. DNA-based assays have also identified key pathogens contributing to such conditions, including various Clostridium, Campylobacter, Salmonella, and Escherichia spp. Moreover, nutritionists have applied DNA-based techniques to study the effects of dietary interventions such as dietary fiber, prebiotics, and probiotics on the canine GI microbiome and associated health indices. Despite recent advances in the field, the canine GI microbiome is far from being fully characterized and a deeper characterization of the phylogenetic and functional/metabolic capacity of the GI microbiome in health and disease is needed. This paper provides an overview of recent studies performed to characterize the canine GI microbiome.
Castanheira, Pedro; Duarte, Ana; Gil, Solange; Cartaxeiro, Clara; Malta, Manuel; Vieira, Sara; Tavares, Luis
2014-04-23
Infections caused by canine parvovirus, canine distemper virus and canine coronavirus are an important cause of mortality and morbidity in dogs worldwide. Prior to this study, no information was available concerning the incidence and prevalence of these viruses in Cape Verde archipelago. To provide information regarding the health status of the canine population in Vila do Maio, Maio Island, Cape Verde, 53 rectal swabs were collected from 53 stray dogs during 2010 and 93 rectal swabs and 88 blood samples were collected from 125 stray dogs in 2011. All rectal swabs (2010 n = 53; 2011 n = 93) were analysed for the presence of canine parvovirus, canine distemper virus and canine coronavirus nucleic acids by quantitative PCR methods. Specific antibodies against canine distemper virus and canine parvovirus were also assessed (2011 n = 88).From the 2010 sampling, 43.3% (23/53) were positive for canine parvovirus DNA, 11.3% (6/53) for canine distemper virus RNA and 1.9% (1/53) for canine coronavirus RNA. In 2011, the prevalence values for canine parvovirus and canine coronavirus were quite similar to those from the previous year, respectively 44.1% (41/93), and 1.1% (1/93), but canine distemper virus was not detected in any of the samples analysed (0%, 0/93). Antibodies against canine parvovirus were detected in 71.6% (63/88) blood samples and the seroprevalence found for canine distemper virus was 51.1% (45/88). This study discloses the data obtained in a molecular and serological epidemiological surveillance carried out in urban populations of stray and domestic animals. Virus transmission and spreading occurs easily in large dog populations leading to high mortality rates particularly in unvaccinated susceptible animals. In addition, these animals can act as disease reservoirs for wild animal populations by occasional contact. Identification of susceptible wildlife of Maio Island is of upmost importance to evaluate the risk of pathogen spill over from
Decaro, Nicola; Mari, Viviana; Larocca, Vittorio; Losurdo, Michele; Lanave, Gianvito; Lucente, Maria Stella; Corrente, Marialaura; Catella, Cristiana; Bo, Stefano; Elia, Gabriella; Torre, Giorgio; Grandolfo, Erika; Martella, Vito; Buonavoglia, Canio
2016-08-30
A molecular survey for traditional and emerging pathogens associated with canine infectious respiratory disease (CIRD) was conducted in Italy between 2011 and 2013 on a total of 138 dogs, including 78 early acute clinically ill CIRD animals, 22 non-clinical but exposed to clinically ill CIRD dogs and 38 CIRD convalescent dogs. The results showed that canine parainfluenza virus (CPIV) was the most commonly detected CIRD pathogen, followed by canine respiratory coronavirus (CRCoV), Bordetella bronchiseptica, Mycoplasma cynos, Mycoplasma canis and canine pneumovirus (CnPnV). Some classical CIRD agents, such as canine adenoviruses, canine distemper virus and canid herpesvirus 1, were not detected at all, as were not other emerging respiratory viruses (canine influenza virus, canine hepacivirus) and bacteria (Streptococcus equi subsp. zooepidemicus). Most severe forms of respiratory disease were observed in the presence of CPIV, CRCoV and M. cynos alone or in combination with other pathogens, whereas single CnPnV or M. canis infections were detected in dogs with no or very mild respiratory signs. Interestingly, only the association of M. cynos (alone or in combination with either CRCoV or M. canis) with severe clinical forms was statistically significant. The study, while confirming CPIV as the main responsible for CIRD occurrence, highlights the increasing role of recently discovered viruses, such as CRCoV and CnPnV, for which effective vaccines are not available in the market. Copyright © 2016 Elsevier B.V. All rights reserved.
Comparison of canine retraction using single and Siamese edgewise brackets: An in vivo study
Directory of Open Access Journals (Sweden)
Zeeshan Iqbal Bhat
2013-01-01
Full Text Available Objectives: The purpose of this study was to check the rate of canine retraction with bodily mechanics using two different pre-adjusted edgewise bracket Systems. Materials and Methods: A split mouth study with twenty patients who were randomly selected and allotted to a single operator. Duration of canine retraction, angulation of canine during its retraction, degree of Rotation, anchorage Loss, distance between canine and premolar at different time intervals were then evaluated, pre- (To, 3 months- (T1 and canine tip touches the second premolar- (T2. Descriptive statistics including mean values and standard deviations were calculated. Paired and unpaired t-test was performed to evaluate the differences between the groups. Results: Rotation and angulation of the canines did not show significant difference in both the systems. There was statistically significant difference (P<0.01 in anchorage loss between single wing and Siamese bracket being 2.65 ±1.41 mm and 1.31 ± 0.93 respectively. There was statistically significant intergroup difference (P<0.01 in canine movement i.e distance between canine and premolar was recorded as 4.72mm (15.06 ± 1.69 to 10.34 ± 1.68mm in single wing bracket and 6.25mm in Siamese (15.52 ± 1.41 to 9.27 ± 1.94. Conclusion: In cases where high anchorage is required and the rate of canine retraction is a concern, Siamese brackets pose a definite advantage over Single wing brackets.
Directory of Open Access Journals (Sweden)
Laura Nordio
2017-05-01
Full Text Available FXR1 (Fragile X mental retardation-related protein 1 is a cytoplasmic RNA binding protein, which genetic expression has been related to metastatic potential in human melanoma. The aims of the present study were: the validation of two commercially available clones of polyclonal anti-human FXR1 antibody in dogs; their application to investigate FXR1 expression in a group of canine oral melanomas. Anti-FXR1 antibody was not previously validated in the canine species. Two different commercially available polyclonal anti-FXR1 antibodies (respectively made in goat and in rabbit were used. FXR1 protein in canine serum was identified by western blot after SDS-PAGE, using human serum as control. FXR1 immunohistochemical expression was tested in a series of normal tissues, that are expected to express FXR1, and in 31 cases of oral melanomas. The final immunohistochemical protocol used heat-induced unmasking and overnight incubation. FXR1 protein bands in canine serum were detected by tested antibodies, in a more specific way by the rabbit antibody. FXR1 immunohistochemical staining was positive in all tested organs, with different levels of expression. FXR1 was also expressed in 31/31 tested melanomas, with variable intensity and percentage of positive cells (Figure 1. Equal results were achieved with the two antibodies in 8 cases of melanoma, whereas there were variable differences in 22, and one case stained only with goat antibody. The rabbit antibody gave less background staining. This study validated anti-FXR1 antibodies for use in the canine species. This protein was expressed in various normal tissues, as well as in the tested neoplasms. Significance of different level of expression is undergoing evaluation with further studies.
Models of experimental saccular aneurysms of carotid arteries in canine
International Nuclear Information System (INIS)
Zhang Haixia; Cheng Yingsheng; Li Minghua
2006-01-01
Objective: To study the availability by making experimental saccular aneurysm models of carotid arteries in canine similar to human intracranial aneurysms. Methods: Twenty healthy canines with experimental saccular side-wall aneurysms of carotid arteries were created successfully by surgery. Results: Forty experimental saccular side-wall aneurysms of carotid arteries were created successfully with 36 aneurysms and parent arteries maintaining patency with each other and four spontaneously occluded confirmed by angiography. Model successful rate reached 90%. Conclusions: Experimental saccular side-wall aneurysms of carotid arteries in canines were one of best models created for simulating human intracranial aneurysms. (authors)
Testosterone biotransformation by the isolated perfused canine pancreas
International Nuclear Information System (INIS)
Fernandez-del Castillo, C.; Diaz-Sanchez, V.; Varela-Fascinetto, G.; Altamirano, A.; Odor-Morales, A.; Lopez-Medrano, R.M.; Robles-Diaz, G.
1991-01-01
There is strong evidence indicating that the pancreas is under the influence of sex steroid hormones, and that it may even participate in their biosynthesis and metabolism. In the present study, [3H]testosterone was perfused into the isolated canine pancreas, and measured in the effluent with several of its metabolites (5 alpha-dihydrotestosterone, androstenedione, and estradiol). Results show that testosterone is readily transformed by the canine pancreas. The main product found in the effluent is androstenedione. The testis and spleen were also perfused with [3H]testosterone and used as controls. In both cases, this hormone appeared mostly unchanged in the effluent as compared to the pancreatic perfusion (p less than 0.0001). From our data, we conclude that the canine pancreas has the capacity to transform sex steroid hormones, and could be considered an extragonadal site of sex steroid biosynthesis
Testosterone biotransformation by the isolated perfused canine pancreas
Energy Technology Data Exchange (ETDEWEB)
Fernandez-del Castillo, C.; Diaz-Sanchez, V.; Varela-Fascinetto, G.; Altamirano, A.; Odor-Morales, A.; Lopez-Medrano, R.M.; Robles-Diaz, G. (Instituto Nacional de la Nutricion Salvador Zubiran, Mexico City (Mexico))
1991-01-01
There is strong evidence indicating that the pancreas is under the influence of sex steroid hormones, and that it may even participate in their biosynthesis and metabolism. In the present study, (3H)testosterone was perfused into the isolated canine pancreas, and measured in the effluent with several of its metabolites (5 alpha-dihydrotestosterone, androstenedione, and estradiol). Results show that testosterone is readily transformed by the canine pancreas. The main product found in the effluent is androstenedione. The testis and spleen were also perfused with (3H)testosterone and used as controls. In both cases, this hormone appeared mostly unchanged in the effluent as compared to the pancreatic perfusion (p less than 0.0001). From our data, we conclude that the canine pancreas has the capacity to transform sex steroid hormones, and could be considered an extragonadal site of sex steroid biosynthesis.
Influence of feeding on serum canine pancreatic lipase immunoreactivity concentrations
Directory of Open Access Journals (Sweden)
Steiner JM
2014-10-01
Full Text Available Jörg M Steiner, Craig G Ruaux, David A Williams Gastrointestinal Laboratory, College of Veterinary Medicine and Biomedical Sciences, Texas A&M University, College Station, TX, USA Abstract: Measurement of serum concentration of pancreatic lipase immunoreactivity (PLI has been shown to be highly specific for exocrine pancreatic function and sensitive for the diagnosis of canine pancreatitis. Currently, it is recommended that food be withheld for at least 12 hours before collecting a blood sample for analysis from dogs. However, it is unknown whether feeding has any influence on serum canine PLI concentration. Thus, the goal of this study was to evaluate the influence of feeding on serum canine PLI concentrations in healthy dogs. Food was withheld from eight healthy adult Beagle dogs for at least 17 hours and a baseline serum sample (0 minutes was collected. Dogs were fed and serum samples were collected at 15, 30, 45, 60, 75, 90, 105, 150, 180, 210, 240, 300, 360, 420, and 480 minutes. There was no significant difference in serum canine PLI concentrations at any time after feeding (P=0.131. We conclude that feeding has no significant influence on serum canine PLI concentrations. Keywords: dog, pancreatic function, pancreatitis, biomarker, diagnostic test
Alkaline phosphatase activity in gingival crevicular fluid during canine retraction.
Batra, P; Kharbanda, Op; Duggal, R; Singh, N; Parkash, H
2006-02-01
The aim of the study was to investigate alkaline phosphatase activity in the gingival crevicular fluid (GCF) during orthodontic tooth movement in humans. Postgraduate orthodontic clinic. Ten female patients requiring all first premolar extractions were selected and treated with standard edgewise mechanotherapy. Canine retraction was done using 100 g sentalloy springs. Maxillary canine on one side acted as experimental site while the contralateral canine acted as control. Gingival crevicular fluid was collected from mesial and distal of canines before initiation of canine retraction (baseline), immediately after initiation of retraction, and on 1st, 7th, 14th and 21st day and the alkaline phosphatase activity was estimated. The results show significant (p < 0.05) changes in alkaline phosphatase activity on the 7th, 14th and 21st day on both mesial and distal aspects of the compared experimental and control sides. The peak in enzyme activity occurred on the 14th day of initiation of retraction followed by a significant fall in activity especially on the mesial aspect. The study showed that alkaline phosphatase activity could be successfully estimated in the GCF using calorimetric estimation assay kits. The enzyme activity showed variation according to the amount of tooth movement.
Orthodontic-surgical treatment of bilateral maxillary canine impaction
Sumitra
2012-01-01
A 13-year-old female patient reported with the chief complaint of irregular front teeth. She had a skeletal Class III and Angle's Class I malocclusion with hyperdivergent growth pattern and bilateral impaction of maxillary canines. Surgical exposure of the impacted teeth and orthodontic alignment was planned. The surgical exposure was done by a minimally invasive modified window technique. Orthodontic treatment of impacted canines without causing significant morbidity to the adjacent teeth an...
MiR-34a regulates the invasive capacity of canine osteosarcoma cell lines.
Lopez, Cecilia M; Yu, Peter Y; Zhang, Xiaoli; Yilmaz, Ayse Selen; London, Cheryl A; Fenger, Joelle M
2018-01-01
Osteosarcoma (OSA) is the most common bone tumor in children and dogs; however, no substantial improvement in clinical outcome has occurred in either species over the past 30 years. MicroRNAs (miRNAs) are small non-coding RNAs that regulate gene expression and play a fundamental role in cancer. The purpose of this study was to investigate the potential contribution of miR-34a loss to the biology of canine OSA, a well-established spontaneous model of the human disease. RT-qPCR demonstrated that miR-34a expression levels were significantly reduced in primary canine OSA tumors and canine OSA cell lines as compared to normal canine osteoblasts. In canine OSA cell lines stably transduced with empty vector or pre-miR-34a lentiviral constructs, overexpression of miR-34a inhibited cellular invasion and migration but had no effect on cell proliferation or cell cycle distribution. Transcriptional profiling of canine OSA8 cells possessing enforced miR-34a expression demonstrated dysregulation of numerous genes, including significant down-regulation of multiple putative targets of miR-34a. Moreover, gene ontology analysis of down-regulated miR-34a target genes showed enrichment of several biological processes related to cell invasion and motility. Lastly, we validated changes in miR-34a putative target gene expression, including decreased expression of KLF4, SEM3A, and VEGFA transcripts in canine OSA cells overexpressing miR-34a and identified KLF4 and VEGFA as direct target genes of miR-34a. Concordant with these data, primary canine OSA tumor tissues demonstrated increased expression levels of putative miR-34a target genes. These data demonstrate that miR-34a contributes to invasion and migration in canine OSA cells and suggest that loss of miR-34a may promote a pattern of gene expression contributing to the metastatic phenotype in canine OSA.
MiR-34a regulates the invasive capacity of canine osteosarcoma cell lines.
Directory of Open Access Journals (Sweden)
Cecilia M Lopez
Full Text Available Osteosarcoma (OSA is the most common bone tumor in children and dogs; however, no substantial improvement in clinical outcome has occurred in either species over the past 30 years. MicroRNAs (miRNAs are small non-coding RNAs that regulate gene expression and play a fundamental role in cancer. The purpose of this study was to investigate the potential contribution of miR-34a loss to the biology of canine OSA, a well-established spontaneous model of the human disease.RT-qPCR demonstrated that miR-34a expression levels were significantly reduced in primary canine OSA tumors and canine OSA cell lines as compared to normal canine osteoblasts. In canine OSA cell lines stably transduced with empty vector or pre-miR-34a lentiviral constructs, overexpression of miR-34a inhibited cellular invasion and migration but had no effect on cell proliferation or cell cycle distribution. Transcriptional profiling of canine OSA8 cells possessing enforced miR-34a expression demonstrated dysregulation of numerous genes, including significant down-regulation of multiple putative targets of miR-34a. Moreover, gene ontology analysis of down-regulated miR-34a target genes showed enrichment of several biological processes related to cell invasion and motility. Lastly, we validated changes in miR-34a putative target gene expression, including decreased expression of KLF4, SEM3A, and VEGFA transcripts in canine OSA cells overexpressing miR-34a and identified KLF4 and VEGFA as direct target genes of miR-34a. Concordant with these data, primary canine OSA tumor tissues demonstrated increased expression levels of putative miR-34a target genes.These data demonstrate that miR-34a contributes to invasion and migration in canine OSA cells and suggest that loss of miR-34a may promote a pattern of gene expression contributing to the metastatic phenotype in canine OSA.
Homologous radioimmunoassay for canine prolactin and its application in various physiological states
International Nuclear Information System (INIS)
Graef, K.-J.; Friedreich, E.; Matthes, S.; Hasan, S.H.
1977-01-01
The purification of canine prolactin and the development of an homologous radioimmunoassay including several physiological studies in the Beagle dog are described. The assay measured immunoreactive canine prolactin with a sensitivity limit of 0.6 ng/ml. Purified canine luteinizing hormone gave no significant inhibition in the assay whereas purified canine growth hormone inhibited the binding of 125 I-labelled canine prolactin to antiserum only at very high dose levels. In Beagle dogs, basal serum prolactin concentrations were in the range 1 to 2 ng/ml in normal male, normal female (metoestrus and anoestrus) and oophorectomized-hysterectomized female dogs. The prolactin concentration in one sample of amniotic fluid was in the same range, while in hypophysectomized make dogs no serum prolactin could be detected by the assay system. Serum prolactin concentrations tended to increase during late pregnancy and parturition, remaining high during the first 9 days of lactation. In consequence, a negative correlation was suggested between serum prolactin and serum progesterone concentrations. (author)
Sehata, Go; Sato, Hiroaki; Yamanaka, Morimasa; Takahashi, Takuo; Kainuma, Risa; Igarashi, Tatsuhiko; Oshima, Sho; Noro, Taichi; Oishi, Eiji
2017-11-01
Identifying molecular determinants of virulence attenuation in live attenuated canine parvovirus (CPV) vaccines is important for assuring their safety. To this end, we identified mutations in the attenuated CPV 9985-46 vaccine strain that arose during serial passage in Crandell-Rees feline kidney cells by comparison with the wild-type counterpart, as well as minimal determinants of the loss of virulence. Four amino acid substitutions (N93K, G300V, T389N and V562L) in VP2 of strain 9985-46 significantly restricted infection in canine A72 cells. Using an infectious molecular clone system, we constructed isogenic CPVs of the parental virulent 9985 strain carrying single or double mutations. We observed that only a single amino acid substitution in VP2, G300V or T389N, attenuated the virulent parental virus. Combinations of these mutations further attenuated CPV to a level comparable to that of 9985-46. Strains with G300V/T389N substitutions did not induce clinical symptoms in experimentally infected pups, and their ability to infect canine cells was highly restricted. We found that another G300V/V562L double mutation decreased affinity of the virus for canine cells, although its pathogenicity to dogs was maintained. These results indicate that mutation of residue 300, which plays a critical role in host tropism, is not sufficient for viral attenuation in vivo, and that attenuation of 9985-46 strain is defined by at least two mutations in residues 300 and 389 of the VP2 capsid protein. This finding is relevant for quality control of the vaccine and provides insight into the rational design of second-generation live attenuated vaccine candidates.
Extraction of Unerupted Maxillary Canine Teeth in a Maned Wolf (Chrysocyon brachyurus
Directory of Open Access Journals (Sweden)
Lourdes M. B. Pessoa
2016-01-01
Full Text Available The purpose of this case report is to describe the diagnosis and treatment of unerupted canine teeth in a maned wolf. After physical examination, complete blood count, and serum biochemical profile, the animal underwent general anesthesia and head radiography was performed to confirm the diagnosis. The treatment consisted of the extraction of both maxillary canine teeth and clinical and radiographic follow-up of the right mandibular canine tooth.
Extraction of Unerupted Maxillary Canine Teeth in a Maned Wolf (Chrysocyon brachyurus)
Pessoa, Lourdes M. B.; Roza, Marcello; Farias, Anderson; Jesus, Pedro Henrique de; Campbell, Rita de Cassia; Pinho, Mariângela Pereira de
2016-01-01
The purpose of this case report is to describe the diagnosis and treatment of unerupted canine teeth in a maned wolf. After physical examination, complete blood count, and serum biochemical profile, the animal underwent general anesthesia and head radiography was performed to confirm the diagnosis. The treatment consisted of the extraction of both maxillary canine teeth and clinical and radiographic follow-up of the right mandibular canine tooth.
... Safe Videos for Educators Search English Español Chronic Kidney Diseases KidsHealth / For Kids / Chronic Kidney Diseases What's ... re talking about your kidneys. What Are the Kidneys? Your kidneys are tucked under your lower ribs ...
PMab-38 Recognizes Canine Podoplanin of Squamous Cell Carcinomas.
Kaneko, Mika K; Honma, Ryusuke; Ogasawara, Satoshi; Fujii, Yuki; Nakamura, Takuro; Saidoh, Noriko; Takagi, Michiaki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari
2016-10-01
Podoplanin, a type I transmembrane protein, is expressed in lymphatic endothelial cells. Although we previously developed an anticanine podoplanin monoclonal antibody (mAb), PMab-38, immunohistochemistry (IHC) showed that it did not react with canine lymphatic endothelial cells. Here, we determined whether PMab-38 recognizes canine podoplanin of squamous cell carcinomas (SCCs) and clarified its epitope. In IHC, PMab-38 reacted with 83% of SCCs (15/18 cases). Flow cytometry showed that the epitope of PMab-38 was different from that of the platelet aggregation-stimulating domain of the N-terminus, which was detected by almost all antipodoplanin mAbs such as D2-40 or NZ-1. PMab-38 is expected to be useful for investigating the function of podoplanin in canine tumors.
Yu, Lei; Gan, Xiuguo; Liu, Xukun; An, Ruihua
2017-11-01
Tight junction plays important roles in regulating paracellular transports and maintaining cell polarity. Calcium oxalate monohydrate (COM) crystals, the major crystalline composition of kidney stones, have been demonstrated to be able to cause tight junction disruption to accelerate renal cell injury. However, the cellular signaling involved in COM crystal-induced tight junction disruption remains largely to be investigated. In the present study, we proved that COM crystals induced tight junction disruption by activating ROS/Akt/p38 MAPK pathway. Treating Madin-Darby canine kidney (MDCK) cells with COM crystals induced a substantial increasing of ROS generation and activation of Akt that triggered subsequential activation of ASK1 and p38 mitogen-activated protein kinase (MAPK). Western blot revealed a significantly decreased expression of ZO-1 and occludin, two important structural proteins of tight junction. Besides, redistribution and dissociation of ZO-1 were observed by COM crystals treatment. Inhibition of ROS by N-acetyl-l-cysteine (NAC) attenuated the activation of Akt, ASK1, p38 MAPK, and down-regulation of ZO-1 and occludin. The redistribution and dissociation of ZO-1 were also alleviated by NAC treatment. These results indicated that ROS were involved in the regulation of tight junction disruption induced by COM crystals. In addition, the down-regulation of ZO-1 and occludin, the phosphorylation of ASK1 and p38 MAPK were also attenuated by MK-2206, an inhibitor of Akt kinase, implying Akt was involved in the disruption of tight junction upstream of p38 MAPK. Thus, these results suggested that ROS-Akt-p38 MAPK signaling pathway was activated in COM crystal-induced disruption of tight junction in MDCK cells.
International Nuclear Information System (INIS)
Mochalova, Larisa; Gambaryan, Alexandra; Romanova, Julia; Tuzikov, Alexander; Chinarev, Alexander; Katinger, Dietmar; Katinger, Herman; Egorov, Andrej; Bovin, Nicolai
2003-01-01
To study the receptor specificity of modern human influenza H1N1 and H3N2 viruses, the analogs of natural receptors, namely sialyloligosaccharides conjugated with high molecular weight (about 1500 kDa) polyacrylamide as biotinylated and label-free probes, have been used. Viruses isolated from clinical specimens were grown in African green monkey kidney (Vero) or Madin-Darby canine kidney (MDCK) cells and chicken embryonated eggs. All Vero-derived viruses had hemagglutinin (HA) sequences indistinguishable from original viruses present in clinical samples, but HAs of three of seven tested MDCK-derived isolates had one or two amino acid substitutions. Despite these host-dependent mutations and differences in the structure of HA molecules of individual strains, all studied Vero- and MDCK-isolated viruses bound to Neu5Ac α2-6Galβ1-4GlcNAc (6'SLN) essentially stronger than to Neu5Acα2-6Galβ1-4Glc (6'SL). Such receptor-binding specificity has been typical for earlier isolated H1N1 human influenza viruses, but there is a new property of H3N2 viruses that has been circulating in the human population during recent years. Propagation of human viruses in chicken embryonated eggs resulted in a selection of variants with amino acid substitutions near the HA receptor-binding site, namely Gln226Arg or Asp225Gly for H1N1 viruses and Leu194Ile and Arg220Ser for H3N2 viruses. These HA mutations disturb the observed strict 6'SLN specificity of recent human influenza viruses
Veleva, Ralitsa; Petkova, Bela; Moskova-Doumanova, Veselina; Doumanov, Jordan; Dimitrova, Milena; Koleva, Petya; Mladenova, Kirilka; Petrova, Svetla; Yordanova, Zhenya; Kapchina-Toteva, Veneta; Topouzova-Hristova, Tanya
2015-01-02
Lamium album L. is a perennial herb widely used in folk medicine. It possesses a wide spectrum of therapeutic activities (anti-inflammatory, astringent, antiseptic, antibiotic, antispasmodic, antioxidant and anti-proliferative). Preservation of medicinal plant could be done by in vitro propagation to avoid depletion from their natural habitat. It is important to know whether extracts from L. album plants grown in vitro possess similar properties as extracts from plants grown in vivo . For these reasons, it is important to examine changes in the composition of secondary metabolites during in vitro cultivation of the plant and how they affect the biological activity. We used A549 human cancer cell line and normal kidney epithelial cells MDCKII (Madin-Darby canine kidney cells II) as controls in assessing the anti-cancer effect of plant extracts. To elucidate changes in some key functional characteristics, adhesion test, MTT (3-(4,5-dimethylthiazol-2-yl)-2-5-diphenyl tetrazolium bromide), transepithelial resistance (TER), immunofluorescence staining and trypan blue exclusion test were performed. Methanol and chloroform extracts of in vivo and in vitro propagated plants affected differently cancerous and non-cancerous cells. The most pronounced differences were observed in the morphological analysis and in the cell adhesive properties. We also detected suppressed epithelial transmembrane electrical resistance of MDCK II cells, by treatment with plant extracts, compared to non-treated MDCK II cells. A549 cells did not polarize under the same conditions. Altered organization of actin filaments in both cell types were noticed suggesting that extracts from L. album L. change TER and actin filaments, and somehow may block cell mechanisms, leading to the polarization of MDCK II cells.
Activation of ERK mitogen-activated protein kinase in human cells by the mycotoxin patulin
International Nuclear Information System (INIS)
Wu, T.-S.; Yu, F.-Y.; Su, C.-C.; Kan, J.-C.; Chung, C.-P.; Liu, B.-H.
2005-01-01
Patulin (PAT), a mycotoxin produced by certain species of Penicillium and Aspergillus, is often detectable in moldy fruits and their derivative products. PAT led to a concentration-dependent and time-dependent increase in phosphorylation of extracellular signal-regulated protein kinases 1 and 2 (ERK1/2) in human embryonic kidney (HEK293) cells, human peripheral blood mononuclear cells (PBMCs), and Madin-Darby canine kidney (MDCK) cells. Exposure of HEK293 cells to concentrations above 5 μM PAT for 30 min induced ERK1/2 phosphorylation; activation of ERK1/2 was also observed after 24 h incubation with 0.05 μM of PAT. Treatment of human PBMCs for 30 min with 30 μM PAT dramatically increased the phosphorylated ERK1/2 levels. Both MEK1/2 inhibitors, U0126 and PD98059, suppressed ERK1/2 activation in either HEK293 or MDCK cells. In HEK293 cells, U0126-mediated inhibition of PAT-induced ERK1/2 phosphorylation resulted in a significant decrease in levels of DNA damage, expressed as tail moment values, in the single cell gel electrophoresis assay. Conversely, U0126 did not affect cell viability, lactate dehydrogenase release, and the DNA synthesis rate in PAT-treated cultures. Exposure of HEK293 cells for 90 min to 15 μM PAT elevated the levels of early growth response gene-1 (egr-1) mRNA, but not of c-fos, fosB, and junB mRNAs. These results indicate that in human cells, PAT causes a rapid and persistent activation of ERK1/2 and this signaling pathway plays an important role in mediating PAT-induced DNA damage and egr-1 gene expression
Effect of imidazole and indomethacin on hemodynamics of the obstructed canine kidney
International Nuclear Information System (INIS)
Balint, P.; Laszlo, K.
1985-01-01
In the anesthetized dog renal blood flow (RBF) and its intrarenal distribution were investigated by the radioactive microsphere technique 24 hr after bilateral (BUL) and unilateral (UUL) ureteral ligation. In the control series indomethacin (IM) led to a decrease in RBF with outward shifting of zonal perfusions; imidazole (IA) did not cause significant changes in renal hemodynamics. In the BUL series there was a sharp drop in RBF with a proportional decrease in outer (OC) and inner (IC) cortical perfusion; IM treatment resulted in a further decrease in overall and zonal perfusions. IA, a selective inhibitor of thromboxane synthetase, relieved IC vasoconstriction. In the ligated kidney of the UUL preparations decrease in RBF was due to OC vasoconstriction, while IC perfusion equalled controls. IM led to an overall vasoconstriction in all cortical layers; IA did not influence either total RBF or its distribution. It was concluded that BUL ''unmasked'' TXA2 production in the IC layers, while IM treatment, by inhibiting the production of PGE2, PGI2, and TXA2, resulted in an overall vasoconstriction both in controls and the BUL and UUL preparations
[Biological characteristics of a chimeric rabies virus expressing canine parvovirus VP2 protein].
Niu, Xue-Feng; Liu, Xiao-Hui; Sun, Zhao-Jin; Shi, He-He; Chen, Jing; Jiang, Bido; Sun, Jing-Chen; Guo, Xiao-Feng
2009-09-01
To obtain a bivalence vaccine against canine rabies virus and canine parvovirus, a chimeric rabies virus expressing canine parvovirus VP2 protein was generated by the technique of reverse genetics. It was shown that the chimeric virus designated as HEP-Flury (VP2) grew well on BHK-21 cells and the VP2 gene could still be stably expressed after ten passages on BHK-21 cells. Experiments on the mice immunized with the chimeric virus HEP-Flury (VP2) demonstrated that specific antibodies against rabies virus and canine parvovirus were induced in immunized mice after vaccination with the live chimeric virus.
Cellular endocytic compartment localization of expressed canine CD1 molecules
DEFF Research Database (Denmark)
Schjærff, Mette; Keller, Stefan M.; Affolter, Verena K.
2016-01-01
CD1 molecules are glycoproteins present primarily on dendritic cells (DCs), which recognize and presenta variety of foreign- and self-lipid antigens to T-cells. Humans have five different CD1 isoforms that sur-vey distinct cellular compartments allowing for recognition of a large repertoire...... onlya diminished GFP expression. In conclusion, canine CD1 transfectants show distinct localization patternsthat are similar to human CD1 proteins with the exception of the canine CD1d isoform, which most likelyis non-functional. These findings imply that canine CD1 localization overall resembles human...... CD1 traf-ficking patterns. This knowledge is important for the understanding of lipid antigen-receptor immunityin the dog....
Canine Gouging: A Taboo Resurfacing in Migrant Urban Population.
Noman, Anila Virani; Wong, Ferranti; Pawar, Ravikiran Ramakrishna
2015-01-01
Cosmopolitan cities have become a pool of migrants from different parts of the world, who carry their cultural beliefs and superstitions with them around the globe. Canine gouging is a kind of infant oral mutilation (IOM) which is widely practiced among rural population of Africa where the primary tooth bud of the deciduous canine is enucleated. The belief is that the life threatening illnesses in children like vomiting, diarrhoea, and fevers are caused by worms which infest on tooth buds. This case report is of a 15-year-old Somalian born boy, who presented at the dental institute with intermittent pain in his lower right permanent canine which was associated with a discharging intra oral buccal sinus. The tooth was endodontically treated and then restored with composite. General dental practitioners need to be vigilant when encountered with tooth presenting unusual morphology, unilateral missing tooth, and shift in the midline due to early loss of deciduous/permanent canines. Identification of any such dental mutilation practice will need further counselling of the individual and family members. It is the duty of every dental professional to educate and safeguard the oral and dental health of general public.
Cellular and Phenotypic Characterization of Canine Osteosarcoma Cell Lines
Directory of Open Access Journals (Sweden)
Marie E. Legare, Jamie Bush, Amanda K. Ashley, Taka Kato, William H. Hanneman
2011-01-01
Full Text Available Canine and human osteosarcoma (OSA have many similarities, with the majority of reported cases occurring in the appendicular skeleton, gender predominance noted, high rate of metastasis at the time of presentation, and a lack of known etiology for this devastating disease. Due to poor understanding of the molecular mechanisms underlying OSA, we have characterized seven different OSA canine cell lines: Abrams, D17, Grey, Hughes, Ingles, Jarques, and Marisco and compared them to U2, a human OSA cell line, for the following parameters: morphology, growth, contact inhibition, migrational tendencies, alkaline phosphatase staining, heterologous tumor growth, double-strand DNA breaks, and oxidative damage. All results demonstrated the positive characteristics of the Abrams cell line for use in future studies of OSA. Of particular interest, the robust growth of a subcutaneous tumor and rapid pulmonary metastasis of the Abrams cell line in an immunocompromised mouse shows incredible potential for the future use of Abrams as a canine OSA model. Further investigations utilizing a canine cell model of OSA, such as Abrams, will be invaluable to understanding the molecular events underlying OSA, pharmaceutical inhibition of metastasis, and eventual prevention of this devastating disease.
Orthodontic management of bilaterally impacted mandibular canines in a growing patient
Directory of Open Access Journals (Sweden)
Rajaganesh J Gautam
2016-01-01
Full Text Available KK, an 11.9-year-old male patient, presented with the chief complaint of forwardly placed upper front teeth. Diagnosis revealed a Class II subdivision right malocclusion on an underlying Class I skeletal base with a horizontal growth pattern, bimaxillary proclination, crowding in the lower arch, over retained deciduous canines in the upper right and lower quadrants, an unerupted maxillary right permanent canine, and bilaterally impacted mandibular permanent canines, an increased overjet, and a deep overbite. He had a mild convex profile, a toothy smile with a nonconsonant smile arc and mildly protrusive lips. Treatment with a nonextraction treatment plan, which included surgical uncovering and orthodontic eruptive guidance of the impacted mandibular canines, with multibracket metallic fixed appliances, solved the patient′s complaints and achieved an esthetically pleasing and functionally adequate occlusal result.
... the kidney (in rare cases, may require a blood transfusion) Bleeding into the muscle, which might cause soreness Infection (small risk) Alternative Names Renal biopsy; Biopsy - kidney Images Kidney anatomy ...
Comparison of canine parvovirus with mink enteritis virus by restriction site mapping.
McMaster, G K; Tratschin, J D; Siegl, G
1981-01-01
The genomes of canine parvovirus and mink enteritis virus were compared by restriction enzyme analysis of their replicative-form DNAs. Of 79 mapped sites, 68, or 86%, were found to be common for both types of DNA, indicating that canine parvovirus and mink enteritis virus are closely related viruses. Whether they evolved from a common precursor or whether canine parvovirus is derived from mink enteritis virus, however, cannot be deduced from our present data.
Enzyme-linked immunosorbent Assay for detecting of antibody to canine distemper virus
Directory of Open Access Journals (Sweden)
Sudarisman
2006-03-01
Full Text Available Serum neutralisation test (SNT has been established for evaluating canine distemper vaccination, but until now SNT was rarely used due to the need for continuous tissue culture facilities and requires 3 days to perform. For detecting antibody to canine distemper virus, an enzyme-linked immunosorbent assay (ELISA is relatively simple and rapid seroassay. ELISA for canine immunoglobulin (Ig G antibodies to canine distemper virus (CDV was developed by using Onderstepoort strain of canine distemper virus as coating antigen. Rabbit anti canine IgG labelled with horse radish peroxidase was used as the conjugate, while phenylenediamine dihydrochloride (OPD was used as the substrate. The ELISA results were then compared with the results of the SNT, using the sera of 312 random-source dogs from West Java. The two test-results had a high degree of correlation. Very few discrepancies occurred and most of these were at the lower limits of each test. When the sera were tested at 1 : 100 dilutions, there was a 95.5% agreement between the ELISA and SNT. Their sensitivity and spesificity were 83.9 and 98.4%. Titrated SNT and ELISA also were performed on sera from 7 dogs whose lifetime medical histories were known. The antibodies were inclining up after two months of post vaccination, where the titre was not in zero/lower position at the day of vaccination. However, antibody zero or low position were found at 28 days post vaccination. All of the results indicated that ELISA can be used for evaluating antibody to canine distemper virus response, replacing the SNT.
Comparative photoelastic study of dental and skeletal anchorages in the canine retraction
Directory of Open Access Journals (Sweden)
Cristiane Aparecida de Assis Claro
2014-01-01
Full Text Available OBJECTIVE: To compare dental and skeletal anchorages in mandibular canine retraction by means of a stress distribution analysis. METHODS: A photoelastic model was produced from second molar to canine, without the first premolar, and mandibular canine retraction was simulated by a rubber band tied to two types of anchorage: dental anchorage, in the first molar attached to adjacent teeth, and skeletal anchorage with a hook simulating the mini-implant. The forces were applied 10 times and observed in a circular polariscope. The stresses located in the mandibular canine were recorded in 7 regions. The Mann-Whitney test was employed to compare the stress in each region and between both anchorage systems. The stresses in the mandibular canine periradicular regions were compared by the Kruskal-Wallis test. RESULTS: Stresses were similar in the cervical region and the middle third. In the apical third, the stresses associated with skeletal anchorage were higher than the stresses associated with dental anchorage. The results of the Kruskal-Wallis test showed that the highest stresses were identified in the cervical-distal, apical-distal, and apex regions with the use of dental anchorage, and in the apical-distal, apical-mesial, cervical-distal, and apex regions with the use of skeletal anchorage. CONCLUSIONS: The use of skeletal anchorage in canine retraction caused greater stress in the apical third than the use of dental anchorage, which indicates an intrusive component resulting from the direction of the force due to the position of the mini-implant and the bracket hook of the canine.
Sajnani, Anand K
2015-02-01
The position of the permanent maxillary canine at the angle of the mouth is strategically significant in maintaining the harmony and symmetry of the occlusal relationship. However, the maxillary canine is the second most frequently impacted tooth, with prevalence reported to be between 1% and 2%. Moreover, treatment of this condition is often complex and involves substantial time and financial cost. Hence, it is only prudent to monitor the eruption and identify the etiological factors that lead to impaction of the maxillary canine. Numerous researchers have tried to identify specific and nonspecific etiological factors responsible for displacement of canines. The purpose of this review was to track the development processes of maxillary canines and determine the hindrances that affect the eruption at different ages. Awareness of the eruption process and etiology of noneruption will help to reduce the incidence of impacted canines by allowing for early recognition and interceptive treatment. © 2013 Wiley Publishing Asia Pty Ltd.
Tumor microvessel density–associated mast cells in canine nodal lymphoma
Mann, Elizabeth; Whittington, Lisa
2014-01-01
Objective: Mast cells are associated in angiogenesis in various human and animal neoplasms. However, association of mast cells with tumor microvessel density in canine lymphoma was not previously documented. The objective of the study is to determine if mast cells are increased in canine nodal lymphomas and to evaluate their correlation with tumor microvessel density and grading of lymphomas. Methods: Nodal lymphomas from 33 dogs were studied and compared with nonneoplastic lymph nodes from 6 dogs as control. Mast cell count was made on Toluidine blue stained sections. Immunohistochemistry using antibody against Factor VIII was employed to visualize and determine microvessel density. Results: The mast cell count in lymphoma (2.95 ± 2.4) was significantly higher (p < 0.05) than that in the control (0.83 ± 0.3) and was positively correlated with tumor microvessel density (r = 0.44, p = 0.009). Significant difference was not observed in mast cell count and tumor microvessel density among different gradings of lymphomas. Conclusions: Mast cells are associated with tumor microvessel density in canine nodal lymphoma with no significant difference among gradings of lymphomas. Mast cells may play an important role in development of canine nodal lymphomas. Further detailed investigation on the role of mast cells as important part of tumor microenvironment in canine nodal lymphomas is recommended. PMID:26770752
Tumor microvessel density–associated mast cells in canine nodal lymphoma
Directory of Open Access Journals (Sweden)
Moges Woldemeskel
2014-11-01
Full Text Available Objective: Mast cells are associated in angiogenesis in various human and animal neoplasms. However, association of mast cells with tumor microvessel density in canine lymphoma was not previously documented. The objective of the study is to determine if mast cells are increased in canine nodal lymphomas and to evaluate their correlation with tumor microvessel density and grading of lymphomas. Methods: Nodal lymphomas from 33 dogs were studied and compared with nonneoplastic lymph nodes from 6 dogs as control. Mast cell count was made on Toluidine blue stained sections. Immunohistochemistry using antibody against Factor VIII was employed to visualize and determine microvessel density. Results: The mast cell count in lymphoma (2.95 ± 2.4 was significantly higher (p < 0.05 than that in the control (0.83 ± 0.3 and was positively correlated with tumor microvessel density (r = 0.44, p = 0.009. Significant difference was not observed in mast cell count and tumor microvessel density among different gradings of lymphomas. Conclusions: Mast cells are associated with tumor microvessel density in canine nodal lymphoma with no significant difference among gradings of lymphomas. Mast cells may play an important role in development of canine nodal lymphomas. Further detailed investigation on the role of mast cells as important part of tumor microenvironment in canine nodal lymphomas is recommended.
How far is the root apex of a unilateral impacted canine from the root apices' arch form?
Kim, Sung-Hun; Kim, You-Min; Oh, Sewoong; Kim, Seong-Sik; Park, Soo-Byung; Son, Woo-Sung; Kim, Yong-Il
2017-02-01
The purpose of this study was to determine the arch form of the root apices of normally erupting teeth and then determine the differences in the location of the apex of impacted canines relative to normally erupting canines. In addition, we sought to determine whether the labiopalatal position of the impacted canines influences the position of the apices. The study included 21 patients with unerupted canines that subsequently had a normal eruption, 21 patients with palatally impacted canines, 27 patients with labially impacted canines, and 17 patients with midalveolus impacted canines. Images were obtained using cone beam computed tomography, and the x, y, and z coordinates of the root apices were determined using Ondemand3D software (Cybermed Co., Seoul, Korea). Two-dimensional coordinates were converted from acquired 3-dimensional coordinates via projection on a palatal plane, and the Procrustes method was used to process the converted 2-dimensional coordinates and to draw the arch forms of the root apices. Finally, we measured the extent of root apex deviation from the arch forms of the root apices. Normally erupting canines showed that even though calcifications may be immature, their positions were aligned with a normal arch form. The root apices of the impacted canines were an average of 6.572 mm away from the root apices' arch form, whereas those of the contralateral nonimpacted canines were an average distance of 2.221 mm away, a statistically significant difference. The palatally impacted canines' root apices distribution tended toward the first premolar root apices. Incompletely calcified, unerupted teeth with a subsequent normal eruption showed a normal arch form of the root apices. The root apices of impacted canines were farther from the arch forms than were the nonimpacted canines. Also, the root apices of impacted canines in the palatal area showed distributions different from those of the other impacted canine groups. Copyright © 2017 American
The anti-canine distemper virus activities of ex vivo-expanded canine natural killer cells.
Park, Ji-Yun; Shin, Dong-Jun; Lee, Soo-Hyeon; Lee, Je-Jung; Suh, Guk-Hyun; Cho, Duck; Kim, Sang-Ki
2015-04-17
Natural killer (NK) cells play critical roles in induction of antiviral effects against various viruses of humans and animals. However, few data on NK cell activities during canine distemper virus (CDV) infections are available. Recently, we established a culture system allowing activation and expansion of canine non-B, non-T, large granular NK lymphocytes from PBMCs of normal dogs. In the present study, we explored the ability of such expanded NK cells to inhibit CDV infection in vitro. Cultured CD3-CD5-CD21- NK cells produced large amounts of IFN-γ, exhibited highly upregulated expression of mRNAs encoding NK-cell-associated receptors, and demonstrated strong natural killing activity against canine tumor cells. Although the expanded NK cells were dose-dependently cytotoxic to both normal and CDV-infected Vero cells, CDV infection rendered Vero cells more susceptible to NK cells. Pretreatment with anti-CDV serum from hyperimmunized dogs enhanced the antibody-dependent cellular cytotoxicity (ADCC) of NK cells against CDV-infected Vero cells. The culture supernatants of NK cells, added before or after infection, dose-dependently inhibited both CDV replication and development of CDV-induced cytopathic effects (CPEs) in Vero cells. Anti-IFN-γ antibody neutralized the inhibitory effects of NK cell culture supernatants on CDV replication and CPE induction in Vero cells. Such results emphasize the potential significance of NK cells in controlling CDV infection, and indicate that NK cells may play roles both during CDV infection and in combating such infections, under certain conditions. Copyright © 2015 Elsevier B.V. All rights reserved.
Automated tru-cut imaging-guided core needle biopsy of canine ...
African Journals Online (AJOL)
The purpose of this study was to evaluate the diagnostic value of imaging-guided core needle biopsy for canine orbital mass diagnosis. A second excisional biopsy obtained during surgery or necropsy was used as the reference standard. A prospective feasibility study was conducted in 23 canine orbital masses at a single ...
Wu, Lisa Y; Johnson, Jacqueline M; Simmons, Jessica K; Mendes, Desiree E; Geruntho, Jonathan J; Liu, Tiancheng; Dirksen, Wessel P; Rosol, Thomas J; Davis, William C; Berkman, Clifford E
2014-05-01
Prostate-specific membrane antigen (PSMA) remains an important target for diagnostic and therapeutic application for human prostate cancer. Model cell lines have been recently developed to study canine prostate cancer but their PSMA expression and enzymatic activity have not been elucidated. The present study was focused on determining PSMA expression in these model canine cell lines and the use of fluorescent small-molecule enzyme inhibitors to detect canine PSMA expression by flow cytometry. Western blot and RT-PCR were used to determine the transcriptional and translational expression of PSMA on the canine cell lines Leo and Ace-1. An endpoint HPLC-based assay was used to monitor the enzymatic activity of canine PSMA and the potency of enzyme inhibitors. Flow cytometry was used to detect the PSMA expressed on Leo and Ace-1 cells using a fluorescently tagged PSMA enzyme inhibitor. Canine PSMA expression on the Leo cell line was confirmed by Western blot and RT-PCR, the enzyme activity, and flow cytometry. Kinetic parameters Km and Vmax of PSMA enzymatic activity for the synthetic substrate (PABGγG) were determined to be 393 nM and 220 pmol min(-1) mg protein(-1) , respectively. The inhibitor core 1 and fluorescent inhibitor 2 were found to be potent reversible inhibitors (IC50 = 13.2 and 1.6 nM, respectively) of PSMA expressed on the Leo cell line. Fluorescent labeling of Leo cells demonstrated that the fluorescent PSMA inhibitor 2 can be used for the detection of PSMA-positive canine prostate tumor cells. Expression of PSMA on Ace-1 was low and not detectable by flow cytometry. The results described herein have demonstrated that PSMA is expressed on canine prostate tumor cells and exhibits similar enzymatic characteristics as human PSMA. The findings show that the small molecule enzyme inhibitors currently being studied for use in diagnosis and therapy of human prostate cancer can also be extended to include canine prostate cancer. Importantly
Evaluation of the kinase domain of c-KIT in canine cutaneous mast cell tumors
International Nuclear Information System (INIS)
Webster, Joshua D; Kiupel, Matti; Yuzbasiyan-Gurkan, Vilma
2006-01-01
Mutations in the c-KIT proto-oncogene have been implicated in the progression of several neoplastic diseases, including gastrointestinal stromal tumors and mastocytosis in humans, and cutaneous mast cell tumors (MCTs) in canines. Mutations in human mastocytosis patients primarily occur in c-KIT exon 17, which encodes a portion of its kinase domain. In contrast, deletions and internal tandem duplication (ITD) mutations are found in the juxtamembrane domain of c-KIT in approximately 15% of canine MCTs. In addition, ITD c-KIT mutations are significantly associated with aberrant KIT protein localization in canine MCTs. However, some canine MCTs have aberrant KIT localization but lack ITD c-KIT mutations, suggesting that other mutations or other factors may be responsible for aberrant KIT localization in these tumors. In order to characterize the prevalence of mutations in the phospho-transferase portion of c-KIT's kinase domain in canine MCTs exons 16–20 of 33 canine MCTs from 33 dogs were amplified and sequenced. Additionally, in order to determine if mutations in c-KIT exon 17 are responsible for aberrant KIT localization in MCTs that lack juxtamembrane domain c-KIT mutations, c-KIT exon 17 was amplified and sequenced from 18 canine MCTs that showed an aberrant KIT localization pattern but did not have ITD c-KIT mutations. No mutations or polymorphisms were identified in exons 16–20 of any of the MCTs examined. In conclusion, mutations in the phospho-transferase portion of c-KIT's kinase domain do not play an important role in the progression of canine cutaneous MCTs, or in the aberrant localization of KIT in canine MCTs
Feline and canine coronaviruses: common genetic and pathobiological features.
Le Poder, Sophie
2011-01-01
A new human coronavirus responsible for severe acute respiratory syndrome (SARS) was identified in 2003, which raised concern about coronaviruses as agents of serious infectious disease. Nevertheless, coronaviruses have been known for about 50 years to be major agents of respiratory, enteric, or systemic infections of domestic and companion animals. Feline and canine coronaviruses are widespread among dog and cat populations, sometimes leading to the fatal diseases known as feline infectious peritonitis (FIP) and pantropic canine coronavirus infection in cats and dogs, respectively. In this paper, different aspects of the genetics, host cell tropism, and pathogenesis of the feline and canine coronaviruses (FCoV and CCoV) will be discussed, with a view to illustrating how study of FCoVs and CCoVs can improve our general understanding of the pathobiology of coronaviruses.
Chronic Kidney Disease and Kidney Failure
... death rates limited life expectancy. Some patients were lucky enough to get a kidney transplant, which greatly ... epidemic rates. Through the 1980s and 1990s, the number of patients developing end-stage kidney failure nearly ...
Directory of Open Access Journals (Sweden)
Susann Kummer
Full Text Available We studied the dynamics of the proteome of influenza virus A/PR/8/34 (H1N1 infected Madin-Darby canine kidney cells up to 12 hours post infection by mass spectrometry based quantitative proteomics using the approach of stable isotope labeling by amino acids in cell culture (SILAC. We identified 1311 cell proteins and, apart from the proton channel M2, all major virus proteins. Based on their abundance two groups of virus proteins could be distinguished being in line with the function of the proteins in genesis and formation of new virions. Further, the data indicate a correlation between the amount of proteins synthesized and their previously determined copy number inside the viral particle. We employed bioinformatic approaches such as functional clustering, gene ontology, and pathway (KEGG enrichment tests to uncover co-regulated cellular protein sets, assigned the individual subsets to their biological function, and determined their interrelation within the progression of viral infection. For the first time we are able to describe dynamic changes of the cellular and, of note, the viral proteome in a time dependent manner simultaneously. Through cluster analysis, time dependent patterns of protein abundances revealed highly dynamic up- and/or down-regulation processes. Taken together our study provides strong evidence that virus infection has a major impact on the cell status at the protein level.
Genetic Characterization of Influenza A (H1N1) Pandemic 2009 Virus Isolates from Mumbai.
Gohil, Devanshi; Kothari, Sweta; Shinde, Pramod; Meharunkar, Rhuta; Warke, Rajas; Chowdhary, Abhay; Deshmukh, Ranjana
2017-08-01
Pandemic influenza A (H1N1) 2009 virus was first detected in India in May 2009 which subsequently became endemic in many parts of the country. Influenza A viruses have the ability to evade the immune response through its ability of antigenic variations. The study aims to characterize influenza A (H1N1) pdm 09 viruses circulating in Mumbai during the pandemic and post-pandemic period. Nasopharyngeal swabs positive for influenza A (H1N1) pdm 09 viruses were inoculated on Madin-Darby canine kidney cell line for virus isolation. Molecular and phylogenetic analysis of influenza A (H1N1) pdm 09 isolates was conducted to understand the evolution and genetic diversity of the strains. Nucleotide and amino acid sequences of the HA gene of Mumbai isolates when compared to A/California/07/2009-vaccine strain revealed 14 specific amino acid differences located at the antigenic sites. Amino acid variations in HA and NA gene resulted in changes in the N-linked glycosylation motif which may lead to immune evasion. Phylogenetic analysis of the isolates revealed their evolutionary position with vaccine strain A/California/07/2009 but had undergone changes gradually. The findings in the present study confirm genetic variability of influenza viruses and highlight the importance of continuous surveillance during influenza outbreaks.
Guo, Tingting; Huang, Jinhu; Zhang, Hongyu; Dong, Lingling; Guo, Dawei; Guo, Li; He, Fang; Bhutto, Zohaib Ahmed; Wang, Liping
2016-01-01
P-glycoprotein (P-gp) is one of the best-known ATP-dependent efflux transporters, contributing to differences in pharmacokinetics and drug-drug interactions. Until now, studies on pig P-gp have been scarce. In our studies, the full-length porcine P-gp cDNA was cloned and expressed in a Madin-Darby Canine Kidney (MDCK) cell line. P-gp expression was then determined in tissues and its role in the pharmacokinetics of oral enrofloxacin in pigs was studied. The coding region of pig Abcb1 gene was 3,861 bp, encoding 1,286 amino acid residues (Mw = 141,966). Phylogenetic analysis indicated a close evolutionary relationship between porcine P-gp and those of cow and sheep. Pig P-gp was successfully stably overexpressed in MDCK cells and had efflux activity for rhodamine 123, a substrate of P-gp. Tissue distribution analysis indicated that P-gp was highly expressed in brain capillaries, small intestine, and liver. In MDCK-pAbcb1 cells, enrofloxacin was transported by P-gp with net efflux ratio of 2.48 and the efflux function was blocked by P-gp inhibitor verapamil. High expression of P-gp in the small intestine could modify the pharmacokinetics of orally administrated enrofloxacin by increasing the Cmax, AUC and Ka, which was demonstrated using verapamil, an inhibitor of P-gp. PMID:27572343
Baatartsogt, Tugsbaatar; Bui, Vuong N; Trinh, Dai Q; Yamaguchi, Emi; Gronsang, Dulyatad; Thampaisarn, Rapeewan; Ogawa, Haruko; Imai, Kunitoshi
2016-10-01
Viral neuraminidase inhibitors are widely used as synthetic anti-influenza drugs for the prevention and treatment of influenza. However, drug-resistant influenza A virus variants, including H5N1 highly pathogenic avian influenza viruses (HPAIVs), have been reported. Therefore, the discovery of novel and effective antiviral agents is warranted. We screened the antiviral effects of 11 herbal tea extracts (hibiscus, black tea, tencha, rosehip tea, burdock tea, green tea, jasmine tea, ginger tea, lavender tea, rose tea and oak tea) against the H5N1 HPAIV in vitro. Among the tested extracts, only the hibiscus extract and its fractionated extract (frHibis) highly and rapidly reduced the titers of all H5 HPAIVs and low pathogenic AIVs (LPAIVs) used in the pre-treatment tests of Madin-Darby canine kidney (MDCK) cells that were inoculated with a mixture of the virus and the extract. Immunogold electron microscopy showed that anti-H5 monoclonal antibodies could not bind to the deformed H5 virus particles pretreated with frHibis. In post-treatment tests of MDCK cells cultured in the presence of frHibis after infection with H5N1 HPAIV, the frHibis inhibited viral replication and the expression of viral antigens and genes. Among the plants tested, hibiscus showed the most prominent antiviral effects against both H5 HPAIV and LPAIV.
NHS-A isoform of the NHS gene is a novel interactor of ZO-1.
Sharma, Shiwani; Koh, Katrina S Y; Collin, Caitlin; Dave, Alpana; McMellon, Amy; Sugiyama, Yuki; McAvoy, John W; Voss, Anne K; Gécz, Jozef; Craig, Jamie E
2009-08-15
Mutations in the NHS (Nance-Horan Syndrome) gene lead to severe congenital cataracts, dental defects and sometimes mental retardation. NHS encodes two protein isoforms, NHS-A and -1A that display cell-type dependent differential expression and localization. Here we demonstrate that of these two isoforms, the NHS-A isoform associates with the cell membrane in the presence of intercellular contacts and it immunoprecipitates with the tight junction protein ZO-1 in MDCK (Madin Darby Canine Kidney) epithelial cells and in neonatal rat lens. The NHS-1A isoform however is a cytoplasmic protein. Both Nhs isoforms are expressed during mouse development. Immunolabelling of developing mouse with the anti-NHS antibody that detects both isoforms revealed the protein in the developing head including the eye and brain. It was primarily expressed in epithelium including neural epithelium and certain vascular endothelium but only weakly expressed in mesenchymal cells. In the epithelium and vascular endothelium the protein associated with the cell membrane and co-localized with ZO-1, which indirectly indicates expression of the Nhs-A isoform in these structures. Membrane localization of the protein in the lens vesicle similarly supports Nhs-A expression. In conclusion, the NHS-A isoform of NHS is a novel interactor of ZO-1 and may have a role at tight junctions. This isoform is important in mammalian development especially of the organs in the head.
The renal effects and initial characterization of venom from Philodryas nattereri Steindachner, 1870
Directory of Open Access Journals (Sweden)
Marinetes Dantas de Aquino Nery
2014-01-01
Full Text Available The venom of the snake Philodryas nattereri is a mixture of proteins and toxic peptides with several important local and systemic actions, which are similar to those occurring in Bothrops snake bites. The mechanisms involved in the local and systemic actions of this venom are unknown. The aims of the work were to initial characterization of P. nattereri venom and investigate the effects of the poison in the renal perfusion system and in cultured renal tubular cells of the type MDCK (Madin–Darby canine kidney. The P. nattereri venom is composed majority of proteins (86.3% and this poison promoted changes in all the evaluated renal parameters, mainly decreasing renal perfusion pressure (PP and renal vascular resistance (RVR and increasing urine flow (UF and glomerular filtration rate (GFR. The most relevant result was that this venom was highly detrimental to the renal tubules independent of the PP reduction, which was shown by a decrease in sodium (Na+, potassium (K+ and chloride (Cl− electrolyte transport in the studied concentrations. The glomeruli and tubules contain protein bodies and blood extravasation, which were observed by histological analysis. The venom of P. nattereri reduced viability of the MDCK cells only at high concentrations (50 and 100 μg/mL with an IC50 of 169.5 μg/mL.
Pyhälä, R; Kleemola, M; Kumpulainen, V; Vartiainen, E; Lappi, S; Pönkä, A; Cantell, K
1992-01-01
Vaccination of adults (healthy female employees potentially capable of transmitting influenza to high-risk persons; n = 104) in autumn 1990 with a trivalent influenza virus vaccine containing B/Yamagata/16/88 induced a low antibody response to B/Finland/150/90, a recent variant of B/Victoria/2/87-like viruses, as compared with the antibody response to B/Finland/172/91, a current variant in the lineage of B/Yamagata/16/88-like viruses. Up to the end of the epidemic season, the antibody status declined but was still significantly better than before the vaccination. The results suggest that the vaccine strain was appropriate for the outbreak of 1990 to 1991 in Finland, but may provide unsatisfactory protection against B/Victoria/2/87-like viruses. Evidence is given that use of Madin-Darby canine kidney (MDCK)-grown virus as an antigen in the haemagglutination inhibition test (HI) may provide more reliable information about the protective antibodies than use of untreated or ether-treated egg-grown viruses. Significantly higher postvaccination and postepidemic antibody titres were recorded among subjects who exhibited the antibody before vaccination than among seronegative subjects. A significantly higher response rate among initially seronegative people than among seropositive people was recorded for antibody to B/Finland/150/90, but no clear evidence was obtained that the pre-existing antibody could have had a negative effect on the antibody production.
A novel, colorimetric neutralization assay for measuring antibodies to influenza viruses.
Lehtoranta, Liisa; Villberg, Anja; Santanen, Riitta; Ziegler, Thedi
2009-08-01
A colorimetric cell proliferation assay for measuring neutralizing antibodies to influenza viruses in human sera is described. Following a 90-min incubation, the serum-virus mixture was transferred to Madin-Darby canine kidney cells cultured in 96-well plates. After further incubation for three days, a tetrazolium salt was added to the wells. Cellular mitochondrial dehydrogenases cleave the tetrazolium salt to formazan, and the resulting color change is read by a spectrophotometer. The absorbance values correlate directly to the number of viable cells in the assay well and thus also to the neutralizing activity of influenza-specific antibodies present in the serum. With the few hands-on manipulations required, this assay allows simultaneous testing of a considerable number of sera, offers opportunities for automation, and is suitable for use under biosafety level-3 conditions. The test was used to study the antibody response after the administration of seasonal, inactivated, trivalent influenza vaccine. Antibody titers determined by the neutralization test in pre- and post-vaccination serum pairs were compared with those obtained by the hemagglutination inhibition assay. The neutralization test yielded higher pre- and post-vaccination titers and a larger number of significant increases in post-vaccination antibody titer than the hemagglutination inhibition test. This new test format could serve as a valuable laboratory tool for influenza vaccine studies.
Gregersen, Jens-Peter
2008-06-19
A risk-assessment model has demonstrated the ability of a new cell culture-based vaccine manufacturing process to reduce the level of any adventitious agent to a million-fold below infectious levels. The cell culture-derived subunit influenza vaccine (OPTAFLU), Novartis Vaccines and Diagnostics) is produced using Madin-Darby canine kidney (MDCK) cells to propagate seasonal viral strains, as an alternative to embryonated chicken-eggs. As only a limited range of mammalian viruses can grow in MDCK cells, similar to embryonated eggs, MDCK cells can act as an effective filter for a wide range of adventitious agents that might be introduced during vaccine production. However, the introduction of an alternative cell substrate (for example, MDCK cells) into a vaccine manufacturing process requires thorough investigations to assess the potential for adventitious agent risk in the final product, in the unlikely event that contamination should occur. The risk assessment takes into account the entire manufacturing process, from initial influenza virus isolation, through to blending of the trivalent subunit vaccine and worst-case residual titres for the final vaccine formulation have been calculated for >20 viruses or virus families. Maximum residual titres for all viruses tested were in the range of 10(-6) to 10(-16) infectious units per vaccine dose. Thus, the new cell culture-based vaccine manufacturing process can reduce any adventitious agent to a level that is unable to cause infection.
Suspension culture process for H9N2 avian influenza virus (strain Re-2).
Wang, Honglin; Guo, Suying; Li, Zhenguang; Xu, Xiaoqin; Shao, Zexiang; Song, Guicai
2017-10-01
H9N2 avian influenza virus has caused huge economic loss for the Chinese poultry industry since it was first identified. Vaccination is frequently used as a control method for the disease. Meanwhile suspension culture has become an important tool for the development of influenza vaccines. To optimize the suspension culture conditions for the avian influenza H9N2 virus (Re-2 strain) in Madin-Darby Canine Kidney (MDCK) cells, we studied the culture conditions for cell growth and proliferation parameters for H9N2 virus replication. MDCK cells were successfully cultured in suspension, from a small scale to industrial levels of production, with passage time and initial cell density being optimized. The influence of pH on the culture process in the reactor has been discussed and the process parameters for industrial production were explored via amplification of the 650L reactor. Subsequently, we cultivated cells at high cell density and harvested high amounts of virus, reaching 10log2 (1:1024). Furthermore an animal experiment was conducted to detect antibody. Compared to the chicken embryo virus vaccine, virus cultured from MDCK suspension cells can produce a higher amount of antibodies. The suspension culture process is simple and cost efficient, thus providing a solid foundation for the realization of large-scale avian influenza vaccine production.
Hessel, Stefanie; Gottschalk, Christoph; Schumann, Dania; These, Anja; Preiss-Weigert, Angelika; Lampen, Alfonso
2014-05-01
1,2-Unsaturated pyrrolizidine alkaloids (PA) are found in plants such as Asteraceae and Boraginaceae families. Acute PA poisoning via contaminated food or feed causes severe damage to liver depending on species-specific oral bioavailability. For assessing PA bioavailability, their passage across the intestinal barrier was investigated using Caco-2 cells. Differentiated Caco-2 cells were exposed in transport chambers to the PA heliotrine (Hn), echimidine (Em), senecionine (Sc), and senkirkine (Sk). Cell supernatants were analyzed by LC-MS/MS. PA pass Caco-2 monolayer from the apical into basolateral compartment depending on their chemical structure. Compared to the cyclic diesters Sc and Sk with a passage rate of 47% ± 4 and 40% ± 3, respectively, the transferred amount of the monoester Hn (32% ± 3) and open-chained diester Em (13% ± 2) was substantially lower. This suggested an active transport of Hn and Em. Using Madin-Darby canine kidney II/P-glycoprotein (ABCB1)-overexpressing cells, the active excretion of Hn and Em by ABCB1 from the gastrointestinal epithelium into the gut lumen was shown. PA cross the intestinal barrier structure-dependently. The passage of the noncyclic PA Hn and Em is reduced by an ABCB1-driven efflux into the gastrointestinal lumen resulting in a decreased oral bioavailability. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Directory of Open Access Journals (Sweden)
Leonardo Pisani
2016-03-01
Full Text Available The need for developing real disease-modifying drugs against neurodegenerative syndromes, particularly Alzheimer’s disease (AD, shifted research towards reliable drug discovery strategies to unveil clinical candidates with higher therapeutic efficacy than single-targeting drugs. By following the multi-target approach, we designed and synthesized a novel class of dual acetylcholinesterase (AChE-monoamine oxidase B (MAO-B inhibitors through the decoration of the 2H-chromen-2-one skeleton. Compounds bearing a propargylamine moiety at position 3 displayed the highest in vitro inhibitory activities against MAO-B. Within this series, derivative 3h emerged as the most interesting hit compound, being a moderate AChE inhibitor (IC50 = 8.99 µM and a potent and selective MAO-B inhibitor (IC50 = 2.8 nM. Preliminary studies in human neuroblastoma SH-SY5Y cell lines demonstrated its low cytotoxicity and disclosed a promising neuroprotective effect at low doses (0.1 µM under oxidative stress conditions promoted by two mitochondrial toxins (oligomycin-A and rotenone. In a Madin-Darby canine kidney (MDCKII-MDR1 cell-based transport study, Compound 3h was able to permeate the BBB-mimicking monolayer and did not result in a glycoprotein-p (P-gp substrate, showing an efflux ratio = 0.96, close to that of diazepam.
Low Prevalence of Enzootic Equine Influenza Virus among Horses in Mongolia
Directory of Open Access Journals (Sweden)
Alexandra Sack
2017-11-01
Full Text Available Horses are critically important for Mongolian herders’ livelihoods, providing transportation and food products, and playing important cultural roles. Equine influenza virus (EIV epizootics have been frequent among Mongolia’s horses, with five occurring since 1970. We sought to estimate the prevalence for EIV infection among horses and Bactrian camels with influenza-like illness between national epizootics. In 2016–2017, active surveillance for EIV was periodically performed in four aimags (provinces. Nasal swabs were collected from 680 horses and 131 camels. Seven of the horse swabs were “positive” for qRT-PCR evidence of influenza A (Ct value ≤ 38. Two more were “suspect positive” (Ct value > 38 and ≤ 40. These nine specimens were collected from four aimags. None of the camel specimens had molecular evidence of infection. Despite serial blind passage in Madin-Darby Canine Kidney cells (MDCK cells, none of the nine horse specimens yielded an influenza A virus. None of the 131 herder households surveyed had recently vaccinated their horses against EIV. It seems likely that sporadic EIV is enzootic in multiple Mongolian aimags. This finding, the infrequent use of EIV vaccination, periodic prevalence of highly pathogenic avian influenza, and the mixing of domestic and wild equid herds suggest that Mongolia may be a hot spot for novel EIV emergence.
Gebhard, Christiane; Fuchs-Baumgartinger, Andrea; Razzazi-Fazeli, Ebrahim; Miller, Ingrid; Walter, Ingrid
2016-01-01
Overexpression of matrix metalloproteinases (MMPs) has been associated with increased tumor aggressiveness and metastasis dissemination. We investigated whether the contrasting metastatic behavior of feline and canine osteosarcoma is related to levels and activities of MMP2 and MMP9. Zymography and immunohistochemistry were used to determine expression levels of MMP2 and MMP9 in canine and feline osteosarcoma. Using immunohistochemistry, increased MMP9 levels were identified in most canine osteosarcomas, whereas cat samples more often displayed moderate levels. High levels of pro-MMP9, pro-MMP2, and active MMP2 were detected by gelatin zymography in both species, with significantly higher values for active MMP2 in canine osteosarcoma. These findings indicate that MMP2 is probably involved in canine and feline osteosarcoma and their expression and activity could be associated with the different metastatic behavior of canine and feline osteosarcoma.
Detection of canine cytokine gene expression by reverse transcription-polymerase chain reaction.
Pinelli, E; van der Kaaij, S Y; Slappendel, R; Fragio, C; Ruitenberg, E J; Bernadina, W; Rutten, V P
1999-08-02
Further characterization of the canine immune system will greatly benefit from the availability of tools to detect canine cytokines. Our interest concerns the study on the role of cytokines in canine visceral leishmaniasis. For this purpose, we have designed specific primers using previously published sequences for the detection of canine IL-2, IFN-gamma and IL10 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). For IL-4, we have cloned and sequenced this cytokine gene, and developed canine-specific primers. To control for sample-to-sample variation in the quantity of mRNA and variation in the RT and PCR reactions, the mRNA levels of glyceraldehyde-3-phosphate dehydrogenase (G3PDH), a housekeeping gene, were determined in parallel. Primers to amplify G3PDH were designed from consensus sequences obtained from the Genbank database. The mRNA levels of the cytokines mentioned here were detected from ConA-stimulated peripheral mononuclear cells derived from Leishmania-infected dogs. A different pattern of cytokine production among infected animals was found.
Immunopathogenic and Neurological Mechanisms of Canine Distemper Virus
Directory of Open Access Journals (Sweden)
Otávio Valério Carvalho
2012-01-01
Full Text Available Canine distemper is a highly contagious viral disease caused by the canine distemper virus (CDV, which is a member of the Morbillivirus genus, Paramyxoviridae family. Animals that most commonly suffer from this disease belong to the Canidae family; however, the spectrum of natural hosts for CDV also includes several other families of the order Carnivora. The infectious disease presents worldwide distribution and maintains a high incidence and high levels of lethality, despite the availability of effective vaccines, and no specific treatment. CDV infection in dogs is characterized by the presentation of systemic and/or neurological courses, and viral persistence in some organs, including the central nervous system (CNS and lymphoid tissues. An elucidation of the pathogenic mechanisms involved in canine distemper disease will lead to a better understanding of the injuries and clinical manifestations caused by CDV. Ultimately, further insight about this disease will enable the improvement of diagnostic methods as well as therapeutic studies.
Immunopathogenic and Neurological Mechanisms of Canine Distemper Virus
Carvalho, Otávio Valério; Botelho, Clarisse Vieira; Ferreira, Caroline Gracielle Torres; Scherer, Paulo Oldemar; Soares-Martins, Jamária Adriana Pinheiro; Almeida, Márcia Rogéria; Silva Júnior, Abelardo
2012-01-01
Canine distemper is a highly contagious viral disease caused by the canine distemper virus (CDV), which is a member of the Morbillivirus genus, Paramyxoviridae family. Animals that most commonly suffer from this disease belong to the Canidae family; however, the spectrum of natural hosts for CDV also includes several other families of the order Carnivora. The infectious disease presents worldwide distribution and maintains a high incidence and high levels of lethality, despite the availability of effective vaccines, and no specific treatment. CDV infection in dogs is characterized by the presentation of systemic and/or neurological courses, and viral persistence in some organs, including the central nervous system (CNS) and lymphoid tissues. An elucidation of the pathogenic mechanisms involved in canine distemper disease will lead to a better understanding of the injuries and clinical manifestations caused by CDV. Ultimately, further insight about this disease will enable the improvement of diagnostic methods as well as therapeutic studies. PMID:23193403
Canine Leishmaniosis: tools for diagnosis in veterinary practice in Colombia
Directory of Open Access Journals (Sweden)
Víctor Acero P
2015-09-01
Full Text Available The objective of this article is to perform a critical analysis and guide veterinarians in the management of canine Leishmaniosis. A systematic literature review was performed between 2005 and 2014 including scientific papers which take into account experiences and reports of: pathogenesis, diagnosis, clinical presentation, treatment, vaccination, prevention and control strategies. We discuss the different aspects of VL management and aspects that should be taken into account depending on the country, after a patient is suspected or confirmed as positive, including the possibility of euthanasia. We describe the different clinical manifestations of the disease, diagnosis, signs and treatment of canine leishmaniosis. Canine leishmaniosis is present in different parts of the country, therefore it must be considered as a possible differential diagnosis in the veterinary clinic, in patients with dermatological and systemic signs that are compatible with various diseases. In Colombia, the patients diagnosed with cutaneous leishmaniasis could be treated and have a favorable prognosis, whereas in canines with diagnosis of visceral leishmaniasis euthanasia should be considered because of the public health implications.
Compensatory canine angulation in angle Class II and III patients
Directory of Open Access Journals (Sweden)
Mauro Carlos Agner Busato
2009-09-01
Full Text Available The aim of this study was to evaluate the occurence of compensation in mesiodistal axial inclinations of canines in skeletal malocclusions patients. The sample consisted of 25 Angle Class II, division 1 malocclusion (group 1 and 19 Angle Class III malocclusion patients (group 2. After measurement of dental angulations through a method that associates plaster model photography and AutoCad software, comparisons between the groups were performed by T-test for independent samples. Results showed that there was no statistically significant difference (p < 0.05 between groups, when maxillary canine angulations were compared. Regarding the mandibular canines, there was a statistically significant difference in dental angulation, expressed by 3.2° for group 1 and 0.15° for group 2. An upright position tendency for mandibular canines was observed in the Angle Class III sample. This configures a pattern of compensatory coronary positioning, since the angulation of these teeth makes them occupy less space in the dental arch and consequently mandibular incisors can be in a more retracted position in the sagittal plane.
Transplantation of Kidneys From Donors With Acute Kidney Injury: Friend or Foe?
Boffa, C.; van de Leemkolk, F.; Curnow, E.; Homan van der Heide, J.; Gilbert, J.; Sharples, E.; Ploeg, R. J.
2017-01-01
The gap between supply and demand in kidney transplantation has led to increased use of marginal kidneys; however, kidneys with acute kidney injury are often declined/discarded. To determine whether this policy is justified, we analyzed outcomes of donor kidneys with acute kidney injury (AKI) in a
European surveillance of emerging pathogens associated with canine infectious respiratory disease.
Mitchell, Judy A; Cardwell, Jacqueline M; Leach, Heather; Walker, Caray A; Le Poder, Sophie; Decaro, Nicola; Rusvai, Miklos; Egberink, Herman; Rottier, Peter; Fernandez, Mireia; Fragkiadaki, Eirini; Shields, Shelly; Brownlie, Joe
2017-12-01
Canine infectious respiratory disease (CIRD) is a major cause of morbidity in dogs worldwide, and is associated with a number of new and emerging pathogens. In a large multi-centre European study the prevalences of four key emerging CIRD pathogens; canine respiratory coronavirus (CRCoV), canine pneumovirus (CnPnV), influenza A, and Mycoplasma cynos (M. cynos); were estimated, and risk factors for exposure, infection and clinical disease were investigated. CIRD affected 66% (381/572) of the dogs studied, including both pet and kennelled dogs. Disease occurrence and severity were significantly reduced in dogs vaccinated against classic CIRD agents, canine distemper virus (CDV), canine adenovirus 2 (CAV-2) and canine parainfluenza virus (CPIV), but substantial proportions (65.7%; 201/306) of vaccinated dogs remained affected. CRCoV and CnPnV were highly prevalent across the different dog populations, with overall seropositivity and detection rates of 47% and 7.7% for CRCoV, and 41.7% and 23.4% for CnPnV, respectively, and their presence was associated with increased occurrence and severity of clinical disease. Antibodies to CRCoV had a protective effect against CRCoV infection and more severe clinical signs of CIRD but antibodies to CnPnV did not. Involvement of M. cynos and influenza A in CIRD was less apparent. Despite 45% of dogs being seropositive for M. cynos, only 0.9% were PCR positive for M. cynos. Only 2.7% of dogs were seropositive for Influenza A, and none were positive by PCR. Copyright © 2017 Elsevier B.V. All rights reserved.
Gossellin, J; Wren, J A; Sunderland, S J
2007-08-01
Canine patients are generally regarded as being clinically obese when their body weight is at least 15% above ideal. The incidence of obesity in dogs is thought to be in the range of 20-40% of the general population and, since obesity is known to predispose or exacerbate a range of serious medical conditions, its importance cannot be overstated. Management of obesity through dietary restriction and increased exercise is often difficult to achieve and dependent upon owner compliance. Until recently there has been no authorized therapeutic medication available for weight reduction in dogs, and drugs used in people have proved unsuitable. However, with the development of microsomal triglyceride transfer protein inhibitors for canine use, such as dirlotapide, the veterinarian has a novel method with which to augment traditional weight control programmes. This approach has the additional advantage that weight loss is achieved without dietary restriction or change in exercise regimen, providing encouragement for the owner to comply with subsequent dietary and exercise recommendations, thereby increasing the likelihood for long-term success.
Peracute Infectious Canine Hepatitis
Directory of Open Access Journals (Sweden)
A. H. Cheema*, I. Ahmed, G. Mustafa and A. Aslam
2012-05-01
Full Text Available Peracute infectious canine hepatitis (ICH was diagnosed in two young male dogs out of 56 dead canines presented for necropsy examination during the period of April 2009 to June 2010. These dogs were purebred, one- month old Alsatian and 5-month old Labrador. None of the dogs had received any vaccination or deworming treatment; both had died after illness lasting for six hours and twenty four hours respectively. The dogs had shown signs of depression, anorexia and fever. At necropsy, lymph nodes were swollen, edematous and congested; livers were enlarged, bright red and mottled with numerous small white foci. Petechial hemorrhages were seen in the mucosa. Excessive serosanguinous fluid was present in the abdominal cavities. Histologically, the most significant lesion was necrohemorrhagic hepatitis with single cell necrosis of hepatocytes, lacunose dilation of sinusoids filled with blood and numerous large, solid intranuclear inclusion bodies (IIBs in the hepatocytes and macrophages. Both eosinophilic and basophilic (amphophilic inclusions were seen. It has been observed that ICH is re-emerging in some endemic countries. Pet dogs should be regularly protected by effective vaccination.
Radioresistant canine hematopoietic cells
International Nuclear Information System (INIS)
Kawakami, T.G.; Shimizu, J.; Rosenblatt, L.S.; Goldman, M.
1987-01-01
Survival of dogs that are continuously exposed to a moderate dose-rate of gamma radiation (10 cGy/day) is dependent on the age of the dog at the time of exposure. Most dogs exposed postpartum to gamma radiation suffered from suppressed hematopoiesis and died of aplasia. On the other hand, none of the in utero-exposed dogs suffered from suppressed hematopoiesis and most became long-term survivors, tolerating 10-fold greater total dose, but dying of myeloproliferative disease (MPD). Using acute gamma irradiation of hematopoietic cells and colony forming unit cell assay (CFU), they observed that a canine hematopoietic cell line established from a myeloid leukemic dog that was a long-term survivor of continuous irradiation was approximately 4-fold more radioresistant than a hematopoietic cell line established from a dog with nonradiation-induced myeloid leukemia or hematopoietic cells from normal canine bone marrow. In utero dogs that are long-term survivors of continuous irradiation have radioresistant hematopoietic cells, and radioresistance that is a constitutive property of the cells
... nephrectomy is needed because of other kidney diseases. Kidney function Most people have two kidneys — fist-sized ... and the disease that prompted the surgery? Monitoring kidney function Most people can function well with only ...
Surgical innovations in canine gonadectomy
Van Goethem, Bart
2016-01-01
In this thesis some recent technological developments in human surgery are evaluated for their potential use in veterinary medicine by introducing them as surgical innovations for canine gonadectomy. Barbed sutures achieve wound apposition without surgical knot tying and thus avoid knot-associated
Stahl, Franka; Grabowski, Rosemarie
2003-05-01
The relationship between maxillary canine displacement and the simultaneous occurrence of "genetically determined predisposition to disturbed development of the dentition" as defined by Hoffmeister was investigated in 675 patients. Panoramic radiographs taken of each patient during the first and the second mixed dentition periods were evaluated. Canine inclination and the distance between the tip of the canine and a line connecting the cusps of the molars were computed in five different age groups according to Dausch-Neumann. Statistical analysis revealed 34 patients with "potential canine displacement", who exhibited further symptoms of "genetically determined predisposition to disturbed development of the dentition" significantly more frequently than the total group. The symptoms concerned were agenesia, displaced tooth buds, rotated or tilted incisors, aplasia and microdontia of lateral incisors. Careful follow-ups in patients with a predisposition to disturbed dental development enables risks to be anticipated and canine displacement to be detected at an early stage.
Expression of nociceptive ligands in canine osteosarcoma.
Shor, S; Fadl-Alla, B A; Pondenis, H C; Zhang, X; Wycislo, K L; Lezmi, S; Fan, T M
2015-01-01
Canine osteosarcoma (OS) is associated with localized pain as a result of tissue injury from tumor infiltration and peritumoral inflammation. Malignant bone pain is caused by stimulation of peripheral pain receptors, termed nociceptors, which reside in the localized tumor microenvironment, including the periosteal and intramedullary bone cavities. Several nociceptive ligands have been determined to participate directly or indirectly in generating bone pain associated with diverse skeletal abnormalities. Canine OS cells actively produce nociceptive ligands with the capacity to directly or indirectly activate peripheral pain receptors residing in the bone tumor microenvironment. Ten dogs with appendicular OS. Expression of nerve growth factor, endothelin-1, and microsomal prostaglandin E synthase-1 was characterized in OS cell lines and naturally occurring OS samples. In 10 dogs with OS, circulating concentrations of nociceptive ligands were quantified and correlated with subjective pain scores and tumor volume in patients treated with standardized palliative therapies. Canine OS cells express and secrete nerve growth factor, endothelin-1, and prostaglandin E2. Naturally occurring OS samples uniformly express nociceptive ligands. In a subset of OS-bearing dogs, circulating nociceptive ligand concentrations were detectable but failed to correlate with pain status. Localized foci of nerve terminal proliferation were identified in a minority of primary bone tumor samples. Canine OS cells express nociceptive ligands, potentially permitting active participation of OS cells in the generation of malignant bone pain. Specific inhibitors of nociceptive ligand signaling pathways might improve pain control in dogs with OS. Copyright © 2015 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of American College of Veterinary Internal Medicine.
Jeon, Sunghoon; Lee, Gahyun; Lee, Sang-Kwon; Kim, Hyunwoo; Yu, Dohyeon; Choi, Jihye
2015-01-01
Standard ultrasonography is often insensitive for distinguishing normal vs. diseased states for canine abdominal organs. Ultrasonographic elastography is a new technique that is becoming increasingly available and may help to improve sensitivity. This study evaluated the feasibility, repeatability, and reproducibility of strain elastography of the liver, spleen, kidneys, and prostate in healthy dogs and described the elasticity of each organ using strain values and strain ratios. The reproducibility of strain elastography was excellent, and intraobserver repeatability was moderate to excellent. The strain value of each organ was not significantly different among dogs (liver = 143.38 ± 7.41, spleen = 141.04 ± 9.03, left renal cortex = 141.26 ± 7.50, right renal cortex = 145.80 ± 7.79, and prostate = 135.46 ± 5.80), except for the renal medulla (left = 51.19 ± 4.54 and right = 51.93 ± 5.09) (P spleen, renal cortex, and prostate were similar with no significant difference (liver = 10.20 ± 1.47, spleen = 8.40 ± 1.53, left renal cortex = 9.62 ± 1.56, right renal cortex = 8.29 ± 1.63, and prostate = 8.20 ± 1.21), except for the renal medulla (left = 3.48 ± 0.68 and right = 2.95 ± 0.63) (P spleen, kidneys, and prostate. This study provides basic information for strain values and strain ratios for the liver, spleen, kidneys, and prostate in clinically normal dogs. © 2015 American College of Veterinary Radiology.
Feline and Canine Coronaviruses: Common Genetic and Pathobiological Features
Directory of Open Access Journals (Sweden)
Sophie Le Poder
2011-01-01
Full Text Available A new human coronavirus responsible for severe acute respiratory syndrome (SARS was identified in 2003, which raised concern about coronaviruses as agents of serious infectious disease. Nevertheless, coronaviruses have been known for about 50 years to be major agents of respiratory, enteric, or systemic infections of domestic and companion animals. Feline and canine coronaviruses are widespread among dog and cat populations, sometimes leading to the fatal diseases known as feline infectious peritonitis (FIP and pantropic canine coronavirus infection in cats and dogs, respectively. In this paper, different aspects of the genetics, host cell tropism, and pathogenesis of the feline and canine coronaviruses (FCoV and CCoV will be discussed, with a view to illustrating how study of FCoVs and CCoVs can improve our general understanding of the pathobiology of coronaviruses.
THE REDUCED CANINE PANCREAS TO STUDY THE EFFECTS OF INTRAOPERATIVE RADIOTHERAPY
HEIJMANS, HJ; MEHTA, D; KLEIBEUKER, JH; SLUITER, WJ; HOEKSTRA, HJ
1993-01-01
A canine model is described to study the tolerance of the pancreas to intra-operative radiotherapy (IORT). The canine pancreas is a horseshoe-shaped organ. To create a homogeneous delivery of IORT to the whole pancreas surgical manipulation is necessary which may induce pancreatitis. A resection of
Laparoscopic radical prostatectomy in the canine model.
Price, D T; Chari, R S; Neighbors, J D; Eubanks, S; Schuessler, W W; Preminger, G M
1996-12-01
The purpose of this study was to determine the feasibility of performing laparoscopic radical prostatectomy in a canine model. Laparoscopic radical prostatectomy was performed on six adult male canines. A new endoscopic needle driver was used to construct a secure vesicourethral anastomosis. Average operative time required to complete the procedure was 304 min (range 270-345 min). Dissection of the prostate gland took an average of 67 min (range 35-90 min), and construction of the vesicourethral anastomosis took 154 min (rage 80-240 min). There were no intraoperative complications and only one postoperative complication (anastomotic leak). Five of the six animals recovered uneventfully from the procedure, and their foley catheters were removed 10-14 days postoperatively after a retrograde cystourethrogram demonstrated an intact vesicourethral anastomosis. Four (80%) of the surviving animals were clinically continent within 10 days after catheter removal. Post mortem examination confirmed that the vesicourethral anastomosis was intact with no evidence of urine extravasation. These data demonstrate the feasibility of laparoscopic radical prostatectomy in a canine model, and suggest that additional work with this technique should be continued to develop its potential clinical application.
Angstadt, Andrea Y; Motsinger-Reif, Alison; Thomas, Rachael; Kisseberth, William C; Guillermo Couto, C; Duval, Dawn L; Nielsen, Dahlia M; Modiano, Jaime F; Breen, Matthew
2011-11-01
Osteosarcoma (OS) is the most commonly diagnosed malignant bone tumor in humans and dogs, characterized in both species by extremely complex karyotypes exhibiting high frequencies of genomic imbalance. Evaluation of genomic signatures in human OS using array comparative genomic hybridization (aCGH) has assisted in uncovering genetic mechanisms that result in disease phenotype. Previous low-resolution (10-20 Mb) aCGH analysis of canine OS identified a wide range of recurrent DNA copy number aberrations, indicating extensive genomic instability. In this study, we profiled 123 canine OS tumors by 1 Mb-resolution aCGH to generate a dataset for direct comparison with current data for human OS, concluding that several high frequency aberrations in canine and human OS are orthologous. To ensure complete coverage of gene annotation, we identified the human refseq genes that map to these orthologous aberrant dog regions and found several candidate genes warranting evaluation for OS involvement. Specifically, subsequenct FISH and qRT-PCR analysis of RUNX2, TUSC3, and PTEN indicated that expression levels correlated with genomic copy number status, showcasing RUNX2 as an OS associated gene and TUSC3 as a possible tumor suppressor candidate. Together these data demonstrate the ability of genomic comparative oncology to identify genetic abberations which may be important for OS progression. Large scale screening of genomic imbalance in canine OS further validates the use of the dog as a suitable model for human cancers, supporting the idea that dysregulation discovered in canine cancers will provide an avenue for complementary study in human counterparts. Copyright © 2011 Wiley-Liss, Inc.
Cavalli, Alessandra; Desario, Costantina; Kusi, Ilir; Mari, Viviana; Lorusso, Eleonora; Cirone, Francesco; Kumbe, Ilirjan; Colaianni, Maria Loredana; Buonavoglia, Domenico; Decaro, Nicola
2014-07-01
An epidemiological survey for Canine parvovirus 2 (CPV-2) and Canine coronavirus (CCoV) was conducted in Albania. A total of 57 fecal samples were collected from diarrheic dogs in the District of Tirana during 2011-2013. The molecular assays detected 53 and 31 CPV- and CCoV-positive specimens, respectively, with mixed CPV-CCoV infections diagnosed in 28 dogs. The most frequently detected CPV type was 2a, whereas IIa was the predominant CCoV subtype. A better comprehension of the CPV-CCoV epidemiology in eastern European countries will help to assess the most appropriate vaccination strategies to prevent disease due to infections with these widespread agents of acute gastroenteritis in the dog.
Effects of aurothiomalate treatment on canine osteosarcoma in a murine xenograft model.
Scharf, Valery F; Farese, James P; Siemann, Dietmar W; Abbott, Jeffrey R; Kiupel, Matti; Salute, Marc E; Milner, Rowan J
2014-03-01
Osteosarcoma is a highly fatal cancer, with most patients ultimately succumbing to metastatic disease. The purpose of this study was to evaluate the effects of the antirheumatoid drug aurothiomalate on canine and human osteosarcoma cells and on canine osteosarcoma growth and metastasis in a mouse xenograft model. We hypothesized that aurothiomalate would decrease osteosarcoma cell survival, tumor cellular proliferation, tumor growth, and metastasis. After performing clonogenic assays, aurothiomalate or a placebo was administered to 54 mice inoculated with canine osteosarcoma. Survival, tumor growth, embolization, metastasis, histopathology, cell proliferation marker Ki67, and apoptosis marker caspase-3 were compared between groups. Statistical analysis was carried out using the Kaplan-Meier method with the log-rank test and one-way analysis of variance with the Tukey's test or Dunn's method. Aurothiomalate caused dose-dependent inhibition of osteosarcoma cell survival (Posteosarcoma cell survival and reduced tumor cell proliferation, growth, embolization, and pulmonary metastasis. Given aurothiomalate's established utility in canine and human medicine, our results suggest that this compound may hold promise as an adjunctive therapy for osteosarcoma. Further translational research is warranted to better characterize the dose response of canine and human osteosarcoma to aurothiomalate.
Intra- and interspecies gene expression models for predicting drug response in canine osteosarcoma.
Fowles, Jared S; Brown, Kristen C; Hess, Ann M; Duval, Dawn L; Gustafson, Daniel L
2016-02-19
Genomics-based predictors of drug response have the potential to improve outcomes associated with cancer therapy. Osteosarcoma (OS), the most common primary bone cancer in dogs, is commonly treated with adjuvant doxorubicin or carboplatin following amputation of the affected limb. We evaluated the use of gene-expression based models built in an intra- or interspecies manner to predict chemosensitivity and treatment outcome in canine OS. Models were built and evaluated using microarray gene expression and drug sensitivity data from human and canine cancer cell lines, and canine OS tumor datasets. The "COXEN" method was utilized to filter gene signatures between human and dog datasets based on strong co-expression patterns. Models were built using linear discriminant analysis via the misclassification penalized posterior algorithm. The best doxorubicin model involved genes identified in human lines that were co-expressed and trained on canine OS tumor data, which accurately predicted clinical outcome in 73 % of dogs (p = 0.0262, binomial). The best carboplatin model utilized canine lines for gene identification and model training, with canine OS tumor data for co-expression. Dogs whose treatment matched our predictions had significantly better clinical outcomes than those that didn't (p = 0.0006, Log Rank), and this predictor significantly associated with longer disease free intervals in a Cox multivariate analysis (hazard ratio = 0.3102, p = 0.0124). Our data show that intra- and interspecies gene expression models can successfully predict response in canine OS, which may improve outcome in dogs and serve as pre-clinical validation for similar methods in human cancer research.
Functional Characterization of Canine Interferon-Lambda
Fan, Wenhui; Xu, Lei; Ren, Liqian; Qu, Hongren; Li, Jing; Liang, Jingjing; Liu, Wenjun
2014-01-01
In this study, we provide the first comprehensive annotation of canine interferon-λ (CaIFN-λ, type III IFN). Phylogenetic analysis based on genomic sequences indicated that CaIFN-λ is located in the same branch with Swine IFN-λ1 (SwIFN-λ), Bat IFN-λ1 (BaIFN-λ), and human IFN-λ1 (HuIFN-λ1). CaIFN-λ was cloned, expressed in Escherichia coli, and purified to further investigate the biological activity in vitro. The recombinant CaIFN-λ (rCaIFN-λ) displayed potent antiviral activity on both homologous and heterologous animal cells in terms of inhibiting the replication of the New Jersey serotype of vesicular stomatitis virus (VSV), canine parvovirus, and influenza virus A/WSN/33 (H1N1), respectively. In addition, we also found that rCaIFN-λ exhibits a significant antiproliferative response against A72 canine tumor cells and MDCK cells in a dose-dependent manner. Furthermore, CaIFN-λ activated the JAK-STAT signaling pathway. To evaluate the expression of CaIFN-λ induced by virus and the expression of IFN-stimulated genes (ISGs) induced by rCaIFN-λ in the MDCK cells, we measured the relative mRNA level of CaIFN-λ and ISGs (ISG15, Mx1, and 2′5′-OAS) by quantitative real-time PCR and found that the mRNA level of CaIFN-λ and the ISGs significantly increased after treating the MDCK cells with viruses and rCaIFN-λ protein, respectively. Finally, to evaluate the binding activity of rCaIFN-λ to its receptor, we expressed the extracellular domain of the canine IFN-λ receptor 1 (CaIFN-λR1-EC) and determined the binding activity via ELISA. Our results demonstrated that rCaIFN-λ bound tightly to recombinant CaIFN-λR1-EC (rCaIFN-λR1-EC). PMID:24950142
Kidney Exchange to Overcome Financial Barriers to Kidney Transplantation.
Rees, M A; Dunn, T B; Kuhr, C S; Marsh, C L; Rogers, J; Rees, S E; Cicero, A; Reece, L J; Roth, A E; Ekwenna, O; Fumo, D E; Krawiec, K D; Kopke, J E; Jain, S; Tan, M; Paloyo, S R
2017-03-01
Organ shortage is the major limitation to kidney transplantation in the developed world. Conversely, millions of patients in the developing world with end-stage renal disease die because they cannot afford renal replacement therapy-even when willing living kidney donors exist. This juxtaposition between countries with funds but no available kidneys and those with available kidneys but no funds prompts us to propose an exchange program using each nation's unique assets. Our proposal leverages the cost savings achieved through earlier transplantation over dialysis to fund the cost of kidney exchange between developed-world patient-donor pairs with immunological barriers and developing-world patient-donor pairs with financial barriers. By making developed-world health care available to impoverished patients in the developing world, we replace unethical transplant tourism with global kidney exchange-a modality equally benefitting rich and poor. We report the 1-year experience of an initial Filipino pair, whose recipient was transplanted in the United states with an American donor's kidney at no cost to him. The Filipino donor donated to an American in the United States through a kidney exchange chain. Follow-up care and medications in the Philippines were supported by funds from the United States. We show that the logistical obstacles in this approach, although considerable, are surmountable. © 2016 The American Society of Transplantation and the American Society of Transplant Surgeons.
Maxillary canine impactions related to impacted central incisors: two case reports.
Bayram, Mehmet; Ozer, Mete; Sener, Ismail
2007-09-01
The purpose of this case report is to describe the combined surgical and orthodontic treatment of two cases with an impacted maxillary central incisor and canine in the same quadrant and to discuss the causal relationship between them. The most common causes of canine impactions are usually the result of one or more factors such as a long path of eruption, tooth size-arch length discrepancies, abnormal position of the tooth bud, prolonged retention or early loss of the deciduous canine, trauma, the presence of an alveolar cleft, ankylosis, cystic or neoplastic formation, dilaceration of the root, supernumerary teeth, and odontomas. Although impaction of the maxillary central incisor is almost as prevalent as impacted canines its etiology is different. The principal factors involved in causing the anomaly are supernumerary teeth, odontomas, and trauma. Case #1: A 10.5-year-old girl in the early mixed dentition stage presented with a chief complaint of the appearance of her anterior teeth. She had a Class I skeletal pattern and a history of trauma to the maxillary central incisors at age five with premature exfoliation. Radiographs revealed an impacted upper right central incisor in the region of the nasal floor, delayed eruption of the maxillary permanent central incisor, and the adjacent lateral incisor was inclined toward the edentulous space. Treatment was done in two stages consisting of surgical exposure and traction of the impacted central incisor and fixed orthodontic treatment. Case #2: An 11.5-year-old girl presented for orthodontic treatment with the chief complaint of an unerupted tooth and the appearance of her upper anterior teeth. She was in the late mixed dentition period with a Class III skeletal pattern along with an anterior cross-bite with some maxillary transverse deficiency. The maxillary right canine and central incisor were absent, but the maxillary right deciduous canine was still present. Treatment included arch expansion followed by
DEFF Research Database (Denmark)
Koffman, Jennifer Skaarup; Christensen, Eva Arnspang; Marlar, Saw
2015-01-01
Aquaporin-5 (AQP5) facilitates passive water transport in glandular epithelia in response to secretory stimuli via intracellular pathways involving calcium release, cAMP and protein kinase A (PKA). In epithelial plasma membranes, AQP5 may be acutely regulated to facilitate water transport...... in the plasma membrane diffusion coefficient of AQP5. We aimed to test the short-term regulatory effects of the above pathways, by measuring lateral diffusion of AQP5 and an AQP5 phospho-mutant, T259A, using k-space Image Correlation Spectroscopy of quantum dot- and EGFP-labeled AQP5. Elevated cAMP and PKA...... inhibition significantly decreased lateral diffusion of AQP5, whereas T259A mutation showed opposing effects; slowing diffusion without stimulation and increasing diffusion to basal levels after cAMP elevation. Thus, lateral diffusion of AQP5 is significantly regulated by cAMP, PKA, and T259 phosphorylation...
... kidney; Ureteral injury; Pre-renal failure - injury, Post-renal failure - injury; Kidney obstruction - injury Images Kidney anatomy Kidney - blood and urine flow References Molitoris BA. Acute kidney injury. In: Goldman ...
Orthodontic treatment of a stubborn palatally ectopic canine: a case report.
Al-Musfir, Tumadher M; Morris, David O
2014-03-01
This is a case report that highlights a different treatment approach in dealing with palatally ectopic canines. The modified transpalatal arch with an 'active' arm was used to align a palatally ectopic canine with 'push' mechanics after the initial use of more conventional 'pull' mechanics (piggy-back archwire technique) had failed.
Carmichael, L E; Joubert, J C; Pollock, R V
1981-10-01
A canine parvovirus (CPV) strain (C-780916) was found attenuated for pups at 80, but not after 51 serial passages in dog kidney cell (DKC) cultures. A variant viral population ('large plaque') emerged after prolonged cultivation in DKC cultures that may be associated with reduced native virulence. Dogs vaccinated with modified CPV developed high hemagglutination-inhibiting (HI) antibody titers within 4 days of incoluation and antibody persisted. Vaccinated animals shed small amounts of virus in the feces that spread to contact dogs. After five back-passages in dogs the modified strain was not pathogenic for pups and the plaque characteristics of the virus isolated from the feces were typical of the attenuated strain. The modified live CPV did not cause infection of the fetus when inoculated parenterally into pregnant bitches at various stages of gestation. It was not pathogenic for neonatal pups. These results suggest that a safe and effective live homologous (CPV) vaccine has been developed which should aid substantially in controlling CPV infection.
Successful experimental challenge of dogs with canine parvovirus-2.
Carman, S; Povey, C
1982-01-01
Withholding food from dogs for 24 hours prior to, and for 48 hours following oral challenge with a gut mucosal homogenate of canine parvovirus-2, was a successful means of reproducing gastroenteric signs of canine parvovirus-2 infection. Twenty-one of 24 dogs, which had previously received various vaccine preparations of mink enteritis virus or were unvaccinated, and which were starved at challenge, developed soft or liquid feces with large or without large clots of mucus. Altered feces were ...
Hageman, D.; Kooman, J.P.; Lance, M.D.; van Heurn, L.W.; Snoeijs, M.G.
2012-01-01
- 'Acute kidney injury' is modern terminology for a sudden decline in kidney function, and is defined by the RIFLE classification (RIFLE is an acronym for Risk, Injury, Failure, Loss and End-stage kidney disease).- Acute kidney injury occurs as a result of the combination of reduced perfusion in the
Adina Coșarcă; Mariana Păcurar; Cecilia Petrovan; Alina Ormenișan
2014-01-01
Aim: The aim of this study was to compare the periodontal status of impacted canines after 5 years following completion of the combined surgical and orthodontic treatment. Materials and methods: We examined 20 labially impacted canines and 20 palatally impacted canines at 5 years after the end of treatment. We assessed the periodontal status of these teeth. Results: Different outcomes were found regarding the probing depth and the amount of keratinized gingiva in the two mentioned groups of t...
Bilateral Second Premolars Agenesia Together with a Unilateral Canine Radiculomegaly.
Kemoli, Arthur Musakulu; Junior, Thomas Munyao
2017-01-01
Congenitally missing teeth is a common feature for the third molars. However, missing teeth, macrodontia and radiculomegaly occurring in a single patient is very rare. This article describes a case of agenesis of mandibular second premolars, radiculomegaly with dilacerations of a canine tooth together with elongated roots of other canines. All these features had been discerned through diagnostic radiographs taken during a routine treatment planning.
Directory of Open Access Journals (Sweden)
Martín-Vasallo Pablo
2003-06-01
Full Text Available Abstract Background An important physiological function of the normal prostate gland is the synthesis and secretion of a citrate rich prostatic fluid. In prostate cancer, citrate production levels are reduced as a result of altered cellular metabolism and bioenergetics. Na, K-ATPase is essential for citrate production since the inward Na+ gradients it generates are utilized for the Na+ dependent uptake of aspartate, a major substrate for citrate synthesis. The objective of this study was to compare the expression of previously identified Na, K-ATPase isoforms in normal canine prostate, benign prostatic hyperplasia (BPH and prostatic adenocarcinoma (PCa using immunohistochemistry in order to determine whether reduced citrate levels in PCa are also accompanied by changes in Na, K-ATPase expression. Results Expression of Na, K-ATPase α1 and β1 isoforms was observed in the lateral and basolateral plasma membrane domains of prostatic epithelial cells in normal and BPH prostates. Canine kidney was used as positive control for expression of Na, K-ATPase α1 and γ isoforms. The α1 isoform was detected in abundance in prostatic epithelial cells but there was no evidence of α2, α3 or γ subunit expression. In advanced PCa, Na, K-ATPase α1 isoform expression was significantly lower compared to normal and BPH glands. The abundant basolateral immunostaining observed in normal and BPH tissue was significantly attenuated in PCa. Conclusion The loss of epithelial structure and function and the transformation of normal epithelial cells to malignant cells in the canine prostate have important implications for cellular metabolism and are accompanied by a down regulation of Na, K-ATPase.
Recent advances in canine leptospirosis: focus on vaccine development
Directory of Open Access Journals (Sweden)
Klaasen HLBM
2015-06-01
Full Text Available Henricus LBM (Eric Klaasen,1 Ben Adler2 1Global Companion Animals Research and Development, Merck Sharp and Dohme Animal Health, Boxmeer, the Netherlands; 2Department of Microbiology, Monash University, Clayton, VIC, Australia Abstract: Leptospirosis is a global infection of humans and animals caused by pathogenic Leptospira spp. Leptospirosis is a major zoonosis, with infection acquired from wild and domestic animals. It is also a significant cause of morbidity, mortality, and economic loss in production and companion animals. Leptospirosis in dogs is prevalent worldwide and as well as a cause of canine disease, it presents a zoonotic risk to human contacts. Canine leptospirosis does not differ greatly from the syndromes seen in other animal species, with hepatic, renal, and pulmonary involvement being the main manifestations. While the pathogenesis of disease is well documented at the whole animal level, the cellular and molecular basis remains obscure. Killed, whole-cell bacterin vaccines are licensed worldwide and have not changed greatly over the past several decades. Vaccine-induced immunity is restricted to serologically related serovars and is generally short-lived, necessitating annual revaccination. The appearance of new serovars as causes of canine leptospirosis requires constant epidemiological surveillance and tailoring of vaccines to cover emerging serovars. At the present time, there is no realistic prospect of alternative, non-bacterin vaccines in the foreseeable future. Keywords: canine leptospirosis, vaccines, diagnosis, epidemiology, pathogenesis
International Nuclear Information System (INIS)
Kako, K.; Kato, M.; Matsuoka, T.; Mustapha, A.
1988-01-01
A partially purified, membrane-bound Na + -K + -ATPase fraction, prepared from the outer medulla of porcine kidney, was incubated in the presence of 0.1-100 mM H 2 O 2 for either 15 or 30 min at 37 degree C. The activity of ouabain-sensitive Na + -K + -ATPase was reduced proportionally to the concentration of H 2 O 2 and the duration of incubation. There were decreases in SH contents and turnover rates of the Na + -K + -ATPase preparation, while malondialdehyde (MDA) and conjugated dienes were generated from the membrane lipids in the course of the incubation. The concentrations of ethanolamine (E) plasmalogen and of arachidonic acid in the E glycerophospholipid molecules were reduced by the free radical reaction. Similarly, a reduction in Na + K + -ATPase activity and the formation of MDA and conjugated dienes, together with a decrease in E glycerophospholipids, were observed when the membrane fraction was exposed to ultraviolet irradiation (254 nm) for 30 min at 4 degree C. Microsomal fractions, prepared from the outer medulla of canine kidney after 1 h of unilateral ischemia and 1 h of reperfusion, showed a decreased Na + -K + -ATPase activity, a reduced amount of SH groups, and an increased MDA. These changes were normalized by the infusion of N-mercaptopropionylglycine. These results support the view (1) that free radical generation affects the enzyme protein as well as membrane lipids, and (2) that free radicals may be formed in the ischemic reperfused kidney
Energy Technology Data Exchange (ETDEWEB)
Jaschke, W.; Lipton, M.J.; Boyd, D.P.; Cann, C.; Strauss, L.; Sievers, R.S.
The potential of CT scanning to explore total and regional renal blood flow was evaluated in a dog model with unilateral renal artery stenosis (n=7, reduction of renal blood flow: 32-75% of base line flow). Attenuation versus time curves were generated for the renal cortex and medulla, as well as for the aorta and renal vein. A fast CT scanner was used which allowed for up to 24 scans/minute at the same level (slice thickness: 10 mm). A total of 10 ml contrast medim was injected into a peripheral vein for each scan series taken. During baseline conditions, the curve of the renal cortex and medulla demonstrated 2 peaks. The first peak was mainly related to early vascular enhancement, whereas the second peak corresponded mainly to the appearance of contrast medium in the distal convolutes and collecting ducts. Ischemia of the kidney resulted in a reduction of the first peak and a flattening of the leading edge slope. Transport of contrast medium through the extravascular compartments of the kidney was delayed during ischemia. Relative renal blood flow was obtained from the CT data by dividing peak enhancement by rise-time as assessed from the cortical curve. All measurements were related to baseline flow and validated by flow measurements using radioactive labeled microspheres (n=5). Correlation was found to be r=0.97. (orig.).
Efficacy of feline anti-parvovirus antibodies in the treatment of canine parvovirus infection.
Gerlach, M; Proksch, A L; Unterer, S; Speck, S; Truyen, U; Hartmann, K
2017-07-01
This prospective, randomised, placebo-controlled, double-blinded study aimed to evaluate efficacy of commercially available feline anti-parvovirus antibodies in dogs with canine parvovirus infection. First, cross-protection of feline panleukopenia virus antibodies against canine parvovirus was evaluated in vitro. In the subsequent prospective clinical trial, 31 dogs with clinical signs of canine parvovirus infection and a positive faecal canine parvovirus polymerase chain reaction were randomly assigned to a group receiving feline panleukopenia virus antibodies (n=15) or placebo (n=16). All dogs received additional routine treatment. Clinical signs, blood parameters, time to clinical recovery and mortality were compared between the groups. Serum antibody titres and quantitative faecal polymerase chain reaction were compared on days 0, 3, 7, and 14. In vitro, canine parvovirus was fully neutralised by feline panleukopenia virus antibodies. There were no detected significant differences in clinical signs, time to clinical recovery, blood parameters, mortality, faecal virus load, or viral shedding between groups. Dogs in the placebo group showed a significant increase of serum antibody titres and a significant decrease of faecal virus load between day 14 and day 0, which was not detectable in dogs treated with feline panleukopenia virus antibodies. No significant beneficial effect of passively transferred feline anti-parvovirus antibodies in the used dosage regimen on the treatment of canine parvovirus infection was demonstrated. © 2017 British Small Animal Veterinary Association.
Impacted canines: Etiology, diagnosis, and orthodontic management
Directory of Open Access Journals (Sweden)
Ranjit Manne
2012-01-01
Full Text Available Impaction of maxillary and mandibular canines is a frequently encountered clinical problem, the treatment of which usually requires an interdisciplinary approach. Surgical exposure of the impacted tooth and the complex orthodontic mechanisms that are applied to align the tooth into the arch may lead to varying amounts of damage to the supporting structures of the tooth, not to mention the long treatment duration and the financial burden to the patient. Hence, it seems worthwhile to focus on the means of early diagnosis and interception of this clinical situation. In the present article, an overview of the incidence and sequelae, as well as the surgical, periodontal, and orthodontic considerations in the management of impacted canines is presented.
Leigh, S R; Jungers, W L
1994-12-01
A recent study suggests that differing populations of woolly spider monkeys exhibit a substantial degree of morphological, cytogenetic, and behavioral variation. We re-evaluate the differences between populations in the degree of canine tooth height sexual dimorphism and in the frequency of thumbs. Statistical analysis of variation in the degree of canine sexual dimorphism between these populations fails to provide strong evidence for subspecific variation: differences in the degree of canine dimorphism cannot be considered statistically significant. Differences between populations in the frequency of thumbs are, however, statistically significant. The lack of clear distinctions between populations in the degree of canine dimorphism complicates assessments of behavioral variation between these populations. We suggest that the level of geographic variation in woolly spider monkey canine dimorphism is not consistent with subspecific status.
Cost-effectiveness of canine vaccination to prevent human rabies in rural Tanzania.
Fitzpatrick, Meagan C; Hampson, Katie; Cleaveland, Sarah; Mzimbiri, Imam; Lankester, Felix; Lembo, Tiziana; Meyers, Lauren A; Paltiel, A David; Galvani, Alison P
2014-01-21
The annual mortality rate of human rabies in rural Africa is 3.6 deaths per 100 000 persons. Rabies can be prevented with prompt postexposure prophylaxis, but this is costly and often inaccessible in rural Africa. Because 99% of human exposures occur through rabid dogs, canine vaccination also prevents transmission of rabies to humans. To evaluate the cost-effectiveness of rabies control through annual canine vaccination campaigns in rural sub-Saharan Africa. We model transmission dynamics in dogs and wildlife and assess empirical uncertainty in the biological variables to make probability-based evaluations of cost-effectiveness. Epidemiologic variables from a contact-tracing study and literature and cost data from ongoing vaccination campaigns. Two districts of rural Tanzania: Ngorongoro and Serengeti. 10 years. Health policymaker. Vaccination coverage ranging from 0% to 95% in increments of 5%. Life-years for health outcomes and 2010 U.S. dollars for economic outcomes. Annual canine vaccination campaigns were very cost-effective in both districts compared with no canine vaccination. In Serengeti, annual campaigns with as much as 70% coverage were cost-saving. Across a wide range of variable assumptions and levels of societal willingness to pay for life-years, the optimal vaccination coverage for Serengeti was 70%. In Ngorongoro, although optimal coverage depended on willingness to pay, vaccination campaigns were always cost-effective and lifesaving and therefore preferred. Canine vaccination was very cost-effective in both districts, but there was greater uncertainty about the optimal coverage in Ngorongoro. Annual canine rabies vaccination campaigns conferred extraordinary value and dramatically reduced the health burden of rabies. National Institutes of Health.
Wilkes, Rebecca P; Tsai, Yun-Long; Lee, Pei-Yu; Lee, Fu-Chun; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas
2014-09-09
Canine distemper virus (CDV) has been associated with outbreaks of canine infectious respiratory disease in shelters and boarding kennel environments. POCKITTM Nucleic Acid Analyzer is a field-deployable device capable of generating automatically interpreted insulated isothermal polymerase chain reaction (iiPCR) results from extracted nucleic acid within one hour. In this study, reverse transcription iiPCR (RT-iiPCR) was developed to facilitate point-of-need diagnosis of CDV infection. Analytical sensitivity (limit of detection 95%) of the established CDV RT-iiPCR was about 11 copies of in vitro transcribed RNA per reaction. CDV RT-iiPCR generated positive signals from CDV, but not Bordetella bronchiseptica, canine parvovirus, canine herpesvirus, canine adenovirus 2, canine influenza virus (subtype H3N8), canine parainfluenza virus, and canine respiratory coronavirus. To evaluate accuracy of the established reaction in canine distemper clinical diagnosis, 110 specimens from dogs, raccoons, and foxes suspected with CDV infection were tested simultaneously by CDV RT-iiPCR and real-time RT-PCR. CDV RT-iiPCR demonstrated excellent sensitivity (100%) and specificity (100%), compared to real-time RT-PCR. The results indicated an excellent correlation between RT-iiPCR and a reference real time RT-PCR method. Working in a lyophilized format, the established method has great potential to be used for point-of-care diagnosis of canine distemper in animals, especially in resource-limited facilities.
Identification and function analysis of canine stimulator of interferon gene (STING).
Zhang, Yuxiang; Zhu, Mengyan; Li, Gairu; Liu, Jie; Zhai, Xiaofeng; Wang, Ruyi; Zhang, Junyan; Xing, Gang; Gu, Jinyan; Yan, Liping; Lei, Jing; Sun, Haifeng; Shi, Zhiyu; Liu, Fei; Hu, Boli; Su, Shuo; Zhou, Jiyong
2017-12-01
Stimulator of interferon gene (STING) plays an important role in the cyclic GMP-AMP synthase (cGAS)-mediated activation of type I IFN responses. In this study, we identified and cloned canine STING gene. Full-length STING encodes a 375 amino acid product that shares the highest similarity with feline STING. Highest levels of mRNA of canine STING were detected in the spleen and lungs while the lowest levels in the heart and muscle. Analysis of its cellular localization showed that STING is localizes to the endoplasmic reticulum. STING overexpression induced the IFN response via the IRF3 and NF-κB pathways and up-regulated the expression of ISG15 and viperin. However, knockdown of STING did not inhibit the IFN-β response triggered by poly(dA:dT), poly(I:C), or SeV. Finally, overexpression of STING significantly inhibited the replication of canine influenza virus H3N2. Collectively, our findings indicate that STING is involved in the regulation of the IFN-β pathway in canine. Copyright © 2017 Elsevier Ltd. All rights reserved.
Mandibular Canine Dimorphism in Establishing Sex Identity in the Lebanese Population
Directory of Open Access Journals (Sweden)
Fouad Ayoub
2014-01-01
Full Text Available Background and Objective. In forensic investigations, mandibular canines provide excellent materials to identify gender since they are more likely to survive disasters. The objective of this study was to investigate gender dimorphism by comparing the mesiodistal width of mandibular permanent canines and intercanine distance in a group of Lebanese population. Methods. Participants consisted of undergraduate students from the School of Dentistry, Lebanese University, for two academic years who fulfilled the inclusion criteria. Canine widths and intercanine distance were measured by one operator directly on dental casts using a digital caliper. Results. One hundred thirty-three Lebanese dental students (54 males and 69 females aged 18–25 were included in the study. The intercanine distance was significantly greater in males (P value 0.05 and females (P value > 0.05. The mean width of canine was greater than 7.188 mm for males. Conclusion. The parameters measured in the present study are of great help in sex identification in forensic investigations in the Lebanese adult population.
Increasing Incidence of Canine Leptospirosis in Switzerland
Directory of Open Access Journals (Sweden)
Andrea Major
2014-07-01
Full Text Available A marked increase in canine leptospirosis was observed in Switzerland over 10 years with a peak incidence of 28.1 diagnosed cases/100,000 dogs/year in the most affected canton. With 95% affected dogs living at altitudes <800 m, the disease presented a seasonal pattern associated with temperature (r2 0.73 and rainfall (r2 0.39, >90% cases being diagnosed between May and October. The increasing yearly incidence however was only weakly correlated with climatic data including number of summer (r2 0.25 or rainy days (r2 0.38. Serovars Australis and Bratislava showed the highest seropositivity rates with 70.5% and 69.1%, respectively. Main clinical manifestations included renal (99.6%, pulmonary (76.7%, hepatic (26.0%, and hemorrhagic syndromes (18.2%, leading to a high mortality rate (43.3%. Similar to the human disease, liver involvement had the strongest association with negative outcome (OR 16.3. Based on these data, canine leptospirosis presents similar features and severity as the human infection for which it therefore can be considered a model. Its re-emergence in a temperate country with very high incidence rates in canines should thus be viewed as a warning and emphasize the need for increased awareness in other species.
Directory of Open Access Journals (Sweden)
Jennifer Ann Foltz
2016-11-01
Full Text Available Canines spontaneously develop many cancers similar to humans - including osteosarcoma, leukemia, and lymphoma - offering the opportunity to study immune therapies in a genetically heterogeneous and immunocompetent environment. However, a lack of antibodies recognizing canine NK cell markers has resulted in suboptimal characterization and unknown purity of NK cell products, hindering the development of canine models of NK cell adoptive immunotherapy. To this end, we generated a novel antibody to canine NCR1 (NKp46, the putative species-wide marker of NK cells, enabling purification of NK cells for further characterization. We demonstrate that CD3-/NKp46+ cells in healthy and osteosarcoma-bearing canines have phenotypic similarity to human CD3-/NKp46+ NK cells, expressing mRNA for CD16 and the natural cytotoxicity receptors NKp30, NKp44, and NKp80. Functionally, we demonstrate with the calcein release assay that canine CD3-/NKp46+ cells kill canine tumor cell lines without prior sensitization and secrete IFN-γ, TNF-α, IL-8, IL-10, and GM-CSF as measured by Luminex. Like human NK cells, CD3-/NKp46+ cells expand rapidly on feeder cells expressing 4-1BBL and membrane-bound IL-21 (median= 20,283-fold in 21 days. Further, we identify a minor Null population (CD3-/CD21-/CD14-/NKp46- with reduced cytotoxicity against osteosarcoma cells, but similar cytokine secretion as CD3-/NKp46+ cells. Null cells in canines and humans have reduced expression of NKG2D, NKp44, and CD16 compared to NKp46+ NK cells, and can be induced to express NKp46 with further expansion on feeder cells. In conclusion, we have identified and characterized canine NK cells, including an NKp46- subset of canine and human NK cells, using a novel anti-canine NKp46 antibody, and report robust ex vivo expansion of canine NK cells sufficient for adoptive immunotherapy.
Sequence-independent VIDISCA-454 technique to discover new viruses in canine livers
van der Heijden, Mitzi; de Vries, Michel; van Steenbeek, Frank G.; Favier, Robert P.; Deijs, Martin; Brinkhof, Bas; Rothuizen, Jan; van der Hoek, Lia; Penning, Louis C.
2012-01-01
In many mammals, viruses cause hepatitis. Despite many efforts a specific virus responsible for canine idiopathic hepatitis has not been identified. The discovery of a viral etiology in canine hepatitis will promote the development of specific drugs and vaccines for the treatment of idiopathic
2013-05-21
...] Availability of an Environmental Assessment for Field Testing a Canine Lymphoma Vaccine, DNA AGENCY: Animal and... Canine Lymphoma Vaccine, DNA. The environmental assessment, which is based on a risk analysis prepared to... biological product: Requester: Merial, Inc. Product: Canine Lymphoma Vaccine, DNA. Possible Field Test...
Directory of Open Access Journals (Sweden)
Kimon C. Kanelakis
2009-01-01
Full Text Available The heme-regulated inhibitor (HRI negatively regulates protein synthesis by phosphorylating eukaryotic initiation factor-2α (eIF2α thereby inhibiting protein translation. The importance of HRI in regulating hemoglobin synthesis in erythroid cells makes it an attractive molecular target in need of further characterization. In this work, we have cloned and expressed the canine form of the HRI kinase. The canine nucleotide sequence has 86%, 82%, and 81% identity to the human, mouse, and rat HRI, respectively. It was noted that an isoleucine residue in the ATP binding site of human, rat, and mouse HRI is replaced by a valine in the canine kinase. The expression of canine HRI protein by in vitro translation using wheat germ lysate or in Sf9 cells using a baculovirus expression system was increased by the addition of hemin. Following purification, the canine protein was found to be 72 kD and showed kinase activity determined by its ability to phosphorylate a synthetic peptide substrate. Quercetin, a kinase inhibitor known to inhibit mouse and human HRI, inhibits canine HRI in a concentration-dependent manner. Additionally, quercetin is able to increase de novo protein synthesis in canine reticulocytes. We conclude that the canine is a suitable model species for studying the role of HRI in erythropoiesis.
Hassan, Siba E; Hajeer, Mohammad Y; Alali, Osama H; Kaddah, Ayham S
2016-06-01
The results of previous studies about the efficacy of using self-ligating brackets (SLBs) in controlling canine movement during retraction are not in harmony. Therefore, the current study aimed to compare the effects of using new passive SLBs on maxillary canine retraction with sliding mechanics vs conventional ligating brackets (CLBs) tied with metal ligatures. The sample comprised 15 adult patients (4 males, 11 females; 18-24 years) requiring bilateral extraction of maxillary first premolars. Units of randomization are the left or right maxillary canines within the same patient. The two maxillary canines in each patient were randomly assigned to one of the two groups in a simple split-mouth design. The canines in the SLBs group (n = 15) were bracketed with SLBs (Damon Q™), while the canines in the CLBs group (n = 15) were bracketed with conventional brackets (Mini Master Series). Transpalatal bars were used for anchorage. After leveling and alignment, 0.019 × 0.025" stainless steel working archwires were placed. Canines were retracted using a nickel-titanium close-coil springs with a 150 gm force. The amount and rate of maxillary canine retraction, canine rotation, and loss of anchorage were measured on study models collected at the beginning of canine retraction (T0) and 12 weeks later (T1). Differences were analyzed using paired-samples t-tests. The effect differences were statistically significant (p brackets gave better results compared to the CLBs in terms of rate of movement, amount of canine rotation following extraction, and anchorage loss.
Canine osteosarcoma cells exhibit resistance to aurora kinase inhibitors.
Cannon, C M; Pozniak, J; Scott, M C; Ito, D; Gorden, B H; Graef, A J; Modiano, J F
2015-03-01
We evaluated the effect of Aurora kinase inhibitors AZD1152 and VX680 on canine osteosarcoma cells. Cytotoxicity was seen in all four cell lines; however, half-maximal inhibitory concentrations were significantly higher than in human leukaemia and canine lymphoma cells. AZD1152 reduced Aurora kinase B phosphorylation, indicating resistance was not because of failure of target recognition. Efflux mediated by ABCB1 and ABCG2 transporters is one known mechanism of resistance against these drugs and verapamil enhanced AZD1152-induced apoptosis; however, these transporters were only expressed by a small percentage of cells in each line and the effects of verapamil were modest, suggesting other mechanisms contribute to resistance. Our results indicate that canine osteosarcoma cells are resistant to Aurora kinase inhibitors and suggest that these compounds are unlikely to be useful as single agents for this disease. Further investigation of these resistance mechanisms and the potential utility of Aurora kinase inhibitors in multi-agent protocols is warranted. © 2013 Blackwell Publishing Ltd.
An RCT on treatment of palatally displaced canines with RME and/or a transpalatal arch.
Baccetti, Tiziano; Sigler, Lauren M; McNamara, James A
2011-12-01
To investigate the effect of rapid maxillary expansion (RME) and/or transpalatal arch (TPA) therapy in combination with deciduous canine extraction on the eruption of palatally displaced canines (PDCs). Hundred and twenty subjects were enrolled in an RCT based on PDCs diagnosed on panoramic radiographs and they were randomly assigned to one of four study groups. Three treatment groups (TGs) (RME followed by TPA therapy plus extraction of deciduous canines, RME/TPA/EC group, 40 subjects; TPA therapy plus extraction of deciduous canines, TPA/EC group, 25 subjects; extraction of deciduous canines, EC group, 25 subjects) were analyzed. A control group (CG, 30 subjects) received no orthodontic treatment. Prevalence rates of eruption of PDCs in the three TGs were compared with the CG at T2. Predictive features at T1 for successful canine eruption were tested in the three TGs. The prevalence of canine eruption was 80 per cent for the RME/TPA/EC group, 79 per cent for the TPA/EC group, 62.5 per cent for the EC group, versus 28 per cent in the CG, with statistically significant differences between all the groups, with the exception of the comparison between RME/TPA/EC and TPA/EC. Predictive pretreatment variables for the success of treatment were less severe sectors of canine displacement, prepubertal stages of skeletal maturity, and an open root apex of PDCs. The use of a TPA in absence of RME can be equally effective than the RME/TPA combination in PDC cases not requiring maxillary expansion, thus reducing the burden of treatment for the patient.
Bilateral second premolars agenesia together with a unilateral canine radiculomegaly
Directory of Open Access Journals (Sweden)
Arthur Musakulu Kemoli
2017-01-01
Full Text Available Congenitally missing teeth is a common feature for the third molars. However, missing teeth, macrodontia and radiculomegaly occurring in a single patient is very rare. This article describes a case of agenesis of mandibular second premolars, radiculomegaly with dilacerations of a canine tooth together with elongated roots of other canines. All these features had been discerned through diagnostic radiographs taken during a routine treatment planning.
In vitro development of canine somatic cell nuclear transfer embryos in different culture media.
Kim, Dong-Hoon; No, Jin-Gu; Choi, Mi-Kyung; Yeom, Dong-Hyeon; Kim, Dong-Kyo; Yang, Byoung-Chul; Yoo, Jae Gyu; Kim, Min Kyu; Kim, Hong-Tea
2015-01-01
The objective of the present study was to investigate the effects of three different culture media on the development of canine somatic cell nuclear transfer (SCNT) embryos. Canine cloned embryos were cultured in modified synthetic oviductal fluid (mSOF), porcine zygote medium-3 (PZM-3), or G1/G2 sequential media. Our results showed that the G1/G2 media yielded significantly higher morula and blastocyst development in canine SCNT embryos (26.1% and 7.8%, respectively) compared to PZM-3 (8.5% and 0%or mSOF (2.3% and 0%) media. In conclusion, this study suggests that blastocysts can be produced more efficiently using G1/G2 media to culture canine SCNT embryos.
... Renal failure - acute; ARF; Kidney injury - acute Images Kidney anatomy References Devarajan P. Biomarkers for assessment of renal function during acute kidney injury. In: Alpern RJ, Moe OW, Caplan M, ...
Directory of Open Access Journals (Sweden)
Deli Liu
2015-06-01
Full Text Available Spontaneous canine head and neck squamous cell carcinoma (HNSCC represents an excellent model of human HNSCC but is greatly understudied. To better understand and utilize this valuable resource, we performed a pilot study that represents its first genome-wide characterization by investigating 12 canine HNSCC cases, of which 9 are oral, via high density array comparative genomic hybridization and RNA-seq. The analyses reveal that these canine cancers recapitulate many molecular features of human HNSCC. These include analogous genomic copy number abnormality landscapes and sequence mutation patterns, recurrent alteration of known HNSCC genes and pathways (e.g., cell cycle, PI3K/AKT signaling, and comparably extensive heterogeneity. Amplification or overexpression of protein kinase genes, matrix metalloproteinase genes, and epithelial-mesenchymal transition genes TWIST1 and SNAI1 are also prominent in these canine tumors. This pilot study, along with a rapidly growing body of literature on canine cancer, reemphasizes the potential value of spontaneous canine cancers in HNSCC basic and translational research.
Ravaioli, Matteo; De Pace, Vanessa; Comai, Giorgia; Busutti, Marco; Gaudio, Massimo Del; Amaduzzi, Annalisa; Cucchetti, Alessandro; Siniscalchi, Antonio; La Manna, Gaetano; D’Errico, Antonietta A.D.; Pinna, Antonio Daniele
2017-01-01
Patient: Female, 58 Final Diagnosis: Nephroangiosclerosis Symptoms: Renal failure Medication: — Clinical Procedure: Resuscitation of grafts by hypothermic oxygenated perfusion Specialty: Transplantology Objective: Challenging differential diagnosis Background: The recovery of discarded human kidneys has increased in recent years and impels to use of unconventional organ preservation strategies that improve graft function. We report the first case of human kidneys histologically discarded and transplanted after hypothermic oxygenated perfusion (HOPE). Case Report: Marginal kidneys from a 78-year-old woman with brain death were declined by Italian transplant centers due to biopsy score (right kidney: 6; left kidney: 7). We recovered and preserved both kidneys through HOPE and we revaluated their use for transplantation by means of perfusion parameters. The right kidney was perfused for 1 h 20 min and the left kidney for 2 h 30 min. During organ perfusion, the renal flow increased progressively. We observed an increase of 34% for the left kidney (median flow 52 ml/min) and 50% for the right kidney (median flow 24 ml/min). Both kidneys had low perfusate’s lactate levels. We used perfusion parameters as important determinants of the organ discard. Based on our previous organ perfusion experience, the increase of renal flow and the low level of lactate following 1 h of HOPE lead us to declare both kidneys as appropriate for dual kidney transplantation (DKT). No complications were reported during the transplant and in the post-transplant hospital stay. The recipient had immediate graft function and serum creatinine value of 0.95 mg/dL at 3 months post-transplant. Conclusions: HOPE provides added information in the organ selection process and may improve graft quality of marginal kidneys. PMID:28928357
Shedding of the immunodominant P20 surface antigen of Eimeria bovis sporozoites.
Speer, C A; Whitmire, W M
1989-01-01
P20 is an immunodominant surface antigen of Eimeria bovis sporozoites. As parasites underwent merogony within cultured bovine monocytes and Madin-Darby bovine kidney (MDBK) cells, P20 appeared to be shed gradually by meronts and was absent in type 1 and 2 first-generation merozoites. Meronts of E. bovis appeared to shed P20 into the parasitophorous vacuole of bovine monocytes, whereas MDBK cells evidently released P20 into the culture medium or destroyed its antigenic determinant.
Surgical Removal of a Canine Aortic Thromboembolism Secondary to Pancreatitis
Directory of Open Access Journals (Sweden)
Jill Narak
2015-01-01
Full Text Available A 7-year-old castrated male Pomeranian was evaluated on emergency for diagnostic work-up and treatment for acute nonpainful paraparesis. The neurologic examination suggested a L4-S3 myelopathy, but physical examination revealed lack of femoral pulses and rectal hypothermia, as well as a grade II/VI systolic heart murmur, so ischemic neuromyopathy was suspected. Clinicopathologic analysis revealed increased muscle enzymes and proteinuria. Abdominal ultrasonography confirmed aortic thromboembolism (ATE, and surgical histopathology diagnosed necrotizing pancreatitis. Surgical aortic thrombectomy was performed, and antithrombotic therapy was instituted. Pancreatitis was treated supportively. The dog was discharged to the owners after 10 days of hospitalization. Recheck examination 6 weeks after initial presentation revealed a normal neurologic examination and normal femoral pulses. The patient has had no further bouts of pancreatitis and remains neurologically normal 5 years after initial presentation. Canine ATE is relatively rare compared to the feline counterpart. Directed therapy for feline ATE is often not recommended, as underlying conditions are oftentimes ultimately fatal. Underlying etiologies for canine ATE include cardiovascular disease and endocrinopathies, but canine ATE secondary to pancreatitis has not yet been reported. Surgical removal of aortic thromboembolus should be considered as curative for pelvic limb dysfunction in the canine patient without a terminal underlying disease.
Friberg, L
1984-01-01
The paper is a review of certain aspects of importance of cadmium and the kidney regarding the assessment of risks and understanding of mechanisms of action. The review discusses the following topics: history and etiology of cadmium-induced kidney dysfunction and related disorders; cadmium metabolism, metallothionein and kidney dysfunction; cadmium in urine as indicator of body burden, exposure and kidney dysfunction; cadmium levels in kidney and liver as indicators of kidney dysfunction; cha...
Kobayashi, Tetsuro; Fujisawa, Akiko; Amagai, Masayuki; Iwasaki, Toshiroh; Ohyama, Manabu
2011-10-01
The dermal papilla (DP) plays pivotal roles in hair follicle morphogenesis and cycling. However, our understanding of the biology of the canine DP is extremely limited. The aim of this study was to elucidate molecular biological and immunohistochemical characteristics of canine DP cells and determine appropriate conditions for in vitro expansion. Histological investigation revealed that the canine DP expressed biomarkers of human and rodent DP, including alkaline phosphatase (ALP) and versican. When microdissected, canine DP, but not fibroblasts, strongly expressed the DP-related genes for alkaline phosphatase, Wnt inhibitory factor 1 and lymphoid enhancer-binding factor 1, confirming successful isolation. The growth rate of isolated canine DP cells was moderate in conventional culture conditions for rodent and human DP; however, AmnioMAX-C100 complete medium allowed more efficient cultivation. Dermal papilla marker gene expression was maintained in early passage cultured DP cells, but gradually lost after the third passage. Approaches to mimic the in vivo DP environment in culture, such as supplementation of keratinocyte-conditioned medium or use of extracellular matrix-coated dishes, moderately ameliorated loss of DP gene expression in canine DP cells. It is possible that constituent factors in AmnioMAX may influence culture. These findings suggested that further refinements of culture conditions may enable DP cell expansion without impairing intrinsic properties and, importantly, demonstrated that AmnioMAX-cultured early passage canine DP cells partly maintained the biological characteristics of in vivo canine DP cells. This study provides crucial information necessary for further optimization of culture conditions of canine DP. © 2011 The Authors. Veterinary Dermatology. © 2011 ESVD and ACVD.
Collett, A R; Fletcher, B
2000-12-01
A case report is detailed in which autotransplanted maxillary canines were removed and the spaces closed. Substantial surrounding bone loss was associated with the upper right canine, and a bone graft was needed to reestablish normal dentoalveolar ridge morphology. Bone was taken from the maxillary tuberosity and placed in the canine extraction site, fixed with a bone screw, and covered with GoreTex. Seven months after placement of the bone graft, the GoreTex and stabilizing screw were removed to allow for consolidation of the bone. The upper left canine and lower second premolars were extracted, and fixed appliances were placed in both arches to align the teeth and close the spaces. Protraction of the upper right first premolar and retraction of the lateral incisor into the graft site were kept slow and constant with continued periodontal assessment. During the space closure, there was some concern that the bone in the graft site might resorb, leaving the teeth with compromised periodontal support. However, no significant periodontal attachment loss occurred despite ongoing concern about the amount of keratinized tissue. Perhaps the relatively slow rate of tooth movement provided for bone to be maintained and recreated ahead of the tooth. Almost complete closure of the upper canine extraction spaces was achieved. The upper premolars were substituted for the maxillary canines, and unfavorable prosthetic options were thus avoided. The lower arch was aligned, and the extraction spaces completely closed.
"Fooling fido"--chemical and behavioral studies of pseudo-explosive canine training aids.
Kranz, William D; Strange, Nicholas A; Goodpaster, John V
2014-12-01
Genuine explosive materials are traditionally employed in the training and testing of explosive-detecting canines so that they will respond reliably to these substances. However, challenges arising from the acquisition, storage, handling, and transportation of explosives have given rise to the development of "pseudo-explosive" training aids. These products attempt to emulate the odor of real explosives while remaining inert. Therefore, a canine trained on a pseudo-explosive should respond to its real-life analog. Similarly, a canine trained on an actual explosive should respond to the pseudo-explosive as if it was real. This research tested those assumptions with a focus on three explosives: single-base smokeless powder, 2,4,6-trinitrotoluene (TNT), and a RDX-based plastic explosive (Composition C-4). Using gas chromatography-mass spectrometry with solid phase microextraction as a pre-concentration technique, we determined that the volatile compounds given off by pseudo-explosive products consisted of various solvents, known additives from explosive formulations, and common impurities present in authentic explosives. For example, simulated smokeless powders emitted terpenes, 2,4-dinitrotoluene, diphenylamine, and ethyl centralite. Simulated TNT products emitted 2,4- and 2,6-dinitrotoluene. Simulated C-4 products emitted cyclohexanone, 2-ethyl-1-hexanol, and dimethyldinitrobutane. We also conducted tests to determine whether canines trained on pseudo-explosives are capable of alerting to genuine explosives and vice versa. The results show that canines trained on pseudo-explosives performed poorly at detecting all but the pseudo-explosives they are trained on. Similarly, canines trained on actual explosives performed poorly at detecting all but the actual explosives on which they were trained.
Morphological study of maxillary canine region based on CT
International Nuclear Information System (INIS)
Yamada, Maiko; Takamori, Hitoshi; Ide, Yoshiaki; Yosue, Takashi
2010-01-01
The maxilla is generally known as a site where anatomical limitations make it difficult to obtain sufficient bone volume. A large amount of bone exists in the canine region between the anterior margin of the maxillary sinus and the piriform aperture margin. Although this region is crucial for implant treatments, there have not been any reports on morphological studies of the region. In this study, we investigated the morphology of the canine region based on CT, and also the morphology and position of the maxillary sinus located posterior to the canine region. The results were as follows: In the area above the anterior nasal spine, the higher the level, the smaller the mesio-distal length and the bucco-lingual width tended to become. In the area above the anterior nasal spine, the mesio-distal length and the bucco-lingual width tended to be smaller in female patients than in male patients. In the area above the anterior nasal spine, no significant differences in mesio-distal length and bucco-lingual width were observed between dentulous and edentulous jaws. The morphology of the maxillary sinus was mainly of an inverse-trapezoidal, circular, or triangular form. The position of the anterior wall of the maxillary sinus was most frequently found at the site corresponding to the second premolar. Through this study, we have reconfirmed that the canine region is vital for implant treatments in the maxilla. (author)
Acidosis-mediated regulation of the NHE1 isoform of the Na⁺/H⁺ exchanger in renal cells.
Odunewu, Ayodeji; Fliegel, Larry
2013-08-01
The mammalian Na⁺/H⁺ exchanger isoform 1 (NHE1) is a ubiquitous plasma membrane protein that regulates intracellular pH by removing a proton in exchange for extracellular sodium. Renal tissues are subject to metabolic and respiratory acidosis, and acidosis has been shown to acutely activate NHE1 activity in other cell types. We examined if NHE1 is activated by acute acidosis in HEK293 and Madin-Darby canine kidney (MDCK) cells. Acute sustained intracellular acidosis (SIA) activated NHE1 in both cell types. We expressed wild-type and mutant NHE1 cDNAs in MDCK cells. All the cDNAs had a L163F/G174S mutation, which conferred a 100-fold resistance to EMD87580, an NHE1-specific inhibitor. We assayed exogenous NHE1 activity while inhibiting endogenous activity with EMD87580 and while inhibiting the NHE3 isoform of the Na⁺/H⁺ exchanger using the isoform-specific inhibitor S3226. We examined the activation and phosphorylation of the wild-type and mutant NHE1 proteins in response to SIA. In MDCK cells we demonstrated that the amino acids Ser⁷⁷¹, Ser⁷⁷⁶, Thr⁷⁷⁹, and Ser⁷⁸⁵ are important for NHE1 phosphorylation and activation after acute SIA. SIA activated ERK-dependent pathways in MDCK cells, and this was blocked by treatment with the MEK inhibitor U0126. Treatment with U0126 also blocked activation of NHE1 by SIA. These results suggest that acute acidosis activates NHE1 in mammalian kidney cells and that in MDCK cells this activation occurs through an ERK-dependent pathway affecting phosphorylation of a distinct set of amino acids in the cytosolic regulatory tail of NHE1.
Pathophysiology, diagnosis, and treatment of canine hip dysplasia
International Nuclear Information System (INIS)
Cook, J.L.; Tomlinson, J.L.; Constantinescu, G.M.
1996-01-01
Dogs with hip dysplasia are commonly presented to veterinarians for evaluation. Although many causes of the condition have been proposed, a definitive cause has not been established. The multifactorial nature of canine hip dysplasia can confuse client education and management ofthe disease. The basic concept involved is the biomechanical imbalance between the forces on the coxofemoral joint and the associated muscle mass; the result is joint laxity in young, growing dogs. This laxity leads to incongruity; the eventual result is degenerative joint disease. Canine hip dysplasia can affect any breed but is most often reported in large and giant breeds. Understanding the pathophysiology and biomechanics involved with this developmental disease is important in providing clients with diagnostic, therapeutic, and prognostic information. The selection of treatment is influenced by the following factors:the age, health, and intended use of the patient; clinical signs; diagnostic findings; the availability of treatment; and the financial constraints of the owner. This article discusses the current concepts concerning the pathophysiology and biomechanics of canine hip dysplasia and outlines diagnostic and therapeutic options. The objective of the article is to provide practitioners with a reference for decision making and client education
Does contemporary canine diet cause cancer? ; A review
Directory of Open Access Journals (Sweden)
Joseph B Gentzel
2013-07-01
Full Text Available Recent discoveries have discerned the presence of advanced glycation end products (AGEs and their impact on chronic diseases that include cancer in dogs. AGEs are closely allied with chronic systemic inflammation (metaflammation. These two occurrences are observed in many cancers in both humans and dogs. AGEs are exogenous and endogenous. Exogenous AGEs occur from, among other causes, ingestion of food that is affected by the Maillard reaction in its preparation. The result is an accumulation of AGEs and progressive metaflammation that is linked with many cancers in both humans and dogs. Aspects of AGE ingestion and formation are reviewed in association with the contemporary canine diet that is primarily a kibbled meal based diet. Anovel canine diet paradigm is offered as one that diminishes the AGE/ metaflammation axis. This is proposed to be less carcinogenic than the current canine diet in use by much of the civilized world. The proposed paradigm is a unique approach that offers opportunities to be tested for AGE and metaflammation accumulation that results in diminished prevalence and incidence of cancer in dogs. The paradigm diet is suggested as a prevention, treatment, and recovery aide from cancer
Almuhtaseb, Eyad; Mao, Jing; Mahony, Derek; Bader, Rawan; Zhang, Zhi-xing
2014-06-01
The purpose of this study was to develop a new way to localize the impacted canines from three dimensions and to investigate the root resorption of the adjacent teeth by using cone beam computed tomography (CBCT). Forty-six patients undergoing orthodontic treatments and having impacted canines in Tongji Hospital were examined. The images of CBCT scans were obtained from KaVo 3D exam vision. Angular and linear measurements of the cusp tip and root apex according to the three planes (mid-sagittal, occlusal and frontal) have been taken using the cephalometric tool of the InVivo Dental Anatomage Version 5.1.10. The measurements of the angular and linear coordinates of the maxillary and mandibular canines were obtained. Using this technique the operators could envision the location of the impacted canine according to the three clinical planes. Adjacent teeth root resorption of 28.26 % was in the upper lateral incisors while 17.39% in upper central incisors, but no lower root resorption was found in our samples. Accurate and reliable localization of the impacted canines could be obtained from the novel analysis system, which offers a better surgical and orthodontic treatment for the patients with impacted canines.
Successful management of refractory cases of canine demodicosis with homeopathy medicine Graphitis.
Ranjan, Rakesh; Dua, Kirti; Turkar, Sujata; Singh, Harkirat; Singla, L D
2014-12-01
Canine demodicosis is a refractory skin disease caused by excessive proliferation of mite Demodex canis. Despite availability of several treatment options, the disease poses a great challenge to clinicians for its long term management as some drugs may be ineffective or toxic. Present report describes successful treatment of two refractory cases of canine demodicosis using homeopathy medicine. After oral administration of Graphitis 200 C two drops once daily for 2 months, complete cure from the disease was observed. No adverse health effects of the medication were recorded during the treatment. Thus, it may be concluded that homeopathy medicine may be used safely for long-term management of canine demodicosis.
... too high. Over time, this can damage your kidneys. Your kidneys clean your blood. If they are damaged, waste ... in your blood instead of leaving your body. Kidney damage from diabetes is called diabetic nephropathy. It ...
Canine parvovirus in asymptomatic feline carriers.
Clegg, S R; Coyne, K P; Dawson, S; Spibey, N; Gaskell, R M; Radford, A D
2012-05-25
Canine parvovirus (CPV) and feline panleukopaenia virus (FPLV) are two closely related viruses, which are known to cause severe disease in younger unvaccinated animals. As well as causing disease in their respective hosts, CPV has recently acquired the feline host range, allowing it to infect both cats and dogs. As well as causing disease in dogs, there is evidence that under some circumstances CPV may also cause disease in cats. This study has investigated the prevalence of parvoviruses in the faeces of clinically healthy cats and dogs in two rescue shelters. Canine parvovirus was demonstrated in 32.5% (13/50) of faecal samples in a cross sectional study of 50 cats from a feline only shelter, and 33.9% (61/180) of faecal samples in a longitudinal study of 74 cats at a mixed canine and feline shelter. Virus was isolated in cell cultures of both canine and feline origin from all PCR-positive samples suggesting they contained viable, infectious virus. In contrast to the high CPV prevalence in cats, no FPLV was found, and none of 122 faecal samples from dogs, or 160 samples collected from the kennel environment, tested positive for parvovirus by PCR. Sequence analysis of major capsid VP2 gene from all positive samples, as well as the non-structural gene from 18 randomly selected positive samples, showed that all positive cats were shedding CPV2a or 2b, rather than FPLV. Longitudinally sampling in one shelter showed that all cats appeared to shed the same virus sequence type at each date they were positive (up to six weeks), despite a lack of clinical signs. Fifty percent of the sequences obtained here were shown to be similar to those recently obtained in a study of sick dogs in the UK (Clegg et al., 2011). These results suggest that in some circumstances, clinically normal cats may be able to shed CPV for prolonged periods of time, and raises the possibility that such cats may be important reservoirs for the maintenance of infection in both the cat and the dog
Electroencephalography as a diagnostic technique for canine neurological diseases
Directory of Open Access Journals (Sweden)
Wrzosek Marcin
2016-06-01
Full Text Available Electroencephalography (EEG is a non-invasive examination method for the assessment of functional central nervous system (CNS disturbances. In human medicine it has a special importance as a diagnostic tool for epilepsy. Although many studies were done on the use of EEG for diagnostics of canine central nervous system disorders, the technique is still not applied routinely. The purpose of this paper was to review the use of the electroencephalography in canine neurological disorders of central nervous system diagnosis and assess the future perspectives of this technique in veterinary medicine.
A negative search of acute canine distemper virus infection in DogSLAM transgenic C57BL/6 mice
Directory of Open Access Journals (Sweden)
Somporn Techangamsuwan
2010-12-01
Full Text Available Canine distemper is a highly contagious and immunosuppressive viral disease caused by canine distemper virus(CDV, an enveloped RNA virus of the family Paramyxoviridae. The susceptible host spectrum of CDV is broad andincludes all families of the order Carnivora. To accomplish the infection, CDV requires an expression of signaling lymphocyteactivation molecule (SLAM functioning as a cellular receptor which generally presents in a variety of different lymphoid cellsubpopulations, including immature thymocytes, primary B cells, activated T cells, memory T cells, macrophages and maturedendritic cells. The distribution of SLAM-presenting cells is in accordance with the lymphotropism and immunosuppressionfollowing morbillivirus infection. In the present study, the C57BL/6 mice engrafted with dog-specific SLAM sequence(DogSLAM were used. The weanling (3-week-old transgenic offspring C57BL/6 mice were infected with CDV Snyder Hill(CDV-SH strain via the intranasal (n=6, intracerebral (n=6 and intraperitoneal (n=5 routes. Clinical signs, hematology,histopathology, immunohistochemistry, virus isolation and RT-PCR were observed for two weeks post infection. Resultsshowed that CDV-SH-inoculated transgenic mice displayed mild-to-moderate congestion of various organs (brain, lung,spleen, kidney, lymph node, and adrenal gland. By means of immunohistochemistry, virus isolation and RT-PCR, CDV couldnot be detected. The evidence of CDV infection in this study could not be demonstrated in acute phase. Even though thetransgenic mouse is not a suitable animal model for CDV, or a longer incubation period is prerequisite, it needs to be clarifiedin a future study.
Canine distemper virus detection in asymptomatic and non vaccinated dogs
Directory of Open Access Journals (Sweden)
Helen L. Del Puerto
2010-02-01
Full Text Available A quantitative real time polymerase chain reaction (PCR revealed canine distemper virus presence in peripheral blood samples from asymptomatic and non vaccinated dogs. Samples from eleven domestic dogs with no signs of canine distemper and not vaccinated at the month of collection were used. Canine distemper virus vaccine samples in VERO cells were used as positive controls. RNA was isolated with Trizol®, and treated with a TURBO DNA-free kit. Primers were designed for canine distemper virus nucleocapsid protein coding region fragment amplification (84 bp. Canine b-actin (93 bp was utilized as the endogenous control for normalization. Quantitative results of real time PCR generated by ABI Prism 7000 SDS Software showed that 54.5% of dogs with asymptomatic canine distemper were positive for canine distemper virus. Dissociation curves confirmed the specificity of the real time PCR fragments. This technique could detect even a few copies of viral RNA and identificate subclinically infected dogs providing accurate diagnosis of this disease at an early stage.A reação em cadeia da polimerase (PCR em tempo real revelou a presença do vírus da cinomose canina em amostra de sangue de cães assintomáticos e não vacinados. Amostra de onze cães domésticos sem nenhum sinal clínico de cinomose e que não foram vacinados no mês da coleta de sangue foram utilizados para análise. Amostra vacinal do vírus da cinomose canina em células VERO foi utilizada como controle positivo. O RNA total foi isolado utilizando-se Trizol®, e tratadas com o Kit TURBO DNA-free. Os iniciadores foram desenhados para amplificar a região do nucleocapsídeo viral com 319pb e 84pb para a PCR convencional e PCR em tempo real, respectivamente. O fragmento alvo da b-actina canina com 93pb foi utilizado como controle endógeno e normalizador. Resultados quantitativos da PCR em tempo real gerados pelo programa ABI Prism 7000 SDS demonstraram que 54,5% dos cães assintom
International Nuclear Information System (INIS)
Robbins, M.E.C.; Hopewell, J.W.; Golding, S.J.
1986-01-01
Radiation-induced damage to one kidney in the pig causes a fall in total renal function; this would be recognised and lead to a compensatory response in the unirradiated kidney. The presence of the unirradiated contralateral kidney may effectively prevent the irradiated kidney from expressing any potential for repair and/or recovery of function. If this were true then the question would obviously arise, does the irradiated kidney retain some capacity for recovery? In order to answer this question, the contralateral unirradiated kidney was removed from pigs 26 weeks after the irradiation of the other kidney. The subsequent response of the irradiated kidney to nephrectomy was assessed in terms of the changes in renal size and haemodynamics, i.e. GFR and effective renal plasma flow (ERPF). (Auth.)
... UTI removing any kidney stones Curing an Existing Urinary Tract Infection To treat a UTI , the health care provider ... UTIs and kidney stones. Medications to Prevent Future Urinary Tract Infections and Kidney Stones Health care providers may prescribe ...
Experimental study of pulmonary thromboembolism ischemia-reperfusion injury in canine model
International Nuclear Information System (INIS)
Li Jianjun; Zhai Renyou; Zhang Dongpo; Huang Qiang; Yu Ping; Dai Dingke; Bao Na
2009-01-01
Objective: To establish a canine model of pulmonary thromboembolism ischemia- reperfusion injury (PTE IRI) that may be used for imaging study. Methods: Ten male and 10 female healthy mongrel canines with (18.6±0.8) kg/body weight, were used. A Swan-Ganz catheter was introduced into the right internal jugular vein via a preset percutaneous sheath using the Seldinger technique, and then was with further insertion the pulmonary artery. Balloon occlusion of the right inferior lobe pulmonary artery for 4 hours was followed by removing the catheter and ending with 4 hours of reperfusion. CT was performed before ischemia, 4 h after ischemia and 4 h after reperfusion. At last, dogs were killed and the bilateral inferior lung tissues were prepared for the examination by light and electronic microscopy. Results: All canine models were successfully developed pulmonary thromboembolism ischemia-reperfusion injury. The examination of CT, light and electron microscopy consistently indicated the presence of permeability pulmonary edema after reperfusion. Conclusions: A closed-chest canine model in vivo of pulmonary thromboembolism ischemia-reperfusion injury can be established with virtual pathophysiological process in human and be as well as for imaging experimental study. (authors)
A survey of canine tick-borne diseases in India
Directory of Open Access Journals (Sweden)
Coleman Glen T
2011-07-01
Full Text Available Abstract Background There are few published reports on canine Babesia, Ehrlichia, Anaplasma, Hepatozoon and haemotropic Mycoplasma infections in India and most describe clinical disease in individual dogs, diagnosed by morphological observation of the microorganisms in stained blood smears. This study investigated the occurrence and distribution of canine tick-borne disease (TBD pathogens using a combination of conventional and molecular diagnostic techniques in four cities in India. Results On microscopy examination, only Hepatozoon gamonts were observed in twelve out of 525 (2.3%; 95% CI: 1.2, 4 blood smears. Using polymerase chain reaction (PCR, a total of 261 from 525 dogs (49.7%; 95% CI: 45.4, 54.1 in this study were infected with one or more canine tick-borne pathogen. Hepatozoon canis (30%; 95% CI: 26.0, 34.0 was the most common TBD pathogen found infecting dogs in India followed by Ehrlichia canis (20.6%; 95% CI: 17.2, 24.3, Mycoplasma haemocanis (12.2%; 95% CI: 9.5, 15.3, Anaplasma platys (6.5%; 95% CI: 4.5, 8.9, Babesia vogeli (5.5%, 95% CI: 3.7, 7.8 and Babesia gibsoni (0.2%, 95% CI: 0.01, 1.06. Concurrent infection with more than one TBD pathogen occurred in 39% of cases. Potential tick vectors, Rhipicephalus (most commonly and/or Haemaphysalis ticks were found on 278 (53% of dogs examined. Conclusions At least 6 species of canine tick-borne pathogens are present in India. Hepatozoon canis was the most common pathogen and ticks belonging to the genus Rhipicephalus were encountered most frequently. Polymerase chain reaction was more sensitive in detecting circulating pathogens compared with peripheral blood smear examination. As co-infections with canine TBD pathogens were common, Indian veterinary practitioners should be cognisant that the discovery of one such pathogen raises the potential for multiple infections which may warrant different clinical management strategies.
Directory of Open Access Journals (Sweden)
Denisova Т.Р.
2015-03-01
Full Text Available The given work summarizes external data and self-obtained results on development and diagnostic of kidney involution modifications. Article discusses definition of "senile kidney" as a clinical and pathomorphological term. Major statements on pathophysiological causes of age-associated renal disorders and their prognosis, specifics of chronic kidney disease in elderly and senile patients have been reviewed. Phenomenon of renal "multimorbidity" in eldely maximizes worsening risk of unmodifiable kidney function.
New hominin fossils from Kanapoi, Kenya, and the mosaic evolution of canine teeth in early hominins
Directory of Open Access Journals (Sweden)
J. Michael Plavcan
2012-03-01
Full Text Available Whilst reduced size, altered shape and diminished sexual dimorphism of the canine–premolar complex are diagnostic features of the hominin clade, little is known about the rate and timing of changes in canine size and shape in early hominins. The earliest Australopithecus, Australopithecus anamensis, had canine crowns similar in size to those of its descendant Australopithecus afarensis, but a single large root alveolus has suggested that this species may have had larger and more dimorphic canines than previously recognised. Here we present three new associated dentitions attributed to A. anamensis, recently recovered from the type site of Kanapoi, Kenya, that provide evidence of canine evolution in early Australopithecus. These fossils include the largest mandibular canine root in the hominin fossil record. We demonstrate that, although canine crown height did not differ between these species, A. anamensis had larger and more dimorphic roots, more like those of extant great apes and Ardipithecus ramidus, than those of A. afarensis. The canine and premolar occlusal shapes of A. anamensis also resemble those of Ar. ramidus, and are intermediary between extant great apes and A. afarensis. A. afarensis achieved Homo-like maxillary crown basal proportions without a reduction in crown height. Thus, canine crown size and dimorphism remained stable during the early evolution of Australopithecus, but mandibular root dimensions changed only later within the A. anamensis–afarensis lineage, coincident with morphological changes in the canine–premolar complex. These observations suggest that selection on canine tooth crown height, shape and root dimensions was not coupled in early hominin evolution, and was not part of an integrated adaptive package.
... Staying Safe Videos for Educators Search English Español Kidney Stones KidsHealth / For Parents / Kidney Stones What's in ... other treatments to help remove the stones. How Kidney Stones Form It's the kidneys' job to remove ...
Molecular characterization of the canine HMGB1.
Murua Escobar, H; Meyer, B; Richter, A; Becker, K; Flohr, A M; Bullerdiek, J; Nolte, I
2003-01-01
Due to the close similarities of numerous canine diseases to their human counterparts, the dog could join the mouse as the species of choice to unravel the genetic background of complex diseases as e.g. cancer and metabolic diseases. Accordingly, the role of the dog as a model for therapeutic approaches is strongly increasing. However, prerequisite for such studies is the characterization of the corresponding canine genes. Recently, the human high mobility group protein B1 (HMGB1) has attracted considerable interest of oncologists because of what is called its "double life". Besides its function as an architectural transcription factor HMGB1 can also be secreted by certain cells and then acts as a ligand for the receptor for advanced glycation end products (RAGE). The binding of HMGB1 to RAGE can activate key cell signaling pathways, such as p38(MAPK), JNK, and p42/p44(MAPK) emphasizing the important role of HMGB1 in inflammation and tumor metastasis. These results make HMGB1 a very interesting target for therapeutic studies done in model organisms like the dog. In this study we characterized the molecular structure of the canine HMGB1 gene on genomic and cDNA levels, its predicted protein, the gene locus and a basic expression pattern. Copyright 2003 S. Karger AG, Basel
Milovancev, Milan; Hilgart-Martiszus, Ian; McNamara, Michael J; Goodall, Cheri P; Seguin, Bernard; Bracha, Shay; Wickramasekara, Samanthi I
2013-06-13
Osteosarcoma (OSA) is the most common primary bone tumor of dogs and carries a poor prognosis despite aggressive treatment. An improved understanding of the biology of OSA is critically needed to allow for development of novel diagnostic, prognostic, and therapeutic tools. The surface-exposed proteome (SEP) of a cancerous cell includes a multifarious array of proteins critical to cellular processes such as proliferation, migration, adhesion, and inter-cellular communication. The specific aim of this study was to define a SEP profile of two validated canine OSA cell lines and a normal canine osteoblast cell line utilizing a biotinylation/streptavidin system to selectively label, purify, and identify surface-exposed proteins by mass spectrometry (MS) analysis. Additionally, we sought to validate a subset of our MS-based observations via quantitative real-time PCR, Western blot and semi-quantitative immunocytochemistry. Our hypothesis was that MS would detect differences in the SEP composition between the OSA and the normal osteoblast cells. Shotgun MS identified 133 putative surface proteins when output from all samples were combined, with good consistency between biological replicates. Eleven of the MS-detected proteins underwent analysis of gene expression by PCR, all of which were actively transcribed, but varied in expression level. Western blot of whole cell lysates from all three cell lines was effective for Thrombospondin-1, CYR61 and CD44, and indicated that all three proteins were present in each cell line. Semi-quantitative immunofluorescence indicated that CD44 was expressed at much higher levels on the surface of the OSA than the normal osteoblast cell lines. The results of the present study identified numerous differences, and similarities, in the SEP of canine OSA cell lines and normal canine osteoblasts. The PCR, Western blot, and immunocytochemistry results, for the subset of proteins evaluated, were generally supportive of the mass spectrometry data
You have two kidneys, each about the size of your fist. Their main job is to filter your blood. They remove wastes and ... help control blood pressure, and make hormones. Chronic kidney disease (CKD) means that your kidneys are damaged ...
... Videos for Educators Search English Español Kidneys and Urinary Tract KidsHealth / For Teens / Kidneys and Urinary Tract What's ... a sign of diabetes . What the Kidneys and Urinary Tract Do Although the two kidneys work together to ...
Wen, Jiexia; Pan, Sumin; Liang, Shuang; Zhong, Zhenyu; He, Ying; Lin, Hongyu; Li, Wenyan; Wang, Liyue; Li, Xiujin; Zhong, Fei
2013-01-01
Canine parvovirus (CPV) disease is an acute, highly infectious disease threatening the dog-raising industry. So far there are no effective therapeutic strategies to control this disease. Although the canine transferrin receptor (TfR) was identified as a receptor for CPV infection, whether extracellular domain of TfR (called soluble TfR (sTfR)) possesses anti-CPV activities remains elusive. Here, we used the recombinant sTfR prepared from HEK293T cells with codon-optimized gene structure to investigate its anti-CPV activity both in vitro and in vivo. Our results indicated that codon optimization could significantly improve sTfR expression in HEK293T cells. The prepared recombinant sTfR possessed a binding activity to both CPV and CPV VP2 capsid proteins and significantly inhibited CPV infection of cultured feline F81 cells and decreased the mortality of CPV-infected dogs, which indicates that the sTfR has the anti-CPV activity both in vitro and in vivo. PMID:24089666
Directory of Open Access Journals (Sweden)
Jiexia Wen
2013-01-01
Full Text Available Canine parvovirus (CPV disease is an acute, highly infectious disease threatening the dog-raising industry. So far there are no effective therapeutic strategies to control this disease. Although the canine transferrin receptor (TfR was identified as a receptor for CPV infection, whether extracellular domain of TfR (called soluble TfR (sTfR possesses anti-CPV activities remains elusive. Here, we used the recombinant sTfR prepared from HEK293T cells with codon-optimized gene structure to investigate its anti-CPV activity both in vitro and in vivo. Our results indicated that codon optimization could significantly improve sTfR expression in HEK293T cells. The prepared recombinant sTfR possessed a binding activity to both CPV and CPV VP2 capsid proteins and significantly inhibited CPV infection of cultured feline F81 cells and decreased the mortality of CPV-infected dogs, which indicates that the sTfR has the anti-CPV activity both in vitro and in vivo.
3D enamel thickness in Neandertal and modern human permanent canines.
Buti, Laura; Le Cabec, Adeline; Panetta, Daniele; Tripodi, Maria; Salvadori, Piero A; Hublin, Jean-Jacques; Feeney, Robin N M; Benazzi, Stefano
2017-12-01
Enamel thickness figures prominently in studies of human evolution, particularly for taxonomy, phylogeny, and paleodietary reconstruction. Attention has focused on molar teeth, through the use of advanced imaging technologies and novel protocols. Despite the important results achieved thus far, further work is needed to investigate all tooth classes. We apply a recent approach developed for anterior teeth to investigate the 3D enamel thickness of Neandertal and modern human (MH) canines. In terms of crown size, the values obtained for both upper and lower unworn/slightly worn canines are significantly greater in Neandertals than in Upper Paleolithic and recent MH. The 3D relative enamel thickness (RET) is significantly lower in Neandertals than in MH. Moreover, differences in 3D RET values between the two groups appear to decrease in worn canines beginning from wear stage 3, suggesting that both the pattern and the stage of wear may have important effects on the 3D RET value. Nevertheless, the 3D average enamel thickness (AET) does not differ between the two groups. In both groups, 3D AET and 3D RET indices are greater in upper canines than in lower canines, and overall the enamel is thicker on the occlusal half of the labial aspect of the crown, particularly in MH. By contrast, the few early modern humans investigated show the highest volumes of enamel while for all other components of 3D enamel, thickness this group holds an intermediate position between Neandertals and recent MH. Overall, our study supports the general findings that Neandertals have relatively thinner enamel than MH (as also observed in molars), indicating that unworn/slightly worn canines can be successfully used to discriminate between the two groups. Further studies, however, are needed to understand whether these differences are functionally related or are the result of pleiotropic or genetic drift effects. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.
Benetka, V; Leschnik, M; Affenzeller, N; Möstl, K
2011-04-09
Austrian field cases of canine distemper (14 dogs, one badger [Meles meles] and one stone marten [Martes foina]) from 2002 to 2007 were investigated and the case histories were summarised briefly. Phylogenetic analysis of fusion (F) and haemagglutinin (H) gene sequences revealed different canine distemper virus (CDV) lineages circulating in Austria. The majority of CDV strains detected from 2002 to 2004 were well embedded in the European lineage. One Austrian canine sample detected in 2003, with a high similarity to Hungarian sequences from 2005 to 2006, could be assigned to the Arctic group (phocine distemper virus type 2-like). The two canine sequences from 2007 formed a clearly distinct group flanked by sequences detected previously in China and the USA on an intermediate position between the European wildlife and the Asia-1 cluster. The Austrian wildlife strains (2006 and 2007) could be assigned to the European wildlife group and were most closely related to, yet clearly different from, the 2007 canine samples. To elucidate the epidemiological role of Austrian wildlife in the transmission of the disease to dogs and vice versa, H protein residues related to receptor and host specificity (residues 530 and 549) were analysed. All samples showed the amino acids expected for their host of origin, with the exception of a canine sequence from 2007, which had an intermediate position between wildlife and canine viral strains. In the period investigated, canine strains circulating in Austria could be assigned to four different lineages reflecting both a high diversity and probably different origins of virus introduction to Austria in different years.
Gebhard, Christiane; Fuchs-Baumgartinger, Andrea; Razzazi-Fazeli, Ebrahim; Miller, Ingrid; Walter, Ingrid
2016-01-01
Overexpression of matrix metalloproteinases (MMPs) has been associated with increased tumor aggressiveness and metastasis dissemination. We investigated whether the contrasting metastatic behavior of feline and canine osteosarcoma is related to levels and activities of MMP2 and MMP9. Zymography and immunohistochemistry were used to determine expression levels of MMP2 and MMP9 in canine and feline osteosarcoma. Using immunohistochemistry, increased MMP9 levels were identified in most canine os...
Directory of Open Access Journals (Sweden)
I Nyoman Suartha
2008-03-01
Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.
DETECTION OF CANINE PARVOVIRUS ANTIGEN IN DOGS IN KUMASI, GHANA.
Folitse, R D; Kodie, D O; Amemor, E; Dei, D; Tasiame, W; Burimuah, V; Emikpe, B O
2018-01-01
Canine Parvovirus (CPV) in dogs has been documented in many countries. However, evidence of the infection is scanty in Ghana. This study was conducted to detect canine parvovirus antigen in dogs presented with diarrhoea to the Government Veterinary Clinic in Kumasi, Ghana. Faecal samples from 72 dogs presented with diarrhoea were tested for the presence of canine parvovirus antigen using commercially available rapid test kit (BIT ® Rapid Colour Canine Parvovirus Ag Test Kit, BIOINDIST Co. Ltd, Korea) based on the principle of immunochromatography. Influence of breed, sex, age, vaccination history and the nature of diarrhoea were assessed. Data obtained was analysed with SPSS and subjected to the chi-square test. Significance was at α 0.05 . We found 61.11% tested positive (44/72) for CPV. Based on sex, 61.54% of males (20/33) and 60.61% of females tested positive (24/39). A total of 65.67% of samples from puppies below 6 months were positive. 56.25% of CPV vaccinated dogs and 70.83% of unvaccinated dogs were positive respectively. 69.05% of samples from haemorrhagic diarrhoeic dogs and 50.00% from non-haemorrhagic diarrhoeic dogs were positive of CPV. The study is the first documented evidence of the existence of CPV in Ghana. It also revealed that absence of bloody diarrhoea does not necessarily rule out CPV infection.
DETECTION OF CANINE PARVOVIRUS ANTIGEN IN DOGS IN KUMASI, GHANA
Folitse, R. D; Kodie, D.O; Amemor, E.; Dei, D.; Tasiame, W.; Burimuah, V.; Emikpe, B.O
2018-01-01
Background: Canine Parvovirus (CPV) in dogs has been documented in many countries. However, evidence of the infection is scanty in Ghana. This study was conducted to detect canine parvovirus antigen in dogs presented with diarrhoea to the Government Veterinary Clinic in Kumasi, Ghana. Materials and Methods: Faecal samples from 72 dogs presented with diarrhoea were tested for the presence of canine parvovirus antigen using commercially available rapid test kit (BIT® Rapid Colour Canine Parvovirus Ag Test Kit, BIOINDIST Co. Ltd, Korea) based on the principle of immunochromatography. Influence of breed, sex, age, vaccination history and the nature of diarrhoea were assessed. Data obtained was analysed with SPSS and subjected to the chi-square test. Significance was at α0.05 Results: We found 61.11% tested positive (44/72) for CPV. Based on sex, 61.54% of males (20/33) and 60.61% of females tested positive (24/39). A total of 65.67% of samples from puppies below 6 months were positive. 56.25% of CPV vaccinated dogs and 70.83% of unvaccinated dogs were positive respectively. 69.05% of samples from haemorrhagic diarrhoeic dogs and 50.00% from non-haemorrhagic diarrhoeic dogs were positive of CPV. Conclusion: The study is the first documented evidence of the existence of CPV in Ghana. It also revealed that absence of bloody diarrhoea does not necessarily rule out CPV infection. PMID:29302647
DEFF Research Database (Denmark)
Lindskov Hansen, Kristoffer; Nielsen, Michael Bachmann; Ewertsen, Caroline
2016-01-01
Ultrasonography of the kidneys is essential in the diagnosis and management of kidney-related diseases. The kidneys are easily examined, and most pathological changes in the kidneys are distinguishable with ultrasound. In this pictorial review, the most common findings in renal ultrasound...
Canine Detection of Illict Drugs: Sensory Apparatus Technology
National Research Council Canada - National Science Library
Morrison, Edward
2000-01-01
This report describes basic anatomical and physiological observations of the peripheral canine olfactory system, provided by means of investigations into its structural and molecular characteristics...
Coryneform bacteria associated with canine otitis externa
DEFF Research Database (Denmark)
Aalbæk, Bent; Bemis, David A.; Schjærff, Mette
2010-01-01
This study aims to investigate the occurrence of coryneform bacteria in canine otitis externa. A combined case series and case-control study was carried out to improve the current knowledge on frequency and clinical significance of coryneform bacteria in samples from canine otitis externa. A total...... of 16 cases of otitis externa with involvement of coryneform bacteria were recorded at two referral veterinary hospitals in Denmark and the US, respectively. Coryneform bacteria were identified by partial 16S rRNA gene sequencing. Corynebacterium auriscanis was the most common coryneform species (10...... cases). Small colony variants of this species were also observed. Other coryneform isolates were identified as Corynebacterium amycolatum (3 cases), Corynebacterium freneyi (2 cases) and an Arcanobacterium-like species (1 case). The coryneform bacteria were in all cases isolated together with other...
Antigenic typing Polish isolates of canine parvovirus
Energy Technology Data Exchange (ETDEWEB)
Mizak, B. [National Veterinary Research Institute, Pulawy (Poland); Plucienniczak, A. [Polish Academy ofd Sciences. Microbiology and Virology Center, Lodz (Poland)
1995-12-31
Polish strains of canine parvovirus isolated between 1982 and 1993 were examined to determine the extent to which the virus has evolved antigenically and genetically over eleven years. Two CPV isolates obtained in Warsaw in 1982 and Pulawy in 1993, were examined using monoclonal antibody typing, restriction analysis and sequencing VP-2 protein gene. Five other isolates from Warsaw and Pulawy were tested with the panel of monoclonal antibodies specific to CPV-2, CPV-2a and common for canine parvovirus, feline panleukopenia virus and milk enteritis virus. Results of the studies demonstrated that all isolates tested represented CPV-2a antigenic type. Rapid antigenic strain replacement recorded by Parrish and Senda in the U.S.A and Japan was not confirmed in Poland. (author). 30 refs, 2 tabs.
Antigenic typing Polish isolates of canine parvovirus
International Nuclear Information System (INIS)
Mizak, B.; Plucienniczak, A.
1995-01-01
Polish strains of canine parvovirus isolated between 1982 and 1993 were examined to determine the extent to which the virus has evolved antigenically and genetically over eleven years. Two CPV isolates obtained in Warsaw in 1982 and Pulawy in 1993, were examined using monoclonal antibody typing, restriction analysis and sequencing VP-2 protein gene. Five other isolates from Warsaw and Pulawy were tested with the panel of monoclonal antibodies specific to CPV-2, CPV-2a and common for canine parvovirus, feline panleukopenia virus and milk enteritis virus. Results of the studies demonstrated that all isolates tested represented CPV-2a antigenic type. Rapid antigenic strain replacement recorded by Parrish and Senda in the U.S.A and Japan was not confirmed in Poland. (author). 30 refs, 2 tabs
Szarmach, I J; Szarmach, J; Waszkiel, D; Paniczko, A
2006-01-01
The aim of the study was to assess the effect of orthodontic movement of the impacted canines after surgical exposure and alignment on the periodontal status of the transpositioned and adjacent teeth as well as to compare certain parameters with those of spontaneously erupted teeth. Twenty-four patients (mean age 18.4 +/- 3.66) with unilaterally impacted 24 canines were enrolled in the study. The following parameters were assessed: pocket depth (PD), clinical attachment level (CAL), platelet index (PI) of Silness and Löe, and modified sulcus bleeding index (SBI). Optic density of the alveolar bone along the root surface of the aligned canine was analysed based on digital radiological images made with the right angle technique. Control group consisted of spontaneously erupted teeth. In comparison to the control group, in the orthodonticaly treated group PD was found to increase on the mesial buccal and palatal surfaces of the first premolar (p aligned canine (p aligned tooth were statistically significant (p alignment zone and the control, and there was no link between the method of treatment and periodontal status, either. The alignment of the impacted permanent maxillary canines poses a risk of periodontal deterioration. Patients subjected to surgical-orthodontic treatment require periodic periodontal follow-ups.
Directory of Open Access Journals (Sweden)
D S Kothavade
2012-01-01
Full Text Available Aim : The purpose of the present study was to establish the relationship between the eruption of permanent maxillary canines and cervical vertebral maturation stages (CVMs to assess an alternative method for determining time of canine eruption in the late mixed dentition. Materials and Methods : One hundred and twenty subjects with erupting permanent maxillary canines were observed both intraorally and radiographically with orthopantamograms. Lateral cephalograms were recorded to divide subjects according to CVM stage into prepeak (CS1 and CS2, peak (CS3 and CS4 and postpeak (CS5 and CS6 groups of puberty. Statistical Analysis : The differences between the prevalence rates of canine eruption in different groups of puberty were estimated using ′z test′. Results : Prepeak group comprised of forty six subjects, peak group sixty eight subjects and postpeak group six subjects. The differences in prevalence rates between peak and prepeak and between peak and postpeak groups were noticed highly significant (p<0.001, while prevalence rates between peak and postpeak was found less significant ( p0 <0.01. Conclusion : Eruption of the permanent maxillary canine can occur at any CVM stage till end of the puberty or after puberty (CS1-CS6. Thus, an absence of maxillary canine during or after postpeak stage of puberty (CS5 or CS6 suggests delayed eruption and canine impaction.
Cathepsin K expression and activity in canine osteosarcoma.
Schmit, J M; Pondenis, H C; Barger, A M; Borst, L B; Garrett, L D; Wypij, J M; Neumann, Z L; Fan, T M
2012-01-01
Cathepsin K (CatK) is a lysosomal protease with collagenolytic activity, and its secretion by osteoclasts is responsible for degrading organic bone matrix. People with pathologic bone resorption have higher circulating CatK concentrations. Canine osteosarcoma (OS) cells will possess CatK, and its secretion will be cytokine inducible. Circulating CatK concentrations will be increased in dogs with OS, and will be a surrogate marker of bone resorption. Fifty-one dogs with appendicular OS and 18 age- and weight-matched healthy control dogs. In a prospective study, expressions of CatK mRNA and protein were investigated in OS cells. The inducible secretion and proteolytic activity of CatK from OS cells was assessed in vitro. Serum CatK concentrations were quantified in normal dogs and dogs with OS and its utility as a bone resorption marker was evaluated in dogs with OS treated with palliative radiation and antiresorptive agents. Canine OS cells contain preformed CatK within cytoplasmic vesicles. In OS cells, TGFβ1 induced the secretion of CatK, which degraded bone-derived type I collagen in vitro. CatK concentrations were higher in dogs with OS than healthy dogs (11.3 ± 5.2 pmol/L versus 8.1 ± 5.0 pmol/L, P = .03). In a subset of dogs with OS, pretreatment CatK concentrations gradually decreased after palliative radiation and antiresorptive treatment, from 9.3 ± 3.2 pmol/L to 5.0 ± 3.1 pmol/L, P = .03. Canine OS is associated with pathologic bone resorption, and CatK inhibitors might aid in the management of canine OS-related malignant osteolysis. Copyright © 2011 by the American College of Veterinary Internal Medicine.
Revisiting double kidney transplantation: two kidneys provide better graft survival than one.
Cruzado, J M; Fernandez, L; Riera, L; Bestard, O; Carrera, M; Torras, J; Gil Vernet, S; Melilli, E; Ngango, L; Grinyó, J M
2011-01-01
Double kidney transplantation is an accepted strategy to increase the donor pool. Regarding older donor kidneys, protocols for deciding to perform a dual or a single transplantation are mainly based on preimplantation biopsies. The aim of our study was to evaluate the long-term graft and patient survivals of our "Dual Kidney Transplant program." Patients who lost one of their grafts peritransplantation were used as controls. A total of 203 patients underwent kidney transplantation from December 1996 to January 2008 in our "old for old" renal transplantation program. We excluded 21 patients because of a nonfunctioning kidney, hyperacute rejection, or patient death with a functioning graft within the first month. Seventy-nine among 182 kidney transplantation the "old for old" program were dual kidney transplantation (DKT). Fifteen of 79 patients lost one of their kidney grafts (the uninephrectomized (UNX) UNX group). At 1 year, renal function was lower and proteinuria greater among the UNX than the DKT group. Patient survival was similar in both groups. However, death-censored graft survival was lower in UNX than DKT patients. The 5-year graft survival rate was 70% in UNX versus 93% in DKT cohorts (P = .04). In conclusion, taking into account the kidney shortage, our results may question whether the excellent transplant outcomes with DKT counter balance the reduced donor pool obviating acceptable transplant outcomes for more patients with single kidney transplantation. Copyright © 2011 Elsevier Inc. All rights reserved.
Epidemiology of canine gastrointestinal helminths in sub-Saharan Africa
Directory of Open Access Journals (Sweden)
Nozyechi Ngulube Chidumayo
2018-02-01
Full Text Available Abstract Background Dogs have a close association with humans providing companionship, security and a source of dietary protein. However, dogs are also potential carriers of zoonotic pathogens. Dogs, therefore, pose a public health risk and a good understanding of canine diseases is important for planning and implementing control measures. The aim of this study was to characterise canine helminthiasis in sub-Saharan Africa using a systematic approach. Methods Pubmed and Google Scholar were searched for relevant primary studies published from 2000. Forty-one eligible studies were included in the meta-analysis. Pooled prevalences were estimated using the quality effects model. Results and conclusions Twenty-six genera of enteric helminths were reported and the pooled estimate of canine helminthiasis was 71% (95% CI: 63–79%. Species of Ancylostoma and Toxocara, causative agents of larva migrans in humans, were the most frequently reported helminths with pooled estimated prevalences of 41% (95% CI: 32–50% and 22% (95% CI: 16–29%, respectively. Dipylidium caninum and Taenia spp. were the most frequently reported cestodes with pooled estimated prevalences of 20% (95% CI: 12–29% and 9% (95% CI: 5–15%, respectively. Trematodes were rarely reported. There was a high level of heterogeneity in most pooled estimates (I2 ˃ 80%. The results of this study show that canine helminthiasis is highly prevalent in sub-Saharan Africa and there is need for regular deworming programmes to improve the health status of the dogs and minimise the potential health risk to humans.
Kidneys at Higher Risk of Discard: Expanding the Role of Dual Kidney Transplantation
Tanriover, B.; Mohan, S.; Cohen, D. J.; Radhakrishnan, J.; Nickolas, T. L.; Stone, P. W.; Tsapepas, D. S.; Crew, R. J.; Dube, G. K.; Sandoval, P. R.; Samstein, B.; Dogan, E.; Gaston, R. S.; Tanriover, J. N.; Ratner, L. E.; Hardy, M. A.
2014-01-01
Half of the recovered expanded criteria donor (ECD) kidneys are discarded in the United States. A new kidney allocation system offers kidneys at higher risk of discard, Kidney Donor Profile Index (KDPI) >85%, to a wider geographic area to promote broader sharing and expedite utilization. Dual kidney transplantation (DKT) based on the KDPI is a potential option to streamline allocation of kidneys which otherwise would have been discarded. To assess the clinical utility of the KDPI in kidneys at higher risk of discard, we analyzed the OPTN/UNOS Registry that included the deceased donor kidneys recovered between 2002 and 2012. The primary outcomes were allograft survival, patient survival and discard rate based on different KDPI categories (90%). Kidneys with KDPI >90% were associated with increased odds of discard (OR = 1.99, 95% CI 1.74–2.29) compared to ones with KDPI 90% were associated with lower overall allograft failure (HR = 0.74, 95% CI 0.62–0.89) and better patient survival (HR = 0.79, 95% CI 0.64–0.98) compared to single ECD kidneys with KDPI >90%. Kidneys at higher risk of discard may be offered in the up-front allocation system as a DKT. Further modeling and simulation studies are required to determine a reasonable KDPI cutoff percentile. PMID:24472195
Canine trypanosomosis: Clinical observations and morphological ...
African Journals Online (AJOL)
Clinical and pathological aspects of canine trypanosomosis were determined in naturally infected dogs presented to the Veterinary Teaching Hospital, Federal University of Agriculture, Abeokuta, at different times between 2012 and 2013. The breeds, sexes, ages and body weights of the dogs were recorded. Clinical signs ...
The unerupted maxillary canine - a post-surgical review.
LENUS (Irish Health Repository)
O'Dowling, Ian
2009-10-01
The orthodontic records of 685 patients referred for surgical exposure of an unerupted impacted maxillary canine tooth were examined. The condition was more common among females than males, slightly less than 2:1. The impacted teeth had a palatal-labial ratio of 3:1. All of the teeth were exposed using the open surgical technique and in 98% of cases the tooth erupted and was orthodontically aligned. In 2% of cases ankylosis occurred and the teeth were subsequently extracted. The presence of peg-shaped lateral incisors associated with the impacted maxillary canine tooth was 3.4% of the total number of impacted teeth and congenital absence was found in 1.7% of impacted teeth.
The unerupted maxillary canine--a post-surgical review.
O'Dowling, Ian
2009-01-01
The orthodontic records of 685 patients referred for surgical exposure of an unerupted impacted maxillary canine tooth were examined. The condition was more common among females than males, slightly less than 2:1. The impacted teeth had a palatal-labial ratio of 3:1. All of the teeth were exposed using the open surgical technique and in 98% of cases the tooth erupted and was orthodontically aligned. In 2% of cases ankylosis occurred and the teeth were subsequently extracted. The presence of peg-shaped lateral incisors associated with the impacted maxillary canine tooth was 3.4% of the total number of impacted teeth and congenital absence was found in 1.7% of impacted teeth.
Canine distemper spillover in domestic dogs from urban wildlife.
Kapil, Sanjay; Yeary, Teresa J
2011-11-01
Canine distemper virus (CDV) causes a major disease of domestic dogs that develops as a serious systemic infection in unvaccinated or improperly vaccinated dogs. Domesticated dogs are the main reservoir of CDV, a multihost pathogen. This virus of the genus Morbillivirus in the family Paramyxoviridae occurs in other carnivorous species including all members of the Canidae and Mustelidae families and in some members of the Procyonidae, Hyaenidae, Ursidae, and Viverridae families. Canine distemper also has been reported in the Felidae family and marine mammals. The spread and incidences of CDV epidemics in dogs and wildlife here and worldwide are increasing.
Relation between agenesis and shape anomaly of maxillary lateral incisors and canine impaction
Directory of Open Access Journals (Sweden)
Anísio Bueno de Carvalho
2012-12-01
Full Text Available OBJECTIVE: The purpose was to obtain information about the relation between agenesis and shape anomaly of maxillary lateral incisors and canine impaction. METHODS: Seventy-three patients with canine impaction and 73 control patients, without canine impaction, were evaluated. The mesiodistal distances of the maxillary lateral incisors adjacent to the impacted canines and the correspondent mandibular lateral incisors were measured. The adjacent lateral incisors were classified in: 1 - absent, 2 - small, 3 - peg-shaped, 4 - standard. RESULTS: The results showed that among the patients with impacted canines, there were 21 anomalous teeth (small and peg-shaped and among the control patients there were only three small and peg-shaped teeth, with a statistically significant difference (p = 0.001. No patients were found with impacted canines and absent lateral incisors. CONCLUSION: It was concluded that in patients with anomalous lateral incisors (small and peg-shaped there is a probability to present impacted canines and this must be considered.OBJETIVO: o objetivo foi obter informação sobre a relação existente entre a agenesia e/ou anomalia de forma de incisivos laterais superiores e impacção de caninos. MÉTODOS: foram avaliados 73 pacientes com impacção de caninos e 73 pacientes controle, sem impacção de caninos. Foram medidas as distâncias mesiodistais dos incisivos laterais superiores adjacentes aos caninos impactados e os incisivos laterais correspondentes inferiores. Os incisivos laterais adjacentes foram classificados em: 1 - ausentes; 2 - pequenos; 3 - conoides; 4 - normais. RESULTADOS: os resultados mostraram que no grupo de pacientes com caninos impactados foram encontrados 22 dentes anômalos (pequenos e conoides, e no grupo controle apenas três dentes pequenos e conoides, sendo uma diferença estatisticamente significativa (p=0,001. Não foram encontrados pacientes com canino impactado e incisivo lateral ausente. CONCLUS
Vulnerability of cultured canine lung tumor cells to NK cell-mediated cytolysis
International Nuclear Information System (INIS)
Haley, P.J.; Kohr, J.M.; Kelly, G.; Muggenburg, B.A.; Guilmette, B.A.
1988-01-01
Five cell lines, designated as canine lung epithelial cell (CLEP), derived from radiation induced canine lung tumors and canine thyroid adeno-carcinoma (CTAC) cells were compared for their susceptibility to NK cell-mediated cytolysis using peripheral blood lymphocytes from normal, healthy Beagle dogs as effector cells. Effector cells and chromium 51 radiolabeled target cells were incubated for 16 h at ratios of 12.5:1, 25:1, 50:1, and 100:1. Increasing cytolysis was observed for all cell lines as the effector-to-target-cell ratios increased from 12.5:1 to 100:1. The percent cytotoxicity was significantly less for all lung tumor cell lines as compared to CTAC at the 100:1 ratio. One lung tumor cell line, CLEP-9, had 85% of the lytic vulnerability of the CTAC cell line and significantly greater susceptibility to NK cell-mediated lysis than all of the other lung tumor cell lines. Susceptibility to NK cell cytolysis did not correlate with in vivo malignant behavior of the original tumor. These data suggest that cultured canine lung tumor cells are susceptible to NK cell cytolytic activity in vitro and that at least one of these cell lines (CLEP-9) is a candidate for substitution of the standard canine NK cell target, CTAC, in NK cell assays. The use of lung tumor cells in NK cell assays may provide greater insight into the control of lung tumors by immune mechanisms. (author)
International Nuclear Information System (INIS)
Alif, Sheikh Mohammad; Haque, Sejuty; Nimmi, Naima; Ashraf, Ali; Khan, Saeed Hossain; Khan, Mahfujul Haq
2011-01-01
This study was performed to determine the prevalence of maxillary canine impaction on a basis of a single panoramic radiograph in Bangladeshi population. A random sample of seven hundred panoramic radiographs was collected from the patient record of a dental clinic. All the selected panoramic radiographs were taken from January 2009 to August 2010 by a single panoramic radiograph machine with the same exposure time (19 seconds) for all radiographs. One hundred and twenty panoramic radiographs were excluded to minimize the selection bias. In a dim lit room, an observer assessed the radiographs on a standard radiographic light box. The position of the impacted maxillary canine was recorded in line with the longitudinal axis of a tooth using the edge of a metal ruler. Data were subsequently put on SPSS 11.5 software and chi-square (x 2 ) tests were applied to find out the association. Among 580 panoramic radiographs it was found that impacted maxillary canines were present in only 7 (1.2%) radiographs. A statistical significant difference was found between the age of the patients and the vertical position of the impacted canines (p=0.000) and between the age of the patients and the horizontal position of the impacted canines (p=0.003). The prevalence was found to be low compared with the present study from the limitation of panoramic image. Further study needs to include three-dimensional imaging modality.
... kind of kidney cancer called Wilms' tumor. The incidence of kidney cancer seems to be increasing. One ... doesn't go away Loss of appetite Unexplained weight loss Tiredness Fever, which usually comes and goes ( ...
A comparative study between mixed-type tumours from human salivary and canine mammary glands
International Nuclear Information System (INIS)
Genelhu, Marisa CLS; Cardoso, Sérgio V; Gobbi, Helenice; Cassali, Geovanni D
2007-01-01
In comparative pathology, canine mammary tumours have special interest because of their similarities with human breast cancer. Mixed tumours are uncommon lesions in the human breast, but they are found most frequently in the mammary gland of the female dogs and in the human salivary glands. The aim of the study was to compare clinical, morphological and immunohistochemical features of human salivary and canine mammary gland mixed tumours, in order to evaluate the latter as an experimental model for salivary gland tumours. Ten examples of each mixed tumour type (human pleomorphic adenoma and carcinomas ex-pleomorphic adenomas and canine mixed tumour and metaplastic carcinoma) were evaluated. First, clinical and morphologic aspects of benign and malignant variants were compared between the species. Then, streptavidin-biotin-peroxidase immunohistochemistry was performed to detect the expression of cytokeratins, vimentin, p63 protein, estrogen receptor, β-catenin, and E-cadherin. After standardization, similar age and site distributions were observed in human and canine tumours. Histological similarities were identified in the comparison of the benign lesions as well. Metaplastic carcinomas also resembled general aspects of carcinomas ex-pleomorphic adenomas in morphological evaluation. Additionally, immunohistochemical staining further presented similar antigenic expression between lesions. There are many similar features between human salivary and canine mammary gland mixed tumours. This observation is of great relevance for those interested in the study and management of salivary gland tumours, since canine lesions may constitute useful comparative models for their investigations
Contribution of stone size to chronic kidney disease in kidney stone formers.
Ahmadi, Farrokhlagha; Etemadi, Samira Motedayen; Lessan-Pezeshki, Mahbob; Mahdavi-Mazdeh, Mitra; Ayati, Mohsen; Mir, Alireza; Yazdi, Hadi Rokni
2015-01-01
To determine whether stone burden correlates with the degree of chronic kidney disease in kidney stone formers. A total of 97 extracorporeal shockwave lithotripsy candidates aged 18 years and older were included. Size, number and location of the kidney stones, along with cumulative stone size, defined as the sum of diameters of all stones) were determined. Estimated glomerular filtration rate was determined using the Chronic Kidney Disease Epidemiology Collaboration cystatin C/creatinine equation, and chronic kidney disease was defined as estimated glomerular filtration rate chronic kidney disease. The relationship persisted even after adjustment for age, sex, body mass index, C-reactive protein, fasting plasma glucose, thyroid stimulating hormone, presence of microalbuminuria, history of renal calculi, history of extracorporeal shockwave lithotripsy, number and location of the stones (odds ratio 1.24, 95% confidence interval 1.02-1.52). The same was not observed for individuals with a cumulative stone size ≥ 20 mm. In kidney stone formers with a cumulative stone size up to 20 mm, estimated glomerular filtration rate linearly declines with increasing cumulative stone size. Additionally, cumulative stone size is an independent predictor of chronic kidney disease in this group of patients. © 2014 The Japanese Urological Association.
Ryan, V H; Trayhurn, P; Hunter, L; Morris, P J; German, A J
2011-10-01
The enzyme 11β-hydroxysteroid dehydrogenase 1 (11β-HSD-1) is expressed in a number of tissues in rodents and humans and is responsible for the reactivation of inert cortisone into cortisol. Its gene expression and activity are increased in white adipose tissue (WAT) from obese humans and may contribute to the adverse metabolic consequences of obesity and the metabolic syndrome. The extent to which 11β-HSD-1 contributes to adipose tissue function in dogs is unknown; the aim of the present study was to examine 11β-HSD-1 gene expression and its regulation by proinflammatory and anti-inflammatory agents in canine adipocytes. Real-time PCR was used to examine the expression of 11β-HSD-1 in canine adipose tissue and canine adipocytes differentiated in culture. The mRNA encoding 11β-HSD-1 was identified in all the major WAT depots in dogs and also in liver, kidney, and spleen. Quantification by real-time PCR showed that 11β-HSD-1 mRNA was least in perirenal and falciform depots and greatest in subcutaneous, omental, and gonadal depots. Greater expression was seen in the omental depot in female than in male dogs (P=0.05). Gene expression for 11β-HSD-1 was also seen in adipocytes, from both subcutaneous and visceral depots, differentiated in culture; expression was evident throughout differentiation but was generally greatest in preadipocytes and during early differentiation, declining as cells progressed to maturity. The inflammatory mediators lipopolysaccharide and tumor necrosis factor α had a main stimulatory effect on 11β-HSD-1 gene expression in canine subcutaneous adipocytes, but IL-6 had no significant effect. Treatment with dexamethasone resulted in a significant time- and dose-dependent increase in 11β-HSD-1 gene expression, with greatest effects seen at 24 h (2 nM: approximately 4-fold; 20 nM: approximately 14-fold; P=0.010 for both). When subcutaneous adipocytes were treated with the peroxisome proliferator activated receptor γ agonist rosiglitazone
Dettwiler, M; Croci, M; Vaughan, L; Guscetti, F
2013-09-01
The BH3-only protein Bad is a proapoptotic Bcl-2 family member that acts as a sensitizer in intrinsic apoptosis by inactivating antiapoptotic members through heterodimer formation. Bad has been shown to contribute to tumorigenesis, including lymphoma formation in humans and mice, through alteration in expression or functional status. Here, its immunohistochemical expression was analyzed in canine nonneoplastic and lymphoma tissues using tissue microarrays. Bad was expressed in the cytoplasm of a wide range of nonneoplastic tissues, especially epithelial cells. Nonneoplastic lymph nodes displayed weak immunostaining in the follicular germinal centers only. Immunoblotting supported these observations but also revealed presence of nonspecific labeling in some organs. Of 81 lymphomas, 29 (35.8%) displayed moderate to strong immunohistochemical Bad labeling, and a significant expression increase was found in lymphomas (especially B cell and double negative) compared to nonneoplastic lymph nodes. These findings warrant further investigations of the functional status, the involvement of partner proteins, and a possible impact of Bad on prognosis in canine lymphoma.
Shin, Y; Mori, T; Okita, M; Gemma, T; Kai, C; Mikami, T
1995-06-01
For a rapid diagnosis of canine distemper virus (CDV) infection, the reverse transcription-PCR (RT-PCR) was carried out to detect CDV nucleoprotein (NP) gene from canine peripheral blood mononuclear cells (PBMCs). Two sets of primers were targeted to two regions of NP gene of CDV Onderstepoort strain. The NP gene fragments were well amplified by the RT-PCR in each of the RNA extracts from Vero cells infected with 6 laboratory strains of CDV including Onderstepoort strain, and from PBMCs of a dog experimentally infected with CDV. The amplified NP gene was detected in 17 of 32 samples from dogs which were clinically suspected for CDV infection at veterinary hospitals. No RT-PCR product was found in 52 samples from healthy dogs including 40 specific pathogen free beagles vaccinated with an attenuated live virus-vaccine for CDV and 12 stray dogs. The RT-PCR provides a fast, sensitive, and supplementary method for the diagnosis of CDV infection in dogs.
Cytotoxic action of Brazilian propolis in vitro on canine osteosarcoma cells.
Cinegaglia, N C; Bersano, P R O; Búfalo, M C; Sforcin, J M
2013-09-01
Osteosarcoma (OSA) is a primary bone neoplasm frequently diagnosed in dogs. The biology of OSA in pet dogs is identical to that of pediatric patients, and it has been considered an excellent model in vivo to study human OSA. Since the individual response to chemotherapy is unpredictable and considering that propolis is a natural product with several biological properties, this work evaluated the cytotoxic action of propolis on canine OSA cells. The primary cell culture of canine OSA was obtained from the tumor of a dog with OSA. Cell viability was assessed after incubation with propolis, 70% ethanol (propolis solvent), and carboplatin after 6, 24, 48, and 72 h. Cell viability was analyzed by the crystal violet method. Data showed that canine OSA cells were sensitive to propolis in a dose- and time-dependent manner and had a distinct morphology compared to control. Its solvent (70% ethanol) had no effect on cell viability, suggesting that the cytotoxic action was exclusively due to propolis. Our propolis sample exerted a cytotoxic effect on canine OSA cells, and its introduction as a possible therapeutic agent in vivo could be investigated, providing a new contribution to OSA treatment. Copyright © 2012 John Wiley & Sons, Ltd.
Healthy kidneys clean your blood by removing excess fluid, minerals, and wastes. They also make hormones that keep your ... strong and your blood healthy. But if the kidneys are damaged, they don't work properly. Harmful ...
Prosser, C; Stelwagen, K; Cummins, R; Guerin, P; Gill, N; Milne, C
2004-02-01
Male Sprague-Dawley rats were assigned to one of three dietary groups [standard diet (Cont; n = 8), standard diet plus bovine colostrum powder (BColost 1.7 g/kg; n = 8), or goat milk powder (GMilk 1.7 g/kg; n = 8)] to determine the ability of these supplements to reduce gastrointestinal hyperpermeability induced by heat. Raising core body temperature of rats to 41.5 degrees C increased transfer of (51)Cr-EDTA from gut into blood 34-fold relative to the ambient temperature value (P transferred into the blood of rats in either the BColost (27% of Cont) or GMilk group (10% of Cont) after heating, showing that prior supplementation with either bovine colostrum or goat milk powder significantly reduced the impact of heat stress on gastrointestinal permeability. The changes in the BColost group were not significantly different than those of the GMilk group. The potential mechanism of the protective effect of bovine colostrum and goat milk powders may involve modulation of tight junction permeability, because both powders were able to maintain transepithelial resistance in Madin Darby canine kidney cells challenged with EGTA compared with cells maintained in media only. The results show that bovine colostrum powder can partially alleviate the effects of hyperthermia on gastrointestinal permeability in the intact animal. Moreover, goat milk powder was equally as effective as bovine colostrum powder, and both may be of benefit in other situations where gastrointestinal barrier function is compromised.
Khurana, Surender; Loving, Crystal L; Manischewitz, Jody; King, Lisa R; Gauger, Phillip C; Henningson, Jamie; Vincent, Amy L; Golding, Hana
2013-08-28
Vaccine-induced disease enhancement has been described in connection with several viral vaccines in animal models and in humans. We investigated a swine model to evaluate mismatched influenza vaccine-associated enhanced respiratory disease (VAERD) after pH1N1 infection. Vaccinating pigs with whole inactivated H1N2 (human-like) virus vaccine (WIV-H1N2) resulted in enhanced pneumonia and disease after pH1N1 infection. WIV-H1N2 immune sera contained high titers of cross-reactive anti-pH1N1 hemagglutinin (HA) antibodies that bound exclusively to the HA2 domain but not to the HA1 globular head. No hemagglutination inhibition titers against pH1N1 (challenge virus) were measured. Epitope mapping using phage display library identified the immunodominant epitope recognized by WIV-H1N2 immune sera as amino acids 32 to 77 of pH1N1-HA2 domain, close to the fusion peptide. These cross-reactive anti-HA2 antibodies enhanced pH1N1 infection of Madin-Darby canine kidney cells by promoting virus membrane fusion activity. The enhanced fusion activity correlated with lung pathology in pigs. This study suggests a role for fusion-enhancing anti-HA2 antibodies in VAERD, in the absence of receptor-blocking virus-neutralizing antibodies. These findings should be considered during the evaluation of universal influenza vaccines designed to elicit HA2 stem-targeting antibodies.
Matsui, Ryutaro; Hattori, Ryutaro; Usami, Youhei; Koyama, Masumi; Hirayama, Yuki; Matsuba, Emi; Hashimoto, Yukiya
2018-02-01
We have recently found an H + /quinidine (a lipophilic cation, QND) antiport system in Madin-Darby canine kidney (MDCK) cells. The primary aim of the present study was to evaluate whether the H + /lipophilic cation antiport system is expressed in porcine LLC-PK 1 cells. That is, we investigated uptake and/or efflux of QND and another cation, bisoprolol, in LLC-PK 1 cells. In addition, we studied the renal clearance of bisoprolol in rats. Uptake of QND into LLC-PK 1 cells was decreased by acidification of the extracellular pH or alkalization of the intracellular pH. Cellular uptake of QND from the apical side was much greater than from the basolateral side. In addition, apical efflux of QND from LLC-PK 1 cells was increased by acidification of the extracellular pH. Furthermore, lipophilic cationic drugs significantly reduced uptake of bisoprolol in LLC-PK 1 cells. Renal clearance of bisoprolol in rats was approximately 7-fold higher than that of creatinine, and was markedly decreased by alkalization of the urine pH. The present study suggests that the H + /lipophilic cation antiport system is expressed in the apical membrane of LLC-PK 1 cells. Moreover, the H + /lipophilic cation antiport system may be responsible for renal tubular secretion of bisoprolol in rats. Copyright © 2017 The Japanese Society for the Study of Xenobiotics. Published by Elsevier Ltd. All rights reserved.
The Palmitoylation State of PMP22 Modulates Epithelial Cell Morphology and Migration
Directory of Open Access Journals (Sweden)
Susie J. Zoltewicz
2012-11-01
Full Text Available PMP22 (peripheral myelin protein 22, also known as GAS 3 (growth-arrest-specific protein 3, is a disease-linked tetraspan glycoprotein of peripheral nerve myelin and constituent of intercellular junctions in epithelia. To date, our knowledge of the post-translational modification of PMP22 is limited. Using the CSS-Palm 2.0 software we predicted that C85 (cysteine 85, a highly conserved amino acid located between the second and third transmembrane domains, is a potential site for palmitoylation. To test this, we mutated C85S (C85 to serine and established stable cells lines expressing the WT (wild-type or the C85S-PMP22. In Schwann and MDCK (Madin–Darby canine kidney cells mutating C85 blocked the palmitoylation of PMP22, which we monitored using 17-ODYA (17-octadecynoic acid. While palmitoylation was not necessary for processing the newly synthesized PMP22 through the secretory pathway, overexpression of C85S-PMP22 led to pronounced cell spreading and uneven monolayer thinning. To further investigate the functional significance of palmitoylated PMP22, we evaluated MDCK cell migration in a wound-healing assay. While WT-PMP22 expressing cells were resistant to migration, C85S cells displayed lamellipodial protrusions and migrated at a similar rate to vector control. These findings indicate that palmitoylation of PMP22 at C85 is critical for the role of the protein in modulating epithelial cell shape and motility.
Hashimoto, Ayako; Ohkura, Katsuma; Takahashi, Masakazu; Kizu, Kumiko; Narita, Hiroshi; Enomoto, Shuichi; Miyamae, Yusaku; Masuda, Seiji; Nagao, Masaya; Irie, Kazuhiro; Ohigashi, Hajime; Andrews, Glen K; Kambe, Taiho
2015-12-01
Dietary zinc deficiency puts human health at risk, so we explored strategies for enhancing zinc absorption. In the small intestine, the zinc transporter ZIP4 functions as an essential component of zinc absorption. Overexpression of ZIP4 protein increases zinc uptake and thereby cellular zinc levels, suggesting that food components with the ability to increase ZIP4 could potentially enhance zinc absorption via the intestine. In the present study, we used mouse Hepa cells, which regulate mouse Zip4 (mZip4) in a manner indistinguishable from that in intestinal enterocytes, to screen for suitable food components that can increase the abundance of ZIP4. Using this ZIP4-targeting strategy, two such soybean extracts were identified that were specifically able to decrease mZip4 endocytosis in response to zinc. These soybean extracts also effectively increased the abundance of apically localized mZip4 in transfected polarized Caco2 and Madin-Darby canine kidney cells and, moreover, two apically localized mZip4 acrodermatitis enteropathica mutants. Soybean components were purified from one extract and soyasaponin Bb was identified as an active component that increased both mZip4 protein abundance and zinc levels in Hepa cells. Finally, we confirmed that soyasaponin Bb is capable of enhancing cell surface endogenous human ZIP4 in human cells. Our results suggest that ZIP4 targeting may represent a new strategy to improve zinc absorption in humans. © 2015 Authors; published by Portland Press Limited.
Energy Technology Data Exchange (ETDEWEB)
Kang, Hyereen; Lee, Minjae [Department of Biomedical Sciences, University of Ulsan College of Medicine, Seoul 138-736 (Korea, Republic of); Jang, Sung-Wuk, E-mail: swjang@amc.seoul.kr [Department of Biomedical Sciences, University of Ulsan College of Medicine, Seoul 138-736 (Korea, Republic of); Department of Biochemistry and Molecular Biology, University of Ulsan College of Medicine, Seoul 138-736 (Korea, Republic of)
2013-08-09
Highlights: •We investigated the effects of celastrol on TGF-β1-induced EMT in epithelial cells. •Celastrol regulates TGF-β1-induced morphological changes and E-cadherin expression. •Celastrol inhibits TGF-β1-induced Snail expression. •Celastrol strongly suppresses TGF-β1-induced invasion in MDCK and A549 cells. -- Abstract: The epithelial–mesenchymal transition (EMT) is a pivotal event in the invasive and metastatic potentials of cancer progression. Celastrol inhibits the proliferation of a variety of tumor cells including leukemia, glioma, prostate, and breast cancer; however, the possible role of celastrol in the EMT is unclear. We investigated the effect of celastrol on the EMT. Transforming growth factor-beta 1 (TGF-β1) induced EMT-like morphologic changes and upregulation of Snail expression. The downregulation of E-cadherin expression and upregulation of Snail in Madin–Darby Canine Kidney (MDCK) and A549 cell lines show that TGF-β1-mediated the EMT in epithelial cells; however, celastrol markedly inhibited TGF-β1-induced morphologic changes, Snail upregulation, and E-cadherin expression. Migration and invasion assays revealed that celastrol completely inhibited TGF-β1-mediated cellular migration in both cell lines. These findings indicate that celastrol downregulates Snail expression, thereby inhibiting TGF-β1-induced EMT in MDCK and A549 cells. Thus, our findings provide new evidence that celastrol suppresses lung cancer invasion and migration by inhibiting TGF-β1-induced EMT.
Antiviral Protein of Momordica charantia L. Inhibits Different Subtypes of Influenza A
Directory of Open Access Journals (Sweden)
Viroj Pongthanapisith
2013-01-01
Full Text Available The new antiviral activity of the protein extracted from Momordica charantia was determined with different subtypes of influenza A. The protein was purified from the seed of M. charantia using an anion exchanger and a Fast Protein Liquid Chromatography (FPLC system. At the concentration of 1.401 mg/mL, the protein did not exhibit cytotoxicity in Madin-Darby canine kidney cells (MDCK but inhibited FFU influenza A/PR/8/34 H1N1 virus at 56.50%, 65.72%, and 100% inhibition by the protein treated before the virus (pretreated, the protein treated alongside with the virus (simultaneously treated, and the protein treated after the virus (posttreated during incubation, respectively. Using 5, 25, and 100 TCID50 of influenza A/New Caledonia/20/99 H1N1, A/Fujian/411/01 H3N2 and A/Thailand/1(KAN-1/2004 H5N1, the IC50 was calculated to be 100, 150, and 200; 75, 175, and 300; and 40, 75, and 200 μg/mL, respectively. Our present finding indicated that the plant protein inhibited not only H1N1 and H3N2 but also H5N1 subtype. As a result of the broad spectrum of its antiviral activity, this edible plant can be developed as an effective therapeutic agent against various and even new emerging subtypes of influenza A.
Luo, Jun; Shi, Hehe; Tan, Yeping; Niu, Xuefeng; Long, Teng; Zhao, Jing; Tian, Qin; Wang, Yifei; Chen, Hao; Guo, Xiaofeng
2016-08-17
Both rabies virus (RABV) and canine parvovirus (CPV) cause lethal diseases in dogs. In this study, both high egg passage Flury (HEP-Flury) strains of RABV and recombinant RABV carrying double RABV glycoprotein (G) gene were used to express the CPV virion protein 2 (VP2) gene, and were designated rHEP-VP2 and, rHEP-dG-VP2 respectively. The two recombinant RABVs maintained optimal virus titration according to their viral growth kinetics assay compared with the parental strain HEP-Flury. Western blotting indicated that G protein and VP2 were expressed in vitro. The expression of VP2 in Crandell feline kidney cells post-infection by rHEP-VP2 and rHEP-dG-VP2 was confirmed by indirect immunofluorescence assay with antibody against VP2. Immunogenicity of recombinant rabies viruses was tested in Kunming mice. Both rHEP-VP2 and rHEP-dG-VP2 induced high levels of rabies antibody compared with HEP-Flury. Mice immunized with rHEP-VP2 and rHEP-dG-VP2 both had a high level of antibodies against VP2, which can protect against CPV infection. A challenge experiment indicated that more than 80% mice immunized with recombinant RABVs survived after infection of challenge virus standard 24 (CVS-24). Together, this study showed that recombinant RABVs expressing VP2 induced protective immune responses to RABV and CPV. Therefore, rHEP-VP2 and rHEP-dG-VP2 might be potential combined vaccines for RABV and CPV. Copyright © 2016 Elsevier Ltd. All rights reserved.
The Kidney-Vascular-Bone Axis in the Chronic Kidney Disease-Mineral Bone Disorder.
Seifert, Michael E; Hruska, Keith A
2016-03-01
The last 25 years have been characterized by dramatic improvements in short-term patient and allograft survival after kidney transplantation. Long-term patient and allograft survival remains limited by cardiovascular disease and chronic allograft injury, among other factors. Cardiovascular disease remains a significant contributor to mortality in native chronic kidney disease as well as cardiovascular mortality in chronic kidney disease more than doubles that of the general population. The chronic kidney disease (CKD)-mineral bone disorder (MBD) is a syndrome recently coined to embody the biochemical, skeletal, and cardiovascular pathophysiology that results from disrupting the complex systems biology between the kidney, skeleton, and cardiovascular system in native and transplant kidney disease. The CKD-MBD is a unique kidney disease-specific syndrome containing novel cardiovascular risk factors, with an impact reaching far beyond traditional notions of renal osteodystrophy and hyperparathyroidism. This overview reviews current knowledge of the pathophysiology of the CKD-MBD, including emerging concepts surrounding the importance of circulating pathogenic factors released from the injured kidney that directly cause cardiovascular disease in native and transplant chronic kidney disease, with potential application to mechanisms of chronic allograft injury and vasculopathy.
Mechanical properties of canine osteosarcoma-affected antebrachia.
Steffey, Michele A; Garcia, Tanya C; Daniel, Leticia; Zwingenberger, Allison L; Stover, Susan M
2017-05-01
To determine the influence of neoplasia on the biomechanical properties of canine antebrachia. Ex vivo biomechanical study. Osteosarcoma (OSA)-affected canine antebrachia (n = 12) and unaffected canine antebrachia (n = 9). Antebrachia were compressed in axial loading until failure. A load-deformation curve was used to acquire the structural mechanical properties of neoplastic and unaffected specimens. Structural properties and properties normalized by body weight (BW) and radius length were compared using analysis of variance (ANOVA). Modes of failure were compared descriptively. Neoplastic antebrachia fractured at, or adjacent to, the OSA in the distal radial diaphysis. Unaffected antebrachia failed via mid-diaphyseal radial fractures with a transverse cranial component and an oblique caudal component. Structural mechanical properties were more variable in neoplastic antebrachia than unaffected antebrachia, which was partially attributable to differences in bone geometry related to dog size. When normalized by dog BW and radial length, strength, stiffness, and energy to yield and failure, were lower in neoplastic antebrachia than in unaffected antebrachia. OSA of the distal radial metaphysis in dogs presented for limb amputation markedly compromises the structural integrity of affected antebrachia. However, biomechanical properties of affected bones was sufficient for weight-bearing, as none of the neoplastic antebrachia fractured before amputation. The behavior of tumor invaded bone under cyclic loading warrants further investigations to evaluate the viability of in situ therapies for bone tumors in dogs. © 2017 The American College of Veterinary Surgeons.
Outbreak of canine visceral leishmaniasis in Barra Mansa, State of Rio de Janeiro
Directory of Open Access Journals (Sweden)
Cintia Xavier de Mello
2014-12-01
Full Text Available Introduction In Brazil, visceral leishmaniasis (VL has spread to various regions. This study reports canine cases of VL in Barra Mansa, where human VL cases were recently reported. Methods Using the human index case, a canine survey was performed by dual-path platform immunochromatography and enzyme-linked immunosorbent assay. Seropositive animals were euthanized. Cultures were collected to detect Leishmania parasites. Results Serological tests detected 141 canine VL cases, and Leishmania chagasi were isolated from 82.2% animals. Conclusions Leishmania chagasi is in circulation in Barra Mansa. This study broadens information on the parasite's distribution in the State of Rio de Janeiro.
Directory of Open Access Journals (Sweden)
Adina Coșarcă
2014-02-01
Full Text Available Aim: The aim of this study was to compare the periodontal status of impacted canines after 5 years following completion of the combined surgical and orthodontic treatment. Materials and methods: We examined 20 labially impacted canines and 20 palatally impacted canines at 5 years after the end of treatment. We assessed the periodontal status of these teeth. Results: Different outcomes were found regarding the probing depth and the amount of keratinized gingiva in the two mentioned groups of teeth. Conclusions: The assessed periodontal indices may signal the appearance of a periodontal disease around the teeth that were surgically and orthodontically treated
Canine Distemper Viral Inclusions in Blood Cells of Four Vaccinated Dogs
McLaughlin, Bruce G.; Adams, Pamela S.; Cornell, William D.; Elkins, A. Darrel
1985-01-01
Four cases of canine distemper were detected by the presence of numerous cytoplasmic inclusions in various circulating blood cells. Fluorescent antibody techniques and electron microscopy confirmed the identity of the viral inclusions. The cases occurred in the same geographic area and within a short time span. All four dogs had been vaccinated against canine distemper, but stress or other factors may have compromised their immune status. The possibility of an unusually virulent virus strain ...