The Darwin Core extension for genebanks opens up new opportunities for sharing genebank datasets
Directory of Open Access Journals (Sweden)
Dag Terje Filip Endresen
2012-07-01
Full Text Available Darwin Core (DwC defines a standard set of terms to describe the primary biodiversity data. Primary biodiversity data are data records derived from direct observation of species occurrences in nature or describing specimens in biological collections. The Darwin Core terms can be seen as an extension to the standard Dublin Core metadata terms. The new Darwin Core extension for genebanks declares the additional terms required for describing genebank datasets, and is based on established standards from the plant genetic resources community. The Global Biodiversity Information Facility (GBIF provides an information infrastructure for biodiversity data including a suite of software tools for data publishing, distributed data access, and the capture of biodiversity data. The Darwin Core extension for genebanks is a key component that provides access for the genebanks and the plant genetic resources community to the GBIF informatics infrastructure including the new toolkits for data exchange. This paper provides one of the first examples and guidelines for how to create extensions to the Darwin Core standard.
Directory of Open Access Journals (Sweden)
Flávia Barbosa Silva Botelho
2015-04-01
Full Text Available World’s ornamental plant market, including domestic market of several countries and its exports, is currently evaluated in 107 billion dollars yearly. Such estimate highlights the importance of the sector in the economy of the countries, as well as its important social role, as it represents one of the main activities, which contributes to income and employment. Therefore a well-structured plant breeding program, which is connected with consumers’ demands, is required in order to fulfill these market needs globally. Activities related to pre-breeding, conventional breeding, and breeding by biotechnological techniques constitute the basis for the successful development of new ornamental plant cultivars. Techniques that involve tissue culture, protoplast fusion and genetic engineering greatly aid conventional breeding (germplasm introduction, plant selection and hybridization, aiming the obtention of superior genotypes. Therefore it makes evident, in the literature, the successful employment of genetic breeding, since it aims to develop plants with commercial value that are also competitive with the ones available in the market.
INFORMATION SYSTEM SALES OF INDOOR AND OUTDOOR ORNAMENTAL PLANTS-BASED ONLINE
Directory of Open Access Journals (Sweden)
Sutedi Sutedi
2017-05-01
Full Text Available Ornamental plants have fairly high commercial value and much sought after by various circles. The prospect is in the business of ornamental plants can be said very brilliant and profitable. Where is in the business of ornamental plants can bring about advantages not the least. The business struggled with ornamental plants can have very favorable prospects for the long term. There are an awful lot of various kinds of ornamental plants that we can choose to use as ornaments to beautify residential home. The ornamental plants can be used as indoor ornamental plants placed in homes or can also be used as outdoor ornamental plants grown in the garden. Ornamental plants while more popular community-wide information system for ornamental plant however is currently designed specifically and not many people who know the information on price and specs or type of indoor and outdoor ornamental plants so that the need for sales information system of indoor and outdoor ornamental plants-based online. With the sales information system of Indoor and Outdoor ornamental plants-based online is expected to facilitate the customers, business processes that occur in the company's units, unit – units that exist within the system a functioning production units as the unit working on/produce ornamental plants. With the utilization of the system marketing media, promoting, finding new customers, the sales process, recapitulation payment of ornamental plants, control the conditions of stock products, development and delivery of products to customers including convincing the product gets to the customer
Vegetatively propagated plant collections within genebanks are vulnerable to threats when they are maintained in field or greenhouse conditions. International genebanking standards recommend that these collections be securely backed-up at either secondary locations or by using in vitro culture or cr...
Planning product quality: An example - ornamental plants
Directory of Open Access Journals (Sweden)
Kovačević Miodrag
2003-01-01
Full Text Available The industry of ornamental plants is a subject of quality planning. The quality plan is a document setting out the specific quality practices in ornamental plants production. That plan introduce organizational structure procedures, processes and resources needed to implement quality in life cycle of product chain. For engineers it represents a new tool.
Many of the world's national genebanks, responsible for the safeguarding and availability of their country's Plant Genetic Resource (PGR) collections, have lacked access to high quality IT needed to document and manage their collections electronically. The Germplasm Resource Information System (GRI...
The mission of the GRIN-Global Project is to create a new, scalable version of the Germplasm Resource Information System (GRIN) to provide the world’s crop genebanks with a powerful, flexible, easy-to-use plant genetic resource (PGR) information management system. The system will help safeguard PGR ...
Biotechnological improvement of ornamental plants
Flavia Soledad Darqui; Laura Mabel Radonic; Horacio Esteban Hopp; Marisa Lopez Bilbao
2017-01-01
The discovery of commercial transgenic varieties of orange petunias sold in Europe and the United States although they had never reached the approved status, and the consequent recommendation to destroy them, was the trigger to discuss about biotechnological improvement of ornamental plants. Inside the restricted world of 26 vegetal transgenic species, according to the ISAAA’s reports (http://www.isaaa.org), there are three ornamental species: carnation, rose and the Beijing University develo...
Major diseases of ornamental plants and their management
International Nuclear Information System (INIS)
Akhtar, M.A.; Zakria, M.; Sohail, F.
2003-01-01
Major diseases of ornamental plants are caused by infections agents (biotic) or non-infectious (abiotic) agents. Infectious agents are bacteria, fungi, nematodes and virus. Non infectious agents are nutritional imbalances, environmental stresses and chemical toxicities. Grouping of the diseases has been done on symptomatology basis. Disease management in ornamental plants has been described through cultural practices, chemical and other control strategies. (author)
Biotechnological improvement of ornamental plants
Directory of Open Access Journals (Sweden)
Flavia Soledad Darqui
2017-10-01
Full Text Available The discovery of commercial transgenic varieties of orange petunias sold in Europe and the United States although they had never reached the approved status, and the consequent recommendation to destroy them, was the trigger to discuss about biotechnological improvement of ornamental plants. Inside the restricted world of 26 vegetal transgenic species, according to the ISAAA’s reports (http://www.isaaa.org, there are three ornamental species: carnation, rose and the Beijing University developed petunia; all of them with the same trait, a change in their colour. On the other hand, in 2014, the whole-genome sequence of carnation appeared which was the first and until now the only one among ornamental species. In this context, we review the publications from the last five years in petunia, rose, chrysanthemum and carnation. In these papers there are detailed descriptions of modification of the cascade of genes and transcription factors involved in stress situations, in different developmental stages and their regulation through different plant hormones. This knowledge will allow breeding for better and new varieties with changes in their abiotic or biotic stress tolerance, altered growth or yield and modified product quality as colour or fragrance.
Chronic gamma irradiation of ornamental and landscaping plants at gamma greenhouse
International Nuclear Information System (INIS)
Shuhaimi Shamsudin; Zaiton Ahmad; Affrida Abu Hassan
2011-01-01
Activities on chronic gamma irradiation of ornamental and landscaping plants have started since April 2010. Among plants which have been irradiated were landscaping plants such as hibiscus, canna, turnera, plumeria, amaryllis, and ornamental plants such as orchid, heliconia, cucurma and sanseviera, as well as vanilla. The main objectives at the initial stage were to develop database for optimum chronic irradiation dose and suitable experimental design for each species. The ultimate aim is to obtain new varieties of ornamental plants with flower and horticultural traits of commercial values and landscaping plants suitable for Malaysian landscape such as large and colourful flower, longer bloom period and frequent flowering. This paper discusses irradiation activities for ornamental plants in Gamma Greenhouse including preparation of samples, growing medium and screening plots, selection/determination of optimum dose and dose rate, collection of data and selection of mutants. (author)
The Attractivity of Ornamental Plants to Some Natural Enemies of Pest
Directory of Open Access Journals (Sweden)
Fatima Ramdan Muhamed Al Kawan
2018-01-01
Full Text Available There are several roles of ornamental plants to environment management and human being. One of them is to attract some natural enemies of pest which more ecofriendly and specific target. Related with this role, the objectives of this study are to inventory kind of ornamental plants in the play ground, to inventory kind of ornamental plants which attract natural enemies, and to know the foreign students perception to the function of the ornamental plant species for attracting the natural enemies. This study was conducted using Visual Encounter Survey (VES method with three repetitions. The result showed that there were 5 ornamental plants in the area study as Acalypha siamensis, Osmoxylon lineare, Canna indica, Crinum asiaticum L. and Oleina syzigium. Data analysis using Community structure of Arthropods, Index of Diversity, and Index of Similarity on different area. The result Based on the average of species abundance, O. lineare is the most visited plant by animals. It was showed from range of average of species abundance which reached from 0.17 to 13.72 individu. The second one was A. siamensis which had average of species abundance 0.14 - 13.14 individu. The next plant which visited by many animals are C. indica and C. asiaticum L. The average of species abundance respectively varied from 0.43 to 12.00 individu and from 0.14 to 8.72 individu. Oleina syzigium became the least one, because the average of species abundance reached from 0.14 to 3.14 individu. Overall, the level of respondents (foreign students knowledge about the function of ornamental plants for attracting natural enemies was categorized into high Key words: Attractivity, Natural enemies, Ornamental plants
Velesanova, Ivana; Trajkova, Fidanka; Koleva Gudeva, Liljana
2018-01-01
Planting material of ornamental plants is in great demand for commercial production as well as for domestic gardens and landscaping. Good quality planting material is a basic need of growers for improving productivity. The most recent data show that 700 million plants worldwide are produced in vitro. USA, India, Israel, Colombia, Ecuador and Brazil are leading countries in production of ornamental plants via in vitro propagation. Ornamental industry has applied immensely in vitro propagation ...
Phytostabilization potential of ornamental plants grown in soil contaminated with cadmium.
Zeng, Peng; Guo, Zhaohui; Cao, Xia; Xiao, Xiyuan; Liu, Yanan; Shi, Lei
2018-03-21
In a greenhouse experiment, five ornamental plants, Osmanthus fragrans (OF), Ligustrum vicaryi L. (LV), Cinnamomum camphora (CC), Loropetalum chinense var. rubrum (LC), and Euonymus japonicas cv. Aureo-mar (EJ), were studied for the ability to phytostabilization for Cd-contaminated soil. The results showed that these five ornamental plants can grow normally when the soil Cd content is less than 24.6 mg·kg -1 . Cd was mainly deposited in the roots of OF, LV, LC and EJ which have grown in Cd-contaminated soils, and the maximum Cd contents reached 15.76, 19.09, 20.59 and 32.91 mg·kg -1 , respectively. For CC, Cd was mainly distributed in the shoots and the maximum Cd content in stems and leaves were 12.5 and 10.71 mg·kg -1 , however, the total amount of Cd in stems and leaves was similar with the other ornamental plants. The enzymatic activities in Cd-contaminated soil were benefited from the five tested ornamental plants remediation. Soil urease and sucrase activities were improved, while dehydrogenase activity was depressed. Meanwhile, the soil microbial community was slightly influenced when soil Cd content is less than 24.6 mg·kg -1 under five ornamental plants remediation. The results further suggested that ornamental plants could be promising candidates for phytostabilization of Cd-contaminated soil.
Repeat Buying Behavior for Ornamental Plants: A Consumer Profile
Palma, Marco A.; Collart, Alba J.; Hall, Charles R.
2010-01-01
This paper used an electronic survey conducted in Texas to study the main factors affecting the frequency of purchase, measured in transactions per month, for ornamental plants. While we found several differences in demographic characteristics of respondents, the two major factors impacting the frequency of buying for ornamental plants were the purpose of the purchase (self use vs. gifts) and seasonality. Respondents with a college degree in the older age groups, and higher income levels had ...
The progress of mutation breeding for ornamental plants in China
International Nuclear Information System (INIS)
Jin Shouming
1994-02-01
In China, research on mutation breeding of ornamental plants was begun in the late 70's. In the past decade, about 40 plant species were tested, and hundreds of useful mutants were obtained. At least 63 mutant varieties have been produced, approved and released for cultivation in rose, chrysanthemum, canna, dahlia, bougainvillea and lotus. A rapid progress in methodology and technology of induced mutation breeding has been achieved, particularly in the selection of starting material, determination of suitable exposure and irradiation dose, expression and isolation of somatic mutation etc. In the future it is necessary to develop more plant species and mutation varieties to improve the mutation breeding method and to raise the economic benefit. Along with the development of China's economy and improvement of people's living standard more and more new varieties of ornamental plants will be required. In view of the good beginning, rich germplasm resource and favorable conditions, the prospect of mutation breeding for ornamental plants in China is very encouraging
Botanical seed technology at the US Potato Genebank
Studies on botanical seed technology have potential payoffs for genebank in-house operations as well as promoting efficient use of the germplasm by cooperators. When we tested the effects of soil fertilization, mother plants with extra fertilizer produced more fruit and seeds, but those extra seeds ...
Mutation induction as a tool for varietal development in ornamental plants
International Nuclear Information System (INIS)
Mohd Nazir Basiran
2000-01-01
Although the current advancement in biotechnology has tremendously change the modern breeding approach, the induced mutation techniques is still very much in use as complementary tools. MINT experiences in using the techniques for varietal development in ornamental plants has helped to increase genetic variabilities in several ornamental plant species, produced twelve new mutant cultivars as well as developed efficient tissue culture system for six ornamental plant species as tool for in vitro mutagenesis procedures and micropropagation. The technology and expertise that have been established are ready for transfer to the horticulture industry. Sharing of capability and capacity between research institutions and private sector is one possible way by improving and maintaining long-term sustenance of the floriculture industry. (author)
Potential pest transfer mediated by international ornamental plant trade.
Patoka, Jiří; Bláha, Martin; Kalous, Lukáš; Vrabec, Vladimír; Buřič, Miloš; Kouba, Antonín
2016-05-25
In recent years, the keeping of ornamental freshwater animals and plants in garden ponds has been growing in popularity. Water hyacinth (Eichhornia crassipes) is one of the preferred macrophytes seasonally imported mainly from South-eastern Asia throughout the world. This constitutes a secondary introduction inasmuch as the species is native to South America. Although many assemblages of aquatic invertebrates have been described as associated with this plant in the wild, there has been no research focused on their potential introduction via the international plant trade. We examined 216 specimens of water hyacinths imported for ornamental purposes from Indonesia into the Czech Republic. Numerous meio- and macroinvertebrates belonging to at least 39 species were captured. On the total number of individuals, the highest prevalence was of Tubulinea and Rotifera. Most of these were still alive and vital, including a caterpillar of the Indo-Australian invasive moth Spodoptera litura. Water hyacinths are usually placed into outdoor ponds immediately after import, which facilitates the release of non-target alien species. The present paper aims to draw attention to "hitchhikers" associated with the ornamental trade.
Conser, Christiana; Seebacher, Lizbeth; Fujino, David W.; Reichard, Sarah; DiTomaso, Joseph M.
2015-01-01
Weed Risk Assessment (WRA) methods for evaluating invasiveness in plants have evolved rapidly in the last two decades. Many WRA tools exist, but none were specifically designed to screen ornamental plants prior to being released into the environment. To be accepted as a tool to evaluate ornamental plants for the nursery industry, it is critical that a WRA tool accurately predicts non-invasiveness without falsely categorizing them as invasive. We developed a new Plant Risk Evaluation (PRE) too...
DEFF Research Database (Denmark)
Lütken, Henrik Vlk; Hegelund, Josefine Nymark; Himmelboe, Martin
2015-01-01
Compactness is a desirable trait in ornamental plant breeding because it is preferred by producers, distributors and consumers. Presently, in ornamental plant production growth of many potted plants is regulated by application of chemical growth retardants, several of which are harmful to both...... (rol)-genes rolA, rolB, rolC and rolD among 18 ORFs, into the plant genome. Infection of plants by A. rhizogenes induces hairy roots, from which shoots containing rol-genes can be regenerated. Natural transformation with A. rhizogenes reveals very promising results in several plant species and can...... be useful in a broader range of application than ornamental breeding. One important aspect of this technology is that the hairy roots can be used directly in the selection proceß as a primary indicator of a succeßful transformation. Thus the technology avoids use of undesired antibiotic resistance marker...
Seed conservation in ex situ genebanks - genetic studies on longevity in barley
Nagel, M.; Vogel, H.; Landjeva, S.; Buck-Sorlin, G.H.; Lohwasser, U.; Scholz, U.; Börner, A.
2009-01-01
Recognizing the danger due to a permanent risk of loss of the genetic variability of cultivated plants and their wild relatives in response to changing environmental conditions and cultural practices, plant ex situ genebank collections were created since the beginning of the last century. World-wide
Brazilian consumption of flowers and ornamental plants: habits, practices and trends
Directory of Open Access Journals (Sweden)
Antonio Helio Junqueira
2017-06-01
Full Text Available The Brazilian consumption of flowers and ornamental plants reproduces the main typical conditions of developing countries, which it shares with other nations of Latin America, Asia and Africa. These include low per capita consumption rates, the centralization of purchases in a few traditional items, and the concentration of demand on dates and special occasions of the national calendar of celebrations. However, in recent decades, strong growth rates have been observed for this sector, signaling a potent and promising market for producers, wholesalers, retailers, floral designers, landscapists and other professionals working in the floral segment. This article analyzes original quantitative research data applied throughout Brazil, from 2014 to 2016, by the market intelligence firm Hórtica Consultoria and by the Union of the Retail Trade of Flowers and Ornamental Plants of the State of São Paulo (Sindiflores, revealing preferences, habits, practices and tendencies for the consumption of flowers and ornamental plants in Brazil.
Interspecific Hybridization within Ornamental Plants
DEFF Research Database (Denmark)
Kuligowska, Katarzyna
commercially important genera of ornamental plants: Kalanchoë and Hibiscus. The nature of hybridization barriers hampering hybrid production was investigated during pre- and post-fertilization stages. For each genus the interspecific crosses of Kalanchoë species and Hibiscus species, abnormal germination...... and growth of pollen tubes, as well as lower frequencies of pollen tubes were observed in specific cross-combinations. Post-fertilization barriers related to endosperm development and hybrid incompatibility were also observed in Kalanchoë and Hibiscus genus, respectively. Qualitative and quantitative...
Toxic ornamental plants in Venezuela
Directory of Open Access Journals (Sweden)
Carlos Varela Romero
2017-01-01
Full Text Available The aim of this research was to contribute information on toxic ornamental plants in Venezuela. Information on taxonomy, common names, habit, origin, status, location, propagation and toxicology (part of the plant, effects was compiled from articles, books, catalogs, herbarium collections. A botanical analysis (taxonomy, common names, habit, origin, status, location, propagation and toxicology (part of the plant, effects was performed. The information about plant poisoning cases was requested to SIMET (Pharmacy faculty -UCV. Seventy-eight species were found in 34 families, the most important were: Apocynaceae (10 genera/12 species, Araceae (9/9, Euphorbiaceae (4/10 and Solanaceae (5/6. Genus Euphorbia was the most species rich. Most species were exotic species (79.5% and shrubs (32.1%. The entire plant (35 and latex (19 were the most toxic parts and the most frequent accidental ingestion (61.5%. Twenty cases were reported between 2009-2013, of which 80% were minors, female and urban areas. There is very little information published in Hispanic American countries
Genebanks: a comparison of eight proposed international genetic databases.
Austin, Melissa A; Harding, Sarah; McElroy, Courtney
2003-01-01
To identify and compare population-based genetic databases, or "genebanks", that have been proposed in eight international locations between 1998 and 2002. A genebank can be defined as a stored collection of genetic samples in the form of blood or tissue, that can be linked with medical and genealogical or lifestyle information from a specific population, gathered using a process of generalized consent. Genebanks were identified by searching Medline and internet search engines with key words such as "genetic database" and "biobank" and by reviewing literature on previously identified databases such as the deCode project. Collection of genebank characteristics was by an electronic and literature search, augmented by correspondence with informed individuals. The proposed genebanks are located in Iceland, the United Kingdom, Estonia, Latvia, Sweden, Singapore, the Kingdom of Tonga, and Quebec, Canada. Comparisons of the genebanks were based on the following criteria: genebank location and description of purpose, role of government, commercial involvement, consent and confidentiality procedures, opposition to the genebank, and current progress. All of the groups proposing the genebanks plan to search for susceptibility genes for complex diseases while attempting to improve public health and medical care in the region and, in some cases, stimulating the local economy through expansion of the biotechnology sector. While all of the identified plans share these purposes, they differ in many aspects, including funding, subject participation, and organization. The balance of government and commercial involvement in the development of each project varies. Genetic samples and health information will be collected from participants and coded in all of the genebanks, but consent procedures range from presumed consent of the entire eligible population to recruitment of volunteers with informed consent. Issues regarding confidentiality and consent have resulted in opposition to
Towards development of new ornamental plants
DEFF Research Database (Denmark)
Kuligowska, Katarzyna; Lütken, Henrik Vlk; Müller, Renate
2016-01-01
is one of the oldest breeding techniques that contributed enormously to the development of modern plant cultivars. Within ornamental breeding, it represents the main source of genetic variation. During the long history of wide hybridization, a number of methods were implemented allowing the evolution...... from a conventional breeding tool into a modern methodology. Nowadays, the research on model plants and crop species increases our understanding of reproductive isolation among distant species and partly explains the background of the traditional approaches previously used for overcoming hybridization...... barriers. Characterization of parental plants and hybrids is performed using molecular and cytological techniques that strongly facilitate breeding processes. Molecular markers and sequencing technologies are used for the assessment of genetic relationships among plants, as the genetic distance...
In vitro micro-propagation of endangered ornamental plant ...
African Journals Online (AJOL)
The ornamental plant, Neotchihatchewia isatidea, is an endangered species of Turkey and threatened by complete extinction in the future. Therefore, in vitro multiplication of this species can be valuable for commercial production and germplasm conservation. Immature embryos of N. isatidea were cultured for initiation on ...
Thin Cell Layer technology in ornamental plant micropropagation ...
African Journals Online (AJOL)
Thin cell layer (TCL) technology originated almost 30 years ago with the controlled development of flowers, roots, shoots and somatic embryos on tobacco pedicel longitudinal TCLs. Since then TCLs have been successfully used in the micropropagation of many ornamental plant species whose previous in vitro ...
Directory of Open Access Journals (Sweden)
Maic A.L. Sihombing
2015-02-01
Full Text Available Home garden is a habitat for many plants species which are important in planning and management of tourism in rural area. Ornamental plants have crucial function to increase the appearance of homes and buildings through landscaping. The purpose of this study is to analyze ornamental plants species which grow in the home garden along the corridor of Kopendukuh Village as one of the potential attractions of tourism development. The observation of ornamental plants diversity was carried out at home gardens along the rural coridor of Kopendukuh Village. Totally, there are about 10 home gardens were assessed. In each home gardens, plans species were recorded and identified systematically. Qualitative analysis was performed using analysis of sociability, vitality, and periodicity. Result of the survey confirm that home garden is home of about 40 ornamental plants species. These species came from 24 family. About 59% of the ornamental species was classified as individual plant species live in small groups, 28% of ornamental plant was classified as shrubs. About 65% of are ornamental plant without flowers and seeds. The diversity of plants in home garden needs special attention, especially in order to increase settlement visual quality. Keywords: Kopendukuh, ornamental plant, sociability, vitality, periodicity.
New and improved ornamental plants for a world of environmental stresses
Energy Technology Data Exchange (ETDEWEB)
Seibert, R J
1970-01-01
Ornamental plants serve several useful functions, among them beautification of the environment and oxygen production. The strengths and advantages of a large number of plant species and varieties are discussed. Resistance to pollution damage, when known, is discussed.
Establishment and Operation of Crop Genebank in Shandong Province
Institute of Scientific and Technical Information of China (English)
Dong WANG; Yingjie LIN; Xiaodong ZHANG; Runfang LI; Shihua LIU; Cun'e WANG; Lingyun LU; Nana LI; Hanfeng DING; Xiaomu WANG; Xiaohong GU
2017-01-01
Shandong Province has abundant and diverse crop germplasm resources, but it is in lack of unified and effective preservation and management, leading to the decline and even extinction of many rare germplasm resources. In this study, the necessity for the establishment of crop genebank in Shandong Province was briefly described. In addition, the type, functions and technical indicators, as well as the operation of the crop genebank were introduced comprehensively to provide a reference for the establishment of genebank by other units or organizations.
Advancement of mutation breeding on ornamental plants in Indonesia
International Nuclear Information System (INIS)
Handayati, W.
2013-01-01
Along with the increasing demand of ornamental plants in Indonesia and the change of consumers preference, Indonesian breeders have released 102 varieties in the last 5 year. However, the resulted varieties were not enough to substitute the imported varieties. A breeding method for a new variety was carried out through induced mutation. Many researches have been conducted in Indonesia, but these activities have not been comprehensively designed to create the potential genotypes that ready to be released as new superior varieties. Commonly, these activities were still in the stage of basic researches about the type and the most effective dose or lethal dose (LD 50 ), the sensitivity of both the plants cultured in-vitro and in-vivo to mutagen; and genetic or phenotypic diversity due to the mutagen treatments. Chrysanthemum and rose were the most of the ornamental plants that had been conducted. Some mutants have been released as new national superior varieties namely Julikara, Rosanda and Rosmarun (mini rose); Rosma (cut rose) and Mustika Kania (chrysanthemum). (author)
Evaluation of mistletoes ( Tapinanthus sp ) on the ornamental plants ...
African Journals Online (AJOL)
Samples of the ornamental plants and trees were collected during the survey in 2001 and were identified in Ahmadu Bello University, Zaria herbarium. The severity and incidence of the parasite were determined by differential host test and the number of infected stands, were expressed in percentage of total stands sampled ...
Qualls, Whitney A; Xue, Rui De; Beier, John C; Müller, Günter C
2013-06-01
The international trade of lucky bamboo (Dracaena sanderiana [Asparagaceae]) is responsible for certain introductions of the exotic species Aedes albopictus (Skuse) in California and the Netherlands. Understanding the association of this species with lucky bamboo and other ornamental plants is important from a public health standpoint. The aim of this study was to investigate the importance of indoor ornamental plants as sugar sources for adult A. albopictus. If exposed to D. sanderiana, bromeliad (Guzmania spp. hybrid [Bromeliaceae]), Moses-in-the-cradle (Rhoeo spathacea [Commelinaceae]), 10 % sucrose solution, and a negative water control as the only nutrient source, adult female A. albopictus mean survival time was 12, 7, 6, 15, and 4 days, respectively. Mean survival times for adult males were not significantly different (P > 0.05) from the females and were 10, 7, 6, 14, and 3 days, respectively. Combined male and female survival times were not significantly different on lucky bamboo compared to survival times on a 10 % sucrose control. Based on our findings, A. albopictus can readily survive long enough to complete a gonotrophic cycle and potentially complete the extrinsic incubation period for many arboviruses when only provided access to lucky bamboo plants or possibly other common ornamentals. Vector control professionals should be aware of potential in-home infestations and public health concerns associated with mosquito breeding and plant tissue feeding on ornamental plants.
The Inter-genebank Potato Database and the dimensions of available wild potato germplasm
Huamán, Z.; Hoekstra, R.; Bamberg, J.B.
2000-01-01
The Association of Potato Inter-genebank Collaborators (APIC) constructed a database of all wild potato holdings of the most important potato genebanks in Europe, the United States, Peru, and Argentina. The Inter-genebank Potato Database (IPD) now contains data of 11,819 wild potato accessions
7 CFR 1437.305 - Ornamental nursery.
2010-01-01
... 7 Agriculture 10 2010-01-01 2010-01-01 false Ornamental nursery. 1437.305 Section 1437.305... Determining Coverage Using Value § 1437.305 Ornamental nursery. (a) Eligible ornamental nursery stock is a... ornamental nursery stock is limited to field-grown and containerized decorative plants grown in a controlled...
ORNAMENTAL PLANTS OF CHECHNYA AND ITS ADJACENT AREAS
Directory of Open Access Journals (Sweden)
Musa A. Taysumov
2018-01-01
Full Text Available Abstract. The aim of the research is to summarize the scattered information about the types of decorative flora of the Chechen Republic and adjacent territories; to identify highly resistant ornamental plants for cities and settlements of the North Caucasus and other territories of Russia. Discussion. Currently, in a variety of botanical gardens of the North Caucasus grows a large number of decorative plant species, widely used in green construction. However, not all species posses the quality to sufficient resist unfavorable conditions of the changed abiotic and biotic environment. Among the studied, the most valuable and promising for widespread introduction are the species of more than 122 taxa, the decorative effect of which is preserved throughout the year with no signs of aging. Many examples of the targeted use of herbs, tree species, lianas, bulbous plants were cited in the research. We give a large list of Caucasian species for growing on lawns, flowerbeds, flower gardens, alpine and stony mountains, roadsides and parks, urban parks, squares and alleys as a type of gardening. Their decorative properties, vitality, durability, life form and other bio-ecological features, attitude to abiotic factors (soil conditions, illumination, temperature, soil and atmospheric humidification conditions, etc. were taken into account. Conclusion. We give a large list of ornamental species and various planting techniques of specific species are introduced in conditions of Chechnya and its adjacent territories as well as the methods of implementing in the landscaping practice in other (middle and northern regions of Russia.
Induction of somatic mutations in ornamental plants by ionizing radiations and chemical mutagens
International Nuclear Information System (INIS)
Desai, B.M.; Abraham, V.
1980-01-01
Improvement in some ornamental plants through induction of somatic mutations by ionizing radiations and chemical mutagens viz. colchicine, EMS and DS has been attempted. Mutants of high ornamental value have been evolved, isolated and multiplied in canna, perennial portulaca, tuberose, bougainvillea, hibiscus, daisy, lilies. These pertain to changes in colour, shape and size of flower and foliage. Procedural details on induction, isolation, stabilisation of the mutants and description of the new characteristics are presented. (author)
Susceptibility of ornamental pepper banker plant candidates to common greenhouse pests
Susceptibility of four potential ornamental pepper banker plant candidates [Black Pearl (BP), Explosive Ember (EE), Masquerade (MA), Red Missile (RM), and a commercial pepper cultivar Blitz (BL)] were evaluated against three common greenhouse pests - Bemisia tabaci, Polyphagotarsonemus latus and Fra...
Hospitability of ornamental and medicinal plants to root-knot nematode (Meloidogyne incognita race 2
Directory of Open Access Journals (Sweden)
Francisco José Carvalho Moreira
2017-10-01
Full Text Available The correct identification of species and genus of nematodes that affect a particular culture is of great importance to form a quantity of information that will be useful to laboratories for diagnosis and control of these pathogens. Because of the increase in the production of ornamental and medicinal plants in the of Cear. á State, the agricultural importance of the genus Meloidogyne and the scarcity of information on the hospitability this pathogen in these species, in that it was to evaluate the susceptibility testing of 30 species, and 20 ornamental (Antirrhimum majus, Gazania ringens, Carthamus tinctorius, Bryophyllum cayicinum, Ceasalpinia pulcherrima, Thumbergia alata, Petunia hibryda, Exacum affine, Catharanthus roseus, Opuntia sp., Sansevieria trifasciata, Asparagus densiflorus, Hibiscus mutabilis-roreus, Impatiens balsamiana, Celosia spicata, Antirrhimum sp., Dianthus chinensis, Zinnia elegans, Tagetes patula, Capsicum annuum and 10 medicinal (Peumus boldus, Ocimum gratissimum, Mentha arvensis var. piperascens, Mentha x Vilosa, Plectranthus amboinicus, Ocimum bassilicum, Rosmarinus officinalis, Cymbopogon citratus, Lippia alba, Cymbopogon winterianus. The test was conducted in a greenhouse, of the Phytosanitary Sector, Department of Plant Science, Federal University of Ceará. The inoculation was conducted with 4,000 eggs/J2 for pot. Evaluation of the plants gave to 60 days after inoculation. Evaluated is the reaction of the plants, measuring up: number of galls and eggs, egg mass index, reproduction factor and reduce the reproduction factor. From these variables it was classified the reaction of plants to the nematode by means of five criterions. Of ownership of the results, it was verified that of the ornamental plants only species T. patula didn’t presented galls in your root system. Concerning medicinal species M. vilosa, C. citrates, L. alba, C. winterianus and P. boldus showed no galls in their root systems. Thus, concluded
Directory of Open Access Journals (Sweden)
2016-11-01
Full Text Available The study compared the air pollution tolerance indices (APTI of five plant species and five ornamental shrubs in Enugu Urban Center. Laboratory analysis was performed on the four physiological and biological parameters including leaf relative water content (RWC, ascorbic acid (AA content, total leaf chlorophyll (TCH and leaf extract pH. These parameters were used to develop an air pollution tolerance index. Factor analysis and descriptive statistics were utilized in the analysis to examine the interactions between these parameters. Vegetation monitoring in terms of its APTI acts as a \\'Bioindicator\\' of air pollution. The study also showed the possibility of utilizing APTI as a tool for selecting plants or ornamental shrubs for urban heat Island mitigation in Enugu City. The result of APTI showed order of tolerance for plants as Anacarduim occidentale (23.20, Pinus spp (22.35, Catalpa burgei (22.57, Magifera indica (23.37, and Psidum guajava (24.15.The result of APTI showed increasing order of sensitivity for ornamental shrubs from ixora red (14.32, yellow ficus(12.63, masquerade pine(12.26, Tuja pine(11.000,to Yellow bush(10.60. The APTI of all the plants examined were higher than those of ornamental shrubs. Thus suggesting that plants in general were more tolerant to air pollution than ornamental shrubs. The ornamental shrubs with lower APTI values (sensitive were recommended as bioindicator of poor urban air quality while plants with high APTI values (tolerant are planted around areas anticipated to have high air pollution load. The result of this current study is therefore handy for future planning and as well provides tolerant species for streetscape and urban heat island mitigation.
Directory of Open Access Journals (Sweden)
Norman Philipp
2018-05-01
Full Text Available Genebanks are a rich source of genetic variation. Most of this variation is absent in breeding programs but may be useful for further crop plant improvement. However, the lack of phenotypic information forms a major obstacle for the educated choice of genebank accessions for research and breeding. A promising approach to fill this information gap is to exploit historical information gathered routinely during seed regeneration cycles. Still, this data is characterized by a high non-orthogonality hampering their analysis. By examining historical data records for flowering time, plant height, and thousand grain weight collected during 70 years of regeneration of 6,207 winter wheat (Triticum aestivum L. accessions at the German Federal ex situ Genebank, we aimed to elaborate a strategy to analyze and validate non-orthogonal historical data in order to charge genebank information platforms with high quality ready-to-use phenotypic information. First, a three-step quality control assessment considering the plausibility of trait values and a standard as well as a weather parameter index based outlier detection was implemented, resulting in heritability estimates above 0.90 for all three traits. Then, the data was analyzed by estimating best linear unbiased estimations (BLUEs applying a linear mixed-model approach. An in silico resampling study mimicking different missing data patterns revealed that accessions should be regenerated in a random fashion and not blocked by origin or acquisition date in order to minimize estimation biases in historical data sets. Validation data was obtained from multi-environmental orthogonal field trials considering a random subsample of 3,083 accessions. Correlations above 0.84 between BLUEs estimated for historical data and validation trials outperformed previous approaches and confirmed the robustness of our strategy as well as the high quality of the historical data. The results indicate that the IPK winter wheat
Authenticity of old cultivars in genebank collections: a case study on lettuce
Wouw, van de M.J.; Treuren, van R.; Hintum, van T.J.L.
2011-01-01
Ex situ collections in genebanks conserve many old cultivars that had disappeared from mainstream agriculture before modern genebanks were established. The collections incorporated cultivars from many sources, such as botanical gardens and working collections, sometimes with little further
The changing role of ornamental horticulture in alien plant invasions.
van Kleunen, Mark; Essl, Franz; Pergl, Jan; Brundu, Giuseppe; Carboni, Marta; Dullinger, Stefan; Early, Regan; González-Moreno, Pablo; Groom, Quentin J; Hulme, Philip E; Kueffer, Christoph; Kühn, Ingolf; Máguas, Cristina; Maurel, Noëlie; Novoa, Ana; Parepa, Madalin; Pyšek, Petr; Seebens, Hanno; Tanner, Rob; Touza, Julia; Verbrugge, Laura; Weber, Ewald; Dawson, Wayne; Kreft, Holger; Weigelt, Patrick; Winter, Marten; Klonner, Günther; Talluto, Matthew V; Dehnen-Schmutz, Katharina
2018-03-05
The number of alien plants escaping from cultivation into native ecosystems is increasing steadily. We provide an overview of the historical, contemporary and potential future roles of ornamental horticulture in plant invasions. We show that currently at least 75% and 93% of the global naturalised alien flora is grown in domestic and botanical gardens, respectively. Species grown in gardens also have a larger naturalised range than those that are not. After the Middle Ages, particularly in the 18th and 19th centuries, a global trade network in plants emerged. Since then, cultivated alien species also started to appear in the wild more frequently than non-cultivated aliens globally, particularly during the 19th century. Horticulture still plays a prominent role in current plant introduction, and the monetary value of live-plant imports in different parts of the world is steadily increasing. Historically, botanical gardens - an important component of horticulture - played a major role in displaying, cultivating and distributing new plant discoveries. While the role of botanical gardens in the horticultural supply chain has declined, they are still a significant link, with one-third of institutions involved in retail-plant sales and horticultural research. However, botanical gardens have also become more dependent on commercial nurseries as plant sources, particularly in North America. Plants selected for ornamental purposes are not a random selection of the global flora, and some of the plant characteristics promoted through horticulture, such as fast growth, also promote invasion. Efforts to breed non-invasive plant cultivars are still rare. Socio-economical, technological, and environmental changes will lead to novel patterns of plant introductions and invasion opportunities for the species that are already cultivated. We describe the role that horticulture could play in mediating these changes. We identify current research challenges, and call for more
Citrus genebank collections: International collaboration opportunities between the U.S. and Russia
Citrus germplasm is conserved in genebanks at sites around the world to provide genetic resources for breeding and research programs. The value of genebank collections is particularly evident as diseases and climate change threaten citrus production areas. We provide historical, inventory, and maint...
Naturalization of ornamental plant species in public green spaces and private gardens
Czech Academy of Sciences Publication Activity Database
Mayer, K.; Haeuser, E.; Dawson, W.; Essl, F.; Kreft, H.; Pergl, Jan; Pyšek, Petr; Weigelt, P.; Winter, M.; Lenzner, B.; van Kleunen, M.
2017-01-01
Roč. 19, č. 12 (2017), s. 3613-3627 ISSN 1387-3547 R&D Projects: GA MK(CZ) DG16P02M041 Keywords : climate change * ornamental plants * invasioins Subject RIV: EF - Botanics OBOR OECD: Ecology Impact factor: 2.473, year: 2016
Benson, Dennis A.; Karsch-Mizrachi, Ilene; Lipman, David J.; Ostell, James; Rapp, Barbara A.; Wheeler, David L.
2002-01-01
The GenBank sequence database incorporates publicly available DNA sequences of more than 105 000 different organisms, primarily through direct submission of sequence data from individual laboratories and large-scale sequencing projects. Most submissions are made using the BankIt (web) or Sequin programs and accession numbers are assigned by GenBank staff upon receipt. Data exchange with the EMBL Data Library and the DNA Data Bank of Japan helps ensure comprehensive worldwide coverage. GenBank...
Hulme, Philip E.; Brundu, Giuseppe; Carboni, Marta; Dehnen-schmutz, Katharina; Dullinger, Stefan; Early, Regan; Essl, Franz; González-moreno, Pablo; Groom, Quentin J.; Kueffer, Christoph; Kühn, Ingolf; Maurel, Noëlie; Novoa, Ana; Pergl, Jan; Pyšek, Petr; Seebens, Hanno; Tanner, Rob; Touza, Julia M.; Van Kleunen, Mark; Verbrugge, Laura Nicoline Halley
2017-01-01
1.Ornamental horticulture is the primary pathway for invasive alien plant introductions. We critically appraise published evidence on the effectiveness of four policy instruments that tackle invasions along the horticulture supply chain: pre-border import restrictions, post-border bans, industry
U.S. Department of Health & Human Services — GenBank is the NIH genetic sequence database, an annotated collection of all publicly available DNA sequences. GenBank is designed to provide and encourage access...
Production of oil palm empty fruit bunch compost for ornamental plant cultivation
Trisakti, B.; Mhardela, P.; Husaini, T.; Irvan; Daimon, H.
2018-02-01
The aim of this research was to produce the oil palm empty fruit bunch (EFB) compost for ornamental plant cultivation. EFB compost was produced by chopping fresh EFB into 1-3 cm pieces, inserting the pieces into basket composter (33 cm W × 28 cm L × 40 cm H), and adding activated liquid organic fertilizer (ALOF) until moisture content (MC) in the range of 55-65%. During composting, the compost pile was turned every 3 days and the MC was maintained at 55-65% range by adding the ALOF. The compost processed was then mixed with sand and rice husk with a ratio of 1:1:1; 1:3:1; 1:0:1 and was used as a potting medium for planting some valuable ornamental plants i.e. cactus (cactaceae), sansevieria, and anthurium. Composting was carried out for 40 days and the compost characteristic were pH 9.0; MC 52.59%; WHC 76%; CN ratio 12.15; N 1.96%; P 0.58%; and K 0.95%. The compost-sand-husk rice mixture can be used as a growing medium where the best ratio for cactus, sansevieria, and anthurium was 1:3:1; 1:1:1; and 1:0:1, respectively.
Treatment and Remediation of Petroleum-Contaminated Soils Using Selective Ornamental Plants
Liu, Rui; Jadeja, Rajendrasinh N.; Zhou, Qixing; Liu, Zhe
2012-01-01
Pot-culture experiments were carried out to assess the phytoremediation potential of 14 ornamental plants in weathered petroleum-contaminated soil, which was collected in the Shengli Oil Field, one of the biggest oil fields in China, by examining their impact on the degradation potential of total petroleum hydrocarbons (TPHs) and its composition. Results showed Gaillardia aristata, Echinacea purpurea, Fawn (Festuca arundinacea Schreb), Fire Phoenix (a combined F. arundinacea), and Medicago sa...
IRRIGATION OF ORNAMENTAL PLANT NURSERY
Directory of Open Access Journals (Sweden)
Eduardo de Aguiar do Couto
2013-01-01
Full Text Available Airports consume significant amounts of water which can be compared to the volume consumed by mid-size cities, thus practices aimed at reducing water consumption are important and necessar y. The objective of this study was to assess the reuse potential of sewage effluent produced at a mid-size international airport for nursery irri gation. The sewage treatment system consisted of a facultative pond followed by a constructed wetland, which were monitored during one hydrological year a nd the parameters COD, pH, solids, nitrogen, phosphorus and Escherichia coli we re analyzed. Removal efficiencies of 85% and 91% were achieved for C OD and solids, respectively. Removal efficiencies for ammonia nitrogen a nd total phosphorus were 77% and 59%, respectively. In terms of E. coli concen tration, the treated effluent met the recommendations by the World Health Organization for reuse in irrigation with the advantage of providing high levels of residual nutrient. The ornamental species Impatiens walleriana was irrigated with treated sewage effluent and plant growth characteristics were evalua ted. The experiment showed that reuse can enhance plant growth without signi ficantly affecting leaf tissue and soil characteristics. This study highlighted th e importance of simple technologies for sewage treatment especially in count ries which still do not present great investment in sanitation and proved that effluent reuse for landscape irrigation can provide great savings of water and financial resources for airport environments.
Cacao (Theobroma cacao L.), the tree from which cocoa butter and chocolate is derived, is conserved in field genebanks. The largest of these ex situ collections in the public domain is the International Cocoa Genebank, Trinidad (ICG,T). Reduction of genetic redundancy is essential to improve the acc...
International Nuclear Information System (INIS)
Gupta, M.N.
1980-01-01
Research work on improvement of some ornamental plants by induced somatic mutations has been in progress at the National Botanical Research Institute, Lucknow, since 1964. The methods of treatments with gamma rays, detection, isolation and multiplication of induced somatic mutations have been given for Bougainvillea, Chrysanthemum, perennial Portulaca, rose and tuberose. During the last 15 years, a total of 38 new cultivars of different ornamentals evolved by gamna induced somatic mutations have been released. They include Bougainvillea 1; Chrysanthemum 28; perennial portulaca 6; rose 1 and tuberose 2. Descriptions of the original cultivars and their gamma induced mutants are given along with other pertinent details. (author)
Calonectria spp. causing leaf spot, crown and root rot of ornamental plants in Tunisia
Lombard, L.; Polizzi, G.; Guarnaccia, V.; Vitale, A.; Crous, P.W.
2011-01-01
Calonectria spp. are important pathogens of ornamental plants in nurseries, especially in the Northern Hemisphere. They are commonly associated with a wide range of disease symptoms of roots, leaves and shoots. During a recent survey in Tunisia, a number of Calonectria spp. were isolated from
Calonectria spp. causing leaf spot, crown and root rot of ornamental plants in Tunisia
Lombard, L.; Polizzi, G.; Guarnaccia, V.; Vitale, A.; Crous, P.W.
2012-01-01
Calonectria spp. are important pathogens of ornamental plants in nurseries, especially in the Northern Hemisphere. They are commonly associated with a wide range of disease symptoms of roots, leaves and shoots. During a recent survey in Tunisia, a number of Calonectria spp. were isolated from
Directory of Open Access Journals (Sweden)
Yesica Mayett-Moreno
2018-01-01
Full Text Available The use of native ornamental plants in urban landscapes and ornamental consumers’ designs is one strategy to preserve biodiversity. Sprekelia formosissima (L. Herb., known as Aztec lily (ALY, is one of the nearly 4000 species of native ornamental plants of Mexico. However, its domestic market is not yet developed and is virtually unknown. The objectives of this study were to: (1 compare consumers’ and retailers’ knowledge of ALY, and (2 to identify potential clusters of consumers and retailers based on their knowledge and preferences, such that marketing of the ALY could be best tailored to different market segments, leading to its sustainable commercialization. There were 464 interviews conducted in four nurseries in Mexico. Results showed only one consumer knew about the ALY; additionally, we found different behaviors in consumers and in retailers: those not interested in the ALY, but when they know it is Mexican they will acquire it; those interested no matter the ALY origin, and those who dislike the ALY because it is Mexican. Those answers suggest that improving consumers/retailers knowledge about this native flower could lead to a sustainable commercialization in Mexico, helping to ensure its conservation as well.
Benson, Dennis A.; Cavanaugh, Mark; Clark, Karen; Karsch-Mizrachi, Ilene; Lipman, David J.; Ostell, James; Sayers, Eric W.
2012-01-01
GenBank? (http://www.ncbi.nlm.nih.gov) is a comprehensive database that contains publicly available nucleotide sequences for almost 260 000 formally described species. These sequences are obtained primarily through submissions from individual laboratories and batch submissions from large-scale sequencing projects, including whole-genome shotgun (WGS) and environmental sampling projects. Most submissions are made using the web-based BankIt or standalone Sequin programs, and GenBank staff assig...
Unlocking the diversity of genebanks: whole-genome marker analysis of Swiss bread wheat and spelt
Mü ller, Thomas; Schierscher-Viret, Beate; Fossati, Dario; Brabant, Cé cile; Schori, Arnold; Keller, Beat; Krattinger, Simon G.
2017-01-01
Genebanks play a pivotal role in preserving the genetic diversity present among old landraces and wild progenitors of modern crops and they represent sources of agriculturally important genes that were lost during domestication and in modern breeding. However, undesirable genes that negatively affect crop performance are often co-introduced when landraces and wild crop progenitors are crossed with elite cultivars, which often limit the use of genebank material in modern breeding programs. A detailed genetic characterization is an important prerequisite to solve this problem and to make genebank material more accessible to breeding. Here, we genotyped 502 bread wheat and 293 spelt accessions held in the Swiss National Genebank using a 15K wheat SNP array. The material included both spring and winter wheats and consisted of old landraces and modern cultivars. Genome- and sub-genome-wide analyses revealed that spelt and bread wheat form two distinct gene pools. In addition, we identified bread wheat landraces that were genetically distinct from modern cultivars. Such accessions were possibly missed in the early Swiss wheat breeding program and are promising targets for the identification of novel genes. The genetic information obtained in this study is appropriate to perform genome-wide association studies, which will facilitate the identification and transfer of agriculturally important genes from the genebank into modern cultivars through marker-assisted selection.
Unlocking the diversity of genebanks: whole-genome marker analysis of Swiss bread wheat and spelt
Müller, Thomas
2017-11-04
Genebanks play a pivotal role in preserving the genetic diversity present among old landraces and wild progenitors of modern crops and they represent sources of agriculturally important genes that were lost during domestication and in modern breeding. However, undesirable genes that negatively affect crop performance are often co-introduced when landraces and wild crop progenitors are crossed with elite cultivars, which often limit the use of genebank material in modern breeding programs. A detailed genetic characterization is an important prerequisite to solve this problem and to make genebank material more accessible to breeding. Here, we genotyped 502 bread wheat and 293 spelt accessions held in the Swiss National Genebank using a 15K wheat SNP array. The material included both spring and winter wheats and consisted of old landraces and modern cultivars. Genome- and sub-genome-wide analyses revealed that spelt and bread wheat form two distinct gene pools. In addition, we identified bread wheat landraces that were genetically distinct from modern cultivars. Such accessions were possibly missed in the early Swiss wheat breeding program and are promising targets for the identification of novel genes. The genetic information obtained in this study is appropriate to perform genome-wide association studies, which will facilitate the identification and transfer of agriculturally important genes from the genebank into modern cultivars through marker-assisted selection.
Benson, Dennis A.; Karsch-Mizrachi, Ilene; Lipman, David J.; Ostell, James; Sayers, Eric W.
2008-01-01
GenBank? is a comprehensive database that contains publicly available nucleotide sequences for more than 300 000 organisms named at the genus level or lower, obtained primarily through submissions from individual laboratories and batch submissions from large-scale sequencing projects. Most submissions are made using the web-based BankIt or standalone Sequin programs, and accession numbers are assigned by GenBank? staff upon receipt. Daily data exchange with the European Molecular Biology Labo...
Identification of Meloidogyne species associated with uptall ornamentals plants in Costa Rica
International Nuclear Information System (INIS)
Solano-Gonzalez, Stefany; Esquivel-Hernandez, Alejandro; Molina-Bravo, Ramon; Morera-Brenes, Bernal
2015-01-01
Nematodes species of the genus Meloidogyne associated with upland ornamental plants were identified. Ten ornamental species in a commercial nursery were sampled in San Isidro, Heredia, Costa Rica between 2011-2012. Morphometric measurements of the stylet length, the trail length, and the hyaline region of J_2s as well as perineal patterns of egg-carrying females were used for identification, Genomic DNA was extracted from single J_2s and molecular analyses were performed by amplifying the intergenic region between cytochrome oxidase subunit II of the COII and the long subunit of the ARN ribosomal genes by PCR-RFLP. Combining these methods allowed identification of five species of nematodes of the genus Meloidogyne (M. arenaria, M. hapla, M. hispanica, M. incognita and M. javanica), and new restriction enzyme patterns were reported for M. hapla and M. javanica using AluI. Additionally a preliminary report of M. hispanica was described by sequencing the 28S and 18S regions. (author) [es
Benson, Dennis A.; Karsch-Mizrachi, Ilene; Lipman, David J.; Ostell, James; Wheeler, David L.
2006-01-01
GenBank (R) is a comprehensive database that contains publicly available nucleotide sequences for more than 240 000 named organisms, obtained primarily through submissions from individual laboratories and batch submissions from large-scale sequencing projects. Most submissions are made using the web-based BankIt or standalone Sequin programs and accession numbers are assigned by GenBank staff upon receipt. Daily data exchange with the EMBL Data Library in Europe and the DNA Data Bank of Japan...
Most ornamental plants on sale in garden centres are unattractive to flower-visiting insects.
Garbuzov, Mihail; Alton, Karin; Ratnieks, Francis L W
2017-01-01
Gardeners and park managers seeking to support biodiversity in urban areas often plant ornamentals attractive to flower-visiting insects. There is a huge diversity of garden plant varieties, and some recommendations are available as to which are attractive to insects. However, these are largely not based on rigorous empirical data. An important factor in consumer choice is the range of varieties available for purchase. In the UK, garden centres are a key link in the supply chain between growers and private gardens. This study is the first to determine the proportions of flowering ornamentals being sold that are attractive to flower-visiting insects. We surveyed six garden centres in Sussex, UK, each over two days in 2015, by making 12 counts of insects visiting patches of each ornamental plant on display for sale that was in bloom. To provide a consistent baseline among different locations, we brought with us and surveyed marjoram ( Origanum vulgare ) plants in pots, which are known to be attractive to a wide range of flower-visiting insects. The attractiveness of plant varieties to insects was then expressed in two ways: the absolute number and relative to that on marjoram ('marjoram score'), both per unit area of plant cover. In addition, we noted whether each variety was recommended as pollinator-friendly either via a symbol on the label, or by being included in the Royal Horticultural Society's 'Perfect for Pollinators' list. Furthermore, we compared the attractiveness of plants that are typically grown for more than one year versus only one year. We surveyed 59-74 plant varieties in bloom across the six garden centres. In each garden centre, the distributions of variety attractiveness were highly skewed to the right, with most varieties being relatively unattractive, and few varieties highly attractive to flower-visiting insects. The median attractiveness of varieties with a recommendation was 4.2× higher than that of varieties without. But, due to the large
Micropropagation of ornamental species Petunia grandiflora and Dianthus chinensis x barbatus
Velesanova, Ivana; Trajkova, Fidanka; Koleva Gudeva, Liljana
2017-01-01
Petunia (Petunia sp.) and pink dianthus (Dianthus sp.) are important ornamental plants which are grown on balconies, in flower gardens, parks and other during summer period. Approximately 156 ornamental species are cultivated via tissue culture in different commercial laboratories worldwide. In vitro plant culture is one of the key tools in plant biotechnology that utilizes the totipotency of plant cells. In this research the influence of different concentrations and combinations of BA, GA...
Using GIS to check co-ordinates of genebank accessions
Hijmans, R.J.; Schreuder, M.; Cruz, de la J.; Guarino, L.
1999-01-01
The geographic co-ordinates of the locations where germplasm accessions have been collected are usually documented in genebank databases. However, the co-ordinate data are often incomplete and may contain errors. This paper describes procedures to check for errors, to determine the cause of these
Identification of Meloidogyne species associated with upland ornamentals plants in Costa Rica.
Directory of Open Access Journals (Sweden)
Stefany Solano-González
2015-06-01
Full Text Available The objective of this study was to identify nematodes species of the genus Meloidogyne associated with upland ornamental plants. We sampled ten ornamental species in a commercial nursery in San Isidro, Heredia, Costa Rica between 2011-2012. Morphometric measurements of the stylet length, the tail length, and the hyaline region of J2s, as well as perineal patterns of egg-carrying females were used for identification, Genomic DNA was extracted from single J2s and molecular analyses were performed by amplifying the intergenic region between cytochrome oxidase subunit II of the COII and the long subunit of the ARN ribosomal genes by PCR-RFLP. Combining these methods allowed identification of five species of nematodes of the genus Meloidogyne (M. arenaria, M. hapla, M. hispanica, M. incognita and M. javanica, and new restriction enzyme patterns were reported for M. hapla and M. javanica using AluI. Additionally, a preliminary report of M. hispanica was described by sequencing the 28S and 18S regions.
Directory of Open Access Journals (Sweden)
Eltohamy A A Yousef
Full Text Available Cauliflower (Brassica oleracea var. botrytis is an important vegetable crop for human nutrition. We characterized 192 cauliflower accessions from the USDA and IPK genebanks with genotyping by sequencing (GBS. They originated from 26 different countries and represent about 44% of all cauliflower accessions in both genebanks. The analysis of genetic diversity revealed that accessions formed two major groups that represented the two genebanks and were not related to the country of origin. This differentiation was robust with respect to the analysis methods that included principal component analysis, ADMIXTURE and neighbor-joining trees. Genetic diversity was higher in the USDA collection and significant phenotypic differences between the two genebanks were found in three out of six traits investigated. GBS data have a high proportion of missing data, but we observed that the exclusion of single nucleotide polymorphisms (SNPs with missing data or the imputation of missing SNP alleles produced very similar results. The results indicate that the composition and type of accessions have a strong effect on the structure of genetic diversity of ex situ collections, although regeneration procedures and local adaptation to regeneration conditions may also contribute to a divergence. Fst-based outlier tests of genetic differentiation identified only a small proportion (<1% of SNPs that are highly differentiated between the two genebanks, which indicates that selection during seed regeneration is not a major cause of differentiation between genebanks. Seed regeneration procedures of both genebanks do not result in different levels of genetic drift and loss of genetic variation. We therefore conclude that the composition and type of accessions mainly influence the level of genetic diversity and explain the strong genetic differentiation between the two ex situ collections. In summary, GBS is a useful method for characterizing genetic diversity in cauliflower
Directory of Open Access Journals (Sweden)
Bergstrand Karl-Johan I.
2017-06-01
Full Text Available Chemical plant growth regulators (PGRs are used in the production of ornamental potted and bedding plants. Growth control is needed for maximizing production per unit area, reducing transportation costs and to obtain a desired visual quality. However, the use of PGRs is associated with toxicity risks to humans and the environment. In many countries the availability of PGRs is restricted as few substances are registered for use. A number of alternative methods have been suggested. The methods include genetic methods (breeding and crop cultivation practices such as fertigation, temperature and light management. A lot of research into “alternative” growth regulation was performed during the 1980-1990s, revealing several possible ways of using different climatic factors to optimize plant growth with respect to plant height. In recent years, the interest in climatic growth regulation has been resurrected, not least due to the coming phase-out of the plant growth regulator chlormequat chloride (CCC. Today, authorities in many countries are aiming towards reducing the use of agrochemicals. At the same time, there is a strong demand from consumers for products produced without chemicals. This article provides a broad overview of available methods for non-chemical growth control. It is concluded that a combination of plant breeding and management of temperature, fertigation and light management has the potential of replacing chemical growth regulators in the commercial production of ornamental pot- and bedding plants.
Directory of Open Access Journals (Sweden)
Moacir Pasqual
2008-03-01
Full Text Available O Ananas comosus var. erectifolius, cultivar de abacaxi ornamental, tem apresentado grande interesse para paisagistas e floricultores do Brasil e do exterior, por ser uma planta ornamental tropical, exótica e rústica. A produção de plantas ornamentais a partir de técnicas de cultura de tecidos apresenta-se como uma alternativa viável para a obtenção de um grande número de plantas com qualidade genética e fitossanitária, em um curto espaço de tempo, suprindo, assim, a necessidade do mercado na aquisição de mudas com qualidade comprovada. Estudou-se a influência das concentrações de BAP (0; 0,5; 1,0 e 1,5 mg L-1 e ANA (0,0; 0,12; 0,24; 0,48 mg L-1 no meio de cultura MS com 0; 2,5; 5,0; e 7,5 g L-1 de ágar, visando estabelecer um protocolo para multiplicação e enraizamento in vitro de brotos de abacaxizeiro ornamental. Brotações com 1,5 ± 0,5 cm, já estabelecidas in vitro, oriundas das gemas da coroa do fruto do abacaxizeiro ornamental, foram inoculados assepticamente nos frascos. Após inoculados, os explantes foram mantidos em sala de crescimento com luminosidade em torno de 35 ìmol m-2 s-1, 26±1ºC e fotoperíodo de 16 horas. Após 45 dias observou-se que a multiplicação in vitrodo abacaxi ornamental é viável em meio MS líquido acrescido de BAP 1,5 mg L-1 e o enraizamento também em meio MS líquido, na ausência de reguladores de crescimento.The Ananas comosus var. erectifoliusis an ornamental pineapple cultivar which greatly interests Brazilians and foreign landscapers and flower producers for being an exotic and rustic tropical ornamental plant. The market demand for high quality of cuttings requires efficient methods of propagation and in this context the tissue culture stands out as a viable alternative to obtain plants with genetic and phytossanitary quality in a short time. In the present work we studied the influence of concentrations of BAP (0; 0.5; 1.0; 1.5 mg L-1 and NAA (0; 0.12; 0.24; 0.48 mg L-1 in
International Nuclear Information System (INIS)
Pacheco Acevedo, Maria Jose
2010-01-01
The presence of Xylella fastidiosa is detected in plants considered as hosts of urban ornament with characteristic symptoms, present in gardens in the area of the university district and around in the area. Urban ornamental plants are identified with suggestive symptomatology of infection by X. fastidiosa in gardens of urban areas. Plants are classified according to the presence or absence of symptoms. In the study were gathered 97 samples, belonging to 29 vegetable species with symptoms of chlorosis on leaves, leaf scorch, delay in the development and loss of foliage. The identified plants are screened by techniques of ELISA, and immunofluorescence for the detection of X. fastidiosa. Xylella fastidiosa is isolated from urban ornamental plants. The isolates of Xylella obtained, are characterized phenotypic and molecularly. The performance of two standardized immunological techniques are compared for the serological detection of Xylella fastidiosa. The presence of X. fastidiosa is detected, using the DAS-ELISA technique on 48 of the 97 processed samples, corresponding to 46,1% of the samples. Parallely, the samples processed using the IFA technique, have detected the presence of X. fastidiosa in the same proportions [es
The influence of growth retardants and cytokinins on flowering of ornamental plants
Directory of Open Access Journals (Sweden)
Anna Pobudkiewicz
2012-12-01
Full Text Available Growth retardants are applied in order to obtain short and well compact plants. They usually inhibit stem elongation, but also can influence the flowering of plants. The aim of cytokinin application is to obtain well branched plants without removing the apical meristem. Cytokinins usually increase the number of axillary shoots but also can influence flowering. Growth retardants and cytokinins can affect flower size, pedicel length, number of flowers, flower longevity, abortion of flower buds and number of days from potting plants to the first open flower. Flowering of growth retardant and cytokinin treated plants might depend on the method of growth regulator used (foliar spray or soil drench, plant species or even a plant cultivar, but in the highest degree it depends on the growth regulator rate used. These growth regulators, when are applied at rates appropriate for height and habit control, very seldom influence flowering of ornamental plants, but applied at high rates can delay flowering, diminish flower diameter or flower pedicel length and also can decrease the number of flowers per plant. In cultivation of bulb plants, growth retardants, used at very high rates, also cause abortion of flower buds.
Nigeria is the fourth largest cacao producer in the world. Field performance and quality of cacao hybrid families is largely dependent on the genetic integrity of parental clones obtained from field genebank collections. However, information on the impact of mislabeling on seed garden output and ger...
Energy Technology Data Exchange (ETDEWEB)
Carmona, E.; Moreno, M. T.; Aviles, M.; Ordovas, J.
2012-11-01
To study the process of composting of grape marc and test the resulting compost as a substrate for the cultivation of ornamental plants, six composting processes, with mixtures of dealcoholised grapevine marc and grape stalk (DM + GS) in a 1:1 ratio (v:v), were carried out in Seville (Spain) between 2000 and 2006. The duration of the composting ranged between 20 and 24 weeks in the Spring-Summer season. Weekly, temperature, pH, EC, N-NO{sub 3}{sup -} and N-NH{sub 4} +, were measured. The maximum temperatures reached values of 65-73 degree centigrade at a depth between 40 and 80 cm. The compost had a slightly alkaline pH, slightly salinity, high organic matter and total nitrogen contents. The final compost chemical composition in total elements showed values in the same range as those corresponding to plant material, except for Fe. The distribution in the size of the particles gives way to a total porous space that is close to the one considered as optimal in a substrate for soil less cropping. Pore size distribution showed a prevalence of big pores that produces unbalance in the water-air ratios, resulting in a material with a good aeration but with low water retention. The composts were tested as substrates for four ornamental species: geranium, petunia, carnation and gerbera. The results suggest that compost has no limiting characteristics for its use as a medium for the cultivation of ornamental plants in container, and can replace conventional substrates, such as peat and coconut fibre. (Author) 35 refs.
Ornamental Eudicotyledons from grasslands of Pampa biome in Rio Grande do Sul
Directory of Open Access Journals (Sweden)
Ana De Araújo Carrion
2012-10-01
Full Text Available The present study aims at investigating the group of Eudicotyledons native plants with ornamental potential of grasslands from the Pampa biome in the south of Brazil. The Pampa presents a high level of biodiversity; however, it requires studies related to the richness of vascular plants and its biological and ecological knowledge. The purpose of this work is to elaborate a preliminary inventory of this group of plants, analyzing the ornamental potential of each specie and indicating those that could be considered as being priorities for the purpose of sustainable use with this objective. Some grassland species were selected through the search for information in herbarium registers, national and international works about decorative plants, floristic surveys, besides the authors´ practical knowledge. Some parameters and values were associated, aiming at reducing the subjectivity of the choice. The survey resulted in a list of 177 species distributed in 36 families and 101 genera. Among these species, ten presented high ornamental potential. These data show that the richness of the grassland native ornamental flora is high, even though its use is poorly known. The use of these plants, if in a sustainable manner, can produce economic and ecological benefits.
Vegetative Regeneration Capacities of Five Ornamental Plant Invaders After Shredding
Monty, Arnaud; Eugène, Marie; Mahy, Grégory
2015-02-01
Vegetation management often involves shredding to dispose of cut plant material or to destroy the vegetation itself. In the case of invasive plants, this can represent an environmental risk if the shredded material exhibits vegetative regeneration capacities. We tested the effect of shredding on aboveground and below-ground vegetative material of five ornamental widespread invaders in Western Europe that are likely to be managed by cutting and shredding techniques: Buddleja davidii (butterfly bush, Scrophulariaceae), Fallopia japonica (Japanese knotweed, Polygonaceae), Spiraea × billardii Hérincq (Billard's bridewort, Rosaceae), Solidago gigantea (giant goldenrod, Asteraceae), and Rhus typhina L. (staghorn sumac, Anacardiaceae). We looked at signs of vegetative regeneration and biomass production, and analyzed the data with respect to the season of plant cutting (spring vs summer), the type of plant material (aboveground vs below-ground), and the shredding treatment (shredded vs control). All species were capable of vegetative regeneration, especially the below-ground material. We found differences among species, but the regeneration potential was generally still present after shredding despite a reduction of growth rates. Although it should not be excluded in all cases (e.g., destruction of giant goldenrod and staghorn sumac aboveground material), the use of a shredder to destroy woody alien plant material cannot be considered as a general management option without significant environmental risk.
Directory of Open Access Journals (Sweden)
Nonić Marina
2016-01-01
Full Text Available European beech (Fagus sylvatica L. is, along with its significance as a forest species, renowned as an ornamental species, due to its numerous cultivars. Ornamental beech cultivars are planted in various green spaces, but a small number of such trees have ascertained in Serbia. For the time being, production of beech cultivars is represented in a very small number of nurseries, with a negligible share of those seedlings in their total assortment. The aim of this research is to study the attitudes of ornamental trees and shrubs producers towards the nursery production of ornamental beech cultivars, and possibilities of its improvements in Serbia. “Door to door” survey and in-depth interviews were used as research techniques. Surveys with the representatives of 65 nurseries in Serbia (in the selected statistical region Šumadija and Western Serbia were conducted in the first stage of data collection. In the second stage of data collection were interviewed the representatives of the 10 nurseries who, during the survey, pointed out that they produce ornamental beech cultivars. Nurserymen’s attitudes suggest that there is a possibility to improve the production of ornamental beech cultivars in Serbia, with the appropriate support measures and increased interest of customers on the market, i.e. with the provision of subsidies for the production of seedlings and greater use of cultivars by utility companies in the cities of Serbia. [Projekat Ministarstva nauke Republike Srbije, br. ТP 31041: Establishment of forest plantations to increase the afforested areas in Serbia
Directory of Open Access Journals (Sweden)
F.C.L. Freitas
2007-09-01
g ha-1 de oxyfluorfen, para plantas de copo-de-leite, estrelítzia e palmeira-australiana, respectivamente, na aplicação em área total, e nas concentrações superiores a 0,0018%, na aplicação dirigida, aos 30 DAA.This study aimed to evaluate efficacy of oxyfluorfen in controlling Pilea microphylla for the production of ornamental plant shoots. Two experiments were carried out in a randomized block design, arranged in a factorial scheme 2 x 7, with three replicates. One trial was composed by three ornamental plant species (Zantedeschia aethiopica, Strelitzia reginae and Archontophoenix cunninghamiana and seven oxyfluorfen rates (0, 24, 72, 144, 216, 288 and 360 g ha-1, sprayed in a total area; the other trial was composed by the same species and seven oxyfluorfen concentrations (0.00000, 0.00036, 0.00072, 0.00144, 0.00288, 0.00576 and 0.01152% of a.i. applied directly as spray, without reaching the ornamental plant leaves. Each experimental unit was represented by a pot with an ornamental plant shoot, infested with Pilea microphylla. At 15, 30 and 60 days after application (DAA visual evaluations of the control on P. microphylla and toxicity on ornamental plants were carried out. For the total area spray, the A. cunninghamiana plant pots demanded high herbicide doses due to this species' larger foliar area, during application, making the herbicide contact with weeds difficult. Still in this application modality,light intoxication symptoms were observed in the ornamental plants, being more evident in the A. cunninghamiana plants. For the direct spray modality, no interaction among the factors, species and herbicide concentration, nor herbicide behavior differences were observed for the characteristics evaluated. Intoxication was not observed in the ornamental plants in none of the treatments evaluated, for the direct spray modality. Efficient P. microphylla control was verified for rates above 90% at 300, 320 and 340 kg ha-1 of oxyfluorfen, plants of Z
Directory of Open Access Journals (Sweden)
Fatma Şafak
2017-09-01
Full Text Available This study was conducted in order to detect Tomato spotted wilt virus (TSWV, Irish yellow spot virus (IYSV and Impatients necrotic spot virus (INSV in ornamental plants growing in hobby gardens and landscaping areas in Adalar district (Büyükada, Heybeliada, Kınalıada and Burgazada of Istanbul province between 2015 and 2016. During the surveys carried out in that district, the samples were collected from both simptomatologically suspicious ornamental plants and the plants which did not show any symptoms. All of the collected samples (n=150 were firstly tested by Double Antibody Sandwich (DAS ELISA and none of the samples were found to be infected with TSWV and INSV. The samples detected to be positive with IYSV by ELISA tests were then used in RT-PCR studies. At the RT-PCR using the IYSV-465c; IYSV-239f primer pair, a band with a size of 240 bp was observed for Pittosporum tobira and Hydrangea macrophylla. Therefore, the presence of IYSV infection in Adalar was also confirmed molecularly.
Directory of Open Access Journals (Sweden)
Marlon López
2015-09-01
Full Text Available Potato Genebank of the Universidad Austral de Chile (UACh is an important gene bank in Chile. The accessions collected all over the country possess high genetic diversity, present interesting agronomic and cooking traits, and show resistance to biotic and abiotic stress. A particularly interesting subgroup of the gene bank includes the accessions collected in the South of Chile, the Chilota Potato Genebank. The focus of this study is the identification of virus and nematode resistant genes in potatoes (Solatium tuberosum L., using the RYSC3 and YES3-3B molecular markers. The Potato virus Y(PVY resistance genes Ry adg and Ry sto were identified. Furthermore, the CP60 marker was used to assess the Rx resistance gene that confers resistance to Potato virus X (PVX. In addition, the HC and GRO1-4 markers were utilized to identify the GpaVvrn_QTL and Gro1-4, resistance genes of Globodera pallida and Globodera rostochiensis, respectively. Both G. pallida and G. rostochiensis are Potato Cyst Nematodes (PCN. The plant material used in this study included leaves from 271 accessions of the gene bank. These samples were collected in the field where natural pathogen pressure of potential viruses and diseases exists. ELISA assays were run for field detection of PVY and PVX. However, there have been no previous reports of nematode presence in the plant material. The results herein presented indicate presence of virus and nematode resistance genes in accessions of the Chilota Potato Genebank. In terms of virus resistance, 99 accessions out of the 271 tested possess the Ry adg resistance gene and 17 accessions of these 271 tested have the Ry sto resistance gene. Also, 10 accessions showed positive amplification of the Rxl resistant gene marker. As to nematode resistance, 99 accessions have possible resistance to G. pallida and 54 accessions show potential resistance to G. rostochiensis as detected using the available molecular markers.
Yang, Xiao; Richardson, Patricia A.; Hong, Chuanxue
2014-01-01
A novel Phytophthora species was frequently recovered from irrigation reservoirs at several ornamental plant production facilities in eastern Virginia. Initial sequencing of the internal transcribed spacer (ITS) region of this species generated unreadable sequences due to continual polymorphic positions. Cloning and sequencing the ITS region as well as sequencing the mitochondrially encoded cytochrome c oxidase 1 and beta-tubulin genes revealed that it is a hybrid between P. taxon PgChlamydo as its paternal parent and an unknown species genetically close to P. mississippiae as its maternal parent. This hybrid has some diagnostic morphological features of P. taxon PgChlamydo and P. mississippiae. It produces catenulate hyphal swellings, characteristic of P. mississippiae, and chlamydospores, typical of P. taxon PgChlamydo. It also produces both ornamented and relatively smooth-walled oogonia. Ornamented oogonia are another important diagnostic character of P. mississippiae. The relatively smooth-walled oogonia may be indicative of oogonial character of P. taxon PgChlamydo. The new hybrid is described here as Phytophthora ×stagnum. PMID:25072374
Katarzyna Wróblewska; Regina Dębicz
2012-01-01
Recent research has proved that supplementary application of silicon, involved in plant tolerance against many stress factors, positively influences plant development improving the quality of ornamental plants. A two-factorial experiment involved four cultivars of ornamental plants: Argyranthemum frutescens 'Blazer Rose', Xerochrysum bracteatum 'Gold', Osteospermum ecklonis 'Grande Pink Blush', and Gaura lindheimeri 'Corinas Choice' The first experimental factor was the concentration of Actis...
Czech Academy of Sciences Publication Activity Database
Püschel, David; Rydlová, Jana; Vosátka, Miroslav
2014-01-01
Roč. 80, Aug 2014 (2014), s. 93-99 ISSN 0929-1393 R&D Projects: GA MŠk 1M0571 Institutional support: RVO:67985939 Keywords : ornamental plants * arbuscular mycorrhizal fungi * beat-based substrate Subject RIV: EF - Botanics Impact factor: 2.644, year: 2014
Directory of Open Access Journals (Sweden)
Boros Lech
2014-12-01
Full Text Available The main purpose of this work was to analyse the morphological, phenological and agronomical variability among common bean local populations from The National Centre for Plant Genetic Resources, Polish Genebank, in order to know the relation among them, and to identify potentially useful accessions for future production and breeding. A considerable genotypic variation for number of seeds per plant, number of pods per plant and weight of seeds per plant were found. Studied bean accessions differed significantly in terms of thousand seeds weight (TSW as well as severity of bacterial halo blight and anthracnose, the major bean diseases. The lowest genotypic diversity was found for the percentage of protein in the seeds, the length of the vegetation period and lodging. The cluster analysis allowed identification of five groups of bean accessions. Genotypes from the first cluster (POLPOD 98-77, KOS 002 and Raba cv. and from the second cluster (WUKR 06-573a, KRA 4, WUKR 06-0534 together with Prosna cv. are of the highest usefulness for breeding purposes. There was no grouping of local populations depending on region of origin.
Clonal evaluation of new ornamental pineapple hybrids to use as cut flowers
Directory of Open Access Journals (Sweden)
Davi Silva Costa Junior
2016-09-01
Full Text Available Embrapa Cassava and Fruits has developed ornamental pineapple hybrids for several categories of ornamental use including cut flowers, potted plants and landscaping. The objective of this study was to carry out a clonal evaluation of two ornamental hybrids using quantitative and qualitative morphological descriptors to recommend these hybrids as new ornamental pineapple cultivars. Twenty plants of each hybrid (PL01 and PL04 were evaluated regarding the response to floral induction as well as the stability and homogeneity of the clones in two production cycles. The descriptive statistics were calculated and analyzed to determine the genetic distance based on the Gower algorithm. Four groups were formed, two using parental data and the other two containing the different hybrids that were evaluated in the two growing cycles. In the floral evaluation, the time from field planting to harvest of the stem as a cut flower was determined to be as long as 17 months in the first cycle and 13.5 months in the second cycle for both hybrids. They were characterized as a novelty in the flower market; they showed genetic stability and homogeneity and can be recommended as new cultivars of ornamental pineapple because they exhibit satisfactory quality and meet the market requirements.
Wanlop, Atcharaphan; Wongsawad, Chalobol; Prattapong, Pongphol; Wongsawad, Pheravut; Chontananarth, Thapana; Chai, Jong-Yil
2017-08-01
The prevalence of Centrocestus formosanus metacercariae was investigated in ornamental fish purchased from a pet shop in Chiang Mai, Thailand, including Carassius auratus (goldfish), Cyprinus carpio (Koi), Poecilia latipinna (Sailfin Molly), Danio rerio (Zebrafish), and Puntigrus tetrazona (Tiger barb). The parasite species was identified by the morphology of worms as well as by a molecular approach using ITS2. The results showed that 50 (33.3%) of 150 fish examined were infected with the metacercariae. The highest prevalence was found in C. auratus (83.3%), and the highest intensity was noted in C. carpio (70.8 metacercariae/fish). The most important morphological character was the presence of 32-34 circumoral spines on the oral sucker. The phylogenetic studies using the rRNA ITS2 region revealed that all the specimens of C. formosanus in this study were grouped together with C. formosanus in GenBank database. This is the first report on ornamental fish, C. carpio, P. latipinna, D. rerio, and P. tetrazona, taking the role of second intermediate hosts of C. formosanus in Thailand. Prevention and control of metacercarial infection in ornamental fish is urgently needed.
Breeding Hedychium Species, Ornamental Ginger Plants with Insecticidal and Anti-Microbial Activities
Hedychium species belong to the ginger family with great potential as ornamentals, but lodging is an impediment to this possibility, so there is a need for more compact Hedychium cultivars. Hedychium muluense (diploid) is one of the few dwarf species, but it is not ornamentally as attractive as som...
Directory of Open Access Journals (Sweden)
Roman Hołubowicz
2013-12-01
Full Text Available In the years 1996-1997 the experiments were carried out on methods to investigate seed vigour of tassel flower (Amaranthus caudatus L., sand pink (Dianthus chinensis L., babies' breath (Gypsophila elegans M.B., sweet pea (Lathyrus odorathus L., African marigold (Tagetes erecta L. and zinnia (Zinnia elegans Jasq.. The main goals of this research were to specify conditions for accelerated ageing (AA of the seeds of a few selected ornamental plant species and to choose the most appropriate methods for their seed vigour evaluation in the laboratory and greenhouse conditions. All used in the experiments seeds came from the commercial seed lots from Polish seed company. Evaluation was carried out on the seed samples with high and low vigour. The latter ones were received through subjecting the seed samples to AA, i.e. by placing them in 100% relative humidity (RH at 44°C, except African marigold-at 42°C, in the darkness and keeping them for 144, 88, 100, 48, 72 and 72 hours, respectively. The tested seed vigour estimated methods included the Germ's method, the 2,3,5-triphenyl tetrazoilum chloride (TTC method and the test of plant emergences in the greenhouse. The high vigour seeds samples were used as a check. The Germ's method was found to be useful to evaluate sand pink, babies' breath and African marigold seed vigour, whereas the TTC method was found to be suitable for vigour evaluation of sand pink, babies' breath and zinnia. At present stage of our knowledge about seed vigour, the plant emergences in the greenhouse method was found to be the best for evaluation of seed vigour of tassel flower, sand pink, babies' breath, sweet pea and zinnia. It is reasonable to combine a few methods of seed vigour evaluation for ornamental plant species.
O Elansary, Hosam; Ashfaq, Muhammad; Ali, Hayssam M; Yessoufou, Kowiyou
2017-01-01
DNA barcoding relies on short and standardized gene regions to identify species. The agricultural and horticultural applications of barcoding such as for marketplace regulation and copyright protection remain poorly explored. This study examines the effectiveness of the standard plant barcode markers (matK and rbcL) for the identification of plant species in private and public nurseries in northern Egypt. These two markers were sequenced from 225 specimens of 161 species and 62 plant families of horticultural importance. The sequence recovery was similar for rbcL (96.4%) and matK (84%), but the number of specimens assigned correctly to the respective genera and species was lower for rbcL (75% and 29%) than matK (85% and 40%). The combination of rbcL and matK brought the number of correct generic and species assignments to 83.4% and 40%, respectively. Individually, the efficiency of both markers varied among different plant families; for example, all palm specimens (Arecaceae) were correctly assigned to species while only one individual of Asteraceae was correctly assigned to species. Further, barcodes reliably assigned ornamental horticultural and medicinal plants correctly to genus while they showed a lower or no success in assigning these plants to species and cultivars. For future, we recommend the combination of a complementary barcode (e.g. ITS or trnH-psbA) with rbcL + matK to increase the performance of taxa identification. By aiding species identification of horticultural crops and ornamental palms, the analysis of the barcode regions will have large impact on horticultural industry.
Yousef, Eltohamy A A; Müller, Thomas; Börner, Andreas; Schmid, Karl J
2018-01-01
Cauliflower (Brassica oleracea var. botrytis) is an important vegetable crop for human nutrition. We characterized 192 cauliflower accessions from the USDA and IPK genebanks with genotyping by sequencing (GBS). They originated from 26 different countries and represent about 44% of all cauliflower accessions in both genebanks. The analysis of genetic diversity revealed that accessions formed two major groups that represented the two genebanks and were not related to the country of origin. This differentiation was robust with respect to the analysis methods that included principal component analysis, ADMIXTURE and neighbor-joining trees. Genetic diversity was higher in the USDA collection and significant phenotypic differences between the two genebanks were found in three out of six traits investigated. GBS data have a high proportion of missing data, but we observed that the exclusion of single nucleotide polymorphisms (SNPs) with missing data or the imputation of missing SNP alleles produced very similar results. The results indicate that the composition and type of accessions have a strong effect on the structure of genetic diversity of ex situ collections, although regeneration procedures and local adaptation to regeneration conditions may also contribute to a divergence. Fst-based outlier tests of genetic differentiation identified only a small proportion (cauliflower genebank material and our results suggest that it may be useful to incorporate routine genotyping into accession management and seed regeneration to monitor the diversity present in ex situ collections and to reduce the loss of genetic diversity during seed regeneration.
Genetic engineering and sustainable production of ornamentals: current status and future directions.
Lütken, Henrik; Clarke, Jihong Liu; Müller, Renate
2012-07-01
Through the last decades, environmentally and health-friendly production methods and conscientious use of resources have become crucial for reaching the goal of a more sustainable plant production. Protection of the environment requires careful consumption of limited resources and reduction of chemicals applied during production of ornamental plants. Numerous chemicals used in modern plant production have negative impacts on human health and are hazardous to the environment. In Europe, several compounds have lost their approval and further legal restrictions can be expected. This review presents the more recent progress of genetic engineering in ornamental breeding, delivers an overview of the biological background of the used technologies and critically evaluates the usefulness of the strategies to obtain improved ornamental plants. First, genetic engineering is addressed as alternative to growth retardants, comprising recombinant DNA approaches targeting relevant hormone pathways, e.g. the gibberellic acid (GA) pathway. A reduced content of active GAs causes compact growth and can be facilitated by either decreased anabolism, increased catabolism or altered perception. Moreover, compactness can be accomplished by using a natural transformation approach without recombinant DNA technology. Secondly, metabolic engineering approaches targeting elements of the ethylene signal transduction pathway are summarized as a possible alternative to avoid the use of chemical ethylene inhibitors. In conclusion, molecular breeding approaches are dealt with in a way allowing a critical biological assessment and enabling the scientific community and public to put genetic engineering of ornamental plants into a perspective regarding their usefulness in plant breeding.
Genetic engineering and sustainable production of ornamentals
DEFF Research Database (Denmark)
Lütken, Henrik Vlk; Clarke, Jihong Liu; Müller, Renate
2012-01-01
Abstract Through the last decades, environmentally and health-friendly production methods and conscientious use of resources have become crucial for reaching the goal of a more sustainable plant production. Protection of the environment requires careful consumption of limited resources and reduct......Abstract Through the last decades, environmentally and health-friendly production methods and conscientious use of resources have become crucial for reaching the goal of a more sustainable plant production. Protection of the environment requires careful consumption of limited resources....... This review presents the more recent progress of genetic engineering in ornamental breeding, delivers an overview of the biological background of the used technologies and critically evaluates the usefulness of the strategies to obtain improved ornamental plants. First, genetic engineering is addressed......, compactness can be accomplished by using a natural transformation approach without recombinant DNA technology. Secondly, metabolic engineering approaches targeting elements of the ethylene signal transduction pathway are summarized as a possible alternative to avoid the use of chemical ethylene inhibitors...
Directory of Open Access Journals (Sweden)
Daniela Bărbuceanu
2012-04-01
Full Text Available The observations carried-out in 2008/2010 to ornamental plants from parks and greenhouses of ADP Pitesti relieve 12 species of thrips. One species of them, Frankliniella occidentalis was identified in greenhouses on Rosa sp., Dianthus sp. and Zantedeschia sp. In parks, the thrips species belong to 12 species, dominated by Frankliniella intonsa. All of them are polypfagous and divided in two throphic levels: primary and secondary consumers. The thrips species are mentioned for the first time in Romania on this host plant. In greenhouses are necessary intensive chemical treatments and methods of cultural hygiene to limit the F. occidentalis populations.
2013-01-01
Advances in research in the past few years on the ornamental plant torenia (Torenia spps.) have made it notable as a model plant on the frontier of genetic engineering aimed at studying ornamental characteristics and pest control in horticultural ecosystems. The remarkable advantage of torenia over other ornamental plant species is the availability of an easy and high-efficiency transformation system for it. Unfortunately, most of the current torenia research is still not very widespread, because this species has not become prominent as an alternative to other successful model plants such as Arabidopsis, snapdragon and petunia. However, nowadays, a more global view using not only a few selected models but also several additional species are required for creating innovative ornamental traits and studying horticultural ecosystems. We therefore introduce and discuss recent research on torenia, the family Scrophulariaceae, for secondary metabolite bioengineering, in which global insights into horticulture, agriculture and ecology have been advanced. Floral traits, in torenia particularly floral color, have been extensively studied by manipulating the flavonoid biosynthetic pathways in flower organs. Plant aroma, including volatile terpenoids, has also been genetically modulated in order to understand the complicated nature of multi-trophic interactions that affect the behavior of predators and pollinators in the ecosystem. Torenia would accordingly be of great use for investigating both the variation in ornamental plants and the infochemical-mediated interactions with arthropods. PMID:23803155
Directory of Open Access Journals (Sweden)
Spyros Papapetros
2012-12-01
Full Text Available What would be the relationship between the rich historiography of ornament in the late nineteenth century and ornament’s ostensible eclipse from early twentieth-century building practice? Alina Payne’s From Ornament to Object retraces the gradual shift in interest from the endless stylistic iterations of architectural ornamentation in fin-de-siécle culture to the unornamented artifacts of architectural modernism and argues that such plain yet highly sculptural implements carry over architecture’s rhetorical function previously allotted to ornamentation. While Payne’s “genealogy” is based on a carefully crafted polarity, this review-essay underscores the implicit analogies and correspondences between ornament and object and demonstrates how Payne’s intricate historical design corroborates that ornament is an object, a highly privileged but also an enigmatic one, whose loss and periodic recovery replicate the negative dialectics between art historiography and design practice.
Directory of Open Access Journals (Sweden)
Gilberto Luiz Curti
2012-06-01
Full Text Available O girassol ornamental amplia o mercado de comercialização de plantas ornamentais no Brasil. Desta forma, este trabalho teve como objetivo apresentar uma caracterização do manejo pós-colheita e propor uma escala de senescência da cultura do girassol ornamental quanto à senescência, durabilidade das flores e referências de valores de comercialização. A produção de flores é uma atividade de alto risco pela fragilidade do produto, qualidades estéticas e as condições de produção, bem como a menor durabilidade pós-colheita do produto. Esse estudo propõe uma escala de senescência para cultivares de girassol ornamental quanto à senescência dos capítulos para atribuir diferentes remunerações e possibilidades de comercialização da cultura.The ornamental sunflower widen the market of ornamental plants in Brazil. Thus, this study aimed to present a characterization of post-harvest management and to propose a range of senescence stage of sunflower as an ornamental in relation to senescence, flower longevity and benchmark values of trade. The production of flowers is a high risk activity for the fragility of the product, aesthetic qualities and conditions of production as well as lower post-harvest durability of the product. This study proposes a range of senescence stages for ornamental sunflower cultivars as the aging of different chapters to assign salaries and marketability of the crop.
Directory of Open Access Journals (Sweden)
Regina Dębicz
2012-12-01
Full Text Available Silicon is known as an element stimulating plant immunity and resistance to unfavorable conditions. Additional treatment with silicon may also cause a positive change in plant performance, improving the quality of ornamental plants. In the years 2009-2010, a two-factorial experiment was conducted involving three cultivars of seasonal ornamental plant species: creeping zinnia Sanvitalia speciosa 'Sunbini', vervain Verbena 'Patio Blue', and purslane Portulaca umbraticola 'Duna Red'. The first experimental factor was the concentration of Actisil preparation being an equivalent of 60, 120, and 180 mg Si×dm-3, applied three times by spraying, the second one was the type of medium: peat substrate and peat substrate with sand. The experiment proved the beneficial effect of fertilization with silicon on plant development of Verbena and the number of shoots of all examined plant species. The higher concentrations of Actisil were applied, the higher number of shoots the plants developed. Plants treated with Actisil also produced a higher number of buds and flowers or inflorescences featuring an increased diameter. Plants cultivated in peat substrate flowered better.
Paula Cristina Carvalho Lima; Milena Maria Tomaz Oliveira; Wellington Souto Ribeiro; Lucas Cavalcante Costa; Fernando Luiz Finger
2017-01-01
The species of Capsicum genus have great genetic variability with enormous potential for marketing as ornamental potted plants. The exposure at ethylene induces various deleterious responses during plants life cycle, but there are few studies on how the ethylene affects early developmental stages of these ornamental plants. Thus, this study aimed to evaluate the effects of the application of ethylene and ethylene inhibitors, 1-methylcyclopropene (1-MCP) and silver thiosulphate (STS) in two ea...
On the issue of drought-tolerant ornamental woody plants the Black Sea coast (near Sochi
Directory of Open Access Journals (Sweden)
Karpun Yuriy Nikolaevich
2017-12-01
Full Text Available The summer-autumn drought, when rainfall in July - September, less than 200 mm, a significant limiting factor for ornamental woody plants of the Black Sea coast of the Caucasus. In the region under dry periods are irregular, the study of their impact on plants is problematic and delayed for many years. The last drought was in 2015, when the three months fell only 87 mm of rainfall. In the last days of the dry period were examined 501 views and intraspecific taxa belonging to 112 genera, bushy evergreen shrubs and trees, as the most vulnerable. Evaluation of drought resistance was evaluated according to our 3-point system, and the results were analyzed in the context of consolidated floristic regions. The results showed adequate drought tolerance, not less than 65 %, cultivated in the region of evergreen shrubs and bushy trees mainly from East Asia and the Mediterranean. Among the species that are recommended for mass plantings, for the pre-emptive use of landscaping and street-resistant plants 67-80 %. All this ensures stability and high decorative plants ofSochi city.
Tissue culture of ornamental cacti
Directory of Open Access Journals (Sweden)
Eugenio Pérez-Molphe-Balch
2015-12-01
Full Text Available Cacti species are plants that are well adapted to growing in arid and semiarid regions where the main problem is water availability. Cacti have developed a series of adaptations to cope with water scarcity, such as reduced leaf surface via morphological modifications including spines, cereous cuticles, extended root systems and stem tissue modifications to increase water storage, and crassulacean acid metabolism to reduce transpiration and water loss. Furthermore, seeds of these plants very often exhibit dormancy, a phenomenon that helps to prevent germination when the availability of water is reduced. In general, cactus species exhibit a low growth rate that makes their rapid propagation difficult. Cacti are much appreciated as ornamental plants due to their great variety and diversity of forms and their beautiful short-life flowers; however, due to difficulties in propagating them rapidly to meet market demand, they are very often over-collected in their natural habitats, which leads to numerous species being threatened, endangered or becoming extinct. Therefore, plant tissue culture techniques may facilitate their propagation over a shorter time period than conventional techniques used for commercial purposes; or may help to recover populations of endangered or threatened species for their re-introduction in the wild; or may also be of value to the preservation and conservation of the genetic resources of this important family. Herein we present the state-of-the-art of tissue culture techniques used for ornamental cacti and selected suggestions for solving a number of the problems faced by members of the Cactaceae family.
Mutation breeding in ornamental plants
International Nuclear Information System (INIS)
Datta, S.K.
1990-01-01
Full text: Mutation induction produced a large number of new promising varieties in ornamental species. 37 new mutants of Chrysanthemum and 14 of rose have been developed by mutations and released for commercialisation. The mutations in flower colour/shape were detected as chimeras in M 1 V 1 , M 1 V 2 , M 1 V 3 generations. The mutation frequency varied with the cultivar and exposure to gamma rays. Comparative analysis of original cultivars and their respective induced mutants on cytomorphological, anatomical and biochemical characters are being carried out for better understanding of the mechanism involved in the origin and evolution of somatic flower colour/shape mutations. Cytological analysis with reference to chromosomal aberrations, chromosome number, ICV, INV and DNA content gave no differences between the original and mutant cultivars. Analysis of florets/petal pigments by TLC and spectrophotometric methods indicated both qualitative and quantitative changes. (author)
Triplicate water samples were collected monthly from 9 waterways (8 recycling containment basins (RCBs) and 1 stream) on 4 commercial ornamental plant nurseries from February to July, and from 1 RCB and nursery from April to October. Four RCBs, one per nursery, were actively utilized as an irrigatio...
Ellis, David; Chavez, Oswaldo; Coombs, Joseph J; Soto, Julian V; Gomez, Rene; Douches, David S; Panta, Ana; Silvestre, Rocio; Anglin, Noelle Lynette
2018-05-24
Breeders rely on genetic integrity of material from genebanks, however, mislabeling and errors in original data can occur. Paired samples of original material and their in vitro counterparts from 250 diverse potato landrace accessions from the International Potato Center (CIP), were fingerprinted using the Infinium 12K V2 Potato Array to confirm genetic identity and evaluate genetic diversity. Diploid, triploid, and tetraploid accessions were included representing seven cultivated potato taxa (Hawkes, 1990). Fingerprints between mother field plants and in vitro clones, were used to evaluate identity, relatedness, and ancestry. Clones of the same accession grouped together, however eleven (4.4%) accessions were mismatches genetically. SNP genotypes were used to construct a phylogeny to evaluate inter- and intraspecific relationships and population structure. Data suggests that the triploids evaluated are genetically similar. STRUCTURE analysis identified several putative hybrids and suggests six populations with significant gene flow between. This study provides a model for genetic identity of plant genetic resources collections as mistakes in conservation of these collections and in genebanks is a reality and confirmed identity is critical for breeders and other users of these collections, as well as for quality management programs and to provide insights into the diversity of the accessions evaluated.
The evolution of mutual ornamentation
Kraaijeveld, Ken; Kraaijeveld-Smit, Femmie J. L.; Komdeur, Jan
2007-01-01
Many conspicuous ornamental traits in animals are expressed in both males and females. Despite this, most research has focused on sexually dimorphic ornamentation. Mutual ornamentation has often been viewed as a result of either a nonadaptive genetic correlation between the sexes or similar
Mitochondrial function, ornamentation, and immunocompetence.
Koch, Rebecca E; Josefson, Chloe C; Hill, Geoffrey E
2017-08-01
Understanding the mechanisms that link ornamental displays and individual condition is key to understanding the evolution and function of ornaments. Immune function is an aspect of individual quality that is often associated with the expression of ornamentation, but a general explanation for why the expression of some ornaments seems to be consistently linked to immunocompetence remains elusive. We propose that condition-dependent ornaments may be linked to key aspects of immunocompetence through co-dependence on mitochondrial function. Mitochondrial involvement in immune function is rarely considered outside of the biomedical literature, but the role of mitochondria as the primary energy producers of the cell and the centres of biosynthesis, the oxidative stress response, and cellular signalling place them at the hub of a variety of immune pathways. A promising new mechanistic explanation for correlations between a wide range of ornamental traits and the properties of individual quality is that mitochondrial function may be the 'shared pathway' responsible for links between ornament production and individual condition. Herein, we first review the role of mitochondria as both signal transducers and metabolic regulators of immune function. We then describe connections between hormonal pathways and mitochondria, with implications for both immune function and the expression of ornamentation. Finally, we explore the possibility that ornament expression may link directly to mitochondrial function. Considering condition-dependent traits within the framework of mitochondrial function has the potential to unify central tenets within the study of sexual selection, eco-immunology, oxidative stress ecology, stress and reproductive hormone biology, and animal physiology. © 2016 Cambridge Philosophical Society.
Energy Technology Data Exchange (ETDEWEB)
Persson, Joergen [Jordbruksverket, Joenkoeping (Sweden)
2012-11-15
During the past decade, Swedish greenhouse cultivation has seen a continual structural and energy use transformation. As the number of holdings and the cultivated area has decreased, energy use has been reduced, streamlined and has changed character. The present report is a description of the current energy use pattern in the Swedish greenhouse business, as well as an overview of changes since 2002. The focus lies on the - from an area perspective - major branches: tomato-, cucumber- and ornamental plant cultivation. Between 2002 and 2011, the number of Swedish commercial greenhouse holdings has been reduced by 40 %, while the cultivated area has decreased by 12 %. During the same period, energy consumption for cultivation has been reduced from about 1,2 TWh to just over 0,6 TWh. The relatively large decrease in energy consumption as compared to cultivation area, signifies an increased energy efficiency. For the entire greenhouse cultivation, energy consumption was reduced from 371 to 215 kWh per square meter during the 2002-2011 period. For the specific branches, the decreased amounted to 21 %, 54 % and 58 % for tomato-, cucumber and ornamental plant cultivation, respectively. The use of various energy sources exhibited a distinct alteration between 2002 and 2011. The share of fossil fuels decreased from 77 % of the total energy consumption in 2002, to 43 % in 2011. Meanwhile, the share of biofuels increased from 5 % to 37 % of the energy used. Tomato- and cucumber cultivation exhibited a biofuel share of 55 % and 56 %, respectively, while the use of biofuels in the cultivation of ornamental plants reached 31 %. Holdings exhibiting different energy source use profiles also exhibited some general differences regarding cultivation branch, geographic location, greenhouse size and use of materials. Even as the change in direction towards a higher share of biofuels in the energy mix appears clear, changes on a holding level are more complex. While 95 holdings increased
Induced mutations in ornamental plants by 'in vitro' irradiation of Petunia hybrida meristems
International Nuclear Information System (INIS)
Gonzalez-Jimenez, J.
1993-01-01
In recent decades it has been observed that for the induction of mutation in ornamental plants we can obtain better results when the plants are irradiated in vegetative state and even better 'in vitro' that when its are irradiated 'in vivo'. In this work the possibilities are showed to avoid the best use of a new biotechnology: the gamma irradiations on the meristem 'in vitro'. A tissue culture method was described for the best vegetative propagation of Petunia hybrid hort through morphogenesis induction of meristem. These were planted in the Murashige and Skoog's basic medium added with BAP and ANA. The pH was adjusted to 6.5 prior autoclaving at 121 Centigrade degree and 1.1 Kg/ cm 2 for 15 minutes. Latter the meristem of plantules in immature and mature physiology stated were irradiated with gamma ray doses ranging from 1.0 at 10.0 Gy. The meristem were then subcultived aseptically with the following results: 1) The immature stage was higher radio sensibilities. 2) The LD 50 for the matured plants was to ranged from 1.0 at 9.0 Gy. and immature 1.0 at 8.0 Gy. 3) The better doses was at 7.5 Gy. 4) The meristem gamma irradiation at 7.5 Gy. showed in the first culture: the adventitious bud induced and the multi meristem formation. 5) In the second cultured the results reveals the 'variegadas' plants formations and the new purples flowers. (Author)
Benson, D; Lipman, D J; Ostell, J
1993-01-01
The GenBank sequence database has undergone an expansion in data coverage, annotation content and the development of new services for the scientific community. In addition to nucleotide sequences, data from the major protein sequence and structural databases, and from U.S. and European patents is now included in an integrated system. MEDLINE abstracts from published articles describing the sequences provide an important new source of biological annotation for sequence entries. In addition to ...
Directory of Open Access Journals (Sweden)
Luis Carlos Sandoval-Herazo
2018-05-01
Full Text Available The high costs involved in treating wastewater are problems that developing countries confront, mainly in rural areas. Therefore, Constructed Wetlands (CWs, which are composed of substrate, vegetation, and microorganisms, are an economically and ecologically viable option for wastewater treatment in these places. There is a wide variety of possibilities for substrates and ornamental plants that have not yet been evaluated to be implemented in future CW designs. The goal of this study was to evaluate the process of adaptation and removal of wastewater pollutants in CW microcosms using different terrestrial ornamental plants (Lavandula sp., Spathiphyllum wallisii, and Zantedeschia aethiopica. Those plants were sown in two types of substrate: red volcanic gravel (RVG and polyethylene terephthalate (PET. CWs with vegetation reduced 5-day biochemical oxygen demand (BOD5 by 68% with RVG substrate and 63% with PET substrate, nitrates 50% in RVG substrate and 35% in PET substrate, phosphates 38% in RVG substrate and 35% in PET substrate, and fecal coliforms 64% in RVG and 59% in PET substrate. In control microcosms without vegetation, reductions were significantly lower than those in the presence of plants, with reduction of BOD5 by 61% in RVG substrate and 55% in PET substrate, nitrates 26% in RVG substrate and 22% in PET substrate, phosphates 27% in RVG substrate and 25% in PET substrate. Concerning fecal coliforms 62% were removed in RVG substrate and 59% in PET substrate. Regarding the production of flowers, Lavandula sp. did not manage to adapt and died 45 days after sowing and did not produce flowers. Spathiphyllum wallisii produced 12 flowers in RVG and nine flowers in PET, while Zantedeschia aethiopica produced 10 in RVG and 7 in PET. These results showed that the use of substrates made of RVG and PET is a viable alternative to be implemented in CWs. In addition, the reuse of PET is an option that decreases pollution by garbage. The plants
DEFF Research Database (Denmark)
Glaveanu, Vlad Petre
2014-01-01
of their manifold functions that integrates aesthetic and utilitarian, individual and social roles. Ornaments help us to identify and locate, tell or communicate, remind and organise our action, they guide our attention, express and individualise, can generate an experience, beautify as well as re......-present. These functions are illustrated with examples from a study of Easter egg decoration practices in northern Romania. In the end, the ‘meta-function’ of emergence is discussed and consideration is given to the spatial and temporal contexts of ornaments. Future opportunities for theorising ornamentation...
National Plant Germplasm System: Critical Role of Customer Service
The National Plant Germplasm System (NPGS) conserves plant genetic resources, not only for use by future generations, but for immediate use by scientists and educators around the world. With a great deal of interaction between genebank curators and users of plant genetic resources, customer service...
International Nuclear Information System (INIS)
Jiaxiang, J.; Khalid, M.; Hong, Z.; Leqi, Y.; Dongqin, T.; Danfeng, H.
2018-01-01
Biogas slurry is a good source of plant nutrients and substituting chemical fertilizers with biogas slurry not only achieve resource utilization of slurry, but also reduce the amount of fertilizer. The present study investigated the influence of different ratios of biogas slurry fertilizer (BSF) on the growth, yield and quality characteristics of ornamental lettuce 'Biscia Rossa'. Results revealed that BSF significantly (p<0.05) improved the growth of ornamental lettuce on treatment with Z1 fertilizer; the plant height was increased by 12.66% and 16.75%, while leaf area was improved by 19.97% and 42.03%, in comparison with control group. The improvement in yield of ornamental lettuce was noted in varying degrees by BSF. The highest dry and fresh weights were observed in case of Z1 treated lettuce plants. The fresh weight was 33.52%, 44.77%, 43.96% and 49.04% higher than that of other 2 fertilizers and 2 control groups, respectively. Whereas the dry weight was 2.7 and 3.17-times greater than that of two control groups. The biogas slurry irrigation also considerably improved the quality of ornamental lettuce. Moreover, it was observed that vitamin C, anthocyanin, soluble sugar and protein were higher than that of control groups. Contrarily, the BSF led to decrease in nitrate-nitrogen content in ornamental lettuce. (author)
Directory of Open Access Journals (Sweden)
Katarzyna Wróblewska
2012-12-01
Full Text Available Recent research has proved that supplementary application of silicon, involved in plant tolerance against many stress factors, positively influences plant development improving the quality of ornamental plants. A two-factorial experiment involved four cultivars of ornamental plants: Argyranthemum frutescens 'Blazer Rose', Xerochrysum bracteatum 'Gold', Osteospermum ecklonis 'Grande Pink Blush', and Gaura lindheimeri 'Corinas Choice' The first experimental factor was the concentration of Actisil preparation being an equivalent of 60, 120, and 180 mg Si×dm-3, applied three times by spraying, while the second one was the type of medium: peat substrate and peat substrate with sand. Actisil had a beneficial effect on the number of lateral shoots in all plants. The highest number of buds and inflorescences was determined in Xerochrysum and Osteospermum plants sprayed with 0.3% Actisil, and 0.2% Actisil in case of Argyranthemum and Gaura. The effect of medium type on plant growth depended on plant species. Argyranthemum and Osteospermum plants cultivated in the medium with sand showed inhibited growth, although medium type did not affect the growth of Xerochrysum.
Directory of Open Access Journals (Sweden)
Miriam Valli Büttow
2010-06-01
Full Text Available Os acessos de pimentas e pimentões (Capsicum annuum L. da Embrapa Clima Temperado constituem parte dos recursos genéticos de Capsicum. Contudo, é necessário conhecer o quanto esses genótipos são divergentes para que possam ser utilizados em programas de melhoramento. Os objetivos deste trabalho foram avaliar e caracterizar a divergência genética entre os acessos de C. annuum do banco ativo de germoplasma de Capsicum da Embrapa Clima Temperado. Foram caracterizados 20 acessos com base em 36 descritores morfológicos multicategóricos. A diversidade genética foi avaliada por meio do método de agrupamento de Tocher e UPGMA. O método de Tocher formou três grupos de acessos. Pelos critérios utilizados, os dois métodos foram concordantes em agrupar isoladamente o acesso P77, que apresenta caracteres morfológicos particulares em relação aos demais. O estudo realizado evidencia a existência de variabilidade genética moderada entre os 20 acessos de C. annuum estudados e apresenta acessos com características ornamentais, os quais podem ser incorporados em programas de melhoramento.Accessions of peppers and sweet peppers (Capsicum annuum of Embrapa Clima Temperado genebank (Pelotas - RS integrate Capsicum genetic resources. However, it is necessary to know how much these genotypes are different, so they can be harnessed and used in breeding programs. The aim of this study was to evaluate and characterize genetic diversity among C. annuum accessions which belongs to Capsicum Embrapa Clima Temperado genebank. Twenty accessions were characterized through 36 multicategorical morphologic descriptors. Genetic diversity was assessed using Tocher grouping method and UPGMA. Three groups of accessions were formed by Tocher. Both methods were in agreement with the isolation of P77, due to its exclusive morphological traits. The study shows moderate genetic variability among 20 accessions of C. annuum studied and introduced accession with
Ma, Jun; Kanakala, S.; He, Yehua; Zhang, Junli; Zhong, Xiaolan
2015-01-01
Background Ananas comosus var. bracteatus (Red Pineapple) is an important ornamental plant for its colorful leaves and decorative red fruits. Because of its complex genome, it is difficult to understand the molecular mechanisms involved in the growth and development. Thus high-throughput transcriptome sequencing of Ananas comosus var. bracteatus is necessary to generate large quantities of transcript sequences for the purpose of gene discovery and functional genomic studies. Results The Anana...
Substrate and fertilizer rate comparison for commercial ornamental ginger production
Hedychiums (ornamental gingers) belong to the Zingiberaceae family and have showy and fragrant flowers, which are used in leis and perfumery. Hedychium plants are mostly free of major diseases and pests and the essential oils of some species have been found to have insecticidal, antibacterial, and a...
Abad, Z Gloria; Abad, Jorge A; Cacciola, Santa Olga; Pane, Antonella; Faedda, Roberto; Moralejo, Eduardo; Pérez-Sierra, Ana; Abad-Campos, Paloma; Alvarez-Bernaola, Luis A; Bakonyi, József; Józsa, András; Herrero, Maria Luz; Burgess, Treena I; Cunnington, James H; Smith, Ian W; Balci, Yilmaz; Blomquist, Cheryl; Henricot, Béatrice; Denton, Geoffrey; Spies, Chris; Mcleod, Adele; Belbahri, Lassaad; Cooke, David; Kageyama, Koji; Uematsu, Seiji; Kurbetli, Ilker; Değirmenci, Kemal
2014-01-01
A non-papillate, heterothallic Phytophthora species first isolated in 2001 and subsequently from symptomatic roots, crowns and stems of 33 plant species in 25 unrelated botanical families from 13 countries is formally described here as a new species. Symptoms on various hosts included crown and stem rot, chlorosis, wilting, leaf blight, cankers and gumming. This species was isolated from Australia, Hungary, Israel, Italy, Japan, the Netherlands, Norway, South Africa, Spain, Taiwan, Turkey, the United Kingdom and United States in association with shrubs and herbaceous ornamentals grown mainly in greenhouses. The most prevalent hosts are English ivy (Hedera helix) and Cistus (Cistus salvifolius). The association of the species with acorn banksia (Banksia prionotes) plants in natural ecosystems in Australia, in affected vineyards (Vitis vinifera) in South Africa and almond (Prunus dulcis) trees in Spain and Turkey in addition to infection of shrubs and herbaceous ornamentals in a broad range of unrelated families are a sign of a wide ecological adaptation of the species and its potential threat to agricultural and natural ecosystems. The morphology of the persistent non-papillate ellipsoid sporangia, unique toruloid lobate hyphal swellings and amphigynous antheridia does not match any of the described species. Phylogenetic analysis based on sequences of the ITS rDNA, EF-1α, and β-tub supported that this organism is a hitherto unknown species. It is closely related to species in ITS clade 7b with the most closely related species being P. sojae. The name Phytophthora niederhauserii has been used in previous studies without the formal description of the holotype. This name is validated in this manuscript with the formal description of Phytophthora niederhauserii Z.G. Abad et J.A. Abad, sp. nov. The name is coined to honor Dr John S. Niederhauser, a notable plant pathologist and the 1990 World Food Prize laureate. © 2014 by The Mycological Society of America.
Ozdemir, Fethi Ahmet; Yildirim, Mehmet Ugur; Pourali Kahriz, Mahsa
2014-01-01
Lallemantia iberica (Bieb.) Fisch. and C. A. Mey is high valued annual ornamental and medicinal plant from Lamiaceae family that prefers dry sunny hillsides, roadsides, slopes, and fallow fields over an altitude of 500-2150 m. It bears beautiful white flowers and bloom from April to June each year. This study reports L. iberica micropropagation using cotyledon node explants isolated from 15-day-old in vitro regenerated plantlets. The cotyledon node explants were cultured on MS medium containing 0.50, 1.00 plus 2.00 mg/L BAP, 0.00, 0.01, and 0.02 mg/L NAA. Maximum shoot regeneration was noted on MS medium containing 0.50 mg/L BAP. Well-developed micropropagated shoots were rooted on MS medium containing 1.00 mg/L IBA. The rooted plants were easily hardened in the growth chamber and acclimatised in greenhouse.
The International Cocoa Genebank, Trinidad (ICG,T) is the largest public domain field gene bank collection of cacao and the correct identity of each tree is crucial for germplasm movement, evaluation and phenotypic characterization. Nine microsatellite loci were used to assess the identity of 1480 t...
Energy Technology Data Exchange (ETDEWEB)
NONE
2010-07-01
Ornamental crops are high-cash crops, grown under greenhouse conditions in semi-arid regions in Israel where a reduction in the native population of arbuscular mycorrhizal fungi (AMF) is expected due to routine soil disinfection. The application of AMF inoculum to the soil has been shown to be effective at improving plant growth and enhancing plant resilience to abiotic and biotic stresses. One of our aims is to introduce mycorrhizal application to ornamental crops, and a test case is presented here for two cultivars of lisianthus (Eustoma grandiflorum), one of the major ornamental crops grown in Israel. Several different methods of AMF application and their effects on growth, yield and vase life were examined in lisianthus grown in two different semi-arid locations in southern Israel. AMF enhanced lisianthus growth and yield, especially when introduced to the growth medium during seeding and to the pit hole during planting. Significantly enhanced growth and yield parameters included flowering stem length (58 {+-} 0.7 and 65.1 {+-} 0.7 cm for control and AMF treated, respectively) and number of flowering stems per square meter (73 {+-} 9 and 106 {+-} 6 for control and AMF treated, respectively); positive but non-significant effects were recorded on stem weight, number of flowers per stem and vase life of cut flowers. Yield enhancement was recorded under both low and regular phosphorus conditions. Although not significant, higher resilience against two pathogenic fungi was also recorded following AMF inoculation (23 {+-} 13 and 41 {+-} 10 surviving plants for control and AMF treated, respectively). Hence, AMF is suggested to be a useful growth amendment for promotion of lisianthus commercial production, and may potentially be applied to additional ornamental crops. (Author) 23 refs.
Directory of Open Access Journals (Sweden)
Shahril Efzueni Rozali
2014-01-01
Full Text Available A successful protocol was established for micropropagation in two selected varieties of exotic ornamental plants, Calathea crotalifera. The effects of different sterilization techniques, explant type, and the combination and concentration of plant growth regulators on shoots induction were studied. The axillary shoot buds explants sprouted from rhizomes in soil free conditions showed high induction rate of shoots with lowest contamination percentage when treated with combination of 30% (v/v NaOCl, 70% (v/v ethanol, and 0.3% (w/v HgCl2. In the present study, the highest number of multiple shoots was obtained in MS basal medium supplemented with 3.5 mg/L 6-Benzylaminopurine (BAP, 1.0 mg/L 1-Naphthaleneacetic acid (NAA, 3% sucrose, and 6 g/L plant agar for both varieties and was used as multiplication medium. Microshoots were highly induced when the young shoot bud explants were incised longitudinally prior subculture. Chlorophyll analysis was studied to test the effects of activated charcoal and L-glutamine on reduction of necrosis problem. The maximum roots induction was recorded on MS medium supplemented with 1.0 mg/L 1-Naphthaleneacetic acid (NAA compared to indolebutyric acid (IBA. The complete regenerated plantlets were successfully acclimatized in the soilless medium under greenhouse condition. This is the first report of rapid mass propagation for C. crotalifera.
Rozali, Shahril Efzueni; Rashid, Kamaludin A; Taha, Rosna Mat
2014-01-01
A successful protocol was established for micropropagation in two selected varieties of exotic ornamental plants, Calathea crotalifera. The effects of different sterilization techniques, explant type, and the combination and concentration of plant growth regulators on shoots induction were studied. The axillary shoot buds explants sprouted from rhizomes in soil free conditions showed high induction rate of shoots with lowest contamination percentage when treated with combination of 30% (v/v) NaOCl, 70% (v/v) ethanol, and 0.3% (w/v) HgCl2. In the present study, the highest number of multiple shoots was obtained in MS basal medium supplemented with 3.5 mg/L 6-Benzylaminopurine (BAP), 1.0 mg/L 1-Naphthaleneacetic acid (NAA), 3% sucrose, and 6 g/L plant agar for both varieties and was used as multiplication medium. Microshoots were highly induced when the young shoot bud explants were incised longitudinally prior subculture. Chlorophyll analysis was studied to test the effects of activated charcoal and L-glutamine on reduction of necrosis problem. The maximum roots induction was recorded on MS medium supplemented with 1.0 mg/L 1-Naphthaleneacetic acid (NAA) compared to indolebutyric acid (IBA). The complete regenerated plantlets were successfully acclimatized in the soilless medium under greenhouse condition. This is the first report of rapid mass propagation for C. crotalifera.
Directory of Open Access Journals (Sweden)
Renata Bažok
2016-12-01
Full Text Available In the production of ornamental plants, it is often necessary to combine plant protection products (PPPs for simultaneous pest control. The use of a combination of PPPs often leads to phytotoxicity. The aim of this study was to determine the phytotoxicity of the combination of fungicides (azoxystrobin and cyprodinil + fludioxonil and insecticides based on abamectin and thiomethoxam on the ornamental plant Petunia sp. The PPPs are used at recommended and double doses. Based on the damage, phytotoxicity indices were calculated. Petunia plants are sensitive even when PPPs are used in recommended doses. Combinations of the both insecticides with the combined fungicide based on cyprodinil and fludioxinil can be advised to protect petunias only if one applies the recommended doses. All combinations of insecticides with a fungicide based on azoxystrobin should not be applied because there is a serious risk of phytotoxicity.
Preserving Accuracy in GenBank
DEFF Research Database (Denmark)
Bidartondo, M.I.; Bruns, T. D.; Blackwell, M.
2008-01-01
GenBank, the public repository for nucleotide and protein sequences, is a critical resource for molecular biology, evolutionary biology, and ecology. While some attention has been drawn to sequence errors (1), common annotation errors also reduce the value of this database. In fact, for organisms...
Nitrogen use efficiency as a tool to evaluate the development of ornamental cacti species
Directory of Open Access Journals (Sweden)
Karina Gonçalves da Silva
2017-12-01
Full Text Available Nitrogen efficiency, along with associated indexes, is a widely used tool for assessing nutritional status in agricultural species. However, this parameter is not used in studies with ornamental plants, especially epiphytic cacti species. In particular, we know very little about the potential response of ornamental cacti to N absorption and use. Therefore, this study aimed to evaluate N use efficiency (NUE, along with its associated parameters, in three species of ornamental cacti under nitrogen nutrition. To accomplish this, Rhipsalis baccifera, Rhipsalis paradoxa and Hatiora salicornioides were fertilized by Hogland and Arnon nutrition solution modified and enriched with urea in the concentrations of 0, 33.3 or 66.6 mM N during 180 days. At the end of the experiment, efficiency indexes were calculated. Efficiency parameters varied according to species. R. baccifera presented the greatest dissimilarity among the species, with highest uptake efficiency (NUpE, but lowest use efficiency (NUtE and biomass conversion (BCE. R. paradoxa presented high values for NUE, NUtE, BCE and physiological efficiency (NPE at concentrations of 33.3 mM N, suggesting greater investment in biological processes with lower supply of N. H. salicornioides had the highest averages in most parameters measured. Our results show that these indexes provided important comparative baseline information on nutritional status and investment strategy, thus serving as a suitable analytical tool to increase knowledge about this group of ornamental plants.
DEFF Research Database (Denmark)
Adsetts Edberg Hansen, Michael; R. Hay, Fiona; Carstensen, Jens Michael
2015-01-01
We present a method for multispectral seed phenotyping as a fast and robust tool for managing genebank accessions. A multispectral vision system was used to take images of the seeds of 20 diverse varieties of rice (approximately 30 seeds for each variety). This was followed by extraction of feature...
Directory of Open Access Journals (Sweden)
Sunil Archak
2016-10-01
Full Text Available Chickpea is the third most important pulse crop as a source of dietary protein. Ever-increasing demand in Asian countries calls for breeding superior desi-type varieties, in turn necessitating the availability of characterized germplasm to breeders. The Indian National Genebank, located at the National Bureau of Plant Genetic Resources, New Delhi, conserves 14,651 accessions of chickpea. The entire set was characterized in a single large-scale experiment. High variation was observed for eight quantitative and 12 qualitative agro-morphological traits. Allelic richness procedure was employed to assemble a core set comprising 1103 accessions, 70.0% of which were of Indian origin. Comparable values of total variation explained by the first three principal components in the entire collection (51.1% and the core (52.4% together with conservation of nine pairwise r values among quantitative traits in the core collection and a coincidence rate around 99.7% indicated that the chickpea core was indeed an excellent representation of the entire chickpea collection in the National Genebank. The chickpea core exhibited greater diversity than the entire collection in agro-morphological traits, as assessed by higher variance and Shannon–Weaver diversity indices, indicating that the chickpea core maximized the phenotypic diversity available in the Indian chickpea germplasm. The chickpea core, comprising mainly indigenous desi genotypes, is expected to be an excellent resource for chickpea breeders. Information on the chickpea core can be accessed at http://www.nbpgr.ernet.in/pgrportal.
The biology and in vitro propagation of the ornamental aquatic plant, Aponogeton ulvaceus.
Kam, Melissa Yit Yee; Chai, Li Chin; Chin, Chiew Foan
2016-01-01
Aponogeton ulvaceus Baker (Aponogetonaceae) is a commercially important ornamental aquatic plant species with traditional medicinal uses. Due to the low survival rate of seedlings, propagation by conventional means has been met with many difficulties. In this study, botanical aspects of A. ulvaceus were examined with regards to the morphology, anatomy and physiology of the plant and an efficient protocol for its in vitro propagation using immature tuber explants has been established. The existence of glandular trichomes on the leaves was discovered and the occurrence of circumnutation in A. ulvaceus has been demonstrated. Immature tuber segments with meristems were cultured on MS medium supplemented with various combinations (0, 1, 2, and 3 mg/L) of BAP and NAA for callus induction. The highest percentage of callus production (100 %) was obtained in two different treatments: 1 mg/L BAP and 3 mg/L NAA, and 2 mg/L BAP and 3 mg/L NAA. For shoot and root organogenesis, the combination of 1 mg/L BAP and 1 mg/L NAA was shown to be significant for A. ulvaceus regeneration when compared to control, which yields a mean shoot and root number of 22.50 and 29.50 respectively. The current protocol is the first reported successful establishment of in vitro clonal propagation of A. ulvaceus .
Emotional ornamentation in performances of a Handel sonata
Timmers, R.; Ashley, R.
2007-01-01
ORNAMENTATION IS ONE ASPECT OF MUSIC ASSOCIATED with emotional affect in Baroque music. In an empirical study, the relationship between ornamentation and emotion was investigated by asking a violinist and flutist to ornament three melodies in different ways to express four emotions: happiness,
Holiday ornament-related injuries in children.
Kimia, Amir; Lee, Lois; Shannon, Michael; Capraro, Andrew; Mays, Donald; Johnston, Patrick; Hummel, David; Shuman, Margot
2009-12-01
Holiday ornament injuries in children have not been well documented in the medical literature. Our aim was to investigate the patterns of injuries sustained from these ornaments as a first measure toward prevention. This was a retrospective cohort analysis of all patients examined in an urban pediatric emergency department over a 13-year period ending in March 2008 for holiday ornament-related injuries. Cases were identified using a computer-assisted text query followed by a manual chart review. Data collected from each chart included the child's age, sex, injury characteristics, physical examination findings, radiographic imaging, interventions, and disposition. To analyze injury rates over the years, we used a multiplicative Poisson model allowing varying exposures. Over the study period, we identified 76 eligible patients. The median age was 2 years (interquartile range, 1.17-3.3 years); 44.7% were female. Forty-three of the 76 cases (53.9%) involved ingestions: 35 were of holiday ornaments, and 8 were of light bulbs. All but one of these ornaments were made of glass. In 28%, there was an associated bleed either from the mouth or as a delayed gastrointestinal bleed. Other patients experienced lacerations (27.6%), eye injuries (5.1%), and minor electrocution injury (2.5%). Imaging was performed in 85%. A subspecialty consult was obtained in 23%, primarily addressing a foreign body ingestion or removal after skin exploration. The incidence rate has not changed over the years. Holiday ornament-related injuries primarily involve foreign body ingestions and glass-related injuries. Over half of the injuries involved small light bulbs and ornaments made of glass placed at the level a toddler can reach. Pediatricians are advised to discuss these points with families during holiday season.
Preservation of plant genetic resources in the biotechnology era.
Börner, Andreas
2006-12-01
Thousands of years ago humans began domesticating crops as a food source. Among the wild germplasm available, they selected those that were best adapted for cultivation and utilization. Although wild ancestors have continued to persist in regions where domestication took place, there is a permanent risk of loss of the genetic variability of cultivated plants and their wild relatives in response to changing environmental conditions and cultural practices. Recognizing this danger, plant ex situ genebank collections were created since the beginning of the last century. World-wide, more than 6 million accessions have been accumulated including the German ex situ genebank in Gatersleben, one of the four largest global collections, housing 150,000 accessions belonging to 890 genera and 3032 species. This review summarizes the ex situ plant genetic resources conservation behavior with a special emphasis on German activities. Strategies for maintenance and management of germplasm collections are reviewed, considering modern biotechnologies (in vitro and cryo preservation). General aspects on genetic diversity and integrity are discussed.
Nutritional requirements of freshwater ornamental fish: a review
Directory of Open Access Journals (Sweden)
Yohana Velasco-Santamaría
2011-05-01
Full Text Available The knowledge of nutritional requirements in ornamental fish species is essential to improve the productive development; however, the nutritional information of these species is scarce and sometimes this information is extrapolated from results obtained from non-ornamental fish species. In ornamental fish, a correct formulation of the diet improve the nutrient digestibility and supply the metabolic needs, reducing the maintenance cost and at the same time the water pollution. Inert food such as meal powder, flakes, milk powder, bovine heart and liver, tubifex worms, as well as live food including Artemia sp., rotifers and Moina have been used extensively in ornamental fish feeding with a diverse range of nutritional values and productive properties. In contrast with farmed fish, skin pigmentation is a mandatory characteristic in ornamental fish and the use of dietary supplements with carotenoids is recommended. The aim of this document is to review the specific nutritional requirements which are indispensable to improve economical and productive potential of freshwater ornamental fish.
Inhibition of ethylene response by 1-methylcyclopropene in potted ornamental pepper
Directory of Open Access Journals (Sweden)
Fernando Luiz Finger
2015-06-01
Full Text Available In the face of great potential of 1-MCP in blocking ethylene action, this study aimed to evaluate the efficacy of 1-MCP on ethylene action and extend the post-production of ornamental peppers Capsicum annuum potted plants. Ornamental pepper cultivar Calypso shows complete abscission of leaves when exposed to 10µL L-1 ethylene. By exposing plants to ethylene, significant drops on a, b and total chlorophyll were found at the end of the treatment. Nevertheless, no changes on leaf total carotenoid were observed after the treatment with ethylene. When the plants were treated with 1-methylcyclopropene (1-MCP, followed or not by treatment with ethylene, contents of a, b, total chlorophyll and carotenoid remained unchanged. Control plants showed no changes in chlorophylls or carotenoid contents after 48 hours from moving the pots from greenhouse to indoor conditions illuminated with white fluorescent light. The 1-MCP was able to prolong the post production shelf life, by inhibiting the abscission of leaves. Plants treated with 1-MCP, followed by ethylene had 38% accumulated leaf abscission, after 18 days of post production life, similar to control plants. After the same period, plants treated only with 1-MCP had 22% leaf abscission. The 1-MCP partially blocked ethylene and induced leaf abscission. Regardless which treatment was applied during post production life, there was a continuous decrease on leaf chlorophyll content beyond 18th day. Thus, 1-MCP was effective in preventing leaf abscission even in the presence of ethylene, avoiding deleterious effects of ethylene by blocking its receptor sites.
EVOLUTION OF ABSTRACT VEGETAL ORNAMENTS IN ISLAMIC ARCHITECTURE
Directory of Open Access Journals (Sweden)
Yahya Abdullahi
2015-03-01
Full Text Available This research investigated the history of Islamic abstract vegetal ornaments and sketched their evolution to understand their creation process and innovations. We studied these ornaments regionally to identify regional variations and classified them based on tastes of patrons. Meanwhile, we analysed the formal aspects of these ornaments, including their dimension, proportion, dominant colour, material, and techniques. In addition, the study conducted detailed observations of their characteristics, such as margins, apex, thickness of stem scrolls and vents, to define their constructive elements, aesthetical properties, and design principles that reveal date, region, and styles. This research not only provides a comprehensive guide to the evolution of Islamic abstract vegetal ornaments for architectural conservation projects but also serves as a reference for the comparative and critical analysis of contemporary Islamic-inspired ornaments.
Directory of Open Access Journals (Sweden)
Beatrice SZILAGYI
2011-11-01
Full Text Available Tree species Asimina triloba (L. Dunal, is native to North America. In the area of origin is cultivated, both as food species because the edible fruit, and as ornamental species. Ornamental value derives both from decorative flowers, that open in early spring, and because habitus species. The species is demanding from slightly acidic soils (pH 5.5 to 7.0 and well drained. Seedlings are susceptible to heatstroke and need areas of the sun, but since the second year, vegetate well in bright light conditions [27]. Optimum climate is temperate to subtropical one. The species exhibits unique quality traits for a temperate fruit that are similar to other fruit in the Annonaceae family, including cherimoya (Annona cherimola Mill., sugar apple or sweetsop, (A. squamosa L., soursop (A. muricata L., custard apple (A. reticulata L., and atemoya (A. squamosa X A. cherimola, all of which are tropical [2].This study follows the behavior of the species, in particular conditions of the Baia Mare and its surroundings. In this area a fewindividuals were introduced, in order to diversigy the range of species of ornamental plants. In Baia Mare, topoclimate is specifically depression, sheltered by mountains, more atenuated as temperature and winds, than in surrounding areas. As a result ofclimatic conditions, chestnut Castanea sativa, grows in good conditions in Baia Mare. Instead, the area is heavily polluted,especially at ground level. Pollution by heavy metals is a historical being generated by the mining industry.The introduction and use of a new plant species into a new area involves: 1. easy to obtain seed; 2.- maintaining the crown shape habitus and and leaf shape and size, respectively; 3 – determination of optimal physiological parameters. Therefore have been performed, the following experimental determinations: 1. - germination of seed obtained in the particular conditions of the Baia Mare; 2. - some morphomtric characteristics of leaves, in the juveniles
Jansen, J.; Verbakel, H.; Peleman, J.; Hintum, van T.J.L.
2006-01-01
This paper discusses a statistical approach for measuring genetic diversity within genebank accessions of a self-fertilising species. This approach is applied to lettuce (Lactuca sativa L.), using AFLP marker data on a set of 1,390 accessions, representing six different lettuce types. Knowledge of
Xiong, Juan; Wan, Jiang; Ding, Jie; Wang, Pei-Pei; Ma, Guang-Lei; Li, Jia; Hu, Jin-Feng
2017-11-22
Seven new naturally occurring barrigenol-like compounds, camellianols A-G (1-7), and 10 known triterpenoids were isolated from the twigs and leaves of the cultivated endangered ornamental plant Camellia crapnelliana. According to the ECD octant rule for saturated cyclohexanones, the absolute configurations of camellianols D (4) and E (5) were defined. The backbones of the remaining new isolates are assumed to have the same absolute configuration as compounds 4, 5, and harpullone (12). Compounds 2, 3, 9, 10, 13, and 16 exhibited inhibitory effects on the protein tyrosine phosphatase 1B (PTP1B) enzyme, with IC 50 values less than 10 μM.
The Distinction of Ornament and Decoration in Architecture
Directory of Open Access Journals (Sweden)
Fatemeh Ahani
2017-06-01
Full Text Available Ornament has been present throughout the recorded history, revealing human's aspirations, reflections and imaginations. Correspondingly, the discussion of ornament has almost uninterruptedly been a major topic for architectural discourses; one which has led to the publication of several significant texts in which ornamental practices has been addressed from a variety of perspectives. An investigation into the key architectural texts however, reveals that the absence of a certain definition of ornament and its functions in architecture as well as the interchangeable use of the terms 'decoration' and ornament as synonyms, have always been a serious obstacle to reach a clear conception of ornament nature . In this regard, the present paper attempted to distinguish between 'ornament' and 'decoration' based on a comparative analysis of the scholars’ accounts and the way the terms were employed in the architectural texts. Results indicated that the aforementioned concepts can be distinguished by means of seven criteria including components, connection, reference source, role, field of application and reference mode. According to the most referred criteria, ornament is an essential part of architecture which creates a firm bonding with its carrier and often fulfills functions more than aesthetic one .It is mostly made up of transformed motifs and evokes natural forces that originate deeply beyond or within the body of building. Decoration on the other hand, is a pleasing arrangement of real things; a suggestion of the decorous which does not have a permanent connection with its carrier. It is also purely representational, due to its reference to external matters such as mythology, religion, history, or cultural practice.
Identification and Control of Common Insect Pests of Ornamental Shrubs and Trees.
Gesell, Stanley G.
This agriculture extension service publication from Pennsylvania State University introduces the identification and control of common ornamental insect pests. For each of the insects or insect groups (i.e. aphids) identified in this publication, information on host plants, pest description, and damage caused by the pest is given. Also a calendar…
Genetical Studies On Haploid Production In Some Ornamental Plants
International Nuclear Information System (INIS)
MOSTAFA, M.A.M.
2013-01-01
Haploid are plants with a gametophytic chromosome number and doubled haploid are dihaploids that have undergone chromosome duplication. The production of haploid and doubled haploid (DHs) through gametic embryogenesis allows a single-step development of complete homozygous lines from heterozygous parents, shortening the time required to produce homozygous plants in comparison with the conventional breeding methods that employ several generations of selfing. The production of haploid and DHs provides a particularly attractive biotechnological tool, and the development of haploidy technology and protocols to produce homozygous plants has had a significant impact on agricultural systems. Nowadays, these bio technologies represent an integral part of the breeding programmes of many agronomically important crops. There are several available methods to obtain haploid and DHs, of which in vitro anther or isolated microspore culture are the most effective and widely used (Germana Maria 2011). Tissue culture techniques, particularly short-term culture procedures such as shoot-tip culture and regeneration from primary explants, have been proposed as methods for obtaining large numbers of plants identical to the plant used as an explant source( Evans et al., 1984). Nicotiana spp. are one of the most important commercial crops in the world ( Liu and Zhang, 2008). Nicotiana alata is member from family solanacea, it is ornamental plant and the diploid cells contains 18 chromosomes. Nitsch (1969) reported the first production of haploid plants through anther culture and regeneration of plants of Nicotiana alata, For these reasons they have been considered to suitable candidates for model species in somatic cell genetics research( Bourgin et al., 1979). Radiobiological studies on plant tissues in culture may provide information on the cell growth behavior, radiosensitivity and the induction of mutations. The radiosensitivity of plants and calli can be manifested mostly in three
Handicap principle implies emergence of dimorphic ornaments.
Clifton, Sara M; Braun, Rosemary I; Abrams, Daniel M
2016-11-30
Species spanning the animal kingdom have evolved extravagant and costly ornaments to attract mating partners. Zahavi's handicap principle offers an elegant explanation for this: ornaments signal individual quality, and must be costly to ensure honest signalling, making mate selection more efficient. Here, we incorporate the assumptions of the handicap principle into a mathematical model and show that they are sufficient to explain the heretofore puzzling observation of bimodally distributed ornament sizes in a variety of species. © 2016 The Author(s).
16 CFR 501.2 - Christmas tree ornaments.
2010-01-01
... specify how the net quantity statement should be expressed, provided: (a) The quantity of contents is expressed in terms of numerical count of the ornaments, and (b) The ornaments are so packaged that the...
Mutant breeding of ornamental trees for creating variations with high value using Proton Beam
International Nuclear Information System (INIS)
Kwon, H. J.; Lim, J. H.; Woo, S. M.; Hwang, M. J.; Pyo, S. H.; Woo, J. S.
2009-04-01
It is necessary to induce the improved strains of ornamental plants with more disease-resistant and useful for landscape or phytoremediation. Mutation breeding has played an important role in crop improvement, and more than 2,000 mutant cultivars have been released. For the induction of mutation, gamma rays and X-rays are widely used as a mutagen. Proton beam had higher energy than -ray and worked with localized strength, so that proton-beam radiation could be valuable tool to induce useful strains of ornamental plants. Proton ion beam irradiation was used to induce a useful mutant in rice, chrysanthemum, carnation, and so on in Japan. Also, proton ion beam was used to select a useful host strain, in polyhydroxybutyrate (PHB), a member of biodegradable plastic, could be overproduced in Korea. Therefore, we surmise that the effects of proton beam is different from those of gamma rays and X-rays, and we expect proton beam to be a new mutagen. This research was conducted to investigate the proton-beam radiation sensitivity and seed germination rate of the various ornamental plants like as Albizia julibrissin, Ficus religiosa, Rhus chinensis, Sorbaria sorbilfolia and Spiraea chinensis, to survey the quantitative characteristics of proton beam induced strains. To induce the variants of ornamental plants, seeds were irradiated at the dose of 0∼2kGy of proton beam at room temperature. Proton beam energy level was 45 MeV and was irradiated at dose of 0∼2kGy by MC-50 Cyclotron. After irradiation, to assess the effects of proton beam on radiation sensitivity and morphological changes of the plants and the seed germination rate were analysed. By the proton beam radiation, the germination rate decreased at the higher dose. The other hand, the germination rate of Rhus chinensis increased the dose higher, so that it need to investigate the germination rate over 2kGy radiation. The effects of mutation induction by proton beam irradiation on seeds in Lagerstroemia indica were
Mutant breeding of ornamental trees for creating variations with high value using Proton Beam
Energy Technology Data Exchange (ETDEWEB)
Kwon, H. J.; Lim, J. H.; Woo, S. M.; Hwang, M. J.; Pyo, S. H.; Woo, J. S. [Phygen Co., Daejeon (Korea, Republic of)
2009-04-15
It is necessary to induce the improved strains of ornamental plants with more disease-resistant and useful for landscape or phytoremediation. Mutation breeding has played an important role in crop improvement, and more than 2,000 mutant cultivars have been released. For the induction of mutation, gamma rays and X-rays are widely used as a mutagen. Proton beam had higher energy than -ray and worked with localized strength, so that proton-beam radiation could be valuable tool to induce useful strains of ornamental plants. Proton ion beam irradiation was used to induce a useful mutant in rice, chrysanthemum, carnation, and so on in Japan. Also, proton ion beam was used to select a useful host strain, in polyhydroxybutyrate (PHB), a member of biodegradable plastic, could be overproduced in Korea. Therefore, we surmise that the effects of proton beam is different from those of gamma rays and X-rays, and we expect proton beam to be a new mutagen. This research was conducted to investigate the proton-beam radiation sensitivity and seed germination rate of the various ornamental plants like as Albizia julibrissin, Ficus religiosa, Rhus chinensis, Sorbaria sorbilfolia and Spiraea chinensis, to survey the quantitative characteristics of proton beam induced strains. To induce the variants of ornamental plants, seeds were irradiated at the dose of 0{approx}2kGy of proton beam at room temperature. Proton beam energy level was 45 MeV and was irradiated at dose of 0{approx}2kGy by MC-50 Cyclotron. After irradiation, to assess the effects of proton beam on radiation sensitivity and morphological changes of the plants and the seed germination rate were analysed. By the proton beam radiation, the germination rate decreased at the higher dose. The other hand, the germination rate of Rhus chinensis increased the dose higher, so that it need to investigate the germination rate over 2kGy radiation. The effects of mutation induction by proton beam irradiation on seeds in Lagerstroemia
Cope's Rule and the Universal Scaling Law of Ornament Complexity.
Raia, Pasquale; Passaro, Federico; Carotenuto, Francesco; Maiorino, Leonardo; Piras, Paolo; Teresi, Luciano; Meiri, Shai; Itescu, Yuval; Novosolov, Maria; Baiano, Mattia Antonio; Martínez, Ricard; Fortelius, Mikael
2015-08-01
Luxuriant, bushy antlers, bizarre crests, and huge, twisting horns and tusks are conventionally understood as products of sexual selection. This view stems from both direct observation and from the empirical finding that the size of these structures grows faster than body size (i.e., ornament size shows positive allometry). We contend that the familiar evolutionary increase in the complexity of ornaments over time in many animal clades is decoupled from ornament size evolution. Increased body size comes with extended growth. Since growth scales to the quarter power of body size, we predicted that ornament complexity should scale according to the quarter power law as well, irrespective of the role of sexual selection in the evolution and function of the ornament. To test this hypothesis, we selected three clades (ammonites, deer, and ceratopsian dinosaurs) whose species bore ornaments that differ in terms of the importance of sexual selection to their evolution. We found that the exponent of the regression of ornament complexity to body size is the same for the three groups and is statistically indistinguishable from 0.25. We suggest that the evolution of ornament complexity is a by-product of Cope's rule. We argue that although sexual selection may control size in most ornaments, it does not influence their shape.
Ethylene, 1-methylcyclopropene and silver thiosulfate on the post-production of ornamental pepper
Directory of Open Access Journals (Sweden)
Paula Cristina Carvalho Lima
Full Text Available ABSTRACT: Species from Capsicum genus are used for different purposes and in more recent years as ornamental potted plant. Despite the increased commercial importance, there are only a few studies on the environmental factors affecting the post-production shelf life of these ornamental plants. The presence of ethylene induces various responses on potted peppers, reducing the shelf life of sensitive cultivars. This study aimed to evaluate the effects of ethylene and the inhibitors of ethylene action, 1-methylcyclopropene (1-MCP and silver thiosulfate (STS on the shelf life of potted 'Calypso' and 'MG 302' peppers. Cultivar 'MG 302' showed intermediate sensitivity to ethylene action, while the cultivar 'Calypso' showed complete abscission of leaves when exposed to ethylene. In both cultivars, treatment with STS + Ethylene presented symptoms of phytotoxicity in plants, while treatment with 1-MCP + Ethylene was effective in delaying senescence and abscission for the cultivar 'MG 302', while cultivar 'Calypso' showed abscission similar to control plants. Plants treated with STS showed the longest durability when compared to the other treatments, about six days for 'Calypso' and 18 days for 'MG 302'. Nevertheless, plants treated with 1-MCP also exhibited good shelf life, about six days for 'Calypso' and nine days for the 'MG 302'. Although the treatment with STS was more efficient on the plants shelf life, did not completely block the action of ethylene and exhibited some phytotoxicity, while the treatment with 1-MCP had good efficiency without inducing any toxicity.
Mutant breeding of ornamental trees for creating variations with high value using proton beam
Energy Technology Data Exchange (ETDEWEB)
Yim, Jae Hong; Woo, Seong Min; Hwang, Mun Joo; Pyo, Sun Hui [Phygen, Daejeon (Korea, Republic of); Kwon, Hye Jin [Environmental-Friendly Agriculture Research Institute, Seoul (Korea, Republic of); Woo, Jong Suk [Cheonan Yonam College, Cheonan (Korea, Republic of)
2010-04-15
This research was conducted to investigate the proton-beam radiation sensitivity and seed germination rate of 18 ornamental plants and to survey the quantitative characteristics of proton beam induced strains. To induce the variants of ornamental plants, seeds were irradiated at the dose of 0{approx} 2kGy of proton beam at room temperature by 45 MeV MC-50 Cyclotron. After irradiation, to assess the effects of proton beam on radiation sensitivity and morphological changes of the plants and the seed germination rate were analysed. The effects of mutation induction by proton beam irradiation on seeds in Lagerstroemia indica and Ligustrum obtusifolium were investigated. Irradiation with proton beam at the dose of 750Gy induced mutants in leaf length, leaf width, internode length, plant height, leaf color, autumn leaves and plant width in each strains. According to a principal component analysis, the induced strains were divided into three groups. Promising strain(strain 25) for commercial varieties was selected Lagerstroemia indica. It was analysed that strain 25 showed the highest genetic dissimility from original species. The strain 25 had red leaf edge and maintained autumnal tints till late fall. So, we try to promote a patent registration of the strain 25 as a new caltivar 'Bulkkot'
Mutant breeding of ornamental trees for creating variations with high value using proton beam
International Nuclear Information System (INIS)
Yim, Jae Hong; Woo, Seong Min; Hwang, Mun Joo; Pyo, Sun Hui; Kwon, Hye Jin; Woo, Jong Suk
2010-04-01
This research was conducted to investigate the proton-beam radiation sensitivity and seed germination rate of 18 ornamental plants and to survey the quantitative characteristics of proton beam induced strains. To induce the variants of ornamental plants, seeds were irradiated at the dose of 0∼ 2kGy of proton beam at room temperature by 45 MeV MC-50 Cyclotron. After irradiation, to assess the effects of proton beam on radiation sensitivity and morphological changes of the plants and the seed germination rate were analysed. The effects of mutation induction by proton beam irradiation on seeds in Lagerstroemia indica and Ligustrum obtusifolium were investigated. Irradiation with proton beam at the dose of 750Gy induced mutants in leaf length, leaf width, internode length, plant height, leaf color, autumn leaves and plant width in each strains. According to a principal component analysis, the induced strains were divided into three groups. Promising strain(strain 25) for commercial varieties was selected Lagerstroemia indica. It was analysed that strain 25 showed the highest genetic dissimility from original species. The strain 25 had red leaf edge and maintained autumnal tints till late fall. So, we try to promote a patent registration of the strain 25 as a new caltivar 'Bulkkot'
Ornamentation, age, and survival of female striped plateau lizards, Sceloporus virgatus
Weiss, Stacey L.
2016-04-01
Individuals with greater expression of secondary sexual traits are often older and have higher survivorship than individuals with lower expression; if so, assessment of such indicator traits may provide genetic and/or direct benefits to potential mates. I examined the relationship between ornament expression, age, and survival in the striped plateau lizard, Sceloporus virgatus, a species with female-specific ornamentation that honestly signals reproductive quality. I followed a group of females from 2008 to 2013, examined ornament color and size as females aged, and compared ornamentation of survivors versus non-survivors. In addition, I explored whether other (non-ornamental) phenotypic characters predicted survival. I found that peak ornament expression (both color and size) of individual females changed year to year but appeared to be a weak signal of age due to high among-female variation in ornament expression that occurred independent of age and a non-linear pattern of change for ornament color. However, both absolute and relative ornament size did increase significantly as an individual aged and therefore may provide some age-related information such as reproductive investment, which is expected to increase as residual reproductive value declines with age. Individual survival was unrelated to peak ornament expression and to other phenotypic variables measured, providing no support for the ornament as a viability indicator and suggesting that individual survival prospects are affected by stochastic and environmental factors.
Molluscs for Sale: Assessment of Freshwater Gastropods and Bivalves in the Ornamental Pet Trade.
Ng, Ting Hui; Tan, Siong Kiat; Wong, Wing Hing; Meier, Rudolf; Chan, Sow-Yan; Tan, Heok Hui; Yeo, Darren C J
2016-01-01
The ornamental pet trade is often considered a key culprit for conservation problems such as the introduction of invasive species (including infectious diseases) and overharvesting of rare species. Here, we present the first assessment of the biodiversity of freshwater molluscs in the ornamental pet trade in Singapore, one of the most important global hubs of the ornamental aquarium trade, and discuss associated conservation concerns. We recorded freshwater molluscs from ornamental pet shops and major exporters including non-ornamental species (e.g., hitchhikers, molluscs sold as fish feed). We recorded an unexpectedly high diversity-59 species-of freshwater bivalves and gastropods, with the majority (38 species or 64%) being from the Oriental region. In addition to morphological examination, we sequenced the DNA barcode region of mitochondrial CO1 and 16S genes to provide molecular data for the confirmation of the identification and for future re-identification. DNA barcodes were obtained for 50 species, and all but four were separated by > 3% uncorrected pairwise distances. The trade has been considered a main introduction pathway for non-native species to Singapore, and we found that out of 15 species in the trade as well as in the wild in Singapore, 12 are either introduced or of unknown origin, representing almost half of the known non-native freshwater molluscs in Singapore. Particularly prevalent are non-ornamental species: six hitchhikers on aquarium plants and six species sold as fish feed. We found that a quarter of the trade species have a history of introduction, which includes 11 known or potentially invasive species. We conclude that potential overharvesting is difficult to assess because only half of the trade species have been treated by IUCN. Of these, 21 species are of Least Concern and three are Data Deficient. Our checklist, with accompanying DNA barcodes, images, and museum vouchers, provides an important reference library for future monitoring
Downy mildews on ornamental plants and their control.
Skrzypczak, C
2006-01-01
Among downy mildews occurring on ornamentals in Poland the most dangerous are downy mildew of rose and downy mildew of German statice (Tartarian statice). Downy mildew of rose caused by Peronospora sparsa Berk. is a serious threat to commercial cultivation of cut roses, especially grown under plastic tunnels. Peronospora statices Lobik casual agent of German statice downy mildew can causes the total losses in the second year of statice cultivation more than 70%. Both pathogens are very difficult to control. Effectiveness of azoxystrobine, cymoxanil + famoxate, mancozeb, phosethyl aluminium, phosethyl aluminium + fenamidone, propamocarb in the control of P. sparsa and P. statices was presented. In the control of statice downy mildew none of tested compounds was able to control satisfactory the pathogen. Relatively the best results were obtained with mixture of fenamidone (88 microg/cm3) and phosethyl AL (1334 microg/cm3). In the control of rose downy mildew, the best results were obtained with phosethyl Al at concentration 1600 microg/cm3.
Nutritional requirements of freshwater ornamental fish: a review
Velasco-Santamaría, Yohana; Corredor-Santamaría, Wilson
2011-01-01
The knowledge of nutritional requirements in ornamental fish species is essential to improve the productive development; however, the nutritional information of these species is scarce and sometimes this information is extrapolated from results obtained from non-ornamental fish species. In ornamental fish, a correct formulation of the diet improve the nutrient digestibility and supply the metabolic needs, reducing the maintenance cost and at the same time the water pollution. Inert food such ...
BREEDING FIELD CROPS FOR ORNAMENTAL PURPOSE: A CASE IN Jathropa spp.
Directory of Open Access Journals (Sweden)
Narathid Muakrong
2014-10-01
Full Text Available Populations of F1, F2 and BC1F1 were formed from an interspecific cross between green-flowered Jatropha curcas and red-flowered J. integerrima (dwarf type to observe for segregation in flower colors and to select for ornamental segregants. The crossing to produce F1 and BC1F1 was successful only when J. curcas was used as the female parent. The suitable time for crossing was between 08:00 – 13:00 o’clock with fruit setting rate of 65-78%. The F1 segregated into white- and pink-flowered plants. While flowers of the F2 population segregated into nine different colors, viz. light green, green, white, very light pink, light pink, pink, deep pink, very deep pink, and red. When J. curcas was backcrossed by a pink-flowered F1, its BC1F1 progenies segregated into green, light green, white, very light pink and light pink flowers. While another set of BC1F1 progenies obtained from a white-flowered F1 parent segregated into green, light green, and white. The segregating progenies in both sets showed smaller plants than jatropha and bore colorful flowers suitable for ornamental purpose. Six plants were chosen and registered at Kasetsart University and the Thai Department of Agriculture as commercial cultivars, ‘Kamphaeng Saen 1’ to ‘Kamphaeng Saen 6’.
International Nuclear Information System (INIS)
Qarawi, A.A.; Mridha, M.A.U.; Alghamdi, O.M.
2014-01-01
Arbuscular mycorrhizal fungi (AMF) regarded as ubiquitous soil fungi which help in improving plant growth under harsh conditions. Petunia hybrida is one of the most favorite ornamental plants growing all over the Riyadh city of Saudi Arabia. In the present study, we would like to highlight the Petunia as a mycotrophic plant for the management of mycorrhizal fungi under field conditions. Roots along with rhizosphere soils of P. hybrida were collected from various sites in Riyadh, Saudi Arabia to study AM colonization and biodiversity of AMF. The data obtained in this study indicated that P. hybrida is a very highly mycotrophic plants, and all the samples produced very high colonization with mycelium, vesicles, coiled hyphae and arbuscules. The significant variation was found with the occurrence of mycelium and vesicles among the locations but in case of arbuscules more or less same range of occurrence was found. Only different species of Glomus were observed in all the locations. Glomus showed diversity in all the locations as indicated by the Shanon Diversity Index. As the P. hybrida is a highly mycotrophic plant, so this plant may be grown under harsh condition of Saudi Arabia to manage the plant growth under different stresses viz., water stress, saline soils and heavy metal toxicity conditions. (author)
Directory of Open Access Journals (Sweden)
Osman Gulsen
2017-12-01
Full Text Available Turkey is in the middle of major continents, Africa, Asia and Europe that creates considerable diversity. Many plant species are endemic to Turkey and the members of Boraginaceae family is one of the most important among them. For years, we are evaluating/observing Heliotropium greuteri H. Riedl, named as ‘yoghurt otu’ and affiliated to the Boraginaceae family. Heliotropium greuteri, seen as extensively in Kayseri region, has fragrant flowers and quite long flowering period. It has good ornamental characteristics because of long flowering period up to four months, showy plants with white and green colors, fragrant flowers, and considerable drought tolerance. They also attract honeybees, especially during poor vegetation as at the end of summer and in the first half of fall season. They can be used as cover plant in parks, home gardens and road sides. It can be successfully used in open areas as well as under trees (semi-shaded. Especially they can produce healthy plants at the borders where they are often exposed to drought stress. Overall, this species has desirable ornamental characteristics and can be alternative for landscaping.
People-plant relationships in an office workplace
DEFF Research Database (Denmark)
Thomsen, Jane Dyrhauge; Sønderstrup-Andersen, Hans Henrik Krogh; Müller, Renate
2011-01-01
, explorative, and inductive case-study design, the study provides an example of how a cross-disciplinary unit engaged in administrative office work at a Danish institution applied ornamental plants. The results document that ornamental plants are an integrated part of the workplace. The employees used......The study presented in this article represents an initial attempt to generate indepth information about how ornamental plants in real-life office workplaces interact with workplace characteristics, thus influencing working environment and well-being of the employees. Using a qualitative.......g., size, species and condition), and characteristics of the individual employee (e.g., personal experiences, preferences, and values)....
Mutual ornamentation, age, and reproductive performance in the European starling
Komdeur, J; Oorebeek, M; van Overveld, T; Cuthill, IC; Cuthill, Innes C.
2005-01-01
Ornamental traits expressed in both sexes are widespread among birds. Many studies have indicated that male ornaments develop through sexual selection. Female ornaments may be correlated effects of selection on males or have signaling functions in their own right. In the facultatively polygynous
Directory of Open Access Journals (Sweden)
Bayat H.
2012-04-01
Full Text Available Application of salicylic acid (SA as a phytohormone has been increased due to resistance to stresses such as salt stress. Pot experiments were conducted to determine the effect of exogenous salicylic acid application on growth and ornamental characteristics of calendula grown under salt stress and greenhouse conditions. For this purpose a factorial experiment based on completely randomized design was conducted with 3 levels of SA (0 (control, 1, 2 mM and 3 levels of NaCl (0, 100 and 200 mM with 4 replications. At flowering stage, SA was applied with spraying two times in two week intervals. NaCl was also applied as drench (200 ml per pot in two day intervals. The results showed that salinity decreased the growth, Chlorophyll reading values, flower number per plant and flower diameter. However, foliar applications of SA resulted in greater root, shoot and total dry weight, plant height and leaf area of calendula plants under salt stress. The highest chlorophyll reading values was obtained from 2.00 mM SA application in all NaCl treatments. Salinity decreased number of flower per plant and flower diameter as ornamental characteristics; however SA increased them under salinity stress. Plants treated with 1.00 mM SA had the highest flower diameter at 100 and 200 mM of NaCl. Electrolyte leakage increased by salinity, however foliar application of SA significantly reduced electrolyte leakage under salt stress. Based on the present results, foliar application of SA treatments can ameliorate the negative effects of salinity on the growth and ornamental characteristics of calendula plants.
Directory of Open Access Journals (Sweden)
Paula Cristina Carvalho Lima
2017-09-01
Full Text Available The species of Capsicum genus have great genetic variability with enormous potential for marketing as ornamental potted plants. The exposure at ethylene induces various deleterious responses during plants life cycle, but there are few studies on how the ethylene affects early developmental stages of these ornamental plants. Thus, this study aimed to evaluate the effects of the application of ethylene and ethylene inhibitors, 1-methylcyclopropene (1-MCP and silver thiosulphate (STS in two early development stages (seedling or initial flowering of potted ornamental peppers of the cultivars ‘Calypso’ and ‘MG 302’. Cultivar ‘MG 302’ showed intermediate sensitivity to ethylene, while the cultivar ‘Calypso’ showed complete abscission of leaves when exposed to 10 µl of ethylene for 48 hours in both development stages. Plants treated with 1-MCP showed similar durability to control for both varieties and developmental stages, and the treatment with 1-MCP + ethylene was beneficial only for ‘MG 302’. STS was the most efficient substance in delaying the ethylene, wherein at stage 1 there was no leaf abscission and at stage 2 had much reduced leaf abscission occurred, regardless the cultivar. Treatment with STS + ethylene was efficient only at stage 1 for ‘Calypso’ and at stage 2 for ‘MG 302’. According to the data, cultivars showed different levels of sensitivity to ethylene, ‘Calypso’ is very sensitive and ‘MG 302’ showed intermediate sensitivity. Regardless the cultivar, STS treatment significantly blocked the ethylene action in both development stages and the use of 1-MCP was less efficient
GeoBoost: accelerating research involving the geospatial metadata of virus GenBank records.
Tahsin, Tasnia; Weissenbacher, Davy; O'Connor, Karen; Magge, Arjun; Scotch, Matthew; Gonzalez-Hernandez, Graciela
2018-05-01
GeoBoost is a command-line software package developed to address sparse or incomplete metadata in GenBank sequence records that relate to the location of the infected host (LOIH) of viruses. Given a set of GenBank accession numbers corresponding to virus GenBank records, GeoBoost extracts, integrates and normalizes geographic information reflecting the LOIH of the viruses using integrated information from GenBank metadata and related full-text publications. In addition, to facilitate probabilistic geospatial modeling, GeoBoost assigns probability scores for each possible LOIH. Binaries and resources required for running GeoBoost are packed into a single zipped file and freely available for download at https://tinyurl.com/geoboost. A video tutorial is included to help users quickly and easily install and run the software. The software is implemented in Java 1.8, and supported on MS Windows and Linux platforms. gragon@upenn.edu. Supplementary data are available at Bioinformatics online.
Interactions between insect pollinators and the ornamental tree, Tecoma stans (L.
Directory of Open Access Journals (Sweden)
K.H. Jonathan
2009-02-01
Full Text Available Tecoma stans (Bignoniaceae is a native of Central America but occurs throughout tropical latitudes due to cultivation as an ornamental; in India it is also normally cultivated as an ornamental tree. The plant has two anthesis schedules in a day - one during 0500-0800hrs and another during 1500-1700hrs. Different species of bees and wasps collect pollen and nectar from the flowers during daylight hours, while hawk moths collect nectar during the 0530-0700hrs and 1630-1830hrs periods. The flowers are an important source of pollen and/or nectar for these insects, and all facilitate pollination. The nectar contains three common sugars: hexoses, glucose and fructose, and it is also a source of three essential amino acids: lysine, histidine and threonine, and eight non-essential amino acids: glycine, serine, proline, arginine, glutamic acid, cystine, cysteine and alanine. With these floral rewards, T. stans sustains pollinator populations in areas where it is cultivated.
7 CFR 1437.303 - Aquaculture, including ornamental fish.
2010-01-01
... 7 Agriculture 10 2010-01-01 2010-01-01 false Aquaculture, including ornamental fish. 1437.303... ASSISTANCE PROGRAM Determining Coverage Using Value § 1437.303 Aquaculture, including ornamental fish. (a... human consumption as determined by CCC. (2) Fish raised as feed for other fish that are consumed by...
Genetic Architecture of Conspicuous Red Ornaments in Female Threespine Stickleback
Directory of Open Access Journals (Sweden)
Lengxob Yong
2016-03-01
Full Text Available Explaining the presence of conspicuous female ornaments that take the form of male-typical traits has been a longstanding challenge in evolutionary biology. Such female ornaments have been proposed to evolve via both adaptive and nonadaptive evolutionary processes. Determining the genetic underpinnings of female ornaments is important for elucidating the mechanisms by which such female traits arise and persist in natural populations, but detailed information about their genetic basis is still scarce. In this study, we investigated the genetic architecture of two ornaments, the orange-red throat and pelvic spine, in the threespine stickleback (Gasterosteus aculeatus. Throat coloration is male-specific in ancestral marine populations but has evolved in females in some derived stream populations, whereas sexual dimorphism in pelvic spine coloration is variable among populations. We find that ornaments share a common genetic architecture between the sexes. At least three independent genomic regions contribute to red throat coloration, and harbor candidate genes related to pigment production and pigment cell differentiation. One of these regions is also associated with spine coloration, indicating that both ornaments might be mediated partly via pleiotropic genetic mechanisms.
Directory of Open Access Journals (Sweden)
Reyhane Setayesh
2017-08-01
this regard, drought stress tolerance thresholds of ornamental barberry plant in Mashhad landscape were evaluated. Materials and Methods: In order to determine the qualitative and quantitative drought stress tolerance thresholds of ornamental barberry (Berberis thunbergii plant an experiment was conducted basis on randomized complete block design with three replications in Plant Production Complex of Mashhad Municipality. Treatments included; 100, 80, 60, 40, and 20% of culculated water requirements based on evaporation pan data. Two years old plants with similar size were transplanted from pots to field in 16 March 2012. Treatments were applied after establishment in 28 April and sampling was arranged in 6 August, 23 August, 6 September, and 7 October. During the growing season, the evaporation level was daily measured from pan Class A. In each sampling two plants sampled randomly from each plot for measuring the plant height, highest branches, number of branches, fresh and dry weight, dry mater percentage, irrigation water use index and freshness index. Results and Discussion: Results showed that with increasing severity of drought stress plant height of barberry reduced significantly, but there were no significant difference between 100 and 80% of water requirement treatments. The highest branches reduced by diminishing water application volume but there were no significant difference among 100, 80 and 60% of water requirement application. The maximum of branch number was observed at 60 percent water requirement, however, there were no significant difference between 100 and 60% of water requirement treatments. The number of branches in 60% was 26% lower than 80% of water requirement. Therefore, application of 60% water requirement with 23 branches per plant produced highest branch number. The highest and lowest plant fresh weight was measured in 100% and 20% water requirement application, respectively. Application of 60% of water requirement produced statistically
Reproduction of Bela Krajina Ornaments on Linen Fabrics by Screen Printing
Directory of Open Access Journals (Sweden)
Tatjana Rijavec
2017-07-01
Full Text Available Decorated Bela Krajina (White Carniolan towels called “otirači” are historical textiles, which represent an important cultural heritage of the Slovenian nation. This article presents the research of the suitability of the screen printing technique for reproducing ornaments from Bela Krajina towels, originally made with a technique called “tkaničenje”. The basic characteristics of woven fabrics, the colours of ornaments from Bela Krajina towels and the linen fabric, suitable for kitchen textiles, were analysed. Two Bela Krajina motifs were chosen for the decoration, namely a diamond and an eight-arm star. A comparison of the the colour diff erences, DE*ab , of the replica ornaments and the ornaments on the original towels made in blue and red colours showed a good match even after washing. It was confi rmed that the screen printing technique is suitable for decorating linen textiles with the original Bela Krajina ornaments, wherein the ornaments retaining their aesthetic and message values.
Bony cranial ornamentation linked to rapid evolution of gigantic theropod dinosaurs
Gates, Terry A.; Organ, Chris; Zanno, Lindsay E.
2016-09-01
Exaggerated cranial structures such as crests and horns, hereafter referred to collectively as ornaments, are pervasive across animal species. These structures perform vital roles in visual communication and physical interactions within and between species. Yet the origin and influence of ornamentation on speciation and ecology across macroevolutionary time scales remains poorly understood for virtually all animals. Here, we explore correlative evolution of osseous cranial ornaments with large body size in theropod dinosaurs using a phylogenetic comparative framework. We find that body size evolved directionally toward phyletic giantism an order of magnitude faster in theropod species possessing ornaments compared with unadorned lineages. In addition, we find a body mass threshold below which bony cranial ornaments do not originate. Maniraptoriform dinosaurs generally lack osseous cranial ornaments despite repeatedly crossing this body size threshold. Our study provides novel, quantitative support for a shift in selective pressures on socio-sexual display mechanisms in theropods coincident with the evolution of pennaceous feathers.
Ornamental rocks prospection in Uruguay. A new database territorial management
International Nuclear Information System (INIS)
Carmignani, L.; Gattiglio, S.; Masquelin, H.; Gomez Rifas, C.; Medina, E.; Da Silva, J.; Pirelli, H.
1998-01-01
Here are exposed the main of the last ornamental rocks inventory and their exploitation ambiental implicances. The project was realized between the Uruguayan government (Ministry of Industries, Energy and Mining) and the economical European Community (C.E.E). a two -fold target was poursuit. The first o administrative order in the sense that results of such recensement could allow to review the ornamental rocks management in a more efficiently and realistic manner. The second of geoeconomical order permits to re-evaluate traditional ornamental rocks facilities (marbles and granites) form the marketing and either the valoration of a new generation of ornamental materials also. (author)
Plant genetic resource collections provide novel materials to the breeding and research communities. Availability of detailed documentation of passport, phenotypic, and genetic data increases the value of the genebank accessions. Inclusion of georeferenced sources, habitats, and sampling data in co...
Ganteaume, A.; Jappiot, M.; Lampin, C.
2012-04-01
The increasing urbanization of Wildland-Urban Interfaces (WUI) as well as the high fire occurrence in these areas requires the assessment and the ranking of the flammability of the ornamental vegetation surrounding houses especially that planted in hedges. Thus, the flammability of seven species, among those most frequently planted in hedges in Provence (South-Eastern France), were studied at particle level and at dead surface fuel level (litters) under laboratory conditions. The flammability parameters (ignition frequency, time-to-ignition, flaming duration) of the very fine particles (live leaves and particles fire bench. Burning experiments using the epiradiator showed that live leaves of Phyllostachys sp., Photinia frasei and Prunus laurocerasus had the shortest time-to-ignition and the highest ignition frequency and flaming duration whereas Pittosporum tobira and Nerium oleander were the longest to ignite with a low frequency. Phyllostachys sp. and Nerium oleander litters were the shortest to ignite while Prunus laurocerasus litter had the lowest bulk density and long time-to-ignition, but high flame propagation. Photinia fraseri litter ignited frequently and had a high flame spread while Pittosporum tobira litter ignited the least frequently and for the shortest duration. Cupressus sempervirens litter had the highest bulk density and the longest flaming duration but the lowest flame propagation. Pyracantha coccinea litter was the longest to ignite and flame propagation was low but lasted a long time. Hierarchical cluster analysis performed on the flammability parameters of live leaves and of litters ranked the seven species in four distinct clusters from the most flammable (Prunus laurocerasus and Pyracantha coccinea) to the least flammable (Pittosporum tobira and Nerium oleander); the other species displaying two groups of intermediate flammabilities (Phyllostachys sp.- Photinia fraseri and Cupressus sempervirens ). The species with highly flammable
Application of wood chips for soil mulching in the cultivation of ornamental grasses
Directory of Open Access Journals (Sweden)
Henschke Monika
2016-12-01
Full Text Available A mulch is a layer of material applied to the surface of the soil. Mulching plays an important role in the maintenance of green spaces. Organic materials are still sought for the preparation of mulches. Recently interest in wood chips has grown. The aim of the study was to determine the effect of mulching with pine and birch chips on the contents of phenolic compounds in the soil, as well as on the growth and flowering of ornamental grasses – Bouteloua gracilis (Kunth. Lag. ex Griffiths, Panicum virgatum L. and Pennisetum alopecuroides L. The content of phenolic compounds in the soil steadily increased from spring to autumn. Mulching led to a substantial increase in the level of phenolic compounds. In the first year of cultivation more phenolic compounds were released by chips of pine than birch, while in the second year this difference did not occur. Mulching had a negative impact on the growth and flowering of ornamental grasses, especially in the first year of cultivation. Ornamental grass sensitivity to the substances released from mulches decreased with the age of the plants and was dependent on the species – Bouteloua gracilis was found to be particularly sensitive.
Gas exchange and chlorophyll a fluorescence parameters of ornamental bromeliads
Directory of Open Access Journals (Sweden)
Karina Gonçalves da Silva
2017-10-01
Full Text Available Gas exchange and chlorophyll a fluorescence are widely used in physiological and ecological studies; however, few studies have used these techniques with ornamental plants. This study tested the potential contribution of gas exchange and chlorophyll a fluorescence to evaluate the water and nutrients uptake by the tank and root system of epiphyte bromeliad Guzmania lingulata. For this purpose, we conducted an experiment with different water regime and another with different concentrations of nitrogen. The experiments were: 1 - Watering: Control (application of water into Tank and Root, Tank (watering into Tank, Root (watering Root and Drought (water suspension during the 90 days of experimentation and 2 - Nitrogen: Plants fertilized with Hoagland and Arnon nutrient solution exclusively into Tank or Root with nitrogen concentrations of control and 2.62 or 5.34 mM N applied as urea. The Fv /Fm ratio allowed comparing the treatments between experiments, demonstrating that Root and Tank both have the capacity to maintain G. lingulata photosynthetic activity and growth, while Drought treatment (water suspension was the limiting factor for energy conversion efficiency of PSII. However, gas exchange was more permissive as a parameter for comparing treatments in the nitrogen experiment, providing important information about the general aspects of the photosynthetic process in the watering experiment. Both gas exchange and chlorophyll a fluorescence can support the evaluation of G. lingulata physiological status and can be useful tools in ornamental horticultural studies.
Acclimatization and growth of ornamental pineapple seedlings under organic substrates
Directory of Open Access Journals (Sweden)
Ronan Carlos Colombo
2017-09-01
Full Text Available The in vitro propagation techniques are commonly used to produce ornamental pineapple seedlings in commercial scale, aiming to attend the growers with genetic and sanitary quality seedlings. However, the choice of the ideal substrate is essential for the acclimatization and growth stage of the seedlings propagated by this technique, since some substrates can increase the seedling mortality and/or limit the seedling growth due to its physical and chemical characteristics. Thus, the aim of this study was to evaluate the acclimatization of ornamental pineapple [Ananas comosus (L. Merr. var. ananassoides (Baker Coppens & Leal] on different substrates. Seedlings with approximately seven centimeters, obtained from in vitro culture, were transplanted into styrofoam trays filled with the following substrates: sphagnum; semi-composed pine bark; carbonized rice husk; sphagnum + semicomposed pine bark; sphagnum + carbonized rice husk; and semi-composed pine bark + carbonized rice husk. Each treatment was replicated five times using 10 plants. At 180 days, there were evaluated the following variables: survival percentage, plant height, number of leaves, leaf area, largest root length, and shoot and root dry matter. The substrate semi-composed pine bark + carbonized rice husk presented the lowest mean (62% for survival percentage. The semi-composed pine bark and semi-composed pine bark + carbonized rice husk treatments presented significant increments in some evaluated biometric characteristics. The semi-composed pine bark is the most favorable substrate for the A. comosus var. ananassoids acclimatization.
Color ornaments and territory position in king penguins.
Keddar, Ismaël; Jouventin, Pierre; Dobson, F Stephen
2015-10-01
King penguins exhibit mutual color ornamentation of feathers and beak color. They breed in dense colonies and produce a single chick every 2 years. Thus, males and females must choose partners carefully to be reproductively successful, and auricular patches of males and UV coloration of beak spots have been shown to influence mate choice. Position in the breeding colony is also important to reproductive success, with pairs on the edge of the colony less successful than those in the center. We studied the mutual ornaments, individual condition, and position of pairs in their breeding colony. Males were significantly larger than females in size, body mass, and auricular patch size. Within pairs, auricular patch size of males and females were significantly correlated, and male auricular patch size and body mass were significantly associated, suggesting a link between this ornament and male body condition. Moving from the edge to the center of the colony, pairs had larger yellow-orange auricular patches, indicating a link between this ornament and settlement in higher quality territories in the center of the colony. Pairs were also less brightly brown colored on the breast and less saturated in UV color of the beak spot. Since we observed pairs that were settling for egg laying, location in the colony may have reflected aspects of pair condition, rather than later jockeying for positioning using ornaments as signals of behavioral dominance. Copyright © 2015 Elsevier B.V. All rights reserved.
Jelusic, Masa; Lestan, Domen
2015-11-01
Soils highly contaminated with toxic metals are currently treated as waste despite their potential inherent fertility. We applied EDTA washing technology featuring chelant and process water recovery for remediation of soil with 4037, 2527, and 26 mg kg(-1) of Pb, Zn and Cd, respectively in a pilot scale. A high EDTA dose (120 mmol kg(-1) of soil) removed 70%, 15%, and 58% of Pb, Zn, and Cd, respectively, and reduced human oral bioaccessibility of Pb below the limit of quantification and that of Zn and Cd 3.4 and 3.2 times. In a lysimeters experiment, the contaminated and remediated soils were laid into two garden beds (4×1×0.15 m) equipped with lysimeters, and subjected to cultivation of ornamental plants: Impatiens walleriana, Tagetes erecta, Pelargonium×peltatum, and Verbena×hybrida and grasses: Dactylis glomerata, Lolium multiflorum, and Festuca pratensis. Plants grown on remediated soil demonstrated the same or greater biomass yield and reduced the uptake of Pb, Zn and Cd up to 10, 2.5 and 9.5 times, respectively, compared to plants cultivated on the original soil. The results suggest that EDTA remediation produced soil suitable for greening. Copyright © 2014 Elsevier Ltd. All rights reserved.
PESTS OF ORNAMENTAL TREES AND SHRUBS IN THE PARKS OF PITEŞTI AND METHODS OF FIGHTING THEM
Directory of Open Access Journals (Sweden)
Daniela Bărbuceanu
2012-04-01
Full Text Available The observations carried-out in 2008 to ornamental trees and shrubs from parks of ADP Pitesti conducted to identified of the follows pests species: Macrosiphum rosae (L., Aphis spiraephaga Müll., Cinara cupressi Buckton, Hyphantria cunea Drury, Oxycarenus lavaterae (F.. Cinara cupressi and Oxycarenus lavaterae are mentioned for the first time in Romania. Cinara cupressi was noticed on an imported Abies nordmanniana specimen in a park from this city. O. lavaterae, a Mediterranean species from Tilia sp., currently it is expanding his area in northern regions. We recommend carefully monitoring of imported ornamental plants, because they can be infested and open ways to invasion for the pests with devastated potential.
Micropropagation of ornamental Prunus spp. and GF305 peach, a Prunus viral indicator.
Kalinina, Anna; Brown, Daniel C W
2007-07-01
A micropropagation approach was developed for nine ornamental Prunus species, P. americana, P. cistena, P. glandulosa, P. serrulata 'Kwanzan', P. laurocerasus, P. sargentii, P. tomentosa, P. triloba, P. virginiana 'Schubert', commercially important in North America, and GF305 peach, commonly used for Prunus virus indexing. The micropropagation cycle based on proliferation of vegetative tissues includes establishment of tissue culture through introduction of shoot meristems in vitro, shoot proliferation, root induction and plant acclimatization steps and can be completed in 5 months. A meristem sterilization protocol minimized bacterial and fungal contamination. Multiple shoot formation in ornamental Prunus was obtained through the use of 1 mg l(-1) 6-benzyladenine. For GF305 peach, alteration in the sugar composition, fructose instead of sucrose, and addition of 1 mg l(-1 )ferulic acid had a significant impact on the shoot proliferation rate and maintenance of long-term in vitro culture. Rooting and plant acclimatization conditions were improved using a two-step protocol with a 4-day root induction in indole-3-butiric acid (IBA)-containing media with consequent 3-week root elongation in IBA-free media. One-month incubation of rooted shoots in a vermiculite-based medium resulted in additional shoot and root growth and provided better acclimatization and plant recovery. The micropropagation approach can be used for maintenance of the clonal properties for Prunus spp. as well as a protocol to support meristem therapy against viral infection.
DEFF Research Database (Denmark)
Karpova, Yulia
noted, “they don’t paint pictures, they work in production, speak of materials, textures, and constructions, but the result is still an old-fashioned decorativism, applied fancywork, [ornamental] roosters and flowers or circles and doodles.” The future material culture, as Brik saw it, would...
Does skull morphology constrain bone ornamentation? A morphometric analysis in the Crocodylia.
Clarac, F; Souter, T; Cubo, J; de Buffrénil, V; Brochu, C; Cornette, R
2016-08-01
Previous quantitative assessments of the crocodylians' dermal bone ornamentation (this ornamentation consists of pits and ridges) has shown that bone sculpture results in a gain in area that differs between anatomical regions: it tends to be higher on the skull table than on the snout. Therefore, a comparative phylogenetic analysis within 17 adult crocodylian specimens representative of the morphological diversity of the 24 extant species has been performed, in order to test if the gain in area due to ornamentation depends on the skull morphology, i.e. shape and size. Quantitative assessment of skull size and shape through geometric morphometrics, and of skull ornamentation through surface analyses, produced a dataset that was analyzed using phylogenetic least-squares regression. The analyses reveal that none of the variables that quantify ornamentation, be they on the snout or the skull table, is correlated with the size of the specimens. Conversely, there is more disparity in the relationships between skull conformations (longirostrine vs. brevirostrine) and ornamentation. Indeed, both parameters GApit (i.e. pit depth and shape) and OArelat (i.e. relative area of the pit set) are negatively correlated with snout elongation, whereas none of the values quantifying ornamentation on the skull table is correlated with skull conformation. It can be concluded that bone sculpture on the snout is influenced by different developmental constrains than on the skull table and is sensible to differences in the local growth 'context' (allometric processes) prevailing in distinct skull parts. Whatever the functional role of bone ornamentation on the skull, if any, it seems to be restricted to some anatomical regions at least for the longirostrine forms that tend to lose ornamentation on the snout. © 2016 Anatomical Society.
GARDEN PLANTS: PROBLEMS CAUSED BY AN UNEXPECTED VISITOR
Directory of Open Access Journals (Sweden)
M. A. Oliveira
2014-09-01
Full Text Available Scarabaeidae defoliators are considered of great importance in Brazil because they seriously damage the leaf system of several plant species. The objective of this study was to report the occurrence of the defoliating beetle Bolax campicola Machatschke, 1974 (Coleoptera: Scarabaeidae attacking ornamental plants in the urban area of municipality of Forestal, Minas Gerais State, Brazil. The initial attack was observed on the ornamental palm species Dypsis lutescens (Arecaceae whose leaves were completely consumed, and then these insects began to feed on Canna indica (Cannaceae, another ornamental species, which was found near to the first. However, in the same location newly planted fruit tree seedlings of Plinia trunciflora (Myrtaceae, Averrhoa carambola (Oxalidaceae and Malpighia emarginata (Malpighiaceae were attacked and completely defoliated. This report of damage to plants in urban areas by B. flavolineatus demonstrates the need for studies on the behavior and feeding preference of these insects, and even their ability to adapt to different host plants.
Stress and welfare in ornamental fishes: what can be learned from aquaculture?
Stevens, C H; Croft, D P; Paull, G C; Tyler, C R
2017-08-01
The ornamental fish trade is estimated to handle up to 1·5 billion fishes. Transportation and handling of fishes imposes a range of stressors that can result in mortality at rates of up to 73%. These rates vary hugely, however, and can be as low as 2%, because they are generally estimated rather than based on experimental work. Given the numbers of ornamental fishes traded, any of the estimated mortality rates potentially incur significant financial losses and serious welfare issues. Industry bodies, such as the Ornamental Aquatic Trade Association (OATA), have established standards and codes of best practice for handling fishes, but little scientific research has been conducted to understand the links between stress, health and welfare in ornamental species. In aquaculture, many of the same stressors occur as those in the ornamental trade, including poor water quality, handling, transportation, confinement, poor social and physical environment and disease and in this sector directed research and some resulting interventions have resulted in improved welfare standards. This review considers the concept of welfare in fishes and evaluates reported rates of mortality in the ornamental trade. It assesses how the stress response can be quantified and used as a welfare indicator in fishes. It then analyses whether lessons from aquaculture can be usefully applied to the ornamental fish industry to improve welfare. Finally, this analysis is used to suggest how future research might be directed to help improve welfare in the ornamental trade. © 2017 The Fisheries Society of the British Isles.
DEFF Research Database (Denmark)
Riisberg, Vibeke; Munch, Anders V.
2013-01-01
In this paper we will look at contemporary use of ornament in different scale and contexts – from fashion textiles and interior objects to architecture. The lifespan of a building is different from that of a fashion dress or a plate, but with the digital area it seems like the concern...
Anaerobic soil disinfestation (ASD) combined with soil solarization continues to be evaluated for management of plant-parasitic nematodes in vegetable and ornamental crops in Florida. ASD combines organic amendments and soil saturation to stimulate microbial activity and create anaerobic conditions...
Directory of Open Access Journals (Sweden)
Priyanka Basu
2015-06-01
Full Text Available This article examines texts by Elisabeth Wilson and Martin Heydrich written in 1914 at the University of Leipzig on the subject of ‘primitive’ ornament. Both synopsize the history and literature of this field from its beginnings in the nineteenth century to the time of their writing. This article considers how Wilson and Heydrich represent this history and how the field’s multidisciplinary practitioners perceived its pressing problems. Above all, Wilson and Heydrich set up a number of recurring oppositions between major approaches to ‘primitive’ art and ornament, between ‘materialist’ interpretation, allied with archaeology, symbolic interpretation practiced for the most part by ethnologists, and an ‘aesthetic’ approach, pursued by art theorists and focused on the psychological will of its creators. These issues and this configuration of approaches are further examined in one of August Schmarsow’s important essays on art history and ethnology.
DEFF Research Database (Denmark)
Munch, Anders V.; Riisberg, Vibeke
? In this paper we will look at contemporary use of ornament in different scales and contexts – from fashion textiles and interior objects to architecture. The lifespan of a building is different from that of a fashion dress or a plate, but with the digital era it seems like the concern of appropriateness...
Directory of Open Access Journals (Sweden)
Napoleon N. A. Tjou-Tam-Sin
2017-11-01
Full Text Available Ralstonia pseudosolanacearum (Ralstonia solanacearum phylotype I isolates found in stunted, yellowing, and wilted ornamental rose (Rosa spp. were assessed for their pathogenic ability in two rose cultivars (cv. “Armando” and cv. “Red Naomi” and in four solanaceous crops: tomato (Solanum lycopersicum cv. “Money Maker”, tobacco (Nicotiana tabacum cv. “White Burley”, eggplant (Solanum melongena cv. “Black Beauty” and sweet pepper (Capsicum annum cv. “Yolo Wonder”. Significant differences were observed in susceptibility between the two rose cultivars as well as between the two modes of inoculation performed. The cultivar “Armando” was significantly more susceptible than cultivar “Red Naomi,” exhibiting higher disease severity and incidence. Similarly, stem inoculation after wounding was found to be significantly more effective than soil drenching, resulting in higher disease severity. Additionally, a temperature dependency in susceptibility was observed for both cultivars irrespective of the mode of inoculation, however, this was significantly more pronounced upon soil drenching. The solanaceous crops all showed to be susceptible to the R. pseudosolanacearum isolates originated from the Rosa spp. plants. Furthermore, both rose cultivars were able to harbor symptomless infections with other R. pseudosolanacearum and R. solanacearum isolates than those isolated from rose. Our results clearly demonstrated that latent infections in a rose cultivar such as cv. “Red Naomi” do occur even at temperatures as low as 20°C. This latency poses high risks for the entire floricultural industry as latently infected Rosa spp. plants are propagated and distributed over various continents, including areas where climatic conditions are optimal for the pathogen.
Male mate choice scales female ornament allometry in a cichlid fish
Directory of Open Access Journals (Sweden)
Kullmann Harald
2010-10-01
Full Text Available Abstract Background Studies addressing the adaptive significance of female ornamentation have gained ground recently. However, the expression of female ornaments in relation to body size, known as trait allometry, still remains unexplored. Here, we investigated the allometry of a conspicuous female ornament in Pelvicachromis taeniatus, a biparental cichlid that shows mutual mate choice and ornamentation. Females feature an eye-catching pelvic fin greatly differing from that of males. Results We show that allometry of the female pelvic fin is scaled more positively in comparison to other fins. The pelvic fin exhibits isometry, whereas the other fins (except the caudal fin show negative allometry. The size of the pelvic fin might be exaggerated by male choice because males prefer female stimuli that show a larger extension of the trait. Female pelvic fin size is correlated with individual condition, suggesting that males can assess direct and indirect benefits. Conclusions The absence of positive ornament allometry might be a result of sexual selection constricted by natural selection: fins are related to locomotion and thus may be subject to viability selection. Our study provides evidence that male mate choice might scale the expression of a female sexual ornament, and therefore has implications for the understanding of the relationship of female sexual traits with body size in species with conventional sex-roles.
Mutation breedings in ornamental plants
International Nuclear Information System (INIS)
Matsubara, Hisao
1984-01-01
Several methods of obtaining somatic mutant plants by γ-ray irradiation on pieces of tissues as in vitro adventitious bud technique or small cutting methods with repeated pruning are described. 1) The irradiation to the adventitious buds in the small pieces of organ cultured in vitro and to the small cuttings are employed. Culture beds of agar or of Japanese Kanuma soil were used in vitro culture. In these experiments, Japanese Kanuma soil bed in in vitro culture worked well for root development and transplant of the induced mutants. 2) Combination with in vitro culture and repeated pruning technique were used for isolation and fixation of solid somatic mutant from small sectorial mutation induced by irradiation. This method was successful for begonia, chrysanthemum, aberia and winter daphne. 3) These data indicates that most of the induced mutant plants were non-chimeric, while a few others were chimeric. Among the new varieties, ''Gin-Sei'', ''Ryoku-Ha'', ''Big-Cross'', ''Kaede-Iron'', ''Mei-Fu-Hana-Tsukubane-Utsugi'' and ''Daphne-γ-3'' are non-chimeric, and ''Mini-Mini-Iron'' and ''Orange-Iron'' are chimeric. Moreover, these new varieties have remarkably differed in size and in color pattern from original variety. From the experimental results of somatic mutation, it is indicated that plant tissue culture have enormous potential in radiation breeding and in rapid propagation of the somatic mutant. (author)
Molecular characterisation and expression analysis of acc oxidase gene from guzmania ruiz and pav
International Nuclear Information System (INIS)
Jianxin, L.; Huaqiao, D.; Weiyong, W.; Danqing, T.
2017-01-01
ACC oxidase is the last key enzyme of ethylene synthesis pathway, while ethylene is a key factor affecting flowering in ornamental bromeliad. To understand ACC oxidase gene's characteristics and its effect on ornamental bromeliad flowering, we cloned 1504bp full-length cDNA sequence (GenBank: JX972145) and 2546bp corresponding genomic sequence (GenBank: JX972146)of GoACO1 (ACC oxidase gene) from Guzmania variety: Ostara. Prokaryotic expression study showed that expression of GoACO1 can produced a 41 KD protein precipitation in Escherichia coli DE3(BL-21); Real-time quantitative analysis showed that GoACO1 can express in all tested tissues including floral organ, bract, leaf and scape, and expression quantity in bract was the highest. Through constructing plant overexpression vector, transforming into Arabidopsis thaliana, and investigating blossom character of T2 generation seeds, we found that first flowering time of the goal Arabidopsis thaliana was 1.5 days earlier, and their peak flowering time(the number of flowering more than 50%) was 1.8 days earlier, compared with wild type one. Taken together, our results suggested that GoACO1can express in all kinds of tissues and seems to promote Arabidopsis thaliana flowering earlier. (author)
Directory of Open Access Journals (Sweden)
Marlo P Maciel
2012-02-01
Full Text Available Plantas de girassol ornamental 'Sol Vermelho' foram cultivadas em hidroponia com o objetivo de avaliar o uso de águas salobras sobre seu rendimento e qualidade da inflorescência. As águas salobras foram usadas para preparar a solução nutritiva e repor as perdas por evapotranspiração. O experimento foi conduzido em delineamento inteiramente aleatorizado com cinco níveis de salinidade da água: 1,51; 2,56; 3,86 e 6,19 dS m-1, obtidos pela adição de NaCl na água doce local (0,47 dS m-1 que também foi usada como testemunha. Cada tratamento foi repetido quatro vezes e cada parcela (com quatro plantas foi construída para simular um sistema independente da técnica do fluxo laminar de nutrientes (NFT. Observou-se uma redução linear causada pelo aumento da salinidade da água sobre a altura das plantas, o diâmetro do caule e a massa da matéria seca da parte aérea. Tanto a altura da planta quanto o diâmetro do caule foram reduzidos em 3,2% e a massa de matéria seca da parte aérea foi reduzida em 5,78% (dS m-1-1, para cada acréscimo unitário da salinidade da água (dS m-1. Por outro lado, a salinidade da água não afetou o tamanho do capítulo do girassol e não foram registrados sintomas de toxicidade causados pela salinidade. Esses resultados sustentam a viabilidade técnica do uso de águas salobras para produção hidropônica de girassol ornamental.Plants of ornamental sunflower 'Sol Vermelho' were grown under hydroponic conditions aiming to evaluate the effects of use of brackish water on its yield and inflorescence (capitulum quality. The brackish waters were utilized to prepare nutrient solution and to replace water due to evapotranspiration loss. The experiment was carried out in a completely randomized experimental design with five levels of water salinity: 1.51; 2.56; 3.86 and 6.19 dS m-1, obtained by addition of NaCl to local fresh water; this fresh water (0.47 dS m-1 was also studied as control treatment. Each
State of the science and challenges of breeding landscape plants with ecological function
Wilde, H Dayton; Gandhi, Kamal J K; Colson, Gregory
2015-01-01
Exotic plants dominate esthetically-managed landscapes, which cover 30–40 million hectares in the United States alone. Recent ecological studies have found that landscaping with exotic plant species can reduce biodiversity on multiple trophic levels. To support biodiversity in urbanized areas, the increased use of native landscaping plants has been advocated by conservation groups and US federal and state agencies. A major challenge to scaling up the use of native species in landscaping is providing ornamental plants that are both ecologically functional and economically viable. Depending on ecological and economic constraints, accelerated breeding approaches could be applied to ornamental trait development in native plants. This review examines the impact of landscaping choices on biodiversity, the current status of breeding and selection of native ornamental plants, and the interdisciplinary research needed to scale up landscaping plants that can support native biodiversity. PMID:26504560
The Pometum Apple Key - an internet tool for genebank data including cultivar identification
DEFF Research Database (Denmark)
Toldam-Andersen, Torben; Korsgaard, Maren; Nordling, Jonas
2011-01-01
by Robert Hogg in 1880s. Other parameters focus on quality for use (table fruit, cooking, juice), flowering characteristics and tree growth and health (disease sensitivity). The development and use of the Apple Key is demonstrated and the stability of different characters in cultivar identification......Cultivar descriptions and correct identification are central for the work with genetic material, especially in Genebanks. The data collection of many descriptive parameters is very laborious in itself, but the handling of the data is also a challenge. However, when it comes to the level of use....... A dual aim was; firstly to present the diversity of apples in terms of appearance and qualities and also allow the inclusion of unique historical and cultural information including photos, pomological drawings and paintings. Secondly, the aim was to develop a tool for identification of cultivars and easy...
Ornamental Horticulture. Course of Study Outlines. 1975 Edition. Volume XXX.
Wilson, Aubry
These courses of study in ornamental horticulture for secondary and adult technical education levels are based on a 1972 Rutgers University study and are designed to accomodate occupational needs in the field of ornamental horticulture. Job titles emphasized at the secondary level are caretaker, nurserymen, flower grower, and flower salesperson;…
Induction of somatic mutations in some vegetatively Propagated ornamentals by gamma radiation
International Nuclear Information System (INIS)
Das, P.K.; Ghosh, P.; Dube, S.; Dhua, S.P.
1974-01-01
Attempts were made to produce mutations in some vegetatively propagated ornamentals by acute and chronic gamma irradiation. Rooted cutting of Chrysanthemums and dormant bulbs of Dahlias were exposed to 1.5, 2.5, 3.5 and 2.0, 3.0 kR of acute doses respectively. In chronic irradiation, potted plants of Bougainvillea, Hibiscus, Allamanda, Achania, Jasminum, Chrysanthemum were exposed to several dose rates at different isodose arcs in the gamma field. Isolated mutants are being vegetatively multiplied and some of them have already been stabilized as pure forms. (M.G.B.)
Plan de marketing para un vivero de planta ornamental
MARCH CUBERTORET, PAULA
2017-01-01
[ES] Se ha realizado un plan de marketing de un vivero de planta ornamental interior en Petrés (Valencia), así como un estudio de mercado para analizar las necesidades del consumidor y proponer mejorar el posicionamiento de la empresa para finalmente aumentar las ventas de sus productos. March Cubertoret, P. (2017). Plan de marketing para un vivero de planta ornamental. http://hdl.handle.net/10251/92819 TFGM
Influence of culture on ornament of the traditional architecture in Medan (Malay Deli Sultanate)
Nawawiy Loebis, M.; Ginting, Nurlisa; Simanjuntak, Haryanto; Jamaluddin, Fattah
2018-03-01
During the Dutch colonialism, Malay Deli Sultanate was dominant and big which now their superiority was destroyed by Social Revolution. At that time, Malay people live in the peak of glory and civilization resulting in their growing culture. The purpose of research is to find the influence of culture in Malay Deli ornaments as a part of Architecture. Data obtained with literatures study and observation. The data was analysed using qualitative method to describe the phenomenon occur between variables. The aim of this research is identifying any culture influences ornaments in architecture. Such as Islam influences Malay ornament on the building and ornament division between the noble and people. The research result is the culture such as language, religion have influence on ornaments in Malay Deli architecture.
Potencial ornamental de Curcuma.
Directory of Open Access Journals (Sweden)
Ana Christina Rossini Pinto
2003-06-01
Full Text Available A introdução de novas espécies e de novos produtos na indústria da floricultura brasileira é de grande importância para o crescimento do setor, ampliando osortimento de produtos disponíveis, atendendo à necessidade dos produtores e consumidores por novidade, importante componente da estratégia de marketing, desenvolvendo competitividade e estimulando a comercialização, tanto ao nível de mercado interno como externo. O presente artigo discorre sobre o potencial ornamental de espécies do gênero Curcuma L. (Zingiberaceae e apresenta informações referentes à botânica, à produção e à tecnologia de pós-colheita e pós-produção de algumas espécies disponíveis atualmente no mercado internacional de flores e plantas ornamentais, bem como de espécies com potencial de utilização como ornamental. Espera-se, assim, chamar a atenção de pesquisadores e produtores para o potencial do gênero e contribuir para o estabelecimento e desenvolvimento da sua produção no Brasil.
Holman, Luke; Bro-Jørgensen, Jakob
2016-08-01
Raia et al. propose that the evolution of the shape and complexity of animal ornaments (e.g., deer antlers) can be explained by interspecific variation in body size and is not influenced by sexual selection. They claim to show that ornament complexity is related to body size by an 0.25-power law and argue that this finding precludes a role for sexual selection in the evolution of ornament complexity. However, their study does not test alternative hypotheses and mismeasures antler shape allometry by omitting much of the published data. We show that an index of sexual selection (sexual size dimorphism) is positively correlated with size-corrected antler complexity and that the allometric slope of complexity is substantially greater than 0.25, contra Raia et al. We conclude that sexual selection and physical constraints both affect the evolution of antler shape.
Diseases of Ornamental and Shade Trees, Shrubs, Vines, and Ground Covers.
Nichols, Lester P.
This agriculture extension service publication from Pennsylvania State University covers the identification and control of common ornamental trees, shrubs, and ground cover diseases. The publication is divided into sections. The first section discusses the diseases of ornamental and shade trees, including general diseases and diseases of specific…
Directory of Open Access Journals (Sweden)
Darcy Mitchell
2011-11-01
Full Text Available Bromeliads grow almost exclusively in the New World tropics and subtropics, mainly in South America in the Brazilian Atlantic Forest (ca. 1200 species. Within the last few decades, their beautiful shapes and colors, low maintenance and easy adaptability to small gardens have brought bromeliads into worldwide use as ornamental plants. While the ornamental bromeliad trade could make significant contributions to household economies in rural areas, the trade may represent a significant threat in some of the bromeliad biodiversity hotspot countries such as Brazil, Bolivia and Colombia. This paper presents an overview of production volumes, analysis of the Brazilian bromeliads trade chain – at the state, national and international levels – and recommendations to address development and conservation challenges.
Energy Technology Data Exchange (ETDEWEB)
Gori, R.; Lubello, C. [Florence Univ., Florence (Italy). Dipt. di Ingegneria Civile
1999-12-01
After a brief introduction on irrigation waste water reuse, the paper deals with the case of Pistoia (italy), the most important nursery area in Italy, which has developed an experiment for evaluating the effects of waste water treatment plant effluent irrigation. The better physiological and growth parameters of plants irrigated with the effluent shows that it could be a valid alternative of water and fertilizer nutrients resources for ornamental plants. [Italian] Dopo una breve introduzione sul riuso delle acque reflue a fini irrigui, il lavoro affronta il caso di Pistoia, sede della maggiore area vivaistica italiana, che utilizza le acque reflue dal 1998 con una sperimentazione volta a verificare gli effetti dell'irrigazione con l'effluente dell'impianto di depurazione centrale. Le piante cosi' irrigate hanno mostrato parametri di crescita e fisiologici generalmente migliori di quelli riscontrati sulle piante irrigate con i metodi tradizionali.
Analysis of Chromosome Number in Some Allium and Silene Wild Species with Ornamental Use
Lucia DRAGHIA; Elena Liliana CHELARIU; Culiţă SÎRBU; Maria BRÂNZĂ; Cristina SANDU MICULSCHI
2013-01-01
The present study analyses the number of somatic chromosomes in plant species with ornamental value, in Romanian indigenous flora, Allium (A. flavum L., A. saxatile Bieb.) and Silene (S. compacta Fischer., S. supina M.Bieb.). The biological material was identified and harvested in the South-Eastern part of Dobrogea (Tulcea and Constanţa counties), area in the South-Eastern part of Romania, situated between the Danube and the Black Sea. Individuals from two populations of Allium flavum and All...
Crawling to collapse: ecologically unsound ornamental invertebrate fisheries.
Directory of Open Access Journals (Sweden)
Andrew Rhyne
Full Text Available BACKGROUND: Fishery management has historically been an inexact and reactionary discipline, often taking action only after a critical stock suffers overfishing or collapse. The invertebrate ornamental fishery in the State of Florida, with increasing catches over a more diverse array of species, is poised for collapse. Current management is static and the lack of an adaptive strategy will not allow for adequate responses associated with managing this multi-species fishery. The last decade has seen aquarium hobbyists shift their display preference from fish-only tanks to miniature reef ecosystems that include many invertebrate species, creating increased demand without proper oversight. The once small ornamental fishery has become an invertebrate-dominated major industry supplying five continents. METHODOLOGY/PRINCIPAL FINDINGS: Here, we analyzed the Florida Marine Life Fishery (FLML landing data from 1994 to 2007 for all invertebrate species. The data were organized to reflect both ecosystem purpose (in the wild and ecosystem services (commodities for each reported species to address the following question: Are ornamental invertebrates being exploited for their fundamental ecosystem services and economic value at the expense of reef resilience? We found that 9 million individuals were collected in 2007, 6 million of which were grazers. CONCLUSIONS/SIGNIFICANCE: The number of grazers now exceeds, by two-fold, the number of specimens collected for curio and ornamental purposes altogether, representing a major categorical shift. In general, landings have increased 10-fold since 1994, though the number of licenses has been dramatically reduced. Thus, despite current management strategies, the FLML Fishery appears to be crawling to collapse.
Directory of Open Access Journals (Sweden)
Caroline de Moura D'Andréa Mateus
2009-09-01
Full Text Available O objetivo do trabalho foi avaliar o uso de tela plástica fotosseletiva e de doses do regulador de crescimento paclobutrazol (0; 0,25; 0,50; 0,75 e 1,0 mg L-1 de substrato no desenvolvimento de plantas de girassol ornamental cv. Sunbright Supreme em ambiente protegido, visando à comercialização em vasos. Dois abrigos foram cobertos com filme de polietileno transparente de 0,1 mm de espessura e, em um deles, o filme plástico foi aplicado sobre tela plástica de cor azul, com 30% de sombreamento. Foram realizadas avaliações de microclima e fitotécnicas. A radiação solar global foi reduzida em 27,5% com o uso da tela fotosseletiva, porém, houve pouca influência sobre a temperatura e umidade relativa do ar. Ainda, o uso de tela fotosseletiva não reduziu o porte das plantas e não influenciou significativamente o diâmetro do capítulo, o número de folhas por planta e o tempo para a floração. Todavia, o uso de paclobutrazol reduziu significativamente a altura das plantas, de modo que permitisse sua comercialização em vasos, sem prejuízos ao seu aspecto visual, visto que não diminuiu o diâmetro do capítulo. O uso do regulador de crescimento retardou a floração, por um tempo que variou com a dose empregada, mas que não ultrapassou uma semana.The objective of the research was to evaluate the use of photoselective plastic shadenet and the effect of plant growth retardant paclobutrazol drench at different concentrations (0; 0.25; 0.50; 0.75 e 1.0 mg L-1 of substrate on potted plants of sunflower cv Sunbright Supreme grown under protected environment. Two greenhouses were covered with transparent polyethylene film, 0,1 mm thick, and at one of them, the plastic film was applied over a blue photoselective plastic shadenet (30% of shading. Microclimatic and agronomic parameters were evaluated. The solar radiation was reduced by 27.5 % when the shadenet was used, which resulted in a very low influence on the air temperature and
DEFF Research Database (Denmark)
Lütken, Henrik Vlk; Hegelund, Josefine Nymark; Lauridsen, Uffe Bjerre
of these compounds are potentially harmful to both the environment and human health. A new non-GMO molecular breeding strategy, as opposed to both the application of chemical growth retardants and conventional molecular breeding is Agrobacterium rhizogenes-mediated transformation. In this method, the soil borne...... for transformations, plants produced via this approach are not considered as GMOs in the European Union and Japan. We have developed an optimised Agrobacterium rhizogenes-mediated transformation platform useful for a wide range of ornamentals. Kalanchoë was the starting point and the effect of the rol-genes has now...
Directory of Open Access Journals (Sweden)
Lúcia Sadayo Assari Takahashi
2009-09-01
Full Text Available O gênero Anthurium Schott. (Araceae compreende mais de 600 espécies. Todas são ornamentais e se destacam pela beleza da folhagem. A espécie Anthurium andraeanum Lind. tem a preferência dos consumidores como planta ornamental devido ao tamanho e colorido de suas espatas. O objetivo do trabalho foi avaliar o desenvolvimento, em vaso, de cinco cultivares de A. andraeanum em Londrina, Norte do Paraná. As cultivares 'Parakanã', 'Terena', 'Apalai', 'Ianomami' e 'Rubi' foram produzidas por meio de micropropagação e selecionadas pelo Instituto Agronômico (IAC. O trabalho foi desenvolvido em estufa tipo arco com 80% de sombreamento obtido por tela de polipropileno de cor preta. Foi plantada uma muda por vaso plástico com volume de quatro litros usando como substrato fibra de coco tipo 80. A avaliação do desempenho comparativo foi iniciada, a partir do transplante das mudas. O comprimento do pecíolo, o número de folhas, a largura e o comprimento das espatas e o comprimento da haste floral foram avaliados mensalmente. Houve aumento na altura e no número de folhas das plantas nos três anos de cultivo. As cultivares 'Parakanã', 'Rubi', 'Terena' e 'Apalai' floresceram e tiveram maior desenvolvimento vegetativo sendo recomendadas para o cultivo em vasos no Norte do Paraná.The genus Anthurium Schott. (Araceae comprehends more than 600 species. All species are ornamental and are distinguished by the beauty of their foliage. The Anthurium andraeanum Lind. has the preference of the public as an ornamental plant because of the color and size of its spathes. The objective of this work was to evaluate of five cultivars of A. andraeanum, as vessel plant, in the northern region of Paraná State. The cultivars 'Parakanã', 'Terena', 'Apalai', 'Ianomami' and 'Rubi' produced by micropropagation by Instituto Agronômico (IAC were analyzed. The study was conducted at greenhouse with 80% of shade given by a black colored polypropylene screen. One seedling
I'm sexy and I glow it: female ornamentation in a nocturnal capital breeder.
Hopkins, Juhani; Baudry, Gautier; Candolin, Ulrika; Kaitala, Arja
2015-10-01
In many species, males rely on sexual ornaments to attract females. Females, by contrast, rarely produce ornaments. The glow-worm (Lampyris noctiluca) is an exception where wingless females glow to attract males that fly in search of females. However, little is known about the factors that promote the evolution of female ornaments in a sexual selection context. Here, we investigated if the female ornament of the glow-worm is a signal of fecundity used in male mate choice. In support of this, we found brightness to correlate with female fecundity, and males to prefer brighter dummy females. Thus, the glow emitted by females is a reliable sexual signal of female fecundity. It is likely that male preference for the fecundity-indicating ornament has evolved because of large variation among females in fecundity, and because nocturnal males cannot directly assess female size and fecundity. These results indicate that female ornamentation may evolve in capital breeders (i.e. those in which stored resources are invested in reproduction) when females vary significantly in fecundity and this variation cannot be assessed directly by males. © 2015 The Author(s).
Directory of Open Access Journals (Sweden)
James B Johnson
Full Text Available Determining the costs of sexual ornaments is complicated by the fact that ornaments are often integrated with other, non-sexual traits, making it difficult to dissect the effect of ornaments independent of other aspects of the phenotype. Hybridization can produce reduced phenotypic integration, allowing one to evaluate performance across a broad range of multivariate trait values. Here we assess the relationship between morphology and performance in the swordtails Xiphophorus malinche and X. birchmanni, two naturally-hybridizing fish species that differ extensively in non-sexual as well as sexual traits. We took advantage of novel trait variation in hybrids to determine if sexual ornaments incur a cost in terms of locomotor ability. For both fast-start and endurance swimming, hybrids performed at least as well as the two parental species. The sexually-dimorphic sword did not impair swimming performance per se. Rather, the sword negatively affected performance only when paired with a sub-optimal body shape. Studies seeking to quantify the costs of ornaments should consider that covariance with non-sexual traits may create the spurious appearance of costs.
Oxidative stress and the effect of parasites on a carotenoid-based ornament.
Mougeot, F; Martínez-Padilla, J; Blount, J D; Pérez-Rodríguez, L; Webster, L M I; Piertney, S B
2010-02-01
Oxidative stress, the physiological condition whereby the production of reactive oxygen and nitrogen species overwhelms the capacity of antioxidant defences, causes damage to key bio-molecules. It has been implicated in many diseases, and is proposed as a reliable currency in the trade-off between individual health and ornamentation. Whether oxidative stress mediates the expression of carotenoid-based signals, which are among the commonest signals of many birds, fish and reptiles, remains controversial. In the present study, we explored interactions between parasites, oxidative stress and the carotenoid-based ornamentation of red grouse Lagopus lagopus scoticus. We tested whether removing nematode parasites influenced both oxidative balance (levels of oxidative damage and circulating antioxidant defences) and carotenoid-based ornamentation. At the treatment group level, parasite purging enhanced the size and colouration of ornaments but did not significantly affect circulating carotenoids, antioxidant defences or oxidative damage. However, relative changes in these traits among individuals indicated that males with a greater number of parasites prior to treatment (parasite purging) showed a greater increase in the levels of circulating carotenoids and antioxidants, and a greater decrease in oxidative damage, than those with initially fewer parasites. At the individual level, a greater increase in carotenoid pigmentation was associated with a greater reduction in oxidative damage. Therefore, an individual's ability to express a carotenoid-based ornament appeared to be linked to its current oxidative balance and susceptibility to oxidative stress. Our experimental results suggest that oxidative stress can mediate the impact of parasites on carotenoid-based signals, and we discuss possible mechanisms linking carotenoid-based ornaments to oxidative stress.
Directory of Open Access Journals (Sweden)
Fatemeh Ahani
2017-12-01
Full Text Available This paper addresses the status of ornamental practices in contemporary Iranian architecture, specifically after the Islamic revolution, using a descriptive–analytical method. In this regard, the external appearances of 92 prominent buildings constructed in Tehran between 1979–2013, were examined, and their means of visual expression were analyzed. The results indicate that half of the samples lack ornament; in the others, a noticeable increase in the ornamental element size and visual complexity, as well as a significant decrease in their semantic contents (as compared with traditional ornament were observed. These are changes that mostly resulted from modernization and subsequent processes such as industrialization and rationalization, as well as the long-lasting influence of modernists’ arguments against such practices. The presence of ornament in architecture, however, is necessary due to its crucial role in increasing the visual coherence of the environment and fulfilling the human desire for order and beauty. Therefore, this paper suggests the replacement of the current dualistic model of thought, which is dominant in the profession and schools of architecture in Iran, with one that provides an opportunity for the coexistence of concepts such as ornament and structure, form and function, and the sensuous and the rational, hence providing a revitalization of ornament in contemporary architecture.
Induced mutation and in vitro culture techniques for the genetic improvement of ornamentals
International Nuclear Information System (INIS)
Lapade, Avelina G.; Veluz, Ana Maria S.; Marbella, Lucia J.; Rama, Manny G.
2001-01-01
Mutation breeding using cobalt-60 ( 60 Co) gamma radiation coupled with tissue culture techniques is undertaken for genetic improvement of foliage ornamentals (Dracaena sp. and Murraya exotica L.) and cutflowers (Chrysanthemum morifolium and orchids; Vanda sanderiana, Dendrobium Pattaya Beauty and Phalenopsis schilleriana). Gamma radiation (10-30 Gy) induced chlorophyll mutations and several morphological changes in D. sanderiana. For D. godseffiana, irradiated cuttings resulted in reduction of leaf size and chlorophyll mutations. Reduction in height was observed in the M 2 generation of Murraya exotica L. irradiated at doses ranging from 10 to 30 Gy. The dwarf Murraya mutant was multiplied through the use of seeds and presently 116 plants are commercially available and are ''test marketed'' to the public. Tissue culture technique was used to induce mutation and as a means of micropropagation in two ornamental crops (orchids and chrysanthemum). Effects of different doses of gamma radiation on callus induction from nodal sections of chrysanthemum grown in Murashige and Skoog's (MS) with naphthalene acetic acid (NAA) and benzyl adenine (BA) were studied. Micropropagation of irradiated and unirradiated chrysanthemum using MS basal medium is presently being studied. Whorling and changes in leaf color were observed at 10 Gy and doubling of leaf growth at the node at 20 Gy for vegetatively generated V 3 plant. In orchids, irradiation of immature embryo with gamma rays ranging from 5 to 10 Gy increased the percentage of germination in Dendrobium Pattaya Beauty and P. schilleriana. Protocorms of Vanda sanderiana irradiated at 10 Gy and grown in Knudson C medium developed into plantlets that are bigger and more vigorous than those irradiated at 20 GY and from the control plant. A decrease in seedling height was observed with increasing dose of gamma radiation. (Author)
Darcy Mitchell; Raquel Rejane Bonato Negrelle; Adilson Anacleto
2012-01-01
Bromeliads grow almost exclusively in the New World tropics and subtropics, mainly in South America in the Brazilian Atlantic Forest (ca. 1200 species). Within the last few decades, their beautiful shapes and colors, low maintenance and easy adaptability to small gardens have brought bromeliads into worldwide use as ornamental plants. While the ornamental bromeliad trade could make significant contributions to household economies in rural areas, the trade may represent a significant threat in...
Ornamental Horticulture Production Occupations. Curriculum Guide.
Reneau, Fred; And Others
This curriculum guide contains guidesheets for the ornamental horticulture production occupations. Each guidesheet provides a job-relevant task; performance objective, with task, performance standard, source of standard, and conditions for performance of task; enabling objectives; a list of resources; teaching activities; a criterion-referenced…
Weiss, S L; Foerster, K; Hudon, J
2012-02-01
Indicator models of sexual selection suggest that signal honesty is maintained via costs of ornament expression. Carotenoid-based visual signals are a well-studied example, as carotenoids may be environmentally limited and impact signaler health. However, not all bright yellow, orange and red ornaments found in vertebrates are carotenoid-based; pteridine pigments may also produce these colors. We examine the contribution of carotenoid and pteridine pigments to the orange reproductive color of female striped plateau lizards (Sceloporus virgatus). This color ornament reliably indicates female mate quality, yet costs maintaining signal honesty are currently unknown. Dietary carotenoid manipulations did not affect orange color, and orange skin differed from surrounding white skin in drosopterin, not carotenoid, content. Further, orange color positively correlated with drosopterin, not carotenoid, concentration. Drosopterin-based female ornaments avoid the direct trade-offs of using carotenoids for ornament production vs egg production, thus may relax counter-selection against color ornament exaggeration in females. Direct experimentation is needed to determine the actual costs of pteridine-based ornaments. Like carotenoids, pteridines influence important biological processes, including immune and antioxidant function; predation and social costs may also be relevant. Copyright © 2011 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Evgeniy S Balakirev
2017-08-01
Full Text Available The complete mitochondrial (mt genome is sequenced in 2 individuals of the Cherskii’s sculpin Cottus czerskii . A surprisingly high level of sequence divergence (10.3% has been detected between the 2 genomes of C czerskii studied here and the GenBank mt genome of C czerskii (KJ956027. At the same time, a surprisingly low level of divergence (1.4% has been detected between the GenBank C czerskii (KJ956027 and the Amur sculpin Cottus szanaga (KX762049, KX762050. We argue that the observed discrepancies are due to incorrect taxonomic identification so that the GenBank accession number KJ956027 represents actually the mt genome of C szanaga erroneously identified as C czerskii . Our results are of consequence concerning the GenBank database quality, highlighting the potential negative consequences of entry errors, which once they are introduced tend to be propagated among databases and subsequent publications. We illustrate the premise with the data on recombinant mt genome of the Siberian taimen Hucho taimen (NCBI Reference Sequence Database NC_016426.1; GenBank accession number HQ897271.1, bearing 2 introgressed fragments (≈0.9 kb [kilobase] from 2 lenok subspecies, Brachymystax lenok and Brachymystax lenok tsinlingensis , submitted to GenBank on June 12, 2011. Since the time of submission, the H taimen recombinant mt genome leading to incorrect phylogenetic inferences was propagated in multiple subsequent publications despite the fact that nonrecombinant H taimen genomes were also available (submitted to GenBank on August 2, 2014; KJ711549, KJ711550. Other examples of recombinant sequences persisting in GenBank are also considered. A GenBank Entry Error Depositary is urgently needed to monitor and avoid a progressive accumulation of wrong biological information.
Kenneth Frank Baker--pioneer leader in plant pathology.
Cook, R James
2005-01-01
Kenneth F. Baker (1908-1996) made major contributions to understanding diseases of ornamental plants, seed pathology, soil-borne plant pathogens, biological control, and history of plant pathology. His work set the stage for the success of today's ornamentals and nursery industries. His leadership and writings created the scientific framework for research and teaching on soil-borne plant pathogens and biological control. After B.Sc. and Ph.D. degrees from Washington State University in 1930 and 1934, respectively, and one year as a National Research Council Fellow with B.M. Dugger at Wisconsin, he took jobs in 1935 with the U.S. Department of Agriculture in Nebraska on establishment of shelter belts and 1936-39 with the Pineapple Producers Cooperative Association in Hawaii. He worked on diseases of ornamental plants at the University of California, Los Angeles, starting in 1939, moving to Berkeley in 1961 when the UCLA program closed. He retired in 1975 and moved to Corvallis, OR, as Emeritus Professor, Oregon State University, and Collaborator, U.S. Department of Agriculture, Agricultural Research Service. He spent four sabbatical leaves in Australia, and was elected fellow of the American Association for the Advancement of Science in 1950, fellow of the American Phytopathological Society in 1969, and the Horticultural Hall of Fame in 1976.
Selected Landscape Plants. Slide Script.
McCann, Kevin
This slide script, part of a series of slide scripts designed for use in vocational agriculture classes, deals with commercially important woody ornamental landscape plants. Included in the script are narrations for use with a total of 253 slides illustrating 92 different plants. Several slides are used to illustrate each plant: besides a view of…
SURVEY OF ORNAMENTAL FERNS, THEIR MORPHOLOGY AND ...
African Journals Online (AJOL)
ornamental ferns for environmental management and economic values. ... little variations in the structures of rhizome except in Phymatodes .... forms such as erect, tall, open, bushy and .... linear leaflet with acute apex and flat, glabrous lamina.
International Nuclear Information System (INIS)
Mufti, F.U.D.; Banaras, S.
2015-01-01
Internal control genes are the constitutive genes which maintain the basic cellular functions and regularly express in both normal and stressed conditions in living organisms. They are used in normalization of gene expression studies in comparative analysis of target genes, as their expression remains comparatively unchanged in all varied conditions. Among internal control genes, actin is considered as a candidate gene for expression studies due to its vital role in shaping cytoskeleton and plant physiology. Unfortunately most of such knowledge is limited to only model plants or crops, not much is known about important medicinal plants. Therefore, we selected seven important medicinal wild plants for molecular identification of actin gene. We used gene specific primers designed from the conserved regions of several known orthologues or homologues of actin genes from other plants. The amplified products of 370-380 bp were sequenced and submitted to GeneBank after their confirmation using different bioinformatics tools. All the novel partial sequences of putative actin genes were submitted to GeneBank (Parthenium hysterophorus (KJ774023), Fagonia indica (KJ774024), Rhazya stricta (KJ774025), Whithania coagulans (KJ774026), Capparis decidua (KJ774027), Verbena officinalis (KJ774028) and Aerva javanica (KJ774029)). The comparisons of these partial sequences by Basic Local Alignment Search Tool (BLAST) and phylogenetic trees demonstrated high similarity with known actin genes of other plants. Our findings illustrated highly conserved nature of actin gene among these selected plants. These novel partial fragments of actin genes from these wild medicinal plants can be used as internal controls for future gene expression studies of these important plants after precise validations of their stable expression in such plants. (author)
Directory of Open Access Journals (Sweden)
Yu. V. Plugatar
2017-01-01
Full Text Available The article provides the data on creating information system (IS for stocktaking and handling the ornamental woody and herbaceous plants at the Nikitsky Botanical Gardens (NBG on the basis of a database (DB and a geographic information system (GIS for addressing the problems related to the preservation of biological diversity and sustainable development of the territory.The DB is being created on the basis of a relation model using of an analytic language and a graphic method of displaying the model “object – property – relation” using International Transfer Format (ITF for coding standard fields. For formation of web maps, the electronic layers are exported to the web-GIS on the NextGIS Web platform and configured into the thematic web maps.The information on the infological DB model has been provided. Functions to be performed by the IS and its final components have been described. The IS will make it possible to assess the current status of the NBG’s collection funds and plan the collection policy aimed at rehabilitating of plants’ gene pool and enriching the cultivated flora at the Southern Coast of Crimea.
Rotylenchulus reniformis on Greenhouse-grown Foliage Plants: Host Range and Sources of Inoculum.
Starr, J L
1991-10-01
Two sources of inoculum of reniform nematodes, Rotylenchulus reniformis, were identified for infestation of ornamental foliage plants in commercial greenhouses. These were water from a local canal system and rooted cuttings purchased from other sources. Eight ornamental plant species were identified as good hosts for the reniform nematode, with each species supporting a reniform population density equal to or greater than that supported by 'Rutgers' tomato and a reproduction factor of greater than 1.0. Nine other plant species were identified as poor hosts.
Gumilar, I.; Rizal, A.; Sriati; Setiawan Putra, R.
2018-04-01
This research aim was to analyzed process of decision making of purchasing ornamental freshwater fish at Peta Street, Bandung City and Analyzed what factors are driving consumers to buy freshwater fish Peta Street. The method used in this research is case study with rating scale and rank spearman analysis. The sampling technique is the accidental random sampling method consist of 30 respondents. The consumer’s decision making process consist of five stages, namely the recognition of needs, information searching, alternative evaluation, process of purchasing, and the evaluation of results. The results showed that at the stage of recognition of needs the motivation of purchasing freshwater fish because respondents are very fond of ornamental freshwater fish, at the stage of information search, the information sources are from the print media and friends or neighborhood. At the stage of alternative evaluation, the reason consumers buy ornamental freshwater fish because the quality of good products. The stage of purchasing decision process consumers bought 1-5 fish with frequency of purchase 1 time per month. The evaluation of results of post-purchasing consumers feel very satisfied with the fish products and the price is very affordable. To observe the factors that influence purchasing motivation of consumers, spearman rank test is the method. The results showed that the quality and price of the product are the factors that most influence the purchase decision of ornamental freshwater fish with the range of student-t value 3,968 and 2,107.
Vibe, Ingrid M Østby
2007-01-01
A critical factor that distinguishes modern humans, Homo sapiens, from animals is the ability to communicate using symbols. One example is the use of personal ornaments. People in all cultures use personal ornaments to express something about themselves, and a wide range of functions and meanings can be applied to different ornamentation. The personal ornaments from three Later Stone Age sites in the Blomboschfontein Region, southern Cape, South Africa were analysed in order to determine vari...
The prevalence of parasites in ornamental fish from fish market in Medan
Dewi, R. R.; Desrita; Fadhilla, A.
2018-02-01
Parasites still become the major problem in ornamental fish as the fast grown of its trading in Indonesia. Parasites causes diseases in ornamental fish hence followed by death and reducing its appearence. In this study, the prevalence of parasites in 100 apparently healthy ornamental fishes namely Guppy (Poecilia reticulate) and Goldfish (Carrasius auratus) were determined. The method of this research used was survey in local fish market in Medan from March to May 2017 The aim of this study was to determine the parasite that infects aquarium fishes and find out its prevalence. For this purpose, ornamental fishes were examined for parasites from their skin, fin, gill and intestine using wet mount method under a light microscope. The survey result showed that parasites that infect Guppy and Goldfish were Monogenea (Dactylogyrus sp and Gyrodactylus sp) in their skin and gill, Protozoa (piscinodinium sp) in their gill and Nematoda (Capillaria sp) in abdominal cavity. Prevalence rate of parasites that attack Guppy in Medan is Dactylogyrus sp (8%), Gyrodactylus sp (14 %), Piscinodinium sp (6%) and Capillaria sp (8%). Then, prevalence rate of Capilaria sp that attack Goldfish is 4%. The conclusion of this work revealed that the prevalence rate of ectoparasite and endoparasites in ornamental fishes in Medan had the low rate as well as there was no pathological findings is observed. However, these parasites could be a harmful parasitic diseases in case there is the changes in aquarium environment and improper fish handling.
Sexual selection on land snail shell ornamentation: a hypothesis that may explain shell diversity
Directory of Open Access Journals (Sweden)
Schilthuizen Menno
2003-06-01
Full Text Available Abstract Background Many groups of land snails show great interspecific diversity in shell ornamentation, which may include spines on the shell and flanges on the aperture. Such structures have been explained as camouflage or defence, but the possibility that they might be under sexual selection has not previously been explored. Presentation of the hypothesis The hypothesis that is presented consists of two parts. First, that shell ornamentation is the result of sexual selection. Second, that such sexual selection has caused the divergence in shell shape in different species. Testing the hypothesis The first part of the hypothesis may be tested by searching for sexual dimorphism in shell ornamentation in gonochoristic snails, by searching for increased variance in shell ornamentation relative to other shell traits, and by mate choice experiments using individuals with experimentally enhanced ornamentation. The second part of the hypothesis may be tested by comparing sister groups and correlating shell diversity with degree of polygamy. Implications of the hypothesis If the hypothesis were true, it would provide an explanation for the many cases of allopatric evolutionary radiation in snails, where shell diversity cannot be related to any niche differentiation or environmental differences.
Schull, Quentin; Robin, Jean-Patrice; Dobson, F Stephen; Saadaoui, Hédi; Viblanc, Vincent A; Bize, Pierre
2018-01-01
Sexual selection and social selection are two important theories proposed for explaining the evolution of colorful ornamental traits in animals. Understanding signal honesty requires studying how environmental and physiological factors during development influence the showy nature of sexual and social ornaments. We experimentally manipulated physiological stress and immunity status during the molt in adult king penguins ( Aptenodytes patagonicus ), and studied the consequences of our treatments on colourful ornaments (yellow-orange and UV beak spots and yellow-orange auricular feather patches) known to be used in sexual and social contexts in this species. Whereas some ornamental features showed strong condition-dependence (yellow auricular feather chroma, yellow and UV chroma of the beak), others were condition-independent and remained highly correlated before and after the molt (auricular patch size and beak UV hue). Our study provides a rare examination of the links between ornament determinism and selection processes in the wild. We highlight the coexistence of ornaments costly to produce that may be honest signals used in mate choice, and ornaments for which honesty may be enforced by social mediation or rely on genetic constraints.
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2011-12-01
Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene
Sex-biased parental investment is correlated with mate ornamentation in eastern bluebirds.
Ligon, Russell A; Hill, Geoffrey E
2010-03-01
Males typically have greater variance in reproductive success than females, so mothers should benefit by producing sons under favorable conditions. Being paired with a better-than-average mate is one such favorable circumstance. High-quality fathers can improve conditions for their offspring by providing good genes, good resources, or both, so females paired to such males should invest preferentially in sons. Ornamentation has been linked to male quality in many birds and, in support of differential allocation theory, females of several avian species invest more in entire broods when paired to attractive mates. Additionally, the females of some bird species apparently manipulate the primary sex-ratio of their broods in relation to the attractiveness of their mates. However, empirical support for a link between mate ornamentation and preferential feeding of sons (another form of biased investment) is lacking. We tested for correlations between sex-biased parental investment and mate plumage colour in the eastern bluebird (Sialia sialis), a species in which juveniles have sexually dichromatic UV-blue plumage. We found that the proportion of maternal feeding attempts to fledgling sons (versus fledgling daughters) was positively correlated with structurally coloured plumage ornamentation of fathers. Additionally, paternal feeding attempts to sons were correlated with plumage ornamentation of mothers and increased in fathers exhibiting breast plumage characteristics typical of older males. These results provide further support for the idea that parental strategies are influenced by mate attractiveness and provide the first evidence that mate ornamentation can influence parental behavior even after offspring have left the nest.
Improvement of some vegetatively propagated ornamentals by gamma radiation
International Nuclear Information System (INIS)
Das, P.K.; Dube, S.; Ghosh, P.; Dhua, S.D.
1977-01-01
Studies were made to induce mutations in some vegetatively propagated ornamentals like, Chrysanthemum, Dahlia, Hibiscus, Acalpha, Iresine, etc. by acute as well as chronic gamma irradiation. In both the types of irradiation experiments, apart from growth reduction and various physiological anomalies in growth and leaf characters, a total of 27 somatic mutants have been isolated in Chrysanthemum, Dahlia, Hibiscus, Acalypha and Iresine. Some of the mutants have been established by perpetuation over 3-5 vegetative generations while few could not be maintained on account of initially small chimeric changes of failure of regeneration of the propagable materials. However, most of the mutants hold as practical improvements and will find place in ornamental improvement programme in the country. (author)
Immune activation affects chemical sexual ornaments of male Iberian wall lizards
López, Pilar; Gabirot, Marianne; Martín, José
2009-01-01
Many animals use chemical signals in sexual selection, but it is not clear how these sexual traits might have evolved to signal honestly male condition. It is possible that there is a trade-off between maintaining the immune system and the elaboration of ornaments. We experimentally challenged the immune system of male Iberian wall lizards, Podarcis hispanica, with a bacterial antigen (lipopolysaccharide), without pathogenic effects, to explore whether the immune activation affected chemical ornaments. Immune activation resulted in decreased proportions of a major chemical in femoral secretions (cholesta-5,7-dien-3-ol = provitamin D3) known to be selected in scent of males by females and which active form (vitamin D) has a variety of important effects on immune system function. This result suggests the existence of a potential trade-off between physiological regulation of the immune system and the allocation of essential nutrients (vitamins) to sexual chemical ornaments in male lizards.
Parasites of ornamental fish commercialized in Macapá, Amapá State (Brazil
Directory of Open Access Journals (Sweden)
Érico de Melo Hoshino
2018-02-01
Full Text Available Abstract This study investigated the parasites fauna of four freshwater ornamental fish species in aquarium shops of Macapá, Amapá State, in addition to survey the commercialized fish species and sanitary conditions of aquarium shops. Different native and non-native ornamental fish species were found in aquarium shops, mainly Poecilidae. We examined 30 specimens of Xiphophorus maculatus, 30 Danio rerio, 30 Paracheirodon axelrodi, and 30 Corydoras ephippifer for parasites. Of the 120 fish examined, 22.5% were parasitized by one or more species and a total of 438 parasites were collected and identified. Parasites such as: Ichthyophthirius multifiliis, Monogenea, undermined Digenea metacercariae, Acanthostomum sp. metacercariae, Camallanus spp., Bothriocephalus acheilognathi and Echinorhynchus sp. infected the hosts examined. Endoparasites in the larval stage showed the greatest diversity and Camallanus spp. was found in all hosts species examined. Paracheirodon axelrodi (43.3% was the most parasitized host, while C. ephippifer (6.7% was the least parasitized. Despite the low ectoparasites level, six species of endoparasites was observed, demonstrating that prophylactic and quarantine procedures were not fully adequate. Therefore, failures in prophylactic procedures on any link in the production industry of ornamental fish may cause parasite transmission to ornamental fish captured in different environments and localities.
Balakirev, Evgeniy S; Saveliev, Pavel A; Ayala, Francisco J
2017-01-01
The complete mitochondrial (mt) genome is sequenced in 2 individuals of the Cherskii's sculpin Cottus czerskii . A surprisingly high level of sequence divergence (10.3%) has been detected between the 2 genomes of C czerskii studied here and the GenBank mt genome of C czerskii (KJ956027). At the same time, a surprisingly low level of divergence (1.4%) has been detected between the GenBank C czerskii (KJ956027) and the Amur sculpin Cottus szanaga (KX762049, KX762050). We argue that the observed discrepancies are due to incorrect taxonomic identification so that the GenBank accession number KJ956027 represents actually the mt genome of C szanaga erroneously identified as C czerskii . Our results are of consequence concerning the GenBank database quality, highlighting the potential negative consequences of entry errors, which once they are introduced tend to be propagated among databases and subsequent publications. We illustrate the premise with the data on recombinant mt genome of the Siberian taimen Hucho taimen (NCBI Reference Sequence Database NC_016426.1; GenBank accession number HQ897271.1), bearing 2 introgressed fragments (≈0.9 kb [kilobase]) from 2 lenok subspecies, Brachymystax lenok and Brachymystax lenok tsinlingensis , submitted to GenBank on June 12, 2011. Since the time of submission, the H taimen recombinant mt genome leading to incorrect phylogenetic inferences was propagated in multiple subsequent publications despite the fact that nonrecombinant H taimen genomes were also available (submitted to GenBank on August 2, 2014; KJ711549, KJ711550). Other examples of recombinant sequences persisting in GenBank are also considered. A GenBank Entry Error Depositary is urgently needed to monitor and avoid a progressive accumulation of wrong biological information.
Directory of Open Access Journals (Sweden)
Candida Elisa Manfio
2010-07-01
Full Text Available Orthophytum grossiorum is a typical bromeliad from Atlantic forestry threatened of extinction. The objectives of this research were to select O. grossiorum clones with ornamental values easy to propagate in vitro, and establish in vitro propagation protocols for these clones. The project was developed in three steps: germination and in vitro selection of seedlings responsive to BAP (6-benzylaminopurine, selection of clones with ornamental values, and establishment of protocol for in vitro propagation of the selected clones. In the first step only 18.33% of plantlets germinated in vitro were responsive to BAP. These plantlets were selected and replicated in vitro several times, each replicated plantlet constituting a clone. In the second step these clones were established ex vitro and surveyed for ornamental attributes. Five out of 11 clones were selected in this step. These clones presented distinct phenotypic traits and were considered of high ornamental quality. In the third step a protocol for in vitro propagation was developed for each selected clone.Orthophytum grossiorum é uma bromélia ameaçada de extinção típica de Mata Atlântica. Os objetivos deste trabalho foram selecionar clones de O. grossiorum com potencial ornamental e de fácil propagação in vitro e estabelecer protocolo de propagação in vitro para esses clones. O trabalho foi desenvolvido em três etapas: germinação e em seleção in vitro de plântulas responsivas a BAP (6-benzylaminopurine, seleção de clones com valores ornamentais e estabelecimento de protocolo para propagação in vitro dos clones selecionados. Na primeira etapa, foi observado que apenas 18.33% das plântulas germinadas in vitro eram responsivas a BAP. Essas plântulas foram selecionadas e reproduzidas em in vitro, e cada plântula selecionada e reproduzida constituiu um clone. Na segunda etapa, esses clones foram estabelecidos ex vitro e selecionados em relação aos atributos ornamentais
Screening for drought tolerance in cultivars of the ornamental genus Tagetes (Asteraceae
Directory of Open Access Journals (Sweden)
Raluca Cicevan
2016-06-01
Full Text Available Drought tolerance was evaluated in twelve cultivars of three ornamental Tagetes species (T. patula, T. tenuifolia and T. erecta. A stress treatment was performed by completely stopping watering of plants maintained in controlled greenhouse conditions. After three weeks, several plant growth parameters (stem length (SL, fresh weight (FW and water content (WC, photosynthetic pigments (chlorophylls and carotenoids (Car, osmolytes (proline (Pro, glycine betaine (GB and total soluble sugars (TSS, an oxidative stress maker (malondialdehyde (MDA and antioxidants (total phenolic compounds (TPC and total flavonoids (TF were measured. Considerable differences in the evaluated traits were found among the control and drought-stressed plants. Drought stress generally caused a marked reduction in plant growth and carotenoid pigments, and an increase in soluble solutes and oxidative stress. For most cultivars, proline levels in stressed plants increased between 30 and 70-fold compared to the corresponding controls. According to the different measured parameters, on average T. erecta proved to be more tolerant to drought than T. patula and T. tenuifolia. However, a considerable variation in the tolerance to drought was found within each species. The traits with greater association to drought tolerance as well as the most tolerant cultivars could be clearly identified in a principal components analysis (PCA. Overall, our results indicate that drought tolerant cultivars of Tagetes can be identified at early stages using a combination of plant growth and biochemical markers.
Characterization of slate ornaments from Teotihuacan by nuclear and conventional techniques
International Nuclear Information System (INIS)
Villa-Cordoba, T.; Lopez-Palacios, J.A.; Jimenez-Reyes, M.; Tenorio, D.
2012-01-01
Several ornaments named tezcacuitlapilli (coccyx-mirrors) are described and chemical analyses of raw materials (slate and pigments) were carried out by neutron activation, X-ray diffraction, scanning electron microscopy and radiography. Elemental and statistical analyses revealed that three different kinds of slate were used in their manufacture. The white pigment contains gypsum while ochre, yellow and red pigments contain iron oxide. These ornaments were identified as coming from the Cave of the Sun Pyramid of Teotihuacan. An attempt was undertaken to reconstruct the contexts of their manufacture and symbolic interpretation. (author)
Ornaments of Metropolis: Siegfried Kracauer and Modern Urban Culture
DEFF Research Database (Denmark)
Reeh, Henrik
Arkitektur, byrum, idéhistorie, byhistorie, Sigfried Kracauer (1889-1966), Walter Benjamin, Georg Simmel, ornament, bykultur, Paris, Frankfurt am Main, berlin, Nice, Urban Studies, humanistiske bystudier, byplanlægning, byteori, bysociologi...
Directory of Open Access Journals (Sweden)
GRIB VITALIE
2016-12-01
Full Text Available The eclectic style in the interpretative manner of the younger generation of traditional violinists, which oft en distorts the aesthetic essence of folklore creations, has determined the need for research, scientifi c reasoning and elaboration of some methods of learning the traditional ornamental instrumental style, which can be general or individual, yet specifi c to the historical Moldovan folk space. To achieve this, we consider important to identify the types of ornaments in traditional instrumental music; to delimit the interpretative particularities of ornaments in literate and folk music; to analyse the ornamentation styles of songs within the repertoire of diff erent traditional violinists, that belong to the folk space investigated in terms of the type of creation. As a model for analysing the particularities of interpreting these ornaments, we select violinists from older generations, whose repertoire and style of execution has not been aff ected by the media and technological progress.
Directory of Open Access Journals (Sweden)
Cristina P. Vila-Ruiz
2014-09-01
Full Text Available Green spaces within residential areas provide important contributions to the sustainability of urban systems. Therefore, studying the characteristics of these areas has become a research priority in cities worldwide. This project evaluated various aspects of the plant biodiversity of residential yards (i.e., front yards and back yards within the Río Piedras watershed in the San Juan metropolitan area of Puerto Rico. Our work included gathering information on vegetation composition and abundance of woody species (i.e., trees, shrubs, palms, ferns and large herbs (>2 m height, species origin (native vs. introduced, and species uses (ornamental, food, and medicinal plants. A total of 424 yards were surveyed within an area of 187,191 m². We found 383 woody species, with shrubs being the most abundant plant habitat. As expected, residential yards hosted a disproportionate amount of introduced species (69.5%. The most common shrub species were all non-native ornamentals, whereas the most common tree species included food trees as well as ornamental plants and two native species. Front yards hosted more ornamental species per unit area than backyards, while the latter had more food plants. The high amount of introduced species may present a challenge in terms of implementation of plant conservation initiatives if there is no clear definition of urban conservation goals. On the other hand, the high frequency of yards containing food plants may facilitate the development of residential initiatives that could provide future adaptive capacity to food shortages.
Ornamental comb colour predicts T-cell-mediated immunity in male red grouse Lagopus lagopus scoticus
Mougeot, Francois
2008-02-01
Sexual ornaments might reliably indicate the ability to cope with parasites and diseases, and a better ability to mount a primary inflammatory response to a novel challenge. Carotenoid-based ornaments are amongst the commonest sexual signals of birds and often influence mate choice. Because carotenoids are immuno-stimulants, signallers may trade-off allocating these to ornamental colouration or using them for immune responses, so carotenoid-based ornaments might be particularly useful as honest indicators of immuno-compentence. Tetraonid birds, such as the red grouse Lagopus lagopus scoticus, exhibit supra-orbital yellow red combs, a conspicuous ornament which functions in intra- and inter-sexual selection. The colour of combs is due to epidermal pigmentation by carotenoids, while their size is testosterone-dependent. In this study, I investigated whether comb characteristics, and in particular, comb colour, indicated immuno-competence in free-living male red grouse. I assessed T-cell-mediated immunity using a standardised challenge with phytohaemagglutinin. Red grouse combs reflect in the red and in the ultraviolet spectrum of light, which is not visible to humans but that grouse most likely see, so I measured comb colour across the whole bird visible spectrum (300 700 nm) using a reflectance spectrometer. I found that males with bigger and redder combs, but with less ultraviolet reflectance, had greater T-cell-mediated immune response. Comb colour predicted T-cell-mediated immune response better than comb size, indicating that the carotenoid-based colouration of this ornament might reliably signal this aspect of male quality.
DEFF Research Database (Denmark)
Pilastro, Andrea; Griggio, Matteo; Matessi, Giuliano
2003-01-01
We investigated the relations between female quality and ornamentation and between male breeding investment and female ornamentation in the rock sparrow, Petronia petronia, a passerine in which both sexes have a yellow breast patch. Breast patch size in females was positively correlated with body...
Balakirev, Evgeniy S; Saveliev, Pavel A; Ayala, Francisco J
2017-01-01
The complete mitochondrial (mt) genome is sequenced in 2 individuals of the Cherskii’s sculpin Cottus czerskii. A surprisingly high level of sequence divergence (10.3%) has been detected between the 2 genomes of C czerskii studied here and the GenBank mt genome of C czerskii (KJ956027). At the same time, a surprisingly low level of divergence (1.4%) has been detected between the GenBank C czerskii (KJ956027) and the Amur sculpin Cottus szanaga (KX762049, KX762050). We argue that the observed discrepancies are due to incorrect taxonomic identification so that the GenBank accession number KJ956027 represents actually the mt genome of C szanaga erroneously identified as C czerskii. Our results are of consequence concerning the GenBank database quality, highlighting the potential negative consequences of entry errors, which once they are introduced tend to be propagated among databases and subsequent publications. We illustrate the premise with the data on recombinant mt genome of the Siberian taimen Hucho taimen (NCBI Reference Sequence Database NC_016426.1; GenBank accession number HQ897271.1), bearing 2 introgressed fragments (≈0.9 kb [kilobase]) from 2 lenok subspecies, Brachymystax lenok and Brachymystax lenok tsinlingensis, submitted to GenBank on June 12, 2011. Since the time of submission, the H taimen recombinant mt genome leading to incorrect phylogenetic inferences was propagated in multiple subsequent publications despite the fact that nonrecombinant H taimen genomes were also available (submitted to GenBank on August 2, 2014; KJ711549, KJ711550). Other examples of recombinant sequences persisting in GenBank are also considered. A GenBank Entry Error Depositary is urgently needed to monitor and avoid a progressive accumulation of wrong biological information. PMID:28890653
HIGH-QUALITY ORNAMENTAL FINE CONCRETES MODIFIED BY NANOPARTICLES OF TITANIUM DIOXIDE
Directory of Open Access Journals (Sweden)
Bazhenov Yuriy Mikhaylovich
2012-10-01
Full Text Available Ultrasonic method of generation of a stable suspension of nano-particles of titanium dioxide and the strengthening properties of the ornamental fine concrete that contains cement binders with a nano-dispersed additive constitute the subject of the research covered by the authors. Nanoparticles react with the basic chemical elements that compose the concrete and act as crystallization centres. Therefore, the concrete porosity is reduced, while physical and technology-related properties of the ornamental fine concrete are improved. The authors have proven that the application of the nano-dispersed additive that contains titanium dioxide influences the processes of the structure formation in respect of fine ornamental concretes and improves the strength, as well as the water and cold resistance of fine concretes. The improvement is attributed to the dense concrete structure and strong adhesion between cement grains and between the cement and the aggregate. This conclusion is based on the data obtained through the employment of an electronic microscope used to identify the porosity of fine concretes.
The Ornamental Design of Traditional Malay Utensils (Kukuran in Peninsula Malaysia
Directory of Open Access Journals (Sweden)
Md Yusoff Zulkfli bin
2016-01-01
Full Text Available Woodcarving is a significant craft in Malay society that reflects the local traditions and customs. It is a manifestation of craftsmen artistic skills and intutitive ideas into a piece of wood. It is also manifestation of the creative process of imitation, denaturalization, stylization and abstraction. Historically, the Malay craftsmen have created many attractive traditional art forms and one of it is the coconut graters (kukuran. The ornamental carved kukuran is closely related to its Malay woodcarving tradition and philosophy. The aim of this paper is to illustrate this tradition of the great traditional Malay kukuran, the testiment of its time through its visual characteristics and design composition. This study presents an analysis of six kukuran, which were gathered from the state museums in Peninsular Malaysia. The discussion is focused on the formalistic and iconology aspects of the kukuran carving ornaments. The finding briefly shows the fusion of Malay concept of beauty, Malay culture and the understanding of Islam had been manifested in these domestic utensils - the ornamental kukuran
Zygospore ornamentation in the genera Mucor and Zygorhynchus
Schipper, Maria A.A.; Samson, R.A.; Stalpers, J.A.
1975-01-01
Zygospores of species of the genera Mucor and Zygorhynchus were studied by means of scanning electron microscopy. The types of ornamentation are described and compared with those of some species of other genera of the Mucorales. The possibility of grouping the species according to zygospore
Learners’ Mistakes or Professional Error – the Nordic Bronze Age ornaments
DEFF Research Database (Denmark)
Nørgaard, Heide Wrobel
Nordic Bronze Age ornaments are known for their rich decorations, often consisting of spiral bands used as part of a variety of other decorative elements. Even a cursory examination makes it clear that these ornaments vary greatly in terms of their quality. How can this variation be explained......? Is this the result of different workshops, levels of crafting skills or perhaps even the incorporation of novice metalworkers? As part of a study on craft organization in the Nordic Bronze Age, several metal workshops were analyzed in relation to the skill of the craftsmen and the amount of time involved...
Morteza Heidari
2016-01-01
AbstractThe literal rhetoric (scheme) is a most important branch of Persian language aesthetics. The purpose of the knowledge is studying and evaluating the verbal music with applying the instruments that called Ornaments. Ornament as is obvious from its name is all devices that writers using them for making their art fine. With historical skimming over Badi` books, we understand our rhetoricians have gave and dedicated useless names and titles to the literal ornaments rather than analyzing t...
Total exploitation of an ornamental granite quarry
Directory of Open Access Journals (Sweden)
Taboada, J.
2005-09-01
Full Text Available In this paper we propose a methodology to estimate the recovery percentage for each of the products which can be obtained from the exploitation of an ornamental granite quarry: block, semiblock, masonry-transverse stone, and the smaller materials that can be used to obtain construction aggregates. This methodology ensures that quarry exploitation is exhaustive, thereby minimising the production of spoils and the consequent negative impact on the environment. The analysis is based on a detailed and exhaustive compilation of discontinuity data from the research fronts, which are then interpreted statistically and projected over the three weakness planes that are a particular feature of ornamental granite deposits. Using this information, and bearing in mind the minimum commercially viable sizes for each kind of granite, the corresponding recovery rates are calculated for each material in each plane. The results are then integrated using spatial techniques, and the result is an evaluation of quarry contents with a view to total exploitation. This methodology was applied to a quarry in the opening phase in order to carry out an a priori assessment of the economic feasibility of the quarry.
En este trabajo se propone una metodología para estimar el porcentaje de recuperación de cada uno de los productos que se pueden obtener en la explotación de una cantera de granito ornamental: bloque, semibloque, manpostería y per piaños, y material restante destinado a la obtención de áridos. De esta manera se logra un aprovechamiento integral de la cantera, evitándose la generación de estériles y el subsiguiente impacto ambiental producido por éstos. La metodología de análisis se basa en la recopilación detallada y exhaustiva de datos de discontinuidades en los frentes de investigación, que se interpretan estadísticamente y se proyectan sobre los tres planos de debilidad propios del granito ornamental. Con esta información, y las
NATURAL BASES OF GENESIS OF UNTZUKUL ORNAMENTAL ART
Directory of Open Access Journals (Sweden)
G. G. GAZIMAGOMEDOV
2010-01-01
Full Text Available The work deals with Untzukul ornamental hatching wood by metal - it is the only phenomena in decoration applied art. Special attention is paid to succession of the traditions important for conservation and further development of the natural art trade of Daghestan republic.
Geographic distributions and ecology of ornamental Curcuma (Zingiberaceae) in Northeastern Thailand.
Khumkratok, Sutthira; Boongtiang, Kriangsuk; Chutichudet, Prasit; Pramaul, Pairot
2012-10-01
The genus Curcuma is a very important economic plant. Members of this genus were used as food, medicine and ornament plants. The objectives of this study were to examine the geographic distributions and ecological conditions in the natural habitats of Curcuma in Northeastern Thailand. Species diversity was examined using the line transect method. Ecological conditions of the species were examined using a sampling plot of 20 x 20 m. A total of five species were found including Curcuma angustifolia Roxb., C. alismatifolia Gagnep., C. gracillima Gagnep., C. parviflora Wall. and C. rhabdota. These species were in an altitudinal range between 290 m and 831 m above sea level. Four species (C. angustifolia, C. alismatifolia, C. gracillima and C. rhabdota) were distributed in open gaps in dry dipterocarp forest. One species, C. parviflora was found in the contact zone between dry dipterocarp and bamboo (Gigantochloa sp.) forest. C. rhabdota was found only in a habitat with high humidity and shading along the Thailand-Lao PDR border. Significant ecological conditions of the natural habitats of these Curcuma species were identified. Altitude is the most important factor when determining the geographic distributions of these Curcuma species in Northeastern Thailand.
Micropropagation of Crataeva adansonii D.C. Prodr: an ornamental avenue tree.
Tyagi, Purnima; Sharma, P K; Kothari, S L
2010-01-01
In this chapter, we describe multiplication of the superior and elite tree of Crataeva adansonii using plant tissue culture techniques. An ornamental and avenue tree, it is not available in abundance because of poor seed germination and seedling establishment. It reproduces in nature by root suckers, but that restricts its distribution to very limited areas. Efficient procedures are outlined for plant regeneration through direct shoot bud formation, indirect organogenesis, and somatic embryogenesis through callus formation. Different explants were utilized for separate pathways of regeneration. Murashige and Skoog's (MS) medium containing 3 mg/L BA and 0.05-0.1 mg/L NAA is most effective in direct induction of axillary buds from nodal explants and shoot tips. Adventitious shoots developed from leaves on MS medium containing 3 mg/L BA and 0.1 mg/L NAA. De novo shoots were obtained from the anthers on MS medium supplemented with 3 mg/L BA. Somatic embryos developed on half strength MS medium containing 0.1 mg/L 2, 4-D. Roots were induced at the cut ends of shoots on MS basal medium devoid of growth regulators. The plantlets were then transferred to pots.
Botryosphaeriaceae associated with the die-back of ornamental trees in the Western Balkans.
Zlatković, Milica; Keča, Nenad; Wingfield, Michael J; Jami, Fahimeh; Slippers, Bernard
2016-04-01
Extensive die-back and mortality of various ornamental trees and shrubs has been observed in parts of the Western Balkans region during the past decade. The disease symptoms have been typical of those caused by pathogens residing in the Botryosphaeriaceae. The aims of this study were to isolate and characterize Botryosphaeriaceae species associated with diseased ornamental trees in Serbia, Montenegro, Bosnia and Herzegovina. Isolates were initially characterized based on the DNA sequence data for the internal transcribed spacer rDNA and six major clades were identified. Representative isolates from each clade were further characterized using DNA sequence data for the translation elongation factor 1-alpha, β-tubulin-2 and large subunit rRNA gene regions, as well as the morphology of the asexual morphs. Ten species of the Botryosphaeriaceae were identified of which eight, i.e., Dothiorella sarmentorum, Neofusicoccum parvum, Botryosphaeria dothidea, Phaeobotryon cupressi, Sphaeropsis visci, Diplodia seriata, D. sapinea and D. mutila were known taxa. The remaining two species could be identified only as Dothiorella spp. Dichomera syn-asexual morphs of D. sapinea, Dothiorella sp. 2 and B. dothidea, as well as unique morphological characters for a number of the known species are described. Based on host plants and geographic distribution, the majority of Botryosphaeriaceae species found represent new records. The results of this study contribute to our knowledge of the distribution, host associations and impacts of these fungi on trees in urban environments.
Identification of Values of Ornaments in Indonesian Batik in Visual Content of Nitiki Game
Directory of Open Access Journals (Sweden)
Chandra Tresnadi
2015-08-01
Full Text Available Batik is a form of visual art on textile materials produced using traditional drawing techniques originating from Indonesia. For the Javanese, batik is a traditional cloth integral to their cultural identity. Visuals on ornaments of batik cloths illustrate the life sayings and values upon which the life of the community is laid. The study focuses on identifying the values found in Indonesian batik ornaments which are adapted as visual content on the Nitiki game. The findings are then used to reconstruct the values that represent the real batik culture. This study employs the qualitative descriptive method by collecting dozens of batik ornaments on the Nitiki game, exploring the values mentioned in literature, sorting out the dominant values, and reconstructing them. The findings suggest that the values found in Indonesian batik ornaments in the Nitiki game clearly show the patterns of how traditional culture of batik survives and thrives in Indonesian society, as well as show the flexibility of batik against the current development of modern culture, including its integration as culture-based content in interactive media. This study contributes to the dissertation research on aesthetical interaction in cultural content-based game.
N. Utaberta; S. D. M. Sojak; M. Surat; A. I. Che-Ani; M.M. Tahir
2012-01-01
Since the admission of Islam onto the Malay World in 16th century, the Malay culture began to grow in line with the teachings of Islam as a guide of life. Mosque become a symbol of Muslim communities, as well as the cultural values that have been adapted represent the maturity and readiness of Malay Muslim in manifest a lifestyle tradition into the community. Refinement of ornament that used to take from Hindu-Buddhist beliefs before were adopted and refined to the Islami...
Czech Academy of Sciences Publication Activity Database
Kumari, A.; Baskaran, P.; Plačková, Lenka; Omámiková, Hana; Nisler, Jaroslav; Doležal, Karel; Van Staden, J.
2018-01-01
Roč. 223, APR (2018), s. 65-71 ISSN 0176-1617 R&D Projects: GA MŠk(CZ) LO1204 Institutional support: RVO:61389030 Keywords : Endogenous hormone * Exogenous hormone application * In vitro regeneration * Ornamental and medicinal plant * Physiological process * Tulbaghia simmleri Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Plant sciences, botany Impact factor: 3.121, year: 2016
International Development Research Centre (IDRC) Digital Library (Canada)
In addition, the Group is including a number of other boxes titled "Different Viewpoints. ... Intellectual property policies could set the framework for how we approach ...... Community germplasm maintenance, including "community genebanks," ...
Full Length Research Paper Plant regeneration of Michelia ...
African Journals Online (AJOL)
Michelia champaca L. is a woody ornamental tree species which has high commercial value to be used as a basic material for perfume, cosmetic, and medicine. The development of an efficient plant regeneration system for M. champaca is essential for the production of Champaca planting material and precondition for ...
Evaluation of Selected Ornamental Asteraceae as a Pollen Source for Urban Bees
Directory of Open Access Journals (Sweden)
Wróblewska Anna
2016-12-01
Full Text Available Offering more floral resources for urban bees can be achieved by growing ornamental bee plants. The aim of the present study was to evaluate selected Asteraceae (Calendula officinalis ‘Persimmon Beauty’ and ‘Santana’, Centaurea macrocephala, Cosmos sulphureus, Dahlia pinnata, Tagetes patula, Tithonia rotundifolia, and Zinnia elegans as pollen sources for pollinators. Under urban conditions in Lublin, SE Poland, the investigated plants flowered from late June to the end of October. The mass of pollen produced in florets and capitula was found to be species-related. The highest pollen amounts per 10 florets (10.1 mg as well as per capitulum (249.7 mg were found for C. macrocephala. The mass of pollen yielded by a single plant depended on both the pollen mass delivered per disk florets and the proportion of disk florets in capitulum, and the flowering abundance of the plants. A single plant of D. pinnata and a single plant of T. rotundifolia each produced the largest pollen mass. Mean pollen yield per 1m2 of a plot ranged from 6.2 g (Z. elegans to 60.7 g (D. pinnata. Pollen grains are tricolporate, with echinate exine, medium or small in size. They can be categorised as oblatespherical, spherical, and prolatespherical. The principal visitors to C. macrocephala, C. sulphureus, and C. officinalis were honey bees, whereas bumble bees dominated on T. rotundifolia and D. pinnata. A magnet plant for butterflies was Z. elegans. Among the investigated species, D. pinnata, C. macrocephala, and T. rotundifolia were found to be the most valuable sources of pollen flow for managed and wild bees.
Introduced pathogens found on ornamentals, strawberry and trees in Finland over the past 20 years
Directory of Open Access Journals (Sweden)
A. LILJA
2008-12-01
Full Text Available The comparative ease and speed of international trade and travel have enabled or enhanced the spread of pests around the globe. For example, trade in ornamental plants has bolstered the spread of alien Oomycetes such as pathogenic species of Phytophthora. To date, four Phytophthora species have been identified in Finland: P. cactorum on Fragaria x ananassa, Betula pendula and Rhododendron spp., P. plurivora on Rhododendron spp. and Syringa vulgaris, and P. pini and P. ramorum on Rhododendron spp. The ascomycete Colletotrichum acutatum, which was listed as a quarantine pathogen by the European Union until 2009, was introduced in 2000 and can survive in plant debris over two winters in Finland. Positive PCR results have also been obtained from bait plants grown in soil collected from locations where diseased Fragaria x ananassa plants had earlier been destroyed. In the mid-1990s, there was an epidemic of foliar rust caused by the Asian basidiomycete Melampsoridium hiratsukanum on Alnus glutinosa and A. incana. Recently, two ascomycetes that have been introduced are Dothistroma septosporum (responsible for red band needle blight on Pinus sylvestris and Chalara fraxinea (causing ash decline on Fraxinus excelsior.;
Polo, Vicente; Veiga, José P
2006-07-01
1. The use of behavioural traits by females in signalling condition has been practically ignored in evolutionary theory. However, females may also exhibit ornaments and behavioural displays, although less elaborated than those of males. 2. In this study we suggest that the carrying of feathers by spotless starlings Sturnus unicolor Temminck females to decorate the nest represents an elaborated and costly behaviour that is displayed in response to a courtship male behaviour: the carrying of nest green plants. 3. By experimentally increasing the amount of green plants in the nests, to give the appearance that highly attractive males defended them, we induced females to increase their feather carrying rates. 4. The amount of feathers carried to the nest was correlated to female reproductive experience and laying date, two variables correlated with female body condition. These results suggests that this behaviour may work as an honest indicator of female quality. 5. We conclude that male carrying plants and female carrying feathers can be viewed as two sex-specific functionally related signalling behaviours involved in mutual courtship or status signalling.
Development of Two Intelligent Spray Systems for Ornamental Nurseries
Current application technology for floral, nursery, and other specialty crop production wastes significant amounts of pesticides. Two different real-time variable-rate sprayer prototypes for ornamental nursery and tree crops were developed to deliver chemicals on target areas as needed. The first pr...
Czech Academy of Sciences Publication Activity Database
Kavallieratos, N. G.; Tomanović, Ž.; Petrović, A.; Janković, M.; Starý, Petr; Yovkova, M.; Athanassiou, CH. G.
2013-01-01
Roč. 106, č. 3 (2013), s. 294-309 ISSN 0013-8746 Grant - others:Ministry of Education , Science, and Technology of the Republic of Serbia(RS) III43001 Institutional support: RVO:60077344 Keywords : Aphidiinae * ornamental * herbs Subject RIV: EG - Zoology Impact factor: 1.174, year: 2013 http://www.bioone.org/doi/pdf/10.1603/AN12090
Conservation and restoration of ornamental elements
Directory of Open Access Journals (Sweden)
Carmen Rallo Gruss
1999-12-01
Full Text Available Intervention on a building as complex and rich in ornamentation as the Palacio del Marqués de Dos Aguas requires special attention as regards the restoration of all the singular elements, both inside and outside, and the different finishes and furnishings. Within this methodology of integral restoration, it is worth pointing out especially the consolidation and cleaning of the emblematic alabaster portal, the restoration of the paintings and the treatment of the different collections of tiles.
Controlling plant architecture by manipulation of gibberellic acid signalling in petunia
Gibberellic acid (GA), a plant hormone, regulates many crucial growth and developmental processes, including seed germination, leaf expansion, induction of flowering and stem elongation. A common problem in the production of ornamental potted plants is undesirably tall growth, so inhibitors of gibbe...
Kingma, Sjouke A.; Szentirmai, Istvan; Szekely, Tamas; Bokony, Veronika; Bleeker, Maarten; Liker, Andras; Komdeur, Jan; McGraw, K.
Melanin-based ornaments are often involved in signaling aggression and dominance, and their role in sexual selection is increasingly recognized. We investigated the functions of a melanin-based plumage ornament (facial 'mask') in male Eurasian penduline tits Remiz pendulinus in the contexts of
Complex Ornament Machining Process on a CNC Router
Directory of Open Access Journals (Sweden)
Camelia COŞEREANU
2014-03-01
Full Text Available The paper investigates the CNC routering possibilities for three species of wood, namely ash (Fraxinus Excelsior, lime wood (Tilia cordata and fir wood (Abies Alba, in order to obtain right surfaces of Art Nouveau sculptured ornaments. Given the complexity of the CNC tool path for getting wavy shapes of Art Nouveau decorations, the choice of processing parameters for each processed species of wood requires a laborious research work to correlate these parameters. Two Art Nouveau ornaments are proposed for the investigation. They are CNC routered using two types of cutting tools. The processed parameters namely the spindle speed, feed speed and depth of cut were the three variables of the machining process for the three species of wood, which were combined so, to provide good surface finish as a quality attribute. There were totally forty six variants of combining the processing parameter which were applied for CNC routering the samples made of the three species of wood. At the end, an optimum combination of the processed parameters is recommended for each species of wood.
Ribeiro, Carlos E. Gomes; Rodriguez, Rubén J. Sánchez; Vieira, Carlos M. Fontes
Ornamental compound stone are produced by industry for decades, however, few published studies describe these materials. Brazil has many deposits of stone wastes and a big potential to produce these materials. This work aims to evaluate the chemical resistance of ornamental compound stones produced with marble waste and unsaturated polyester. An adaptation of Annex H of ABNT NBR 13818:97 standard, with reagents commonly used in household products, was used. The results were compared with those obtained for natural stone used in composite production.
Miriti, Maria N; Ibrahim, Tahir; Palik, Destiny; Bonin, Catherine; Heaton, Emily; Mutegi, Evans; Snow, Allison A
2017-08-01
Perennial grasses are promising candidates for bioenergy crops, but species that can escape cultivation and establish self-sustaining naturalized populations (feral) may have the potential to become invasive. Fertile Miscanthus × giganteus , known as "PowerCane," is a new potential biofuel crop. Its parent species are ornamental, non-native Miscanthus species that establish feral populations and are sometimes invasive in the USA. As a first step toward assessing the potential for "PowerCane" to become invasive, we documented its growth and fecundity relative to one of its parent species ( Miscanthus sinensis ) in competition with native and invasive grasses in common garden experiments located in Columbus, Ohio and Ames, Iowa, within the targeted range of biofuel cultivation. We conducted a 2-year experiment to compare growth and reproduction among three Miscanthus biotypes-"PowerCane," ornamental M. sinensis , and feral M. sinensis -at two locations. Single Miscanthus plants were subjected to competition with a native grass ( Panicum virgatum ), a weedy grass ( Bromus inermis ), or no competition. Response variables were aboveground biomass, number of shoots, basal area, and seed set. In Iowa, all Miscanthus plants died after the first winter, which was unusually cold, so no further results are reported from the Iowa site. In Ohio, we found significant differences among biotypes in growth and fecundity, as well as significant effects of competition. Interactions between these treatments were not significant. "PowerCane" performed as well or better than ornamental or feral M. sinensis in vegetative traits, but had much lower seed production, perhaps due to pollen limitation. In general, ornamental M. sinensis performed somewhat better than feral M. sinensis . Our findings suggest that feral populations of "PowerCane" could become established adjacent to biofuel production areas. Fertile Miscanthus × giganteus should be studied further to assess its
Knapp, Andrew; Knell, Robert J; Farke, Andrew A; Loewen, Mark A; Hone, David W E
2018-03-28
Establishing the origin and function of unusual traits in fossil taxa provides a crucial tool in understanding macroevolutionary patterns over long periods of time. Ceratopsian dinosaurs are known for their exaggerated and often elaborate horns and frills, which vary considerably between species. Many explanations have been proposed for the origin and evolution of these 'ornamental' traits, from predator defence to socio-sexual dominance signalling and, more recently, species recognition. A key prediction of the species recognition hypothesis is that two or more species possessing divergent ornamental traits should have been at least partially sympatric. For the first time to our knowledge, we test this hypothesis in ceratopsians by conducting a comparison of the morphological characters of 46 species. A total of 350 ceratopsian cladistic characters were categorized as either 'internal', 'display' (i.e. ornamental) or 'non display'. Patterns of diversity of these characters were evaluated across 1035 unique species pairs. Display characters were found to diverge rapidly overall, but sympatric species were not found to differ significantly in their ornamental disparity from non-sympatric species, regardless of phylogenetic distance. The prediction of the species recognition hypothesis, and thus the idea that ornamentation evolved as a species recognition mechanism, has no statistical support among known ceratopsians. © 2018 The Authors.
Preliminary study on irradiation breeding of ornamental lotus
International Nuclear Information System (INIS)
Chen Xiulan; Bao Jianzhong; Liu Chungui; Cao Hong; Zhai Jianqing
2004-01-01
The effects of γ-ray irradiation on seeds and stems of ornamental lotus were studied. The results show that the mutation rate of seeds is higher than that of stems, and 30-60 Gy is the appropriate irradiation dose. The varieties with red or multi-color flower are more mutable than those with white flower. Two varieties were selected
Potato has about 100 wild species relatives that are multiplied in the form of botanical seed populations by genebanks, and distributed for use in research and breeding, so factors that affect long term seed germination are of interest. In 1987 the US Potato Genebank conducted routine seed multiplic...
Shokry, Ahmed M.
2014-02-01
The wild plant species Calotropis procera (C. procera) has many potential applications and beneficial uses in medicine, industry and ornamental field. It also represents an excellent source of genes for drought and salt tolerance. Genes encoding proteins that contain the conserved universal stress protein (USP) domain are known to provide organisms like bacteria, archaea, fungi, protozoa and plants with the ability to respond to a plethora of environmental stresses. However, information on the possible occurrence of Usp in C. procera is not available. In this study, we uncovered and characterized a one-class A Usp-like (UspA-like, NCBI accession No. KC954274) gene in this medicinal plant from the de novo assembled genome contigs of the high-throughput sequencing dataset. A number of GenBank accessions for Usp sequences were blasted with the recovered de novo assembled contigs. Homology modelling of the deduced amino acids (NCBI accession No. AGT02387) was further carried out using Swiss-Model, accessible via the EXPASY. Superimposition of C. procera USPA-like full sequence model on Thermus thermophilus USP UniProt protein (PDB accession No. Q5SJV7) was constructed using RasMol and Deep-View programs. The functional domains of the novel USPA-like amino acids sequence were identified from the NCBI conserved domain database (CDD) that provide insights into sequence structure/function relationships, as well as domain models imported from a number of external source databases (Pfam, SMART, COG, PRK, TIGRFAM). © 2014 Académie des sciences.
Economic significance of viroids in ornamental crops (Book Chapter)
The economic significance of viroids in ornamental crops is less obvious than in food crops. Most serious direct impact is known for chrysanthemum stunt viroid in chrysanthemum and, to a lesser extent, for chrysanthemum chlorotic mottle viroid in the same crop. However, the majority of viroid infect...
Garden ponds as potential introduction pathway of ornamental crayfish
Directory of Open Access Journals (Sweden)
Patoka J.
2014-01-01
Full Text Available The private stocking of ornamental crayfish in garden ponds was discussed in previous studies, but there is a lack of detailed analysis for better understanding of this introduction pathway. The Czech Republic is one of leading EU countries in trade with ornamental crayfish and private garden ponds are popular among people. The crayfish keepers in the country were interviewed by self-administered questionnaire to gather data about principal characteristics of the keepers and detailed information about crayfish breeding that are of interest for conservation managers. Besides of releasing crayfish into garden ponds, alarming illegal behavior such as releasing of juvenile crayfish into the wild, and capturing of indigenous crayfish from wild populations, were registered. Therefore focusing on public education to increase awareness of possible unwanted consequences of crayfish release and introduction of an obligation to inform customers about hazardousness of non-indigenous crayfish species for retailers and wholesalers is recommended.
Ornamenting 3D printed scaffolds with cell-laid extracellular matrix for bone tissue regeneration.
Pati, Falguni; Song, Tae-Ha; Rijal, Girdhari; Jang, Jinah; Kim, Sung Won; Cho, Dong-Woo
2015-01-01
3D printing technique is the most sophisticated technique to produce scaffolds with tailorable physical properties. But, these scaffolds often suffer from limited biological functionality as they are typically made from synthetic materials. Cell-laid mineralized ECM was shown to be potential for improving the cellular responses and drive osteogenesis of stem cells. Here, we intend to improve the biological functionality of 3D-printed synthetic scaffolds by ornamenting them with cell-laid mineralized extracellular matrix (ECM) that mimics a bony microenvironment. We developed bone graft substitutes by using 3D printed scaffolds made from a composite of polycaprolactone (PCL), poly(lactic-co-glycolic acid) (PLGA), and β-tricalcium phosphate (β-TCP) and mineralized ECM laid by human nasal inferior turbinate tissue-derived mesenchymal stromal cells (hTMSCs). A rotary flask bioreactor was used to culture hTMSCs on the scaffolds to foster formation of mineralized ECM. A freeze/thaw cycle in hypotonic buffer was used to efficiently decellularize (97% DNA reduction) the ECM-ornamented scaffolds while preserving its main organic and inorganic components. The ECM-ornamented 3D printed scaffolds supported osteoblastic differentiation of newly-seeded hTMSCs by upregulating four typical osteoblastic genes (4-fold higher RUNX2; 3-fold higher ALP; 4-fold higher osteocalcin; and 4-fold higher osteopontin) and increasing calcium deposition compared to bare 3D printed scaffolds. In vivo, in ectopic and orthotopic models in rats, ECM-ornamented scaffolds induced greater bone formation than that of bare scaffolds. These results suggest a valuable method to produce ECM-ornamented 3D printed scaffolds as off-the-shelf bone graft substitutes that combine tunable physical properties with physiological presentation of biological signals. Copyright © 2014 Elsevier Ltd. All rights reserved.
Alternative potassium source for the cultivation of ornamental sunflower
Directory of Open Access Journals (Sweden)
Sabrina Thereza dos Santos Torqueti
2016-06-01
Full Text Available ABSTRACT Brazil is dependent on importation of fertilizers, especially the potassics. Rocks and minerals that contain nutrients have a potential for use in agriculture as fertilizer, especially those of slow solubilization and that exhibit residual effect. In this context, the objective was to assess the feasibility of glauconite rock as potassium source for the cultivation of ornamental sunflower. The experiment was conducted under controlled conditions arranged in an entirely randomized design, in a 4x4 + 4 factorial scheme, with four replicates and one plant per plot. Four glauconite-based fertilizers were used as a potassium source: fine grained glauconite, fine grained organo-mineral glauconite, coarse grained glauconite and coarse grained organo-mineral glauconite, in four doses, as well as an additional treatment with four doses of KCl, the principal conventional source of the nutrient. The height of the flower stalks, the diameter of the stem and floral capitulum, the number of cultivation days and post-harvest durability were evaluated. The application of KCl yielded the production of flower stems with greater height and larger capitulum diameter in relation to the supply of glauconite. Among the glauconite based fertilizers, the fine grained organo-mineral product provided the best flower charateristics. The postharvest commercial durability of the flower stalks was higher in plants that received the glauconite and fine grained organo-mineral glauconite. The fine grained organo-mineral glauconite surpasses all other alternative sources of potassium in relation to the agronomic characteristics evaluated.
Plant morphological and development responses to light quality in a horticultural context
Ieperen, van W.
2012-01-01
Many horticultural crops (food and ornamental) are produced year-round in greenhouses at high latitudes, where the limited availability of natural sunlight restricts plant production during large parts of the year. To enable year-round plant production supplemental light is necessary to enhance
GBParsy: A GenBank flatfile parser library with high speed
Directory of Open Access Journals (Sweden)
Kim Yeon-Ki
2008-07-01
Full Text Available Abstract Background GenBank flatfile (GBF format is one of the most popular sequence file formats because of its detailed sequence features and ease of readability. To use the data in the file by a computer, a parsing process is required and is performed according to a given grammar for the sequence and the description in a GBF. Currently, several parser libraries for the GBF have been developed. However, with the accumulation of DNA sequence information from eukaryotic chromosomes, parsing a eukaryotic genome sequence with these libraries inevitably takes a long time, due to the large GBF file and its correspondingly large genomic nucleotide sequence and related feature information. Thus, there is significant need to develop a parsing program with high speed and efficient use of system memory. Results We developed a library, GBParsy, which was C language-based and parses GBF files. The parsing speed was maximized by using content-specified functions in place of regular expressions that are flexible but slow. In addition, we optimized an algorithm related to memory usage so that it also increased parsing performance and efficiency of memory usage. GBParsy is at least 5 - 100× faster than current parsers in benchmark tests. Conclusion GBParsy is estimated to extract annotated information from almost 100 Mb of a GenBank flatfile for chromosomal sequence information within a second. Thus, it should be used for a variety of applications such as on-time visualization of a genome at a web site.
Effects of radiations on ornamental fish
International Nuclear Information System (INIS)
Anita; Kalyankar, Amol D.; Ohlyan, Sunita; Gupta, R.K.
2012-01-01
Radiation is a process in which energetic particles or energetic waves travel through a medium or space. There are two distinct types of radiations: ionizing and non-ionizing. Ultraviolet, X-rays, and gamma rays are some examples of radiation. 'Ornamental fish' is designed for aquatic hobbyists and the aquatic industry for several purposes. UV light has two primary uses in fish culture: Controlling green water and disinfecting the water supply. Many proponents of UV disinfection sometimes overlook the additional benefits relating to ornamental fish; those being that cleaner water reduces the stress on the fish by not having to fight off diseases, thus enhancing its immune system and leading to faster growth and more brilliant colors. Ultraviolet sterilizers are often used in aquaria to help control unwanted microorganisms in the water. UV radiation also ensures that exposed pathogens cannot reproduce, thus decreasing the likelihood of a disease outbreak in an aquarium. Despite of these benefits, the ill-effects of radiations cannot be ruled out. Ultraviolet Radiation-induced DNA Damage is seen in the skin of the Platyfish Xiphophorus. Higher radiation doses may cause the gastrointestinal syndrome that leads to defects of the intestinal mucosa barrier with successive contamination of musculature. Exposure to UV radiation can kill the fish and induce sublethal effects in embryos, larvae and adults. The change in skin includes irregularity of skin surface, epidermal oedema, necrosis etc. Irradiation may badly influence the textural attributes of fish muscle. (author)
Büssow, Konrad; Hoffmann, Steve; Sievert, Volker
2002-12-19
Functional genomics involves the parallel experimentation with large sets of proteins. This requires management of large sets of open reading frames as a prerequisite of the cloning and recombinant expression of these proteins. A Java program was developed for retrieval of protein and nucleic acid sequences and annotations from NCBI GenBank, using the XML sequence format. Annotations retrieved by ORFer include sequence name, organism and also the completeness of the sequence. The program has a graphical user interface, although it can be used in a non-interactive mode. For protein sequences, the program also extracts the open reading frame sequence, if available, and checks its correct translation. ORFer accepts user input in the form of single or lists of GenBank GI identifiers or accession numbers. It can be used to extract complete sets of open reading frames and protein sequences from any kind of GenBank sequence entry, including complete genomes or chromosomes. Sequences are either stored with their features in a relational database or can be exported as text files in Fasta or tabulator delimited format. The ORFer program is freely available at http://www.proteinstrukturfabrik.de/orfer. The ORFer program allows for fast retrieval of DNA sequences, protein sequences and their open reading frames and sequence annotations from GenBank. Furthermore, storage of sequences and features in a relational database is supported. Such a database can supplement a laboratory information system (LIMS) with appropriate sequence information.
Mrozek, Dariusz; Małysiak-Mrozek, Bożena; Siążnik, Artur
2013-03-01
Due to the growing number of biomedical entries in data repositories of the National Center for Biotechnology Information (NCBI), it is difficult to collect, manage and process all of these entries in one place by third-party software developers without significant investment in hardware and software infrastructure, its maintenance and administration. Web services allow development of software applications that integrate in one place the functionality and processing logic of distributed software components, without integrating the components themselves and without integrating the resources to which they have access. This is achieved by appropriate orchestration or choreography of available Web services and their shared functions. After the successful application of Web services in the business sector, this technology can now be used to build composite software tools that are oriented towards biomedical data processing. We have developed a new tool for efficient and dynamic data exploration in GenBank and other NCBI databases. A dedicated search GenBank system makes use of NCBI Web services and a package of Entrez Programming Utilities (eUtils) in order to provide extended searching capabilities in NCBI data repositories. In search GenBank users can use one of the three exploration paths: simple data searching based on the specified user's query, advanced data searching based on the specified user's query, and advanced data exploration with the use of macros. search GenBank orchestrates calls of particular tools available through the NCBI Web service providing requested functionality, while users interactively browse selected records in search GenBank and traverse between NCBI databases using available links. On the other hand, by building macros in the advanced data exploration mode, users create choreographies of eUtils calls, which can lead to the automatic discovery of related data in the specified databases. search GenBank extends standard capabilities of the
Jacob, Sherry R.; Srinivasan, Kalyani; Radhamani, J.; Parimalan, R.; Sivaswamy, M.; Tyagi, Sandhya; Yadav, Mamata; Kumari, Jyotisna; Deepali; Sharma, Sandeep; Bhagat, Indoo; Meeta, Madhu; Bains, N. S.; Chowdhury, A. K.; Saha, B. C.; Bhattacharya, P. M.; Kumari, Jyoti; Singh, M. C.; Gangwar, O. P.; Prasad, P.; Bharadwaj, S. C.; Gogoi, Robin; Sharma, J. B.; GM, Sandeep Kumar; Saharan, M. S.; Bag, Manas; Roy, Anirban; Prasad, T. V.; Sharma, R. K.; Dutta, M.; Sharma, Indu; Bansal, K. C.
2016-01-01
A comprehensive germplasm evaluation study of wheat accessions conserved in the Indian National Genebank was conducted to identify sources of rust and spot blotch resistance. Genebank accessions comprising three species of wheat–Triticum aestivum, T. durum and T. dicoccum were screened sequentially at multiple disease hotspots, during the 2011–14 crop seasons, carrying only resistant accessions to the next step of evaluation. Wheat accessions which were found to be resistant in the field were then assayed for seedling resistance and profiled using molecular markers. In the primary evaluation, 19,460 accessions were screened at Wellington (Tamil Nadu), a hotspot for wheat rusts. We identified 4925 accessions to be resistant and these were further evaluated at Gurdaspur (Punjab), a hotspot for stripe rust and at Cooch Behar (West Bengal), a hotspot for spot blotch. The second round evaluation identified 498 accessions potentially resistant to multiple rusts and 868 accessions potentially resistant to spot blotch. Evaluation of rust resistant accessions for seedling resistance against seven virulent pathotypes of three rusts under artificial epiphytotic conditions identified 137 accessions potentially resistant to multiple rusts. Molecular analysis to identify different combinations of genetic loci imparting resistance to leaf rust, stem rust, stripe rust and spot blotch using linked molecular markers, identified 45 wheat accessions containing known resistance genes against all three rusts as well as a QTL for spot blotch resistance. The resistant germplasm accessions, particularly against stripe rust, identified in this study can be excellent potential candidates to be employed for breeding resistance into the background of high yielding wheat cultivars through conventional or molecular breeding approaches, and are expected to contribute toward food security at national and global levels. PMID:27942031
Directory of Open Access Journals (Sweden)
Sundeep Kumar
Full Text Available A comprehensive germplasm evaluation study of wheat accessions conserved in the Indian National Genebank was conducted to identify sources of rust and spot blotch resistance. Genebank accessions comprising three species of wheat-Triticum aestivum, T. durum and T. dicoccum were screened sequentially at multiple disease hotspots, during the 2011-14 crop seasons, carrying only resistant accessions to the next step of evaluation. Wheat accessions which were found to be resistant in the field were then assayed for seedling resistance and profiled using molecular markers. In the primary evaluation, 19,460 accessions were screened at Wellington (Tamil Nadu, a hotspot for wheat rusts. We identified 4925 accessions to be resistant and these were further evaluated at Gurdaspur (Punjab, a hotspot for stripe rust and at Cooch Behar (West Bengal, a hotspot for spot blotch. The second round evaluation identified 498 accessions potentially resistant to multiple rusts and 868 accessions potentially resistant to spot blotch. Evaluation of rust resistant accessions for seedling resistance against seven virulent pathotypes of three rusts under artificial epiphytotic conditions identified 137 accessions potentially resistant to multiple rusts. Molecular analysis to identify different combinations of genetic loci imparting resistance to leaf rust, stem rust, stripe rust and spot blotch using linked molecular markers, identified 45 wheat accessions containing known resistance genes against all three rusts as well as a QTL for spot blotch resistance. The resistant germplasm accessions, particularly against stripe rust, identified in this study can be excellent potential candidates to be employed for breeding resistance into the background of high yielding wheat cultivars through conventional or molecular breeding approaches, and are expected to contribute toward food security at national and global levels.
Kumar, Sundeep; Archak, Sunil; Tyagi, R K; Kumar, Jagdish; Vk, Vikas; Jacob, Sherry R; Srinivasan, Kalyani; Radhamani, J; Parimalan, R; Sivaswamy, M; Tyagi, Sandhya; Yadav, Mamata; Kumari, Jyotisna; Deepali; Sharma, Sandeep; Bhagat, Indoo; Meeta, Madhu; Bains, N S; Chowdhury, A K; Saha, B C; Bhattacharya, P M; Kumari, Jyoti; Singh, M C; Gangwar, O P; Prasad, P; Bharadwaj, S C; Gogoi, Robin; Sharma, J B; Gm, Sandeep Kumar; Saharan, M S; Bag, Manas; Roy, Anirban; Prasad, T V; Sharma, R K; Dutta, M; Sharma, Indu; Bansal, K C
2016-01-01
A comprehensive germplasm evaluation study of wheat accessions conserved in the Indian National Genebank was conducted to identify sources of rust and spot blotch resistance. Genebank accessions comprising three species of wheat-Triticum aestivum, T. durum and T. dicoccum were screened sequentially at multiple disease hotspots, during the 2011-14 crop seasons, carrying only resistant accessions to the next step of evaluation. Wheat accessions which were found to be resistant in the field were then assayed for seedling resistance and profiled using molecular markers. In the primary evaluation, 19,460 accessions were screened at Wellington (Tamil Nadu), a hotspot for wheat rusts. We identified 4925 accessions to be resistant and these were further evaluated at Gurdaspur (Punjab), a hotspot for stripe rust and at Cooch Behar (West Bengal), a hotspot for spot blotch. The second round evaluation identified 498 accessions potentially resistant to multiple rusts and 868 accessions potentially resistant to spot blotch. Evaluation of rust resistant accessions for seedling resistance against seven virulent pathotypes of three rusts under artificial epiphytotic conditions identified 137 accessions potentially resistant to multiple rusts. Molecular analysis to identify different combinations of genetic loci imparting resistance to leaf rust, stem rust, stripe rust and spot blotch using linked molecular markers, identified 45 wheat accessions containing known resistance genes against all three rusts as well as a QTL for spot blotch resistance. The resistant germplasm accessions, particularly against stripe rust, identified in this study can be excellent potential candidates to be employed for breeding resistance into the background of high yielding wheat cultivars through conventional or molecular breeding approaches, and are expected to contribute toward food security at national and global levels.
Development of soda-lime glasses from ornamental rock wastes
International Nuclear Information System (INIS)
Babisk, Michelle Pereira
2009-01-01
During the ornamental rocks production, among other steps, one saw the rock blocks in order to transform them into semi-finished plates. In this step, expressive amounts of residues are generated, which are not properly discharged in nature, without any programmed utilization. The residues of silicide rocks present, in their compositions, oxides which are raw materials employed to fabricate soda-lime type glasses (containing SiO_2, Al_2O_3, CaO, Na_2O and K_2O). On the other hand the residues of carbonatic rocks are constituted of glass net modifier oxides, like CaO and MgO. In this work it was developed four types of soda-lime glasses using ornamental rock residues, where the glasses compositions were adjusted by adding sand, as silica source, as well as sodium and calcium carbonates as sources of Na_2O and CaO, respectively. The obtained glasses were characterized by means of Archimed's method for densities measurements, microstructure by using optical and electronic microscopy, phases by means of X-ray diffraction (XRD), hardness by Vickers indentation, spectroscopy (UV/VIS), and hydrolytic resistance according to ISO 719. The XRD analyses confirmed the compositions total vitrification, where the greened aspect of the samples was due to the presence of the iron oxides. The produced glasses properties were compared with those of commercial glasses aiming their industrial employment. The main difference between the produced glasses and those commercials varied primarily regarding the amount of carbonates incorporated. The results showed that the ornamental rocks residues may be used as raw materials for glasses fabrication, and they found a useful economic destination rather than discharge which promotes undesirable environmental impact. (author)
Directory of Open Access Journals (Sweden)
Naghmeh Nejat
2015-01-01
Full Text Available Catharanthus roseus (L. known as Madagascar periwinkle (MP is a legendary medicinal plant mostly because of possessing two invaluable antitumor terpenoid indole alkaloids (TIAs, vincristine and vinblastine. The plant has also high aesthetic value as an evergreen ornamental that yields prolific blooms of splendid colors. The plant possesses yet another unique characteristic as an amiable experimental host for the maintenance of the smallest bacteria found on earth, the phytoplasmas and spiroplasmas, and serves as a model for their study. Botanical information with respect to synonyms, vernacular names, cultivars, floral morphology, and reproduction adds to understanding of the plant while the geography and ecology of periwinkle illustrate the organism’s ubiquity. Good agronomic practices ensure generous propagation of healthy plants that serve as a source of bioactive compounds and multitudinous horticultural applications. The correlation between genetic diversity, variants, and TIA production exists. MP is afflicted with a whole range of diseases that have to be properly managed. The ethnobotanical significance of MP is exemplified by its international usage as a traditional remedy for abundant ailments and not only for cancer. TIAs are present only in micro quantities in the plant and are highly poisonous per se rendering a challenge for researchers to increase yield and reduce toxicity.
Priemetz, O.; Samoilov, K.; Mukasheva, M.
2017-11-01
An ornament is an actual phenomenon of the architecture modern theory, a common element in the practice of design and construction. It has been an important aspect of shaping for millennia. The description of the methods of its application occupies a large place in the studies on the theory and practice of architecture. However, the problem of the saturation of compositions with ornamentation, the specificity of its themes and forms have not been sufficiently studied yet. This aspect requires accumulation of additional knowledge. The application of quantitative methods for the plastic solutions types and a thematic diversity of facade compositions of buildings constructed in different periods creates another tool for an objective analysis of ornament development. It demonstrates the application of this approach for studying the features of the architectural development in Kazakhstan at the end of the XIX - XXI centuries.
Directory of Open Access Journals (Sweden)
Akmaral Ardasher Yussupova
2017-11-01
Full Text Available The use of symbolism in contemporary architecture is increasingly gaining momentum, especially so in the Eastern countries currently undergoing rapid economic development. Sociologically, this phenomenon can be related to a desire to manifest a vast wealth of national art and respond to the globalisation and unification of world culture. Taking this tendency as a prompt, this study explores different ways of implementing symbolic ornaments in landscape architecture. Traditionally architecture has been defined through and judged against culturally acceptable criteria that set the norm for appropriate form and expression. Yet, technical advances have altered this process and contributed to a certain level of oblivion of traditional architectural form. Thus, the meaning of many Kazakh ornaments has been lost through time. On one hand, this paper collects historical information on the semiotics of Kazakh ornaments and on the other hand, it conducts field studies focusing on the cultural tradition of the native people in Eurasia. The study introduces the use of symbolism in landscape architecture as an aspiration for luck and prosperity which then dictates the quality of the landscape compositions. The findings show that the use of symbolic ornamentation in architecture is not bound to specific geographic areas but rather motivated by broader underlying principles. Through analytical exploration of different cultures and their use of symbols in architecture, this study identifies four main categories of architectural symbolism relating to floral, zoomorphic, geometric and cosmogonic patterns. Each nation then recognises its own identity in the semiotics of those patterns and incorporates them in the urban realm as part of its cultural legacy.
How sexual selection can drive the evolution of costly sperm ornamentation
Lüpold, Stefan; Manier, Mollie K.; Puniamoorthy, Nalini; Schoff, Christopher; Starmer, William T.; Luepold, Shannon H. Buckley; Belote, John M.; Pitnick, Scott
2016-05-01
Post-copulatory sexual selection (PSS), fuelled by female promiscuity, is credited with the rapid evolution of sperm quality traits across diverse taxa. Yet, our understanding of the adaptive significance of sperm ornaments and the cryptic female preferences driving their evolution is extremely limited. Here we review the evolutionary allometry of exaggerated sexual traits (for example, antlers, horns, tail feathers, mandibles and dewlaps), show that the giant sperm of some Drosophila species are possibly the most extreme ornaments in all of nature and demonstrate how their existence challenges theories explaining the intensity of sexual selection, mating-system evolution and the fundamental nature of sex differences. We also combine quantitative genetic analyses of interacting sex-specific traits in D. melanogaster with comparative analyses of the condition dependence of male and female reproductive potential across species with varying ornament size to reveal complex dynamics that may underlie sperm-length evolution. Our results suggest that producing few gigantic sperm evolved by (1) Fisherian runaway selection mediated by genetic correlations between sperm length, the female preference for long sperm and female mating frequency, and (2) longer sperm increasing the indirect benefits to females. Our results also suggest that the developmental integration of sperm quality and quantity renders post-copulatory sexual selection on ejaculates unlikely to treat male-male competition and female choice as discrete processes.
Viruses of ornamentals emerging in Florida and the Caribbean region
Tomato chlorotic spot virus (TCSV) has been reported in common weeds including American black nightshade and jimsonweed in Florida and/or Puerto Rico. Experimental host range studies demonstrated that TCSV and/or GRSV can also infect ornamentals including petunia, brugmansia and garden impatiens. ...
Other pospiviroids infecting Solanaceous plants (Book Chapter)
Aside from potato spindle tuber viroid, the genus Pospiviroid contains several agents reported to naturally infect solanaceous crops (e.g. tomato, potato, pepper) or ornamental plants (e.g. Petunia hybrida, Solanum spp., Brugmansia spp.). The present chapter focuses on the following so-called solana...
[Research and investigation on original plants of medicinal Moutan].
Peng, Hua-Sheng; Wang, De-Qun; Peng, Dai-Yin; Huang, Lu-Qi
2017-05-01
As a kind of famous ornamental flowers, Moutan, known as "the king of flower", mainly originates from various cultivars of Paeonia suffruticosa. Moutan Cortex, a common traditional Chinese medicine, has a long medicinal history for more than 2 000 years. At present, "Fengdanpi", which is the root bark of P. ostii mainly growing in Tongling, Anhui, is a sort of Dao-di herbs in traditional Chinese medicine. However,various editions of Chinese pharmacopoeia has been stipulating that Moutan Cortex originates from the bark root of P. suffruticosa. Textual researches on germplasm of ornamental and medicinal Moutan provided that, Xi'an, Luoyang, Pengcheng, Bozhou, Heze and some other famous cultivation centers had been formed throughout the history. In addition, medicinal practitioners in Song Dynasty had been fully aware of the medicinal differences between ornamental and wild Moutan, and preferred wild single flowers as medicinal Moutan. Moreover, none of cultivation centers of ornamental Moutan were recorded in producing areas of medicinal Moutan. So far, Fengdan and Dianjiang Moutan in Chongqing are single flowers, which is consistent with the ancient herbal books. Therefore, this paper believes that the medicinal and ornamental Moutan are two different germplasm since ancient times. And we proposethat Chinese pharmacopoeia should record P. ostii and the single-flower varieties of P. suffruticosa as the original plants of Moutan Cortex. Copyright© by the Chinese Pharmaceutical Association.
Velando, A.; Lessells, C.M.; Marquez, J.C.
2001-01-01
Inca Terns Larosterna inca are medium-size seabirds that breed along the Peruvian and Chilean coast. They are monogamous and both sexes incubate and contribute to chick provisioning. The sexes are similar in appearance and have elaborate ornaments, including a long white moustache of feathers and
Taxonomical Studies Of Selected Ornamental Plants | Oloyede | Ife ...
African Journals Online (AJOL)
The plants were collected in Osun-State, Nigeria and identified using standard horticultural literatures and herbarium specimens of the Department of Botany, Obafemi Awolowo University, Ile-Ife, Nigeria. ... Reticulate venation was common to them with the exception of C.bicolor and R. spathacea with parallel venation.
Ornament induced complications in snake bites: Revisiting the "Do it RIGHT" approach.
Mallik, Subhendu; Singh, Sudipta Ranjan; Sahoo, Sangeeta; Mohanty, Manoj Kumar
2016-01-01
Limb adorning ornaments (LAO) can exacerbate the local effects of envenoming in case of venomous snake bite. Cultural presuppositions do inhibit victims from removing symbolically/ritually important jewelry even under circumstances that might increase the dangers of envenoming-induced gangrene formation. The recommendation to remove the LAO is usually skipped in guidelines and if at all included the very real hazard is uncommonly documented. We observed 14 cases of snake bite with LAO on the bitten limb with minimal to severe local complications. The possible reasons were discussed with recommendations of proper and timely methods of removal of these ornaments. We suggest inclusion of this concept of 'Remove' in the recommended first aid methods of the guidelines/protocols.
Epigrafical Ornaments In Architecture Of Uzbekistan
Directory of Open Access Journals (Sweden)
Sultanova Dilshoda
2015-07-01
Full Text Available Abstract Article illuminates using of artistic importance epigrafical ornamenst on architecture ofUzbekistan. Calligraphic group formed embellishment in the manner of ornament in medicine to be taken externally and in internal parts of the public buildings. The Inscription taken from Koran were executed on arabic alphabet consists of themes - religious inctructive. Using appeared In mosque from Koran and hadis in hotel of the expression of the nature. Resemblance of the inscriptions ed in interior of the hotels Buhara Samarkand and Tashkent with inscription of the dishes gives the cause to expect that probably poetry IX-X ages were in the beginning used in product decorative-aplied arts tureen plate and gradually moved to wall. Besides they were broadly used in interior of buildings the mosques mausoleum in premiseses vein of the houses and on surfaces subject decorative-aplied arts. Amongst which there are real and fantastic images animal - a phoenix dragon deer. Meet in SHerdor and Nadir Devonbegi in Samarkand in Abdulazizhan and Nadir Devonbegi. About using ornament except mausoleum of Amir Temur and Temuridov and cathedral mosque of Amir Temur appropriately was in detail describe the artistic facilities of Aksaray. Of the building process was it is important to fill am empty the surface of the dome by new artistic method. In this period by new direction was - a technology amp1082amp1091amp1085amp1076amp1072amp1083amp1100 which as raised decoration has alterred by sawing in architecture of the interior due to artistic embroidery.
Potencial ornamental de acessos de pimenta
Directory of Open Access Journals (Sweden)
Leane Fialho de Melo
2014-11-01
Full Text Available O objetivo deste trabalho foi avaliar o potencial ornamental de dez acessos de pimenta Capsicum spp. procedentes da Coleção de Germoplasma da Universidade Federal do Piauí, Brasil. O experimento foi conduzido em casa de vegetação, no Departamento de Fitotecnia, do Centro de Ciências Agrárias, no município de Teresina, Piauí, obedecendo ao delineamento experimental inteiramente casualizado, com três repetições. Na caracterização morfoagronômica dos acessos, conforme orientação do Bioversity International, utilizaram-se os seguintes descritores qualitativos e quantitativos para o gênero Capsicum: forma da folha, hábito de crescimento da planta, antocianina no nó da planta, posição da flor, cor da corola, cor do fruto no estado intermediário e maduro, forma do fruto, forma do ápice do fruto, textura da epiderme do fruto, comprimento do fruto, comprimento do pedicelo, persistência do fruto maduro e altura da planta. Dentre os dez acessos avaliados, sete foram considerados com potencial ornamental: CGC-06 (C. chinense, CGC-07 (C. chinense, CGC-11 (C. annuum var. glabriusculum, CGC-23 (C. chinense, CGC-36 (C. annuum var. glabriusculum, CGC-59 (C. annuum var. glabriusculum e CGC-67 (C. annuum var. glabriusculum. O CGC 11 apresentou estética mais harmoniosa, com flores eretas, as quais são de fácil percepção; frutos eretos e vistosos e folhas de formato lanceolado.
Aprea, Cristina; Lunghini, Liana; Banchi, Bruno; Peruzzi, Antonio; Centi, Letizia; Coppi, Luana; Bogi, Mirella; Marianelli, Enrico; Fantacci, Mariella; Catalano, Pietro; Benvenuti, Alessandra; Miligi, Lucia; Sciarra, Gianfranco
2009-09-01
The aim of this research was to assess dermal and respiratory exposure of workers to imidacloprid during manual operations with ornamental plants previously treated in greenhouses or tunnels. A total of 10 female workers, 5 in greenhouses and 5 in tunnels, were monitored for 3 or 5 consecutive days. Actual skin contamination, excluding hands, was evaluated using nine filter paper pads placed directly on the skin. To evaluate the efficacy of protective clothing in reducing occupational exposure we also placed four pads on top of the outer clothing. Hand contamination was evaluated by washing with 95% ethanol. Respiratory exposure was evaluated by personal air sampling. Respiratory dose was calculated on the basis of a lung ventilation of 15 l/min. Absorbed doses were calculated assuming a skin penetration of 10% and a respiratory retention of 100%. Dislodgeable foliar residues (DFRs) were determined during the days of re-entry in order to determine the dermal transfer factor. From the dependence of dermal exposure of hands from DFRs, a mean transfer factor was estimated to be 36.4 cm(2)/h. Imidacloprid was determined by liquid chromatography with selective mass detection and electrospray interface in all matrices analysed. Respiratory dose was 4.1+/-4.0 (0.1-14.3)% and 3.0+/-2.0 (0.6-6.9)% (mean+/-SD (range)) of the total real dose during work in tunnels and greenhouses, respectively. The estimated absorbed doses, 0.29+/-0.45 microg/kg (0.06-2.25 microg/kg) body weight and 0.32+/-0.18 microg/kg (0.07-0.66 microg/kg) body weight (mean+/-SD (range)) in tunnels and in greenhouses, respectively, were less than the acceptable operator exposure level of 0.15 mg/kg body weight and than the acceptable daily intake of 0.05 mg/kg body weight. The hands and exposed skin of all workers were found to be contaminated, indicating that greater precautions, such as daily changing of gloves and clothing, are necessary to reduce skin exposure.
Tibbetts, Elizabeth A; Forrest, Taylor; Vernier, Cassondra; Jinn, Judy; Madagame, Andrew
2015-11-01
Many animals have ornaments that mediate choice and competition in social and sexual contexts. Individuals with elaborate sexual ornaments typically have higher fitness than those with less elaborate ornaments, but less is known about whether socially selected ornaments are associated with fitness. Here, we test the relationship between fitness and facial patterns that are a socially selected signal of fighting ability in Polistes dominula wasps. We found wasps that signal higher fighting ability have larger nests, are more likely to survive harsh winters, and obtain higher dominance rank than wasps that signal lower fighting ability. In comparison, body weight was not associated with fitness. Larger wasps were dominant over smaller wasps, but showed no difference in nest size or survival. Overall, the positive relationship between wasp facial patterns and fitness indicates that receivers can obtain diverse information about a signaler's phenotypic quality by paying attention to socially selected ornaments. Therefore, there are surprisingly strong parallels between the information conveyed by socially and sexually selected signals. Similar fitness relationships in social and sexually selected signals may be one reason it can be difficult to distinguish the role of social versus sexual selection in ornament evolution. © 2015 The Author(s). Evolution © 2015 The Society for the Study of Evolution.
Plant diversity in the homegardens of Karwar, Karnataka, India
Directory of Open Access Journals (Sweden)
SHIVANAND BHAT
2014-10-01
Full Text Available Bhat S, Bhandary MJ, Rajanna L. 2014. Plant diversity in the homegardens of Karwar, Karnataka, India. Biodiversitas 15: 229-235. A study was conducted in 50 selected home gardens of Karwar, Karnataka, India to document their floristic diversity and composition with regard to life forms and uses. As many as 210 species of flowering plants belonging to 69 families were recorded. Euphorbiaceae (13species, Apocynaceae (11spp., Cucurbitaceae (10 spp. and Fabaceae (10 spp. are the predominant families. Shrubs are the dominant life forms (73 spp. followed by trees (61 spp., herbs (42 spp. and climbers (24 spp.. Areca palm (Areca catechu, coconut palm (Cocos nucifera, mango tree (Mangifera indica, banana (Musa paradisiaca, shoe flower (Hibiscus rosa-sinensis and holy basil (Ocimum tenuiflorum are the most common plants occurring in all of the 50 studied gardens. 38% of the plant species are grown mainly for ornamental and aesthetic purposes while 33% of the species are used for obtaining food products like fruits and vegetables and 22% of the plants are mainly used for medicinal purposes. The predominance of ornamental species makes the home gardens of Karwar different from those occurring in other regions in which mostly food plants form the major component.
International Nuclear Information System (INIS)
Datta, SK.
2001-01-01
In floriculture trade there is always demand and necessity of new and novel ornamental varieties. Flower colour is one of the most important component of novelties. Induced somatic mutation techniques by using ionizing radiations and other mutagens have successfully produced quite a large number of new promising varieties (50 Nos.) in different ornamental (Bougainvillea, Chrysanthemum, Hibiscus, Rose, Tuberose, Lantana depressa etc.) plants by bringing about genetic changes at Floriculture Section, National Botanical Research Institute, India. For inducing novelties in flower colour of different plants the technique of selection of proper type/state of plant material for experiment, suitable dose, detection of mutation at right stage of development, isolation and multiplication of chimeric tissue have been standardised. The capability of the technique is well understood from significant number of new varieties developed via direct mutation breeding in already adapted, modern genotypes and enriched the germplasm. The mutations in flower lour/shape were detected as chimera in M1v1, M1v2, M1v3 generations. The mutation frequency varied with the cultivar and exposure of gamma rays. The main bottleneck of mutation breeding is that the mutation appears as chimera. When the entire branch is mutated, mutants can be isolated through conventional propagation techniques while small sectorial mutation in the floret cannot be isolated using existing conventional techniques. Therefore, many new flower colour/shape mutants are lost due to the lack of a suitable propagation technique. By applying biotechnological technique on the same mutagen treated gamma rays population a novel tissue culture technique hasbeen standardised to regenerate plants directly from such mutated sectors (ray florets) of Chrysanthemum. A number of somatic flower colour/shape mutants have been developed in Chrysanthemum by using this in vitro technique. Combination of classical mutation breeding and
Characterization of ceramic ornaments of a theatre-like incense burner
International Nuclear Information System (INIS)
Lopez-Valenzuela, R.; Lopez-Palacios, J.A.; Jimenez-Reyes, M.; Tenorio, D.; Catano, G.
2010-01-01
Thirteen Teotihuacan-style ornaments of an incense burner were studied. Ceramic pastes, pigments and mica were analyzed by neutron activation, X-ray diffraction and scanning electron microscopy. Elemental (Sc, Cr, Fe, Co, Rb, Cs, La, Ce, Nd, Sm, Eu, Tb, Yb, Lu, Hf, Th and U) and statistical analyses of ceramic-body data showed that these pieces were made from the same raw material, which is chemically different from the fine orange ceramic of Teotihuacan. Montmorillonite and the classical components of sand were the minerals identified in the ceramic pastes. The white pigment contained calcium, titanium and aluminium, the yellow pigment was ocher, and the red pigment was a mixture of red ocher and cinnabar, the binder of the pigments being clay. Exoskeletons of diatoms and locust ootecs were found in the pigments. Mica was identified as biotite, identical with that coming from Monte Alban Oaxaca. We wish to undertake a historical reconstruction of these ornaments based on archaeometric and literature data. (author)
Directory of Open Access Journals (Sweden)
Ali Agharokh
2008-03-01
Full Text Available In this study, 24 species of aquaponically grown ornamental flowers and 10 fish species were used. The purpose of the study was to put urban wastewater into economic use in an attempt to reduce contaminate loads in coastal waters through biological treatment. Certain chemical parameters of pond water such as EC, temperature, DO, pH and TDS were measured on a daily basis while parameters such as salinity, nitrate, nitrite, ammonia, TSS, chloride, sulphate, potassium, carbonate, etc. were measured on a monthly basis. It was found that Petunia hybrida, Verbena hybrida, Ficus sp., Phinix sp., and Conokarpus sp. as the ornamental flowers and Serresalmus natlerei and Junit sp. in the ornamental fish group had the highest adaptability to life and growth in urban wastewater.
Lubell, Jessica D; Brand, Mark H; Lehrer, Jonathan M; Holsinger, Kent E
2008-06-01
Japanese barberry (Berberis thunbergii DC.) is a widespread invasive plant that remains an important landscape shrub represented by ornamental, purple-leaved forms of the botanical variety atropurpurea. These forms differ greatly in appearance from feral plants, bringing into question whether they contribute to invasive populations or whether the invasions represent self-sustaining populations derived from the initial introduction of the species in the late 19th century. In this study we used amplified fragment length polymorphism (AFLP) markers to determine whether genetic contributions from B. t. var. atropurpurea are found within naturalized Japanese barberry populations in southern New England. Bayesian clustering of AFLP genotypes and principal coordinate analysis distinguished B. t. var. atropurpurea genotypes from 85 plants representing five invasive populations. While a single feral plant resembled B. t. var. atropurpurea phenotypically and fell within the same genetic cluster, all other naturalized plants sampled were genetically distinct from the purple-leaved genotypes. Seven plants from two different sites possessed morphology consistent with Berberis vulgaris (common barberry) or B. ×ottawensis (B. thunbergii × B. vulgaris). Genetic analysis placed these plants in two clusters separate from B. thunbergii. Although the Bayesian analysis indicated some introgression of B. t. var. atropurpurea and B. vulgaris, these genotypes have had limited influence on extant feral populations of B. thunbergii.
Qureshi, Asifa; Kapley, Atya; Purohit, Hemant J.
2012-01-01
Arthrobacter sp. HPC1223 (Genebank Accession No. AY948280) isolated from activated biomass of effluent treatment plant was capable of utilizing 2,4,6 trinitrophenol (TNP) under aerobic condition at 30 °C and pH 7 as nitrogen source. It was observed that the isolated bacteria utilized TNP up to 70 % (1 mM) in R2A media with nitrite release. The culture growth media changed into orange-red color hydride-meisenheimer complex at 24 h as detected by HPLC. Oxygen uptake of Arthrobacter HPC1223 towa...
Delonix regia Rat. (Gulmohar) is a highly ornamental tree largely ...
Indian Academy of Sciences (India)
Delonix regia Rat. (Gulmohar) is a highly ornamental tree largely cultivated on roadsides and in gardens for its beautiful foliage and scarlet red (lowers. Gulmohar trees in full bloom and new leaves dominate other flora in summer months. The infusion of flowers is used in bronchitis, asthma and malaria.
Directory of Open Access Journals (Sweden)
CR Amundsen
2015-04-01
Full Text Available Reports on reddish carotenoid-based ornaments in female three-spined sticklebacks (Gasterosteus aculeatus are few, despite the large interest in the species’ behaviour, ornamentation, morphology and evolution. We sampled sticklebacks from 17 sites in north-western Europe in this first extensive study on the occurrence of carotenoid-based female pelvic spines and throat ornaments. The field results showed that females, and males, with reddish spines were found in all 17 populations. Specimens of both sexes with conspicuous red spines were found in several of the sites. The pelvic spines of males were more intensely red compared to the females’ spines, and large specimens were more red than small ones. Fish infected with the tapeworm (Schistocephalus solidus had drabber spines than uninfected fish. Both sexes had red spines both during and after the spawning period, but the intensity of the red colour was more exaggerated during the spawning period. As opposed to pelvic spines, no sign of red colour at the throat was observed in any female from any of the 17 populations. A rearing experiment was carried out to estimate a potential genetic component of the pelvic spine ornament by artificial crossing and rearing of 15 family groups during a 12 months period. The results indicated that the genetic component of the red colour at the spines was low or close to zero. Although reddish pelvic spines seem common in populations of stickleback, the potential adaptive function of the reddish pelvic spines remains largely unexplained.
Seasonal foreign bodies: the dangers of winter holiday ornamentation.
Trout, Andrew T; Towbin, Alexander J
2014-12-01
Foreign bodies, whether ingested, aspirated or retained in the soft tissues, are a particular hazard to pediatric patients. Ornamentation associated with the winter holidays is an uncommon source of foreign bodies in children, and many of these foreign bodies have a distinct appearance on imaging. Knowledge of these appearances and the unusual features of winter holiday foreign bodies might facilitate their identification.
Directory of Open Access Journals (Sweden)
О. P. Pryimak
2009-03-01
Full Text Available Basic descriptions of the seminal productivity for some ornamental flowering plants under influence of cars’ emissions are presented. Decreasing of the seminal productivity, germinating capacity of seeds and mass of thousand seeds was found. Recommendations on plants using for planting of the cities environment polluted by vehicles emissions are proposed.
Deep Learning for Plant Identification in Natural Environment.
Sun, Yu; Liu, Yuan; Wang, Guan; Zhang, Haiyan
2017-01-01
Plant image identification has become an interdisciplinary focus in both botanical taxonomy and computer vision. The first plant image dataset collected by mobile phone in natural scene is presented, which contains 10,000 images of 100 ornamental plant species in Beijing Forestry University campus. A 26-layer deep learning model consisting of 8 residual building blocks is designed for large-scale plant classification in natural environment. The proposed model achieves a recognition rate of 91.78% on the BJFU100 dataset, demonstrating that deep learning is a promising technology for smart forestry.
Deep Learning for Plant Identification in Natural Environment
Directory of Open Access Journals (Sweden)
Yu Sun
2017-01-01
Full Text Available Plant image identification has become an interdisciplinary focus in both botanical taxonomy and computer vision. The first plant image dataset collected by mobile phone in natural scene is presented, which contains 10,000 images of 100 ornamental plant species in Beijing Forestry University campus. A 26-layer deep learning model consisting of 8 residual building blocks is designed for large-scale plant classification in natural environment. The proposed model achieves a recognition rate of 91.78% on the BJFU100 dataset, demonstrating that deep learning is a promising technology for smart forestry.
Genetic diversity in a collection of ornamental squash (Cucurbita pepo L.
Directory of Open Access Journals (Sweden)
Mladenović Emina
2014-01-01
Full Text Available The aim of this study is collecting and preserving of unique Cucurbita pepo germplasm in Serbia. This study also describes the intraspecific variation of C. pepo within twenty germplasm accessions. Conservation work aimed to develop a representative core collection of C. pepo germplasm, to guide future studies and breeding of its ornamental use. A wide range of C. pepo germplasm was collected from diferent parts of the world. Nineteen variables were recorded in 20 varieties to determine the overall degree of polymorphism and to detect similarities among them. Qualitative traits of fruit such is shape, color and texture, showed immense variation. Coefficient of variation were highest for fruit length, fruit weight and number of fruits per plant (CV=56.69161.32%, while they were the lowest for leaf length (CV=20.65%. Morphological characterization is need to facilitate the use of C. pepo varieties in breeding work. Based on the PCA results, 20 accessions of squash are separate in five groups. Those groups are unique in qualitative and quantitative traits. Knowledge of genetic divergence among varieties is essential for breeding.
Retardation of hypocotyl elongation of ornamental and vegetable seedlings by ultraviolet irradiation
International Nuclear Information System (INIS)
Bae, E.; Inamoto, K.; Doi, M.; Imanishi, H.
1998-01-01
Seedlings of cosmos (Cosmos bipinnatus Cav.), lettuce (Lactuca sativa L.), sunflower (Helianthus annuus L), ornamental kale (Brassica oleracea L. var. acephara), tomato (Lycopersicon esculentum Mill.), bell pepper (Capsicum annuum L.), and cucumber (Cucumis sativus L.) were irradiated by a UV-B lamp (fluorescent sun lamp) or a three-band fluorescent lamp (control) for 72 hr just after sowing. Hypocotyl elongation was repressed by all species during the irradiation with UV-B. The retarding effects of UV-B persisted when these seedlings were placed in dark or a greenhouse with 30% shade after irradiation. The most effective timing of UV-B irradiation for cosmos and ornamental kale seedlings was from 48 hr to 72 hr after sowing, when the seedlings were rapidly increasing their surface area to UV-B
Results of gas exposure experiments for determination of HF concentrations injurious to plants
Energy Technology Data Exchange (ETDEWEB)
Guderian, R
1971-01-01
Gas exposure experiments were performed under greenhouse conditions to determine the effects of hydrogen fluoride on the growth capacity, yield and quality of plants. Damage to plants was assessed after HF concentrations of 0.85-25 ..mu..g/m/sup 3/. The effects of definite HF quantities on plants are described and relative sensitivities of 17 deciduous trees, 9 evergreens, 24 agricultural garden plants and 17 ornamental plants are presented. 2 references, 7 tables.
Sohn, B.K.; Kim, K.Y.; Chung, S.J.; Kim, W.S.; Park, S.M.; Kang, J.G.; Rim, Y.S.; Cho, J.S.; Kim, T.H.; Lee, J.H.
2003-01-01
Plant growth and flower quality of an ornamental plant (Chrysanthemum morifolium Ramat) var. Baekgwang in response to the different timing of arbuscular mycorrhizal fungi (AMF) inoculation were examined. To evaluate the effects of AMF inoculation timing on growth of chrysanthemum cuttings, AMF was
Genetic assessment of ornamental fish species from North East India.
Dhar, Bishal; Ghosh, Sankar Kumar
2015-01-25
Ornamental fishes are traded with multiple names from various parts around the world, including North East India. Most are collected from the wild, due to lack of species-specific culture or breeding, and therefore, such unmanaged collection of the wild and endemic species could lead to severe threats to biodiversity. Despite many regulatory policies, trade of threatened species, including the IUCN listed species have been largely uncontrolled, due to species identification problems arising from the utilization of multiple trade names. So, the development of species-specific DNA marker is indispensable where DNA Barcoding is proved to be helpful in species identification. Here, we investigated, through DNA Barcoding and morphological assessment, the identification of 128 ornamental fish specimens exported from NE India from different exporters. The generated sequences were subjected to similarity match in BOLD-IDS as well as BLASTN, and analysed using MEGA5.2 for species identification through Neighbour-Joining (NJ) clustering, and K2P distance based approach. The analysis revealed straightforward identification of 84 specimens into 35 species, while 44 specimens were difficult to distinguish based on CO1 barcode alone. However, these cases were resolved through morphology, NJ and distanced based method and found to be belonging to 16 species. Among the 51 identified species, 14 species represented multiple trade names; 17 species belonged to threatened category. Species-level identification through DNA Barcoding along with traditional morphotaxonomy reflects its efficacy in regulating ornamental fish trade and therefore, appeals for their conservation in nature. The use of trade names rather than the zoological name created the passage for trafficking of the threatened species and demands immediate attention for sustaining wildlife conservation. Copyright © 2014 Elsevier B.V. All rights reserved.
Mycorrhiza-induced resistance against Thielaviopsis basicola in the ornemental crop Petunia hybrida
Hayek , Soukayna
2012-01-01
Wurzelpathogene zeigen bedeutenden Einfluss auf die Produktion von Zierpflanzen. Vor Allem in erdelosen Produktionssystemen unter Glas verursachen sie erhebliche Verluste und ihre Bekämpfung mit konventionellen Mitteln beinhaltet normalerweise ein hoher Einsatz an Pestiziden. Ein mehr nachhaltiger Gartenbau braucht alternative Methoden, um den Eintrag dieser Chemikalien zu vermeiden. Die Einführung arbuskulärer Mykorrhizapilze (AM Pilze) in das Produktionssystem könnte ein integraler Bestandt...
Ediviani, W.; Priadi, C. R.; Moersidik, S. S.
2018-05-01
Indonesia has implemented energy recovery from organic (food) waste by anaerobic digestion method, but the digestate was commonly treated only by composting, and still as a separated treatment (not integrated into a resource recovery system). Whilst not getting any pretreatment, the digestate was disposed to the environment and then act as a pollutant. Yet it contains nutrients which could be recovered as a nutrient source for plants. The study was about how ornamental aquatic macrophytes could uptake nitrogen from liquid digestate in a constructed wetland method. Canna indica, Iris pseudacorus, and Typha latifolia were the experimented ornamental aquatic macrophytes used to uptake the nutrient (nitrogen—N) from liquid digestate. The study showed that the highest N uptake was done by C. indica (25.1%) which has the highest biomass increment as well (80.5%). Effluent quality improvement also shown by N removal by C. indica (68.5—76.4% TN), I. pseudacorus (61.8—71.3% TN), and T. latifolia (61.6—74.5%). This research proved that C. indica has the performance for the N uptake, best N removal efficiency, with a great growth rate as well. This system using C. indica could also improve the water quality of the effluent and add the aesthetic of environment.
Barcoding and border biosecurity: identifying cyprinid fishes in the aquarium trade.
Directory of Open Access Journals (Sweden)
Rupert A Collins
Full Text Available Poorly regulated international trade in ornamental fishes poses risks to both biodiversity and economic activity via invasive alien species and exotic pathogens. Border security officials need robust tools to confirm identifications, often requiring hard-to-obtain taxonomic literature and expertise. DNA barcoding offers a potentially attractive tool for quarantine inspection, but has yet to be scrutinised for aquarium fishes. Here, we present a barcoding approach for ornamental cyprinid fishes by: (1 expanding current barcode reference libraries; (2 assessing barcode congruence with morphological identifications under numerous scenarios (e.g. inclusion of GenBank data, presence of singleton species, choice of analytical method; and (3 providing supplementary information to identify difficult species.We sampled 172 ornamental cyprinid fish species from the international trade, and provide data for 91 species currently unrepresented in reference libraries (GenBank/Bold. DNA barcodes were found to be highly congruent with our morphological assignments, achieving success rates of 90-99%, depending on the method used (neighbour-joining monophyly, bootstrap, nearest neighbour, GMYC, percent threshold. Inclusion of data from GenBank (additional 157 spp. resulted in a more comprehensive library, but at a cost to success rate due to the increased number of singleton species. In addition to DNA barcodes, our study also provides supporting data in the form of specimen images, morphological characters, taxonomic bibliography, preserved vouchers, and nuclear rhodopsin sequences. Using this nuclear rhodopsin data we also uncovered evidence of interspecific hybridisation, and highlighted unrecognised diversity within popular aquarium species, including the endangered Indian barb Puntius denisonii.We demonstrate that DNA barcoding provides a highly effective biosecurity tool for rapidly identifying ornamental fishes. In cases where DNA barcodes are unable to
Mutual ornamentation, sexual selection, and social dominance in the black swan
Kraaijeveld, K; Gregurke, J; Hall, C; Komdeur, J; Mulder, RA
We investigated the adaptive significance of a sexually monomorphic ornament in the black swan Cygnus atratus. Both sexes grow curled feathers on their wings (range 7-22 curled feathers per wing), which are displayed prominently in a range of social interactions. The number of curled feathers
Horticulture hybrid cultivars and exotic plant invasion: A case study of Wisteria (Fabaceae)
J.L. Trusty; B.G. Lockaby; W.C. Zipperer; L.R. Goertzen
2008-01-01
Ornamental plant horticulture has had a long history in the USA, beginning with the first botanical garden started by John Bartram in Philadelphia in 1728 (Hedrick, 1988). From this modest start, the nursery and horticulture business in the USA was flourishing by the early 19th century. The growth and sale of useful and attractive plant species inspired American plant...
Mini-DNA barcode in identification of the ornamental fish: A case study from Northeast India.
Dhar, Bishal; Ghosh, Sankar Kumar
2017-09-05
The ornamental fishes were exported under the trade names or generic names, thus creating problems in species identification. In this regard, DNA barcoding could effectively elucidate the actual species status. However, the problem arises if the specimen is having taxonomic disputes, falsified by trade/generic names, etc., On the other hand, barcoding the archival museum specimens would be of greater benefit to address such issues as it would create firm, error-free reference database for rapid identification of any species. This can be achieved only by generating short sequences as DNA from chemically preserved are mostly degraded. Here we aimed to identify a short stretch of informative sites within the full-length barcode segment, capable of delineating diverse group of ornamental fish species, commonly traded from NE India. We analyzed 287 full-length barcode sequences from the major fish orders and compared the interspecific K2P distance with nucleotide substitutions patterns and found a strong correlation of interspecies distance with transversions (0.95, pbarcode. The proposed segment was compared with the full-length barcodes and found to delineate the species effectively. Successful PCR amplification and sequencing of the 171bp segment using designed primers for different orders validated it as mini-barcodes for ornamental fishes. Thus, our findings would be helpful in strengthening the global database with the sequence of archived fish species as well as an effective identification tool of the traded ornamental fish species, as a less time consuming, cost effective field-based application. Copyright © 2017 Elsevier B.V. All rights reserved.
Ornament induced complications in snake bites: Revisiting the “Do it RIGHT” approach
Mallik, Subhendu; Singh, Sudipta Ranjan; Sahoo, Sangeeta; Mohanty, Manoj Kumar
2016-01-01
Limb adorning ornaments (LAO) can exacerbate the local effects of envenoming in case of venomous snake bite. Cultural presuppositions do inhibit victims from removing symbolically/ritually important jewelry even under circumstances that might increase the dangers of envenoming-induced gangrene formation. The recommendation to remove the LAO is usually skipped in guidelines and if at all included the very real hazard is uncommonly documented. We observed 14 cases of snake bite with LAO on the bitten limb with minimal to severe local complications. The possible reasons were discussed with recommendations of proper and timely methods of removal of these ornaments. We suggest inclusion of this concept of 'Remove’ in the recommended first aid methods of the guidelines/protocols. PMID:27843867
Ornament induced complications in snake bites: Revisiting the “Do it RIGHT” approach
Directory of Open Access Journals (Sweden)
Subhendu Mallik
2016-01-01
Full Text Available Limb adorning ornaments (LAO can exacerbate the local effects of envenoming in case of venomous snake bite. Cultural presuppositions do inhibit victims from removing symbolically/ritually important jewelry even under circumstances that might increase the dangers of envenoming-induced gangrene formation. The recommendation to remove the LAO is usually skipped in guidelines and if at all included the very real hazard is uncommonly documented. We observed 14 cases of snake bite with LAO on the bitten limb with minimal to severe local complications. The possible reasons were discussed with recommendations of proper and timely methods of removal of these ornaments. We suggest inclusion of this concept of 'Remove' in the recommended first aid methods of the guidelines/protocols.
The whitefly Bemisia tabaci (Hemiptera: Aleyodidae) is an invasive insect pest affecting different crops including vegetables, fruits, cereals, and ornamentals. The efficacy of some products such as commercial soap, natural oils and Preferal® (based on the entomopathogenic fungus Isaria fumosorosea ...
Colletotrichum fungal pathogens and symbionts of ornamental nursery and landscape plants
Fungi in the ascomycete genus Colletotrichum are ranked by the plant pathology community as one of the ten most economically and scientifically important fungal phytopathogens. Major losses due to Colletotrichum are experienced in almost every crop worldwide, including nursery and landscape plants ...
Ieperen, van W.; Savvides, A.; Fanourakis, D.
2012-01-01
Many horticultural crops (food and ornamental) are produced year-round in greenhouses at high latitudes, where the limited availability of natural sunlight restricts plant production during large parts of the year. To enable year-round plant production supplemental light is necessary to enhance
A female melanin ornament signals offspring fluctuating asymmetry in the barn owl
Roulin, A; Ducrest, AL; Balloux, F; Dijkstra, Cornelis; Riols, C
2003-01-01
Sexual selection theory predicts that males advertise quality by displaying extravagant ornaments. By contrast, whether phenotypic variation in females has a signalling function remains an open question. Here, to our knowledge, we provide the first evidence that a female plumage trait can signal
Selection and Vegetative Propagation of Native Woody Plants for Water-Wise Landscaping
Rupp, Larry A; Varga, William A; Anderson, David
2011-01-01
Native woody plants with ornamental characteristics such as brilliant fall color, dwarf form, or glossy leaves have potential for use in water conserving urban landscapes. Individual accessions with one or more of these unique characteristics were identified based on the recommendations of a wide range of plant enthusiasts (both professional and amateur). Documentation of these accessions has been done through locating plants on-site where possible and then developing a record based on digita...
The evolution of honest communication: integrating social and physiological costs of ornamentation.
Tibbetts, Elizabeth A
2014-10-01
Much research on animal communication has addressed how costs such as social costs or physiological costs favor the accuracy of signals. Previous work has largely considered these costs separately, but we may be missing essential connections by studying costs in isolation. After all, social interactions produce rapid changes in hormone titers which can then affect individual behavior and physiology. As a result, social costs are likely to have widespread physiological consequences. Here, I present a new perspective on the factors that maintain honest signals by describing how the interplay between social costs and physiological costs may maintain an accurate link between an animal's abilities and ornament elaboration. I outline three specific mechanisms by which the interaction between social behavior and hormones could favor honest signals and present specific predictions for each of the three models. Then, I review how ornaments alter agonistic behavior, agonistic behavior influences hormones, and how these hormonal effects influence fitness. I also describe the few previous studies that have directly tested how ornaments influence hormones. Finally, opportunities for future work are discussed. Considering the interaction between social behavior and physiology may address some challenges associated with both social and physiological models of costs. Understanding the dynamic feedbacks between physiology and social costs has potential to transform our understanding of the stability of animals' communication systems. © The Author 2014. Published by Oxford University Press on behalf of the Society for Integrative and Comparative Biology. All rights reserved. For permissions please email: journals.permissions@oup.com.
Draft Genome Sequences of 17 Isolates of the Plant Pathogenic Bacterium Dickeya
Pritchard, Leighton; Humphris, Sonia; Saddler, Gerry S.; Elphinstone, John G.; Pirhonen, Minna; Toth, Ian K.
2013-01-01
Dickeya (formerly Erwinia chrysanthemi) species cause diseases on a wide range of crops and ornamental plants worldwide. Here we present the draft sequences of 17 Dickeya isolates spanning four Dickeya species, including five isolates that are currently unassigned to a species.
Draft genome sequences of 17 isolates of the plant pathogenic bacterium dickeya.
Pritchard, Leighton; Humphris, Sonia; Saddler, Gerry S; Elphinstone, John G; Pirhonen, Minna; Toth, Ian K
2013-11-21
Dickeya (formerly Erwinia chrysanthemi) species cause diseases on a wide range of crops and ornamental plants worldwide. Here we present the draft sequences of 17 Dickeya isolates spanning four Dickeya species, including five isolates that are currently unassigned to a species.
McDaniel, Justin
2014-01-01
Despite the prevalence of ornament and decoration in Buddhist monasteries in Thailand, as an art form, ornament has been almost entirely ignored in favor of the study of narrative and didactic art and literature. In this paper, I approach the subject of temple ornament (focusing primarily on the use of decorative birds) in Thai Buddhism through the lens of Affect Theory. As scholars of this approach emphasize that to study affect is to study “of accumulative beside-ness.” It is the study of a...
Viruses that enhance the aethetics of some ornamental plants: beauty or beast?
Although most viruses that infect plants cause diseases that are detrimental to the plant, there are some instances in which infections by mild viral strains of a virus have been used to protect the plant against severe strains of the same virus. There are other viruses that can cause desirable effe...
Evaluation of Plant Growth Regulators for Use in Grounds Maintenance at Military Installations
1992-07-01
the plant hormone, gibberellin , which is necessary for stem elongation Susceptible Species: Ornamentals, turf species, wheat, barley, rice , sor- ghum...Paclobutrazol - inhibits gibberellin synthesis; activity of both compounds togethef results in reduced vegetative growth and sup- pressed seedhead
Use of biochar as peat substitute for growing substrates of Euphorbia × lomi potted plants
International Nuclear Information System (INIS)
Dispenza, V.; Pasquale, C. de; Fascella, G.; Mammano, M.M.; Alonzo, G.
2016-01-01
Biochar from conifers wood was used in soilless culture as growing substrate alternative to peat for ornamental crops. Potted plants of Euphorbia × lomi Rauh cv. ‘Ilaria’ were grown with different mixtures (v:v) of brown peat and biochar in order to evaluate main physical and chemical characteristics of this biomaterial as well as its effect on plant growth, ornamental characteristics and nutrients uptake. Biochar addition to peat increased pH, EC and K content of the growing substrates, as well as air content and bulk density. Biochar content of substrates significantly affected plant growth and biomass partitioning: higher number of shoots and leaves, leaf area and leaf dry weight were recorded in plants grown in 40% peat-60% biochar, with respect to plants grown in 100% peat and secondarily in 100% biochar. Leaf chlorophyll content was higher in plants grown in 60% and 80% biochar, while biomass water use efficiency was higher with 60% biochar. Plant uptake of K and Ca increased as biochar content of the substrates increased. Hence, a growing substrate containing 40% brown peat and 60% conifers wood biochar was identified as the more suitable mixture allowing to have a high-quality production of Euphorbia × lomi potted plants.
Use of biochar as peat substitute for growing substrates of Euphorbia × lomi potted plants
Directory of Open Access Journals (Sweden)
Vincenzo Dispenza
2016-12-01
Full Text Available Biochar from conifers wood was used in soilless culture as growing substrate alternative to peat for ornamental crops. Potted plants of Euphorbia × lomi Rauh cv. ‘Ilaria’ were grown with different mixtures (v:v of brown peat and biochar in order to evaluate main physical and chemical characteristics of this biomaterial as well as its effect on plant growth, ornamental characteristics and nutrients uptake. Biochar addition to peat increased pH, EC and K content of the growing substrates, as well as air content and bulk density. Biochar content of substrates significantly affected plant growth and biomass partitioning: higher number of shoots and leaves, leaf area and leaf dry weight were recorded in plants grown in 40% peat-60% biochar, with respect to plants grown in 100% peat and secondarily in 100% biochar. Leaf chlorophyll content was higher in plants grown in 60% and 80% biochar, while biomass water use efficiency was higher with 60% biochar. Plant uptake of K and Ca increased as biochar content of the substrates increased. Hence, a growing substrate containing 40% brown peat and 60% conifers wood biochar was identified as the more suitable mixture allowing to have a high-quality production of Euphorbia × lomi potted plants.
Use of biochar as peat substitute for growing substrates of Euphorbia × lomi potted plants
Energy Technology Data Exchange (ETDEWEB)
Dispenza, V.; Pasquale, C. de; Fascella, G.; Mammano, M.M.; Alonzo, G.
2016-07-01
Biochar from conifers wood was used in soilless culture as growing substrate alternative to peat for ornamental crops. Potted plants of Euphorbia × lomi Rauh cv. ‘Ilaria’ were grown with different mixtures (v:v) of brown peat and biochar in order to evaluate main physical and chemical characteristics of this biomaterial as well as its effect on plant growth, ornamental characteristics and nutrients uptake. Biochar addition to peat increased pH, EC and K content of the growing substrates, as well as air content and bulk density. Biochar content of substrates significantly affected plant growth and biomass partitioning: higher number of shoots and leaves, leaf area and leaf dry weight were recorded in plants grown in 40% peat-60% biochar, with respect to plants grown in 100% peat and secondarily in 100% biochar. Leaf chlorophyll content was higher in plants grown in 60% and 80% biochar, while biomass water use efficiency was higher with 60% biochar. Plant uptake of K and Ca increased as biochar content of the substrates increased. Hence, a growing substrate containing 40% brown peat and 60% conifers wood biochar was identified as the more suitable mixture allowing to have a high-quality production of Euphorbia × lomi potted plants.
Directory of Open Access Journals (Sweden)
Mukti Chanda
2011-01-01
Full Text Available The lucrative business of ornamental fish culture in West Bengal (Mainly in three districts-Howrah, North and South 24 Parganas are facing loses due to the invasion of different ecto- and endo-parasites. The present study shows that the ornamental fish (Goldfish - Carassius auratus are mainly affected with ecto-parasites like Ichthyophthirius sp., Dactylogyrus sp., Gyrodactylus sp., Argulus sp. and endo-parasites like Procamallanus sp. and Cucullanus sp. The intensity of infection is high in case of Ichthyophthirius sp. and the intensity of the infection is high in summer months when the temperature is high or moderately high. In cooler months the intensity of the infection is lower as because the parasites are unable to breed or scarcity of food particles.
Buurt, van G.; Debrot, A.O.
2012-01-01
Most information on invasive alien pests is available for the leeward Dutch islands while the least is known for the windward Dutch islands. The principal means of entry is the importation of unsterilized soil and plant material through container shipment, import of ornamental plants and air
Physiological blockage in plants in response to postharvest stress ...
African Journals Online (AJOL)
Flowers have been designed primarily for cutting because of the diversity of shapes, colors and also durability. However, ornamental plants are used in floral arrangements in vases and have limited shelf-life. Thus, this study showed that one of the factors contributing to this limitation is the physiological blockage that occurs ...
Isolation and Properties of Floral Defensins from Ornamental Tobacco and Petunia1
Lay, Fung T.; Brugliera, Filippa; Anderson, Marilyn A.
2003-01-01
The flowers of the solanaceous plants ornamental tobacco (Nicotiana alata) and petunia (Petunia hybrida) produce high levels of defensins during the early stages of development. In contrast to the well-described seed defensins, these floral defensins are produced as precursors with C-terminal prodomains of 27 to 33 amino acids in addition to a typical secretion signal peptide and central defensin domain of 47 or 49 amino acids. Defensins isolated from N. alata and petunia flowers lack the C-terminal domain, suggesting that it is removed during or after transit through the secretory pathway. Immunogold electron microscopy has been used to demonstrate that the N. alata defensin is deposited in the vacuole. In addition to the eight canonical cysteine residues that define the plant defensin family, the two petunia defensins have an extra pair of cysteines that form a fifth disulfide bond and hence define a new subclass of this family of proteins. Expression of the N. alata defensin NaD1 is predominantly flower specific and is most active during the early stages of flower development. NaD1 transcripts accumulate in the outermost cell layers of petals, sepals, anthers, and styles, consistent with a role in protection of the reproductive organs against potential pathogens. The floral defensins inhibit the growth of Botrytis cinerea and Fusarium oxysporum in vitro, providing further support for a role in protection of floral tissues against pathogen invasion. PMID:12644678
Directory of Open Access Journals (Sweden)
A. J. Souza
2011-06-01
Full Text Available A indústria de rochas ornamentais gera grandes quantidades de resíduos sólidos na forma de pós finos. Estes resíduos, quando descartados no ambiente, provocam impacto ambiental negativo. Foi feito um estudo sobre a influência de um resíduo de rocha ornamental nas propriedades e microestrutura de piso cerâmico vitrificado. Foi preparada uma série de massas cerâmicas contendo até 30% em peso de resíduo de rocha ornamental. Peças cerâmicas foram preparadas por prensagem uniaxial e sinterizadas entre 1190 e 1250 ºC em um ciclo de queima rápida. As seguintes propriedades tecnológicas foram determinadas: retração linear, absorção de água, massa específica aparente, e tensão de ruptura a flexão. A evolução da microestrutura e a análise de fases foram acompanhadas por microscopia eletrônica de varredura e difração de raios X. Os resultados mostraram que adições de até 30% em peso de resíduo de rocha ornamental causaram variações significativas na generalidade das propriedades tecnológicas da massa cerâmica de referência. A microestrutura das peças cerâmicas também foi influenciada com a incorporação do resíduo estudado. Os resultados também mostram que a substituição de feldspato sódico por resíduo de rocha ornamental nas massas cerâmicas tende a melhorar a qualidade do piso cerâmico.The ornamental rock industries generate huge amounts of solid wastes (fine powders. These wastes as disposed in the environment generate negative environmental impacts. In this work a study was done on the influence of an ornamental rock waste in the technological properties and microstructure of vitrified floor tile. A series of ceramic pastes were prepared with additions of up to 30 wt% of waste. Ceramic pieces were prepared by uniaxial pressing and sintered between 1190 and 1250 ºC using a fast-firing cycle. The following technological properties were determined: linear shrinkage, water absorption, apparent density
Induced Polyploidy in Diploid Ornamental Ginger (Hedychium muluense) Using Colchicine and Oryzalin
The ploidy level of H. muluense, a diploid (2n = 2x = 34) and dwarf ornamental ginger species, has been determined and is reported for the first time. Oryzalin and colchicine were successfully used to induce polyploidy in Hedychium muluense in vitro. Embryogenic cell lines were treated with oryzalin...
Directory of Open Access Journals (Sweden)
Agata Jędrzejuk
2016-09-01
Full Text Available Bedding plants are often subjected to soil water deficit – either after planting and/or during the market chain. Methods to alleviate the negative water stress effects are sought for to preserve ornamental values of plants. The aim of this study was to evaluate the response of two bedding plants, Ageratum houstonianum Mill. and Salvia splendens Sellow ex Scult., to water stress and treatments with calcium chloride aimed to alleviate drought effects. Plants were subjected either to 45 days of periodical stress (five cycles when watering was off for 5 consecutive days, followed by four cycles on for 5 consecutive days or 10 days of radical drought (complete water withdrawal. On the first day, before the onset of drought, plants were watered with 0.5% Ca or 1% Ca w/v as a solution of calcium chloride (5 g or 10 g Ca per 1 dm3 of the growing substrate. The similarly Ca-treated but routinely watered plants provided controls to evaluate the water shortage effects. Plant height, inflorescence length/number, leaf number, leaf area (in Salvia splendens only, aboveground plant part weight, and root weight (in Salvia splendens only as well as leaf relative water content (RWC were measured at the beginning and at the end of the experiments. Water withdrawal during 10 days of growth (radical drought reduced by half RWC in leaves of withering Salvia splendens and Ageratum houstonianum plants. Its effects on the growth parameters were less pronounced and mitigated by Ca applications. Also in the periodically stressed plants of both species, RWC and most growth parameters were reduced by water shortage but Ca applications alleviated the negative stress effects.
Production of engineered long-life and male sterile Pelargonium plants
Directory of Open Access Journals (Sweden)
García-Sogo Begoña
2012-08-01
Full Text Available Abstract Background Pelargonium is one of the most popular garden plants in the world. Moreover, it has a considerable economic importance in the ornamental plant market. Conventional cross-breeding strategies have generated a range of cultivars with excellent traits. However, gene transfer via Agrobacterium tumefaciens could be a helpful tool to further improve Pelargonium by enabling the introduction of new genes/traits. We report a simple and reliable protocol for the genetic transformation of Pelargonium spp. and the production of engineered long-life and male sterile Pelargonium zonale plants, using the pSAG12::ipt and PsEND1::barnase chimaeric genes respectively. Results The pSAG12::ipt transgenic plants showed delayed leaf senescence, increased branching and reduced internodal length, as compared to control plants. Leaves and flowers of the pSAG12::ipt plants were reduced in size and displayed a more intense coloration. In the transgenic lines carrying the PsEND1::barnase construct no pollen grains were observed in the modified anther structures, which developed instead of normal anthers. The locules of sterile anthers collapsed 3–4 days prior to floral anthesis and, in most cases, the undeveloped anther tissues underwent necrosis. Conclusion The chimaeric construct pSAG12::ipt can be useful in Pelargonium spp. to delay the senescence process and to modify plant architecture. In addition, the use of engineered male sterile plants would be especially useful to produce environmentally friendly transgenic plants carrying new traits by preventing gene flow between the genetically modified ornamentals and related plant species. These characteristics could be of interest, from a commercial point of view, both for pelargonium producers and consumers.
A mechanism of extreme growth and reliable signaling in sexually selected ornaments and weapons.
Emlen, Douglas J; Warren, Ian A; Johns, Annika; Dworkin, Ian; Lavine, Laura Corley
2012-08-17
Many male animals wield ornaments or weapons of exaggerated proportions. We propose that increased cellular sensitivity to signaling through the insulin/insulin-like growth factor (IGF) pathway may be responsible for the extreme growth of these structures. We document how rhinoceros beetle horns, a sexually selected weapon, are more sensitive to nutrition and more responsive to perturbation of the insulin/IGF pathway than other body structures. We then illustrate how enhanced sensitivity to insulin/IGF signaling in a growing ornament or weapon would cause heightened condition sensitivity and increased variability in expression among individuals--critical properties of reliable signals of male quality. The possibility that reliable signaling arises as a by-product of the growth mechanism may explain why trait exaggeration has evolved so many different times in the context of sexual selection.
Directory of Open Access Journals (Sweden)
D. V. Rodrigues
2012-09-01
Full Text Available Para avaliação da degradação acelerada em laboratório sofrida pelos corpos de prova de cerâmica vermelha com adição de rejeito de rocha ornamental isento de granalha, foi utilizado um equipamento que lixivia com água quente e fria em tempos controlados, e também, congela a amostra em até -4 ºC. Os corpos de prova cerâmicos foram confeccionados com até 10% em massa de rejeito de rocha ornamental a seco, e em seguida, umedecidos e moldados por extrusão. Os materiais produzidos foram calcinados nas temperaturas de 700 ºC, 800 ºC e 900 ºC. Após 1060 h de degradação acelerada em equipamento de laboratório, analisaram-se as propriedades cerâmicas do material. Os resultados das resistências mecânicas foram comparados através da distribuição de Weibull, antes e depois da degradação. Nota-se que o material com adição de 10% de rejeito de rocha ornamental na massa cerâmica é mais confiável quando queimada a 900 ºC após a degradação, quando comparados com as amostras sem adição de rejeito, proporcionando maior durabilidade.For the evaluation of the accelerated degradation in laboratory of red ceramic specimens with addition of ornamental rock waste free from steel particles, an equipment that leach with hot and cool water and time control, and also freezing the specimen at -4 ºC was used,. The ceramic samples were made with up to 10 wt.% of the dry ornamental rock waste, and after humidifying and molding by extrusion. The specimens were fired at 700 ºC, 800 ºC and 900 ºC. After 1060 h of accelerated degradation lab test, ceramic properties were evaluated. The results of the strength were compared for Weibull distribution, before and after degradation. The specimens with addition of 10 wt.% waste is more durable and reliable when fired to 900 ºC after the degradation.
Santos, M D M; Buso, G C S; Torres, A C
2008-10-21
The objective of the present study was to evaluate the genetic variability in micropropagated plantlets of ornamental pineapple, after the fourth period of subculture. The basal culture medium consisted of MS salts, vitamins, 3% sucrose, liquid formulation, supplemented with 6-benzylaminopurine (BAP) at concentrations of 0.125, 0.25, 0.5, 1.0, and 2.0 mg/L. The addition of BAP influenced the occurrence of genetic variation revealed using random amplified polymorphic DNA (RAPD) markers. Of a total of 520 primers tested, 44 were selected and amplified; 402 monomorphic bands (97.2%) and 18 polymorphic bands (2.8%) resulted among regenerated plantlets. The polymorphic fragments were produced by 12 primers (OPA-01, OPA-20, OPB-01, OPB-19, OPC-19, OPF-13, OPL-17, OPM-13, OPP-16, OPT-07, OPV-19, and OPX-03). Among the primers that identified polymorphism, OPA-01, OPA-20, OPB-19, OPC-19, OPL-17, OPP-16, and OPX-3 each showed, one polymorphic band and OPF-13 amplified a maximum of three bands. In this study, the RAPD technique was effective in showing the occurrence of somaclonal variations that occur during the micropropagation process of ornamental pineapple cultivation in BAP-supplemented medium, and it is possible to detect the presence of genetic variation in early stages of plant development.
Aportación al estudio palinológico de la flora ornamental de la ciudad de Granada (España)
Díaz de la Guardia Guerrero, Consuelo; Blanca López, Gabriel; Nieto, Rosa Mª
1988-01-01
Se estudian los caracteres polínicos de 23 especies pertenecientes a la flora ornamental de la ciudad de Granada, utilizando microscopía óptica y microscopía electrónica de barrido, indicando su posible incidencia alergógena. The pollen characters of 23 species, representing the flora ornamental from the city of Granada (Spain), are studied by optical and scanning electron microscopy to determine allergenic incidence.
Alonso-Alvarez, Carlos; Galván, Ismael
2011-01-01
Oxidative stress could be a key selective force shaping the expression of colored traits produced by the primary animal pigments in integuments: carotenoids and melanins. However, the impact of oxidative stress on melanic ornaments has only recently been explored, whereas its role in the expression of carotenoid-based traits is not fully understood. An interesting study case is that of those animal species simultaneously expressing both kinds of ornaments, such as the red-legged partridge (Alectoris rufa). In this bird, individuals exposed to an exogenous source of free radicals (diquat) during their development produced larger eumelanin-based (black) plumage traits than controls. Here, we show that the same red-legged partridges exposed to diquat simultaneously developed paler carotenoid-based ornaments (red beak and eye rings), and carried lower circulating carotenoid levels as well as lower levels of some lipids involved in carotenoid transport in the bloodstream (i.e., cholesterol). Moreover, partridges treated with a hormone that stimulates eumelanin production (i.e., alpha-melanocyte-stimulating hormone) also increased blood carotenoid levels, but this effect was not mirrored in the expression of carotenoid-based traits. The redness of carotenoid-based ornaments and the size of a conspicuous eumelanic trait (the black bib) were negatively correlated in control birds, suggesting a physiological trade-off during development. These findings contradict recent studies questioning the sensitivity of carotenoids to oxidative stress. Nonetheless, the impact of free radicals on plasma carotenoids seems to be partially mediated by changes in cholesterol metabolism, and not by direct carotenoid destruction/consumption. The results highlight the capacity of oxidative stress to create multiple phenotypes during development through differential effects on carotenoids and melanins, raising questions about evolutionary constraints involved in the production of multiple
Directory of Open Access Journals (Sweden)
Carlos Alonso-Alvarez
2011-04-01
Full Text Available Oxidative stress could be a key selective force shaping the expression of colored traits produced by the primary animal pigments in integuments: carotenoids and melanins. However, the impact of oxidative stress on melanic ornaments has only recently been explored, whereas its role in the expression of carotenoid-based traits is not fully understood. An interesting study case is that of those animal species simultaneously expressing both kinds of ornaments, such as the red-legged partridge (Alectoris rufa. In this bird, individuals exposed to an exogenous source of free radicals (diquat during their development produced larger eumelanin-based (black plumage traits than controls. Here, we show that the same red-legged partridges exposed to diquat simultaneously developed paler carotenoid-based ornaments (red beak and eye rings, and carried lower circulating carotenoid levels as well as lower levels of some lipids involved in carotenoid transport in the bloodstream (i.e., cholesterol. Moreover, partridges treated with a hormone that stimulates eumelanin production (i.e., alpha-melanocyte-stimulating hormone also increased blood carotenoid levels, but this effect was not mirrored in the expression of carotenoid-based traits. The redness of carotenoid-based ornaments and the size of a conspicuous eumelanic trait (the black bib were negatively correlated in control birds, suggesting a physiological trade-off during development. These findings contradict recent studies questioning the sensitivity of carotenoids to oxidative stress. Nonetheless, the impact of free radicals on plasma carotenoids seems to be partially mediated by changes in cholesterol metabolism, and not by direct carotenoid destruction/consumption. The results highlight the capacity of oxidative stress to create multiple phenotypes during development through differential effects on carotenoids and melanins, raising questions about evolutionary constraints involved in the production of
Journal of Biosciences | Indian Academy of Sciences
Indian Academy of Sciences (India)
Worldwide germplasm collections contain about 7.4 million accessions of plant genetic resources for food and agriculture. One of the 10 largest ex situ genebanks of our globe is located at the Leibniz Institute of Plant Genetics and Crop Plant Research in Gatersleben, Germany. Molecular tools have been used for various ...
Managing the marine aquarium trade: revealing the data gaps using ornamental polychaetes.
Murray, Joanna M; Watson, Gordon J; Giangrande, Adriana; Licciano, Margherita; Bentley, Matt G
2012-01-01
The marine aquarium industry has great potential to generate jobs in low-income coastal communities creating incentives for the maintenance of a healthy coral reef, if effectively managed. In the absence of current monitoring or legislation to govern the trade, baseline information regarding the species, number and source location of animals traded is missing despite being critical for its successful management and sustainability. An industry assessment to establish the number and provenance of species of ornamental polychaetes (sabellids and serpulids) traded was undertaken across UK wholesalers and retailers. Six geographical regions exporting fan worms were identified. Singapore contributed the highest percentage of imports, but of only one worm "type" whereas Bali, the second largest source, supplied five different worm "types". Over 50% of UK retailers were supplied by one wholesaler while the remainder were stocked by a mixture of one other wholesaler and/or direct imports from the source country. We estimate that up to 18,500 ornamental polychaetes (16,980 sabellids and 1,018 serpulids) are sold annually in the UK revealing a drastic underestimation of currently accepted trade figures. Incorrect identification (based on exporting region or visual characteristics) of traded animals exacerbates the inaccuracy in market quantification, although identification of preserved sabellids using published keys proved just as inconclusive with high within-species variability and the potential for new or cryptic species. A re-description of the polychaete groups traded using a combination of molecular and morphological techniques is necessary for effective identification and market quantification. This study provides the first assessment of ornamental polychaetes but more importantly highlights the issues surrounding the collection of baseline information necessary to manage the aquarium trade. We recommend that future management should be community based and site
Managing the marine aquarium trade: revealing the data gaps using ornamental polychaetes.
Directory of Open Access Journals (Sweden)
Joanna M Murray
Full Text Available The marine aquarium industry has great potential to generate jobs in low-income coastal communities creating incentives for the maintenance of a healthy coral reef, if effectively managed. In the absence of current monitoring or legislation to govern the trade, baseline information regarding the species, number and source location of animals traded is missing despite being critical for its successful management and sustainability. An industry assessment to establish the number and provenance of species of ornamental polychaetes (sabellids and serpulids traded was undertaken across UK wholesalers and retailers. Six geographical regions exporting fan worms were identified. Singapore contributed the highest percentage of imports, but of only one worm "type" whereas Bali, the second largest source, supplied five different worm "types". Over 50% of UK retailers were supplied by one wholesaler while the remainder were stocked by a mixture of one other wholesaler and/or direct imports from the source country. We estimate that up to 18,500 ornamental polychaetes (16,980 sabellids and 1,018 serpulids are sold annually in the UK revealing a drastic underestimation of currently accepted trade figures. Incorrect identification (based on exporting region or visual characteristics of traded animals exacerbates the inaccuracy in market quantification, although identification of preserved sabellids using published keys proved just as inconclusive with high within-species variability and the potential for new or cryptic species. A re-description of the polychaete groups traded using a combination of molecular and morphological techniques is necessary for effective identification and market quantification. This study provides the first assessment of ornamental polychaetes but more importantly highlights the issues surrounding the collection of baseline information necessary to manage the aquarium trade. We recommend that future management should be community
Heat treatment of processing sludge of ornamental rocks: application as pozzolan in cement matrices
Directory of Open Access Journals (Sweden)
J.G. Uliana
Full Text Available The sector of ornamental rocks produces significant volume of waste during the sawing of the blocks and demand to find ways to recycle, given its environmental impact. Considering the possibilities of use of industrial by-products as mineral admixtures, aiming at sustainable development in the construction industry, this paper aims to study the performance of the processing sludge of ornamental rocks and grinding after heat treatment, based on their potential application as partial substitute for cement. The residue was characterized, cast and milled to produce glassy material. Was analyzed the mechanical performance and pozzolanic activity with partial replacement of cement by waste in natural condition and after heat treatment in mortars for comparison. The results were promising, so it was possible to verify that after heat treatment, the treated waste is presented as a material with pozzolanic characteristics.
Diplomonad flagellates of some ornamental fish cultured in Thailand
Directory of Open Access Journals (Sweden)
Boonkob Viriyapongsutee
2012-11-01
Full Text Available The study on diplomonad flagellates infection in some ornamental fishes in the family cichlidae i.e., angelfish(Pterophyllum scalare, oscar (Astronotus ocellatus, blue mbuna (Labeotropheus fuelleborni and the family osphronemidaei.e., Siamese fighting fish (Betta splendens revealed that this parasite infected three out of four ornamental fish species,angelfish, oscar and blue mbuna. The highest infection was recorded in angelfish (90% followed by oscar (75.4% and bluembuna (61%, respectively. Identification of diplomonad flagellates from angelfish by means of morphological studies underlight and electron microscopes indicated that the parasite was Spironucleus vortens. The 14–days LD50 of S. vortens inangelfish was 2.99x103 cells. Histopathological changes of infected angelfish revealed granulomatous liver, numerousnumbers of melanomacrophage in the spleen and inflammation of the intestine. Susceptibility study of S. vortens to goldfish(Carassius auratus, guppy (Poecilia reticulata and platy (Xiphophorus maculatus indicated that they were resistant toartificial infection. In vitro examination of the growth inhibition assay of S. vortens indicated that dimetridazole and metronidazolewere effective in inhibiting parasite growth after 48 hrs exposure at concentrations of >4.0 μg/ml and >6.0 μg/ml,respectively. Magnesium sulfate at a concentration of >60 mg/ml inhibited the parasite growth after 72 hrs exposure. In vivoexamination of the dimetridazole efficiency on S. vortens infection indicated that dimetridazole at 4.0 μg/ml provided thehighest efficiency which could be used for treatment of spironucleosis in angelfish.
Skirvin, D J; de Courcy Williams, M
1999-06-01
The influence of plant species on the population dynamics of the spider mite pest, Tetranychus urticae, and its predator, Phytoseiulus persimilis, was examined as a prerequisite to effective biological control on ornamental nursery stock. Experiments have been done to investigate how the development, fecundity and movement of T. urticae, and the movement of P. persimilis were affected by plant species. A novel experimental method, which incorporates plant structure, was used to investigate the functional response of P. persimilis. Development times for T. urticae were consistent with published data and did not differ with plant species in a biologically meaningful way. Plant species was shown to have a major influence on fecundity (P < 0.001) and movement of the pest mite (P < 0.01), but no influence on the movement of the predator. The movement of both pest and predator was shown to be related to the density of the adult pest mites on the plant (P < 0.001). Plant structure affected the functional response, particularly in relation to the ability of the predator to locate prey at low densities. The impact of these findings on the effective use of biological control on ornamental nursery stock is discussed.
Histopathological study on parasites in freshwater ornamental fishes in Iran
Nematollahi, A.; Jaberi, S.; Helan, J. Ashrafi; Sheikhzadeh, N.
2014-01-01
During March 2012 through February 2013, 100 freshwater ornamental fishes in 22 species from some aquarium fish shops were examined. Specimens were dissected and tissue samples consisted of liver, kidney, spleen, heart, intestine, ovary, brain and eye were fixed in 10 % buffered formalin and sections were provided and stained with hematoxylin and eosin, Periodic Acid-Schiff, Giemsa and acid-fast staining (Ziehl-Neelsen). At present study six species of protozoans consisting of Eimeria spp. Cr...
Directory of Open Access Journals (Sweden)
Rildo Sartori Barbosa Coelho
2011-04-01
Full Text Available Anthracnose, generally caused by Colletotrichum gloeosporioides, affects inflorescences quality in different species of ornamental tropical plants and it is one of the main fungal diseases to those crops. The objective of this study was to evaluate the aggressiveness and exoenzimes production on solid medium of 25 Colletotrichum isolates collected from anthurium, torch ginger, and heliconia plants with necrosis symptoms. The symptomatic floral stems were harvested in different counties of the Pernambuco State, Brazil, and carried to the laboratory, where the isolation process took place. The isolates were inoculated in the floral stems bracts of the three species studied, and the aggressiveness evaluated five days after inoculation. Isolates were also plated on specific culture media to determine amylolytic, lipolytic, and proteolytic activity, and assessed seven days after inoculation. The isolates aggressiveness was variable and some of them were not pathogenic when inoculated to their origin hosts. Six isolates were pathogenic to all the analyzed ornamental species and four isolates showed host specificity. All tested isolates presented amylolytic, lipolytic, and proteolytic activity. No relation between aggressiveness and enzyme activity was observed in the isolates tested.
KEY-WORDS: Anthurium andraeanum; Etlingera elatior; Heliconia spp.; variability.
A antracnose, geralmente causada por Colletotrichum gloeosporioides, afeta a qualidade de inflorescências em diversas espécies de plantas ornamentais tropicais e destaca-se como uma das principais doenças de origem fúngica, para estas culturas. O objetivo deste trabalho foi verificar a agressividade e a produção de exoenzimas, em meio sólido, de 25 isolados de Colletotrichum obtidos a partir de inflorescências de
International Nuclear Information System (INIS)
Suda, Hirokatsu
1997-01-01
During about 30-years, we have developed γ-irradiation technique and breeding back pruning method for the study of mutation breeding of ornamental plants. As a result, we have made a wide variety of new mutant lines in chrysanthemum, narcissus, begonia rex, begonia iron cross, winter daphne, zelkova, sweet-scented oleander, abelia, kobus, and have obtained 7 plant patents. By the use of γ-irradiation to plant mutation breeding, we often observed that plants irradiated by low dose of γ-rays showed superior or inferior growth than the of non-irradiated plants. Now, we established the irradiation conditions of γ-rays for mutation breeding and growth of regulation in narcissus, tulip, Enkianthus perulatus Schneid., komatsuna, moyashi, african violet. In most cases, irradiation dose rate is suggested to be a more important factor to induce plant growth regulators than irradiation dose. (author)
The Effects of Designated Pollutants on Plants
1978-11-01
Persea americana Mill. Haas and Bacon Barley Hordeum vulgare L. CM 67 Bean Phaseolus vulgaris L. Pinto, U.I. III Briza Briza maxima L. Ornamental...Tagetes patula L. French dwarf double goldie Marigold Tagetes erecta L. American ,Senator Dirksen Petunia Petunia hybrida Vilm. White cascade Radish...Probit analysis of five plant species: citrus seedlings, lemon, orange,, grape, French marigold, American marigold. Probit scale is the probability that a
DNA BARCODING IKAN HIAS INTRODUKSI
Directory of Open Access Journals (Sweden)
Melta Rini Fahmi
2017-05-01
ilmu pengetahuan. Species identification becomes a new challenge in the management of ornamental fish either for cultivation, or for conservation proposes. The objective of this study was to identify currently existing introduced ornamental fish in Indonesian farmers and markets using DNA barcodes COI gene. Fish samples were collected from farmers and importers of ornamental fish in Bandung and Jakarta. Total genome was extracted from caudal fin tissue using the column method. Amplification of the target gene was done by using FishF1, FishF2, FishR1, and FishR2 primers. DNA sequence was aligned with the sequences from genbank by BLAST program. Species identification was decided through the phylogenetic tree and similarity index with genbank sequences. The results showed that all of tested samples fall into five groups; Synodontis consisted of five species, Corydoras four species, Phseudoplatystoma four species, Botia three species, and Leporinus three species with 99-100 boostrap value. Sequence similarity index showed around 11 species have 99%-100% similarity index with sequence data on genbank which are Synodontis decorus, Synodontis eupterus, Synodontis greshoffi, Botia kubotai, Botia lohachata, Rasbora erythromicron, Corydoras aeneus, Gyrinocheilus aymonieri, Eigenmannia virescens, Leporinus affinis, Phractocephalus hemioliopterus. Two species were identified as hybridization product (interbreeding including leopard catfish (100% identical with Pseudoplatystoma faciatum and the leopard Synodontis (100% identical with Synodontis notatus. Analysis of nucleotide diagnostic showed Synodontis decora has seven nucleotides diagnostic, Synodontis tanganyicae 10 nucleotides, Synodontis euterus 13 nucleotides, Synodontis notatus four nucleotides, and Synodontis grashoffi 14 nucleotides. The correct identification of fish species is a useful tool for aquaculture, global marketing, management or conservation, and academic/scientific purpose.
Ma, Jun; Kanakala, S; He, Yehua; Zhang, Junli; Zhong, Xiaolan
2015-01-01
Ananas comosus var. bracteatus (Red Pineapple) is an important ornamental plant for its colorful leaves and decorative red fruits. Because of its complex genome, it is difficult to understand the molecular mechanisms involved in the growth and development. Thus high-throughput transcriptome sequencing of Ananas comosus var. bracteatus is necessary to generate large quantities of transcript sequences for the purpose of gene discovery and functional genomic studies. The Ananas comosus var. bracteatus transcriptome was sequenced by the Illumina paired-end sequencing technology. We obtained a total of 23.5 million high quality sequencing reads, 1,555,808 contigs and 41,052 unigenes. In total 41,052 unigenes of Ananas comosus var. bracteatus, 23,275 unigenes were annotated in the NCBI non-redundant protein database and 23,134 unigenes were annotated in the Swiss-Port database. Out of these, 17,748 and 8,505 unigenes were assigned to gene ontology categories and clusters of orthologous groups, respectively. Functional annotation against Kyoto Encyclopedia of Genes and Genomes Pathway database identified 5,825 unigenes which were mapped to 117 pathways. The assembly predicted many unigenes that were previously unknown. The annotated unigenes were compared against pineapple, rice, maize, Arabidopsis, and sorghum. Unigenes that did not match any of those five sequence datasets are considered to be Ananas comosus var. bracteatus unique. We predicted unigenes encoding enzymes involved in terpenoid and phenylpropanoid biosynthesis. The sequence data provide the most comprehensive transcriptomic resource currently available for Ananas comosus var. bracteatus. To our knowledge; this is the first report on the de novo transcriptome sequencing of the Ananas comosus var. bracteatus. Unigenes obtained in this study, may help improve future gene expression, genetic and genomics studies in Ananas comosus var. bracteatus.
Directory of Open Access Journals (Sweden)
Jun Ma
Full Text Available Ananas comosus var. bracteatus (Red Pineapple is an important ornamental plant for its colorful leaves and decorative red fruits. Because of its complex genome, it is difficult to understand the molecular mechanisms involved in the growth and development. Thus high-throughput transcriptome sequencing of Ananas comosus var. bracteatus is necessary to generate large quantities of transcript sequences for the purpose of gene discovery and functional genomic studies.The Ananas comosus var. bracteatus transcriptome was sequenced by the Illumina paired-end sequencing technology. We obtained a total of 23.5 million high quality sequencing reads, 1,555,808 contigs and 41,052 unigenes. In total 41,052 unigenes of Ananas comosus var. bracteatus, 23,275 unigenes were annotated in the NCBI non-redundant protein database and 23,134 unigenes were annotated in the Swiss-Port database. Out of these, 17,748 and 8,505 unigenes were assigned to gene ontology categories and clusters of orthologous groups, respectively. Functional annotation against Kyoto Encyclopedia of Genes and Genomes Pathway database identified 5,825 unigenes which were mapped to 117 pathways. The assembly predicted many unigenes that were previously unknown. The annotated unigenes were compared against pineapple, rice, maize, Arabidopsis, and sorghum. Unigenes that did not match any of those five sequence datasets are considered to be Ananas comosus var. bracteatus unique. We predicted unigenes encoding enzymes involved in terpenoid and phenylpropanoid biosynthesis.The sequence data provide the most comprehensive transcriptomic resource currently available for Ananas comosus var. bracteatus. To our knowledge; this is the first report on the de novo transcriptome sequencing of the Ananas comosus var. bracteatus. Unigenes obtained in this study, may help improve future gene expression, genetic and genomics studies in Ananas comosus var. bracteatus.
Temperate and Tropical Plant Collections
DEFF Research Database (Denmark)
Friis, Ib
2015-01-01
The first botanical gardens and collections of preserved plants in the 16th century served didactic purposes and should ensure correct identification of medicinal, ornamental and other useful plants. Collections of preserved plants were nearly all book-herbaria, emulating illustrated books...... and owned by individual botanists. Curiosity cabinets of nobles and prominent scholars were larger collections, in which all kinds of objects of natural history from remote regions could be incorporated. The Linnaean revolution favoured loose-leaf herbaria over the old book-herbaria: herbaria with loose...... sheets could be reorganised in agreement with new knowledge or theories and newly accessed specimens could be placed next to earlier ones of the same species. However, the Linnaean collections reflected the essentialist species concept, according to which all species consisted of individuals with similar...
Potato psyllid and the South American desert plant Nolana: an unlikely psyllid host?
Managing zebra chip disease in the potato growing regions of Washington, Oregon, and Idaho is complicated by confusion about the role of non-crop plant species in zebra chip epidemiology. Weedy and ornamental Solanaceae have been shown to be reservoirs of both the potato psyllid (vector of the dise...
d'Errico, Francesco; Vanhaeren, Marian; Barton, Nick; Bouzouggar, Abdeljalil; Mienis, Henk; Richter, Daniel; Hublin, Jean-Jacques; McPherron, Shannon P; Lozouet, Pierre
2009-09-22
Recent investigations into the origins of symbolism indicate that personal ornaments in the form of perforated marine shell beads were used in the Near East, North Africa, and SubSaharan Africa at least 35 ka earlier than any personal ornaments in Europe. Together with instances of pigment use, engravings, and formal bone tools, personal ornaments are used to support an early emergence of behavioral modernity in Africa, associated with the origin of our species and significantly predating the timing for its dispersal out of Africa. Criticisms have been leveled at the low numbers of recovered shells, the lack of secure dating evidence, and the fact that documented examples were not deliberately shaped. In this paper, we report on 25 additional shell beads from four Moroccan Middle Paleolithic sites. We review their stratigraphic and chronological contexts and address the issue of these shells having been deliberately modified and used. We detail the results of comparative analyses of modern, fossil, and archaeological assemblages and microscopic examinations of the Moroccan material. We conclude that Nassarius shells were consistently used for personal ornamentation in this region at the end of the last interglacial. Absence of ornaments at Middle Paleolithic sites postdating Marine Isotope Stage 5 raises the question of the possible role of climatic changes in the disappearance of this hallmark of symbolic behavior before its reinvention 40 ka ago. Our results suggest that further inquiry is necessary into the mechanisms of cultural transmission within early Homo sapiens populations.
Exotic ambrosia beetles, particularly Xylosandrus crassiusculus (Motschulsky) and Xylosandrus germanus (Blandford), are among the most economically damaging pests of ornamental trees in nurseries. Growers have had few tactics besides insecticide applications to reduce ambrosia beetle attacks but rec...
First report of scuticociliatosis caused by Uronema sp. in ornamental reef fish imported into Brazil
Directory of Open Access Journals (Sweden)
Pedro Henrique Magalhães Cardoso
Full Text Available Abstract Scuticociliatosis, which is caused by an opportunistic ciliate protozoan, is responsible for significant economic losses in marine ornamental fish. This study reports the occurrence of Uronema sp., which was found to be parasitizing three species of marine reef fish imported into Brazil and maintained in quarantine: Vanderbilt’s Chromis (Chromis vanderbilti, blue-green damselfish (Chromis viridis, and sea goldie (Pseudanthias squamipinnis. During the quarantine period, some fish presented with behavioral disorders and hemorrhages and ulcerative lesions on the body surface. Histopathological analysis showed hemorrhages, inflammation comprising mononuclear and granular cells in the skeletal muscle, and necrosis of the skin and the secondary lamellae of the gills, and parasites were also observed in the renal capsule. The absence of transboundary measures available to prevent the occurrence of ornamental fish diseases is also discussed.
The Ornamental Design of Traditional Malay Utensils (Kukuran) in Peninsula Malaysia
Md Yusoff Zulkfli bin; Md Zain Dzul Haimi bin; Saniman Hamidon bin
2016-01-01
Woodcarving is a significant craft in Malay society that reflects the local traditions and customs. It is a manifestation of craftsmen artistic skills and intutitive ideas into a piece of wood. It is also manifestation of the creative process of imitation, denaturalization, stylization and abstraction. Historically, the Malay craftsmen have created many attractive traditional art forms and one of it is the coconut graters (kukuran). The ornamental carved kukuran is closely related to its Mala...
Cseke, Leland J; Talley, Sharon M
2012-02-20
Wild-type I. cylindrica (cogongrass) is one of the top ten worst invasive plants in the world, negatively impacting agricultural and natural resources in 73 different countries throughout Africa, Asia, Europe, New Zealand, Oceania and the Americas(1-2). Cogongrass forms rapidly-spreading, monodominant stands that displace a large variety of native plant species and in turn threaten the native animals that depend on the displaced native plant species for forage and shelter. To add to the problem, an ornamental variety [I. cylindrica var. koenigii (Retzius)] is widely marketed under the names of Imperata cylindrica 'Rubra', Red Baron, and Japanese blood grass (JBG). This variety is putatively sterile and noninvasive and is considered a desirable ornamental for its red-colored leaves. However, under the correct conditions, JBG can produce viable seed (Carol Holko, 2009 personal communication) and can revert to a green invasive form that is often indistinguishable from cogongrass as it takes on the distinguishing characteristics of the wild-type invasive variety(4) (Figure 1). This makes identification using morphology a difficult task even for well-trained plant taxonomists. Reversion of JBG to an aggressive green phenotype is also not a rare occurrence. Using sequence comparisons of coding and variable regions in both nuclear and chloroplast DNA, we have confirmed that JBG has reverted to the green invasive within the states of Maryland, South Carolina, and Missouri. JBG has been sold and planted in just about every state in the continental U.S. where there is not an active cogongrass infestation. The extent of the revert problem in not well understood because reverted plants are undocumented and often destroyed. Application of this molecular protocol provides a method to identify JBG reverts and can help keep these varieties from co-occurring and possibly hybridizing. Cogongrass is an obligate outcrosser and, when crossed with a different genotype, can produce
International Nuclear Information System (INIS)
Marušić, Katarina; Pucić, Irina; Desnica, Vladan
2016-01-01
Cultural heritage objects that are radiation treated in order to stop their biodegradation often contain ornamenting materials that cannot be removed. Radiation may produce unwanted changes to such materials. Nacre is a common ornamenting material so this is an attempt to assess the impact of gamma-radiation on its optical properties. Two types of nacre (yellow and white) were obtained from a museum and subjected to different absorbed doses of Co-60 gamma irradiation under the same conditions. The radiation induced changes of nacres color were investigated with fiber optic reflectance spectroscopy (FORS). Colorimetry in CIE Lab space revealed that in both nacres the lightness shifted to darker grey hues at high doses while the color component's (red, green, yellow and blue) behavior depended on the nacre type. Observable changes occurred at doses much above the dose range needed for radiation treatment of cultural heritage objects that are often ornamented with nacre. In UV–vis reflectance spectra of samples irradiated to high doses carbonate radical anion absorption appeared. - Highlights: • Radiation induced changes of nacres color were investigated with FORS. • Nacres darken at high doses while the color component depends on the nacre type. • Observable changes occurred at larger doses than needed for cultural heritage. • For samples irradiated to high doses carbonate radical anion absorption appeared.
Sexual selection on land snail shell ornamentation: a hypothesis that may explain shell diversity
Schilthuizen, M.
2003-01-01
Background: Many groups of land snails show great interspecific diversity in shell ornamentation, which may include spines on the shell and flanges on the aperture. Such structures have been explained as camouflage or defence, but the possibility that they might be under sexual selection has not
Cryoprotectants and their components induce plasmolytic responses in sweet potato suspension cells
Plant genebanks often use cryopreservation to securely conserve clonally propagated collections. Shoot tip cryopreservation procedures may employ vitrification techniques whereby highly concentrated solutions remove water and prevent ice crystallization, ensuring survival after liquid nitrogen expos...
Cascade Cropping System with Horticultural and Ornamental Plants under Greenhouse Conditions
Directory of Open Access Journals (Sweden)
Pedro García-Caparrós
2018-01-01
Full Text Available The blending of drainage with water of low electrical conductivity and the sequential reuse of the drainage water are innovative technologies to manage salts in agricultural drainage. Plants of Cucumis melo were grown in coir grow bags, and Rosmarinus officinalis and Cacti spp. were grown in pots with a mixture of sphagnum peat-moss and perlite. In order to assess the effect and evolution over time of these water treatments on plant growth and water management and removal of nutrients, three water treatments were applied over a period of eight weeks. These were: (1 standard nutrient solution; (2 blended water treatment (drainage water blended with water of low electrical conductivity (EC and (3 sequential reuse of drainage water treatment. During the experimental growing period, samples of water supplies and drainages generated in each water treatment were collected weekly and from these data water volume and nutrient loads were calculated. At the end of the experiment, leaf fresh weight of rosemary plants decreased under the fertigation with the blended and sequential reuse water treatments. Nevertheless, the application of blended and sequentially reused water allowed for the saving of significant amounts of water and nutrients in comparison to the standard nutrient solution treatment. Considering these advantages, we strongly recommend the setting-up of these water treatments in areas with water scarcity such as in the Mediterranean Basin.
Directory of Open Access Journals (Sweden)
Carmen Garcia-Jares
2017-10-01
Full Text Available Camellia (genus of flowering plants of fam. Theaceae is one of the main crops in Asia, where tea and oil from leaves and seeds have been utilized for thousands of years. This plant is excellently adapted to the climate and soil of Galicia (northwestern Spain and northern Portugal where it is grown not only as an ornamental plant, but to be evaluated as a source of bioactive compounds. In this work, the main fatty acids were extracted from Camellia seeds of four varieties of Camellia: sasanqua, reticulata, japonica and sinensis, by means of matrix-solid phase dispersion (MSPD, and analyzed by gas chromatography (GC with MS detection of the corresponding methyl esters. MSPD constitutes an efficient and greener alternative to conventional extraction techniques, moreover if it is combined with the use of green solvents such as limonene. The optimization of the MSPD extraction procedure has been conducted using a multivariate approach based on strategies of experimental design, which enabled the simultaneous evaluation of the factors influencing the extraction efficiency as well as interactions between factors. The optimized method was applied to characterize the fatty acids profiles of four Camellia varieties seeds, allowing us to compare their fatty acid composition.
Garcia-Jares, Carmen; Sanchez-Nande, Marta; Lamas, Juan Pablo; Lores, Marta
2017-01-01
Camellia (genus of flowering plants of fam. Theaceae) is one of the main crops in Asia, where tea and oil from leaves and seeds have been utilized for thousands of years. This plant is excellently adapted to the climate and soil of Galicia (northwestern Spain) and northern Portugal where it is grown not only as an ornamental plant, but to be evaluated as a source of bioactive compounds. In this work, the main fatty acids were extracted from Camellia seeds of four varieties of Camellia: sasanqua, reticulata, japonica and sinensis, by means of matrix-solid phase dispersion (MSPD), and analyzed by gas chromatography (GC) with MS detection of the corresponding methyl esters. MSPD constitutes an efficient and greener alternative to conventional extraction techniques, moreover if it is combined with the use of green solvents such as limonene. The optimization of the MSPD extraction procedure has been conducted using a multivariate approach based on strategies of experimental design, which enabled the simultaneous evaluation of the factors influencing the extraction efficiency as well as interactions between factors. The optimized method was applied to characterize the fatty acids profiles of four Camellia varieties seeds, allowing us to compare their fatty acid composition. PMID:29039745
Can ornamental potted plants remove volatile organic compounds from indoor air? - a review
DEFF Research Database (Denmark)
Dela Cruz, Majbrit; Christensen, Jan H.; Thomsen, Jane Dyrhauge
2014-01-01
Volatile organic compounds (VOCs) are found in indoor air, and many of these can affect human health (e.g. formaldehyde and benzene are carcinogenic). Plants affect the levels of VOCs in indoor environments, thus they represent a potential green solution for improving indoor air quality that at t...... concentration. For instance, an increase in light intensity has in some studies been shown to lead to an increase in removal of a pollutant. Studies conducted in real-life settings such as offices and homes are few and show mixed results....... that plant induced removal of VOCs is a combination of direct (e.g. absorption) and indirect (e.g. biotransformation by microorganisms) mechanisms. They also demonstrate that plants' rate of reducing the level of VOCs is influenced by a number of factors such as plant species, light intensity and VOC...
Plant Resources Center and the Vietnamese genebank system
The highly diverse floristic composition of Vietnam has been recognized as a center of angiosperm expansion and crop biodiversity. The broad range of climatic environments include habitats from tropical and subtropical, to temperate and alpine flora. The human component of the country includes 54 et...
Cardiac Glycoside Plants Self-Poisoning
Directory of Open Access Journals (Sweden)
Radenkova-Saeva J.
2014-06-01
Full Text Available Cardiac glycosides are found in a diverse group of plants including Digitalis purpurea and Digitalis lanata (foxgloves, Nerium oleander, Convallaria majalis (lily of the valley, Strophanthus gratus, etc. Nerium Oleander is an indoor and ornamental plant of an evergreen shrub. It’s widespread in countries with a Mediterranean climate. Oleander is one of the most poisonous plants known to humans. All parts of the nerium oleander are poisonous, primarily due to the contained cardiac glycosides - oleandrin, nerin, digitoxigenin, and olinerin of which oleandrin is the principal toxin. The bark contains the toxic substances of rosagenin which causes strychnine-like effects. Signs of poisoning appear a few hours after the adoption of the parts of the plant. Two cases of Nerium Oleander poisoning were presented. Clinical picture included gastrointestinal, cardiovascular and central nervous system effects. The clinical symptoms were characterized by nausea, vomiting, salivation, colic, diarrhoea, ventricular tachycardia, dysrhythmia, heart block, ataxia, drowsiness, muscular tremor. Treatment included administration of activated charcoal, symptomatic and supportive care.
phylotaR: An Automated Pipeline for Retrieving Orthologous DNA Sequences from GenBank in R
Directory of Open Access Journals (Sweden)
Dominic J. Bennett
2018-06-01
Full Text Available The exceptional increase in molecular DNA sequence data in open repositories is mirrored by an ever-growing interest among evolutionary biologists to harvest and use those data for phylogenetic inference. Many quality issues, however, are known and the sheer amount and complexity of data available can pose considerable barriers to their usefulness. A key issue in this domain is the high frequency of sequence mislabeling encountered when searching for suitable sequences for phylogenetic analysis. These issues include, among others, the incorrect identification of sequenced species, non-standardized and ambiguous sequence annotation, and the inadvertent addition of paralogous sequences by users. Taken together, these issues likely add considerable noise, error or bias to phylogenetic inference, a risk that is likely to increase with the size of phylogenies or the molecular datasets used to generate them. Here we present a software package, phylotaR that bypasses the above issues by using instead an alignment search tool to identify orthologous sequences. Our package builds on the framework of its predecessor, PhyLoTa, by providing a modular pipeline for identifying overlapping sequence clusters using up-to-date GenBank data and providing new features, improvements and tools. We demonstrate and test our pipeline’s effectiveness by presenting trees generated from phylotaR clusters for two large taxonomic clades: Palms and primates. Given the versatility of this package, we hope that it will become a standard tool for any research aiming to use GenBank data for phylogenetic analysis.
Directory of Open Access Journals (Sweden)
Monica V. Biondo
2017-07-01
Full Text Available Millions of marine ornamental fishes are traded every year. Today, over half of the known nearly 4000 coral reef fish species are in trade with poor or no monitoring and demand is increasing. This study investigates their trade into and through Switzerland by analyzing import documents for live animals. In 2009, 151 import declarations with attached species lists for marine ornamental fishes from non-EU countries totaled 28 356 specimens. The 62% of the fishes remaining in Switzerland, comprised 440 marine species from 45 families, the rest transited to EU and non-EU countries. Despite the recognized large trade volume for the European region, due to bilateral agreements, no data is collected for imports from the EU. However, inferred data shows that more than 200 000 marine ornamental fishes could be imported into Switzerland every year and an unknown quantity re-exported. As biggest import region, it is therefore safe to assume, that the European region is importing at least as many marine ornamental fishes as the US. There is no adequate data-collecting system known to be in place in any country for monitoring this trade. The EU Trade Control and Expert System (TRACES to monitor animal diseases could be adjusted to gather compulsory information for the EU and Switzerland. More than half of the species imported into Switzerland are not assessed by the IUCN and therefore marked as ‘not evaluated’ on the Red List. Overall, 70% of all known coral reef fish species have not been evaluated. If coral reef fishes are threatened or endangered due to large, possibly unsustainable numbers traded, it may be rational to monitor the trade in these species through the Convention on International Trade of Endangered Species (CITES.
Does Sexual Selection Influence Ornamentation of Hemipenes in Old World Snakes?
Andonov, Kostadin; Natchev, Nikolay; Kornilev, Yurii V; Tzankov, Nikolay
2017-09-01
In the present study, we investigated and documented the morphology of the male copulatory organs (hemipenes) in fifteen wide-ranging snake species. The species represent four families (Boidae, Colubridae, Lamprophiidae, and Viperidae) and ten genera. We applied the same preparation techniques for all species, successfully everting and expanding the organs completely. The detailed description of the general morphology of the male copulatory organs was based on 31 specimens. Our data were compared with published observations and we point out some incorrectly described details in previous investigations. We provide the first description of the hemipenial morphology for three ophidian species (Elaphe sauromates, Telescopus fallax, and Malpolon insignitus). In addition to the morphological characteristics of the hemipenes presented in the research, we propose the adoption of a standardized index describing the hemipenial proportions. The immense variation in hemipenial morphology presupposes its dynamic evolution, but we suggest that many of the significant structures observed here may have escaped previous researchers due to differing methodologies. Some of the highly ornamented morphologies that we describe are consistent with a locking mechanism during copulation. However, other morphologies may relate to the variety of mating behaviors observed. As a result, we propose that sexual selection is the major driver affecting the hemipenial ornamentation in snakes. Anat Rec, 300:1680-1694, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
The basidiomycetous soilborne fungus Rhizoctonia (sensu lato) is an economically important pathogen of worldwide distribution and it is known to attack at least 188 species of higher plants, including agronomic crops, vegetables, ornamentals, forest trees and turfgrasses. The pathogenic isolates may...
Bioinformatics analysis of the predicted polyprenol reductase genes in higher plants
Basyuni, M.; Wati, R.
2018-03-01
The present study evaluates the bioinformatics methods to analyze twenty-four predicted polyprenol reductase genes from higher plants on GenBank as well as predicted the structure, composition, similarity, subcellular localization, and phylogenetic. The physicochemical properties of plant polyprenol showed diversity among the observed genes. The percentage of the secondary structure of plant polyprenol genes followed the ratio order of α helix > random coil > extended chain structure. The values of chloroplast but not signal peptide were too low, indicated that few chloroplast transit peptide in plant polyprenol reductase genes. The possibility of the potential transit peptide showed variation among the plant polyprenol reductase, suggested the importance of understanding the variety of peptide components of plant polyprenol genes. To clarify this finding, a phylogenetic tree was drawn. The phylogenetic tree shows several branches in the tree, suggested that plant polyprenol reductase genes grouped into divergent clusters in the tree.
Directory of Open Access Journals (Sweden)
Bin-Bin Chen
2015-01-01
Full Text Available In three studies, we tested the hypothesis that men respond to intersexual and intrasexual selection by facultatively choosing between weapon-like and ornament-like behaviors. In the first two studies, we manipulated intersexual and intrasexual selection by having male participants take part in a simulated dating game (Study 1 or imagine having a date (Study 2. In both studies, participants were told either that the target female would choose her date (intersexual or that male suitors would nominate one another (intrasexual. Under the intersexual selection condition, men demonstrated increased creativity levels and decreased aggression levels, whereas the opposite pattern was observed under the intrasexual selection condition. Study 3 showed that individual differences in creativity and aggression as personality traits similarly predicted intrasexual and intersexual mating strategies, respectively. These extend existing evolutionary mating research by specifying the mechanism of intrasexual or intersexual selection in shaping men's weapon-like or ornament-like situational response and personality development.
Ornament induced complications in snake bites: Revisiting the ?Do it RIGHT? approach
Mallik, Subhendu; Singh, Sudipta Ranjan; Sahoo, Sangeeta; Mohanty, Manoj Kumar
2016-01-01
Limb adorning ornaments (LAO) can exacerbate the local effects of envenoming in case of venomous snake bite. Cultural presuppositions do inhibit victims from removing symbolically/ritually important jewelry even under circumstances that might increase the dangers of envenoming-induced gangrene formation. The recommendation to remove the LAO is usually skipped in guidelines and if at all included the very real hazard is uncommonly documented. We observed 14 cases of snake bite with LAO on the ...
Determination of dose ranges of gamma rays to induce specific changes in three ornamental species
International Nuclear Information System (INIS)
Gonzalez J, J.
2011-11-01
In order to confirming the possibility of to settle a dose range that takes place directly and not at random, a specific effect independently of the species that is were produced several similar organisms to three ornamental species took place via meristems cultivation: Petunia hybrid, Impatiens walleriana and Sprekelia formosissima, same that were irradiated in an irradiator Gamma cell 220, to different dose: 0, 3.5, 5.0, 7.5, 10, 12.5, 15, 17.5 and 20 Gy. Later on, of the plants treated via in vitro the subsequent generations were obtained until the M 4 . To determine the DL 50 and the possible good doses, the survival parameters, development, morphogenesis and height were evaluated during 8 weeks, interpreting based on them, the possible physiologic and genetic alterations induced by the radiation. The established DL 50 were: 7.5 Gy (Petunia), 19.0 Gy (Impatiens) and 12.0 Gy (Sprekelia). Based on the DL 50 of each species, a range of coincident dose settled down that produces a similar effect in the three species: a range of DL 23 to the DL 50 induces and alteration in the cytokinins production affecting directly in the leaves number, buds and plants taken place by meristem, also a range of DL 32 - DL 50 impacts in the auxins production altering to the radicule system. However, when being superimposed the dose is considered that the investigation should continue. (Author)
DEFF Research Database (Denmark)
Mao, Hongyu; Sun, Yanqi; Müller, Renate
2014-01-01
Potted ornamental plants are often exposed to drought stress during shipping and retailing, which decreases the value and postharvest quality. Thus, selection of genotypes which can better withstand soil water deficits is essential for sustainable production. Here, the response of three genotypes...
Directory of Open Access Journals (Sweden)
Peter Pany
2014-12-01
Full Text Available The paper presented examines how useful plants can help counteracting “plant blindness” – a phenomenon leading people to overlook plants in everyday-life. Recent research indicates that people are most likely interested in useful plants, hence this group of plants could be used to trigger interest in botanical content in general. This study has investigated the structure of interest in five subgroups of useful plants (medicinal plants, stimulant herbal drugs, spice plants, edible plants, and ornamental plants. For this purpose, the FEIN-questionnaire (Fragebogen zur Erhebung des Interesses an Nutzpflanzen = Questionnaire acquiring interest in useful plants was filled in by N = 1299 pupils from grade 5 to 12. Data analysis shows (for all age groups and both genders that medicinal plants and stimulant herbal drugs trigger high interest while spice plants, edible plants and ornamental plants raise only lower interest. However, mean values do not allow conclusions on individual level (e.g. in a school class. In order to gain information about the interest structure in a specific target group teachers deal with in practice, we have analysed the interests on individual level using frequency analysis of different interest types. Results show that stimulant herbal drugs seem to strongly polarize students, whereas medicinal plants are interesting for almost the whole sample. Eventually, medicinal plants turned out to be well suited to introduce botanical content by means of plants catching the interest of as many students as possible. Therefore, medicinal plants should be established as flagships counteracting plant blindness.
She Wore a Flower in Her Hair: The Effect of Ornamentation on Nonverbal Communication.
Stillman, JeriJayne W.; Hensley, Wayne E.
Six waitresses in a restaurant of a large midwestern city agreed to participate in a study of the nonverbal effects of ornamentation. The hypothesis was that diners would leave larger tips for a waitress who wore a flower in her hair than for the same waitress without a flower. During the four nights that data were collected, the waitresses…
Crop wild relatives of the brinjal eggplant (Solanum melongena)
Syfert, Mindy M.; Castañeda-Álvarez, Nora P.; Khoury, Colin K.; Särkinen, Tiina; Sosa, Chrystian C.; Achicanoy, Harold A.; Bernau, Vivian; Prohens, Jaime; Daunay, Marie Christine; Knapp, Sandra
2016-01-01
PREMISE OF THE STUDY: Crop wild relatives (CWR) provide important traits for plant breeding, including pest, pathogen, and abiotic stress resistance. Therefore, their conservation and future availability are essential for food security. Despite this need, the world's genebanks are currently
GENERATION OF GEOMETRIC ORNAMENTS IN ANCIENT MOSAIC ART
Directory of Open Access Journals (Sweden)
SASS Ludmila
2015-06-01
Full Text Available The paper examines geometrical ornaments from ancient mosaic.We studied the geometric generation by using Computer Aided Graphics for three examples of ancient mosaic: a mosaic of Ancient Corinth, a mosaic of the sacred geometry Flower of Life (exposed in the National Museum of Israel and a mosaic of fortress Masada - Israel. The technique of drawing ancient mosaic is recomposed using computer aided graphics. A program has been developed that can help draw a petal-type arc (semicircle of the mosaic that is the Byzantine church of Masada. Based on these mosaics, other variants of aesthetic images in monochrome or black and white and polychrome were drawn, all of which can be materialized in decorative art to embellish various surfaces: walls, floors, pools, fountains, etc.
Host plants of leaf worm, Spodoptera litura (Fabricius (Lepidoptera: noctuidae in Pakistan
Directory of Open Access Journals (Sweden)
Munir Ahmad
2013-04-01
Full Text Available Spodoptera litura is a notorious leaf feeding insect pest of more than one hundred plants around the Asia-Pacific region. Host plant survey for two years from three different locations in cotton belt revealed 27 plant species as host plants of S. litura belonging to 25 genera of 14 families including cultivated crops, vegetables, weeds, fruits and ornamental plants. Major host plants on which it thrived for maximum period were Gossypium hirsutum L., Ricinus communis L., Brassica oleracea var. botrytis L., Colocasia esculenta L., Trianthema portulacastrum L. and Sesbania sesban L.. Eggs were also collected from tree plants but larvae did not complete their development. Reliance of S. litura on major plant species of cultivated crops necessitates their regular monitoring especially during March to April for their population abundance and early warning for their management on commercial crops like cotton.
Directory of Open Access Journals (Sweden)
Ahmadreza Saberi
2015-12-01
Full Text Available Woodcarving ornamentation is considered as, a national heritage and can be found in many Malaysian mosques. Woodcarvings are mostly displayed in three different motifs, namely floral, geometry and calligraphy. The application of floral and geometry motifs is to convey an abstract meaning of Islamic teachings to the viewers. However, the calligraphic decorations directly express the messages of Allah almighty or the sayings of the prophets to the congregations. Muslims are the main users of mosques as these are places for prayers as well as other religious and community activities. Therefore, the assessment of users’ opinion about this type of decoration needs to be investigated. This paper aims to evaluate the perception of two groups of mosque users on the calligraphic woodcarving ornamentations from two regions, namely the East Coast and Southwest of Peninsula Malaysia. As Arabic is not the primary language in Malaysia, it would be interesting to find out how much of the calligraphic ornamentation is recognised and understood by the mosque users. The quantitative approach and questionnaire survey were adopted to fulfil the objectives of the study through convenient sampling where 420 questionnaire surveys were distributed at eight selected mosques. A total of 408 respondents amongst users completed and returned the survey forms. The mosques were chosen based on the abundance and diversity of calligraphy woodcarving elements found in the prayer hall. The Mann-Whitney U-test was conducted to find out the differences between the two groups of respondents. Ability of reading and understanding the Arabic scripts, the aesthetic values, the function, appropriate location and finally the desirability of scripts were assessed and compared between the participants of North East and Southwest of Peninsula Malaysia. The results showed that respondents of two areas in Malaysia had different opinions about this traditional sacred ornamentation in mosques
Field dodder life cycle and interaction with host plants
Directory of Open Access Journals (Sweden)
Sarić-Krsmanović Marija
2017-01-01
Full Text Available Field dodder is a parasitic plant that attaches to stems and leaves of broadleaf plants, including weeds, field crops, vegetables and ornamentals, across most agricultural regions of the world. Effective field dodder control is extremely difficult to achieve due to the nature of attachment and close association between the host and the parasite, which require a highly effective and selective herbicide to destroy the parasite without damaging its host. To establish a strategy for controlling parasite growth and restricting the spread of field dodder in crop fields, it is important to learn more about this weed, its life cycle and development.
Mander, Luke; Li, Mao; Mio, Washington; Fowlkes, Charless C; Punyasena, Surangi W
2013-11-07
Taxonomic identification of pollen and spores uses inherently qualitative descriptions of morphology. Consequently, identifications are restricted to categories that can be reliably classified by multiple analysts, resulting in the coarse taxonomic resolution of the pollen and spore record. Grass pollen represents an archetypal example; it is not routinely identified below family level. To address this issue, we developed quantitative morphometric methods to characterize surface ornamentation and classify grass pollen grains. This produces a means of quantifying morphological features that are traditionally described qualitatively. We used scanning electron microscopy to image 240 specimens of pollen from 12 species within the grass family (Poaceae). We classified these species by developing algorithmic features that quantify the size and density of sculptural elements on the pollen surface, and measure the complexity of the ornamentation they form. These features yielded a classification accuracy of 77.5%. In comparison, a texture descriptor based on modelling the statistical distribution of brightness values in image patches yielded a classification accuracy of 85.8%, and seven human subjects achieved accuracies between 68.33 and 81.67%. The algorithmic features we developed directly relate to biologically meaningful features of grass pollen morphology, and could facilitate direct interpretation of unsupervised classification results from fossil material.
Daskalakis, M I; Magoulas, A; Kotoulas, G; Catsikis, I; Bakolas, A; Karageorgis, A P; Mavridou, A; Doulia, D; Rigas, F
2013-08-01
Bacterially induced calcium carbonate precipitation from various isolates was investigated aiming at developing an environmentally friendly technique for ornamental stone protection and restoration. Micro-organisms isolated from stone samples and identified using 16S rDNA and biochemical tests promoted calcium carbonate precipitation in solid and novel liquid growth media. Biomineral morphology was studied on marble samples with scanning electron microscopy. Most isolates demonstrated specimen weight increase, covering partially or even completely the marble surfaces mainly with vaterite. The conditions under which vaterite precipitated and its stability throughout the experimental runs are presented. A growth medium that facilitated bacterial growth of different species and promoted biomineralization was formulated. Most isolates induced biomineralization of CaCO3 . Micro-organisms may actually be a milestone in the investigation of vaterite formation facilitating our understanding of geomicrobiological interactions. Pseudomonas, Pantoea and Cupriavidus strains could be candidates for bioconsolidation of ornamental stone protection. Characterization of biomineralization capacity of different bacterial species improves understanding of the bacterially induced mineralization processes and enriches the list of candidates for biorestoration applications. Knowledge of biomineral morphology assists in differentiating mineral from biologically induced precipitates. © 2013 The Society for Applied Microbiology.
Directory of Open Access Journals (Sweden)
Mário Barreto Figueiredo
2007-06-01
Full Text Available Plantas de abutilon recebidas para análise fitopatológica pelo Instituto Biológico, São Paulo, Brasil mostrando como sintomas pústulas semelhantes a ferrugem (Uredinales sobre folhas e caule foram estudadas para determinar o agente causal. Numerosos esporângios amarelos característicos de fungos zoospóricos pertencentes à Ordem Chytridiales foram encontrados no interior de galhas superficiais. Com base no estudo de KARLING (1955, o patógeno foi identificado como Synchytrium australe Speg. O material foi herborizado e armazenado no Herbário Micológico do Instituto Biológico sob o número IBI/SP 11975. Esta foi a primeira constatação desta espécie no Brasil.The genus Abutilon includes a large number of ornamental species with nice foliage and flowers. The different species are known under several common names as Indian mallow, China jute, butterprint, etc. Plants of abutilon received for phytopathological analysis by the Instituto Biologico, São Paulo, Brazil showing curious rust like symptoms (pustules on leaves, stems and pods were studied to determine the causal agent. Numerous yellow sporangia characteristic of zoosporic fungi belonging to the Order Chytridiales were found within the superficial intact galls. Based on KARLING (1955 paper the pathogen was identified as Synchytrium australe Speg. The voucher material was saved and settled in the Mycological Herbarium of the Institution under the number IBI/SP 11975. This was the first report of the occurrence of this species in Brazil.
Wild and native plants and mushrooms sold in the open-air markets of south-eastern Poland.
Kasper-Pakosz, Renata; Pietras, Marcin; Łuczaj, Łukasz
2016-10-07
The study of plants and fungi sold in open-air markets is an important part of ethnobotanical enquiry. Only few such studies were carried out in Europe. Four of the largest open-air markets of south-eastern Poland were visited regularly, and the plants sold in them were recorded between 2013 and 2015. The aim of the study was to record native and/or wild species sold in the markets. All the plants sold in the markets were photographed regularly. In each market, 25 sellers were interviewed. Voucher specimens were collected and fungi were identified using DNA barcoding. Altogether, 468 species of plants were recorded, 117 of them native to south-eastern Poland - 19 only collected from the wild and 11 both wild and cultivated. Seventeen of the species are under legal protection. Most protected plants were sold from cultivation, although proper authorization procedures had not been performed. Thirty-two species of fungi were sold (including two cultivated species), all of them for culinary purposes. Two species (Lactarius quieticolor, Leccinum schistophilum) are new to the mycobiota of Poland. Ornamental plants constituted a large section of the market, and they dominated the group of native species. Food plants dominated among wild-collected plants and were sold mainly as fruits for jams, juices and alcoholic drinks, or as culinary herbs. Very few medicinal or green vegetable plants were sold. An interesting feature of the markets was the sale of Ledum palustre as an insect repellent. Finding two species of fungi which are new to Poland highlights the importance of DNA barcoding in ethnomycological studies. Most items in the markets are ornamental plants, or edible fruits and mushrooms. Very few medicinal plants and green vegetables are sold, which differentiates the markets from southern European ones. Such a pattern is probably the model for most central European markets.
75 FR 12691 - Hexythiazox; Pesticide Tolerances
2010-03-17
... assessment: Turf, gardens, ornamental landscape plantings, ornamental plants, trees and vines in nurseries, residential fruit trees, nut trees and caneberries, and orchids. Residential handler exposures are expected to...
The importance of the marine ornamental reef fish trade in the wider Caribbean
Directory of Open Access Journals (Sweden)
A.W Bruckner
2005-05-01
Full Text Available The marine ornamental fish trade began in the 1930s in Sri Lanka,spread to Hawaii and the Philippines in the 1950s,and expanded to a multi-million dollar industry in the 1970s with fisheries established throughout the tropical Pacific,Indian and Atlantic Oceans.Currently,45 countries supply global markets an estimated 14-30 million fish annually,with an import value of US$28-44 million.The largest suppliers are Indonesia and the Philippines,followed by Brazil,Maldives,Vietnam,Sri Lanka and Hawaii.In the tropical Western Atlantic,16 countries have export fisheries, including the U.S.(Florida and Puerto Rico.The U.S.is the world ’s largest buyer,followed by the European Union and Japan.The global trade consists of over 1400 species of reef fishes,of which only about 25 are captive bred on a commercial scale.Damselfish,anemonefish, and angelfish constitute over 50%of the global volume; butterflyfish, wrasses,blennies,gobies,triggerfish,file-fish,hawkfishes,groupers and basselets account for 31%of the trade,and the remaining 16%is represented by 33 families.The most important fishes from the Caribbean are angelfish (six species, seahorses (two species, royal gramma, jawfish,queen triggerfish,redlip blenny,puddingwife,bluehead wrasse,and blue chromis.The Caribbean currently supplies a small percentage of the global trade in marine ornamental species,but ornamental fisheries in this region represent important emerging industries.It is critical that effective ornamental fishery management plans and regulations are developed and enforced,and fishery-dependent and fishery-independent data are collected and utilized in decision making processes to ensure sustainable ornamental fisheries throughout the region.El comercio de peces marinos ornamentales se inició en la década de 1930 en Sri Lanka y se extendió a Hawai y Las Filipinas en la década de 1950.Posteriormente se convirtió en una industria multimillonaria cuando,en la década de 1970,se
Wang, Y S; Liu, Z Y; Li, Y F; Zhang, Y; Yang, X F; Feng, H
2013-04-02
Artistic diversiform leaf color is an important agronomic trait that affects the market value of ornamental kale. In the present study, genetic analysis showed that a single-dominant gene, Re (red leaf), determines the red leaf trait in ornamental kale. An F2 population consisting of 500 individuals from the cross of a red leaf double-haploid line 'D05' with a white leaf double-haploid line 'D10' was analyzed for the red leaf trait. By combining bulked segregant analysis and sequence-related amplified polymorphism technology, we identified 3 markers linked to the Re/re locus. A genetic map of the Re locus was constructed using these sequence-related amplified polymorphism markers. Two of the markers, Me8Em4 and Me8Em17, were located on one side of Re/re at distances of 2.2 and 6.4 cM, whereas the other marker, Me9Em11, was located on the other side of Re/re at a distance of 3.7 cM. These markers could be helpful for the subsequent cloning of the red trait gene and marker-assisted selection in ornamental kale breeding programs.
Ralstonia solanacearum biovar 1 associated with a new outbreak of potato brown rot in Portugal
Directory of Open Access Journals (Sweden)
Leonor Cruz
2008-10-01
Full Text Available In May 2007, potato plants exhibiting symptoms possibly of brown rot were collected in some potato fields in the Baixo Mondego region (Center, Portugal, as a part of a nationwide programme to monitor Ralstonia solanacearum. All laboratory procedures laid down in Commission Directive 2006/63/EC, including dilution plating on semi-selective medium SMSA, indirect imunofluorescence (IIF, polymerase chain reaction (PCR using specific primers and bioassays on tomato plants, were strictly followed and the causal agent of the disease was identified as Ralstonia solanacearum. The identity of the pure cultures of the isolated organism was confirmed by PCR, IIF and pathogenicity tests on several other plant species (eggplant, tobacco, pelargonium and eucalyptus. In biovar determination, the failure of the isolates to utilise/oxidise certain carbon sources indicated that the isolates were all biovar 1. This biovar has a broader host range than biovar 2 strains, and affects several crops of economic importance including ornamental plants and forest trees. Comparative analysis of 16S rRNA and endoglucanase (egl gene sequences of these isolates with sequences that have been deposited at the GenBank revealed a similarity higher than 99% for several Ralstonia solanacearum isolates from biovar 1, including isolate DAR 64836 (Accession number DQ011551. This is the first report of Ralstonia solanacearum biovar 1 in Portugal. All control measures specified in the Commission Directive are being implemented.
Treuren, van R.; Goossens, P.J.; Sevcikova, M.
2006-01-01
Genebank accessions stored as seed populations require periodic rejuvenation in order to maintain sufficient numbers of viable seeds. During rejuvenation the genetic composition of accessions may be altered for a variety of reasons, of which variation in pollination rates between plants is the least
The GRIN-Global Information Management System – Public Interface Demonstration and Input Opportunity
The GRIN-Global (GG) Information Management System, under development for the past three years, provides the world's crop genebanks and plant genetic resource (PGR) users with a powerful, flexible, easy-to-use PGR information management system. Developed jointly by the USDA Agricultural Research Ser...
The GRIN-Global Information Management System – A Preview and Opportunity for Public User Input
The GRIN-Global Information Management System, under development for the past two years, will provide the world's crop genebanks and plant genetic resource (PGR) users with a powerful, flexible, easy-to-use PGR information management system. Developed jointly by the USDA Agricultural Research Servi...
Czech Academy of Sciences Publication Activity Database
Schnitzer, J.; Exnerová, A.; Poláková, Radka; Vinkler, Michal; Tomášek, Oldřich; Munclinger, P.; Albrecht, Tomáš
2014-01-01
Roč. 17, č. 2 (2014), s. 89-97 ISSN 0873-9749 Institutional support: RVO:68081766 Keywords : Carotenoid-based ornamentation * Extra-pair paternity * Feeding effort * Parental care Subject RIV: EG - Zoology Impact factor: 1.000, year: 2014
Energy Technology Data Exchange (ETDEWEB)
Moy, J H; Chinnasri, B; Sipes, B S; Schmitt, D P; Hamasaki, R T; Mersino, E F; Yamakawa, R M [Hawaii Institute of Tropical Agriculture and Human Resources, University of Hawaii at Manoa, Honolulu, HI (United States)
1999-05-01
Many fresh herbs, ornamental plants, and several varieties of taro grown in Hawaii are infested with various pests such as aphids, mites, thrips, and nematodes. Finding an efficacious quarantine treatment for these commodities is difficult because most cannot tolerate heat or cold, and a suitable chemical treatment is lacking. Irradiation could be a feasible, practical alternative. Quality of these irradiated materials should be studied to help determine if irradiation is a suitable quarantine treatment. Of the ten fresh herbs irradiated with up to 0.70 kGy, five (rosemary, thyme, oregano, parsley, chives) are very tolerant, and show no difference from the controls after two to three weeks at 7 deg. C. Red ginger and four cultivars of heliconia, very attractive ornamental plants, can be irradiated at 0.75 and 0.50 kGy, respectively, and have a vase life of 10 days or more at 21 deg. C. Leafminer in bean plants cannot emerge when irradiated at 0.15 kGy. The nematode, Meloidogyne javanica, which infects taro and ginger, is prevalent in Hawaii. To cause mortality in second stage juveniles (J2), a gamma-radiation dose higher than 4.0 kGy is necessary. Suppression of hatching of egg masses requires doses of 2.0 kGy and above. Galling of tomato plants inoculated with J2 and egg masses decreases when J2 and egg masses were irradiated at 3.25 kGy and above. Heating J2 at 43 deg. C for 10 min before inoculating them into the plants effectively reduces root galling. Synergism was not found between heat treatment (49 deg. C for 10 or 20 min) and irradiation with up to 0.015 kGy, the dose above which sprouting of ginger rhizomes and taro cormels is inhibited. The results suggest that irradiation is promising as a quarantine treatment for selected fresh herbs and ornamental plants, but not for control of nematodes in root crops. (author) 10 refs, 3 tabs
International Nuclear Information System (INIS)
Moy, J.H.; Chinnasri, B.; Sipes, B.S.; Schmitt, D.P.; Hamasaki, R.T.; Mersino, E.F.; Yamakawa, R.M.
1999-01-01
Many fresh herbs, ornamental plants, and several varieties of taro grown in Hawaii are infested with various pests such as aphids, mites, thrips, and nematodes. Finding an efficacious quarantine treatment for these commodities is difficult because most cannot tolerate heat or cold, and a suitable chemical treatment is lacking. Irradiation could be a feasible, practical alternative. Quality of these irradiated materials should be studied to help determine if irradiation is a suitable quarantine treatment. Of the ten fresh herbs irradiated with up to 0.70 kGy, five (rosemary, thyme, oregano, parsley, chives) are very tolerant, and show no difference from the controls after two to three weeks at 7 deg. C. Red ginger and four cultivars of heliconia, very attractive ornamental plants, can be irradiated at 0.75 and 0.50 kGy, respectively, and have a vase life of 10 days or more at 21 deg. C. Leafminer in bean plants cannot emerge when irradiated at 0.15 kGy. The nematode, Meloidogyne javanica, which infects taro and ginger, is prevalent in Hawaii. To cause mortality in second stage juveniles (J2), a gamma-radiation dose higher than 4.0 kGy is necessary. Suppression of hatching of egg masses requires doses of 2.0 kGy and above. Galling of tomato plants inoculated with J2 and egg masses decreases when J2 and egg masses were irradiated at 3.25 kGy and above. Heating J2 at 43 deg. C for 10 min before inoculating them into the plants effectively reduces root galling. Synergism was not found between heat treatment (49 deg. C for 10 or 20 min) and irradiation with up to 0.015 kGy, the dose above which sprouting of ginger rhizomes and taro cormels is inhibited. The results suggest that irradiation is promising as a quarantine treatment for selected fresh herbs and ornamental plants, but not for control of nematodes in root crops. (author)
Directory of Open Access Journals (Sweden)
Csongor I Vágási
2010-12-01
Full Text Available Many animals display colorful signals in their integument which convey information about the quality of their bearer. Theoretically, these ornaments incur differential production and/or maintenance costs that enforce their honesty. However, the proximate mechanisms of production costs are poorly understood and contentious in cases of non-carotenoid-based plumage ornaments like the melanin-based badge and depigmented white wing-bar in house sparrows Passer domesticus. Costly life-history events are adaptively separated in time, thus, when reproduction is extended, the time available for molt is curtailed and, in turn, molt rate is accelerated.We experimentally accelerated the molt rate by shortening the photoperiod in order to test whether this environmental constraint is mirrored in the expression of plumage ornaments. Sparrows which had undergone an accelerated molt developed smaller badges and less bright wing-bars compared to conspecifics that molted at a natural rate being held at natural-like photoperiod. There was no difference in the brightness of the badge or the size of the wing-bar.These results indicate that the time available for molt and thus the rate at which molt occurs may constrain the expression of melanin-based and depigmented plumage advertisements. This mechanism may lead to the evolution of honest signaling if the onset of molt is condition-dependent through the timing of and/or trade-off between breeding and molt.
Stiner, Mary C; Kuhn, Steven L; Güleç, Erksin
2013-05-01
Ten early Upper Paleolithic layers in Üçağızlı Cave I (41-29 uncalibrated ky BP) on the Hatay coast of southern Turkey preserve a rich and varied record of early Upper Paleolithic life, including the production and use of large numbers of shell ornaments. This study examines shell bead production, use, and discard in relation to site function and the diversity of on-site human activities. Four factors are expected to contribute to variation in the ornament assemblages, one environmental and three behavioral. The behavioral factors relate to winnowing for quality as a function of distance from the raw material source, changes in the size of user groups, and symbol standardization. The accumulation rates for shell beads, bones, and stone tools paralleled one another through time, indicating that ornament discard followed the pulse of daily life at this site. All stages of manufacture and use are well represented in each assemblage, and half or more of the ornaments show evidence of extended use. Changes in the local marine environment do not explain much of the variation in the assemblages, pointing instead to behavioral causes. The richness of shell types that were collected as raw material correlates to greater exploitation of edible marine shellfish and greater occupation intensity. Much of this variation in the ornament raw material was eliminated during the manufacture stage, almost certainly reflecting the influence of cultural norms. A focus on basket-shaped shells changed remarkably little over thousands of years, despite significant changes in other domains of technology. This last result suggests that beads were the most irreducible and conservative elements of more complex design traditions. Copyright © 2013 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Suriadi Suriadi
2016-11-01
This study aimed to : (1 Analyze the cost of ornamental plants in Dima Flora, (2 analyzing the operating revenues of ornamental plants in Dima Flora, (3 analyzing the business advantage of ornamental plants in Dima Flora, (4 Analyze the time capital controls on plants business Dima ornamental Flora. The object of this study are the data costs and revenues Enterprises Ornamental Plants In Dima Flora. The research proves that the total costs incurred in 2012 amounted to IDR 761,677,350. -, in the year 2013 by IDR 838,177,350. - and in 2014 amounted to IDR 923,677,350. -. Issued revenue in 2012 amounted to IDR 820.237.500, -, in the year 2013 by IDR 900,950,000, -, and in 2014 amounted to IDR 1,007,112,500, -. Net profit earned in 2012 amounted to IDR 58,560,150, -, in the year 2013 by IDR 62,772,650.-, whereas in 2014 amounted IDR 83,435,150. -. For a long payback by the Dima Flora for 2.1 years or for 2 years and 1 month.
Directory of Open Access Journals (Sweden)
Rodrigo Y. Fujimoto
2013-09-01
Full Text Available A total of 281 specimens of freshwater armored ornamental fish species (Leporacanthicus galaxias, Lasiancistrus saetiger, Cochliodon sp., Hypostomus sp., Pseudacanthicus spinosus, Ancistrus sp. and Rineloricaria cf. lanceolata were captured at the hydrological basin of Guamá River, Pará, Brazil. The infection by Trypanosoma spp. was inspected. The morphological and morphometric characterization of the parasites and the hematological parameters were determined. Leporacanthicus galaxias and Pseudacanthicus spinosus presented 100% infection prevalence, and the other species showed a variable prevalence of infection. The parasites showed clearly different morphotypes and dimensions, and probably belong to different species. The hematological response to the infection varied with the host. Cochliodon sp. showed no differences between infected and not infected fish. In other species several modifications on some hematological parameters were found, but apparently without causing disease. It is emphasized the possibility of introduction of the parasites in new environments due to the artificial movements of these ornamental fish.
Cryopreservation of eucalyptus genetic resources
The long-term preservation of forest genetic resources is a vital part of preserving our forest crops for future generations. Unfortunately there are few genebanks dedicated to forest trees and very few methods aside from field plantings of germplasm collections of elite clonal individuals. The use ...
Martin, Cliff G; Mannion, Catharine; Schaffer, Bruce
2009-06-01
The hypothesis that herbivory by Diaprepes root weevil larvae reduces leaf gas exchange and biomass was tested on buttonwood (Conocarpus erectus L.), Surinam cherry (Eugenia uniflora L.), mahogany (Swietenia mahagoni Jacq.), and pond apple (Annona glabra L). For Surinam cherry, net CO2 assimilation, transpiration, and stomatal conductance, but not internal CO2 concentration (collectively referred to as leaf gas exchange values), were 7-32% higher in noninfested than infested plants. For buttonwood, all four gas exchange values were 10-54% higher for noninfested than infested plants 3 h after infestation with large, seventh-instar larvae. However, by 4 wk after this infestation, net CO2 assimilation, transpiration, and stomatal conductance, but not internal CO2 concentration, were 11-37% higher for infested than for noninfested plants. For mahogany and pond apple, there were few or no significant differences in leaf gas exchange values between infested and noninfested plants. For all species, mean shoot and root fresh and dry weights were higher for noninfested than infested plants, with the differences most significant for buttonwood (37-85% higher), followed by Surinam cherry (37-143% higher), mahogany (49-84% higher), and pond apple (24-46% higher), which had no significant differences. There were significant differences among plant species in mean head capsule widths, thus larval instars, of larvae recovered from soil with the largest larvae from Surinam cherry (2.59 +/- 0.19 mm) and the smallest from mahogany (2.29 +/- 0.06 mm). Based on differences in leaf gas exchange and plant biomass between infested and noninfested plants of the four species tested, buttonwood and Surinam cherry are the most vulnerable to feeding by Diaprepes larvae followed by mahogany then pond apple.
Directory of Open Access Journals (Sweden)
A. Z. Destefani
2011-12-01
Full Text Available A utilização de agregados industrializados vem crescendo ao longo dos anos para atender a grande demanda da construção civil devido ao crescimento econômico do país. O objetivo deste trabalho foi utilizar o planejamento experimental em Rede Simplex para avaliar o efeito da adição do resíduo de rocha ornamental como filler na composição de misturas ternárias (brita 0, pó de pedra e resíduo, que levem a máxima compacidade (densidade seca aparente máxima. Foram tomados dezesseis pontos experimentais, cujos teores dos materiais utilizados variaram de 0 a 100%. O modelo em rede simplex cúbico completo apresentou melhor ajuste aos resultados experimentais, o qual resulta em respostas estatisticamente mais adequadas para as composições estudadas. A superfície de resposta gerada indicou que a densidade seca aparente máxima de 2,0 g/cm³ foi obtida para a composição ternária: 63% de brita 0/17% de pó de pedra/20% de resíduo de rocha ornamental. Portanto, o uso de resíduo de rocha ornamental como filler em agregados para a construção civil pode ser uma alternativa viável para deposição final deste abundante resíduo de forma ambientalmente correta.The use of industrial aggregates has grown over the years to meet the great demand of the civil construction due to the country's economical growth. The aim of this work was to use the experimental design in Simplex Lattice to evaluate the effect of the addition of ornamental rock waste as filler in the composition of ternary mixtures (crushed rock 0, stone powder, rock waste, leading to maximum compaction (maximum apparent dry density. Sixteen experimental points were taken, whose contents of the used materials ranged from 0 to 100%. The complete cubic simplex model showed to best fit to the experimental results, which results in more statistically appropriated responses to the studied compositions. The response surface generated indicated that the maximum apparent dry density (2
García-Sogo, Begoña; Pineda, Benito; Castelblanque, Lourdes; Antón, Teresa; Medina, Mónica; Roque, Edelín; Torresi, Claudia; Beltrán, José Pío; Moreno, Vicente; Cañas, Luis Antonio
2010-01-01
Engineered male sterility in ornamental plants has many applications such as facilitate hybrid seed production, eliminate pollen allergens, reduce the need for deadheading to extend the flowering period, redirect resources from seeds to vegetative growth, increase flower longevity and prevent gene flow between genetically modified and related native plants. We have developed a reliable and efficient Agrobacterium-mediated protocol for the genetic transformation of different Kalanchoe blossfeldiana commercial cultivars. Transformation efficiency for cv. 'Hillary' was 55.3% whereas that of cv. 'Tenorio' reached 75.8%. Selection was carried out with the nptII gene and increasing the kanamycin concentration from 25 to 100 mg l(-1) allowed to reduced escapes from 50 to 60% to virtually 0%. This method was used to produce male-sterile plants through engineered anther ablation. In our approach, we tested a male sterility chimaeric gene construct (PsEND1::barnase) to evaluate its effectiveness and effect on phenotype. No significant differences were found in the growth patterns between the transgenic lines and the wild-type plants. No viable pollen grains were observed in the ablated anthers of any of the lines carrying the PsEND1::barnase construct, indicating that the male sterility was complete. In addition, seed set was completely abolished in all the transgenic plants obtained. Our engineered male-sterile approach could be used, alone or in combination with a female-sterility system, to reduce the invasive potential of new ornamentals, which has become an important environmental problem in many countries.
Directory of Open Access Journals (Sweden)
Elisabeth R. Tempel Stumpf
2007-06-01
Full Text Available Para garantir o êxito no mercado de novos produtos da Floricultura, é preciso estabelecer critérios objetivos de escolha das características ornamentais desejáveis. Este trabalho tem como objetivo propor e validar um método para a avaliação do potencial ornamental de plantas nativas e não-convencionais, para uso como flores e folhagens de corte. A partir de uma planilha de avaliação especialmente elaborada para tal fim, foi testado o grau de potencialidade ornamental de 11 espécies nativas do Rio Grande do Sul, resultante do somatório das notas dadas para cada uma das dez características escolhidas por sua importância para a arte floral e para o mercado. Para a validação da eficácia do método, foi efetuada uma pesquisa de opinião on line. Andropogon bicornis, Baccharis articulata, B. usterii, Eryngium ebracteatum, E. eriophorum, E. sanguisorba, Hypericum connatum, Limonium brasiliense, Myrsine umbellata, Schinus lentiscifolius e S. terebinthifolius receberam pontuação superior a 70 pontos, sendo categorizadas como de alta potencialidade ornamental. A eficácia da escolha destas espécies com base em atributos estéticos visuais ficou comprovada nos resultados obtidos pela aplicação da planilha e posteriormente validados pela pesquisa de opinião. Os resultados indicam que o método aqui proposto é uma ferramenta eficaz para avaliar o grau de potencialidade ornamental de flores e folhagens de corte nativas e não-convencionais
Directory of Open Access Journals (Sweden)
Julián Martínez
2017-12-01
Full Text Available Low yields in ornamental rock mining remain one of the most important problems in this industry. This fact is usually associated with the presence of anisotropies in the rock, which makes it difficult to extract the blocks. An optimised planning of the exploitation, together with an improved geological understanding of the deposit, could increase these yields. In this work, marble mining in Macael (Spain was studied to test the capacity of non-destructive geophysical prospecting methods (GPR and ERI as tools to characterize the geology of the deposit. It is well-known that the ERI method provides a greater penetration depth. By using this technique, it is possible to distinguish the boundaries between the marble and the underlying micaschists, the morphology of the unit to be exploited, and even fracture zones to be identified. Therefore, this technique could be used in the early stages of research, to estimate the reserves of the deposit. The GPR methodology, with a lower penetration depth, is able to offer more detailed information. Specifically, it detects lateral and vertical changes of the facies inside the marble unit, as well as the anisotropies of the rock (fractures or holes. This technique would be suitable for use in a second stage of research. On the one hand, it is very useful for characterization of the texture and fabric of the rock, which allows us to determine in advance its properties, and therefore, the quality for ornamental use. On the other hand, the localization of anisotropy using the GPR technique will make it possible to improve the planning of the rock exploitation in order to increase yields. Both integrated geophysical techniques are effective for assessing the quality of ornamental rock and thus can serve as useful tools in mine planning to improve yields and costs.
Czech Academy of Sciences Publication Activity Database
Edme, A.; Zobač, P.; Opatová, Pavlína; Šplíchalová, P.; Munclinger, P.; Albrecht, Tomáš; Krist, M.
2017-01-01
Roč. 71, č. 1 (2017), č. článku 3. ISSN 0340-5443 R&D Projects: GA ČR(CZ) GAP506/12/2472 Institutional support: RVO:68081766 Keywords : Mating success * Extra-pair paternity * Differential allocation * Sexual ornament * Sperm size Subject RIV: EG - Zoology OBOR OECD: Zoology Impact factor: 2.185, year: 2016
Clarac, F; De Buffrénil, V; Cubo, J; Quilhac, A
2018-01-01
Vascularization in the core of crocodylian osteoderms, and in their superficial pits has been hypothesized to be a key feature involved in physiological thermoregulation and/or acidosis buffering during anoxia (apnea). However, up to now, there have been no quantitative data showing that the inner, or superficial, blood supply of the osteoderms is greater than that occurring in neighboring dermal tissues. We provide such data: our results clearly indicate that the vascular networks in both the osteoderms and the pits forming their superficial ornamentation are denser than in the overlying dermis. These results support previous physiological assumptions and indicate that vascularization in pseudosuchian (crocodylians and close relatives) ornamented osteoderms could be part of a broad eco-physiological adaptation towards ectothermy and aquatic ambush predation acquired by the crocodylomorphs during their post-Triassic evolution. Moreover, regressions demonstrate that the number of enclosed vessels is correlated with the sectional area of the cavities housing them (superficial pits and inner cavities). These regressions can be used to infer the degree of vascularization on dry and fossilized osteoderms and thus document the evolution of the putative function of the osteoderms in the Pseudosuchia. Anat Rec, 2017. © 2017 Wiley Periodicals, Inc. Anat Rec, 301:175-183, 2018. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Biochar versus hydrochar as growth media constituents for ornamental plant cultivation
Directory of Open Access Journals (Sweden)
Fernando Fornes
Full Text Available ABSTRACT Biochar and hydrochar have been proposed as novel materials for providing soilless growth media. However, much more knowledge is required before reliable advice can be given on the use of these materials for this purpose. Depending on the material and the technology applied (pyrolysis or hydrothermal carbonization, phytotoxicity and greenhouse gas emissions have been found for certain chars. In this study, our aim was to assess the feasibility of three chars as substrate constituents. We compared two biochars, one from forest waste and the other from olive mill waste, and a hydrochar from forest waste. We studied how chars affected substrate characteristics, plant performance, water economy and respiratory CO2 emission. Substrates containing biochar from forest waste showed the best characteristics, with good air/water relationships and adequate electrical conductivity. Those with biochar from olive mill waste were highly saline and, consequently, low quality. The substrates with hydrochar retained too much water and were poorly aerated, presenting high CO2 concentrations due to high respiratory activity. Plants performed well only when grown in substrates containing a maximum of 25 % biochar from forest waste or hydrochar. After analyzing the char characteristics, we concluded that biochar from forest waste could be safely used as a substrate constituent and is environmentally friendly when applied due to its low salinity and low CO2 emission. However, biochar from olive mill waste and hydrochar need to be improved before they can be used as substrate constituents.
Directory of Open Access Journals (Sweden)
Ioan Blada
2013-12-01
Full Text Available In order to get ornamental trees for landscaping, Colorado blue spuce (Picea pungens Engelm. var.glauca Regel scions were grafted on Norway spruce (Picea abies (L. Karst. rootstocks. An original double-side-veneer grafting method was applied in five experimental or basic variants. The plastic tapes and the ecological Ceraltin wax developed by the Research and Development of Bio-stimulators (CCDB BIOS Cluj were tested. In addition, two controls in which the classic raffia and the traditional hot wax and the classic side-veneer-grafting method were used. The obtained results, expressed in percents, were transformed in arcsin square root of percent values, and then a two-way analysis of variance (ANOVA was used. Highly significant (p < 0.001 statistical differences were found between all grafting variants, including controls. The Duncan test proved that original double-side-veneer grafting method and the new developed materials, i.e. plastic tapes and the ecological Ceraltin wax have contributed in getting a better grafting success compared to the controls.Thus, the double-side-veneer grafting method and the two grafting materials are highly recommended to be used in getting grafted Colorado blue spuce ornamental trees.
Stešević, D.; Caković, D.
2013-01-01
This contribution is based on the field observations from 2011 to 2013. Besides new data about distribution of some known plant invaders, one new alien species for the flora of Montenegro is reported- Solidago gigantea. This plant was recorded in 2011, on two distinct localities near the road side in peri-urban area of Nikšić and Mojkovac, in the vicinity of gardens, were it has been grown as ornamental. In 2012 survey, species was again reported for Mojkovac, but it disappeared f...
Directory of Open Access Journals (Sweden)
Jessica L Deichmann
Full Text Available Development projects in west Central Africa are proceeding at an unprecedented rate, often with little concern for their effects on biodiversity. In an attempt to better understand potential impacts of a road development project on the anuran amphibian community, we conducted a biodiversity assessment employing multiple methodologies (visual encounter transects, auditory surveys, leaf litter plots and pitfall traps to inventory species prior to construction of a new road within the buffer zone of Moukalaba-Doudou National Park, Gabon. Because of difficulties in morphological identification and taxonomic uncertainty of amphibian species observed in the area, we integrated a DNA barcoding analysis into the project to improve the overall quality and accuracy of the species inventory. Based on morphology alone, 48 species were recognized in the field and voucher specimens of each were collected. We used tissue samples from specimens collected at our field site, material available from amphibians collected in other parts of Gabon and the Republic of Congo to initiate a DNA barcode library for west Central African amphibians. We then compared our sequences with material in GenBank for the genera recorded at the study site to assist in identifications. The resulting COI and 16S barcode library allowed us to update the number of species documented at the study site to 28, thereby providing a more accurate assessment of diversity and distributions. We caution that because sequence data maintained in GenBank are often poorly curated by the original submitters and cannot be amended by third-parties, these data have limited utility for identification purposes. Nevertheless, the use of DNA barcoding is likely to benefit biodiversity inventories and long-term monitoring, particularly for taxa that can be difficult to identify based on morphology alone; likewise, inventory and monitoring programs can contribute invaluable data to the DNA barcode library and
McGraw, K J; Hill, G E
2000-01-01
The striking diversity of sexual dimorphisms in nature begs the question: Why are there so many signal types? One possibility is that ornamental traits convey different sets of information about the quality of the sender to the receiver. The colourful, pigmented feathers of male birds seem to meet the predictions of this hypothesis. Evidence suggests that carotenoid pigmentation reflects the nutritional condition of males during moult, whereas in many instances melanin pigmentation is a relia...
Climate change will increase the naturalization risk from garden plants in Europe
Czech Academy of Sciences Publication Activity Database
Dullinger, Y.; Wessely, J.; Bossdorf, O.; Dawson, W.; Essl, F.; Gattringer, A.; Klonner, G.; Kreft, H.; Kuttner, M.; Moser, D.; Pergl, Jan; Pyšek, Petr; Thuiller, W.; van Kleunen, M.; Weigelt, P.; Winter, M.; Dullinger, S.
2017-01-01
Roč. 26, č. 1 (2017), s. 43-53 ISSN 1466-822X R&D Projects: GA ČR(CZ) GAP504/11/1028; GA ČR GB14-36079G Grant - others:AV ČR(CZ) AP1002 Program:Akademická prémie - Praemium Academiae Institutional support: RVO:67985939 Keywords : future invasions * ornamental plants * climate change Subject RIV: EH - Ecology, Behaviour OBOR OECD: Ecology Impact factor: 6.045, year: 2016
Kraaijeveld, Ken; Ming, Ma; Komdeur, Jan; Mulder, Raoul A.
In sexually dichromatic birds, females may adaptively adjust the sex ratio of their offspring prior to hatching in relation to male ornamentation, for example, by producing more sons when paired to a highly attractive partner. However, to our knowledge no studies have investigated offspring sex
Christopher A. Lee; Janice M. Alexander; Susan J. Frankel; Yana Valachovic
2012-01-01
We conducted a research needs assessment (RNA) in 2010 to gather opinions of "experts" and a larger public on research priorities for Phytophthora ramorum, the pathogen that causes sudden oak death in forest trees and Ramorum blight in ornamental plants. We place these 2010 findings in context with findings of similar P. ramorum...
Characteristics of ornamental rocks waste: application of mechanochemical concepts
International Nuclear Information System (INIS)
Santos, J. dos; Galembeck, F.
2016-01-01
Processing of ornamental rocks produces up to 80% weight residues which become an environmental problem. In this work, we analyzed residual powders from cutting and crushing granite Cinza Corumba, to study the influence of mechanical processes in the properties of the residues. The powders were characterized by X-ray diffraction and fluorescence, infrared spectroscopy, scanning electron microscopy, surface area determination and adsorption of methylene blue. The same elements and minerals are found in both powders but the powders formed during crushing contain lubricating oil residues, from the crusher. Particle shapes of the crushed powder (surface area 2.85 m2/g) are more irregular than cut powder (surface area 1.98 m2/g). Adsorption of methylene blue is lighter in the crushed powder than in the cutting powder. Thus, the powders analyzed have different surface properties. (author)
Elk and plants thrive near power lines
Energy Technology Data Exchange (ETDEWEB)
Lustre, L.
1997-11-01
Butterflies and elk gather in clearings near power line right-of-ways and on the edges of such clearings, where the wild flowers and plants that have widely disappeared as a result of intensive farming and subsurface drainage of fields have found a good habitat. Ornamental coniferous trees, various herbs and assorted berries do well and can be harvested near power lines from woodland clearings once thought unfit for cultivation. IVS, the nationwide network company, takes part in many projects aiming both to increase productive utilization of land areas under power lines and to promote biodiversity
Overexpression of the AtSHI gene in poinsettia, Euphorbia pulcherrima, results in compact plants
DEFF Research Database (Denmark)
Islam, M. Ashraful; Lütken, Henrik Vlk; Haugslien, Sissel
2013-01-01
of the AtSHI gene into poinsettia by genetic engineering can be an effective approach in controlling plant height without negatively affecting flowering time. This can help to reduce or avoid the use of toxic growth retardants of environmental and human health concern. This is the first report that At......Euphorbia pulcherrima, poinsettia, is a non-food and non-feed vegetatively propagated ornamental plant. Appropriate plant height is one of the most important traits in poinsettia production and is commonly achieved by application of chemical growth retardants. To produce compact poinsettia plants...... integration of transgene was verified by PCR and Southern blot analysis. Reduced plant height (21–52%) and internode lengths (31–49%) were obtained in the transgenic lines compared to control plants. This correlates positively with the AtSHI transcript levels, with the highest levels in the most dwarfed...
DEFF Research Database (Denmark)
Sønderstrup-Andersen, Hans H. K.; Thomsen, Jane Dyrhauge; Müller, Renate
2012-01-01
office workplaces. A paper-pencil questionnaire was developed in order to collect demographical information about the employees at the workplaces under investigation. A scale composed of 13 items regarding the attitudes towards ornamental plants at the workplace was also included in the questionnaire...... was 0.79 and 0.93 for the second factor. These two factors form an interesting platform from which the question of how personal attitudes are influencing the people-plant relationship at Danish workplaces can be investigated further. However, it should be noted that the results reported here...
DEFF Research Database (Denmark)
Thomsen, Jane Dyrhauge; Müller, Renate; Sønderstrup-Andersen, Hans H. K.
2012-01-01
office workplaces. A paper-pencil questionnaire was developed in order to collect demographical information about the employees at the workplaces under investigation. A scale composed of 13 items regarding the attitudes towards ornamental plants at the workplace was also included in the questionnaire...... was 0.79 and 0.93 for the second factor. These two factors form an interesting platform from which the question of how personal attitudes are influencing the people-plant relationship at Danish workplaces can be investigated further. However, it should be noted that the results reported here...
Liu, Xiao-Ping; Gao, Bao-Zhen; Han, Feng-Qing; Fang, Zhi-Yuan; Yang, Li-Mei; Zhuang, Mu; Lv, Hong-Hao; Liu, Yu-Mei; Li, Zhan-Sheng; Cai, Cheng-Cheng; Yu, Hai-Long; Li, Zhi-Yuan; Zhang, Yang-Yong
2017-03-14
Due to its variegated and colorful leaves, ornamental kale (Brassica oleracea L. var. acephala) has become a popular ornamental plant. In this study, we report the fine mapping and analysis of a candidate purple leaf gene using a backcross population and an F 2 population derived from two parental lines: W1827 (with white leaves) and P1835 (with purple leaves). Genetic analysis indicated that the purple leaf trait is controlled by a single dominant gene, which we named BoPr. Using markers developed based on the reference genome '02-12', the BoPr gene was preliminarily mapped to a 280-kb interval of chromosome C09, with flanking markers M17 and BoID4714 at genetic distances of 4.3 cM and 1.5 cM, respectively. The recombination rate within this interval is almost 12 times higher than the usual level, which could be caused by assembly error for reference genome '02-12' at this interval. Primers were designed based on 'TO1000', another B. oleracea reference genome. Among the newly designed InDel markers, BRID485 and BRID490 were found to be the closest to BoPr, flanking the gene at genetic distances of 0.1 cM and 0.2 cM, respectively; the interval between the two markers is 44.8 kb (reference genome 'TO1000'). Seven annotated genes are located within the 44.8 kb genomic region, of which only Bo9g058630 shows high homology to AT5G42800 (dihydroflavonol reductase), which was identified as a candidate gene for BoPr. Blast analysis revealed that this 44.8 kb interval is located on an unanchored scaffold (Scaffold000035_P2) of '02-12', confirming the existence of assembly error at the interval between M17 and BoID4714 for reference genome '02-12'. This study identified a candidate gene for BoPr and lays a foundation for the cloning and functional analysis of this gene.
Mining metadata from unidentified ITS sequences in GenBank: A case study in Inocybe (Basidiomycota
Directory of Open Access Journals (Sweden)
Jacobsson Stig
2008-02-01
Full Text Available Abstract Background The lack of reference sequences from well-identified mycorrhizal fungi often poses a challenge to the inference of taxonomic affiliation of sequences from environmental samples, and many environmental sequences are thus left unidentified. Such unidentified sequences belonging to the widely distributed ectomycorrhizal fungal genus Inocybe (Basidiomycota were retrieved from GenBank and divided into species that were identified in a phylogenetic context using a reference dataset from an ongoing study of the genus. The sequence metadata of the unidentified Inocybe sequences stored in GenBank, as well as data from the corresponding original papers, were compiled and used to explore the ecology and distribution of the genus. In addition, the relative occurrence of Inocybe was contrasted to that of other mycorrhizal genera. Results Most species of Inocybe were found to have less than 3% intraspecific variability in the ITS2 region of the nuclear ribosomal DNA. This cut-off value was used jointly with phylogenetic analysis to delimit and identify unidentified Inocybe sequences to species level. A total of 177 unidentified Inocybe ITS sequences corresponding to 98 species were recovered, 32% of which were successfully identified to species level in this study. These sequences account for an unexpectedly large proportion of the publicly available unidentified fungal ITS sequences when compared with other mycorrhizal genera. Eight Inocybe species were reported from multiple hosts and some even from hosts forming arbutoid or orchid mycorrhizae. Furthermore, Inocybe sequences have been reported from four continents and in climate zones ranging from cold temperate to equatorial climate. Out of the 19 species found in more than one study, six were found in both Europe and North America and one was found in both Europe and Japan, indicating that at least many north temperate species have a wide distribution. Conclusion Although DNA
Mining metadata from unidentified ITS sequences in GenBank: a case study in Inocybe (Basidiomycota).
Ryberg, Martin; Nilsson, R Henrik; Kristiansson, Erik; Töpel, Mats; Jacobsson, Stig; Larsson, Ellen
2008-02-18
The lack of reference sequences from well-identified mycorrhizal fungi often poses a challenge to the inference of taxonomic affiliation of sequences from environmental samples, and many environmental sequences are thus left unidentified. Such unidentified sequences belonging to the widely distributed ectomycorrhizal fungal genus Inocybe (Basidiomycota) were retrieved from GenBank and divided into species that were identified in a phylogenetic context using a reference dataset from an ongoing study of the genus. The sequence metadata of the unidentified Inocybe sequences stored in GenBank, as well as data from the corresponding original papers, were compiled and used to explore the ecology and distribution of the genus. In addition, the relative occurrence of Inocybe was contrasted to that of other mycorrhizal genera. Most species of Inocybe were found to have less than 3% intraspecific variability in the ITS2 region of the nuclear ribosomal DNA. This cut-off value was used jointly with phylogenetic analysis to delimit and identify unidentified Inocybe sequences to species level. A total of 177 unidentified Inocybe ITS sequences corresponding to 98 species were recovered, 32% of which were successfully identified to species level in this study. These sequences account for an unexpectedly large proportion of the publicly available unidentified fungal ITS sequences when compared with other mycorrhizal genera. Eight Inocybe species were reported from multiple hosts and some even from hosts forming arbutoid or orchid mycorrhizae. Furthermore, Inocybe sequences have been reported from four continents and in climate zones ranging from cold temperate to equatorial climate. Out of the 19 species found in more than one study, six were found in both Europe and North America and one was found in both Europe and Japan, indicating that at least many north temperate species have a wide distribution. Although DNA-based species identification and circumscription are associated
Directory of Open Access Journals (Sweden)
Ahmet Uludağ
2012-12-01
söz konusu tehdidin büyüklüğüne ve önemine dikkat çekilmektedir. The Negative Effects Of Imported Ornamentals And Pets On Environment Ornamentals improve environment outdoor and contribute our health, prospect and creativity indoor. Open areas and green corners that are planned well have positive impact on cities and their dwellers. Pets and companion animals have important role as friend of human, which can create a special atmosphere for owner, increase social life and help education of kids. Urbanization which has occurred in parallel to migration from rural areas to cities with industrialization era imposed a grey life style surrounded with concrete, glass and pavement. A person who is emigrated from villages himself or his parents tried to fulfill his desire of nature via growing ornamentals and having pets. Turkey has experienced the same cases. Due to the desire of being different, increasing effect of media, and effective marketing technique, new exotic ornamentals and pets have replaced usual common ones. Rising demand to the exotic plants and animals increased import, production, and retail marketing, which can increase the risk on environment due to these creatures. Those species that live in other places than their origins and have negative effect on biodiversity, human activities or health are described as invasive alien species (IAS. Ornamentals and pets escape to wild or release to wild, which can become IAS. There are legal documents and code of conducts in some countries. Unfortunately there are no legal documents enough including quarantine on IAS in Turkey. In order to control IAS, the impact of IAS should be determined nationwide and awareness should be created from policy makers to ordinary citizens. Getting attention on importance and magnitude of IAS problem caused by ornamental plants and animals by using second hand data was aimed in this paper.
Directory of Open Access Journals (Sweden)
Oğulcan Avcı
2016-03-01
Full Text Available Bu çalışmada, 19. yüzyılın başında Çapanoğlu Süleyman Bey’in başçavuşu Halil Ağa tarafından Yozgat ilinin merkezinde inşa edilmiş Başçavuşoğlu Camii’nin mimarisi ve süslemeleri incelenmiştir. Başçavuş Halil Ağa’nın Çapanoğlu sülalesinin emrinde olması onu önemli bir kişi kılmaktadır. Söz konusu yapı ile ilgili Rüçhan Arık, Hakkı Acun gibi araştırmacılar çalışmalar yapmıştır. Yapı, Yozgat iline hâkim bir noktaya konumlandırılmış ve külliyenin bir parçasıdır. Külliyede yer alan yapılardan cami, çeşme, hamam sağlam olmasına rağmen, medrese günümüze gelememiştir. Külliyenin en önemli yapısı camidir. Yapı Batılılaşma döneminin hemen hemen tüm özelliklerini taşımaktadır. Yapının dış cepheleri oldukça sade olmasına rağmen iç kısmı yoğun şekilde süslenmiştir. Cami’nin kalemişi süslemeleri bitkisel ve geometrik motifler ile mimari ögeler ve doğadan manzaralar içeren duvar resimlerinden oluşmaktadır. Bitkisel süslemeler genellikle farklı çiçek türlerini içermektedir. Duvar resimlerinde cami, değirmen, medrese, köprü gibi farklı yapı türleri görülmektedir. Bu yapı türlerinin hayalî manzaralar değil, dönemin Yozgat tasvirleri olduğu düşünülmektedir. Ayrıca yapıdaki ahşap, maden ve alçı süslemeler de çok yönlü irdelenmeye çalışılmıştır. Anahtar Kelimeler: Yozgat, Başçavuşoğlu Camii, kalemişi, Batılılaşma, Osmanlı Abstract: In this study, it is studied architecture ornaments in Bascavusoglu Mosque built by Halil Aga who was master-sergeat of Capanoglu Süleyman Bey center of Yozgat province in early 19. Century. Halil Aga was personage beacuse he worked under Capanoglu family. The mosque in point was studied by researchers such as Rüçhan Arık, Hakkı Acun. The mosque is centrally located in Yozgat and in social complex. Some of buildings in this social complex are solid but madrasah is not
Identification of a highly successful cryopreservation method (droplet-vitrification) for petunia
Petunia (Petunia × hybrida Vilm.) is a very important crop conserved in the National Genebank of China. Petunia cultivar “Niu 2” was used to develop a droplet-vitrification protocol to cryopreserve shoot tips. Six variables (age of the in vitro plants, concentration of sucrose in the preculture solu...
A preliminary study on a specifically expressed arabidopsis promotor in vascular bundle
International Nuclear Information System (INIS)
Gu Yunhong; Xie Chuanxiao; Wu Lifang; Yu Zengliang
2003-01-01
From a population of about 3500 single plants in Arabidopsis promoter trapping bank, one plant whose GUS-gene had been specifically expressed in vascular bundle, was screened by the method of gus tissue staining. The T-DNA flanking sequence was amplified using TAIL-PCR. This band will be purified and connected to TA cloning vector. After sequencing and searching in the genebank, its function will be demonstrated through transformation
The historical role of species from the Solanaceae plant family in genetic research
Gebhardt, Christiane
2016-01-01
Key message This article evaluates the main contributions of tomato, tobacco, petunia, potato, pepper and eggplant to classical and molecular plant genetics and genomics since the beginning of the twentieth century. Abstract Species from the Solanaceae family form integral parts of human civilizations as food sources and drugs since thousands of years, and, more recently, as ornamentals. Some Solanaceous species were subjects of classical and molecular genetic research over the last 100?years...
Daneshparvar, Afrooz; Mowlavi, Gholamreza; Mirjalali, Hamed; Hajjaran, Homa; Mobedi, Iraj; Naddaf, Saeed Reza; Shidfar, Mohammadreza; Sadat Makki, Mahsa
2017-01-01
Demodicosis is one of the most prevalent skin diseases resulting from infestation by Demodex mites. This parasite usually inhabits in follicular infundibulum or sebaceous duct and transmits through close contact with an infested host. This study was carried from September 2014 to January 2016 at Tehran University of Medical Sciences, Tehran, Iran. DNA extraction and amplification of 16S ribosomal RNA was performed on four isolates, already obtained from four different patients and identified morphologically though clearing with 10% Potassium hydroxide (KOH) and microscopical examination. Amplified fragments from the isolates were compared with GeneBank database and phylogenetic analysis was carried out using MEGA6 software. A 390 bp fragment of 16S rDNA was obtained in all isolates and analysis of generated sequences showed high similarity with those submitted to GenBank, previously. Intra-species similarity and distance also showed 99.983% and 0.017, respectively, for the studied isolates. Multiple alignments of the isolates showed Single Nucleotide Polymorphisms (SNPs) in 16S rRNA fragment. Phylogenetic analysis revealed that all 4 isolates clustered with other D. folliculorum, recovered from GenBank database. Our accession numbers KF875587 and KF875589 showed more similarity together in comparison with two other studied isolates. Mitochondrial 16S rDNA is one of the most suitable molecular barcodes for identification D. folliculorum and this fragment can use for intra-species characterization of the most human-infected mites.
Directory of Open Access Journals (Sweden)
ML Martins
Full Text Available In the present work Trichodina reticulata and T. nobilis (Ciliophora: Trichodinidae are morphologically characterised from ornamental freshwater fish culture in the State of Santa Catarina, Brazil. The prevalence of infection and a list of comparative measurements are discussed. We examined "southern platyfish" Xiphophorus maculatus (n = 35, "goldfish" Carassius auratus (n = 31, "guppy" Poecilia reticulata (n = 20, "sailfin molly" Poecilia latipinna (n = 6, "beta" Betta splendens (n = 2 and "spotted headstander" Chilodus punctatus (n = 1. After being anesthetised in a benzocaine solution, fishes were examined for parasitological evaluation. A total of 51.57% fishes were parasitised by Trichodina spp. Carassius auratus was the most parasitised species, followed by X. maculatus and P. reticulata. Beta splendens, C. punctatus and P. latipinna were not parasitised by any trichodinid species. Two species of Trichodina were collected from the skin of fish: T. nobilis was found in C. auratus, P. reticulata and X. maculatus and T. reticulata was only observed in C. auratus. The importance of adequate handling in ornamental fish culture are also discussed.
Directory of Open Access Journals (Sweden)
Keisuke Matsui
2013-01-01
Full Text Available Although phosphorus is an essential factor for proper plant growth in natural environments, an excess of phosphate in water sources causes serious pollution. In this paper we describe transgenic plants which hyperaccumulate inorganic phosphate (Pi and which may be used to reduce environmental water pollution by phytoremediation. AtPHR1, a transcription factor for a key regulator of the Pi starvation response in Arabidopsis thaliana, was overexpressed in the ornamental garden plants Torenia, Petunia, and Verbena. The transgenic plants showed hyperaccumulation of Pi in leaves and accelerated Pi absorption rates from hydroponic solutions. Large-scale hydroponic experiments indicated that the enhanced ability to absorb Pi in transgenic torenia (AtPHR1 was comparable to water hyacinth a plant that though is used for phytoremediation causes overgrowth problems.
Thrips on fabaceous plants and weeds in an ecotone in northeastern Brazil
Lima, Élison Fabrício Bezerra; Zucchi, Roberto Antonio
2015-01-01
ABSTRACT: Thrips (Thysanoptera) on 33 species of Fabaceae (ornamental and forage) and some weed species were surveyed in areas of caatinga-cerrado ecotone in northeastern Brazil. Twenty species of thrips were identified, all of which are associated for the first time with the plants sampled in this study, totaling 26 new host associations, based on collections of immatures. Five species are probably new to science, illustrating the diversity of thrips in the region. A few thrips species that ...
International Nuclear Information System (INIS)
Espín de Gea, A.; Reyes Urquiza, M.; Gil Abellán, A.
2017-01-01
The ornamental rock sector, particularly the investigation of deposits, is not readily given to the incorporation of new technologies. The Marble Technology Center (CTM) has made advances in this sector with the implementation of geophysical techniques able to obtain subsurface information. There are still a few outcrops and active quarries where joint geophysical techniques have been applied sufficiently to obtain a three-dimensional model of the study area. The application of geophysics and more specifically, ground penetrating radar, electrical tomography and seismic refraction, when conducting research of a reservoir or outcrop, is only slightly aggressive to the environment, allowing a real knowledge of the characteristics before beginning the more aggressive work, as is the case when conducting surveys and test pits which can subsequently complement the data obtained. This makes it possible to gain a good idea of the quality of the reservoir thus allowing optimization of resources, both financial and environmental beforehand. Several studies conducted by the CTM illustrate the benefits brought by the application of these geophysical techniques as well as the weaknesses within the characteristics of the extraction sites and ornamental rock outcrops. [es
Directory of Open Access Journals (Sweden)
Glenn J. Bryan
2017-09-01
Full Text Available DNA-based marker analysis of plant genebank material has become a useful tool in the evaluation of levels of genetic diversity and for the informed use and maintenance of germplasm. In this study, we quantify levels of amplified fragment length polymorphism (AFLP in representative accessions of wild and cultivated potato species of differing geographic origin, ploidy, and breeding system. We generated 449 polymorphic AFLP fragments in 619 plants, representing multiple plants (16–23 from 17 accessions of 14 potato taxa as well as single plants sampled from available accessions (from 3 to 56 of the same 14 taxa. Intra-accession diversities were compared to those of a synthetic ‘taxon-wide’ population comprising a single individual from a variable number of available accessions of each sampled taxon. Results confirm the expected considerably lower levels of polymorphism within accessions of self-compatible as compared to self-incompatible taxa. We observed broadly similar levels of ‘taxon-wide’ polymorphism among self-compatible and self-incompatible species, with self-compatible taxa showing only slightly lower rates of polymorphism. The most diverse accessions were the two cultivated potato accessions examined, the least diverse being the Mexican allohexaploids Solanum demissum and S. iopetalum. Generally allopolyploid self-compatible accessions exhibited lower levels of diversity. Some purported self-incompatible accessions showed relatively low levels of marker diversity, similar to the more diverse self-compatible material surveyed. Our data indicate that for self-compatible species a single plant is highly representative of a genebank accession. The situation for self-incompatible taxa is less clear, and sampling strategies used will depend on the type of investigation. These results have important implications for those seeking novel trait variation (e.g., disease resistance in gene banks as well as for the selection of individuals
Gao, Qian; Yang, Zhu L
2016-01-01
The diversity of root-associated fungi associated with four ectomycorrhizal herbaceous species, Kobresia capillifolia, Carex parva, Polygonum macrophyllum and Potentilla fallens, collected in three sites of alpine meadows in southwestern China, was estimated based on internal transcribed spacer (ITS) rDNA sequence analysis of root tips. Three hundred seventy-seven fungal sequences sorted to 154 operational taxonomical units (sequence similarity of ≥ 97% across the ITS) were obtained from the four plant species across all three sites. Similar taxa (in GenBank with ≥ 97% similarity) were not found in GenBank and/or UNITE for most of the OTUs. Ectomycorrhiz a made up 64% of the fungi operational taxonomic units (OTUs), endophytes constituted 4% and the other 33% were unidentified root-associated fungi. Fungal OTUs were represented by 57% basidiomycetes and 43% ascomycetes. Inocybe, Tomentella/Thelophora, Sebacina, Hebeloma, Pezizomycotina, Cenococcum geophilum complex, Cortinarius, Lactarius and Helotiales were OTU-rich fungal lineages. Across the sites and host species the root-associated fungal communities generally exhibited low host and site specificity but high host and sampling site preference. Collectively our study revealed noteworthy diversity and endemism of root-associated fungi of alpine plants in this global biodiversity hotspot. © 2016 by The Mycological Society of America.
Female mate choice and the potential for ornament evolution in túngara frogs Physalaemus pustulosus
Michael J. RYAN, Ximena E. BERNA, A. Stanley RAND
2010-01-01
The potential for ornament evolution in response to sexual selection rests on the interaction between the permissiveness or selectivity of female preferences and the constraints on male development of signaling related traits. We investigate the former by determining how latent female preferences either exaggerate the magnitude of current traits (i.e. elaborations) or favor novel traits (i.e. innovations). In túngara frogs, females prefer complex mating calls (whine-chucks) to simple calls (...
Energy Technology Data Exchange (ETDEWEB)
Cam Van, Do Thi
2013-08-01
Compost and residues from biogas plant have been increasingly recognized as potting substrates in horticulture. To investigate the suitability of both materials to grow salt tolerant plants in 2010 a pot experiment was conducted in the greenhouse of INRES-Plant nutrition, University of Bonn. Ryegrass (Lolium perenne L.), rape (Brassica napus) and sunflower (Helianthus annuus) were chosen as experimental plants. To reduce the high salt content compost and residues from biogas plant were leached. To improve physical characteristics of raw materials, additives including Perlite, Styromull, Hygromull, Lecaton, Peat, Cocofiber were incorporated into compost or residues from biogas plant with the volumetric ratio of 4:1. Plant growth (DM) and nutrient uptake (N, P, K, Mg, Ca, Na and S) of the experimental plants grown in compost-based or residue-based substrates with and without additives and standard soil as a control were determined. Preliminary results reveal that origin compost and residues from biogas plant without leaching are suitable potting substrates for those plants. For compost leaching may not be recommended while for residues from biogas plant the effect of leaching was not distinct and needs further investigations. The incorporation of additives into the basic materials partially resulted in higher plant dry matter yield and nutrient uptake. However, differences between the additives on both parameters were mainly insignificant. Incorporation of Hygromull or Peat, especially into residues from biogas plant favored plant growth and enhanced total nutrient uptake. In 2011, pot experiments were continued with the salt-sensitive ornamental plants, Pelargonium (Pelargonium zonale Toro) and Salvia (Salvia splendens). Two separate experiments were carried out for the mixtures of compost and additives (SPS standard soil type 73 based on Peat, Hygromull or Cocofiber) with different volumetric ratios (4:1, 1:1, 1:4) and the mixtures of Peat incorporated with small
A new horned dinosaur reveals convergent evolution in cranial ornamentation in Ceratopsidae.
Brown, Caleb M; Henderson, Donald M
2015-06-15
Ceratopsid (horned) dinosaurs are an iconic group of large-bodied, quadrupedal, herbivorous dinosaurs that evolved in the Late Cretaceous and were largely restricted to western North America [1-5]. Ceratopsids are easily recognized by their cranial ornamentation in the form of nasal and postorbital horns and frill (capped by epiossifications); these structures show high morphological disparity and also represent the largest cranial display structures known to have evolved [2, 4]. Despite their restricted occurrence in time and space, this group has one of the best fossil records within Dinosauria, showing a rapid diversification in horn and frill morphology [1]. Here a new genus and species of chasmosaurine ceratopsid is described based on a nearly complete and three-dimensionally preserved cranium recovered from the uppermost St. Mary River Formation (Maastrichtian) of southwestern Alberta. Regaliceratops peterhewsi gen. et sp. nov. exhibits many unique characters of the frill and is characterized by a large nasal horncore, small postorbital horncores, and massive parietal epiossifications. Cranial morphology, particularly the epiossifications, suggests close affinity with the late Campanian/early Maastrichian taxon Anchiceratops, as well as with the late Maastrichtian taxon Triceratops. A median epiparietal necessitates a reassessment of epiossification homology and results in a more resolved phylogeny. Most surprisingly, Regaliceratops exhibits a suite of cranial ornamentations that are superficially similar to Campanian centrosaurines, indicating both exploration of novel display morphospace in Chasmosaurinae, especially Maastrichtian forms, and convergent evolution in horn morphology with the recently extinct Centrosaurinae. This marks the first time that evolutionary convergence in horn-like display structures has been demonstrated between dinosaur clades, similar to those seen in fossil and extant mammals [6]. Copyright © 2015 Elsevier Ltd. All rights
Some limitations of public sequence data for phylogenetic inference (in plants).
Hinchliff, Cody E; Smith, Stephen Andrew
2014-01-01
The GenBank database contains essentially all of the nucleotide sequence data generated for published molecular systematic studies, but for the majority of taxa these data remain sparse. GenBank has value for phylogenetic methods that leverage data-mining and rapidly improving computational methods, but the limits imposed by the sparse structure of the data are not well understood. Here we present a tree representing 13,093 land plant genera--an estimated 80% of extant plant diversity--to illustrate the potential of public sequence data for broad phylogenetic inference in plants, and we explore the limits to inference imposed by the structure of these data using theoretical foundations from phylogenetic data decisiveness. We find that despite very high levels of missing data (over 96%), the present data retain the potential to inform over 86.3% of all possible phylogenetic relationships. Most of these relationships, however, are informed by small amounts of data--approximately half are informed by fewer than four loci, and more than 99% are informed by fewer than fifteen. We also apply an information theoretic measure of branch support to assess the strength of phylogenetic signal in the data, revealing many poorly supported branches concentrated near the tips of the tree, where data are sparse and the limiting effects of this sparseness are stronger. We argue that limits to phylogenetic inference and signal imposed by low data coverage may pose significant challenges for comprehensive phylogenetic inference at the species level. Computational requirements provide additional limits for large reconstructions, but these may be overcome by methodological advances, whereas insufficient data coverage can only be remedied by additional sampling effort. We conclude that public databases have exceptional value for modern systematics and evolutionary biology, and that a continued emphasis on expanding taxonomic and genomic coverage will play a critical role in developing
Directory of Open Access Journals (Sweden)
Chapman Tracey
2008-08-01
Full Text Available Abstract Background Exaggerated male ornaments and displays often evolve in species where males only provide females with ejaculates during reproduction. Although "good genes" arguments are typically invoked to explain this phenomenon, a simpler alternative is possible if variation in male reproductive quality (e.g. sperm number, ejaculate content, mating rate is an important determinant of female reproductive success. The "phenotype-linked fertility hypothesis" states that female preference for male ornaments or displays has been selected to ensure higher levels of fertility and has driven the evolution of exaggerated male traits. Females of the stalk-eyed fly Teleopsis dalmanni must mate frequently to maintain high levels of fertility and prefer to mate with males exhibiting large eyespan, a condition-dependent sexual ornament. If eyespan indicates male reproductive quality, females could directly increase their reproductive success by mating with males with large eyespan. Here we investigate whether male eyespan indicates accessory gland and testis length, and then ask whether mating with large eyespan males affects female fertility. Results Male eyespan was a better predictor of two key male reproductive traits – accessory gland and testis length – than was body size alone. This positive relationship held true over three levels of increasing environmental stress during the maturation of the adult accessory glands and testes. Furthermore, females housed with a large eyespan male exhibited higher levels of fertility than those with small eyespan males. Conclusion Male eyespan in stalk-eyed flies is subject to strong directional mate preference and is a reliable indicator of male reproductive quality – both because males with larger eyespan have bigger accessory glands and testes, and also as they confer higher fertility on females. Fertility enhancement may have arisen because males with larger eyespan mated more often and/or because
Larios, Carolina; Casas, Alejandro; Vallejo, Mariana; Moreno-Calles, Ana Isabel; Blancas, José
2013-11-06
The Tehuacán Valley is one of the areas of Mesoamerica with the oldest history of plant management. Homegardens are among the most ancient management systems that currently provide economic benefits to people and are reservoirs of native biodiversity. Previous studies estimated that 30% of the plant richness of homegardens of the region are native plant species from wild populations. We studied in Náhuatl communities the proportion of native plant species maintained in homegardens, hypothesizing to find a proportion similar to that estimated at regional level, mainly plant resources maintained for edible, medicinal and ornamental purposes. We analysed the composition of plant species of homegardens and their similarity with surrounding Cloud Forest (CF), Tropical Rainforest (TRF), Tropical Dry forest (TDF), and Thorn-Scrub Forest (TSF). We determined density, frequency and biomass of plant species composing homegardens and forests through vegetation sampling of a total of 30 homegardens and nine plots of forests, and documented ethnobotanical information on use, management, and economic benefits from plants maintained in homegardens. A total of 281 plant species was recorded with 12 use categories, 115 ornamental, 92 edible, and 50 medicinal plant species. We recorded 49.8 ± 23.2 (average ± S.D.) woody plant species (shrubs and trees) per homegarden. In total, 34% species are native to the Tehuacán Valley and nearly 16% are components of the surrounding forests. A total of 176 species were cultivated through seeds, vegetative propagules or transplanted entire individual plants, 71 tolerated, and 23 enhanced. The highest species richness and diversity were recorded in homegardens from the CF zone (199 species), followed by those from the TRF (157) and those from the TDF (141) zones. Homegardens provide a high diversity of resources for subsistence of local households and significantly contribute to conservation of native biodiversity. The highest diversity was
Selvakumar, M; Pawar, Harpreet Singh; Francis, Nimmy K; Das, Bodhisatwa; Dhara, Santanu; Chattopadhyay, Santanu
2016-03-09
Guided bone regeneration (GBR) scaffolds are unsuccessful in many clinical applications due to a high incidence of postoperative infection. The objective of this work is to fabricate GBR with an anti-infective electrospun scaffold by ornamenting segmented polyurethane (SPU) with two-dimensional Aloe vera wrapped mesoporous hydroxyapatite (Al-mHA) nanorods. The antimicrobial characteristic of the scaffold has been retrieved from the prepared Al-mHA frame with high aspect ratio (∼14.2) via biosynthesis route using Aloe vera (Aloe barbadensis miller) extract. The Al-mHA frame was introduced into an unprecedented SPU matrix (solution polymerized) based on combinatorial soft segments of poly(ε-caprolactone) (PCL), poly(ethylene carbonate) (PEC), and poly(dimethylsiloxane) (PDMS), by an in situ technique followed by electrospinning to fabricate scaffolds. For comparison, pristine mHA nanorods are also ornamented into it. An enzymatic ring-opening polymerization technique was adapted to synthesize soft segment of (PCL-PEC-b-PDMS). Structure elucidation of the synthesized polymers is established by nuclear magnetic resonance spectroscopy. Sparingly, Al-mHA ornamented scaffolds exhibit tremendous improvement (175%) in the mechanical properties with promising antimicrobial activity against various human pathogens. After confirmation of high osteoconductivity, improved biodegradation, and excellent biocompatibility against osteoblast-like MG63 cells (in vitro), the scaffolds were implanted in rabbits as an animal model by subcutaneous and intraosseous (tibial) sites. Improved in vivo biocompatibilities, biodegradation, osteoconductivity, and the ability to provide an adequate biomimetic environment for biomineralization for GBR of the scaffolds (SPU and ornamented SPUs) have been found from the various histological sections. Early cartilage formation, endochondral ossification, and rapid bone healing at 4 weeks were found in the defects filled with Al-mHA ornamented
Directory of Open Access Journals (Sweden)
Daniel Shane Wright
Full Text Available Sexual selection drives the evolution of exaggerated male ornaments in many animal species. Female ornamentation is now acknowledged also to be common but is generally less well understood. One example is the recently documented red female throat coloration in some threespine stickleback (Gasterosteus aculeatus populations. Although female sticklebacks often exhibit a preference for red male throat coloration, the possibility of sexual selection on female coloration has been little studied. Using sequential and simultaneous mate choice trials, we examined male mate preferences for female throat color, as well as pelvic spine color and standard length, using wild-captured threespine sticklebacks from the Little Campbell River, British Columbia. In a multivariate analysis, we found no evidence for a population-level mate preference in males, suggesting the absence of directional sexual selection on these traits arising from male mate choice. Significant variation was detected among males in their preference functions, but this appeared to arise from differences in their mean responsiveness across mating trials and not from variation in the strength (i.e., slope of their preference, suggesting the absence of individual-level preferences as well. When presented with conspecific intruder males, male response decreased as intruder red throat coloration increased, suggesting that males can discriminate color and other aspects of phenotype in our experiment and that males may use these traits in intrasexual interactions. The results presented here are the first to explicitly address male preference for female throat color in threespine sticklebacks.
Wright, Daniel Shane; Pierotti, Michele E R; Rundle, Howard D; McKinnon, Jeffrey S
2015-01-01
Sexual selection drives the evolution of exaggerated male ornaments in many animal species. Female ornamentation is now acknowledged also to be common but is generally less well understood. One example is the recently documented red female throat coloration in some threespine stickleback (Gasterosteus aculeatus) populations. Although female sticklebacks often exhibit a preference for red male throat coloration, the possibility of sexual selection on female coloration has been little studied. Using sequential and simultaneous mate choice trials, we examined male mate preferences for female throat color, as well as pelvic spine color and standard length, using wild-captured threespine sticklebacks from the Little Campbell River, British Columbia. In a multivariate analysis, we found no evidence for a population-level mate preference in males, suggesting the absence of directional sexual selection on these traits arising from male mate choice. Significant variation was detected among males in their preference functions, but this appeared to arise from differences in their mean responsiveness across mating trials and not from variation in the strength (i.e., slope) of their preference, suggesting the absence of individual-level preferences as well. When presented with conspecific intruder males, male response decreased as intruder red throat coloration increased, suggesting that males can discriminate color and other aspects of phenotype in our experiment and that males may use these traits in intrasexual interactions. The results presented here are the first to explicitly address male preference for female throat color in threespine sticklebacks.
Aquatic Plant/microbial Filters for Treating Septic Tank Effluent
Wolverton, B. C.
1988-01-01
The use of natural biological processes for treating many types of wastewater have been developed by NASA at the John C. Stennis Space Center, NSTL, Mississippi, during the past 15 years. The simplest form of this technology involves the use of aquatic plant/marsh filters for treatment of septic tank effluent. Septic tank effluent from single home units can be treated to advanced secondary levels and beyond by using a 37.2 sq m (400 sq ft) surface area washed gravel filter. This filter is generally 0.3 m (1 ft) deep with a surface cover of approximately 0.15 m (6 in.) of gravel. The plants in this filter are usually aesthetic or ornamental such as calla lily (Zantedeschia aethiopica), canna lily (Canna flaccida), elephant ear (Colocasia esculenta), and water iris (Iris pseudacorus).
Energy Technology Data Exchange (ETDEWEB)
Espín de Gea, A.; Reyes Urquiza, M.; Gil Abellán, A.
2017-09-01
The ornamental rock sector, particularly the investigation of deposits, is not readily given to the incorporation of new technologies. The Marble Technology Center (CTM) has made advances in this sector with the implementation of geophysical techniques able to obtain subsurface information. There are still a few outcrops and active quarries where joint geophysical techniques have been applied sufficiently to obtain a three-dimensional model of the study area. The application of geophysics and more specifically, ground penetrating radar, electrical tomography and seismic refraction, when conducting research of a reservoir or outcrop, is only slightly aggressive to the environment, allowing a real knowledge of the characteristics before beginning the more aggressive work, as is the case when conducting surveys and test pits which can subsequently complement the data obtained. This makes it possible to gain a good idea of the quality of the reservoir thus allowing optimization of resources, both financial and environmental beforehand. Several studies conducted by the CTM illustrate the benefits brought by the application of these geophysical techniques as well as the weaknesses within the characteristics of the extraction sites and ornamental rock outcrops. [Spanish] El sector de la roca ornamental, y más concretamente la investigación de los yacimientos, es poco dado a la incorporación de nuevas tecnologías. El Centro Tecnológico del Mármol (CTM) avanza en este sector con la utilización de técnicas geofísicas capaces de obtener información del subsuelo. Existen todavía pocos afloramientos y canteras activas donde se hayan aplicado técnicas geofísicas de manera conjunta y con la intensidad suficiente como para obtener un modelo tridimensional de la zona estudiada. La aplicación de diversas metodologías geofísicas, y más concretamente georadar, tomografía eléctrica y sísmica de refracción, a la hora de realizar la investigación de un yacimiento o
Use your eyes - metallographic versus superficial traces of the crafting of Bronze Age ornaments
DEFF Research Database (Denmark)
Nørgaard, Heide Wrobel
and superficial archaeological examinations can be used to understand prehistoric craft. Furthermore, it will show that with an intensive knowledge about previous scientific investigations the superficial traces preserved can reveal a great amount of information and could talk for themselves. Taking as an example...... the early and middle Bronze Age bronze ornaments from North Germany, superficial traces of the metal crafting process, visible with the naked eye, will be compared with metallographic images. The aim of this presentation is to give an overview over the crafting traces everybody could see (with a bit...
Plant DNA sequences from feces: potential means for assessing diets of wild primates.
Bradley, Brenda J; Stiller, Mathias; Doran-Sheehy, Diane M; Harris, Tara; Chapman, Colin A; Vigilant, Linda; Poinar, Hendrik
2007-06-01
Analyses of plant DNA in feces provides a promising, yet largely unexplored, means of documenting the diets of elusive primates. Here we demonstrate the promise and pitfalls of this approach using DNA extracted from fecal samples of wild western gorillas (Gorilla gorilla) and black and white colobus monkeys (Colobus guereza). From these DNA extracts we amplified, cloned, and sequenced small segments of chloroplast DNA (part of the rbcL gene) and plant nuclear DNA (ITS-2). The obtained sequences were compared to sequences generated from known plant samples and to those in GenBank to identify plant taxa in the feces. With further optimization, this method could provide a basic evaluation of minimum primate dietary diversity even when knowledge of local flora is limited. This approach may find application in studies characterizing the diets of poorly-known, unhabituated primate species or assaying consumer-resource relationships in an ecosystem. (c) 2007 Wiley-Liss, Inc.
Phytoliths as Emerging Taxonomic Tools for Identification of Plants: An Overview
Directory of Open Access Journals (Sweden)
Sheikh Abdul Shakoor
2014-01-01
Full Text Available In the recent advancements in identification of plant species, phytoliths have found an immense role in the identification of plants at different levels of taxonomic hierarchy. Many plant groups are known to accumulate silica in solid form in and between the cells and tissues and hence create the structures commonly known as phytoliths. These phytoliths create replicas of the structures where they are deposited. The shapes of phytolith replicas, their size dimensions (morphometric parameters, surface features (ornamentation, distribution, and orientation pattern in epidermal layers of vegetative and reproductive structures as well as their frequency are highly important for characterization of species. Monocotyledonous families particularly the family Poaceae (Gramineae are known to produce diverse phytolith types that can serve as diagnostic markers for characterization of different taxa at different levels of taxonomic hierarchy. The present paper highlights the importance of phytoliths in taxonomic analysis of plants particularly in the family Poaceae.
Plant life forms in thermal regulation and self purification of urban housing environments
Energy Technology Data Exchange (ETDEWEB)
Raza, S H [Osmania Univ., Ecology and Environmental Studies Div., Hyderabad (India)
1995-12-01
This article is concerned with the air quality of the closed indoor environment with respect to its temperature and carbon dioxide levels and with the assessment of management practices that have been used to reduce temperature and carbon dioxide levels with the help of certain plants. Phanerophytic lifeforms, such as trees, shrubs, herbs and creepers surrounding dwellings can be shown to produce a cooling effect, reducing temperatures by up to 11{sup o}C. Certain succulent plants like Kalanchoe marmorata, Bryophyllum pinnata and Apicra deltoideae were observed under experimental conditions to reduce carbon dioxide levels up to 90% from closed chambers under dark conditions. Certain ornamental plants such as Verbena bipinnatifida and Ixora coccinea could remove 63-75% of carbon dioxide from closed indoor environments in the presence of light. (author) 3 tabs., 11 refs.
Directory of Open Access Journals (Sweden)
Jeong Ho Park
2018-06-01
Full Text Available The floristic inventory of vascular plants in Nam Ha National Biodiversity Conservation Area was conducted to understand the plant diversity in the northern area of Lao People's Democratic Republic. From the joint field surveys between Korean and Laos experts conducted during 2015–2017, it was found that there are 64 families, 145 genera, and 189 species distributed in the Nam Ba National Biodiversity Conservation Area, and a total of 56 families, 117 genera, and 148 species which comprise more than 78% of the total species were identified as endemic plants to the Lao People's Democratic Republic. Considering the usage of the plants, there are 91 species of medicinal plants, 33 species of ornamental plants, eight species of edible plants, and 16 species of economic plants. In addition, it was found out that Dalbergia balansae and Cinnamomum macrocarpum are categorized as vulnerable in the International Union for Conservation of Nature (IUCN Red list, and 13 more species are categorized as the least concern.
Directory of Open Access Journals (Sweden)
ANAND S. BISHT
2014-04-01
Full Text Available Bisht AS, Sharma KD. 2014. Plants utilization by the communities of Bharsar and adjoining area of Pauri Garhwal District, Uttarakhand, India. Biodiversitas 15: 92-98. Garhwal Himalaya possesses luxuriant a varied vegetation with in the Himalaya region. Almost every plant has economic value in the form of shelter, food, water, medicine, fuel and industrial products and fodder. Surveys were conducted in entire Bharsar, Pauri Garhwal district of Uttarakhand, India in order to get information on traditional uses of plants by local inhabitants. A total of 169 plants were collected of which 40 species of vegetables, 19 species of forest and agroforestry, 24 species of ornamental flower, 71 species of less known medicinal plants and 15 species of agricultural crops were found economically important as they are used by the people frequently for various purposes.
Comparative study of ornamental granite cleaning using femtosecond and nanosecond pulsed lasers
Energy Technology Data Exchange (ETDEWEB)
Rivas, T., E-mail: trivas@uvigo.es [Dpto. Ingeniería de los Recursos Naturales y Medioambiente. E.T.S. Ingeniería de Minas, Universidad de Vigo, 36200 Vigo Spain (Spain); Lopez, A.J.; Ramil, A. [Centro de Investigaciones Tecnológicas. Campus de Esteiro. Universidad de A Coruña 15403 Ferrol Spain (Spain); Pozo, S. [Dpto. Ingeniería de los Recursos Naturales y Medioambiente. E.T.S. Ingeniería de Minas, Universidad de Vigo, 36200 Vigo Spain (Spain); Fiorucci, M.P. [Centro de Investigaciones Tecnológicas. Campus de Esteiro. Universidad de A Coruña 15403 Ferrol Spain (Spain); Silanes, M.E. López de [Dpto. Ingeniería de los Recursos Naturales y Medioambiente. E.I. Forestales. Universidad de Vigo, Campus Pontevedra. 36005 Pontevedra Spain (Spain); García, A.; Aldana, J. R. Vazquez de; Romero, C.; Moreno, P. [Grupo de Investigación en Microprocesado de Materiales con Laser. Facultad de Ciencias, Universidad de Salamanca, 37008 Salamanca Spain (Spain)
2013-08-01
Granite has been widely used as a structural and ornamental element in public works and buildings. In damp climates it is almost permanently humid and its exterior surfaces are consequently biologically colonized and blackened We describe a comparative analysis of the performance of two different laser sources in removing biological crusts from granite surfaces: nanosecond Nd:YVO{sub 4} laser (355 nm) and femtosecond Ti:Sapphire laser at its fundamental wavelength (790 nm) and second harmonic (395 nm). The granite surface was analyzed using scanning electron microscopy, attenuated total reflection – Fourier transform infrared spectroscopy and profilometry, in order to assess the degree of cleaning and to characterize possible morphological and chemical changes caused by the laser sources.
Comparative study of ornamental granite cleaning using femtosecond and nanosecond pulsed lasers
International Nuclear Information System (INIS)
Rivas, T.; Lopez, A.J.; Ramil, A.; Pozo, S.; Fiorucci, M.P.; Silanes, M.E. López de; García, A.; Aldana, J. R. Vazquez de; Romero, C.; Moreno, P.
2013-01-01
Granite has been widely used as a structural and ornamental element in public works and buildings. In damp climates it is almost permanently humid and its exterior surfaces are consequently biologically colonized and blackened We describe a comparative analysis of the performance of two different laser sources in removing biological crusts from granite surfaces: nanosecond Nd:YVO 4 laser (355 nm) and femtosecond Ti:Sapphire laser at its fundamental wavelength (790 nm) and second harmonic (395 nm). The granite surface was analyzed using scanning electron microscopy, attenuated total reflection – Fourier transform infrared spectroscopy and profilometry, in order to assess the degree of cleaning and to characterize possible morphological and chemical changes caused by the laser sources.
Maloukh, Lina; Kumarappan, Alagappan; Jarrar, Mohammad; Salehi, Jawad; El-Wakil, Houssam; Rajya Lakshmi, T V
2017-06-01
DNA barcoding of United Arab Emirates (UAE) native plants is of high practical and scientific value as the plants adapt to very harsh environmental conditions that challenge their identification. Fifty-one plant species belonged to 22 families, 2 monocots, and 20 eudicots; a maximum number of species being legumes and grasses were collected. To authenticate the morphological identification of the wild plant taxa, rbcL and matK regions were used in the study. The primer universality and discriminatory power of rbcL is 100%, while it is 35% for matK locus for these plant species. The sequences were submitted to GenBank; accession numbers were obtained for all the rbcL sequences and for 6 of matK sequences. We suggest rbcL as a promising barcode locus for the tested group of 51 plants. In the present study, an inexpensive, simple method of identification of rare desert plant taxa through rbcL barcode is being reported.
Ornamental fish in pet stores in Greece: a threat to biodiversity?
Directory of Open Access Journals (Sweden)
I. PAPAVLASOPOULOU
2013-12-01
Full Text Available The aquarium trade has been recognized as an important pathway for the introduction of invasive species around the world. This study investigates the availability of ornamental fish species in ten large-size, centrally positioned aquarium stores that control a large share of imports and the Hellenic market chain, and aims to provide a provisional checklist on the aquarium fish trade in Greece. For each recorded species, additional data concerning various aspects (e.g. natural environment, native range, established as aliens, conservation status and threats to humans were collected from Fishbase, IUCN red list and the scientific literature. Overall, 326 fish species belonging to 64 families were reported according to the store labels. The majority of the species recorded were freshwater (66%, originating mainly from South America and Asia, while most of the marine species (26% had primarily an Indo-Pacific native distribution. Among the freshwater fishes, Cichlidae and Cyprinidae were the dominant families with 64 and 27 species, respectively, while the family Acanthuridae dominated within the marine fishes with ten species. The vast majority of both freshwater and marine species (>90% were tropical. Concerning the presence of alien species, 62 ornamental species have been established outside their natural range, with 22 of them positively confirmed as aliens in the European waters. Moreover, 25 species were listed in the critically endangered (CR, endangered (EN and vulnerable (VU categories of the IUCN red list. Even more surprisingly, for 192 species recorded, data were missing to assign their conservation status or had not been assessed at all. Finally, the majority of the species (84% were harmless to humans. However, 35 species (11% were recognised as potentially harmful (i.e. venomous, ciguatera poisoning, traumatogenic and two were found to be poisonous if consumed. In conclusion, the aquarium fish sector in Greece is practically
Directory of Open Access Journals (Sweden)
Valentina ePasseri
2016-02-01
Full Text Available In the last decade plant biotechnologists and breeders have made several attempt to improve the antioxidant content of plant-derived food. Most efforts concentrated on increasing the synthesis of antioxidants, in particular anthocyanins, by inducing the transcription of genes encoding the synthesizing enzymes. We present here an overview of economically interesting plant species, both food crops and ornamentals, in which anthocyanin content was improved by traditional breeding or transgenesis. Old genetic studies in petunia and more recent biochemical work in brunfelsia, have shown that after synthesis and compartmentalization in the vacuole, anthocyanins need to be stabilized to preserve the color of the plant tissue over time. The final yield of antioxidant molecules is the result of the balance between synthesis and degradation. Therefore the understanding of the mechanism that determine molecule stabilization in the vacuolar lumen is the next step that needs to be taken to further improve the anthocyanin content in food.In several species a phenomenon known as fading is responsible for the disappearance of pigmentation which in some case can be nearly complete. We discuss the present knowledge about the genetic and biochemical factors involved in pigment preservation/destabilization in plant cells.The improvement of our understanding of the fading process will supply new tools for both biotechnological approaches and marker-assisted breeding.
Maggini, Valentina; De Leo, Marinella; Mengoni, Alessio; Gallo, Eugenia Rosaria; Miceli, Elisangela; Reidel, Rose Vanessa Bandeira; Biffi, Sauro; Pistelli, Luisa; Fani, Renato; Firenzuoli, Fabio; Bogani, Patrizia
2017-12-05
The influence of the interaction(s) between the medicinal plant Echinacea purpurea (L.) Moench and its endophytic communities on the production of alkamides is investigated. To mimic the in vivo conditions, we have set up an infection model of axenic in vitro E. purpurea plants inoculated with a pool of bacterial strains isolated from the E. purpurea stems and leaves. Here we show different alkamide levels between control (not-inoculated) and inoculated plants, suggesting that the alkamide biosynthesis may be modulated by the bacterial infection. Then, we have analysed the branched-chain amino acids (BCCA) decarboxylase gene (GenBank Accession #LT593930; the enzymatic source for the amine moiety formation of the alkamides) expression patterns. The expression profile shows a higher expression level in the inoculated E. purpurea tissues than in the control ones. These results suggest that the plant-endophyte interaction can influence plant secondary metabolism affecting the therapeutic properties of E. purpurea.
Källqvist, Torsten; Borgå, Katrine; Dirven, Hubert; Eklo, Ole Martin; Grung, Merete; Lyche, Jan Ludvig; Låg, Marit; Nilsen, Asbjørn Magne; Sverdrup, Line Emilie
2014-01-01
Nemasys G and Nemasys H with the nematode Heterorhabditis bacteriophora as the active organism is applied for as a plant protection product in Norway. Nemasys G is intended for use against the garden chafer (Phyllopertha horticola) in lawns and Nemasys H against black vine weevil (Otiorhynchus sulcatus) in strawberries and ornamentals. VKM was requested by the Norwegian Food Safety Authority to consider the possible health and environmental risk related to the properties of Nemasys G and Nema...
Hydroponic cultivation techniques: good results with Eg system
Energy Technology Data Exchange (ETDEWEB)
Mimiola, G; Sigliuzzo, C [Tecnagro, Valenzano (Italy)
1988-12-01
This report describes results obtained at the Tecnagro agronomic institute (Valenzano, Italy) in which research is being carried out on the use of the Eg hydroponic system developed in Israel. The research program examined the following: composition of nutritive solutions for ornamental plants and vegetables, methods of application of nutritive substances, breeding densities for ornamental plants and vegetables. Successful nutritive formulas were obtained which resulted, in the case of ornamental plants, in increases in plant height (from 30 to 50%), foliage area (50%), as well as, in shortened growth cycles. For vegetables, shortened growth cycles were developed along with a greater and more consistant production. From the economics point of view, tomatoes proved to be the best choice of vegetable for cultivation with the Eg technique.
Ross, Christel Anne
2009-01-01
Invasive species are a major threat to global biodiversity and cause significant economic costs. Studying biological invasions is both essential for preventing future invasions and is also useful in order to understand basic ecological processes. Christel Ross investigates whether evolutionary changes by plant breeding are a relevant factor for the invasion success of Mahonia aquifolium in Germany. Her findings show that invasive populations differ from native populations in quantitative-genetic traits and molecular markers, whereas their genetic diversity is similar. She postulates that these evolutionary changes are rather a result of plant breeding, which includes interspecific hybridisation, than the result of a genetic bottleneck or the releases from specialist herbivores.
Llorente, Berta E; Alasia, María A; Larraburu, Ezequiel E
2016-01-25
Biofertilization with plant growth-promoting rhizobacteria is a potential alternative to plant productivity. Here, in vitro propagation of Handroanthus ochraceus (yellow lapacho), a forest crop with high economic and environmental value, was developed using the Azospirillum brasilense strains Cd and Az39 during rhizogenesis. Epicotiles of in vitro plantlets were multiplied in Woody Plant Medium (WPM). For rooting, elongated shoots were transferred to auxin-free Murashige-Skoog medium with Gamborg's vitamins and WPM, both at half salt concentration (½MSG and ½WPM), and inoculated with Cd or Az39 at the base of each shoot. Anatomical studies were performed using leaves cleared and stained with safranin for optical microscopy and leaves and roots metalized with gold-palladium for scanning electron microscopy (SEM). In ½WPM auxin-free medium, A. brasilense Cd inoculation produced 55% of rooting, increased root fresh and dry weight (45% and 77%, respectively), and led to lower stomata size and density with similar proportion of open and closed stomata. Both strains selectively increased the size or density of glandular trichomes in ½MSG. Moreover, bacteria were detected on the root surface by SEM. In conclusion, the difference in H. ochraceus response to A. brasilense inoculation depends on the strain and the plant culture media. Cd strain enhanced rooting in auxin-free ½WPM and produced plantlets with features similar to those expected in ex vitro plants. This work presents an innovative in vitro approach using beneficial plant-microorganism interaction as an ecologically compatible strategy in plant biotechnology. Copyright © 2015 Elsevier B.V. All rights reserved.
Biosolid-borne tetracyclines and sulfonamides in plants.
Mathews, Shiny; Reinhold, Dawn
2013-07-01
Tetracyclines and sulfonamides used in human and animal medicine are released to terrestrial ecosystems from wastewater treatment plants or by direct manure application. The interactions between plants and these antibiotics are numerous and complex, including uptake and accumulation, phytometabolism, toxicity responses, and degradation in the rhizosphere. Uptake and accumulation of antibiotics have been studied in plants such as wheat, maize, potato, vegetables, and ornamentals. Once accumulated in plant tissue, organic contaminants can be metabolized through a sequential process of transformation, conjugation through glycosylation and glutathione pathways, and ultimately sequestration into plant tissue. While studies have yet to fully elucidate the phytometabolism of tetracyclines and sulfonamides, an in-depth review of plant and mammalian studies suggest multiple potential transformation and conjugation pathways for tetracyclines and sulfonamides. The presence of contaminants in the vicinity or within the plants can elicit stress responses and defense mechanisms that can help tolerate the negative effects of contaminants. Antibiotics can change microbial communities and enzyme activity in the rhizosphere, potentially inducing microbial antibiotic resistance. On the other hand, the interaction of microbes and root exudates on pharmaceuticals in the rhizosphere can result in degradation of the parent molecule to less toxic compounds. To fully characterize the environmental impacts of increased antibiotic use in human medicine and animal production, further research is essential to understand the effects of different antibiotics on plant physiology and productivity, uptake, translocation, and phytometabolism of antibiotics, and the role of antibiotics in the rhizosphere.
Potential plant poisonings in dogs and cats in southern Africa : review article
Directory of Open Access Journals (Sweden)
C.J. Botha
2009-05-01
Full Text Available Plant poisoning occurs less commonly in dogs and cats than in herbivorous livestock, but numerous cases have been documented worldwide, most of them caused by common and internationally widely cultivated ornamental garden and house plants. Few cases of poisoning of cats and dogs have been reported in southern Africa, but many of the plants that have caused poisoning in these species elsewhere are widely available in the subregion and are briefly reviewed in terms of toxic principles, toxicity, species affected, clinical signs, and prognosis. The list includes Melia azedarach (syringa, Brunfelsia spp. (yesterday, today and tomorrow, Datura stramonium (jimsonweed, stinkblaar, a wide variety of lilies and lily-like plants, cycads, plants that contain soluble oxalates, plants containing cardiac glycosides and other cardiotoxins and euphorbias (Euphorbia pulcherrima, E. tirucalli. Poisoning by plant products such as macadamia nuts, onions and garlic, grapes and raisins, cannabis (marijuana, dagga or hashish and castor oil seed or seedcake is also discussed. Many of the poisonings are not usually fatal, but others frequently result in death unless rapid action is taken by the owner and the veterinarian, underlining the importance of awareness of the poisonous potential of a number of familiar plants.
Rationalization of a genebank cucumber collection with SSR markers
Dooijeweert, van W.; Treuren, van R.
2012-01-01
The CGN cucumber (Cucumis sativus) collection consists of 937 accessions. The majority of accessions originated from the working collection of the former Institute for Horticultural Plant Breeding (IVT), where they were used for breeding. The collection mainly includes old cultivars received from
International Nuclear Information System (INIS)
Durán Suárez, J.A.; García Casco, A.
2017-01-01
The technique of volumetric reintegration in severely deteriorated stone materials is of major importance for the restoration of architectural heritage. In using mortars for restoration it is important to control aspects such as the colour and textural similarity in relation to the adjacent stone, minor or equal strength and equal or greater porosity/permeability with respect to the original stone. This latter aspect is of particular complexity because the percentage distribution of pore-size ranges should not differ from that of the original stone material. The invention patent (with numbers of publication ES2187245 A1 and B1 16. 06. 2004), owned by the University of Granada, allows the production of excellent porous stones for decorative work in construction and mortar for restoration of stone materials with controlled porosity. Both materials consist of ornamental rock waste, so that a particular recycling purpose is given to this type of material which is difficult to reuse. In this paper we present the manufacturing process of these artificial stones and porous mortars with decorative and restorative purposes, from the controlled mixture of aggregates of ornamental rocks, organic and inorganic binders and generators of porosity. Once the curing and hardening has been done it is worth noting that one of the most important aspects of the product is the generation of a complex connected porous system as a result of the incorporation of crushed expanded polystyrene, which is activated after hardening through the application of organic solvents. [es
Directory of Open Access Journals (Sweden)
Radin Mohamed Radin Maya Saphira
2017-01-01
Full Text Available The present study aimed to reuse of ablution water for washing peat soil in order to reduce the concentrations of heavy metals in these soils which might effect negatively on the plant growth. The washing process design was similar to horizontal subsurface flow constructed wetlands (HSSFCW consist of layers of peat and sand soil and surrounded by gravel on both sides. Strelitzia sp. was used to detect the presence negative effect of the washing process on the morphological characteristics of the plants. The physical and chemical characteristics of ablution water was examined before and after the washing process by using Inductively Couple Plasma- Mass Spectrometer (ICP-MS Atomic Absorption Spectrometer (AAS. The characteristics of peat soil before and after the washing process were examined by using X-Ray Fluorescence (XRF. The results revealed that the percentage of FeO3in peat soil reduced from 45.80 to 1.01%. The percentage of SiO2 in sand soil dropped from 87.7 to 67.10%. Parameters of ablution water resulted from the washing process which including Biological Oxygen Demand (BOD5 and heavy metals have increased but still within the standard limits for the disposal of ablution water into the environment. No atrophy was observed in Strelitzia sp. leaves, indicating the ability of plant to grow normally. It can be concluded that the utilization of ablution water in the washing of peat soil has improve the characteristics of the soil without effect on their organic constitutes.
Imaging-based logics for ornamental stone quality chart definition
Bonifazi, Giuseppe; Gargiulo, Aldo; Serranti, Silvia; Raspi, Costantino
2007-02-01
Ornamental stone products are commercially classified on the market according to several factors related both to intrinsic lythologic characteristics and to their visible pictorial attributes. Sometimes these latter aspects prevail in quality criteria definition and assessment. Pictorial attributes are in any case also influenced by the performed working actions and the utilized tools selected to realize the final stone manufactured product. Stone surface finishing is a critical task because it can contribute to enhance certain aesthetic features of the stone itself. The study was addressed to develop an innovative set of methodologies and techniques able to quantify the aesthetic quality level of stone products taking into account both the physical and the aesthetical characteristics of the stones. In particular, the degree of polishing of the stone surfaces and the presence of defects have been evaluated, applying digital image processing strategies. Morphological and color parameters have been extracted developing specific software architectures. Results showed as the proposed approaches allow to quantify the degree of polishing and to identify surface defects related to the intrinsic characteristics of the stone and/or the performed working actions.
Directory of Open Access Journals (Sweden)
Nilufar Z. Mamadalieva
2017-02-01
Full Text Available Plants of the Lamiaceae family are important ornamental, medicinal, and aromatic plants, many of which produce essential oils that are used in traditional and modern medicine, and in the food, cosmetics, and pharmaceutical industry. Various species of the genera Hyssopus, Leonurus, Mentha, Nepeta, Origanum, Perovskia, Phlomis, Salvia, Scutellaria, and Ziziphora are widespread throughout the world, are the most popular plants in Uzbek traditional remedies, and are often used for the treatment of wounds, gastritis, infections, dermatitis, bronchitis, and inflammation. Extensive studies of the chemical components of these plants have led to the identification of many compounds, as well as essentials oils, with medicinal and other commercial values. The purpose of this review is to provide a critical overview of the literature surrounding the traditional uses, ethnopharmacology, biological activities, and essential oils composition of aromatic plants of the family Lamiaceae, from the Uzbek flora.
Czech Academy of Sciences Publication Activity Database
Aremu, A.O.; Plačková, Lenka; Masondo, N.A.; Amoo, S.O.; Moyo, M.; Novák, Ondřej; Doležal, Karel; Van Staden, J.
2017-01-01
Roč. 82, č. 2 (2017), s. 305-315 ISSN 0167-6903 R&D Projects: GA MŠk LK21306; GA MŠk(CZ) LO1204; GA ČR GA14-34792S Institutional support: RVO:61389030 Keywords : adventitious bud formation * zeatin-type cytokinins * in-vitro * cv ronina * endogenous cytokinin * biological -activity * bulb production * south-africa * biotechnology * organogenesis * Asparagaceae * Floriculture * Phytohormones * Physiological disorders * meta-Topolin * Ornamentals Subject RIV: EF - Botanics OBOR OECD: Plant sciences, botany Impact factor: 2.646, year: 2016
Fresh from the Ornamental Garden: Hips of Selected Rose Cultivars Rich in Phytonutrients.
Cunja, Vlasta; Mikulic-Petkovsek, Maja; Weber, Nika; Jakopic, Jerneja; Zupan, Anka; Veberic, Robert; Stampar, Franci; Schmitzer, Valentina
2016-02-01
Morphological parameters (size, weight, color), the content of sugars, organic acids, lycopene, β-carotene, and phenolics were determined in hips of Rosa canina (RCA), Rosa sweginzowii (RSW), Rosa rugosa (RUG), and selected ornamental Rosa cultivars Fru Dagmar Hastrup (FDH), Repandia (REP), Veilchenblau (RVB), Aloha (RAL), Bonica (BON), and Golden Gate (RGG). Although traditionally used RCA hips contained the highest amount of cyanidin-3-glucoside (83 μg/g DW) and were the reddest (h° = 17.5), they did not stand out in other analyzed parameters. RGG climber had the biggest hips (8.86 g), which also contained highest sugar levels (50.9 g/100 g DW). RAL stood out as the cultivar rich in organic acids (33.9 g/100 g DW), mainly because of high quinic acid content (17.6 g/100g DW). FDH and RSW hips were characterized by particularly high ascorbic acid levels (4325 mg/100 g DW and 4711 mg/100 g DW). Other ornamental cultivars contained low amounts of ascorbic acid compared to the analyzed species. The phenolic profile was species/cultivars-specific. The greatest diversity of phenolic compounds was detected in RUG and FDH hips (55 and 54 different tentatively identified compounds with HPLC/MS). Flavanols represented the main phenolic class in most of the investigated species/cultivars and RGG hips contained the highest amount of catechin and proanthocyandin derivatives (15855 μg/g DW). Altogether RAL hips contained the highest quantity of phenolics (44746 μg/g DW) mainly due to high levels of hydrolysable tannins compared to other species/cultivars. Although small, hips of BON and REP were most abundant regarding β-carotene and lycopene content, respectively. © 2016 Institute of Food Technologists®
GenBank blastn search result: AK063309 [KOME
Lifescience Database Archive (English)
Full Text Available AK063309 001-113-G01 E38913.1 Plant cell growth factor precursor polypeptide, gene encoding growth... factor precursor polypeptide and method for promoting plant growth.|PAT PAT 0.0 Plus Plus ...
GenBank blastn search result: AK065420 [KOME
Lifescience Database Archive (English)
Full Text Available AK065420 J013022D10 BD084915.1 DNA sequences encoding the subunit CHLD of plant magnesium... chelatases, and determining the activity of plant magnesium chelatases.|PAT PAT 9e-39 Plus Plus ...
GenBank blastn search result: AK061963 [KOME
Lifescience Database Archive (English)
Full Text Available AK061963 001-042-G05 BD084913.1 DNA sequences encoding the subunit CHLD of plant magnesium... chelatases, and determining the activity of plant magnesium chelatases.|PAT PAT 3e-50 Plus Plus ...
GenBank blastn search result: AK069545 [KOME
Lifescience Database Archive (English)
Full Text Available AK069545 J023025I06 BD084915.1 DNA sequences encoding the subunit CHLD of plant magnesium... chelatases, and determining the activity of plant magnesium chelatases.|PAT PAT 4e-91 Plus Plus ...
GenBank blastn search result: AK104435 [KOME
Lifescience Database Archive (English)
Full Text Available AK104435 006-208-D12 BD084914.1 DNA sequences encoding the subunit CHLD of plant magnesium... chelatases, and determining the activity of plant magnesium chelatases.|PAT PAT 3e-29 Plus Plus ...
GenBank blastn search result: AK062262 [KOME
Lifescience Database Archive (English)
Full Text Available AK062262 001-047-H04 BD084915.1 DNA sequences encoding the subunit CHLD of plant magnesium... chelatases, and determining the activity of plant magnesium chelatases.|PAT PAT 3e-44 Plus Plus ...
GenBank blastn search result: AK066270 [KOME
Lifescience Database Archive (English)
Full Text Available AK066270 J013062C16 BD084914.1 DNA sequences encoding the subunit CHLD of plant magnesium... chelatases, and determining the activity of plant magnesium chelatases.|PAT PAT 5e-29 Plus Plus ...
GenBank blastn search result: AK071134 [KOME
Lifescience Database Archive (English)
Full Text Available AK071134 J023078K03 BD084914.1 DNA sequences encoding the subunit CHLD of plant magnesium... chelatases, and determining the activity of plant magnesium chelatases.|PAT PAT 3e-29 Plus Plus ...
GenBank blastn search result: AK067323 [KOME
Lifescience Database Archive (English)
Full Text Available AK067323 J013106B16 BD084915.1 DNA sequences encoding the subunit CHLD of plant magnesium... chelatases, and determining the activity of plant magnesium chelatases.|PAT PAT 1e-95 Plus Plus ...
GenBank blastn search result: AK060612 [KOME
Lifescience Database Archive (English)
Full Text Available AK060612 001-025-F03 BD084915.1 DNA sequences encoding the subunit CHLD of plant magnesium... chelatases, and determining the activity of plant magnesium chelatases.|PAT PAT 5e-44 Plus Plus ...
GenBank blastn search result: AK060389 [KOME
Lifescience Database Archive (English)
Full Text Available AK060389 001-009-H01 BD084914.1 DNA sequences encoding the subunit CHLD of plant magnesium... chelatases, and determining the activity of plant magnesium chelatases.|PAT PAT 3e-29 Plus Plus ...
GenBank blastn search result: AK287972 [KOME
Lifescience Database Archive (English)
Full Text Available AK287972 J075076D12 DD083450.1 DD083450 Method of accumulating allergen-specific T-cell epitopes in plants... and engineering transgenic plants accumulating T-cell epitopes. PAT 6e-26 1 -1 ...
GenBank blastn search result: AK287985 [KOME
Lifescience Database Archive (English)
Full Text Available AK287985 J075093G10 DD083450.1 DD083450 Method of accumulating allergen-specific T-cell epitopes in plants... and engineering transgenic plants accumulating T-cell epitopes. PAT 1e-27 1 -1 ...
GenBank blastn search result: AK287967 [KOME
Lifescience Database Archive (English)
Full Text Available AK287967 J075068E20 DD083448.1 DD083448 Method of accumulating allergen-specific T-cell epitopes in plants... and engineering transgenic plants accumulating T-cell epitopes. PAT 3e-12 1 -1 ...