WorldWideScience

Sample records for cytosine nucleotides

  1. Flexible double-headed cytosine-linked 2'-deoxycytidine nucleotides. Synthesis, polymerase incorporation to DNA and interaction with DNA methyltransferases

    Czech Academy of Sciences Publication Activity Database

    Kielkowski, Pavel; Cahová, Hana; Pohl, Radek; Hocek, Michal

    2016-01-01

    Roč. 24, č. 6 (2016), s. 1268-1276 ISSN 0968-0896 R&D Projects: GA ČR GBP206/12/G151 Institutional support: RVO:61388963 Keywords : nucleosides * nucleotides * pyrimidines * DNA methyltransferases * DNA polymerases Subject RIV: CC - Organic Chemistry Impact factor: 2.930, year: 2016

  2. Alkylsulfanylphenyl derivatives of cytosine and 7-deazaadenine nucleosides, nucleotides and nucleoside triphosphates. Synthesis, polymerase incorporation to DNA and electrochemical study

    Czech Academy of Sciences Publication Activity Database

    Macíčková-Cahová, Hana; Pohl, Radek; Horáková Brázdilová, Petra; Havran, Luděk; Špaček, Jan; Fojta, Miroslav; Hocek, Michal

    2011-01-01

    Roč. 17, č. 21 (2011), s. 5833-5841 ISSN 0947-6539 R&D Projects: GA MŠk(CZ) LC06035; GA MŠk LC512; GA ČR GA203/09/0317; GA AV ČR(CZ) IAA400040901 Institutional research plan: CEZ:AV0Z40550506; CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : DNA polymerases * electrochemistry * nucleosides * nucleotides * organosulfur compounds Subject RIV: CC - Organic Chemistry Impact factor: 5.925, year: 2011

  3. Metal-ion binding properties of (S)-1-[3-hydroxy-2-(phosphonomethoxy)propyl]cytosine (HPMPC, Cidofovir). A nucleotide analogue with activity against DNA viruses

    Czech Academy of Sciences Publication Activity Database

    Blindauer, C. A.; Sigel, A.; Operschall, B. P.; Holý, Antonín; Sigel, H.

    2018-01-01

    Roč. 472, Mar 1 (2018), s. 283-294 ISSN 0020-1693 Institutional support: RVO:61388963 Keywords : acyclic nucleoside phosphonates * antivirals * chelates * isomeric equilibria * metal ion complexes * nucleotide analogues Subject RIV: CC - Organic Chemistry OBOR OECD: Organic chemistry Impact factor: 2.002, year: 2016

  4. Extent of Intramolecular pi Stacks in Aqueous Solution in Mixed-Ligand Copper(II) Complexes Formed by Heteroaromatic Amines and 1-[2-(Phosphonomethoxy)ethyl]cytosine (PMEC), a Relative of Antivirally Active Acyclic Nucleotide Analogues (Part 72)

    Czech Academy of Sciences Publication Activity Database

    Blindauer, C. A.; Sigel, A.; Operschall, B. P.; Holý, Antonín; Sigel, H.

    2013-01-01

    Roč. 639, 8-9 (2013), s. 1661-1673 ISSN 0044-2313 Institutional support: RVO:61388963 Keywords : nucleotide analogues * antivirals * complex stabilities * isomers * equilibria * mixed ligand complexes Subject RIV: CC - Organic Chemistry Impact factor: 1.251, year: 2013

  5. Photochemistry of DNA containing iodinated cytosine

    Energy Technology Data Exchange (ETDEWEB)

    Rahn, R O; Stafford, R S [Oak Ridge National Lab., TN (USA)

    1979-10-01

    Irradiation at 313 nm of compounds containing iodinated cytosine moieties results in the photolysis of iodine. Photolysis occurs with a quantum yield of 0.022-0.024 for 5-iododeoxycytidine and 5-iododeoxycytidine monophosphate, and 0.004-0.008 for iodinated DNA as well as for iodinated polycytidylate. Photodegradation of the cytosine moiety occurs when air is present during irradiation, presumably due to the reaction of oxygen with the cytosyl radical formed when iodine is lost. This oxygen promoted photodegradation destroys the cytosine chromophore and is complete in the monomers but occurs to only a limited extent in the polymers. In the absence of oxygen or in the presence of ethanol, photodegradation is prevented and the loss of iodine leads exclusively to the formation of the cytosine chromophore. In DNA, the loss of iodine is accompanied by the formation of sugar damage and/or chain breaks. As measured by sedimentation in alkaline sucrose gradients, approximately one break is made for every six iodines lost in denatured DNA. The frequency of chain breakage per iodine photolyzed is reduced 2-fold in renatured DNA. Analysis in neutral gradients suggests that half of the breaks observed in alkali are alkali-labile bonds. Both ethanol and cysteamine reduce the number of chain breaks in alkali by approximately 3-fold.

  6. Nucleotide Metabolism

    DEFF Research Database (Denmark)

    Martinussen, Jan; Willemoës, M.; Kilstrup, Mogens

    2011-01-01

    Metabolic pathways are connected through their utilization of nucleotides as supplier of energy, allosteric effectors, and their role in activation of intermediates. Therefore, any attempt to exploit a given living organism in a biotechnological process will have an impact on nucleotide metabolis...

  7. NSun2-Mediated Cytosine-5 Methylation of Vault Noncoding RNA Determines Its Processing into Regulatory Small RNAs

    Directory of Open Access Journals (Sweden)

    Shobbir Hussain

    2013-07-01

    Full Text Available Autosomal-recessive loss of the NSUN2 gene has been identified as a causative link to intellectual disability disorders in humans. NSun2 is an RNA methyltransferase modifying cytosine-5 in transfer RNAs (tRNAs, yet the identification of cytosine methylation in other RNA species has been hampered by the lack of sensitive and reliable molecular techniques. Here, we describe miCLIP as an additional approach for identifying RNA methylation sites in transcriptomes. miCLIP is a customized version of the individual-nucleotide-resolution crosslinking and immunoprecipitation (iCLIP method. We confirm site-specific methylation in tRNAs and additional messenger and noncoding RNAs (ncRNAs. Among these, vault ncRNAs contained six NSun2-methylated cytosines, three of which were confirmed by RNA bisulfite sequencing. Using patient cells lacking the NSun2 protein, we further show that loss of cytosine-5 methylation in vault RNAs causes aberrant processing into Argonaute-associated small RNA fragments that can function as microRNAs. Thus, impaired processing of vault ncRNA may contribute to the etiology of NSun2-deficiency human disorders.

  8. Microhydration of cytosine and its radical anion: Cytosine.(H2O)n (n=1-5)

    Science.gov (United States)

    Kim, Sunghwan; Schaefer, Henry F.

    2007-02-01

    Microhydration effects on cytosine and its radical anion have been investigated theoretically, by explicitly considering various structures of cytosine complexes with up to five water molecules. Each successive water molecule (through n =5) is bound by 7-10kcalmol-1 to the relevant cytosine complex. The hydration energies are uniformly higher for the analogous anion systems. While the predicted vertical detachment energy (VDE) of the isolated cytosine is only 0.48eV, it is predicted to increase to 1.27eV for the lowest-lying pentahydrate of cytosine. The adiabatic electron affinity (AEA) of cytosine was also found to increase from 0.03to0.61eV for the pentahydrate, implying that the cytosine anion, while questionable in the gas phase, is bound in aqueous solution. Both the VDE and AEA values for cytosine are smaller than those of uracil and thymine for a given hydration number. These results are in qualitative agreement with available experimental results from photodetachment-photoelectron spectroscopy studies of Schiedt et al. [Chem. Phys. 239, 511 (1998)].

  9. Information Thermodynamics of Cytosine DNA Methylation.

    Directory of Open Access Journals (Sweden)

    Robersy Sanchez

    Full Text Available Cytosine DNA methylation (CDM is a stable epigenetic modification to the genome and a widespread regulatory process in living organisms that involves multicomponent molecular machines. Genome-wide cytosine methylation patterning participates in the epigenetic reprogramming of a cell, suggesting that the biological information contained within methylation positions may be amenable to decoding. Adaptation to a new cellular or organismal environment also implies the potential for genome-wide redistribution of CDM changes that will ensure the stability of DNA molecules. This raises the question of whether or not we would be able to sort out the regulatory methylation signals from the CDM background ("noise" induced by thermal fluctuations. Here, we propose a novel statistical and information thermodynamic description of the CDM changes to address the last question. The physical basis of our statistical mechanical model was evaluated in two respects: 1 the adherence to Landauer's principle, according to which molecular machines must dissipate a minimum energy ε = kBT ln2 at each logic operation, where kB is the Boltzmann constant, and T is the absolute temperature and 2 whether or not the binary stretch of methylation marks on the DNA molecule comprise a language of sorts, properly constrained by thermodynamic principles. The study was performed for genome-wide methylation data from 152 ecotypes and 40 trans-generational variations of Arabidopsis thaliana and 93 human tissues. The DNA persistence length, a basic mechanical property altered by CDM, was estimated with values from 39 to 66.9 nm. Classical methylome analysis can be retrieved by applying information thermodynamic modelling, which is able to discriminate signal from noise. Our finding suggests that the CDM signal comprises a language scheme properly constrained by molecular thermodynamic principles, which is part of an epigenomic communication system that obeys the same thermodynamic

  10. Nucleotide Selectivity in Abiotic RNA Polymerization Reactions

    Science.gov (United States)

    Coari, Kristin M.; Martin, Rebecca C.; Jain, Kopal; McGown, Linda B.

    2017-09-01

    In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

  11. Nucleotide Selectivity in Abiotic RNA Polymerization Reactions.

    Science.gov (United States)

    Coari, Kristin M; Martin, Rebecca C; Jain, Kopal; McGown, Linda B

    2017-09-01

    In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

  12. Pleiotropic phenotypes of the salt-tolerant and cytosine ...

    Indian Academy of Sciences (India)

    2SKA Institution for Research, Education and Development (SKAIRED), 4/11 Sarv Priya Vihar, ... wild-type parent cv Nirmal were characterized for overall cytosine methylation at .... (ii) altered in the expression of genes involved in the perfor-.

  13. Elastic electron scattering from the DNA bases: cytosine and thymine

    International Nuclear Information System (INIS)

    Colyer, C J; Bellm, S M; Lohmanny, B; Blanco, F; Garcia, G

    2012-01-01

    Relative elastic differential cross sections for elastic scattering from cytosine and thymine have been measured using the crossed beam method. The experimental data are compared with theoretical cross sections calculated by the screen corrected additivity rule method.

  14. Intramolecular tautomerisation and the conformational variability of some classical mutagens – cytosine derivatives: quantum chemical study

    Directory of Open Access Journals (Sweden)

    Hovorun D. M.

    2011-04-01

    Full Text Available Aim. To determine the lifetime of the mutagenic cytosine derivatives through the investigation of the physicochemical mechanisms of their intramolecular proton transfer. Methods. Non-empirical quantum chemistry, the analysis of the electron density by means of Bader’s atoms in molecules (AIM theory and physicochemical kinetics were used. Results. It is shown that the modification of all investigated compounds, except DCyt, prevents their pairing in both mutagenic and canonical tautomeric forms with a base which is an interacting partner. This effect can inhibit their mutagenic potential. It is also established that Watson-Crick tautomeric hypothesis can be formally expanded for the investigated molecules so far as a lifetime of the mutagenic tautomers much more exceeds characteristic time for the incorporation of one nucleotides pair by DNA biosynthesis machinery. It seems that just within the frame of this hypothesis it will be possible to give an adequate explanation of the mechanisms of mutagenic action of N4-aminocytosine, N4-methoxycytosine, N4-hydroxycytosine and N4dehydrocytosine, which have much more energy advantageous imino form in comparison with amino form. Conclusions. For the first time the comprehensive conformational analysis of a number of classical mutagens, namely cytosine derivatives, has been performed using the methods of non-empirical quantum chemistry at the MP2/6-311++G (2df,pd//B3LYP/6-311++G(d,p level of theory

  15. Water-mediated tautomerization of cytosine to the rare imino form: An ab initio dynamics study

    Energy Technology Data Exchange (ETDEWEB)

    Fogarasi, Geza [Institute of Chemistry, Eotvos University, H-1518 Budapest, Pf. 32. (Hungary)], E-mail: fg@chem.elte.hu

    2008-06-16

    Tautomerism in nucleotide bases is one of the possible mechanisms of mutation of DNA. In spite of numerous studies on the structure and energy of cytosine tautomers, little information is available on the process of proton transfer itself. We present here Born-Oppenheimer dynamics calculations, with the potential surface obtained 'on the fly' from ab initio quantum chemistry (QC) and the atoms moving classically. In search for water-mediated tautomerization the monohydrated complex was studied, running about 300 trajectories each of 3000-5000 points of 1 fs steps. One single trajectory has been found to lead to tautomerization. Although the QC method used in the simulations was inevitably modest (B3LYP/3-21G), higher-level test calculations along the same trajectory suggest that the simulation grasped the basic mechanism of proton transfer: a concerted, synchronous process characterized by strong coupling between the motions of the two participating hydrogen atoms.

  16. Metal-mediated deamination of cytosine: experiment and DFT calculations

    Czech Academy of Sciences Publication Activity Database

    Šponer, Judit E.; Sanz Miguel, P. J.; Rodríguez-Santiago, L.; Erxleben, A.; Krumm, M.; Sodupe, M.; Šponer, Jiří; Lippert, B.

    2004-01-01

    Roč. 43, č. 40 (2004), s. 5396-5399 ISSN 1433-7851 R&D Projects: GA MŠk LN00A016 Institutional research plan: CEZ:AV0Z5004920 Keywords : cytosine * deamination * density functional calculations Subject RIV: BO - Biophysics Impact factor: 9.161, year: 2004

  17. High-resolution analysis of cytosine methylation in ancient DNA.

    Directory of Open Access Journals (Sweden)

    Bastien Llamas

    Full Text Available Epigenetic changes to gene expression can result in heritable phenotypic characteristics that are not encoded in the DNA itself, but rather by biochemical modifications to the DNA or associated chromatin proteins. Interposed between genes and environment, these epigenetic modifications can be influenced by environmental factors to affect phenotype for multiple generations. This raises the possibility that epigenetic states provide a substrate for natural selection, with the potential to participate in the rapid adaptation of species to changes in environment. Any direct test of this hypothesis would require the ability to measure epigenetic states over evolutionary timescales. Here we describe the first single-base resolution of cytosine methylation patterns in an ancient mammalian genome, by bisulphite allelic sequencing of loci from late Pleistocene Bison priscus remains. Retrotransposons and the differentially methylated regions of imprinted loci displayed methylation patterns identical to those derived from fresh bovine tissue, indicating that methylation patterns are preserved in the ancient DNA. Our findings establish the biochemical stability of methylated cytosines over extensive time frames, and provide the first direct evidence that cytosine methylation patterns are retained in DNA from ancient specimens. The ability to resolve cytosine methylation in ancient DNA provides a powerful means to study the role of epigenetics in evolution.

  18. AID/APOBEC cytosine deaminase induces genome-wide kataegis

    Directory of Open Access Journals (Sweden)

    Lada Artem G

    2012-12-01

    Full Text Available Abstract Clusters of localized hypermutation in human breast cancer genomes, named “kataegis” (from the Greek for thunderstorm, are hypothesized to result from multiple cytosine deaminations catalyzed by AID/APOBEC proteins. However, a direct link between APOBECs and kataegis is still lacking. We have sequenced the genomes of yeast mutants induced in diploids by expression of the gene for PmCDA1, a hypermutagenic deaminase from sea lamprey. Analysis of the distribution of 5,138 induced mutations revealed localized clusters very similar to those found in tumors. Our data provide evidence that unleashed cytosine deaminase activity is an evolutionary conserved, prominent source of genome-wide kataegis events. Reviewers This article was reviewed by: Professor Sandor Pongor, Professor Shamil R. Sunyaev, and Dr Vladimir Kuznetsov.

  19. Cytosine Arabinoside Influx and Nucleoside Transport Sites in Acute Leukemia

    OpenAIRE

    Wiley, J. S.; Jones, S. P.; Sawyer, W. H.; Paterson, A. R. P.

    1982-01-01

    Although cytosine arabinoside (araC) can induce a remission in a majority of patients presenting with acute myeloblastic leukemia (AML), a minority fail to respond and moreover the drug has less effect in acute lymphoblastic leukemia (ALL). The carrier-mediated influx of araC into purified blasts from patients with AML, ALL, and acute undifferentiated leukemia (AUL) has been compared to that of normal lymphocytes and polymorphs. Blasts showed a larger mediated influx of araC than mature cells...

  20. Three-Dimensional Structure and Catalytic Mechanism of Cytosine Deaminase

    Energy Technology Data Exchange (ETDEWEB)

    R Hall; A Fedorov; C Xu; E Fedorov; S Almo; F Raushel

    2011-12-31

    Cytosine deaminase (CDA) from E. coli is a member of the amidohydrolase superfamily. The structure of the zinc-activated enzyme was determined in the presence of phosphonocytosine, a mimic of the tetrahedral reaction intermediate. This compound inhibits the deamination of cytosine with a K{sub i} of 52 nM. The zinc- and iron-containing enzymes were characterized to determine the effect of the divalent cations on activation of the hydrolytic water. Fe-CDA loses activity at low pH with a kinetic pKa of 6.0, and Zn-CDA has a kinetic pKa of 7.3. Mutation of Gln-156 decreased the catalytic activity by more than 5 orders of magnitude, supporting its role in substrate binding. Mutation of Glu-217, Asp-313, and His-246 significantly decreased catalytic activity supporting the role of these three residues in activation of the hydrolytic water molecule and facilitation of proton transfer reactions. A library of potential substrates was used to probe the structural determinants responsible for catalytic activity. CDA was able to catalyze the deamination of isocytosine and the hydrolysis of 3-oxauracil. Large inverse solvent isotope effects were obtained on k{sub cat} and k{sub cat}/K{sub m}, consistent with the formation of a low-barrier hydrogen bond during the conversion of cytosine to uracil. A chemical mechanism for substrate deamination by CDA was proposed.

  1. Effects of cytosine methylation on transcription factor binding sites

    KAUST Repository

    Medvedeva, Yulia A

    2014-03-26

    Background: DNA methylation in promoters is closely linked to downstream gene repression. However, whether DNA methylation is a cause or a consequence of gene repression remains an open question. If it is a cause, then DNA methylation may affect the affinity of transcription factors (TFs) for their binding sites (TFBSs). If it is a consequence, then gene repression caused by chromatin modification may be stabilized by DNA methylation. Until now, these two possibilities have been supported only by non-systematic evidence and they have not been tested on a wide range of TFs. An average promoter methylation is usually used in studies, whereas recent results suggested that methylation of individual cytosines can also be important.Results: We found that the methylation profiles of 16.6% of cytosines and the expression profiles of neighboring transcriptional start sites (TSSs) were significantly negatively correlated. We called the CpGs corresponding to such cytosines " traffic lights" We observed a strong selection against CpG " traffic lights" within TFBSs. The negative selection was stronger for transcriptional repressors as compared with transcriptional activators or multifunctional TFs as well as for core TFBS positions as compared with flanking TFBS positions.Conclusions: Our results indicate that direct and selective methylation of certain TFBS that prevents TF binding is restricted to special cases and cannot be considered as a general regulatory mechanism of transcription. 2013 Medvedeva et al.; licensee BioMed Central Ltd.

  2. NUCLEOTIDES IN INFANT FEEDING

    Directory of Open Access Journals (Sweden)

    L.G. Mamonova

    2007-01-01

    Full Text Available The article reviews the application of nucleotides-metabolites, playing a key role in many biological processes, for the infant feeding. The researcher provides the date on the nucleotides in the women's milk according to the lactation stages. She also analyzes the foreign experience in feeding newborns with nucleotides-containing milk formulas. The article gives a comparison of nucleotides in the adapted formulas represented in the domestic market of the given products.Key words: children, feeding, nucleotides.

  3. Single nucleotide polymorphism discrimination with and without an ethidium bromide intercalator.

    Science.gov (United States)

    Fenati, Renzo A; Connolly, Ashley R; Ellis, Amanda V

    2017-02-15

    Single nucleotide polymorphism (SNP) genotyping is an important aspect in understanding genetic variations. Here, we discriminate SNPs using toe-hold mediated displacement reactions. The biological target is an 80 nucleotide long double-stranded-DNA from the mtDNA HV1 region, associated with maternal ancestry. This target has been specially designed with a pendant toehold and a cationic fluorophore, ATTO 647N, as a reporter, produced in a polymerase chain reaction. Rates of reaction for the toehold-polymerase chain reaction products (TPPs) with their corresponding complementary displacing sequences, labelled with a Black Hole Quencher 1, followed the order TPP-Cytosine > TPP-Thymine > TPP-Adenine ≥ TPP-Guanine. Non-complementary rates were the slowest with mismatches involving cytosine. These reactions, operating in a static/or contact mode, gave averaged readouts between SNPs within 15 min (with 80-90% quenching), compared to 25-30 min in previous studies involving fluorescence resonance energy transfer. Addition of an intercalating agent, ethidium bromide, retarded the rate of reaction in which cytosine was involved, presumably through stabilization of the base pairing, which resulted in markedly improved discrimination of cytosine containing SNPs. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Methylation-sensitive amplified polymorphism-based genome-wide analysis of cytosine methylation profiles in Nicotiana tabacum cultivars.

    Science.gov (United States)

    Jiao, J; Wu, J; Lv, Z; Sun, C; Gao, L; Yan, X; Cui, L; Tang, Z; Yan, B; Jia, Y

    2015-11-26

    This study aimed to investigate cytosine methylation profiles in different tobacco (Nicotiana tabacum) cultivars grown in China. Methylation-sensitive amplified polymorphism was used to analyze genome-wide global methylation profiles in four tobacco cultivars (Yunyan 85, NC89, K326, and Yunyan 87). Amplicons with methylated C motifs were cloned by reamplified polymerase chain reaction, sequenced, and analyzed. The results show that geographical location had a greater effect on methylation patterns in the tobacco genome than did sampling time. Analysis of the CG dinucleotide distribution in methylation-sensitive polymorphic restriction fragments suggested that a CpG dinucleotide cluster-enriched area is a possible site of cytosine methylation in the tobacco genome. The sequence alignments of the Nia1 gene (that encodes nitrate reductase) in Yunyan 87 in different regions indicate that a C-T transition might be responsible for the tobacco phenotype. T-C nucleotide replacement might also be responsible for the tobacco phenotype and may be influenced by geographical location.

  5. Hydroxyl radical induced cross-linking of cytosine and tyrosine in nucleohistone

    International Nuclear Information System (INIS)

    Gajewski, E.; Dizdaroglu, M.

    1990-01-01

    Hydroxyl radical induced formation of a DNA-protein cross-link involving cytosine and tyrosine in nucleohistone in buffered aqueous solution is reported. The technique of gas chromatography-mass spectrometry was used for this investigation. A γ-irradiated aqueous mixture of cytosine and tyrosine was first investigated in order to obtain gas chromatographic-mass spectrometric properties of possible cytosine-tyrosine cross-links. One cross-link was observed, and its structure was identified as the product from the formation of a covalent bond between carbon 6 of cytosine and carbon 3 of tyrosine. With the use of gas chromatography-mass spectrometry with selected-ion monitoring, this cytosine-tyrosine cross-link was identified in acidic hydrolysates of calf thymus nucleohistone γ-irradiated in N 2 O-saturated aqueous solution. The yield of this DNA-protein cross-link in nucleohistone was found to be a linear function of the radiation dose in the range of 100-500 Gy (J·kg -1 ). This yield amounted to 0.05 nmol·J -1 . Mechanisms underlying the formation of the cytosine-tyrosine cross-link in nucleohistone were proposed to involve radical-radical and/or radical addition reactions of hydroxyl adduct radicals of cytosine and tyrosine moieties, forming a covalent bond between carbon 6 of cytosine and carbon 3 of tyrosine. When oxygen was present in irradiated solutions, no cytosine-tyrosine cross-links were observed

  6. Elastic electron scattering from the DNA bases cytosine and thymine

    International Nuclear Information System (INIS)

    Colyer, C. J.; Bellm, S. M.; Lohmann, B.; Blanco, F.; Garcia, G.

    2011-01-01

    Cross-section data for electron scattering from biologically relevant molecules are important for the modeling of energy deposition in living tissue. Relative elastic differential cross sections have been measured for cytosine and thymine using the crossed-beam method. These measurements have been performed for six discrete electron energies between 60 and 500 eV and for detection angles between 15 deg. and 130 deg. Calculations have been performed via the screen-corrected additivity rule method and are in good agreement with the present experiment.

  7. Classifying Coding DNA with Nucleotide Statistics

    Directory of Open Access Journals (Sweden)

    Nicolas Carels

    2009-10-01

    Full Text Available In this report, we compared the success rate of classification of coding sequences (CDS vs. introns by Codon Structure Factor (CSF and by a method that we called Universal Feature Method (UFM. UFM is based on the scoring of purine bias (Rrr and stop codon frequency. We show that the success rate of CDS/intron classification by UFM is higher than by CSF. UFM classifies ORFs as coding or non-coding through a score based on (i the stop codon distribution, (ii the product of purine probabilities in the three positions of nucleotide triplets, (iii the product of Cytosine (C, Guanine (G, and Adenine (A probabilities in the 1st, 2nd, and 3rd positions of triplets, respectively, (iv the probabilities of G in 1st and 2nd position of triplets and (v the distance of their GC3 vs. GC2 levels to the regression line of the universal correlation. More than 80% of CDSs (true positives of Homo sapiens (>250 bp, Drosophila melanogaster (>250 bp and Arabidopsis thaliana (>200 bp are successfully classified with a false positive rate lower or equal to 5%. The method releases coding sequences in their coding strand and coding frame, which allows their automatic translation into protein sequences with 95% confidence. The method is a natural consequence of the compositional bias of nucleotides in coding sequences.

  8. Single nucleotide polymorphism discrimination with and without an ethidium bromide intercalator

    International Nuclear Information System (INIS)

    Fenati, Renzo A.; Connolly, Ashley R.; Ellis, Amanda V.

    2017-01-01

    Single nucleotide polymorphism (SNP) genotyping is an important aspect in understanding genetic variations. Here, we discriminate SNPs using toe-hold mediated displacement reactions. The biological target is an 80 nucleotide long double-stranded–DNA from the mtDNA HV1 region, associated with maternal ancestry. This target has been specially designed with a pendant toehold and a cationic fluorophore, ATTO 647N, as a reporter, produced in a polymerase chain reaction. Rates of reaction for the toehold-polymerase chain reaction products (TPPs) with their corresponding complementary displacing sequences, labelled with a Black Hole Quencher 1, followed the order TPP–Cytosine > TPP–Thymine > TPP–Adenine ≥ TPP–Guanine. Non-complementary rates were the slowest with mismatches involving cytosine. These reactions, operating in a static/or contact mode, gave averaged readouts between SNPs within 15 min (with 80–90% quenching), compared to 25–30 min in previous studies involving fluorescence resonance energy transfer. Addition of an intercalating agent, ethidium bromide, retarded the rate of reaction in which cytosine was involved, presumably through stabilization of the base pairing, which resulted in markedly improved discrimination of cytosine containing SNPs. - Highlights: • Fluorophores and DNA intercalators effect the rate of toehold-mediated strand displacement. • Ethidium bromide had a destabilizing effect on mismatches that contained cytosine. • A cationic fluorophore and Black Hole Quencher 1 strand displacement system was 2–3 times faster than a FRET system. • This enabled SNP detection using toehold-mediated strand displacement in 15 min.

  9. Single nucleotide polymorphism discrimination with and without an ethidium bromide intercalator

    Energy Technology Data Exchange (ETDEWEB)

    Fenati, Renzo A.; Connolly, Ashley R. [Flinders Centre for Nanoscale Science and Technology, Flinders University, Sturt Road, Bedford Park, Adelaide, South Australia 5042 (Australia); Ellis, Amanda V., E-mail: amanda.ellis@flinders.edu.au [Flinders Centre for Nanoscale Science and Technology, Flinders University, Sturt Road, Bedford Park, Adelaide, South Australia 5042 (Australia); Chemical and Biomolecular Engineering, The University of Melbourne, Parkville, VIC 3010 (Australia)

    2017-02-15

    Single nucleotide polymorphism (SNP) genotyping is an important aspect in understanding genetic variations. Here, we discriminate SNPs using toe-hold mediated displacement reactions. The biological target is an 80 nucleotide long double-stranded–DNA from the mtDNA HV1 region, associated with maternal ancestry. This target has been specially designed with a pendant toehold and a cationic fluorophore, ATTO 647N, as a reporter, produced in a polymerase chain reaction. Rates of reaction for the toehold-polymerase chain reaction products (TPPs) with their corresponding complementary displacing sequences, labelled with a Black Hole Quencher 1, followed the order TPP–Cytosine > TPP–Thymine > TPP–Adenine ≥ TPP–Guanine. Non-complementary rates were the slowest with mismatches involving cytosine. These reactions, operating in a static/or contact mode, gave averaged readouts between SNPs within 15 min (with 80–90% quenching), compared to 25–30 min in previous studies involving fluorescence resonance energy transfer. Addition of an intercalating agent, ethidium bromide, retarded the rate of reaction in which cytosine was involved, presumably through stabilization of the base pairing, which resulted in markedly improved discrimination of cytosine containing SNPs. - Highlights: • Fluorophores and DNA intercalators effect the rate of toehold-mediated strand displacement. • Ethidium bromide had a destabilizing effect on mismatches that contained cytosine. • A cationic fluorophore and Black Hole Quencher 1 strand displacement system was 2–3 times faster than a FRET system. • This enabled SNP detection using toehold-mediated strand displacement in 15 min.

  10. Surface study of gallium- and aluminum- doped graphenes upon adsorption of cytosine: DFT calculations

    International Nuclear Information System (INIS)

    Shokuhi Rad, Ali; Zareyee, Daryoush; Peyravi, Majid; Jahanshahi, Mohsen

    2016-01-01

    Highlights: • P1 and P4 are the most stable adsorption configurations for cytosine. • NBO analysis show n-type semiconductor property for both Al- and Ga-doped graphenes. • Important changes in the HOMO and LUMO of doped graphene upon adsorption of cytosine. • Increase in the conductivity of system when cytosine is adsorbed on doped graphenes. - Abstract: The adsorption of cytosine molecule on Al- and Ga- doped graphenes is studied using first-principles density functional theory (DFT) calculations. The energetically most stable geometries of cytosine on both Al- and Ga- doped graphenes are determined and the adsorption energies are calculated. The net charge of transfer as well as local charge of doped atoms upon adsorption of cytosine are studied by natural bond orbitals (NBO) analysis. Orbital hybridizing of complexes was searched by frontier molecular orbital theory (FMO), and density of states (DOS). Depending on the side of cytosine, there are four possible sites for its adsorption on doped graphene; denoted as P1, P2, P3, and P4, respectively. The order of binding energy in the case of Al-doped graphene is found as P1 > P4 > P3 > P2. Interestingly, the order in the case of Ga-doped graphene changes to: P4 ∼ P1 > P3 > P2. Both surfaces show superior adsorbent property, resulting chemisorption of cytosine, especially at P1 and P4 position configurations. The NBO charge analysis reveals that the charge transfers from Al- and Ga- doped graphene sheets to cytosine. The electronic properties of both surfaces undertake important changes after cytosine adsorption, which indicates notable change in its electrical conductivity.

  11. Surface study of gallium- and aluminum- doped graphenes upon adsorption of cytosine: DFT calculations

    Energy Technology Data Exchange (ETDEWEB)

    Shokuhi Rad, Ali, E-mail: a.shokuhi@gmail.com [Department of Chemical Engineering, Qaemshahr Branch, Islamic Azad University, Qaemshahr (Iran, Islamic Republic of); Zareyee, Daryoush [Department of Chemistry, Qaemshahr Branch, Islamic Azad University, Qaemshahr (Iran, Islamic Republic of); Peyravi, Majid; Jahanshahi, Mohsen [Faculty of Chemical Engineering, Babol University of Technology, Babol (Iran, Islamic Republic of)

    2016-12-30

    Highlights: • P1 and P4 are the most stable adsorption configurations for cytosine. • NBO analysis show n-type semiconductor property for both Al- and Ga-doped graphenes. • Important changes in the HOMO and LUMO of doped graphene upon adsorption of cytosine. • Increase in the conductivity of system when cytosine is adsorbed on doped graphenes. - Abstract: The adsorption of cytosine molecule on Al- and Ga- doped graphenes is studied using first-principles density functional theory (DFT) calculations. The energetically most stable geometries of cytosine on both Al- and Ga- doped graphenes are determined and the adsorption energies are calculated. The net charge of transfer as well as local charge of doped atoms upon adsorption of cytosine are studied by natural bond orbitals (NBO) analysis. Orbital hybridizing of complexes was searched by frontier molecular orbital theory (FMO), and density of states (DOS). Depending on the side of cytosine, there are four possible sites for its adsorption on doped graphene; denoted as P1, P2, P3, and P4, respectively. The order of binding energy in the case of Al-doped graphene is found as P1 > P4 > P3 > P2. Interestingly, the order in the case of Ga-doped graphene changes to: P4 ∼ P1 > P3 > P2. Both surfaces show superior adsorbent property, resulting chemisorption of cytosine, especially at P1 and P4 position configurations. The NBO charge analysis reveals that the charge transfers from Al- and Ga- doped graphene sheets to cytosine. The electronic properties of both surfaces undertake important changes after cytosine adsorption, which indicates notable change in its electrical conductivity.

  12. The Impact of DNA Topology and Guide Length on Target Selection by a Cytosine-Specific Cas9.

    Science.gov (United States)

    Tsui, Tsz Kin Martin; Hand, Travis H; Duboy, Emily C; Li, Hong

    2017-06-16

    Cas9 is an RNA-guided DNA cleavage enzyme being actively developed for genome editing and gene regulation. To be cleaved by Cas9, a double stranded DNA, or the protospacer, must be complementary to the guide region, typically 20-nucleotides in length, of the Cas9-bound guide RNA, and adjacent to a short Cas9-specific element called Protospacer Adjacent Motif (PAM). Understanding the correct juxtaposition of the protospacer- and PAM-interaction with Cas9 will enable development of versatile and safe Cas9-based technology. We report identification and biochemical characterization of Cas9 from Acidothermus cellulolyticus (AceCas9). AceCas9 depends on a 5'-NNNCC-3' PAM and is more efficient in cleaving negative supercoils than relaxed DNA. Kinetic as well as in vivo activity assays reveal that AceCas9 achieves optimal activity when combined with a guide RNA containing a 24-nucleotide complementarity region. The cytosine-specific, DNA topology-sensitive, and extended guide-dependent properties of AceCas9 may be explored for specific genome editing applications.

  13. Syntheses of [5-2H]-uracil, [5-2H]-cytosine, [6-2H]-uracil and [6-2H]-cytosine

    International Nuclear Information System (INIS)

    Kiritani, Reiko; Asano, Takeyoshi; Fujita, Shin-ichi; Dohmaru, Takaaki; Kawanishi, Tetsuro

    1986-01-01

    Syntheses of [5- 2 H]-, [6- 2 H]-uracil and [5- 2 H]-, [6- 2 H]-cytosine were investigated. The catalytic reaction of uracil or cytosine with 2 H 2 gas in alkaline media gave rise to [6- 2 H]-compounds almost exclusively. On the other hand, the reaction of 5-bromouracil or 5-bromocytosine with 2 H 2 gas gave rise to a mixture of [5- 2 H]-, [6- 2 H]- and [5- 2 H, 6- 2 H]-compounds depending on the experimental conditions. By controlling the temperature, the pressure of 2 H 2 gas and the amount of catalyst, [5- 2 H]-uracil and [5- 2 H]-cytosine were obtained. The isotopic distribution in each product was measured by 1 H NMR spectroscopy combined with an HPLC method. (author)

  14. Main: Nucleotide Analysis [KOME

    Lifescience Database Archive (English)

    Full Text Available Nucleotide Analysis Japonica genome blast search result Result of blastn search against jap...onica genome sequence kome_japonica_genome_blast_search_result.zip kome_japonica_genome_blast_search_result ...

  15. Identification and characterization of the cytosine-5 DNA methyltransferase gene family in Salvia miltiorrhiza

    OpenAIRE

    Jiang Li; Caili Li; Shanfa Lu

    2018-01-01

    Cytosine DNA methylation is highly conserved epigenetic modification involved in a wide range of biological processes in eukaryotes. It was established and maintained by cytosine-5 DNA methyltransferases (C5-MTases) in plants. Through genome-wide identification, eight putative SmC5-MTase genes were identified from the genome of Salvia miltiorrhiza, a well-known traditional Chinese medicine material and an emerging model medicinal plant. Based on conserved domains and phylogenetic analysis, ei...

  16. Cytosine methylation dysregulation in neonates following intrauterine growth restriction.

    Directory of Open Access Journals (Sweden)

    Francine Einstein

    2010-01-01

    Full Text Available Perturbations of the intrauterine environment can affect fetal development during critical periods of plasticity, and can increase susceptibility to a number of age-related diseases (e.g., type 2 diabetes mellitus; T2DM, manifesting as late as decades later. We hypothesized that this biological memory is mediated by permanent alterations of the epigenome in stem cell populations, and focused our studies specifically on DNA methylation in CD34+ hematopoietic stem and progenitor cells from cord blood from neonates with intrauterine growth restriction (IUGR and control subjects.Our epigenomic assays utilized a two-stage design involving genome-wide discovery followed by quantitative, single-locus validation. We found that changes in cytosine methylation occur in response to IUGR of moderate degree and involving a restricted number of loci. We also identify specific loci that are targeted for dysregulation of DNA methylation, in particular the hepatocyte nuclear factor 4alpha (HNF4A gene, a well-known diabetes candidate gene not previously associated with growth restriction in utero, and other loci encoding HNF4A-interacting proteins.Our results give insights into the potential contribution of epigenomic dysregulation in mediating the long-term consequences of IUGR, and demonstrate the value of this approach to studies of the fetal origin of adult disease.

  17. Cytosine Methylation Dysregulation in Neonates Following Intrauterine Growth Restriction

    Science.gov (United States)

    Bhagat, Tushar D.; Fazzari, Melissa J.; Verma, Amit; Barzilai, Nir; Greally, John M.

    2010-01-01

    Background Perturbations of the intrauterine environment can affect fetal development during critical periods of plasticity, and can increase susceptibility to a number of age-related diseases (e.g., type 2 diabetes mellitus; T2DM), manifesting as late as decades later. We hypothesized that this biological memory is mediated by permanent alterations of the epigenome in stem cell populations, and focused our studies specifically on DNA methylation in CD34+ hematopoietic stem and progenitor cells from cord blood from neonates with intrauterine growth restriction (IUGR) and control subjects. Methods and Findings Our epigenomic assays utilized a two-stage design involving genome-wide discovery followed by quantitative, single-locus validation. We found that changes in cytosine methylation occur in response to IUGR of moderate degree and involving a restricted number of loci. We also identify specific loci that are targeted for dysregulation of DNA methylation, in particular the hepatocyte nuclear factor 4α (HNF4A) gene, a well-known diabetes candidate gene not previously associated with growth restriction in utero, and other loci encoding HNF4A-interacting proteins. Conclusions Our results give insights into the potential contribution of epigenomic dysregulation in mediating the long-term consequences of IUGR, and demonstrate the value of this approach to studies of the fetal origin of adult disease. PMID:20126273

  18. Dynamics of self-assembled cytosine nucleobases on graphene

    Science.gov (United States)

    Saikia, Nabanita; Johnson, Floyd; Waters, Kevin; Pandey, Ravindra

    2018-05-01

    Molecular self-assembly of cytosine (C n ) bases on graphene was investigated using molecular dynamics methods. For free-standing C n bases, simulation conditions (gas versus aqueous) determine the nature of self-assembly; the bases prefer to aggregate in the gas phase and are stabilized by intermolecular H-bonds, while in the aqueous phase, the water molecules disrupt base-base interactions, which facilitate the formation of π-stacked domains. The substrate-induced effects, on the other hand, find the polarity and donor-acceptor sites of the bases to govern the assembly process. For example, in the gas phase, the assembly of C n bases on graphene displays short-range ordered linear arrays stabilized by the intermolecular H-bonds. In the aqueous phase, however, there are two distinct configurations for the C n bases assembly on graphene. For the first case corresponding to low surface coverage, the bases are dispersed on graphene and are isolated. The second configuration archetype is disordered linear arrays assembled with medium and high surface coverage. The simulation results establish the role of H-bonding, vdW π-stacking, and the influence of graphene surface towards the self-assembly. The ability to regulate the assembly into well-defined patterns can aid in the design of self-assembled nanostructures for the next-generation DNA based biosensors and nanoelectronic devices.

  19. Cytosine modifications after gamma irradiation in aerated aqueous solution of Escherichia coli DNA

    International Nuclear Information System (INIS)

    Polverelli, M.

    1983-04-01

    After gamma irradiation of cytosine in aerated aqueous solution and utilization of various spectrometric methods (mass spectrometry, proton nuclear magnetic resonance and infrared spectrometry) about ten new radiolysis products were identified. The formation of N-glycolylbiuret in H 2 18 O aqueous solution of irradiated cytosine at pH 4,5 indicated that the preferred 18 OH hydroxyl radical attack was at C-5. The formation of trans 1-carbamoyl-4,5 dihydroxyimidazolidin-2 oxo which is the major product after cytosine pyrimidine ring rearrangement took place preferentially at neutral pH, while N-glycolylbiuret predominated at pH 4,5. The deamination pathway was predominant when cytosine was irradiated at acidic pH values (pH 2 ) or in copper complexes. The development of a new acid hydrolysis method using fluorhydric acid stabilized in pyridine made easier the evaluation of cytosine modifications after gamma irradiation in aerated aqueous solution of E. Coli DNA- 14 C-2 cytosine. This hydrolytic agent removed the modified bases from the polynucleotidic chain. A difference was found between the proportion of radiolytic products removed by acid hydrolysis and by irradiation of the free base in solution [fr

  20. Structure Determination of an Ag-I-Mediated Cytosine-Cytosine Base Pair within DNA Duplex in Solution with H-1/N-15/Ag-109 NMR Spectroscopy

    Czech Academy of Sciences Publication Activity Database

    Dairaku, T.; Furuita, K.; Sato, H.; Šebera, Jakub; Nakashima, K.; Kondo, J.; Yamanaka, D.; Kondo, Y.; Okamoto, I.; Ono, A.; Sychrovský, Vladimír; Kojima, C.; Tanaka, Y.

    2016-01-01

    Roč. 22, č. 37 (2016), s. 13028-13031 ISSN 0947-6539 R&D Projects: GA ČR GA13-27676S Institutional support: RVO:61388963 Keywords : NMR * Ag * cytosine * DFT Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 5.317, year: 2016

  1. Cyclic nucleotides and radioresistnace

    International Nuclear Information System (INIS)

    Kulinskij, V.I.; Mikheeva, G.A.; Zel'manovich, B.M.

    1982-01-01

    The addition of glucose to meat-peptone broth does not change the radiosensitizing effect (RSE) of cAMP at the logarithmic phase (LP) and the radioprotective effect (RPE) at the stationary phase (SP), but sensitization, characteristic of cGMP, disappears in SP and turns into RPE in LP. Introduction of glucose into the broth for 20 min eliminates all the effects of both cyclic nucleotides in the cya + strain while cya - mutant exhibits RSE. RSE of both cyclic nucleotides is only manifested on minimal media. These data brought confirmation of the dependence of the influence of cyclic media. These data brought confirmation of the dependence of the influence of cyclic nucleotides on radioresistance upon the metabolic status of the cell [ru

  2. DNA (cytosine-5-methyltransferase 3B (DNMT 3B polymorphism and risk of Down syndrome offspring

    Directory of Open Access Journals (Sweden)

    Cláudia Melo de Moura

    2018-01-01

    Full Text Available Down syndrome (DS is the most common form of human genetic mental retardation. Several polymorphisms in genes coding folic acid cycle enzymes have been associated to the risk of bearing a DS child; however, the results are controversial. S-adenosyl-l-methionine (SAM is an important intermediate of folic acid pathway and acts as methyl donor and substrate for DNA (cytosine-5-methyltransferase 3B (DNMT3B – EC 2.1.1.37 de novo methylation processes during embryogenesis. Recent studies suggest that a functional polymorphism of DNMT 3B in maternal genotype may be associated with a decreased risk of having a DS child. We herein investigate the association of this polymorphism with the occurrence of DS in a Brazilian population. We have genotyped 111 mothers of DS infants (MDS and 212 control mothers (CM through PCR-RFLP. The observed genotypic frequencies were CC = 0.22; CT = 0.49 and TT = 0.29 in CM, and CC = 0.30; CT = 0.52 and TT = 0.18 in MDS. Allelic frequencies were C = 0.47 and T = 0.53 in CM and C = 0.56 and T = 0.44 in MDS. No deviation of HWE was observed, and both DNMT 3B rs2424913 genotype (χ2 = 4.53; DF = 1; P = 0.03 and allelic (χ2 = 4.90; DF = 1; P = 0.03 frequencies show significant differences between MDS and CM. The presence of the mutant DNMT 3B T allele decreases 30% the risk of bearing a DS child (OR = 0.69; 95% CI: 0.50–0.96; P = 0.03, and the risk is diminished up to 45% in association with the homozygous genotype (OR = 0.54; 95% CI: 0.31–0.96; P = 0.04. Our results suggest that women harboring the single nucleotide polymorphism DNMT 3B rs2424913 have a decreased risk of a DS pregnancy, and further studies are necessary to confirm this protective effect.

  3. Cytosine arabinoside influx and nucleoside transport sites in acute leukemia.

    Science.gov (United States)

    Wiley, J S; Jones, S P; Sawyer, W H; Paterson, A R

    1982-02-01

    Although cytosine arabinoside (araC) can induce a remission in a majority of patients presenting with acute myeloblastic leukemia (AML), a minority fail to respond and moreover the drug has less effect in acute lymphoblastic leukemia (ALL). The carrier-mediated influx of araC into purified blasts from patients with AML, ALL, and acute undifferentiated leukemia (AUL) has been compared to that of normal lymphocytes and polymorphs. Blasts showed a larger mediated influx of araC than mature cells, since mean influxes for myeloblasts and lymphoblasts were 6- and 2.3-fold greater than polymorphs and lymphocytes, respectively. Also, the mean influx for myeloblasts was fourfold greater than the mean for lymphoblasts. The number of nucleoside transport sites was estimated for each cell type by measuring the equilibrium binding of [(3)H]nitrobenzylthioinosine (NBMPR), which inhibits nucleoside fluxes by binding with high affinity to specific sites on the transport mechanism. The mean binding site numbers for myeloblasts and lymphoblasts were 5- and 2.8-fold greater, respectively, than for the mature cells of the same maturation series. The mean number of NBMPR binding sites for myeloblasts was fourfold greater than for lymphoblasts. Patients with AUL were heterogeneous since blasts from some gave values within the myeloblastic range and others within the lymphoblastic range. The araC influx correlated closely with the number of NBMPR binding sites measured in the same cells on the same day. Transport parameters were measured on blasts from 15 patients with AML or AUL who were then treated with standard induction therapy containing araC. Eight patients entered complete remission, while seven failed therapy, among whom were the three patients with the lowest araC influx (myeloblasts have both higher araC transport rates and more nucleoside transport sites than lymphoblasts and this factor may contribute to the greater sensitivity of AML to this drug. AraC transport varied >10

  4. HPLC-UV, MALDI-TOF-MS and ESI-MS/MS analysis of the mechlorethamine DNA crosslink at a cytosine-cytosine mismatch pair.

    Directory of Open Access Journals (Sweden)

    Pornchai Rojsitthisak

    Full Text Available Mechlorethamine [ClCH(2CH(2N(CH(3CH(2CH(2Cl], a nitrogen mustard alkylating agent, has been proven to form a DNA interstrand crosslink at a cytosine-cytosine (C-C mismatch pair using gel electrophoresis. However, the atomic connectivity of this unusual crosslink is unknown.HPLC-UV, MALDI-TOF-MS, and ESI-MS/MS were used to determine the atomic connectivity of the DNA C-C crosslink formed by mechlorethamine, MALDI-TOF-MS of the HPLC-purified reaction product of mechlorethamine with the DNA duplex d[CTCACACCGTGGTTC]•d[GAACCACCGTGTGAG] (underlined bases are a C-C mismatch pair indicated formation of an interstrand crosslink at m/z 9222.088 [M-2H+Na](+. Following enzymatic digestion of the crosslinked duplex by snake venom phosphodiesterase and calf intestinal phosphatase, ESI-MS/MS indicated the presence of dC-mech-dC [mech = CH(2CH(2N(CH(3CH(2CH(2] at m/z 269.2 [M](2+ (expected m/z 269.6, exact mass 539.27 and its hydrolytic product dC-mech-OH at m/z 329.6 [M](+ (expected m/z 329.2. Fragmentation of dC-mech-dC gave product ions at m/z 294.3 and 236.9 [M](+, which are both due to loss of the 4-amino group of cytosine (as ammonia, in addition to dC and dC+HN(CH(3CH = CH(2, respectively. The presence of m/z 269.2 [M](2+ and loss of ammonia exclude crosslink formation at cytosine N(4 or O(2 and indicate crosslinking through cytosine N(3 with formation of two quaternary ammonium ions.Our results provide an important addition to the literature, as the first example of the use of HPLC and MS for analysis of a DNA adduct at the N(3 position of cytosine.

  5. Cytosine deamination and the precipitous decline of spontaneous mutation during Earth's history.

    Science.gov (United States)

    Lewis, Charles A; Crayle, Jesse; Zhou, Shuntai; Swanstrom, Ronald; Wolfenden, Richard

    2016-07-19

    The hydrolytic deamination of cytosine and 5-methylcytosine residues in DNA appears to contribute significantly to the appearance of spontaneous mutations in microorganisms and in human disease. In the present work, we examined the mechanism of cytosine deamination and the response of the uncatalyzed reaction to changing temperature. The positively charged 1,3-dimethylcytosinium ion was hydrolyzed at a rate similar to the rate of acid-catalyzed hydrolysis of 1-methylcytosine, for which it furnishes a satisfactory kinetic model and a probable mechanism. In agreement with earlier reports, uncatalyzed deamination was found to proceed at very similar rates for cytosine, 1-methylcytosine, cytidine, and cytidine 5'-phosphate, and also for cytosine residues in single-stranded DNA generated from a phagemid, in which we sequenced an insert representing the gene of the HIV-1 protease. Arrhenius plots for the uncatalyzed deamination of cytosine were linear over the temperature range from 90 °C to 200 °C and indicated a heat of activation (ΔH(‡)) of 23.4 ± 0.5 kcal/mol at pH 7. Recent evidence indicates that the surface of the earth has been cool enough to support life for more than 4 billion years and that life has been present for almost as long. If the temperature at Earth's surface is assumed to have followed Newton's law of cooling, declining exponentially from 100 °C to 25 °C during that period, then half of the cytosine-deaminating events per unit biomass would have taken place during the first 0.2 billion years, and <99.4% would have occurred during the first 2 billion years.

  6. Single Nucleotide Polymorphism

    DEFF Research Database (Denmark)

    Børsting, Claus; Pereira, Vania; Andersen, Jeppe Dyrberg

    2014-01-01

    Single nucleotide polymorphisms (SNPs) are the most frequent DNA sequence variations in the genome. They have been studied extensively in the last decade with various purposes in mind. In this chapter, we will discuss the advantages and disadvantages of using SNPs for human identification...... of SNPs. This will allow acquisition of more information from the sample materials and open up for new possibilities as well as new challenges....

  7. The arabidopsis cyclic nucleotide interactome

    KAUST Repository

    Donaldson, Lara Elizabeth; Meier, Stuart Kurt; Gehring, Christoph A

    2016-01-01

    Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms

  8. IRMPD Action Spectroscopy of Alkali Metal Cation-Cytosine Complexes: Effects of Alkali Metal Cation Size on Gas Phase Conformation

    NARCIS (Netherlands)

    Yang, B.; Wu, R.R.; Polfer, N.C.; Berden, G.; Oomens, J.; Rodgers, M.T.

    2013-01-01

    The gas-phase structures of alkali metal cation-cytosine complexes generated by electrospray ionization are probed via infrared multiple photon dissociation (IRMPD) action spectroscopy and theoretical calculations. IRMPD action spectra of five alkali metal cation-cytosine complexes exhibit both

  9. Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.

    Science.gov (United States)

    Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant

    2017-11-28

    Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.

  10. Electron Attachment to the Gas Phase DNA Bases Cytosine and Thymine

    Czech Academy of Sciences Publication Activity Database

    Denifl, S.; Ptasiňska, S.; Probst, M.; Hrušák, Jan; Scheier, P.; Märk, T. D.

    2004-01-01

    Roč. 108, č. 31 (2004), s. 6562-6569 ISSN 1089-5639 R&D Projects: GA ČR GA203/02/0737 Institutional research plan: CEZ:AV0Z4040901 Keywords : gas-phase * cytosine * thymine Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.639, year: 2004

  11. Genomic DNA sequence and cytosine methylation changes of adult rice leaves after seeds space flight

    Science.gov (United States)

    Shi, Jinming

    In this study, cytosine methylation on CCGG site and genomic DNA sequence changes of adult leaves of rice after seeds space flight were detected by methylation-sensitive amplification polymorphism (MSAP) and Amplified fragment length polymorphism (AFLP) technique respectively. Rice seeds were planted in the trial field after 4 days space flight on the shenzhou-6 Spaceship of China. Adult leaves of space-treated rice including 8 plants chosen randomly and 2 plants with phenotypic mutation were used for AFLP and MSAP analysis. Polymorphism of both DNA sequence and cytosine methylation were detected. For MSAP analysis, the average polymorphic frequency of the on-ground controls, space-treated plants and mutants are 1.3%, 3.1% and 11% respectively. For AFLP analysis, the average polymorphic frequencies are 1.4%, 2.9%and 8%respectively. Total 27 and 22 polymorphic fragments were cloned sequenced from MSAP and AFLP analysis respectively. Nine of the 27 fragments from MSAP analysis show homology to coding sequence. For the 22 polymorphic fragments from AFLP analysis, no one shows homology to mRNA sequence and eight fragments show homology to repeat region or retrotransposon sequence. These results suggest that although both genomic DNA sequence and cytosine methylation status can be effected by space flight, the genomic region homology to the fragments from genome DNA and cytosine methylation analysis were different.

  12. Formulation, quality control and shelf life of the experimental cytostatic drug cyclopentenyl cytosine

    NARCIS (Netherlands)

    Schimmel, Kirsten; Guchelaar, Henk-Jan; van Kan, Erik

    2006-01-01

    This paper describes the formulation and quality control of an aqueous sterilized formulation of the experimental cytostatic drug cyclopentenyl cytosine (CPEC) to be used in Phase I/II clinical trials. The raw drug substance was extensively tested. A High Pressure Liquid Chromotography (HPLC) method

  13. Cytosine deletion at AP2-box region of HSP70 promoter and its ...

    Indian Academy of Sciences (India)

    Cytosine deletion at AP2-box region of HSP70 promoter and its influence on semen quality traits in crossbred bulls ... Laboratory, ICAR-Central Institute for Research on Cattle, Meerut 250 001, India; School of Atmospheric Stress Management, ICAR-National Institute of Abiotic Stress Management, Baramati 413 115, India ...

  14. Cytosine methylation alteration in natural populations of Leymus chinensis induced by multiple abiotic stresses.

    Directory of Open Access Journals (Sweden)

    Yingjie Yu

    Full Text Available BACKGROUND: Human activity has a profound effect on the global environment and caused frequent occurrence of climatic fluctuations. To survive, plants need to adapt to the changing environmental conditions through altering their morphological and physiological traits. One known mechanism for phenotypic innovation to be achieved is environment-induced rapid yet inheritable epigenetic changes. Therefore, the use of molecular techniques to address the epigenetic mechanisms underpinning stress adaptation in plants is an important and challenging topic in biological research. In this study, we investigated the impact of warming, nitrogen (N addition, and warming+nitrogen (N addition stresses on the cytosine methylation status of Leymus chinensis Tzvel. at the population level by using the amplified fragment length polymorphism (AFLP, methylation-sensitive amplified polymorphism (MSAP and retrotransposon based sequence-specific amplification polymorphism (SSAP techniques. METHODOLOGY/PRINCIPAL FINDINGS: Our results showed that, although the percentages of cytosine methylation changes in SSAP are significantly higher than those in MSAP, all the treatment groups showed similar alteration patterns of hypermethylation and hypomethylation. It meant that the abiotic stresses have induced the alterations in cytosine methylation patterns, and the levels of cytosine methylation changes around the transposable element are higher than the other genomic regions. In addition, the identification and analysis of differentially methylated loci (DML indicated that the abiotic stresses have also caused targeted methylation changes at specific loci and these DML might have contributed to the capability of plants in adaptation to the abiotic stresses. CONCLUSIONS/SIGNIFICANCE: Our results demonstrated that abiotic stresses related to global warming and nitrogen deposition readily evoke alterations of cytosine methylation, and which may provide a molecular basis for rapid

  15. Cytosine Methylation Alteration in Natural Populations of Leymus chinensis Induced by Multiple Abiotic Stresses

    Science.gov (United States)

    Yu, Yingjie; Yang, Xuejiao; Wang, Huaying; Shi, Fengxue; Liu, Ying; Liu, Jushan; Li, Linfeng; Wang, Deli; Liu, Bao

    2013-01-01

    Background Human activity has a profound effect on the global environment and caused frequent occurrence of climatic fluctuations. To survive, plants need to adapt to the changing environmental conditions through altering their morphological and physiological traits. One known mechanism for phenotypic innovation to be achieved is environment-induced rapid yet inheritable epigenetic changes. Therefore, the use of molecular techniques to address the epigenetic mechanisms underpinning stress adaptation in plants is an important and challenging topic in biological research. In this study, we investigated the impact of warming, nitrogen (N) addition, and warming+nitrogen (N) addition stresses on the cytosine methylation status of Leymus chinensis Tzvel. at the population level by using the amplified fragment length polymorphism (AFLP), methylation-sensitive amplified polymorphism (MSAP) and retrotransposon based sequence-specific amplification polymorphism (SSAP) techniques. Methodology/Principal Findings Our results showed that, although the percentages of cytosine methylation changes in SSAP are significantly higher than those in MSAP, all the treatment groups showed similar alteration patterns of hypermethylation and hypomethylation. It meant that the abiotic stresses have induced the alterations in cytosine methylation patterns, and the levels of cytosine methylation changes around the transposable element are higher than the other genomic regions. In addition, the identification and analysis of differentially methylated loci (DML) indicated that the abiotic stresses have also caused targeted methylation changes at specific loci and these DML might have contributed to the capability of plants in adaptation to the abiotic stresses. Conclusions/Significance Our results demonstrated that abiotic stresses related to global warming and nitrogen deposition readily evoke alterations of cytosine methylation, and which may provide a molecular basis for rapid adaptation by

  16. In planta assays involving epigenetically silenced genes reveal inhibition of cytosine methylation by genistein

    Directory of Open Access Journals (Sweden)

    Arase Sachiko

    2012-03-01

    Full Text Available Abstract Background Cytosine methylation is involved in epigenetic control of gene expression in a wide range of organisms. An increasing number of examples indicate that changing the frequency of cytosine methylation in the genome is a feasible tool to engineer novel traits in plants. Although demethylating effects of compounds have been analyzed in human cultured cells in terms of suppressing cancer, their effect in plant cells has not been analyzed extensively. Here, we developed in planta assay systems to detect inhibition of cytosine methylation using plants that contain a transgene transcriptionally silenced by an epigenetic mechanism. Results Seeds of two transgenic plants were used: a petunia line that has been identified as a revertant of the co-suppression of the chalcone synthase-A (CHS-A gene and contains CHS-A transgenes whose transcription is repressed; Nicotiana benthamiana plants that contain the green fluorescent protein (GFP reporter gene whose transcription is repressed through virus-induced transcriptional gene silencing. Seeds of these plants were sown on a medium that contained a demethylating agent, either 5-azacytidine or trichostatin A, and the restoration of the transcriptionally active state of the transgene was detected in seedlings. Using these systems, we found that genistein, a major isoflavonoid compound, inhibits cytosine methylation, thus restoring transgene transcription. Genistein also restored the transcription of an epigenetically silenced endogenous gene in Arabidopsis plants. Conclusions Our assay systems allowed us to assess the inhibition of cytosine methylation, in particular of maintenance of methylation, by compounds in plant cells. These results suggest a novel role of flavonoids in plant cells and that genistein is useful for modifying the epigenetic state of plant genomes.

  17. Clinical implications of cytosine deletion of exon 5 of P53 gene in non small cell lung cancer patients

    Directory of Open Access Journals (Sweden)

    Rashid Mir

    2016-01-01

    Full Text Available Aim: Lung cancer is considered to be the most common cancer in the world. In humans, about 50% or more cancers have a mutated tumor suppressor p53 gene thereby resulting in accumulation of p53 protein and losing its function to activate the target genes that regulate the cell cycle and apoptosis. Extensive research conducted in murine cancer models with activated p53, loss of p53, or p53 missense mutations have facilitated researchers to understand the role of this key protein. Our study was aimed to evaluate the frequency of cytosine deletion in nonsmall cell lung cancer (NSCLC patients. Methods: One hundred NSCLC patients were genotyped for P53 (exon5, codon168 cytosine deletion leading to loss of its function and activate the target genes by allele-specific polymerase chain reaction. The P53 cytosine deletion was correlated with all the clinicopathological parameters of the patients. Results and Analysis: 59% cases were carrying P53 cytosine deletion. Similarly, the significantly higher incidence of cytosine deletion was reported in current smokers (75% in comparison to exsmoker and nonsmoker. Significantly higher frequency of cytosine deletion was reported in adenocarcinoma (68.08% than squamous cell carcinoma (52.83%. Also, a significant difference was reported between p53 cytosine deletion and metastasis (64.28%. Further, the majority of the cases assessed for response carrying P53 cytosine deletion were found to show faster disease progression. Conclusion: The data suggests that there is a significant association of the P53 exon 5 deletion of cytosine in codon 168 with metastasis and staging of the disease.

  18. Replication protein A (RPA) hampers the processive action of APOBEC3G cytosine deaminase on single-stranded DNA.

    Science.gov (United States)

    Lada, Artem G; Waisertreiger, Irina S-R; Grabow, Corinn E; Prakash, Aishwarya; Borgstahl, Gloria E O; Rogozin, Igor B; Pavlov, Youri I

    2011-01-01

    Editing deaminases have a pivotal role in cellular physiology. A notable member of this superfamily, APOBEC3G (A3G), restricts retroviruses, and Activation Induced Deaminase (AID) generates antibody diversity by localized deamination of cytosines in DNA. Unconstrained deaminase activity can cause genome-wide mutagenesis and cancer. The mechanisms that protect the genomic DNA from the undesired action of deaminases are unknown. Using the in vitro deamination assays and expression of A3G in yeast, we show that replication protein A (RPA), the eukaryotic single-stranded DNA (ssDNA) binding protein, severely inhibits the deamination activity and processivity of A3G. We found that mutations induced by A3G in the yeast genomic reporter are changes of a single nucleotide. This is unexpected because of the known property of A3G to catalyze multiple deaminations upon one substrate encounter event in vitro. The addition of recombinant RPA to the oligonucleotide deamination assay severely inhibited A3G activity. Additionally, we reveal the inverse correlation between RPA concentration and the number of deaminations induced by A3G in vitro on long ssDNA regions. This resembles the "hit and run" single base substitution events observed in yeast. Our data suggest that RPA is a plausible antimutator factor limiting the activity and processivity of editing deaminases in the model yeast system. Because of the similar antagonism of yeast RPA and human RPA with A3G in vitro, we propose that RPA plays a role in the protection of the human genome cell from A3G and other deaminases when they are inadvertently diverged from their natural targets. We propose a model where RPA serves as one of the guardians of the genome that protects ssDNA from the destructive processive activity of deaminases by non-specific steric hindrance.

  19. Replication protein A (RPA hampers the processive action of APOBEC3G cytosine deaminase on single-stranded DNA.

    Directory of Open Access Journals (Sweden)

    Artem G Lada

    Full Text Available Editing deaminases have a pivotal role in cellular physiology. A notable member of this superfamily, APOBEC3G (A3G, restricts retroviruses, and Activation Induced Deaminase (AID generates antibody diversity by localized deamination of cytosines in DNA. Unconstrained deaminase activity can cause genome-wide mutagenesis and cancer. The mechanisms that protect the genomic DNA from the undesired action of deaminases are unknown. Using the in vitro deamination assays and expression of A3G in yeast, we show that replication protein A (RPA, the eukaryotic single-stranded DNA (ssDNA binding protein, severely inhibits the deamination activity and processivity of A3G.We found that mutations induced by A3G in the yeast genomic reporter are changes of a single nucleotide. This is unexpected because of the known property of A3G to catalyze multiple deaminations upon one substrate encounter event in vitro. The addition of recombinant RPA to the oligonucleotide deamination assay severely inhibited A3G activity. Additionally, we reveal the inverse correlation between RPA concentration and the number of deaminations induced by A3G in vitro on long ssDNA regions. This resembles the "hit and run" single base substitution events observed in yeast.Our data suggest that RPA is a plausible antimutator factor limiting the activity and processivity of editing deaminases in the model yeast system. Because of the similar antagonism of yeast RPA and human RPA with A3G in vitro, we propose that RPA plays a role in the protection of the human genome cell from A3G and other deaminases when they are inadvertently diverged from their natural targets. We propose a model where RPA serves as one of the guardians of the genome that protects ssDNA from the destructive processive activity of deaminases by non-specific steric hindrance.

  20. N3 and O2 Protonated Conformers of the Cytosine Mononucleotides Coexist in the Gas Phase

    Science.gov (United States)

    Wu, R. R.; Hamlow, L. A.; He, C. C.; Nei, Y.-w.; Berden, G.; Oomens, J.; Rodgers, M. T.

    2017-08-01

    The gas-phase conformations of the protonated forms of the DNA and RNA cytosine mononucleotides, [pdCyd+H]+ and [pCyd+H]+, are examined by infrared multiple photon dissociation (IRMPD) action spectroscopy over the IR fingerprint and hydrogen-stretching regions complemented by electronic structure calculations. The low-energy conformations of [pdCyd+H]+ and [pCyd+H]+ and their relative stabilities are computed at the B3LYP/6-311+G(2d,2p)//B3LYP/6-311+G(d,p) and MP2(full)/6-311+G(2d,2p)//B3LYP/6-311+G(d,p) levels of theory. Comparisons of the measured IRMPD action spectra and B3LYP/6-311+G(d,p) linear IR spectra computed for the low-energy conformers allow the conformers present in the experiments to be determined. Similar to that found in previous IRMPD action spectroscopy studies of the protonated forms of the cytosine nucleosides, [dCyd+H]+ and [Cyd+H]+, both N3 and O2 protonated cytosine mononucleotides exhibiting an anti orientation of cytosine are found to coexist in the experimental population. The 2'-hydroxyl substituent does not significantly influence the most stable conformations of [pCyd+H]+ versus those of [pdCyd+H]+, as the IRMPD spectral profiles of [pdCyd+H]+ and [pCyd+H]+ are similar. However, the presence of the 2'-hydroxyl substituent does influence the relative intensities of the measured IRMPD bands. Comparisons to IRMPD spectroscopy studies of the deprotonated forms of the cytosine mononucleotides, [pdCyd-H]- and [pCyd-H]-, provide insight into the effects of protonation versus deprotonation on the conformational features of the nucleobase and sugar moieties. Likewise, comparisons to results of IRMPD spectroscopy studies of the protonated cytosine nucleosides provide insight into the influence of the phosphate moiety on structure. Comparison with previous ion mobility results shows the superiority of IRMPD spectroscopy for distinguishing various protonation sites.

  1. The arabidopsis cyclic nucleotide interactome

    KAUST Repository

    Donaldson, Lara Elizabeth

    2016-05-11

    Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.

  2. The role of cytosine methylation on charge transport through a DNA strand

    Energy Technology Data Exchange (ETDEWEB)

    Qi, Jianqing, E-mail: jqqi@uw.edu; Anantram, M. P., E-mail: anantmp@uw.edu [Department of Electrical Engineering, University of Washington, Seattle, Washington 98195-2500 (United States); Govind, Niranjan, E-mail: niri.govind@pnnl.gov [William R. Wiley Environmental Molecular Sciences Laboratory, Pacific Northwest National Laboratory, Richland, Washington 99352 (United States)

    2015-09-07

    Cytosine methylation has been found to play a crucial role in various biological processes, including a number of human diseases. The detection of this small modification remains challenging. In this work, we computationally explore the possibility of detecting methylated DNA strands through direct electrical conductance measurements. Using density functional theory and the Landauer-Büttiker method, we study the electronic properties and charge transport through an eight base-pair methylated DNA strand and its native counterpart. We first analyze the effect of cytosine methylation on the tight-binding parameters of two DNA strands and then model the transmission of the electrons and conductance through the strands both with and without decoherence. We find that the main difference of the tight-binding parameters between the native DNA and the methylated DNA lies in the on-site energies of (methylated) cytosine bases. The intra- and inter-strand hopping integrals between two nearest neighboring guanine base and (methylated) cytosine base also change with the addition of the methyl groups. Our calculations show that in the phase-coherent limit, the transmission of the methylated strand is close to the native strand when the energy is nearby the highest occupied molecular orbital level and larger than the native strand by 5 times in the bandgap. The trend in transmission also holds in the presence of the decoherence with the same rate. The lower conductance for the methylated strand in the experiment is suggested to be caused by the more stable structure due to the introduction of the methyl groups. We also study the role of the exchange-correlation functional and the effect of contact coupling by choosing coupling strengths ranging from weak to strong coupling limit.

  3. A novel fluorescent probe (dtpa-bis(cytosine)) for detection of Eu(III) in rare earth metal ions

    Science.gov (United States)

    Yang, Fan; Ren, Peipei; Liu, Guanhong; Song, Youtao; Bu, Naishun; Wang, Jun

    2018-03-01

    In this paper, a novel fluorescent probe, dtpa-bis(cytosine), was designed and synthesized for detecting europium (Eu3 +) ion. Upon addition of Eu3 + ions into the dtpa-bis(cytosine) solution, the fluorescence intensity can strongly be enhanced. Conversely, adding other rare earth metal ions, such as Y3 +, Ce3 +, Pr3 +, Nd3 +, Sm3 +, Gd3 +, Tb3 +, Dy3 +, Ho3 +, Er3 +, Yb3 + and Lu3 +, into dtpa-bis(cytosine) solution, the fluorescence intensity is decreased slightly. Some parameters affecting the fluorescence intensity of dtpa-bis(cytosine) solution in the presence of Eu3 + ions were investigated, including solution pH value, Eu3 + ion concentration and interfering substances. The detection mechanism of Eu3 + ion using dtpa-bis(cytosine) as fluorescent probe was proposed. Under optimum conditions, the fluorescence emission intensities of EuIII-dtpa-bis(cytosine) at 375 nm in the concentration range of 0.50 × 10- 5 mol • L- 1-5.00 × 10- 5 mol • L- 1 of Eu3 + ion display a better linear relationship. The limit of detection (LOD) was determined as 8.65 × 10- 7 mol • L- 1 and the corresponding correlation coefficient (R2) of the linear equation is 0.9807. It is wished that the proposed method could be applied for sensitively and selectively detecting Eu3 + ion.

  4. Genetic analysis of the cardiac methylome at single nucleotide resolution in a model of human cardiovascular disease.

    Directory of Open Access Journals (Sweden)

    Michelle D Johnson

    2014-12-01

    Full Text Available Epigenetic marks such as cytosine methylation are important determinants of cellular and whole-body phenotypes. However, the extent of, and reasons for inter-individual differences in cytosine methylation, and their association with phenotypic variation are poorly characterised. Here we present the first genome-wide study of cytosine methylation at single-nucleotide resolution in an animal model of human disease. We used whole-genome bisulfite sequencing in the spontaneously hypertensive rat (SHR, a model of cardiovascular disease, and the Brown Norway (BN control strain, to define the genetic architecture of cytosine methylation in the mammalian heart and to test for association between methylation and pathophysiological phenotypes. Analysis of 10.6 million CpG dinucleotides identified 77,088 CpGs that were differentially methylated between the strains. In F1 hybrids we found 38,152 CpGs showing allele-specific methylation and 145 regions with parent-of-origin effects on methylation. Cis-linkage explained almost 60% of inter-strain variation in methylation at a subset of loci tested for linkage in a panel of recombinant inbred (RI strains. Methylation analysis in isolated cardiomyocytes showed that in the majority of cases methylation differences in cardiomyocytes and non-cardiomyocytes were strain-dependent, confirming a strong genetic component for cytosine methylation. We observed preferential nucleotide usage associated with increased and decreased methylation that is remarkably conserved across species, suggesting a common mechanism for germline control of inter-individual variation in CpG methylation. In the RI strain panel, we found significant correlation of CpG methylation and levels of serum chromogranin B (CgB, a proposed biomarker of heart failure, which is evidence for a link between germline DNA sequence variation, CpG methylation differences and pathophysiological phenotypes in the SHR strain. Together, these results will

  5. Antinociceptive effect of purine nucleotides.

    Science.gov (United States)

    Mello, C F; Begnini, J; De-La-Vega, D D; Lopes, F P; Schwartz, C C; Jimenez-Bernal, R E; Bellot, R G; Frussa-Filho, R

    1996-10-01

    The antinociceptive effect of purine nucleotides administered systematically (sc) was determined using the formalin and writhing tests in adult male albino mice. The mechanisms underlying nucleotide-induced antinociception were investigated by preinjecting the animals (sc) with specific antagonists for opioid (naloxone, 1 mg/kg), purinergic P1 (caffeine, 5, 10, of 30 mg/kg); theophylline, 10 mg/kg) or purinergic P2 receptors (suramin, 100 mg/kg; Coomassie blue, 30-300 mg/kg; quinidine, 10 mg/kg). Adenosine, adenosine monophosphate (AMP), diphosphate (ADP) and triphosphate (ATP) caused a reduction in the number of writhes and in the time of licking the formalin-injected paw. Naloxone had no effect on adenosine- or adenine nucleotide-induced antinociception. Caffeine (30 mg/kg) and theophylline (10 mg/kg) reversed the antinociceptive action of adenosine and adenine nucleotide derivatives in both tests. P2 antagonists did not reverse adenine nucleotide-induced antinociception. These results suggest that antinociceptive effect of adenine nucleotides is mediated by adenosine.

  6. Cytosine methylation is a conserved epigenetic feature found throughout the phylum Platyhelminthes

    Science.gov (United States)

    2013-01-01

    Background The phylum Platyhelminthes (flatworms) contains an important group of bilaterian organisms responsible for many debilitating and chronic infectious diseases of human and animal populations inhabiting the planet today. In addition to their biomedical and veterinary relevance, some platyhelminths are also frequently used models for understanding tissue regeneration and stem cell biology. Therefore, the molecular (genetic and epigenetic) characteristics that underlie trophic specialism, pathogenicity or developmental maturation are likely to be pivotal in our continued studies of this important metazoan group. Indeed, in contrast to earlier studies that failed to detect evidence of cytosine or adenine methylation in parasitic flatworm taxa, our laboratory has recently defined a critical role for cytosine methylation in Schistosoma mansoni oviposition, egg maturation and ovarian development. Thus, in order to identify whether this epigenetic modification features in other platyhelminth species or is a novelty of S. mansoni, we conducted a study simultaneously surveying for DNA methylation machinery components and DNA methylation marks throughout the phylum using both parasitic and non-parasitic representatives. Results Firstly, using both S. mansoni DNA methyltransferase 2 (SmDNMT2) and methyl-CpG binding domain protein (SmMBD) as query sequences, we illustrate that essential DNA methylation machinery components are well conserved throughout the phylum. Secondly, using both molecular (methylation specific amplification polymorphism, MSAP) and immunological (enzyme-linked immunoabsorbent assay, ELISA) methodologies, we demonstrate that representative species (Echinococcus multilocularis, Protopolystoma xenopodis, Schistosoma haematobium, Schistosoma japonicum, Fasciola hepatica and Polycelis nigra) within all four platyhelminth classes (Cestoda, Monogenea, Trematoda and ‘Turbellaria’) contain methylated cytosines within their genome compartments

  7. Chronic low-dose ultraviolet-induced mutagenesis in nucleotide excision repair-deficient cells.

    Science.gov (United States)

    Haruta, Nami; Kubota, Yoshino; Hishida, Takashi

    2012-09-01

    UV radiation induces two major types of DNA lesions, cyclobutane pyrimidine dimers (CPDs) and 6-4 pyrimidine-pyrimidine photoproducts, which are both primarily repaired by nucleotide excision repair (NER). Here, we investigated how chronic low-dose UV (CLUV)-induced mutagenesis occurs in rad14Δ NER-deficient yeast cells, which lack the yeast orthologue of human xeroderma pigmentosum A (XPA). The results show that rad14Δ cells have a marked increase in CLUV-induced mutations, most of which are C→T transitions in the template strand for transcription. Unexpectedly, many of the CLUV-induced C→T mutations in rad14Δ cells are dependent on translesion synthesis (TLS) DNA polymerase η, encoded by RAD30, despite its previously established role in error-free TLS. Furthermore, we demonstrate that deamination of cytosine-containing CPDs contributes to CLUV-induced mutagenesis. Taken together, these results uncover a novel role for Polη in the induction of C→T transitions through deamination of cytosine-containing CPDs in CLUV-exposed NER deficient cells. More generally, our data suggest that Polη can act as both an error-free and a mutagenic DNA polymerase, depending on whether the NER pathway is available to efficiently repair damaged templates.

  8. Simultaneous determination of cytosine arabinoside, daunorubicin and etoposide in human plasma

    DEFF Research Database (Denmark)

    Krogh-Madsen, Mikkel; Hansen, Steen Honoré; Honoré, Per Hartvig

    2010-01-01

    A method for simultaneous bioanalysis of the three cytotoxic drugs cytosine arabinoside, daunorubicin and etoposide in human plasma was developed and validated. A HPLC method with ultra-violet and fluorescence detection, preceded by mixed-mode cation-exchange solid phase extraction sample....... The overall precision (% relative standard deviation) was within 0.2-13.5% and the recovery ranged between 86.1% and 110.1% for the three drugs at all concentrations tested. Plasma samples were stable for at least two months when stored at -20 degrees C. The method was successfully applied to quantification...

  9. Two-dimensional condensation of nucleobases: A comparative study of halogen derivatives of cytosine

    Czech Academy of Sciences Publication Activity Database

    Fojt, Lukáš; Vetterl, Vladimír; Doneux, T.

    2009-01-01

    Roč. 74, 11-12 (2009), s. 1611-1622 ISSN 0010-0765 R&D Projects: GA AV ČR(CZ) KAN200040651; GA MŠk(CZ) LC06035; GA ČR(CZ) GA202/08/1688 Grant - others:GA MŠk(CZ) 1M0528 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : hanging mercury drop electrode * cytosine * 2D condensation Subject RIV: BO - Biophysics Impact factor: 0.856, year: 2009

  10. Genome-wide nucleosome map and cytosine methylation levels of an ancient human genome

    DEFF Research Database (Denmark)

    Pedersen, Jakob Skou; Valen, Eivind; Velazquez, Amhed Missael Vargas

    2014-01-01

    Epigenetic information is available from contemporary organisms, but is difficult to track back in evolutionary time. Here, we show that genome-wide epigenetic information can be gathered directly from next-generation sequence reads of DNA isolated from ancient remains. Using the genome sequence...... data generated from hair shafts of a 4000-yr-old Paleo-Eskimo belonging to the Saqqaq culture, we generate the first ancient nucleosome map coupled with a genome-wide survey of cytosine methylation levels. The validity of both nucleosome map and methylation levels were confirmed by the recovery...

  11. Base Flip in DNA Studied by Molecular Dynamics Simulationsof Differently-Oxidized Forms of Methyl-Cytosine

    Directory of Open Access Journals (Sweden)

    Mahdi Bagherpoor Helabad

    2014-07-01

    Full Text Available Distortions in the DNA sequence, such as damage or mispairs, are specifically recognized and processed by DNA repair enzymes. Many repair proteins and, in particular, glycosylases flip the target base out of the DNA helix into the enzyme’s active site. Our molecular dynamics simulations of DNA with intact and damaged (oxidized methyl-cytosine show that the probability of being flipped is similar for damaged and intact methyl-cytosine. However, the accessibility of the different 5-methyl groups allows direct discrimination of the oxidized forms. Hydrogen-bonded patterns that vary between methyl-cytosine forms carrying a carbonyl oxygen atom are likely to be detected by the repair enzymes and may thus help target site recognition.

  12. Cytosine methylation does not affect binding of transcription factor Sp1

    International Nuclear Information System (INIS)

    Harrington, M.A.; Jones, P.A.; Imagawa, M.; Karin, M.

    1988-01-01

    DNA methylation may be a component of a multilevel control mechanism that regulates eukaryotic gene expression. The authors used synthetic oligonucleotides to investigate the effect of cytosine methylation on the binding of the transcription factor Sp1 to its target sequence (a G+C-rich sequence known as a GC box). Concatemers of double-stranded 14-mers containing a GC box successfully competed with the human metallothionein IIA promoter for binding to Sp1 in DNase I protection experiments. The presence of 5-methylcytosine in the CpG sequence of the GC box did not influence Sp1 binding. The result was confirmed using double-stranded 20-mers containing 16 base pairs of complementary sequence. Electrophoretic gel retardation analysis of annealed 28-mers containing a GC box incubated with an Sp1-containing HeLa cell nuclear extract demonstrated the formation of DNA-protein complexes; formation of these complexes was not inhibited when an oligomer without a GC box was used as a competitor. Once again, the presence of a 5-methylcytosine residue in the GC box did not influence the binding of the protein to DNA. The results therefore preclude a direct effect of cytosine methylation on Sp1-DNA interactions

  13. Cytosine methylation at CpCpG sites triggers accumulation of non-CpG methylation in gene bodies

    OpenAIRE

    Zabet, NR; Catoni, Marco; Prischi, F; Paszkowski, Jerzy Waclaw

    2017-01-01

    Methylation of cytosine is an epigenetic mark involved in the regulation of transcription, usually associated with transcriptional repression. In mammals, methylated cytosines are found predominantly in CpGs but in plants non-CpG methylation (in the CpHpG or CpHpH contexts, where H is A, C or T) is also present and is associated with the transcriptional silencing of transposable elements. In addition, CpG methylation is found in coding regions of active genes. In the absence of the demethylas...

  14. Nucleotide excision repair in yeast

    NARCIS (Netherlands)

    Eijk, Patrick van

    2012-01-01

    Nucleotide Excision Repair (NER) is a conserved DNA repair pathway capable of removing a broad spectrum of DNA damage. In human cells a defect in NER leads to the disorder Xeroderma pigmentosum (XP). The yeast Saccharomyces cerevisiae is an excellent model organism to study the mechanism of NER. The

  15. Effect of alginate microencapsulation on the catalytic efficiency and in vitro enzyme-prodrug therapeutic efficacy of cytosine deaminase and of recombinant E. coli expressing cytosine deaminase.

    Science.gov (United States)

    Funaro, Michael G; Nemani, Krishnamurthy V; Chen, Zhihang; Bhujwalla, Zaver M; Griswold, Karl E; Gimi, Barjor

    2016-02-01

    Cytosine deaminase (CD) catalyses the enzymatic conversion of the non-toxic prodrug 5-fluorocytosine (5-FC) to the potent chemotherapeutic form, 5-fluorouracil (5-FU). Intratumoral delivery of CD localises chemotherapy dose while reducing systemic toxicity. Encapsulation in biocompatible microcapsules immunoisolates CD and protects it from degradation. We report on the effect of alginate encapsulation on the catalytic and functional activity of isolated CD and recombinant E. coli engineered to express CD (E. coli(CD)). Alginate microcapsules containing either CD or Escherichia coli(CD) were prepared using ionotropic gelation. Conversion of 5-FC to 5-FU was quantitated in unencapsulated and encapsulated CD/E. coli(CD) using spectrophotometry, with a slower rate of conversion observed following encapsulation. Both encapsulated CD/5-FC and E. coli(CD)/5-FC resulted in cell kill and reduced proliferation of 9 L rat glioma cells, which was comparable to direct 5-FU treatment. Our results show that encapsulation preserves the therapeutic potential of CD and E. coli(CD) is equally effective for enzyme-prodrug therapy.

  16. Quantitative analysis of the experimental cytotoxic drug cyclopentenyl cytosine and its metabolite in plasma with HPLC tandem mass spectrometry

    NARCIS (Netherlands)

    Schimmel, Kirsten; van Lenthe, Henk; Leen, Rene; Kulik, Willem; Verschuur, Arnauld; Guchelaar, Henk-Jan; van Kuilenburg, André

    2008-01-01

    The cytotoxic drug cyclopentenyl cytosine (CPEC) is currently being investigated in early clinical trials. Monitoring of plasma levels is required for pharmacokinetic analysis and management of toxicity. This paper describes the analysis of CPEC and cyclopentenyl uracil (CPEU) in plasma by

  17. Supramolecular Switches Based on the Guanine–Cytosine (GC) Watson–Crick Pair: Effect of Neutral and Ionic Substituents

    NARCIS (Netherlands)

    Guerra, C.F.; van der Wijst, T.; Bickelhaupt, F.M.

    2006-01-01

    We have theoretically analyzed Watson–Crick guanine–cytosine (GC) base pairs in which purine-C8 and/or pyrimidine-C6 positions carry a substituent X = NH−, NH2, NH3+ (N series), O−, OH, or OH2+ (O series), using the generalized gradient approximation (GGA) of density functional theory at the

  18. Nanoswitches based on DNA base pairs: why adenine-thymine is less suitable than guanine-cytosine

    NARCIS (Netherlands)

    Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.

    2006-01-01

    Substituted Watson-Crick guanine-cytosine (GC) base pairs were recently shown to yield robust three-state nanoswitches. Here, we address the question: Can such supramolecular switches also be based on Watson-Crick adenine-thymine (AT) base pairs? We have theoretically analyzed AT pairs in which

  19. Cyclopentenyl cytosine induces apoptosis and increases cytarabine-induced apoptosis in a T-lymphoblastic leukemic cell-line

    NARCIS (Netherlands)

    Verschuur, A. C.; Brinkman, J.; van Gennip, A. H.; Leen, R.; Vet, R. J.; Evers, L. M.; Voûte, P. A.; van Kuilenburg, A. B.

    2001-01-01

    Cyclopentenyl cytosine (CPEC) is a nucleoside-analogue that decreases the concentrations of cytidine triphosphate (CTP) and deoxycytidine triphosphate (dCTP) in leukemic cells by inhibiting the enzyme CTP synthetase, resulting in a decreased synthesis of RNA and DNA. Low concentrations of dCTP

  20. Detection of hypoxanthine, xanthine and uric acid in γ-irradiated aqueous solution of cytosine

    International Nuclear Information System (INIS)

    Kobayashi, Tsuya; Shirai, Kazuo

    1979-01-01

    The aqueous solution of cytosine of 3.6 x 10 -2 M was irradiated with gamma -ray (60 megarad) in nitrogen-saturated glass ampules, and freeze-dried, then the residue obtained was changed to trimethylsilylacid, and this was analyzed by paper chromatography, UV spectrometry, and/or gas-liquid chromatography. Hypoxanthine, xanthine and uric acid were detected in this solution, in addition to some other compounds already known to be produced by gamma -irradiation, e.g., TMS-uracil, TMS-6-hydroxyuracil and TMS-hypoxanthine. It was presumed that these compounds were formed by the recombination of the primary radiolytic products. Uric acid formation by this mechanism was confirmed by gamma -irradiation of the mixture that contained urea, and 5- and 6-hydroxyuracil. (Kaihara, S.)

  1. Mutation Processes in 293-Based Clones Overexpressing the DNA Cytosine Deaminase APOBEC3B.

    Directory of Open Access Journals (Sweden)

    Monica K Akre

    Full Text Available Molecular, cellular, and clinical studies have combined to demonstrate a contribution from the DNA cytosine deaminase APOBEC3B (A3B to the overall mutation load in breast, head/neck, lung, bladder, cervical, ovarian, and other cancer types. However, the complete landscape of mutations attributable to this enzyme has yet to be determined in a controlled human cell system. We report a conditional and isogenic system for A3B induction, genomic DNA deamination, and mutagenesis. Human 293-derived cells were engineered to express doxycycline-inducible A3B-eGFP or eGFP constructs. Cells were subjected to 10 rounds of A3B-eGFP exposure that each caused 80-90% cell death. Control pools were subjected to parallel rounds of non-toxic eGFP exposure, and dilutions were done each round to mimic A3B-eGFP induced population fluctuations. Targeted sequencing of portions of TP53 and MYC demonstrated greater mutation accumulation in the A3B-eGFP exposed pools. Clones were generated and microarray analyses were used to identify those with the greatest number of SNP alterations for whole genome sequencing. A3B-eGFP exposed clones showed global increases in C-to-T transition mutations, enrichments for cytosine mutations within A3B-preferred trinucleotide motifs, and more copy number aberrations. Surprisingly, both control and A3B-eGFP clones also elicited strong mutator phenotypes characteristic of defective mismatch repair. Despite this additional mutational process, the 293-based system characterized here still yielded a genome-wide view of A3B-catalyzed mutagenesis in human cells and a system for additional studies on the compounded effects of simultaneous mutation mechanisms in cancer cells.

  2. Transgenerational epigenetics: Inheritance of global cytosine methylation and methylation-related epigenetic markers in the shrub Lavandula latifolia.

    Science.gov (United States)

    Herrera, Carlos M; Alonso, Conchita; Medrano, Mónica; Pérez, Ricardo; Bazaga, Pilar

    2018-04-01

    The ecological and evolutionary significance of natural epigenetic variation (i.e., not based on DNA sequence variants) variation will depend critically on whether epigenetic states are transmitted from parents to offspring, but little is known on epigenetic inheritance in nonmodel plants. We present a quantitative analysis of transgenerational transmission of global DNA cytosine methylation (= proportion of all genomic cytosines that are methylated) and individual epigenetic markers (= methylation status of anonymous MSAP markers) in the shrub Lavandula latifolia. Methods based on parent-offspring correlations and parental variance component estimation were applied to epigenetic features of field-growing plants ('maternal parents') and greenhouse-grown progenies. Transmission of genetic markers (AFLP) was also assessed for reference. Maternal parents differed significantly in global DNA cytosine methylation (range = 21.7-36.7%). Greenhouse-grown maternal families differed significantly in global methylation, and their differences were significantly related to maternal origin. Methylation-sensitive amplified polymorphism (MSAP) markers exhibited significant transgenerational transmission, as denoted by significant maternal variance component of marker scores in greenhouse families and significant mother-offspring correlations of marker scores. Although transmission-related measurements for global methylation and MSAP markers were quantitatively lower than those for AFLP markers taken as reference, this study has revealed extensive transgenerational transmission of genome-wide global cytosine methylation and anonymous epigenetic markers in L. latifolia. Similarity of results for global cytosine methylation and epigenetic markers lends robustness to this conclusion, and stresses the value of considering both types of information in epigenetic studies of nonmodel plants. © 2018 Botanical Society of America.

  3. Nucleotide variability in the 5-enolpyruvylshikimate-3-phosphate synthase gene from Eleusine indica (L.) Gaertn.

    Science.gov (United States)

    Chong, J L; Wickneswari, R; Ismail, B S; Salmijah, S

    2008-02-01

    This study reports the results of the partial DNA sequence analysis of the 5-enolpyruvyl-shikimate-3-phosphate synthase (EPSPS) gene in glyphosate-resistant (R) and glyphosate-susceptible (S) biotypes of Eleusine indica (L.) Gaertn from Peninsular Malaysia. Sequencing results revealed point mutation at nucleotide position 875 in the R biotypes of Bidor, Chaah and Temerloh. In the Chaah R population, substitution of cytosine (C) to adenine (A) resulted in the change of threonine (Thr106) to proline (Pro106) and from C to thymidine (T) in the Bidor R population, leading to serine (Ser106) from Pro106. As for the Temerloh R, C was substituted by T resulting in the change of Pro106 to Ser106. A new mutation previously undetected in the Temerloh R was revealed with C being substituted with A, resulting in the change of Pro106 to Thr106 indicating multiple founding events rather than to the spread of a single resistant allele. There was no point mutation recorded at nucleotide position 875 previously demonstrated to play a pivotal role in conferring glyphosate resistance to E. indica for the Lenggeng, Kuala Selangor, Melaka R populations. Thus, there may be another resistance mechanism yet undiscovered in the resistant Lenggeng, Kuala Selangor and Melaka populations.

  4. Automated quantum chemistry based molecular dynamics simulations of electron ionization induced fragmentations of the nucleobases Uracil, Thymine, Cytosine, and Guanine.

    Science.gov (United States)

    Grimme, Stefan; Bauer, Christopher Alexander

    2015-01-01

    The gas-phase decomposition pathways of electron ionization (EI)-induced radical cations of the nucleobases uracil, thymine, cytosine, and guanine are investigated by means of mixed quantum-classical molecular dynamics. No preconceived fragmentation channels are used in the calculations. The results compare well to a plethora of experimental and theoretical data for these important biomolecules. With our combined stochastic and dynamic approach, one can access in an unbiased way the energetically available decomposition mechanisms. Additionally, we are able to separate the EI mass spectra of different tautomers of cytosine and guanine. Our method (previously termed quantum chemistry electron ionization mass spectra) reproduces free nucleobase experimental mass spectra well and provides detailed mechanistic in-sight into high-energy unimolecular decomposition processes.

  5. An N-Glycosidase from Escherichia coli That Releases Free Uracil from DNA Containing Deaminated Cytosine Residues

    Science.gov (United States)

    Lindahl, Tomas

    1974-01-01

    An enzyme that liberates uracil from single-stranded and double-stranded DNA containing deaminated cytosine residues and from deoxycytidylate-deoxyuridylate copolymers in the absence of Mg++ has been purified 30-fold from cell extracts of E. coli. The enzyme does not release uracil from deoxyuridine, dUMP, uridine, or RNA, nor does it liberate the normally occurring pyrimidine bases, cytosine and thymine, from DNA. The enzymatic cleavage of N-glycosidic bonds in DNA occurs without concomitant cleavage of phosphodiester bonds, resulting in the formation of free uracil and DNA strands of unaltered chain length that contain apyrimidinic sites as reaction products. The enzyme may be active in DNA repair, converting deaminated dCMP residues to an easily repairable form. PMID:4610583

  6. Biophysical and molecular docking insight into the interaction of cytosine β-D arabinofuranoside with human serum albumin

    International Nuclear Information System (INIS)

    Alam, Parvez; Chaturvedi, Sumit Kumar; Anwar, Tamanna; Siddiqi, Mohammad Khursheed; Ajmal, Mohd Rehan; Badr, Gamal; Mahmoud, Mohamed H.; Hasan Khan, Rizwan

    2015-01-01

    Interaction of pharmacologically important anticancer drug cytosine β-D arabinofuranoside with human serum albumin (HSA) at physiological pH 7.4 has been studied by utilizing various spectroscopic and molecular docking strategies. Fluorescence results revealed that cytosine β-D arabinofuranoside interacts with HSA through static quenching mechanism with binding affinity of 2.4×10 3 M −1 . The average binding distance between drug and Trp 214 of HSA was found to be 2.23 nm on the basis of the theory of Förster's energy transfer. Synchronous fluorescence data indicated that interaction of drug with HSA changed the microenvironment around the tryptophan residue. UV–visible spectroscopy and circular dichroism results deciphered the complex formation and conformational alterations in the HSA respectively. Dynamic light scattering was utilized to understand the topology of protein in absence and presence of drug. Thermodynamic parameters obtained from isothermal titration calorimetry (ΔH=−26.01 kJ mol −1 and TΔS=6.5 kJ mol −1 ) suggested the involvement of van der Waal interaction and hydrogen bonding. Molecular docking and displacement study with site specific markers suggested that cytosine β-D arabinofuranoside binds to subdomain IB of HSA which is also known as the hemin binding site. This study will be helpful to understand the binding mechanism of cytosine β-D arabinofuranoside with HSA and associated alterations. - Highlights: • Comprehensive insight into the interaction of CBDA with HSA. • The interaction process is spontaneous and exothermic. • The main governing forces for stabilizing HSA–CBDA complex are van der Waal interaction and hydrogen bonding. • CBDA binds at subdomain IB on HSA

  7. Genome-wide identification and comparative analysis of cytosine-5 DNA methyltransferases and demethylase families in wild and cultivated peanut

    Directory of Open Access Journals (Sweden)

    Pengfei eWang

    2016-02-01

    Full Text Available AbstractDNA methylation plays important roles in genome protection, regulation of gene expression and was associated with plants development. Plant DNA methylation pattern was mediated by cytosine-5 DNA methyltransferases and demethylase. Although the genomes of AA and BB wild peanuts have been fully sequence, these two gene families have not been studied. In this study we report the identification and analysis of putative cytosine-5 DNA methyltransferases (C5-MTases and demethylase in AA and BB wild peanuts. Cytosine-5 DNA methyltransferases in AA and BB wild peanuts could be classified in known MET, CMT and DRM2 groups based on their domain organization. This result was supported by the gene and protein structural characteristics and phylogenetic analysis. We found that some wild peanut DRM2 numbers didn’t contain UBA domain which was different from other plants such as Arabidopsis, maize, soybean. Five DNA demethylase were found in AA genome and five in BB genome. The selective pressure analysis showed that wild peanut C5-MTases gene mainly underwent purifying selection but many positive selection sites can be detected. Conversely, DNA demethylase genes mainly underwent positive selection during evolution. Additionally, the expression dynamic of cytosine-5 DNA methyltransferases and demethylase genes in different cultivated peanut tissues were analyzed. Expression result showed that cold, heat or drought stress could influence the expression level of C5-MTases and DNA demethylase genes in cultivated peanut. These results are useful for better understanding the complexity of these two gene families, and will facilitate epigenetic studies in peanut.

  8. Biophysical and molecular docking insight into the interaction of cytosine β-D arabinofuranoside with human serum albumin

    Energy Technology Data Exchange (ETDEWEB)

    Alam, Parvez; Chaturvedi, Sumit Kumar [Interdisciplinary Biotechnology Unit, Aligarh Muslim University, Aligarh 202002, UP (India); Anwar, Tamanna [Center of Bioinformatics Research and Technology, Aligarh 202002 (India); Siddiqi, Mohammad Khursheed; Ajmal, Mohd Rehan [Interdisciplinary Biotechnology Unit, Aligarh Muslim University, Aligarh 202002, UP (India); Badr, Gamal [Laboratory of Immunology & Molecular Physiology, Zoology Department, Faculty of Science, Assiut University, 71516 Assiut (Egypt); Mahmoud, Mohamed H. [Food Science and Nutrition Department, National Research Center, Dokki, Cairo (Egypt); Deanship of Scientific Research, King Saud University, Riyadh (Saudi Arabia); Hasan Khan, Rizwan, E-mail: rizwanhkhan@hotmail.com [Interdisciplinary Biotechnology Unit, Aligarh Muslim University, Aligarh 202002, UP (India)

    2015-08-15

    Interaction of pharmacologically important anticancer drug cytosine β-D arabinofuranoside with human serum albumin (HSA) at physiological pH 7.4 has been studied by utilizing various spectroscopic and molecular docking strategies. Fluorescence results revealed that cytosine β-D arabinofuranoside interacts with HSA through static quenching mechanism with binding affinity of 2.4×10{sup 3} M{sup −1}. The average binding distance between drug and Trp{sup 214} of HSA was found to be 2.23 nm on the basis of the theory of Förster's energy transfer. Synchronous fluorescence data indicated that interaction of drug with HSA changed the microenvironment around the tryptophan residue. UV–visible spectroscopy and circular dichroism results deciphered the complex formation and conformational alterations in the HSA respectively. Dynamic light scattering was utilized to understand the topology of protein in absence and presence of drug. Thermodynamic parameters obtained from isothermal titration calorimetry (ΔH=−26.01 kJ mol{sup −1} and TΔS=6.5 kJ mol{sup −1}) suggested the involvement of van der Waal interaction and hydrogen bonding. Molecular docking and displacement study with site specific markers suggested that cytosine β-D arabinofuranoside binds to subdomain IB of HSA which is also known as the hemin binding site. This study will be helpful to understand the binding mechanism of cytosine β-D arabinofuranoside with HSA and associated alterations. - Highlights: • Comprehensive insight into the interaction of CBDA with HSA. • The interaction process is spontaneous and exothermic. • The main governing forces for stabilizing HSA–CBDA complex are van der Waal interaction and hydrogen bonding. • CBDA binds at subdomain IB on HSA.

  9. Electron attachment to the guanine-cytosine nucleic acid base pair and the effects of monohydration and proton transfer.

    Science.gov (United States)

    Gupta, Ashutosh; Jaeger, Heather M; Compaan, Katherine R; Schaefer, Henry F

    2012-05-17

    The guanine-cytosine (GC) radical anion and its interaction with a single water molecule is studied using ab initio and density functional methods. Z-averaged second-order perturbation theory (ZAPT2) was applied to GC radical anion for the first time. Predicted spin densities show that the radical character is localized on cytosine. The Watson-Crick monohydrated GC anion is compared to neutral GC·H2O, as well as to the proton-transferred analogue on the basis of structural and energetic properties. In all three systems, local minima are identified that correspond to water positioned in the major and minor grooves of macromolecular DNA. On the anionic surface, two novel structures have water positioned above or below the GC plane. On the neutral and anionic surfaces, the global minimum can be described as water interacting with the minor groove. These structures are predicted to have hydration energies of 9.7 and 11.8 kcal mol(-1), respectively. Upon interbase proton-transfer (PT), the anionic global minimum has water positioned in the major groove, and the hydration energy increases to 13.4 kcal mol(-1). PT GC·H2O(•-) has distonic character; the radical character resides on cytosine, while the negative charge is localized on guanine. The effects of proton transfer are further investigated through the computed adiabatic electron affinities (AEA) of GC and monohydrated GC, and the vertical detachment energies (VDE) of the corresponding anions. Monohydration increases the AEAs and VDEs by only 0.1 eV, while proton-transfer increases the VDEs substantially (0.8 eV). The molecular charge distribution of monohydrated guanine-cytosine radical anion depends heavily on interbase proton transfer.

  10. Involvement of a cytosine side chain in proton transfer in the rate-determining step of ribozyme self-cleavage

    Science.gov (United States)

    Shih, I-hung; Been, Michael D.

    2001-01-01

    Ribozymes of hepatitis delta virus have been proposed to use an active-site cytosine as an acid-base catalyst in the self-cleavage reaction. In this study, we have examined the role of cytosine in more detail with the antigenomic ribozyme. Evidence that proton transfer in the rate-determining step involved cytosine 76 (C76) was obtained from examining cleavage activity of the wild-type and imidazole buffer-rescued C76-deleted (C76Δ) ribozymes in D2O and H2O. In both reactions, a similar kinetic isotope effect and shift in the apparent pKa indicate that the buffer is functionally substituting for the side chain in proton transfer. Proton inventory of the wild-type reaction supported a mechanism of a single proton transfer at the transition state. This proton transfer step was further characterized by exogenous base rescue of a C76Δ mutant with cytosine and imidazole analogues. For the imidazole analogues that rescued activity, the apparent pKa of the rescue reaction, measured under kcat/KM conditions, correlated with the pKa of the base. From these data a Brønsted coefficient (β) of 0.51 was determined for the base-rescued reaction of C76Δ. This value is consistent with that expected for proton transfer in the transition state. Together, these data provide strong support for a mechanism where an RNA side chain participates directly in general acid or general base catalysis of the wild-type ribozyme to facilitate RNA cleavage. PMID:11171978

  11. Analysis of DNA Cytosine Methylation Patterns Using Methylation-Sensitive Amplification Polymorphism (MSAP).

    Science.gov (United States)

    Guevara, María Ángeles; de María, Nuria; Sáez-Laguna, Enrique; Vélez, María Dolores; Cervera, María Teresa; Cabezas, José Antonio

    2017-01-01

    Different molecular techniques have been developed to study either the global level of methylated cytosines or methylation at specific gene sequences. One of them is the methylation-sensitive amplified polymorphism technique (MSAP) which is a modification of amplified fragment length polymorphism (AFLP). It has been used to study methylation of anonymous CCGG sequences in different fungi, plants, and animal species. The main variation of this technique resides on the use of isoschizomers with different methylation sensitivity (such as HpaII and MspI) as a frequent-cutter restriction enzyme. For each sample, MSAP analysis is performed using both EcoRI/HpaII- and EcoRI/MspI-digested samples. A comparative analysis between EcoRI/HpaII and EcoRI/MspI fragment patterns allows the identification of two types of polymorphisms: (1) methylation-insensitive polymorphisms that show common EcoRI/HpaII and EcoRI/MspI patterns but are detected as polymorphic amplified fragments among samples and (2) methylation-sensitive polymorphisms which are associated with the amplified fragments that differ in their presence or absence or in their intensity between EcoRI/HpaII and EcoRI/MspI patterns. This chapter describes a detailed protocol of this technique and discusses the modifications that can be applied to adjust the technology to different species of interest.

  12. Isoschizomers and amplified fragment length polymorphism for the detection of specific cytosine methylation changes.

    Science.gov (United States)

    Ruiz-García, Leonor; Cabezas, Jose Antonio; de María, Nuria; Cervera, María-Teresa

    2010-01-01

    Different molecular techniques have been developed to study either the global level of methylated cytosines or methylation at specific gene sequences. One of them is a modification of the Amplified Fragment Length Polymorphism (AFLP) technique that has been used to study methylation of anonymous CCGG sequences in different fungi, plant and animal species. The main variation of this technique is based on the use of isoschizomers with different methylation sensitivity (such as HpaII and MspI) as a frequent cutter restriction enzyme. For each sample, AFLP analysis is performed using both EcoRI/HpaII and EcoRI/MspI digested samples. Comparative analysis between EcoRI/HpaII and EcoRI/MspI fragment patterns allows the identification of two types of polymorphisms: (1) "Methylation-insensitive polymorphisms" that show common EcoRI/HpaII and EcoRI/MspI patterns but are detected as polymorphic amplified fragments among samples; and (2) "Methylation-sensitive polymorphisms" that are associated with amplified fragments differing in their presence or absence or in their intensity between EcoRI/HpaII and EcoRI/MspI patterns. This chapter describes a detailed protocol of this technique and discusses modifications that can be applied to adjust the technology to different species of interest.

  13. RNA-mediated epigenetic heredity requires the cytosine methyltransferase Dnmt2.

    Directory of Open Access Journals (Sweden)

    Jafar Kiani

    2013-05-01

    Full Text Available RNA-mediated transmission of phenotypes is an important way to explain non-Mendelian heredity. We have previously shown that small non-coding RNAs can induce hereditary epigenetic variations in mice and act as the transgenerational signalling molecules. Two prominent examples for these paramutations include the epigenetic modulation of the Kit gene, resulting in altered fur coloration, and the modulation of the Sox9 gene, resulting in an overgrowth phenotype. We now report that expression of the Dnmt2 RNA methyltransferase is required for the establishment and hereditary maintenance of both paramutations. Our data show that the Kit paramutant phenotype was not transmitted to the progeny of Dnmt2(-/- mice and that the Sox9 paramutation was also not established in Dnmt2(-/- embryos. Similarly, RNA from Dnmt2-negative Kit heterozygotes did not induce the paramutant phenotype when microinjected into Dnmt2-deficient fertilized eggs and microinjection of the miR-124 microRNA failed to induce the characteristic giant phenotype. In agreement with an RNA-mediated mechanism of inheritance, no change was observed in the DNA methylation profiles of the Kit locus between the wild-type and paramutant mice. RNA bisulfite sequencing confirmed Dnmt2-dependent tRNA methylation in mouse sperm and also indicated Dnmt2-dependent cytosine methylation in Kit RNA in paramutant embryos. Together, these findings uncover a novel function of Dnmt2 in RNA-mediated epigenetic heredity.

  14. [Triplet expansion cytosine-guanine-guanine: Three cases of OMIM syndrome in the same family].

    Science.gov (United States)

    González-Pérez, Jesús; Izquierdo-Álvarez, Silvia; Fuertes-Rodrigo, Cristina; Monge-Galindo, Lorena; Peña-Segura, José Luis; López-Pisón, Francisco Javier

    2016-04-01

    The dynamic increase in the number of triplet repeats of cytosine-guanine-guanine (CGG) in the FMR1 gene mutation is responsible for three OMIM syndromes with a distinct clinical phenotype: Fragile X syndrome (FXS) and two pathologies in adult carriers of the premutation (55-200 CGG repeats): Primary ovarian insufficiency (FXPOI) and tremor-ataxia syndrome (FXTAS) associated with FXS. CGG mutation dynamics of the FMR1 gene were studied in DNA samples from peripheral blood from the index case and other relatives of first, second and third degree by TP-PCR, and the percentage methylation. Diagnosis of FXS was confirmed in three patients (21.4%), eight patients (57.1%) were confirmed in the premutation range transmitters, one male patient with full mutation/permutation mosaicism (7.1%) and two patients (14.3%) with normal study. Of the eight permutated patients, three had FXPOI and one male patient had FXTAS. Our study suggests the importance of making an early diagnosis of SXF in order to carry out a family study and genetic counselling, which allow the identification of new cases or premutated patients with FMR1 gene- associated syndromes (FXTAS, FXPOI). Copyright © 2015 Elsevier España, S.L.U. All rights reserved.

  15. Epigenetic contribution to successful polyploidizations: variation in global cytosine methylation along an extensive ploidy series in Dianthus broteri (Caryophyllaceae).

    Science.gov (United States)

    Alonso, Conchita; Balao, Francisco; Bazaga, Pilar; Pérez, Ricardo

    2016-11-01

    Polyploidization is a significant evolutionary force in plants which involves major genomic and genetic changes, frequently regulated by epigenetic factors. We explored whether natural polyploidization in Dianthus broteri complex resulted in substantial changes in global DNA cytosine methylation associated to ploidy. Global cytosine methylation was estimated by high-performance liquid chromatography (HPLC) in 12 monocytotypic populations with different ploidies (2×, 4×, 6×, 12×) broadly distributed within D. broteri distribution range. The effects of ploidy level and local variation on methylation were assessed by generalized linear mixed models (GLMMs). Dianthus broteri exhibited a higher methylation percent (˜33%) than expected by its monoploid genome size and a large variation among study populations (range: 29.3-35.3%). Global methylation tended to increase with ploidy but did not significantly differ across levels due to increased variation within the highest-order polyploidy categories. Methylation varied more among hexaploid and dodecaploid populations, despite such cytotypes showing more restricted geographic location and increased genetic relatedness than diploids and tetraploids. In this study, we demonstrate the usefulness of an HPLC method in providing precise and genome reference-free global measure of DNA cytosine methylation, suitable to advance current knowledge of the roles of this epigenetic mechanism in polyploidization processes. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

  16. The Human SLC25A33 and SLC25A36 Genes of Solute Carrier Family 25 Encode Two Mitochondrial Pyrimidine Nucleotide Transporters*

    Science.gov (United States)

    Di Noia, Maria Antonietta; Todisco, Simona; Cirigliano, Angela; Rinaldi, Teresa; Agrimi, Gennaro; Iacobazzi, Vito; Palmieri, Ferdinando

    2014-01-01

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport inorganic anions, amino acids, carboxylates, nucleotides, and coenzymes across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. Here two members of this family, SLC25A33 and SLC25A36, have been thoroughly characterized biochemically. These proteins were overexpressed in bacteria and reconstituted in phospholipid vesicles. Their transport properties and kinetic parameters demonstrate that SLC25A33 transports uracil, thymine, and cytosine (deoxy)nucleoside di- and triphosphates by an antiport mechanism and SLC25A36 cytosine and uracil (deoxy)nucleoside mono-, di-, and triphosphates by uniport and antiport. Both carriers also transported guanine but not adenine (deoxy)nucleotides. Transport catalyzed by both carriers was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. In confirmation of their identity (i) SLC25A33 and SLC25A36 were found to be targeted to mitochondria and (ii) the phenotypes of Saccharomyces cerevisiae cells lacking RIM2, the gene encoding the well characterized yeast mitochondrial pyrimidine nucleotide carrier, were overcome by expressing SLC25A33 or SLC25A36 in these cells. The main physiological role of SLC25A33 and SLC25A36 is to import/export pyrimidine nucleotides into and from mitochondria, i.e. to accomplish transport steps essential for mitochondrial DNA and RNA synthesis and breakdown. PMID:25320081

  17. The human SLC25A33 and SLC25A36 genes of solute carrier family 25 encode two mitochondrial pyrimidine nucleotide transporters.

    Science.gov (United States)

    Di Noia, Maria Antonietta; Todisco, Simona; Cirigliano, Angela; Rinaldi, Teresa; Agrimi, Gennaro; Iacobazzi, Vito; Palmieri, Ferdinando

    2014-11-28

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport inorganic anions, amino acids, carboxylates, nucleotides, and coenzymes across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. Here two members of this family, SLC25A33 and SLC25A36, have been thoroughly characterized biochemically. These proteins were overexpressed in bacteria and reconstituted in phospholipid vesicles. Their transport properties and kinetic parameters demonstrate that SLC25A33 transports uracil, thymine, and cytosine (deoxy)nucleoside di- and triphosphates by an antiport mechanism and SLC25A36 cytosine and uracil (deoxy)nucleoside mono-, di-, and triphosphates by uniport and antiport. Both carriers also transported guanine but not adenine (deoxy)nucleotides. Transport catalyzed by both carriers was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. In confirmation of their identity (i) SLC25A33 and SLC25A36 were found to be targeted to mitochondria and (ii) the phenotypes of Saccharomyces cerevisiae cells lacking RIM2, the gene encoding the well characterized yeast mitochondrial pyrimidine nucleotide carrier, were overcome by expressing SLC25A33 or SLC25A36 in these cells. The main physiological role of SLC25A33 and SLC25A36 is to import/export pyrimidine nucleotides into and from mitochondria, i.e. to accomplish transport steps essential for mitochondrial DNA and RNA synthesis and breakdown. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  18. Synthesis of aldehyde-linked nucleotides and DNA and their bioconjugations with lysine and peptides through reductive amination.

    Science.gov (United States)

    Raindlová, Veronika; Pohl, Radek; Hocek, Michal

    2012-03-26

    5-(5-Formylthienyl)-, 5-(4-formylphenyl)- and 5-(2-fluoro-5-formylphenyl)cytosine 2'-deoxyribonucleoside mono- (dC(R)MP) and triphosphates (dC(R)TP) were prepared by aqueous Suzuki-Miyaura cross-coupling of 5-iodocytosine nucleotides with the corresponding formylarylboronic acids. The dC(R)TPs were excellent substrates for DNA polymerases and were incorporated into DNA by primer extension or PCR. Reductive aminations of the model dC(R)MPs with lysine or lysine-containing tripeptide were studied and optimized. In aqueous phosphate buffer (pH 6.7) the yields of the reductive aminations with tripeptide III were up to 25 %. Bioconjugation of an aldehyde-containing DNA with a lysine-containing tripeptide was achieved through reductive amination in yields of up to 90 % in aqueous phosphate buffer. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Nucleotide compositional asymmetry between the leading and lagging strands of eubacterial genomes

    KAUST Repository

    Qu, Hongzhu; Wu, Hao; Zhang, Tongwu; Zhang, Zhang; Hu, Songnian; Yu, Jun

    2010-01-01

    Nucleotide compositional asymmetry (NCA) between leading and lagging strands (LeS and LaS) is dynamic and diverse among eubacterial genomes due to different mutation and selection forces. A thorough investigation is needed in order to study the relationship between nucleotide composition dynamics and gene distribution biases. Based on a collection of 364 eubacterial genomes that were grouped according to a DnaE-based scheme (DnaE1-DnaE1, DnaE2-DnaE1, and DnaE3-PolC), we investigated NCA and nucleotide composition gradients at three codon positions and found that there was universal G-enrichment on LeS among all groups. This was due to a strong selection for G-heading (codon position1 or cp1) codons and mutation pressure that led to more G-ending (cp3) codons. Moreover, a slight T-enrichment of LeS due to the mutation of cytosine deamination at cp3 was universal among DnaE1-DnaE1 and DnaE2-DnaE1 genomes, but was not clearly seen among DnaE3-PolC genomes, in which A-enrichment of LeS was proposed to be the effect of selections unique to polC and a mutation bias toward A-richness at cp1 that may be a result of transcription-coupled DNA repair mechanisms. Furthermore, strand-biased gene distribution enhances the purine-richness of LeS for DnaE3-PolC genomes and T-richness of LeS for DnaE1-DnaE1 and DnaE2-dnaE1 genomes. © 2010 Institut Pasteur.

  20. Nucleotide compositional asymmetry between the leading and lagging strands of eubacterial genomes

    KAUST Repository

    Qu, Hongzhu

    2010-12-01

    Nucleotide compositional asymmetry (NCA) between leading and lagging strands (LeS and LaS) is dynamic and diverse among eubacterial genomes due to different mutation and selection forces. A thorough investigation is needed in order to study the relationship between nucleotide composition dynamics and gene distribution biases. Based on a collection of 364 eubacterial genomes that were grouped according to a DnaE-based scheme (DnaE1-DnaE1, DnaE2-DnaE1, and DnaE3-PolC), we investigated NCA and nucleotide composition gradients at three codon positions and found that there was universal G-enrichment on LeS among all groups. This was due to a strong selection for G-heading (codon position1 or cp1) codons and mutation pressure that led to more G-ending (cp3) codons. Moreover, a slight T-enrichment of LeS due to the mutation of cytosine deamination at cp3 was universal among DnaE1-DnaE1 and DnaE2-DnaE1 genomes, but was not clearly seen among DnaE3-PolC genomes, in which A-enrichment of LeS was proposed to be the effect of selections unique to polC and a mutation bias toward A-richness at cp1 that may be a result of transcription-coupled DNA repair mechanisms. Furthermore, strand-biased gene distribution enhances the purine-richness of LeS for DnaE3-PolC genomes and T-richness of LeS for DnaE1-DnaE1 and DnaE2-dnaE1 genomes. © 2010 Institut Pasteur.

  1. Epigenetic variation, inheritance, and parent-of-origin effects of cytosine methylation in maize (Zea mays).

    Science.gov (United States)

    Lauria, Massimiliano; Piccinini, Sara; Pirona, Raul; Lund, Gertrud; Viotti, Angelo; Motto, Mario

    2014-03-01

    Pure epigenetic variation, or epigenetic variation that is independent of genetic context, may provide a mechanism for phenotypic variation in the absence of DNA mutations. To estimate the extent of pure epigenetic variation within and across generations and to identify the DNA regions targeted, a group of eight plants derived from a highly inbred line of maize (Zea mays) was analyzed by the methylation-sensitive amplified polymorphism (MSAP) technique. We found that cytosine methylation (mC) differences among individuals accounted for up to 7.4% of CCGG sites investigated by MSAP. Of the differentially methylated fragments (DMFs) identified in the S0 generation, ∼12% were meiotically inherited for at least six generations. We show that meiotically heritable mC variation was consistently generated for an average of 0.5% CCGG sites per generation and that it largely occurred somatically. We provide evidence that mC variation can be established and inherited in a parent-of-origin manner, given that the paternal lineage is more prone to both forward and reverse mC changes. The molecular characterization of selected DMFs revealed that the variation was largely determined by CG methylation changes that map within gene regions. The expression analysis of genes overlapping with DMFs did not reveal an obvious correlation between mC variation and transcription, reinforcing the idea that the primary function of gene-body methylation is not to control gene expression. Because this study focuses on epigenetic variation in field-grown plants, the data presented herein pertain to spontaneous epigenetic changes of the maize genome in a natural context.

  2. Induction of cytosine arabinoside-resistant human myeloid leukemia cell death through autophagy regulation by hydroxychloroquine.

    Science.gov (United States)

    Kim, Yundeok; Eom, Ju-In; Jeung, Hoi-Kyung; Jang, Ji Eun; Kim, Jin Seok; Cheong, June-Won; Kim, Young Sam; Min, Yoo Hong

    2015-07-01

    We investigated the effects of the autophagy inhibitor hydroxychloroquine (HCQ) on cell death of cytosine arabinoside (Ara-C)-resistant human acute myeloid leukemia (AML) cells. Ara-C-sensitive (U937, AML-2) and Ara-C-resistant (U937/AR, AML-2/AR) human AML cell lines were used to evaluate HCQ-regulated cytotoxicity, autophagy, and apoptosis as well as effects on cell death-related signaling pathways. We found that HCQ-induced dose- and time-dependent cell death in Ara-C-resistant cells compared to Ara-C-sensitive cell lines. The extent of cell death and features of HCQ-induced autophagic markers including increase in microtubule-associated protein light chain 3 (LC3) I conversion to LC3-II, beclin-1, ATG5, as well as green fluorescent protein-LC3 positive puncta and autophagosome were remarkably greater in U937/AR cells. Also, p62/SQSTM1 was increased in response to HCQ. p62/SQSTM1 protein interacts with both LC3-II and ubiquitin protein and is degraded in autophagosomes. Therefore, a reduction of p62/SQSTM1 indicates increased autophagic degradation, whereas an increase of p62/SQSTM1 by HCQ indicates inhibited autophagic degradation. Knock down of p62/SQSTM1 using siRNA were prevented the HCQ-induced LC3-II protein level as well as significantly reduced the HCQ-induced cell death in U937/AR cells. Also, apoptotic cell death and caspase activation in U937/AR cells were increased by HCQ, provided evidence that HCQ-induced autophagy blockade. Taken together, our data show that HCQ-induced apoptotic cell death in Ara-C-resistant AML cells through autophagy regulation. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  3. Cytosine arabinoside enhancement of gamma irradiation induced mutations in human T-lymphocytes

    International Nuclear Information System (INIS)

    O'Neill, J.P.; Sullivan, L.M.; Hunter, T.C.; Nicklas, J.A.

    1991-01-01

    The frequency of 6-thioguanine resistant (TGr) mutants induced in human G0 phase T-lymphocytes by 200 cGy of gamma irradiation is greatly enhanced by incubation with cytosine arabinoside (ara-C) after irradiation. The mutant frequency increased with increasing incubation time in ara-C for up to 2 hr. This mutation induction required a phenotypic expression time of 5-8 days mass culture growth, similar to that found with mutants induced by 300 cGy of irradiation alone. Southern blot analysis of 40 isolated mutant clones revealed 8 independent mutations by T-cell receptor (TCR) gene rearrangement patterns. Four of these eight showed hprt gene structural alterations (0.50). An alternative method to allow phenotypic expression was developed to minimize the isolation of hprt/TCR sibling mutants. The use of in situ expression in the microtiter dish wells resulted in the isolation of 17 independent mutations in 19 mutant clones. Ten of these 17 mutations showed hprt structural alterations (0.59). The high fraction of mutations involving structural alterations detected by Southern blot analysis is consistent with the known induction of chromosome aberrations by irradiation plus ara-C treatment. We propose that both the increase in Mf and the increase in the incidence of hprt gene structural alterations are due to the accumulation of strand breaks in repairing regions of DNA under these conditions of ara-C induced inhibition of repair. We further propose that upon release of the ara-C inhibition, these repairing regions can interact to yield both gene mutations and chromosome aberrations

  4. Concerted bis-alkylating reactivity of clerocidin towards unpaired cytosine residues in DNA

    Science.gov (United States)

    Richter, Sara N.; Menegazzo, Ileana; Fabris, Daniele; Palumbo, Manlio

    2004-01-01

    Clerocidin (CL) is a topoisomerase II poison, which cleaves DNA irreversibly at guanines (G) and reversibly at cytosines (C). Furthermore, the drug can induce enzyme-independent strand breaks at the G and C level. It has been previously shown that G-damage is induced by alkylation of the guanine N7, followed by spontaneous depurination and nucleic acid cleavage, whereas scission at C is obtained only after treatment with hot alkali, and no information is available to explain the nature of this damage. We present here a systematic study on the reactivity of CL towards C both in the DNA environment and in solution. Selected synthetic derivatives were employed to evaluate the role of each chemical group of the drug. The structure of CL–dC adduct was then characterized by tandem mass spectrometry and NMR: the adduct is a stable condensed ring system resulting from a concerted electrophilic attack of the adjacent carbonyl and epoxide groups of CL towards the exposed NH2 and N3, respectively. This reaction mechanism, shown here for the first time, is characterized by faster kinetic rates than alkylation at G, due to the fact that the rate-determining step, alkylation at the epoxide, is an intramolecular process, provided a Schiff base linking CL and C can rapidly form, whereas the corresponding reaction of G N7 is intermolecular. These results provide helpful hints to explain the reversible/irreversible nature of topoisomerase II mediated DNA damage produced by CL at C/G steps. PMID:15494453

  5. Nucleotide sequence preservation of human mitochondrial DNA

    International Nuclear Information System (INIS)

    Monnat, R.J. Jr.; Loeb, L.A.

    1985-01-01

    Recombinant DNA techniques have been used to quantitate the amount of nucleotide sequence divergence in the mitochondrial DNA population of individual normal humans. Mitochondrial DNA was isolated from the peripheral blood lymphocytes of five normal humans and cloned in M13 mp11; 49 kilobases of nucleotide sequence information was obtained from 248 independently isolated clones from the five normal donors. Both between- and within-individual differences were identified. Between-individual differences were identified in approximately = to 1/200 nucleotides. In contrast, only one within-individual difference was identified in 49 kilobases of nucleotide sequence information. This high degree of mitochondrial nucleotide sequence homogeneity in human somatic cells is in marked contrast to the rapid evolutionary divergence of human mitochondrial DNA and suggests the existence of mechanisms for the concerted preservation of mammalian mitochondrial DNA sequences in single organisms

  6. Sequential Oral Hydroxyurea and Intravenous Cytosine Arabinoside in Refractory Childhood Acute Leukemia: A Pediatric Oncology Group Phase I Study

    OpenAIRE

    Dubowy, Ronald; Graham, Michael; Hakami, Nasrollah; Kletzel, Morris; Mahoney, Donald; Newman, Edward; Ravindranath, Yaddanapudi; Camitta, Bruce

    2008-01-01

    At concentrations >0.1 mM, Hydroxyurea (HU) enhances the accumulation of cytosine arabinoside (ara-C) in leukemia cells in vitro. This study of children with refractory acute leukemia was designed to take advantage of this biochemical modulation. A fixed dose of HU and an escalating dose of ara-C were used. Oral HU, 1200 mg/m2 was followed 2 hours later by ara-C, 250-3100 mg/m2 intravenously in 15 minutes. The combination was given on days 1,2,3 and 8,9,10. Thirty-three children (26 ALL, 7 AN...

  7. Rationalizing the structural variability of the exocyclic amino groups in nucleobases and their metal complexes: cytosine and adenine.

    Science.gov (United States)

    Fonseca Guerra, Célia; Sanz Miguel, Pablo J; Cebollada, Andrea; Bickelhaupt, F Matthias; Lippert, Bernhard

    2014-07-28

    The exocyclic amino groups of cytosine and adenine nucleobases are normally almost flat, with the N atoms essentially sp(2) hybridized and the lone pair largely delocalized into the heterocyclic rings. However, a change to marked pyramidality of the amino group (N then sp(3) hybridized, lone pair essentially localized at N) occurs during i) involvement of an amino proton in strong hydrogen bonding donor conditions or ii) with monofunctional metal coordination following removal of one of the two protons. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. The inhibition of DNA repair by aphidicolin or cytosine arabinoside in X-irradiated normal and xeroderma pigmentosum fibroblasts

    International Nuclear Information System (INIS)

    Waters, R.; Crocombe, K.; Mirzayans, R.

    1981-01-01

    Normal and excision-deficient xeroderma pigmentosum fibroblasts were X-irradiated and the influence on DNA repair of either the repair inhibitor cytosine arabinoside or the specific inhibitor of DNA polymerase α, aphidicolin, investigated. The data indicated that the repair of a certain fraction of X-ray-induced lesions can be inhibited in both cell lines by both compounds. Thus, as aphidicolin blocks the operation of polymerase α, this enzyme must be involved in an excision repair pathway operating in both normal and excision-deficient xeroderma pigmentosum cells. (orig.)

  9. Pulsed magnetic field from video display terminals enhances teratogenic effects of cytosine arabinoside in mice

    Energy Technology Data Exchange (ETDEWEB)

    Chiang, H.; Wu, R.Y.; Shao, B.J.; Fu, Y.D.; Yao, G.D.; Lu, D.J. [Zhejiang Medical Univ. (China)

    1995-05-01

    Eighty-nine Swiss Webster mice were randomly divided into four groups: a control group, a pulsed magnetic field (PMF) group, a cytosine arabinoside (ara-C, a teratogen) group, and a combined PMF + ara-C group. Mice in the PMF and PMF + ara-C groups were irradiated with a PMF (a sawtooth waveform with 52 {mu}s rise time, 12{mu}s decay time, and 15.6 kHz frequency) at a peak magnetic flux density of 40 {mu}T for 4 hours daily on days 6-17 of gestation. The mice in the ara-C and the PMF + ara-C groups were injected intraperitoneally on day 9 of gestation with 10 mg/kg of ara-C. The incidence of resorption and dead fetuses was not affected by PMF but was increased by ara-C injection. The malformation incidence of cleft palate (CP) and/or cleft lip (CL) was significantly higher in all three of the treated groups than in the control group (P < 0.05). If, however, statistical analyses had been done on litters rather than on individual fetuses, they would show that the incidence of CP and/or CL in the PMF group is not significantly greater than that in the control group. A significantly higher incidence of CP and/or CL was found in the PMF + ara-C group (49%) than the ara-C alone group (26.1%). These data suggest that PMF might enhance the development of ara-C-induced CP and/or CL. The incidence of minor variations in skeletal development, including reduction of skeletal calcification and loss of skeleton, was not statistically significant in the PMF group. However, it was higher in the two ara-C-treated groups, and there was no significant difference between the ara-C alone group and the ara-C + PMF group. From these results it is concluded that the very weak embryotoxic effects of PMF exposure may be revealed and enhanced in combination with a teratogenic agent.

  10. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    2017-03-03

    Mar 3, 2017 ... 2Department of Botany, D. S. B. Campus, Kumaun University, Nainital 263 001, India ... Rana T. S. 2017 Nucleotide diversity and phylogenetic relationships ... Anderson and Park 1989). ..... Edgewood Press, Edgewood, USA.

  11. Nucleotide excision repair in the test tube.

    NARCIS (Netherlands)

    N.G.J. Jaspers (Nicolaas); J.H.J. Hoeijmakers (Jan)

    1995-01-01

    textabstractThe eukaryotic nucleotide excision-repair pathway has been reconstituted in vitro, an achievement that should hasten the full enzymological characterization of this highly complex DNA-repair pathway.

  12. Structure-wise discrimination of cytosine, thymine, and uracil by proteins in terms of their nonbonded interactions.

    Science.gov (United States)

    Usha, S; Selvaraj, S

    2014-01-01

    The molecular recognition and discrimination of very similar ligand moieties by proteins are important subjects in protein-ligand interaction studies. Specificity in the recognition of molecules is determined by the arrangement of protein and ligand atoms in space. The three pyrimidine bases, viz. cytosine, thymine, and uracil, are structurally similar, but the proteins that bind to them are able to discriminate them and form interactions. Since nonbonded interactions are responsible for molecular recognition processes in biological systems, our work attempts to understand some of the underlying principles of such recognition of pyrimidine molecular structures by proteins. The preferences of the amino acid residues to contact the pyrimidine bases in terms of nonbonded interactions; amino acid residue-ligand atom preferences; main chain and side chain atom contributions of amino acid residues; and solvent-accessible surface area of ligand atoms when forming complexes are analyzed. Our analysis shows that the amino acid residues, tyrosine and phenyl alanine, are highly involved in the pyrimidine interactions. Arginine prefers contacts with the cytosine base. The similarities and differences that exist between the interactions of the amino acid residues with each of the three pyrimidine base atoms in our analysis provide insights that can be exploited in designing specific inhibitors competitive to the ligands.

  13. Synthesis, Characterization, and Physicochemical Studies of Mixed Ligand Complexes of Inner Transition Metals with Lansoprazole and Cytosine

    Directory of Open Access Journals (Sweden)

    Sarika Verma

    2013-01-01

    Full Text Available Few complexes of inner transition metals [Th(IV, Ce(IV, Nd(III, Gd(III] have been synthesized by reacting their metal salts with lansoprazole, 2-([3-methyl-4-(2,2,2-trifluoroethoxypyridin-2-yl]methylsulfinyl-1H-benzoimidazole and cytosine. All the complexes were synthesized in ethanolic medium. The yield percentage rangs from 80 to 90%. The complexes are coloured solids. The complexes were characterized through elemental analyses, conductance measurements, and spectroscopic methods (FT IR, FAB Mass, 1H NMR and UV. An IR spectrum indicates that the ligand behaves as bidentate ligands. The metal complexes have been screened for their antifungal activity towards Aspergillus niger fungi. The interaction of inner transition metals with lansoprazole, in presence of cytosine, has also been investigated potentiometrically at two different temperatures 26±1°C and 36±1°C and at 0.1 M (KNO3 ionic strength. The stability constants of ternary complexes indicate the stability order as Th(IV < Ce(IV < Gd(III < Nd(III. logK values obtained are positive and suggest greater stabilization of ternary complexes. The values of thermodynamic parameters (free energy (ΔG, enthalpy (ΔH, and entropy (ΔS are also calculated.

  14. Planarizing cytosine: The S1 state structure, vibrations, and nonradiative dynamics of jet-cooled 5,6-trimethylenecytosine

    Science.gov (United States)

    Trachsel, Maria A.; Lobsiger, Simon; Schär, Tobias; Blancafort, Lluís; Leutwyler, Samuel

    2017-06-01

    We measure the S0 → S1 spectrum and time-resolved S1 state nonradiative dynamics of the "clamped" cytosine derivative 5,6-trimethylenecytosine (TMCyt) in a supersonic jet, using two-color resonant two-photon ionization (R2PI), UV/UV holeburning, and ns time-resolved pump/delayed ionization. The experiments are complemented with spin-component scaled second-order approximate coupled cluster (SCS-CC2), time-dependent density functional theory, and multi-state second-order perturbation-theory (MS-CASPT2) ab initio calculations. While the R2PI spectrum of cytosine breaks off ˜500 cm-1 above its 000 band, that of TMCyt extends up to +4400 cm-1 higher, with over a hundred resolved vibronic bands. Thus, clamping the cytosine C5-C6 bond allows us to explore the S1 state vibrations and S0 → S1 geometry changes in detail. The TMCyt S1 state out-of-plane vibrations ν1', ν3', and ν5' lie below 420 cm-1, and the in-plane ν11', ν12', and ν23' vibrational fundamentals appear at 450, 470, and 944 cm-1. S0 → S1 vibronic simulations based on SCS-CC2 calculations agree well with experiment if the calculated ν1', ν3', and ν5' frequencies are reduced by a factor of 2-3. MS-CASPT2 calculations predict that the ethylene-type S1 ⇝ S0 conical intersection (CI) increases from +366 cm-1 in cytosine to >6000 cm-1 in TMCyt, explaining the long lifetime and extended S0 → S1 spectrum. The lowest-energy S1 ⇝ S0 CI of TMCyt is the "amino out-of-plane" (OPX) intersection, calculated at +4190 cm-1. The experimental S1 ⇝ S0 internal conversion rate constant at the S1(v'=0 ) level is kI C=0.98 -2.2 ṡ1 08 s-1, which is ˜10 times smaller than in 1-methylcytosine and cytosine. The S1(v'=0 ) level relaxes into the T1(3π π *) state by intersystem crossing with kI S C=0.41 -1.6 ṡ1 08 s-1. The T1 state energy is measured to lie 24 580 ±560 cm-1 above the S0 state. The S1(v'=0 ) lifetime is τ =2.9 ns, resulting in an estimated fluorescence quantum yield of Φf l=24 %. Intense

  15. Single nucleotide editing without DNA cleavage using CRISPR/Cas9-deaminase in the sea urchin embryo.

    Science.gov (United States)

    Shevidi, Saba; Uchida, Alicia; Schudrowitz, Natalie; Wessel, Gary M; Yajima, Mamiko

    2017-12-01

    A single base pair mutation in the genome can result in many congenital disorders in humans. The recent gene editing approach using CRISPR/Cas9 has rapidly become a powerful tool to replicate or repair such mutations in the genome. These approaches rely on cleaving DNA, while presenting unexpected risks. In this study, we demonstrate a modified CRISPR/Cas9 system fused to cytosine deaminase (Cas9-DA), which induces a single nucleotide conversion in the genome. Cas9-DA was introduced into sea urchin eggs with sgRNAs targeted for SpAlx1, SpDsh, or SpPks, each of which is critical for skeletogenesis, embryonic axis formation, or pigment formation, respectively. We found that both Cas9 and Cas9-DA edit the genome, and cause predicted phenotypic changes at a similar efficiency. Cas9, however, resulted in significant deletions in the genome centered on the gRNA target sequence, whereas Cas9-DA resulted in single or double nucleotide editing of C to T conversions within the gRNA target sequence. These results suggest that the Cas9-DA approach may be useful for manipulating gene activity with decreased risks of genomic aberrations. Developmental Dynamics 246:1036-1046, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  16. Helicase and Polymerase Move Together Close to the Fork Junction and Copy DNA in One-Nucleotide Steps

    Directory of Open Access Journals (Sweden)

    Manjula Pandey

    2014-03-01

    Full Text Available By simultaneously measuring DNA synthesis and dNTP hydrolysis, we show that T7 DNA polymerase and T7 gp4 helicase move in sync during leading-strand synthesis, taking one-nucleotide steps and hydrolyzing one dNTP per base-pair unwound/copied. The cooperative catalysis enables the helicase and polymerase to move at a uniformly fast rate without guanine:cytosine (GC dependency or idling with futile NTP hydrolysis. We show that the helicase and polymerase are located close to the replication fork junction. This architecture enables the polymerase to use its strand-displacement synthesis to increase the unwinding rate, whereas the helicase aids this process by translocating along single-stranded DNA and trapping the unwound bases. Thus, in contrast to the helicase-only unwinding model, our results suggest a model in which the helicase and polymerase are moving in one-nucleotide steps, DNA synthesis drives fork unwinding, and a role of the helicase is to trap the unwound bases and prevent DNA reannealing.

  17. A single nucleotide in stem loop II of 5'-untranslated region contributes to virulence of enterovirus 71 in mice.

    Directory of Open Access Journals (Sweden)

    Ming-Te Yeh

    Full Text Available BACKGROUND: Enterovirus 71 (EV71 has emerged as a neuroinvasive virus responsible for several large outbreaks in the Asia-Pacific region while virulence determinant remains unexplored. PRINCIPAL FINDINGS: In this report, we investigated increased virulence of unadapted EV71 clinical isolate 237 as compared with isolate 4643 in mice. A fragment 12 nucleotides in length in stem loop (SL II of 237 5'-untranslated region (UTR visibly reduced survival time and rate in mice was identified by constructing a series of infectious clones harboring chimeric 5'-UTR. In cells transfected with bicistronic plasmids, and replicon RNAs, the 12-nt fragment of isolate 237 enhanced translational activities and accelerated replication of subgenomic EV71. Finally, single nucleotide change from cytosine to uridine at base 158 in this short fragment of 5'-UTR was proven to reduce viral translation and EV71 virulence in mice. Results collectively indicated a pivotal role of novel virulence determinant C158 on virus translation in vitro and EV71 virulence in vivo. CONCLUSIONS: These results presented the first reported virulence determinant in EV71 5'-UTR and first position discovered from unadapted isolates.

  18. A Nucleotide Phosphatase Activity in the Nucleotide Binding Domain of an Orphan Resistance Protein from Rice*

    Science.gov (United States)

    Fenyk, Stepan; de San Eustaquio Campillo, Alba; Pohl, Ehmke; Hussey, Patrick J.; Cann, Martin J.

    2012-01-01

    Plant resistance proteins (R-proteins) are key components of the plant immune system activated in response to a plethora of different pathogens. R-proteins are P-loop NTPase superfamily members, and current models describe their main function as ATPases in defense signaling pathways. Here we show that a subset of R-proteins have evolved a new function to combat pathogen infection. This subset of R-proteins possesses a nucleotide phosphatase activity in the nucleotide-binding domain. Related R-proteins that fall in the same phylogenetic clade all show the same nucleotide phosphatase activity indicating a conserved function within at least a subset of R-proteins. R-protein nucleotide phosphatases catalyze the production of nucleoside from nucleotide with the nucleotide monophosphate as the preferred substrate. Mutation of conserved catalytic residues substantially reduced activity consistent with the biochemistry of P-loop NTPases. Kinetic analysis, analytical gel filtration, and chemical cross-linking demonstrated that the nucleotide-binding domain was active as a multimer. Nuclear magnetic resonance and nucleotide analogues identified the terminal phosphate bond as the target of a reaction that utilized a metal-mediated nucleophilic attack by water on the phosphoester. In conclusion, we have identified a group of R-proteins with a unique function. This biochemical activity appears to have co-evolved with plants in signaling pathways designed to resist pathogen attack. PMID:22157756

  19. A nucleotide phosphatase activity in the nucleotide binding domain of an orphan resistance protein from rice.

    Science.gov (United States)

    Fenyk, Stepan; Campillo, Alba de San Eustaquio; Pohl, Ehmke; Hussey, Patrick J; Cann, Martin J

    2012-02-03

    Plant resistance proteins (R-proteins) are key components of the plant immune system activated in response to a plethora of different pathogens. R-proteins are P-loop NTPase superfamily members, and current models describe their main function as ATPases in defense signaling pathways. Here we show that a subset of R-proteins have evolved a new function to combat pathogen infection. This subset of R-proteins possesses a nucleotide phosphatase activity in the nucleotide-binding domain. Related R-proteins that fall in the same phylogenetic clade all show the same nucleotide phosphatase activity indicating a conserved function within at least a subset of R-proteins. R-protein nucleotide phosphatases catalyze the production of nucleoside from nucleotide with the nucleotide monophosphate as the preferred substrate. Mutation of conserved catalytic residues substantially reduced activity consistent with the biochemistry of P-loop NTPases. Kinetic analysis, analytical gel filtration, and chemical cross-linking demonstrated that the nucleotide-binding domain was active as a multimer. Nuclear magnetic resonance and nucleotide analogues identified the terminal phosphate bond as the target of a reaction that utilized a metal-mediated nucleophilic attack by water on the phosphoester. In conclusion, we have identified a group of R-proteins with a unique function. This biochemical activity appears to have co-evolved with plants in signaling pathways designed to resist pathogen attack.

  20. The GC-Rich Mitochondrial and Plastid Genomes of the Green Alga Coccomyxa Give Insight into the Evolution of Organelle DNA Nucleotide Landscape

    Energy Technology Data Exchange (ETDEWEB)

    Smith, David Roy; Burki, Fabien; Yamada, Takashi; Grimwood, Jane; Grigoriev, Igor V.; Van Etten, James L.; Keeling, Patrick J.

    2011-05-13

    Most of the available mitochondrial and plastid genome sequences are biased towards adenine and thymine (AT) over guanine and cytosine (GC). Examples of GC-rich organelle DNAs are limited to a small but eclectic list of species, including certain green algae. Here, to gain insight in the evolution of organelle nucleotide landscape, we present the GC-rich mitochondrial and plastid DNAs from the trebouxiophyte green alga Coccomyxa sp. C-169. We compare these sequences with other GC-rich organelle DNAs and argue that the forces biasing them towards G and C are nonadaptive and linked to the metabolic and/or life history features of this species. The Coccomyxa organelle genomes are also used for phylogenetic analyses, which highlight the complexities in trying to resolve the interrelationships among the core chlorophyte green algae, but ultimately favour a sister relationship between the Ulvophyceae and Chlorophyceae, with the Trebouxiophyceae branching at the base of the chlorophyte crown.

  1. Cyclopentenyl cytosine has biological and anti-tumour activity, but does not enhance the efficacy of gemcitabine and radiation in two animal tumour models

    NARCIS (Netherlands)

    van Bree, Chris; Barten-van Rijbroek, Angeliqué D.; Leen, René; Rodermond, Hans M.; van Kuilenburg, André B. P.; Kal, Henk B.

    2009-01-01

    Cyclopentenyl cytosine (CPEC), targetting the de novo biosynthesis of cytidine triphosphate (CTP), increases the cytotoxicity of gemcitabine (2',2'-difluoro-2'-deoxycytidine, dFdC) alone and in combination with irradiation in several human tumour cells in vitro. We investigated whether OPEC enhances

  2. Bacillus halodurans Strain C125 Encodes and Synthesizes Enzymes from Both Known Pathways To Form dUMP Directly from Cytosine Deoxyribonucleotides

    DEFF Research Database (Denmark)

    Oehlenschlæger, Christian Berg; Løvgreen, Monika Nøhr; Reinauer, Eva

    2015-01-01

    Analysis of the genome of Bacillus halodurans strain C125 indicated that two pathways leading from a cytosine deoxyribonucleotide to dUMP, used for dTMP synthesis, were encoded by the genome of the bacterium. The genes that were responsible, the comEB gene and the dcdB gene, encoding dCMP deaminase...

  3. Interaction of Cu+ with cytosine and formation of i-motif-like C-M+-C complexes: alkali versus coinage metals

    NARCIS (Netherlands)

    Gao, J.; Berden, G.; Rodgers, M.T.; Oomens, J.

    2016-01-01

    The Watson-Crick structure of DNA is among the most well-known molecular structures of our time. However, alternative base-pairing motifs are also known to occur, often depending on base sequence, pH, or the presence of cations. Pairing of cytosine (C) bases induced by the sharing of a single proton

  4. Mechanism of interaction of the antileukemic drug cytosine arabinoside with aromatic peptides: role of sugar conformation and peptide backbone.

    Science.gov (United States)

    Datta, G; Hosur, R V; Verma, N C; Khetrapal, C L; Gurnani, S

    1989-01-01

    Interaction of the antileukemic drugs, cytosine-arabinoside (Ara-C) and adenosine-arabinoside (Ara-A) and a structural analogue, cytidine, with aromatic dipeptides has been studied by fluorescence and NMR spectroscopy. Ara-C and cytidine bind tryptophanyl and histidyl dipeptides but not tyrosyl dipeptides, while Ara-A does not bind to any of them. Both studies indicate association involving stacking of aromatic moieties. NMR spectra also indicate a protonation of the histidine moiety by Ara-C. In case of cytidine, the chemical shifts observed on binding to His-Phe imply that the backbone protons of the dipeptide participate in the binding. The conformation of the sugar and the base seem to play a very important role in the binding phenomenon as three similar molecules, Ara-C, Ara-A and cytidine bind in totally different ways.

  5. Ultraviolet and chemical induced DNA repair in human cells assayed by bromodeoxyuridine photolysis or cytosine arabinoside arrest

    International Nuclear Information System (INIS)

    Regan, J.D.; Dunn, W.C.

    1979-01-01

    The bromodeoxyuridine photolysis assay of DNA damage in human cells permits an estimate of both the number of repaired regions in the DNA and the size of the average repaired region - the patch size. The antineoplastic agent arabinofuranosyl cytosine (ara-C) can also be employed to assay the magnitude of repair since this agent appears to block rejoining of single-strand incisions made in the DNA during the initial step of repair. Thus, the number of incisions can be accumulated. The ara-C effect is dependent on the presence of hydroxyurea. Both assays can be employed for the study of physical or chemical DNA damages. Results comparing these assays are presented

  6. Fingerprints of Both Watson-Crick and Hoogsteen Isomers of the Isolated (Cytosine-Guanine)H+ Pair.

    Science.gov (United States)

    Cruz-Ortiz, Andrés F; Rossa, Maximiliano; Berthias, Francis; Berdakin, Matías; Maitre, Philippe; Pino, Gustavo A

    2017-11-16

     Gas phase protonated guanine-cytosine (CGH + ) pair was generated using an electrospray ionization source from solutions at two different pH (5.8 and 3.2). Consistent evidence from MS/MS fragmentation patterns and differential ion mobility spectra (DIMS) point toward the presence of two isomers of the CGH + pair, whose relative populations depend strongly on the pH of the solution. Gas phase infrared multiphoton dissociation (IRMPD) spectroscopy in the 900-1900 cm -1 spectral range further confirms that the Watson-Crick isomer is preferentially produced (91%) at pH = 5.8, while the Hoogsteen isomer predominates (66%) at pH = 3.2). These fingerprint signatures are expected to be useful for the development of new analytical methodologies and to trigger isomer selective photochemical studies of protonated DNA base pairs.

  7. Spectroscopic (UV/VIS, Raman) and Electrophoresis Study of Cytosine-Guanine Oligonucleotide DNA Influenced by Magnetic Field.

    Science.gov (United States)

    Banihashemian, Seyedeh Maryam; Periasamy, Vengadesh; Boon Tong, Goh; Abdul Rahman, Saadah

    2016-01-01

    Studying the effect of a magnetic field on oligonucleotide DNA can provide a novel DNA manipulation technique for potential application in bioengineering and medicine. In this work, the optical and electrochemical response of a 100 bases oligonucleotides DNA, cytosine-guanine (CG100), is investigated via exposure to different magnetic fields (250, 500, 750, and 1000 mT). As a result of the optical response of CG100 to the magnetic field, the ultra-violet-visible spectrum indicated a slight variation in the band gap of CG100 of about 0.3 eV. Raman spectroscopy showed a significant deviation in hydrogen and phosphate bonds' vibration after exposure to the magnetic field. Oligonucleotide DNA mobility was investigated in the external electric field using the gel electrophoresis technique, which revealed a small decrease in the migration of CG100 after exposure to the magnetic field.

  8. Spectroscopic (UV/VIS, Raman and Electrophoresis Study of Cytosine-Guanine Oligonucleotide DNA Influenced by Magnetic Field.

    Directory of Open Access Journals (Sweden)

    Seyedeh Maryam Banihashemian

    Full Text Available Studying the effect of a magnetic field on oligonucleotide DNA can provide a novel DNA manipulation technique for potential application in bioengineering and medicine. In this work, the optical and electrochemical response of a 100 bases oligonucleotides DNA, cytosine-guanine (CG100, is investigated via exposure to different magnetic fields (250, 500, 750, and 1000 mT. As a result of the optical response of CG100 to the magnetic field, the ultra-violet-visible spectrum indicated a slight variation in the band gap of CG100 of about 0.3 eV. Raman spectroscopy showed a significant deviation in hydrogen and phosphate bonds' vibration after exposure to the magnetic field. Oligonucleotide DNA mobility was investigated in the external electric field using the gel electrophoresis technique, which revealed a small decrease in the migration of CG100 after exposure to the magnetic field.

  9. Ultrasensitive Direct Quantification of Nucleobase Modifications in DNA by Surface-Enhanced Raman Scattering: The Case of Cytosine.

    Science.gov (United States)

    Morla-Folch, Judit; Xie, Hai-nan; Gisbert-Quilis, Patricia; Gómez-de Pedro, Sara; Pazos-Perez, Nicolas; Alvarez-Puebla, Ramon A; Guerrini, Luca

    2015-11-09

    Recognition of chemical modifications in canonical nucleobases of nucleic acids is of key importance since such modified variants act as different genetic encoders, introducing variability in the biological information contained in DNA. Herein, we demonstrate the feasibility of direct SERS in combination with chemometrics and microfluidics for the identification and relative quantification of 4 different cytosine modifications in both single- and double-stranded DNA. The minute amount of DNA required per measurement, in the sub-nanogram regime, removes the necessity of pre-amplification or enrichment steps (which are also potential sources of artificial DNA damages). These findings show great potentials for the development of fast, low-cost and high-throughput screening analytical devices capable of detecting known and unknown modifications in nucleic acids (DNA and RNA) opening new windows of activity in several fields such as biology, medicine and forensic sciences. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Human tumour xenografts established and serially transplanted in mice immunologically deprived by thymectomy, cytosine arabinoside and whole-body irradiation

    International Nuclear Information System (INIS)

    Selby, P.J.; Thomas, J.M.; Peckham, M.J.

    1980-01-01

    Mice immunologically deprived by thymectomy, cytosine arabinoside treatment and whole-body irradiation were used to study the growth of human tumours as xenografts. 10/16 melanoma biopsies, 4/13 ovarian carcinoma biopsies and 3/6 uterine cancer biopsies grew as serially transplantable xenograft lines. The tumour lines were studied through serial passages by histology, histo-chemistry, electron microscopy, chromosome analysis, immune fluorescence, growth rate measurement and mitotic counts. They retained the characteristics of the tumours of origin, with the exception of loss of pigmentation in two melanomas, histological dedifferentiation in the uterine carcinomas, and increased mitotic frequency and growth rate in some melanomas. It was concluded that this type of animal preparation is as useful as alternative methods of immunological deprivation, or as athymic nude mice, for the growth of human tumour xenografts, at least for some experimental purposes. (author)

  11. Dynamic DNA cytosine methylation in the Populus trichocarpa genome: tissue-level variation and relationship to gene expression

    Directory of Open Access Journals (Sweden)

    Vining Kelly J

    2012-01-01

    Full Text Available Abstract Background DNA cytosine methylation is an epigenetic modification that has been implicated in many biological processes. However, large-scale epigenomic studies have been applied to very few plant species, and variability in methylation among specialized tissues and its relationship to gene expression is poorly understood. Results We surveyed DNA methylation from seven distinct tissue types (vegetative bud, male inflorescence [catkin], female catkin, leaf, root, xylem, phloem in the reference tree species black cottonwood (Populus trichocarpa. Using 5-methyl-cytosine DNA immunoprecipitation followed by Illumina sequencing (MeDIP-seq, we mapped a total of 129,360,151 36- or 32-mer reads to the P. trichocarpa reference genome. We validated MeDIP-seq results by bisulfite sequencing, and compared methylation and gene expression using published microarray data. Qualitative DNA methylation differences among tissues were obvious on a chromosome scale. Methylated genes had lower expression than unmethylated genes, but genes with methylation in transcribed regions ("gene body methylation" had even lower expression than genes with promoter methylation. Promoter methylation was more frequent than gene body methylation in all tissues except male catkins. Male catkins differed in demethylation of particular transposable element categories, in level of gene body methylation, and in expression range of genes with methylated transcribed regions. Tissue-specific gene expression patterns were correlated with both gene body and promoter methylation. Conclusions We found striking differences among tissues in methylation, which were apparent at the chromosomal scale and when genes and transposable elements were examined. In contrast to other studies in plants, gene body methylation had a more repressive effect on transcription than promoter methylation.

  12. Transcriptional similarity in couples reveals the impact of shared environment and lifestyle on gene regulation through modified cytosines

    Directory of Open Access Journals (Sweden)

    Ke Tang

    2016-06-01

    Full Text Available Gene expression is a complex and quantitative trait that is influenced by both genetic and non-genetic regulators including environmental factors. Evaluating the contribution of environment to gene expression regulation and identifying which genes are more likely to be influenced by environmental factors are important for understanding human complex traits. We hypothesize that by living together as couples, there can be commonly co-regulated genes that may reflect the shared living environment (e.g., diet, indoor air pollutants, behavioral lifestyle. The lymphoblastoid cell lines (LCLs derived from unrelated couples of African ancestry (YRI, Yoruba people from Ibadan, Nigeria from the International HapMap Project provided a unique model for us to characterize gene expression pattern in couples by comparing gene expression levels between husbands and wives. Strikingly, 778 genes were found to show much smaller variances in couples than random pairs of individuals at a false discovery rate (FDR of 5%. Since genetic variation between unrelated family members in a general population is expected to be the same assuming a random-mating society, non-genetic factors (e.g., epigenetic systems are more likely to be the mediators for the observed transcriptional similarity in couples. We thus evaluated the contribution of modified cytosines to those genes showing transcriptional similarity in couples as well as the relationships these CpG sites with other gene regulatory elements, such as transcription factor binding sites (TFBS. Our findings suggested that transcriptional similarity in couples likely reflected shared common environment partially mediated through cytosine modifications.

  13. Patterns of cytosine methylation in an elite rice hybrid and its parental lines, detected by a methylation-sensitive amplification polymorphism technique.

    Science.gov (United States)

    Xiong, L Z; Xu, C G; Saghai Maroof, M A; Zhang, Q

    1999-04-01

    DNA methylation is known to play an important role in the regulation of gene expression in eukaryotes. In this study, we assessed the extent and pattern of cytosine methylation in the rice genome, using the technique of methylation-sensitive amplified polymorphism (MSAP), which is a modification of the amplified fragment length polymorphism (AFLP) method that makes use of the differential sensitivity of a pair of isoschizomers to cytosine methylation. The tissues assayed included seedlings and flag leaves of an elite rice hybrid, Shanyou 63, and the parental lines Zhenshan 97 and Minghui 63. In all, 1076 fragments, each representing a recognition site cleaved by either or both of the isoschizomers, were amplified using 16 pairs of selective primers. A total of 195 sites were found to be methylated at cytosines in one or both parents, and the two parents showed approximately the same overall degree of methylation (16.3%), as revealed by the incidence of differential digestion by the isoschizomers. Four classes of patterns were identified in a comparative assay of cytosine methylation in the parents and hybrid; increased methylation was detected in the hybrid compared to the parents at some of the recognition sites, while decreased methylation in the hybrid was detected at other sites. A small proportion of the sites was found to be differentially methylated in seedlings and flag leaves; DNA from young seedlings was methylated to a greater extent than that from flag leaves. Almost all of the methylation patterns detected by MSAP could be confirmed by Southern analysis using the isolated amplified fragments as probes. The results clearly demonstrate that the MSAP technique is highly efficient for large-scale detection of cytosine methylation in the rice genome. We believe that the technique can be adapted for use in other plant species.

  14. The mitochondrial genome sequence of the ciliate Paramecium caudatum reveals a shift in nucleotide composition and codon usage within the genus Paramecium

    Directory of Open Access Journals (Sweden)

    Berendonk Thomas U

    2011-05-01

    Full Text Available Abstract Background Despite the fact that the organization of the ciliate mitochondrial genome is exceptional, only few ciliate mitochondrial genomes have been sequenced until today. All ciliate mitochondrial genomes are linear. They are 40 kb to 47 kb long and contain some 50 tightly packed genes without introns. Earlier studies documented that the mitochondrial guanine + cytosine contents are very different between Paramecium tetraurelia and all studied Tetrahymena species. This raises the question of whether the high mitochondrial G+C content observed in P. tetraurelia is a characteristic property of Paramecium mtDNA, or whether it is an exception of the ciliate mitochondrial genomes known so far. To test this question, we determined the mitochondrial genome sequence of Paramecium caudatum and compared the gene content and sequence properties to the closely related P. tetraurelia. Results The guanine + cytosine content of the P. caudatum mitochondrial genome was significantly lower than that of P. tetraurelia (22.4% vs. 41.2%. This difference in the mitochondrial nucleotide composition was accompanied by significantly different codon usage patterns in both species, i.e. within P. caudatum clearly A/T ending codons dominated, whereas for P. tetraurelia the synonymous codons were more balanced with a higher number of G/C ending codons. Further analyses indicated that the nucleotide composition of most members of the genus Paramecium resembles that of P. caudatum and that the shift observed in P. tetraurelia is restricted to the P. aurelia species complex. Conclusions Surprisingly, the codon usage bias in the P. caudatum mitochondrial genome, exemplified by the effective number of codons, is more similar to the distantly related T. pyriformis and other single-celled eukaryotes such as Chlamydomonas, than to the closely related P. tetraurelia. These differences in base composition and codon usage bias were, however, not reflected in the amino

  15. The International Nucleotide Sequence Database Collaboration.

    Science.gov (United States)

    Cochrane, Guy; Karsch-Mizrachi, Ilene; Nakamura, Yasukazu

    2011-01-01

    Under the International Nucleotide Sequence Database Collaboration (INSDC; http://www.insdc.org), globally comprehensive public domain nucleotide sequence is captured, preserved and presented. The partners of this long-standing collaboration work closely together to provide data formats and conventions that enable consistent data submission to their databases and support regular data exchange around the globe. Clearly defined policy and governance in relation to free access to data and relationships with journal publishers have positioned INSDC databases as a key provider of the scientific record and a core foundation for the global bioinformatics data infrastructure. While growth in sequence data volumes comes no longer as a surprise to INSDC partners, the uptake of next-generation sequencing technology by mainstream science that we have witnessed in recent years brings a step-change to growth, necessarily making a clear mark on INSDC strategy. In this article, we introduce the INSDC, outline data growth patterns and comment on the challenges of increased growth.

  16. Bacterial nucleotide-based second messengers.

    Science.gov (United States)

    Pesavento, Christina; Hengge, Regine

    2009-04-01

    In all domains of life nucleotide-based second messengers transduce signals originating from changes in the environment or in intracellular conditions into appropriate cellular responses. In prokaryotes cyclic di-GMP has emerged as an important and ubiquitous second messenger regulating bacterial life-style transitions relevant for biofilm formation, virulence, and many other bacterial functions. This review describes similarities and differences in the architecture of the cAMP, (p)ppGpp, and c-di-GMP signaling systems and their underlying signaling principles. Moreover, recent advances in c-di-GMP-mediated signaling will be presented and the integration of c-di-GMP signaling with other nucleotide-based signaling systems will be discussed.

  17. Nucleotide Manipulatives to Illustrate the Central Dogma

    OpenAIRE

    Sonja B. Yung; Todd P. Primm

    2015-01-01

    The central dogma is a core concept that is critical for introductory biology and microbiology students to master. However, students often struggle to conceptualize the processes involved, and fail to move beyond simply memorizing the basic facts. To encourage critical thinking, we have designed a set of magnetic nucleotide manipulatives that allow students to model DNA structure, along with the processes of replication, transcription, and translation.

  18. Nucleotide Manipulatives to Illustrate the Central Dogma

    Directory of Open Access Journals (Sweden)

    Sonja B. Yung

    2015-08-01

    Full Text Available The central dogma is a core concept that is critical for introductory biology and microbiology students to master. However, students often struggle to conceptualize the processes involved, and fail to move beyond simply memorizing the basic facts. To encourage critical thinking, we have designed a set of magnetic nucleotide manipulatives that allow students to model DNA structure, along with the processes of replication, transcription, and translation.

  19. Histone displacement during nucleotide excision repair

    DEFF Research Database (Denmark)

    Dinant, C.; Bartek, J.; Bekker-Jensen, S.

    2012-01-01

    Nucleotide excision repair (NER) is an important DNA repair mechanism required for cellular resistance against UV light and toxic chemicals such as those found in tobacco smoke. In living cells, NER efficiently detects and removes DNA lesions within the large nuclear macromolecular complex called...... of histone variants and histone displacement (including nucleosome sliding). Here we review current knowledge, and speculate about current unknowns, regarding those chromatin remodeling activities that physically displace histones before, during and after NER....

  20. Pyrrolidine nucleotide analogs with a tunable conformation

    Czech Academy of Sciences Publication Activity Database

    Poštová Slavětínská, Lenka; Rejman, Dominik; Pohl, Radek

    2014-01-01

    Roč. 10, Aug 22 (2014), s. 1967-1980 ISSN 1860-5397 R&D Projects: GA ČR GA13-24880S Institutional support: RVO:61388963 Keywords : conformation * NMR * nucleic acids * nucleotide analog * phosphonic acid * pseudorotation * pyrrolidine Subject RIV: CC - Organic Chemistry Impact factor: 2.762, year: 2014 http://www.beilstein-journals.org/bjoc/single/articleFullText.htm?publicId=1860-5397-10-205

  1. Vacuum ultraviolet photoionization of carbohydrates and nucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Shin, Joong-Won, E-mail: jshin@govst.edu [Division of Science, Governors State University, University Park, Illinois 60484-0975 (United States); Department of Chemistry, Colorado State University, Fort Collins, Colorado 80523-1872 (United States); Bernstein, Elliot R., E-mail: erb@lamar.colostate.edu [Department of Chemistry, Colorado State University, Fort Collins, Colorado 80523-1872 (United States)

    2014-01-28

    Carbohydrates (2-deoxyribose, ribose, and xylose) and nucleotides (adenosine-, cytidine-, guanosine-, and uridine-5{sup ′}-monophosphate) are generated in the gas phase, and ionized with vacuum ultraviolet photons (VUV, 118.2 nm). The observed time of flight mass spectra of the carbohydrate fragmentation are similar to those observed [J.-W. Shin, F. Dong, M. Grisham, J. J. Rocca, and E. R. Bernstein, Chem. Phys. Lett. 506, 161 (2011)] for 46.9 nm photon ionization, but with more intensity in higher mass fragment ions. The tendency of carbohydrate ions to fragment extensively following ionization seemingly suggests that nucleic acids might undergo radiation damage as a result of carbohydrate, rather than nucleobase fragmentation. VUV photoionization of nucleotides (monophosphate-carbohydrate-nucleobase), however, shows that the carbohydrate-nucleobase bond is the primary fragmentation site for these species. Density functional theory (DFT) calculations indicate that the removed carbohydrate electrons by the 118.2 nm photons are associated with endocyclic C–C and C–O ring centered orbitals: loss of electron density in the ring bonds of the nascent ion can thus account for the observed fragmentation patterns following carbohydrate ionization. DFT calculations also indicate that electrons removed from nucleotides under these same conditions are associated with orbitals involved with the nucleobase-saccharide linkage electron density. The calculations give a general mechanism and explanation of the experimental results.

  2. Vacuum ultraviolet photoionization of carbohydrates and nucleotides

    International Nuclear Information System (INIS)

    Shin, Joong-Won; Bernstein, Elliot R.

    2014-01-01

    Carbohydrates (2-deoxyribose, ribose, and xylose) and nucleotides (adenosine-, cytidine-, guanosine-, and uridine-5 ′ -monophosphate) are generated in the gas phase, and ionized with vacuum ultraviolet photons (VUV, 118.2 nm). The observed time of flight mass spectra of the carbohydrate fragmentation are similar to those observed [J.-W. Shin, F. Dong, M. Grisham, J. J. Rocca, and E. R. Bernstein, Chem. Phys. Lett. 506, 161 (2011)] for 46.9 nm photon ionization, but with more intensity in higher mass fragment ions. The tendency of carbohydrate ions to fragment extensively following ionization seemingly suggests that nucleic acids might undergo radiation damage as a result of carbohydrate, rather than nucleobase fragmentation. VUV photoionization of nucleotides (monophosphate-carbohydrate-nucleobase), however, shows that the carbohydrate-nucleobase bond is the primary fragmentation site for these species. Density functional theory (DFT) calculations indicate that the removed carbohydrate electrons by the 118.2 nm photons are associated with endocyclic C–C and C–O ring centered orbitals: loss of electron density in the ring bonds of the nascent ion can thus account for the observed fragmentation patterns following carbohydrate ionization. DFT calculations also indicate that electrons removed from nucleotides under these same conditions are associated with orbitals involved with the nucleobase-saccharide linkage electron density. The calculations give a general mechanism and explanation of the experimental results

  3. Identification of cyclic nucleotide gated channels using regular expressions

    KAUST Repository

    Zelman, Alice K.; Dawe, Adam Sean; Berkowitz, Gerald A.

    2013-01-01

    Cyclic nucleotide-gated channels (CNGCs) are nonselective cation channels found in plants, animals, and some bacteria. They have a six-transmembrane/one- pore structure, a cytosolic cyclic nucleotide-binding domain, and a cytosolic calmodulin

  4. Effects of hypokinesia on cyclic nucleotides and hormonal regulation ...

    African Journals Online (AJOL)

    PTH), calcitonin (CT), cyclic nucleotides (cAMP, cGMP) and calcium in the blood of rats, while in urine - phosphate, calcium and cyclic nucleotides. Design: Laboratory based experiment. Setting: Laboratory in the Department of Biochemistry, ...

  5. Formation of amino acids and nucleotide bases in a Titan atmosphere simulation experiment.

    Science.gov (United States)

    Hörst, S M; Yelle, R V; Buch, A; Carrasco, N; Cernogora, G; Dutuit, O; Quirico, E; Sciamma-O'Brien, E; Smith, M A; Somogyi, A; Szopa, C; Thissen, R; Vuitton, V

    2012-09-01

    The discovery of large (>100 u) molecules in Titan's upper atmosphere has heightened astrobiological interest in this unique satellite. In particular, complex organic aerosols produced in atmospheres containing C, N, O, and H, like that of Titan, could be a source of prebiotic molecules. In this work, aerosols produced in a Titan atmosphere simulation experiment with enhanced CO (N(2)/CH(4)/CO gas mixtures of 96.2%/2.0%/1.8% and 93.2%/5.0%/1.8%) were found to contain 18 molecules with molecular formulae that correspond to biological amino acids and nucleotide bases. Very high-resolution mass spectrometry of isotopically labeled samples confirmed that C(4)H(5)N(3)O, C(4)H(4)N(2)O(2), C(5)H(6)N(2)O(2), C(5)H(5)N(5), and C(6)H(9)N(3)O(2) are produced by chemistry in the simulation chamber. Gas chromatography-mass spectrometry (GC-MS) analyses of the non-isotopic samples confirmed the presence of cytosine (C(4)H(5)N(3)O), uracil (C(5)H(4)N(2)O(2)), thymine (C(5)H(6)N(2)O(2)), guanine (C(5)H(5)N(5)O), glycine (C(2)H(5)NO(2)), and alanine (C(3)H(7)NO(2)). Adenine (C(5)H(5)N(5)) was detected by GC-MS in isotopically labeled samples. The remaining prebiotic molecules were detected in unlabeled samples only and may have been affected by contamination in the chamber. These results demonstrate that prebiotic molecules can be formed by the high-energy chemistry similar to that which occurs in planetary upper atmospheres and therefore identifies a new source of prebiotic material, potentially increasing the range of planets where life could begin.

  6. Ionophoretic method in the study of mixed ligand ternary chelates of UO2(II), Ni(II) and Zn(II) involving nitrilotriacetate and cytosine as ligands

    International Nuclear Information System (INIS)

    Mishra, A.P.; Mishra, S.K.; Yadava, K.L.

    1987-01-01

    A novel electrophoretic technique is described for the assessment of the equilibria in mixed-ligand complex system in solution. It is based on the movement of spot of the metal ion under an electric field with the complexants added in the background electrolyte at fixed pH. The concentration of primary ligand nitrilotriacetate was constant while that of secondary ligand (cytosine) was varied. The plot of log (cytosine) against mobility was used to obtain information on the formation of the mixed complexes and to calculate its stability constants. Experimentally obtained logK values are as 5.62, 4.55 and 4.42 for mixed complexes of UO 2 (II), Ni(II) and Zn(II) respectively at μ=0.1 and temp.=35 +- 01.degC. (author). 10 refs

  7. DNA (Cytosine-C5) Methyltransferase Inhibition by Oligodeoxyribonucleotides Containing 2-(1H)-Pyrimidinone (Zebularine Aglycon) at the Enzymatic Target Site

    OpenAIRE

    van Bemmel, Dana M.; Brank, Adam S.; Eritja, Ramon; Marquez, Victor E.; Christman, Judith K.

    2009-01-01

    Aberrant cytosine methylation in promoter regions leads to gene silencing associated with cancer progression. A number of DNA methyltransferase inhibitors are known to reactivate silenced genes; including 5-azacytidine and 2-(1H)-pyrimidinone riboside (zebularine). Zebularine is a more stable, less cytotoxic inhibitor compared to 5-azacytidine. To determine the mechanistic basis for this difference, we carried out a detailed comparisons of the interaction between purified DNA methyltransferas...

  8. Accurate CpG and non-CpG cytosine methylation analysis by high-throughput locus-specific pyrosequencing in plants.

    Science.gov (United States)

    How-Kit, Alexandre; Daunay, Antoine; Mazaleyrat, Nicolas; Busato, Florence; Daviaud, Christian; Teyssier, Emeline; Deleuze, Jean-François; Gallusci, Philippe; Tost, Jörg

    2015-07-01

    Pyrosequencing permits accurate quantification of DNA methylation of specific regions where the proportions of the C/T polymorphism induced by sodium bisulfite treatment of DNA reflects the DNA methylation level. The commercially available high-throughput locus-specific pyrosequencing instruments allow for the simultaneous analysis of 96 samples, but restrict the DNA methylation analysis to CpG dinucleotide sites, which can be limiting in many biological systems. In contrast to mammals where DNA methylation occurs nearly exclusively on CpG dinucleotides, plants genomes harbor DNA methylation also in other sequence contexts including CHG and CHH motives, which cannot be evaluated by these pyrosequencing instruments due to software limitations. Here, we present a complete pipeline for accurate CpG and non-CpG cytosine methylation analysis at single base-resolution using high-throughput locus-specific pyrosequencing. The devised approach includes the design and validation of PCR amplification on bisulfite-treated DNA and pyrosequencing assays as well as the quantification of the methylation level at every cytosine from the raw peak intensities of the Pyrograms by two newly developed Visual Basic Applications. Our method presents accurate and reproducible results as exemplified by the cytosine methylation analysis of the promoter regions of two Tomato genes (NOR and CNR) encoding transcription regulators of fruit ripening during different stages of fruit development. Our results confirmed a significant and temporally coordinated loss of DNA methylation on specific cytosines during the early stages of fruit development in both promoters as previously shown by WGBS. The manuscript describes thus the first high-throughput locus-specific DNA methylation analysis in plants using pyrosequencing.

  9. Hydration properties of natural and synthetic DNA sequences with methylated adenine or cytosine bases in the R.DpnI target and BDNF promoter studied by molecular dynamics simulations

    Science.gov (United States)

    Shanak, Siba; Helms, Volkhard

    2014-12-01

    Adenine and cytosine methylation are two important epigenetic modifications of DNA sequences at the levels of the genome and transcriptome. To characterize the differential roles of methylating adenine or cytosine with respect to their hydration properties, we performed conventional MD simulations and free energy perturbation calculations for two particular DNA sequences, namely the brain-derived neurotrophic factor (BDNF) promoter and the R.DpnI-bound DNA that are known to undergo methylation of C5-methyl cytosine and N6-methyl adenine, respectively. We found that a single methylated cytosine has a clearly favorable hydration free energy over cytosine since the attached methyl group has a slightly polar character. In contrast, capping the strongly polar N6 of adenine with a methyl group gives a slightly unfavorable contribution to its free energy of solvation. Performing the same demethylation in the context of a DNA double-strand gave quite similar results for the more solvent-accessible cytosine but much more unfavorable results for the rather buried adenine. Interestingly, the same demethylation reactions are far more unfavorable when performed in the context of the opposite (BDNF or R.DpnI target) sequence. This suggests a natural preference for methylation in a specific sequence context. In addition, free energy calculations for demethylating adenine or cytosine in the context of B-DNA vs. Z-DNA suggest that the conformational B-Z transition of DNA transition is rather a property of cytosine methylated sequences but is not preferable for the adenine-methylated sequences investigated here.

  10. Genomic change, retrotransposon mobilization and extensive cytosine methylation alteration in Brassica napus introgressions from two intertribal hybridizations.

    Directory of Open Access Journals (Sweden)

    Xueli Zhang

    Full Text Available Hybridization and introgression represent important means for the transfer and/or de novo origination of traits and play an important role in facilitating speciation and plant breeding. Two sets of introgression lines in Brassica napus L. were previously established by its intertribal hybridizations with two wild species and long-term selection. In this study, the methods of amplified fragment length polymorphisms (AFLP, sequence-specific amplification polymorphism (SSAP and methylation-sensitive amplified polymorphism (MSAP were used to determine their genomic change, retrotransposon mobilization and cytosine methylation alteration in these lines. The genomic change revealed by the loss or gain of AFLP bands occurred for ∼10% of the total bands amplified in the two sets of introgressions, while no bands specific for wild species were detected. The new and absent SSAP bands appeared for 9 out of 11 retrotransposons analyzed, with low frequency of new bands and their total percentage of about 5% in both sets. MSAP analysis indicated that methylation changes were common in these lines (33.4-39.8% and the hypermethylation was more frequent than hypomethylation. Our results suggested that certain extents of genetic and epigenetic alterations were induced by hybridization and alien DNA introgression. The cryptic mechanism of these changes and potential application of these lines in breeding were also discussed.

  11. Genomic change, retrotransposon mobilization and extensive cytosine methylation alteration in Brassica napus introgressions from two intertribal hybridizations.

    Science.gov (United States)

    Zhang, Xueli; Ge, Xianhong; Shao, Yujiao; Sun, Genlou; Li, Zaiyun

    2013-01-01

    Hybridization and introgression represent important means for the transfer and/or de novo origination of traits and play an important role in facilitating speciation and plant breeding. Two sets of introgression lines in Brassica napus L. were previously established by its intertribal hybridizations with two wild species and long-term selection. In this study, the methods of amplified fragment length polymorphisms (AFLP), sequence-specific amplification polymorphism (SSAP) and methylation-sensitive amplified polymorphism (MSAP) were used to determine their genomic change, retrotransposon mobilization and cytosine methylation alteration in these lines. The genomic change revealed by the loss or gain of AFLP bands occurred for ∼10% of the total bands amplified in the two sets of introgressions, while no bands specific for wild species were detected. The new and absent SSAP bands appeared for 9 out of 11 retrotransposons analyzed, with low frequency of new bands and their total percentage of about 5% in both sets. MSAP analysis indicated that methylation changes were common in these lines (33.4-39.8%) and the hypermethylation was more frequent than hypomethylation. Our results suggested that certain extents of genetic and epigenetic alterations were induced by hybridization and alien DNA introgression. The cryptic mechanism of these changes and potential application of these lines in breeding were also discussed.

  12. A highly selective fluorescence sensing platform for nanomolar Hg(II) detection based on cytosine derived quantum dot

    Science.gov (United States)

    Luo, Liang; Song, Ting; Wang, Haoqiang; Yuan, Qunhui; Zhou, Shenghai

    2018-03-01

    Inspired by low toxicity and good biocompatibility of biomass derived quantum dot (QD), we herein developed a cytosine derived quantum dot, namely cyt-dot, via a one-step hydrothermal synthesis. The as-prepared cyt-dot emits blue fluorescence (FL) containing abundant oxygen (20.6 at.%) and nitrogen (24.1 at.%) contents. The cyt-dot based sensing platform shows exclusive selectivity for Hg(II) while being insensitive towards Fe(III) and Ag(I), which are important interference that usually cannot be ruled out. The detection limit for Hg(II) is of 11 nM, which is very close to the guideline value of 10 nM allowed by the U.S. Environmental Protection Agency in drinking water. In real water sample analyses, the present sensing platform can fulfil satisfied recoveries ranging from 100% to 108%. Besides, the acidity of solution has almost no effect on the sensing performance of the cyt-dot in a pH range of 5-8, suggesting its potential applications in sensing and bio-imaging.

  13. Mutations in Cytosine-5 tRNA Methyltransferases Impact Mobile Element Expression and Genome Stability at Specific DNA Repeats

    Directory of Open Access Journals (Sweden)

    Bianca Genenncher

    2018-02-01

    Full Text Available The maintenance of eukaryotic genome stability is ensured by the interplay of transcriptional as well as post-transcriptional mechanisms that control recombination of repeat regions and the expression and mobility of transposable elements. We report here that mutations in two (cytosine-5 RNA methyltransferases, Dnmt2 and NSun2, impact the accumulation of mobile element-derived sequences and DNA repeat integrity in Drosophila. Loss of Dnmt2 function caused moderate effects under standard conditions, while heat shock exacerbated these effects. In contrast, NSun2 function affected mobile element expression and genome integrity in a heat shock-independent fashion. Reduced tRNA stability in both RCMT mutants indicated that tRNA-dependent processes affected mobile element expression and DNA repeat stability. Importantly, further experiments indicated that complex formation with RNA could also contribute to the impact of RCMT function on gene expression control. These results thus uncover a link between tRNA modification enzymes, the expression of repeat DNA, and genomic integrity.

  14. Excision of deaminated cytosine from the vertebrate genome: role of the SMUG1 uracil–DNA glycosylase

    Science.gov (United States)

    Nilsen, Hilde; Haushalter, Karl A.; Robins, Peter; Barnes, Deborah E.; Verdine, Gregory L.; Lindahl, Tomas

    2001-01-01

    Gene-targeted mice deficient in the evolutionarily conserved uracil–DNA glycosylase encoded by the UNG gene surprisingly lack the mutator phenotype characteristic of bacterial and yeast ung– mutants. A complementary uracil–DNA glycosylase activity detected in ung–/– murine cells and tissues may be responsible for the repair of deaminated cytosine residues in vivo. Here, specific neutralizing antibodies were used to identify the SMUG1 enzyme as the major uracil–DNA glycosylase in UNG-deficient mice. SMUG1 is present at similar levels in cell nuclei of non-proliferating and proliferating tissues, indicating a replication- independent role in DNA repair. The SMUG1 enzyme is found in vertebrates and insects, whereas it is absent in nematodes, plants and fungi. We propose a model in which SMUG1 has evolved in higher eukaryotes as an anti-mutator distinct from the UNG enzyme, the latter being largely localized to replication foci in mammalian cells to counteract de novo dUMP incorporation into DNA. PMID:11483530

  15. Adenovirus-assisted lipofection: efficient in vitro gene transfer of luciferase and cytosine deaminase to human smooth muscle cells.

    Science.gov (United States)

    Kreuzer, J; Denger, S; Reifers, F; Beisel, C; Haack, K; Gebert, J; Kübler, W

    1996-07-01

    Smooth muscle cells (SMC) are a central cell type involved in multiple processes of coronary artery diseases including restenosis and therefore are major target cells for different aspects of gene transfer. Previous attempts to transfect primary arterial cells using different techniques like liposomes, CaPO4 and electroporation resulted in only low transfection efficiency. The development of recombinant adenoviruses dramatically improved the delivery of foreign genes into different cell types including SMC. However, cloning and identification of recombinants remain difficult and time-consuming techniques. The present study demonstrates that a complex consisting of reporter plasmid encoding firefly luciferase (pLUC), polycationic liposomes and replication-deficient adenovirus was able to yield very high in vitro transfection of primary human smooth muscle cells under optimized conditions. The technique of adenovirus-assisted lipofection (AAL) increases transfer and expression of plasmid DNA in human smooth muscle cells in vitro up to 1000-fold compared to lipofection. To verify the applicability of AAL for gene transfer into human smooth muscle cells we studied a gene therapy approach to suppress proliferation of SMC in vitro, using the prokaryotic cytosine deaminase gene (CD) which enables transfected mammalian cells to deaminate 5-fluorocytosine (5-FC) to the highly toxic 5-fluorouracil (5-FU). The effect of a transient CD expression on RNA synthesis was investigated by means of a cotransfection with a RSV-CD expression plasmid and the luciferase reporter plasmid. Western blot analysis demonstrated high expression of CD protein in transfected SMC. Cotransfected SMC demonstrated two-fold less luciferase activity in the presence of 5-FC (5 mmol/l) after 48 h compared to cells transfected with a non-CD coding plasmid. The data demonstrate that a transient expression of CD could be sufficient to reduce the capacity of protein synthesis in human SMC. This simple and

  16. Potential benefits of combining cytosine deaminase/5-fluorocytosine gene therapy and irradiation for prostate cancer. Experimental study

    Energy Technology Data Exchange (ETDEWEB)

    Kato, Hiroaki; Koshida, Kiyoshi; Yokoyama, Kunihiko; Mizokami, Atsushi; Namiki, Mikio [Kanazawa Univ. (Japan). School of Medicine

    2002-10-01

    The purpose of this study was to investigate the potential of combining cytosine deaminase/5-fluorocytosine (CD/5-FC) gene therapy and radiation therapy (either external beam radiation or radioimmunotherapy [RIT]), for the treatment of prostate cancer. Tumor xenografts of CD-transduced LNCaP cells grown in the testes of severe combined immunodeficiency (SCID) mice were used to evaluate antitumor effect. The mice were injected intraperitoneally with 500 mg/kg of 5-FC, or with 5, 15 or 30 mg/kg of 5-fluorouracil (5-FU), for 9 days. The tumors were treated with fractionated radiation at a dose of 1 or 3 Gy/day for 3 days, or I-131 labelled anti-prostate specific antigen (anti-PSA) monoclonal antibody (mAb) administration at a subtherapeutic dose of 20 or 80 {mu}Ci. Intratumoral and serum concentrations of 5-FU were measured using high performance liquid chromatography. Mice treated with CD/5-FC gene therapy presented a significant tumor growth inhibition comparable to that obtained with 15 mg/kg, 5-FU systemic administration without marked weight loss. Treatment with CD/5-FC gene therapy resulted in higher tumor but lower serum concentrations of 5-FU than treatment with systemic 5-FU chemotherapy. An additive antitumor effect was obtained when CD/5-FC therapy was combined with 1 Gy irradiation, which by itself did not produce a significant antitumor effect. However, the efficacy of CD/5-FC therapy was not enhanced when combined with RIT, probably due to poor accumulation of the mAb as the tumor/blood ratio never exceeded 1. These findings indicate that CD/5-FC gene therapy for prostate cancer may function with enhanced antitumor effect when combined with external beam radiation. However, combining CD/5-FC gene therapy and RIT using an anti-PSA mAb may not be effective because of insufficient accumulation of the mAb at the target tumors. (author)

  17. Potential benefits of combining cytosine deaminase/5-fluorocytosine gene therapy and irradiation for prostate cancer. Experimental study

    International Nuclear Information System (INIS)

    Kato, Hiroaki; Koshida, Kiyoshi; Yokoyama, Kunihiko; Mizokami, Atsushi; Namiki, Mikio

    2002-01-01

    The purpose of this study was to investigate the potential of combining cytosine deaminase/5-fluorocytosine (CD/5-FC) gene therapy and radiation therapy (either external beam radiation or radioimmunotherapy [RIT]), for the treatment of prostate cancer. Tumor xenografts of CD-transduced LNCaP cells grown in the testes of severe combined immunodeficiency (SCID) mice were used to evaluate antitumor effect. The mice were injected intraperitoneally with 500 mg/kg of 5-FC, or with 5, 15 or 30 mg/kg of 5-fluorouracil (5-FU), for 9 days. The tumors were treated with fractionated radiation at a dose of 1 or 3 Gy/day for 3 days, or I-131 labelled anti-prostate specific antigen (anti-PSA) monoclonal antibody (mAb) administration at a subtherapeutic dose of 20 or 80 μCi. Intratumoral and serum concentrations of 5-FU were measured using high performance liquid chromatography. Mice treated with CD/5-FC gene therapy presented a significant tumor growth inhibition comparable to that obtained with 15 mg/kg, 5-FU systemic administration without marked weight loss. Treatment with CD/5-FC gene therapy resulted in higher tumor but lower serum concentrations of 5-FU than treatment with systemic 5-FU chemotherapy. An additive antitumor effect was obtained when CD/5-FC therapy was combined with 1 Gy irradiation, which by itself did not produce a significant antitumor effect. However, the efficacy of CD/5-FC therapy was not enhanced when combined with RIT, probably due to poor accumulation of the mAb as the tumor/blood ratio never exceeded 1. These findings indicate that CD/5-FC gene therapy for prostate cancer may function with enhanced antitumor effect when combined with external beam radiation. However, combining CD/5-FC gene therapy and RIT using an anti-PSA mAb may not be effective because of insufficient accumulation of the mAb at the target tumors. (author)

  18. Regulation of nucleotide excision repair through ubiquitination

    Institute of Scientific and Technical Information of China (English)

    Jia Li; Audesh Bhat; Wei Xiao

    2011-01-01

    Nucleotide excision repair (NER) is the most versatile DNA-repair pathway in all organisms.While bacteria require only three proteins to complete the incision step of NER,eukaryotes employ about 30 proteins to complete the same step.Here we summarize recent studies demonstrating that ubiquitination,a post-translational modification,plays critical roles in regulating the NER activity either dependent on or independent of ubiquitin-proteolysis.Several NER components have been shown as targets of ubiquitination while others are actively involved in the ubiquitination process.We argue through this analysis that ubiquitination serves to coordinate various steps of NER and meanwhile connect NER with other related pathways to achieve the efficient global DNA-damage response.

  19. Palindromic nucleotide analysis in human T cell receptor rearrangements.

    Directory of Open Access Journals (Sweden)

    Santosh K Srivastava

    Full Text Available Diversity of T cell receptor (TCR genes is primarily generated by nucleotide insertions upon rearrangement from their germ line-encoded V, D and J segments. Nucleotide insertions at V-D and D-J junctions are random, but some small subsets of these insertions are exceptional, in that one to three base pairs inversely repeat the sequence of the germline DNA. These short complementary palindromic sequences are called P nucleotides. We apply the ImmunoSeq deep-sequencing assay to the third complementarity determining region (CDR3 of the β chain of T cell receptors, and use the resulting data to study P nucleotides in the repertoire of naïve and memory CD8(+ and CD4(+ T cells. We estimate P nucleotide distributions in a cross section of healthy adults and different T cell subtypes. We show that P nucleotide frequency in all T cell subtypes ranges from 1% to 2%, and that the distribution is highly biased with respect to the coding end of the gene segment. Classification of observed palindromic sequences into P nucleotides using a maximum conditional probability model shows that single base P nucleotides are very rare in VDJ recombination; P nucleotides are primarily two bases long. To explore the role of P nucleotides in thymic selection, we compare P nucleotides in productive and non-productive sequences of CD8(+ naïve T cells. The naïve CD8(+ T cell clones with P nucleotides are more highly expanded.

  20. Modification of the cerebral perfusion during a chemotherapy by arabinoside cytosine (A.R.A.C.) among patients suffering of an acute myelo-blastic leukemia (A.M.L.); Modification de la perfusion cerebrale au cours d'une chimiotherapie par cytosine arabinoside (ARAC) chez les patients atteints d'une leucemie aigue myeloblastique (LAM)

    Energy Technology Data Exchange (ETDEWEB)

    Modzelewski, R.; Vera, P. [Universite de Medecine de Rouen, QUANT.I.F-LITIS EA4108, departement de medecine nucleaire, 76 (France); Lepretre, S.; Tilly, H. [Centre Henri-Becquerel, departement d' hematologie, 76 - Rouen (France); Martinaud, O.; Hannequin, D. [CHU de Rouen, departement de neurologie, 76 (France); Habert, M.O. [CHU de la Pitie-Salpetriere, departement de medecine nucleaire, 75 - Paris (France)

    2010-07-01

    Cytosine arabinoside in high doses is a major treatment in acute myelo-blastic leukemia (A.M.L.). This treatment leads to neurological complications in 3-16% of cases, but the EEG, CT or MRI are normal.This prospective study examines brain perfusion in single photon emission tomography (SPECT) for patients receiving high dose arabinoside cytosine (H.D. A.R.A.C.). The SPECT of perfusion with hexamethyl propylene amine oxime (H.M.P.A.O.) for patients suffering of A.M.L. allowed to show a reduction of perfusion at the cerebellum level, of the occipito-parietal cortex and thalami, after conventional doses of A.R.A.C., while the patients had not any neurological accidents. (N.C.)

  1. Rasp21 sequences opposite the nucleotide binding pocket are required for GRF-mediated nucleotide release

    DEFF Research Database (Denmark)

    Leonardsen, L; DeClue, J E; Lybaek, H

    1996-01-01

    The substrate requirements for the catalytic activity of the mouse Cdc25 homolog Guanine nucleotide Release Factor, GRF, were determined using the catalytic domain of GRF expressed in insect cells and E. coli expressed H-Ras mutants. We found a requirement for the loop 7 residues in Ras (amino ac...... and the human Ras like proteins RhoA, Rap1A, Rac1 and G25K revealed a strict Ras specificity; of these only S. pombe Ras was GRF sensitive....

  2. Targeted cytosine deaminase-uracil phosphoribosyl transferase suicide gene therapy induces small cell lung cancer-specific cytotoxicity and tumor growth delay

    DEFF Research Database (Denmark)

    Christensen, Camilla L; Gjetting, Torben; Poulsen, Thomas Tuxen

    2010-01-01

    Small cell lung cancer (SCLC) is a highly malignant cancer for which there is no curable treatment. Novel therapies are therefore in great demand. In the present study we investigated the therapeutic effect of transcriptionally targeted suicide gene therapy for SCLC based on the yeast cytosine...... deaminase (YCD) gene alone or fused with the yeast uracil phosphoribosyl transferase (YUPRT) gene followed by administration of 5-fluorocytosine (5-FC) prodrug. Experimental design: The YCD gene or the YCD-YUPRT gene was placed under regulation of the SCLC-specific promoter insulinoma-associated 1 (INSM1...

  3. Cyclic nucleotide specific phosphodiesterases of Leishmania major

    Directory of Open Access Journals (Sweden)

    Linder Markus

    2006-03-01

    Full Text Available Abstract Background Leishmania represent a complex of important human pathogens that belong to the systematic order of the kinetoplastida. They are transmitted between their human and mammalian hosts by different bloodsucking sandfly vectors. In their hosts, the Leishmania undergo several differentiation steps, and their coordination and optimization crucially depend on numerous interactions between the parasites and the physiological environment presented by the fly and human hosts. Little is still known about the signalling networks involved in these functions. In an attempt to better understand the role of cyclic nucleotide signalling in Leishmania differentiation and host-parasite interaction, we here present an initial study on the cyclic nucleotide-specific phosphodiesterases of Leishmania major. Results This paper presents the identification of three class I cyclic-nucleotide-specific phosphodiesterases (PDEs from L. major, PDEs whose catalytic domains exhibit considerable sequence conservation with, among other, all eleven human PDE families. In contrast to other protozoa such as Dictyostelium, or fungi such as Saccharomyces cerevisiae, Candida ssp or Neurospora, no genes for class II PDEs were found in the Leishmania genomes. LmjPDEA contains a class I catalytic domain at the C-terminus of the polypeptide, with no other discernible functional domains elsewhere. LmjPDEB1 and LmjPDEB2 are coded for by closely related, tandemly linked genes on chromosome 15. Both PDEs contain two GAF domains in their N-terminal region, and their almost identical catalytic domains are located at the C-terminus of the polypeptide. LmjPDEA, LmjPDEB1 and LmjPDEB2 were further characterized by functional complementation in a PDE-deficient S. cerevisiae strain. All three enzymes conferred complementation, demonstrating that all three can hydrolyze cAMP. Recombinant LmjPDEB1 and LmjPDEB2 were shown to be cAMP-specific, with Km values in the low micromolar range

  4. Targeting the Immune System to Fight Cancer Using Chemical Receptor Homing Vectors Carrying Polyinosine/Cytosine (PolyIC)

    International Nuclear Information System (INIS)

    Levitzki, Alexander

    2012-01-01

    Cancer researchers have been looking for ways to harness the immune system and to reinstate immune surveillance, to kill cancer cells without collateral damage. Here we scan current approaches to targeting the immune system against cancer, and emphasize our own approach. We are using chemical vectors attached to a specific ligand, to introduce synthetic dsRNA, polyinosine/cytosine (polyIC), into tumors. The ligand binds to a receptor protein that is overexpressed on the surface of the tumor cells. Upon ligand binding, the receptor complex is internalized, introducing the polyIC into the cell. In this fashion a large amount of synthetic dsRNA can be internalized, leading to the activation of dsRNA-binding proteins, such as dsRNA dependent protein kinase (PKR), Toll-like receptor 3 (TLR3), retinoic acid-inducible gene I (RIG-1), and melanoma differentiation-associated gene 5 (MDA5). The simultaneous activation of these signaling proteins leads to the rapid demise of the targeted cell and to cytokine secretion. The cytokines lead to a strong bystander effect and to the recruitment of immune cells that converge upon the targeted cells. The bystander effects lead to the destruction of neighboring tumor cells not targeted themselves by the vector. Normal cells, being more robust than tumor cells, survive. This strategy has several advantages: (1) recruitment of the immune system is localized to the tumor. (2) The response is rapid, leading to fast tumor eradication. (3) The bystander effects lead to the eradication of tumor cells not harboring the target. (4) The multiplicity of pro-death signaling pathways elicited by PolyIC minimizes the likelihood of the emergence of resistance. In this chapter we focus on EGFR as the targeted receptor, which is overexpressed in many tumors. In principle, the strategy can be extended to other tumors that overexpress a protein that can be internalized by a ligand, which can be a small molecule, a single chain antibody, or an affibody.

  5. Targeting the immune system to fight cancer using chemical receptor homing vectors carrying Poly Inosine/Cytosine (PolyIC

    Directory of Open Access Journals (Sweden)

    Alexander eLevitzki

    2012-02-01

    Full Text Available Cancer researchers have been looking for ways to harness the immune system and to reinstate immune surveillance, to kill cancer cells without collateral damage. Here we scan current approaches to targeting the immune system against cancer, and emphasize our own approach. We are using chemical vectors attached to a specific ligand, to introduce synthetic dsRNA, poly Inosine/Cytosine (polyIC, into tumors. The ligand binds to a receptor protein that is overexpressed on the surface of the tumor cells. Upon ligand binding, the receptor complex is internalized, introducing the polyIC into the cell. In this fashion a large amount of synthetic dsRNA can be internalized, leading to the activation of dsRNA binding proteins, such as dsRNA dependent protein kinase (PKR, Toll-3 receptor (TLR3, retinoic acid–inducible gene I (RIG-1 and melanoma differentiation–associated gene 5 (MDA5. The simultaneous activation of these signaling proteins leads to the rapid demise of the targeted cell and to cytokine secretion. The cytokines lead to a strong bystander effect and to the recruitment of immune cells that converge upon the targeted cells. The bystander effects lead to the destruction of neighboring tumor cells not targeted themselves by the vector. Normal cells, being more robust than tumor cells, survive. This strategy has several advantages: (1 Recruitment of the immune system is localized to the tumor. (2 The response is rapid, leading to fast tumor eradication. (3 The bystander effects lead to the eradication of tumor cells not harboring the target. (4 The multiplicity of pro-death signaling pathways elicited by PolyIC minimizes the likelihood of the emergence of resistance. In this chapter we focus on EGFR as the targeted receptor, which is overexpressed in many tumors. In principle, the strategy can be extended to other tumors that overexpress a protein that can be internalized by a ligand, which be a small molecule, a single chain antibody or an

  6. Exploiting nucleotide composition to engineer promoters.

    Directory of Open Access Journals (Sweden)

    Manfred G Grabherr

    Full Text Available The choice of promoter is a critical step in optimizing the efficiency and stability of recombinant protein production in mammalian cell lines. Artificial promoters that provide stable expression across cell lines and can be designed to the desired strength constitute an alternative to the use of viral promoters. Here, we show how the nucleotide characteristics of highly active human promoters can be modelled via the genome-wide frequency distribution of short motifs: by overlapping motifs that occur infrequently in the genome, we constructed contiguous sequence that is rich in GC and CpGs, both features of known promoters, but lacking homology to real promoters. We show that snippets from this sequence, at 100 base pairs or longer, drive gene expression in vitro in a number of mammalian cells, and are thus candidates for use in protein production. We further show that expression is driven by the general transcription factors TFIIB and TFIID, both being ubiquitously present across cell types, which results in less tissue- and species-specific regulation compared to the viral promoter SV40. We lastly found that the strength of a promoter can be tuned up and down by modulating the counts of GC and CpGs in localized regions. These results constitute a "proof-of-concept" for custom-designing promoters that are suitable for biotechnological and medical applications.

  7. Supplementary Material for: The arabidopsis cyclic nucleotide interactome

    KAUST Repository

    Donaldson, Lara; Meier, Stuart; Gehring, Christoph A

    2016-01-01

    Abstract Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.

  8. In-silico single nucleotide polymorphisms (SNP) mining of Sorghum ...

    African Journals Online (AJOL)

    Single nucleotide polymorphisms (SNPs) may be considered the ultimate genetic markers as they represent the finest resolution of a DNA sequence (a single nucleotide), and are generally abundant in populations with a low mutation rate. SNPs are important tools in studying complex genetic traits and genome evolution.

  9. Condensing the information in DNA with double-headed nucleotides

    DEFF Research Database (Denmark)

    Hornum, Mick; Sharma, Pawan K; Reslow-Jacobsen, Charlotte

    2017-01-01

    A normal duplex holds as many Watson-Crick base pairs as the number of nucleotides in its constituent strands. Here we establish that single nucleotides can be designed to functionally imitate dinucleotides without compromising binding affinity. This effectively allows sequence information...

  10. Adenine nucleotide depletion from endothelial cells exposed to xanthine oxidase

    International Nuclear Information System (INIS)

    Aalto, T.K.; Raivio, K.O.

    1990-01-01

    Hypoxia causes breakdown of cellular nucleotides, accumulation of hypoxanthine (HX), and conversion of xanthine dehydrogenase into xanthine oxidase (XO). Upon reoxygenation, the HX-XO reaction generates free radicals, one potential mechanism of tissue damage. Because endothelial cells contain XO and are exposed to circulating HX, they are a likely target for damage. We studied the effect of XO and/or HX at physiologically relevant concentrations on nucleotide metabolism of cultured endothelial cells from human umbilical veins. Cells were labeled with [14C]adenine and incubated for up to 6 h with HX, XO, or both, in the absence or presence of serum. Adenine nucleotides from cell extracts and nucleotide breakdown products (HX, xanthine, and urate) from the medium were separated and counted. HX alone had no effect. XO (80 mU/ml) alone caused a 70% (no serum) or 40% (with serum) fall in adenine nucleotides and an equivalent increase of xanthine and urate. The combination of HX and XO caused a 90% (no serum) or 70% (with serum) decrease in nucleotides, decrease in energy charge, and detachment of cells from the culture plate. Nucleotide depletion was not accounted for by proteolytic activity in the XO preparation. Albumin was only half as effective as serum in preventing nucleotide loss. Thus exogenous XO, in the presence of endogenous HX, triggers adenine nucleotide catabolism, but endogenous XO activity is too low to influence nucleotide levels even at high exogenous HX concentrations. Serum limits the catabolic effect of XO and thus protects cells from free radical damage

  11. Effects of temperature and isotopic substitution on electron attachment dynamics of guanine–cytosine base pair: Ring-polymer and classical molecular dynamics simulations

    Energy Technology Data Exchange (ETDEWEB)

    Minoshima, Yusuke; Seki, Yusuke [Department of Chemistry, Saitama University, 255 Shimo-Okubo, Sakura-ku, Saitama City, Saitama 338-8570 (Japan); Takayanagi, Toshiyuki, E-mail: tako@mail.saitama-u.ac.jp [Department of Chemistry, Saitama University, 255 Shimo-Okubo, Sakura-ku, Saitama City, Saitama 338-8570 (Japan); Shiga, Motoyuki [Center for Computational Science and E-Systems, Japan Atomic Energy Agency, 148-4, Kashiwanoha Campus, 178-4 Wakashiba, Kashiwa, Chiba 277-0871 (Japan)

    2016-06-15

    Highlights: • Dynamics of excess electron attachment to guanine–cytosine base pair. • Ring-polymer and classical molecular dynamics simulations are performed. • Temperature and isotope substitution effects are investigated. - Abstract: The dynamical process of electron attachment to a guanine–cytosine pair in the normal (h-GC) and deuterated (d-GC) forms has been studied theoretically by semiclassical ring-polymer molecular dynamics (RPMD) simulations using the empirical valence bond model. The initially formed dipole-bound anion is converted rapidly to the valence-bound anion within about 0.1 ps in both h-GC and d-GC. However, the subsequent proton transfer in h-GC occurs with a rate five times greater than the deuteron transfer in d-GC. The change of rates with isotopic substitution and temperature variation in the RPMD simulations are quantitatively and qualitatively different from those in the classical molecular dynamics (MD) simulations, demonstrating the importance of nuclear quantum effects on the dynamics of this system.

  12. Targeted inhibition of osteosarcoma tumor growth by bone marrow-derived mesenchymal stem cells expressing cytosine deaminase/5-fluorocytosine in tumor-bearing mice.

    Science.gov (United States)

    NguyenThai, Quynh-Anh; Sharma, Neelesh; Luong, Do Huynh; Sodhi, Simrinder Singh; Kim, Jeong-Hyun; Kim, Nameun; Oh, Sung-Jong; Jeong, Dong Kee

    2015-01-01

    Mesenchymal stem cells (MSCs) are considered as an attractive approach for gene or drug delivery in cancer therapy. In the present study, the ability of human bone marrow-derived MSCs expressing the cytosine deaminase/5-fluorocytosine prodrug (CD/5-FC MSCs) to target the human osteosarcoma cell line Cal72 was evaluated. The stable CD/5-FC MSC cell line was established by transfection of pEGFP containing the cytosine deaminase gene into MSCs with G418 selection. The anti-tumor effect was verified by a bystander effect assay in vitro and co-injection of Cal72 and CD/5-FC MSCs in cancer-bearing mice. The therapeutic CD/5-FC MSCs retained the characteristics of multipotent cells, such as differentiation into adipocytes/osteocytes and expression of mesenchymal markers (CD90 and CD44), and showed migration toward Cal72 cells to a greater extent than the native MSCs. The bystander effect assay showed that the CD/5-FC MSCs significantly augmented Cal72 cytotoxicity in direct co-culture and in the presence of 5-FC through the application of conditioned medium. In osteosarcoma-bearing mice, the CD/5-FC MSCs inhibited tumor growth compared to control mice subcutaneously injected with only Cal72 cells. Taken together, these findings suggest that CD/5-FC MSCs may be suitable for targeting human osteosarcoma. Copyright © 2015 John Wiley & Sons, Ltd.

  13. Effects of temperature and isotopic substitution on electron attachment dynamics of guanine–cytosine base pair: Ring-polymer and classical molecular dynamics simulations

    International Nuclear Information System (INIS)

    Minoshima, Yusuke; Seki, Yusuke; Takayanagi, Toshiyuki; Shiga, Motoyuki

    2016-01-01

    Highlights: • Dynamics of excess electron attachment to guanine–cytosine base pair. • Ring-polymer and classical molecular dynamics simulations are performed. • Temperature and isotope substitution effects are investigated. - Abstract: The dynamical process of electron attachment to a guanine–cytosine pair in the normal (h-GC) and deuterated (d-GC) forms has been studied theoretically by semiclassical ring-polymer molecular dynamics (RPMD) simulations using the empirical valence bond model. The initially formed dipole-bound anion is converted rapidly to the valence-bound anion within about 0.1 ps in both h-GC and d-GC. However, the subsequent proton transfer in h-GC occurs with a rate five times greater than the deuteron transfer in d-GC. The change of rates with isotopic substitution and temperature variation in the RPMD simulations are quantitatively and qualitatively different from those in the classical molecular dynamics (MD) simulations, demonstrating the importance of nuclear quantum effects on the dynamics of this system.

  14. Effect of D-valine and cytosine arabinoside on [3H]thymidine incorporation in rat and rabbit epididymal epithelial cell cultures

    International Nuclear Information System (INIS)

    Orgebin-Crist, M.C.; Jonas-Davies, J.; Storey, P.; Olson, G.E.

    1984-01-01

    Epithelial cell enriched primary cultures were established from the rat and the rabbit epididymis. Epithelial cell aggregates, obtained after pronase digestion of minced epididymis, attached to the culture dish and after 72 h in vitro spread out to form discrete patches of cells. These cells have an epithelioid morphology and form a monolayer of closely apposed polygonal cells where DNA synthesis, as judged by [ 3 H]thymidine uptake, is very low. In L-valine medium the nonepithelial cell contamination was no more than 10% in rat and rabbit epididymal primary cultures. The labeling index of rat epididymal cells cultured in D-valine medium was significantly lower than that of cells cultured in L-valine medium. In contrast, the labeling index of rabbit epididymal cells cultured in D-valine medium was significantly higher than that of cells cultured in L-valine medium. Cytosine arabinoside decreased the number of labeled cells in both L-valine and D-valine cultures. From these results, it appears that D-valine is a selective agent for rat epididymal epithelial cells, but not for rabbit epithelial cells, and that cytosine arabinoside is a simple and effective means to control the proliferation of fibroblast-like cells in both rat and rabbit epididymal cell cultures

  15. Interaction of Cu(+) with cytosine and formation of i-motif-like C-M(+)-C complexes: alkali versus coinage metals.

    Science.gov (United States)

    Gao, Juehan; Berden, Giel; Rodgers, M T; Oomens, Jos

    2016-03-14

    The Watson-Crick structure of DNA is among the most well-known molecular structures of our time. However, alternative base-pairing motifs are also known to occur, often depending on base sequence, pH, or the presence of cations. Pairing of cytosine (C) bases induced by the sharing of a single proton (C-H(+)-C) may give rise to the so-called i-motif, which occurs primarily in expanded trinucleotide repeats and the telomeric region of DNA, particularly at low pH. At physiological pH, silver cations were recently found to stabilize C dimers in a C-Ag(+)-C structure analogous to the hemiprotonated C-dimer. Here we use infrared ion spectroscopy in combination with density functional theory calculations at the B3LYP/6-311G+(2df,2p) level to show that copper in the 1+ oxidation state induces an analogous formation of C-Cu(+)-C structures. In contrast to protons and these transition metal ions, alkali metal ions induce a different dimer structure, where each ligand coordinates the alkali metal ion in a bidentate fashion in which the N3 and O2 atoms of both cytosine ligands coordinate to the metal ion, sacrificing hydrogen-bonding interactions between the ligands for improved chelation of the metal cation.

  16. Nucleotide excision repair in differentiated cells

    Energy Technology Data Exchange (ETDEWEB)

    Wees, Caroline van der [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Department of Cardiology, Leiden University Medical Center, Leiden (Netherlands); Jansen, Jacob [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Vrieling, Harry [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Laarse, Arnoud van der [Department of Cardiology, Leiden University Medical Center, Leiden (Netherlands); Zeeland, Albert van [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Mullenders, Leon [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands)]. E-mail: l.mullenders@lumc.nl

    2007-01-03

    Nucleotide excision repair (NER) is the principal pathway for the removal of a wide range of DNA helix-distorting lesions and operates via two NER subpathways, i.e. global genome repair (GGR) and transcription-coupled repair (TCR). Although detailed information is available on expression and efficiency of NER in established mammalian cell lines, little is known about the expression of NER pathways in (terminally) differentiated cells. The majority of studies in differentiated cells have focused on repair of UV-induced cyclobutane pyrimidine dimers (CPD) and 6-4-photoproducts (6-4PP) because of the high frequency of photolesions at low level of toxicity and availability of sensitive technologies to determine photolesions in defined regions of the genome. The picture that emerges from these studies is blurred and rather complex. Fibroblasts and terminally differentiated myocytes of the rat heart display equally efficient GGR of 6-4PP but poor repair of CPD due to the absence of p48 expression. This repair phenotype is clearly different from human terminal differentiated neurons. Furthermore, both cell types were found to carry out TCR of CPD, thus mimicking the repair phenotype of established rodent cell lines. In contrast, in intact rat spermatogenic cells repair was very inefficient at the genome overall level and in transcriptionally active genes indicating that GGR and TCR are non-functional. Also, non-differentiated mouse embryonic stem (ES) cells exhibit low levels of NER after UV irradiation. However, the mechanisms that lead to low NER activity are clearly different: in differentiated spermatogenic cells differences in chromatin compaction and sequestering of NER proteins may underlie the lack of NER activity in pre-meiotic cells, whereas in non-differentiated ES cells NER is impaired by a strong apoptotic response.

  17. Nucleotide Excision Repair in Cellular Chromatin: Studies with Yeast from Nucleotide to Gene to Genome

    Directory of Open Access Journals (Sweden)

    Simon Reed

    2012-09-01

    Full Text Available Here we review our development of, and results with, high resolution studies on global genome nucleotide excision repair (GGNER in Saccharomyces cerevisiae. We have focused on how GGNER relates to histone acetylation for its functioning and we have identified the histone acetyl tranferase Gcn5 and acetylation at lysines 9/14 of histone H3 as a major factor in enabling efficient repair. We consider results employing primarily MFA2 as a model gene, but also those with URA3 located at subtelomeric sequences. In the latter case we also see a role for acetylation at histone H4. We then go on to outline the development of a high resolution genome-wide approach that enables one to examine correlations between histone modifications and the nucleotide excision repair (NER of UV-induced cyclobutane pyrimidine dimers throughout entire genomes. This is an approach that will enable rapid advances in understanding the complexities of how compacted chromatin in chromosomes is processed to access DNA damage and then returned to its pre-damaged status to maintain epigenetic codes.

  18. The possible role of human milk nucleotides as sleep inducers.

    Science.gov (United States)

    Sánchez, Cristina L; Cubero, Javier; Sánchez, Javier; Chanclón, Belén; Rivero, Montserrat; Rodríguez, Ana B; Barriga, Carmen

    2009-02-01

    Breast-milk contains a potent mixture of diverse components, such as the non-protein nitrogen fraction which includes nucleotides, whose variation in levels is evident throughout lactation. In addition, these substances play an important role in sleep homeostasis. In the present study, human milk samples were analyzed using a capillary electrophoresis system. The rhythmicity of each nucleotide was studied by cosinor analysis. It was found that the nucleotides 5'AMP, 5'GMP, 5'CMP, and 5'IMP have significant (P inducing the 'hypnotic' action of breast-milk at night in the infant.

  19. Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

    OpenAIRE

    Le Gall, O; Candresse, T; Brault, V; Dunez, J

    1989-01-01

    The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that o...

  20. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes.

    Science.gov (United States)

    Kondo, Jiro; Westhof, Eric

    2011-10-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.

  1. Computational identification of candidate nucleotide cyclases in higher plants

    KAUST Repository

    Wong, Aloysius Tze; Gehring, Christoph A

    2013-01-01

    In higher plants guanylyl cyclases (GCs) and adenylyl cyclases (ACs) cannot be identified using BLAST homology searches based on annotated cyclic nucleotide cyclases (CNCs) of prokaryotes, lower eukaryotes, or animals. The reason is that CNCs

  2. A single nucleotide polymorphism (SNP) assay for population ...

    African Journals Online (AJOL)

    A single nucleotide polymorphism (SNP) assay for population stratification test ... phenotypes and unlinked candidate loci in case-control and cohort studies of ... Key words: Chinese, Japanese, population stratification, ancestry informative ...

  3. Mitochondrial DNA analysis reveals a low nucleotide diversity of ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-06-17

    Jun 17, 2009 ... gene sequences of C. japonica in China to assess nucleotide sequence diversity (GenBank ... provide a scientific basis for the regional control of forestry .... population (AB015869) was downloaded from GenBank database.

  4. Extracellular nucleotide derivatives protect cardiomyctes against hypoxic stress

    DEFF Research Database (Denmark)

    Golan, O; Issan, Y; Isak, A

    2011-01-01

    assures cardioprotection. Treatment with extracellular nucleotides, or with tri/di-phosphate, administered under normoxic conditions or during hypoxic conditions, led to a decrease in reactive oxygen species production. CONCLUSIONS: Extracellular tri/di-phosphates are apparently the molecule responsible...

  5. Enzymatic Incorporation of Modified Purine Nucleotides in DNA.

    Science.gov (United States)

    Abu El Asrar, Rania; Margamuljana, Lia; Abramov, Mikhail; Bande, Omprakash; Agnello, Stefano; Jang, Miyeon; Herdewijn, Piet

    2017-12-14

    A series of nucleotide analogues, with a hypoxanthine base moiety (8-aminohypoxanthine, 1-methyl-8-aminohypoxanthine, and 8-oxohypoxanthine), together with 5-methylisocytosine were tested as potential pairing partners of N 8 -glycosylated nucleotides with an 8-azaguanine or 8-aza-9-deazaguanine base moiety by using DNA polymerases (incorporation studies). The best results were obtained with the 5-methylisocytosine nucleotide followed by the 1-methyl-8-aminohypoxanthine nucleotide. The experiments demonstrated that small differences in the structure (8-azaguanine versus 8-aza-9-deazaguanine) might lead to significant differences in recognition efficiency and selectivity, base pairing by Hoogsteen recognition at the polymerase level is possible, 8-aza-9-deazaguanine represents a self-complementary base pair, and a correlation exists between in vitro incorporation studies and in vivo recognition by natural bases in Escherichia coli, but this recognition is not absolute (exceptions were observed). © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Detection of DNA nucleotides on pretreated boron doped diamond electrodes

    Energy Technology Data Exchange (ETDEWEB)

    Garbellini, Gustavo S.; Uliana, Carolina V.; Yamanaka, Hideko [UNESP, Araraquara, SP (Brazil). Inst. de Quimica

    2011-07-01

    The individual detection and equimolar mixture of DNA nucleotides guanosine monophosphate (GMP), adenosine monophosphate (AMP), thymidine (TMP) and cytidine (CMP) 5'-monophosphate using square wave voltammetry was performed on boron doped diamond (BDD) electrodes cathodically (Red-DDB) and anodically (Oxi-DDB) pretreated. The oxidation of individual DNA nucleotides was more sensitive on Oxi-BDD electrode. In a simultaneous detection of nucleotides, the responses of GMP, AMP, TMP and CMP were very adequate on both treated electrodes. Particularly, more sensitive and separate peaks for TMP and CMP on Oxi-BDD and Red-BDD electrodes, respectively, were observed after deconvolution procedure. The detection of nucleotides in aqueous solutions will certainly contribute for genotoxic evaluation of substances and hybridization reactions by immobilizing ss or ds-DNA on BDD surface. (author)

  7. Nucleotide Metabolism and its Control in Lactic Acid Bacteria

    DEFF Research Database (Denmark)

    Kilstrup, Mogens; Hammer, Karin; Jensen, Peter Ruhdal

    2005-01-01

    Most metabolic reactions are connected through either their utilization of nucleotides or their utilization of nucleotides or their regulation by these metabolites. In this review the biosynthetic pathways for pyrimidine and purine metabolism in lactic acid bacteria are described including...... the interconversion pathways, the formation of deoxyribonucleotides and the salvage pathways for use of exogenous precursors. The data for the enzymatic and the genetic regulation of these pathways are reviewed, as well as the gene organizations in different lactic acid bacteria. Mutant phenotypes and methods...... for manipulation of nucleotide pools are also discussed. Our aim is to provide an overview of the physiology and genetics of nucleotide metabolism and its regulation that will facilitate the interpretation of data arising from genetics, metabolomics, proteomics, and transcriptomics in lactic acid bacteria....

  8. Free amino acids and 5'-nucleotides in Finnish forest mushrooms.

    Science.gov (United States)

    Manninen, Hanna; Rotola-Pukkila, Minna; Aisala, Heikki; Hopia, Anu; Laaksonen, Timo

    2018-05-01

    Edible mushrooms are valued because of their umami taste and good nutritional values. Free amino acids, 5'-nucleotides and nucleosides were analyzed from four Nordic forest mushroom species (Lactarius camphoratus, Boletus edulis, Cantharellus cibarius, Craterellus tubaeformis) using high precision liquid chromatography analysis. To our knowledge, these taste components were studied for the first time from Craterellus tubaeformis and Lactarius camphoratus. The focus was on the umami amino acids and 5'-nucleotides. The free amino acid and 5'-nucleotide/nucleoside contents of studied species differed from each other. In all studied samples, umami amino acids were among five major free amino acids. The highest concentration of umami amino acids was on L. camphoratus whereas B. edulis had the highest content of sweet amino acids and C. cibarius had the highest content of bitter amino acids. The content of umami enhancing 5'-nucleotides were low in all studied species. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Statistical properties and fractals of nucleotide clusters in DNA sequences

    International Nuclear Information System (INIS)

    Sun Tingting; Zhang Linxi; Chen Jin; Jiang Zhouting

    2004-01-01

    Statistical properties of nucleotide clusters in DNA sequences and their fractals are investigated in this paper. The average size of nucleotide clusters in non-coding sequence is larger than that in coding sequence. We investigate the cluster-size distribution P(S) for human chromosomes 21 and 22, and the results are different from previous works. The cluster-size distribution P(S 1 +S 2 ) with the total size of sequential Pu-cluster and Py-cluster S 1 +S 2 is studied. We observe that P(S 1 +S 2 ) follows an exponential decay both in coding and non-coding sequences. However, we get different results for human chromosomes 21 and 22. The probability distribution P(S 1 ,S 2 ) of nucleotide clusters with the size of sequential Pu-cluster and Py-cluster S 1 and S 2 respectively, is also examined. In the meantime, some of the linear correlations are obtained in the double logarithmic plots of the fluctuation F(l) versus nucleotide cluster distance l along the DNA chain. The power spectrums of nucleotide clusters are also discussed, and it is concluded that the curves are flat and hardly changed and the 1/3 frequency is neither observed in coding sequence nor in non-coding sequence. These investigations can provide some insights into the nucleotide clusters of DNA sequences

  10. Differences in substrate specificity of C(5)-substituted or C(5)-unsubstituted pyrimidine nucleotides by DNA polymerases from thermophilic bacteria, archaea, and phages.

    Science.gov (United States)

    Sawai, Hiroaki; Nagashima, Junichi; Kuwahara, Msayasu; Kitagata, Rina; Tamura, Takehiro; Matsui, Ikuo

    2007-09-01

    The pyrimidine bases of RNA are uracil (U) and cytosine (C), while thymine (T) and C are used for DNA. The C(5) position of C and U is unsubstituted, whereas the C(5) of T is substituted with a Me group. Miller et al. hypothesized that various C(5)-substituted uracil derivatives were formed during chemical evolution, and that C(5)-substituted U derivatives may have played important roles in the transition from an 'RNA world' to a 'DNA-RNA-protein world'. Hyperthermophilic bacteria and archaea are considered to be primitive organisms that are evolutionarily close to the universal ancestor of all life on earth. Thus, we examined the substrate specificity of several C(5)-substituted or C(5)-unsubstituted dUTP and dCTP analogs for several DNA polymerases from hyperthermophilic bacteria, hyperthermophilic archaea, and viruses during PCR or primer extension reaction. The substrate specificity of the C(5)-substituted or C(5)-unsubstituted pyrimidine nucleotides varied greatly depending on the type of DNA polymerase. The significance of this difference in substrate specificity in terms of the origin and evolution of the DNA replication system is discussed briefly.

  11. The yield of fission neutron-induced chromatid aberrations in G[sub 2]-stage human lymphocytes: effect of caffeine, hydroxyurea and cytosine arabinoside post-irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Antoccia, A.; Tanzarella, C. (La Sapienza Univ., Rome (Italy)); Palitti, F. (Tuscia Univ., Viterbo (Italy) La Sapienza Univ., Rome (Italy)); Raggi, T. (Tuscia Univ., Viterbo (Italy)); Catena, C. (ENEA, Casaccia (Italy). Centro Ricerche Energia)

    1992-11-01

    To evaluate the influence of inhibitors of DNA synthesis/repair on the yield of chromosomal aberrations in the G[sub 2] phase of the cell cycle, whole-blood cultures of human lymphocytes were exposed to various doses of fission neutrons or X-rays and treated post-irradiation during the last 2.45 h before harvesting, with 5mM hydroxyurea (HU) and 0.05 mM cytosine arabinoside (ara-C). The presence of caffeine and HU strongly potentiated the yield of chromatid-type aberrations induced by both neutrons and X-rays. No potentiating effect, except at the highest dose of neutrons, was observed when irradiated cells were subsequently treated with ara-C. In addition, neutron-induced mitotic delay was shortened by treatment with caffeine, mainly within the first 2 h after irradiation. (Author).

  12. An Insight into the Environmental Effects of the Pocket of the Active Site of the Enzyme. Ab initio ONIOM-Molecular Dynamics (MD) Study on Cytosine Deaminase

    International Nuclear Information System (INIS)

    Matsubara, Toshiaki; Dupuis, Michel; Aida, Misako

    2008-01-01

    We applied the ONIOM-molecular dynamics (MD) method to cytosine deaminase to examine the environmental effects of the amino acid residues in the pocket of the active site on the substrate taking account of their thermal motion. The ab initio ONIOM-MD simulations show that the substrate uracil is strongly perturbed by the amino acid residue Ile33, which sandwiches the uracil with His62, through the steric contact due to the thermal motion. As a result, the magnitude of the thermal oscillation of the potential energy and structure of the substrate uracil significantly increases. TM and MA were partly supported by grants from the Ministry of Education, Culture, Sports, Science and Technology of Japan.MD was supported by the Division of Chemical Sciences, Office of Basic Energy Sciences, and by the Office of Biological and Environmental Research of the U.S. Department of Energy DOE. Battelle operates Pacific Northwest National Laboratory for DOE

  13. Cytosine-assisted synthesis of gold nanochains and gold nanoflowers for the construction of a microperoxidase-11 based amperometric biosensor for hydrogen peroxide

    International Nuclear Information System (INIS)

    Zhang, Qian-Li; Zhou, Dan-Ling; Wang, Ai-Jun; Qin, Su-Fang; Feng, Jiu-Ju; Li, Yong-Fang

    2014-01-01

    A simple method was developed for synthesis of network-like gold nanochains and gold nanoflowers in the presence of cytosine by reduction of tetrachloroauric acid with sodium borohydride and ascorbic acid, respectively. The resulting gold nanocrystals were coated with microperoxidase-11 via electrostatic interactions. Electrodes modified with protein-coated gold nanochains or nanoflowers display well-defined and quasi reversible redox peaks and enhanced high electrocatalytic activity toward the reduction of H 2 O 2 that is due to direct electron transfer to the protein. The effects were exploited for the amperometric detection of H 2 O 2 with a linear response from 0.5 μM to 0.13 mM (for the gold nanochains) and from 1.0 μM to 0.11 mM (for the gold nanoflowers), respectively. The sensor shows lower detection limit and faster response time than sensors based on the use of spherical gold nanoparticles. (author)

  14. Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

    Science.gov (United States)

    Le Gall, O; Candresse, T; Brault, V; Dunez, J

    1989-10-11

    The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that of other viral polyproteins, revealing the same general genetic organization as that of other picorna-like viruses (comoviruses, potyviruses and picornaviruses), except that an additional protein is suspected to occupy the N-terminus of the polyprotein.

  15. DNA Nucleotide Sequence Restricted by the RI Endonuclease

    Science.gov (United States)

    Hedgpeth, Joe; Goodman, Howard M.; Boyer, Herbert W.

    1972-01-01

    The sequence of DNA base pairs adjacent to the phosphodiester bonds cleaved by the RI restriction endonuclease in unmodified DNA from coliphage λ has been determined. The 5′-terminal nucleotide labeled with 32P and oligonucleotides up to the heptamer were analyzed from a pancreatic DNase digest. The following sequence of nucleotides adjacent to the RI break made in λ DNA was deduced from these data and from the 3′-dinucleotide sequence and nearest-neighbor analysis obtained from repair synthesis with the DNA polymerase of Rous sarcoma virus [Formula: see text] The RI endonuclease cleavage of the phosphodiester bonds (indicated by arrows) generates 5′-phosphoryls and short cohesive termini of four nucleotides, pApApTpT. The most striking feature of the sequence is its symmetry. PMID:4343974

  16. Adenovirus-mediated interleukin-12 gene transfer combined with cytosine deaminase followed by 5-fluorocytosine treatment exerts potent antitumor activity in Renca tumor-bearing mice

    International Nuclear Information System (INIS)

    Hwang, Kyung-Sun; Cho, Won-Kyung; Yoo, Jinsang; Yun, Hwan-Jung; Kim, Samyong; Im, Dong-Soo

    2005-01-01

    Therapeutic gene transfer affords a clinically feasible and safe approach to cancer treatment but a more effective modality is needed to improve clinical outcomes. Combined transfer of therapeutic genes with different modes of actions may be a means to this end. Interleukin-12 (IL-12), a heterodimeric immunoregulatory cytokine composed of covalently linked p35 and p40 subunits, has antitumor activity in animal models. The enzyme/prodrug strategy using cytosine deaminase (CD) and 5-fluorocytosine (5-FC) has been used for cancer gene therapy. We have evaluated the antitumor effect of combining IL-12 with CD gene transfer in mice bearing renal cell carcinoma (Renca) tumors. Adenoviral vectors were constructed encoding one or both subunits of murine IL-12 (Ad.p35, Ad.p40 and Ad.IL-12) or cytosine deaminase (Ad.CD). The functionality of the IL-12 or CD gene products expressed from these vectors was validated by splenic interferon (IFN)-γ production or viability assays in cultured cells. Ad.p35 plus Ad.p40, or Ad.IL-12, with or without Ad.CD, were administered (single-dose) intratumorally to Renca tumor-bearing mice. The animals injected with Ad.CD also received 5-FC intraperitoneally. The antitumor effects were then evaluated by measuring tumor regression, mean animal survival time, splenic natural killer (NK) cell activity and IFN-γ production. The inhibition of tumor growth in mice treated with Ad.p35 plus Ad.p40 and Ad.CD, followed by injection of 5-FC, was significantly greater than that in mice treated with Ad.CD/5-FC, a mixture of Ad.p35 plus Ad.p40, or Ad.GFP (control). The combined gene transfer increased splenic NK cell activity and IFN-γ production by splenocytes. Ad.CD/5-FC treatment significantly increased the antitumor effect of Ad.IL-12 in terms of tumor growth inhibition and mean animal survival time. The results suggest that adenovirus-mediated IL-12 gene transfer combined with Ad.CD followed by 5-FC treatment may be useful for treating cancers

  17. Development of a single nucleotide polymorphism (SNP) marker for ...

    African Journals Online (AJOL)

    The nature of the single nucleotide polymorphism (SNP) marker was validated by DNA sequencing of the parental PCR products. Using high resolution melt (HRM) profiles and normalised difference plots, we successfully differentiated the homozygous dominant (wild type), homozygous recessive (LPA) and heterozygous ...

  18. Four new single nucleotide polymorphisms (SNPs) of toll-like ...

    African Journals Online (AJOL)

    In order to reveal the single nucleotide polymorphisms (SNPs), genotypes and allelic frequencies of each mutation site of TLR7 gene in Chinese native duck breeds, SNPs of duck TLR7 gene were detected by DNA sequencing. The genotypes of 465 native ducks from eight key protected duck breeds were determined by ...

  19. Detection of new single nucleotide polymorphisms by means of real ...

    Indian Academy of Sciences (India)

    Unknown

    amplified millions to billions of times by means of a PCR before the PCR product ... Keywords. Single nucleotide polymorphism; real time PCR; DNA melting curve analysis. ... VAL158MET SNP and alcoholism and to test for interac- tions between the .... indicate a heterozygote sample (VAL/MET genotype). The curve with ...

  20. Involvement of cyclic nucleotides in locust flight muscle metabolism

    NARCIS (Netherlands)

    Worm, R.A.A.

    1980-01-01

    1. Flight had no significant effect on the levels of c-AMP of c-GMP in the flight muscles of Locusta migratoria. 2. Injections of 0.01 or 0.1 corpus cardiacum equivalents into the abdominal cavity did not elicit any effect on cyclic nucleotide levels either. 3. Injection of A23187 resulted in

  1. Analysis of single nucleotide polymorphisms in case-control studies.

    Science.gov (United States)

    Li, Yonghong; Shiffman, Dov; Oberbauer, Rainer

    2011-01-01

    Single nucleotide polymorphisms (SNPs) are the most common type of genetic variants in the human genome. SNPs are known to modify susceptibility to complex diseases. We describe and discuss methods used to identify SNPs associated with disease in case-control studies. An outline on study population selection, sample collection and genotyping platforms is presented, complemented by SNP selection, data preprocessing and analysis.

  2. Subpicosecond Dynamics in Nucleotides Measured by Spontaneous Raman Spectroscopy

    NARCIS (Netherlands)

    Terpstra, P.A.; Terpstra, P.A.; Otto, Cornelis; Greve, Jan

    1997-01-01

    The band widths in Raman spectra are sensitive to dynamics active on a time scale from 0.1 to 10 ps. The band widths of nucleotide vibrations and their dependence on temperature, concentration, and structure are reported. From the experimental band widths and second moments, it is derived that the

  3. Nucleotide excision repair II: From yeast to mammals

    NARCIS (Netherlands)

    J.H.J. Hoeijmakers (Jan)

    1993-01-01

    textabstractAn intricate network of repair systems safeguards the integrity of genetic material, by eliminating DNA lesions induced by numerous environmental and endogenous genotoxic agents. Nucleotide excision repair (NER) is one of the most versatile DNA repair systems. Deficiencies in this

  4. Nucleotide excision repair I: from E.coli to yeast.

    NARCIS (Netherlands)

    J.H.J. Hoeijmakers (Jan)

    1993-01-01

    textabstractGenetic information is constantly deteriorating, mainly as a consequence of the action of numerous genotoxic agents. In order to cope with this fundamental problem, all living organisms have acquired a complex network of DNA repair systems to safeguard their genetic integrity. Nucleotide

  5. Characterization of single nucleotide polymorphism markers for eelgrass (Zostera marina)

    NARCIS (Netherlands)

    Ferber, Steven; Reusch, Thorsten B. H.; Stam, Wytze T.; Olsen, Jeanine L.

    We characterized 37 single nucleotide polymorphism (SNP) makers for eelgrass Zostera marina. SNP markers were developed using existing EST (expressed sequence tag)-libraries to locate polymorphic loci and develop primers from the functional expressed genes that are deposited in The ZOSTERA database

  6. DNA Nucleotides Detection via capacitance properties of Graphene

    Science.gov (United States)

    Khadempar, Nahid; Berahman, Masoud; Yazdanpanah, Arash

    2016-05-01

    In the present paper a new method is suggested to detect the DNA nucleotides on a first-principles calculation of the electronic features of DNA bases which chemisorbed to a graphene sheet placed between two gold electrodes in a contact-channel-contact system. The capacitance properties of graphene in the channel are surveyed using non-equilibrium Green's function coupled with the Density Functional Theory. Thus, the capacitance properties of graphene are theoretically investigated in a biological environment, and, using a novel method, the effect of the chemisorbed DNA nucleotides on electrical charges on the surface of graphene is deciphered. Several parameters in this method are also extracted including Electrostatic energy, Induced density, induced electrostatic potential, Electron difference potential and Electron difference density. The qualitative and quantitative differences among these parameters can be used to identify DNA nucleotides. Some of the advantages of this approach include its ease and high accuracy. What distinguishes the current research is that it is the first experiment to investigate the capacitance properties of gaphene changes in the biological environment and the effect of chemisorbed DNA nucleotides on the surface of graphene on the charge.

  7. Effects of Dietary Nucleotides on Growth Rate and Disease ...

    African Journals Online (AJOL)

    Effects of dietary nucleotides on growth and disease resistance of crustaceans were evaluated using axenic Artemia culture tests. Higher Artemia growth in xenic culture (15.6 ± 2.9 mm) than in axenic culture (9.2 ± 1.9 mm) reaffirmed the need to eliminate microbial populations known to influence growth and disease ...

  8. Adiponectin Single Nucleotide Polymorphism (+276G/T) and Its ...

    African Journals Online (AJOL)

    The present study was investigating the association between the single nucleotide polymorphism +276 G/T of the adiponectin gene with serum adiponectin level in patients with coronary artery disease (CAD). In this study 100 healthy controls and 100 Egyptian patients with coronary artery disease of both genders ...

  9. The nucleotide sequences of two leghemoglobin genes from soybean

    DEFF Research Database (Denmark)

    Wiborg, O; Hyldig-Nielsen, J J; Jensen, E O

    1982-01-01

    We present the complete nucleotide sequences of two leghemoglobin genes isolated from soybean DNA. Both genes contain three intervening sequences in identical positions. Comparison of the coding sequences with known amino-acid sequences of soybean leghemoglobins suggest that the two genes...

  10. Single nucleotide polymorphisms in the 5'-flanking region of the ...

    African Journals Online (AJOL)

    Prolactin (PRL), a polypeptide hormone synthesized and secreted by the animal's anterior pituitary gland, plays an important role in the regulation of mammalian lactation and avian reproduction. Considering the significant association between single nucleotide polymorphisms (SNPs) in the 5'-flanking region of PRL and ...

  11. Effects of Dietary Nucleotides on Growth Rate and Disease ...

    African Journals Online (AJOL)

    Nucleotides are low molecular weight biological compounds, which are ... nutrition and disease aspects of crustaceans (Overton and Bland 1981 .... additives on growth and disease resistance. Effects of ... metabolically active cells during stressful conditions ... in humans supplemented with Uracyl, which resulted in optimal ...

  12. Phenolic Amides Are Potent Inhibitors of De Novo Nucleotide Biosynthesis.

    Science.gov (United States)

    Pisithkul, Tippapha; Jacobson, Tyler B; O'Brien, Thomas J; Stevenson, David M; Amador-Noguez, Daniel

    2015-09-01

    An outstanding challenge toward efficient production of biofuels and value-added chemicals from plant biomass is the impact that lignocellulose-derived inhibitors have on microbial fermentations. Elucidating the mechanisms that underlie their toxicity is critical for developing strategies to overcome them. Here, using Escherichia coli as a model system, we investigated the metabolic effects and toxicity mechanisms of feruloyl amide and coumaroyl amide, the predominant phenolic compounds in ammonia-pretreated biomass hydrolysates. Using metabolomics, isotope tracers, and biochemical assays, we showed that these two phenolic amides act as potent and fast-acting inhibitors of purine and pyrimidine biosynthetic pathways. Feruloyl or coumaroyl amide exposure leads to (i) a rapid buildup of 5-phosphoribosyl-1-pyrophosphate (PRPP), a key precursor in nucleotide biosynthesis, (ii) a rapid decrease in the levels of pyrimidine biosynthetic intermediates, and (iii) a long-term generalized decrease in nucleotide and deoxynucleotide levels. Tracer experiments using (13)C-labeled sugars and [(15)N]ammonia demonstrated that carbon and nitrogen fluxes into nucleotides and deoxynucleotides are inhibited by these phenolic amides. We found that these effects are mediated via direct inhibition of glutamine amidotransferases that participate in nucleotide biosynthetic pathways. In particular, feruloyl amide is a competitive inhibitor of glutamine PRPP amidotransferase (PurF), which catalyzes the first committed step in de novo purine biosynthesis. Finally, external nucleoside supplementation prevents phenolic amide-mediated growth inhibition by allowing nucleotide biosynthesis via salvage pathways. The results presented here will help in the development of strategies to overcome toxicity of phenolic compounds and facilitate engineering of more efficient microbial producers of biofuels and chemicals. Copyright © 2015, Pisithkul et al.

  13. Phenolic Amides Are Potent Inhibitors of De Novo Nucleotide Biosynthesis

    Science.gov (United States)

    Pisithkul, Tippapha; Jacobson, Tyler B.; O'Brien, Thomas J.; Stevenson, David M.

    2015-01-01

    An outstanding challenge toward efficient production of biofuels and value-added chemicals from plant biomass is the impact that lignocellulose-derived inhibitors have on microbial fermentations. Elucidating the mechanisms that underlie their toxicity is critical for developing strategies to overcome them. Here, using Escherichia coli as a model system, we investigated the metabolic effects and toxicity mechanisms of feruloyl amide and coumaroyl amide, the predominant phenolic compounds in ammonia-pretreated biomass hydrolysates. Using metabolomics, isotope tracers, and biochemical assays, we showed that these two phenolic amides act as potent and fast-acting inhibitors of purine and pyrimidine biosynthetic pathways. Feruloyl or coumaroyl amide exposure leads to (i) a rapid buildup of 5-phosphoribosyl-1-pyrophosphate (PRPP), a key precursor in nucleotide biosynthesis, (ii) a rapid decrease in the levels of pyrimidine biosynthetic intermediates, and (iii) a long-term generalized decrease in nucleotide and deoxynucleotide levels. Tracer experiments using 13C-labeled sugars and [15N]ammonia demonstrated that carbon and nitrogen fluxes into nucleotides and deoxynucleotides are inhibited by these phenolic amides. We found that these effects are mediated via direct inhibition of glutamine amidotransferases that participate in nucleotide biosynthetic pathways. In particular, feruloyl amide is a competitive inhibitor of glutamine PRPP amidotransferase (PurF), which catalyzes the first committed step in de novo purine biosynthesis. Finally, external nucleoside supplementation prevents phenolic amide-mediated growth inhibition by allowing nucleotide biosynthesis via salvage pathways. The results presented here will help in the development of strategies to overcome toxicity of phenolic compounds and facilitate engineering of more efficient microbial producers of biofuels and chemicals. PMID:26070680

  14. Effect of Cytosine Arabinoside, 3-Aminobenzamide and Hydroxyurea on the frequencies of radiation-induced micronuclei and aneuploidy in human lymphocytes

    International Nuclear Information System (INIS)

    Cho, Yoon Hee; Kim, Yang Jee; Ha, Sung Whan; Chung, Hai Won; Kang, Chang Mo

    2005-01-01

    This study was carried out to examine the effect of the DNA repair inhibitors, Cytosine Arabinoside(Ara C), 3-Aminobenzamide(3AB) and Hydroxyurea(HU) on the frequencies of radiation-induced MicroNuclei(MNi) and aneuploidy. Irradiated lymphocytes(1-3Gy) were treated with DNA repair inhibitors, Ara C, 3AB and HU for 3 hours and CBMN assay - FISH technique with DNA probe for chromosome 1 and 4 was performed. The frequencies of x-ray induced MNi and aneuploidy of chromosome 1 and 4 were increased in a dose-dependent manner. Ara C, 3AB and HU enhanced the frequencies of radiation-induced MNi and the frequencies of radiation-induced aneuploidy of chromosome 1 and 4 were enhanced by HU and Ara C while no effect was observed by 3AB. The frequency of radiation-induced aneuploidy of chromosome 1 was higher than that of chromosome 4. These results suggest that there are different mechanisms involved in the formation of MNi and aneuploidy by radiation

  15. Effect of Cytosine Arabinoside, 3-Aminobenzamide and Hydroxyurea on the frequencies of radiation-induced micronuclei and aneuploidy in human lymphocytes

    Energy Technology Data Exchange (ETDEWEB)

    Cho, Yoon Hee; Kim, Yang Jee; Ha, Sung Whan; Chung, Hai Won [Seoul National Univ., Seoul (Korea, Republic of); Kang, Chang Mo [Korea Institute of Radiological and Medical Sciences, Seoul (Korea, Republic of)

    2005-12-15

    This study was carried out to examine the effect of the DNA repair inhibitors, Cytosine Arabinoside(Ara C), 3-Aminobenzamide(3AB) and Hydroxyurea(HU) on the frequencies of radiation-induced MicroNuclei(MNi) and aneuploidy. Irradiated lymphocytes(1-3Gy) were treated with DNA repair inhibitors, Ara C, 3AB and HU for 3 hours and CBMN assay - FISH technique with DNA probe for chromosome 1 and 4 was performed. The frequencies of x-ray induced MNi and aneuploidy of chromosome 1 and 4 were increased in a dose-dependent manner. Ara C, 3AB and HU enhanced the frequencies of radiation-induced MNi and the frequencies of radiation-induced aneuploidy of chromosome 1 and 4 were enhanced by HU and Ara C while no effect was observed by 3AB. The frequency of radiation-induced aneuploidy of chromosome 1 was higher than that of chromosome 4. These results suggest that there are different mechanisms involved in the formation of MNi and aneuploidy by radiation.

  16. Solvent effect on the intermolecular proton transfer of the Watson and Crick guanine-cytosine and adenine-thymine base pairs: a polarizable continuum model study.

    Science.gov (United States)

    Romero, Eduardo E; Hernandez, Florencio E

    2018-01-03

    Herein we present our results on the study of the double proton transfer (DPT) mechanism in the adenine-thymine (AT) and guanine-cytosine (GC) base pairs, both in gas phase and in solution. The latter was modeled using the polarizable continuum method (PCM) in different solvents. According to our DFT calculations, the DPT may occur for both complexes in a stepwise mechanism in condensate phase. In gas phase only the GC base pair exhibits a concerted DPT mechanism. Using the Wigner's tunneling corrections to the transition state theory we demonstrate that such corrections are important for the prediction of the rate constants of both systems in gas and in condensate phase. We also show that (i) as the polarity of the medium decreases the equilibrium constant of the DPT reaction increases in both complexes, and (ii) that the equilibrium constant in the GC complex is four orders of magnitude larger than in AT. This observation suggests that the spontaneous mutations in DNA base pairs are more probable in GC than in AT.

  17. The influence of anharmonic and solvent effects on the theoretical vibrational spectra of the guanine-cytosine base pairs in Watson-Crick and Hoogsteen configurations.

    Science.gov (United States)

    Bende, Attila; Muntean, Cristina M

    2014-03-01

    The theoretical IR and Raman spectra of the guanine-cytosine DNA base pairs in Watson-Crick and Hoogsteen configurations were computed using DFT method with M06-2X meta-hybrid GGA exchange-correlation functional, including the anharmonic corrections and solvent effects. The results for harmonic frequencies and their anharmonic corrections were compared with our previously calculated values obtained with the B3PW91 hybrid GGA functional. Significant differences were obtained for the anharmonic corrections calculated with the two different DFT functionals, especially for the stretching modes, while the corresponding harmonic frequencies did not differ considerable. For the Hoogtseen case the H⁺ vibration between the G-C base pair can be characterized as an asymmetric Duffing oscillator and therefore unrealistic anharmonic corrections for normal modes where this proton vibration is involved have been obtained. The spectral modification due to the anharmonic corrections, solvent effects and the influence of sugar-phosphate group for the Watson-Crick and Hoogsteen base pair configurations, respectively, were also discussed. For the Watson-Crick case also the influence of the stacking interaction on the theoretical IR and Raman spectra was analyzed. Including the anharmonic correction in our normal mode analysis is essential if one wants to obtain correct assignments of the theoretical frequency values as compared with the experimental spectra.

  18. Selective in vivo radiosensitization by 5-fluorocytosine of human colorectal carcinoma cells transduced with the E. coli cytosine deaminase (CD) gene

    International Nuclear Information System (INIS)

    Gabel, M.; Kim, J.H.; Kolozsvary, A.; Khil, M.; Freytag, S.

    1998-01-01

    Purpose: The E. coli cytosine deaminase (CD) gene encodes an enzyme capable of converting the nontoxic prodrug 5-fluorocytosine (5-FC) to 5-fluorouracil (5-FU), a known radiosensitizer. Having previously shown that combined CD suicide gene therapy and radiation (RT) results in pronounced radiosensitization in vitro, we progressed to in vivo studies of combined therapy. Methods and Materials: WiDr human colon cancer cells were transduced in vitro with the CD gene and cells expressing CD were selected for use as xenografts in a nude mouse model. After administration of 5-FC, tumors received 10-30 Gy local field radiation (RT) and tumor growth delay was compared to control animals receiving either 5-FU, 5-FC, or RT alone. Results: Maximal growth delay was seen in mice treated with 5-FC for 6 consecutive days prior to RT. Combined treatment with 15 Gy radiation resulted in a dose-modifying factor (DMF) of 1.50, and a greater DMF was observed with higher doses of radiation. There was no appreciable toxicity using this new approach. In contrast, a similar treatment of combined 5-FU and radiation resulted in considerable toxicity and no appreciable radiosensitization. Conclusion: The present results show that combined suicide gene therapy and RT results in pronounced antitumor effect without any notable toxicity. This indicates that the CD gene may be useful in the development of novel treatment strategies combining radiation and gene therapy in the treatment of locally advanced cancers

  19. 4-Amino-3H-pyrimidin-2-one ('isocytosine') is a short-lived non-radical intermediate formed in the pulse radiolysis of cytosine in aqueous solution

    International Nuclear Information System (INIS)

    Nien Schuchmann, Man; Naumov, Sergej; Schuchmann, Heinz-Peter; Sonntag, Justus von; Sonntag, Clemens von

    2005-01-01

    In the pulse radiolysis of 2'-deoxycytidine (dCyd) in N 2 O-saturated solutions containing 0.5M tertiary butanol to completely scavenge the water radicals, a short-lived intermediate (λmax=287nm) is observed by UV spectroscopy which is attributed to dCydH + , generated in the reaction of dCyd with H + formed during the pulse. By reacting with OH - , which is formed in the pulse in amounts matching that of H + , this intermediate disappears in the μs time range without a change of the spectrum. Similarly, cytosine (Cyt) gives rise to CytH + which, in contrast, in part transforms into another species (λmax=286nm) which can be assigned to isocytosine 1, 4-amino-3H-pyrimidin-2-one, a tautomer of Cyt which is formed by two routes (i) deprotonation of CytH + at N(1) by OH - and (ii) deprotonation of Cyt and reprotonation of the Cyt anion by water at N(3). Compared to Cyt, 1 is richer in Gibbs' free enthalpy by 14kJmol -1 . Its presence in low equilibrium concentrations has also been observed by conventional UV spectroscopy, making use of the increase of its equilibrium concentration with increasing temperature. From these data, an absorption coefficient of 3.3x10 4 dm 3 mol -1 cm -1 at 286nm has been calculated. Supporting quantum chemical calculations are also reported

  20. Polysomnographic and neurometabolic features may mark preclinical autosomal dominant cerebellar ataxia, deafness, and narcolepsy due to a mutation in the DNA (cytosine-5-)-methyltransferase gene, DNMT1.

    Science.gov (United States)

    Moghadam, Keivan Kaveh; Pizza, Fabio; Tonon, Caterina; Lodi, Raffaele; Carelli, Valerio; Poli, Francesca; Franceschini, Christian; Barboni, Piero; Seri, Marco; Ferrari, Simona; La Morgia, Chiara; Testa, Claudia; Cornelio, Ferdinando; Liguori, Rocco; Winkelmann, Juliane; Lin, Ling; Mignot, Emmanuel; Plazzi, Giuseppe

    2014-05-01

    We aimed to report the clinical picture of two asymptomatic daughters of a patient with autosomal dominant cerebellar ataxia, deafness, and narcolepsy (ADCA-DN) due to a mutation in the DNA (cytosine-5-)-methyltransferase gene, DNMT1. Clinical assessment based on history, neurologic examination, sleep recordings, neurophysiologic neuroimaging, and genetic tests was performed. History and neurologic examination in both subjects were unremarkable. Genetic analysis disclosed in both the paternally-inherited heterozygous point mutation in the DNMT1 gene. Sleep recordings found sleep-onset rapid eye movement periods (SOREMPs) and proton magnetic resonance spectroscopy (MRS) revealed increased cerebellar myoinositol (mI) in both subjects. Auditory and ophthalmologic investigations as well as structural brain magnetic resonance imaging (MRI) scans revealed no abnormalities. The two asymptomatic carriers of the heterozygous DNMT1 mutation for ADCA-DN, a late-onset neurodegenerative disease, presented with SOREMPs associated with an increase of mI in the brain, a marker of glial cell activity and density characteristic of early stages of neurodegenerative diseases. Therefore, SOREMPs may precede the clinical picture of ADCA-DN as an early polysomnographic marker of central nervous system involvement detected by MRS. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. Silver(I)-Mediated Base Pairs in DNA Sequences Containing 7-Deazaguanine/Cytosine: towards DNA with Entirely Metallated Watson-Crick Base Pairs.

    Science.gov (United States)

    Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A

    2018-03-26

    DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Methylation by a unique α-class N4-cytosine methyltransferase is required for DNA transformation of Caldicellulosiruptor bescii DSM6725.

    Directory of Open Access Journals (Sweden)

    Daehwan Chung

    Full Text Available Thermophilic microorganisms capable of using complex substrates offer special advantages for the conversion of lignocellulosic biomass to biofuels and bioproducts. Members of the gram-positive bacterial genus Caldicellulosiruptor are anaerobic thermophiles with optimum growth temperatures between 65°C and 78°C and are the most thermophilic cellulolytic organisms known. In fact, they efficiently use biomass non-pretreated as their sole carbon source and in successive rounds of application digest 70% of total switchgrass substrate. The ability to genetically manipulate these organisms is a prerequisite to engineering them for use in conversion of these complex substrates to products of interest as well as identifying gene products critical for their ability to utilize non-pretreated biomass. Here, we report the first example of DNA transformation of a member of this genus, C. bescii. We show that restriction of DNA is a major barrier to transformation (in this case apparently absolute and that methylation with an endogenous unique α-class N4-Cytosine methyltransferase is required for transformation of DNA isolated from E. coli. The use of modified DNA leads to the development of an efficient and reproducible method for DNA transformation and the combined frequencies of transformation and recombination allow marker replacement between non-replicating plasmids and chromosomal genes providing the basis for rapid and efficient methods of genetic manipulation.

  3. Preparation of protected nucleotides usable in oligonucleotide synthesis

    International Nuclear Information System (INIS)

    Debiard, Jean-Pascal

    1983-01-01

    After having presented the components of DNA, the author of this research thesis outlines that, when dealing the chemical synthesis, the respect of the sequence of these components is the main problem as each nucleotide possesses several functions which may react with each other. In order to solve this problem, functional protection is used to protect functions which may react in an undesirable way and to let free those which participate to the desired reaction. But a selective protector group must be used and this group must remain stable during the operations it is not involved in. Therefore, its elimination will be easy and without any risk of deterioration of the synthesised molecule. This research thesis first addresses the various available techniques to perform these steps, and then reports the study of possible applications of synthetic nucleotides in the field of genetic engineering [fr

  4. Identification of cyclic nucleotide gated channels using regular expressions

    KAUST Repository

    Zelman, Alice K.

    2013-09-03

    Cyclic nucleotide-gated channels (CNGCs) are nonselective cation channels found in plants, animals, and some bacteria. They have a six-transmembrane/one- pore structure, a cytosolic cyclic nucleotide-binding domain, and a cytosolic calmodulin-binding domain. Despite their functional similarities, the plant CNGC family members appear to have different conserved amino acid motifs within corresponding functional domains than animal and bacterial CNGCs do. Here we describe the development and application of methods employing plant CNGC-specific sequence motifs as diagnostic tools to identify novel candidate channels in different plants. These methods are used to evaluate the validity of annotations of putative orthologs of CNGCs from plant genomes. The methods detail how to employ regular expressions of conserved amino acids in functional domains of annotated CNGCs and together with Web tools such as PHI-BLAST and ScanProsite to identify novel candidate CNGCs in species including Physcomitrella patens. © Springer Science+Business Media New York 2013.

  5. Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

    International Nuclear Information System (INIS)

    Lo, A.; Yang, H.L.

    1990-01-01

    This patent describes a composition of matter that is specific for Neisseria gonorrhoeae. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of Neisseria gonorrhoeae to the amount of the sequence which hybridizes to chromosomal DNA of Neisseria meningitidis is greater than about five. The ratio being obtained by a method described

  6. Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

    Energy Technology Data Exchange (ETDEWEB)

    Lo, A.; Yang, H.L.

    1990-02-13

    This patent describes a composition of matter that is specific for {ital Neisseria gonorrhoeae}. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria gonorrhoeae} to the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria meningitidis} is greater than about five. The ratio being obtained by a method described.

  7. Statistical properties of nucleotides in human chromosomes 21 and 22

    International Nuclear Information System (INIS)

    Zhang Linxi; Sun Tingting

    2005-01-01

    In this paper the statistical properties of nucleotides in human chromosomes 21 and 22 are investigated. The n-tuple Zipf analysis with n = 3, 4, 5, 6, and 7 is used in our investigation. It is found that the most common n-tuples are those which consist only of adenine (A) and thymine (T), and the rarest n-tuples are those in which GC or CG pattern appears twice. With the n-tuples become more and more frequent, the double GC or CG pattern becomes a single GC or CG pattern. The percentage of four nucleotides in the rarest ten and the most common ten n-tuples are also considered in human chromosomes 21 and 22, and different behaviors are found in the percentage of four nucleotides. Frequency of appearance of n-tuple f(r) as a function of rank r is also examined. We find the n-tuple Zipf plot shows a power-law behavior for r n-1 and a rapid decrease for r > 4 n-1 . In order to explore the interior statistical properties of human chromosomes 21 and 22 in detail, we divide the chromosome sequence into some moving windows and we discuss the percentage of ξη (ξ, η = A, C, G, T) pair in those moving windows. In some particular regions, there are some obvious changes in the percentage of ξη pair, and there maybe exist functional differences. The normalized number of repeats N 0 (l) can be described by a power law: N 0 (l) ∼ l -μ . The distance distributions P 0 (S) between two nucleotides in human chromosomes 21 and 22 are also discussed. A two-order polynomial fit exists in those distance distributions: log P 0 (S) = a + bS + cS 2 , and it is quite different from the random sequence

  8. Mitochondria as determinant of nucleotide pools and chromosomal stability

    DEFF Research Database (Denmark)

    Madsen, Claus Desler; Munch-Petersen, Birgitte; Stevnsner, Tinna

    2007-01-01

    Mitochondrial function plays an important role in multiple human diseases and mutations in the mitochondrial genome have been detected in nearly every type of cancer investigated to date. However, the mechanism underlying the interrelation is unknown. We used human cell lines depleted of mitochon...... mitochondrial activity. Our results suggest that mitochondria are central players in maintaining genomic stability and in controlling essential nuclear processes such as upholding a balanced supply of nucleotides....

  9. Prediction of Nucleotide Binding Peptides Using Star Graph Topological Indices.

    Science.gov (United States)

    Liu, Yong; Munteanu, Cristian R; Fernández Blanco, Enrique; Tan, Zhiliang; Santos Del Riego, Antonino; Pazos, Alejandro

    2015-11-01

    The nucleotide binding proteins are involved in many important cellular processes, such as transmission of genetic information or energy transfer and storage. Therefore, the screening of new peptides for this biological function is an important research topic. The current study proposes a mixed methodology to obtain the first classification model that is able to predict new nucleotide binding peptides, using only the amino acid sequence. Thus, the methodology uses a Star graph molecular descriptor of the peptide sequences and the Machine Learning technique for the best classifier. The best model represents a Random Forest classifier based on two features of the embedded and non-embedded graphs. The performance of the model is excellent, considering similar models in the field, with an Area Under the Receiver Operating Characteristic Curve (AUROC) value of 0.938 and true positive rate (TPR) of 0.886 (test subset). The prediction of new nucleotide binding peptides with this model could be useful for drug target studies in drug development. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Nucleotide sequence of tomato ringspot virus RNA-2.

    Science.gov (United States)

    Rott, M E; Tremaine, J H; Rochon, D M

    1991-07-01

    The sequence of tomato ringspot virus (TomRSV) RNA-2 has been determined. It is 7273 nucleotides in length excluding the 3' poly(A) tail and contains a single long open reading frame (ORF) of 5646 nucleotides in the positive sense beginning at position 78 and terminating at position 5723. A second in-frame AUG at position 441 is in a more favourable context for initiation of translation and may act as a site for initiation of translation. The TomRSV RNA-2 3' noncoding region is 1550 nucleotides in length. The coat protein is located in the C-terminal region of the large polypeptide and shows significant but limited amino acid sequence similarity to the putative coat proteins of the nepoviruses tomato black ring (TBRV), Hungarian grapevine chrome mosaic (GCMV) and grapevine fanleaf (GFLV). Comparisons of the coding and non-coding regions of TomRSV RNA-2 and the RNA components of TBRV, GCMV, GFLV and the comovirus cowpea mosaic virus revealed significant similarity for over 300 amino acids between the coding region immediately to the N-terminal side of the putative coat proteins of TomRSV and GFLV; very little similarity could be detected among the non-coding regions of TomRSV and any of these viruses.

  11. Scambio, a novel guanine nucleotide exchange factor for Rho

    Directory of Open Access Journals (Sweden)

    Groffen John

    2004-04-01

    Full Text Available Abstract Background Small GTPases of the Rho family are critical regulators of various cellular functions including actin cytoskeleton organization, activation of kinase cascades and mitogenesis. For this reason, a major objective has been to understand the mechanisms of Rho GTPase regulation. Here, we examine the function of a novel protein, Scambio, which shares homology with the DH-PH domains of several known guanine nucleotide exchange factors for Rho family members. Results Scambio is located on human chromosome 14q11.1, encodes a protein of around 181 kDa, and is highly expressed in both heart and skeletal muscle. In contrast to most DH-PH-domain containing proteins, it binds the activated, GTP-bound forms of Rac and Cdc42. However, it fails to associate with V14RhoA. Immunofluorescence studies indicate that Scambio and activated Rac3 colocalize in membrane ruffles at the cell periphery. In accordance with these findings, Scambio does not activate either Rac or Cdc42 but rather, stimulates guanine nucleotide exchange on RhoA and its close relative, RhoC. Conclusion Scambio associates with Rac in its activated conformation and functions as a guanine nucleotide exchange factor for Rho.

  12. The Role of Cyclic Nucleotide Signaling Pathways in Cancer: Targets for Prevention and Treatment

    Energy Technology Data Exchange (ETDEWEB)

    Fajardo, Alexandra M.; Piazza, Gary A. [Drug Discovery Research Center, Mitchell Cancer Institute, University of South Alabama, 1660 Springhill Ave, Suite 3029, Mobile, AL 36604 (United States); Tinsley, Heather N., E-mail: htinsley@montevallo.edu [Department of Biology, Chemistry, and Mathematics, University of Montevallo, Station 6480, Montevallo, AL 35115 (United States)

    2014-02-26

    For more than four decades, the cyclic nucleotides cyclic AMP (cAMP) and cyclic GMP (cGMP) have been recognized as important signaling molecules within cells. Under normal physiological conditions, cyclic nucleotides regulate a myriad of biological processes such as cell growth and adhesion, energy homeostasis, neuronal signaling, and muscle relaxation. In addition, altered cyclic nucleotide signaling has been observed in a number of pathophysiological conditions, including cancer. While the distinct molecular alterations responsible for these effects vary depending on the specific cancer type, several studies have demonstrated that activation of cyclic nucleotide signaling through one of three mechanisms—induction of cyclic nucleotide synthesis, inhibition of cyclic nucleotide degradation, or activation of cyclic nucleotide receptors—is sufficient to inhibit proliferation and activate apoptosis in many types of cancer cells. These findings suggest that targeting cyclic nucleotide signaling can provide a strategy for the discovery of novel agents for the prevention and/or treatment of selected cancers.

  13. New insights in the removal of the hydantoins, oxidation product of pyrimidines, via the base excision and nucleotide incision repair pathways.

    Directory of Open Access Journals (Sweden)

    Modesto Redrejo-Rodríguez

    Full Text Available BACKGROUND: Oxidative damage to DNA, if not repaired, can be both miscoding and blocking. These genetic alterations can lead to mutations and/or cell death, which in turn cause cancer and aging. Oxidized DNA bases are substrates for two overlapping repair pathways: base excision (BER and nucleotide incision repair (NIR. Hydantoin derivatives such as 5-hydroxyhydantoin (5OH-Hyd and 5-methyl-5-hydroxyhydantoin (5OH-5Me-Hyd, major products of cytosine and thymine oxidative degradation pathways, respectively, have been detected in cancer cells and ancient DNA. Hydantoins are blocking lesions for DNA polymerases and excised by bacterial and yeast DNA glycosylases in the BER pathway. However little is known about repair of pyrimidine-derived hydantoins in human cells. METHODOLOGY/PRINCIPAL FINDINGS: Here, using both denaturing PAGE and MALDI-TOF MS analyses we report that the bacterial, yeast and human AP endonucleases can incise duplex DNA 5' next to 5OH-Hyd and 5OH-5Me-Hyd thus initiating the NIR pathway. We have fully reconstituted the NIR pathway for these lesions in vitro using purified human proteins. Depletion of Nfo in E. coli and APE1 in HeLa cells abolishes the NIR activity in cell-free extracts. Importantly, a number of redundant DNA glycosylase activities can excise hydantoin residues, including human NTH1, NEIL1 and NEIL2 and the former protein being a major DNA glycosylase activity in HeLa cells extracts. CONCLUSIONS/SIGNIFICANCE: This study demonstrates that both BER and NIR pathways can compete and/or back-up each other to remove hydantoin DNA lesions in vivo.

  14. Immunostimulation by cytosine-phosphate-guanine oligodeoxynucleotides in combination with IL-2 can improve the success rate of karyotype analysis in chronic lymphocytic leukaemia.

    Science.gov (United States)

    Lin, Xiaolan; Chen, Jiadi; Huang, Huifang

    2016-07-01

    To assess whether immunostimulatory cytosine-phosphate-guanine oligodeoxynucleotides (CpG-ODN) combined with interleukin-2 (IL-2) improves the number of mitotic metaphases and the detection rate of chromosomal abnormalities in chronic lymphocytic leukaemia (CLL). Bone marrow specimens were collected from 36 patients with CLL. CLL cells were cultured with CpG-ODN type DSP30 plus IL-2 for 72 h, following which R-banding analysis was conducted. Conventional culture without the immunostimulant served as the control group. The incidence of genetic abnormalities was measured by fluorescence in situ hybridisation (FISH) using a panel of five specific probes: D13S25 (13q14.3), RB1 (13q14), P53 (17p13), ATM (11q22.3) and CSP12 (trisomy 12, +12). In the control group, chromosome analysis achieved a success rate of only 22.2, and 11.1% of abnormal karyotypes were detected. After immunostimulation with DSP30 plus IL-2, chromosome analysis achieved a success rate of up to 91.6, and 41.6% of abnormal karyotypes were detected. FISH analysis detected 77.7% of abnormalities. FISH combined with CpG-ODN DSP30 plus IL-2 improved the detection rate of chromosomal abnormalities in CLL to 83.3%. CpG-ODN DSP30 combined with IL-2 is effective in improving the detection rate of chromosomal abnormalities in CLL cells. This combination with FISH analysis is conducive to increasing the detection rate of genetic abnormalities in CLL.

  15. Influence of Hydration on Proton Transfer in the Guanine-Cytosine Radical Cation (G•+-C) Base Pair: A Density Functional Theory Study

    Science.gov (United States)

    Kumar, Anil; Sevilla, Michael D.

    2009-01-01

    On one-electron oxidation all molecules including DNA bases become more acidic in nature. For the GC base pair experiments suggest that a facile proton transfer takes place in the G•+-C base pair from N1 of G•+ to N3 of cytosine. This intra-base pair proton transfer reaction has been extensively considered using theoretical methods for the gas phase and it is predicted that the proton transfer is slightly unfavorable in disagreement with experiment. In the present study, we consider the effect of the first hydration layer on the proton transfer reaction in G•+-C by the use of density functional theory (DFT), B3LYP/6-31+G** calculations of the G•+-C base pair in the presence of 6 and 11 water molecules. Under the influence of hydration of 11 waters, a facile proton transfer from N1 of G•+ to N3 of C is predicted. The zero point energy (ZPE) corrected forward and backward energy barriers, for the proton transfer from N1 of G•+ to N3 of C, was found to be 1.4 and 2.6 kcal/mol, respectively. The proton transferred G•-(H+)C + 11H2O was found to be 1.2 kcal/mol more stable than G•+-C + 11H2O in agreement with experiment. The present calculation demonstrates that the inclusion of the first hydration shell around G•+-C base pair has an important effect on the internal proton transfer energetics. PMID:19485319

  16. Fluorescent strategy based on cationic conjugated polymer fluorescence resonance energy transfer for the quantification of 5-(hydroxymethyl)cytosine in genomic DNA.

    Science.gov (United States)

    Hong, Tingting; Wang, Tianlu; Guo, Pu; Xing, Xiwen; Ding, Fei; Chen, Yuqi; Wu, Jinjun; Ma, Jingwei; Wu, Fan; Zhou, Xiang

    2013-11-19

    DNA methylation is dynamically reprogrammed during early embryonic development in mammals. It can be explained partially by the discovery of 5-(hydroxymethyl)cytosine (5-hmC), 5-formylcytosine (5-fC), and 5-carboxylcytosine (5-caC), which are identified as key players involved in both active and passive demethylation pathways. As one of the ten-eleven translocation oxidation products, 5-hmC was found relatively abundant in neuron cells and embryonic stem cells. Herein we report a new method for 5-hmC quantification in genomic DNA based on CCP-FRET (cationic conjugated polymers act as the energy donor and induce fluorescence resonance energy transfer) assay combined with KRuO4 oxidation. 5-hmC in genomic DNA can be selectively transformed into 5-fC by the oxidation of KRuO4 and then labeled with hydroxylamine-BODIPY (BODIPY = 4,4-difluoro-4-bora-3a,4a-diaza-s-indacene) fluorophore through the reaction between 5-fC and hydroxylamine-BODIPY. After the fluorescently labeled DNA was captured by CCP through electrostatic interactions, a significant FRET between CCP and hydroxylamine-BODIPY fluorophore was observed. This CCP-FRET-based assay benefits from light-harvesting, large Stokes shift, and optical signal amplification properties of the CCP. Furthermore, this CCP-FRET-based assay was quite successfully demonstrated for the 5-hmC quantification in three types of cells (mESc, HeLa, HEK 293T), providing a much more convenient choice for 5-hmC quantification in genomic DNA.

  17. Complexes of Escherichia coli adenylate kinase and nucleotides: 1H NMR studies of the nucleotide sites in solution

    International Nuclear Information System (INIS)

    Vetter, I.R.; Reinstein, J.; Roesch, P.

    1990-01-01

    One- and two-dimensional nuclear magnetic resonance (NMR) studies, in particular substrate-protein nuclear Overhauser effect (NOESY) measurements, as well as nucleotide and P 1 ,P 5 -bis-(5'-adenosyl) pentaphosphate (AP 5 A) titrations and studies of the temperature-dependent unfolding of the tertiary structure of Escherichia coli adenylate kinase (AK EC ) were performed. These experiments and comparison with the same type of experiments performed with the porcine enzyme led them to the following conclusions: (1) at pH 8 and concentrations of approximately 2.5-3 mM, AK EC is partially unfolded at 318 K; (2) ATP·Mg 2+ binds to the ATP site with a dissociation constant of approximately 40 μM under the assumption that ATP binds to one nucleotide site only; (3) AP 5 A·Mg 2+ binds to both nucleotide sites and thus simulates the active complex; (4) the ATP·Mg 2+ adenine in the AK EC ·AP 5 A·Mg 2+ complex is located close to His 134 and Phe 19 ; (5) the AK EC G-loop with bound ATP·Mg 2+ is structurally highly homologous to the loop region in the oncogene product p21 with bound GTP·Mg 2+

  18. AVP-stimulated nucleotide secretion in perfused mouse medullary thick ascending limb and cortical collecting duct

    DEFF Research Database (Denmark)

    Odgaard, Elvin V. P.; Prætorius, Helle; Leipziger, Jens Georg

    2009-01-01

    is stimulated remain elusive. Here, we investigate the phenomenon of nucleotide secretion in intact, perfused mouse medullary thick ascending limb (mTAL) and cortical collecting duct (CCD). The nucleotide secretion was monitored by a biosensor adapted to register nucleotides in the tubular outflow...

  19. The Tomato Nucleotide-binding Leucine-rich Repeat Immune Receptor I-2 Couples DNA-binding to Nucleotide-binding Domain Nucleotide Exchange*

    Science.gov (United States)

    Fenyk, Stepan; Dixon, Christopher H.; Gittens, William H.; Townsend, Philip D.; Sharples, Gary J.; Pålsson, Lars-Olof; Takken, Frank L. W.; Cann, Martin J.

    2016-01-01

    Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable plants to recognize and respond to pathogen attack. Previously, we demonstrated that the Rx1 NLR of potato is able to bind and bend DNA in vitro. DNA binding in situ requires its genuine activation following pathogen perception. However, it is unknown whether other NLR proteins are also able to bind DNA. Nor is it known how DNA binding relates to the ATPase activity intrinsic to NLR switch function required to immune activation. Here we investigate these issues using a recombinant protein corresponding to the N-terminal coiled-coil and nucleotide-binding domain regions of the I-2 NLR of tomato. Wild type I-2 protein bound nucleic acids with a preference of ssDNA ≈ dsDNA > ssRNA, which is distinct from Rx1. I-2 induced bending and melting of DNA. Notably, ATP enhanced DNA binding relative to ADP in the wild type protein, the null P-loop mutant K207R, and the autoactive mutant S233F. DNA binding was found to activate the intrinsic ATPase activity of I-2. Because DNA binding by I-2 was decreased in the presence of ADP when compared with ATP, a cyclic mechanism emerges; activated ATP-associated I-2 binds to DNA, which enhances ATP hydrolysis, releasing ADP-bound I-2 from the DNA. Thus DNA binding is a general property of at least a subset of NLR proteins, and NLR activation is directly linked to its activity at DNA. PMID:26601946

  20. The Tomato Nucleotide-binding Leucine-rich Repeat Immune Receptor I-2 Couples DNA-binding to Nucleotide-binding Domain Nucleotide Exchange.

    Science.gov (United States)

    Fenyk, Stepan; Dixon, Christopher H; Gittens, William H; Townsend, Philip D; Sharples, Gary J; Pålsson, Lars-Olof; Takken, Frank L W; Cann, Martin J

    2016-01-15

    Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable plants to recognize and respond to pathogen attack. Previously, we demonstrated that the Rx1 NLR of potato is able to bind and bend DNA in vitro. DNA binding in situ requires its genuine activation following pathogen perception. However, it is unknown whether other NLR proteins are also able to bind DNA. Nor is it known how DNA binding relates to the ATPase activity intrinsic to NLR switch function required to immune activation. Here we investigate these issues using a recombinant protein corresponding to the N-terminal coiled-coil and nucleotide-binding domain regions of the I-2 NLR of tomato. Wild type I-2 protein bound nucleic acids with a preference of ssDNA ≈ dsDNA > ssRNA, which is distinct from Rx1. I-2 induced bending and melting of DNA. Notably, ATP enhanced DNA binding relative to ADP in the wild type protein, the null P-loop mutant K207R, and the autoactive mutant S233F. DNA binding was found to activate the intrinsic ATPase activity of I-2. Because DNA binding by I-2 was decreased in the presence of ADP when compared with ATP, a cyclic mechanism emerges; activated ATP-associated I-2 binds to DNA, which enhances ATP hydrolysis, releasing ADP-bound I-2 from the DNA. Thus DNA binding is a general property of at least a subset of NLR proteins, and NLR activation is directly linked to its activity at DNA. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  1. Microarray Beads for Identifying Blood Group Single Nucleotide Polymorphisms

    OpenAIRE

    Drago, Francesca; Karpasitou, Katerina; Poli, Francesca

    2009-01-01

    We have developed a high-throughput system for single nucleotide polymorphism (SNP) genotyping of alleles of diverse blood group systems exploiting Luminex technology. The method uses specific oligonucleotide probes coupled to a specific array of fluorescent microspheres and is designed for typing Jka/Jkb, Fya/Fyb, S/s, K/k, Kpa/Kpb, Jsa/Jsb, Coa/Cob and Lua/Lub alleles. Briefly, two multiplex PCR reactions (PCR I and PCR II) according to the laboratory specific needs are set up. PCR I amplif...

  2. Nucleotide sequence of the triosephosphate isomerase gene from Macaca mulatta

    Energy Technology Data Exchange (ETDEWEB)

    Old, S.E.; Mohrenweiser, H.W. (Univ. of Michigan, Ann Arbor (USA))

    1988-09-26

    The triosephosphate isomerase gene from a rhesus monkey, Macaca mulatta, charon 34 library was sequenced. The human and chimpanzee enzymes differ from the rhesus enzyme at ASN 20 and GLU 198. The nucleotide sequence identity between rhesus and human is 97% in the coding region and >94% in the flanking regions. Comparison of the rhesus and chimp genes, including the intron and flanking sequences, does not suggest a mechanism for generating the two TPI peptides of proliferating cells from hominoids and a single peptide from the rhesus gene.

  3. Single nucleotide polymorphism (SNP) detection on a magnetoresistive sensor

    DEFF Research Database (Denmark)

    Rizzi, Giovanni; Østerberg, Frederik Westergaard; Dufva, Martin

    2013-01-01

    We present a magnetoresistive sensor platform for hybridization assays and demonstrate its applicability on single nucleotide polymorphism (SNP) genotyping. The sensor relies on anisotropic magnetoresistance in a new geometry with a local negative reference and uses the magnetic field from...... the sensor bias current to magnetize magnetic beads in the vicinity of the sensor. The method allows for real-time measurements of the specific bead binding to the sensor surface during DNA hybridization and washing. Compared to other magnetic biosensing platforms, our approach eliminates the need...... for external electromagnets and thus allows for miniaturization of the sensor platform....

  4. Nucleotide Selectivity at a Preinsertion Checkpoint of T7 RNA Polymerase Transcription Elongation.

    Science.gov (United States)

    E, Chao; Duan, Baogen; Yu, Jin

    2017-04-20

    Nucleotide selection is crucial for transcription fidelity control, in particular, for viral T7 RNA polymerase (RNAP) lack of proofreading activity. It has been recognized that multiple kinetic checkpoints exist prior to full nucleotide incorporation. In this work, we implemented intensive atomistic molecular dynamics (MD) simulations to quantify how strong the nucleotide selection is at the initial checkpoint of an elongation cycle of T7 RNAP. The incoming nucleotides bind into a preinsertion site where a critical tyrosine residue locates nearby to assist the nucleotide selection. We calculated the relative binding free energy between a noncognate nucleotide and a cognate one at a preinsertion configuration via alchemical simulations, showing that a small selection free energy or the binding free energy difference (∼3 k B T) exists between the two nucleotides. Indeed, another preinsertion configuration favored by the noncognate nucleotides was identified, which appears to be off path for further nucleotide insertion and additionally assists the nucleotide selection. By chemical master equation (CME) approach, we show that the small selection free energy at the preinsertion site along with the off-path noncognate nucleotide filtering can help substantially to reduce the error rate and to maintain the elongation rate high in the T7 RNAP transcription.

  5. Kinetic mechanism and nucleotide specificity of NADH peroxidase

    International Nuclear Information System (INIS)

    Stoll, V.S.; Blanchard, J.S.

    1988-01-01

    NADH peroxidase is a flavoprotein isolated from Streptococcus faecalis which catalyzes the pyridine nucleotide-dependent reduction of hydrogen peroxide to water. Initial velocity, product, and dead-end inhibition studies have been performed at pH 7.5 and support a ping-pong kinetic mechanism. In the absence of hydrogen peroxide, both transhydrogenation between NADH and thioNAD, and isotope exchange between [ 14 C]NADH and NAD, have been demonstrated, although in both these experiments, the maximal velocity of nucleotide exchange was less than 1.5% the maximal velocity of the peroxidatic reaction. We propose that NADH binds tightly to both oxidized and two-electron reduced enzyme. NADH oxidation proceeds stereospecifically with the transfer of the 4S hydrogen to enzyme, and then, via exchange, to water. No primary tritium kinetic isotope effect was observed, and no statistically significant primary deuterium kinetic isotope effects on V/K were determined, although primary deuterium kinetic isotope effects on V were observed in the presence and absence of sodium acetate. NADH peroxidase thus shares with other flavoprotein reductases striking kinetic, spectroscopic, and stereochemical similarities. On this basis, we propose a chemical mechanism for the peroxide cleaving reaction catalyzed by NADH peroxidase which involves the obligate formation of a flavinperoxide, and peroxo bond cleavage by nucleophilic attack by enzymatic dithiols

  6. Single Nucleotide Polymorphism Analysis of Protamine Genes in Infertile Men

    Directory of Open Access Journals (Sweden)

    Ahamad Salamian

    2008-01-01

    Full Text Available Background: Single nucleotide polymorphism (SNPs are considered as one of the underlyingcauses of male infertility. Proper sperm chromatin packaging which involves replacement ofhistones with protamines has profound effect on male fertility. Over 20 SNPs have been reportedfor the protamine 1 and 2.Materials and Methods: The aim of this study was to evaluate the frequency of two previouslyreported SNPs using polymerase chain reaction (PCR-restriction fragment length polymorphism(RFLP approach in 35, 96 and 177 normal, oligozoospermic and azoospermic individuals. TheseSNPs are: 1. A base pair substitution (G at position 197 instead of T in protamine type 1 Openreading frame (ORF including untranslated region, which causes an Arg residue change to Serresidue in a highly conserved region. 2. cytidine nucleotide change to thymidine in position of 248of protamine type 2 ORF which caused a nonsense point mutation.Results: The two mentioned SNPs were not present in the studied population, thus concluding thatthese SNPs can not serves as molecular markers for male infertility diagnosis.Conclusion: The results of our study reveal that in a selected Iranian population, the SNP G197Tand C248T are completely absent and are not associated with male infertility and therefore theseSNPs may not represent a molecular marker for genetic diagnosis of male infertility.

  7. Retinal Cyclic Nucleotide-Gated Channels: From Pathophysiology to Therapy

    Directory of Open Access Journals (Sweden)

    Stylianos Michalakis

    2018-03-01

    Full Text Available The first step in vision is the absorption of photons by the photopigments in cone and rod photoreceptors. After initial amplification within the phototransduction cascade the signal is translated into an electrical signal by the action of cyclic nucleotide-gated (CNG channels. CNG channels are ligand-gated ion channels that are activated by the binding of cyclic guanosine monophosphate (cGMP or cyclic adenosine monophosphate (cAMP. Retinal CNG channels transduce changes in intracellular concentrations of cGMP into changes of the membrane potential and the Ca2+ concentration. Structurally, the CNG channels belong to the superfamily of pore-loop cation channels and share a common gross structure with hyperpolarization-activated cyclic nucleotide-gated (HCN channels and voltage-gated potassium channels (KCN. In this review, we provide an overview on the molecular properties of CNG channels and describe their physiological role in the phototransduction pathways. We also discuss insights into the pathophysiological role of CNG channel proteins that have emerged from the analysis of CNG channel-deficient animal models and human CNG channelopathies. Finally, we summarize recent gene therapy activities and provide an outlook for future clinical application.

  8. Cyclic Nucleotide Monophosphates and Their Cyclases in Plant Signaling

    KAUST Repository

    Gehring, Christoph A.

    2017-10-04

    The cyclic nucleotide monophosphates (cNMPs), and notably 3′,5′-cyclic guanosine monophosphate (cGMP) and 3′,5′-cyclic adenosine monophosphate (cAMP) are now accepted as key signaling molecules in many processes in plants including growth and differentiation, photosynthesis, and biotic and abiotic defense. At the single molecule level, we are now beginning to understand how cNMPs modify specific target molecules such as cyclic nucleotide-gated channels, while at the systems level, a recent study of the Arabidopsis cNMP interactome has identified novel target molecules with specific cNMP-binding domains. A major advance came with the discovery and characterization of a steadily increasing number of guanylate cyclases (GCs) and adenylate cyclases (ACs). Several of the GCs are receptor kinases and include the brassinosteroid receptor, the phytosulfokine receptor, the Pep receptor, the plant natriuretic peptide receptor as well as a nitric oxide sensor. We foresee that in the near future many more molecular mechanisms and biological roles of GCs and ACs and their catalytic products will be discovered and further establish cNMPs as a key component of plant responses to the environment.

  9. Cyclic Nucleotide Monophosphates and Their Cyclases in Plant Signaling

    KAUST Repository

    Gehring, Christoph A; Turek, Ilona S.

    2017-01-01

    The cyclic nucleotide monophosphates (cNMPs), and notably 3′,5′-cyclic guanosine monophosphate (cGMP) and 3′,5′-cyclic adenosine monophosphate (cAMP) are now accepted as key signaling molecules in many processes in plants including growth and differentiation, photosynthesis, and biotic and abiotic defense. At the single molecule level, we are now beginning to understand how cNMPs modify specific target molecules such as cyclic nucleotide-gated channels, while at the systems level, a recent study of the Arabidopsis cNMP interactome has identified novel target molecules with specific cNMP-binding domains. A major advance came with the discovery and characterization of a steadily increasing number of guanylate cyclases (GCs) and adenylate cyclases (ACs). Several of the GCs are receptor kinases and include the brassinosteroid receptor, the phytosulfokine receptor, the Pep receptor, the plant natriuretic peptide receptor as well as a nitric oxide sensor. We foresee that in the near future many more molecular mechanisms and biological roles of GCs and ACs and their catalytic products will be discovered and further establish cNMPs as a key component of plant responses to the environment.

  10. Modification of synthesis nucleotides [γ-32P] ATP

    International Nuclear Information System (INIS)

    Wira Y Rahman; Endang Sarmini; Herlina; Triyanto; Hambali; Abdul Mutalib; Santi Nurbaiti

    2013-01-01

    In molecular biology, radionuclides in the form of radiolabeled compounds have been widely used as deoxyribonucleic acid (DNA) / ribonucleic acid (RNA) tracer in order to explore a wide range of physiological and pathological processes. One of such compounds is [γ- 32 P]-adenosine triphosphate {[γ- 32 P]-ATP} [γ- 32 P]-ATP which has been widely used in the biotechnology research. In order to support the biotechnology research in Indonesia in this project, [γ- 32 P]- ATP had been synthesized by enzymatic reactions with modifying the method of synthesis using the precursor DL-glyceraldehyde 3-phosphate, nucleotides Adenosine Diphosphate (ADP) and H 3 32 PO 4 and enzymes glyceraldehyde 3-phosphate dehydrogenase, 3-phosphoroglyceric phosphokinase and lactate dehydrogenase. The purification of the synthesized [γ- 32 P]-ATP, by using DEAE Sephadex column chromatography. The synthesis and purification process that had been performed were able in producing of [γ- 32 P]-ATP with radioactivity of 1,175 mCi and radiochemical purity of 99,49%.. Having successfully prepared the [γ- 32 P]-ATP and application, in the near future the Radioisotopes and Radiopharmaceuticals Centre is expected to be able in providing the above-mentioned radiolabeled nucleotide for biotechnology research in Indonesia. (author)

  11. Nucleobases, nucleosides, and nucleotides: versatile biomolecules for generating functional nanomaterials.

    Science.gov (United States)

    Pu, Fang; Ren, Jinsong; Qu, Xiaogang

    2018-02-21

    The incorporation of biomolecules into nanomaterials generates functional nanosystems with novel and advanced properties, presenting great potential for applications in various fields. Nucleobases, nucleosides and nucleotides, as building blocks of nucleic acids and biological coenzymes, constitute necessary components of the foundation of life. In recent years, as versatile biomolecules for the construction or regulation of functional nanomaterials, they have stimulated interest in researchers, due to their unique properties such as structural diversity, multiplex binding sites, self-assembly ability, stability, biocompatibility, and chirality. In this review, strategies for the synthesis of nanomaterials and the regulation of their morphologies and functions using nucleobases, nucleosides, and nucleotides as building blocks, templates or modulators are summarized alongside selected applications. The diverse applications range from sensing, bioimaging, and drug delivery to mimicking light-harvesting antenna, the construction of logic gates, and beyond. Furthermore, some perspectives and challenges in this emerging field are proposed. This review is directed toward the broader scientific community interested in biomolecule-based functional nanomaterials.

  12. Assay of cyclic nucleotide phosphodiesterase using radiolabeled and fluorescent substrates

    International Nuclear Information System (INIS)

    Kincaid, R.L.; Manganiello, V.C.

    1988-01-01

    There are four major classes of phosphodiesterase with different specificities for cAMP and cGMP and different allosteric regulators. Type I phosphodiesterase is activated by calmodulin plus Ca/sup 2+/ and has a higher affinity for cGMP than cAMP. Type II phosphodiesterase likewise has a higher affinity for cGMP than cAMP, but the activity toward one substrate is markedly stimulated by low (micromolar) concentrations of the other nucleotide. Type III phosphodiesterase has a higher affinity for cAMP than cGMP; its activity is increased in responsive cells by certain hormones, e.g., insulin, isoproterenol. Type IV phosphodiesterase is the cGMP-specific enzyme, which also has an allosteric binding site for cGMP. An example of this class of enzyme is the one from retinal rod outer segments, which is activated by light via rhodopsin and the guanine nucleotide-binding protein transducin. There appears to be little structural relatedness among these enzymes based on immunologic analysis, consistent with the possibility that divergent forms evolved from an ancestral enzyme. Determination of the amount of a specific form of phosphodiesterase in crude material is often difficult. Modification of assay conditions by judicious choice of substrate and/or inhibitor concentrations may selectively favor (or reduce) the activity of a particular form; in many instances, however, some fractionation of enzymes may be necessary. This is discussed more fully in the final section of this chapter

  13. Complete nucleotide sequences of avian metapneumovirus subtype B genome.

    Science.gov (United States)

    Sugiyama, Miki; Ito, Hiroshi; Hata, Yusuke; Ono, Eriko; Ito, Toshihiro

    2010-12-01

    Complete nucleotide sequences were determined for subtype B avian metapneumovirus (aMPV), the attenuated vaccine strain VCO3/50 and its parental pathogenic strain VCO3/60616. The genomes of both strains comprised 13,508 nucleotides (nt), with a 42-nt leader at the 3'-end and a 46-nt trailer at the 5'-end. The genome contains eight genes in the order 3'-N-P-M-F-M2-SH-G-L-5', which is the same order shown in the other metapneumoviruses. The genes are flanked on either side by conserved transcriptional start and stop signals and have intergenic sequences varying in length from 1 to 88 nt. Comparison of nt and predicted amino acid (aa) sequences of VCO3/60616 with those of other metapneumoviruses revealed higher homology with aMPV subtype A virus than with other metapneumoviruses. A total of 18 nt and 10 deduced aa differences were seen between the strains, and one or a combination of several differences could be associated with attenuation of VCO3/50.

  14. Thoroughbred Horse Single Nucleotide Polymorphism and Expression Database: HSDB

    Directory of Open Access Journals (Sweden)

    Joon-Ho Lee

    2014-09-01

    Full Text Available Genetics is important for breeding and selection of horses but there is a lack of well-established horse-related browsers or databases. In order to better understand horses, more variants and other integrated information are needed. Thus, we construct a horse genomic variants database including expression and other information. Horse Single Nucleotide Polymorphism and Expression Database (HSDB (http://snugenome2.snu.ac.kr/HSDB provides the number of unexplored genomic variants still remaining to be identified in the horse genome including rare variants by using population genome sequences of eighteen horses and RNA-seq of four horses. The identified single nucleotide polymorphisms (SNPs were confirmed by comparing them with SNP chip data and variants of RNA-seq, which showed a concordance level of 99.02% and 96.6%, respectively. Moreover, the database provides the genomic variants with their corresponding transcriptional profiles from the same individuals to help understand the functional aspects of these variants. The database will contribute to genetic improvement and breeding strategies of Thoroughbreds.

  15. Preliminary study of MR diffusion weighted imaging in nude mice models of hepatic Bel7402 tumors after adenovirus-mediated cytosine diaminase-thymidine kinase gene therapy

    International Nuclear Information System (INIS)

    Jiang Xinqing; Chen Liang; Wu Hongzhen; Huang Jingjun; Wei Xinhua; Mo Lei; Yang Ruimeng; Xiao Xiangsheng

    2012-01-01

    Objective: To study the characteristics of DWI in nude mice models of hepatic Bel7402 tumors after treatment with adenovirus-mediated cytosine diaminase-thymidine kinase (Ad. CD-TK) double suicide gene therapy, and then to identify whether DWI can be used for assessing curative effect of postoperative tumors. Methods: Thirty nude mice models of hepatic Bel7402 tumors were successfully created using cell suspension method, after the tumor grew to more than 1 cm in diameter, 20 tumor models were treated by intratumoral administration of Ad. CD-TK for 3 days plus intraperitonea (i.p.) treatment with 5-Fc and GCV for the duration of the study.Then they were randomly divided into three groups during 5-Fc and GCV treatment. The remaining 10 tumor models were used as controls. MR scanning were performed in 10 th day before and after tumor implantation in all models by using EPI-SE series and SENSE technology for treatment group. Tumor volumes and ADC values were calculated pretreatment and posttreatment. Cell apoptosis were determined by using TUNEL method. Analyze the change of ADC and apoptosis index (AI) in different times, t test was used for comparison the difference of AI and ADC values respectively. Results: After 10 days,the tumor volumes of the treatment groups and controls were respectively (724.16 ±57.45) mm 3 , (754.57 ± 66.84) mm 3 , with no significant difference (t=0.488, P >0.05). The ADC values of the treatment groups were (0.98 ±0.11) × 10 -3 mm 2 /s,the ones of the control groups were (0.68 ±0.04) × 10 -3 mm 2 /s; AI of the treatment groups were (23.25 ±6.57)%, the ones of the control groups were (2.57 ± 0.58)%. There were difference in both groups (t=4.473, 5.874; P<0.01). Conclusion: DWI can be effectively to monitor the early pathological changes of hepatic Bel7402 tumors after Ad. CD-TK double suicide gene therapy, and provide experimental evidences for clinical application. (authors)

  16. A Ser29Leu substitution in the cytosine deaminase Fca1p is responsible for clade-specific flucytosine resistance in Candida dubliniensis.

    LENUS (Irish Health Repository)

    McManus, Brenda A

    2009-11-01

    The population structure of the opportunistic yeast pathogen Candida dubliniensis is composed of three main multilocus sequence typing clades (clades C1 to C3), and clade C3 predominantly consists of isolates from the Middle East that exhibit high-level resistance (MIC(50) > or = 128 microg\\/ml) to the fungicidal agent flucytosine (5FC). The close relative of C. dubliniensis, C. albicans, also exhibits clade-specific resistance to 5FC, and resistance is most commonly mediated by an Arg101Cys substitution in the FUR1 gene encoding uracil phosphoribosyltransferase. Broth microdilution assays with fluorouracil (5FU), the toxic deaminated form of 5FC, showed that both 5FC-resistant and 5FC-susceptible C. dubliniensis isolates exhibited similar 5FU MICs, suggesting that the C. dubliniensis cytosine deaminase (Fca1p) encoded by C. dubliniensis FCA1 (CdFCA1) may play a role in mediating C. dubliniensis clade-specific 5FC resistance. Amino acid sequence analysis of the CdFCA1 open reading frame (ORF) identified a homozygous Ser29Leu substitution in all 12 5FC-resistant isolates investigated which was not present in any of the 9 5FC-susceptible isolates examined. The tetracycline-inducible expression of the CdFCA1 ORF from a 5FC-susceptible C. dubliniensis isolate in two separate 5FC-resistant clade C3 isolates restored susceptibility to 5FC, demonstrating that the Ser29Leu substitution was responsible for the clade-specific 5FC resistance and that the 5FC resistance encoded by FCA1 genes with the Ser29Leu transition is recessive. Quantitative real-time PCR analysis showed no significant difference in CdFCA1 expression between 5FC-susceptible and 5FC-resistant isolates in either the presence or the absence of subinhibitory concentrations of 5FC, suggesting that the Ser29Leu substitution in the CdFCA1 ORF is the sole cause of 5FC resistance in clade C3 C. dubliniensis isolates.

  17. Imaging Expression of Cytosine Deaminase-Herpes Virus Thymidine Kinase Fusion Gene (CD/TK Expression with [124I]FIAU and PET

    Directory of Open Access Journals (Sweden)

    Trevor Hackman

    2002-01-01

    Full Text Available Double prodrug activation gene therapy using the Escherichia coli cytosine deaminase (CDherpes simplex virus type 1 thymidine kinase (HSV1-tk fusion gene (CD/TK with 5-fluorocytosine (5FC, ganciclovir (GCV, and radiotherapy is currently under evaluation for treatment of different tumors. We assessed the efficacy of noninvasive imaging with [124I]FIAU (2′-fluoro-2′-deoxy-1-β-d-arabinofuranosyl-5-iodo-uracil and positron emission tomography (PET for monitoring expression of the CD/TK fusion gene. Walker-256 tumor cells were transduced with a retroviral vector bearing the CD/TK gene (W256CD/TK cells. The activity of HSV1-TK and CD subunits of the CD/TK gene product was assessed in different single cell-derived clones of W256CD/TK cells using the FIAU radiotracer accumulation assay in cells and a CD enzyme assay in cell homogenates, respectively. A linear relationship was observed between the levels of CD and HSV1-tk subunit expression in corresponding clones in vitro over a wide range of CD/TK expression levels. Several clones of W256CD/TK cells with significantly different levels of CD/TK expression were selected and used to produce multiple subcutaneous tumors in rats. PET imaging of HSV1-TK subunit activity with [124I]FIAU was performed on these animals and demonstrated that different levels of CD/TK expression in subcutaneous W256CD/TK tumors can be imaged quantitatively. CD expression in subcutaneous tumor sample homogenates was measured using a CD enzyme assay. A comparison of CD and HSV1-TK subunit enzymatic activity of the CD/TK fusion protein in vivo showed a significant correlation. Knowing this relationship, the parametric images of CD subunit activity were generated. Imaging with [124I]FIAU and PET could provide pre- and posttreatment assessments of CD/TK-based double prodrug activation in clinical gene therapy trials.

  18. Computational learning on specificity-determining residue-nucleotide interactions

    KAUST Repository

    Wong, Ka-Chun; Li, Yue; Peng, Chengbin; Moses, Alan M.; Zhang, Zhaolei

    2015-01-01

    The protein–DNA interactions between transcription factors and transcription factor binding sites are essential activities in gene regulation. To decipher the binding codes, it is a long-standing challenge to understand the binding mechanism across different transcription factor DNA binding families. Past computational learning studies usually focus on learning and predicting the DNA binding residues on protein side. Taking into account both sides (protein and DNA), we propose and describe a computational study for learning the specificity-determining residue-nucleotide interactions of different known DNA-binding domain families. The proposed learning models are compared to state-of-the-art models comprehensively, demonstrating its competitive learning performance. In addition, we describe and propose two applications which demonstrate how the learnt models can provide meaningful insights into protein–DNA interactions across different DNA binding families.

  19. Radicals of DNA and DNA nucleotides generated by ionising radiation

    International Nuclear Information System (INIS)

    Przybytniak, G.

    2004-01-01

    A first stage of cell processes leading to DNA damage of initiated by radical reactions. In a model system such transformations were generated by ionising radiation which involves production of electron loss and electron gain centers of the substrate and radical formation. Using cryogenic ESR spectroscopy it was found that the DNA nucleotides, which convert to radical anions upon electron capture undergo the separation of unpaired spin and charge due to protonation. Circular and linear dichroism studies enabled to conclude that iron ions(III) induce strong changes in the DNA helical structure indicating their coordination with nitrogen bases. The repair of DNA radicals produced via radiolytic oxidation, i.e. the guanine radical cation and the allyl type radical of thymine, is possible at elevated temperatures due to the involvement of sulphydryl groups. The influence of the thiol charge is then limited

  20. Nucleic acid and nucleotide-mediated synthesis of inorganic nanoparticles

    Science.gov (United States)

    Berti, Lorenzo; Burley, Glenn A.

    2008-02-01

    Since the advent of practical methods for achieving DNA metallization, the use of nucleic acids as templates for the synthesis of inorganic nanoparticles (NPs) has become an active area of study. It is now widely recognized that nucleic acids have the ability to control the growth and morphology of inorganic NPs. These biopolymers are particularly appealing as templating agents as their ease of synthesis in conjunction with the possibility of screening nucleotide composition, sequence and length, provides the means to modulate the physico-chemical properties of the resulting NPs. Several synthetic procedures leading to NPs with interesting photophysical properties as well as studies aimed at rationalizing the mechanism of nucleic acid-templated NP synthesis are now being reported. This progress article will outline the current understanding of the nucleic acid-templated process and provides an up to date reference in this nascent field.

  1. Environmental heat stress, hyperammonemia and nucleotide metabolism during intermittent exercise

    DEFF Research Database (Denmark)

    Mohr, Magni; Rasmussen, Peter; Drust, Barry

    2006-01-01

    ) followed by five 15 s all-out sprints. Control trials were conducted in a 20°C environment while heat stress trials were performed at an ambient temperature of 40°C. Muscle biopsies and venous blood samples were obtained at rest, after 40 min of exercise and following the maximal sprints. Following......Abstract  This study investigated the influence of environmental heat stress on ammonia (NH3) accumulation in relation to nucleotide metabolism and fatigue during intermittent exercise. Eight males performed 40 min of intermittent exercise (15 s at 306±22 W alternating with 15 s of unloaded cycling...... exercise with heat stress, the core and muscle temperatures peaked at 39.5±0.2 and 40.2±0.2°C to be ~ 1°C higher (Pheat stress trial (P

  2. Computational learning on specificity-determining residue-nucleotide interactions

    KAUST Repository

    Wong, Ka-Chun

    2015-11-02

    The protein–DNA interactions between transcription factors and transcription factor binding sites are essential activities in gene regulation. To decipher the binding codes, it is a long-standing challenge to understand the binding mechanism across different transcription factor DNA binding families. Past computational learning studies usually focus on learning and predicting the DNA binding residues on protein side. Taking into account both sides (protein and DNA), we propose and describe a computational study for learning the specificity-determining residue-nucleotide interactions of different known DNA-binding domain families. The proposed learning models are compared to state-of-the-art models comprehensively, demonstrating its competitive learning performance. In addition, we describe and propose two applications which demonstrate how the learnt models can provide meaningful insights into protein–DNA interactions across different DNA binding families.

  3. Genome-wide patterns of nucleotide polymorphism in domesticated rice

    DEFF Research Database (Denmark)

    Caicedo, Ana L; Williamson, Scott H; Hernandez, Ryan D

    2007-01-01

    Domesticated Asian rice (Oryza sativa) is one of the oldest domesticated crop species in the world, having fed more people than any other plant in human history. We report the patterns of DNA sequence variation in rice and its wild ancestor, O. rufipogon, across 111 randomly chosen gene fragments......, and use these to infer the evolutionary dynamics that led to the origins of rice. There is a genome-wide excess of high-frequency derived single nucleotide polymorphisms (SNPs) in O. sativa varieties, a pattern that has not been reported for other crop species. We developed several alternative models...... to explain contemporary patterns of polymorphisms in rice, including a (i) selectively neutral population bottleneck model, (ii) bottleneck plus migration model, (iii) multiple selective sweeps model, and (iv) bottleneck plus selective sweeps model. We find that a simple bottleneck model, which has been...

  4. Computational identification of candidate nucleotide cyclases in higher plants

    KAUST Repository

    Wong, Aloysius Tze

    2013-09-03

    In higher plants guanylyl cyclases (GCs) and adenylyl cyclases (ACs) cannot be identified using BLAST homology searches based on annotated cyclic nucleotide cyclases (CNCs) of prokaryotes, lower eukaryotes, or animals. The reason is that CNCs are often part of complex multifunctional proteins with different domain organizations and biological functions that are not conserved in higher plants. For this reason, we have developed CNC search strategies based on functionally conserved amino acids in the catalytic center of annotated and/or experimentally confirmed CNCs. Here we detail this method which has led to the identification of >25 novel candidate CNCs in Arabidopsis thaliana, several of which have been experimentally confirmed in vitro and in vivo. We foresee that the application of this method can be used to identify many more members of the growing family of CNCs in higher plants. © Springer Science+Business Media New York 2013.

  5. Reduction of nucleotides by ionizing radiation: uridine 5' phosphate, and cytidine 3' phosphate

    International Nuclear Information System (INIS)

    Box, H.C.; Potter, W.R.; Budzinski, E.E.

    1974-01-01

    Anions formed by the addition of an electron to the uracil base were observed in single crystals of the barium salt of uridine 5' phosphate x irradiated at 4.2 0 K. The hyperfine coupling tensor for the C 6 -H proton was deduced from ENDOR measurements; the principal values are -59.12, -32.92 and -16.24 MHz. Similar measurements were made on single crystals of cytidine 3' phosphate. The principal values for the C 6 -H proton hyperfine coupling in the anion formed on the cytosine base are -59.26, -33.98 and -14.68 MHz. (U.S.)

  6. The reduction of nucleotides by ionizing radiation: uridine 5' phosphate and cytidine 3' phosphate

    International Nuclear Information System (INIS)

    Box, H.C.; Potter, W.R.; Budzinski, E.E.

    1975-01-01

    Anions formed by the addition of an electron to the uracil base were observed in single crystals of the barium salt of uridine 5' phosphate x-irradiated at 4.2 degreeK. The hyperfine coupling tensor for the C 6 --H proton was deduced from ENDOR measurements; the principal values are -59.12, -32.92, and -16.24 MHz. Similar measurements were made on single crystals of cytidine 3' phosphate. The principal values for the C 6 --H proton hyperfine coupling in the anion formed on the cytosine base are -59.26, -33.98, and -14.68 MHz

  7. High pressure {sup 31}P NMR spectroscopy on guanine nucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Spoerner, Michael; Karl, Matthias; Lopes, Pedro; Hoering, Marcus; Loeffel, Karoline; Nuehs, Andrea; Adelsberger, Joseph; Kremer, Werner; Kalbitzer, Hans Robert, E-mail: hans-robert.kalbitzer@ur.de [University of Regensburg, Centre of Magnetic Resonance in Chemistry and Biomedicine, Institute of Biophysics and Physical Biochemistry (Germany)

    2017-01-15

    The {sup 31}P NMR pressure response of guanine nucleotides bound to proteins has been studied in the past for characterizing the pressure perturbation of conformational equilibria. The pressure response of the {sup 31}P NMR chemical shifts of the phosphate groups of GMP, GDP, and GTP as well as the commonly used GTP analogs GppNHp, GppCH{sub 2}p and GTPγS was measured in the absence and presence of Mg{sup 2+}-ions within a pressure range up to 200 MPa. The pressure dependence of chemical shifts is clearly non-linear. For all nucleotides a negative first order pressure coefficient B{sub 1} was determined indicating an upfield shift of the resonances with pressure. With exception of the α-phosphate group of Mg{sup 2+}·GMP and Mg{sup 2+}·GppNHp the second order pressure coefficients are positive. To describe the data of Mg{sup 2+}·GppCH{sub 2}p and GTPγS a Taylor expansion of 3rd order is required. For distinguishing pH effects from pressure effects a complete pH titration set is presented for GMP, as well as GDP and GTP in absence and presence of Mg{sup 2+} ions using indirect referencing to DSS under identical experimental conditions. By a comparison between high pressure {sup 31}P NMR data on free Mg{sup 2+}-GDP and Mg{sup 2+}-GDP in complex with the proto-oncogene Ras we demonstrate that pressure induced changes in chemical shift are clearly different between both forms.

  8. Electrical detection and quantification of single and mixed DNA nucleotides in suspension

    Science.gov (United States)

    Ahmad, Mahmoud Al; Panicker, Neena G.; Rizvi, Tahir A.; Mustafa, Farah

    2016-09-01

    High speed sequential identification of the building blocks of DNA, (deoxyribonucleotides or nucleotides for short) without labeling or processing in long reads of DNA is the need of the hour. This can be accomplished through exploiting their unique electrical properties. In this study, the four different types of nucleotides that constitute a DNA molecule were suspended in a buffer followed by performing several types of electrical measurements. These electrical parameters were then used to quantify the suspended DNA nucleotides. Thus, we present a purely electrical counting scheme based on the semiconductor theory that allows one to determine the number of nucleotides in a solution by measuring their capacitance-voltage dependency. The nucleotide count was observed to be similar to the multiplication of the corresponding dopant concentration and debye volume after de-embedding the buffer contribution. The presented approach allows for a fast and label-free quantification of single and mixed nucleotides in a solution.

  9. The Coding of Biological Information: From Nucleotide Sequence to Protein Recognition

    Science.gov (United States)

    Štambuk, Nikola

    The paper reviews the classic results of Swanson, Dayhoff, Grantham, Blalock and Root-Bernstein, which link genetic code nucleotide patterns to the protein structure, evolution and molecular recognition. Symbolic representation of the binary addresses defining particular nucleotide and amino acid properties is discussed, with consideration of: structure and metric of the code, direct correspondence between amino acid and nucleotide information, and molecular recognition of the interacting protein motifs coded by the complementary DNA and RNA strands.

  10. The immediate nucleotide precursor, guanosine triphosphate, in the riboflavin biosynthetic pathway

    International Nuclear Information System (INIS)

    Mitsuda, Hisateru; Nakajima, Kenji; Nadamoto, Tomonori

    1977-01-01

    In the present paper, the nucleotide precursor of riboflavin was investigated by experiments with labeled purines using non-growing cells of Eremothecium ashbyii. The added purines, at 10 -4 M, were effectively incorporated into riboflavin at an early stage of riboflavin biosynthesis under the experimental conditions. In particular, both labeled xanthine and labeled guanine were specifically transported to guanosine nucleotides, GMP, GDP, GDP-Mannose and GTP, in the course of the riboflavin biosynthesis. A comparison of specific activities of labeled guanosine nucleotides and labeled riboflavin indicated that the nucleotide precursor of riboflavin is guanosine triphosphate. From the results obtained, a biosynthetic pathway of riboflavin is proposed. (auth.)

  11. Nucleos: a web server for the identification of nucleotide-binding sites in protein structures.

    Science.gov (United States)

    Parca, Luca; Ferré, Fabrizio; Ausiello, Gabriele; Helmer-Citterich, Manuela

    2013-07-01

    Nucleos is a web server for the identification of nucleotide-binding sites in protein structures. Nucleos compares the structure of a query protein against a set of known template 3D binding sites representing nucleotide modules, namely the nucleobase, carbohydrate and phosphate. Structural features, clustering and conservation are used to filter and score the predictions. The predicted nucleotide modules are then joined to build whole nucleotide-binding sites, which are ranked by their score. The server takes as input either the PDB code of the query protein structure or a user-submitted structure in PDB format. The output of Nucleos is composed of ranked lists of predicted nucleotide-binding sites divided by nucleotide type (e.g. ATP-like). For each ranked prediction, Nucleos provides detailed information about the score, the template structure and the structural match for each nucleotide module composing the nucleotide-binding site. The predictions on the query structure and the template-binding sites can be viewed directly on the web through a graphical applet. In 98% of the cases, the modules composing correct predictions belong to proteins with no homology relationship between each other, meaning that the identification of brand-new nucleotide-binding sites is possible using information from non-homologous proteins. Nucleos is available at http://nucleos.bio.uniroma2.it/nucleos/.

  12. Microarray Beads for Identifying Blood Group Single Nucleotide Polymorphisms.

    Science.gov (United States)

    Drago, Francesca; Karpasitou, Katerina; Poli, Francesca

    2009-01-01

    We have developed a high-throughput system for single nucleotide polymorphism (SNP) genotyping of alleles of diverse blood group systems exploiting Luminex technology. The method uses specific oligonucleotide probes coupled to a specific array of fluorescent microspheres and is designed for typing Jk(a)/Jk(b), Fy(a)/Fy(b), S/s, K/k, Kp(a)/Kp(b), Js(a)/Js(b), Co(a)/Co(b) and Lu(a)/Lu(b) alleles. Briefly, two multiplex PCR reactions (PCR I and PCR II) according to the laboratory specific needs are set up. PCR I amplifies the alleles tested routinely, namely Jk(a)/Jk(b), Fy(a)/Fy(b), S/s, and K/k. PCR II amplifies those alleles that are typed less frequently. Biotinylated PCR products are hybridized in a single multiplex assay with the corresponding probe mixture. After incubation with R-phycoerythrin-conjugated streptavidin, the emitted fluorescence is analyzed with Luminex 100. So far, we have typed more than 2,000 subjects, 493 of whom with multiplex assay, and there have been no discrepancies with the serology results other than null and/or weak phenotypes. The cost of consumables and reagents for typing a single biallelic pair per sample is less than EUR 3.-, not including DNA extraction costs. The capability to perform multiplexed reactions makes the method markedly suitable for mass screening of red blood cell alleles. This genotyping approach represents an important tool in transfusion medicine.

  13. Implication of SUMO E3 ligases in nucleotide excision repair.

    Science.gov (United States)

    Tsuge, Maasa; Kaneoka, Hidenori; Masuda, Yusuke; Ito, Hiroki; Miyake, Katsuhide; Iijima, Shinji

    2015-08-01

    Post-translational modifications alter protein function to mediate complex hierarchical regulatory processes that are crucial to eukaryotic cellular function. The small ubiquitin-like modifier (SUMO) is an important post-translational modification that affects transcriptional regulation, nuclear localization, and the maintenance of genome stability. Nucleotide excision repair (NER) is a very versatile DNA repair system that is essential for protection against ultraviolet (UV) irradiation. The deficiencies in NER function remarkably increase the risk of skin cancer. Recent studies have shown that several NER factors are SUMOylated, which influences repair efficiency. However, how SUMOylation modulates NER has not yet been elucidated. In the present study, we performed RNAi knockdown of SUMO E3 ligases and found that, in addition to PIASy, the polycomb protein Pc2 affected the repair of cyclobutane pyrimidine dimers. PIAS1 affected both the removal of 6-4 pyrimidine pyrimidone photoproducts and cyclobutane pyrimidine dimers, whereas other SUMO E3 ligases did not affect the removal of either UV lesion.

  14. Base Sequence Context Effects on Nucleotide Excision Repair

    Directory of Open Access Journals (Sweden)

    Yuqin Cai

    2010-01-01

    Full Text Available Nucleotide excision repair (NER plays a critical role in maintaining the integrity of the genome when damaged by bulky DNA lesions, since inefficient repair can cause mutations and human diseases notably cancer. The structural properties of DNA lesions that determine their relative susceptibilities to NER are therefore of great interest. As a model system, we have investigated the major mutagenic lesion derived from the environmental carcinogen benzo[a]pyrene (B[a]P, 10S (+-trans-anti-B[a]P-2-dG in six different sequence contexts that differ in how the lesion is positioned in relation to nearby guanine amino groups. We have obtained molecular structural data by NMR and MD simulations, bending properties from gel electrophoresis studies, and NER data obtained from human HeLa cell extracts for our six investigated sequence contexts. This model system suggests that disturbed Watson-Crick base pairing is a better recognition signal than a flexible bend, and that these can act in concert to provide an enhanced signal. Steric hinderance between the minor groove-aligned lesion and nearby guanine amino groups determines the exact nature of the disturbances. Both nearest neighbor and more distant neighbor sequence contexts have an impact. Regardless of the exact distortions, we hypothesize that they provide a local thermodynamic destabilization signal for repair.

  15. Myristoylated α subunits of guanine nucleotide-binding regulatory proteins

    International Nuclear Information System (INIS)

    Buss, J.E.; Mumby, S.M.; Casey, P.J.; Gilman, A.G.; Sefton, B.M.

    1987-01-01

    Antisera directed against specific subunits of guanine nucleotide-binding regulatory proteins (G proteins) were used to immunoprecipitate these polypeptides from metabolically labeled cells. This technique detects, in extracts of a human astrocytoma cell line, the α subunits of G/sub s/ (stimulatory) (α 45 and α 52 ), a 41-kDa subunit of G/sub i/ (inhibitory) (α 41 ), a 40-kDa protein (α 40 ), and the 36-kDa β subunit. No protein that comigrated with the α subunit of G 0 (unknown function) (α 39 ) was detected. In cells grown in the presence of [ 3 H]myristic acid, α 41 and α 40 contained 3 H label, while the β subunit did not. Chemical analysis of lipids attached covalently to purified α 41 and α 39 from bovine brain also revealed myristic acid. Similar analysis of brain G protein β and γ subunits and of G/sub t/ (Transducin) subunits (α, β, and γ) failed to reveal fatty acids. The fatty acid associated with α 41 , α 40 , and α 39 was stable to treatment with base, suggesting that the lipid is linked to the polypeptide via an amide bond. These GTP binding proteins are thus identified as members of a select group of proteins that contains myristic acid covalently attached to the peptide backbone. Myristate may play an important role in stabilizing interactions of G proteins with phospholipid or with membrane-bound proteins

  16. Nucleotide sequence of the human N-myc gene

    International Nuclear Information System (INIS)

    Stanton, L.W.; Schwab, M.; Bishop, J.M.

    1986-01-01

    Human neuroblastomas frequently display amplification and augmented expression of a gene known as N-myc because of its similarity to the protooncogene c-myc. It has therefore been proposed that N-myc is itself a protooncogene, and subsequent tests have shown that N-myc and c-myc have similar biological activities in cell culture. The authors have now detailed the kinship between N-myc and c-myc by determining the nucleotide sequence of human N-myc and deducing the amino acid sequence of the protein encoded by the gene. The topography of N-myc is strikingly similar to that of c-myc: both genes contain three exons of similar lengths; the coding elements of both genes are located in the second and third exons; and both genes have unusually long 5' untranslated regions in their mRNAs, with features that raise the possibility that expression of the genes may be subject to similar controls of translation. The resemblance between the proteins encoded by N-myc and c-myc sustains previous suspicions that the genes encode related functions

  17. Expression of Vesicular Nucleotide Transporter in Rat Odontoblasts

    International Nuclear Information System (INIS)

    Ikeda, Erina; Goto, Tetsuya; Gunjigake, Kaori; Kuroishi, Kayoko; Ueda, Masae; Kataoka, Shinji; Toyono, Takashi; Nakatomi, Mitsushiro; Seta, Yuji; Kitamura, Chiaki; Nishihara, Tatsuji; Kawamoto, Tatsuo

    2016-01-01

    Several theories have been proposed regarding pain transmission mechanisms in tooth. However, the exact signaling mechanism from odontoblasts to pulp nerves remains to be clarified. Recently, ATP-associated pain transmission has been reported, but it is unclear whether ATP is involved in tooth pain transmission. In the present study, we focused on the vesicular nucleotide transporter (VNUT), a transporter of ATP into vesicles, and examined whether VNUT was involved in ATP release from odontoblasts. We examined the expression of VNUT in rat pulp by RT-PCR and immunostaining. ATP release from cultured odontoblast-like cells with heat stimulation was evaluated using ATP luciferase methods. VNUT was expressed in pulp tissue, and the distribution of VNUT-immunopositive vesicles was confirmed in odontoblasts. In odontoblasts, some VNUT-immunopositive vesicles were colocalized with membrane fusion proteins. Additionally P2X 3 , an ATP receptor, immunopositive axons were distributed between odontoblasts. The ATP release by thermal stimulation from odontoblast-like cells was inhibited by the addition of siRNA for VNUT. These findings suggest that cytosolic ATP is transported by VNUT and that the ATP in the vesicles is then released from odontoblasts to ATP receptors on axons. ATP vesicle transport in odontoblasts seems to be a key mechanism for signal transduction from odontoblasts to axons in the pulp

  18. Implication of Posttranslational Histone Modifications in Nucleotide Excision Repair

    Directory of Open Access Journals (Sweden)

    Shisheng Li

    2012-09-01

    Full Text Available Histones are highly alkaline proteins that package and order the DNA into chromatin in eukaryotic cells. Nucleotide excision repair (NER is a conserved multistep reaction that removes a wide range of generally bulky and/or helix-distorting DNA lesions. Although the core biochemical mechanism of NER is relatively well known, how cells detect and repair lesions in diverse chromatin environments is still under intensive research. As with all DNA-related processes, the NER machinery must deal with the presence of organized chromatin and the physical obstacles it presents. A huge catalogue of posttranslational histone modifications has been documented. Although a comprehensive understanding of most of these modifications is still lacking, they are believed to be important regulatory elements for many biological processes, including DNA replication and repair, transcription and cell cycle control. Some of these modifications, including acetylation, methylation, phosphorylation and ubiquitination on the four core histones (H2A, H2B, H3 and H4 or the histone H2A variant H2AX, have been found to be implicated in different stages of the NER process. This review will summarize our recent understanding in this area.

  19. Adenine nucleotide translocator transports haem precursors into mitochondria.

    Directory of Open Access Journals (Sweden)

    Motoki Azuma

    2008-08-01

    Full Text Available Haem is a prosthetic group for haem proteins, which play an essential role in oxygen transport, respiration, signal transduction, and detoxification. In haem biosynthesis, the haem precursor protoporphyrin IX (PP IX must be accumulated into the mitochondrial matrix across the inner membrane, but its mechanism is largely unclear. Here we show that adenine nucleotide translocator (ANT, the inner membrane transporter, contributes to haem biosynthesis by facilitating mitochondrial accumulation of its precursors. We identified that haem and PP IX specifically bind to ANT. Mitochondrial uptake of PP IX was inhibited by ADP, a known substrate of ANT. Conversely, ADP uptake into mitochondria was competitively inhibited by haem and its precursors, suggesting that haem-related porphyrins are accumulated into mitochondria via ANT. Furthermore, disruption of the ANT genes in yeast resulted in a reduction of haem biosynthesis by blocking the translocation of haem precursors into the matrix. Our results represent a new model that ANT plays a crucial role in haem biosynthesis by facilitating accumulation of its precursors into the mitochondrial matrix.

  20. Chlamydial entry involves TARP binding of guanine nucleotide exchange factors.

    Directory of Open Access Journals (Sweden)

    B Josh Lane

    2008-03-01

    Full Text Available Chlamydia trachomatis attachment to cells induces the secretion of the elementary body-associated protein TARP (Translocated Actin Recruiting Protein. TARP crosses the plasma membrane where it is immediately phosphorylated at tyrosine residues by unknown host kinases. The Rac GTPase is also activated, resulting in WAVE2 and Arp2/3-dependent recruitment of actin to the sites of chlamydia attachment. We show that TARP participates directly in chlamydial invasion activating the Rac-dependent signaling cascade to recruit actin. TARP functions by binding two distinct Rac guanine nucleotide exchange factors (GEFs, Sos1 and Vav2, in a phosphotyrosine-dependent manner. The tyrosine phosphorylation profile of the sequence YEPISTENIYESI within TARP, as well as the transient activation of the phosphatidylinositol 3-kinase (PI3-K, appears to determine which GEF is utilized to activate Rac. The first and second tyrosine residues, when phosphorylated, are utilized by the Sos1/Abi1/Eps8 and Vav2, respectively, with the latter requiring the lipid phosphatidylinositol 3,4,5-triphosphate. Depletion of these critical signaling molecules by siRNA resulted in inhibition of chlamydial invasion to varying degrees, owing to a possible functional redundancy of the two pathways. Collectively, these data implicate TARP in signaling to the actin cytoskeleton remodeling machinery, demonstrating a mechanism by which C.trachomatis invades non-phagocytic cells.

  1. Single Nucleotide Polymorphism Identification, Characterization, and Linkage Mapping in Quinoa

    Directory of Open Access Journals (Sweden)

    P. J. Maughan

    2012-11-01

    Full Text Available Quinoa ( Willd. is an important seed crop throughout the Andean region of South America. It is important as a regional food security crop for millions of impoverished rural inhabitants of the Andean Altiplano (high plains. Efforts to improve the crop have led to an increased focus on genetic research. We report the identification of 14,178 putative single nucleotide polymorphisms (SNPs using a genomic reduction protocol as well as the development of 511 functional SNP assays. The SNP assays are based on KASPar genotyping chemistry and were detected using the Fluidigm dynamic array platform. A diversity screen of 113 quinoa accessions showed that the minor allele frequency (MAF of the SNPs ranged from 0.02 to 0.50, with an average MAF of 0.28. Structure analysis of the quinoa diversity panel uncovered the two major subgroups corresponding to the Andean and coastal quinoa ecotypes. Linkage mapping of the SNPs in two recombinant inbred line populations produced an integrated linkage map consisting of 29 linkage groups with 20 large linkage groups, spanning 1404 cM with a marker density of 3.1 cM per SNP marker. The SNPs identified here represent important genomic tools needed in emerging plant breeding programs for advanced genetic analysis of agronomic traits in quinoa.

  2. Domestication rewired gene expression and nucleotide diversity patterns in tomato.

    Science.gov (United States)

    Sauvage, Christopher; Rau, Andrea; Aichholz, Charlotte; Chadoeuf, Joël; Sarah, Gautier; Ruiz, Manuel; Santoni, Sylvain; Causse, Mathilde; David, Jacques; Glémin, Sylvain

    2017-08-01

    Plant domestication has led to considerable phenotypic modifications from wild species to modern varieties. However, although changes in key traits have been well documented, less is known about the underlying molecular mechanisms, such as the reduction of molecular diversity or global gene co-expression patterns. In this study, we used a combination of gene expression and population genetics in wild and crop tomato to decipher the footprints of domestication. We found a set of 1729 differentially expressed genes (DEG) between the two genetic groups, belonging to 17 clusters of co-expressed DEG, suggesting that domestication affected not only individual genes but also regulatory networks. Five co-expression clusters were enriched in functional terms involving carbohydrate metabolism or epigenetic regulation of gene expression. We detected differences in nucleotide diversity between the crop and wild groups specific to DEG. Our study provides an extensive profiling of the rewiring of gene co-expression induced by the domestication syndrome in one of the main crop species. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

  3. Nucleotide diversity and linkage disequilibrium in five Lolium perenne genes with putative role in shoot branching

    DEFF Research Database (Denmark)

    Brazauskas, Gintaras; Pašakinskienė, Izolda; Asp, Torben

    2010-01-01

    Knowledge on nucleotide diversity and linkage disequilibrium (LD) patterns is prerequisite for association analyses. However, little is known about the nucleotide diversity in the evolutionary important ryegrass shoot morphology genes. Five candidate genes, LpIAA1, LpRUB1, LpBRI1, LpSHOOT1 and Lp...

  4. Direct detection of single-nucleotide polymorphisms in bacterial DNA by SNPtrap

    DEFF Research Database (Denmark)

    Grønlund, Hugo Ahlm; Moen, Birgitte; Hoorfar, Jeffrey

    2011-01-01

    A major challenge with single-nucleotide polymorphism (SNP) fingerprinting of bacteria and higher organisms is the combination of genome-wide screenings with the potential of multiplexing and accurate SNP detection. Single-nucleotide extension by the minisequencing principle represents a technolo...

  5. A novel Y-xylosidase, nucleotide sequence encoding it and use thereof.

    NARCIS (Netherlands)

    Graaff, de L.H.; Peij, van N.N.M.E.; Broeck, van den H.C.; Visser, J.

    1996-01-01

    A nucleotide sequence is provided which encodes a peptide having beta-xylosidase activity and exhibits at least 30mino acid identity with the amino acid sequence shown in SEQ ID NO. 1 or hybridises under stringent conditions with a nucleotide sequence shown in SEQ ID NO. 1, or a part thereof having

  6. The nucleotide sequence of satellite RNA in grapevine fanleaf virus, strain F13.

    Science.gov (United States)

    Fuchs, M; Pinck, M; Serghini, M A; Ravelonandro, M; Walter, B; Pinck, L

    1989-04-01

    The nucleotide sequence of cDNA copies of grapevine fanleaf virus (strain F13) satellite RNA has been determined. The primary structure obtained was 1114 nucleotides in length, excluding the poly(A) tail, and contained only one long open reading frame encoding a 341 residue, highly hydrophilic polypeptide of Mr37275. The coding sequence was bordered by a leader of 14 nucleotides and a 3'-terminal non-coding region of 74 nucleotides. No homology has been found with small satellite RNAs associated with other nepoviruses. Two limited homologies of eight nucleotides have been detected between the satellite RNA in grapevine fanleaf virus and those in tomato black ring virus, and a consensus sequence U.G/UGAAAAU/AU/AU/A at the 5' end of nepovirus RNAs is reported. A less extended consensus exists in this region in comovirus and picornavirus RNA.

  7. Mutations of the resistance to 6-thioguanine after exposure of Chinese hamster cells at G1 phase to x-radiation and subsequent treatment with cytosine arabinoside combined with hydroxyurea

    International Nuclear Information System (INIS)

    Elisova, T.V.; Feoktistova, T.P.; Stavrakova, N.M.

    1988-01-01

    A study was made of the effect of two-hour treatment of Chinese hamster cells with cytosine arabinoside (AraC) combined with hydroxyurea (HU) at the G 1 phase of the cell cycle on lethal and mutagenic effects of X-radiation (50 to 400 cGy). The inhibitors were shown to increase a spontaneous mutation level of the resistance to 6-thioguanine: this increase augmented by 3 times as the time the treatment increased from 1-2 to 6 h. However, while shorply enhancing the inactivating effect of X-radiation (the enhancement coefficient was 2.6) Arac+HU caused an additive, or a somewhat lesser, effect as estimated by the yield of mutations. It is suggested that AraC combined with hydroxyurea fail to modify the radiation-induced premutation damages

  8. R3D Align web server for global nucleotide to nucleotide alignments of RNA 3D structures.

    Science.gov (United States)

    Rahrig, Ryan R; Petrov, Anton I; Leontis, Neocles B; Zirbel, Craig L

    2013-07-01

    The R3D Align web server provides online access to 'RNA 3D Align' (R3D Align), a method for producing accurate nucleotide-level structural alignments of RNA 3D structures. The web server provides a streamlined and intuitive interface, input data validation and output that is more extensive and easier to read and interpret than related servers. The R3D Align web server offers a unique Gallery of Featured Alignments, providing immediate access to pre-computed alignments of large RNA 3D structures, including all ribosomal RNAs, as well as guidance on effective use of the server and interpretation of the output. By accessing the non-redundant lists of RNA 3D structures provided by the Bowling Green State University RNA group, R3D Align connects users to structure files in the same equivalence class and the best-modeled representative structure from each group. The R3D Align web server is freely accessible at http://rna.bgsu.edu/r3dalign/.

  9. Actinides and rare earths complexation with adenosine phosphate nucleotides

    International Nuclear Information System (INIS)

    Mostapha, Sarah

    2013-01-01

    Organophosphorus compounds are important molecules in both nuclear industry and living systems fields. Indeed, several extractants of organophosphorus compounds (such as TBP, HDEHP) are used in the nuclear fuel cycle reprocessing and in the biological field. For instance, the nucleotides are organophosphates which play a very important role in various metabolic processes. Although the literature on the interactions of actinides with inorganic phosphate is abundant, published studies with organophosphate compounds are generally limited to macroscopic and / or physiological approaches. The objective of this thesis is to study the structure of several organophosphorus compounds with actinides to reach a better understanding and develop new specific buildings blocks. The family of the chosen molecules for this procedure consists of three adenine nucleotides mono, bi and triphosphate (AMP, adenosine monophosphate - ADP, adenosine diphosphate - ATP, adenosine triphosphate) and an amino-alkylphosphate (AEP O-phosphoryl-ethanolamine). Complexes synthesis was conducted in aqueous and weakly acidic medium (2.8-4) for several lanthanides (III) (Lu, Yb, Eu) and actinides (U (VI), Th (IV) and Am (III)). Several analytical and spectroscopic techniques have been used to describe the organization of the synthesized complexes: spectrometric analysis performed by FTIR and NMR were used to identify the functional groups involved in the complexation, analysis by ESI-MS and pH-metric titration were used to determine the solution speciation and EXAFS analyzes were performed on Mars beamline of the SOLEIL synchrotron, have described the local cation environment, for both solution and solid compounds. Some theoretical approaches of DFT were conducted to identify stable structures in purpose of completing the experimental studies. All solid complexes (AMP, ADP, ATP and AEP) have polynuclear structures, while soluble ATP complexes are mononuclear. For all synthesized complexes, it has been

  10. Sequencing genes in silico using single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Zhang Xinyi

    2012-01-01

    Full Text Available Abstract Background The advent of high throughput sequencing technology has enabled the 1000 Genomes Project Pilot 3 to generate complete sequence data for more than 906 genes and 8,140 exons representing 697 subjects. The 1000 Genomes database provides a critical opportunity for further interpreting disease associations with single nucleotide polymorphisms (SNPs discovered from genetic association studies. Currently, direct sequencing of candidate genes or regions on a large number of subjects remains both cost- and time-prohibitive. Results To accelerate the translation from discovery to functional studies, we propose an in silico gene sequencing method (ISS, which predicts phased sequences of intragenic regions, using SNPs. The key underlying idea of our method is to infer diploid sequences (a pair of phased sequences/alleles at every functional locus utilizing the deep sequencing data from the 1000 Genomes Project and SNP data from the HapMap Project, and to build prediction models using flanking SNPs. Using this method, we have developed a database of prediction models for 611 known genes. Sequence prediction accuracy for these genes is 96.26% on average (ranges 79%-100%. This database of prediction models can be enhanced and scaled up to include new genes as the 1000 Genomes Project sequences additional genes on additional individuals. Applying our predictive model for the KCNJ11 gene to the Wellcome Trust Case Control Consortium (WTCCC Type 2 diabetes cohort, we demonstrate how the prediction of phased sequences inferred from GWAS SNP genotype data can be used to facilitate interpretation and identify a probable functional mechanism such as protein changes. Conclusions Prior to the general availability of routine sequencing of all subjects, the ISS method proposed here provides a time- and cost-effective approach to broadening the characterization of disease associated SNPs and regions, and facilitating the prioritization of candidate

  11. Association of single nucleotide polymorphisms with radiation-induced esophagitis

    International Nuclear Information System (INIS)

    Zhang Li; Wang Lvhua; Yang Ming; Ji Wei; Zhao Lujun; Yang Weizhi; Zhou Zongmei; Ou Guangfei; Lin Dongxin

    2008-01-01

    Objective: To evaluate the relationship between single nucleotide polymorphism(SNP) of candidate genes and radiation-induced esophagitis (RIE) in patients with lung cancer. Methods: Between Jan. 2004 and Aug. 2006, 170 patients with pathologically diagnosed lung cancer were enrolled in this study. The total target dose was 45-70 Gy (median 60 Gy). One hundred and thirty-two patients were treated with three-dimensional conformal radiotherapy(3DCRT) and 38 with two-dimensional radiotherapy(2DRT). Forty-one patients received radiotherapy alone, 78 received sequential chemoradiotherapy and 51 received concurrent chemoradiotherapy. Thirty-seven SNPs in 20 DNA repair genes were analyzed by using PCR- based restricted fragment length polymorphism (RFLP). These genes were apoptosis and inflammatory cytokine genes including ATM, ERCC1, XRCC3, XRCCI, XPD, XPC, XPG, NBS1, STK15, ZNF350, ADPRT, TP53, FAS, FASL, CYP2D6*4, CASPASE8, COX2,TGF-β, CD14 and ACE. The endpoint was grade ≥2 R I E. Results: Forty of the 170 patients developed grade ≥2 R I E, including 36 in grade 2 and 4 in grade 3. Univariate analysis revealed that radiation technique and concurrent chemoradiotherapy were statistically significant relatives to the incidence of R I E (P=0.032, 0.049), and both of them had the trend associating with the esophagitis (P=0.072, 0.094). An increased incidence of esophagitis was observed associating with the TGF-β 1 -509T and XPD 751Lys/Lys genotypes (χ 2 =5.65, P=0.017; χ 2 =3.84, P=0.048) in multivariate analysis. Conclusions: Genetic polymorphisms in TGF-β 1 gene and XPD gene have a significant association with radiation-induced esophagitis. (authors)

  12. Association of prediabetes-associated single nucleotide polymorphisms with microalbuminuria.

    Science.gov (United States)

    Choi, Jong Wook; Moon, Shinje; Jang, Eun Jung; Lee, Chang Hwa; Park, Joon-Sung

    2017-01-01

    Increased glycemic exposure, even below the diagnostic criteria for diabetes mellitus, is crucial in the pathogenesis of diabetic microvascular complications represented by microalbuminuria. Nonetheless, there is limited evidence regarding which single nucleotide polymorphisms (SNPs) are associated with prediabetes and whether genetic predisposition to prediabetes is related to microalbuminuria, especially in the general population. Our objective was to answer these questions. We conducted a genomewide association study (GWAS) separately on two population-based cohorts, Ansung and Ansan, in the Korean Genome and Epidemiology Study (KoGES). The initial GWAS was carried out on the Ansung cohort, followed by a replication study on the Ansan cohort. A total of 5682 native Korean participants without a significant medical illness were classified into either control group (n = 3153) or prediabetic group (n = 2529). In the GWAS, we identified two susceptibility loci associated with prediabetes, one at 17p15.3-p15.1 in the GCK gene and another at 7p15.1 in YKT6. When variations in GCK and YKT6 were used as a model of prediabetes, this genetically determined prediabetes increased microalbuminuria. Multiple logistic regression analyses revealed that fasting glucose concentration in plasma and SNP rs2908289 in GCK were associated with microalbuminuria, and adjustment for age, gender, smoking history, systolic blood pressure, waist circumference, and serum triglyceride levels did not attenuate this association. Our results suggest that prediabetes and the associated SNPs may predispose to microalbuminuria before the diagnosis of diabetes mellitus. Further studies are needed to explore the details of the physiological and molecular mechanisms underlying this genetic association.

  13. Association of prediabetes-associated single nucleotide polymorphisms with microalbuminuria

    Science.gov (United States)

    Choi, Jong Wook; Moon, Shinje; Jang, Eun Jung; Lee, Chang Hwa; Park, Joon-Sung

    2017-01-01

    Increased glycemic exposure, even below the diagnostic criteria for diabetes mellitus, is crucial in the pathogenesis of diabetic microvascular complications represented by microalbuminuria. Nonetheless, there is limited evidence regarding which single nucleotide polymorphisms (SNPs) are associated with prediabetes and whether genetic predisposition to prediabetes is related to microalbuminuria, especially in the general population. Our objective was to answer these questions. We conducted a genomewide association study (GWAS) separately on two population-based cohorts, Ansung and Ansan, in the Korean Genome and Epidemiology Study (KoGES). The initial GWAS was carried out on the Ansung cohort, followed by a replication study on the Ansan cohort. A total of 5682 native Korean participants without a significant medical illness were classified into either control group (n = 3153) or prediabetic group (n = 2529). In the GWAS, we identified two susceptibility loci associated with prediabetes, one at 17p15.3-p15.1 in the GCK gene and another at 7p15.1 in YKT6. When variations in GCK and YKT6 were used as a model of prediabetes, this genetically determined prediabetes increased microalbuminuria. Multiple logistic regression analyses revealed that fasting glucose concentration in plasma and SNP rs2908289 in GCK were associated with microalbuminuria, and adjustment for age, gender, smoking history, systolic blood pressure, waist circumference, and serum triglyceride levels did not attenuate this association. Our results suggest that prediabetes and the associated SNPs may predispose to microalbuminuria before the diagnosis of diabetes mellitus. Further studies are needed to explore the details of the physiological and molecular mechanisms underlying this genetic association. PMID:28158221

  14. Deregulation of ocular nucleotide homeostasis in patients with diabetic retinopathy.

    Science.gov (United States)

    Loukovaara, Sirpa; Sandholm, Jouko; Aalto, Kristiina; Liukkonen, Janne; Jalkanen, Sirpa; Yegutkin, Gennady G

    2017-02-01

    Clear signaling roles for ATP and adenosine have been established in all tissues, including the eye. The magnitude of signaling responses is governed by networks of enzymes; however, little is known about the regulatory mechanisms of purinergic signaling in the eye. By employing thin-layer chromatographic assays with 3 H-labeled substrates, this study aimed to evaluate the role of nucleotide homeostasis in the pathogenesis of vitreoretinal diseases in humans. We have identified soluble enzymes ecto-5'-nucleotidase/CD73, adenylate kinase-1, and nucleoside diphosphate kinase in the vitreous fluid that control active cycling between pro-inflammatory ATP and anti-inflammatory adenosine. Strikingly, patients with proliferative form of diabetic retinopathy (DR) had higher adenylate kinase activity and ATP concentration, when compared to non-proliferative DR eyes and non-diabetic controls operated for rhegmatogenous retinal detachment, macular hole, and pucker. The non-parametric correlation analysis revealed positive correlations between intravitreal adenylate kinase and concentrations of ATP, ADP, and other angiogenic (angiopoietins-1 and -2), profibrotic (transforming growth factor-β1), and proteolytic (matrix metalloproteinase-9) factors but not erythropoietin and VEGF. Immunohistochemical staining of postmortem human retina additionally revealed selective expression of ecto-5'-nucleotidase/CD73 on the rod-and-cone-containing photoreceptor cells. Collectively, these findings provide novel insights into the regulatory mechanisms that influence purinergic signaling in diseased eye and open up new possibilities in the development of enzyme-targeted therapeutic approaches for prevention and treatment of DR. Ecto-5'-nucleotidase/CD73 and adenylate kinase-1 circulate in human vitreous fluid. Adenylate kinase activity is high in diabetic eyes with proliferative retinopathy. Diabetic eyes display higher intravitreal ATP/ADP ratio than non-diabetic controls. Soluble adenylate

  15. Degradation of brown adipocyte purine nucleotides regulates uncoupling protein 1 activity

    Directory of Open Access Journals (Sweden)

    Tobias Fromme

    2018-02-01

    Full Text Available Objective: Non-shivering thermogenesis in mammalian brown adipose tissue depends on thermogenic uncoupling protein 1. Its activity is triggered by free fatty acids while purine nucleotides mediate inhibition. During activation, it is thought that free fatty acids overcome purine-mediated inhibition. We measured the cellular concentration and the release of purine nucleotide metabolites to uncover a possible role of purine nucleotide degradation in uncoupling protein 1 activation. Methods: With mass spectrometry, purine nucleotide metabolites were quantified in cellular homogenates and supernatants of cultured primary brown adipocytes. We also determined oxygen consumption in response to a β-adrenergic agonist. Results: Upon adrenergic activation, brown adipocytes decreased the intracellular concentration of inhibitory nucleotides (ATP, ADP, GTP and GDP and released the respective degradation products. At the same time, an increase in cellular calcium occurred. None of these phenomena occurred in white adipocytes or myotubes. The brown adipocyte expression of enzymes implicated in purine metabolic remodeling is altered upon cold exposure. Pharmacological and genetic interference of purine metabolism altered uncoupling protein 1 mediated uncoupled respiration. Conclusion: Adrenergic stimulation of brown adipocytes lowers the intracellular concentration of purine nucleotides, thereby contributing to uncoupling protein 1 activation. Keywords: Purine nucleotides, Uncoupling protein 1, Brown adipose tissue, Non-shivering thermogenesis, HILIC-MS/MS, Guanosine monophosphate reductase

  16. Molecular recognition of nucleotides in micelles and the development and expansion of a chemistry outreach program

    Science.gov (United States)

    Schechinger, Linda Sue

    I. To investigate the delivery of nucleotide-based drugs, we are studying molecular recognition of nucleotide derivatives in environments that are similar to cell membranes. The Nowick group previously discovered that membrane-like surfactant micelles tetradecyltrimethylammonium bromide (TTAB) micelle facilitate molecular of adenosine monophosphate (AMP) recognition. The micelles bind nucleotides by means of electrostatic interactions and hydrogen bonding. We observed binding by following 1H NMR chemical shift changes of unique hexylthymine protons upon addition of AMP. Cationic micelles are required for binding. In surfactant-free or sodium dodecylsulfate solutions, no hydrogen bonding is observed. These observations suggest that the cationic surfactant headgroups bind the nucleotide phosphate group, while the intramicellar base binds the nucleotide base. The micellar system was optimized to enhance binding and selectivity for adenosine nucleotides. The selectivity for adenosine and the number of phosphate groups attached to the adenosine were both investigated. Addition of cytidine, guanidine, or uridine monophosphates, results in no significant downfield shifting of the NH resonance. Selectivity for the phosphate is limited, since adenosine mono-, di-, and triphosphates all have similar binding constants. We successfully achieved molecular recognition of adenosine nucleotides in micellar environments. There is significant difference in the binding interactions between the adenosine nucleotides and three other natural nucleotides. II. The UCI Chemistry Outreach Program (UCICOP) addresses the declining interest of the nations youth for science. UCICOP brings fun and exciting chemistry experiments to local high schools, to remind students that science is fun and has many practical uses. Volunteer students and alumni of UCI perform the demonstrations using scripts and material provided by UCICOP. The preparation of scripts and materials is done by two coordinators

  17. Subnanomole detection and quantitation of high specific activity 32P-nucleotides

    International Nuclear Information System (INIS)

    Coniglio, C.; Pappas, G.; Gill, W.J.; Kashdan, M.; Maniscalco, M.

    1991-01-01

    Microbore liquid chromatography utilizes conventional HPLC and ultraviolet detection principles to determine subnanomole mass quantities of biologically significant molecules. This system takes advantage of specifically designed microflow equipment to analyze ultraviolet absorbing species at the picomole range. 32P-labeled nucleotides are examples of compounds routinely used at picomole quantities that are extremely difficult to accurately quantify using standard mass measurement techniques. The procedure described in this paper has the capability of measuring nucleotides down to 10 pmol using commercially available microbore ultraviolet detection equipment. The technique can be used to accurately measure the specific activity of as little as 10 microCi of an aqueous 32P-nucleotide solution

  18. A novel genome signature based on inter-nucleotide distances profiles for visualization of metagenomic data

    Science.gov (United States)

    Xie, Xian-Hua; Yu, Zu-Guo; Ma, Yuan-Lin; Han, Guo-Sheng; Anh, Vo

    2017-09-01

    There has been a growing interest in visualization of metagenomic data. The present study focuses on the visualization of metagenomic data using inter-nucleotide distances profile. We first convert the fragment sequences into inter-nucleotide distances profiles. Then we analyze these profiles by principal component analysis. Finally the principal components are used to obtain the 2-D scattered plot according to their source of species. We name our method as inter-nucleotide distances profiles (INP) method. Our method is evaluated on three benchmark data sets used in previous published papers. Our results demonstrate that the INP method is good, alternative and efficient for visualization of metagenomic data.

  19. Pro-inflammatory cytokine single nucleotide polymorphisms in Kawasaki disease.

    Science.gov (United States)

    Assari, Raheleh; Aghighi, Yahya; Ziaee, Vahid; Sadr, Maryam; Rahmani, Farzaneh; Rezaei, Arezou; Sadr, Zeinab; Moradinejad, Mohammad Hassan; Raeeskarami, Seyed Reza; Rezaei, Nima

    2016-07-25

    Kawasaki disease (KD) is a systemic vasculitis of children associated with cardiovascular sequelae. Proinflammatory cytokines play a major role in KD pathogenesis. However, their role is both influenced and modified by regulatory T-cells. IL-1 gene cluster, IL-6 and TNF-α polymorphisms have shown significant associations with some vasculitides. Herein we investigated their role in KD. Fifty-five patients with KD who were randomly selected from referrals to the main pediatric hospital were enrolled in this case-control study. Single nucleotide polymorphisms (SNPs) of the following genes were assessed in patients and 140 healthy subjects as control group: IL-1α at -889 (rs1800587), IL-1β at -511 (rs16944), IL-1β at +3962 (rs1143634), IL-1R at Pst-I 1970 (rs2234650), IL-1RN/A at Mspa-I 11100 (rs315952), TNF-α at -308 (rs1800629), TNF-α at -238, IL-6 at -174 (rs1800795) and IL-6 at +565. Twenty-one percent of the control group had A allele at TNF-α -238 while only 8% of KD patients had A allele at this position (P = 0.003, OR [95%CI] = 0.32 [0.14-0.71]). Consistently, TNF-α genotype GG at -238 had significant association with KD (OR [95% CI] = 4.31 [1.79-10.73]). Most controls carried the CG genotype at IL-6 -174 (n = 93 [66.9%]) while GG genotype was the most common genotype (n = 27 [49%]) among patients. Carriers of the GG haplotype at TNF-α (-308, -238) were significantly more prevalent among the KD group. No association was found between IL-1 gene cluster, allelic or haplotypic variants and KD. TNF-α GG genotype at -238 and GG haplotype at positions -308 and -238 were associated with KD in an Iranian population. © 2016 Asia Pacific League of Associations for Rheumatology and John Wiley & Sons Australia, Ltd.

  20. Unraveling the cellular context of cyclic nucleotide signaling proteins by chemical proteomics

    NARCIS (Netherlands)

    Corradini, E.

    2015-01-01

    Understanding the molecular mechanisms which regulate signal transduction is fundamental to the development of therapeutic molecules for the treatment of several diseases. In particular, signaling proteins, such as cyclic nucleotide dependent enzymes are the orchestrators of many tissue functions.

  1. WEB-server for search of a periodicity in amino acid and nucleotide sequences

    Science.gov (United States)

    E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.

    2017-12-01

    A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.

  2. Study on the change of cyclic nucleotide in mice with yang vacuity disease

    International Nuclear Information System (INIS)

    Zhu Xinhua; Shen Ling; Wang Shuguang

    2002-01-01

    To study the relation between Yang Vacuity disease happening, development and cyclic nucleotide response, and prove curative effects of some assisting Yang drug, the plasma cAMP, cGMP and cAMP/cGMP levels were detected by radioimmunoassay in the Yang Vacuity group and curing group. Results: showed: (1) Yang Vacuity group: the symptoms were clear, death rate was high, the plasma cAMP and cAMP/cGMP increased obviously, it suggests that cyclic nucleotide was imbalance. (2) Curing group: the symptoms of Yang Vacuity disease were improved obviously, death rate dropped, cAMP declined, cGMP increased, while cAMP/cGMP reached the normal level, it showed that cyclic nucleotide of the body had altered greatly. (3) It is a reference target for Yang Vacuity. (4) Assisting yang drug (Sini Decoction) had a close relation with correcting imbalance of cyclic nucleotide

  3. Efficient reverse transcription using locked nucleic acid nucleotides towards the evolution of nuclease resistant RNA aptamers

    DEFF Research Database (Denmark)

    Crouzier, Lucile; Dubois, Camille; Edwards, Stacey L

    2012-01-01

    We found that SuperScript® III Reverse Transcriptase is an efficient enzyme for the recognition of LNA nucleotides, making it a prime candidate to be used in de novo selection of LNA containing RNA aptamers....

  4. The effect of exhaustive exercise on the concentration of purine nucleotides and their metabolites in erythrocytes

    OpenAIRE

    E Skotnicka; I Baranowska-Bosiacka; W Dudzińska; M Suska; R Nowak; K Krupecki; AJ Hłyńczak

    2008-01-01

    In this study we tried to obtain a complete overview of purine nucleotide metabolism in erythrocytes before and during an incremental, intermittent exhaustive exercise bout protocol for sportsmen (high-performance rowers) and untrained, healthy, active volunteers. Erythrocyte levels of the main nucleotides (ATP, ADP, AMP, GTP, GDP, GMP, IMP, NAD and NADP ), nucleosides (Ado, Guo, Ino) and the base Hyp were measured using the HPLC method. The parameters that can be deducted from their concent...

  5. Guanine nucleotides stimulate hydrolysis of phosphatidyl inositol bis phosphate in human myelin membranes

    International Nuclear Information System (INIS)

    Boulias, C.; Moscarello, M.A.

    1989-01-01

    Phosphodiesterase activity was stimulated in myelin membranes in the presence of guanine nucleotide analogues. This activity was reduced in myelin membranes which had been adenosine diphosphate ribosylated in the presence of cholera toxin which ADP-ribosylated three proteins of Mr 46,000, 43,000 and 18,500. Aluminum fluoride treatment of myelin had the same stimulatory effects on phosphodiesterase activity as did the guanine nucleotides

  6. Critical role of DNA intercalation in enzyme-catalyzed nucleotide flipping

    Science.gov (United States)

    Hendershot, Jenna M.; O'Brien, Patrick J.

    2014-01-01

    Nucleotide flipping is a common feature of DNA-modifying enzymes that allows access to target sites within duplex DNA. Structural studies have identified many intercalating amino acid side chains in a wide variety of enzymes, but the functional contribution of these intercalating residues is poorly understood. We used site-directed mutagenesis and transient kinetic approaches to dissect the energetic contribution of intercalation for human alkyladenine DNA glycosylase, an enzyme that initiates repair of alkylation damage. When AAG flips out a damaged nucleotide, the void in the duplex is filled by a conserved tyrosine (Y162). We find that tyrosine intercalation confers 140-fold stabilization of the extrahelical specific recognition complex, and that Y162 functions as a plug to slow the rate of unflipping by 6000-fold relative to the Y162A mutant. Surprisingly, mutation to the smaller alanine side chain increases the rate of nucleotide flipping by 50-fold relative to the wild-type enzyme. This provides evidence against the popular model that DNA intercalation accelerates nucleotide flipping. In the case of AAG, DNA intercalation contributes to the specific binding of a damaged nucleotide, but this enhanced specificity comes at the cost of reduced speed of nucleotide flipping. PMID:25324304

  7. Biochemistry of an olfactory purinergic system: dephosphorylation of excitatory nucleotides and uptake of adenosine

    Energy Technology Data Exchange (ETDEWEB)

    Trapido-Rosenthal, H G; Carr, W E; Gleeson, R A

    1987-10-01

    The olfactory organ of the spiny lobster, Panulirus argus, is composed of chemosensory sensilla containing the dendrites of primary chemosensory neurons. Receptors on these dendrites are activated by the nucleotides AMP, ADP, and ATP but not by the nucleoside adenosine. It is shown here that the lobster chemosensory sensilla contain enzymes that dephosphorylate excitatory nucleotides and an uptake system that internalizes the nonexcitatory dephosphorylated product adenosine. The uptake of (/sup 3/H)-adenosine is saturable with increasing concentration, linear with time for up to 3 h, sodium dependent, insensitive to moderate pH changes and has a Km of 7.1 microM and a Vmax of 5.2 fmol/sensillum/min (573 fmol/micrograms of protein/min). Double-label experiments show that sensilla dephosphorylate nucleotides extracellularly; /sup 3/H from adenine-labeled AMP or ATP is internalized, whereas 32P from phosphate-labeled nucleotides is not. The dephosphorylation of AMP is very rapid; /sup 3/H from AMP is internalized at the same rate as /sup 3/H from adenosine. Sensillar 5'-ectonucleotidase activity is inhibited by ADP and the ADP analog alpha, beta-methylene ADP. Collectively, these results indicate that the enzymes and the uptake system whereby chemosensory sensilla of the lobster inactivate excitatory nucleotides and clear adenosine from extracellular spaces are very similar to those present in the internal tissues of vertebrates, where nucleotides have many neuroactive effects.

  8. Regulation of Ca2+ release from mitochondria by the oxidation-reduction state of pyridine nucleotides

    Science.gov (United States)

    Lehninger, Albert L.; Vercesi, Anibal; Bababunmi, Enitan A.

    1978-01-01

    Mitochondria from normal rat liver and heart, and also Ehrlich tumor cells, respiring on succinate as energy source in the presence of rotenone (to prevent net electron flow to oxygen from the endogenous pyridine nucleotides), rapidly take up Ca2+ and retain it so long as the pyridine nucleotides are kept in the reduced state. When acetoacetate is added to bring the pyridine nucleotides into a more oxidized state, Ca2+ is released to the medium. A subsequent addition of a reductant of the pyridine nucleotides such as β-hydroxybutyrate, glutamate, or isocitrate causes reuptake of the released Ca2+. Successive cycles of Ca2+ release and uptake can be induced by shifting the redox state of the pyridine nucleotides to more oxidized and more reduced states, respectively. Similar observations were made when succinate oxidation was replaced as energy source by ascorbate oxidation or by the hydrolysis of ATP. These and other observations form the basis of a hypothesis for feedback regulation of Ca2+-dependent substrate- or energy-mobilizing enzymatic reactions by the uptake or release of mitochondrial Ca2+, mediated by the cytosolic phosphate potential and the ATP-dependent reduction of mitochondrial pyridine nucleotides by reversal of electron transport. Images PMID:25436

  9. GDP-bound and nucleotide-free intermediates of the guanine nucleotide exchange in the Rab5·Vps9 system.

    Science.gov (United States)

    Uejima, Tamami; Ihara, Kentaro; Goh, Tatsuaki; Ito, Emi; Sunada, Mariko; Ueda, Takashi; Nakano, Akihiko; Wakatsuki, Soichi

    2010-11-19

    Many GTPases regulate intracellular transport and signaling in eukaryotes. Guanine nucleotide exchange factors (GEFs) activate GTPases by catalyzing the exchange of their GDP for GTP. Here we present crystallographic and biochemical studies of a GEF reaction with four crystal structures of Arabidopsis thaliana ARA7, a plant homolog of Rab5 GTPase, in complex with its GEF, VPS9a, in the nucleotide-free and GDP-bound forms, as well as a complex with aminophosphonic acid-guanylate ester and ARA7·VPS9a(D185N) with GDP. Upon complex formation with ARA7, VPS9 wedges into the interswitch region of ARA7, inhibiting the coordination of Mg(2+) and decreasing the stability of GDP binding. The aspartate finger of VPS9a recognizes GDP β-phosphate directly and pulls the P-loop lysine of ARA7 away from GDP β-phosphate toward switch II to further destabilize GDP for its release during the transition from the GDP-bound to nucleotide-free intermediates in the nucleotide exchange reaction.

  10. Schizosaccharomyces pombe MutSα and MutLα Maintain Stability of Tetra-Nucleotide Repeats and Msh3 of Hepta-Nucleotide Repeats

    Directory of Open Access Journals (Sweden)

    Desirée Villahermosa

    2017-05-01

    Full Text Available Defective mismatch repair (MMR in humans is associated with colon cancer and instability of microsatellites, that is, DNA sequences with one or several nucleotides repeated. Key factors of eukaryotic MMR are the heterodimers MutSα (Msh2-Msh6, which recognizes base-base mismatches and unpaired nucleotides in DNA, and MutLα (Mlh1-Pms1, which facilitates downstream steps. In addition, MutSβ (Msh2-Msh3 recognizes DNA loops of various sizes, although our previous data and the data presented here suggest that Msh3 of Schizosaccharomyces pombe does not play a role in MMR. To test microsatellite stability in S. pombe and hence DNA loop repair, we have inserted tetra-, penta-, and hepta-nucleotide repeats in the ade6 gene and determined their Ade+ reversion rates and spectra in wild type and various mutants. Our data indicate that loops with four unpaired nucleotides in the nascent and the template strand are the upper limit of MutSα- and MutLα-mediated MMR in S. pombe. Stability of hepta-nucleotide repeats requires Msh3 and Exo1 in MMR-independent processes as well as the DNA repair proteins Rad50, Rad51, and Rad2FEN1. Most strikingly, mutation rates in the double mutants msh3 exo1 and msh3 rad51 were decreased when compared to respective single mutants, indicating that Msh3 prevents error prone processes carried out by Exo1 and Rad51. We conclude that Msh3 has no obvious function in MMR in S. pombe, but contributes to DNA repeat stability in MMR-independent processes.

  11. Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA gamma.

    Science.gov (United States)

    Gustafson, G; Hunter, B; Hanau, R; Armour, S L; Jackson, A O

    1987-06-01

    The complete nucleotide sequences of RNA gamma from the Type and ND18 strains of barley stripe mosaic virus (BSMV) have been determined. The sequences are 3164 (Type) and 2791 (ND18) nucleotides in length. Both sequences contain a 5'-noncoding region (87 or 88 nucleotides) which is followed by a long open reading frame (ORF1). A 42-nucleotide intercistronic region separates ORF1 from a second, shorter open reading frame (ORF2) located near the 3'-end of the RNA. There is a high degree of homology between the Type and ND18 strains in the nucleotide sequence of ORF1. However, the Type strain contains a 366 nucleotide direct tandem repeat within ORF1 which is absent in the ND18 strain. Consequently, the predicted translation product of Type RNA gamma ORF1 (mol wt 87,312) is significantly larger than that of ND18 RNA gamma ORF1 (mol wt 74,011). The amino acid sequence of the ORF1 polypeptide contains homologies with putative RNA polymerases from other RNA viruses, suggesting that this protein may function in replication of the BSMV genome. The nucleotide sequence of RNA gamma ORF2 is nearly identical in the Type and ND18 strains. ORF2 codes for a polypeptide with a predicted molecular weight of 17,209 (Type) or 17,074 (ND18) which is known to be translated from a subgenomic (sg) RNA. The initiation point of this sgRNA has been mapped to a location 27 nucleotides upstream of the ORF2 initiation codon in the intercistronic region between ORF1 and ORF2. The sgRNA is not coterminal with the 3'-end of the genomic RNA, but instead contains heterogeneous poly(A) termini up to 150 nucleotides long (J. Stanley, R. Hanau, and A. O. Jackson, 1984, Virology 139, 375-383). In the genomic RNA gamma, ORF2 is followed by a short poly(A) tract and a 238-nucleotide tRNA-like structure.

  12. Bacterial Signaling Nucleotides Inhibit Yeast Cell Growth by Impacting Mitochondrial and Other Specifically Eukaryotic Functions.

    Science.gov (United States)

    Hesketh, Andy; Vergnano, Marta; Wan, Chris; Oliver, Stephen G

    2017-07-25

    We have engineered Saccharomyces cerevisiae to inducibly synthesize the prokaryotic signaling nucleotides cyclic di-GMP (cdiGMP), cdiAMP, and ppGpp in order to characterize the range of effects these nucleotides exert on eukaryotic cell function during bacterial pathogenesis. Synthetic genetic array (SGA) and transcriptome analyses indicated that, while these compounds elicit some common reactions in yeast, there are also complex and distinctive responses to each of the three nucleotides. All three are capable of inhibiting eukaryotic cell growth, with the guanine nucleotides exhibiting stronger effects than cdiAMP. Mutations compromising mitochondrial function and chromatin remodeling show negative epistatic interactions with all three nucleotides. In contrast, certain mutations that cause defects in chromatin modification and ribosomal protein function show positive epistasis, alleviating growth inhibition by at least two of the three nucleotides. Uniquely, cdiGMP is lethal both to cells growing by respiration on acetate and to obligately fermentative petite mutants. cdiGMP is also synthetically lethal with the ribonucleotide reductase (RNR) inhibitor hydroxyurea. Heterologous expression of the human ppGpp hydrolase Mesh1p prevented the accumulation of ppGpp in the engineered yeast and restored cell growth. Extensive in vivo interactions between bacterial signaling molecules and eukaryotic gene function occur, resulting in outcomes ranging from growth inhibition to death. cdiGMP functions through a mechanism that must be compensated by unhindered RNR activity or by functionally competent mitochondria. Mesh1p may be required for abrogating the damaging effects of ppGpp in human cells subjected to bacterial infection. IMPORTANCE During infections, pathogenic bacteria can release nucleotides into the cells of their eukaryotic hosts. These nucleotides are recognized as signals that contribute to the initiation of defensive immune responses that help the infected

  13. Multifactor dimensionality reduction analysis identifies specific nucleotide patterns promoting genetic polymorphisms

    Directory of Open Access Journals (Sweden)

    Arehart Eric

    2009-03-01

    Full Text Available Abstract Background The fidelity of DNA replication serves as the nidus for both genetic evolution and genomic instability fostering disease. Single nucleotide polymorphisms (SNPs constitute greater than 80% of the genetic variation between individuals. A new theory regarding DNA replication fidelity has emerged in which selectivity is governed by base-pair geometry through interactions between the selected nucleotide, the complementary strand, and the polymerase active site. We hypothesize that specific nucleotide combinations in the flanking regions of SNP fragments are associated with mutation. Results We modeled the relationship between DNA sequence and observed polymorphisms using the novel multifactor dimensionality reduction (MDR approach. MDR was originally developed to detect synergistic interactions between multiple SNPs that are predictive of disease susceptibility. We initially assembled data from the Broad Institute as a pilot test for the hypothesis that flanking region patterns associate with mutagenesis (n = 2194. We then confirmed and expanded our inquiry with human SNPs within coding regions and their flanking sequences collected from the National Center for Biotechnology Information (NCBI database (n = 29967 and a control set of sequences (coding region not associated with SNP sites randomly selected from the NCBI database (n = 29967. We discovered seven flanking region pattern associations in the Broad dataset which reached a minimum significance level of p ≤ 0.05. Significant models (p Conclusion The present study represents the first use of this computational methodology for modeling nonlinear patterns in molecular genetics. MDR was able to identify distinct nucleotide patterning around sites of mutations dependent upon the observed nucleotide change. We discovered one flanking region set that included five nucleotides clustered around a specific type of SNP site. Based on the strongly associated patterns identified in

  14. Vγ9Vδ2 T cell activation by strongly agonistic nucleotidic phosphoantigens.

    Science.gov (United States)

    Moulin, Morgane; Alguacil, Javier; Gu, Siyi; Mehtougui, Asmaa; Adams, Erin J; Peyrottes, Suzanne; Champagne, Eric

    2017-12-01

    Human Vγ9Vδ2 T cells can sense through their TCR tumor cells producing the weak endogenous phosphorylated antigen isopentenyl pyrophosphate (IPP), or bacterially infected cells producing the strong agonist hydroxyl dimethylallyl pyrophosphate (HDMAPP). The recognition of the phosphoantigen is dependent on its binding to the intracellular B30.2 domain of butyrophilin BTN3A1. Most studies have focused on pyrophosphate phosphoantigens. As triphosphate nucleotide derivatives are naturally co-produced with IPP and HDMAPP, we analyzed their specific properties using synthetic nucleotides derived from HDMAPP. The adenylated, thymidylated and uridylated triphosphate derivatives were found to activate directly Vγ9Vδ2 cell lines as efficiently as HDMAPP in the absence of accessory cells. These antigens were inherently resistant to terminal phosphatases, but apyrase, when added during a direct stimulation of Vγ9Vδ2 cells, abrogated their stimulating activity, indicating that their activity required transformation into strong pyrophosphate agonists by a nucleotide pyrophosphatase activity which is present in serum. Tumor cells can be sensitized with nucleotide phosphoantigens in the presence of apyrase to become stimulatory, showing that this can occur before their hydrolysis into pyrophosphates. Whereas tumors sensitized with HDMAPP rapidly lost their stimulatory activity, sensitization with nucleotide derivatives, in particular with the thymidine derivative, induced long-lasting stimulating ability. Using isothermal titration calorimetry, binding of some nucleotide derivatives to BTN3A1 intracellular domain was found to occur with an affinity similar to that of IPP, but much lower than that of HDMAPP. Thus, nucleotide phosphoantigens are precursors of pyrophosphate antigens which can deliver strong agonists intracellularly resulting in prolonged and strengthened activity.

  15. pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.

    Science.gov (United States)

    Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo

    2009-11-23

    Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.

  16. Reversal of Proximal Renal Tubular Dysfunction after Nucleotide Analogue Withdrawal in Chronic Hepatitis B

    Directory of Open Access Journals (Sweden)

    Abhasnee Sobhonslidsuk

    2017-01-01

    Full Text Available Aims. Proximal renal tubular dysfunction (PRTD is an infrequent complication after nucleotide analogue therapy. We evaluated the outcomes of PRTD and nephrotoxicity after nucleotide analogue withdrawal in chronic hepatitis B (CHB. Methods. A longitudinal follow-up study was performed in patients with PRTD after nucleotide analogue discontinuation. Serum and urine were collected at baseline and every 3 months for one year. The fractional excretion of phosphate (PO4, uric acid (UA, and potassium and tubular maximal reabsorption rate of PO4 to glomerular filtration rate (TmPO4/GFR were calculated. Renal losses were defined based on the criteria of substance losses. Subclinical PRTD and overt PRTD were diagnosed when 2 and ≥3 criteria were identified. Results. Eight subclinical and eight overt PRTD patients were enrolled. After nucleotide analogue withdrawal, there were overall improvements in GFR, serum PO4, and UA. Renal loss of PO4, UA, protein, and β2-microglobulin reduced over time. At one year, complete reversal of PRTD was seen in 13 patients (81.2%. Improvements in PRTD were seen in all but one patient. Conclusion. One year after nucleotide analogue withdrawal, PRTD was resolved in most patients. Changes in TmPO4/GFR, urinary protein, and β2-microglobulin indicate that urinary biomarkers may represent an early sign of PRTD recovery.

  17. Enhanced NMR signal detection of imino protons in RNA molecules containing 3' dangling nucleotides

    International Nuclear Information System (INIS)

    Amborski, Andrew N.; Johnson, Philip E.

    2008-01-01

    We present a method for improving the quality of nuclear magnetic resonance (NMR) spectra involving exchangeable protons near the base of the stem of RNA hairpin molecules. NMR spectra of five different RNA hairpins were compared. These hairpins consisted of a native RNA structure and four molecules each having different unpaired, or dangling, nucleotides at the 3' end. NMR experiments were acquired in water for each construct and the quality of the imino proton spectral regions were examined. The imino resonances near the base of the stem of the wild type RNA structure were not observed due to breathing motions. However, a significant increase in spectral quality for molecules with dangling 3' adenosine or guanosine nucleotides was observed, with imino protons detected in these constructs that were not observed in the wild type construct. A modest improvement in spectral quality was seen for the construct with a 3' unpaired uridine, whereas no significant improvement was observed for a 3' unpaired cytidine. This improvement in NMR spectral quality mirrors the increased thermodynamic stability observed for 3' unpaired nucleotides which is dependant on the stacking interactions of these nucleotides against the base of the stem. The use of a dangling 3' adenosine nucleotide represents an easy method to significantly improve the quality of NMR spectra of RNA molecules

  18. Guanine nucleotide binding to the Bateman domain mediates the allosteric inhibition of eukaryotic IMP dehydrogenases

    Science.gov (United States)

    Buey, Rubén M.; Ledesma-Amaro, Rodrigo; Velázquez-Campoy, Adrián; Balsera, Mónica; Chagoyen, Mónica; de Pereda, José M.; Revuelta, José L.

    2015-11-01

    Inosine-5'-monophosphate dehydrogenase (IMPDH) plays key roles in purine nucleotide metabolism and cell proliferation. Although IMPDH is a widely studied therapeutic target, there is limited information about its physiological regulation. Using Ashbya gossypii as a model, we describe the molecular mechanism and the structural basis for the allosteric regulation of IMPDH by guanine nucleotides. We report that GTP and GDP bind to the regulatory Bateman domain, inducing octamers with compromised catalytic activity. Our data suggest that eukaryotic and prokaryotic IMPDHs might have developed different regulatory mechanisms, with GTP/GDP inhibiting only eukaryotic IMPDHs. Interestingly, mutations associated with human retinopathies map into the guanine nucleotide-binding sites including a previously undescribed non-canonical site and disrupt allosteric inhibition. Together, our results shed light on the mechanisms of the allosteric regulation of enzymes mediated by Bateman domains and provide a molecular basis for certain retinopathies, opening the door to new therapeutic approaches.

  19. Optimization time synthesis of nucleotide labelled [γ-32P]-ATP

    International Nuclear Information System (INIS)

    Rahman, Wira Y; Sarmini, Endang; Herlina; Lubis, Hotman; Triyanto; Hambali

    2013-01-01

    Adenosine triphosphate-labelled with γ- 32 P([γ- 32 p]-ATP) has been widely used in the biotechnology research, usually as a tracer to study aspects of physiological and pathological processes. In order to support biotechnology research in Indonesia, a process for production of [γ- 32 P]-ATP with enzymatic reaction was used as precursors DL-glyceraldehydde 3-phosphate, Adenosine Diphosphate (ADP) and H 3 32 PO 4 , and enzyme glyceraldehid 3-phosphate dehydrogenase, 3-phosphoglyceryc phosphokinase and lactate dehydrogenase. Optimization of incubation time labeled nucleotide synthesis process is performed to find the optimum conditions, in terms of the most advantageous time in the synthesis process. With the success of the synthesis and optimization is done incubation time of synthesis labeled nucleotide, the result suggested can be used for producing [γ- 32 P] -ATP to support the provision of radiolabeled nucleotide for biotechnology research in Indonesia. (author)

  20. Heated oligonucleotide ligation assay (HOLA): an affordable single nucleotide polymorphism assay.

    Science.gov (United States)

    Black, W C; Gorrochotegui-Escalante, N; Duteau, N M

    2006-03-01

    Most single nucleotide polymorphism (SNP) detection requires expensive equipment and reagents. The oligonucleotide ligation assay (OLA) is an inexpensive SNP assay that detects ligation between a biotinylated "allele-specific detector" and a 3' fluorescein-labeled "reporter" oligonucleotide. No ligation occurs unless the 3' detector nucleotide is complementary to the SNP nucleotide. The original OLA used chemical denaturation and neutralization. Heated OLA (HOLA) instead uses a thermal stable ligase and cycles of denaturing and hybridization for ligation and SNP detection. The cost per genotype is approximately US$1.25 with two-allele SNPs or approximately US$1.75 with three-allele SNPs. We illustrate the development of HOLA for SNP detection in the Early Trypsin and Abundant Trypsin loci in the mosquito Aedes aegypti (L.) and at the a-glycerophosphate dehydrogenase locus in the mosquito Anopheles gambiae s.s.

  1. The Fanconi anaemia components UBE2T and FANCM are functionally linked to nucleotide excision repair.

    Directory of Open Access Journals (Sweden)

    Ian R Kelsall

    Full Text Available The many proteins that function in the Fanconi anaemia (FA monoubiquitylation pathway initiate replicative DNA crosslink repair. However, it is not clear whether individual FA genes participate in DNA repair pathways other than homologous recombination and translesion bypass. Here we show that avian DT40 cell knockouts of two integral FA genes--UBE2T and FANCM are unexpectedly sensitive to UV-induced DNA damage. Comprehensive genetic dissection experiments indicate that both of these FA genes collaborate to promote nucleotide excision repair rather than translesion bypass to protect cells form UV genotoxicity. Furthermore, UBE2T deficiency impacts on the efficient removal of the UV-induced photolesion cyclobutane pyrimidine dimer. Therefore, this work reveals that the FA pathway shares two components with nucleotide excision repair, intimating not only crosstalk between the two major repair pathways, but also potentially identifying a UBE2T-mediated ubiquitin-signalling response pathway that contributes to nucleotide excision repair.

  2. De novo synthesis of purine nucleotides in different fiber types of rat skeletal muscle

    International Nuclear Information System (INIS)

    Tullson, P.C.; John-Alder, H.; Hood, D.A.; Terjung, R.L.

    1986-01-01

    The contribution of de novo purine nucleotide synthesis to nucleotide metabolism in skeletal muscles is not known. The authors have determined rates of de novo synthesis in soleus (slow-twitch red), red gastrocnemius (fast-twitch red), and white gastrocnemius (fast-twitch white) using the perfused rat hindquarter. 14 C glycine incorporation into ATP was linear after 1 and 2 hours of perfusion with 0.2 mM added glycine. The intracellular (I) and extracellular (E) specific activity of 14 C glycine was determined by HPLC of phenylisothiocyanate derivatives of neutralized PCA extracts. The rates of de novo synthesis when expressed relative to muscle ATP content show slow and fast-twitch red muscles to be similar and about twice as great as fast-twitch white muscles. This could represent a greater turnover of the adenine nucleotide pool in more oxidative red muscle types

  3. Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica.

    Directory of Open Access Journals (Sweden)

    Shui-Lian He

    Full Text Available Foxtail millet (Setaria italica (L. Beauv is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1 in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

  4. Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica).

    Science.gov (United States)

    He, Shui-Lian; Yang, Yang; Morrell, Peter L; Yi, Ting-Shuang

    2015-01-01

    Foxtail millet (Setaria italica (L.) Beauv) is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP) and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1) in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

  5. Nucleotide sequence and genetic organization of Hungarian grapevine chrome mosaic nepovirus RNA2.

    Science.gov (United States)

    Brault, V; Hibrand, L; Candresse, T; Le Gall, O; Dunez, J

    1989-10-11

    The complete nucleotide sequence of hungarian grapevine chrome mosaic nepovirus (GCMV) RNA2 has been determined. The RNA sequence is 4441 nucleotides in length, excluding the poly(A) tail. A polyprotein of 1324 amino acids with a calculated molecular weight of 146 kDa is encoded in a single long open reading frame extending from nucleotides 218 to 4190. This polyprotein is homologous with the protein encoded by the S strain of tomato black ring virus (TBRV) RNA2, the only other nepovirus sequenced so far. Direct sequencing of the viral coat protein and in vitro translation of transcripts derived from cDNA sequences demonstrate that, as for comoviruses, the coat protein is located at the carboxy terminus of the polyprotein. A model for the expression of GCMV RNA2 is presented.

  6. [Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2].

    Science.gov (United States)

    Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I

    1985-11-01

    The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.

  7. Different characteristics and nucleotide binding properties of inosine monophosphate dehydrogenase (IMPDH isoforms.

    Directory of Open Access Journals (Sweden)

    Elaine C Thomas

    Full Text Available We recently reported that Inosine Monophosphate Dehydrogenase (IMPDH, a rate-limiting enzyme in de novo guanine nucleotide biosynthesis, clustered into macrostructures in response to decreased nucleotide levels and that there were differences between the IMPDH isoforms, IMPDH1 and IMPDH2. We hypothesised that the Bateman domains, which are present in both isoforms and serve as energy-sensing/allosteric modules in unrelated proteins, would contribute to isoform-specific differences and that mutations situated in and around this domain in IMPDH1 which give rise to retinitis pigmentosa (RP would compromise regulation. We employed immuno-electron microscopy to investigate the ultrastructure of IMPDH macrostructures and live-cell imaging to follow clustering of an IMPDH2-GFP chimera in real-time. Using a series of IMPDH1/IMPDH2 chimera we demonstrated that the propensity to cluster was conferred by the N-terminal 244 amino acids, which includes the Bateman domain. A protease protection assay suggested isoform-specific purine nucleotide binding characteristics, with ATP protecting IMPDH1 and AMP protecting IMPDH2, via a mechanism involving conformational changes upon nucleotide binding to the Bateman domain without affecting IMPDH catalytic activity. ATP binding to IMPDH1 was confirmed in a nucleotide binding assay. The RP-causing mutation, R224P, abolished ATP binding and nucleotide protection and this correlated with an altered propensity to cluster. Collectively these data demonstrate that (i the isoforms are differentially regulated by AMP and ATP by a mechanism involving the Bateman domain, (ii communication occurs between the Bateman and catalytic domains and (iii the RP-causing mutations compromise such regulation. These findings support the idea that the IMPDH isoforms are subject to distinct regulation and that regulatory defects contribute to human disease.

  8. Guanine nucleotide regulation of α1-adrenergic receptors of muscle and kidney eptihelial cells

    International Nuclear Information System (INIS)

    Terman, B.I.; Hughes, R.J.; Slivka, S.R.; Insel, P.A.

    1986-01-01

    The authors have examined the effect of guanine nucleotides on the interaction of adrenergic agents with α 1 -adrenergic receptors of two cell lines, the Madin-Darby Canine Kidney (MDCK) and BC3H-1 muscle cells. While gaunylylimidodiphosphoate (Gpp(NH)p) had no effect on the affinity or the total number of [ -3 H]prazosin binding sites in membranes prepared from these cells, the nucleotide decreased the apparent affinity of the agonist epinephrine in competing for [ 3 H]prazosin binding sites in both cell types. The EC 50 of Gpp(NH)p was ∼100 μM, and a maximal effect was seen at 500 μM. In contrast, 100 μM Gpp(NH)p yielding maximal shifts in binding of epinephrine to β-adrenergic receptors in BC3H-1 cell membranes. Guanine nucleotides were significantly more effective than adenine nucleotides in shifting agonist affinity for the α 1 -receptor and Mg ++ was required to observe a maximal effect. α 1 -receptor agonists activated phosphatidylinositol (PI) hydrolysis in both cell types, but have no direct effect on membrane adenylate cyclase activity. In intact BC3H-1 cells, α 1 -agonists inhibited β-adrenergic cAMP production, an effect which appears in preliminary studies not to result from enhanced phosphodieterase activity. These results show that agonist binding to α 1 -adrenergic receptors in mammalian kidney and muscle cells is regulated by guanine nucleotides. This regulation and inturn transmembrane signalling (PI hydrolysis) by these receptors appear to involve a guanine nucleotide binding (G) protein, which may be different than G/sub s/ and G/sub i/

  9. Plastid: nucleotide-resolution analysis of next-generation sequencing and genomics data.

    Science.gov (United States)

    Dunn, Joshua G; Weissman, Jonathan S

    2016-11-22

    Next-generation sequencing (NGS) informs many biological questions with unprecedented depth and nucleotide resolution. These assays have created a need for analytical tools that enable users to manipulate data nucleotide-by-nucleotide robustly and easily. Furthermore, because many NGS assays encode information jointly within multiple properties of read alignments - for example, in ribosome profiling, the locations of ribosomes are jointly encoded in alignment coordinates and length - analytical tools are often required to extract the biological meaning from the alignments before analysis. Many assay-specific pipelines exist for this purpose, but there remains a need for user-friendly, generalized, nucleotide-resolution tools that are not limited to specific experimental regimes or analytical workflows. Plastid is a Python library designed specifically for nucleotide-resolution analysis of genomics and NGS data. As such, Plastid is designed to extract assay-specific information from read alignments while retaining generality and extensibility to novel NGS assays. Plastid represents NGS and other biological data as arrays of values associated with genomic or transcriptomic positions, and contains configurable tools to convert data from a variety of sources to such arrays. Plastid also includes numerous tools to manipulate even discontinuous genomic features, such as spliced transcripts, with nucleotide precision. Plastid automatically handles conversion between genomic and feature-centric coordinates, accounting for splicing and strand, freeing users of burdensome accounting. Finally, Plastid's data models use consistent and familiar biological idioms, enabling even beginners to develop sophisticated analytical workflows with minimal effort. Plastid is a versatile toolkit that has been used to analyze data from multiple NGS assays, including RNA-seq, ribosome profiling, and DMS-seq. It forms the genomic engine of our ORF annotation tool, ORF-RATER, and is readily

  10. Purine nucleotide synthesis from exogenous adenine and guanine in rodent small intestine

    International Nuclear Information System (INIS)

    Gross, C.J.; Karlberg, P.K.; Savaiano, D.A.

    1986-01-01

    14 C-Adenine and 14 C-guanine uptake was studied in isolated guinea pig enterocytes. Cells were incubated in Hank's buffer and separated from the medium by centrifugation through silicone oil into 1M PCA. Uptake was temperature and concentration dependent. Both compounds were incorporated into nucleotides as measured by HPLC and HVE. Adenine was more extensively incorporated into nucleotides than was guanine. Adenine nucleotides accounted for about 70% of the intracellular label after 30 min with a majority being ADP and ATP (medium concentration = 10 μM). Guanine nucleotides accounted for only 30% of the intracellular label after 30 min. Labeled intracellular free adenine or guanine were not detected. Significantly more guanine vs. adenine was converted to uric acid. After 30 min, 11.5 +/- 3.9% (n=3) and 83.0 +/- 8.4% (n=4) of the label was present as uric acid in the medium when adenine and guanine, respectively, were the substrate. After 1 min, 34.8 +/- 3.4% (n=4) of the label in the medium was present as uric acid when guanine was the substrate. Decreasing the concentration of adenine resulted in an increase in the percent of uric acid in the medium. 14 C-adenine (75 nmol) was injected into 1 gm segments of rat jejunum. After 5 min., segments were quickly flushed and the tissue homogenized in 1M PCA. Only uric acid was present after 5 min (n=6). In contrast, in animals fasted 3 to 5 days, less conversion to uric acid was observed in the intestinal content (50-80% of the same dose was still present as adenine after 5 min) and nucleotide formation was observed in the tissue. The results indicate that uric acid and nucleotide synthesis from exogenous adenine and guanine are concentration dependent and affected by nutritional state

  11. De novo synthesis of adenine nucleotides in different skeletal muscle fiber types

    International Nuclear Information System (INIS)

    Tullson, P.C.; John-Alder, H.B.; Hood, D.A.; Terjung, R.L.

    1988-01-01

    Management of adenine nucleotide catabolism differs among skeletal muscle fiber types. This study evaluated whether there are corresponding differences in the rates of de novo synthesis of adenine nucleotide among fiber type sections of skeletal muscle using an isolated perfused rat hindquarter preparation. Label incorporation into adenine nucleotides from the [1-14C]glycine precursor was determined and used to calculate synthesis rates based on the intracellular glycine specific radioactivity. Results show that intracellular glycine is closely related to the direct precursor pool. Rates of de novo synthesis were highest in fast-twitch red muscle (57.0 +/- 4.0, 58.2 +/- 4.4 nmol.h-1.g-1; deep red gastrocnemius and vastus lateralis), relatively high in slow-twitch red muscle (47.0 +/- 3.1; soleus), and low in fast-twitch white muscle (26.1 +/- 2.0 and 21.6 +/- 2.3; superficial white gastrocnemius and vastus lateralis). Rates for four mixed muscles were intermediate, ranging between 32.3 and 37.3. Specific de novo synthesis rates exhibited a strong correlation (r = 0.986) with muscle section citrate synthase activity. Turnover rates (de novo synthesis rate/adenine nucleotide pool size) were highest in high oxidative muscle (0.82-1.06%/h), lowest in low oxidative muscle (0.30-0.35%/h), and intermediate in mixed muscle (0.44-0.55%/h). Our results demonstrate that differences in adenine nucleotide management among fiber types extends to the process of de novo adenine nucleotide synthesis

  12. Complete nucleotide sequence of Alfalfa mosaic virus isolated from alfalfa (Medicago sativa L.) in Argentina.

    Science.gov (United States)

    Trucco, Verónica; de Breuil, Soledad; Bejerman, Nicolás; Lenardon, Sergio; Giolitti, Fabián

    2014-06-01

    The complete nucleotide sequence of an Alfalfa mosaic virus (AMV) isolate infecting alfalfa (Medicago sativa L.) in Argentina, AMV-Arg, was determined. The virus genome has the typical organization described for AMV, and comprises 3,643, 2,593, and 2,038 nucleotides for RNA1, 2 and 3, respectively. The whole genome sequence and each encoding region were compared with those of other four isolates that have been completely sequenced from China, Italy, Spain and USA. The nucleotide identity percentages ranged from 95.9 to 99.1 % for the three RNAs and from 93.7 to 99 % for the protein 1 (P1), protein 2 (P2), movement protein and coat protein (CP) encoding regions, whereas the amino acid identity percentages of these proteins ranged from 93.4 to 99.5 %, the lowest value corresponding to P2. CP sequences of AMV-Arg were compared with those of other 25 available isolates, and the phylogenetic analysis based on the CP gene was carried out. The highest percentage of nucleotide sequence identity of the CP gene was 98.3 % with a Chinese isolate and 98.6 % at the amino acid level with four isolates, two from Italy, one from Brazil and the remaining one from China. The phylogenetic analysis showed that AMV-Arg is closely related to subgroup I of AMV isolates. To our knowledge, this is the first report of a complete nucleotide sequence of AMV from South America and the first worldwide report of complete nucleotide sequence of AMV isolated from alfalfa as natural host.

  13. Bacterial Signaling Nucleotides Inhibit Yeast Cell Growth by Impacting Mitochondrial and Other Specifically Eukaryotic Functions

    Directory of Open Access Journals (Sweden)

    Andy Hesketh

    2017-07-01

    Full Text Available We have engineered Saccharomyces cerevisiae to inducibly synthesize the prokaryotic signaling nucleotides cyclic di-GMP (cdiGMP, cdiAMP, and ppGpp in order to characterize the range of effects these nucleotides exert on eukaryotic cell function during bacterial pathogenesis. Synthetic genetic array (SGA and transcriptome analyses indicated that, while these compounds elicit some common reactions in yeast, there are also complex and distinctive responses to each of the three nucleotides. All three are capable of inhibiting eukaryotic cell growth, with the guanine nucleotides exhibiting stronger effects than cdiAMP. Mutations compromising mitochondrial function and chromatin remodeling show negative epistatic interactions with all three nucleotides. In contrast, certain mutations that cause defects in chromatin modification and ribosomal protein function show positive epistasis, alleviating growth inhibition by at least two of the three nucleotides. Uniquely, cdiGMP is lethal both to cells growing by respiration on acetate and to obligately fermentative petite mutants. cdiGMP is also synthetically lethal with the ribonucleotide reductase (RNR inhibitor hydroxyurea. Heterologous expression of the human ppGpp hydrolase Mesh1p prevented the accumulation of ppGpp in the engineered yeast and restored cell growth. Extensive in vivo interactions between bacterial signaling molecules and eukaryotic gene function occur, resulting in outcomes ranging from growth inhibition to death. cdiGMP functions through a mechanism that must be compensated by unhindered RNR activity or by functionally competent mitochondria. Mesh1p may be required for abrogating the damaging effects of ppGpp in human cells subjected to bacterial infection.

  14. Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.

    Science.gov (United States)

    Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A

    2016-01-01

    A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.

  15. Cytosolic nucleotides block and regulate the Arabidopsis vacuolar anion channel AtALMT9.

    Science.gov (United States)

    Zhang, Jingbo; Martinoia, Enrico; De Angeli, Alexis

    2014-09-12

    The aluminum-activated malate transporters (ALMTs) form a membrane protein family exhibiting different physiological roles in plants, varying from conferring tolerance to environmental Al(3+) to the regulation of stomatal movement. The regulation of the anion channels of the ALMT family is largely unknown. Identifying intracellular modulators of the activity of anion channels is fundamental to understanding their physiological functions. In this study we investigated the role of cytosolic nucleotides in regulating the activity of the vacuolar anion channel AtALMT9. We found that cytosolic nucleotides modulate the transport activity of AtALMT9. This modulation was based on a direct block of the pore of the channel at negative membrane potentials (open channel block) by the nucleotide and not by a phosphorylation mechanism. The block by nucleotides of AtALMT9-mediated currents was voltage dependent. The blocking efficiency of intracellular nucleotides increased with the number of phosphate groups and ATP was the most effective cellular blocker. Interestingly, the ATP block induced a marked modification of the current-voltage characteristic of AtALMT9. In addition, increased concentrations of vacuolar anions were able to shift the ATP block threshold to a more negative membrane potential. The block of AtALMT9-mediated anion currents by ATP at negative membrane potentials acts as a gate of the channel and vacuolar anion tune this gating mechanism. Our results suggest that anion transport across the vacuolar membrane in plant cells is controlled by cytosolic nucleotides and the energetic status of the cell. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  16. Cytosolic Nucleotides Block and Regulate the Arabidopsis Vacuolar Anion Channel AtALMT9*

    Science.gov (United States)

    Zhang, Jingbo; Martinoia, Enrico; De Angeli, Alexis

    2014-01-01

    The aluminum-activated malate transporters (ALMTs) form a membrane protein family exhibiting different physiological roles in plants, varying from conferring tolerance to environmental Al3+ to the regulation of stomatal movement. The regulation of the anion channels of the ALMT family is largely unknown. Identifying intracellular modulators of the activity of anion channels is fundamental to understanding their physiological functions. In this study we investigated the role of cytosolic nucleotides in regulating the activity of the vacuolar anion channel AtALMT9. We found that cytosolic nucleotides modulate the transport activity of AtALMT9. This modulation was based on a direct block of the pore of the channel at negative membrane potentials (open channel block) by the nucleotide and not by a phosphorylation mechanism. The block by nucleotides of AtALMT9-mediated currents was voltage dependent. The blocking efficiency of intracellular nucleotides increased with the number of phosphate groups and ATP was the most effective cellular blocker. Interestingly, the ATP block induced a marked modification of the current-voltage characteristic of AtALMT9. In addition, increased concentrations of vacuolar anions were able to shift the ATP block threshold to a more negative membrane potential. The block of AtALMT9-mediated anion currents by ATP at negative membrane potentials acts as a gate of the channel and vacuolar anion tune this gating mechanism. Our results suggest that anion transport across the vacuolar membrane in plant cells is controlled by cytosolic nucleotides and the energetic status of the cell. PMID:25028514

  17. Adenylate Nucleotides and 2,3-Biphosphoglycerate Concentration in Erythrocytes of Growing Wielkopolska Stallions

    OpenAIRE

    M. Suska; E. Skotnicka; W. Dudzińska; W. Orowicz; M. Brzezinska

    2006-01-01

    The aim of this study was to examine the relationships between the concentrations of adenylate nucleotides (ATP, ADP, AMP), total nucleotide pool (TAN), adenylate energy charge (AEC) and 2,3-biphosphoglycerate (2,3-BPG) in the erythrocytes of young horses in the period of their rapid growth and development. The studies were conducted on 10 young Wielkopolska breed stallions for two years; Group A: 1-month-old, Group B: 3-month-old, Group C: 6-month-old, Group D: 1-year-old, and Group E: 2-yea...

  18. NUCLEOTIDE COMPARISON OF GDF9 GENE IN INDIAN YAK AND GADDI GOAT: HIGH ALTITUDE LIVESTOCK ANIMALS

    Directory of Open Access Journals (Sweden)

    Lakshya Veer Singh

    2013-06-01

    Full Text Available The present study was undertaken to characterize exon 1 and exon 2 sequence of one of fecundity genes: GDF9 (Growth differentiation factor 9, in high altitude livestock animal (Yak and Gaddi goat. Six nucleotide differences were identified between sheep (AF078545 and goats (EF446168 in exon 1 and exon 2. Sequencing revealed nine novel single nucleotide mutations in exon 1 and exon 2 of Indian yak that compared with Bos taurus (GQ922451. These results preliminarily showed that the GDF9 gene might be a major gene that influences prolificacy of Gaddi goats and Indian yak.

  19. Hydrolytic and alcoholytic dephosphorylation of nucleotides by acid phosphatase in the presence of ethanol.

    Science.gov (United States)

    Tomaszewski, M; Buchowicz, J

    1971-08-01

    The effect of ethanol on the activity of acid phosphatase from wheat germ was studied, by using ribonucleoside monophosphates as the enzyme substrates. The nucleotides were effectively degraded to the corresponding nucleosides in the presence of ethanol at all concentrations tested, including a 96% (v/v) solution. However, the nucleotide dephosphorylation was accompanied by the liberation of orthophosphate only when the concentration of ethanol in the assay mixture did not exceed 15%. No inorganic phosphate was liberated when ethanol was present at higher concentrations. Instead, monoethyl phosphate was formed in quantities expected for orthophosphate. The results are explained in terms of phosphatase-catalysed alcoholysis.

  20. Detecting Single-Nucleotides by Tunneling Current Measurements at Sub-MHz Temporal Resolution.

    Science.gov (United States)

    Morikawa, Takanori; Yokota, Kazumichi; Tanimoto, Sachie; Tsutsui, Makusu; Taniguchi, Masateru

    2017-04-18

    Label-free detection of single-nucleotides was performed by fast tunneling current measurements in a polar solvent at 1 MHz sampling rate using SiO₂-protected Au nanoprobes. Short current spikes were observed, suggestive of trapping/detrapping of individual nucleotides between the nanoelectrodes. The fall and rise features of the electrical signatures indicated signal retardation by capacitance effects with a time constant of about 10 microseconds. The high temporal resolution revealed current fluctuations, reflecting the molecular conformation degrees of freedom in the electrode gap. The method presented in this work may enable direct characterizations of dynamic changes in single-molecule conformations in an electrode gap in liquid.

  1. Effect of the nucleotides surrounding the start codon on the translation of foot-and-mouth disease virus RNA.

    Science.gov (United States)

    Ma, X X; Feng, Y P; Gu, Y X; Zhou, J H; Ma, Z R

    2016-06-01

    As for the alternative AUGs in foot-and-mouth disease virus (FMDV), nucleotide bias of the context flanking the AUG(2nd) could be used as a strong signal to initiate translation. To determine the role of the specific nucleotide context, dicistronic reporter constructs were engineered to contain different versions of nucleotide context linking between internal ribosome entry site (IRES) and downstream gene. The results indicate that under FMDV IRES-dependent mechanism, the nucleotide contexts flanking start codon can influence the translation initiation efficiencies. The most optimal sequences for both start codons have proved to be UUU AUG(1st) AAC and AAG AUG(2nd) GAA.

  2. Nucleotide composition of the Zika virus RNA genome and its codon usage

    NARCIS (Netherlands)

    van Hemert, Formijn; Berkhout, Ben

    2016-01-01

    RNA viruses have genomes with a distinct nucleotide composition and codon usage. We present the global characteristics of the RNA genome of Zika virus (ZIKV), an emerging pathogen within the Flavivirus genus. ZIKV was first isolated in 1947 in Uganda, caused a widespread epidemic in South and

  3. Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

    NARCIS (Netherlands)

    Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

    1983-01-01

    The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

  4. Building the library of RNA 3D nucleotide conformations using the clustering approach

    Directory of Open Access Journals (Sweden)

    Zok Tomasz

    2015-09-01

    Full Text Available An increasing number of known RNA 3D structures contributes to the recognition of various RNA families and identification of their features. These tasks are based on an analysis of RNA conformations conducted at different levels of detail. On the other hand, the knowledge of native nucleotide conformations is crucial for structure prediction and understanding of RNA folding. However, this knowledge is stored in structural databases in a rather distributed form. Therefore, only automated methods for sampling the space of RNA structures can reveal plausible conformational representatives useful for further analysis. Here, we present a machine learning-based approach to inspect the dataset of RNA three-dimensional structures and to create a library of nucleotide conformers. A median neural gas algorithm is applied to cluster nucleotide structures upon their trigonometric description. The clustering procedure is two-stage: (i backbone- and (ii ribose-driven. We show the resulting library that contains RNA nucleotide representatives over the entire data, and we evaluate its quality by computing normal distribution measures and average RMSD between data points as well as the prototype within each cluster.

  5. Understanding specificity in metabolic pathways-Structural biology of human nucleotide metabolism

    International Nuclear Information System (INIS)

    Welin, Martin; Nordlund, Paer

    2010-01-01

    Interactions are the foundation of life at the molecular level. In the plethora of activities in the cell, the evolution of enzyme specificity requires the balancing of appropriate substrate affinity with a negative selection, in order to minimize interactions with other potential substrates in the cell. To understand the structural basis for enzyme specificity, the comparison of structural and biochemical data between enzymes within pathways using similar substrates and effectors is valuable. Nucleotide metabolism is one of the largest metabolic pathways in the human cell and is of outstanding therapeutic importance since it activates and catabolises nucleoside based anti-proliferative drugs and serves as a direct target for anti-proliferative drugs. In recent years the structural coverage of the enzymes involved in human nucleotide metabolism has been dramatically improved and is approaching completion. An important factor has been the contribution from the Structural Genomics Consortium (SGC) at Karolinska Institutet, which recently has solved 33 novel structures of enzymes and enzyme domains in human nucleotide metabolism pathways and homologs thereof. In this review we will discuss some of the principles for substrate specificity of enzymes in human nucleotide metabolism illustrated by a selected set of enzyme families where a detailed understanding of the structural determinants for specificity is now emerging.

  6. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    Science.gov (United States)

    Hori, H; Osawa, S; Murao, K; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  7. Sirtuin 1 gene rs2273773 C >T single nucleotide polymorphism and ...

    African Journals Online (AJOL)

    Background: Sirtuin-1 (SIRT-1), a protein has been found to protect the cells against oxidative stress due to its deacetylase activity. In this investigation, we aimed to study SIRT-1 gene rs2273773 C >T single nucleotide polymorphism and markers of serum protein oxidation (protein carbonyl and sulfhydryl groups) in ...

  8. Evolutionary and structural perspectives of plant cyclic nucleotide-gated cation channels

    KAUST Repository

    Zelman, Alice K.; Dawe, Adam; Gehring, Christoph A; Berkowitz, Gerald A.

    2012-01-01

    , including Ca2+ and K+. CNGCs are present in both plant and animal cells, typically in the plasma membrane; recent studies have also documented their presence in prokaryotes. All eukaryote CNGC polypeptides have a cyclic nucleotide-binding domain and a

  9. 2′-O-methyl nucleotide modified DNA substrates influence the ...

    Indian Academy of Sciences (India)

    2014-07-18

    Jul 18, 2014 ... 1. Introduction. Due to the development of novel nucleotide derivatives, ..... which is located in a spiral ring made of 152-157 bases before α6. ..... 8 126–. 130. Majlessi M, Nelson NC and Becker MM 1998 Advantages of 2'-O-.

  10. Twelve single nucleotide polymorphisms on chromosome 19q13.2-13.3

    DEFF Research Database (Denmark)

    Yin, Jiaoyang; Vogel, Ulla; Gerdes, Lars Ulrik

    2003-01-01

    The genetic susceptibility to basal cell carcinoma (BCC) among Danish psoriatic patients was investigated in association studies with 12 single nucleotide polymorphisms on chromosome 19q13.2-3. The results show a significant association between BCC and the A-allele of a polymorphism in ERCCI exon4...

  11. Factor 11 single-nucleotide variants in women with heavy menstrual bleeding

    NARCIS (Netherlands)

    Wiewel-Verschueren, Sophie; Mulder, Andre B.; Meijer, Karina; Mulder, Rene

    2017-01-01

    In a previous study it was shown that lower factor XI (FXI) levels in women with heavy menstrual bleeding (HMB). Our aim was to determine the single-nucleotide variants (SNVs) in the F11 gene in women with HMB. In addition, an extensive literature search was performed to determine the clinical

  12. Single nucleotide polymorphism discovery in bovine liver using RNA-seq technology

    DEFF Research Database (Denmark)

    Pareek, Chandra Shekhar; Błaszczyk, Paweł; Dziuba, Piotr

    2017-01-01

    Background RNA-seq is a useful next-generation sequencing (NGS) technology that has been widely used to understand mammalian transcriptome architecture and function. In this study, a breed-specific RNA-seq experiment was utilized to detect putative single nucleotide polymorphisms (SNPs) in liver...

  13. Infectious mononucleosis-linked HLA class I single nucleotide polymorphism is associated with multiple sclerosis.

    Science.gov (United States)

    Jafari, Naghmeh; Broer, Linda; Hoppenbrouwers, Ilse A; van Duijn, Cornelia M; Hintzen, Rogier Q

    2010-11-01

    Multiple sclerosis is a presumed autoimmune disease associated with genetic and environmental risk factors such as infectious mononucleosis. Recent research has shown infectious mononucleosis to be associated with a specific HLA class I polymorphism. Our aim was to test if the infectious mononucleosis-linked HLA class I single nucleotide polymorphism (rs6457110) is also associated with multiple sclerosis. Genotyping of the HLA-A single nucleotide polymorphism rs6457110 using TaqMan was performed in 591 multiple sclerosis cases and 600 controls. The association of multiple sclerosis with the HLA-A single nucleotide polymorphism was tested using logistic regression adjusted for age, sex and HLA-DRB1*1501. HLA-A minor allele (A) is associated with multiple sclerosis (OR = 0.68; p = 4.08 × 10( -5)). After stratification for HLA-DRB1*1501 risk allele (T) carrier we showed a significant OR of 0.70 (p = 0.003) for HLA-A. HLA class I single nucleotide polymorphism rs6457110 is associated with infectious mononucleosis and multiple sclerosis, independent of the major class II allele, supporting the hypothesis that shared genetics may contribute to the association between infectious mononucleosis and multiple sclerosis.

  14. Nucleotide Sequence and Characterization of the Broad-Host-Range Lactococcal Plasmid pWVO1

    NARCIS (Netherlands)

    Leenhouts, Cornelis; Tolner, Berend; Bron, Sierd; Kok, Jan; Venema, Gerhardus; Seegers, Jozef

    The nucleotide sequence of the Lactococcus lactis broad-host-range plasmid pWVO1, replicating in both gram-positive and gram-negative bacteria, was determined. This analysis revealed four open reading frames (ORFs). ORF A appeared to encode a trans-acting 26.8-kDa protein (RepA), necessary for

  15. Resampling nucleotide sequences with closest-neighbor trimming and its comparison to other methods.

    Directory of Open Access Journals (Sweden)

    Kouki Yonezawa

    Full Text Available A large number of nucleotide sequences of various pathogens are available in public databases. The growth of the datasets has resulted in an enormous increase in computational costs. Moreover, due to differences in surveillance activities, the number of sequences found in databases varies from one country to another and from year to year. Therefore, it is important to study resampling methods to reduce the sampling bias. A novel algorithm-called the closest-neighbor trimming method-that resamples a given number of sequences from a large nucleotide sequence dataset was proposed. The performance of the proposed algorithm was compared with other algorithms by using the nucleotide sequences of human H3N2 influenza viruses. We compared the closest-neighbor trimming method with the naive hierarchical clustering algorithm and [Formula: see text]-medoids clustering algorithm. Genetic information accumulated in public databases contains sampling bias. The closest-neighbor trimming method can thin out densely sampled sequences from a given dataset. Since nucleotide sequences are among the most widely used materials for life sciences, we anticipate that our algorithm to various datasets will result in reducing sampling bias.

  16. Pyridine nucleotides in regulation of cell death and survival by redox and non-redox reactions.

    Science.gov (United States)

    Novak Kujundžić, Renata; Žarković, Neven; Gall Trošelj, Koraljka

    2014-01-01

    Changes of the level and ratios of pyridine nucleotides determine metabolism- dependent cellular redox status and the activity of poly(ADP-ribose) polymerases (PARPs) and sirtuins, thereby influencing several processes closely related to cell survival and death. Pyridine nucleotides participate in numerous metabolic reactions whereby their net cellular level remains constant, but the ratios of NAD+/NADP+ and NADH/NADPH oscillate according to metabolic changes in response to diverse stress signals. In non-redox reactions, NAD+ is degraded and quickly, afterward, resynthesized in the NAD+ salvage pathway, unless overwhelming activation of PARP-1 consumes NAD+ to the point of no return, when the cell can no longer generate enough ATP to accommodate NAD+ resynthesis. The activity of PARP-1 is mandatory for the onset of cytoprotective autophagy on sublethal stress signals. It has become increasingly clear that redox status, largely influenced by the metabolism-dependent composition of the pyridine nucleotides pool, plays an important role in the synthesis of pro-apoptotic and anti-apoptotic sphingolipids. Awareness of the involvement of the prosurvival sphingolipid, sphingosine-1-phosphate, in transition from inflammation to malignant transformation has recently emerged. Here, the participation of pyridine nucleotides in redox and non-redox reactions, sphingolipid metabolism, and their role in cell fate decisions is reviewed.

  17. SUMO and ubiquitin-dependent XPC exchange drives nucleotide excision repair

    DEFF Research Database (Denmark)

    Van Cuijk, Loes; Van Belle, Gijsbert J.; Turkyilmaz, Yasemin

    2015-01-01

    XPC recognizes UV-induced DNA lesions and initiates their removal by nucleotide excision repair (NER). Damage recognition in NER is tightly controlled by ubiquitin and SUMO modifications. Recent studies have shown that the SUMO-targeted ubiquitin ligase RNF111 promotes K63-linked ubiquitylation o...

  18. Grinding up Wheat: a Massive Loss of Nucleotide Diversity Since Domestication

    DEFF Research Database (Denmark)

    Haudry, Anabelle; Cenci, Alberto; Ravel, Catherine

    2007-01-01

    Several demographic and selective events occurred during the domestication of wheat from the allotetraploid wild emmer (Triticum turgidum ssp. dicoccoides). Cultivated wheat has since been affected by other historical events. We analyzed nucleotide diversity at 21 loci in a sample of 101 individu...

  19. A fluorimetric readout reporting the kinetics of nucleotide-induced human ribonucleotide reductase oligomerization.

    Science.gov (United States)

    Fu, Yuan; Lin, Hongyu; Wisitpitthaya, Somsinee; Blessing, William A; Aye, Yimon

    2014-11-24

    Human ribonucleotide reductase (hRNR) is a target of nucleotide chemotherapeutics in clinical use. The nucleotide-induced oligomeric regulation of hRNR subunit α is increasingly being recognized as an innate and drug-relevant mechanism for enzyme activity modulation. In the presence of negative feedback inhibitor dATP and leukemia drug clofarabine nucleotides, hRNR-α assembles into catalytically inert hexameric complexes, whereas nucleotide effectors that govern substrate specificity typically trigger α-dimerization. Currently, both knowledge of and tools to interrogate the oligomeric assembly pathway of RNR in any species in real time are lacking. We therefore developed a fluorimetric assay that reliably reports on oligomeric state changes of α with high sensitivity. The oligomerization-directed fluorescence quenching of hRNR-α, covalently labeled with two fluorophores, allows for direct readout of hRNR dimeric and hexameric states. We applied the newly developed platform to reveal the timescales of α self-assembly, driven by the feedback regulator dATP. This information is currently unavailable, despite the pharmaceutical relevance of hRNR oligomeric regulation. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Solubilization and reconstitution of the formylmethionylleucylphenylalanine receptor coupled to guanine nucleotide regulatory protein

    International Nuclear Information System (INIS)

    Williamson, K.; Dickey, B.F.; Pyun, H.Y.; Navarro, J.

    1988-01-01

    The authors describe the solubilization, resolution, and reconstitution of the formylmethionylleucylphenylalanine (fMet-Leu-Phe) receptor and guanine nucleotide regulatory proteins (G-proteins). The receptor was solubilized with 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate. Guanine nucleotides decreased the number of high-affinity binding sites and accelerated the rate of dissociation of the receptor-ligand complex, suggesting that the solubilized receptor remained coupled to endogenous G-proteins. The solubilized receptor was resolved from endogenous G-proteins by fractionation on a wheat germ agglutinin (WGA)-Sepharose 4B column. High-affinity [ 3 H]fMet-Leu-Phe binding to the WGA-purified receptor was diminished and exhibited reduced guanine nucleotide sensitivity. High-affinity [ 3 H]fMET-Leu-Phe binding and guanine nucleotide sensitivity were reconstituted upon the addition of purified brain G-proteins. Similar results were obtained when the receptor was reconstituted with brain G-proteins into phospholipid vesicles by gel filtration chromatography. In addition, they also demonstrated fMET-Leu-Phe-dependent GTP hydrolysis in the reconstituted vesicles. The results of this work indicate that coupling of the fMet-Leu-Phe receptor to G-proteins converts the receptor to a high-affinity binding state and that agonist produces activation of G-proteins. The resolution and functional reconstitution of this receptor should provide an important step toward the elucidation of the molecular mechanism of the fMet-Leu-Phe transduction system in neutrophils

  1. Development and characterization of 35 single nucleotide polymorphism markers for the brown alga Fucus vesiculosus

    NARCIS (Netherlands)

    Canovas, Fernando; Mota, Catarina; Ferreira-Costa, Joana; Serrao, Ester; Coyer, Jim; Olsen, Jeanine; Pearson, Gareth

    2011-01-01

    We characterized 35 single nucleotide polymorphism (SNP) markers for the brown alga Fucus vesiculosus. Based on existing Fucus Expressed Sequence Tag libraries for heat and desiccation-stressed tissue, SNPs were developed and confirmed by re-sequencing cDNA from a diverse panel of individuals. SNP

  2. Targeted Metabolic Engineering Guided by Computational Analysis of Single-Nucleotide Polymorphisms (SNPs)

    DEFF Research Database (Denmark)

    Udatha, D B R K Gupta; Rasmussen, Simon; Sicheritz-Pontén, Thomas

    2013-01-01

    The non-synonymous SNPs, the so-called non-silent SNPs, which are single-nucleotide variations in the coding regions that give "birth" to amino acid mutations, are often involved in the modulation of protein function. Understanding the effect of individual amino acid mutations on a protein...

  3. Association between nucleotide mutation of eNOS gene and serum ...

    African Journals Online (AJOL)

    Various mutation on endothelial nitric oxide synthase (eNOs) gene cause reduced production of NO, the expansion factor (VEF) and may accelerate the process of atherosclerosis. The study was designed to investigate the frequency of T-786C polymorphism of the gene or nucleotide mutation of eNOS gene in patients ...

  4. A lateral flow biosensor for detection of single nucleotide polymorphism by circular strand displacement reaction.

    Science.gov (United States)

    Xiao, Zhuo; Lie, Puchang; Fang, Zhiyuan; Yu, Luxin; Chen, Junhua; Liu, Jie; Ge, Chenchen; Zhou, Xuemeng; Zeng, Lingwen

    2012-09-04

    A lateral flow biosensor for detection of single nucleotide polymorphism based on circular strand displacement reaction (CSDPR) has been developed. Taking advantage of high fidelity of T4 DNA ligase, signal amplification by CSDPR, and the optical properties of gold nanoparticles, this assay has reached a detection limit of 0.01 fM.

  5. Slow spontaneous [Ca2+]i oscillations reflect nucleotide release from renal epithelia

    DEFF Research Database (Denmark)

    Geyti, Christine Stride; Odgaard, Elvin V. P.; Overgaard, Morten Thaarup

    2008-01-01

    Renal epithelia can be provoked mechanically to release nucleotides, which subsequently increases the intracellular Ca(2+) concentration [Ca(2+)](i) through activation of purinergic (P2) receptors. Cultured cells often show spontaneous [Ca(2+)](i) oscillations, a feature suggested to involve nucl...

  6. Interaction of organophosphorus pesticides with DNA nucleotides on a Boron-doped diamond electrode

    Energy Technology Data Exchange (ETDEWEB)

    Garbellini, Gustavo S.; Uliana, Carolina V.; Yamanaka, Hideko, E-mail: gustgarb@yahoo.com.br [Universidade Estadual Paulista Julio de Mesquita Filho (UNESP), Bauru, SP (Brazil). Dept. de Quimica Analitica

    2013-12-01

    Diamond electrode was used to evaluate the interaction of the nucleotides guanosine monophosphate (GMP) and adenosine monophosphate (AMP) with the pesticides chlorpyrifos, methamidophos and monocrotophos. Changes were observed in the currents and peak potentials of the nucleotide voltammograms in the presence of the pesticides, with dependence on the pesticide concentration (from 5.0 Multiplication-Sign 10{sup -7} to 5.0 Multiplication-Sign 10{sup -5} mol L{sup -1}) and the interaction time (from 1 min to 4 h). This is probably due to binding of the pesticides to the nitrogenous bases present in the nucleotides, which could lead to problems in the DNA replication and biological functions of nucleotides. The pesticides showed stronger interaction with AMP than with GMP. Studies of the interaction of 50 Micro-Sign g mL{sup -1} DNA with the pesticides (from 30 min to 4 h and from 1.0 Multiplication-Sign 10{sup -6} to 6.0 Multiplication-Sign 10{sup -5} mol L{sup -1}) did not reveal any peaks relating to double helix opening or DNA unwinding. (author)

  7. Analysis of multiple single nucleotide polymorphisms (SNP) on DNA traces from plasma and dried blood samples

    NARCIS (Netherlands)

    Catsburg, Arnold; van der Zwet, Wil C.; Morre, Servaas A.; Ouburg, Sander; Vandenbroucke-Grauls, Christina M. J. E.; Savelkoul, Paul H. M.

    2007-01-01

    Reliable analysis of single nucleotide polymorphisms (SNPs) in DNA derived from samples containing low numbers of cells or from suboptimal sources can be difficult. A new procedure to characterize multiple SNPs in traces of DNA from plasma and old dried blood samples was developed. Six SNPs in the

  8. Determination of the Nucleic Acid Adducts Structure at the Nucleoside/Nucleotide Level by NMR Spectroscopy

    Czech Academy of Sciences Publication Activity Database

    Dračínský, Martin; Pohl, Radek

    2015-01-01

    Roč. 28, č. 2 (2015), s. 155-165 ISSN 0893-228X R&D Projects: GA ČR GA13-24880S Institutional support: RVO:61388963 Keywords : NMR spectroscopy * nucleic acids * nucleotides Subject RIV: CC - Organic Chemistry Impact factor: 3.025, year: 2015

  9. Lupus-related single nucleotide polymorphisms and risk of diffuse large B-cell lymphoma

    NARCIS (Netherlands)

    Bernatsky, Sasha; Velásquez García, Héctor A; Spinelli, John; Gaffney, Patrick; Smedby, Karin E; Ramsey-Goldman, Rosalind; Wang, Sophia S.; Adami, Hans-Olov; Albanes, Demetrius; Angelucci, Emanuele; Ansell, Stephen M.; Asmann, Yan W.; Becker, Nikolaus; Benavente, Yolanda; Berndt, Sonja I.; Bertrand, Kimberly A.; Birmann, Brenda M.; Boeing, Heiner; Boffetta, Paolo; Bracci, Paige M.; Brennan, Paul; Brooks-Wilson, Angela R.; Cerhan, James R.; Chanock, Stephen J.; Clavel, Jacqueline; Conde, Lucia; Cotenbader, Karen H; Cox, David G; Cozen, Wendy; Crouch, Simon; De Roos, Anneclaire J.; De Sanjose, Silvia; Di Lollo, Simonetta; Diver, W. Ryan; Dogan, Ahmet; Foretova, Lenka; Ghesquières, Hervé; Giles, Graham G.; Glimelius, Bengt; Habermann, Thomas M.; Haioun, Corinne; Hartge, Patricia; Hjalgrim, Henrik; Holford, Theodore R.; Holly, Elizabeth A.; Jackson, Rebecca D.; Kaaks, Rudolph; Kane, Eleanor; Kelly, Rachel S.; Klein, Robert J.; Kraft, Peter; Kricker, Anne; Lan, Qing; Lawrence, Charles; Liebow, Mark; Lightfoot, Tracy; Link, Brian K.; Maynadie, Marc; McKay, James; Melbye, Mads; Molina, Thierry Jo; Monnereau, Alain; Morton, Lindsay M.; Nieters, Alexandra; North, Kari E.; Novak, Anne J.; Offit, Kenneth; Purdue, Mark P.; Rais, Marco; Riby, Jacques; Roman, Eve; Rothman, Nathaniel; Salles, Gilles; Severi, Gianluca; Severson, Richard K.; Skibola, Christine F.; Slager, Susan L.; Smith, Alex; Smith, Martyn T.; Southey, Melissa C.; Staines, Anthony; Teras, Lauren R.; Thompson, Carrie A.; Tilly, Hervé; Tinker, Lesley F.; Tjonneland, Anne; Turner, Jenny; Vajdic, Claire M.; Vermeulen, Roel C H; Vijai, Joseph; Vineis, Paolo; Virtamo, Jarmo; Wang, Zhaoming; Weinstein, Stephanie; Witzig, Thomas E.; Zelenetz, Andrew; Zeleniuch-Jacquotte, Anne; Zhang, Yawei; Zheng, Tongzhang; Zucca, Mariagrazia; Clarke, Ann E

    2017-01-01

    Objective: Determinants of the increased risk of diffuse large B-cell lymphoma (DLBCL) in SLE are unclear. Using data from a recent lymphoma genome-wide association study (GWAS), we assessed whether certain lupus-related single nucleotide polymorphisms (SNPs) were also associated with DLBCL.

  10. Synthesis of Benzene and Pyridine 2-C-Methyl-C-ribonucleosides and -nucleotides

    Czech Academy of Sciences Publication Activity Database

    Tokarenko, Anna; Poštová Slavětínská, Lenka; Klepetářová, Blanka; Hocek, Michal

    2015-01-01

    Roč. 2015, č. 36 (2015), s. 7962-7983 ISSN 1434-193X R&D Projects: GA ČR GAP207/11/0344 Institutional support: RVO:61388963 Keywords : nucleosides * nucleotides * glycosides * antiviral agents * cross - coupling Subject RIV: CC - Organic Chemistry Impact factor: 3.068, year: 2015

  11. Synthesis of Substituted Benzyl Homo-C-Ribonucleosides and -Nucleotides as Carba-Analogues of Phosphoribosylanthranilate

    Czech Academy of Sciences Publication Activity Database

    Kubelka, Tomáš; Slavětínská, Lenka; Hocek, Michal

    -, č. 26 (2012), s. 4969-4981 ISSN 1434-193X R&D Projects: GA ČR GAP207/11/0344; GA AV ČR IAA400550902 Institutional support: RVO:61388963 Keywords : C-nucleosides * homonucleosides * cross - coupling * nucleotides Subject RIV: CC - Organic Chemistry Impact factor: 3.344, year: 2012

  12. Adsorption of nucleotides onto Fe-Mg-Al rich swelling clays

    Science.gov (United States)

    Feuillie, Cécile; Daniel, Isabelle; Michot, Laurent J.; Pedreira-Segade, Ulysse

    2013-11-01

    Mineral surfaces may have played a role in the origin of the first biopolymers, by concentrating organic monomers from a dilute ocean. Swelling clays provide a high surface area for the concentration of prebiotic monomers, and have therefore been the subject of numerous investigations. In that context, montmorillonite, the most abundant swelling clay in modern environments, has been extensively studied with regard to adsorption and polymerization of nucleic acids. However, montmorillonite was probably rather marginal on the primitive ocean floor compared to iron-magnesium rich phyllosilicates such as nontronite that results from the hydrothermal alteration of a mafic or ultramafic oceanic crust. In the present paper, we study the adsorption of nucleotides on montmorillonite and nontronite, at various pH and ionic strength conditions plausible for Archean sea-water. A thorough characterization of the mineral surfaces shows that nucleotide adsorb mainly on the edge faces of the smectites by ligand exchange between the phosphate groups of the nucleotides and the -OH groups from the edge sites over a wide pH range (4-10). Nontronite is more reactive than montmorillonite. At low pH, additional ion exchange may play a role as the nucleotides become positively charged.

  13. Transmembrane Domain Single-Nucleotide Polymorphisms Impair Expression and Transport Activity of ABC Transporter ABCG2

    NARCIS (Netherlands)

    Sjostedt, N.; Heuvel, J.J.M.W. van den; Koenderink, J.B.; Kidron, H.

    2017-01-01

    PURPOSE: To study the function and expression of nine naturally occurring single-nucleotide polymorphisms (G406R, F431L, S441N, P480L, F489L, M515R, L525R, A528T and T542A) that are predicted to reside in the transmembrane regions of the ABC transporter ABCG2. METHODS: The transport activity of the

  14. Typing of canine parvovirus isolates using mini-sequencing based single nucleotide polymorphism analysis.

    Science.gov (United States)

    Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A

    2012-05-01

    The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.

  15. Oligodeoxynucleotides containing 2'-amino-LNA nucleotides as constrained morpholino phosphoramidate and phosphorodiamidate monomers

    DEFF Research Database (Denmark)

    Kristensen, Kim Vejlegaard; Paul, Sibasish; Kosbar, Tamer

    2017-01-01

    Incorporation in a 2'→5' direction of a phosphorodiamidite 2'-amino-LNA-T nucleotide as the morpholino phosphoramidate and N,N-dimethylamino phosphorodiamidate monomers into six oligonucleotides is reported. Thermal denaturation studies showed that the novel 2'-amino-LNA-based morpholino monomers...

  16. Dietary nucleotide supplementation raises erythrocyte 2, 3-diphosphoglycerate concentration in neonatal rats.

    Science.gov (United States)

    Scopesi, F; Verkeste, C M; Paola, D; Gazzolo, D; Pronzato, M A; Bruschettini, P L; Marinari, U M

    1999-03-01

    The present study was designed to test if dietary intake of nucleotides increases erythrocyte 2,3-diphosphoglycerate (2,3-DPG) in neonatal rats. To this end, rat pups were fed a nucleotide-supplemented formula (S, n = 14) from d 9 until d 16 after birth. The results were compared with those obtained from a group of breast-fed pups (C, n = 14) and a group of pups artificially fed with nucleotide-free formula (NS, n = 14). Neonatal weight, 2,3-DPG concentration, hematocrit (Hct) and hemoglobin concentration (Hb) were determined before the experiment (d 9) and after 7 d of treatment (d 16). In all groups, 2,3-DPG concentration was greater at d 16 than d 9, and the increase was greater in the S group than in the NS group. Alterations in neonatal weight, Hct and Hb concentration did not differ among the groups. On d 16 the 2, 3-DPG/Hb ratio, reflecting the affinity of hemoglobin for oxygen, was significantly higher in the C and S groups than in the NS group. We conclude that in neonatal rats, dietary nucleotides increase erythrocyte 2,3-DPG concentration. Studies need to be conducted in humans to assess the effect of this increase on both neonatal peripheral hemodynamics and metabolism in this species.

  17. Synthesis of Hydrazone-Modified Nucleotides and Their Polymerase Incorporation onto DNA for Redox Labeling

    Czech Academy of Sciences Publication Activity Database

    Raindlová, Veronika; Pohl, Radek; Klepetářová, Blanka; Havran, Luděk; Šimková, Eva; Horáková Brázdilová, Petra; Pivoňková, Hana; Fojta, Miroslav; Hocek, Michal

    2012-01-01

    Roč. 77, č. 8 (2012), s. 652-662 ISSN 2192-6506 R&D Projects: GA AV ČR(CZ) IAA400040901; GA ČR GBP206/12/G151 Institutional research plan: CEZ:AV0Z40550506; CEZ:AV0Z50040702 Keywords : DNA * oligonucleotides * polymerase * hydrazones * nucleotides Subject RIV: CC - Organic Chemistry

  18. Single-nucleotide polymorphism of INS, INSR, IRS1, IRS2, PPAR-G ...

    Indian Academy of Sciences (India)

    2017-03-02

    Mar 2, 2017 ... Abstract. Polycystic ovary syndrome (PCOS) is the most common and a complex female endocrine disorder, and is one of the leading cause of female infertility. Here, we aimed to investigate the association of single-nucleotide polymorphism of INS, INSR,. IRS1, IRS2, PPAR-G and CAPN10 gene in the ...

  19. On the biased nucleotide composition of the human coronavirus RNA genome

    NARCIS (Netherlands)

    Berkhout, Ben; van Hemert, Formijn

    2015-01-01

    We investigated the nucleotide composition of the RNA genome of the six human coronaviruses. Some general coronavirus characteristics were apparent (e.g. high U, low C count), but we also detected species-specific signatures. Most strikingly, the high U and low C proportions are quite variable and

  20. Enhanced activity of the purine nucleotide cycle of the exercising muscle in patients with hyperthyroidism.

    Science.gov (United States)

    Fukui, H; Taniguchi , S; Ueta, Y; Yoshida, A; Ohtahara, A; Hisatome, I; Shigemasa, C

    2001-05-01

    Myopathy frequently develops in patients with hyperthyroidism, but its precise mechanism is not clearly understood. In this study we focused on the purine nucleotide cycle, which contributes to ATP balance in skeletal muscles. To investigate purine metabolism in muscles, we measured metabolites related to the purine nucleotide cycle using the semiischemic forearm test. We examined the following four groups: patients with untreated thyrotoxic Graves' disease (untreated group), patients with Graves' disease treated with methimazole (treated group), patients in remission (remission group), and healthy volunteers (control group). To trace the glycolytic process, we measured glycolytic metabolites (lactate and pyruvate) as well as purine metabolites (ammonia and hypoxanthine). In the untreated group, the levels of lactate, pyruvate, and ammonia released were remarkably higher than those in the control group. Hypoxanthine release also increased in the untreated group, but the difference among the patient groups was not statistically significant. The accelerated purine catabolism did not improve after 3 months of treatment with methimazole, but it was completely normalized in the remission group. This indicated that long-term maintenance of thyroid function was necessary for purine catabolism to recover. We presume that an unbalanced ATP supply or conversion of muscle fiber type may account for the acceleration of the purine nucleotide cycle under thyrotoxicosis. Such acceleration of the purine nucleotide cycle is thought to be in part a protective mechanism against a rapid collapse of the ATP energy balance in exercising muscles of patients with hyperthyroidism.

  1. Coupling of guanine nucleotide inhibitory protein to somatostatin receptors on pancreatic acinar membranes

    International Nuclear Information System (INIS)

    Sakamoto, C.; Matozaki, T.; Nagao, M.; Baba, S.

    1987-01-01

    Guanine nucleotides and pertussis toxin were used to investigate whether somatostatin receptors interact with the guanine nucleotide inhibitory protein (NI) on pancreatic acinar membranes in the rat. Guanine nucleotides reduced 125 I-[Tyr 1 ]somatostatin binding to acinar membranes up to 80%, with rank order of potency being 5'-guanylyl imidodiphosphate [Gpp(NH)p]>GTP>TDP>GMP. Scatchard analysis revealed that the decrease in somatostatin binding caused by Gpp(NH)p was due to the decrease in the maximum binding capacity without a significant change in the binding affinity. The inhibitory effect of Gpp(NH)p was partially abolished in the absence of Mg 2+ . When pancreatic acini were treated with 1 μg/ml pertussis toxin for 4 h, subsequent 125 I-[Tyr 1 ]somatostatin binding to acinar membranes was reduced. Pertussis toxin treatment also abolished the inhibitory effect of somatostatin on vasoactive intestinal peptide-stimulated increase in cellular content of adenosine 3',5'-cyclic monophosphate (cAMP) in the acini. The present results suggest that 1) somatostatin probably functions in the pancreas to regulate adenylate cyclase enzyme system via Ni, 2) the extent of modification of Ni is correlated with the ability of somatostatin to inhibit cAMP accumulation in acini, and 3) guanine nucleotides also inhibit somatostatin binding to its receptor

  2. Dynamic interaction of TTDA with TFIIH is stabilized by nucleotide excision repair in living cells.

    NARCIS (Netherlands)

    G. Giglia-Mari (Giuseppina); C. Miquel (Catherine); A.F. Theil (Arjan); P.O. Mari (Pierre-Olivier); D. Hoogstraten (Deborah); J.M.Y. Ng (Jessica); C. Dinant (Christoffel); J.H.J. Hoeijmakers (Jan); W. Vermeulen (Wim)

    2006-01-01

    textabstractTranscription/repair factor IIH (TFIIH) is essential for RNA polymerase II transcription and nucleotide excision repair (NER). This multi-subunit complex consists of ten polypeptides, including the recently identified small 8-kDa trichothiodystrophy group A (TTDA)/ hTFB5 protein.

  3. Nucleotide variation in ATHK1 region of Arabidopsis thaliana and its ...

    African Journals Online (AJOL)

    The ATHK1 gene in Arabidopsis encodes a putative histidine kinase that is transcriptionally upregulated in response to changes in external osmolarity. In this work, we investigated the nucleotide variability of the ATHK1 gene in a sample of 32 core Arabidopsis accessions originating from different ecoclimatic regions and ...

  4. 5-Fluorouracil, colchicine, benzo[a]pyrene and cytosine arabinoside tested in the in vitro mammalian cell micronucleus test (MNvit) in Chinese hamster V79 cells at Covance Laboratories, Harrogate, UK in support of OECD draft Test Guideline 487.

    Science.gov (United States)

    Whitwell, James; Fowler, Paul; Allars, Sarah; Jenner, Karen; Lloyd, Melvyn; Wood, Debbie; Smith, Katie; Young, Jamie; Jeffrey, Laura; Kirkland, David

    2010-10-29

    The reference genotoxic agents 5-fluorouracil (a nucleoside analogue, characterised by a steep dose response profile), colchicine (an aneugen that inhibits tubulin polymerisation), benzo[a]pyrene (a polycyclic aromatic hydrocarbon requiring metabolic activation) and cytosine arabinoside (a nucleoside analogue that inhibits the gap-filling step of excision repair) were tested in the in vitro micronucleus assay using the Chinese hamster V79 cell line at Covance Laboratories, Harrogate, UK. All chemicals were treated in the absence and presence of cytokinesis block (via addition of cytochalasin B) with this work forming part of a collaborative evaluation of the toxicity measures recommended in the draft OECD Test Guideline 487 on the In Vitro Mammalian Cell Micronucleus Test (MNvit). The toxicity measures used, detecting a possible combination of both cytostasis and cell death (though not cell death directly), were relative population doubling, relative increase in cell counts and relative cell counts for treatments in the absence of cytokinesis block, and replication index in the presence of cytokinesis block. All of the chemicals tested either gave marked increases in the percentage of micronucleated cells with and without cytokinesis block, or did not induce micronuclei at concentrations giving approximately 50-60% toxicity (cytostasis and cell death) or less by all of the toxicity measures used. The outcome from this series of tests supports the use of relative increase in cell counts and relative population doubling, as well as relative cell counts, as appropriate measures of cytotoxicity for the non-cytokinesis blocked in vitro micronucleus assay. Copyright © 2010 Elsevier B.V. All rights reserved.

  5. Using a Fluorescent Cytosine Analogue tC[superscript o] To Probe the Effect of the Y567 to Ala Substitution on the Preinsertion Steps of dNMP Incorporation by RB69 DNA Polymerase

    Energy Technology Data Exchange (ETDEWEB)

    Xia, Shuangluo; Beckman, Jeff; Wang, Jimin; Konigsberg, William H. (Yale)

    2012-10-10

    Residues in the nascent base pair binding pocket (NBP) of bacteriophage RB69 DNA polymerase (RB69pol) are responsible for base discrimination. Replacing Tyr567 with Ala leads to greater flexibility in the NBP, increasing the probability of misincorporation. We used the fluorescent cytosine analogue, 1,3-diaza-2-oxophenoxazine (tC{sup o}), to identify preinsertion step(s) altered by NBP flexibility. When tC{sup o} is the templating base in a wild-type (wt) RB69pol ternary complex, its fluorescence is quenched only in the presence of dGTP. However, with the RB69pol Y567A mutant, the fluorescence of tC{sup o} is also quenched in the presence of dATP. We determined the crystal structure of the dATP/tC{sup o}-containing ternary complex of the RB69pol Y567A mutant at 1.9 {angstrom} resolution and found that the incoming dATP formed two hydrogen bonds with an imino-tautomerized form of tC{sup o}. Stabilization of the dATP/tC{sup o} base pair involved movement of the tC{sup o} backbone sugar into the DNA minor groove and required tilting of the tC{sup o} tricyclic ring to prevent a steric clash with L561. This structure, together with the pre-steady-state kinetic parameters and dNTP binding affinity, estimated from equilibrium fluorescence titrations, suggested that the flexibility of the NBP, provided by the Y567 to Ala substitution, led to a more favorable forward isomerization step resulting in an increase in dNTP binding affinity.

  6. The binding of glucose and nucleotides to hexokinase from Saccharomyces cerevisiae.

    Science.gov (United States)

    Woolfitt, A R; Kellett, G L; Hoggett, J G

    1988-01-29

    The binding of glucose, ADP and AdoPP[NH]P, to the native PII dimer and PII monomer and the proteolytically-modified SII monomer of hexokinase (ATP:D-hexose 6-phosphotransferase, EC 2.7.1.1) from Saccharomyces cerevisiae was monitored at pH 6.7 by the concomitant quenching of protein fluorescence. The data were analysed in terms of Qmax, the maximal quenching of fluorescence at saturating concentrations of ligand, and [L]0.5, the concentration of ligand at half-maximal quenching. No changes in fluorescence were observed with free enzyme and nucleotide alone. In the presence of saturating levels of glucose, Qmax induced by nucleotide was between 2 and 7%, and [L]0.5 was between 0.12 and 0.56 mM, depending on the nucleotide and enzyme species. Qmax induced by glucose alone was between 22 and 25%, while [L]0.5 was approx. 0.4 mM for either of the monomeric hexokinase forms and 3.4 for PII dimer. In the presence of 6 mM ADP or 2 mM AdoPP[NH]P, Qmax for glucose was increased by up to 4% and [L]0.5 was diminished 3-fold for hexokinase PII monomer, 6-fold for SII monomer, and 15-fold for PII dimer. The results are interpreted in terms of nucleotide-induced conformational change of hexokinase in the presence of glucose and synergistic binding interactions between glucose and nucleotide.

  7. Ras conformational switching: simulating nucleotide-dependent conformational transitions with accelerated molecular dynamics.

    Directory of Open Access Journals (Sweden)

    Barry J Grant

    2009-03-01

    Full Text Available Ras mediates signaling pathways controlling cell proliferation and development by cycling between GTP- and GDP-bound active and inactive conformational states. Understanding the complete reaction path of this conformational change and its intermediary structures is critical to understanding Ras signaling. We characterize nucleotide-dependent conformational transition using multiple-barrier-crossing accelerated molecular dynamics (aMD simulations. These transitions, achieved for the first time for wild-type Ras, are impossible to observe with classical molecular dynamics (cMD simulations due to the large energetic barrier between end states. Mapping the reaction path onto a conformer plot describing the distribution of the crystallographic structures enabled identification of highly populated intermediate structures. These structures have unique switch orientations (residues 25-40 and 57-75 intermediate between GTP and GDP states, or distinct loop3 (46-49, loop7 (105-110, and alpha5 C-terminus (159-166 conformations distal from the nucleotide-binding site. In addition, these barrier-crossing trajectories predict novel nucleotide-dependent correlated motions, including correlations of alpha2 (residues 66-74 with alpha3-loop7 (93-110, loop2 (26-37 with loop10 (145-151, and loop3 (46-49 with alpha5 (152-167. The interconversion between newly identified Ras conformations revealed by this study advances our mechanistic understanding of Ras function. In addition, the pattern of correlated motions provides new evidence for a dynamic linkage between the nucleotide-binding site and the membrane interacting C-terminus critical for the signaling function of Ras. Furthermore, normal mode analysis indicates that the dominant collective motion that occurs during nucleotide-dependent conformational exchange, and captured in aMD (but absent in cMD simulations, is a low-frequency motion intrinsic to the structure.

  8. DNA incorporation of 6-thioguanine nucleotides during maintenance therapy of childhood acute lymphoblastic leukaemia and non-Hodgkin lymphoma

    DEFF Research Database (Denmark)

    Hedeland, Rikke L; Hvidt, Kristian; Nersting, Jacob

    2010-01-01

    To explore the DNA incorporation of 6-thioguanine nucleotide levels (DNA-6TGN) during 6-mercaptopurine (6MP) therapy of childhood acute lymphoblastic leukaemia (ALL) and non-Hodgkin lymphoma (NHL) and its relation to erythrocyte levels of their metabolites: 6-thioguanine-nucleotides (E-6TGN...

  9. Simulation of the coupling between nucleotide binding and transmembrane domains in the ABC transporter BtuCD

    DEFF Research Database (Denmark)

    Sonne, Jacob; Kandt, C.; Peters, Günther H.j.

    2007-01-01

    The nucleotide-induced structural rearrangements in ATP binding cassette (ABC) transporters, leading to substrate translocation, are largely unknown. We have modeled nucleotide binding and release in the vitamin B12 importer BtuCD using perturbed elastic network calculations and biased molecular...

  10. Genome-wide divergence and linkage disequilibrium analyses for Capsicum baccatum revealed by genome-anchored single nucleotide polymorphisms

    Science.gov (United States)

    Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to show the distribution of these 2 important incompatible cultivated pepper species. Estimated mean nucleotide...

  11. Nucleotide variability and linkage disequilibrium patterns in the porcine MUC4 gene

    Directory of Open Access Journals (Sweden)

    Yang Ming

    2012-07-01

    Full Text Available Abstract Background MUC4 is a type of membrane anchored glycoprotein and serves as the major constituent of mucus that covers epithelial surfaces of many tissues such as trachea, colon and cervix. MUC4 plays important roles in the lubrication and protection of the surface epithelium, cell proliferation and differentiation, immune response, cell adhesion and cancer development. To gain insights into the evolution of the porcine MUC4 gene, we surveyed the nucleotide variability and linkage disequilibrium (LD within this gene in Chinese indigenous breeds and Western commercial breeds. Results A total of 53 SNPs covering the MUC4 gene were genotyped on 5 wild boars and 307 domestic pigs representing 11 Chinese breeds and 3 Western breeds. The nucleotide variability, haplotype phylogeny and LD extent of MUC4 were analyzed in these breeds. Both Chinese and Western breeds had considerable nucleotide diversity at the MUC4 locus. Western pig breeds like Duroc and Large White have comparable nucleotide diversity as many of Chinese breeds, thus artificial selection for lean pork production have not reduced the genetic variability of MUC4 in Western commercial breeds. Haplotype phylogeny analyses indicated that MUC4 had evolved divergently in Chinese and Western pigs. The dendrogram of genetic differentiation between breeds generally reflected demographic history and geographical distribution of these breeds. LD patterns were unexpectedly similar between Chinese and Western breeds, in which LD usually extended less than 20 kb. This is different from the presumed high LD extent (more than 100 kb in Western commercial breeds. The significant positive Tajima’D, and Fu and Li’s D statistics in a few Chinese and Western breeds implied that MUC4 might undergo balancing selection in domestic breeds. Nevertheless, we cautioned that the significant statistics could be upward biased by SNP ascertainment process. Conclusions Chinese and Western breeds have

  12. Nucleotide sequence of the coat protein gene of the Skierniewice isolate of plum pox virus (PPV)

    International Nuclear Information System (INIS)

    Wypijewski, K.; Musial, W.; Augustyniak, J.; Malinowski, T.

    1994-01-01

    The coat protein (CP) gene of the Skierniewice isolate of plum pox virus (PPV-S) has been amplified using the reverse transcription - polymerase chain reaction (RT-PCR), cloned and sequenced. The nucleotide sequence of the gene and the deduced amino-acid sequences of PPV-S CP were compared with those of other PPV strains. The nucleotide sequence showed very high homology to most of the published sequences. The motif: Asp-Ala-Gly (DAG), important for the aphid transmissibility, was present in the amino-acid sequence. Our isolate did not react in ELISA with monoclonal antibodies MAb06 supposed to be specific for PPV-D. (author). 32 refs, 1 fig., 2 tabs

  13. Molecular cloning and complete nucleotide sequence of a human ventricular myosin light chain 1

    Energy Technology Data Exchange (ETDEWEB)

    Hoffmann, E; Shi, Q W; Floroff, M; Mickle, D A.G.; Wu, T W; Olley, P M; Jackowski, G

    1988-03-25

    Human ventricular plasmid library was constructed. The library was screened with the oligonucleotide probe (17-mer) corresponding to a conserve region of myosin light chain 1 near the carboxy terminal. Full length cDNA recombinant plasmid containing 1100 bp insert was isolated. RNA blot hybridization with this insert detected a message of approximately 1500 bp corresponding to the size of VLCl and mRNA. Complete nucleotide sequence of the coding region was determined in M13 subclones using dideoxy chain termination method. With the isolation of this clone (pCD HLVCl), the publication of the complete nucleotide sequence of HVLCl and the predicted secondary structure of this protein will aid in understanding of the biochemistry of myosin and its function in contraction, the evolution of myosin light genes and the genetic, developmental and physiological regulation of myosin genes.

  14. Effects of preservation methods on amino acids and 5'-nucleotides of Agaricus bisporus mushrooms.

    Science.gov (United States)

    Liu, Ying; Huang, Fan; Yang, Hong; Ibrahim, S A; Wang, Yan-Feng; Huang, Wen

    2014-04-15

    In this study, the proximate composition, free amino acids content and 5'-nucleotides in frozen, canned and salted Agaricus bisporus (A. bisporus) were investigated. We found that the three kinds of A. bisporus products were good sources of protein, with amount varying in the ranges of 16.54-24.35g/100g (dry weight). Freezing, canning and salting process, followed by 6months of storage led to a significant reduction in free amino acids, especially tyrosine, alanine, glutamine and cysteine. There were medium levels of MSG-like amino acids in frozen A. bisporus and canned A. bisporus, and low levels of MSG-like amino acids in salted A. bisporus. The mount of flavor 5'-nucleotides in frozen A. bisporus was higher than that of canned and salted A. bisporus. The present study thus suggests that freezing is beneficial for the preservation of A. bisporus. Copyright © 2013 Elsevier Ltd. All rights reserved.

  15. Prioritizing single-nucleotide polymorphisms and variants associated with clinical mastitis

    Directory of Open Access Journals (Sweden)

    Suravajhala P

    2017-06-01

    Full Text Available Prashanth Suravajhala,1 Alfredo Benso2 1Department of Molecular Biology and Genetics, Center for Quantitative Genetics and Genomics, Aarhus University, Aarhus, Denmark; 2Department of Control and Computer Engineering, Politecnico di Torino, Torino, Italy Abstract: Next-generation sequencing technology has provided resources to easily explore and identify candidate single-nucleotide polymorphisms (SNPs and variants. However, there remains a challenge in identifying and inferring the causal SNPs from sequence data. A problem with different methods that predict the effect of mutations is that they produce false positives. In this hypothesis, we provide an overview of methods known for identifying causal variants and discuss the challenges, fallacies, and prospects in discerning candidate SNPs. We then propose a three-point classification strategy, which could be an additional annotation method in identifying causalities. Keywords: clinical mastitis, single-nucleotide polymorphisms, variants, associations, diseases, linkage disequilibrium, GWAS

  16. Effect of ionizing radiation on calcium and cyclic nucleotides metabolism in rats of different age

    International Nuclear Information System (INIS)

    Efimova, N.I.; Libenson, S.V.

    1982-01-01

    Some features of mechanism of calcium homeostasis and cyclic nucleotide exchange breakage in case of acute radiation injury of rats of various age were studied. It is established that calcium level in blood in nonpuberal animals, calcium and cAMP excretion with urine are minimal and reach maximum at puberal age. cGMP excretion with urine and concentrational levels of cAMP and cGMP in blood do not change with age. It is shown that calcium excretion with urine decreases adaptively in conditions of acute radiation injury in rats of all age groups. Maximal shifts in cAMP/cGMP ratio were noted in nonpuberal animals, whereas maximal adaptive-compensatory abilities in the regulation system of calcium homeostasis and cyclic nucleotides are typical to adolescent puberal animals

  17. Protected DNA strand displacement for enhanced single nucleotide discrimination in double-stranded DNA.

    Science.gov (United States)

    Khodakov, Dmitriy A; Khodakova, Anastasia S; Huang, David M; Linacre, Adrian; Ellis, Amanda V

    2015-03-04

    Single nucleotide polymorphisms (SNPs) are a prime source of genetic diversity. Discriminating between different SNPs provides an enormous leap towards the better understanding of the uniqueness of biological systems. Here we report on a new approach for SNP discrimination using toehold-mediated DNA strand displacement. The distinctiveness of the approach is based on the combination of both 3- and 4-way branch migration mechanisms, which allows for reliable discrimination of SNPs within double-stranded DNA generated from real-life human mitochondrial DNA samples. Aside from the potential diagnostic value, the current study represents an additional way to control the strand displacement reaction rate without altering other reaction parameters and provides new insights into the influence of single nucleotide substitutions on 3- and 4-way branch migration efficiency and kinetics.

  18. Role of Metal Oxides in Chemical Evolution: Interaction of Ribose Nucleotides with Alumina

    Science.gov (United States)

    Arora, Avnish Kumar; Kamaluddin

    2009-03-01

    Interaction of ribonucleotides—namely, 5‧-AMP, 5‧-GMP, 5‧-CMP, and 5‧-UMP—with acidic, neutral, and basic alumina has been studied. Purine nucleotides showed higher adsorption on alumina in comparison with pyrimidine nucleotides under acidic conditions. Adsorption data obtained followed Langmuir adsorption isotherm, and Xm and KL values were calculated. On the basis of infrared spectral studies of ribonucleotides, alumina, and ribonucleotide-alumina adducts, we propose that the nitrogen base and phosphate moiety of the ribonucleotides interact with the positive charge surface of alumina. Results of the present study may indicate the importance of alumina in concentrating organic molecules from dilute aqueous solutions in primeval seas in the course of chemical evolution on Earth.

  19. An algorithm and program for finding sequence specific oligo-nucleotide probes for species identification

    Directory of Open Access Journals (Sweden)

    Tautz Diethard

    2002-03-01

    Full Text Available Abstract Background The identification of species or species groups with specific oligo-nucleotides as molecular signatures is becoming increasingly popular for bacterial samples. However, it shows also great promise for other small organisms that are taxonomically difficult to tract. Results We have devised here an algorithm that aims to find the optimal probes for any given set of sequences. The program requires only a crude alignment of these sequences as input and is optimized for performance to deal also with very large datasets. The algorithm is designed such that the position of mismatches in the probes influences the selection and makes provision of single nucleotide outloops. Program implementations are available for Linux and Windows.

  20. A Lateral Flow Biosensor for the Detection of Single Nucleotide Polymorphisms.

    Science.gov (United States)

    Zeng, Lingwen; Xiao, Zhuo

    2017-01-01

    A lateral flow biosensor (LFB) is introduced for the detection of single nucleotide polymorphisms (SNPs). The assay is composed of two steps: circular strand displacement reaction and lateral flow biosensor detection. In step 1, the nucleotide at SNP site is recognized by T4 DNA ligase and the signal is amplified by strand displacement DNA polymerase, which can be accomplished at a constant temperature. In step 2, the reaction product of step 1 is detected by a lateral flow biosensor, which is a rapid and cost effective tool for nuclei acid detection. Comparing with conventional methods, it requires no complicated machines. It is suitable for the use of point of care diagnostics. Therefore, this simple, cost effective, robust, and promising LFB detection method of SNP has great potential for the detection of genetic diseases, personalized medicine, cancer related mutations, and drug-resistant mutations of infectious agents.

  1. Lack of nucleotide variability in a beetle pest with extreme inbreeding

    OpenAIRE

    Andreev, D.; Breilid, H.; Kirkendall, L.; Brun, Luc-Olivier; French-Constant, R.H.

    1998-01-01

    The coffee berry borer beetle #Hypothenemus hampei$ (Ferrari) (#Curculionidae$ : #Scolytinae$) is the major insect pest of coffee and has spread to most of the coffee-growing countries of the world. This beetle also displays an usual life cycle, with regular sibling mating. This regular inbreeding and the population bottlenecks occuring on colonization of new regions should lead to low levels of genetic diversity. We were therefore interested in determining the level of nucleotide variation i...

  2. Non-nucleotide Agonists Triggering P2X7 Receptor Activation and Pore Formation

    Directory of Open Access Journals (Sweden)

    Francesco Di Virgilio

    2018-02-01

    Full Text Available The P2X7 receptor (P2X7R is a ligand-gated plasma membrane ion channel belonging to the P2X receptor subfamily activated by extracellular nucleotides. General consensus holds that the physiological (and maybe the only agonist is ATP. However, scattered evidence generated over the last several years suggests that ATP might not be the only agonist, especially at inflammatory sites. Solid data show that NAD+ covalently modifies the P2X7R of mouse T lymphocytes, thus lowering the ATP threshold for activation. Other structurally unrelated agents have been reported to activate the P2X7R via a poorly understood mechanism of action: (a the antibiotic polymyxin B, possibly a positive allosteric P2X7R modulator, (b the bactericidal peptide LL-37, (c the amyloidogenic β peptide, and (d serum amyloid A. Some agents, such as Alu-RNA, have been suggested to activate the P2X7R acting on the intracellular N- or C-terminal domains. Mode of P2X7R activation by these non-nucleotide ligands is as yet unknown; however, these observations raise the intriguing question of how these different non-nucleotide ligands may co-operate with ATP at inflammatory or tumor sites. New information obtained from the cloning and characterization of the P2X7R from exotic mammalian species (e.g., giant panda and data from recent patch-clamp studies are strongly accelerating our understanding of P2X7R mode of operation, and may provide hints to the mechanism of activation of P2X7R by non-nucleotide ligands.

  3. Non-thiolate ligation of nickel by nucleotide-free UreG of Klebsiella aerogenes

    Energy Technology Data Exchange (ETDEWEB)

    Martin-Diaconescu, Vlad; Joseph, Crisjoe A.; Boer, Jodi L.; Mulrooney, Scott B.; Hausinger, Robert P.; Maroney, Michael J.

    2016-12-21

    Nickel-dependent ureases are activated by a multiprotein complex that includes the GTPase UreG. Prior studies showed that nucleotide-free UreG from Klebsiella aerogenes is monomeric and binds one nickel or zinc ion with near-equivalent affinity using an undefined binding site, whereas nucleotide-free UreG from Helicobacter pylori selectively binds one zinc ion per dimer via a universally conserved Cys-Pro-His motif in each protomer. Iodoacetamide-treated K. aerogenes UreG was nearly unaffected in nickel binding compared to non-treated sample, suggesting the absence of thiolate ligands to the metal. X-ray absorption spectroscopy of nickel-bound UreG showed the metal possessed four-coordinate geometry with all O/N donor ligands including one imidazole, thus confirming the absence of thiolate ligation. The nickel site in Strep-tag II-modified protein possessed six-coordinate geometry, again with all O/N donor ligands, but now including two or three imidazoles. An identical site was noted for the Strep-tag II-modified H74A variant, substituted in the Cys-Pro-His motif, ruling out coordination by this His residue. These results are consistent with metal binding to both His6 and a His residue of the fusion peptide in Strep-tagged K. aerogenes UreG. We conclude that the nickel- and zinc-binding site in nucleotide-free K. aerogenes UreG is distinct from that of nucleotide-free H. pylori UreG and does not involve the Cys-Pro-His motif. Further, we show the Strep-tag II can perturb metal coordination of this protein.

  4. Calcium-dependent, cyclic nucleotide-independent steroidogenesis in the bovine placenta.

    OpenAIRE

    Shemesh, M; Hansel, W; Strauss, J F

    1984-01-01

    Dispersed bovine placental cells (fetal cotyledon and maternal caruncle) were shown to synthesize progesterone. To determine if their steroidogenic activity could be modulated by a cyclic nucleotide-mediated process, we added luteinizing hormone, 8-bromoadenosine 3',5'-monophosphate, 8-bromoguanosine 3',5'-monophosphate, adenosine, or cholera toxin to dispersed cells from placentomes of 100-283 days gestational age and examined progesterone synthesis during 3-to 16-hr incubation periods. Net ...

  5. Robust embryo identification using first polar body single nucleotide polymorphism microarray-based DNA fingerprinting.

    Science.gov (United States)

    Treff, Nathan R; Su, Jing; Kasabwala, Natasha; Tao, Xin; Miller, Kathleen A; Scott, Richard T

    2010-05-01

    This study sought to validate a novel, minimally invasive system for embryo tracking by single nucleotide polymorphism microarray-based DNA fingerprinting of the first polar body. First polar body-based assignments of which embryos implanted and were delivered after multiple ET were 100% consistent with previously validated embryo DNA fingerprinting-based assignments. Copyright 2010 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  6. Prolinol-based nucleoside phosphonic acids: new isosteric conformationally flexible nucleotide analogues

    Czech Academy of Sciences Publication Activity Database

    Vaněk, Václav; Buděšínský, Miloš; Rinnová, Markéta; Rosenberg, Ivan

    2009-01-01

    Roč. 65, č. 4 (2009), s. 862-876 ISSN 0040-4020 R&D Projects: GA ČR GA203/05/0827; GA MŠk(CZ) LC06077; GA MŠk LC512; GA MŠk(CZ) LC06061 Institutional research plan: CEZ:AV0Z40550506 Keywords : nucleotide analogues * phosphonates * prolinol derivatives * N- alkylation Subject RIV: CC - Organic Chemistry Impact factor: 3.219, year: 2009

  7. Adenine and guanine nucleotide metabolism during platelet storage at 22 degree C

    International Nuclear Information System (INIS)

    Edenbrandt, C.M.; Murphy, S.

    1990-01-01

    Adenine and guanine nucleotide metabolism of platelet concentrates (PCs) was studied during storage for transfusion at 22 +/- 2 degrees C over a 7-day period using high-pressure liquid chromatography. There was a steady decrease in platelet adenosine triphosphate (ATP) and adenosine diphosphate (ADP), which was balanced quantitatively by an increase in plasma hypoxanthine. As expected, ammonia accumulated along with hypoxanthine but at a far greater rate. A fall in platelet guanosine triphosphate (GTP) and guanosine diphosphate (GDP) paralleled the fall in ATP + ADP. When adenine was present in the primary anticoagulant, it was carried over into the PC and metabolized. ATP, GTP, total adenine nucleotides, and total guanine nucleotides declined more slowly in the presence of adenine than in its absence. With adenine, the increase in hypoxanthine concentration was more rapid and quantitatively balanced the decrease in adenine and platelet ATP + ADP. Plasma xanthine rose during storage but at a rate that exceeded the decline in GTP + GDP. When platelet ATP + ADP was labeled with 14C-adenine at the initiation of storage, half of the radioactivity was transferred to hypoxanthine (45%) and GTP + GDP + xanthine (5%) by the time storage was completed. The isotopic data were consistent with the presence of a radioactive (metabolic) and a nonradioactive (storage) pool of ATP + ADP at the initiation of storage with each pool contributing approximately equally to the decline in ATP + ADP during storage. The results suggested a continuing synthesis of GTP + GDP from ATP + ADP, explaining the slower rate of fall of GTP + GDP relative to the rate of rise of plasma xanthine. Throughout storage, platelets were able to incorporate 14C-hypoxanthine into both adenine and guanine nucleotides but at a rate that was only one fourth the rate of hypoxanthine accumulation

  8. Nucleotide sequence analysis of regions of adenovirus 5 DNA containing the origins of DNA replication

    International Nuclear Information System (INIS)

    Steenbergh, P.H.

    1979-01-01

    The purpose of the investigations described is the determination of nucleotide sequences at the molecular ends of the linear adenovirus type 5 DNA. Knowledge of the primary structure at the termini of this DNA molecule is of particular interest in the study of the mechanism of replication of adenovirus DNA. The initiation- and termination sites of adenovirus DNA replication are located at the ends of the DNA molecule. (Auth.)

  9. Protected DNA strand displacement for enhanced single nucleotide discrimination in double-stranded DNA

    OpenAIRE

    Khodakov, Dmitriy A.; Khodakova, Anastasia S.; Huang, David M.; Linacre, Adrian; Ellis, Amanda V.

    2015-01-01

    Single nucleotide polymorphisms (SNPs) are a prime source of genetic diversity. Discriminating between different SNPs provides an enormous leap towards the better understanding of the uniqueness of biological systems. Here we report on a new approach for SNP discrimination using toehold-mediated DNA strand displacement. The distinctiveness of the approach is based on the combination of both 3- and 4-way branch migration mechanisms, which allows for reliable discrimination of SNPs within doubl...

  10. Mesenchymal stem cells from different murine tissues have differential capacity to metabolize extracellular nucleotides.

    Science.gov (United States)

    Iser, Isabele C; Bracco, Paula A; Gonçalves, Carlos E I; Zanin, Rafael F; Nardi, Nance B; Lenz, Guido; Battastini, Ana Maria O; Wink, Márcia R

    2014-10-01

    Mesenchymal stem cells (MSCs) have shown a great potential for cell-based therapy and many different therapeutic purposes. Despite the recent advances in the knowledge of MSCs biology, their biochemical and molecular properties are still poorly defined. Ecto-nucleoside triphosphate diphosphohydrolases (E-NTPDases) and ecto-5'-nucleotidase (eNT/CD73) are widely expressed enzymes that hydrolyze extracellular nucleotides, generating an important cellular signaling cascade. Currently, studies have evidenced the relationship between the purinergic system and the development, maintenance, and differentiation of stem cells. The objective of this study is to identify the NTPDases and eNT/CD73 and compare the levels of nucleotide hydrolysis on MSCs isolated from different murine tissues (bone marrow, lung, vena cava, kidney, pancreas, spleen, skin, and adipose tissue). MSCs from all tissues investigated expressed the ectoenzymes at different levels. In MSCs from pancreas and adipose tissue, the hydrolysis of triphosphonucleosides was significantly higher when compared to the other cells. The diphosphonucleosides were hydrolyzed at a higher rate by MSC from pancreas when compared to MSC from other tissues. The differential nucleotide hydrolysis activity and enzyme expression in these cells suggests that MSCs play different roles in regulating the purinergic system in these tissues. Overall MSCs are an attractive adult-derived cell population for therapies, however, the fact that ecto-nucleotide metabolism can affect the microenvironment, modulating important events, such as immune response, makes the assessment of this metabolism an important part of the characterization of MSCs to be applied therapeutically. © 2014 Wiley Periodicals, Inc.

  11. Nucleotide sequence, transcript mapping, and regulation of the RAD2 gene of Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Madura, K.; Prakash, S.

    1986-01-01

    The authors determined the nucleotide sequence, mapped the 5' and 3' nRNA termini, and examined the regulation of the RAD2 gene of Saccharomyces cerevisiae. A long open reading frame within the RAD2 transcribed region encodes a protein of 1031 amino acids with a calculated molecular weight of 117,847. A disruption of the RAD2 gene that deletes the 78 carboxyl terminal codons results in loss of RAD2 function. The 5' ends of RAD2 mRNA show considerable heterogeneity, mapping 5 to 62 nucleotides upstream of the first ATG codon of the long RAD2 open reading frame. The longest RAD2 transcripts also contain a short open reading frame of 37 codons that precedes and overlaps the 5' end of the long RAD2 open reading frame. The RAD2 3' nRNA end maps 171 nucleotides downstream of the TAA termination codon and 20 nucleotides downstream from a 12-base-pair inverted repeat that might function in transcript termination. Northern blot analysis showed a ninefold increase in steady-state levels of RAD2 mRNA after treatment of yeast cells with UV light. The 5' flanking region of the RAD2 gene contains several direct and inverted repeats and a 44-nuclotide-long purine-rich tract. The sequence T G G A G G C A T T A A found at position - 167 to -156 in the RAD2 gene is similar to at sequence present in the 5' flanking regions of the RAD7 and RAD10 genes

  12. Roles of phosphorylation and nucleotide binding domains in calcium transport by sarcoplasmic reticulum adenosinetriphosphatase

    International Nuclear Information System (INIS)

    Teruel, J.A.; Inesi, G.

    1988-01-01

    The roles of the phosphorylation (phosphorylated enzyme intermediate) and nucleotide binding domains in calcium transport were studied by comparing acetyl phosphate and ATP as substrates for the Ca 2+ -ATPase of sarcoplasmic reticulum vesicles. The authors found that the maximal level of phosphoenzyme obtained with either substrate is approximately 4 nmol/mg of protein, corresponding to the stoichiometry of catalytic sites in their preparation. The initial burst of phosphoenzyme formation observed in the transient state, following addition of either substrate, is accompanied by internalization of 2 mol of calcium per mole of phosphoenzyme. The internalized calcium is then translocated with a sequential pattern, independent of the substrate used. Following a rate-limiting step, the phosphoenzyme undergoes hydrolytic cleavage and proceeds to the steady-state activity which is soon back inhibited by the rise of Ca 2+ concentration in the lumen of the vesicles. When the back inhibition is released by the addition of oxalate, substrate utilization and calcium transport occur with a ratio of 1:2, independent of the substrate and its concentration. When the nucleotide binding site is derivatized with FITP, the enzyme can still utilize acetyl phosphate (but not ATP) for calcium transport. These observations demonstrate that the basic coupling mechanism of catalysis and calcium transport involves the phosphorylation and calcium binding domains, and not the nucleotide binding domain. On the other hand, occupancy of the FITC-sensitive nucleotide site is involved in kinetic regulation not only with respect to utilization of substrate for the phosphoryl transfer reaction but also for subsequent steps related to calcium translocation and phosphoenzyme turnover

  13. A single nucleotide change affects fur-dependent regulation of sodB in H. pylori.

    Directory of Open Access Journals (Sweden)

    Beth M Carpenter

    Full Text Available Helicobacter pylori is a significant human pathogen that has adapted to survive the many stresses found within the gastric environment. Superoxide Dismutase (SodB is an important factor that helps H. pylori combat oxidative stress. sodB was previously shown to be repressed by the Ferric Uptake Regulator (Fur in the absence of iron (apo-Fur regulation [1]. Herein, we show that apo regulation is not fully conserved among all strains of H. pylori. apo-Fur dependent changes in sodB expression are not observed under iron deplete conditions in H. pylori strains G27, HPAG1, or J99. However, Fur regulation of pfr and amiE occurs as expected. Comparative analysis of the Fur coding sequence between G27 and 26695 revealed a single amino acid difference, which was not responsible for the altered sodB regulation. Comparison of the sodB promoters from G27 and 26695 also revealed a single nucleotide difference within the predicted Fur binding site. Alteration of this nucleotide in G27 to that of 26695 restored apo-Fur dependent sodB regulation, indicating that a single base difference is at least partially responsible for the difference in sodB regulation observed among these H. pylori strains. Fur binding studies revealed that alteration of this single nucleotide in G27 increased the affinity of Fur for the sodB promoter. Additionally, the single base change in G27 enabled the sodB promoter to bind to apo-Fur with affinities similar to the 26695 sodB promoter. Taken together these data indicate that this nucleotide residue is important for direct apo-Fur binding to the sodB promoter.

  14. Single nucleotide resolution RNA-seq uncovers new regulatory mechanisms in the opportunistic pathogen Streptococcus agalactiae.

    Science.gov (United States)

    Rosinski-Chupin, Isabelle; Sauvage, Elisabeth; Sismeiro, Odile; Villain, Adrien; Da Cunha, Violette; Caliot, Marie-Elise; Dillies, Marie-Agnès; Trieu-Cuot, Patrick; Bouloc, Philippe; Lartigue, Marie-Frédérique; Glaser, Philippe

    2015-05-30

    Streptococcus agalactiae, or Group B Streptococcus, is a leading cause of neonatal infections and an increasing cause of infections in adults with underlying diseases. In an effort to reconstruct the transcriptional networks involved in S. agalactiae physiology and pathogenesis, we performed an extensive and robust characterization of its transcriptome through a combination of differential RNA-sequencing in eight different growth conditions or genetic backgrounds and strand-specific RNA-sequencing. Our study identified 1,210 transcription start sites (TSSs) and 655 transcript ends as well as 39 riboswitches and cis-regulatory regions, 39 cis-antisense non-coding RNAs and 47 small RNAs potentially acting in trans. Among these putative regulatory RNAs, ten were differentially expressed in response to an acid stress and two riboswitches sensed directly or indirectly the pH modification. Strikingly, 15% of the TSSs identified were associated with the incorporation of pseudo-templated nucleotides, showing that reiterative transcription is a pervasive process in S. agalactiae. In particular, 40% of the TSSs upstream genes involved in nucleotide metabolism show reiterative transcription potentially regulating gene expression, as exemplified for pyrG and thyA encoding the CTP synthase and the thymidylate synthase respectively. This comprehensive map of the transcriptome at the single nucleotide resolution led to the discovery of new regulatory mechanisms in S. agalactiae. It also provides the basis for in depth analyses of transcriptional networks in S. agalactiae and of the regulatory role of reiterative transcription following variations of intra-cellular nucleotide pools.

  15. Inferring epidemiological dynamics of infectious diseases using Tajima's D statistic on nucleotide sequences of pathogens.

    Science.gov (United States)

    Kim, Kiyeon; Omori, Ryosuke; Ito, Kimihito

    2017-12-01

    The estimation of the basic reproduction number is essential to understand epidemic dynamics, and time series data of infected individuals are usually used for the estimation. However, such data are not always available. Methods to estimate the basic reproduction number using genealogy constructed from nucleotide sequences of pathogens have been proposed so far. Here, we propose a new method to estimate epidemiological parameters of outbreaks using the time series change of Tajima's D statistic on the nucleotide sequences of pathogens. To relate the time evolution of Tajima's D to the number of infected individuals, we constructed a parsimonious mathematical model describing both the transmission process of pathogens among hosts and the evolutionary process of the pathogens. As a case study we applied this method to the field data of nucleotide sequences of pandemic influenza A (H1N1) 2009 viruses collected in Argentina. The Tajima's D-based method estimated basic reproduction number to be 1.55 with 95% highest posterior density (HPD) between 1.31 and 2.05, and the date of epidemic peak to be 10th July with 95% HPD between 22nd June and 9th August. The estimated basic reproduction number was consistent with estimation by birth-death skyline plot and estimation using the time series of the number of infected individuals. These results suggested that Tajima's D statistic on nucleotide sequences of pathogens could be useful to estimate epidemiological parameters of outbreaks. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  16. Single nucleotide polymorphism in Egyptian cattle insulin-like growth factor binding protein-3 gene

    Directory of Open Access Journals (Sweden)

    Othman E. Othman

    2014-12-01

    It is concluded that the IGFBP-3/HaeIII polymorphism may be utilized as a good marker for genetic differentiation between cattle animals for different body functions such as growth, metabolism, reproduction, immunity and energy balance. The nucleotide sequences of Egyptian cattle IGFBP-3 A and C alleles were submitted to GenBank with the accession numbers KF899893 and KF899894, respectively.

  17. Nucleotide homeostasis and purinergic nociceptive signaling in rat meninges in migraine-like conditions.

    Science.gov (United States)

    Yegutkin, Gennady G; Guerrero-Toro, Cindy; Kilinc, Erkan; Koroleva, Kseniya; Ishchenko, Yevheniia; Abushik, Polina; Giniatullina, Raisa; Fayuk, Dmitriy; Giniatullin, Rashid

    2016-09-01

    Extracellular ATP is suspected to contribute to migraine pain but regulatory mechanisms controlling pro-nociceptive purinergic mechanisms in the meninges remain unknown. We studied the peculiarities of metabolic and signaling pathways of ATP and its downstream metabolites in rat meninges and in cultured trigeminal cells exposed to the migraine mediator calcitonin gene-related peptide (CGRP). Under resting conditions, meningeal ATP and ADP remained at low nanomolar levels, whereas extracellular AMP and adenosine concentrations were one-two orders higher. CGRP increased ATP and ADP levels in meninges and trigeminal cultures and reduced adenosine concentration in trigeminal cells. Degradation rates for exogenous nucleotides remained similar in control and CGRP-treated meninges, indicating that CGRP triggers nucleotide release without affecting nucleotide-inactivating pathways. Lead nitrate-based enzyme histochemistry of whole mount meninges revealed the presence of high ATPase, ADPase, and AMPase activities, primarily localized in the medial meningeal artery. ATP and ADP induced large intracellular Ca(2+) transients both in neurons and in glial cells whereas AMP and adenosine were ineffective. In trigeminal glia, ATP partially operated via P2X7 receptors. ATP, but not other nucleotides, activated nociceptive spikes in meningeal trigeminal nerve fibers providing a rationale for high degradation rate of pro-nociceptive ATP. Pro-nociceptive effect of ATP in meningeal nerves was reproduced by α,β-meATP operating via P2X3 receptors. Collectively, extracellular ATP, which level is controlled by CGRP, can persistently activate trigeminal nerves in meninges which considered as the origin site of migraine headache. These data are consistent with the purinergic hypothesis of migraine pain and suggest new targets against trigeminal pain.

  18. Fluorinated Nucleotide Modifications Modulate Allele Selectivity of SNP-Targeting Antisense Oligonucleotides

    Directory of Open Access Journals (Sweden)

    Michael E. Østergaard

    2017-06-01

    Full Text Available Antisense oligonucleotides (ASOs have the potential to discriminate between subtle RNA mismatches such as SNPs. Certain mismatches, however, allow ASOs to bind at physiological conditions and result in RNA cleavage mediated by RNase H. We showed that replacing DNA nucleotides in the gap region of an ASO with other chemical modification can improve allele selectivity. Herein, we systematically substitute every position in the gap region of an ASO targeting huntingtin gene (HTT with fluorinated nucleotides. Potency is determined in cell culture against mutant HTT (mtHTT and wild-type HTT (wtHTT mRNA and RNase H cleavage intensities, and patterns are investigated. This study profiled five different fluorinated nucleotides and showed them to have predictable, site-specific effects on RNase H cleavage, and the cleavage patterns were rationalized from a published X-ray structure of human RNase H1. The results herein can be used as a guide for future projects where ASO discrimination of SNPs is important.

  19. Porous silicon surfaces for metabonomics: Detection and identification of nucleotides without matrix interference

    Energy Technology Data Exchange (ETDEWEB)

    Gomez, D.; Azcarate, Sabino [Dpto. de Micro y Nanotecnologias, Fundacion Tekniker, Av. Otaola 20, 20600 Eibar (Spain); Fernandez, Jose A.; Astigarraga, Egoitz [Dpto. de Quimica Fisica, Universidad del Pais Vasco, Campus de Lejona, Lejona (Spain); Marcaide, Arrate [Dpto. de Procesos de Fabricacion, Fundacion Tekniker, Av. Otaola 20, 20600 Eibar (Spain)

    2007-07-01

    In present work, porous silicon surfaces (PSS) have been developed for time of flight mass spectrometric experiments (TOF-MS) in the monitoring of nucleotides, commonly found as metabolites in the cell. The mass range of the studied molecules ({proportional_to} 400 amu) is common to several important messengers and other metabolites. Different porosified surfaces have been developed by means of electrochemical etching and different degree of porosity and pore size achieved as function of silicon dopant concentration, silicon resistivity, current density and the presence or absence of illumination along the process. As main conclusion, it can be said that an interesting commercial nucleotide (Cyclic adenosine monophosphate, c-AMP) has been detected on low concentrations ({proportional_to}hundreds of femtomols) for some of the fabricated porous surfaces. Taking into account that these concentrations are similar to the ones found in real samples, this result opens the possibility to the fabrication of DIOS (Desorption Ionization On Silicon) chips for the detection of nucleotides in biological fluids. (copyright 2007 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  20. Nucleotide Pool Depletion Induces G-Quadruplex-Dependent Perturbation of Gene Expression

    Directory of Open Access Journals (Sweden)

    Charikleia Papadopoulou

    2015-12-01

    Full Text Available Nucleotide pool imbalance has been proposed to drive genetic instability in cancer. Here, we show that slowing replication forks by depleting nucleotide pools with hydroxyurea (HU can also give rise to both transient and permanent epigenetic instability of a reporter locus, BU-1, in DT40 cells. HU induces stochastic formation of Bu-1low variants in dividing cells, which have lost the H3K4me3 present in untreated cells. This instability is potentiated by an intragenic G quadruplex, which also promotes local H2Ax phosphorylation and transient heterochromatinization. Genome-wide, gene expression changes induced by HU significantly overlap with those resulting from loss of the G4-helicases FANCJ, WRN, and BLM. Thus, the effects of global replication stress induced by nucleotide pool depletion can be focused by local replication impediments caused by G quadruplex formation to induce epigenetic instability and changes in gene expression, a mechanism that may contribute to selectable transcriptional changes in cancer.

  1. Nucleotide polymorphisms and haplotype diversity of RTCS gene in China elite maize inbred lines.

    Directory of Open Access Journals (Sweden)

    Enying Zhang

    Full Text Available The maize RTCS gene, encoding a LOB domain transcription factor, plays important roles in the initiation of embryonic seminal and postembryonic shoot-borne root. In this study, the genomic sequences of this gene in 73 China elite inbred lines, including 63 lines from 5 temperate heteroric groups and 10 tropic germplasms, were obtained, and the nucleotide polymorphisms and haplotype diversity were detected. A total of 63 sequence variants, including 44 SNPs and 19 indels, were identified at this locus, and most of them were found to be located in the regions of UTR and intron. The coding region of this gene in all tested inbred lines carried 14 haplotypes, which encoding 7 deferring RTCS proteins. Analysis of the polymorphism sites revealed that at least 6 recombination events have occurred. Among all 6 groups tested, only the P heterotic group had a much lower nucleotide diversity than the whole set, and selection analysis also revealed that only this group was under strong negative selection. However, the set of Huangzaosi and its derived lines possessed a higher nucleotide diversity than the whole set, and no selection signal were identified.

  2. Junctional transfer in cultured vascular endothelium: II. Dye and nucleotide transfer

    International Nuclear Information System (INIS)

    Larson, D.M.; Sheridan, J.D.

    1985-01-01

    Vascular endothelial cultures, derived from large vessels, retain many of the characteristics of their in vivo counterparts. However, the observed reduction in size and complexity of intercellular gap and tight junctions in these cultured cells suggests that important functions, thought to be mediated by these structures, may be altered in vitro. In continuing studies on intercellular communication in vessel wall cells, the authors have quantitated the extent of junctional transfer of small molecular tracers (the fluorescent dye Lucifer Yellow CH and tritiated uridine nucleotides) in confluent cultures of calf aortic (BAEC) and umbilical vein (BVEC) endothelium. Both BAEC and BVEC show extensive (and quantitatively equivalent) dye and nucleotide transfer. As an analogue of intimal endothelium, the authors have also tested dye transfer in freshly isolated sheets of endothelium. Transfer in BAEC and BVEC sheets was more rapid, extensive and homogeneous than in the cultured cells, implying a reduction in molecular coupling as endothelium adapts to culture conditions. In addition, they have documented heterocellular nucleotide transfer between cultured endothelium and vascular smooth muscle cells, of particular interest considering the prevalence of ''myo-endothelial'' junctions in vivo. These data yield further information on junctional transfer in cultured vascular endothelium and have broad implications for the functional integration of the vessel wall in the physiology and pathophysiology of the vasculature

  3. The low-dose combination preparation Vertigoheel activates cyclic nucleotide pathways and stimulates vasorelaxation.

    Science.gov (United States)

    Heinle, H; Tober, C; Zhang, D; Jäggi, R; Kuebler, W M

    2010-01-01

    Vertigo of various and often unknown aetiologies has been associated with and attributed to impaired microvascular perfusion in the inner ear or the vertebrobasilar system. Vertigoheel is a low-dose combination preparation of proven value in the symptomatic treatment of vertigo. In the present study we tested the hypothesis that Vertigoheel's anti-vertiginous properties may in part be due to a vasodilatory effect exerted via stimulation of the adenylate and/or guanylate cyclase pathways. Thus, the influence of Vertigoheel or its single constituents on synthesis and degradation of cyclic nucleotides was measured. Furthermore, vessel myography was used to observe the effect of Vertigoheel on the vasoreactivity of rat carotid arteries. Vertigoheel and one of its constituents, Anamirta cocculus, stimulated adenylate cyclase activity, while another constituent, Conium maculatum, inhibited phosphodiesterase 5, suggesting that the individual constituents of Vertigoheel contribute differentially to a synergistic stimulation of cyclic nucleotide signalling pathways. In rat carotid artery rings, Vertigoheel counteracted phenylephrine-induced tonic vasoconstriction. The present data demonstrate a vasorelaxant effect of Vertigoheel that goes along with a synergistic stimulation of cyclic nucleotide pathways and may provide a mechanistic basis for the documented anti-vertiginous effects of this combination preparation.

  4. Ethanol-induced activation of adenine nucleotide turnover. Evidence for a role of acetate

    International Nuclear Information System (INIS)

    Puig, J.G.; Fox, I.H.

    1984-01-01

    Consumption of alcohol causes hyperuricemia by decreasing urate excretion and increasing its production. Our previous studies indicate that ethanol administration increases uric acid production by increasing ATP degradation to uric acid precursors. To test the hypothesis that ethanol-induced increased urate production results from acetate metabolism and enhanced adenosine triphosphate turnover, we gave intravenous sodium acetate, sodium chloride and ethanol (0.1 mmol/kg per min for 1 h) to five normal subjects. Acetate plasma levels increased from 0.04 +/- 0.01 mM (mean +/- SE) to peak values of 0.35 +/- 0.07 mM and to 0.08 +/- 0.01 mM during acetate and ethanol infusions, respectively. Urinary oxypurines increased to 223 +/- 13% and 316 +/- 44% of the base-line values during acetate and ethanol infusions, respectively. Urinary radioactivity from the adenine nucleotide pool labeled with [8-14C] adenine increased to 171 +/- 27% and to 128 +/- 8% of the base-line values after acetate and ethanol infusions. These data indicate that both ethanol and acetate increase purine nucleotide degradation by enhancing the turnover of the adenine nucleotide pool. They support the hypothesis that acetate metabolism contributes to the increased production of urate associated with ethanol intake

  5. An Engineered Kinetic Amplification Mechanism for Single Nucleotide Variant Discrimination by DNA Hybridization Probes.

    Science.gov (United States)

    Chen, Sherry Xi; Seelig, Georg

    2016-04-20

    Even a single-nucleotide difference between the sequences of two otherwise identical biological nucleic acids can have dramatic functional consequences. Here, we use model-guided reaction pathway engineering to quantitatively improve the performance of selective hybridization probes in recognizing single nucleotide variants (SNVs). Specifically, we build a detection system that combines discrimination by competition with DNA strand displacement-based catalytic amplification. We show, both mathematically and experimentally, that the single nucleotide selectivity of such a system in binding to single-stranded DNA and RNA is quadratically better than discrimination due to competitive hybridization alone. As an additional benefit the integrated circuit inherits the property of amplification and provides at least 10-fold better sensitivity than standard hybridization probes. Moreover, we demonstrate how the detection mechanism can be tuned such that the detection reaction is agnostic to the position of the SNV within the target sequence. in contrast, prior strand displacement-based probes designed for kinetic discrimination are highly sensitive to position effects. We apply our system to reliably discriminate between different members of the let-7 microRNA family that differ in only a single base position. Our results demonstrate the power of systematic reaction network design to quantitatively improve biotechnology.

  6. OrthoANI: An improved algorithm and software for calculating average nucleotide identity.

    Science.gov (United States)

    Lee, Imchang; Ouk Kim, Yeong; Park, Sang-Cheol; Chun, Jongsik

    2016-02-01

    Species demarcation in Bacteria and Archaea is mainly based on overall genome relatedness, which serves a framework for modern microbiology. Current practice for obtaining these measures between two strains is shifting from experimentally determined similarity obtained by DNA-DNA hybridization (DDH) to genome-sequence-based similarity. Average nucleotide identity (ANI) is a simple algorithm that mimics DDH. Like DDH, ANI values between two genome sequences may be different from each other when reciprocal calculations are compared. We compared 63 690 pairs of genome sequences and found that the differences in reciprocal ANI values are significantly high, exceeding 1 % in some cases. To resolve this problem of not being symmetrical, a new algorithm, named OrthoANI, was developed to accommodate the concept of orthology for which both genome sequences were fragmented and only orthologous fragment pairs taken into consideration for calculating nucleotide identities. OrthoANI is highly correlated with ANI (using BLASTn) and the former showed approximately 0.1 % higher values than the latter. In conclusion, OrthoANI provides a more robust and faster means of calculating average nucleotide identity for taxonomic purposes. The standalone software tools are freely available at http://www.ezbiocloud.net/sw/oat.

  7. Endogenous adenosine produced during hypoxia attenuates neutrophil accumulation: coordination by extracellular nucleotide metabolism.

    Science.gov (United States)

    Eltzschig, Holger K; Thompson, Linda F; Karhausen, Jorn; Cotta, Richard J; Ibla, Juan C; Robson, Simon C; Colgan, Sean P

    2004-12-15

    Hypoxia is a well-documented inflammatory stimulus and results in tissue polymorphonuclear leukocyte (PMN) accumulation. Likewise, increased tissue adenosine levels are commonly associated with hypoxia, and given the anti-inflammatory properties of adenosine, we hypothesized that adenosine production via adenine nucleotide metabolism at the vascular surface triggers an endogenous anti-inflammatory response during hypoxia. Initial in vitro studies indicated that endogenously generated adenosine, through activation of PMN adenosine A(2A) and A(2B) receptors, functions as an antiadhesive signal for PMN binding to microvascular endothelia. Intravascular nucleotides released by inflammatory cells undergo phosphohydrolysis via hypoxia-induced CD39 ectoapyrase (CD39 converts adenosine triphosphate/adenosine diphosphate [ATP/ADP] to adenosine monophosphate [AMP]) and CD73 ecto-5'-nucleotidase (CD73 converts AMP to adenosine). Extensions of our in vitro findings using cd39- and cd73-null animals revealed that extracellular adenosine produced through adenine nucleotide metabolism during hypoxia is a potent anti-inflammatory signal for PMNs in vivo. These findings identify CD39 and CD73 as critical control points for endogenous adenosine generation and implicate this pathway as an innate mechanism to attenuate excessive tissue PMN accumulation.

  8. A Cascade of Thermophilic Enzymes As an Approach to the Synthesis of Modified Nucleotides.

    Science.gov (United States)

    Esipov, R S; Abramchik, Yu A; Fateev, I V; Konstantinova, I D; Kostromina, M A; Muravyova, T I; Artemova, K G; Miroshnikov, A I

    2016-01-01

    We propose a new approach for the synthesis of biologically important nucleotides which includes a multi-enzymatic cascade conversion of D -pentoses into purine nucleotides. The approach exploits nucleic acid exchange enzymes from thermophilic microorganisms: ribokinase, phosphoribosylpyrophosphate synthetase, and adenine phosphoribosyltransferase. We cloned the ribokinase gene from Thermus sp . 2.9, as well as two different genes of phosphoribosylpyrophosphate synthetase (PRPP-synthetase) and the adenine phosphoribosyltransferase (APR-transferase) gene from Thermus thermophilus HB27 into the expression vectors, generated high-yield E. coli producer strains, developed methods for the purification of the enzymes, and investigated enzyme substrate specificity. The enzymes were used for the conversion of D -pentoses into 5-phosphates that were further converted into 5-phospho-α- D -pentofuranose 1-pyrophosphates by means of ribokinase and PRPP-synthetases. Target nucleotides were obtained through the condensation of the pyrophosphates with adenine and its derivatives in a reaction catalyzed by APR-transferase. 2-Chloro- and 2-fluoroadenosine monophosphates were synthesized from D -ribose and appropriate heterobases in one pot using a system of thermophilic enzymes in the presence of ATP, ribokinase, PRPP-synthetase, and APR-transferase.

  9. Multilocus analysis of nucleotide variation and speciation in three closely related Populus (Salicaceae) species.

    Science.gov (United States)

    Du, Shuhui; Wang, Zhaoshan; Ingvarsson, Pär K; Wang, Dongsheng; Wang, Junhui; Wu, Zhiqiang; Tembrock, Luke R; Zhang, Jianguo

    2015-10-01

    Historical tectonism and climate oscillations can isolate and contract the geographical distributions of many plant species, and they are even known to trigger species divergence and ultimately speciation. Here, we estimated the nucleotide variation and speciation in three closely related Populus species, Populus tremuloides, P. tremula and P. davidiana, distributed in North America and Eurasia. We analysed the sequence variation in six single-copy nuclear loci and three chloroplast (cpDNA) fragments in 497 individuals sampled from 33 populations of these three species across their geographic distributions. These three Populus species harboured relatively high levels of nucleotide diversity and showed high levels of nucleotide differentiation. Phylogenetic analysis revealed that P. tremuloides diverged earlier than the other two species. The cpDNA haplotype network result clearly illustrated the dispersal route from North America to eastern Asia and then into Europe. Molecular dating results confirmed that the divergence of these three species coincided with the sundering of the Bering land bridge in the late Miocene and a rapid uplift of the Qinghai-Tibetan Plateau around the Miocene/Pliocene boundary. Vicariance-driven successful allopatric speciation resulting from historical tectonism and climate oscillations most likely played roles in the formation of the disjunct distributions and divergence of these three Populus species. © 2015 John Wiley & Sons Ltd.

  10. Approach to analysis of single nucleotide polymorphisms by automated constant denaturant capillary electrophoresis

    International Nuclear Information System (INIS)

    Bjoerheim, Jens; Abrahamsen, Torveig Weum; Kristensen, Annette Torgunrud; Gaudernack, Gustav; Ekstroem, Per O.

    2003-01-01

    Melting gel techniques have proven to be amenable and powerful tools in point mutation and single nucleotide polymorphism (SNP) analysis. With the introduction of commercially available capillary electrophoresis instruments, a partly automated platform for denaturant capillary electrophoresis with potential for routine screening of selected target sequences has been established. The aim of this article is to demonstrate the use of automated constant denaturant capillary electrophoresis (ACDCE) in single nucleotide polymorphism analysis of various target sequences. Optimal analysis conditions for different single nucleotide polymorphisms on ACDCE are evaluated with the Poland algorithm. Laboratory procedures include only PCR and electrophoresis. For direct genotyping of individual SNPs, the samples are analyzed with an internal standard and the alleles are identified by co-migration of sample and standard peaks. In conclusion, SNPs suitable for melting gel analysis based on theoretical thermodynamics were separated by ACDCE under appropriate conditions. With this instrumentation (ABI 310 Genetic Analyzer), 48 samples could be analyzed without any intervention. Several institutions have capillary instrumentation in-house, thus making this SNP analysis method accessible to large groups of researchers without any need for instrument modification

  11. Nucleotide diversity analysis of three major bacterial blight resistance genes in rice.

    Directory of Open Access Journals (Sweden)

    Waikhom Bimolata

    Full Text Available Nucleotide sequence polymorphisms among R gene alleles influence the process of co-evolutionary interaction between host and pathogen by shaping the response of host plants towards invading pathogens. Here, we present the DNA sequence polymorphisms and diversities present among natural alleles of three rice bacterial blight resistance genes, Xa21, Xa26 and xa5. The diversity was examined across different wild relatives and cultivars of Oryza species. Functional significance of selected alleles was evaluated through semi-quantitative reverse transcription polymerase chain reaction and real time PCR. The greatest nucleotide diversity and singleton variable sites (SVS were present in Xa26 (π = 0.01958; SVS = 182 followed by xa5 and Xa21 alleles. The highest frequency of single nucleotide polymorphisms were observed in Xa21 alleles and least in xa5. Transition bias was observed in all the genes and 'G' to 'A' transitions were more favored than other form of transitions. Neutrality tests failed to show the presence of selection at these loci, though negative Tajima's D values indicate the presence of a rare form of polymorphisms. At the interspecies level, O. nivara exhibited more diversity than O. sativa. We have also identified two nearly identical resistant alleles of xa5 and two sequentially identical alleles of Xa21. The alleles of xa5 showed basal levels of expression while Xa21 alleles were functionally not expressed.

  12. Synthesis and degradation of cyclic nucleotides in brain after a high dose of ionizing radiation

    International Nuclear Information System (INIS)

    Hunt, W.A.; Dalton, T.K.

    1981-01-01

    Previous data from our laboratory have indicated that a high dose of ionizing radiation can deplete the cyclic nucleotides guanosine 3',5'-cyclic monophosphate (cGMP) and adenosine 3',5'-cyclic monophosphate (cAMP) on several areas of the rat brain. cGMP is more sensitive to radiation than cAMP and does not recover for at least 24 h after irradiation. The response of cAMP is transient and recovery occurs within 4 h. The purpose of the present paper is to determine whether alternations in the activity of the synthetic and degradative enzymes that regulate cyclic nucleotide levels could account for the observed effects. Guanylate and adenylate cyclase and cGMP and cAMP phosphodiesterase activities were determined 10 min after irradiation with 10,000 rad of high-energy electrons. No alteration was detected under these experimental conditions. The data suggest that the reduction in cyclic nucleotides is not a direct effect on their metabolic enzymes and is probably secondary to some as yet-undefined action of radiation on the brain

  13. The nucleotide-binding domain of NLRC5 is critical for nuclear import and transactivation activity

    International Nuclear Information System (INIS)

    Meissner, Torsten B.; Li, Amy; Liu, Yuen-Joyce; Gagnon, Etienne; Kobayashi, Koichi S.

    2012-01-01

    Highlights: ► NLRC5 requires an intact NLS for its function as MHC class I transactivator. ► Nuclear presence of NLRC5 is required for MHC class I induction. ► Nucleotide-binding controls nuclear import and transactivation activity of NLRC5. -- Abstract: Major histocompatibility complex (MHC) class I and class II are crucial for the function of the human adaptive immune system. A member of the NLR (nucleotide-binding domain, leucine-rich repeat) protein family, NLRC5, has recently been identified as a transcriptional regulator of MHC class I and related genes. While a ‘master regulator’ of MHC class II genes, CIITA, has long been known, NLRC5 specifically associates with and transactivates the proximal promoters of MHC class I genes. In this study, we analyzed the molecular requirements of NLRC5 nuclear import and transactivation activity. We show that NLRC5-mediated MHC class I gene induction requires an intact nuclear localization signal and nuclear distribution of NLRC5. In addition, we find that the nucleotide-binding domain (NBD) of NLRC5 is critical not only for nuclear translocation but also for the transactivation of MHC class I genes. Changing the cellular localization of NLRC5 is likely to immediately impact MHC class I expression as well as MHC class I-mediated antigen presentation. NLRC5 may thus provide a promising target for the modulation of MHC class I antigen presentation, especially in the setting of transplant medicine.

  14. The first 3':5'-cyclic nucleotide-amino acid complex: L-His-cIMP.

    Science.gov (United States)

    Slepokura, Katarzyna

    2012-08-01

    In the crystal structure of the L-His-cIMP complex, i.e. L-histidinium inosine 3':5'-cyclic phosphate [systematic name: 5-(2-amino-2-carboxyethyl)-1H-imidazol-3-ium 7-hydroxy-2-oxo-6-(6-oxo-6,9-dihydro-1H-purin-9-yl)-4a,6,7,7a-tetrahydro-4H-1,3,5,2λ(5)-furo[3,2-d][1,3,2λ(5)]dioxaphosphinin-2-olate], C(6)H(10)N(3)O(2)(+)·C(10)H(10)N(4)O(7)P(-), the Hoogsteen edge of the hypoxanthine (Hyp) base of cIMP and the Hyp face are engaged in specific amino acid-nucleotide (His···cIMP) recognition, i.e. by abutting edge-to-edge and by π-π stacking, respectively. The Watson-Crick edge of Hyp and the cIMP phosphate group play a role in nonspecific His···cIMP contacts. The interactions between the cIMP anions (anti/C3'-endo/trans-gauche/chair conformers) are realized mainly between riboses and phosphate groups. The results for this L-His-cIMP complex, compared with those for the previously reported solvated L-His-IMP crystal structure, indicate a different nature of amino acid-nucleotide recognition and interactions upon the 3':5'-cyclization of the nucleotide phosphate group.

  15. Pulmonary preservation studies: effects on endothelial function and pulmonary adenine nucleotides.

    Science.gov (United States)

    Paik, Hyo Chae; Hoffmann, Steven C; Egan, Thomas M

    2003-02-27

    Lung transplantation is an effective therapy plagued by a high incidence of early graft dysfunction, in part because of reperfusion injury. The optimal preservation solution for lung transplantation is unknown. We performed experiments using an isolated perfused rat lung model to test the effect of lung preservation with three solutions commonly used in clinical practice. Lungs were retrieved from Sprague-Dawley rats and flushed with one of three solutions: modified Euro-Collins (MEC), University of Wisconsin (UW), or low potassium dextran and glucose (LPDG), then stored cold for varying periods before reperfusion with Earle's balanced salt solution using the isolated perfused rat lung model. Outcome measures were capillary filtration coefficient (Kfc), wet-to-dry weight ratio, and lung tissue levels of adenine nucleotides and cyclic AMP. All lungs functioned well after 4 hr of storage. By 6 hr, UW-flushed lungs had a lower Kfc than LPDG-flushed lungs. After 8 hr of storage, only UW-flushed lungs had a measurable Kfc. Adenine nucleotide levels were higher in UW-flushed lungs after prolonged storage. Cyclic AMP levels correlated with Kfc in all groups. Early changes in endothelial permeability seemed to be better attenuated in lungs flushed with UW compared with LPDG or MEC; this was associated with higher amounts of adenine nucleotides. MEC-flushed lungs failed earlier than LPDG-flushed or UW-flushed lungs. The content of the solution may be more important for lung preservation than whether the ionic composition is intracellular or extracellular.

  16. Association Mapping and Nucleotide Sequence Variation in Five Drought Tolerance Candidate Genes in Spring Wheat

    Directory of Open Access Journals (Sweden)

    Erena A. Edae

    2013-07-01

    Full Text Available Functional markers are needed for key genes involved in drought tolerance to improve selection for crop yield under moisture stress conditions. The objectives of this study were to (i characterize five drought tolerance candidate genes, namely dehydration responsive element binding 1A (, enhanced response to abscisic acid ( and , and fructan 1-exohydrolase ( and , in wheat ( L. for nucleotide and haplotype diversity, Tajima’s D value, and linkage disequilibrium (LD and (ii associate within-gene single nucleotide polymorphisms (SNPs with phenotypic traits in a spring wheat association mapping panel ( = 126. Field trials were grown under contrasting moisture regimes in Greeley, CO, and Melkassa, Ethiopia, in 2010 and 2011. Genome-specific amplification and DNA sequence analysis of the genes identified SNPs and revealed differences in nucleotide and haplotype diversity, Tajima’s D, and patterns of LD. showed associations (false discovery rate adjusted probability value = 0.1 with normalized difference vegetation index, heading date, biomass, and spikelet number. Both and were associated with harvest index, flag leaf width, and leaf senescence. was associated with grain yield, and was associated with thousand kernel weight and test weight. If validated in relevant genetic backgrounds, the identified marker–trait associations may be applied to functional marker-assisted selection.

  17. Guanylic nucleotide starvation affects Saccharomyces cerevisiae mother-daughter separation and may be a signal for entry into quiescence

    Directory of Open Access Journals (Sweden)

    Sagot Isabelle

    2005-05-01

    Full Text Available Abstract Background Guanylic nucleotides are both macromolecules constituents and crucial regulators for a variety of cellular processes. Therefore, their intracellular concentration must be strictly controlled. Consistently both yeast and mammalian cells tightly correlate the transcription of genes encoding enzymes critical for guanylic nucleotides biosynthesis with the proliferation state of the cell population. Results To gain insight into the molecular relationships connecting intracellular guanylic nucleotide levels and cellular proliferation, we have studied the consequences of guanylic nucleotide limitation on Saccharomyces cerevisiae cell cycle progression. We first utilized mycophenolic acid, an immunosuppressive drug that specifically inhibits inosine monophosphate dehydrogenase, the enzyme catalyzing the first committed step in de novo GMP biosynthesis. To approach this system physiologically, we next developed yeast mutants for which the intracellular guanylic nucleotide pools can be modulated through changes of growth conditions. In both the pharmacological and genetic approaches, we found that guanylic nucleotide limitation generated a mother-daughter separation defect, characterized by cells with two unseparated daughters. We then showed that this separation defect resulted from cell wall perturbations but not from impaired cytokinesis. Importantly, cells with similar separation defects were found in a wild type untreated yeast population entering quiescence upon nutrient limitation. Conclusion Our results demonstrate that guanylic nucleotide limitation slows budding yeast cell cycle progression, with a severe pause in telophase. At the cellular level, guanylic nucleotide limitation causes the emergence of cells with two unseparated daughters. By fluorescence and electron microscopy, we demonstrate that this phenotype arises from defects in cell wall partition between mother and daughter cells. Because cells with two unseparated

  18. Adsorption of nucleotides onto ferromagnesian phyllosilicates: Significance for the origin of life

    Science.gov (United States)

    Pedreira-Segade, Ulysse; Feuillie, Cécile; Pelletier, Manuel; Michot, Laurent J.; Daniel, Isabelle

    2016-03-01

    The concentration of prebiotic organic building blocks may have promoted the formation of biopolymers in the environment of the early Earth. We therefore studied the adsorption of RNA monomers AMP, GMP, CMP, and UMP, and DNA monomers dGMP, dCMP, and TMP, on minerals that were abundant in the early Earth environment as the result of aqueous or hydrothermal alteration of the primitive oceanic crust. We focused our study on swelling clays, i.e. nontronite and montmorillonite, and non-swelling phyllosilicates, i.e. pyrophyllite, chlorite, lizardite and chrysotile suspended in an aqueous saline solution analog to seawater. In this reference study, adsorption experiments were carried out under standard conditions of pressure and temperature and controlled pH. Under such conditions, this work is also relevant to the preservation of nucleic acids in Fe-Mg-rich terrestrial and Martian soils. We compared the adsorption of the different monomers on individual minerals, as well as the adsorption of single monomers on the whole suite of minerals. We found that DNA monomers adsorb much more strongly than RNA monomers, and that any monomer containing the G nucleobase adsorbed more strongly than one containing the C nucleobase. At high surface loadings (greater than about 1 mM monomer in aqueous solution) we also found a dramatic increase in the slope of adsorption isotherm on the swelling clays, leading to large increases in the amounts adsorbed. Data were processed in order to understand the adsorption mechanism of nucleotides onto mineral surfaces. We infer that all nucleotides behave as homologous molecules in regard to their adsorption onto the studied mineral surfaces. At low to moderate surface loadings, their adsorption is best explained by a single mechanism common to the suite of minerals of the present study. At pH 7, adsorption certainly proceeds by ligand exchange between the phosphate group and the hydroxyls of the broken edges of phyllosilicates leading to the

  19. Effects of luminal flow and nucleotides on [Ca(2+)](i) in rabbit cortical collecting duct.

    Science.gov (United States)

    Woda, Craig B; Leite, Maurilo; Rohatgi, Rajeev; Satlin, Lisa M

    2002-09-01

    Nucleotide binding to purinergic P2 receptors contributes to the regulation of a variety of physiological functions in renal epithelial cells. Whereas P2 receptors have been functionally identified at the basolateral membrane of the cortical collecting duct (CCD), a final regulatory site of urinary Na(+), K(+), and acid-base excretion, controversy exists as to whether apical purinoceptors exist in this segment. Nor has the distribution of receptor subtypes present on the unique cell populations that constitute Ca(2+) the CCD been established. To examine this, we measured nucleotide-induced changes in intracellular Ca(2+) concentration ([Ca(2+)](i)) in fura 2-loaded rabbit CCDs microperfused in vitro. Resting [Ca(2+)](i) did not differ between principal and intercalated cells, averaging approximately 120 nM. An acute increase in tubular fluid flow rate, associated with a 20% increase in tubular diameter, led to increases in [Ca(2+)](i) in both cell types. Luminal perfusion of 100 microM UTP or ATP-gamma-S, in the absence of change in flow rate, caused a rapid and transient approximately fourfold increase in [Ca(2+)](i) in both cell types (P < 0.05). Luminal suramin, a nonspecific P2 receptor antagonist, blocked the nucleotide- but not flow-induced [Ca(2+)](i) transients. Luminal perfusion with a P2X (alpha,beta-methylene-ATP), P2X(7) (benzoyl-benzoyl-ATP), P2Y(1) (2-methylthio-ATP), or P2Y(4)/P2Y(6) (UDP) receptor agonist had no effect on [Ca(2+)](i). The nucleotide-induced [Ca(2+)](i) transients were inhibited by the inositol-1,4,5-triphosphate receptor blocker 2-aminoethoxydiphenyl borate, thapsigargin, which depletes internal Ca(2+) stores, luminal perfusion with a Ca(2+)-free perfusate, or the L-type Ca(2+) channel blocker nifedipine. These results suggest that luminal nucleotides activate apical P2Y(2) receptors in the CCD via pathways that require both internal Ca(2+) mobilization and extracellular Ca(2+) entry. The flow-induced rise in [Ca(2+)](i) is

  20. cDNA cloning and nucleotide sequence comparison of Chinese hamster metallothionein I and II mRNAs

    Energy Technology Data Exchange (ETDEWEB)

    Griffith, B B; Walters, R A; Enger, M D; Hildebrand, C E; Griffith, J K

    1983-01-01

    Polyadenylated RNA was extracted from a cadmium resistant Chinese hamster (CHO) cell line, enriched for metal-induced, abundant RNA sequences and cloned as double-stranded cDNA in the plasmid pBR322. Two cDNA clones, pCHMT1 and pCHMT2, encoding two Chinese hamster isometallothioneins were identified, and the nucleotide sequence of each insert was determined. The two Chinese hamster metallothioneins show nucleotide sequence homologies of 80% in the protein coding region and approximately 35% in both the 5' and 3' untranslated regions. Interestingly, an 8 nucleotide sequence (TGTAAATA) has been conserved in sequence and position in the 3' untranslated regions of each metallothionein mRNA sequenced thus far. Estimated nucleotide substitution rates derived from interspecies comparisons were used to calculate a metallothionein gene duplication time of 45 to 120 million years ago. 39 references, 1 figure, 1 table.

  1. The PurR regulon in Lactococcus lactis – transcriptional regulation of the purine nucleotide metabolism and translational machinery

    DEFF Research Database (Denmark)

    Jendresen, Christian Bille; Martinussen, Jan; Kilstrup, Mogens

    2012-01-01

    Purine nucleotides are either synthesized de novo from 5-phosphoribosyl-1-pyrophosphate (PRPP) or salvaged from the environment. In Lactococcus lactis, transcription of the de novo synthesis operons, purCSQLF and purDEK, has genetically been shown to be activated by the PurR protein when bound to......-related functions. Of special interest is the presence of PurBox motifs in rrn promoters, suggesting a novel connection between nucleotide availability and the translational machinery....

  2. Identification of Critical Residues for the Tight Binding of Both Correct and Incorrect Nucleotides to Human DNA Polymerase λ

    Science.gov (United States)

    Brown, Jessica A.; Pack, Lindsey R.; Sherrer, Shanen M.; Kshetry, Ajay K.; Newmister, Sean A.; Fowler, Jason D.; Taylor, John-Stephen; Suo, Zucai

    2010-01-01

    DNA polymerase λ (Pol λ) is a novel X-family DNA polymerase that shares 34% sequence identity with DNA polymerase β (Pol β). Pre-steady state kinetic studies have shown that the Pol λ•DNA complex binds both correct and incorrect nucleotides 130-fold tighter on average than the Pol β•DNA complex, although, the base substitution fidelity of both polymerases is 10−4 to 10−5. To better understand Pol λ’s tight nucleotide binding affinity, we created single- and double-substitution mutants of Pol λ to disrupt interactions between active site residues and an incoming nucleotide or a template base. Single-turnover kinetic assays showed that Pol λ binds to an incoming nucleotide via cooperative interactions with active site residues (R386, R420, K422, Y505, F506, A510, and R514). Disrupting protein interactions with an incoming correct or incorrect nucleotide impacted binding with each of the common structural moieties in the following order: triphosphate ≫ base > ribose. In addition, the loss of Watson-Crick hydrogen bonding between the nucleotide and template base led to a moderate increase in the Kd. The fidelity of Pol λ was maintained predominantly by a single residue, R517, which has minor groove interactions with the DNA template. PMID:20851705

  3. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide–protein complexes

    Science.gov (United States)

    Kondo, Jiro; Westhof, Eric

    2011-01-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide–protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson–Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson–Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues. PMID:21737431

  4. The Nucleotide Synthesis Enzyme CAD Inhibits NOD2 Antibacterial Function in Human Intestinal Epithelial Cells

    Science.gov (United States)

    Richmond, Amy L.; Kabi, Amrita; Homer, Craig R.; García, Noemí Marina; Nickerson, Kourtney P.; NesvizhskiI, Alexey I.; Sreekumar, Arun; Chinnaiyan, Arul M.; Nuñez, Gabriel; McDonald, Christine

    2013-01-01

    BACKGROUND & AIMS Polymorphisms that reduce the function of nucleotide-binding oligomerization domain (NOD)2, a bacterial sensor, have been associated with Crohn’s disease (CD). No proteins that regulate NOD2 activity have been identified as selective pharmacologic targets. We sought to discover regulators of NOD2 that might be pharmacologic targets for CD therapies. METHODS Carbamoyl phosphate synthetase/ aspartate transcarbamylase/dihydroorotase (CAD) is an enzyme required for de novo pyrimidine nucleotide synthesis; it was identified as a NOD2-interacting protein by immunoprecipitation-coupled mass spectrometry. CAD expression was assessed in colon tissues from individuals with and without inflammatory bowel disease by immunohistochemistry. The interaction between CAD and NOD2 was assessed in human HCT116 intestinal epithelial cells by immunoprecipitation, immunoblot, reporter gene, and gentamicin protection assays. We also analyzed human cell lines that express variants of NOD2 and the effects of RNA interference, overexpression and CAD inhibitors. RESULTS CAD was identified as a NOD2-interacting protein expressed at increased levels in the intestinal epithelium of patients with CD compared with controls. Overexpression of CAD inhibited NOD2-dependent activation of nuclear factor κB and p38 mitogen-activated protein kinase, as well as intracellular killing of Salmonella. Reduction of CAD expression or administration of CAD inhibitors increased NOD2-dependent signaling and antibacterial functions of NOD2 variants that are and are not associated with CD. CONCLUSIONS The nucleotide synthesis enzyme CAD is a negative regulator of NOD2. The antibacterial function of NOD2 variants that have been associated with CD increased in response to pharmacologic inhibition of CAD. CAD is a potential therapeutic target for CD. PMID:22387394

  5. The complete nucleotide sequence of RNA 3 of a peach isolate of Prunus necrotic ringspot virus.

    Science.gov (United States)

    Hammond, R W; Crosslin, J M

    1995-04-01

    The complete nucleotide sequence of RNA 3 of the PE-5 peach isolate of Prunus necrotic ringspot ilarvirus (PNRSV) was obtained from cloned cDNA. The RNA sequence is 1941 nucleotides and contains two open reading frames (ORFs). ORF 1 consisted of 284 amino acids with a calculated molecular weight of 31,729 Da and ORF 2 contained 224 amino acids with a calculated molecular weight of 25,018 Da. ORF 2 corresponds to the coat protein gene. Expression of ORF 2 engineered into a pTrcHis vector in Escherichia coli results in a fusion polypeptide of approximately 28 kDa which cross-reacts with PNRSV polyclonal antiserum. Analysis of the coat protein amino acid sequence reveals a putative "zinc-finger" domain at the amino-terminal portion of the protein. Two tetranucleotide AUGC motifs occur in the 3'-UTR of the RNA and may function in coat protein binding and genome activation. ORF 1 homologies to other ilarviruses and alfalfa mosaic virus are confined to limited regions of conserved amino acids. The translated amino acid sequence of the coat protein gene shows 92% similarity to one isolate of apple mosaic virus, a closely related member of the ilarvirus group of plant viruses, but only 66% similarity to the amino acid sequence of the coat protein gene of a second isolate. These relationships are also reflected at the nucleotide sequence level. These results in one instance confirm the close similarities observed at the biophysical and serological levels between these two viruses, but on the other hand call into question the nomenclature used to describe these viruses.

  6. Inhibitory effect of extracellular purine nucleotide and nucleoside concentrations on T cell proliferation

    Energy Technology Data Exchange (ETDEWEB)

    Weiler, Monica [Department of Medicine III and Transfusion Medicine, University Hospital Grosshadern, Ludwig-Maximilians-University, Munich (Germany); Schmetzer, Helga [Helmholtz Center Munich (Germany); German Research Center for Environmental Health, Munich (Germany); Braeu, Marion; Buhmann, Raymund [Helmholtz Center Munich (Germany); German Research Center for Environmental Health, Munich (Germany); Department of Medicine III and Transfusion Medicine, University Hospital Grosshadern, Ludwig-Maximilians-University, Munich (Germany)

    2016-11-15

    The release of nucleic acids and derivatives after tissue-injury may affect cellular immune-response. We studied the impact of extracellular ribo-, desoxyribonucleotides and nucleosides on T-cell immunity. Peripheral-blood-mononuclear-cells (PBMCs) or isolated CD3{sup +}T-cells obtained from 6 healthy donors were stimulated via CD3/CD28 Dynabeads or dendritic cells (DCs) in the presence or absence of pyrimidine-, purine-nucleotides and -nucleosides (range 2–200 µM). Addition of deoxy-, guanosine-triphosphate (dGTP, GTP) and guanosine resulted concentration dependent in a complete, adenosine-triphosphate (ATP) in a partial inhibition of the induced T-cell-proliferation. Deoxyadenosine-triphosphate (dATP), adenosine and the pyrimidine-ribo- and -deoxyribonucleotides displayed no inhibitory capacity. Inhibitory effects of dGTP and GTP, but not of guanosine and ATP were culture-media-dependent and could be almost abrogated by use of the serum-free lymphocyte-culture-media X-Vivo15 instead of RPMI1640 with standard-supplementation. In contrast to RPMI1640, X-Vivo15 resulted in a significant down-regulation of the cell-surface-located ectonucleotidases CD39 (Ecto-Apyrase) and CD73 (Ecto-5′-Nucleotidase), critical for the extracellular nucleotides-hydrolysis to nucleosides, explaining the loss of inhibition mediated by dGTP and GTP, but not Guanosine. In line with previous findings ATP was found to exert immunosuppressive effects on T-cell-proliferation. Purine-nucleotides, dGTP and GTP displayed a higher inhibitory capacity, but seem to be strictly dependent on the microenvironmental conditions modulating the responsiveness of the respective T-lymphocytes. Further evaluation of experimental and respective clinical settings should anticipate these findings.

  7. The pyrimidine nucleotide carrier PNC1 and mitochondrial trafficking of thymidine phosphates in cultured human cells

    Energy Technology Data Exchange (ETDEWEB)

    Franzolin, Elisa; Miazzi, Cristina; Frangini, Miriam; Palumbo, Elisa; Rampazzo, Chiara [Department of Biology, University of Padova, Via Ugo Bassi 58B, I-35131 Padova (Italy); Bianchi, Vera, E-mail: vbianchi@bio.unipd.it [Department of Biology, University of Padova, Via Ugo Bassi 58B, I-35131 Padova (Italy)

    2012-10-15

    In cycling cells cytosolic de novo synthesis of deoxynucleotides is the main source of precursors for mitochondrial (mt) DNA synthesis. The transfer of deoxynucleotides across the inner mt membrane requires protein carriers. PNC1, a SLC25 family member, exchanges pyrimidine nucleoside triphosphates in liposomes and its downregulation decreases mtUTP concentration in cultured cells. By an isotope-flow protocol we confirmed transport of uridine nucleotides by PNC1 in intact cultured cells and investigated PNC1 involvement in the mt trafficking of thymidine phosphates. Key features of our approach were the manipulation of PNC1 expression by RNA interference or inducible overexpression, the employment of cells proficient or deficient for cytosolic thymidine kinase (TK1) to distinguish the direction of flow of thymidine nucleotides across the mt membrane during short pulses with [{sup 3}H]-thymidine, the determination of mtdTTP specific radioactivity to quantitate the rate of mtdTTP export to the cytoplasm. Downregulation of PNC1 in TK1{sup -} cells increased labeled dTTP in mitochondria due to a reduced rate of export. Overexpression of PNC1 in TK1{sup +} cells increased mtdTTP pool size and radioactivity, suggesting an involvement in the import of thymidine phosphates. Thus PNC1 is a component of the network regulating the mtdTTP pool in human cells. -- Highlights: Black-Right-Pointing-Pointer Thymidine phosphates exchange between mitochondria and cytosol in mammalian cells. Black-Right-Pointing-Pointer siRNA-downregulation of PNC1 delays mitochondrial dTTP export in TK1{sup -} cells. Black-Right-Pointing-Pointer PNC1 overexpression accumulates dTTP in mitochondria of TK1{sup +} cells. Black-Right-Pointing-Pointer PNC1 exchanges thymidine nucleotides across the mitochondrial inner membrane. Black-Right-Pointing-Pointer PNC1 participates in the regulation of the mtdTTP pool supporting mtDNA synthesis.

  8. The pyrimidine nucleotide carrier PNC1 and mitochondrial trafficking of thymidine phosphates in cultured human cells

    International Nuclear Information System (INIS)

    Franzolin, Elisa; Miazzi, Cristina; Frangini, Miriam; Palumbo, Elisa; Rampazzo, Chiara; Bianchi, Vera

    2012-01-01

    In cycling cells cytosolic de novo synthesis of deoxynucleotides is the main source of precursors for mitochondrial (mt) DNA synthesis. The transfer of deoxynucleotides across the inner mt membrane requires protein carriers. PNC1, a SLC25 family member, exchanges pyrimidine nucleoside triphosphates in liposomes and its downregulation decreases mtUTP concentration in cultured cells. By an isotope-flow protocol we confirmed transport of uridine nucleotides by PNC1 in intact cultured cells and investigated PNC1 involvement in the mt trafficking of thymidine phosphates. Key features of our approach were the manipulation of PNC1 expression by RNA interference or inducible overexpression, the employment of cells proficient or deficient for cytosolic thymidine kinase (TK1) to distinguish the direction of flow of thymidine nucleotides across the mt membrane during short pulses with [ 3 H]-thymidine, the determination of mtdTTP specific radioactivity to quantitate the rate of mtdTTP export to the cytoplasm. Downregulation of PNC1 in TK1 − cells increased labeled dTTP in mitochondria due to a reduced rate of export. Overexpression of PNC1 in TK1 + cells increased mtdTTP pool size and radioactivity, suggesting an involvement in the import of thymidine phosphates. Thus PNC1 is a component of the network regulating the mtdTTP pool in human cells. -- Highlights: ► Thymidine phosphates exchange between mitochondria and cytosol in mammalian cells. ► siRNA-downregulation of PNC1 delays mitochondrial dTTP export in TK1 − cells. ► PNC1 overexpression accumulates dTTP in mitochondria of TK1 + cells. ► PNC1 exchanges thymidine nucleotides across the mitochondrial inner membrane. ► PNC1 participates in the regulation of the mtdTTP pool supporting mtDNA synthesis.

  9. Different effects of guanine nucleotides (GDP and GTP) on protein-mediated mitochondrial proton leak.

    Science.gov (United States)

    Woyda-Ploszczyca, Andrzej M; Jarmuszkiewicz, Wieslawa

    2014-01-01

    In this study, we compared the influence of GDP and GTP on isolated mitochondria respiring under conditions favoring oxidative phosphorylation (OXPHOS) and under conditions excluding this process, i.e., in the presence of carboxyatractyloside, an adenine nucleotide translocase inhibitor, and/or oligomycin, an FOF1-ATP synthase inhibitor. Using mitochondria isolated from rat kidney and human endothelial cells, we found that the action of GDP and GTP can differ diametrically depending on the conditions. Namely, under conditions favoring OXPHOS, both in the absence and presence of linoleic acid, an activator of uncoupling proteins (UCPs), the addition of 1 mM GDP resulted in the state 4 (non-phosphorylating respiration)-state 3 (phosphorylating respiration) transition, which is characteristic of ADP oxidative phosphorylation. In contrast, the addition of 1 mM GTP resulted in a decrease in the respiratory rate and an increase in the membrane potential, which is characteristic of UCP inhibition. The stimulatory effect of GDP, but not GTP, was also observed in inside-out submitochondrial particles prepared from rat kidney mitochondria. However, the effects of GDP and GTP were more similar in the presence of OXPHOS inhibitors. The importance of these observations in connection with the action of UCPs, adenine nucleotide translocase (or other carboxyatractyloside-sensitive carriers), carboxyatractyloside- and purine nucleotide-insensitive carriers, as well as nucleoside-diphosphate kinase (NDPK) are considered. Because the measurements favoring oxidative phosphorylation better reflect in vivo conditions, our study strongly supports the idea that GDP cannot be considered a significant physiological inhibitor of UCP. Moreover, it appears that, under native conditions, GTP functions as a more efficient UCP inhibitor than GDP and ATP.

  10. Inhibitory effect of extracellular purine nucleotide and nucleoside concentrations on T cell proliferation

    International Nuclear Information System (INIS)

    Weiler, Monica; Schmetzer, Helga; Braeu, Marion; Buhmann, Raymund

    2016-01-01

    The release of nucleic acids and derivatives after tissue-injury may affect cellular immune-response. We studied the impact of extracellular ribo-, desoxyribonucleotides and nucleosides on T-cell immunity. Peripheral-blood-mononuclear-cells (PBMCs) or isolated CD3 + T-cells obtained from 6 healthy donors were stimulated via CD3/CD28 Dynabeads or dendritic cells (DCs) in the presence or absence of pyrimidine-, purine-nucleotides and -nucleosides (range 2–200 µM). Addition of deoxy-, guanosine-triphosphate (dGTP, GTP) and guanosine resulted concentration dependent in a complete, adenosine-triphosphate (ATP) in a partial inhibition of the induced T-cell-proliferation. Deoxyadenosine-triphosphate (dATP), adenosine and the pyrimidine-ribo- and -deoxyribonucleotides displayed no inhibitory capacity. Inhibitory effects of dGTP and GTP, but not of guanosine and ATP were culture-media-dependent and could be almost abrogated by use of the serum-free lymphocyte-culture-media X-Vivo15 instead of RPMI1640 with standard-supplementation. In contrast to RPMI1640, X-Vivo15 resulted in a significant down-regulation of the cell-surface-located ectonucleotidases CD39 (Ecto-Apyrase) and CD73 (Ecto-5′-Nucleotidase), critical for the extracellular nucleotides-hydrolysis to nucleosides, explaining the loss of inhibition mediated by dGTP and GTP, but not Guanosine. In line with previous findings ATP was found to exert immunosuppressive effects on T-cell-proliferation. Purine-nucleotides, dGTP and GTP displayed a higher inhibitory capacity, but seem to be strictly dependent on the microenvironmental conditions modulating the responsiveness of the respective T-lymphocytes. Further evaluation of experimental and respective clinical settings should anticipate these findings.

  11. In silico screening for inhibitors of p-glycoprotein that target the nucleotide binding domains.

    Science.gov (United States)

    Brewer, Frances K; Follit, Courtney A; Vogel, Pia D; Wise, John G

    2014-12-01

    Multidrug resistances and the failure of chemotherapies are often caused by the expression or overexpression of ATP-binding cassette transporter proteins such as the multidrug resistance protein, P-glycoprotein (P-gp). P-gp is expressed in the plasma membrane of many cell types and protects cells from accumulation of toxins. P-gp uses ATP hydrolysis to catalyze the transport of a broad range of mostly hydrophobic compounds across the plasma membrane and out of the cell. During cancer chemotherapy, the administration of therapeutics often selects for cells which overexpress P-gp, thereby creating populations of cancer cells resistant to a variety of chemically unrelated chemotherapeutics. The present study describes extremely high-throughput, massively parallel in silico ligand docking studies aimed at identifying reversible inhibitors of ATP hydrolysis that target the nucleotide-binding domains of P-gp. We used a structural model of human P-gp that we obtained from molecular dynamics experiments as the protein target for ligand docking. We employed a novel approach of subtractive docking experiments that identified ligands that bound predominantly to the nucleotide-binding domains but not the drug-binding domains of P-gp. Four compounds were found that inhibit ATP hydrolysis by P-gp. Using electron spin resonance spectroscopy, we showed that at least three of these compounds affected nucleotide binding to the transporter. These studies represent a successful proof of principle demonstrating the potential of targeted approaches for identifying specific inhibitors of P-gp. Copyright © 2014 by The American Society for Pharmacology and Experimental Therapeutics.

  12. Nucleotide-induced conformational dynamics in ABC transporters from structure-based coarse grained modelling.

    Science.gov (United States)

    Flechsig, Holger

    2016-02-01

    ATP-binding cassette (ABC) transporters are integral membrane proteins which mediate the exchange of diverse substrates across membranes powered by ATP molecules. Our understanding of their activity is still hampered since the conformational dynamics underlying the operation of such proteins cannot yet be resolved in detailed molecular dynamics studies. Here a coarse grained model which allows to mimic binding of nucleotides and follow subsequent conformational motions of full-length transporter structures in computer simulations is proposed and implemented. To justify its explanatory quality, the model is first applied to the maltose transporter system for which multiple conformations are known and we find that the model predictions agree remarkably well with the experimental data. For the MalK subunit the switching from open to the closed dimer configuration upon ATP binding is reproduced and, moreover, for the full-length maltose transporter, progression from inward-facing to the outward-facing state is correctly obtained. For the heme transporter HmuUV, for which only the free structure could yet be determined, the model was then applied to predict nucleotide-induced conformational motions. Upon binding of ATP-mimicking ligands the structure changed from a conformation in which the nucleotide-binding domains formed an open shape, to a conformation in which they were found in tight contact, while, at the same time, a pronounced rotation of the transmembrane domains was observed. This finding is supported by normal mode analysis, and, comparison with structural data of the homologous vitamin B12 transporter BtuCD suggests that the observed rotation mechanism may contribute a common functional aspect for this class of ABC transporters. Although in HmuuV noticeable rearrangement of essential transmembrane helices was detected, there are no indications from our simulations that ATP binding alone may facilitate propagation of substrate molecules in this transporter

  13. Presence of a consensus DNA motif at nearby DNA sequence of the mutation susceptible CG nucleotides.

    Science.gov (United States)

    Chowdhury, Kaushik; Kumar, Suresh; Sharma, Tanu; Sharma, Ankit; Bhagat, Meenakshi; Kamai, Asangla; Ford, Bridget M; Asthana, Shailendra; Mandal, Chandi C

    2018-01-10

    Complexity in tissues affected by cancer arises from somatic mutations and epigenetic modifications in the genome. The mutation susceptible hotspots present within the genome indicate a non-random nature and/or a position specific selection of mutation. An association exists between the occurrence of mutations and epigenetic DNA methylation. This study is primarily aimed at determining mutation status, and identifying a signature for predicting mutation prone zones of tumor suppressor (TS) genes. Nearby sequences from the top five positions having a higher mutation frequency in each gene of 42 TS genes were selected from a cosmic database and were considered as mutation prone zones. The conserved motifs present in the mutation prone DNA fragments were identified. Molecular docking studies were done to determine putative interactions between the identified conserved motifs and enzyme methyltransferase DNMT1. Collective analysis of 42 TS genes found GC as the most commonly replaced and AT as the most commonly formed residues after mutation. Analysis of the top 5 mutated positions of each gene (210 DNA segments for 42 TS genes) identified that CG nucleotides of the amino acid codons (e.g., Arginine) are most susceptible to mutation, and found a consensus DNA "T/AGC/GAGGA/TG" sequence present in these mutation prone DNA segments. Similar to TS genes, analysis of 54 oncogenes not only found CG nucleotides of the amino acid Arg as the most susceptible to mutation, but also identified the presence of similar consensus DNA motifs in the mutation prone DNA fragments (270 DNA segments for 54 oncogenes) of oncogenes. Docking studies depicted that, upon binding of DNMT1 methylates to this consensus DNA motif (C residues of CpG islands), mutation was likely to occur. Thus, this study proposes that DNMT1 mediated methylation in chromosomal DNA may decrease if a foreign DNA segment containing this consensus sequence along with CG nucleotides is exogenously introduced to dividing

  14. Nucleotide Excision DNA Repair is Associated with Age-Related Vascular Dysfunction

    Science.gov (United States)

    Durik, Matej; Kavousi, Maryam; van der Pluijm, Ingrid; Isaacs, Aaron; Cheng, Caroline; Verdonk, Koen; Loot, Annemarieke E.; Oeseburg, Hisko; Musterd-Bhaggoe, Usha; Leijten, Frank; van Veghel, Richard; de Vries, Rene; Rudez, Goran; Brandt, Renata; Ridwan, Yanto R.; van Deel, Elza D.; de Boer, Martine; Tempel, Dennie; Fleming, Ingrid; Mitchell, Gary F.; Verwoert, Germaine C.; Tarasov, Kirill V.; Uitterlinden, Andre G.; Hofman, Albert; Duckers, Henricus J.; van Duijn, Cornelia M.; Oostra, Ben A.; Witteman, Jacqueline C.M.; Duncker, Dirk J.; Danser, A.H. Jan; Hoeijmakers, Jan H.; Roks, Anton J.M.

    2012-01-01

    Background Vascular dysfunction in atherosclerosis and diabetes, as observed in the aging population of developed societies, is associated with vascular DNA damage and cell senescence. We hypothesized that cumulative DNA damage during aging contributes to vascular dysfunction. Methods and Results In mice with genomic instability due to the defective nucleotide excision repair genes ERCC1 and XPD (Ercc1d/− and XpdTTD mice), we explored age-dependent vascular function as compared to wild-type mice. Ercc1d/− mice showed increased vascular cell senescence, accelerated development of vasodilator dysfunction, increased vascular stiffness and elevated blood pressure at very young age. The vasodilator dysfunction was due to decreased endothelial eNOS levels as well as impaired smooth muscle cell function, which involved phosphodiesterase (PDE) activity. Similar to Ercc1d/− mice, age-related endothelium-dependent vasodilator dysfunction in XpdTTD animals was increased. To investigate the implications for human vascular disease, we explored associations between single nucleotide polymorphisms (SNPs) of selected nucleotide excision repair genes and arterial stiffness within the AortaGen Consortium, and found a significant association of a SNP (rs2029298) in the putative promoter region of DDB2 gene with carotid-femoral pulse wave velocity. Conclusions Mice with genomic instability recapitulate age-dependent vascular dysfunction as observed in animal models and in humans, but with an accelerated progression, as compared to wild type mice. In addition, we found associations between variations in human DNA repair genes and markers for vascular stiffness which is associated with aging. Our study supports the concept that genomic instability contributes importantly to the development of cardiovascular disease. PMID:22705887

  15. Computational Analysis of Single Nucleotide Polymorphisms Associated with Altered Drug Responsiveness in Type 2 Diabetes

    Directory of Open Access Journals (Sweden)

    Valerio Costa

    2016-06-01

    Full Text Available Type 2 diabetes (T2D is one of the most frequent mortality causes in western countries, with rapidly increasing prevalence. Anti-diabetic drugs are the first therapeutic approach, although many patients develop drug resistance. Most drug responsiveness variability can be explained by genetic causes. Inter-individual variability is principally due to single nucleotide polymorphisms, and differential drug responsiveness has been correlated to alteration in genes involved in drug metabolism (CYP2C9 or insulin signaling (IRS1, ABCC8, KCNJ11 and PPARG. However, most genome-wide association studies did not provide clues about the contribution of DNA variations to impaired drug responsiveness. Thus, characterizing T2D drug responsiveness variants is needed to guide clinicians toward tailored therapeutic approaches. Here, we extensively investigated polymorphisms associated with altered drug response in T2D, predicting their effects in silico. Combining different computational approaches, we focused on the expression pattern of genes correlated to drug resistance and inferred evolutionary conservation of polymorphic residues, computationally predicting the biochemical properties of polymorphic proteins. Using RNA-Sequencing followed by targeted validation, we identified and experimentally confirmed that two nucleotide variations in the CAPN10 gene—currently annotated as intronic—fall within two new transcripts in this locus. Additionally, we found that a Single Nucleotide Polymorphism (SNP, currently reported as intergenic, maps to the intron of a new transcript, harboring CAPN10 and GPR35 genes, which undergoes non-sense mediated decay. Finally, we analyzed variants that fall into non-coding regulatory regions of yet underestimated functional significance, predicting that some of them can potentially affect gene expression and/or post-transcriptional regulation of mRNAs affecting the splicing.

  16. A novel method to discover fluoroquinolone antibiotic resistance (qnr genes in fragmented nucleotide sequences

    Directory of Open Access Journals (Sweden)

    Boulund Fredrik

    2012-12-01

    Full Text Available Abstract Background Broad-spectrum fluoroquinolone antibiotics are central in modern health care and are used to treat and prevent a wide range of bacterial infections. The recently discovered qnr genes provide a mechanism of resistance with the potential to rapidly spread between bacteria using horizontal gene transfer. As for many antibiotic resistance genes present in pathogens today, qnr genes are hypothesized to originate from environmental bacteria. The vast amount of data generated by shotgun metagenomics can therefore be used to explore the diversity of qnr genes in more detail. Results In this paper we describe a new method to identify qnr genes in nucleotide sequence data. We show, using cross-validation, that the method has a high statistical power of correctly classifying sequences from novel classes of qnr genes, even for fragments as short as 100 nucleotides. Based on sequences from public repositories, the method was able to identify all previously reported plasmid-mediated qnr genes. In addition, several fragments from novel putative qnr genes were identified in metagenomes. The method was also able to annotate 39 chromosomal variants of which 11 have previously not been reported in literature. Conclusions The method described in this paper significantly improves the sensitivity and specificity of identification and annotation of qnr genes in nucleotide sequence data. The predicted novel putative qnr genes in the metagenomic data support the hypothesis of a large and uncharacterized diversity within this family of resistance genes in environmental bacterial communities. An implementation of the method is freely available at http://bioinformatics.math.chalmers.se/qnr/.

  17. The nucleotide sequence of human transition protein 1 cDNA

    Energy Technology Data Exchange (ETDEWEB)

    Luerssen, H; Hoyer-Fender, S; Engel, W [Universitaet Goettingen (West Germany)

    1988-08-11

    The authors have screened a human testis cDNA library with an oligonucleotide of 81 mer prepared according to a part of the published nucleotide sequence of the rat transition protein TP 1. They have isolated a cDNA clone with the length of 441 bp containing the coding region of 162 bp for human transition protein 1. There is about 84% homology in the coding region of the sequence compared to rat. The human cDNA-clone encodes a polypeptide of 54 amino acids of which 7 are different to that of rat.

  18. Single nucleotide polymorphisms as susceptibility, prognostic, and therapeutic markers of nonsmall cell lung cancer

    Directory of Open Access Journals (Sweden)

    Zienolddiny S

    2011-12-01

    Full Text Available Shanbeh Zienolddiny, Vidar SkaugSection for Toxicology and Biological Work Environment, National Institute of Occupational Health, Oslo, NorwayAbstract: Lung cancer is a major public health problem throughout the world. Among the most frequent cancer types (prostate, breast, colorectal, stomach, lung, lung cancer is the leading cause of cancer-related deaths worldwide. Among the two major subtypes of small cell lung cancer and nonsmall cell lung cancer (NSCLC, 85% of tumors belong to the NSCLC histological types. Small cell lung cancer is associated with the shortest survival time. Although tobacco smoking has been recognized as the major risk factor for lung cancer, there is a great interindividual and interethnic difference in risk of developing lung cancer given exposure to similar environmental and lifestyle factors. This may indicate that in addition to chemical and environmental factors, genetic variations in the genome may contribute to risk modification. A common type of genetic variation in the genome, known as single nucleotide polymorphism, has been found to be associated with susceptibility to lung cancer. Interestingly, many of these polymorphisms are found in the genes that regulate major pathways of carcinogen metabolism (cytochrome P450 genes, detoxification (glutathione S-transferases, adduct removal (DNA repair genes, cell growth/apoptosis (TP53/MDM2, the immune system (cytokines/chemokines, and membrane receptors (nicotinic acetylcholine and dopaminergic receptors. Some of these polymorphisms have been shown to alter the level of mRNA, and protein structure and function. In addition to being susceptibility markers, several of these polymorphisms are emerging to be important for response to chemotherapy/radiotherapy and survival of patients. Therefore, it is hypothesized that single nucleotide polymorphisms will be valuable genetic markers in individual-based prognosis and therapy in future. Here we will review some of the most

  19. Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.

    Science.gov (United States)

    Richaud, F; Richaud, C; Ratet, P; Patte, J C

    1986-04-01

    In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amino acid polypeptide of 31,372 daltons.

  20. Tools and drugs for uracil nucleotide-activated P2Y receptors.

    Science.gov (United States)

    Rafehi, Muhammad; Müller, Christa E

    2018-04-13

    P2Y receptors (P2YRs) are a family of G protein-coupled receptors activated by extracellular nucleotides. Physiological P2YR agonists include purine and pyrimidine nucleoside di- and triphosphates, such as ATP, ADP, UTP, UDP, nucleotide sugars, and dinucleotides. Eight subtypes exist, P2Y 1 , P2Y 2 , P2Y 4 , P2Y 6 , P2Y 11 , P2Y 12 , P2Y 13 , and P2Y 14 , which represent current or potential future drug targets. Here we provide a comprehensive overview of ligands for the subgroup of the P2YR family that is activated by uracil nucleotides: P2Y 2 (UTP, also ATP and dinucleotides), P2Y 4 (UTP), P2Y 6 (UDP), and P2Y 14 (UDP, UDP-glucose, UDP-galactose). The physiological agonists are metabolically unstable due to their fast hydrolysis by ectonucleotidases. A number of agonists with increased potency, subtype-selectivity and/or enzymatic stability have been developed in recent years. Useful P2Y 2 R agonists include MRS2698 (6-01, highly selective) and PSB-1114 (6-05, increased metabolic stability). A potent and selective P2Y 2 R antagonist is AR-C118925 (10-01). For studies of the P2Y 4 R, MRS4062 (3-15) may be used as a selective agonist, while PSB-16133 (10-06) represents a selective antagonist. Several potent P2Y 6 R agonists have been developed including 5-methoxyuridine 5'-O-((R p )α-boranodiphosphate) (6-12), PSB-0474 (3-11), and MRS2693 (3-26). The isocyanate MRS2578 (10-08) is used as a selective P2Y 6 R antagonist, although its reactivity and low water-solubility are limiting. With MRS2905 (6-08), a potent and metabolically stable P2Y 14 R agonist is available, while PPTN (10-14) represents a potent and selective P2Y 14 R antagonist. The radioligand [ 3 H]UDP can be used to label P2Y 14 Rs. In addition, several fluorescent probes have been developed. Uracil nucleotide-activated P2YRs show great potential as drug targets, especially in inflammation, cancer, cardiovascular and neurodegenerative diseases. Copyright © 2018. Published by Elsevier Inc.

  1. Horizontal gene transfer and nucleotide compositional anomaly in large DNA viruses

    Directory of Open Access Journals (Sweden)

    Ogata Hiroyuki

    2007-12-01

    Full Text Available Abstract Background DNA viruses have a wide range of genome sizes (5 kb up to 1.2 Mb, compared to 0.16 Mb to 1.5 Mb for obligate parasitic bacteria that do not correlate with their virulence or the taxonomic distribution of their hosts. The reasons for such large variation are unclear. According to the traditional view of viruses as gifted "gene pickpockets", large viral genome sizes could originate from numerous gene acquisitions from their hosts. We investigated this hypothesis by studying 67 large DNA viruses with genome sizes larger than 150 kb, including the recently characterized giant mimivirus. Given that horizontally transferred DNA often have anomalous nucleotide compositions differing from the rest of the genome, we conducted a detailed analysis of the inter- and intra-genome compositional properties of these viruses. We then interpreted their compositional heterogeneity in terms of possible causes, including strand asymmetry, gene function/expression, and horizontal transfer. Results We first show that the global nucleotide composition and nucleotide word usage of viral genomes are species-specific and distinct from those of their hosts. Next, we identified compositionally anomalous (cA genes in viral genomes, using a method based on Bayesian inference. The proportion of cA genes is highly variable across viruses and does not exhibit a significant correlation with genome size. The vast majority of the cA genes were of unknown function, lacking homologs in the databases. For genes with known homologs, we found a substantial enrichment of cA genes in specific functional classes for some of the viruses. No significant association was found between cA genes and compositional strand asymmetry. A possible exogenous origin for a small fraction of the cA genes could be confirmed by phylogenetic reconstruction. Conclusion At odds with the traditional dogma, our results argue against frequent genetic transfers to large DNA viruses from their

  2. Candidate gene analysis using imputed genotypes: cell cycle single-nucleotide polymorphisms and ovarian cancer risk

    DEFF Research Database (Denmark)

    Goode, Ellen L; Fridley, Brooke L; Vierkant, Robert A

    2009-01-01

    Polymorphisms in genes critical to cell cycle control are outstanding candidates for association with ovarian cancer risk; numerous genes have been interrogated by multiple research groups using differing tagging single-nucleotide polymorphism (SNP) sets. To maximize information gleaned from......, and rs3212891; CDK2 rs2069391, rs2069414, and rs17528736; and CCNE1 rs3218036. These results exemplify the utility of imputation in candidate gene studies and lend evidence to a role of cell cycle genes in ovarian cancer etiology, suggest a reduced set of SNPs to target in additional cases and controls....

  3. NU-IN: Nucleotide evolution and input module for the EvolSimulator genome simulation platform

    Directory of Open Access Journals (Sweden)

    Barker Michael S

    2010-08-01

    Full Text Available Abstract Background There is increasing demand to test hypotheses that contrast the evolution of genes and gene families among genomes, using simulations that work across these levels of organization. The EvolSimulator program was developed recently to provide a highly flexible platform for forward simulations of amino acid evolution in multiple related lineages of haploid genomes, permitting copy number variation and lateral gene transfer. Synonymous nucleotide evolution is not currently supported, however, and would be highly advantageous for comparisons to full genome, transcriptome, and single nucleotide polymorphism (SNP datasets. In addition, EvolSimulator creates new genomes for each simulation, and does not allow the input of user-specified sequences and gene family information, limiting the incorporation of further biological realism and/or user manipulations of the data. Findings We present modified C++ source code for the EvolSimulator platform, which we provide as the extension module NU-IN. With NU-IN, synonymous and non-synonymous nucleotide evolution is fully implemented, and the user has the ability to use real or previously-simulated sequence data to initiate a simulation of one or more lineages. Gene family membership can be optionally specified, as well as gene retention probabilities that model biased gene retention. We provide PERL scripts to assist the user in deriving this information from previous simulations. We demonstrate the features of NU-IN by simulating genome duplication (polyploidy in the presence of ongoing copy number variation in an evolving lineage. This example is initiated with real genomic data, and produces output that we analyse directly with existing bioinformatic pipelines. Conclusions The NU-IN extension module is a publicly available open source software (GNU GPLv3 license extension to EvolSimulator. With the NU-IN module, users are now able to simulate both drift and selection at the nucleotide

  4. Efficient Oligo nucleotide mediated CRISPR-Cas9 Gene Editing in Aspergilli

    DEFF Research Database (Denmark)

    Nødvig, Christina Spuur; Hoof, Jakob Blæsbjerg; Kogle, Martin Engelhard

    2018-01-01

    CRISPR-Cas9 technologies are revolutionizing fungal gene editing. Here we show that survival of specific Cas9/sgRNA mediated DNA double strand breaks (DSBs) depends on the non-homologous end-joining, NHEJ, DNA repair pathway and we use this observation to develop a tool to assess protospacer....... niger, and in A. oryzae indicating that this type of repair may be wide spread in filamentous fungi. Importantly, we demonstrate that by using single-stranded oligo nucleotides for CRISPR-Cas9 mediated gene editing it is possible to introduce specific point mutations as well gene deletions...

  5. Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.

    OpenAIRE

    Richaud, F; Richaud, C; Ratet, P; Patte, J C

    1986-01-01

    In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amin...

  6. Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.

    Science.gov (United States)

    Richaud, F; Richaud, C; Ratet, P; Patte, J C

    1986-01-01

    In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amino acid polypeptide of 31,372 daltons. Images PMID:3514578

  7. Quantification of nucleotides by ICPMS: coupling of ICPMS with capillary electrophoresis or capillary HPLC

    International Nuclear Information System (INIS)

    Inagaki, K.; Fujii, S.; Takatsu, A.; Yarita, T.; Zhu, Y.; Chiba, K.

    2009-01-01

    Full text: Quantification of nucleotides in small volumes of biological samples has eagerly been demanded. A method using ICPMS coupled with capillary electrophoresis or capillary liquid chromatography is reported. A new interface system, which consists of a double tube nebulizer inserted with a fused silica capillary tube and a cylinder mini-chamber with a sheath gas inlet, was designed. Moreover, the surface conditions of the sampling and skimmer cones, and the introduction of H 2 gas into the plasma were found to significantly improve the signal/background ratio for phosphorus determination at m/z 31. (author)

  8. Reinvestigations of six unusual paternity cases by typing of autosomal single-nucleotide polymorphisms

    DEFF Research Database (Denmark)

    Børsting, Claus; Morling, Niels

    2012-01-01

    and published as case work examples in forensic journals. Here, the cases were reinvestigated by typing the samples for 49 autosomal single-nucleotide polymorphisms (SNPs) using the SNPforID multiplex assay. RESULTS: Three cases were solved by the SNP investigation without the need for any additional testing....... In two cases, the SNP results supported the conclusions based on STRs. In the last case, the SNP results spoke in favor of paternity, and the combined paternity index based on autosomal STRs and SNPs was 12.3 billion. Nevertheless, the alleged father was excluded by X-chromosome typing. CONCLUSION...

  9. Evolutionary constraints and the neutral theory. [mutation-caused nucleotide substitutions in DNA

    Science.gov (United States)

    Jukes, T. H.; Kimura, M.

    1984-01-01

    The neutral theory of molecular evolution postulates that nucleotide substitutions inherently take place in DNA as a result of point mutations followed by random genetic drift. In the absence of selective constraints, the substitution rate reaches the maximum value set by the mutation rate. The rate in globin pseudogenes is about 5 x 10 to the -9th substitutions per site per year in mammals. Rates slower than this indicate the presence of constraints imposed by negative (natural) selection, which rejects and discards deleterious mutations.

  10. LNA-enhanced detection of single nucleotide polymorphisms in the apolipoprotein E

    DEFF Research Database (Denmark)

    Jacobsen, Nana; Bentzen, Joan; Meldgaard, Michael

    2002-01-01

    Genotyping of single nucleotide polymorphisms (SNPs) in large populations presents a great challenge, especially if the SNPs are embedded in GC-rich regions, such as the codon 112 SNP in the human apolipoprotein E (apoE). In the present study, we have used immobilized locked nucleic acid (LNA...... was applied to a panel of patient samples with simultaneous genotyping of the patients by DNA sequencing. The apoE genotyping assays for the codons 112 and 158 SNPs resulted in unambiguous results for all patient samples, concurring with those obtained by DNA sequencing....

  11. Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes

    Directory of Open Access Journals (Sweden)

    McGuire Patrick E

    2010-12-01

    Full Text Available Abstract Background A genome-wide assessment of nucleotide diversity in a polyploid species must minimize the inclusion of homoeologous sequences into diversity estimates and reliably allocate individual haplotypes into their respective genomes. The same requirements complicate the development and deployment of single nucleotide polymorphism (SNP markers in polyploid species. We report here a strategy that satisfies these requirements and deploy it in the sequencing of genes in cultivated hexaploid wheat (Triticum aestivum, genomes AABBDD and wild tetraploid wheat (Triticum turgidum ssp. dicoccoides, genomes AABB from the putative site of wheat domestication in Turkey. Data are used to assess the distribution of diversity among and within wheat genomes and to develop a panel of SNP markers for polyploid wheat. Results Nucleotide diversity was estimated in 2114 wheat genes and was similar between the A and B genomes and reduced in the D genome. Within a genome, diversity was diminished on some chromosomes. Low diversity was always accompanied by an excess of rare alleles. A total of 5,471 SNPs was discovered in 1791 wheat genes. Totals of 1,271, 1,218, and 2,203 SNPs were discovered in 488, 463, and 641 genes of wheat putative diploid ancestors, T. urartu, Aegilops speltoides, and Ae. tauschii, respectively. A public database containing genome-specific primers, SNPs, and other information was constructed. A total of 987 genes with nucleotide diversity estimated in one or more of the wheat genomes was placed on an Ae. tauschii genetic map, and the map was superimposed on wheat deletion-bin maps. The agreement between the maps was assessed. Conclusions In a young polyploid, exemplified by T. aestivum, ancestral species are the primary source of genetic diversity. Low effective recombination due to self-pollination and a genetic mechanism precluding homoeologous chromosome pairing during polyploid meiosis can lead to the loss of diversity from large

  12. Trichomonas vaginalis NTPDase and ecto-5'-nucleotidase hydrolyze guanine nucleotides and increase extracellular guanosine levels under serum restriction.

    Science.gov (United States)

    Menezes, Camila Braz; Durgante, Juliano; de Oliveira, Rafael Rodrigues; Dos Santos, Victor Hugo Jacks Mendes; Rodrigues, Luiz Frederico; Garcia, Solange Cristina; Dos Santos, Odelta; Tasca, Tiana

    2016-05-01

    Trichomonas vaginalis is the aethiologic agent of trichomoniasis, the most common non-viral sexually transmitted disease in the world. The purinergic signaling pathway is mediated by extracellular nucleotides and nucleosides that are involved in many biological effects as neurotransmission, immunomodulation and inflammation. Extracellular nucleotides can be hydrolyzed by a family of enzymes known as ectonucleotidases including the ecto-nucleoside triphosphate diphosphohydrolases (E-NTPDases) family which hydrolyses nucleosides triphosphate and diphosphate as preferential substrates and ecto-5'-nucleotidase which catalyzes the conversion of monophosphates into nucleosides. In T. vaginalis the E-NTPDase and ecto-5'-nucleotidase activities upon adenine nucleotides have already been characterized in intact trophozoites but little is known concerning guanine nucleotides and nucleoside. These enzymes may exert a crucial role on nucleoside generation, providing the purine sources for the synthesis de novo of these essential nutrients, sustaining parasite growth and survival. In this study, we investigated the hydrolysis profile of guanine-related nucleotides and nucleoside in intact trophozoites from long-term-grown and fresh clinical isolates of T. vaginalis. Knowing that guanine nucleotides are also substrates for T. vaginalis ectoenzymes, we evaluated the profile of nucleotides consumption and guanosine uptake in trophozoites submitted to a serum limitation condition. Results show that guanine nucleotides (GTP, GDP, GMP) were substrates for T. vaginalis ectonucleotidases, with expected kinetic parameters for this enzyme family. Different T. vaginalis isolates (two from the ATCC and nine fresh clinical isolates) presented a heterogeneous hydrolysis profile. The serum culture condition increased E-NTPDase and ecto-5'-nucleotidase activities with high consumption of extracellular GTP generating enhanced GDP, GMP and guanosine levels as demonstrated by HPLC, with final

  13. Lack of nucleotide variability in a beetle pest with extreme inbreeding.

    Science.gov (United States)

    Andreev, D; Breilid, H; Kirkendall, L; Brun, L O; ffrench-Constant, R H

    1998-05-01

    The coffee berry borer beetle Hypothenemus hampei (Ferrari) (Curculionidae: Scolytinae) is the major insect pest of coffee and has spread to most of the coffee-growing countries of the world. This beetle also displays an unusual life cycle, with regular sibling mating. This regular inbreeding and the population bottlenecks occurring on colonization of new regions should lead to low levels of genetic diversity. We were therefore interested in determining the level of nucleotide variation in nuclear and mitochondrial genomes of this beetle worldwide. Here we show that two nuclear loci (Resistance to dieldrin and ITS2) are completely invariant, whereas some variability is maintained at a mitochondrial locus (COI), probably corresponding to a higher mutation rate in the mitochondrial genome. Phylogenetic analysis of the mitochondrial data shows only two clades of beetle haplotypes outside of Kenya, the proposed origin of the species. These data confirm that inbreeding greatly reduces nucleotide variation and suggest the recent global spread of only two inbreeding lines of this bark beetle.

  14. DNA detection and single nucleotide mutation identification using SERS for molecular diagnostics and global health

    Science.gov (United States)

    Ngo, Hoan T.; Gandra, Naveen; Fales, Andrew M.; Taylor, Steve M.; Vo-Dinh, Tuan

    2017-02-01

    Nucleic acid-based molecular diagnostics at the point-of-care (POC) and in resource-limited settings is still a challenge. We present a sensitive yet simple DNA detection method with single nucleotide polymorphism (SNP) identification capability. The detection scheme involves sandwich hybridization of magnetic beads conjugated with capture probes, target sequences, and ultrabright surface-enhanced Raman Scattering (SERS) nanorattles conjugated with reporter probes. Upon hybridization, the sandwich probes are concentrated at the detection focus controlled by a magnetic system for SERS measurements. The ultrabright SERS nanorattles, consisting of a core and a shell with resonance Raman reporters loaded in the gap space between the core and the shell, serve as SERS tags for ultrasensitive signal detection. Specific DNA sequences of the malaria parasite Plasmodium falciparum and dengue virus 1 (DENV1) were used as the model marker system. Detection limit of approximately 100 attomoles was achieved. Single nucleotide polymorphism (SNP) discrimination of wild type malaria DNA and mutant malaria DNA, which confers resistance to artemisinin drugs, was also demonstrated. The results demonstrate the molecular diagnostic potential of the nanorattle-based method to both detect and genotype infectious pathogens. The method's simplicity makes it a suitable candidate for molecular diagnosis at the POC and in resource-limited settings.

  15. Nucleotide sequences of immunoglobulin eta genes of chimpanzee and orangutan: DNA molecular clock and hominoid evolution

    Energy Technology Data Exchange (ETDEWEB)

    Sakoyama, Y.; Hong, K.J.; Byun, S.M.; Hisajima, H.; Ueda, S.; Yaoita, Y.; Hayashida, H.; Miyata, T.; Honjo, T.

    1987-02-01

    To determine the phylogenetic relationships among hominoids and the dates of their divergence, the complete nucleotide sequences of the constant region of the immunoglobulin eta-chain (C/sub eta1/) genes from chimpanzee and orangutan have been determined. These sequences were compared with the human eta-chain constant-region sequence. A molecular clock (silent molecular clock), measured by the degree of sequence divergence at the synonymous (silent) positions of protein-encoding regions, was introduced for the present study. From the comparison of nucleotide sequences of ..cap alpha../sub 1/-antitrypsin and ..beta..- and delta-globulin genes between humans and Old World monkeys, the silent molecular clock was calibrated: the mean evolutionary rate of silent substitution was determined to be 1.56 x 10/sup -9/ substitutions per site per year. Using the silent molecular clock, the mean divergence dates of chimpanzee and orangutan from the human lineage were estimated as 6.4 +/- 2.6 million years and 17.3 +/- 4.5 million years, respectively. It was also shown that the evolutionary rate of primate genes is considerably slower than those of other mammalian genes.

  16. FALDO: a semantic standard for describing the location of nucleotide and protein feature annotation.

    Science.gov (United States)

    Bolleman, Jerven T; Mungall, Christopher J; Strozzi, Francesco; Baran, Joachim; Dumontier, Michel; Bonnal, Raoul J P; Buels, Robert; Hoehndorf, Robert; Fujisawa, Takatomo; Katayama, Toshiaki; Cock, Peter J A

    2016-06-13

    Nucleotide and protein sequence feature annotations are essential to understand biology on the genomic, transcriptomic, and proteomic level. Using Semantic Web technologies to query biological annotations, there was no standard that described this potentially complex location information as subject-predicate-object triples. We have developed an ontology, the Feature Annotation Location Description Ontology (FALDO), to describe the positions of annotated features on linear and circular sequences. FALDO can be used to describe nucleotide features in sequence records, protein annotations, and glycan binding sites, among other features in coordinate systems of the aforementioned "omics" areas. Using the same data format to represent sequence positions that are independent of file formats allows us to integrate sequence data from multiple sources and data types. The genome browser JBrowse is used to demonstrate accessing multiple SPARQL endpoints to display genomic feature annotations, as well as protein annotations from UniProt mapped to genomic locations. Our ontology allows users to uniformly describe - and potentially merge - sequence annotations from multiple sources. Data sources using FALDO can prospectively be retrieved using federalised SPARQL queries against public SPARQL endpoints and/or local private triple stores.

  17. NMR studies of the fate of adenine nucleotides in glucose-starved erythrocytes

    International Nuclear Information System (INIS)

    Bubb, W.A.; Mulquiney, P.J.; Kuchel, P.W.; Rohwer, J.; De Atauri, P.

    2002-01-01

    Full text: As a consequence of many refinements during the past 30 years, we now have a detailed understanding of the glycolytic pathway in human erythrocytes. By comparison, and notwithstanding their central importance to four key steps in erythrocyte glycolysis, our knowledge of the catabolism of adenine nucleotides remains relatively limited. In particular, the mechanism for the degradation of AMP, whose concentration rises under conditions of oxidative stress or glucose deprivation, remains poorly understood, AMP degradation may proceed via two possible pathways which converge in the production of inosine. Analysis of the key intermediates for the respective pathways, adenosine and AMP, as well as determination of end products is not straightforward. High-resolution NMR spectroscopy affords a potentially simple analytical solution to this problem but is complicated by spectral overlap and the sensitivity of key resonances to variations in pH and the concentrations of cations such as Mg 2+ . We describe a multinuclear NMR approach towards characterising the intermediates and end-products of adenine nucleotide metabolism in glucose-starved human erythrocytes. Assignments based on homo- and heteronuclear correlation experiments for both 13 C and 31 P are presented

  18. An intermediate state of T7 RNA polymerase provides another pathway of nucleotide selection

    International Nuclear Information System (INIS)

    Wang Zhan-Feng; Liu Yu-Ru; Wang Peng-Ye; Xie Ping

    2017-01-01

    Phage T7 RNA polymerase is a single-subunit transcription enzyme, transcribing template DNA to RNA. Nucleoside triphosphate (NTP) selection and translocation are two critical steps of the transcription elongation. Here, using all-atom molecular dynamics simulations, we found that between pre- and post-translocation states of T7 RNA polymerase an intermediate state exists, where the O helix C-terminal residue tyrosine 639, which plays important roles in translocation, locates between its pre- and post-translocation positions and the side chain of the next template DNA nucleotide has moved into the active site. NTP selection in this intermediate state was studied, revealing that the selection in the intermediate state can be achieved relying on the effect of Watson–Crick interaction between NTP and template DNA nucleotide, effect of stability of the components near the active site such as the nascent DNA–RNA hybrid and role of tyrosine 639. This indicates that another NTP-selection pathway can also exist besides the main pathway where NTP selection begins at the post-translocation state upon the entry of NTP. (paper)

  19. Base-By-Base: single nucleotide-level analysis of whole viral genome alignments.

    Science.gov (United States)

    Brodie, Ryan; Smith, Alex J; Roper, Rachel L; Tcherepanov, Vasily; Upton, Chris

    2004-07-14

    With ever increasing numbers of closely related virus genomes being sequenced, it has become desirable to be able to compare two genomes at a level more detailed than gene content because two strains of an organism may share the same set of predicted genes but still differ in their pathogenicity profiles. For example, detailed comparison of multiple isolates of the smallpox virus genome (each approximately 200 kb, with 200 genes) is not feasible without new bioinformatics tools. A software package, Base-By-Base, has been developed that provides visualization tools to enable researchers to 1) rapidly identify and correct alignment errors in large, multiple genome alignments; and 2) generate tabular and graphical output of differences between the genomes at the nucleotide level. Base-By-Base uses detailed annotation information about the aligned genomes and can list each predicted gene with nucleotide differences, display whether variations occur within promoter regions or coding regions and whether these changes result in amino acid substitutions. Base-By-Base can connect to our mySQL database (Virus Orthologous Clusters; VOCs) to retrieve detailed annotation information about the aligned genomes or use information from text files. Base-By-Base enables users to quickly and easily compare large viral genomes; it highlights small differences that may be responsible for important phenotypic differences such as virulence. It is available via the Internet using Java Web Start and runs on Macintosh, PC and Linux operating systems with the Java 1.4 virtual machine.

  20. A single nucleotide mutation in Nppc is associated with a long bone abnormality in lbab mice

    Directory of Open Access Journals (Sweden)

    Roe Bruce A

    2007-04-01

    Full Text Available Abstract Background The long bone abnormality (lbab mouse is a new autosomal recessive mutant characterized by overall smaller body size with proportionate dwarfing of all organs and shorter long bones. Previous linkage analysis has located the lbab mutation on chromosome 1 between the markers D1Mit9 and D1Mit488. Results A genome-based positional approach was used to identify a mutation associated with lbab disease. A total of 122 genes and expressed sequence tags at the lbab region were screened for possible mutation by using genomic DNA from lbabl/lbab, lbab/+, and +/+ B6 mice and high throughput temperature gradient capillary electrophoresis. A sequence difference was identified in one of the amplicons of gene Nppc between lbab/lbab and +/+ mice. One-step reverse transcriptase polymerase chain reaction was performed to validate the difference of Nppc in different types of mice at the mRNA level. The mutation of Nppc was unique in lbab/lbab mice among multiple mouse inbred strains. The mutation of Nppc is co-segregated with lbab disease in 200 progenies produced from heterozygous lbab/+ parents. Conclusion A single nucleotide mutation of Nppc is associated with dwarfism in lbab/lbab mice. Current genome information and technology allow us to efficiently identify single nucleotide mutations from roughly mapped disease loci. The lbab mouse is a useful model for hereditary human achondroplasia.

  1. Internucleotide correlations and nucleotide periodicity in Drosophila mtDNA: New evidence for panselective evolution

    Directory of Open Access Journals (Sweden)

    Carlos Y Valenzuela

    2010-01-01

    Full Text Available Analysis for the homogeneity of the distribution of the second base of dinucleotides in relation to the first, whose bases are separated by 0, 1, 2,... 21 nucleotide sites, was performed with the VIH-1 genome (cDNA, the Drosophila mtDNA, the Drosophila Torso gene and the human p-globin gene. These four DNA segments showed highly significant heterogeneities of base distributions that cannot be accounted for by neutral or nearly neutral evolution or by the "neighbor influence" of nucleotides on mutation rates. High correlations are found in the bases of dinucleotides separated by 0, 1 and more number of sites. A periodicity of three consecutive significance values (measured by the x²9 was found only in Drosophila mtDNA. This periodicity may be due to an unknown structure or organization of mtDNA. This non-random distribution of the two bases of dinucleotides widespread throughout these DNA segments is rather compatible with panselective evolution and generalized internucleotide co-adaptation.

  2. Processing closely spaced lesions during Nucleotide Excision Repair triggers mutagenesis in E. coli

    Science.gov (United States)

    Isogawa, Asako; Fujii, Shingo

    2017-01-01

    It is generally assumed that most point mutations are fixed when damage containing template DNA undergoes replication, either right at the fork or behind the fork during gap filling. Here we provide genetic evidence for a pathway, dependent on Nucleotide Excision Repair, that induces mutations when processing closely spaced lesions. This pathway, referred to as Nucleotide Excision Repair-induced Mutagenesis (NERiM), exhibits several characteristics distinct from mutations that occur within the course of replication: i) following UV irradiation, NER-induced mutations are fixed much more rapidly (t ½ ≈ 30 min) than replication dependent mutations (t ½ ≈ 80–100 min) ii) NERiM specifically requires DNA Pol IV in addition to Pol V iii) NERiM exhibits a two-hit dose-response curve that suggests processing of closely spaced lesions. A mathematical model let us define the geometry (infer the structure) of the toxic intermediate as being formed when NER incises a lesion that resides in close proximity of another lesion in the complementary strand. This critical NER intermediate requires Pol IV / Pol II for repair, it is either lethal if left unrepaired or mutation-prone when repaired. Finally, NERiM is found to operate in stationary phase cells providing an intriguing possibility for ongoing evolution in the absence of replication. PMID:28686598

  3. Few single nucleotide variations in exomes of human cord blood induced pluripotent stem cells.

    Directory of Open Access Journals (Sweden)

    Rui-Jun Su

    Full Text Available The effect of the cellular reprogramming process per se on mutation load remains unclear. To address this issue, we performed whole exome sequencing analysis of induced pluripotent stem cells (iPSCs reprogrammed from human cord blood (CB CD34(+ cells. Cells from a single donor and improved lentiviral vectors for high-efficiency (2-14% reprogramming were used to examine the effects of three different combinations of reprogramming factors: OCT4 and SOX2 (OS, OS and ZSCAN4 (OSZ, OS and MYC and KLF4 (OSMK. Five clones from each group were subject to whole exome sequencing analysis. We identified 14, 11, and 9 single nucleotide variations (SNVs, in exomes, including untranslated regions (UTR, in the five clones of OSMK, OS, and OSZ iPSC lines. Only 8, 7, and 4 of these, respectively, were protein-coding mutations. An average of 1.3 coding mutations per CB iPSC line is remarkably lower than previous studies using fibroblasts and low-efficiency reprogramming approaches. These data demonstrate that point nucleotide mutations during cord blood reprogramming are negligible and that the inclusion of genome stabilizers like ZSCAN4 during reprogramming may further decrease reprogramming-associated mutations. Our findings provide evidence that CB is a superior source of cells for iPSC banking.

  4. Effects of fenspiride on human bronchial cyclic nucleotide phosphodiesterase isoenzymes: functional and biochemical study.

    Science.gov (United States)

    Cortijo, J; Naline, E; Ortiz, J L; Berto, L; Girard, V; Malbezin, M; Advenier, C; Morcillo, E J

    1998-01-02

    We have investigated the role of human bronchial cyclic nucleotide phosphodiesterases in the effects of fenspiride, a drug endowed with bronchodilator and anti-inflammatory properties. Functional studies on human isolated bronchi showed that fenspiride (10(-6)-3 x 10(-3) M, 30 min) induced a shift to the left of the concentration-response curves for isoprenaline and sodium nitroprusside with -logEC50 values of 4.1+/-0.1 (n = 7) and 3.5+/-0.2 (n = 8), respectively. Biochemical studies were carried out on three human bronchi in which separation of cyclic nucleotide phosphodiesterase isoenzymes was performed by ion exchange chromatography followed by determination of phosphodiesterase activity with a radioisotopic method. Phosphodiesterase 4 (cyclic AMP-specific) and phosphodiesterase 5 (cyclic GMP-specific) were the major phosphodiesterase isoforms present in the human bronchial tissue. The presence of phosphodiesterase 1 (Ca2+/calmodulin-stimulated), phosphodiesterase 2 (cyclic GMP-stimulated) and, in two cases, phosphodiesterase 3 (cyclic GMP-inhibited) was also identified. Fenspiride inhibited phosphodiesterase 4 and phosphodiesterase 3 activities with -logIC50 values of 4.16+/-0.09 and 3.44+/-0.12, respectively. Phosphodiesterase 5 activity was also inhibited with a -logIC50 value of approximately 3.8. Fenspiride (fenspiride is an effective inhibitor of both cyclic AMP and cyclic GMP hydrolytic activity in human bronchial tissues and this action may contribute to its airway effects.

  5. Ciliate telomerase RNA loop IV nucleotides promote hierarchical RNP assembly and holoenzyme stability.

    Science.gov (United States)

    Robart, Aaron R; O'Connor, Catherine M; Collins, Kathleen

    2010-03-01

    Telomerase adds simple-sequence repeats to chromosome 3' ends to compensate for the loss of repeats with each round of genome replication. To accomplish this de novo DNA synthesis, telomerase uses a template within its integral RNA component. In addition to providing the template, the telomerase RNA subunit (TER) also harbors nontemplate motifs that contribute to the specialized telomerase catalytic cycle of reiterative repeat synthesis. Most nontemplate TER motifs function through linkage with the template, but in ciliate and vertebrate telomerases, a stem-loop motif binds telomerase reverse transcriptase (TERT) and reconstitutes full activity of the minimal recombinant TERT+TER RNP, even when physically separated from the template. Here, we resolve the functional requirements for this motif of ciliate TER in physiological RNP context using the Tetrahymena thermophila p65-TER-TERT core RNP reconstituted in vitro and the holoenzyme reconstituted in vivo. Contrary to expectation based on assays of the minimal recombinant RNP, we find that none of a panel of individual loop IV nucleotide substitutions impacts the profile of telomerase product synthesis when reconstituted as physiological core RNP or holoenzyme RNP. However, loop IV nucleotide substitutions do variably reduce assembly of TERT with the p65-TER complex in vitro and reduce the accumulation and stability of telomerase RNP in endogenous holoenzyme context. Our results point to a unifying model of a conformational activation role for this TER motif in the telomerase RNP enzyme.

  6. Intramolecular transfer of radiation damage in γ-irradiated nucleotides: 8,5'-cyclonucleotides

    International Nuclear Information System (INIS)

    Fuciarelli, A.F.; Raleigh, J.A.

    1984-01-01

    The transfer of radiation damage initiated in the sugar phosphate moiety to a nucleotide base as exemplified by 8,5'-cyclonucleotide formation may be important in double-stranded nucleic acids where the bases are shielded to direct hydroxyl attack. With this in mind the authors have renewed a study of the radiation chemistry of cyclonucleotides including further development of an in situ immunochemical assay for their formation in nucleic acids. 8,5'-cycloadenosine 5'-monophosphate has been prepared by radiation chemical synthesis for this purpose. The authors have discovered that the Erlanger and Bieser technique in which the cyclonucleotide hapten is attached to bovine serum albumin (BSA) through the sugar moiety may not be the best approach for preparing cyclonucleotide-containing immunogens as conformational changes may occur in the cyclonucleotide structure during this procedure. The authors are presently using an alternate approach in which the cyclonucleotide hapten is linked to BSA through the phosphate group of the nucleotide. The authors report on these experiments as well as on the basic radiation chemistry of 8,5'-cyclonucleotides

  7. Yersinia Virulence Depends on Mimicry of Host Rho-Family Nucleotide Dissociation Inhibitors

    Energy Technology Data Exchange (ETDEWEB)

    Prehna,G.; Ivanov, M.; Blisha, J.; Stebbins, C.

    2006-01-01

    Yersinia spp. cause gastroenteritis and the plague, representing historically devastating pathogens that are currently an important biodefense and antibiotic resistance concern. A critical virulence determinant is the Yersinia protein kinase A, or YpkA, a multidomain protein that disrupts the eukaryotic actin cytoskeleton. Here we solve the crystal structure of a YpkA-Rac1 complex and find that YpkA possesses a Rac1 binding domain that mimics host guanidine nucleotide dissociation inhibitors (GDIs) of the Rho GTPases. YpkA inhibits nucleotide exchange in Rac1 and RhoA, and mutations that disrupt the YpkA-GTPase interface abolish this activity in vitro and impair in vivo YpkA-induced cytoskeletal disruption. In cell culture experiments, the kinase and the GDI domains of YpkA act synergistically to promote cytoskeletal disruption, and a Y. pseudotuberculosis mutant lacking YpkA GDI activity shows attenuated virulence in a mouse infection assay. We conclude that virulence in Yersinia depends strongly upon mimicry of host GDI proteins by YpkA.

  8. Evolutionary and Structural Perspectives of Plant Cyclic Nucleotide Gated Cation Channels

    Directory of Open Access Journals (Sweden)

    Alice Kira Zelman

    2012-05-01

    Full Text Available Ligand-gated cation channels are a frequent component of signaling cascades in eukaryotes. Eukaryotes contain numerous diverse gene families encoding ion channels, some of which are shared and some of which are unique to particular kingdoms. Among the many different types are cyclic nucleotide-gated channels (CNGCs. CNGCs are cation channels with varying degrees of ion conduction selectivity. They are implicated in numerous signaling pathways and permit diffusion of divalent and monovalent cations, including Ca2+ and K+. CNGCs are present in both plant and animal cells, typically in the plasma membrane; recent studies have also documented their presence in prokaryotes. All eukaryote CNGC polypeptides have a cyclic nucleotide binding domain (CNBD and a calmodulin binding domain (CaMBD as well as a 6 transmembrane/1 pore tertiary structure. This review summarizes existing knowledge about the functional domains present in these cation-conducting channels, and considers the evidence indicating that plant and animal CNGCs evolved separately. Additionally, an amino acid motif that is only found in the phosphate binding cassette and hinge regions of plant CNGCs, and is present in all experimentally confirmed CNGCs but no other channels was identified. This CNGC-specific amino acid motif provides an additional diagnostic tool to identify plant CNGCs, and can increase confidence in the annotation of open reading frames in newly sequenced genomes as putative CNGCs. Conversely, the absence of the motif in some plant sequences currently identified as probable CNGCs may suggest that they are misannotated or protein fragments.

  9. Imidazopyridine- and purine-thioacetamide derivatives: potent inhibitors of nucleotide pyrophosphatase/phosphodiesterase 1 (NPP1).

    Science.gov (United States)

    Chang, Lei; Lee, Sang-Yong; Leonczak, Piotr; Rozenski, Jef; De Jonghe, Steven; Hanck, Theodor; Müller, Christa E; Herdewijn, Piet

    2014-12-11

    Nucleotide pyrophosphatase/phosphodiesterase 1 (NPP1) belongs to the family of ecto-nucleotidases, which control extracellular nucleotide, nucleoside, and (di)phosphate levels. To study the (patho)physiological roles of NPP1 potent and selective inhibitors with drug-like properties are required. Therefore, a compound library was screened for NPP1 inhibitors using a colorimetric assay with p-nitrophenyl 5'-thymidine monophosphate (p-Nph-5'-TMP) as an artificial substrate. This led to the discovery of 2-(3H-imidazo[4,5-b]pyridin-2-ylthio)-N-(3,4-dimethoxyphenyl)acetamide (5a) as a hit compound with a Ki value of 217 nM. Subsequent structure-activity relationship studies led to the development of purine and imidazo[4,5-b]pyridine analogues with high inhibitory potency (Ki values of 5.00 nM and 29.6 nM, respectively) when assayed with p-Nph-5'-TMP as a substrate. Surprisingly, the compounds were significantly less potent when tested versus ATP as a substrate, with Ki values in the low micromolar range. A prototypic inhibitor was investigated for its mechanism of inhibition and found to be competitive versus both substrates.

  10. Nucleotide excision repair pathway assessment in DNA exposed to low-intensity red and infrared lasers

    International Nuclear Information System (INIS)

    Fonseca, A.S.; Campos, V.M.A.; Magalhaes, L.A.G.; Paoli, F.

    2015-01-01

    Low-intensity lasers are used for prevention and management of oral mucositis induced by anticancer therapy, but the effectiveness of treatment depends on the genetic characteristics of affected cells. This study evaluated the survival and induction of filamentation of Escherichia coli cells deficient in the nucleotide excision repair pathway, and the action of T 4 endonuclease V on plasmid DNA exposed to low-intensity red and near-infrared laser light. Cultures of wild-type (strain AB1157) E. coli and strain AB1886 (deficient in uvrA protein) were exposed to red (660 nm) and infrared (808 nm) lasers at various fluences, powers and emission modes to study bacterial survival and filamentation. Also, plasmid DNA was exposed to laser light to study DNA lesions produced in vitro by T 4 endonuclease V. Low-intensity lasers: i) had no effect on survival of wild-type E. coli but decreased the survival of uvrA protein-deficient cells, ii) induced bacterial filamentation, iii) did not alter the electrophoretic profile of plasmids in agarose gels, and iv) did not alter the electrophoretic profile of plasmids incubated with T 4 endonuclease V. These results increase our understanding of the effects of laser light on cells with various genetic characteristics, such as xeroderma pigmentosum cells deficient in nucleotide excision pathway activity in patients with mucositis treated by low-intensity lasers. (author)

  11. Posttransfusional changes of 2,3-diphosphoglycerate and nucleotides in CPD-SAGM-preserved erythrocytes.

    Science.gov (United States)

    Matthes, G; Strunk, S; Siems, W; Grune, T

    1993-06-01

    Posttransfusional changes of preserved red blood cells can influence the oxygen equilibrium curve which is mainly affected by the concentration of erythrocyte 2,3-diphosphoglycerate (DPG). The regeneration kinetics of DPG and nucleotides (ATP, ADP, AMP, GTP, GDP) was determined over a period of 0-48 h in surgically treated patients following transfusion of DPG-depleted packed red cells stored for 14 days in CPD-SAGM. 3 h after transfusion the DPG levels raised up to 40% of the patients' prior DPG concentrations. Complete regeneration of the DPG concentrations occurred 36-48 h after transfusion. Changes in the nucleotide pattern indicate, after a temporary decrease of ATP and GTP levels (after 10-30 min) and an activation phase (after 3-12 h), the full regeneration of these parameters 24-48 h after transfusion. The regeneration kinetics of DPG should be taken into consideration for transfusions with blood units stored for more than 14 days, especially in patients with reduced compensatory mechanisms (coronary and cerebral scleroses, pacemaker, etc.) and large transfusion volumes.

  12. The effect of ultraviolet light on the cyclic nucleotide system of human fibroblasts

    International Nuclear Information System (INIS)

    Fertel, R.H.; Tejwani, G.A.; Albrightson, C.R.; Hart, R.W.

    1981-01-01

    The concentrations of cyclic AMP and cyclic GMP in in human skin fibroblasts in culture were determined after exposing the cells to varying fluences of UV (254 nm) light. The cyclic nucleotide concentrations of cells irradiated in the log phase of growth were unchanged relative to controls. In contrast, there was a rise in the concentration of cyclic AMP in cells irradiated after they reached confluency. The increase in concentration was observed as early as 30 min after irradiation, reached a maximum of about 200% of control at 4 to 6 h after exposure, and returned to control values by 24 h after irradiation. The effect was proportional to a UV fluence from 5 to 20 J/m 2 , and was blocked by the addition of the UV absorbing agent para-aminobenzoic acid. In contrast, the results indicated that UV light had no effect on the concentration of cyclic GMP in human fibroblast cell cultures. Because of the importance of cyclic nucleotides in the regulation of cellular function, it is reasonable to hypothesize that changes in cyclic AMP induced by UV light may effect the extranuclear functions of irradiated cells. (author)

  13. Anion-exchange analysis of isotopically labelled nucleotides, nucleosides, and bases in metabolic disorders

    International Nuclear Information System (INIS)

    Nissinen, E.A.O.

    1987-01-01

    This paper on the importance of cellular purines and pyrimidines is evidenced by the multitude of diseases, such as hyperuricemia, orotic aciduria, gout, Lesch-Nyhan syndrome, immunodeficiencies with B- and T-cell dysfunctions, etc. which result from aberrant metabolism. In addition, the use of purine and pyrimidine analogs in chemotherapy is of growing interest. Purine metabolism consists of a complex network of biochemical pathway. These pathways are under complicated feedback regulation and there also exists a close relationship between purine and pyrimidine metabolism. In addition, these pathways interact with those of the carbohydrate, amino acid, and energy metabolism. Since metabolic pathways are closely interrelated, a change in the concentration of a particular metabolite may lead to many changes in the overall metabolic profiles. For instance, in the area of nucleotide metabolism, the inhibition of IMP dehydrogenase by mycophenolic acid leads to various changes in both purine and pyrimidine nucleotide pools. Inhibition of de nova purine biosynthesis by methotrexate leads to many changes in purine and pyrimidine ribonucleotides and deoxyribonucleotides. Thus, the simultaneous measurement of all cellular purine and pyrimidine metabolites from individuals whose metabolism is altered, either by a metabolic disease or by the action of drugs, may further our understanding of cellular metabolism

  14. Molecular cloning and characterization of genes required for nucleotide excision repair in yeast

    International Nuclear Information System (INIS)

    Friedberg, E.C.

    1987-01-01

    Nucleotide excision repair in the yeast S. cerevisiae is a complex process which involves a large number of genes. At least five of these genes (RAD1, RAD2, RAD3, RAD4 and RAD10) are absolutely required for this process and mutations in any of these genes result in no detectable excision repair in vivo. In order to understand the function of these genes in DNA repair, the authors isolated a number of them by screening a yeast genomic library for recombinant plasmids which complement the phentoype of sensitivity to ultraviolet (UV) radiation imparted to mutant strains. A plasmid containing the RAD4 gene was isolated by an alternative strategy which will be discussed. The cloned genes have been extensively characterized. It has been determined that the RAD3 gene is essential for the viability of haploid yeast cells in the absence of DNA damage. The RAD2 gene is inducible by treatment of cells with a variety of DNA-damaging agents, including UV radiation and ionizing radiation. The RAD10 gene shares considerable amino acid sequence homology with a cloned gene involved in nucleotide excision repair in human cells. Yeast is a particularly versatile organism for studying gene function by molecular and genetic approaches and emphasis is placed on many of the techniques used in the present studies

  15. Multi-locus genotyping of bottom fermenting yeasts by single nucleotide polymorphisms indicative of brewing characteristics.

    Science.gov (United States)

    Ikushima, Shigehito; Tateishi, Yoshiyuki; Kanai, Keiko; Shimada, Emiko; Tanaka, Misa; Ishiguro, Tatsuji; Mizutani, Satoru; Kobayashi, Osamu

    2012-04-01

    Yeast plays a capital role in brewing fermentation and has a direct impact on flavor and aroma. For the evaluation of competent brewing strains during quality control or development of novel strains it is standard practice to perform fermentation tests, which are costly and time-consuming. Here, we have categorized DNA markers which enable to distinguish and to screen brewing strains more efficiently than ever before. Sequence analysis at 289 loci in the genomes of six bottom fermenting Saccharomyces pastorianus strains revealed that 30 loci contained single nucleotide polymorphisms (SNPs). By determining the nucleotide sequences at the SNP-loci in 26 other S. pastorianus strains and 20 strains of the top fermenting yeast Saccharomyces cerevisiae, almost all these strains could be discriminated solely on the basis of the SNPs. By comparing the fermentative phenotypes of these strains we found that some DNA markers showed a strong association with brewing characteristics, such as the production of ethyl acetate and hydrogen sulphide (H2S). Therefore, the DNA markers we identified will facilitate quality control and the efficient development of brewing yeast strains. Copyright © 2011 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  16. The role of nucleotides in augmentation of lymphocyte locomotion: Adaptional countermeasure development in microgravity analog environments

    Science.gov (United States)

    Sundaresan, Alamelu; Kulkarni, Anil D.; Yamauchi, Keiko; Pellis, Neal R.

    2006-09-01

    Space travel and long-term space residence such as envisaged in the exploration era implicates burdens on the immune system. An optimal immune response is required to countered and with-stand exposure to pathogens. Countermeasure development is an important avenue in space research especially for long-term space exploration. Microgravity exposure causes detrimental effects in lymphocyte functions which may impair immune response. Impaired lymphocyte function can be remedied by bypassing cell membrane events. This is done by using compounds such as Phorbol Myristate Acetate (PMA). Since activation in mouse splenocytes was augmented using nucleotides, it was essential to observe their effects on human lymphocyte locomotion. A nucleotide/nucleoside (NT/NT) mixture from Otsuka Pharmaceuticals (Naruto, Japan) was used at recommended doses. In lymphocytes cultured in modeled microgravity, the NT/NT mixture used orchestrated locomotion recovery by more than 87%, similar to the response documented with PMA in lymphocytes. Both 12µM and 120µM doses worked similarly. These are preliminary results leading to the possible use of the NT/NT mixture to mitigate immune suppression in micro-gravity. More studies in this direction are required to delineate the role of NT/NT on the immune response in microgravity.

  17. Complete nucleotide sequence of the RNA-2 of grapevine deformation and Grapevine Anatolian ringspot viruses.

    Science.gov (United States)

    Ghanem-Sabanadzovic, Nina Abou; Sabanadzovic, Sead; Digiaro, Michele; Martelli, Giovanni P

    2005-05-01

    The nucleotide sequence of RNA-2 of Grapevine Anatolian ringspot virus (GARSV) and Grapevine deformation virus (GDefV), two recently described nepoviruses, has been determined. These RNAs are 3753 nt (GDefV) and 4607 nt (GARSV) in size and contain a single open reading frame encoding a polyprotein of 122 kDa (GDefV) and 150 kDa (GARSV). Full-length nucleotide sequence comparison disclosed 71-73% homology between GDefV RNA-2 and that of Grapevine fanleaf virus (GFLV) and Arabis mosaic virus (ArMV), and 62-64% homology between GARSV RNA-2 and that of Grapevine chrome mosaic virus (GCMV) and Tomato black ring virus (TBRV). As previously observed in other nepoviruses, the 5' non-coding regions of both RNAs are capable of forming stem-loop structures. Phylogenetic analysis of the three proteins encoded by RNA-2 (i.e. protein 2A, movement protein and coat protein) confirmed that GDefV and GARSV are distinct viruses which can be assigned as definitive species in subgroup A and subgroup B of the genus Nepovirus, respectively.

  18. Pervasive within-Mitochondrion Single-Nucleotide Variant Heteroplasmy as Revealed by Single-Mitochondrion Sequencing

    Directory of Open Access Journals (Sweden)

    Jacqueline Morris

    2017-12-01

    Full Text Available Summary: A number of mitochondrial diseases arise from single-nucleotide variant (SNV accumulation in multiple mitochondria. Here, we present a method for identification of variants present at the single-mitochondrion level in individual mouse and human neuronal cells, allowing for extremely high-resolution study of mitochondrial mutation dynamics. We identified extensive heteroplasmy between individual mitochondrion, along with three high-confidence variants in mouse and one in human that were present in multiple mitochondria across cells. The pattern of variation revealed by single-mitochondrion data shows surprisingly pervasive levels of heteroplasmy in inbred mice. Distribution of SNV loci suggests inheritance of variants across generations, resulting in Poisson jackpot lines with large SNV load. Comparison of human and mouse variants suggests that the two species might employ distinct modes of somatic segregation. Single-mitochondrion resolution revealed mitochondria mutational dynamics that we hypothesize to affect risk probabilities for mutations reaching disease thresholds. : Morris et al. use independent sequencing of multiple individual mitochondria from mouse and human brain cells to show high pervasiveness of mutations. The mutations are heteroplasmic within single mitochondria and within and between cells. These findings suggest mechanisms by which mutations accumulate over time, resulting in mitochondrial dysfunction and disease. Keywords: single mitochondrion, single cell, human neuron, mouse neuron, single-nucleotide variation

  19. Mapping DNA methylation by transverse current sequencing: Reduction of noise from neighboring nucleotides

    Science.gov (United States)

    Alvarez, Jose; Massey, Steven; Kalitsov, Alan; Velev, Julian

    Nanopore sequencing via transverse current has emerged as a competitive candidate for mapping DNA methylation without needed bisulfite-treatment, fluorescent tag, or PCR amplification. By eliminating the error producing amplification step, long read lengths become feasible, which greatly simplifies the assembly process and reduces the time and the cost inherent in current technologies. However, due to the large error rates of nanopore sequencing, single base resolution has not been reached. A very important source of noise is the intrinsic structural noise in the electric signature of the nucleotide arising from the influence of neighboring nucleotides. In this work we perform calculations of the tunneling current through DNA molecules in nanopores using the non-equilibrium electron transport method within an effective multi-orbital tight-binding model derived from first-principles calculations. We develop a base-calling algorithm accounting for the correlations of the current through neighboring bases, which in principle can reduce the error rate below any desired precision. Using this method we show that we can clearly distinguish DNA methylation and other base modifications based on the reading of the tunneling current.

  20. A single nucleotide mutation in Nppc is associated with a long bone abnormality in lbab mice.

    Science.gov (United States)

    Jiao, Yan; Yan, Jian; Jiao, Feng; Yang, Hongbin; Donahue, Leah Rae; Li, Xinmin; Roe, Bruce A; Stuart, John; Gu, Weikuan

    2007-04-17

    The long bone abnormality (lbab) mouse is a new autosomal recessive mutant characterized by overall smaller body size with proportionate dwarfing of all organs and shorter long bones. Previous linkage analysis has located the lbab mutation on chromosome 1 between the markers D1Mit9 and D1Mit488. A genome-based positional approach was used to identify a mutation associated with lbab disease. A total of 122 genes and expressed sequence tags at the lbab region were screened for possible mutation by using genomic DNA from lbabl/lbab, lbab/+, and +/+ B6 mice and high throughput temperature gradient capillary electrophoresis. A sequence difference was identified in one of the amplicons of gene Nppc between lbab/lbab and +/+ mice. One-step reverse transcriptase polymerase chain reaction was performed to validate the difference of Nppc in different types of mice at the mRNA level. The mutation of Nppc was unique in lbab/lbab mice among multiple mouse inbred strains. The mutation of Nppc is co-segregated with lbab disease in 200 progenies produced from heterozygous lbab/+ parents. A single nucleotide mutation of Nppc is associated with dwarfism in lbab/lbab mice. Current genome information and technology allow us to efficiently identify single nucleotide mutations from roughly mapped disease loci. The lbab mouse is a useful model for hereditary human achondroplasia.