WorldWideScience

Sample records for cytoprotective nrf2 pathway

  1. Piper betle Induced Cytoprotective Genes and Proteins via the Nrf2/ARE Pathway in Aging Mice.

    Science.gov (United States)

    Aliahmat, Nor Syahida; Abdul Sani, Nur Fathiah; Wan Hasan, Wan Nuraini; Makpol, Suzana; Wan Ngah, Wan Zurinah; Mohd Yusof, Yasmin Anum

    2016-01-01

    The objective of this study was to elucidate the underlying antioxidant mechanism of aqueous extract of Piper betle (PB) in aging rats. The nuclear factor erythroid 2-related factor 2 (Nrf2)/ARE pathway involving phase II detoxifying and antioxidant enzymes plays an important role in the antioxidant system by reducing electrophiles and reactive oxygen species through induction of phase II enzymes and proteins. Genes and proteins of phase II detoxifying antioxidant enzymes were analyzed by QuantiGenePlex 2.0 Assay and Western blot analysis. PB significantly induced genes and proteins of phase II and antioxidant enzymes, NAD(P)H quinone oxidoreductase 1, and catalase in aging mice (p < 0.05). The expression of these enzymes were stimulated via translocation of Nrf2 into the nucleus, indicating the involvement of ARE, a cis-acting motif located in the promoter region of nearly all phase II genes. PB was testified for the first time to induce cytoprotective genes through the Nrf2/ARE signaling pathway, thus unraveling the antioxidant mechanism of PB during the aging process. © 2016 S. Karger AG, Basel.

  2. A novel shogaol analog suppresses cancer cell invasion and inflammation, and displays cytoprotective effects through modulation of NF-κB and Nrf2-Keap1 signaling pathways

    Energy Technology Data Exchange (ETDEWEB)

    Gan, Fei-Fei; Ling, Hui; Ang, Xiaohui; Reddy, Shridhivya A.; Lee, Stephanie S-H.; Yang, Hong; Tan, Sock-Hoon [Department of Pharmacy, Faculty of Science, National University of Singapore (Singapore); Hayes, John D. [Jacqui Wood Cancer Centre, Division of Cancer Research, Ninewells Hospital and Medical School, University of Dundee, Dundee, Scotland (United Kingdom); Chui, Wai-Keung [Department of Pharmacy, Faculty of Science, National University of Singapore (Singapore); Chew, Eng-Hui, E-mail: phaceh@nus.edu.sg [Department of Pharmacy, Faculty of Science, National University of Singapore (Singapore)

    2013-11-01

    Natural compounds containing vanilloid and Michael acceptor moieties appear to possess anti-cancer and chemopreventive properties. The ginger constituent shogaol represents one such compound. In this study, the anti-cancer potential of a synthetic novel shogaol analog 3-phenyl-3-shogaol (3-Ph-3-SG) was assessed by evaluating its effects on signaling pathways. At non-toxic concentrations, 3-Ph-3-SG suppressed cancer cell invasion in MDA-MB-231 and MCF-7 breast carcinoma cells through inhibition of PMA-activated MMP-9 expression. At similar concentrations, 3-Ph-3-SG reduced expression of the inflammatory mediators nitric oxide (NO), inducible nitric oxide synthase (iNOS), cyclooxygenase-2 (COX-2) and prostanglandin-E{sub 2} (PGE{sub 2}) in RAW 264.7 macrophage-like cells. Inhibition of cancer cell invasion and inflammation by 3-Ph-3-SG were mediated through suppression of the nuclear factor-kappaB (NF-κB) signaling pathway. The 3-Ph-3-SG also demonstrated cytoprotective effects by inducing the antioxidant response element (ARE)-driven genes NAD(P)H quinone oxidoreductase-1 (NQO1) and heme oxygenase-1 (HO-1). Cytoprotection by 3-Ph-3-SG was achieved at least partly through modification of cysteine residues in the E3 ubiquitin ligase substrate adaptor Kelch-like ECH-associated protein 1 (Keap1), which resulted in accumulation of transcription factor NF-E2 p45-related factor 2 (Nrf2). The activities of 3-Ph-3-SG were comparable to those of 6-shogaol, the most abundant naturally-occurring shogaol, and stronger than those of 4-hydroxyl-null deshydroxy-3-phenyl-3-shogaol, which attested the importance of the 4-hydroxy substituent in the vanilloid moiety for bioactivity. In summary, 3-Ph-3-SG is shown to possess activities that modulate stress-associated pathways relevant to multiple steps in carcinogenesis. Therefore, it warrants further investigation of this compound as a promising candidate for use in chemotherapeutic and chemopreventive strategies. - Highlights:

  3. Seaweed extracts and unsaturated fatty acid constituents from the green alga Ulva lactuca as activators of the cytoprotective Nrf2–ARE pathway

    Science.gov (United States)

    Wang, Rui; Paul, Valerie J.; Luesch, Hendrik

    2013-01-01

    Increased amounts of reactive oxygen species (ROS) have been implicated in many pathological conditions, including cancer. The major machinery that the cell employs to neutralize excess ROS is through the activation of the antioxidant-response element (ARE) that controls the activation of many phase II detoxification enzymes. The transcription factor that recognizes the ARE, Nrf2, can be activated by a variety of small molecules, most of which contain an α,β-unsaturated carbonyl system. In the pursuit of chemopreventive agents from marine organisms, we built, fractionated, and screened a library of 30 field-collected eukaryotic algae from Florida. An edible green alga, Ulva lactuca, yielded multiple active fractions by ARE–luciferase reporter assay. We isolated three monounsaturated fatty acid (MUFA) derivatives as active components, including a new keto-type C18 fatty acid (1), the corresponding shorter chain C16 acid (2), and an amide derivative (3) of the C18 acid. Their chemical structures were elucidated by NMR and mass spectrometry. All three contain the conjugated enone motif between C7 and C9, which is thought to be responsible for the ARE activity. Subsequent biological studies focused on 1, the most active and abundant ARE activator isolated. C18 acid 1 induced the expression of ARE-regulated cytoprotective genes, including NAD(P)H:quinone oxidoreductase 1, heme oxygenase 1, thioredoxin reductase 1, both subunits of the glutamate–cysteine ligase (catalytic subunit and modifier subunit), and the cystine/glutamate exchange transporter, in IMR-32 human neuroblastoma cells. Its cellular activity requires the presence of Nrf2 and PI3K function, based on RNA interference and pharmacological inhibitor studies, respectively. Treatment with 1 led only to Nrf2 activation, and not the increase in production of NRF2 mRNA. To test its ARE activity and cytoprotective potential in vivo, we treated mice with a single dose of a U. lactuca fraction that was enriched

  4. Seaweed extracts and unsaturated fatty acid constituents from the green alga Ulva lactuca as activators of the cytoprotective Nrf2-ARE pathway.

    Science.gov (United States)

    Wang, Rui; Paul, Valerie J; Luesch, Hendrik

    2013-04-01

    Increased amounts of reactive oxygen species (ROS) have been implicated in many pathological conditions, including cancer. The major machinery that the cell employs to neutralize excess ROS is through the activation of the antioxidant-response element (ARE) that controls the activation of many phase II detoxification enzymes. The transcription factor that recognizes the ARE, Nrf2, can be activated by a variety of small molecules, most of which contain an α,β-unsaturated carbonyl system. In the pursuit of chemopreventive agents from marine organisms, we built, fractionated, and screened a library of 30 field-collected eukaryotic algae from Florida. An edible green alga, Ulva lactuca, yielded multiple active fractions by ARE-luciferase reporter assay. We isolated three monounsaturated fatty acid (MUFA) derivatives as active components, including a new keto-type C18 fatty acid (1), the corresponding shorter chain C16 acid (2), and an amide derivative (3) of the C18 acid. Their chemical structures were elucidated by NMR and mass spectrometry. All three contain the conjugated enone motif between C7 and C9, which is thought to be responsible for the ARE activity. Subsequent biological studies focused on 1, the most active and abundant ARE activator isolated. C18 acid 1 induced the expression of ARE-regulated cytoprotective genes, including NAD(P)H:quinone oxidoreductase 1, heme oxygenase 1, thioredoxin reductase 1, both subunits of the glutamate-cysteine ligase (catalytic subunit and modifier subunit), and the cystine/glutamate exchange transporter, in IMR-32 human neuroblastoma cells. Its cellular activity requires the presence of Nrf2 and PI3K function, based on RNA interference and pharmacological inhibitor studies, respectively. Treatment with 1 led only to Nrf2 activation, and not the increase in production of NRF2 mRNA. To test its ARE activity and cytoprotective potential in vivo, we treated mice with a single dose of a U. lactuca fraction that was enriched with

  5. Natural product-derived pharmacological modulators of Nrf2/ARE pathway for chronic diseases.

    Science.gov (United States)

    Kumar, Hemant; Kim, In-Su; More, Sandeep Vasant; Kim, Byung-Wook; Choi, Dong-Kug

    2014-01-01

    Covering: 2000 to 2013. Oxidative stress is the central component of chronic diseases. The nuclear factor erythroid 2-related factor 2/antioxidant response element (Nrf2/ARE) pathway is vital in the up-regulation of cytoprotective genes and enzymes in response to oxidative stress and treatment with certain dietary phytochemicals. Herein, we classify bioactive compounds derived from natural products that are Nrf2/ARE pathway activators and recapitulate the molecular mechanisms for inducing Nrf2 to provide favorable effects in experimental models of chronic diseases. Moreover, pharmacological inhibition of Nrf2 signalling has emerged as promising strategy against multi-drug resistance thereby improving the treatment efficacy. We have also enlisted natural product-derived inhibitors of Nrf2/ARE pathway.

  6. The chalcone compound isosalipurposide (ISPP) exerts a cytoprotective effect against oxidative injury via Nrf2 activation

    Energy Technology Data Exchange (ETDEWEB)

    Han, Jae Yun [College of Pharmacy, Chosun University, Gwangju 501-759 (Korea, Republic of); Cho, Seung Sik [College of Pharmacy, Mokpo National University, Muan, Jeonnam 535-729 (Korea, Republic of); Yang, Ji Hye; Kim, Kyu Min; Jang, Chang Ho [College of Pharmacy, Chosun University, Gwangju 501-759 (Korea, Republic of); Park, Da Eon [College of Pharmacy, Mokpo National University, Muan, Jeonnam 535-729 (Korea, Republic of); Bang, Joon Seok [Graduate School of Clinical Pharmacy, Sookmyung Women' s University, Seoul (Korea, Republic of); Jung, Young Suk [College of Pharmacy, Pusan National University, Busan (Korea, Republic of); Ki, Sung Hwan, E-mail: shki@chosun.ac.kr [College of Pharmacy, Chosun University, Gwangju 501-759 (Korea, Republic of)

    2015-08-15

    The chalcone compound isosalipurposide (ISPP) has been successfully isolated from the native Korean plant species Corylopsis coreana Uyeki (Korean winter hazel). However, the therapeutic efficacy of ISPP remains poorly understood. This study investigated whether ISPP has the capacity to activate NF-E2-related factor (Nrf2)-antioxidant response element (ARE) signaling and induce its target gene expression, and to determined the protective role of ISPP against oxidative injury of hepatocytes. In HepG2 cells, nuclear translocation of Nrf2 is augmented by ISPP treatment. Consistently, ISPP increased ARE reporter gene activity and the protein levels of glutamate cysteine ligase (GCL) and hemeoxygenase (HO-1), resulting in increased intracellular glutathione levels. Cells pretreated with ISPP were rescued from tert-butylhydroperoxide-induced reactive oxygen species (ROS) production and glutathione depletion and consequently, apoptotic cell death. Moreover, ISPP ameliorated the mitochondrial dysfunction and apoptosis induced by rotenone which is an inhibitor of complex 1 of the mitochondrial respiratory chain. The specific role of Nrf2 activation by ISPP was demonstrated using an ARE-deletion mutant plasmid and Nrf2-knockout cells. Finally, we observed that extracellular signal-regulated kinase (ERK) and AMP-activated protein kinase (AMPK), but not protein kinase C (PKC)-δ or other mitogen-activated protein kinases (MAPKs), are involved in the activation of Nrf2 by ISPP. Taken together, our results demonstrate that ISPP has a cytoprotective effect against oxidative damage mediated through Nrf2 activation and induction of its target gene expression in hepatocytes. - Highlights: • We investigated the effect of ISPP on Nrf2 activation. • ISPP increased Nrf2 activity and its target gene expression. • ISPP inhibited the mitochondrial dysfunction and ROS production. • Nrf2 activation by ISPP is dependent on ERK1/2 and AMPK phosphorylation. • ISPP may be a promising

  7. The chalcone compound isosalipurposide (ISPP) exerts a cytoprotective effect against oxidative injury via Nrf2 activation

    International Nuclear Information System (INIS)

    Han, Jae Yun; Cho, Seung Sik; Yang, Ji Hye; Kim, Kyu Min; Jang, Chang Ho; Park, Da Eon; Bang, Joon Seok; Jung, Young Suk; Ki, Sung Hwan

    2015-01-01

    The chalcone compound isosalipurposide (ISPP) has been successfully isolated from the native Korean plant species Corylopsis coreana Uyeki (Korean winter hazel). However, the therapeutic efficacy of ISPP remains poorly understood. This study investigated whether ISPP has the capacity to activate NF-E2-related factor (Nrf2)-antioxidant response element (ARE) signaling and induce its target gene expression, and to determined the protective role of ISPP against oxidative injury of hepatocytes. In HepG2 cells, nuclear translocation of Nrf2 is augmented by ISPP treatment. Consistently, ISPP increased ARE reporter gene activity and the protein levels of glutamate cysteine ligase (GCL) and hemeoxygenase (HO-1), resulting in increased intracellular glutathione levels. Cells pretreated with ISPP were rescued from tert-butylhydroperoxide-induced reactive oxygen species (ROS) production and glutathione depletion and consequently, apoptotic cell death. Moreover, ISPP ameliorated the mitochondrial dysfunction and apoptosis induced by rotenone which is an inhibitor of complex 1 of the mitochondrial respiratory chain. The specific role of Nrf2 activation by ISPP was demonstrated using an ARE-deletion mutant plasmid and Nrf2-knockout cells. Finally, we observed that extracellular signal-regulated kinase (ERK) and AMP-activated protein kinase (AMPK), but not protein kinase C (PKC)-δ or other mitogen-activated protein kinases (MAPKs), are involved in the activation of Nrf2 by ISPP. Taken together, our results demonstrate that ISPP has a cytoprotective effect against oxidative damage mediated through Nrf2 activation and induction of its target gene expression in hepatocytes. - Highlights: • We investigated the effect of ISPP on Nrf2 activation. • ISPP increased Nrf2 activity and its target gene expression. • ISPP inhibited the mitochondrial dysfunction and ROS production. • Nrf2 activation by ISPP is dependent on ERK1/2 and AMPK phosphorylation. • ISPP may be a promising

  8. Salidroside Suppresses HUVECs Cell Injury Induced by Oxidative Stress through Activating the Nrf2 Signaling Pathway

    Directory of Open Access Journals (Sweden)

    Yao Zhu

    2016-08-01

    Full Text Available Oxidative stress plays an important role in the pathogenesis of cardiovascular diseases. Salidroside (SAL, one of the main effective constituents of Rhodiola rosea, has been reported to suppress oxidative stress-induced cardiomyocyte injury and necrosis by promoting transcription of nuclear factor E2-related factor 2 (Nrf2-regulated genes such as heme oxygenase-1 (HO-1 and NAD(PH dehydrogenase (quinone1 (NQO1. However, it has not been indicated whether SAL might ameliorate endothelial injury induced by oxidative stress. Here, our study demonstrated that SAL might suppress HUVEC cell injury induced by oxidative stress through activating the Nrf2 signaling pathway. The results of our study indicated that SAL decreased the levels of intercellular reactive oxygen species (ROS and malondialdehyde (MDA, and improved the activities of superoxide dismutase (SOD and catalase (CAT, resulting in protective effects against oxidative stress-induced cell damage in HUVECs. It suppressed oxidative stress damage by inducing Nrf2 nuclear translocation and activating the expression of Nrf2-regulated antioxidant enzyme genes such as HO-1 and NQO1 in HUVECs. Knockdown of Nrf2 with siRNA abolished the cytoprotective effects against oxidative stress, decreased the expression of Nrf2, HO-1, and NQO1, and inhibited the nucleus translocation of Nrf2 in HUVECs. This study is the first to demonstrate that SAL suppresses HUVECs cell injury induced by oxidative stress through activating the Nrf2 signaling pathway.

  9. Marine Natural Product Honaucin A Attenuates Inflammation by Activating the Nrf2-ARE Pathway.

    Science.gov (United States)

    Mascuch, Samantha J; Boudreau, Paul D; Carland, Tristan M; Pierce, N Tessa; Olson, Joshua; Hensler, Mary E; Choi, Hyukjae; Campanale, Joseph; Hamdoun, Amro; Nizet, Victor; Gerwick, William H; Gaasterland, Teresa; Gerwick, Lena

    2018-03-23

    The cyanobacterial marine natural product honaucin A inhibits mammalian innate inflammation in vitro and in vivo. To decipher its mechanism of action, RNA sequencing was used to evaluate differences in gene expression of cultured macrophages following honaucin A treatment. This analysis led to the hypothesis that honaucin A exerts its anti-inflammatory activity through activation of the cytoprotective nuclear erythroid 2-related factor 2 (Nrf2)-antioxidant response element/electrophile response element (ARE/EpRE) signaling pathway. Activation of this pathway by honaucin A in cultured human MCF7 cells was confirmed using an Nrf2 luciferase reporter assay. In vitro alkylation experiments with the natural product and N-acetyl-l-cysteine suggest that honaucin A activates this pathway through covalent interaction with the sulfhydryl residues of the cytosolic repressor protein Keap1. Honaucin A presents a potential therapeutic lead for diseases with an inflammatory component modulated by Nrf2-ARE.

  10. Novel cytoprotective mechanism of anti-parkinsonian drug deprenyl: PI3K and Nrf2-derived induction of antioxidative proteins

    International Nuclear Information System (INIS)

    Nakaso, Kazuhiro; Nakamura, Chiharu; Sato, Hiromi; Imamura, Keiko; Takeshima, Takao; Nakashima, Kenji

    2006-01-01

    Neuroprotection has received considerable attention as a strategy for the treatment of Parkinson's disease (PD). Deprenyl (Selegiline) is a promising candidate for neuroprotection; however, its cytoprotective mechanism has not been fully clarified. Here, we report a novel cytoprotective mechanism of deprenyl involving PI3K and Nrf2-mediated induction of oxidative stress-related proteins. Deprenyl increased the expression of HO-1, PrxI, TrxI, TrxRxI, γGCS, and p62/A170 in SH-SY5Y cells. Deprenyl also induced the nuclear accumulation of Nrf2 and increased the binding activity of Nrf2 to the enhancer region of human genomic HO-1. The Nrf2-mediated induction of antioxidative molecules was controlled by PI3K. Indeed, furthermore, neurotrophin receptor TrkB was identified as an upstream signal for PI3K-Nrf2 activation by deprenyl. These results suggest that the cytoprotective effect of deprenyl is, in part, dependent on Nrf2-mediated induction of antioxidative proteins, suggesting that activation of the PI3K-Nrf2 system may be a useful therapeutic strategy for PD

  11. Identification of an unintended consequence of Nrf2-directed cytoprotection against a key tobacco carcinogen plus a counteracting chemopreventive intervention

    Science.gov (United States)

    Paonessa, Joseph D.; Ding, Yi; Randall, Kristen L.; Munday, Rex; Argoti, Dayana; Vouros, Paul; Zhang, Yuesheng

    2011-01-01

    Nrf2 is a major cytoprotective gene and is a key chemopreventive target against cancer and other diseases. Here we show that Nrf2 faces a dilemma in defense against 4-aminobiphenyl (ABP), a major human bladder carcinogen from tobacco smoke and other environmental sources. While Nrf2 protected mouse liver against ABP (which is metabolically activated in liver), the bladder level of N-(deoxyguanosin-8-yl)-4-aminobiphenyl (dG-C8-ABP), the predominant ABP-DNA adduct formed in bladder cells and tissues, was markedly higher in Nrf2+/+ mice than in Nrf2−/− mice after ABP exposure. Notably, Nrf2 protected bladder cells against ABP in vitro. Mechanistic investigations showed that the dichotomous effects of Nrf2 could be explained at least partly by upregulation of UDP-glucuronosyltransferase (UGT). Nrf2 promoted conjugation of ABP with glucuronic acid in the liver, increasing urinary excretion of the conjugate. While glucuronidation of ABP and its metabolites is a detoxification process, these conjugates, which are excreted in urine, are known to be unstable in acidic urine, leading to delivery of the parent compounds to bladder. Hence, while higher liver UGT activity may protect the liver against ABP it increases bladder exposure to ABP. These findings raise concerns of potential bladder toxicity when Nrf2-activating chemopreventive agents are used in humans exposed to ABP, especially in smokers. We further demonstrate that 5,6-dihydrocyclopenta[c][1,2]-dithiole-3(4H)-thione (CPDT) significantly inhibits dG-C8-ABP formation in bladder cells and tissues, but does not appear to significantly modulate ABP-catalyzing UGT in liver. Thus, CPDT exemplifies a counteracting solution to the dilemma posed by Nrf2. PMID:21487034

  12. Role of the Nrf2-heme oxygenase-1 pathway in silver nanoparticle-mediated cytotoxicity

    International Nuclear Information System (INIS)

    Kang, Su Jin; Ryoo, In-geun; Lee, Young Joon; Kwak, Mi-Kyoung

    2012-01-01

    Silver nanoparticles (nano-Ag) have been widely used in various commercial products including textiles, electronic appliances and biomedical products. However, there remains insufficient information on the potential risk of nano-Ag to human health and environment. In the current study, we have investigated the role of NF-E2-related factor 2 (Nrf2) transcription factor in nano-Ag-induced cytotoxicity. When Nrf2 expression was blocked using interring RNA expression in ovarian carcinoma cell line, nano-Ag treatment showed a substantial decrease in cell viability with concomitant increases in apoptosis and DNA damage compared to the control cells. Target gene analysis revealed that the expression of heme oxygenase-1 (HO-1) was highly elevated by nano-Ag in nonspecific shRNA expressing cells, while Nrf2 knockdown cells (NRF2i) did not increase HO-1 expression. The role of HO-1 in cytoprotection against nano-Ag was reinforced by results using pharmacological inducer of HO-1: cobalt protoporphyrin-mediated HO-1 activation in the NRF2i cells prevented nano-Ag-mediated cell death. Similarly, pharmacological or genetic inhibition of HO-1 in nonspecific control cells exacerbated nano-Ag toxicity. As the upstream signaling mechanism, nano-Ag required the phosphoinositide 3-kinase (PI3K) and p38MAPK signaling cascades for HO-1 induction. The treatment with either PI3K inhibitor or p38MAPK inhibitor suppressed HO-1 induction and intensified nano-Ag-induced cell death. Taken together, these results suggest that Nrf2-dependent HO-1 up-regulation plays a protective role in nano-Ag-induced DNA damage and consequent cell death. In addition, nano-Ag-mediated HO-1 induction is associated with the PI3K and p38MAPK signaling pathways. -- Highlights: ► Role of Nrf2 signaling in silver nanoparticle toxicity. ► Silver nanoparticle toxicity is increased by Nrf2 blockade. ► Nrf2-dependent HO-1 induction protects cells from silver nanoparticle toxicity. ► PI3K and p38MAPK cascades are

  13. VPA and MEL induce apoptosis by inhibiting the Nrf2-ARE signaling pathway in TMZ-resistant U251 cells.

    Science.gov (United States)

    Pan, Hao; Wang, Handong; Jia, Yue; Wang, Qiang; Li, Liwen; Wu, Qi; Chen, Longbang

    2017-07-01

    Chemoresistance is the primary obstacle to effective treatment of glioblastoma, the most lethal brain tumor. Our previous study demonstrated that Nf-E2 related factor 2 (Nrf2), a traditional cytoprotective transcription factor, was overexpressed in gliomas and promoted malignancy. The present study aimed to investigate the expression levels of Nrf2‑antioxidant response element (ARE) signaling pathway genes in temozolomide (TMZ)‑resistant U251 human glioblastoma cells (U251‑TMZ). Additionally, the effect of valproic acid (VPA) and melatonin (MEL) on Nrf2 expression in U251‑TMZ cells and their association with chemoresistance was investigated. The results of the present study indicated that the expression levels of components of the Nrf2‑ARE signaling pathway were increased in U251‑TMZ cells compared with U251 parent cells. Silencing of Nrf2 by transfection with small interfering RNA restored the chemosensitivity of U251‑TMZ cells. The Nrf2 inhibitors VPA and MEL successfully reduced Nrf2 expression and survival in U251‑TMZ cells treated with TMZ, accompanied by increased reactive oxygen species levels and apoptosis. Therefore, VPA and MEL may be potential chemotherapeutic sensitizers for the treatment of chemoresistant glioblastoma.

  14. Topical application of the synthetic triterpenoid RTA 408 activates Nrf2 and induces cytoprotective genes in rat skin.

    Science.gov (United States)

    Reisman, Scott A; Lee, Chun-Yue I; Meyer, Colin J; Proksch, Joel W; Ward, Keith W

    2014-07-01

    RTA 408 is a member of the synthetic oleanane triterpenoid class of compounds known to potently activate the cytoprotective transcription factor Nrf2. Because skin is constantly exposed to external oxidative stress, such as that from ultraviolet radiation, from chemical exposure, during improper wound healing, and throughout the course of cancer radiation therapy, it may benefit from activation of Nrf2. This study was conducted to evaluate the transdermal penetration properties and Nrf2 activation potential of RTA 408 in normal rat skin. RTA 408 (0.1, 1.0, or 3.0%) was applied topically to the shaved skin of male Sprague-Dawley rats twice daily for 4 days and once on Day 5. Topical application of RTA 408 resulted in transdermal penetration, with low but dose-dependent plasma exposure with AUC(0-24 h) values of 3.6, 26.0, and 41.1 h ng/mL for the 0.1, 1.0, and 3.0% doses, respectively. Further, topical application of RTA 408 resulted in increased translocation of Nrf2 to the nucleus, dose-dependent mRNA induction of Nrf2 target genes (e.g. Nqo1, Srxn1, Gclc, and Gclm), and induction of the protein expression of the prototypical Nrf2 target gene Nqo1 and increased total glutathione (GSH) in normal rat skin. Immunohistochemistry demonstrated that increased staining for Nqo1 and total GSH of structures in both the epidermis and dermis was consistent with the full transdermal penetration of RTA 408. Finally, topically administered RTA 408 was well tolerated with no adverse in-life observations and normal skin histology. Thus, the data support the further development of RTA 408 for the potential treatment of skin diseases.

  15. Cytoprotective Role of Nrf2 in Electrical Pulse Stimulated C2C12 Myotube.

    Directory of Open Access Journals (Sweden)

    Masaki Horie

    Full Text Available Regular physical exercise is central to a healthy lifestyle. However, exercise-related muscle contraction can induce reactive oxygen species and reactive nitrogen species (ROS/RNS production in skeletal muscle. The nuclear factor-E2-related factor-2 (Nrf2 transcription factor is a cellular sensor for oxidative stress. Regulation of nuclear Nrf2 signaling regulates antioxidant responses and protects organ structure and function. However, the role of Nrf2 in exercise- or contraction-induced ROS/RNS production in skeletal muscle is not clear. In this study, using differentiated C2C12 cells and electrical pulse stimulation (EPS of muscle contraction, we explored whether Nrf2 plays a role in the skeletal muscle response to muscle contraction-induced ROS/RNS. We found that EPS (40 V, 1 Hz, 2 ms stimulated ROS/RNS accumulation and Nrf2 activation. We also showed that expression of NQO1, HO-1 and GCLM increased after EPS-induced muscle contraction and was remarkably suppressed in cells with Nrf2 knockdown. We also found that the antioxidant N-acetylcysteine (NAC significantly attenuated Nrf2 activation after EPS, whereas the nitric oxide synthetase inhibitor Nω-nitro-L-arginine methyl ester (L-NAME did not. Furthermore, Nrf2 knockdown after EPS markedly decreased ROS/RNS redox potential and cell viability and increased expression of the apoptosis marker Annexin V in C2C12 myotubes. These results indicate that Nrf2 activation and expression of Nrf2 regulated-genes protected muscle against the increased ROS caused by EPS-induced muscle contraction. Thus, our findings suggest that Nrf2 may be a key factor for preservation of muscle function during muscle contraction.

  16. Naphthazarin protects against glutamate-induced neuronal death via activation of the Nrf2/ARE pathway

    Energy Technology Data Exchange (ETDEWEB)

    Son, Tae Gen; Kawamoto, Elisa M.; Yu, Qian-Sheng; Greig, Nigel H. [Laboratory of Neurosciences, National Institute on Aging, Intramural Research Program, 251 Bayview Blvd., Baltimore, MD 21224 (United States); Mattson, Mark P. [Laboratory of Neurosciences, National Institute on Aging, Intramural Research Program, 251 Bayview Blvd., Baltimore, MD 21224 (United States); Department of Neuroscience, Johns Hopkins University School of Medicine, Baltimore, MD (United States); Camandola, Simonetta, E-mail: camandolasi@mail.nih.gov [Laboratory of Neurosciences, National Institute on Aging, Intramural Research Program, 251 Bayview Blvd., Baltimore, MD 21224 (United States)

    2013-04-19

    Highlights: •Naphthazarin activates the Nrf2/ARE pathway. •Naphthazarin induces Nrf2-driven genes in neurons and astrocytes. •Naphthazarin protects neurons against excitotoxicity. -- Abstract: Nuclear factor E2-related factor 2 (Nrf2)/antioxidant response element (ARE) pathway is an important cellular stress response pathway involved in neuroprotection. We previously screened several natural phytochemicals and identified plumbagin as a novel activator of the Nrf2/ARE pathway that can protect neurons against ischemic injury. Here we extended our studies to natural and synthetic derivatives of plumbagin. We found that 5,8-dimethoxy-1,4-naphthoquinone (naphthazarin) is a potent activator of the Nrf2/ARE pathway, up-regulates the expression of Nrf2-driven genes in primary neuronal and glial cultures, and protects neurons against glutamate-induced excitotoxicity.

  17. Naphthazarin protects against glutamate-induced neuronal death via activation of the Nrf2/ARE pathway

    International Nuclear Information System (INIS)

    Son, Tae Gen; Kawamoto, Elisa M.; Yu, Qian-Sheng; Greig, Nigel H.; Mattson, Mark P.; Camandola, Simonetta

    2013-01-01

    Highlights: •Naphthazarin activates the Nrf2/ARE pathway. •Naphthazarin induces Nrf2-driven genes in neurons and astrocytes. •Naphthazarin protects neurons against excitotoxicity. -- Abstract: Nuclear factor E2-related factor 2 (Nrf2)/antioxidant response element (ARE) pathway is an important cellular stress response pathway involved in neuroprotection. We previously screened several natural phytochemicals and identified plumbagin as a novel activator of the Nrf2/ARE pathway that can protect neurons against ischemic injury. Here we extended our studies to natural and synthetic derivatives of plumbagin. We found that 5,8-dimethoxy-1,4-naphthoquinone (naphthazarin) is a potent activator of the Nrf2/ARE pathway, up-regulates the expression of Nrf2-driven genes in primary neuronal and glial cultures, and protects neurons against glutamate-induced excitotoxicity

  18. Naphthazarin protects against glutamate-induced neuronal death via activation of the Nrf2/ARE pathway.

    Science.gov (United States)

    Son, Tae Gen; Kawamoto, Elisa M; Yu, Qian-Sheng; Greig, Nigel H; Mattson, Mark P; Camandola, Simonetta

    2013-04-19

    Nuclear factor E2-related factor 2 (Nrf2)/antioxidant response element (ARE) pathway is an important cellular stress response pathway involved in neuroprotection. We previously screened several natural phytochemicals and identified plumbagin as a novel activator of the Nrf2/ARE pathway that can protect neurons against ischemic injury. Here we extended our studies to natural and synthetic derivatives of plumbagin. We found that 5,8-dimethoxy-1,4-naphthoquinone (naphthazarin) is a potent activator of the Nrf2/ARE pathway, up-regulates the expression of Nrf2-driven genes in primary neuronal and glial cultures, and protects neurons against glutamate-induced excitotoxicity. Published by Elsevier Inc.

  19. Naringenin protects against 6-OHDA-induced neurotoxicity via activation of the Nrf2/ARE signaling pathway.

    Science.gov (United States)

    Lou, Haiyan; Jing, Xu; Wei, Xinbing; Shi, Huanying; Ren, Dongmei; Zhang, Xiumei

    2014-04-01

    There is increasing evidence that oxidative stress is critically involved in the pathogenesis of Parkinson's disease (PD), suggesting that pharmacological targeting of the antioxidant machinery may have therapeutic value. Naringenin, a natural flavonoid compound, has been reported to possess neuroprotective effect against PD related pathology; however the mechanisms underlying its beneficial effects are poorly defined. Thus, the purpose of the present study was to investigate the potential neuroprotective role of naringenin and to delineate its mechanism of action against 6-hydroxydopamine (6-OHDA)-induced neurotoxicity in models of PD both in vitro and in vivo. Naringenin treatment resulted in an increase in nuclear factor E2-related factor 2 (Nrf2) protein levels and subsequent activation of antioxidant response element (ARE) pathway genes in SH-SY5Y cells and in mice. Exposure of SH-SY5Y cells to naringenin provided protection against 6-OHDA-induced oxidative insults that was dependent on Nrf2, since treatment with Nrf2 siRNA failed to block against 6-OHDA neurotoxicity or induce Nrf2-dependent cytoprotective genes in SH-SY5Y cells. In mice, oral administration of naringenin resulted in significant protection against 6-OHDA-induced nigrostriatal dopaminergic neurodegeneration and oxidative damage. Our results indicate that activation of Nrf2/ARE signaling by naringenin is strongly associated with its neuroprotective effects against 6-OHDA neurotoxicity and suggest that targeting the Nrf2/ARE pathway may be a promising approach for therapeutic intervention in PD. Copyright © 2013 Elsevier Ltd. All rights reserved.

  20. Novel Hematopoietic Target Genes in the NRF2-Mediated Transcriptional Pathway

    Directory of Open Access Journals (Sweden)

    Michelle R. Campbell

    2013-01-01

    Full Text Available Nuclear factor- (erythroid-derived 2 like 2 (NFE2L2, NRF2 is a key transcriptional activator of the antioxidant response pathway and is closely related to erythroid transcription factor NFE2. Under oxidative stress, NRF2 heterodimerizes with small Maf proteins and binds cis-acting enhancer sequences found near oxidative stress response genes. Using the dietary isothiocyanate sulforaphane (SFN to activate NRF2, chromatin immunoprecipitation sequencing (ChIP-seq identified several hundred novel NRF2-mediated targets beyond its role in oxidative stress. Activated NRF2 bound the antioxidant response element (ARE in promoters of several known and novel target genes involved in iron homeostasis and heme metabolism, including known targets FTL and FTH1, as well as novel binding in the globin locus control region. Five novel NRF2 target genes were chosen for followup: AMBP, ABCB6, FECH, HRG-1 (SLC48A1, and TBXAS1. SFN-induced gene expression in erythroid K562 and lymphoid cells were compared for each target gene. NRF2 silencing showed reduced expression in lymphoid, lung, and hepatic cells. Furthermore, stable knockdown of NRF2 negative regulator KEAP1 in K562 cells resulted in increased NQO1, AMBP, and TBXAS1 expression. NFE2 binding sites in K562 cells revealed similar binding profiles as lymphoid NRF2 sites in all potential NRF2 candidates supporting a role for NRF2 in heme metabolism and erythropoiesis.

  1. NRF2 Pathway Activation and Adjuvant Chemotherapy Benefit in Lung Squamous Cell Carcinoma.

    Science.gov (United States)

    Cescon, David W; She, Desmond; Sakashita, Shingo; Zhu, Chang-Qi; Pintilie, Melania; Shepherd, Frances A; Tsao, Ming-Sound

    2015-06-01

    Genomic profiling of lung squamous cell carcinomas (SCC) has identified NRF2 pathway alterations, which activate oxidative response pathways, in one third of tumors. Preclinical data suggest these tumors may be resistant to platinum-based chemotherapy. We evaluated the clinical relevance of these findings and assessed whether NRF2 activation predicts benefit from adjuvant chemotherapy in SCC. Logistic regression (LR) and significance analysis of microarrays (SAM) were applied to all 104 TCGA (The Cancer Genome Atlas) SCC cases that had microarray gene expression and mutation data to identify genes associated with somatic NRF2 pathway alterations. The resulting signature (NRF2(ACT)) was tested in 3 independent SCC datasets to evaluate its prognostic and predictive effects. IHC and sequencing for NRF2 and KEAP1 were evaluated in one cohort (n = 43) to assess the relationship between gene expression, mutational status, and protein expression. Twenty-eight genes were identified by overlap between LR (291 genes) and SAM (30 genes), and these consistently separated SCC into 2 groups in all datasets, corresponding to putatively NRF pathway-activated and wild-type (WT) tumors. NRF2(ACT) was not prognostic. However, improved survival with adjuvant chemotherapy in the JBR.10-randomized trial appears limited to patients with the WT signature (HR 0.32, P = 0.16; NRF2(ACT) HR 2.28, P = 0.48; interaction P = 0.15). NRF2(ACT) was highly correlated with mutations in NRF2 and KEAP1, and with high NRF2 protein expression. A gene expression signature of NRF2 pathway activation is associated with benefit from adjuvant cisplatin/vinorelbine in SCC. Patients with NRF2 pathway-activating somatic alterations may have reduced benefit from this therapy. ©2015 American Association for Cancer Research.

  2. Sulforaphane reverses glucocorticoid-induced apoptosis in osteoblastic cells through regulation of the Nrf2 pathway

    Directory of Open Access Journals (Sweden)

    Lin H

    2014-07-01

    small interfering ribonucleic acid significantly blocked the cytoprotective effects of SFP against Dex-induced apoptosis, which suggest the important role of Nrf2 signaling pathway and cell apoptosis induced by Dex. Taken together, this study provides a novel strategy for molecular intervention against Dex-induced osteoporosis using phytochemicals. Keywords: osteoporosis, glucocorticoid, apoptosis, sulforaphane, Nrf2 pathway

  3. Pyrrolidine dithiocarbamate activates the Nrf2 pathway in astrocytes.

    Science.gov (United States)

    Liddell, Jeffrey R; Lehtonen, Sarka; Duncan, Clare; Keksa-Goldsteine, Velta; Levonen, Anna-Liisa; Goldsteins, Gundars; Malm, Tarja; White, Anthony R; Koistinaho, Jari; Kanninen, Katja M

    2016-02-26

    Endogenous defense against oxidative stress is controlled by nuclear factor erythroid 2-related factor 2 (Nrf2). The normal compensatory mechanisms to combat oxidative stress appear to be insufficient to protect against the prolonged exposure to reactive oxygen species during disease. Counterbalancing the effects of oxidative stress by up-regulation of Nrf2 signaling has been shown to be effective in various disease models where oxidative stress is implicated, including Alzheimer's disease. Stimulation of Nrf2 signaling by small-molecule activators is an appealing strategy to up-regulate the endogenous defense mechanisms of cells. Here, we investigate Nrf2 induction by the metal chelator and known nuclear factor-κB inhibitor pyrrolidine dithiocarbamate (PDTC) in cultured astrocytes and neurons, and mouse brain. Nrf2 induction is further examined in cultures co-treated with PDTC and kinase inhibitors or amyloid-beta, and in Nrf2-deficient cultures. We show that PDTC is a potent inducer of Nrf2 signaling specifically in astrocytes and demonstrate the critical role of Nrf2 in PDTC-mediated protection against oxidative stress. This induction appears to be regulated by both Keap1 and glycogen synthase kinase 3β. Furthermore, the presence of amyloid-beta magnifies PDTC-mediated induction of endogenous protective mechanisms, therefore suggesting that PDTC may be an effective Nrf2 inducer in the context of Alzheimer's disease. Finally, we show that PDTC increases brain copper content and glial expression of heme oxygenase-1, and decreases lipid peroxidation in vivo, promoting a more antioxidative environment. PDTC activates Nrf2 and its antioxidative targets in astrocytes but not neurons. These effects may contribute to the neuroprotection observed for PDTC in models of Alzheimer's disease.

  4. Isolating a cytoprotective compound from Ganoderma tsugae: effects on induction of Nrf-2-related genes in endothelial cells.

    Science.gov (United States)

    Wei, Yu-Shan; Wung, Being-Sun; Lin, Yuan-Chun; Hsieh, Chia-Wen

    2009-08-01

    Ganoderma tsugae is a medicinal fungus with several biological activities. It has long been used as a folk remedy for the promotion of health and longevity in China and other oriental countries. Here, a bioactive fraction of G. tsugae was progressively purified to be enriched in the activity of cytoprotective enzymes. The highest bioactivity was detected in the 20% EtOH-precipitated fraction, which was prepared from submerged fermentation filtrate of G. tsugae. Following further purification by gel filtration chromatography and acetone extraction, the most bioactive fraction, F5-2, was identified as a peptidoglycan-like compound. Extracts of G. tsugae (F5-2) induced heme oxygenase-1 (HO-1) and thioredoxin reductase-1 (TrxR1) expression in endothelial cells by increasing NF-E2-related factor-2 (Nrf2) nuclear translocation. Pretreatment with F5-2 increased intracellular glutathione (GSH) and protected against H(2)O(2), suggesting that induction of these antioxidant enzymes is important in protection against oxidative stress. Hence the bioactive peptidoglycan-like compound from G. tsugae might protect endothelial cells.

  5. Soybean-Derived Phytoalexins Improve Cognitive Function through Activation of Nrf2/HO-1 Signaling Pathway

    Directory of Open Access Journals (Sweden)

    Ji Yeon Seo

    2018-01-01

    Full Text Available As soy-derived glyceollins are known to induce antioxidant enzymes in various types of cells and tissues, we hypothesized that the compounds could protect neurons from damage due to reactive oxygen species (ROS. In order to examine the neuroprotective effect of glyceollins, primary cortical neurons collected from mice and mouse hippocampal HT22 cells were challenged with glutamate. Glyceollins attenuated glutamate-induced cytotoxicity in primary cortical neuron isolated from mice carrying wild-type nuclear factor (erythroid-derived 2-like 2 (Nrf2, but the compounds were ineffective in those isolated from Nrf2 knockout mice, suggesting the involvement of the Nrf2 signaling pathway in glyceollin-mediated neuroprotection. Furthermore, the inhibition of heme oxygenase-1 (HO-1, a major downstream enzyme of Nrf2, abolished the suppressive effect of glyceollins against glutamate-induced ROS production and cytotoxicity, confirming that activation of HO-1 by glyceollins is responsible for the neuroprotection. To examine whether glyceollins also improve cognitive ability, mice pretreated with glyceollins were challenged with scopolamine and subjected to behavioral tests. Glyceollins attenuated scopolamine-induced cognitive impairment of mice, but failed to enhance memory in Nrf2 knockout mice, suggesting that the memory-enhancing effect is also mediated by the Nrf2 signaling pathway. Overall, glyceollins showed neuroprotection against glutamate-induced damage, and attenuated scopolamine-induced memory deficits in an Nrf2-dependent manner.

  6. Nrf2 protects against airway disorders

    International Nuclear Information System (INIS)

    Cho, Hye-Youn; Kleeberger, Steven R.

    2010-01-01

    Nuclear factor-erythroid 2 related factor 2 (Nrf2) is a ubiquitous master transcription factor that regulates antioxidant response elements (AREs)-mediated expression of antioxidant enzyme and cytoprotective proteins. In the unstressed condition, Kelch-like ECH-associated protein 1 (Keap1) suppresses cellular Nrf2 in cytoplasm and drives its proteasomal degradation. Nrf2 can be activated by diverse stimuli including oxidants, pro-oxidants, antioxidants, and chemopreventive agents. Nrf2 induces cellular rescue pathways against oxidative injury, abnormal inflammatory and immune responses, apoptosis, and carcinogenesis. Application of Nrf2 germ-line mutant mice has identified an extensive range of protective roles for Nrf2 in experimental models of human disorders in the liver, gastrointestinal tract, airway, kidney, brain, circulation, and immune or nerve system. In the lung, lack of Nrf2 exacerbated toxicity caused by multiple oxidative insults including supplemental respiratory therapy (e.g., hyperoxia, mechanical ventilation), cigarette smoke, allergen, virus, bacterial endotoxin and other inflammatory agents (e.g., carrageenin), environmental pollution (e.g., particles), and a fibrotic agent bleomycin. Microarray analyses and bioinformatic studies elucidated functional AREs and Nrf2-directed genes that are critical components of signaling mechanisms in pulmonary protection by Nrf2. Association of loss of function with promoter polymorphisms in NRF2 or somatic and epigenetic mutations in KEAP1 and NRF2 has been found in cohorts of patients with acute lung injury/acute respiratory distress syndrome or lung cancer, which further supports the role for NRF2 in these lung diseases. In the current review, we address the role of Nrf2 in airways based on emerging evidence from experimental oxidative disease models and human studies.

  7. Britanin Ameliorates Cerebral Ischemia-Reperfusion Injury by Inducing the Nrf2 Protective Pathway.

    Science.gov (United States)

    Wu, Guozhen; Zhu, Lili; Yuan, Xing; Chen, Hao; Xiong, Rui; Zhang, Shoude; Cheng, Hao; Shen, Yunheng; An, Huazhang; Li, Tiejun; Li, Honglin; Zhang, Weidong

    2017-10-10

    Oxidative stress is considered the major cause of tissue injury after cerebral ischemia. The nuclear factor erythroid 2-related factor 2 (Nrf2) pathway is one of the most important defensive mechanisms against oxidative stresses and has been confirmed as a target for stroke treatment. Thus, we desired to find new Nrf2 activators and test their neuronal protective activity both in vivo and in vitro. The herb-derived compound, Britanin, is a potent inducer of the Nrf2 system. Britanin can induce the expression of protective enzymes and reverse oxygen-glucose deprivation, followed by reperfusion (OGD-R)-induced neuronal injury in primary cortical neurons in vitro. Furthermore, the administration of Britanin significantly ameliorated middle cerebral artery occlusion-reperfusion (MCAO-R) insult in vivo. We report here the crystal structure of the complex of Britanin and the BTB domain of Keap1. Britanin selectively binds to a conserved cysteine residue, cysteine 151, of Keap1 and inhibits Keap1-mediated ubiquitination of Nrf2, leading to induction of the Nrf2 pathway. Britanin is a potent inducer of Nrf2. The complex crystal structure of Britanin and the BTB domain of Keap1 help clarify the mechanism of Nrf2 induction. Britanin was proven to protect primary cortical neurons against OGD-R-induced injury in an Nrf2-dependant way. Additionally, Britanin had excellent cerebroprotective effect in an MCAO-R model. Our results demonstrate that the natural product Britanin with potent Nrf2-activating and neural protective activities both in vitro and in vivo could be developed into a cerebroprotective therapeutic agent. Antioxid. Redox Signal. 27, 754-768.

  8. Nrf2: bane or blessing in cancer?

    Science.gov (United States)

    Xiang, MingJun; Namani, Akhileshwar; Wu, ShiJun; Wang, XiaoLi

    2014-08-01

    The Kelch-like ECH-associated protein 1 (Keap1)-nuclear factor-E2-related factor 2 (Nrf2)-antioxidant response element pathway serves a major function in endogenous cytoprotection in normal cells. Nrf2 is a transcription factor that mainly regulates the expression of a wide array of genes that produce the antioxidants and other proteins responsible for the detoxification of xenobiotics and reactive oxygen species. Nrf2 mediates the chemoprevention of cancer in normal cells. Growing body of evidence suggests that Nrf2 is not only involved in the chemoprevention of normal cells but also promotes the growth of cancer cells. However, the mechanism underlying the function of Nrf2 in oncogenesis and tumor protection in cancer cells remains unclear and thus requires further study. This review aims to rationalize the existing functions of Nrf2 in chemoprevention and tumorigenesis, as well as the somatic mutations of Nrf2 and Keap1 in cancer and Nrf2 cross talk with miRNAs. This review also discusses the future challenges in Nrf2 research.

  9. Schisandra chinensis regulates drug metabolizing enzymes and drug transporters via activation of Nrf2-mediated signaling pathway

    Directory of Open Access Journals (Sweden)

    He JL

    2014-12-01

    Full Text Available Jin-Lian He,1 Zhi-Wei Zhou,2,3 Juan-Juan Yin,2 Chang-Qiang He,1 Shu-Feng Zhou,2,3 Yang Yu1 1College of Chinese Medicine, Guangzhou University of Chinese Medicine, Guangzhou, Guangdong, People’s Republic of China; 2Department of Pharmaceutical Sciences, College of Pharmacy, University of South Florida, Tampa, FL, USA; 3Guizhou Provincial Key Laboratory for Regenerative Medicine, Stem Cell and Tissue Engineering Research Center and Sino-US Joint Laboratory for Medical Sciences, Guiyang Medical University, Guiyang, Guizhou, People’s Republic of China Abstract: Drug metabolizing enzymes (DMEs and drug transporters are regulated via epigenetic, transcriptional, posttranscriptional, and translational and posttranslational modifications. Phase I and II DMEs and drug transporters play an important role in the disposition and detoxification of a large number of endogenous and exogenous compounds. The nuclear factor (erythroid-derived 2-like 2 (Nrf2 is a critical regulator of a variety of important cytoprotective genes that are involved in disposition and detoxification of xenobiotics. Schisandra chinensis (SC is a commonly used traditional Chinese herbal medicine that has been primarily used to protect the liver because of its potent antioxidative and anti-inflammatory activities. SC can modulate some DMEs and drug transporters, but the underlying mechanisms are unclear. In this study, we aimed to explore the role of Nrf2 in the regulatory effect of SC extract (SCE on selected DMEs and drug transporters in human hepatocellular liver carcinoma cell line (HepG2 cells. The results showed that SCE, schisandrin A, and schisandrin B significantly increased the expression of NAD(PH: Nicotinamide Adenine Dinucleotide Phosphate-oxidase or:quinone oxidoreductase 1, heme oxygenase-1, glutamate–cysteine ligase, and glutathione S-transferase A4 at both transcriptional and posttranscriptional levels. Incubation of HepG2 cells with SCE resulted in a significant

  10. Piper betle induces phase I & II genes through Nrf2/ARE signaling pathway in mouse embryonic fibroblasts derived from wild type and Nrf2 knockout cells.

    Science.gov (United States)

    Wan Hasan, Wan Nuraini; Kwak, Mi-Kyoung; Makpol, Suzana; Wan Ngah, Wan Zurinah; Mohd Yusof, Yasmin Anum

    2014-02-23

    Nuclear factor-erythroid 2 p45 related factor 2 (Nrf2) is a primary transcription factor, protecting cells from oxidative stress by regulating a number of antioxidants and phase II detoxifying enzymes. Dietary components such as sulforaphane in broccoli and quercetin in onions have been shown to be inducers of Nrf2. Piper betle (PB) grows well in tropical climate and the leaves are used in a number of traditional remedies for the treatment of stomach ailments and infections among Asians. The aim of this study was to elucidate the effect of Piper betle (PB) leaves extract in Nrf2 signaling pathway by using 2 types of cells; mouse embryonic fibroblasts (MEFs) derived from wild-type (WT) and Nrf2 knockout (N0) mice. WT and N0 cells were treated with 5 and 10 μg/ml of PB for 10 and 12-h for the determination of nuclear translocation of Nrf2 protein. Luciferase reporter gene activity was performed to evaluate the antioxidant response element (ARE)-induction by PB. Real-time PCR and Western blot were conducted on both WT and N0 cells after PB treatment for the determination of antioxidant enzymes [superoxide dismutase (SOD1) and heme-oxygenase (HO-1)], phase I oxidoreductase enzymes [ quinone oxidoreductase (NQO1)] and phase II detoxifying enzyme [glutathione S-transferase (GST)]. Nuclear translocation of Nrf2 by PB in WT cells was better after 10 h incubation compared to 12 h. Real time PCR and Western blot analysis showed increased expressions of Nrf2, NQO1 and GSTA1 genes with corresponding increases in glutathione, NQO1 and HO-1 proteins in WT cells. Reporter gene ARE was stimulated by PB as shown by ARE/luciferase assay. Interestingly, PB induced SOD1 gene and protein expressions in N0 cells but not in WT cells. The results of this study confirmed that PB activated Nrf2-ARE signaling pathway which subsequently induced some phase I oxidoreductase, phase II detoxifying and antioxidant genes expression via ARE reporter gene involved in the Nrf2 pathway with the

  11. Lansoprazole halts contrast induced nephropathy through activation of Nrf2 pathway in rats.

    Science.gov (United States)

    Khaleel, Sahar A; Alzokaky, Amany A; Raslan, Nahed A; Alwakeel, Asmaa I; Abd El-Aziz, Heba G; Abd-Allah, Adel R

    2017-05-25

    Contrast-induced nephropathy (CIN) is an important cause of acute kidney injury characterized by significant mortality and morbidity. To date, there is no successful protective regimen for CIN especially in poor kidney function patients. Lansoprazole has been shown to exert antioxidant action through induction of nuclear factor-erythroid 2-related factor 2 (Nrf2) pathway. The aim of the present study is to investigate the potential of lansoprazole to activate Nrf2 pathway in the kidney and consequently to protect against oxidative stress induced by iodinated contrast media. Lansoprazole, at a dose of 100 mg/kg, showed a significant induction of Nrf2 mRNA after 3 h. Administration of contrast media induced significant increase in serum creatinine and blood urea nitrogen, histological deterioration, and reduction in total antioxidant capacity. Moreover, it instigated the defensive Nrf2 gene expression and immunoreactivity. In addition, there were overexpression of HO-1, caspase 3, p53 and IL6 genes and downregulation of Bcl2 gene. Pre-treatment with lansoprazole (100 mg/kg) ameliorated the nephrotoxicity parameters and oxidative stress, improved histological lesions, and hijacked apoptotic and inflammatory markers that were provoked by contrast media. In conclusion, lansoprazole attenuates experimental CIN which might be due to activation of Nrf2 antioxidant defence pathway. These findings highlight the potential benefit of incorporating lansoprazole in the protective regimen against CIN especially for susceptible patients. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Luteolin inhibits the Nrf2 signaling pathway and tumor growth in vivo

    Energy Technology Data Exchange (ETDEWEB)

    Chian, Song; Thapa, Ruby; Chi, Zhexu [Department of Biochemistry and Genetics, School of Medicine, Zhejiang University, Hangzhou 310058 (China); Wang, Xiu Jun [Department of Pharmacology, School of Medicine, Zhejiang University, Hangzhou 310058 (China); Tang, Xiuwen, E-mail: xiuwentang@zju.edu.cn [Department of Biochemistry and Genetics, School of Medicine, Zhejiang University, Hangzhou 310058 (China)

    2014-05-16

    Highlights: • Luteolin inhibits the Nrf2 pathway in mouse liver and in xenografted tumors. • Luteolin markedly inhibits the growth of xenograft tumors. • Luteolin enhances the anti-cancer effect of cisplatin in mice in vivo. • Luteolin could serve as an adjuvant in the chemotherapy of NSCLC. - Abstract: Nuclear factor erythroid 2-related factor 2 (Nrf2) is over-expressed in many types of tumor, promotes tumor growth, and confers resistance to anticancer therapy. Hence, Nrf2 is regarded as a novel therapeutic target in cancer. Previously, we reported that luteolin is a strong inhibitor of Nrf2 in vitro. Here, we showed that luteolin reduced the constitutive expression of NAD(P)H quinone oxidoreductase 1 in mouse liver in a time- and dose-dependent manner. Further, luteolin inhibited the expression of antioxidant enzymes and glutathione transferases, decreasing the reduced glutathione in the liver of wild-type mice under both constitutive and butylated hydroxyanisole-induced conditions. In contrast, such distinct responses were not detected in Nrf2{sup −/−} mice. In addition, oral administration of luteolin, either alone or combined with intraperitoneal injection of the cytotoxic drug cisplatin, greatly inhibited the growth of xenograft tumors from non-small-cell lung cancer (NSCLC) cell line A549 cells grown subcutaneously in athymic nude mice. Cell proliferation, the expression of Nrf2, and antioxidant enzymes were all reduced in tumor xenograft tissues. Furthermore, luteolin enhanced the anti-cancer effect of cisplatin. Together, our findings demonstrated that luteolin inhibits the Nrf2 pathway in vivo and can serve as an adjuvant in the chemotherapy of NSCLC.

  13. Dietary Lycium barbarum Polysaccharide Induces Nrf2/ARE Pathway and Ameliorates Insulin Resistance Induced by High-Fat via Activation of PI3K/AKT Signaling

    Directory of Open Access Journals (Sweden)

    Yi Yang

    2014-01-01

    Full Text Available Lycium barbarum polysaccharide (LBP, an antioxidant from wolfberry, displays the antioxidative and anti-inflammatory effects on experimental models of insulin resistance in vivo. However, the effective mechanism of LBP on high-fat diet-induced insulin resistance is still unknown. The objective of the study was to investigate the mechanism involved in LBP-mediated phosphatidylinositol 3-kinase (PI3K/AKT/Nrf2 axis against high-fat-induced insulin resistance. HepG2 cells were incubated with LBP for 12 hrs in the presence of palmitate. C57BL/6J mice were fed a high-fat diet supplemented with LBP for 24 weeks. We analyzed the expression of nuclear factor-E2-related factor 2 (Nrf2, Jun N-terminal kinases (JNK, and glycogen synthase kinase 3β (GSK3β involved in insulin signaling pathway in vivo and in vitro. First, LBP significantly induced phosphorylation of Nrf2 through PI3K/AKT signaling. Second, LBP obviously increased detoxification and antioxidant enzymes expression and reduced reactive oxygen species (ROS levels via PI3K/AKT/Nrf2 axis. Third, LBP also regulated phosphorylation levels of GSK3β and JNK through PI3K/AKT signaling. Finally, LBP significantly reversed glycolytic and gluconeogenic genes expression via the activation of Nrf2-mediated cytoprotective effects. In summary, LBP is novel antioxidant against insulin resistance induced by high-fat diet via activation of PI3K/AKT/Nrf2 pathway.

  14. The Role of Nrf2-Mediated Pathway in Cardiac Remodeling and Heart Failure

    Directory of Open Access Journals (Sweden)

    Shanshan Zhou

    2014-01-01

    Full Text Available Heart failure (HF is frequently the consequence of sustained, abnormal neurohormonal, and mechanical stress and remains a leading cause of death worldwide. The key pathophysiological process leading to HF is cardiac remodeling, a term referring to maladaptation to cardiac stress at the molecular, cellular, tissue, and organ levels. HF and many of the conditions that predispose one to HF are associated with oxidative stress. Increased generation of reactive oxygen species (ROS in the heart can directly lead to increased necrosis and apoptosis of cardiomyocytes which subsequently induce cardiac remodeling and dysfunction. Nuclear factor-erythroid-2- (NF-E2- related factor 2 (Nrf2 is a transcription factor that controls the basal and inducible expression of a battery of antioxidant genes and other cytoprotective phase II detoxifying enzymes that are ubiquitously expressed in the cardiovascular system. Emerging evidence has revealed that Nrf2 and its target genes are critical regulators of cardiovascular homeostasis via the suppression of oxidative stress, which is the key player in the development and progression of HF. The purpose of this review is to summarize evidence that activation of Nrf2 enhances endogenous antioxidant defenses and counteracts oxidative stress-associated cardiac remodeling and HF.

  15. Keap1/Nrf2 pathway in kidney cancer : frequent methylation of KEAP1 gene promoter in clear renal cell carcinoma

    NARCIS (Netherlands)

    Fabrizio, Federico Pio; Costantini, Manuela; Copetti, Massimiliano; la Torre, Annamaria; Sparaneo, Angelo; Fontana, Andrea; Poeta, Luana; Gallucci, Michele; Sentinelli, Steno; Graziano, Paolo; Parente, Paola; Pompeo, Vincenzo; De Salvo, Laura; Simone, Giuseppe; Papalia, Rocco; Picardo, Francesco; Balsamo, Teresa; Flammia, Gerardo Paolo; Trombetta, Domenico; Pantalone, Angela; Kok, Klaas; Paranita, Ferronika; Muscarella, Lucia Anna; Fazio, Vito Michele

    2017-01-01

    The Keap1/Nrf2 pathway is a master regulator of the cellular redox state through the induction of several antioxidant defence genes implicated in chemotherapeutic drugs resistance of tumor cells. An increasing body of evidence supports a key role for Keap1/Nrf2 pathway in kidney diseases and renal

  16. Can Co-Activation of Nrf2 and Neurotrophic Signaling Pathway Slow Alzheimer’s Disease?

    Directory of Open Access Journals (Sweden)

    Kelsey E. Murphy

    2017-05-01

    Full Text Available Alzheimer’s disease (AD is a multifaceted disease that is hard to treat by single-modal treatment. AD starts with amyloid peptides, mitochondrial dysfunction, and oxidative stress and later is accompanied with chronic endoplasmic reticulum (ER stress and autophagy dysfunction, resulting in more complicated pathogenesis. Currently, few treatments can modify the complicated pathogenic progress of AD. Compared to the treatment with exogenous antioxidants, the activation of global antioxidant defense system via Nrf2 looks more promising in attenuating oxidative stress in AD brains. Accompanying the activation of the Nrf2-mediated antioxidant defense system that reduce the AD-causative factor, oxidative stress, it is also necessary to activate the neurotrophic signaling pathway that replaces damaged organelles and molecules with new ones. Thus, the dual actions to activate both the Nrf2 antioxidant system and neurotrophic signaling pathway are expected to provide a better strategy to modify AD pathogenesis. Here, we review the current understanding of AD pathogenesis and neuronal defense systems and discuss a possible way to co-activate the Nrf2 antioxidant system and neurotrophic signaling pathway with the hope of helping to find a better strategy to slow AD.

  17. Licochalcone A Upregulates Nrf2 Antioxidant Pathway and Thereby Alleviates Acetaminophen-Induced Hepatotoxicity

    Directory of Open Access Journals (Sweden)

    Hongming Lv

    2018-03-01

    Full Text Available Acetaminophen (APAP overdose-induced fatal hepatotoxicity is majorly characterized by overwhelmingly increased oxidative stress while enhanced nuclear factor-erythroid 2-related factor 2 (Nrf2 is involved in prevention of hepatotoxicity. Although Licochalcone A (Lico A upregulates Nrf2 signaling pathway against oxidative stress-triggered cell injury, whether it could protect from APAP-induced hepatotoxicity by directly inducing Nrf2 activation is still poorly elucidated. This study aims to explore the protective effect of Lico A against APAP-induced hepatotoxicity and its underlying molecular mechanisms. Our findings indicated that Lico A effectively decreased tert-butyl hydroperoxide (t-BHP- and APAP-stimulated cell apoptosis, mitochondrial dysfunction and reactive oxygen species generation and increased various anti-oxidative enzymes expression, which is largely dependent on upregulating Nrf2 nuclear translocation, reducing the Keap1 protein expression, and strengthening the antioxidant response element promoter activity. Meanwhile, Lico A dramatically protected against APAP-induced acute liver failure by lessening the lethality; alleviating histopathological liver changes; decreasing the alanine transaminase and aspartate aminotransferase levels, malondialdehyde formation, myeloperoxidase level and superoxide dismutase depletion, and increasing the GSH-to-GSSG ratio. Furthermore, Lico A not only significantly modulated apoptosis-related protein by increasing Bcl-2 expression, and decreasing Bax and caspase-3 cleavage expression, but also efficiently alleviated mitochondrial dysfunction by reducing c-jun N-terminal kinase phosphorylation and translocation, inhibiting Bax mitochondrial translocation, apoptosis-inducing factor and cytochrome c release. However, Lico A-inhibited APAP-induced the lethality, histopathological changes, hepatic apoptosis, and mitochondrial dysfunction in WT mice were evidently abrogated in Nrf2-/- mice. These

  18. Targeting NRF2 signaling for cancer chemoprevention

    International Nuclear Information System (INIS)

    Kwak, Mi-Kyoung; Kensler, Thomas W.

    2010-01-01

    Modulation of the metabolism and disposition of carcinogens through induction of cytoprotective enzymes is one of several promising strategies to prevent cancer. Chemopreventive efficacies of inducers such as dithiolethiones and sulforaphane have been extensively studied in animals as well as in humans. The KEAP1-NRF2 system is a key, but not unilateral, molecular target for these chemopreventive agents. The transcription factor NRF2 (NF-E2-related factor 2) is a master regulator of the expression of a subset of genes, which produce proteins responsible for the detoxication of electrophiles and reactive oxygen species as well as the removal or repair of some of their damage products. It is believed that chemopreventive enzyme inducers affect the interaction between KEAP1 and NRF2 through either mediating conformational changes of the KEAP1 protein or activating phosphorylation cascades targeting the KEAP1-NRF2 complex. These events in turn affect NRF2 stability and trafficking. Recent advances elucidating the underlying structural biology of KEAP1-NRF2 signaling and identification of the gene clusters under the transcriptional control of NRF2 are facilitating understanding of the potential pleiotropic effects of NRF2 activators and discovery of novel classes of potent chemopreventive agents such as the triterpenoids. Although there is appropriately a concern regarding a deleterious role of the KEAP1-NRF2 system in cancer cell biology, especially as the pathway affects cell survival and drug resistance, the development and the use of NRF2 activators as chemopreventive agents still holds a great promise for protection of normal cells from a diversity of environmental stresses that contribute to the burden of cancer and other chronic, degenerative diseases.

  19. Curcumin ameliorates dopaminergic neuronal oxidative damage via activation of the Akt/Nrf2 pathway.

    Science.gov (United States)

    Cui, Qunli; Li, Xin; Zhu, Hongcan

    2016-02-01

    Parkinson's disease (PD) is an age-related complex neurodegenerative disease that affects ≤ 80% of dopaminergic neurons in the substantia nigra pars compacta (SNpc). It has previously been suggested that mitochondrial dysfunction, oxidative stress and oxidative damage underlie the pathogenesis of PD. Curcumin, which is a major active polyphenol component extracted from the rhizomes of Curcuma longa (Zingiberaceae), has been reported to exert neuroprotective effects on an experimental model of PD. The present study conducted a series of in vivo experiments, in order to investigate the effects of curcumin on behavioral deficits, oxidative damage and related mechanisms. The results demonstrated that curcumin was able to significantly alleviate motor dysfunction and increase suppressed tyrosine hydroxylase (TH) activity in the SNpc of rotenone (ROT)-injured rats. Biochemical measurements indicated that rats pretreated with curcumin exhibited increased glutathione (GSH) levels, and reduced reactive oxygen species activity and malondialdehyde content. Mechanistic studies demonstrated that curcumin significantly restored the expression levels of heme oxygenase-1 and quinone oxidoreductase 1, thus ameliorating ROT-induced damage in vivo, via the phosphorylation of Akt and nuclear factor erythroid 2-related factor 2 (Nrf2). Further studies indicated that the Akt/Nrf2 signaling pathway was associated with the protective role of curcumin in ROT-treated rats. Inhibiting the Akt/Nrf2 pathway using a lentiviral vector containing Nrf2-specific short hairpin RNA, or the phosphoinositide 3-kinase inhibitor LY294002, markedly reduced the expression levels of TH and GSH, ultimately attenuating the neuroprotective effects of curcumin against oxidative damage. These results indicated that curcumin was able to significantly ameliorate ROT-induced dopaminergic neuronal oxidative damage in the SNpc of rats via activation of the Akt/Nrf2 signaling pathway.

  20. The Keap1-Nrf2 system in cancers: Stress response and anabolic metabolism

    Directory of Open Access Journals (Sweden)

    Yoichiro eMitsuishi

    2012-12-01

    Full Text Available The Keap1-Nrf2 pathway plays a central role in the protection of cells against oxidative and xenobiotic stresses. Nrf2 is a potent transcription activator that recognizes a unique DNA sequence known as the antioxidant response element (ARE. Under normal conditions, Nrf2 binds to Keap1 in the cytoplasm, resulting in proteasomal degradation. Following exposure to electrophiles or reactive oxygen species, Nrf2 becomes stabilized, translocates into the nucleus and activates the transcription of various cytoprotective genes. Increasing attention has been paid to the role of Nrf2 in cancer cells because the constitutive stabilization of Nrf2 has been observed in many human cancers with poor prognosis. Recent studies have shown that the antioxidant and detoxification activities of Nrf2 confer chemo- and radio-resistance to cancer cells. In this review, we provide an overview of the Keap1-Nrf2 system and discuss its role under physiological and pathological conditions, including cancers. We also introduce the results of our recent study describing Nrf2 function in the metabolism of cancer cells. Nrf2 likely confers a growth advantage to cancer cells through enhancing cytoprotection and anabolism. Finally, we discuss the possible impact of Nrf2 inhibitors on cancer therapy.

  1. Embryotoxicity Caused by DON-Induced Oxidative Stress Mediated by Nrf2/HO-1 Pathway

    Directory of Open Access Journals (Sweden)

    Miao Yu

    2017-06-01

    Full Text Available Deoxynivalenol (DON belongs to the type B group of trichothecenes family, which is composed of sesquiterpenoid metabolites produced by Fusarium and other fungi in grain. DON may cause various toxicities, such as cytotoxicity, immunotoxicity, genotoxicity as well as teratogenicity and carcinogenicity. In the present study, we focus on a hypothesis that DON alters the expressions of Nrf2/HO-1 pathway by inducing embryotoxicity in C57BL/6 mouse (5.0, 2.5, 1.0, and 0 mg/kg/day and BeWo cell lines (0 and 50 nM; 3 h, 12 h and 24 h. Our results indicate that DON treatment in mice during pregnancy leads to ROS accumulation in the placenta, which results in embryotoxicity. At the same time Nrf2/HO-1 pathway is up-regulated by ROS to protect placenta cells from oxidative damage. In DON-treated BeWo cells, the level of ROS has time–effect and dose–effect relationships with HO-1 expression. Moderate increase in HO-1 protects the cell from oxidative damage, while excessive increase in HO-1 aggravates the oxidative damage, which is called in some studies the “threshold effect”. Therefore, oxidative stress may be the critical molecular mechanism for DON-induced embryotoxicity. Besides, Nrf2/HO-1 pathway accompanied by the “threshold effect” also plays an important role against DON-induced oxidative damage in this process.

  2. Bardoxolone methyl (BARD) ameliorates aristolochic acid (AA)-induced acute kidney injury through Nrf2 pathway.

    Science.gov (United States)

    Wu, Juan; Liu, Xinhui; Fan, Jinjin; Chen, Wenfang; Wang, Juan; Zeng, Youjia; Feng, Xiaorang; Yu, Xueqing; Yang, Xiao

    2014-04-06

    Bardoxolone methyl (BARD) is an antioxidant modulator that acts through induction of the nuclear factor erythroid 2-related factor 2 (Nrf2) signaling pathway. This study aimed to investigate the role of BARD in protecting kidneys from aristolochic acid (AA)-induced acute kidney injury (AKI). Male C57BL/6 mice received intraperitoneal (i.p.) injections of aristolochic acid I (AAI) (5mg/kg/day) for 5 days to produce acute AA nephropathy (AAN) model. BARD (10mg/kg/day, i.p.) was applied for 7 consecutive days, starting 2 days prior to AAI administration. The mice in the AA group showed AKI as evidenced by worsening kidney function evaluated by blood urea nitrogen (BUN) and serum creatinine (SCr) levels, and severe tubulointerstitial injury marked by massive tubule necrosis in kidney tissues. BARD significantly reduced BUN and SCr levels which were elevated by AAI. Additionally, AAI-induced histopathological renal damage was ameliorated by BARD. Furthermore, the expression of Nrf2 was reduced, and its repressor Kelch-like ECH-associated protein 1 (Keap1) was increased significantly, whereas heme oxygenase-1 (HO-1) was upregulated and NAD(P)H quinone oxidoreductase-1 (NQO1) was barely increased in the cytoplasm of tubules in kidneys after treatment with AAI. BARD significantly upregulated renal Nrf2, NQO1 and HO-1 expression and downregulated Keap1 expression compared with those in the AA group. Moreover, it was found that Nrf2 was expressed both in the cytoplasm and nuclear of glomeruli and tubules, whereas NQO1 and HO-1 were localized in the cytoplasm of tubules only. In conclusion, AA-induced acute renal injury was associated with impaired Nrf2 activation and expression of its downstream target genes in renal tissues. BARD prevented renal damage induced by AAI, and this renoprotective effect may be exerted by activating the Nrf2 signaling pathway and increasing expression of the downstream target genes. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  3. Fisetin alleviates oxidative stress after traumatic brain injury via the Nrf2-ARE pathway.

    Science.gov (United States)

    Zhang, Li; Wang, Handong; Zhou, Yali; Zhu, Yihao; Fei, Maoxin

    2018-05-22

    Fisetin, a natural flavonoid, has neuroprotection properties in many brain injury models. However, its role in traumatic brain injury (TBI) has not been fully explained. In the present study, we aimed to explore the neuroprotective effects of fisetin in a mouse model of TBI. We found that fisetin improved neurological function, reduced cerebral edema, attenuated brain lesion and ameliorated blood-brain barrier (BBB) disruption after TBI. Moreover, the up-regulation of malondialdehyde (MDA) and the activity of glutathione peroxidase (GPx) were reversed by fisetin treatment. Furthermore, administration of fisetin suppressed neuron cell death and apoptosis, increased the expression of B-cell lymphoma 2 (Bcl-2), while decreased the expression of Bcl-2-associated X protein (Bax) and caspase-3 after TBI. In addition, fisetin activated the nuclear factor erythroid 2-related factor 2 (Nrf2)-antioxidant response element (ARE) pathway following TBI. However, fisetin only failed to suppress oxidative stress in Nrf2 -/- mice. In conclusion, our data provided the first evidence that fisetin played a critical role in neuroprotection after TBI partly through the activation of the Nrf2-ARE pathway. Copyright © 2018 Elsevier Ltd. All rights reserved.

  4. Characterization of the Antioxidant Effects of γ-Oryzanol: Involvement of the Nrf2 Pathway

    Directory of Open Access Journals (Sweden)

    W. Rungratanawanich

    2018-01-01

    Full Text Available γ-Oryzanol (ORY is well known for its antioxidant potential. However, the mechanism by which ORY exerts its antioxidant effect is still unclear. In this paper, the antioxidant properties of ORY were investigated for its potential effects as a reactive oxygen and nitrogen species (ROS/RNS scavenger and in activating antioxidant-promoting intracellular pathways utilizing the human embryonic kidney cells (HEK-293. The 24 h ORY exposure significantly prevented hydrogen peroxide- (H2O2- induced ROS/RNS production at 3 h, and this effect was sustained for at least 24 h. ORY pretreatment also enhanced the activity of antioxidant enzymes: superoxide dismutase (SOD and glutathione peroxidase (GPX. Interestingly, ORY induced the nuclear factor (erythroid-derived 2-like 2 (Nrf2 nuclear translocation and upregulation of Nrf2-dependent defensive genes such as NAD(PH quinone reductase (NQO1, heme oxygenase-1 (HO-1, and glutathione synthetase (GSS at mRNA and protein levels in both basal condition and after H2O2 insult. Thus, this study suggested an intriguing effect of ORY in modulating the Nrf2 pathway, which is also involved in regulating longevity as well as age-related diseases.

  5. Characterization of the Antioxidant Effects of γ-Oryzanol: Involvement of the Nrf2 Pathway.

    Science.gov (United States)

    Rungratanawanich, W; Abate, G; Serafini, M M; Guarienti, M; Catanzaro, M; Marziano, M; Memo, M; Lanni, C; Uberti, D

    2018-01-01

    γ -Oryzanol (ORY) is well known for its antioxidant potential. However, the mechanism by which ORY exerts its antioxidant effect is still unclear. In this paper, the antioxidant properties of ORY were investigated for its potential effects as a reactive oxygen and nitrogen species (ROS/RNS) scavenger and in activating antioxidant-promoting intracellular pathways utilizing the human embryonic kidney cells (HEK-293). The 24 h ORY exposure significantly prevented hydrogen peroxide- (H 2 O 2 -) induced ROS/RNS production at 3 h, and this effect was sustained for at least 24 h. ORY pretreatment also enhanced the activity of antioxidant enzymes: superoxide dismutase (SOD) and glutathione peroxidase (GPX). Interestingly, ORY induced the nuclear factor (erythroid-derived 2)-like 2 (Nrf2) nuclear translocation and upregulation of Nrf2-dependent defensive genes such as NAD(P)H quinone reductase (NQO1), heme oxygenase-1 (HO-1), and glutathione synthetase (GSS) at mRNA and protein levels in both basal condition and after H 2 O 2 insult. Thus, this study suggested an intriguing effect of ORY in modulating the Nrf2 pathway, which is also involved in regulating longevity as well as age-related diseases.

  6. Ginsenoside Rb1 protects against 6-hydroxydopamine-induced oxidative stress by increasing heme oxygenase-1 expression through an estrogen receptor-related PI3K/Akt/Nrf2-dependent pathway in human dopaminergic cells

    International Nuclear Information System (INIS)

    Hwang, Yong Pil; Jeong, Hye Gwang

    2010-01-01

    Phytoestrogens are polyphenolic non-steroidal plant compounds with estrogen-like biological activity. Ginseng, the root of Panax ginseng C.A. Meyer (Araliaceae), is a popular traditional herbal medicine. Ginsenoside Rb1 (Rb1), an active component commonly found in ginseng root, is a phytoestrogen that exerts estrogen-like activity. In this study, we demonstrate that the phytoestrogen Rb1 inhibits 6-hydroxydopamine (6-OHDA)-induced oxidative injury via an ER-dependent Gβ1/PI3K/Akt and heme oxygenase-1 (HO-1) pathway. Pretreatment of SH-SY5Y cells with Rb1 significantly reduced 6-OHDA-induced caspase-3 activation and subsequent cell death. Rb1 also up-regulated HO-1 expression, which conferred cytoprotection against 6-OHDA-induced oxidative injury. Moreover, Rb1 induced both Nrf2 nuclear translocation, which is upstream of HO-1 expression and PI3K activation, a pathway that is involved in induced Nrf2 nuclear translocation, HO-1 expression and cytoprotection. Also, Rb1-mediated increases in PI3K activation and HO-1 induction were reversed by co-treatment with ICI 182,780 and pertussis toxin. Taken together, these results suggest that Rb1 augments the cellular antioxidant defenses through ER-dependent HO-1 induction via the Gβ1/PI3K/Akt-Nrf2 signaling pathway, thereby protecting cells from oxidative stress. Thus our study indicates that Rb1 has a partial cytoprotective role in dopaminergic cell culture systems.

  7. Estrogen increases Nrf2 activity through activation of the PI3K pathway in MCF-7 breast cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Juanjuan, E-mail: jwu32@emory.edu [Department of Gynecology and Obstetrics, Emory University School of Medicine, 101 Woodruff Circle, Suite 4211 WMB, Atlanta, GA 30322 (United States); Williams, Devin [Department of Obstetrics and Gynecology, Morehouse School of Medicine, Atlanta, GA 30310 (United States); Walter, Grant A. [Department of Gynecology and Obstetrics, Emory University School of Medicine, 101 Woodruff Circle, Suite 4211 WMB, Atlanta, GA 30322 (United States); Thompson, Winston E. [Department of Obstetrics and Gynecology, Morehouse School of Medicine, Atlanta, GA 30310 (United States); Sidell, Neil [Department of Gynecology and Obstetrics, Emory University School of Medicine, 101 Woodruff Circle, Suite 4211 WMB, Atlanta, GA 30322 (United States)

    2014-11-01

    The actions of the transcription factor Nuclear factor erythroid 2-related factor (Nrf2) in breast cancer have been shown to include both pro-oncogenic and anti-oncogenic activities which is influenced, at least in part, by the hormonal environment. However, direct regulation of Nrf2 by steroid hormones (estrogen and progesterone) has received only scant attention. Nrf2 is known to be regulated by its cytosolic binding protein, Kelch-like ECH-associated protein 1 (Keap1), and by a Keap1-independent mechanism involving a series of phosphorylation steps mediated by phosphatidylinositol 3-kinase (PI3K) and glycogen synthase kinase 3 beta (GSK3β). Here, we report that estrogen (E2) increases Nrf2 activity in MCF7 breast cancer cells through activation of the PI3K/GSK3β pathway. Utilizing antioxidant response element (ARE)-containing luciferase reporter constructs as read-outs for Nrf2 activity, our data indicated that E2 increased ARE activity >14-fold and enhanced the action of the Nrf2 activators, tertiary butylhydroquinone (tBHQ) and sulforaphane (Sul) 4 to 9 fold compared with cells treated with tBHQ or Sul as single agents. This activity was shown to be an estrogen receptor-mediated phenomenon and was antagonized by progesterone. In addition to its action on the reporter constructs, mRNA and protein levels of heme oxygenase 1, an endogenous target gene of Nrf2, was markedly upregulated by E2 both alone and in combination with tBHQ. Importantly, E2-induced Nrf2 activation was completely suppressed by the PI3K inhibitors LY294002 and Wortmannin while the GSK3β inhibitor CT99021 upregulated Nrf2 activity. Confirmation that E2 was, at least partly, acting through the PI3K/GSK3β pathway was indicated by our finding that E2 increased the phosphorylation status of both GSK3β and Akt, a well-characterized downstream target of PI3K. Together, these results demonstrate a novel mechanism by which E2 can regulate Nrf2 activity in estrogen receptor-positive breast cancer

  8. Compensatory role of the Nrf2–ARE pathway against paraquat toxicity: Relevance of 26S proteasome activity

    Directory of Open Access Journals (Sweden)

    Yasuhiko Izumi

    2015-11-01

    Full Text Available Oxidative stress and the ubiquitin–proteasome system play a key role in the pathogenesis of Parkinson disease. Although the herbicide paraquat is an environmental factor that is involved in the etiology of Parkinson disease, the role of 26S proteasome in paraquat toxicity remains to be determined. Using PC12 cells overexpressing a fluorescent protein fused to the proteasome degradation signal, we report here that paraquat yielded an inhibitory effect on 26S proteasome activity without an obvious decline in 20S proteasome activity. Relative low concentrations of proteasome inhibitors caused the accumulation of nuclear factor erythroid 2-related factor 2 (Nrf2, which is targeted to the ubiquitin–proteasome system, and activated the antioxidant response element (ARE-dependent transcription. Paraquat also upregulated the protein level of Nrf2 without increased expression of Nrf2 mRNA, and activated the Nrf2–ARE pathway. Consequently, paraquat induced expression of Nrf2-dependent ARE-driven genes, such as γ-glutamylcysteine synthetase, catalase, and hemeoxygenase-1. Knockdown of Nrf2 or inhibition of γ-glutamylcysteine synthetase and catalase exacerbated paraquat-induced toxicity, whereas suppression of hemeoxygenase-1 did not. These data indicate that the compensatory activation of the Nrf2–ARE pathway via inhibition of 26S proteasome serves as part of a cellular defense mechanism to protect against paraquat toxicity.

  9. Neuroprotection by curcumin in ischemic brain injury involves the Akt/Nrf2 pathway.

    Directory of Open Access Journals (Sweden)

    Jingxian Wu

    Full Text Available Oxidative damage plays a critical role in many diseases of the central nervous system. This study was conducted to determine the molecular mechanisms involved in the putative anti-oxidative effects of curcumin against experimental stroke. Oxygen and glucose deprivation/reoxygenation (OGD/R was used to mimic ischemic insult in primary cultured cortical neurons. A rapid increase in the intracellular expression of NAD(PH: quinone oxidoreductase1 (NQO1 induced by OGD was counteracted by curcumin post-treatment, which paralleled attenuated cell injury. The reduction of phosphorylation Akt induced by OGD was restored by curcumin. Consequently, NQO1 expression and the binding activity of nuclear factor-erythroid 2-related factor 2 (Nrf2 to antioxidant response element (ARE were increased. LY294002 blocked the increase in phospho-Akt evoked by curcumin and abolished the associated protective effect. Adult male Sprague-Dawley rats were subjected to transient middle cerebral artery occlusion for 60 minutes. Curcumin administration significantly reduced infarct size. Curcumin also markedly reduced oxidative stress levels in middle cerebral artery occlusion (MCAO rats; hence, these effects were all suppressed by LY294002. Taken together, these findings provide evidence that curcumin protects neurons against ischemic injury, and this neuroprotective effect involves the Akt/Nrf2 pathway. In addition, Nrf2 is involved in the neuroprotective effects of curcumin against oxidative damage.

  10. Neuroprotection by Curcumin in Ischemic Brain Injury Involves the Akt/Nrf2 Pathway

    Science.gov (United States)

    Wu, Jingxian; Li, Qiong; Wang, Xiaoyan; Yu, Shanshan; Li, Lan; Wu, Xuemei; Chen, Yanlin; Zhao, Jing; Zhao, Yong

    2013-01-01

    Oxidative damage plays a critical role in many diseases of the central nervous system. This study was conducted to determine the molecular mechanisms involved in the putative anti-oxidative effects of curcumin against experimental stroke. Oxygen and glucose deprivation/reoxygenation (OGD/R) was used to mimic ischemic insult in primary cultured cortical neurons. A rapid increase in the intracellular expression of NAD(P)H: quinone oxidoreductase1 (NQO1) induced by OGD was counteracted by curcumin post-treatment, which paralleled attenuated cell injury. The reduction of phosphorylation Akt induced by OGD was restored by curcumin. Consequently, NQO1 expression and the binding activity of nuclear factor-erythroid 2-related factor 2 (Nrf2) to antioxidant response element (ARE) were increased. LY294002 blocked the increase in phospho-Akt evoked by curcumin and abolished the associated protective effect. Adult male Sprague-Dawley rats were subjected to transient middle cerebral artery occlusion for 60 minutes. Curcumin administration significantly reduced infarct size. Curcumin also markedly reduced oxidative stress levels in middle cerebral artery occlusion (MCAO) rats; hence, these effects were all suppressed by LY294002. Taken together, these findings provide evidence that curcumin protects neurons against ischemic injury, and this neuroprotective effect involves the Akt/Nrf2 pathway. In addition, Nrf2 is involved in the neuroprotective effects of curcumin against oxidative damage. PMID:23555802

  11. 1,4 Naphthoquinone protects radiation induced cell death and DNA damage in lymphocytes by activation Nrf2/are pathway and enhancing DNA repair

    Energy Technology Data Exchange (ETDEWEB)

    Khan, Nazir M; Sandur, Santosh K; Checker, Rahul; Sharma, Deepak; Poduval, T.B., E-mail: nazirbiotech@rediffmail.com [Radiation Biology and Health Sciences Division, Bhabha Atomic Research Centre, Mumbai (India)

    2012-07-01

    1,4-Naphthoquinone (NQ) is the parent molecule of many clinically approved anticancer, anti-infective, and antiparasitic drugs such as anthracycline, mitomycin, daunorubicin, doxorubicin, diospyrin, and malarone. Presence of NQ during a-irradiation (4Gy) significantly reduced the death of irradiated murine splenic lymphocytes in a dose dependent manner (0.05-liM), with complete protection at liM as assessed by PI staining. Radioprotection by NQ was further confirmed by inhibition of caspase activation, decrease in cell size, DNA-fragmentation, nuclear-blebbing and clonogenic assay. All trans retinoic acid which is inhibitor of Nrf-2 pathway, completely abrogated the radioprotective effect of NQ, suggesting that radioprotective activity of NQ may be due to activation of Nrf-2 signaling pathways. Further, addition of NQ to lymphocytes activated Nrf-2 in time dependent manner as shown by confocal microscopy, electrophoretic mobility shift assay and quantitative real time PCR. It also increased the expression of Nrf-2 dependent cytoprotective genes like hemeoxygenase-1, MnSOD, catalse as demonstrated by real time PCR and flowcytometry. NQ protected lymphocytes significantly against radiation-induced cell death even when added after irradiation. Complete protection was observed by addition of NQ up to 2 h after irradiation. However, percentage protection decreased with increasing time interval. These results suggested that NQ may offer protection to lymphocytes activating repair pathways. Repair of radiation induced DNA strand breaks was studied by comet assay. Pretreatment of lymphocytes with NQ induced single strand breaks up to 6h but not double strand breaks in DNA. However, NQ mediated single strand breaks were repaired completely at longer time intervals. Addition of NQ to lymphocytes prior to 4 Gy a-radiation exposure showed decrease in the yield of DNA double strand breaks. The observed time-dependent decrease in the DNA strand breaks could be attributed to

  12. Early induction of NRF2 antioxidant pathway by RHBDF2 mediates rapid cutaneous wound healing.

    Science.gov (United States)

    Hosur, Vishnu; Burzenski, Lisa M; Stearns, Timothy M; Farley, Michelle L; Sundberg, John P; Wiles, Michael V; Shultz, Leonard D

    2017-04-01

    Rhomboid family protein RHBDF2, an upstream regulator of the epidermal growth factor (EGF) receptor signaling, has been implicated in cutaneous wound healing. However, the underlying molecular mechanisms are still emerging. In humans, a gain-of-function mutation in the RHBDF2 gene accelerates cutaneous wound healing in an EGFR-dependent manner. Likewise, a gain-of-function mutation in the mouse Rhbdf2 gene (Rhbdf2 cub/cub ) shows a regenerative phenotype (rapid ear-hole closure) resulting from constitutive activation of the EGFR pathway. Because the RHBDF2-regulated EGFR pathway is relevant to cutaneous wound healing in humans, we used Rhbdf2 cub/cub mice to investigate the biological networks and pathways leading to accelerated ear-hole closure, with the goal of identifying therapeutic targets potentially effective in promoting wound healing in humans. Comparative transcriptome analysis of ear pinna tissue from Rhbdf2 cub/cub and Rhbdf2 +/+ mice at 0h, 15min, 2h, and 24h post-wounding revealed an early induction of the nuclear factor E2-related factor 2 (NRF2)-mediated anti-oxidative pathway (0h and 15min), followed by the integrin-receptor aggregation pathway (2h) as early-stage events immediately and shortly after wounding in Rhbdf2 cub/cub mice. Additionally, we observed genes enriched for the Fc fragment of the IgG receptor IIIa (FCGR3A)-mediated phagocytosis pathway 24h post-wounding. Although cutaneous wound repair in healthy individuals is generally non-problematic, it can be severely impaired due to aging, diabetes, and chronic inflammation. This study suggests that activation of the NRF2-antioxidant pathway by rhomboid protein RHBDF2 might be beneficial in treating chronic non-healing wounds. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Modulatory Mechanism of Polyphenols and Nrf2 Signaling Pathway in LPS Challenged Pregnancy Disorders

    Directory of Open Access Journals (Sweden)

    Tarique Hussain

    2017-01-01

    Full Text Available Early embryonic loss and adverse birth outcomes are the major reproductive disorders that affect both human and animals. The LPS induces inflammation by interacting with robust cellular mechanism which was considered as a plethora of numerous reproductive disorders such as fetal resorption, preterm birth, teratogenicity, intrauterine growth restriction, abortion, neural tube defects, fetal demise, and skeletal development retardation. LPS-triggered overproduction of free radicals leads to oxidative stress which mediates inflammation via stimulation of NF-κB and PPARγ transcription factors. Flavonoids, which exist in copious amounts in nature, possess a wide array of functions; their supplementation during pregnancy activates Nrf2 signaling pathway which encounters pregnancy disorders. It was further presumed that the development of strong antioxidant uterine environment during gestation can alleviate diseases which appear at adult stages. The purpose of this review is to focus on modulatory properties of flavonoids on oxidative stress-mediated pregnancy insult and abnormal outcomes and role of Nrf2 activation in pregnancy disorders. These findings would be helpful for providing new insights in ameliorating oxidative stress-induced pregnancy disorders.

  14. Curcumin Protects Skin against UVB-Induced Cytotoxicity via the Keap1-Nrf2 Pathway: The Use of a Microemulsion Delivery System

    Directory of Open Access Journals (Sweden)

    Maya Ben Yehuda Greenwald

    2017-01-01

    Full Text Available Curcumin was found to be beneficial in treating several skin pathologies and diseases, providing antioxidant protection due to its reducing properties and its electrophilic properties (the ability to activate the Nrf2 pathway and induce phase II cytoprotective enzymes. Nevertheless, clinical applications of curcumin are being hampered by its insufficient solubility, chemical instability, and poor absorption, leading to low efficacy in preventing skin pathologies. These limitations can be overcome by using a nanotechnology-based delivery system. Here, we elucidated the possibility of using curcumin encapsulated in a microemulsion preserving its unique chemical structure. We also examined whether curcumin microemulsion would reduce UVB-induced toxicity in skin. A significant curcumin concentration was found in the human skin dermis following topical application of a curcumin microemulsion. Moreover, curcumin microemulsion enhanced the reduction of UV-induced cytotoxicity in epidermal cells, paving the way for other incorporated electrophiles in encapsulated form protecting skin against stress-related diseases.

  15. Curcumin Protects Skin against UVB-Induced Cytotoxicity via the Keap1-Nrf2 Pathway: The Use of a Microemulsion Delivery System

    Science.gov (United States)

    Ben Yehuda Greenwald, Maya; Frušić-Zlotkin, Marina; Soroka, Yoram; Ben Sasson, Shmuel; Bitton, Ronit; Bianco-Peled, Havazelet

    2017-01-01

    Curcumin was found to be beneficial in treating several skin pathologies and diseases, providing antioxidant protection due to its reducing properties and its electrophilic properties (the ability to activate the Nrf2 pathway and induce phase II cytoprotective enzymes). Nevertheless, clinical applications of curcumin are being hampered by its insufficient solubility, chemical instability, and poor absorption, leading to low efficacy in preventing skin pathologies. These limitations can be overcome by using a nanotechnology-based delivery system. Here, we elucidated the possibility of using curcumin encapsulated in a microemulsion preserving its unique chemical structure. We also examined whether curcumin microemulsion would reduce UVB-induced toxicity in skin. A significant curcumin concentration was found in the human skin dermis following topical application of a curcumin microemulsion. Moreover, curcumin microemulsion enhanced the reduction of UV-induced cytotoxicity in epidermal cells, paving the way for other incorporated electrophiles in encapsulated form protecting skin against stress-related diseases. PMID:28757910

  16. Taurine protects against As2O3-induced autophagy in pancreas of rat offsprings through Nrf2/Trx pathway.

    Science.gov (United States)

    Bai, Jie; Yao, Xiaofeng; Jiang, Liping; Qiu, Tianming; Liu, Shuang; Qi, Baoxu; Zheng, Yue; Kong, Yuan; Yang, Guang; Chen, Min; Liu, Xiaofang; Sun, Xiance

    2016-04-01

    Arsenic was increasingly to blame as a risk factor for type 2 diabetes mellitus. In our previous study, we had found iAs stimulated autophagic flux and caused autophagic cell death through ROS pathway in INS-1 cells. Since NF-E2-related factor 2 (Nrf2) and the thioredoxin (Trx) system was a crucial line of defense against ROS, we investigated whether Nrf2/Trx pathway contributed to As2O3-stimulated autophagy and the role of taurine in this study. After treatment with 2 mg/kg BW-8 mg/kg BW As2O3 for 57 d, the expression of Nrf2 protein was decreased significantly in offsprings' pancreas. The expression of Trx gene was decreased significantly in pancreas subsequently. Finally, the generation of reactive oxygen species stimulated autophagy in arsenic-treated pancreas. Taurine could reverse arsenic-inhibited Nrf2 and Trx and inhibit autophagy. In short, inhibition of Nrf2/Trx pathway might play an important role in the pathogenesis of arsenic-related diabetes. Taurine could serve as nutrition supplementation against arsenic-related diabetes in high arsenic exposure area. Copyright © 2016 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  17. Curcumin attenuates quinocetone induced apoptosis and inflammation via the opposite modulation of Nrf2/HO-1 and NF-kB pathway in human hepatocyte L02 cells.

    Science.gov (United States)

    Dai, Chongshan; Li, Bin; Zhou, Yan; Li, Daowen; Zhang, Shen; Li, Hui; Xiao, Xilong; Tang, Shusheng

    2016-09-01

    The potential toxicity of quinocetone (QCT) has raised widely concern, but its mechanism is still unclear. This study aimed to investigate the protective effect of curcumin on QCT induced apoptosis and the underlying mechanism in human hepatocyte L02 cells. The results showed that QCT treatment significantly decreased the cell viability of L02 cell and increased the release of lactate dehydrogenase (LDH), which was attenuated by curcumin pre-treatment at 1.25, 2.5 and 5 μM. Compared to the QCT alone group, curcumin pre-treatment significantly attenuated QCT induced oxidative stress, mitochondrial dysfunction and apoptosis. In addition, curcumin pretreatment markedly attenuated QCT-induced increase of iNOS activity and NO production in a dose-dependent manner. Meanwhile, curcumin pretreatment markedly down-regulated the expression of nuclear factor -kB (NF-kB) and iNOS mRNAs, but up-regulated the expressions of Nrf2 and HO-1 mRNAs, compared to the QCT alone group. Zinc protoporphyrin IX, a HO-1 inhibitor, markedly partly abolished the cytoprotective effect of curcumin against QCT-induced caspase activation, NF-kB mRNA expression. These results indicate that curcumin could effectively inhibit QCT induced apoptosis and inflammatory response in L02 cells, which may involve the activation of Nrf2/HO-1 and inhibition of NF-kB pathway. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. Perspectives of the Nrf-2 signaling pathway in cancer progression and therapy

    Directory of Open Access Journals (Sweden)

    Priyanka Basak

    Full Text Available The Nuclear factor erythroid2-related factor2 (Nrf2, a master regulator of redox homoeostasis, is a key transcription factor regulating a wide array of genes for antioxidant and detoxification enzymes. It protects organs from various kinds of toxic insults. On the other hand, activation of Nrf2 is also correlated with cancer progression and chemoresistance. Downregulation of Nrf2 activity has attracted an increasing amount of attention as it may provide an alternative cancer therapy. In this review, we examine recent studies on roles of Nrf2 in several pathophysiological conditions emphasising cancer. We discuss elaborately the current knowledge on Nrf2 regulation including KEAP1-dependent and KEAP1-independent cascades. KEAP1/Nrf2 system is a master regulator of cellular response against a variety of environmental stresses. We also highlight several tightly controlled regulations of Nrf2 by numerous proteins, small molecules, toxic metals, etc. In addition, we evaluate the possible therapeutic approaches of increasing chemosensitivity via modulating Nrf2 signaling. Keywords: Nrf2, Transcription factor, KEAP1, Oxidative stress, Cell proliferation, Carcinogenesis, Chemoprevention

  19. Polydatin Protects Bone Marrow Stem Cells against Oxidative Injury: Involvement of Nrf 2/ARE Pathways

    Directory of Open Access Journals (Sweden)

    Meihui Chen

    2016-01-01

    Full Text Available Polydatin, a glucoside of resveratrol, has been reported to possess potent antioxidative effects. In the present study, we aimed to investigate the effects of polydatin in bone marrow-derived mesenchymal stem cells (BMSCs death caused by hydrogen peroxide (H2O2, imitating the microenvironment surrounding transplanted cells in the injured spinal cord in vitro. In our study, MTT results showed that polydatin effectively prevented the decrease of cell viability caused by H2O2. Hochest 33258, Annexin V-PI, and Western blot assay showed H2O2-induced apoptosis in BMSCs, which was attenuated by polydatin. Further studies indicated that polydatin significantly protects BMSCs against apoptosis due to its antioxidative effects and the regulation of Nrf 2/ARE pathway. Taken together, our results indicate that polydatin could be used in combination with BMSCs for the treatment of spinal cord injury by improving the cell survival and oxidative stress microenvironments.

  20. Nrf2, the Master Regulator of Anti-Oxidative Responses

    Directory of Open Access Journals (Sweden)

    Sandra Vomund

    2017-12-01

    Full Text Available Tight regulation of inflammation is very important to guarantee a balanced immune response without developing chronic inflammation. One of the major mediators of the resolution of inflammation is the transcription factor: the nuclear factor erythroid 2-like 2 (Nrf2. Stabilized following oxidative stress, Nrf2 induces the expression of antioxidants as well as cytoprotective genes, which provoke an anti-inflammatory expression profile, and is crucial for the initiation of healing. In view of this fundamental modulatory role, it is clear that both hyper- or hypoactivation of Nrf2 contribute to the onset of chronic diseases. Understanding the tight regulation of Nrf2 expression/activation and its interaction with signaling pathways, known to affect inflammatory processes, will facilitate development of therapeutic approaches to prevent Nrf2 dysregulation and ameliorate chronic inflammatory diseases. We discuss in this review the principle mechanisms of Nrf2 regulation with a focus on inflammation and autophagy, extending the role of dysregulated Nrf2 to chronic diseases and tumor development.

  1. Nrf2 facilitates repair of radiation induced DNA damage through homologous recombination repair pathway in a ROS independent manner in cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Jayakumar, Sundarraj; Pal, Debojyoti; Sandur, Santosh K., E-mail: sskumar@barc.gov.in

    2015-09-15

    Highlights: • Nrf2 inhibition in A549 cells led to attenuated DNA repair and radiosensitization. • Influence of Nrf2 on DNA repair is not linked to its antioxidant function. • Nrf2 influences DNA repair through homologous recombination (HR) repair pathway. • Many genes involved in HR pathway show ARE sequences in their upstream region. - Abstract: Nrf2 is a redox sensitive transcription factor that is involved in the co-ordinated transcription of genes involved in redox homeostasis. But the role of Nrf2 in DNA repair is not investigated in detail. We have employed A549 and MCF7 cells to study the role of Nrf2 on DNA repair by inhibiting Nrf2 using all-trans retinoic acid (ATRA) or by knock down approach prior to radiation exposure (4 Gy). DNA damage and repair analysis was studied by γH2AX foci formation and comet assay. Results suggested that the inhibition of Nrf2 in A549 or MCF7 cells led to significant slowdown in DNA repair as compared to respective radiation controls. The persistence of residual DNA damage even in the presence of free radical scavenger N-acetyl cysteine, suggested that the influence of Nrf2 on DNA repair was not linked to its antioxidant functions. Further, its influence on non-homologous end joining repair pathway was studied by inhibiting both Nrf2 and DNA-PK together. This led to synergistic reduction of survival fraction, indicating that Nrf2 may not be influencing the NHEJ pathway. To investigate the role of homologous recombination repair (HR) pathway, RAD51 foci formation was monitored. There was a significant reduction in the foci formation in cells treated with ATRA or shRNA against Nrf2 as compared to their respective radiation controls. Further, Nrf2 inhibition led to significant reduction in mRNA levels of RAD51. BLAST analysis was also performed on upstream regions of DNA repair genes to identify antioxidant response element and found that many repair genes that are involved in HR pathway may be regulated by Nrf2

  2. Nrf2 impacts cellular bioenergetics by controlling substrate availability for mitochondrial respiration

    Directory of Open Access Journals (Sweden)

    Kira M. Holmström

    2013-06-01

    Transcription factor Nrf2 and its repressor Keap1 regulate a network of cytoprotective genes involving more than 1% of the genome, their best known targets being drug-metabolizing and antioxidant genes. Here we demonstrate a novel role for this pathway in directly regulating mitochondrial bioenergetics in murine neurons and embryonic fibroblasts. Loss of Nrf2 leads to mitochondrial depolarisation, decreased ATP levels and impaired respiration, whereas genetic activation of Nrf2 increases the mitochondrial membrane potential and ATP levels, the rate of respiration and the efficiency of oxidative phosphorylation. We further show that Nrf2-deficient cells have increased production of ATP in glycolysis, which is then used by the F1Fo-ATPase for maintenance of the mitochondrial membrane potential. While the levels and in vitro activities of the respiratory complexes are unaffected by Nrf2 deletion, their activities in isolated mitochondria and intact live cells are substantially impaired. In addition, the rate of regeneration of NADH after inhibition of respiration is much slower in Nrf2-knockout cells than in their wild-type counterparts. Taken together, these results show that Nrf2 directly regulates cellular energy metabolism through modulating the availability of substrates for mitochondrial respiration. Our findings highlight the importance of efficient energy metabolism in Nrf2-mediated cytoprotection.

  3. Radioadaptive Cytoprotective Pathways in the Mouse Retina

    Science.gov (United States)

    Zanello, Susana B.; Wotring, V.; Theriot, C.; Ploutz-Snyder, R.; Zhang, Y.; Wu, H.

    2010-01-01

    Exposure to cosmic radiation implies a risk of tissue degeneration. Radiation retinopathy is a complication of radiotherapy and exhibits common features with other retinopathies and neuropathies. Exposure to a low radiation dose elicits protective cellular events (radioadaptive response), reducing the stress of a subsequent higher dose. To assess the risk of radiation-induced retinal changes and the extent to which a small priming dose reduces this risk, we used a mouse model exposed to a source of Cs-137-gamma radiation. Gene expression profiling of retinas from non-irradiated control C57BL/6J mice (C) were compared to retinas from mice treated with a low 50 mGy dose (LD), a high 6 Gy dose (HD), and a combined treatment of 50 mGy (priming) and 6 Gy (challenge) doses (LHD). Whole retina RNA was isolated and expression analysis for selected genes performed by RTqPCR. Relevant target genes associated with cell death/survival, oxidative stress, cellular stress response and inflammation pathways, were analyzed. Cellular stress response genes were upregulated at 4 hr after the challenge dose in LHD retinas (Sirt1: 1.5 fold, Hsf1: 1.7 fold, Hspa1a: 2.5 fold; Hif1a: 1.8 fold, Bag1: 1.7). A similar trend was observed in LD animals. Most antioxidant enzymes (Hmox1, Sod2, Prdx1, Cygb, Cat1) and inflammatory mediators (NF B, Ptgs2 and Tgfb1) were upregulated in LHD and LD retinas. Expression of the pro-survival gene Bcl2 was upregulated in LD (6-fold) and LHD (4-fold) retinas. In conclusion, cytoprotective gene networks activation in the retina suggests a radioadaptive response to a priming irradiation dose, with mitigation of the deleterious effects of a subsequent high dose exposure. The enhancement of these cytoprotective mechanisms has potential value as a countermeasure to ocular alterations caused by radiation alone or in combination with other factors in spaceflight environments.

  4. Sulforaphane is a Nrf2-independent inhibitor of mitochondrial fission

    Directory of Open Access Journals (Sweden)

    Gary B. O'Mealey

    2017-04-01

    Full Text Available The KEAP1-Nrf2-ARE antioxidant system is a principal means by which cells respond to oxidative and xenobiotic stresses. Sulforaphane (SFN, an electrophilic isothiocyanate derived from cruciferous vegetables, activates the KEAP1-Nrf2-ARE pathway and has become a molecule-of-interest in the treatment of diseases in which chronic oxidative stress plays a major etiological role. We demonstrate here that the mitochondria of cultured, human retinal pigment epithelial (RPE-1 cells treated with SFN undergo hyperfusion that is independent of both Nrf2 and its cytoplasmic inhibitor KEAP1. Mitochondrial fusion has been reported to be cytoprotective by inhibiting pore formation in mitochondria during apoptosis, and consistent with this, we show Nrf2-independent, cytoprotection of SFN-treated cells exposed to the apoptosis-inducer, staurosporine. Mechanistically, SFN mitigates the recruitment and/or retention of the soluble fission factor Drp1 to mitochondria and to peroxisomes but does not affect overall Drp1 abundance. These data demonstrate that the beneficial properties of SFN extend beyond activation of the KEAP1-Nrf2-ARE system and warrant further interrogation given the current use of this agent in multiple clinical trials.

  5. The berry constituents quercetin, kaempferol, and pterostilbene synergistically attenuate reactive oxygen species: involvement of the Nrf2-ARE signaling pathway.

    Science.gov (United States)

    Saw, Constance Lay Lay; Guo, Yue; Yang, Anne Yuqing; Paredes-Gonzalez, Ximena; Ramirez, Christina; Pung, Douglas; Kong, Ah-Ng Tony

    2014-10-01

    Quercetin, kaempferol, and pterostilbene are abundant in berries. The anti-oxidative properties of these constituents may contribute to cancer chemoprevention. However, their precise mechanisms of action and their combinatorial effects are not completely understood. Nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates anti-oxidative stress enzymes and Phase II drug metabolizing/detoxifying enzymes by binding to antioxidant response element (ARE). This study aimed to investigate the anti-oxidative stress activities of quercetin, kaempferol, and pterostilbene individually and in combination, as well as the involvement of the Nrf2-ARE signaling pathway. Quercetin, kaempferol, and pterostilbene all exhibited strong free-radical scavenging activity in the DPPH assay. The MTS assay revealed that low concentration combinations we tested were relatively non-toxic to HepG2-C8 cells. The results of the DCFH-DA assay and combination index (CI) indicated that quercetin, kaempferol, and pterostilbene attenuated intracellular reactive oxygen species (ROS) levels when pretreated individually and had synergistic effects when used in combination. In addition, the combination treatment significantly induced ARE and increased the mRNA and protein expression of Nrf2-regulated genes. Collectively, our study demonstrated that the berry constituents quercetin, kaempferol, and pterostilbene activated the Nrf2-ARE signaling pathway and exhibited synergistic anti-oxidative stress activity at appropriate concentrations. Copyright © 2014 Elsevier Ltd. All rights reserved.

  6. Activation of the Nrf2/ARE pathway via S-alkylation of cysteine 151 in the chemopreventive agent-sensor Keap1 protein by falcarindiol, a conjugated diacetylene compound

    International Nuclear Information System (INIS)

    Ohnuma, Tomokazu; Nakayama, Shinji; Anan, Eisaburo; Nishiyama, Takahito; Ogura, Kenichiro; Hiratsuka, Akira

    2010-01-01

    Under basal conditions, the interaction of the cytosolic protein Kelch-like ECH-associated protein 1 (Keap1) with the transcription factor nuclear factor-E2-related factor 2 (Nrf2) results in a low level of expression of cytoprotective genes whose promoter region contains the antioxidant response element (ARE). In response to oxidants and electrophiles, Nrf2 is stabilized and accumulates in the nucleus. The mechanism for this effect has been proposed to involve thiol-dependent modulation of Keap1, leading to loss of its ability to negatively regulate Nrf2. We previously reported that falcarindiol (heptadeca-1,9(Z)-diene-4,6-diyne-3,8-diol), which occurs in Apiaceae and the closely related Araliaceae plants, causes nuclear accumulation of Nrf2 and induces ARE-regulated enzymes. Here, we report the mechanism of Nrf2 induction by falcarindiol. NMR analysis revealed that the conjugated diacetylene carbons of falcarindiol acted as electrophilic moieties to form adducts with a cysteine (Cys) thiol. In addition, using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry and circular dichroism spectroscopy, it was demonstrated that falcarindiol alkylated Cys residues in Keap1 and altered the Keap1 secondary structure. Transfection studies using the purified Keap1 protein, a luciferase reporter construct, and an Nrf2-expressing plasmid indicated that the intact Keap1 protein suppressed Nrf2-mediated ARE-luciferase activity. On the other hand, the falcarindiol-alkylated Keap1 protein did not suppress such activity. Treatment of HEK293 cells overexpressing Keap1 with falcarindiol generated a high molecular weight (HMW) form of Keap1. Furthermore, the Cys151 residue in Keap1 was found to be uniquely required for not only the formation of HMW Keap1 but also an increase in ARE-luciferase activity by falcarindiol. Our results demonstrate that falcarindiol having conjugated diacetylene carbons covalently modifies the Cys151 residue in Keap1 and that the

  7. Role of miR-155 in fluorooctane sulfonate-induced oxidative hepatic damage via the Nrf2-dependent pathway

    Energy Technology Data Exchange (ETDEWEB)

    Wan, Chong; Han, Rui; Liu, Limin [Laboratory of Environment and Health, College of Life Sciences, University of Chinese Academy of Sciences, No. 19A Yuquan Road, Beijing 100049 (China); Zhang, Fang, E-mail: zhangfang@ucas.ac.cn [Laboratory of Environment and Health, College of Life Sciences, University of Chinese Academy of Sciences, No. 19A Yuquan Road, Beijing 100049 (China); Li, Fang [Laboratory of Environment and Health, College of Life Sciences, University of Chinese Academy of Sciences, No. 19A Yuquan Road, Beijing 100049 (China); Xiang, Mingdeng [State Key Laboratory of Environmental Criteria and Risk Assessment, Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); Ding, Wenjun, E-mail: dingwj@ucas.ac.cn [Laboratory of Environment and Health, College of Life Sciences, University of Chinese Academy of Sciences, No. 19A Yuquan Road, Beijing 100049 (China)

    2016-03-15

    Studies demonstrated that perfluorooctane sulfonate (PFOS) tends to accumulate in the liver and is capable to cause hepatomegaly. In the present study, we investigated the roles of miR-155 in PFOS-induced hepatotoxicity in SD rats and HepG2 cells. Male SD rats were orally administrated with PFOS at 1 or 10 mg/kg/day for 28 days while HepG2 cells were treated with 0–50 μM of PFOS for 24 h or 50 μM of PFOS for 1, 3, 6, 12 or 24 h, respectively. We found that PFOS significantly increased the liver weight and serum alanine transaminase (ALT) and aspartate amino transferase (AST) levels in rats. Morphologically, PFOS caused actin filament remodeling and endothelial permeability changes in the liver. Moreover, PFOS triggered reactive oxygen species (ROS) generation and induced apoptosis in both in vivo and in vitro assays. Immunoblotting data showed that NF-E2-related factor-2 (Nrf2) expression and activation and its target genes were all suppressed by PFOS in the liver and HepG2 cells. However, PFOS significantly increased miR-155 expression. Further studies showed that pretreatment of HepG2 cells with catalase significantly decreased miR-155 expression and substantially increased Nrf2 expression and activation, resulting in reduction of PFOS-induced cytotoxicity and oxidative stress. Taken together, these results indicated that miR-155 plays an important role in the PFOS-induced hepatotoxicity by disrupting Nrf2/ARE signaling pathway. - Highlights: • PFOS is capable to cause hepatotoxicity. • PFOS triggers ROS generation and induces apoptosis both in vivo and in vitro assays. • PFOS-induced ROS inhibits Nrf2 expression and its transactivation function. • PFOS promotes miR155 expression in liver and HepG2 cells. • miR-155 is involved in PFOS-induced hepatotoxicity by disrupting Nrf2/ARE pathway.

  8. Eriodictyol-7-O-glucoside activates Nrf2 and protects against cerebral ischemic injury

    International Nuclear Information System (INIS)

    Jing, Xu; Ren, Dongmei; Wei, Xinbing; Shi, Huanying; Zhang, Xiumei; Perez, Ruth G.; Lou, Haiyan; Lou, Hongxiang

    2013-01-01

    Stroke is a complex disease that may involve oxidative stress-related pathways in its pathogenesis. The nuclear factor erythroid-2-related factor 2/antioxidant response element (Nrf2/ARE) pathway plays an important role in inducing phase II detoxifying enzymes and antioxidant proteins and thus has been considered a potential target for neuroprotection in stroke. The aim of the present study was to determine whether eriodictyol-7-O-glucoside (E7G), a novel Nrf2 activator, can protect against cerebral ischemic injury and to understand the role of the Nrf2/ARE pathway in neuroprotection. In primary cultured astrocytes, E7G increased the nuclear localization of Nrf2 and induced the expression of the Nrf2/ARE-dependent genes. Exposure of astrocytes to E7G provided protection against oxygen and glucose deprivation (OGD)-induced oxidative insult. The protective effect of E7G was abolished by RNA interference-mediated knockdown of Nrf2 expression. In vivo administration of E7G in a rat model of focal cerebral ischemia significantly reduced the amount of brain damage and ameliorated neurological deficits. These data demonstrate that activation of Nrf2/ARE signaling by E7G is directly associated with its neuroprotection against oxidative stress-induced ischemic injury and suggest that targeting the Nrf2/ARE pathway may be a promising approach for therapeutic intervention in stroke. - Highlights: • E7G activates Nrf2 in astrocytes. • E7G stimulates expression of Nrf2-mediated cytoprotective proteins in astrocytes. • E7G protects astrocytes against OGD-induced cell death and apoptosis. • The neuroprotective effect of E7G involves the Nrf2/ARE pathway. • E7G protects rats against cerebral ischemic injury

  9. Eriodictyol-7-O-glucoside activates Nrf2 and protects against cerebral ischemic injury

    Energy Technology Data Exchange (ETDEWEB)

    Jing, Xu [Department of Pharmacology, School of Medicine, Shandong University, Jinan 250012 (China); Ren, Dongmei [Department of Natural Product Chemistry, Key Lab of Chemical Biology of Ministry of Education, Shandong University, Jinan 250012 (China); Wei, Xinbing; Shi, Huanying; Zhang, Xiumei [Department of Pharmacology, School of Medicine, Shandong University, Jinan 250012 (China); Perez, Ruth G. [Health Science Center, Paul L. Foster School of Medicine, Texas Tech University, El Paso, TX, 79905 (United States); Lou, Haiyan, E-mail: louhaiyan@sdu.edu.cn [Department of Pharmacology, School of Medicine, Shandong University, Jinan 250012 (China); Lou, Hongxiang [Department of Natural Product Chemistry, Key Lab of Chemical Biology of Ministry of Education, Shandong University, Jinan 250012 (China)

    2013-12-15

    Stroke is a complex disease that may involve oxidative stress-related pathways in its pathogenesis. The nuclear factor erythroid-2-related factor 2/antioxidant response element (Nrf2/ARE) pathway plays an important role in inducing phase II detoxifying enzymes and antioxidant proteins and thus has been considered a potential target for neuroprotection in stroke. The aim of the present study was to determine whether eriodictyol-7-O-glucoside (E7G), a novel Nrf2 activator, can protect against cerebral ischemic injury and to understand the role of the Nrf2/ARE pathway in neuroprotection. In primary cultured astrocytes, E7G increased the nuclear localization of Nrf2 and induced the expression of the Nrf2/ARE-dependent genes. Exposure of astrocytes to E7G provided protection against oxygen and glucose deprivation (OGD)-induced oxidative insult. The protective effect of E7G was abolished by RNA interference-mediated knockdown of Nrf2 expression. In vivo administration of E7G in a rat model of focal cerebral ischemia significantly reduced the amount of brain damage and ameliorated neurological deficits. These data demonstrate that activation of Nrf2/ARE signaling by E7G is directly associated with its neuroprotection against oxidative stress-induced ischemic injury and suggest that targeting the Nrf2/ARE pathway may be a promising approach for therapeutic intervention in stroke. - Highlights: • E7G activates Nrf2 in astrocytes. • E7G stimulates expression of Nrf2-mediated cytoprotective proteins in astrocytes. • E7G protects astrocytes against OGD-induced cell death and apoptosis. • The neuroprotective effect of E7G involves the Nrf2/ARE pathway. • E7G protects rats against cerebral ischemic injury.

  10. Design, synthesis, and evaluation of curcumin derivatives as Nrf2 activators and cytoprotectors against oxidative death.

    Science.gov (United States)

    Tu, Zhi-Shan; Wang, Qi; Sun, Dan-Dan; Dai, Fang; Zhou, Bo

    2017-07-07

    Activation of nuclear factor erythroid-2-related factor 2 (Nrf2) has been proven to be an effective means to prevent the development of cancer, and natural curcumin stands out as a potent Nrf2 activator and cancer chemopreventive agent. In this study, we synthesized a series of curcumin analogs by introducing the geminal dimethyl substituents on the active methylene group to find more potent Nrf2 activators and cytoprotectors against oxidative death. The geminally dimethylated and catechol-type curcumin analog (compound 3) was identified as a promising lead molecule in terms of its increased stability and cytoprotective activity against the tert-butyl hydroperoxide (t-BHP)-induced death of HepG2 cells. Mechanism studies indicate that its cytoprotective effects are mediated by activating the Nrf2 signaling pathway in the Michael acceptor- and catechol-dependent manners. Additionally, we verified by using copper and iron ion chelators that the two metal ion-mediated oxidations of compound 3 to its corresponding electrophilic o-quinone, contribute significantly to its Nrf2-dependent cytoprotection. This work provides an example of successfully designing natural curcumin-directed Nrf2 activators by a stability-increasing and proelectrophilic strategy. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  11. Estrogen receptor and PI3K/Akt signaling pathway involvement in S-(-equol-induced activation of Nrf2/ARE in endothelial cells.

    Directory of Open Access Journals (Sweden)

    Ting Zhang

    Full Text Available S-(-equol, a natural product of the isoflavone daidzein, has been reported to offer cytoprotective effects with respect to the cardiovascular system, but how this occurs is unclear. Interestingly, S-(-equol is produced by the human gut, suggesting a role in physiological processes. We report that treatment of human umbilical vein endothelial cells and EA.hy926 cells with S-(-equol induces ARE-luciferase reporter gene activity that is dose and time dependent. S-(-equol (10-250 nM increases nuclear factor-erythroid 2-related factor 2 (Nrf2 as well as gene products of Nrf2 target genes heme oxygenase-1 (HO-1 and NAD(PH (nicotinamide-adenine-dinucleotide-phosphate quinone oxidoreductase 1 (NQO1. Endothelial cells transfected with an HA-Nrf2 expression plasmid had elevated HA-Nrf2, HO-1, and NQO1 in response to S-(-equol exposure. S-(-equol treatment affected Nrf2 mRNA only slightly but significantly increased HO-1 and NQO1 mRNA. The pretreatment of cells with specific ER inhibitors or PI3K/Akt (ICI182,780 and LY294002 increased Nrf2, HO-1, and NQO1 protein, impaired nuclear translocation of HA-Nrf2, and decreased ARE-luciferase activity. Identical experiments were conducted with daidzein, which had effects similar to S-(-equol. In addition, DPN treatment (an ERβ agonist induced the ARE-luciferase reporter gene, promoting Nrf2 nuclear translocation. Cell pretreatment with an ERβ antagonist (PHTPP impaired S-(-equol-induced Nrf2 activation. Pre-incubation of cells followed by co-treatment with S-(-equol significantly improved cell survival in response to H2O2 or tBHP and reduced apoptotic and TUNEL-positively-stained cells. Notably, the ability of S-(-equol to protect against H2O2-induced cell apoptosis was attenuated in cells transfected with an siRNA against Nrf2. Thus, beneficial effects of S-(-equol with respect to cytoprotective antioxidant gene activation may represent a novel strategy to prevent and treat cardiovascular diseases.

  12. Mechanisms underlying the perifocal neuroprotective effect of the Nrf2–ARE signaling pathway after intracranial hemorrhage

    Directory of Open Access Journals (Sweden)

    Yin XP

    2015-11-01

    Full Text Available Xiao-ping Yin,1,2 Zhi-ying Chen,2 Jun Zhou,1 Dan Wu,1,3 Bing Bao2 1Department of Neurology, The Second Affiliated Hospital of Nanchang University, Nanchang, People’s Republic of China; 2Department of Neurology, Affiliated Hospital of Jiujiang University, Jiujiang, People’s Republic of China; 3Department of Neurology, The Sixth Hospital of Wuhan, Wuhan, People’s Republic of China Background: It has been found that nuclear factor erythroid 2-related factor 2/antioxidant response element (Nrf2–ARE signaling pathway plays a role in antioxidative response, anti-inflammatory response, and neuron-protection in intracerebral hemorrhage (ICH. The aim of this study is to explore mechanisms underlying the perifocal neuroprotective effect of the Nrf2–ARE signaling pathway after ICH.Methods: There were a total of 90 rats with basal ganglia hemorrhage, which were randomly divided into the following four groups: ICH (Sprague–Dawley rats with autologous femoral arterial blood injection into the basal ganglia, sulforaphane (SFN (SFN was intraperitoneally administered into rats, retinoic acid (RA (RA was intraperitoneally administered into rats, and dimethyl sulfoxide (the rats were treated with dimethyl sulfoxide. We observed the neurological score of the rats in the different groups, and collected brain tissues for immunofluorescence, Western blot, and reverse transcription polymerase chain reaction to detect expression of Nrf2, heme oxygenase (HO-1, nuclear factor-κB (NF-κB, and tumor necrosis factor-α (TNF-α.Results: The results indicated that neurological dysfunction of rats was significantly improved in the SFN group, and the expressions of Nrf2 and HO-1 in tissues surrounding the hemorrhage were increased. Also, the level of NF-κB and TNF-α were reduced compared to the ICH group. The RA group exhibited more severe neurological dysfunction and lower levels of Nrf2 and HO-1 than the SFN and ICH groups. Compared to the ICH group, the NF

  13. The NRF2-KEAP1 Pathway Is an Early Responsive Gene Network in Arsenic Exposed Lymphoblastoid Cells

    Science.gov (United States)

    Córdova, Emilio J.; Martínez-Hernández, Angélica; Uribe-Figueroa, Laura; Centeno, Federico; Morales-Marín, Mirna; Koneru, Harsha; Coleman, Matthew A.; Orozco, Lorena

    2014-01-01

    Inorganic arsenic (iAs), a major environmental contaminant, has risen as an important health problem worldwide. More detailed identification of the molecular mechanisms associated with iAs exposure would help to establish better strategies for prevention and treatment. Although chronic iAs exposures have been previously studied there is little to no information regarding the early events of exposure to iAs. To better characterize the early mechanisms of iAs exposure we conducted gene expression studies using sublethal doses of iAs at two different time-points. The major transcripts differentially regulated at 2 hrs of iAs exposure included antioxidants, detoxificants and chaperones. Moreover, after 12 hrs of exposure many of the down-regulated genes were associated with DNA replication and S phase cell cycle progression. Interestingly, the most affected biological pathway by both 2 or 12 hrs of iAs exposure were the Nrf2-Keap1 pathway, represented by the highly up-regulated HMOX1 transcript, which is transcriptionally regulated by the transcription factor Nrf2. Additional Nrf2 targets included SQSTM1 and ABCB6, which were not previously associated with acute iAs exposure. Signalling pathways such as interferon, B cell receptor and AhR route were also responsive to acute iAs exposure. Since HMOX1 expression increased early (20 min) and was responsive to low iAs concentrations (0.1 µM), this gene could be a suitable early biomarker for iAs exposure. In addition, the novel Nrf2 targets SQSTM1 and ABCB6 could play an important and previously unrecognized role in cellular protection against iAs. PMID:24516582

  14. Activation of the Nrf2-ARE pathway by siRNA knockdown of Keap1 reduces oxidative stress and provides partial protection from MPTP-mediated neurotoxicity.

    Science.gov (United States)

    Williamson, Tracy P; Johnson, Delinda A; Johnson, Jeffrey A

    2012-06-01

    Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcription factor that binds to the antioxidant response element, a cis-acting regulatory element that increases expression of detoxifying enzymes and antioxidant proteins. Kelch-like ECH associating protein 1 (Keap1) protein is a negative regulator of Nrf2. Previous work has shown that genetic overexpression of Nrf2 is protective in vitro and in vivo. To modulate the Nrf2-ARE system without overexpressing Nrf2, we used short interfering RNA (siRNA) directed against Keap1. Keap1 siRNA administration in primary astrocytes increased the levels of Nrf2-ARE driven genes and protected against oxidative stress. Moreover, Keap1 siRNA resulted in a persistent upregulation of the Nrf2-ARE pathway and protection against oxidative stress in primary astrocytes. Keap1 siRNA injected into the striatum was also modestly protective against MPTP-induced dopaminergic terminal damage. These data indicate that activation of endogenous intracellular levels of Nrf2 is sufficient to protect in models of oxidative stress and Parkinson's disease. Copyright © 2012 Elsevier Inc. All rights reserved.

  15. Andrographolide Activates Keap1/Nrf2/ARE/HO-1 Pathway in HT22 Cells and Suppresses Microglial Activation by Aβ42 through Nrf2-Related Inflammatory Response.

    Science.gov (United States)

    Seo, Ji Yeon; Pyo, Euisun; An, Jin-Pyo; Kim, Jinwoong; Sung, Sang Hyun; Oh, Won Keun

    2017-01-01

    Therapeutic approach of Alzheimer's disease (AD) has been gradually diversified. We examined the therapeutic and preventive potential of andrographolide, which is a lactone diterpenoid from Andrographis paniculata , and focused on the Kelch-like ECH-associated protein 1 (Keap1)/nuclear factor (erythroid-derived 2)-like 2 (Nrf2)-mediated heme oxygenase (HO)-1-inducing effects and the inhibitory activity of amyloid beta (A β ) 42 -induced microglial activation related to Nrf2 and nuclear factor κ B (NF- κ B)-mediated inflammatory responses. Andrographolide induced the expression and translocation of Nrf2 from the cytoplasm to the nucleus, thereby activating antioxidant response element (ARE) gene transcription and HO-1 expression in murine hippocampal HT22 cells. Andrographolide eliminated intracellular A β 42 in BV-2 cells and decreased the production of interleukin (IL)-6, IL-1 β , prostaglandin (PG)E 2 , and nitric oxide (NO) because of artificial phagocytic A β 42 . It decreased pNF- κ B accumulation in the nucleus and the expression of inducible nitric oxide synthase (i-NOS) and cyclooxygenase II (COX-II) in the microglial BV-2 cell line. In summary, andrographolide activates Nrf2-mediated HO-1 expression and inhibits A β 42 -overexpressed microglial BV-2 cell activation. These results suggested that andrographolide might have the potential for further examination of the therapeutics of AD.

  16. Andrographolide Activates Keap1/Nrf2/ARE/HO-1 Pathway in HT22 Cells and Suppresses Microglial Activation by Aβ42 through Nrf2-Related Inflammatory Response

    Directory of Open Access Journals (Sweden)

    Ji Yeon Seo

    2017-01-01

    Full Text Available Therapeutic approach of Alzheimer’s disease (AD has been gradually diversified. We examined the therapeutic and preventive potential of andrographolide, which is a lactone diterpenoid from Andrographis paniculata, and focused on the Kelch-like ECH-associated protein 1 (Keap1/nuclear factor (erythroid-derived 2-like 2 (Nrf2-mediated heme oxygenase (HO-1-inducing effects and the inhibitory activity of amyloid beta (Aβ42-induced microglial activation related to Nrf2 and nuclear factor κB (NF-κB-mediated inflammatory responses. Andrographolide induced the expression and translocation of Nrf2 from the cytoplasm to the nucleus, thereby activating antioxidant response element (ARE gene transcription and HO-1 expression in murine hippocampal HT22 cells. Andrographolide eliminated intracellular Aβ42 in BV-2 cells and decreased the production of interleukin (IL-6, IL-1β, prostaglandin (PGE2, and nitric oxide (NO because of artificial phagocytic Aβ42. It decreased pNF-κB accumulation in the nucleus and the expression of inducible nitric oxide synthase (i-NOS and cyclooxygenase II (COX-II in the microglial BV-2 cell line. In summary, andrographolide activates Nrf2-mediated HO-1 expression and inhibits Aβ42-overexpressed microglial BV-2 cell activation. These results suggested that andrographolide might have the potential for further examination of the therapeutics of AD.

  17. PFOS induces adipogenesis and glucose uptake in association with activation of Nrf2 signaling pathway

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Jialin [Institute of Biochemistry and Molecular Biology, College of Life and Health Sciences, Northeastern University, Shenyang 110819 (China); Department of Biomedical and Pharmaceutical Sciences, University of Rhode Island, Kingston, RI 02881 (United States); Shimpi, Prajakta; Armstrong, Laura; Salter, Deanna [Department of Biomedical and Pharmaceutical Sciences, University of Rhode Island, Kingston, RI 02881 (United States); Slitt, Angela L., E-mail: aslitt@uri.edu [Department of Biomedical and Pharmaceutical Sciences, University of Rhode Island, Kingston, RI 02881 (United States)

    2016-01-01

    PFOS is a chemical of nearly ubiquitous exposure in humans. Recent studies have associated PFOS exposure to adipose tissue-related effects. The present study was to determine whether PFOS alters the process of adipogenesis and regulates insulin-stimulated glucose uptake in mouse and human preadipocytes. In murine-derived 3T3-L1 preadipocytes, PFOS enhanced hormone-induced differentiation to adipocytes and adipogenic gene expression, increased insulin-stimulated glucose uptake at concentrations ranging from 10 to 100 μM, and enhanced Glucose transporter type 4 and Insulin receptor substrate-1 expression. Nuclear factor (erythroid-derived 2)-like 2 (Nrf2), NAD(P)H dehydrogenase, quinone 1 and Glutamate-cysteine ligase, catalytic subunit were significantly induced in 3T3-L1 cells treated with PFOS, along with a robust induction of Antioxidant Response Element (ARE) reporter in mouse embryonic fibroblasts isolated from ARE-hPAP transgenic mice by PFOS treatment. Chromatin immunoprecipitation assays further illustrated that PFOS increased Nrf2 binding to ARE sites in mouse Nqo1 promoter, suggesting that PFOS activated Nrf2 signaling in murine-derived preadipocytes. Additionally, PFOS administration in mice (100 μg/kg/day) induced adipogenic gene expression and activated Nrf2 signaling in epididymal white adipose tissue. Moreover, the treatment on human visceral preadipocytes illustrated that PFOS (5 and 50 μM) promoted adipogenesis and increased cellular lipid accumulation. It was observed that PFOS increased Nrf2 binding to ARE sites in association with Nrf2 signaling activation, induction of Peroxisome proliferator-activated receptor γ and CCAAT/enhancer-binding protein α expression, and increased adipogenesis. This study points to a potential role of PFOS in dysregulation of adipose tissue expandability, and warrants further investigations on the adverse effects of persistent pollutants on human health. - Highlights: • PFOS induces adipogenesis in association

  18. Carvedilol, a third-generation β-blocker prevents oxidative stress-induced neuronal death and activates Nrf2/ARE pathway in HT22 cells

    Energy Technology Data Exchange (ETDEWEB)

    Ouyang, Ying [Department of Pediatrics, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou (China); Chen, Ziwei [Department of Pharmacology and Toxicology, School of Pharmaceutical Sciences, Sun Yat-Sen University, Guangzhou (China); Tan, Min [Department of Pharmacology and Toxicology, School of Pharmaceutical Sciences, Sun Yat-Sen University, Guangzhou (China); Department of Traditional Chinese Medicine Chemistry, College of Chinese Materia Madica, Guangzhou University of Chinese Medicine, Guangzhou 510006 (China); Liu, Anmin [Department of Neurosurgery, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou (China); Chen, Meihui [Department of Pharmacology and Toxicology, School of Pharmaceutical Sciences, Sun Yat-Sen University, Guangzhou (China); Liu, Jun [Department of Neurology, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou (China); Pi, Rongbiao, E-mail: pirb@mail.sysu.edu.cn [Department of Pharmacology and Toxicology, School of Pharmaceutical Sciences, Sun Yat-Sen University, Guangzhou (China); Fang, Jianpei, E-mail: jpf2005@163.com [Department of Pediatrics, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou (China)

    2013-11-29

    Highlights: •Carvedilol significantly prevented oxidative stress-induced cell death. •Carvedilol significantly decreased the production of ROS. •Carvedilol activated Nrf2/ARE pathway. •Carvedilol increased the protein levels of HO-1 and NQO-1. -- Abstract: Carvedilol, a nonselective β-adrenoreceptor blocker with pleiotropic activities has been shown to exert neuroprotective effect due to its antioxidant property. However, the neuroprotective mechanism of carvedilol is still not fully uncovered. Nuclear factor E2-related factor 2 (Nrf2)/antioxidant response element (ARE) pathway is an important cellular stress response pathway involved in neuroprotection. Here we investigated the effect of carvedilol on oxidative stress-induced cell death (glutamate 2 mM and H{sub 2}O{sub 2} 600 μM) and the activity of Nrf2/ARE pathway in HT22 hippocampal cells. Carvedilol significantly increased cell viability and decreased ROS in HT22 cells exposed to glutamate or H{sub 2}O{sub 2}. Furthermore, carvedilol activated the Nrf2/ARE pathway in a concentration-dependent manner, and increased the protein levels of heme oxygenase-1(HO-1) and NAD(P)H quinone oxidoreductase-1(NQO-1), two downstream factors of the Nrf2/ARE pathway. Collectively, our results indicate that carvedilol protects neuronal cell against glutamate- and H{sub 2}O{sub 2}-induced neurotoxicity possibly through activating the Nrf2/ARE signaling pathway.

  19. Hydrogen gas reduces hyperoxic lung injury via the Nrf2 pathway in vivo

    Science.gov (United States)

    Kawamura, Tomohiro; Wakabayashi, Nobunao; Shigemura, Norihisa; Huang, Chien-Sheng; Masutani, Kosuke; Tanaka, Yugo; Noda, Kentaro; Peng, Ximei; Takahashi, Toru; Billiar, Timothy R.; Okumura, Meinoshin; Toyoda, Yoshiya; Kensler, Thomas W.

    2013-01-01

    Hyperoxic lung injury is a major concern in critically ill patients who receive high concentrations of oxygen to treat lung diseases. Successful abrogation of hyperoxic lung injury would have a huge impact on respiratory and critical care medicine. Hydrogen can be administered as a therapeutic medical gas. We recently demonstrated that inhaled hydrogen reduced transplant-induced lung injury and induced heme oxygenase (HO)-1. To determine whether hydrogen could reduce hyperoxic lung injury and investigate the underlying mechanisms, we randomly assigned rats to four experimental groups and administered the following gas mixtures for 60 h: 98% oxygen (hyperoxia), 2% nitrogen; 98% oxygen (hyperoxia), 2% hydrogen; 98% balanced air (normoxia), 2% nitrogen; and 98% balanced air (normoxia), 2% hydrogen. We examined lung function by blood gas analysis, extent of lung injury, and expression of HO-1. We also investigated the role of NF-E2-related factor (Nrf) 2, which regulates HO-1 expression, by examining the expression of Nrf2-dependent genes and the ability of hydrogen to reduce hyperoxic lung injury in Nrf2-deficient mice. Hydrogen treatment during exposure to hyperoxia significantly improved blood oxygenation, reduced inflammatory events, and induced HO-1 expression. Hydrogen did not mitigate hyperoxic lung injury or induce HO-1 in Nrf2-deficient mice. These findings indicate that hydrogen gas can ameliorate hyperoxic lung injury through induction of Nrf2-dependent genes, such as HO-1. The findings suggest a potentially novel and applicable solution to hyperoxic lung injury and provide new insight into the molecular mechanisms and actions of hydrogen. PMID:23475767

  20. Epalrestat increases glutathione, thioredoxin, and heme oxygenase-1 by stimulating Nrf2 pathway in endothelial cells

    Directory of Open Access Journals (Sweden)

    Kaori Yama

    2015-04-01

    Full Text Available Epalrestat (EPS is the only aldose reductase inhibitor that is currently available for the treatment of diabetic neuropathy. Recently, we found that EPS at near-plasma concentration increases the intracellular levels of glutathione (GSH in rat Schwann cells. GSH plays a crucial role in protecting endothelial cells from oxidative stress, thereby preventing vascular diseases. Here we show that EPS increases GSH levels in not only Schwann cells but also endothelial cells. Treatment of bovine aortic endothelial cells (BAECs, an in vitro model of the vascular endothelium, with EPS caused a dramatic increase in intracellular GSH levels. This was concomitant with the up-regulation of glutamate cysteine ligase, an enzyme catalyzing the first and rate-limiting step in de novo GSH synthesis. Moreover, EPS stimulated the expression of thioredoxin and heme oxygenase-1, which have important redox regulatory functions in endothelial cells. Nuclear factor erythroid 2-related factor 2 (Nrf2 is a key transcription factor that regulates the expression of antioxidant genes. EPS increased nuclear Nrf2 levels in BAECs. Nrf2 knockdown by siRNA suppressed the EPS-induced glutamate cysteine ligase, thioredoxin-1, and heme oxygenase-1 expression. Interestingly, LY294002, an inhibitor of phosphatidylinositol 3-kinase, abolished the EPS-stimulated GSH synthesis, suggesting that the kinase is associated with Nrf2 activation induced by EPS. Furthermore, EPS reduced the cytotoxicity induced by H2O2 and tert-butylhydroperoxide, indicating that EPS plays a role in protecting cells from oxidative stress. Taken together, the results provide evidence that EPS exerts new beneficial effects on endothelial cells by increasing GSH, thioredoxin, and heme oxygenase-1 levels through the activation of Nrf2. We suggest that EPS has the potential to prevent several vascular diseases caused by oxidative stress.

  1. 5-HMF attenuates striatum oxidative damage via Nrf2/ARE signaling pathway following transient global cerebral ischemia.

    Science.gov (United States)

    Ya, Bai-Liu; Li, Hong-Fang; Wang, Hai-Ying; Wu, Fei; Xin, Qing; Cheng, Hong-Ju; Li, Wen-Juan; Lin, Na; Ba, Zai-Hua; Zhang, Ru-Juan; Liu, Qian; Li, Ya-Nan; Bai, Bo; Ge, Feng

    2017-01-01

    Recent studies have shown 5-hydroxymethyl-2-furfural (5-HMF) has favorable biological effects, and its neuroprotection in a variety of neurological diseases has been noted. Our previous study showed that treatment of 5-HMF led to protection against permanent global cerebral ischemia. However, the underlying mechanisms in cerebral ischemic injury are not fully understood. This study was conducted to investigate the neuroprotective effect of 5-HMF and elucidate the nuclear factor erythroid 2-related factor 2 (Nrf2)/antioxidant response element (ARE) signaling pathway mechanism in the striatum after transient global cerebral ischemia. C57BL/6 mice were subjected to bilateral common carotid artery occlusion for 20 min and sacrificed 24 h after reperfusion. 5-HMF (12 mg/kg) or an equal volume of vehicle was intraperitoneally injected 30 min before ischemia and 5 min after the onset of reperfusion. At 24 h after reperfusion, neurological function was evaluated by neurological disability status scale, locomotor activity test and inclined beam walking test. Histological injury of the striatum was observed by cresyl violet staining and terminal deoxynucleotidyl transferase (TdT)-mediated dNTP nick end labeling (TUNEL) staining. Oxidative stress was evaluated by the carbonyl groups introduced into proteins, and malondialdehyde (MDA) levels. An enzyme-linked immunosorbent assay (ELISA)-based measurement was used to detect Nrf2 DNA binding activity. Nrf2 and its downstream ARE pathway protein expression such as heme oxygenase-1, NAD (P)H:quinone oxidoreductase 1, glutamate-cysteine ligase catalytic subunit and glutamate-cysteine ligase modulatory subunit were detected by western blot. Our results showed that 5-HMF treatment significantly ameliorated neurological deficits, reduced brain water content, attenuated striatum neuronal damage, decreased the carbonyl groups and MDA levels, and activated Nrf2/ARE signaling pathway. Taken together, these results demonstrated that

  2. Protective Effect of Tempol on Acute Kidney Injury Through PI3K/Akt/Nrf2 Signaling Pathway

    Directory of Open Access Journals (Sweden)

    Gensheng Zhang

    2016-02-01

    Full Text Available Background/Aims: Tempol is a protective antioxidant against ischemic injury in many animal models. The molecular mechanisms are not well understood. Nuclear factor erythroid 2-related factor (Nrf2 is a master transcription factor during oxidative stress, which is enhanced by activation of protein kinase C (PKC pathway. Another factor, tubular epithelial apoptosis, is mediated by activation of phosphoinositide 3-kinase (PI3K/protein kinase B (PKB, Akt signaling pathway during renal ischemic injury. We tested the hypothesis that tempol activates PKC or PI3K/Akt/Nrf2 pathways to transcribe many genes that coordinate endogenous antioxidant defense. Methods: The right renal pedicle was clamped for 45 minutes and the left kidney was removed to study renal ischemia/reperfusion (I/R injury in C57BL/6 mice. The response was assessed from serum parameters, renal morphology and renal expression of PKC, phosphorylated-PKC (p-PKC, Nrf2, heme oxygenase-1 (HO-1, Akt, phosphorylated-Akt (p-Akt, pro-caspase-3 and cleaved caspase-3 in groups of sham and I/R mice given vehicle, or tempol (50 or 100 mg/kg, intraperitoneal injection. Results: The serum malondialdehyde (MDA, marker of reactive oxygen species doubled and the BUN and creatinine increased 5- to 10-fold after I/R injury. Tempol (50 or 100 mg/kg prevented the increases in MDA but only tempol (50 mg/kg lessened the increases in BUN and creatinine and moderated the acute tubular necrosis. I/R did not change expression of PKC or p-PKC but reduced renal expression of Nrf2, p-Akt, HO-1 and pro-caspase-3 and increased cleaved caspase-3. Tempol (50 mg/kg prevented these changes produced by I/R whereas tempol (100 mg/kg had lesser or inconsistent effects. Conclusion: Tempol (50 mg/kg prevents lipid peroxidation and attenuates renal damage after I/R injury. The beneficial pathway apparently is not dependent on upregulation or phosphorylation of PKC, at lower tempol doses, does implicate upregulation of Akt with

  3. Sulforaphane protects rodent retinas against ischemia-reperfusion injury through the activation of the Nrf2/HO-1 antioxidant pathway.

    Directory of Open Access Journals (Sweden)

    Hong Pan

    Full Text Available Retinal ischemia-reperfusion (I/R injury induces oxidative stress, leukocyte infiltration, and neuronal cell death. Sulforaphane (SF, which can be obtained in cruciferous vegetables such as broccoli, exerts protective effects in response to oxidative stress in various tissues. These effects can be initiated through nuclear factor E2-related factor 2 (Nrf2-mediated induction of heme oxygenase-1 (HO-1. This investigation was designed to elucidate the neural protective mechanisms of SF in the retinal I/R rat model. Animals were intraperitoneally (i.p. injected with SF (12.5 mg/kg or vehicle (corn oil once a day for 7 consecutive days. Then, retinal I/R was made by elevating the intraocular pressure (IOP to 130 mmHg for 1 h. To determine if HO-1 was involved in the Nrf2 antioxidant pathway, rats were subjected to protoporphyrin IX zinc (II (ZnPP, 30 mg/kg, i.p. treatments at 24 h before retinal ischemia. The neuroprotective effects of SF were assessed by determining the morphology of the retina, counting the infiltrating inflammatory cells and the surviving retinal ganglion cells (RGCs and amacrine cells, and measuring apoptosis in the retinal layers. The expression of Nrf2 and HO-1 was studied by immunofluorescence analysis and western blotting. I/R induced a marked increase of ROS generation, caused pronounced inflammation, increased the apoptosis of RGCs and amacrine cells and caused the thinning of the inner retinal layer (IRL, and these effects were diminished or abolished by SF pretreatment. Meanwhile, SF pretreatment significantly elevated the nuclear accumulation of Nrf2 and the level of HO-1 expression in the I/R retinas; however, ZnPP reversed the protective effects of SF on I/R retinas. Together, we offer direct evidence that SF had protective effects on I/R retinas, which could be attributed, at least in part, to the activation of the Nrf2/HO-1 antioxidant pathway.

  4. Cordycepin alleviates lipopolysaccharide-induced acute lung injury via Nrf2/HO-1 pathway.

    Science.gov (United States)

    Qing, Rui; Huang, Zezhi; Tang, Yufei; Xiang, Qingke; Yang, Fan

    2018-04-24

    The present study is to investigate the protective effect of cordycepin on inflammatory reactions in rats with acute lung injury (ALI) induced by lipopolysaccharide (LPS), as well as the underlying mechanism. Wistar rat model of ALI was induced by intravenous injection of LPS (30 mg/kg body weight). One hour later, intravenous injection of cordycepin (1, 10 or 30 mg/kg body weight) was administered. The wet-to-dry weight ratio of lung tissues and myeloperoxidase activity in the lung tissues were measured. The contents of nitrite and nitrate were measured by reduction method, while chemiluminescence was used to determine the content of superoxide. Quantitative real-time polymerase chain reaction and Western blotting were used to determine the expression of mRNA and protein, respectively. Colorimetry was performed to determine the enzymatic activity of heme oxygenase-1 (HO-1). Nuclear translocation of Nrf2 was identified by Western blotting. The plasma contents of cytokines were measured by enzyme-linked immunosorbent assay. Cordycepin enhanced the expression and enzymatic activity of HO-1 in ALI rats, and activated Nrf2 by inducing the translocation of Nrf2 from cytoplasm to nucleus. In addition, cordycepin regulated the secretion of TNF-α, IL-6 and IL-10 via HO-1, and suppressed inflammation in lung tissues of ALI rats by inducing the expression of HO-1. HO-1 played important roles in the down-regulation of superoxide levels in lung tissues by cordycepin, and HO-1 expression induced by cordycepin affected nitrite and nitrate concentrations in plasma and iNOS protein expression in lung tissues. Cordycepin showed protective effect on injuries in lung tissues. The present study demonstrates that cordycepin alleviates inflammation induced by LPS via the activation of Nrf2 and up-regulation of HO-1 expression. Copyright © 2018. Published by Elsevier B.V.

  5. Global mapping of binding sites for Nrf2 identifies novel targets in cell survival response through ChIP-Seq profiling and network analysis

    Science.gov (United States)

    Malhotra, Deepti; Portales-Casamar, Elodie; Singh, Anju; Srivastava, Siddhartha; Arenillas, David; Happel, Christine; Shyr, Casper; Wakabayashi, Nobunao; Kensler, Thomas W.; Wasserman, Wyeth W.; Biswal, Shyam

    2010-01-01

    The Nrf2 (nuclear factor E2 p45-related factor 2) transcription factor responds to diverse oxidative and electrophilic environmental stresses by circumventing repression by Keap1, translocating to the nucleus, and activating cytoprotective genes. Nrf2 responses provide protection against chemical carcinogenesis, chronic inflammation, neurodegeneration, emphysema, asthma and sepsis in murine models. Nrf2 regulates the expression of a plethora of genes that detoxify oxidants and electrophiles and repair or remove damaged macromolecules, such as through proteasomal processing. However, many direct targets of Nrf2 remain undefined. Here, mouse embryonic fibroblasts (MEF) with either constitutive nuclear accumulation (Keap1−/−) or depletion (Nrf2−/−) of Nrf2 were utilized to perform chromatin-immunoprecipitation with parallel sequencing (ChIP-Seq) and global transcription profiling. This unique Nrf2 ChIP-Seq dataset is highly enriched for Nrf2-binding motifs. Integrating ChIP-Seq and microarray analyses, we identified 645 basal and 654 inducible direct targets of Nrf2, with 244 genes at the intersection. Modulated pathways in stress response and cell proliferation distinguish the inducible and basal programs. Results were confirmed in an in vivo stress model of cigarette smoke-exposed mice. This study reveals global circuitry of the Nrf2 stress response emphasizing Nrf2 as a central node in cell survival response. PMID:20460467

  6. Uric acid demonstrates neuroprotective effect on Parkinson's disease mice through Nrf2-ARE signaling pathway.

    Science.gov (United States)

    Huang, Ting-Ting; Hao, Dong-Lin; Wu, Bo-Na; Mao, Lun-Lin; Zhang, Jin

    2017-12-02

    Uric acid has neuroprotective effect on Parkinson's disease (PD) by inhibiting oxidative damage and neuronal cell death. Our previous study has shown that uric acid protected dopaminergic cell line damage through inhibiting accumulation of NF-E2-related factor 2 (Nrf2). This study aimed to investigate its in vivo neuroprotective effect. PD was induced by MPTP intraperitoneally injection for 7 d in male C57BL/6 mice. Mice were treated with either uric acid (intraperitoneally injection 250 mg/kg) or saline for a total of 13 d. We showed that uric acid improved behavioral performances and cognition of PD mice, increased TH-positive dopaminergic neurons and decreased GFAP-positive astrocytes in substantia nigra (SN). Uric acid increased mRNA and protein expressions of Nrf2 and three Nrf2-responsive genes, including γ-glutamate-cysteine ligase catalytic subunit (γ-GCLC), heme oxygenase-1 (HO-1) and NQO1. Uric acid significantly increased superoxide dismutase (SOD), CAT, glutathione (GSH) levels and decreased malondialdehyde (MDA) level in SN regions of MPTP-treated mice. Uric acid inhibited the hippocampal expression of IL-1β and decreased serum and hippocampus levels of interleukin-1β (IL-1β), IL-6 and tumor necrosis factor-α (TNF-α). In conclusion, uric acid demonstrates neuroprotective properties for dopaminergic neurons in PD mice through modulation of neuroinflammation and oxidative stress. Copyright © 2017. Published by Elsevier Inc.

  7. Schisandra sphenanthera extract (Wuzhi Tablet protects against chronic-binge and acute alcohol-induced liver injury by regulating the NRF2-ARE pathway in mice

    Directory of Open Access Journals (Sweden)

    Xuezhen Zeng

    2017-09-01

    Full Text Available Alcohol abuse leads to alcoholic liver disease and no effective therapy is currently available. Wuzhi Tablet (WZ, a preparation of extract from Schisandra sphenanthera that is a traditional hepato-protective herb, exerted a significant protective effect against acetaminophen-induced liver injury in our recent studies, but whether WZ can alleviate alcohol-induced toxicity remains unclear. This study aimed to investigate the contribution of WZ to alcohol-induced liver injury by using chronic-binge and acute models of alcohol feeding. The activities of ALT and AST in serum were assessed as well as the level of GSH and the activity of SOD in the liver. The expression of CYP2E1 and proteins in the NRF2-ARE signaling pathway including NRF2, GCLC, GCLM, HO-1 were measured, and the effect of WZ on NRF2 transcriptional activity was determined. We found that both models resulted in liver steatosis accompanied by increased transaminase activities, but that liver injury was significantly attenuated by WZ. WZ administration also inhibited CYP2E1 expression induced by alcohol, and elevated the level of GSH and the activity of SOD in the liver. Moreover, the NRF2-ARE signaling pathway was activated by WZ and the target genes were all upregulated. Furthermore, WZ significantly activated NRF2 transcriptional activity. Collectively, our study demonstrates that WZ protected against alcohol-induced liver injury by reducing oxidative stress and improving antioxidant defense, possibly by activating the NRF2-ARE pathway.

  8. Naturally Occurring Nrf2 Activators: Potential in Treatment of Liver Injury

    Directory of Open Access Journals (Sweden)

    Ravirajsinh N. Jadeja

    2016-01-01

    Full Text Available Oxidative stress plays a major role in acute and chronic liver injury. In hepatocytes, oxidative stress frequently triggers antioxidant response by activating nuclear erythroid 2-related factor 2 (Nrf2, a transcription factor, which upregulates various cytoprotective genes. Thus, Nrf2 is considered a potential therapeutic target to halt liver injury. Several studies indicate that activation of Nrf2 signaling pathway ameliorates liver injury. The hepatoprotective potential of naturally occurring compounds has been investigated in various models of liver injuries. In this review, we comprehensively appraise various phytochemicals that have been assessed for their potential to halt acute and chronic liver injury by enhancing the activation of Nrf2 and have the potential for use in humans.

  9. Nrf2 and Notch Signaling in Lung Cancer: Near the Crossroad

    Directory of Open Access Journals (Sweden)

    Angelo Sparaneo

    2016-01-01

    Full Text Available The transcription factor Nrf2 (NF-E2 related factor 2 is a master regulator of the cell antioxidant response associated with tumor growth and resistance to cytotoxic treatments. In particular, Nrf2 induces upregulation of cytoprotective genes by interacting with the closely situated AREs (Antioxidant Response Elements in response to endogenous or exogenous stress stimuli and takes part to several oncogenic signaling pathways. Among these, the crosstalk with Notch pathway has been shown to enhance cytoprotection and maintenance of cellular homeostasis, tissue organization by modulating cell proliferation kinetics, and stem cell self-renewal in several organs. The role of Notch and Nrf2 related pathways in tumorigenesis is highly variable and when they are both abnormally activated they can synergistically cause neoplastic proliferation by promoting cell survival, differentiation, invasion, and metastases. NFE2L2, KEAP1, and NOTCH genes family appear in the list of significantly mutated genes in tumors in both combined and individual sets, supporting the crucial role that the aberrant Nrf2-Notch crosstalk might have in cancerogenesis. In this review, we summarize current knowledge about the alterations of Nrf2 and Notch pathways and their reciprocal transcriptional regulation throughout tumorigenesis and progression of lung tumors, supporting the potentiality of putative biomarkers and therapeutic targets.

  10. Coenzyme Q10 Supplementation Modulates NFκB and Nrf2 Pathways in Exercise Training

    Directory of Open Access Journals (Sweden)

    Ragip Pala, Cemal Orhan, Mehmet Tuzcu, Nurhan Sahin, Shakir Ali, Vedat Cinar, Mustafa Atalay, Kazim Sahin

    2016-03-01

    Full Text Available This study reports the effects of Q10, coenzyme Q10 or ubiquinone, a component of the electron transport chain in mitochondria, on nuclear factor kappa-light-chain-enhancer of activated B cells (NFκB, inhibitors of kappa B (IκB, nuclear factor (erythroid-derived 2-like 2 (Nrf2 and hemeoxygenase 1 (HO-1 in rats after chronic exercise training for 6 weeks. 8-week old male Wistar rats were assigned randomly to one of four treatments planned in a 2 x 2 factorial arrangement of two condition (sedentary vs. exercise training, and two coenzyme Q10 levels (0 and 300 mg/kg per day for 6 weeks. The expression levels of the target proteins were determined in the heart, liver and muscle, and biochemical parameters including creatinine, urea, glucose and lipid profile were investigated in plasma. When compared with sedentary group, significant decreases in heart, liver and muscle NFκB levels by 45%, 26% and 44% were observed in Q10 supplemented rats after exercise training, respectively, while the inhibitory protein IκB increased by 179%, 111% and 127% in heart, liver and muscle tissues. Q10 supplementation caused an increase in Nrf2 (167%, 165% and 90% and HO-1 (107%, 156% and 114% after exercise training in heart, liver and muscle tissues (p < 0.05. No significant change was observed in any of the parameters associated with protein, carbohydrate and lipid metabolism, except that exercise caused a decrease in plasma triglyceride, which was further decreased by Q10. In conclusion, these results suggest that Q10 modulates the expression of NFκB, IκB, Nrf2 and HO-1 in exercise training, indicating an anti-inflammatory effect of Q10 and emphasizes its role in antioxidant defense.

  11. Hederagenin Induces Apoptosis in Cisplatin-Resistant Head and Neck Cancer Cells by Inhibiting the Nrf2-ARE Antioxidant Pathway.

    Science.gov (United States)

    Kim, Eun Hye; Baek, Seungho; Shin, Daiha; Lee, Jaewang; Roh, Jong-Lyel

    2017-01-01

    Acquired resistance to cisplatin is the most common reason for the failure of cisplatin chemotherapy. Hederagenin, triterpenoids extracted from ivy leaves, exhibits antitumor activity in various types of cancer. However, the therapeutic potential of hederagenin in head and neck cancer (HNC) has remained unclear. Therefore, we examined the effects of hederagenin in cisplatin-resistant HNC cells and characterized its molecular mechanisms of action in this context. We evaluated the effects of hederagenin treatment on cell viability, apoptosis, reactive oxygen species (ROS) production, glutathione levels, mitochondrial membrane potential (Δ Ψ m), and protein and mRNA expression in HNC cells. The antitumor effect of hederagenin in mouse tumor xenograft models was also analyzed. Hederagenin selectively induced cell death in both cisplatin-sensitive and cisplatin-resistant HNC cells by promoting changes in Δ Ψ m and inducing apoptosis. Hederagenin inhibited the Nrf2-antioxidant response element (ARE) pathway and activated p53 in HNC cells, thereby enhancing ROS production and promoting glutathione depletion. These effects were reversed by the antioxidant trolox. Hederagenin activated intrinsic apoptotic pathways via cleaved PARP, cleaved caspase-3, and Bax. The selective inhibitory effects of hederagenin were confirmed in cisplatin-resistant HNC xenograft models. These data suggest that hederagenin induces cell death in resistant HNC cells via the Nrf2-ARE antioxidant pathway.

  12. Hederagenin Induces Apoptosis in Cisplatin-Resistant Head and Neck Cancer Cells by Inhibiting the Nrf2-ARE Antioxidant Pathway

    Directory of Open Access Journals (Sweden)

    Eun Hye Kim

    2017-01-01

    Full Text Available Acquired resistance to cisplatin is the most common reason for the failure of cisplatin chemotherapy. Hederagenin, triterpenoids extracted from ivy leaves, exhibits antitumor activity in various types of cancer. However, the therapeutic potential of hederagenin in head and neck cancer (HNC has remained unclear. Therefore, we examined the effects of hederagenin in cisplatin-resistant HNC cells and characterized its molecular mechanisms of action in this context. We evaluated the effects of hederagenin treatment on cell viability, apoptosis, reactive oxygen species (ROS production, glutathione levels, mitochondrial membrane potential (ΔΨm, and protein and mRNA expression in HNC cells. The antitumor effect of hederagenin in mouse tumor xenograft models was also analyzed. Hederagenin selectively induced cell death in both cisplatin-sensitive and cisplatin-resistant HNC cells by promoting changes in ΔΨm and inducing apoptosis. Hederagenin inhibited the Nrf2-antioxidant response element (ARE pathway and activated p53 in HNC cells, thereby enhancing ROS production and promoting glutathione depletion. These effects were reversed by the antioxidant trolox. Hederagenin activated intrinsic apoptotic pathways via cleaved PARP, cleaved caspase-3, and Bax. The selective inhibitory effects of hederagenin were confirmed in cisplatin-resistant HNC xenograft models. These data suggest that hederagenin induces cell death in resistant HNC cells via the Nrf2-ARE antioxidant pathway.

  13. Induction of the pi class of glutathione S-transferase by carnosic acid in rat Clone 9 cells via the p38/Nrf2 pathway.

    Science.gov (United States)

    Lin, Chia-Yuan; Wu, Chi-Rei; Chang, Shu-Wei; Wang, Yu-Jung; Wu, Jia-Jiuan; Tsai, Chia-Wen

    2015-06-01

    Induction of phase II enzymes is important in cancer chemoprevention. We compared the effect of rosemary diterpenes on the expression of the pi class of glutathione S-transferase (GSTP) in rat liver Clone 9 cells and the signaling pathways involved. Culturing cells with 1, 5, 10, or 20 μM carnosic acid (CA) or carnosol (CS) for 24 h in a dose-dependent manner increased the GSTP expression. CA was more potent than CS. The RNA level and the enzyme activity of GSTP were also enhanced by CA treatment. Treatment with 10 μM CA highly induced the reporter activity of the enhancer element GPEI. Furthermore, CA markedly increased the translocation of nuclear factor erythroid-2 related factor 2 (Nrf2) from the cytosol to the nucleus after 30 to 60 min. CA the stimulated the protein induction of p38, nuclear Nrf2, and GSTP was diminished in the presence of SB203580 (a p38 inhibitor). In addition, SB203580 pretreatment or silencing of Nrf2 by siRNA suppressed the CA-induced GPEI-DNA binding activity and GSTP protein expression. Knockdown of p38 or Nrf2 by siRNA abolished the activation of p38 and Nrf2 as well as the protein induction and enzyme activity of GSTP by CA. These results suggest that CA up-regulates the expression and enzyme activity of GSTP via the p38/Nrf2/GPEI pathway.

  14. Intermittent hypoxia simulating obstructive sleep apnea causes pulmonary inflammation and activates the Nrf2/HO-1 pathway.

    Science.gov (United States)

    Wang, Yeying; Chai, Yanling; He, Xiaojie; Ai, Li; Sun, Xia; Huang, Yiling; Li, Yongxia

    2017-10-01

    Obstructive sleep apnea (OSA) is a disorder with high morbidity in adults. OSA damages multiple organs and tissues, including the cardiovascular and cerebrovascular systems, the metabolism system, the lungs, liver and heart. OSA-induced damage is earliest and greatest to the pulmonary tissue. The present study established a rat OSA model of differing severity by inducing intermittent hypoxia with different concentrations of O 2 and it was determined that OSA caused a severe oxidative stress response and pulmonary inflammation in a dose-dependent manner. OSA increased serum levels of C-reactive protein and 8-isoprostane and elevated the expression of malondialdehyde, tumor necrosis factor α, interleukin (IL)-1β and IL-6 in the pulmonary tissue. Furthermore, the expression of two important antioxidants, superoxide dismutase and glutathione, was downregulated following intermittent hypoxia. By contrast, levels of cylooxygenase 2 and inducible nitric oxide synthase, which are crucial in the antioxidative response, increased. In addition, OSA activates the nuclear factor erythroid 2-related factor 2 (Nrf2)/heme oxygenase (OH)-1 antioxidative signaling pathway. Finally, all increases and decreases in levels of inflammatory and antioxidative substances were dependent on oxygen concentrations. Therefore, the present study demonstrated that OSA, simulated by intermittent hypoxia, caused an oxidative stress response and pulmonary inflammation, and activated the canonical antioxidative Nrf2/HO-1 signaling pathway in a dose-dependent manner. These results may facilitate the development of clinical therapies to treat pulmonary diseases caused by OSA.

  15. Hydrogen Gas Inhalation Attenuates Seawater Instillation-Induced Acute Lung Injury via the Nrf2 Pathway in Rabbits.

    Science.gov (United States)

    Diao, Mengyuan; Zhang, Sheng; Wu, Lifeng; Huan, Le; Huang, Fenglou; Cui, Yunliang; Lin, Zhaofen

    2016-12-01

    Seawater instillation-induced acute lung injury involves oxidative stress and apoptosis. Although hydrogen gas inhalation is reportedly protective in multiple types of lung injury, the effect of hydrogen gas inhalation on seawater instillation-induced acute lung injury remains unknown. This study investigated the effect of hydrogen gas on seawater instillation-induced acute lung injury and explored the mechanisms involved. Rabbits were randomly assigned to control, hydrogen (2 % hydrogen gas inhalation), seawater (3 mL/kg seawater instillation), and seawater + hydrogen (3 mL/kg seawater instillation + 2 % hydrogen gas inhalation) groups. Arterial partial oxygen pressure and lung wet/dry weight ratio were detected. Protein content in bronchoalveolar lavage fluid (BALF) and serum as well as tumor necrosis factor (TNF)-α, interleukin (IL)-1β, and IL-6 levels were determined. Hematoxylin-eosin staining was used to monitor changes in lung specimens, and malondialdehyde (MDA) content and myeloperoxidase (MPO) activity were assayed. In addition, NF-E2-related factor (Nrf) 2 and heme oxygenase (HO)-1 mRNA and protein expression were measured, and apoptosis was assessed by measuring caspase-3 expression and using terminal deoxy-nucleotidyl transferase dUTP nick end-labeling (TUNEL) staining. Hydrogen gas inhalation markedly improved lung endothelial permeability and decreased both MDA content and MPO activity in lung tissue; these changes were associated with decreases in TNF-α, IL-1β, and IL-6 in BALF. Hydrogen gas also alleviated histopathological changes and cell apoptosis. Moreover, Nrf2 and HO-1 expressions were significantly activated and caspase-3 expression was inhibited. These results demonstrate that hydrogen gas inhalation attenuates seawater instillation-induced acute lung injury in rabbits and that the protective effects observed may be related to the activation of the Nrf2 pathway.

  16. Omeprazole induces heme oxygenase-1 in fetal human pulmonary microvascular endothelial cells via hydrogen peroxide-independent Nrf2 signaling pathway

    International Nuclear Information System (INIS)

    Patel, Ananddeep; Zhang, Shaojie; Shrestha, Amrit Kumar; Maturu, Paramahamsa; Moorthy, Bhagavatula; Shivanna, Binoy

    2016-01-01

    Omeprazole (OM) is an aryl hydrocarbon receptor (AhR) agonist and a proton pump inhibitor that is used to treat humans with gastric acid related disorders. Recently, we showed that OM induces NAD (P) H quinone oxidoreductase-1 (NQO1) via nuclear factor erythroid 2-related factor 2 (Nrf2)-dependent mechanism. Heme oxygenase-1 (HO-1) is another cytoprotective and antioxidant enzyme that is regulated by Nrf2. Whether OM induces HO-1 in fetal human pulmonary microvascular endothelial cells (HPMEC) is unknown. Therefore, we tested the hypothesis that OM will induce HO-1 expression via Nrf2 in HPMEC. OM induced HO-1 mRNA and protein expression in a dose-dependent manner. siRNA-mediated knockdown of AhR failed to abrogate, whereas knockdown of Nrf2 abrogated HO-1 induction by OM. To identify the underlying molecular mechanisms, we determined the effects of OM on cellular hydrogen peroxide (H 2 O 2 ) levels since oxidative stress mediated by the latter is known to activate Nrf2. Interestingly, the concentration at which OM induced HO-1 also increased H 2 O 2 levels. Furthermore, H 2 O 2 independently augmented HO-1 expression. Although N-acetyl cysteine (NAC) significantly decreased H 2 O 2 levels in OM-treated cells, we observed that OM further increased HO-1 mRNA and protein expression in NAC-pretreated compared to vehicle-pretreated cells, suggesting that OM induces HO-1 via H 2 O 2 -independent mechanisms. In conclusion, we provide evidence that OM transcriptionally induces HO-1 via AhR - and H 2 O 2 - independent, but Nrf2 - dependent mechanisms. These results have important implications for human disorders where Nrf2 and HO-1 play a beneficial role. - Highlights: • Omeprazole induces HO-1 in human fetal lung cells. • AhR deficiency fails to abrogate omeprazole-mediated induction of HO-1. • Nrf2 knockdown abrogates omeprazole-mediated HO-1 induction in human lung cells. • Hydrogen peroxide depletion augments omeprazole-mediated induction of HO-1.

  17. Omeprazole induces heme oxygenase-1 in fetal human pulmonary microvascular endothelial cells via hydrogen peroxide-independent Nrf2 signaling pathway

    Energy Technology Data Exchange (ETDEWEB)

    Patel, Ananddeep; Zhang, Shaojie; Shrestha, Amrit Kumar; Maturu, Paramahamsa; Moorthy, Bhagavatula; Shivanna, Binoy, E-mail: shivanna@bcm.edu

    2016-11-15

    Omeprazole (OM) is an aryl hydrocarbon receptor (AhR) agonist and a proton pump inhibitor that is used to treat humans with gastric acid related disorders. Recently, we showed that OM induces NAD (P) H quinone oxidoreductase-1 (NQO1) via nuclear factor erythroid 2-related factor 2 (Nrf2)-dependent mechanism. Heme oxygenase-1 (HO-1) is another cytoprotective and antioxidant enzyme that is regulated by Nrf2. Whether OM induces HO-1 in fetal human pulmonary microvascular endothelial cells (HPMEC) is unknown. Therefore, we tested the hypothesis that OM will induce HO-1 expression via Nrf2 in HPMEC. OM induced HO-1 mRNA and protein expression in a dose-dependent manner. siRNA-mediated knockdown of AhR failed to abrogate, whereas knockdown of Nrf2 abrogated HO-1 induction by OM. To identify the underlying molecular mechanisms, we determined the effects of OM on cellular hydrogen peroxide (H{sub 2}O{sub 2}) levels since oxidative stress mediated by the latter is known to activate Nrf2. Interestingly, the concentration at which OM induced HO-1 also increased H{sub 2}O{sub 2} levels. Furthermore, H{sub 2}O{sub 2} independently augmented HO-1 expression. Although N-acetyl cysteine (NAC) significantly decreased H{sub 2}O{sub 2} levels in OM-treated cells, we observed that OM further increased HO-1 mRNA and protein expression in NAC-pretreated compared to vehicle-pretreated cells, suggesting that OM induces HO-1 via H{sub 2}O{sub 2}-independent mechanisms. In conclusion, we provide evidence that OM transcriptionally induces HO-1 via AhR - and H{sub 2}O{sub 2} - independent, but Nrf2 - dependent mechanisms. These results have important implications for human disorders where Nrf2 and HO-1 play a beneficial role. - Highlights: • Omeprazole induces HO-1 in human fetal lung cells. • AhR deficiency fails to abrogate omeprazole-mediated induction of HO-1. • Nrf2 knockdown abrogates omeprazole-mediated HO-1 induction in human lung cells. • Hydrogen peroxide depletion augments

  18. Green tea polyphenol (−)-epigallocatechin-3-gallate triggered hepatotoxicity in mice: Responses of major antioxidant enzymes and the Nrf2 rescue pathway

    International Nuclear Information System (INIS)

    Wang, Dongxu; Wang, Yijun; Wan, Xiaochun; Yang, Chung S.; Zhang, Jinsong

    2015-01-01

    (−)-Epigallocatechin-3-gallate (EGCG), a constituent of green tea, has been suggested to have numerous health-promoting effects. On the other hand, high-dose EGCG is able to evoke hepatotoxicity. In the present study, we elucidated the responses of hepatic major antioxidant enzymes and nuclear factor erythroid 2-related factor 2 (Nrf2) rescue pathway to high-dose levels of EGCG in Kunming mice. At a non-lethal toxic dose (75 mg/kg, i.p.), repeated EGCG treatments markedly decreased the levels of superoxide dismutase, catalase, and glutathione peroxidase. As a rescue response, the nuclear distribution of Nrf2 was significantly increased; a battery of Nrf2-target genes, including heme oxygenase 1 (HO1), NAD(P)H:quinone oxidoreductase 1 (NQO1), glutathione S-transferase (GST), and those involved in glutathione and thioredoxin systems, were all up-regulated. At the maximum tolerated dose (45 mg/kg, i.p.), repeated EGCG treatments did not disturb the major antioxidant defense. Among the above-mentioned genes, only HO1, NQO1, and GST genes were significantly but modestly up-regulated, suggesting a comprehensive and extensive activation of Nrf2-target genes principally occurs at toxic levels of EGCG. At a lethal dose (200 mg/kg, i.p.), a single EGCG treatment dramatically decreased not only the major antioxidant defense but also the Nrf2-target genes, demonstrating that toxic levels of EGCG are able to cause a biphasic response of Nrf2. Overall, the mechanism of EGCG-triggered hepatotoxicity involves suppression of major antioxidant enzymes, and the Nrf2 rescue pathway plays a vital role for counteracting EGCG toxicity. - Highlights: • EGCG at maximum tolerated dose does not disturb hepatic major antioxidant defense. • EGCG at maximum tolerated dose modestly upregulates hepatic Nrf2 target genes. • EGCG at toxic dose suppresses hepatic major antioxidant enzymes. • EGCG at non-lethal toxic dose pronouncedly activates hepatic Nrf2 rescue response. • EGCG at

  19. Green tea polyphenol (−)-epigallocatechin-3-gallate triggered hepatotoxicity in mice: Responses of major antioxidant enzymes and the Nrf2 rescue pathway

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Dongxu; Wang, Yijun; Wan, Xiaochun [Key Laboratory of Tea Biochemistry & Biotechnology, School of Tea & Food Science, Anhui Agricultural University, Hefei, Anhui 230036 (China); Yang, Chung S. [Department of Chemical Biology, Ernest Mario School of Pharmacy, Rutgers, The State University of New Jersey, Piscataway, NJ 08854 (United States); Zhang, Jinsong, E-mail: zjs@ahau.edu.cn [Key Laboratory of Tea Biochemistry & Biotechnology, School of Tea & Food Science, Anhui Agricultural University, Hefei, Anhui 230036 (China)

    2015-02-15

    (−)-Epigallocatechin-3-gallate (EGCG), a constituent of green tea, has been suggested to have numerous health-promoting effects. On the other hand, high-dose EGCG is able to evoke hepatotoxicity. In the present study, we elucidated the responses of hepatic major antioxidant enzymes and nuclear factor erythroid 2-related factor 2 (Nrf2) rescue pathway to high-dose levels of EGCG in Kunming mice. At a non-lethal toxic dose (75 mg/kg, i.p.), repeated EGCG treatments markedly decreased the levels of superoxide dismutase, catalase, and glutathione peroxidase. As a rescue response, the nuclear distribution of Nrf2 was significantly increased; a battery of Nrf2-target genes, including heme oxygenase 1 (HO1), NAD(P)H:quinone oxidoreductase 1 (NQO1), glutathione S-transferase (GST), and those involved in glutathione and thioredoxin systems, were all up-regulated. At the maximum tolerated dose (45 mg/kg, i.p.), repeated EGCG treatments did not disturb the major antioxidant defense. Among the above-mentioned genes, only HO1, NQO1, and GST genes were significantly but modestly up-regulated, suggesting a comprehensive and extensive activation of Nrf2-target genes principally occurs at toxic levels of EGCG. At a lethal dose (200 mg/kg, i.p.), a single EGCG treatment dramatically decreased not only the major antioxidant defense but also the Nrf2-target genes, demonstrating that toxic levels of EGCG are able to cause a biphasic response of Nrf2. Overall, the mechanism of EGCG-triggered hepatotoxicity involves suppression of major antioxidant enzymes, and the Nrf2 rescue pathway plays a vital role for counteracting EGCG toxicity. - Highlights: • EGCG at maximum tolerated dose does not disturb hepatic major antioxidant defense. • EGCG at maximum tolerated dose modestly upregulates hepatic Nrf2 target genes. • EGCG at toxic dose suppresses hepatic major antioxidant enzymes. • EGCG at non-lethal toxic dose pronouncedly activates hepatic Nrf2 rescue response. • EGCG at

  20. Evaluation of the rotenone-induced activation of the Nrf2 pathway in a neuronal model derived from human induced pluripotent stem cells.

    Science.gov (United States)

    Zagoura, Dimitra; Canovas-Jorda, David; Pistollato, Francesca; Bremer-Hoffmann, Susanne; Bal-Price, Anna

    2017-06-01

    Human induced pluripotent stem cells (hiPSCs) are considered as a powerful tool for drug and chemical screening and development of new in vitro testing strategies in the field of toxicology, including neurotoxicity evaluation. These cells are able to expand and efficiently differentiate into different types of neuronal and glial cells as well as peripheral neurons. These human cells-based neuronal models serve as test systems for mechanistic studies on different pathways involved in neurotoxicity. One of the well-known mechanisms that are activated by chemically-induced oxidative stress is the Nrf2 signaling pathway. Therefore, in the current study, we evaluated whether Nrf2 signaling machinery is expressed in human induced pluripotent stem cells (hiPSCs)-derived mixed neuronal/glial culture and if so whether it becomes activated by rotenone-induced oxidative stress mediated by complex I inhibition of mitochondrial respiration. Rotenone was found to induce the activation of Nrf2 signaling particularly at the highest tested concentration (100 nM), as shown by Nrf2 nuclear translocation and the up-regulation of the Nrf2-downstream antioxidant enzymes, NQO1 and SRXN1. Interestingly, exposure to rotenone also increased the number of astroglial cells in which Nrf2 activation may play an important role in neuroprotection. Moreover, rotenone caused cell death of dopaminergic neurons since a decreased percentage of tyrosine hydroxylase (TH + ) cells was observed. The obtained results suggest that hiPSC-derived mixed neuronal/glial culture could be a valuable in vitro human model for the establishment of neuronal specific assays in order to link Nrf2 pathway activation (biomarker of oxidative stress) with additional neuronal specific readouts that could be applied to in vitro neurotoxicity evaluation. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  1. Enhanced expression of Nrf2 in mice attenuates the fatty liver produced by a methionine- and choline-deficient diet

    International Nuclear Information System (INIS)

    Zhang, Yu-Kun Jennifer; Yeager, Ronnie L.; Tanaka, Yuji; Klaassen, Curtis D.

    2010-01-01

    Oxidative stress has been proposed as an important promoter of the progression of fatty liver diseases. The current study investigates the potential functions of the Nrf2-Keap1 signaling pathway, an important hepatic oxidative stress sensor, in a rodent fatty liver model. Mice with no (Nrf2-null), normal (wild type, WT), and enhanced (Keap1 knockdown, K1-kd) expression of Nrf2 were fed a methionine- and choline-deficient (MCD) diet or a control diet for 5 days. Compared to WT mice, the MCD diet-caused hepatosteatosis was more severe in the Nrf2-null mice and less in the K1-kd mice. The Nrf2-null mice had lower hepatic glutathione and exhibited more lipid peroxidation, whereas the K1-kd mice had the highest amount of glutathione in the liver and developed the least lipid peroxidation among the three genotypes fed the MCD diet. The Nrf2 signaling pathway was activated by the MCD diet, and the Nrf2-targeted cytoprotective genes Nqo1 and Gstα1/2 were induced in WT and even more in K1-kd mice. In addition, Nrf2-null mice on both control and MCD diets exhibited altered expression profiles of fatty acid metabolism genes, indicating Nrf2 may influence lipid metabolism in liver. For example, mRNA levels of long chain fatty acid translocase CD36 and the endocrine hormone Fgf21 were higher in livers of Nrf2-null mice and lower in the K1-kd mice than WT mice fed the MCD diet. Taken together, these observations indicate that Nrf2 could decelerate the onset of fatty livers caused by the MCD diet by increasing hepatic antioxidant and detoxification capabilities.

  2. Induction of cytoprotective pathways is central to the extension of lifespan conferred by multiple longevity pathways.

    Directory of Open Access Journals (Sweden)

    David E Shore

    Full Text Available Many genetic and physiological treatments that extend lifespan also confer resistance to a variety of stressors, suggesting that cytoprotective mechanisms underpin the regulation of longevity. It has not been established, however, whether the induction of cytoprotective pathways is essential for lifespan extension or merely correlated. Using a panel of GFP-fused stress response genes, we identified the suites of cytoprotective pathways upregulated by 160 gene inactivations known to increase Caenorhabditis elegans longevity, including the mitochondrial UPR (hsp-6, hsp-60, the ER UPR (hsp-4, ROS response (sod-3, gst-4, and xenobiotic detoxification (gst-4. We then screened for other gene inactivations that disrupt the induction of these responses by xenobiotic or genetic triggers, identifying 29 gene inactivations required for cytoprotective gene expression. If cytoprotective responses contribute directly to lifespan extension, inactivation of these genes would be expected to compromise the extension of lifespan conferred by decreased insulin/IGF-1 signaling, caloric restriction, or the inhibition of mitochondrial function. We find that inactivation of 25 of 29 cytoprotection-regulatory genes shortens the extension of longevity normally induced by decreased insulin/IGF-1 signaling, disruption of mitochondrial function, or caloric restriction, without disrupting normal longevity nearly as dramatically. These data demonstrate that induction of cytoprotective pathways is central to longevity extension and identify a large set of new genetic components of the pathways that detect cellular damage and couple that detection to downstream cytoprotective effectors.

  3. Activation of the Nrf2 Cell Defense Pathway by Ancient Foods: Disease Prevention by Important Molecules and Microbes Lost from the Modern Western Diet.

    Directory of Open Access Journals (Sweden)

    Donald R Senger

    Full Text Available The Nrf2 (NFE2L2 cell defense pathway protects against oxidative stress and disorders including cancer and neurodegeneration. Although activated modestly by oxidative stress alone, robust activation of the Nrf2 defense mechanism requires the additional presence of co-factors that facilitate electron exchange. Various molecules exhibit this co-factor function, including sulforaphane from cruciferous vegetables. However, natural co-factors that are potent and widely available from dietary sources have not been identified previously. The objectives of this study were to investigate support of the Nrf2 cell defense pathway by the alkyl catechols: 4-methylcatechol, 4-vinylcatechol, and 4-ethylcatechol. These small electrochemicals are naturally available from numerous sources but have not received attention. Findings reported here illustrate that these compounds are indeed potent co-factors for activation of the Nrf2 pathway both in vitro and in vivo. Each strongly supports expression of Nrf2 target genes in a variety of human cell types; and, in addition, 4-ethylcatechol is orally active in mice. Furthermore, findings reported here identify important and previously unrecognized sources of these compounds, arising from biotransformation of common plant compounds by lactobacilli that express phenolic acid decarboxylase. Thus, for example, Lactobacillus plantarum, Lactobacillus brevis, and Lactobacillus collinoides, which are consumed from a diet rich in traditionally fermented foods and beverages, convert common phenolic acids found in fruits and vegetables to 4-vinylcatechol and/or 4-ethylcatechol. In addition, all of the alkyl catechols are found in wood smoke that was used widely for food preservation. Thus, the potentially numerous sources of alkyl catechols in traditional foods suggest that these co-factors were common in ancient diets. However, with radical changes in food preservation, alkyl catechols have been lost from modern foods. The

  4. Agmatine Reduces Lipopolysaccharide-Mediated Oxidant Response via Activating PI3K/Akt Pathway and Up-Regulating Nrf2 and HO-1 Expression in Macrophages.

    Directory of Open Access Journals (Sweden)

    Jianshen Chai

    Full Text Available Macrophages are key responders of inflammation and are closely related with oxidative stress. Activated macrophages can enhance oxygen depletion, which causes an overproduction of reactive oxygen species (ROS and leads to further excessive inflammatory response and tissue damage. Agmatine, an endogenous metabolite of L-arginine, has recently been shown to have neuroprotective effects based on its antioxidant properties. However, the antioxidant effects of agmatine in peripheral tissues and cells, especially macrophages, remain unclear. In this study we explored the role of agmatine in mediating antioxidant effects in RAW 264.7 cells and studied its antioxidant mechanism. Our data demonstrate that agmatine is an activator of Nrf2 signaling that markedly enhances Nrf2 nuclear translocation, increases nuclear Nrf2 protein level, up-regulates the expression of the Nrf2 downstream effector HO-1, and attenuates ROS generation induced by Lipopolysaccharide (LPS. We further demonstrated that the agmatine-induced activation of Nrf2 is likely through the PI3K/Akt pathway. LY294002, a specific PI3K/Akt inhibitor, abolished agmatine-induced HO-1 up-regulation and ROS suppression significantly. Inhibiting HO-1 pathway significantly attenuated the antioxidant effect of agmatine which the products of HO-1 enzymatic activity contributed to. Furthermore, the common membrane receptors of agmatine were evaluated, revealing that α2-adrenoceptor, I1-imidazoline receptor or I2-imidazoline receptor are not required by the antioxidant properties of agmatine. Taken together, our findings revealed that agmatine has antioxidant activity against LPS-induced ROS accumulation in RAW 264.7 cells involving HO-1 expression induced by Nrf2 via PI3K/Akt pathway activation.

  5. Fluvastatin inhibits AGE-induced cell proliferation and migration via an ERK5-dependent Nrf2 pathway in vascular smooth muscle cells.

    Directory of Open Access Journals (Sweden)

    Ae-Rang Hwang

    Full Text Available Advanced glycation endproduct (AGE-induced vascular smooth muscle cell (VSMC proliferation and reactive oxygen species (ROS production are emerging as important mechanisms of diabetic vasculopathy, but little is known about the molecular mechanism responsible for the antioxidative effects of statins on AGEs. It has been reported that statins exert pleiotropic effects on the cardiovascular system due to decreases in AGE-induced cell proliferation, migration, and vascular inflammation. Thus, in the present study, the authors investigated the molecular mechanism by which statins decrease AGE-induced cell proliferation and VSMC migration. In cultured VSMCs, statins upregulated Nrf2-related antioxidant gene, NQO1 and HO-1, via an ERK5-dependent Nrf2 pathway. Inhibition of ERK5 by siRNA or BIX02189 (a specific ERK5 inhibitor reduced the statin-induced upregulations of Nrf2, NQO1, and HO-1. Furthermore, fluvastatin was found to significantly increase ARE promoter activity through ERK5 signaling, and to inhibit AGE-induced VSMC proliferation and migration as determined by MTT assay, cell counting, FACS analysis, a wound scratch assay, and a migration chamber assay. In addition, AGE-induced proliferation was diminished in the presence of Ad-CA-MEK5α encoding a constitutively active mutant form of MEK5α (an upstream kinase of ERK5, whereas depletion of Nrf2 restored statin-mediated reduction of AGE-induced cell proliferation. Moreover, fluvastatin suppressed the protein expressions of cyclin D1 and Cdk4, but induced p27, and blocked VSMC proliferation by regulating cell cycle. These results suggest statin-induced activation of an ERK5-dependent Nrf2 pathway reduces VSMC proliferation and migration induced by AGEs, and that the ERK5-Nrf2 signal module be viewed as a potential therapeutic target of vasculopathy in patients with diabetes and complications of the disease.

  6. Sulforaphane Ameliorates Bladder Dysfunction through Activation of the Nrf2-ARE Pathway in a Rat Model of Partial Bladder Outlet Obstruction

    Directory of Open Access Journals (Sweden)

    Chong Liu

    2016-01-01

    Full Text Available Purpose. We evaluated the effect of sulforaphane (SFN treatment on the function and changes of expression of Nrf2-ARE pathway in the bladder of rats with bladder outlet obstruction (BOO. Materials and Methods. A total of 18 male Sprague-Dawley rats at age of 8 weeks were divided into 3 groups (6 of each: the sham operated group, the BOO group, and the BOO+SFN group. We examined histological alterations and the changes of oxidative stress markers and the protein expression of the Nrf2-ARE pathway. Results. We found that SFN treatment could prolong micturition interval and increase bladder capacity and bladder compliance. However, the peak voiding pressure was lower than BOO group. SFN treatment can ameliorate the increase of collagen fibers induced by obstruction. SFN treatment also increased the activity of SOD, GSH-Px, and CAT compared to the other groups. The level of bladder cell apoptosis was decreased in BOO rats with SFN treatment. Moreover, SFN could reduce the ratio of Bax/Bcl-2 expression. Furthermore, SFN could activate the Nrf2 expression with elevation of its target antioxidant proteins. Conclusions. The sulforaphane-mediated decrease of oxidative stress and activation of the Nrf2-ARE pathway may ameliorate bladder dysfunction caused by bladder outlet obstruction.

  7. Sulforaphane Ameliorates Bladder Dysfunction through Activation of the Nrf2-ARE Pathway in a Rat Model of Partial Bladder Outlet Obstruction

    Science.gov (United States)

    Liu, Chong; Xu, Huan; Fu, Shi; Chen, Yanbo; Chen, Qi; Cai, Zhikang; Zhou, Juan; Wang, Zhong

    2016-01-01

    Purpose. We evaluated the effect of sulforaphane (SFN) treatment on the function and changes of expression of Nrf2-ARE pathway in the bladder of rats with bladder outlet obstruction (BOO). Materials and Methods. A total of 18 male Sprague-Dawley rats at age of 8 weeks were divided into 3 groups (6 of each): the sham operated group, the BOO group, and the BOO+SFN group. We examined histological alterations and the changes of oxidative stress markers and the protein expression of the Nrf2-ARE pathway. Results. We found that SFN treatment could prolong micturition interval and increase bladder capacity and bladder compliance. However, the peak voiding pressure was lower than BOO group. SFN treatment can ameliorate the increase of collagen fibers induced by obstruction. SFN treatment also increased the activity of SOD, GSH-Px, and CAT compared to the other groups. The level of bladder cell apoptosis was decreased in BOO rats with SFN treatment. Moreover, SFN could reduce the ratio of Bax/Bcl-2 expression. Furthermore, SFN could activate the Nrf2 expression with elevation of its target antioxidant proteins. Conclusions. The sulforaphane-mediated decrease of oxidative stress and activation of the Nrf2-ARE pathway may ameliorate bladder dysfunction caused by bladder outlet obstruction. PMID:27433291

  8. Role of Nrf2/ARE pathway in protective effect of electroacupuncture against endotoxic shock-induced acute lung injury in rabbits.

    Directory of Open Access Journals (Sweden)

    Jian-bo Yu

    Full Text Available NF-E2 related factor 2 (Nrf2 is a major transcription factor and acts as a key regulator of antioxidant genes to exogenous stimulations. The aim of current study was to determine whether Nrf2/ARE pathway is involved in the protective effect of electroacupuncture on the injured lung in a rabbit model of endotoxic shock. A dose of lipopolysaccharide (LPS 5 mg/kg was administered intravenously to replicate the model of acute lung injury induced by endotoxic shock. Electroacupuncture pretreatment was handled bilaterally at Zusanli and Feishu acupoints for five consecutive days while sham electroacupuncture punctured at non-acupoints. Fourty anesthetized New England male rabbits were randomized into normal control group (group C, LPS group (group L, electroacupuncture + LPS group (group EL and sham electroacupuncture + LPS (group SEL. At 6 h after LPS administration, the animals were sacrificed and the blood samples were collected for biochemical measurements. The lungs were removed for calculation of wet-to-dry weight ratios (W/D, histopathologic examination, determination of heme oxygenase (HO-1 protein and mRNA, Nrf2 total and nucleoprotein, as well as Nrf2 mRNA expression, and evaluation of the intracellular distribution of Nrf2 nucleoprotein. LPS caused extensive morphologic lung damage, which was lessened by electroacupuncture treatment. Besides, lung W/D ratios were significantly decreased, the level of malondialdehyde was inhibited, plasma levels of TNF-α and interleukin-6 were decreased, while the activities of superoxide dismutase, glutathione peroxidase and catalase were enhanced in the electroacupucnture treated animals. In addition, electroacupuncture stimulation distinctly increased the expressions of HO-1 and Nrf2 protein including Nrf2 total protein and nucleoprotein as well as mRNA in lung tissue, while these effects were blunted in the sham electroacupuncture group. We concluded that electroacupuncture treatment at ST36 and BL13

  9. Role of Nrf2/ARE pathway in protective effect of electroacupuncture against endotoxic shock-induced acute lung injury in rabbits.

    Science.gov (United States)

    Yu, Jian-bo; Shi, Jia; Gong, Li-rong; Dong, Shu-an; Xu, Yan; Zhang, Yuan; Cao, Xin-shun; Wu, Li-li

    2014-01-01

    NF-E2 related factor 2 (Nrf2) is a major transcription factor and acts as a key regulator of antioxidant genes to exogenous stimulations. The aim of current study was to determine whether Nrf2/ARE pathway is involved in the protective effect of electroacupuncture on the injured lung in a rabbit model of endotoxic shock. A dose of lipopolysaccharide (LPS) 5 mg/kg was administered intravenously to replicate the model of acute lung injury induced by endotoxic shock. Electroacupuncture pretreatment was handled bilaterally at Zusanli and Feishu acupoints for five consecutive days while sham electroacupuncture punctured at non-acupoints. Fourty anesthetized New England male rabbits were randomized into normal control group (group C), LPS group (group L), electroacupuncture + LPS group (group EL) and sham electroacupuncture + LPS (group SEL). At 6 h after LPS administration, the animals were sacrificed and the blood samples were collected for biochemical measurements. The lungs were removed for calculation of wet-to-dry weight ratios (W/D), histopathologic examination, determination of heme oxygenase (HO)-1 protein and mRNA, Nrf2 total and nucleoprotein, as well as Nrf2 mRNA expression, and evaluation of the intracellular distribution of Nrf2 nucleoprotein. LPS caused extensive morphologic lung damage, which was lessened by electroacupuncture treatment. Besides, lung W/D ratios were significantly decreased, the level of malondialdehyde was inhibited, plasma levels of TNF-α and interleukin-6 were decreased, while the activities of superoxide dismutase, glutathione peroxidase and catalase were enhanced in the electroacupucnture treated animals. In addition, electroacupuncture stimulation distinctly increased the expressions of HO-1 and Nrf2 protein including Nrf2 total protein and nucleoprotein as well as mRNA in lung tissue, while these effects were blunted in the sham electroacupuncture group. We concluded that electroacupuncture treatment at ST36 and BL13 effectively

  10. Tomatidine enhances lifespan and healthspan in C. elegans through mitophagy induction via the SKN-1/Nrf2 pathway.

    Science.gov (United States)

    Fang, Evandro F; Waltz, Tyler B; Kassahun, Henok; Lu, Qiping; Kerr, Jesse S; Morevati, Marya; Fivenson, Elayne M; Wollman, Bradley N; Marosi, Krisztina; Wilson, Mark A; Iser, Wendy B; Eckley, D Mark; Zhang, Yongqing; Lehrmann, Elin; Goldberg, Ilya G; Scheibye-Knudsen, Morten; Mattson, Mark P; Nilsen, Hilde; Bohr, Vilhelm A; Becker, Kevin G

    2017-04-11

    Aging is a major international concern that brings formidable socioeconomic and healthcare challenges. Small molecules capable of improving the health of older individuals are being explored. Small molecules that enhance cellular stress resistance are a promising avenue to alleviate declines seen in human aging. Tomatidine, a natural compound abundant in unripe tomatoes, inhibits age-related skeletal muscle atrophy in mice. Here we show that tomatidine extends lifespan and healthspan in C. elegans, an animal model of aging which shares many major longevity pathways with mammals. Tomatidine improves many C. elegans behaviors related to healthspan and muscle health, including increased pharyngeal pumping, swimming movement, and reduced percentage of severely damaged muscle cells. Microarray, imaging, and behavioral analyses reveal that tomatidine maintains mitochondrial homeostasis by modulating mitochondrial biogenesis and PINK-1/DCT-1-dependent mitophagy. Mechanistically, tomatidine induces mitochondrial hormesis by mildly inducing ROS production, which in turn activates the SKN-1/Nrf2 pathway and possibly other cellular antioxidant response pathways, followed by increased mitophagy. This mechanism occurs in C. elegans, primary rat neurons, and human cells. Our data suggest that tomatidine may delay some physiological aspects of aging, and points to new approaches for pharmacological interventions for diseases of aging.

  11. Ameliorating mitochondrial dysfunction restores carbon ion-induced cognitive deficits via co-activation of NRF2 and PINK1 signaling pathway

    Directory of Open Access Journals (Sweden)

    Yang Liu

    2018-07-01

    Full Text Available Carbon ion therapy is a promising modality in radiotherapy to treat tumors, however, a potential risk of induction of late normal tissue damage should still be investigated and protected. The aim of the present study was to explore the long-term cognitive deficits provoked by a high-linear energy transfer (high-LET carbon ions in mice by targeting to hippocampus which plays a crucial role in memory and learning. Our data showed that, one month after 4 Gy carbon ion exposure, carbon ion irradiation conspicuously resulted in the impaired cognitive performance, neurodegeneration and neuronal cell death, as well as the reduced mitochondrial integrity, the disrupted activities of tricarboxylic acid cycle flux and electron transport chain, and the depressed antioxidant defense system, consequently leading to a decline of ATP production and persistent oxidative damage in the hippocampus region. Mechanistically, we demonstrated the disruptions of mitochondrial homeostasis and redox balance typically characterized by the disordered mitochondrial dynamics, mitophagy and glutathione redox couple, which is closely associated with the inhibitions of PINK1 and NRF2 signaling pathway as the key regulators of molecular responses in the context of neurotoxicity and neurodegenerative disorders. Most importantly, we found that administration with melatonin as a mitochondria-targeted antioxidant promoted the PINK1 accumulation on the mitochondrial membrane, and augmented the NRF2 accumulation and translocation. Moreover, melatonin pronouncedly enhanced the molecular interplay between NRF2 and PINK1. Furthermore, in the mouse hippocampal neuronal cells, overexpression of NRF2/PINK1 strikingly protected the hippocampal neurons from carbon ion-elicited toxic insults. Thus, these data suggest that alleviation of the sustained mitochondrial dysfunction and oxidative stress through co-modulation of NRF2 and PINK1 may be in charge of restoration of the cognitive

  12. Activation of p62-keap1-Nrf2 antioxidant pathway in the early stage of acetaminophen-induced acute liver injury in mice.

    Science.gov (United States)

    Shen, Zhenyu; Wang, Yu; Su, Zhenhui; Kou, Ruirui; Xie, Keqin; Song, Fuyong

    2018-02-25

    Acetaminophen (APAP) overdose can cause severe liver failure even death. Nearly half of drug-induced liver injury is attributed to APAP in the US and many European countries. Oxidative stress has been validated as a critical event involved in APAP-induced liver failure. p62/SQSTM1, a selective autophagy adaptor protein, is reported to regulate Nrf2-ARE antioxidant pathway in response to oxidative stress. However, the exact role of p62-keap1-Nrf2 antioxidant pathway in APAP-induced hepatotoxicity remains unknown. In the present study, the dose-response and time-course model in C57/BL6 mice were established by intraperitoneal injection of APAP. The results of serum alanine/aspartate aminotransferases (ALT/AST) and histological examination demonstrated that APAP overdose resulted in the severe liver injury. In the meantime, the levels of p62, phospho-p62 and nuclear Nrf2 were significantly increased by APAP in mice liver, suggesting an activation of p62-keap1-Nrf2 pathway. In addition, the expression of GSTA1 mRNA was increased in a dose-dependent manner, while the mRNA levels of HO-1 and GCLC were decreased with the increase of APAP dose. Our further investigation found that expression of HO-1 and GCLC peaked at 3 h∼6 h, and then were decreased gradually. Taken together, these results indicated that p62-keap1-Nrf2 antioxidant pathway was primarily activated in the early stage of APAP hepatotoxicity, which might play a protective role in the process of APAP-induced acute liver injury. Copyright © 2018 Elsevier B.V. All rights reserved.

  13. Electroacupuncture Ameliorates Acute Renal Injury in Lipopolysaccharide-Stimulated Rabbits via Induction of HO-1 through the PI3K/Akt/Nrf2 Pathways.

    Science.gov (United States)

    Yu, Jian-Bo; Shi, Jia; Zhang, Yuan; Gong, Li-Rong; Dong, Shu-An; Cao, Xin-Shun; Wu, Li-Li; Wu, Li-Na

    2015-01-01

    Electroacupuncture at select acupoints have been verified to protect against organ dysfunctions during endotoxic shock. And, heme oxygenase (HO)-1 as a phase II enzyme and antioxidant contributed to the protection of kidney in septic shock rats. The phosphatidylinositol 3-kinase (PI3K)-Akt pathway mediated the activation of NF-E2 related factor-2 (Nrf2), which was involved in HO-1 induction. To understand the efficacy of electroacupuncture stimulation in ameliorating acute kidney injury (AKI) through the PI3K/Akt/Nrf2 pathway and subsequent HO-1 upregulation, a dose of LPS 5mg/kg was administered intravenously to replicate the rabbit model of AKI induced by endotoxic shock. Electroacupuncture pretreatment was handled bilaterally at Zusanli and Neiguan acupoints for five consecutive days while sham electroacupuncture at non-acupoints as control. Results displayed that electroacupuncture stimulation significantly alleviated the morphologic renal damage, attenuated renal tubular apoptosis, suppressed the elevated biochemical indicators of AKI caused by LPS, enhanced the expressions of phospho-Akt, HO-1protein, Nrf2 total and nucleoprotein, and highlighted the proportions of Nrf2 nucleoprotein as a parallel. Furthermore, partial protective effects of elecroacupuncture were counteracted by preconditioning with wortmannin (the selective PI3K inhibitor), indicating a direct involvement of PI3K/Akt pathway. Inconsistently, wortmannin pretreatment made little difference to the expressions of HO-1, Nrf2 nucleoprotein and total protein, which indicated that PI3K/Akt may be not the only pathway responsible for electroacupuncture-afforded protection against LPS-induced AKI. These findings provide new insights into the potential future clinical applications of electroacupuncture for AKI induced by endotoxic shock instead of traditional remedies.

  14. l-Arginine induces antioxidant response to prevent oxidative stress via stimulation of glutathione synthesis and activation of Nrf2 pathway.

    Science.gov (United States)

    Liang, Mingcai; Wang, Zhengxuan; Li, Hui; Cai, Liang; Pan, Jianghao; He, Hongjuan; Wu, Qiong; Tang, Yinzhao; Ma, Jiapei; Yang, Lin

    2018-05-01

    Arginine is a conditionally essential amino acid. To elucidate the influence of l-arginine on the activation of endogenous antioxidant defence, male Wistar rats were orally administered daily with l-arginine at different levels of 25, 50, 100 mg/100 g body weight. After 7 and 14 days feeding, the antioxidative capacities and glutathione (GSH) contents in the plasma and in the liver were uniformly enhanced with the increasing consumption of l-arginine, whereas the oxidative stress was effectively suppressed by l-arginine treatment. After 14 days feeding, the mRNA levels and protein expressions of Keap1 and Cul3 were gradually reduced by increasing l-arginine intake, resulting that the nuclear factor Nrf2 was activated. Upon activation of Nrf2, the expressions of antioxidant responsive element (ARE)-dependent genes and proteins (GCLC, GCLM, GS, GR, GST, GPx, CAT, SOD, NQO1, HO-1) were up-regulated by l-arginine feeding, indicating an upward trend in antioxidant capacity uniformly with the increasing consumption of l-arginine. The present study demonstrates that the supplementation of l-arginine stimulates GSH synthesis and activates Nrf2 pathway, leading to the up-regulation of ARE-driven antioxidant expressions via Nrf2-Keap1 pathway. Results suggest the availability of l-arginine is a critical factor to suppress oxidative stress and induce an endogenous antioxidant response. Copyright © 2018 Elsevier Ltd. All rights reserved.

  15. MicroRNA-140-5p attenuated oxidative stress in Cisplatin induced acute kidney injury by activating Nrf2/ARE pathway through a Keap1-independent mechanism.

    Science.gov (United States)

    Liao, Weitang; Fu, Zongjie; Zou, Yanfang; Wen, Dan; Ma, Hongkun; Zhou, Fangfang; Chen, Yongxi; Zhang, Mingjun; Zhang, Wen

    2017-11-15

    Oxidative stress was predominantly involved in the pathogenesis of acute kidney injury (AKI). Recent studies had reported the protective role of specific microRNAs (miRNAs) against oxidative stress. Hence, we investigated the levels of miR140-5p and its functional role in the pathogenesis of Cisplatin induced AKI. A mice Cisplatin induced-AKI model was established. We found that miR-140-5p expression was markedly increased in mice kidney. Bioinformatics analysis revealed nuclear factor erythroid 2-related factor (Nrf2) was a potential target of miR-140-5p, We demonstrated that miR-140-5p did not affect Kelch-like ECH-associated protein 1 (Keap1) level but directly targeted the 3'-UTR of Nrf2 mRNA and played a positive role in the regulation of Nrf2 expression which was confirmed by luciferase activity assay and western blot. What was more, consistent with miR140-5p expression, the mRNA and protein levels of Nrf2, as well as antioxidant response element (ARE)-driven genes Heme Oxygenase-1 (HO-1) and NAD(P)H:quinone oxidoreductase l (NQO1) were significantly increased in mice kidney tissues. In vitro study, Enforced expression of miR-140-5p in HK2 cells significantly attenuated oxidative stress by decreasing ROS level and increasing the expression of manganese superoxide dismutase (MnSOD). Simultaneously, miR-140-5p decreased lactate dehydrogenase (LDH) leakage and improved cell vitality in HK2 cells under Cisplatin-induced oxidative stress. However, HK2 cells transfected with a siRNA targeting Nrf2 abrogated the protective effects of miR-140-5p against oxidative stress. These results indicated that miR-140-5p might exert its anti-oxidative stress function via targeting Nrf2. Our findings showed the novel transcriptional role of miR140-5p in the expression of Nrf2 and miR-140-5p protected against Cisplatin induced oxidative stress by activating Nrf2-dependent antioxidant pathway, providing a potentially therapeutic target in acute kidney injury. Copyright © 2017

  16. Dendritic cells' death induced by contact sensitizers is controlled by Nrf2 and depends on glutathione levels

    Energy Technology Data Exchange (ETDEWEB)

    El Ali, Zeina [UMR996 - Inflammation, Chemokines and Immunopathology-, INSERM, Univ Paris-Sud, Université Paris-Saclay, 92296 Châtenay-Malabry (France); Deloménie, Claudine [IFR141 IPSIT, Univ Paris-Sud, Université Paris-Saclay, Châtenay-Malabry (France); Botton, Jérémie [INSERM, UMR1153 Epidemiology and Biostatistics Sorbonne Paris Cité Center (CRESS), Team (France); Pallardy, Marc [UMR996 - Inflammation, Chemokines and Immunopathology-, INSERM, Univ Paris-Sud, Université Paris-Saclay, 92296 Châtenay-Malabry (France); Kerdine-Römer, Saadia, E-mail: saadia.kerdine-romer@u-psud.fr [UMR996 - Inflammation, Chemokines and Immunopathology-, INSERM, Univ Paris-Sud, Université Paris-Saclay, 92296 Châtenay-Malabry (France)

    2017-05-01

    Dendritic cells (DC) are known to play a major role during contact allergy induced by contact sensitizers (CS). Our previous studies showed that Nrf2 was induced in DC and controlled allergic skin inflammation in mice in response to chemicals. In this work, we raised the question of the role of Nrf2 in response to a stress provoked by chemical sensitizers in DC. We used two well-described chemical sensitizers, dinitrochlorobenzene (DNCB) and cinnamaldehyde (CinA), known to have different chemical reactivity and mechanism of action. First, we performed a RT-qPCR array showing that CinA was a higher inducer of immune and detoxification genes compared to DNCB. Interestingly, in the absence of Nrf2, gene expression was dramatically affected in response to DNCB but was slightly affected in response to CinA. These observations prompted us to study DC's cell death in response to both chemicals. DNCB and CinA increased apoptotic cells and decreased living cells in the absence of Nrf2. The characterization of DC apoptosis induced by both CS involved the mitochondrial-dependent caspase pathway and was regulated via Nrf2 in response to both chemicals. Oxidative stress induced by DNCB, and leading to cell death, was regulated by Nrf2. Unlike CinA, DNCB treatment provoked a significant reduction of intracellular GSH levels and up-regulated bcl-2 gene expression, under the control of Nrf2. This work underlies that chemical reactivity may control Nrf2-dependent gene expression leading to different cytoprotective mechanisms in DC. - Highlights: • Nrf2 controls cell death induced by contact sensitizers in dendritic cells. • DNCB reduced GSH levels and up-regulated bcl-2 gene expression unlike CinA. • Chemical reactivity controls Nrf2-dependent genes having protective effect in DC.

  17. Nrf2 pathway modulates Substance P-induced human mast cell activation and degranulation in the hair follicle.

    Science.gov (United States)

    Jadkauskaite, Laura; Bahri, Rajia; Farjo, Nilofer; Farjo, Bessam; Jenkins, Gail; Bhogal, Ranjit; Haslam, Iain; Bulfone-Paus, Silvia; Paus, Ralf

    2018-05-30

    Activation of Nrf2 in primary human mast cells exposed to oxidative stress induced by substance P suppresses pro-inflammatory gene transcription, activation and degranulation. Copyright © 2018. Published by Elsevier Inc.

  18. Nrf2 activation ameliorates cytotoxic effects of arsenic trioxide in acute promyelocytic leukemia cells through increased glutathione levels and arsenic efflux from cells

    Energy Technology Data Exchange (ETDEWEB)

    Nishimoto, Shoichi; Suzuki, Toshihiro; Koike, Shin [Department of Analytical Biochemistry, Meiji Pharmaceutical University, 2-522-1 Noshio, Kiyose, Tokyo 204-8588 (Japan); Yuan, Bo; Takagi, Norio [Department of Applied Biochemistry, School of Pharmacy, Tokyo University of Pharmacy and Life Sciences, Hachioji, Tokyo 192-0392 (Japan); Ogasawara, Yuki, E-mail: yo@my-pharm.ac.jp [Department of Analytical Biochemistry, Meiji Pharmaceutical University, 2-522-1 Noshio, Kiyose, Tokyo 204-8588 (Japan)

    2016-08-15

    Carnosic acid (CA), a phenolic diterpene isolated from Rosmarinus officinalis, has been shown to activate nuclear transcription factor E2-related factor 2 (Nrf2), which plays a central role in cytoprotective responses to oxidative and electrophilic stress. Recently, the Nrf2-Kelch ECH associating protein 1 (Keap1) pathway has been associated with cancer drug resistance attributable to modulation of the expression and activation of antioxidant and detoxification enzymes. However, the exact mechanisms by which Nrf2 activation results in chemoresistance are insufficiently understood to date. This study investigated the mechanisms by which the cytotoxic effects of arsenic trioxide (ATO), an anticancer drug, were decreased in acute promyelocytic leukemia cells treated with CA, a typical activator of Nrf2 used to stimulate the Nrf2/Keap1 system. Our findings suggest that arsenic is non-enzymatically incorporated into NB4 cells and forms complexes that are dependent on intracellular glutathione (GSH) concentrations. In addition, the arsenic complexes are recognized as substrates by multidrug resistance proteins and subsequently excreted from the cells. Therefore, Nrf2-associated activation of the GSH biosynthetic pathway, followed by increased levels of intracellular GSH, are key mechanisms underlying accelerated arsenic efflux and attenuation of the cytotoxic effects of ATO. - Highlights: • Nrf2 activation attenuates the effect of arsenic trioxide to acute promyelocytic leukemia cells. • The sensitivity of arsenic trioxide to NB4 cells was dependent on efflux rate of arsenic. • Activation of the GSH biosynthesis is essential in Nrf2-regulated responses for arsenic efflux.

  19. Beneficial Role of Some Natural Products to Attenuate the Diabetic Cardiomyopathy Through Nrf2 Pathway in Cell Culture and Animal Models.

    Science.gov (United States)

    Sathibabu Uddandrao, V V; Brahmanaidu, Parim; Nivedha, P R; Vadivukkarasi, S; Saravanan, Ganapathy

    2017-10-27

    Diabetic cardiomyopathy, as one of the main cardiac complications in diabetic patients, is identified to connect with oxidative stress that is due to interruption in balance between reactive oxygen species or/and reactive nitrogen species generation and their clearance by antioxidant protection systems. Transcription factor the nuclear factor erythroid 2-related factor 2 (Nrf2) plays a significant role in maintaining the oxidative homeostasis by regulating multiple downstream antioxidants. The Nrf2 plays a significant role in ARE-mediated basal and inducible expression of more than 200 genes that can be grouped into numerous categories as well as antioxidant genes and phase II detoxifying enzymes. On the other hand, activation of Nrf2 by natural and synthetic therapeutics or antioxidants has been revealed effective for the prevention and treatment of toxicities and diseases connected with oxidative stress. Hence, recently focus has been shifted toward plants and plant-based medicines in curing such chronic diseases, as they are supposed to be less toxic. In this review, we focused on the role of some natural products on diabetic cardiomyopathy through Nrf2 pathway.

  20. Maresin 1 Ameliorates Lung Ischemia/Reperfusion Injury by Suppressing Oxidative Stress via Activation of the Nrf-2-Mediated HO-1 Signaling Pathway

    Directory of Open Access Journals (Sweden)

    Quanchao Sun

    2017-01-01

    Full Text Available Lung ischemia/reperfusion (I/R injury occurs in various clinical conditions and heavily damaged lung function. Oxidative stress reaction and antioxidant enzymes play a pivotal role in the etiopathogenesis of lung I/R injury. In the current study, we investigated the impact of Maresin 1 on lung I/R injury and explored the possible mechanism involved in this process. MaR 1 ameliorated I/R-induced lung injury score, wet/dry weight ratio, myeloperoxidase, tumor necrosis factor, bronchoalveolar lavage fluid (BALF leukocyte count, BALF neutrophil ratio, and pulmonary permeability index levels in lung tissue. MaR 1 significantly reduced ROS, methane dicarboxylic aldehyde, and 15-F2t-isoprostane generation and restored antioxidative enzyme (superoxide dismutase, glutathione peroxidase, and catalase activities. Administration of MaR 1 improved the expression of nuclear Nrf-2 and cytosolic HO-1 in I/R-treated lung tissue. Furthermore, we also found that the protective effects of MaR 1 on lung tissue injury and oxidative stress were reversed by HO-1 activity inhibitor, Znpp-IX. Nrf-2 transcription factor inhibitor, brusatol, significantly decreased MaR 1-induced nuclear Nrf-2 and cytosolic HO-1 expression. In conclusion, these results indicate that MaR 1 protects against lung I/R injury through suppressing oxidative stress. The mechanism is partially explained by activation of the Nrf-2-mediated HO-1 signaling pathway.

  1. Nrf2 activation prevents cadmium-induced acute liver injury

    International Nuclear Information System (INIS)

    Wu, Kai C.; Liu, Jie J.; Klaassen, Curtis D.

    2012-01-01

    Oxidative stress plays an important role in cadmium-induced liver injury. Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcription factor that up-regulates cytoprotective genes in response to oxidative stress. To investigate the role of Nrf2 in cadmium-induced hepatotoxicity, Nrf2-null mice, wild-type mice, kelch-like ECH-associated protein 1-knockdown (Keap1-KD) mice with enhanced Nrf2, and Keap1-hepatocyte knockout (Keap1-HKO) mice with maximum Nrf2 activation were treated with cadmium chloride (3.5 mg Cd/kg, i.p.). Blood and liver samples were collected 8 h thereafter. Cadmium increased serum alanine aminotransferase (ALT) and lactate dehydrogenase (LDH) activities, and caused extensive hepatic hemorrhage and necrosis in the Nrf2-null mice. In contrast, Nrf2-enhanced mice had lower serum ALT and LDH activities and less morphological alternations in the livers than wild-type mice. H 2 DCFDA (2′,7′-dichlorodihydrofluoresein diacetate) staining of primary hepatocytes isolated from the four genotypes of mice indicated that oxidative stress was higher in Nrf2-null cells, and lower in Nrf2-enhanced cells than in wild-type cells. To further investigate the mechanism of the protective effect of Nrf2, mRNA of metallothionein (MT) and other cytoprotective genes were determined. Cadmium markedly induced MT-1 and MT-2 in livers of all four genotypes of mice. In contrast, genes involved in glutathione synthesis and reducing reactive oxygen species, including glutamate-cysteine ligase (Gclc), glutathione peroxidase-2 (Gpx2), and sulfiredoxin-1 (Srxn-1) were only induced in Nrf2-enhanced mice, but not in Nrf2-null mice. In conclusion, the present study shows that Nrf2 activation prevents cadmium-induced oxidative stress and liver injury through induction of genes involved in antioxidant defense rather than genes that scavenge Cd. -- Highlights: ► Cadmium caused extensive hepatic hemorrhage and necrosis in Nrf2-null mice. ► Keap1-KD and Keap1-HKO mice were

  2. Nrf2 activation prevents cadmium-induced acute liver injury

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Kai C. [Department of Pharmacology, Toxicology, and Therapeutics, University of Kansas Medical Center, Kansas City, KS (United States); Liu, Jie J. [Department of Internal Medicine, University of Kansas Medical Center, Kansas City, KS (United States); Klaassen, Curtis D., E-mail: cklaasse@kumc.edu [Department of Internal Medicine, University of Kansas Medical Center, Kansas City, KS (United States)

    2012-08-15

    Oxidative stress plays an important role in cadmium-induced liver injury. Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcription factor that up-regulates cytoprotective genes in response to oxidative stress. To investigate the role of Nrf2 in cadmium-induced hepatotoxicity, Nrf2-null mice, wild-type mice, kelch-like ECH-associated protein 1-knockdown (Keap1-KD) mice with enhanced Nrf2, and Keap1-hepatocyte knockout (Keap1-HKO) mice with maximum Nrf2 activation were treated with cadmium chloride (3.5 mg Cd/kg, i.p.). Blood and liver samples were collected 8 h thereafter. Cadmium increased serum alanine aminotransferase (ALT) and lactate dehydrogenase (LDH) activities, and caused extensive hepatic hemorrhage and necrosis in the Nrf2-null mice. In contrast, Nrf2-enhanced mice had lower serum ALT and LDH activities and less morphological alternations in the livers than wild-type mice. H{sub 2}DCFDA (2′,7′-dichlorodihydrofluoresein diacetate) staining of primary hepatocytes isolated from the four genotypes of mice indicated that oxidative stress was higher in Nrf2-null cells, and lower in Nrf2-enhanced cells than in wild-type cells. To further investigate the mechanism of the protective effect of Nrf2, mRNA of metallothionein (MT) and other cytoprotective genes were determined. Cadmium markedly induced MT-1 and MT-2 in livers of all four genotypes of mice. In contrast, genes involved in glutathione synthesis and reducing reactive oxygen species, including glutamate-cysteine ligase (Gclc), glutathione peroxidase-2 (Gpx2), and sulfiredoxin-1 (Srxn-1) were only induced in Nrf2-enhanced mice, but not in Nrf2-null mice. In conclusion, the present study shows that Nrf2 activation prevents cadmium-induced oxidative stress and liver injury through induction of genes involved in antioxidant defense rather than genes that scavenge Cd. -- Highlights: ► Cadmium caused extensive hepatic hemorrhage and necrosis in Nrf2-null mice. ► Keap1-KD and Keap1-HKO mice

  3. Synergy between the KEAP1/NRF2 and PI3K Pathways Drives Non-Small-Cell Lung Cancer with an Altered Immune Microenvironment.

    Science.gov (United States)

    Best, Sarah A; De Souza, David P; Kersbergen, Ariena; Policheni, Antonia N; Dayalan, Saravanan; Tull, Dedreia; Rathi, Vivek; Gray, Daniel H; Ritchie, Matthew E; McConville, Malcolm J; Sutherland, Kate D

    2018-04-03

    The lung presents a highly oxidative environment, which is tolerated through engagement of tightly controlled stress response pathways. A critical stress response mediator is the transcription factor nuclear factor erythroid-2-related factor 2 (NFE2L2/NRF2), which is negatively regulated by Kelch-like ECH-associated protein 1 (KEAP1). Alterations in the KEAP1/NRF2 pathway have been identified in 23% of lung adenocarcinomas, suggesting that deregulation of the pathway is a major cancer driver. We demonstrate that inactivation of Keap1 and Pten in the mouse lung promotes adenocarcinoma formation. Notably, metabolites identified in the plasma of Keap1 f/f /Pten f/f tumor-bearing mice indicate that tumorigenesis is associated with reprogramming of the pentose phosphate pathway. Furthermore, the immune milieu was dramatically changed by Keap1 and Pten deletion, and tumor regression was achieved utilizing immune checkpoint inhibition. Thus, our study highlights the ability to exploit both metabolic and immune characteristics in the detection and treatment of lung tumors harboring KEAP1/NRF2 pathway alterations. Copyright © 2018 Elsevier Inc. All rights reserved.

  4. Characterization of the Antioxidant Effects of γ-Oryzanol: Involvement of the Nrf2 Pathway

    OpenAIRE

    W. Rungratanawanich; G. Abate; M. M. Serafini; M. Guarienti; M. Catanzaro; M. Marziano; M. Memo; C. Lanni; D. Uberti

    2018-01-01

    γ-Oryzanol (ORY) is well known for its antioxidant potential. However, the mechanism by which ORY exerts its antioxidant effect is still unclear. In this paper, the antioxidant properties of ORY were investigated for its potential effects as a reactive oxygen and nitrogen species (ROS/RNS) scavenger and in activating antioxidant-promoting intracellular pathways utilizing the human embryonic kidney cells (HEK-293). The 24 h ORY exposure significantly prevented hydrogen peroxide- (H2O2-) induce...

  5. Ameliorating mitochondrial dysfunction restores carbon ion-induced cognitive deficits via co-activation of NRF2 and PINK1 signaling pathway.

    Science.gov (United States)

    Liu, Yang; Yan, Jiawei; Sun, Cao; Li, Guo; Li, Sirui; Zhang, Luwei; Di, Cuixia; Gan, Lu; Wang, Yupei; Zhou, Rong; Si, Jing; Zhang, Hong

    2018-07-01

    Carbon ion therapy is a promising modality in radiotherapy to treat tumors, however, a potential risk of induction of late normal tissue damage should still be investigated and protected. The aim of the present study was to explore the long-term cognitive deficits provoked by a high-linear energy transfer (high-LET) carbon ions in mice by targeting to hippocampus which plays a crucial role in memory and learning. Our data showed that, one month after 4 Gy carbon ion exposure, carbon ion irradiation conspicuously resulted in the impaired cognitive performance, neurodegeneration and neuronal cell death, as well as the reduced mitochondrial integrity, the disrupted activities of tricarboxylic acid cycle flux and electron transport chain, and the depressed antioxidant defense system, consequently leading to a decline of ATP production and persistent oxidative damage in the hippocampus region. Mechanistically, we demonstrated the disruptions of mitochondrial homeostasis and redox balance typically characterized by the disordered mitochondrial dynamics, mitophagy and glutathione redox couple, which is closely associated with the inhibitions of PINK1 and NRF2 signaling pathway as the key regulators of molecular responses in the context of neurotoxicity and neurodegenerative disorders. Most importantly, we found that administration with melatonin as a mitochondria-targeted antioxidant promoted the PINK1 accumulation on the mitochondrial membrane, and augmented the NRF2 accumulation and translocation. Moreover, melatonin pronouncedly enhanced the molecular interplay between NRF2 and PINK1. Furthermore, in the mouse hippocampal neuronal cells, overexpression of NRF2/PINK1 strikingly protected the hippocampal neurons from carbon ion-elicited toxic insults. Thus, these data suggest that alleviation of the sustained mitochondrial dysfunction and oxidative stress through co-modulation of NRF2 and PINK1 may be in charge of restoration of the cognitive impairments in a mouse

  6. Ginsenoside Rb1 improves postoperative fatigue syndrome by reducing skeletal muscle oxidative stress through activation of the PI3K/Akt/Nrf2 pathway in aged rats.

    Science.gov (United States)

    Zhuang, Cheng-Le; Mao, Xiang-Yu; Liu, Shu; Chen, Wei-Zhe; Huang, Dong-Dong; Zhang, Chang-Jing; Chen, Bi-Cheng; Shen, Xian; Yu, Zhen

    2014-10-05

    Ginsenoside Rb1 is reported to possess anti-fatigue activity, but the mechanisms remain unknown. The aim of this study was to investigate the molecular mechanisms responsible for the anti-fatigue effect of ginsenoside Rb1 on postoperative fatigue syndrome induced by major small intestinal resection (MSIR) in aged rat. Aged rats with MSIR were administrated with ginsenoside Rb1 (15 mg/kg) once a day from 3 days before surgery to the day of sacrifice, or with saline as corresponding controls. Rats without MSIR but going through the same surgery procedure were administrated with saline as blank controls. Anti-fatigue effect was assessed by an open field test; superoxide dismutase, reactive oxygen species and malondialdehyde in skeletal muscle were determined. The mRNA levels of Akt2 and Nrf2 in skeletal muscle were measured by real-time quantitative PCR. The activation of Akt and Nrf2 was examined by western blot and immunohistofluorescence. Our results revealed that ginsenoside Rb1 significantly increased the journey and the rearing frequency, decreased the time of rest in aged rats with MSIR. In addition, ginsenoside Rb1 significantly reduced reactive oxygen species and malondialdehyde release and increased the superoxide dismutase activity of skeletal muscle in aged rats with MSIR. Ginsenoside Rb1 also increased the expression of Akt2 and Nrf2 mRNA, up-regulated Akt phosphorylation and Nrf2 nuclear translocation. These findings indicate that ginsenoside Rb1 has an anti-fatigue effect on postoperative fatigue syndrome in aged rat, and the mechanism possibly involves activation of the PI3K/Akt pathway with subsequent Nrf2 nuclear translocation and induction of antioxidant enzymes. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Nrf2 mediates redox adaptations to exercise

    Directory of Open Access Journals (Sweden)

    Aaron J. Done

    2016-12-01

    Full Text Available The primary aim of this review is to summarize the current literature on the effects of acute exercise and regular exercise on nuclear factor erythroid 2-related factor 2 (Nrf2 activity and downstream targets of Nrf2 signaling. Nrf2 (encoded in humans by the NFE2L2 gene is the master regulator of antioxidant defenses, a transcription factor that regulates expression of more than 200 cytoprotective genes. Increasing evidence indicates that Nrf2 signaling plays a key role in how oxidative stress mediates the beneficial effects of exercise. Episodic increases in oxidative stress induced through bouts of acute exercise stimulate Nrf2 activation and when applied repeatedly, as with regular exercise, leads to upregulation of endogenous antioxidant defenses and overall greater ability to counteract the damaging effects of oxidative stress. The evidence of Nrf2 activation in response to exercise across variety of tissues may be an important mechanism of how exercise exerts its well-known systemic effects that are not limited to skeletal muscle and myocardium. Additionally there are emerging data that results from animal studies translate to humans.

  8. The angiogenic related functions of bone marrow mesenchymal stem cells are promoted by CBDL rat serum via the Akt/Nrf2 pathway

    Energy Technology Data Exchange (ETDEWEB)

    Shen, Cheng-Cheng; Chen, Bing; Gu, Jian-Teng; Ning, Jiao-Lin; Chen, Lin; Zeng, Jing; Yi, Bin, E-mail: yibin1974@163.com; Lu, Kai-Zhi, E-mail: lukaizhi2010@163.com

    2016-05-15

    Hepatopulmonary syndrome (HPS) is a complication of severe liver disease. It is characterized by an arterial oxygenation defect. Recent studies have demonstrated that pulmonary angiogenesis contributes to the abnormal gas exchange found in HPS. Additionally, mesenchymal stem cells (MSCs) are considered the stable source of VEGF-producing cells and have the potential to differentiate into multiple cell types. However, it has not been determined whether bone marrow mesenchymal stem cells (BM-MSCs) are mobilized and involved in the pulmonary angiogenesis in HPS. In this study, a CFU-F assay showed that the number of peripheral blood MSCs was increased in common bile duct ligation (CBDL) rats; however, there was no significant difference found in the number of BM-MSCs. In vitro, CBDL rat serum induced the overexpression of CXCR4 and PCNA in BM-MSCs. Consistently, the directional migration as well as the proliferation ability of BM-MSCs were enhanced by CBDL rat serum, as determined by a transwell migration and MTT assays. Moreover, the secretion of VEGF by BM-MSCs increased after treatment with CBDL rat serum. We also found that the expression of phospho-Akt, phospho-ERK, and Nrf2 in BM-MSCs was significantly up-regulated by CBDL rat serum in a time dependent manner, and the blockage of the Akt/Nrf2 signalling pathway with an Akt Inhibitor or Nrf2 siRNA, instead of an ERK inhibitor, attenuated the migration, proliferation and paracrine capacity of BM-MSCs. In conclusion, these findings indicated that the number of MSCs increased in the peripheral blood of CBDL rats, and the Akt/Nrf2 pathway plays a vital role in promoting the angiogenic related functions of BM-MSCs, which could be a potent contributor to pulmonary angiogenesis in HPS. - Highlights: • Peripheral blood MSCs was increased in CBDL rats; however, the difference found for the number of BM-MSCs was not significant. • The directional migration, proliferation and ability to secrete VEGF of BM-MSCs were

  9. Glaucocalyxin B Alleviates Lipopolysaccharide-Induced Parkinson’s Disease by Inhibiting TLR/NF-κB and Activating Nrf2/HO-1 Pathway

    Directory of Open Access Journals (Sweden)

    Wei Xu

    2017-12-01

    Full Text Available Background/Aims: Parkinson’s disease (PD is a common neurodegenerative disease in the old population, characterized by dopaminergic neuron loss, inflammation and oxidative stress injury in the substantia nigra. Glaucocalyxin B (GLB, an ent-kauranoid diterpenoid isolated from Rabdosia japonica, has anti-inflammation and anti-tumor effects. However, its effects on PD remain unclear. Methods: PD was introduced in rats via injection of lipopolysaccharide (LPS into cerebral corpus striatum, and GLB was given intracerebroventricularly to these rats. Their walking, climbing and sensory states were detected by Stepping, Whisker and Cylinder Tests. The expression of tyrosine hydroxylase (TH, glial fibrillary acidic protein (GFAP, CD11b and ionized calcium binding adaptor molecule (IBA-1 were detected by immunohischemical staining. The levels of a series of inflammatory factors, oxidative stress-related factors and apoptosis-related factors were measured by real-time PCR, immunoblotting and ELISA. In addition, Toll-like receptor (TLR/nuclear factor kappa B (NF-κB and nuclear factor erythroid 2-related factor 2 (Nrf2/heme oxygenase (HO-1 pathways were investigated to illustrate the underlying mechanism. In vitro, microglial cells exposed to LPS were treated with GLB. Results: The injection of LPS caused walking, climbing and sensory disturbances in rats, induced inflammation, oxidative stress response and apoptosis, and activated TLR/NF-κB and Nrf2/ HO-1 pathways in the cerebral tissue. GLB administration attenuated LPS-induced alterations. The TLR/NF-κB pathway was deactivated and Nrf2/HO-1 was activated after application of GLB. In vitro, cytotoxic effects induced by the conditioned medium derived from microglial cells exposed to LPS in PC12 cells were attenuated by GLB. Conclusion: GLB suppresses LPS-induced PD symptoms by modification of TLR/NF-κB and Nrf2/HO-1 pathways in vivo and in vitro.

  10. Trimetazidine protects retinal ganglion cells from acute glaucoma via the Nrf2/Ho-1 pathway.

    Science.gov (United States)

    Wan, Peixing; Su, Wenru; Zhang, Yingying; Li, Zhidong; Deng, Caibin; Zhuo, Yehong

    2017-09-15

    Acute glaucoma is one of the leading causes of irreversible vision impairment characterized by the rapid elevation of intraocular pressure (IOP) and consequent retinal ganglion cell (RGC) death. Oxidative stress and neuroinflammation have been considered critical for the pathogenesis of RGC death in acute glaucoma. Trimetazidine (TMZ), an anti-ischemic drug, possesses antioxidative and anti-inflammatory properties, contributing to its therapeutic potential in tissue damage. However, the role of TMZ in acute glaucoma and the underlying molecular mechanisms remain elusive. Here, we report that treatment with TMZ significantly attenuated retinal damage and RGC death in mice with acute glaucoma, with a significant decrease in reactive oxygen species (ROS) and inflammatory cytokine production in the retina. Furthermore, TMZ treatment directly decreased ROS production and rebalanced the intracellular redox state, thus contributing to the survival of RGCs in vitro TMZ treatment also reduced the production of inflammatory cytokines in vitro Mechanistically, the TMZ-mediated inhibition of apoptosis and inflammatory cytokine production in RGCs occurred via the regulation of the nuclear factor erythroid 2-related factor 2/heme oxygenase 1/caspase-8 pathway. Moreover, the TMZ-mediated neuroprotection in acute glaucoma was abrogated when an HO-1 inhibitor, SnPP, was used. Our findings identify potential mechanisms of RGC apoptosis and propose a novel therapeutic agent, TMZ, which exerts a precise neuroprotective effect against acute glaucoma. © 2017 The Author(s).

  11. Induction of 26S proteasome subunit PSMB5 by the bifunctional inducer 3-methylcholanthrene through the Nrf2-ARE, but not the AhR/Arnt-XRE, pathway

    International Nuclear Information System (INIS)

    Kwak, Mi-Kyoung; Kensler, Thomas W.

    2006-01-01

    The 26S proteasome is responsible for degradation of abnormal intracellular proteins, including oxidatively damaged proteins and may play a role as a component of a cellular antioxidative system. However, little is known about regulation of proteasome expression. In the present study, regulation of proteasome expression by the bifunctional enzyme inducer and a specific signaling pathway for this regulation were investigated in murine neuroblastoma cells. Expression of catalytic core subunits including PSMB5 and peptidase activities of the proteasome were elevated following incubation with 3-methylcholanthrene (3-MC). Studies using reporter genes containing the murine Psmb5 promoter showed that transcriptional activity of this gene was enhanced by 3-MC. Overexpression of AhR/Arnt did not affect activation of the Pmsb5 promoter by 3-MC and deletion of the xenobiotic response elements (XREs) from this promoter exerted modest effects on inducibility in response to 3-MC. However, mutation of the proximal AREs of the Psmb5 promoter largely abrogated its inducibility by 3-MC. In addition, this promoter showed a blunted response toward 3-MC in the absence of nrf2; 3-MC incubation increased nuclear levels of Nrf2 only in wild-type cells. Collectively, these results indicate that expression of proteasome subunit PSMB5 is modulated by bifunctional enzyme inducers in a manner independent of the AhR/Arnt-XRE pathway but dependent upon the Nrf2-ARE pathway

  12. Hydrogen-Rich Water Intake Accelerates Oral Palatal Wound Healing via Activation of the Nrf2/Antioxidant Defense Pathways in a Rat Model

    Science.gov (United States)

    Orihuela-Campos, Rita Cristina; Fukui, Makoto; Ito, Hiro-O

    2016-01-01

    The wound healing process attempts to restore the integrity and function of the injured tissue. Additionally, proinflammatory cytokines, growth factors, and oxidative stress play important roles in wound healing. The aim of this study was to determine whether hydrogen-rich water intake induces the activation of the Nrf2/antioxidant defense pathway in rat palatal tissue, thereby reducing systemic oxidative stress and proinflammatory cytokine levels and promoting healing-associated genes. A circular excisional wound was created in the oral palatal region, and the wound healing process was observed. The rats were divided into two experimental groups in which either hydrogen-rich water or distilled water was consumed. In the drinking hydrogen-rich water, the palatal wound healing process was accelerated compared to that in the control group. As molecular hydrogen upregulated the Nrf2 pathway, systemic oxidative stresses were decreased by the activation of antioxidant activity. Furthermore, hydrogen-rich water intake reduced proinflammatory cytokine levels and promoted the expression of healing-associated factors in rat palatal tissue. In conclusion, hydrogen-rich water intake exhibited multiple beneficial effects through activation of the Nrf2/antioxidant defense pathway. The results of this study support the hypothesis that oral administration of hydrogen-rich water benefits the wound healing process by decreasing oxidative stress and inflammatory responses. PMID:26798423

  13. Therapeutic advantage of pro-electrophilic drugs to activate the Nrf2/ARE pathway in Alzheimer's disease models.

    Science.gov (United States)

    Lipton, Stuart A; Rezaie, Tayebeh; Nutter, Anthony; Lopez, Kevin M; Parker, James; Kosaka, Kunio; Satoh, Takumi; McKercher, Scott R; Masliah, Eliezer; Nakanishi, Nobuki

    2016-12-01

    Alzheimer's disease (AD) is characterized by synaptic and neuronal loss, which occurs at least partially through oxidative stress induced by oligomeric amyloid-β (Aβ)-peptide. Carnosic acid (CA), a chemical found in rosemary and sage, is a pro-electrophilic compound that is converted to its active form by oxidative stress. The active form stimulates the Keap1/Nrf2 transcriptional pathway and thus production of phase 2 antioxidant enzymes. We used both in vitro and in vivo models. For in vitro studies, we evaluated protective effects of CA on primary neurons exposed to oligomeric Aβ. For in vivo studies, we used two transgenic mouse models of AD, human amyloid precursor protein (hAPP)-J20 mice and triple transgenic (3xTg AD) mice. We treated these mice trans-nasally with CA twice weekly for 3 months. Subsequently, we performed neurobehavioral tests and quantitative immunohistochemistry to assess effects on AD-related phenotypes, including learning and memory, and synaptic damage. In vitro, CA reduced dendritic spine loss in rat neurons exposed to oligomeric Aβ. In vivo, CA treatment of hAPP-J20 mice improved learning and memory in the Morris water maze test. Histologically, CA increased dendritic and synaptic markers, and decreased astrogliosis, Aβ plaque number, and phospho-tau staining in the hippocampus. We conclude that CA exhibits therapeutic benefits in rodent AD models and since the FDA has placed CA on the 'generally regarded as safe' (GRAS) list, thus obviating the need for safety studies, human clinical trials will be greatly expedited.

  14. Procyanidin B2 ameliorates carrageenan-induced chronic nonbacterial prostatitis in rats via anti-inflammatory and activation of the Nrf2 pathway.

    Science.gov (United States)

    Wang, Wei; Chen, Renzong; Wang, Jiye

    2017-11-04

    Prostatitis is one of the most prevalent problems in andriatry and urinary surgery. In the present study, we evaluated the effect of procyanidin B2 (PB) on carrageenan-induced chronic nonbacterial prostatitis in rats. Results showed that PB significantly decreased the prostatic index and enhanced the body weight inhibited by carrageenan. Biochemical results revealed that PB significantly lowered the prostatic specific antigen (PSA) and alleviated oxidative stress in serum. The levels of TNF-α, IL-6, and IL-10 in prostatic homogenate were also significantly decreased after PB treatment. We also found evidence that PB treatment reversed the suppression of Nrf2 nuclear translocation, and increased the expressions of NQO1 and HO-1 in the prostate glands. In conclusion, treatment with PB attenuates carrageenan-induced chronic nonbacterial prostatitis via anti-inflammatory and activation of the Nrf2 pathway. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Regulation by Phloroglucinol of Nrf2/Maf-Mediated Expression of Antioxidant Enzymes and Inhibition of Osteoclastogenesis via the RANKL/RANK Signaling Pathway: In Silico study

    Science.gov (United States)

    Rahim, Agus Hadian; Setiawan, Bambang; Dewi, Firli Rahmah Primula; Noor, Zairin

    2015-01-01

    Introduction: Phloroglucinol is an antioxidant compound with many positive effects on health. The purpose of this study was to determine the role of phloroglucinol in osteoclastogenesis via the RANKL/RANK signaling pathway and the activity of the transcription factor Nrf2. Material and methods: Analysis was performed in silico using the primary method of docking by the use of Hex 8.0 software and Haddock web server. Analysis of interactions was then performed to determine interactions between the ligand and its receptors by using the software LigPlus and LigandScout 3.1. Results: Results indicated that phloroglucinol compound was thought to inhibit osteoclastogenesis via three mechanisms: inhibiting RANKL−RANK interaction, sustaining the RANKL−OPG bond, and increasing the activity of the transcription factor Nrf2. PMID:26483597

  16. Tert-butylhydroquinone alleviates early brain injury and cognitive dysfunction after experimental subarachnoid hemorrhage: role of Keap1/Nrf2/ARE pathway.

    Directory of Open Access Journals (Sweden)

    Zhong Wang

    Full Text Available Tert-butylhydroquinone (tBHQ, an Nrf2 activator, has demonstrated neuroprotection against brain trauma and ischemic stroke in vivo. However, little work has been done with respect to its effect on early brain injury (EBI after subarachnoid hemorrhage (SAH. At the same time, as an oral medication, it may have extensive clinical applications for the treatment of SAH-induced cognitive dysfunction. This study was undertaken to evaluate the influence of tBHQ on EBI, secondary deficits of learning and memory, and the Keap1/Nrf2/ARE pathway in a rat SAH model. SD rats were divided into four groups: (1 Control group (n=40; (2 SAH group (n=40; (3 SAH+vehicle group (n=40; and (4 SAH+tBHQ group (n=40. All SAH animals were subjected to injection of autologous blood into the prechiasmatic cistern once in 20 s. In SAH+tBHQ group, tBHQ was administered via oral gavage at a dose of 12.5 mg/kg at 2 h, 12 h, 24 h, and 36 h after SAH. In the first set of experiments, brain samples were extracted and evaluated 48 h after SAH. In the second set of experiments, changes in cognition and memory were investigated in a Morris water maze. Results shows that administration of tBHQ after SAH significantly ameliorated EBI-related problems, such as brain edema, blood-brain barrier (BBB impairment, clinical behavior deficits, cortical apoptosis, and neurodegeneration. Learning deficits induced by SAH was markedly alleviated after tBHQ therapy. Treatment with tBHQ markedly up-regulated the expression of Keap1, Nrf2, HO-1, NQO1, and GSTα1 after SAH. In conclusion, the administration of tBHQ abated the development of EBI and cognitive dysfunction in this SAH model. Its action was probably mediated by activation of the Keap1/Nrf2/ARE pathway.

  17. Activation of the Nrf2/HO-1 Antioxidant Pathway Contributes to the Protective Effects of Lycium Barbarum Polysaccharides in the Rodent Retina after Ischemia-Reperfusion-Induced Damage

    Science.gov (United States)

    Chang, Raymond Chuen-Chung; So, Kwok-Fai; Brecha, Nicholas C.; Pu, Mingliang

    2014-01-01

    Lycium barbarum polysaccharides (LBP), extracts from the wolfberries, are protective to retina after ischemia-reperfusion (I/R). The antioxidant response element (ARE)–mediated antioxidant pathway plays an important role in maintaining the redox status of the retina. Heme oxygenase-1 (HO-1), combined with potent AREs in its promoter, is a highly effective therapeutic target for the protection against neurodegenerative diseases, including I/R-induced retinal damage. The aim of our present study was to investigate whether the protective effect of LBP after I/R damage was mediated via activation of the Nrf2/HO-1-antioxidant pathway in the retina. Retinal I/R was induced by an increase in intraocular pressure to 130 mm Hg for 60 minutes. Prior to the induction of ischemia, rats were orally treated with either vehicle (PBS) or LBP (1 mg/kg) once a day for 1 week. For specific experiments, zinc protoporphyrin (ZnPP, 20 mg/kg), an HO-1 inhibitor, was intraperitoneally administered at 24 h prior to ischemia. The protective effects of LBP were evaluated by quantifying ganglion cell and amacrine cell survival, and by measuring cell apoptosis in the retinal layers. In addition, HO-1 expression was examined using Western blotting and immunofluorescence analyses. Cytosolic and nuclear Nrf2 was measured using immunofluorescent staining. LBP treatment significantly increased Nrf2 nuclear accumulation and HO-1 expression in the retina after I/R injury. Increased apoptosis and a decrease in the number of viable cells were observed in the ganglion cell layer (GCL) and inner nuclear layer (INL) in the I/R retina, which were reversed by LBP treatment. The HO-1 inhibitor, ZnPP, diminished the LBP treatment-induced protective effects in the retina after I/R. Taken together, these results suggested that LBP partially exerted its beneficial neuroprotective effects via the activation of Nrf2 and an increase in HO-1 protein expression. PMID:24400114

  18. Protective Effects of Maillard Reaction Products of Whey Protein Concentrate against Oxidative Stress through an Nrf2-Dependent Pathway in HepG2 Cells.

    Science.gov (United States)

    Pyo, Min Cheol; Yang, Sung-Yong; Chun, Su-Hyun; Oh, Nam Su; Lee, Kwang-Won

    2016-09-01

    Whey protein concentrate (WPC), which contains α-lactalbumin and β-lactoglobulin, is utilized widely in the food industry. The Maillard reaction is a complex reaction that produces Maillard reaction products (MRPs), which are associated with the formation of antioxidant compounds. In this study, the hepatoprotection activity of MRPs of WPC against oxidative stress through the nuclear factor-E2-related factor 2 (Nrf2)-dependent antioxidant pathway in HepG2 cells was examined. Glucose-whey protein concentrate conjugate (Glc-WPC) was obtained from Maillard reaction between WPC and glucose. The fluorescence intensity of Glc-WPC increased after 7 d compared to native WPC, and resulted in loss of 48% of the free amino groups of WPC. The sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) patterns of Glc-WPC showed the presence of a high-molecular-weight portion. Treatment of HepG2 cells with Glc-WPC increased cell viability in the presence of oxidative stress, inhibited the generation of intracellular reactive oxygen species by tert-butyl hydroperoxide (t-BHP), and increased the glutathione level. Nrf2 translocation and Nrf2, reduced nicotinamide adenine dinucleotide phosphate (NAD(P)H)-quinone oxidoreductase 1 (NOQ1), heme oxygenase-1 (HO-1), glutamate-L-cysteine ligase (GCL)M and GCLC mRNA levels were increased by Glc-WPC. Also, Glc-WPC increased the phosphorylation of extracellular signal-regulated kinase (ERK) 1/2 and c-Jun N-terminal kinase (JNK). The results of this study demonstrate that Glc-WPC activates the Nrf2-dependent pathway through the phosphorylation of ERK1/2 and JNK in HepG2 cells, and induces production of antioxidant enzymes and phase II enzymes.

  19. Cudarflavone B Provides Neuroprotection against Glutamate-Induced Mouse Hippocampal HT22 Cell Damage through the Nrf2 and PI3K/Akt Signaling Pathways

    Directory of Open Access Journals (Sweden)

    Dong-Sung Lee

    2014-07-01

    Full Text Available Oxidative cell damage contributes to neuronal degeneration in many central nervous system (CNS diseases such as Alzheimer’s disease, Parkinson’s disease, and ischemia. Nrf2 signaling-mediated heme oxygenase (HO-1 expression acts against oxidants that are thought to play a key role in the pathogenesis of neuronal diseases. Cudraflavone B is a prenylated flavone isolated from C. tricuspidata which has shown anti-proliferative activity, mouse brain monoamine oxidase (MAO inhibitory effects, apoptotic actions in human gastric carcinoma cells and mouse melanoma cells, and hepatoprotective activity. In this study, cudraflavone B showed neuroprotective effects and reactive oxygen species (ROS inhibition against glutamate-induced neurotoxicity by inducing the expression of HO-1 in mouse hippocampal HT22 cells. Furthermore, cudraflavone B caused the nuclear accumulation of nuclear factor-E2-related factor 2 (Nrf2 and increased the promoter activity of antioxidant response elements (ARE in mouse hippocampal HT22 cells. In addition, we found that the Nrf2-midiated HO-1 expression by cudraflavone B is involved in the cell protective response and ROS reductions, and cudraflavone B-induced expression of HO-1 was mediated through the phosphatidylinositol 3-kinase (PI3K/Akt pathway in HT22 cells. Our results demonstrated the potential application of naturally occurring cudraflavone B as a therapeutic agent from neurodegenerative disease.

  20. Dioscin alleviates BDL- and DMN-induced hepatic fibrosis via Sirt1/Nrf2-mediated inhibition of p38 MAPK pathway

    Energy Technology Data Exchange (ETDEWEB)

    Gu, Lina; Tao, Xufeng; Xu, Youwei; Han, Xu; Qi, Yan; Xu, Lina; Yin, Lianhong; Peng, Jinyong, E-mail: jinyongpeng2014@163.com

    2016-02-01

    Oxidative stress is involved in hepatic stellate cells (HSCs) activation and extracellular matrix overproduction. We previously reported the promising effects of dioscin against CCl{sub 4}-induced liver fibrosis, but its effects and mechanisms on BDL- and DMN-induced liver fibrosis remain unknown. The results in the present study indicated that dioscin significantly inhibited HSCs activation and attenuated hepatic fibrosis in rats. Furthermore, dioscin markedly up-regulated the levels of sirtuin 1 (Sirt1), HO-1, GST, GCLC and GCLM via increasing the nuclear translocation of nuclear erythroid factor 2-related factor 2 (Nrf2), which in turn inhibited mitogen-activated protein kinase 14 (p38 MAPK) phosphorylation and reduced the levels of COL1A1, COL3A1, α-SMA and fibronectin. These results were further validated by knockdown of Sirt1 and Nrf2 using siRNAs silencing, and abrogation of p38 MAPK using SB-203580 (a p38 MAPK inhibitor) in HSC-T6 and LX-2 cells. Collectively, our findings confirmed the potent effects of dioscin against liver fibrosis and also provided novel insights into the mechanisms of this compound as a candidate for the prevention of liver fibrosis in the future. - Highlights: • Dioscin showed potent effects against BDL- and DMN-induced liver fibrosis in rats. • Dioscin significantly suppressed oxidative stress. • Dioscin triggered Sirt1/Nrf2-mediated inhibition of p38 MAPK pathway. • Dioscin should be developed as a novel candidate to treat liver fibrosis.

  1. Investigation of the effect of a panel of model hepatotoxins on the Nrf2-Keap1 defence response pathway in CD-1 mice

    International Nuclear Information System (INIS)

    Randle, Laura E.; Goldring, Chris E.P.; Benson, Craig A.; Metcalfe, Peter N.; Kitteringham, Neil R.; Park, B. Kevin; Williams, Dominic P.

    2008-01-01

    The Keap1-Nrf2-ARE signalling pathway has emerged as an important regulator of the mammalian defence system to enable detoxification and clearance of foreign chemicals. Recent studies by our group using paracetamol (APAP), diethylmaleate and buthionine sulphoximine have shown that for a given xenobiotic molecule, Nrf2 induction in the murine liver is associated with protein reactivity and glutathione depletion. Here, we have investigated, in vivo, whether the ability of four murine hepatotoxins, paracetamol, bromobenzene (BB), carbon tetrachloride (CCl 4 ) and furosemide (FS) to deplete hepatic glutathione (GSH) is related to induction of hepatic Nrf2 nuclear translocation and Nrf2-dependent gene expression. Additionally, we studied whether hepatic Nrf2 nuclear translocation is a general response during the early stages of acute hepatic chemical stress in vivo. Male CD-1 mice were administered APAP (3.5 mmol/kg), FS (1.21 mmol/kg), BB (4.8 mmol/kg) and CCl 4 (1 mmol/kg) for 1, 5 and 24 h. Each compound elicited significant serum ALT increases after 24 h (ALT U/L: APAP, 3036 ± 1462; BB, 5308 ± 2210; CCl 4 , 5089 ± 1665; FS, 2301 ± 1053), accompanied by centrilobular damage as assessed by histopathology. Treatment with APAP also elicited toxicity at a much earlier time point (5 h) than the other hepatotoxins (ALT U/L: APAP, 1780 ± 661; BB, 161 ± 15; CCl 4 , 90 ± 23; FS, 136 ± 27). Significant GSH depletion was seen with APAP (9.6 ± 1.7% of control levels) and BB (52.8 ± 6.2% of control levels) 1 h after administration, but not with FS and CCl 4 . Western Blot analysis revealed an increase in nuclear Nrf2, 1 h after administration of BB (209 ± 10% control), CCl 4 (146 ± 3% control) and FS (254 ± 41% control), however this was significantly lower than the levels observed in the APAP-treated mice (462 ± 36% control). The levels of Nrf2-dependent gene induction were also analysed by quantitative real-time PCR and Western blotting. Treatment with APAP for 1

  2. Proanthocyanidins Attenuation of Chronic Lead-Induced Liver Oxidative Damage in Kunming Mice via the Nrf2/ARE Pathway

    Directory of Open Access Journals (Sweden)

    Miao Long

    2016-10-01

    Full Text Available Lead is harmful for human health and animals. Proanthocyanidins (PCs, a natural antioxidant, possess a broad spectrum of pharmacological and medicinal properties. However, its protective effects against lead-induced liver damage have not been clarified. This study was aimed to evaluate the protective effect of PCs on the hepatotoxicity of male Kunming mice induced by chronic lead exposure. A total of 70 healthy male Kunming mice were averagely divided into four groups: control group, i.e., the group exposed to lead, the group treated with PCs, and the group co-treated with lead and PCs. The mice exposed to lead were given water containing 0.2% lead acetate. Mice treated in the PCs and PCs lead co-treated groups were given PC (100 mg/kg in 0.9% saline by oral gavage. Lead exposure caused a significant elevation in the liver function parameters, lead level, lipid peroxidation, and inhibition of antioxidant enzyme activities. The induction of oxidative stress and histological alterations in the liver were minimized by co-treatment with PCs. Meanwhile, the number of Transferase-Mediated Deoxyuridine Triphosphate-Biotin Nick End Labeling (TUNEL-positive cells was significantly reduced in the PCs/lead co-treated group compared to the lead group. In addition, the lead group showed an increase in the expression level of Bax, while the expression of Bcl-2 was decreased. Furthermore, the lead group showed an increase in the expression level of endoplasmic reticulum (ER stress-related genes and protein (GRP78 and CHOP. Co-treated with PCs significantly reversed these expressions in the liver. PCs were, therefore, demonstrated to have protective, antioxidant, and anti-ER stress and anti-apoptotic activities in liver damage caused by chronic lead exposure in the Kunming mouse. This may be due to the ability of PCs to enhance the ability of liver tissue to protect against oxidative stress via the Nrf2/ARE signaling pathway, resulting in decreasing ER stress

  3. Sulforaphane Prevents Testicular Damage in Kunming Mice Exposed to Cadmium via Activation of Nrf2/ARE Signaling Pathways

    Directory of Open Access Journals (Sweden)

    Shu-Hua Yang

    2016-10-01

    Full Text Available Sulforaphane (SFN is a natural and highly effective antioxidant. Studies suggest that SFN protects cells and tissues against cadmium (Cd toxicity. This study investigated the protective effect of SFN against oxidative damage in the testes of Kunming mice exposed to cadmium, and explored the possible molecular mechanisms involved. Cadmium greatly reduced the serum testosterone levels in mice, reduced sperm motility, total sperm count, and increased the sperm deformity rate. Cadmium also reduces superoxide dismutase (T-SOD and glutathione (GSH levels and increases malondialdehyde (MDA concentrations. SFN intervention improved sperm quality, serum testosterone, and antioxidant levels. Both mRNA and protein expression of mouse testicular nuclear factor-erythroid 2-related factor 2 (Nrf2 was reduced in cadmium-treated group. Furthermore, the downstream genes of Nrf2, glutathione peroxidase (GSH-Px, γ-glutamyl cysteine synthetase (γ-GCS, heme oxygenase-1 (HO-1, and NAD(PH:quinone oxidoreductase-1 (NQO1 were also decreased in cadmium-treated group. SFN intervention increases the expression of these genes. Sulforaphane prevents cadmium-induced testicular damage, probably via activation of Nrf2/ARE signaling.

  4. Inducers of Senescence, Toxic Compounds, and Senolytics: The Multiple Faces of Nrf2-Activating Phytochemicals in Cancer Adjuvant Therapy

    Directory of Open Access Journals (Sweden)

    Marco Malavolta

    2018-01-01

    Full Text Available The reactivation of senescence in cancer and the subsequent clearance of senescent cells are suggested as therapeutic intervention in the eradication of cancer. Several natural compounds that activate Nrf2 (nuclear factor erythroid-derived 2-related factor 2 pathway, which is involved in complex cytoprotective responses, have been paradoxically shown to induce cell death or senescence in cancer. Promoting the cytoprotective Nrf2 pathway may be desirable for chemoprevention, but it might be detrimental in later stages and advanced cancers. However, senolytic activity shown by some Nrf2-activating compounds could be used to target senescent cancer cells (particularly in aged immune-depressed organisms that escape immunosurveillance. We herein describe in vitro and in vivo effects of fifteen Nrf2-interacting natural compounds (tocotrienols, curcumin, epigallocatechin gallate, quercetin, genistein, resveratrol, silybin, phenethyl isothiocyanate, sulforaphane, triptolide, allicin, berberine, piperlongumine, fisetin, and phloretin on cellular senescence and discuss their use in adjuvant cancer therapy. In light of available literature, it can be concluded that the meaning and the potential of adjuvant therapy with natural compounds in humans remain unclear, also taking into account the existence of few clinical trials mostly characterized by uncertain results. Further studies are needed to investigate the therapeutic potential of those compounds that display senolytic activity.

  5. Potential Ameliorative Effects of Qing Ye Dan Against Cadmium Induced Prostatic Deficits via Regulating Nrf-2/HO-1 and TGF-β1/Smad Pathways.

    Science.gov (United States)

    Du, Lifen; Lei, Yongfang; Chen, Jinglou; Song, Hongping; Wu, Xinying

    2017-01-01

    Cadmium (Cd) is an environmental pollutant with reproductive toxicity. Swertia mileensis is used in Chinese medicine for the treatment of prostatic deficits and named as Qing Ye Dan (QYD). This study was undertaken to investigate the potential protective effects of QYD against Cd-induced prostatic deficits. Rat model of prostatic deficits was induced by 0.2 mg/kg/d CdCl2 subcutaneous injection for 15 days. The prostatic oxidative stress was evaluated by detecting the levels of malondialdehyde, nitric oxide, reduced/ oxidized glutathione, total sulfhydryl groups and enzymatic antioxidant status. The prostatic inflammation was estimated by testing the levels of pro-inflammatory cytokines. The levels of epithelial-mesenchymal transition (EMT) markers E-cadherin, fibronectin, vimentin and α-smooth muscle actin were measured by qPCR analysis. Additionally, the prostatic expressions of transforming growth factor-β1 (TGF-β1), type I TGF-β receptor (TGF-βRI), Smad2, phosphorylation-Smad2 (p-Smad2), Smad3, p-Smad3, Smad7, nuclear related factor-2 (Nrf-2), heme oxygenase-1 (HO-1), B-cell CLL/lymphoma (Bcl)-2 and Bcl-2-associated X protein (Bax) were measured by western blot assay. It was found that QYD ameliorated the Cd-induced prostatic oxidative stress and inflammation, attenuated prostatic EMT, inhibited the TGF-β1/Smad pathway, increased Bcl-2/Bax ratio and enhanced the activity of Nrf-2/HO-1 pathway. These results showed that QYD could ameliorate Cd-induced prostatic deficits via modulating Nrf-2/HO-1 and TGF-β1/Smad pathways. © 2017 The Author(s). Published by S. Karger AG, Basel.

  6. Flavonoids Derived from Abelmoschus esculentus Attenuates UV-B Induced Cell Damage in Human Dermal Fibroblasts Through Nrf2-ARE Pathway.

    Science.gov (United States)

    Patwardhan, Juilee; Bhatt, Purvi

    2016-05-01

    Ultraviolet-B (UV-B) radiation is a smaller fraction of the total radiation reaching the Earth but leads to extensive damage to the deoxyribonucleic acid (DNA) and other biomolecules through formation of free radicals altering redox homeostasis of the cell. Abelmoschus esculentus (okra) has been known in Ayurveda as antidiabetic, hypolipidemic, demulscent, antispasmodic, diuretic, purgative, etc. The aim of this study is to evaluate the protective effect of flavonoids from A. esculentus against UV-B-induced cell damage in human dermal fibroblasts. UV-B protective activity of ethyl acetate (EA) fraction of okra was studied against UV-B-induced cytotoxicity, antioxidant regulation, oxidative DNA damage, intracellular reactive oxygen species (ROS) generation, apoptotic morphological changes, and regulation of heme oxygenase-1 (HO-1) gene through nuclear factor E2-related factor 2-antioxidant response element (Nrf2-ARE) pathway. Flavonoid-rich EA fraction depicted a significant antioxidant potential also showing presence of rutin. Pretreatment of cells with EA fraction (10-30 μg/ml) prevented UV-B-induced cytotoxicity, depletion of endogenous enzymatic antioxidants, oxidative DNA damage, intracellular ROS production, apoptotic changes, and overexpression of Nrf2 and HO-1. Our study demonstrated for the 1(st) time that EA fraction of okra may reduce oxidative stress through Nrf2-ARE pathway as well as through endogenous enzymatic antioxidant system. These results suggested that flavonoids from okra may be considered as potential UV-B protective agents and may also be formulated into herbal sunscreen for topical application. Flavonoid-enriched ethyl acetate (EA) fraction from A. esculentus protected against ultraviolet-B (UV-B)-induced oxidative DNA damageEA fraction prevented UV-B-induced cytotoxicity, depletion of endogenous enzymatic antioxidants, and intracellular reactive oxygen species productionEA fraction could reduce oxidative stress through the Nrf2-ARE

  7. Paeonia lactiflora Pall. protects against ANIT-induced cholestasis by activating Nrf2 via PI3K/Akt signaling pathway

    Directory of Open Access Journals (Sweden)

    Ma X

    2015-09-01

    Full Text Available Xiao Ma,1,2 Yan-ling Zhao,2 Yun Zhu,3 Zhe Chen,1,2 Jia-bo Wang,4 Rui-yu Li,1,4 Chang Chen,1,2 Shi-zhang Wei,1,2 Jian-yu Li,3 Bing Liu,5 Rui-lin Wang,3 Yong-gang Li,3 Li-fu Wang,3 Xiao-he Xiao4 1Pharmacy College, Chengdu University of Traditional Chinese Medicine, Chengdu, People’s Republic of China; 2Department of Pharmacy, 302 Military Hospital of People’s Liberation Army, Beijing, People’s Republic of China; 3Department of Integrative Medical Center, 302 Military Hospital of People’s Liberation Army, Beijing, People’s Republic of China; 4China Military Institute of Chinese Medicine, 302 Military Hospital of People’s Liberation Army, Beijing, People’s Republic of China; 5School of Chinese Medicine, The University of Hong Kong, Hong Kong Background: Paeonia lactiflora Pall. (PLP, a traditional Chinese herbal medicine, has been used for hepatic disease treatment over thousands of years. In our previous study, PLP was shown to demonstrate therapeutic effect on hepatitis with severe cholestasis. The aim of this study was to evaluate the antioxidative effect of PLP on alpha-naphthylisothiocyanate (ANIT-induced cholestasis by activating NF-E2-related factor 2 (Nrf2 via phosphatidylinositol 3-kinase (PI3K/Akt signaling pathway. Materials and methods: Liquid chromatography-mass spectrometry (LC-MS was performed to identify the main compounds present in PLP. The mechanism of action of PLP and its therapeutic effect on cholestasis, induced by ANIT, were further investigated. Serum indices such as total bilirubin (TBIL, direct bilirubin (DBIL, aspartate aminotransferase (AST, alanine aminotransferase (ALT, alkaline phosphatase (ALP, γ-glutamyl transpeptidase (γ-GT, and total bile acid (TBA were measured, and histopathology of liver was also performed to determine the efficacy of treatment with PLP. Moreover, in order to illustrate the underlying signaling pathway, liver glutathione (GSH content and mRNA or protein levels of glutamate

  8. Protective effects of curcumin against mercury-induced hepatic injuries in rats, involvement of oxidative stress antagonism, and Nrf2-ARE pathway activation.

    Science.gov (United States)

    Liu, W; Xu, Z; Li, H; Guo, M; Yang, T; Feng, S; Xu, B; Deng, Yu

    2017-09-01

    Mercury (Hg) represents a ubiquitous environmental heavy metal that could lead to severe toxic effects in a variety of organs usually at a low level. The present study focused on the liver oxidative stress, one of the most important roles playing in Hg hepatotoxicity, by evaluation of different concentrations of mercuric chloride (HgCl 2 ) administration. Moreover, the protective potential of curcumin against Hg hepatotoxic effects was also investigated. Eighty-four rats were randomly divided into six groups for a three-days experiment: control, dimethyl sulfoxide control, HgCl 2 treatment (0.6, 1.2, and 2.4 mg kg -1 day -1 ), and curcumin pretreatment (100 mg kg -1 day -1 ) groups. Exposure of HgCl 2 resulted in acute dose-dependent hepatotoxic effects. Administration of 2.4 mg kg -1 HgCl 2 significantly elevated total Hg, nonprotein sulfhydryl, reactive oxygen species formation, malondialdehyde, apoptosis levels, serum lactate dehydrogenase, and alanine transaminase activities, with an impairment of superoxide dismutase and glutathione peroxidase in the liver. Moreover, HgCl 2 treatment activated nuclear factor-E2-related factor 2-antioxidant response element (Nrf2-ARE) signaling pathway in further investigation, with a significant upregulation of Nrf2, heme oxygenase-1, and γ-glutamylcysteine synthetase heavy subunit expression, relative to control. Pretreatment with curcumin obviously prevented HgCl 2 -induced liver oxidative stress, which may be due to its free radical scavenging or Nrf2-ARE pathway-inducing properties. Taking together these data suggest that curcumin counteracts HgCl 2 hepatotoxicity through antagonizing liver oxidative stress.

  9. 6-Shogaol, an active compound of ginger, alleviates allergic dermatitis-like skin lesions via cytokine inhibition by activating the Nrf2 pathway

    Energy Technology Data Exchange (ETDEWEB)

    Park, Gunhyuk, E-mail: uranos5@kiom.re.kr [The K-herb Research Center, Korea Institute of Oriental Medicine, 1672 Yuseong-daero, Yuseong-gu, Daejeon 34054 (Korea, Republic of); Oh, Dal-Seok [The K-herb Research Center, Korea Institute of Oriental Medicine, 1672 Yuseong-daero, Yuseong-gu, Daejeon 34054 (Korea, Republic of); Lee, Mi Gi; Lee, Chang Eon [Major in Cosmeceutical Science, Division of Bio-technology and Convergence, Daegu Haany University, Gyeongsan (Korea, Republic of); Kim, Yong-ung, E-mail: ykim@dhu.ac.kr [Department of Pharmaceutical Engineering, College of Biomedical Science, Daegu Haany University (Korea, Republic of)

    2016-11-01

    Allergic dermatitis (AD) clinically presents with skin erythematous plaques, eruption, and elevated serum IgE, and T helper cell type 2 and 1 (Th2 and Th1) cytokine levels. 6-Shogaol [1-(4-hydroxy-methoxyphenyl)-4-decen-one], a pungent compound isolated from ginger, has shown anti-inflammatory effects, but its inhibitory effects on AD are unknown. The aim of this study was to examine whether 6-shogaol inhibits AD-like skin lesions and their underlying mechanism in vivo and in vitro. An AD-like response was induced by tumor necrosis factor-α (TNF-α) + IFN-γ in human keratinocytes or by 2,4-dinitrochlorobenzene (DNCB) in mice. In vivo, 6-shogaol inhibited the development of DNCB-induced AD-like skin lesions and scratching behavior, and showed significant reduction in Th2/1-mediated inflammatory cytokines, IgE, TNF-α, IFN-γ, thymus and activation-regulated chemokine, IL-1, 4, 12, and 13, cyclooxygenase-2, and nitric oxide synthase levels. In vitro, 6-shogaol inhibited reactive oxygen species (ROS) and mitogen-activated protein kinases (MAPKs) signaling, and increased the levels of total glutathione, heme oxygenase-1, and quinone 1 via nuclear factor erythroid 2 related factor 2 (Nrf2) activation. 6-Shogaol can alleviate AD-like skin lesions by inhibiting immune mediators via regulating the ROS/MAPKs/Nrf2 signaling pathway, and may be an effective alternative therapy for AD. - Highlights: • 6-Shogaol inhibited Th2/1-mediated inflammatory mediators in vitro and in vivo. • 6-Shogaol regulated ROS/MAPKs/Nrf2 signaling pathway. • 6-Shogaol can protect against the development of AD-like skin lesions.

  10. Mangiferin exerts hepatoprotective activity against D-galactosamine induced acute toxicity and oxidative/nitrosative stress via Nrf2–NFκB pathways

    Energy Technology Data Exchange (ETDEWEB)

    Das, Joydeep; Ghosh, Jyotirmoy; Roy, Anandita; Sil, Parames C., E-mail: parames@bosemain.boseinst.ac.in

    2012-04-01

    Mangiferin, a xanthone glucoside, is well known to exhibit antioxidant, antiviral, antitumor, anti-inflammatory and gene-regulatory effects. In the present study, we isolated mangiferin from the bark of Mangifera indica and assessed its beneficial role in galactosamine (GAL) induced hepatic pathophysiology. GAL (400 mg/kg body weight) exposed hepatotoxic rats showed elevation in the activities of serum ALP, ALT, levels of triglycerides, total cholesterol, lipid-peroxidation and reduction in the levels of serum total proteins, albumin and cellular GSH. Besides, GAL exposure (5 mM) in hepatocytes induced apoptosis and necrosis, increased ROS and NO production. Signal transduction studies showed that GAL exposure significantly increased the nuclear translocation of NFκB and elevated iNOS protein expression. The same exposure also elevated TNF-α, IFN-γ, IL-1β, IL-6, IL-12, IL-18 and decreased IL-10 mRNA expressions. Furthermore, GAL also decreased the protein expression of Nrf2, NADPH:quinine oxidoreductase-1, heme oxygenase-1 and GSTα. However, mangiferin administration in GAL intoxicated rats or coincubation of hepatocytes with mangiferin significantly altered all these GAL-induced adverse effects. In conclusion, the hepatoprotective role of mangiferin was due to induction of antioxidant defense via the Nrf2 pathway and reduction of inflammation via NFκB inhibition. Highlights: ►Galactosamine induces hepatocytes death via oxidative and nitrosative stress. ►Mangiferin exerts hepatoprotective effect/antioxidant defense via Nrf2 pathway. ►Mangiferin exerts anti-inflammatory responses by inhibiting NF-κB. ►Mangiferin suppresses galactosamine-induced repression of IL-10 mRNA.

  11. 6-Shogaol, an active compound of ginger, alleviates allergic dermatitis-like skin lesions via cytokine inhibition by activating the Nrf2 pathway

    International Nuclear Information System (INIS)

    Park, Gunhyuk; Oh, Dal-Seok; Lee, Mi Gi; Lee, Chang Eon; Kim, Yong-ung

    2016-01-01

    Allergic dermatitis (AD) clinically presents with skin erythematous plaques, eruption, and elevated serum IgE, and T helper cell type 2 and 1 (Th2 and Th1) cytokine levels. 6-Shogaol [1-(4-hydroxy-methoxyphenyl)-4-decen-one], a pungent compound isolated from ginger, has shown anti-inflammatory effects, but its inhibitory effects on AD are unknown. The aim of this study was to examine whether 6-shogaol inhibits AD-like skin lesions and their underlying mechanism in vivo and in vitro. An AD-like response was induced by tumor necrosis factor-α (TNF-α) + IFN-γ in human keratinocytes or by 2,4-dinitrochlorobenzene (DNCB) in mice. In vivo, 6-shogaol inhibited the development of DNCB-induced AD-like skin lesions and scratching behavior, and showed significant reduction in Th2/1-mediated inflammatory cytokines, IgE, TNF-α, IFN-γ, thymus and activation-regulated chemokine, IL-1, 4, 12, and 13, cyclooxygenase-2, and nitric oxide synthase levels. In vitro, 6-shogaol inhibited reactive oxygen species (ROS) and mitogen-activated protein kinases (MAPKs) signaling, and increased the levels of total glutathione, heme oxygenase-1, and quinone 1 via nuclear factor erythroid 2 related factor 2 (Nrf2) activation. 6-Shogaol can alleviate AD-like skin lesions by inhibiting immune mediators via regulating the ROS/MAPKs/Nrf2 signaling pathway, and may be an effective alternative therapy for AD. - Highlights: • 6-Shogaol inhibited Th2/1-mediated inflammatory mediators in vitro and in vivo. • 6-Shogaol regulated ROS/MAPKs/Nrf2 signaling pathway. • 6-Shogaol can protect against the development of AD-like skin lesions.

  12. Upregulation of transcription factor NRF2-mediated oxidative stress response pathway in rat brain under short-term chronic hypobaric hypoxia.

    Science.gov (United States)

    Sethy, Niroj Kumar; Singh, Manjulata; Kumar, Rajesh; Ilavazhagan, Govindasamy; Bhargava, Kalpana

    2011-03-01

    Exposure to high altitude (and thus hypobaric hypoxia) induces electrophysiological, metabolic, and morphological modifications in the brain leading to several neurological clinical syndromes. Despite the known fact that hypoxia episodes in brain are a common factor for many neuropathologies, limited information is available on the underlying cellular and molecular mechanisms. In this study, we investigated the temporal effect of short-term (0-12 h) chronic hypobaric hypoxia on global gene expression of rat brain followed by detailed canonical pathway analysis and regulatory network identification. Our analysis revealed significant alteration of 33, 17, 53, 81, and 296 genes (p stress response pathway and genes were detected at all time points suggesting activation of NRF2-ARE antioxidant defense system. The results were further validated by assessing the expression levels of selected genes in temporal as well as brain regions with quantitative RT-PCR and western blot. In conclusion, our whole brain approach with temporal monitoring of gene expression patterns during hypobaric hypoxia has resulted in (1) deciphering sequence of pathways and signaling networks activated during onset of hypoxia, and (2) elucidation of NRF2-orchestrated antioxidant response as a major intrinsic defense mechanism. The results of this study will aid in better understanding and management of hypoxia-induced brain pathologies.

  13. The Crosstalk between Nrf2 and TGF-β1 in the Epithelial-Mesenchymal Transition of Pancreatic Duct Epithelial Cells.

    Directory of Open Access Journals (Sweden)

    Sarah Arfmann-Knübel

    Full Text Available Nrf2 and TGF-β1 both affect tumorigenesis in a dual fashion, either by preventing carcinogen induced carcinogenesis and suppressing tumor growth, respectively, or by conferring cytoprotection and invasiveness to tumor cells during malignant transformation. Given the involvement of Nrf2 and TGF-β1 in the adaptation of epithelial cells to persistent inflammatory stress, e.g. of the pancreatic duct epithelium during chronic pancreatitis, a crosstalk between Nrf2 and TGF-β1 can be envisaged. By using premalignant human pancreatic duct cells (HPDE and the pancreatic ductal adenocarcinoma cell line Colo357, we could show that Nrf2 and TGF-β1 independently but additively conferred an invasive phenotype to HPDE cells, whereas acting synergistically in Colo357 cells. This was accompanied by differential regulation of EMT markers like vimentin, Slug, L1CAM and E-cadherin. Nrf2 activation suppressed E-cadherin expression through an as yet unidentified ARE related site in the E-cadherin promoter, attenuated TGF-β1 induced Smad2/3-activity and enhanced JNK-signaling. In Colo357 cells, TGF-β1 itself was capable of inducing Nrf2 whereas in HPDE cells TGF-β1 per-se did not affect Nrf2 activity, but enhanced Nrf2 induction by tBHQ. In Colo357, but not in HPDE cells, the effects of TGF-β1 on invasion were sensitive to Nrf2 knock-down. In both cell lines, E-cadherin re-expression inhibited the proinvasive effect of Nrf2. Thus, the increased invasion of both cell lines relates to the Nrf2-dependent downregulation of E-cadherin expression. In line, immunohistochemistry analysis of human pancreatic intraepithelial neoplasias in pancreatic tissues from chronic pancreatitis patients revealed strong Nrf2 activity already in premalignant epithelial duct cells, accompanied by partial loss of E-cadherin expression. Our findings indicate that Nrf2 and TGF-β1 both contribute to malignant transformation through distinct EMT related mechanisms accounting for an

  14. Edaravone attenuates hippocampal damage in an infant mouse model of pneumococcal meningitis by reducing HMGB1 and iNOS expression via the Nrf2/HO-1 pathway.

    Science.gov (United States)

    Li, Zheng; Ma, Qian-Qian; Yan, Yan; Xu, Feng-Dan; Zhang, Xiao-Ying; Zhou, Wei-Qin; Feng, Zhi-Chun

    2016-09-01

    Edaravone (3-methyl-1-phenyl-2-pyrazolin-5-one) is a free radical scavenger that has shown potent antioxidant, anti-inflammatory and neuroprotective effects in variety of disease models. In this study, we investigated whether edaravone produced neuroprotective actions in an infant mouse model of pneumococcal meningitis. C57BL/6 mice were infected on postnatal d 11 by intracisternal injection of a certain inoculum of Streptococcus pneumoniae. The mice received intracisternal injection of 10 μL of saline containing edaravone (3 mg/kg) once a day for 7 d. The severity of pneumococcal meningitis was assessed with a clinical score. In mice with severe meningitis, the survival rate from the time of infection to d 8 after infection was analyzed using Kaplan-Meier curves. In mice with mild meningitis, the CSF inflammation and cytokine levels in the hippocampus were analyzed d 7 after infection, and the clinical neurological deficit score was evaluated using a neurological scoring system d 14 after infection. The nuclear factor (erythroid-derived 2)-like 2 knockout (Nrf2 KO) mice and heme oxygenase-1 knockout (HO-1 KO) mice were used to confirm the involvement of Nrf2/HO-1 pathway in the neuroprotective actions of edaravone. In mice with severe meningitis, edaravone treatment significantly increased the survival rate (76.4%) compared with the meningitis model group (32.2%). In mice with mild meningitis, edaravone treatment significantly decreased the number of leukocytes and TNF- levels in CSF, as well as the neuronal apoptosis and protein levels of HMGB1 and iNOS in the hippocampus, but did not affect the high levels of IL-10 and IL-6 in the hippocampus. Moreover, edaravone treatment significantly improved the neurological function of mice with mild meningitis. In Nrf2 KO or HO-1 KO mice with the meningitis, edaravone treatment was no longer effective in improving the survival rate of the mice with severe meningitis (20.2% and 53.6%, respectively), nor it affected the

  15. Fisetin Imparts Neuroprotection in Experimental Diabetic Neuropathy by Modulating Nrf2 and NF-κB Pathways.

    Science.gov (United States)

    Sandireddy, Reddemma; Yerra, Veera Ganesh; Komirishetti, Prashanth; Areti, Aparna; Kumar, Ashutosh

    2016-08-01

    The current study is aimed to assess the therapeutic potential of fisetin, a phytoflavonoid in streptozotocin (STZ)-induced experimental diabetic neuropathy (DN) in rats. Fisetin was administered (5 and 10 mg/kg) for 2 weeks (7th and 8th week) post STZ administration. Thermal and mechanical hyperalgesia were assessed by measuring tactile sensitivity to thermal and mechanical stimuli, respectively. Motor nerve conduction velocity (MNCV) was determined using power lab system and sciatic nerve blood flow (NBF) was determined using laser Doppler system. Nerve sections were processed for TUNEL assay and NF-κB, COX-2 immunohistochemical staining. Sciatic nerve homogenate was used for biochemical and Western blotting analysis. MNCV and sciatic NBF deficits associated with DN were ameliorated in fisetin administered rats. Fisetin treatment reduced the interleukin-6 and tumour necrosis factor-alpha in sciatic nerves of diabetic rats (p < 0.001). Protein expression studies have identified that the therapeutic benefit of fisetin might be through regulation of redox sensitive transcription factors such as nuclear erythroid 2-related factor 2 (Nrf2) and nuclear factor kappa B (NF-κB). Our study provides an evidence for the therapeutic potential of fisetin in DN through simultaneous targeting of NF-κB and Nrf2.

  16. Fluoxetine protects against methamphetamine‑induced lung inflammation by suppressing oxidative stress through the SERT/p38 MAPK/Nrf2 pathway in rats.

    Science.gov (United States)

    Wang, Yun; Gu, Yu-Han; Liu, Ming; Bai, Yang; Wang, Huai-Liang

    2017-02-01

    Methamphetamine (MA) abuse is a major public health and safety concern throughout the world and a growing burden on healthcare costs. The purpose of the present study was to investigate the protective effect of fluoxetine against MA‑induced chronic pulmonary inflammation and to evaluate the potential role of nuclear factor erythroid 2-related factor 2 (Nrf2)-mediated antioxidative stress. Wistar rats were divided into control, MA and two fluoxetine‑treated groups. Rats in the MA and the two fluoxetine‑treated groups were treated daily with intraperitoneal injection of 10 mg/kg MA twice daily. Rats in the two fluoxetine‑treated groups were injected intragastrically with fluoxetine (2 and 10 mg/kg) once daily, respectively. After 5 weeks, the rats were euthanized and hematoxylin and eosin staining, immunohistochemistry, western blot analysis and redox assay were performed. It was demonstrated that chronic exposure to MA can induce pulmonary inflammation in rats, with the symptoms of inflammatory cell infiltration, crowded lung parenchyma, thickened septum and a reduced number of alveolar sacs. Fluoxetine attenuated pulmonary inflammation and the expression of interleukin‑6 and tumor necrosis factor‑α in rat lungs. Fluoxetine inhibited MA‑induced increases in the expression levels of serotonin transporter (SERT) and p‑p38 mitogen‑activated protein kinase (MAPK), and reversed the MA‑induced decrease in nuclear Nrf2 and human heme oxygenase‑1 in lungs. Fluoxetine at 10 mg/kg significantly reversed the reduced glutathione (GSH) level, the ratio of GSH/oxidized glutathione, and the reactive oxygen species level in rat lungs from the MA group. These findings suggested that fluoxetine, a SERT inhibitor, has a protective effect against MA‑induced lung inflammation by suppressing oxidative stress through the SERT/p38 MAPK/Nrf2 pathway in rats.

  17. Chaetominine reduces MRP1-mediated drug resistance via inhibiting PI3K/Akt/Nrf2 signaling pathway in K562/Adr human leukemia cells

    Energy Technology Data Exchange (ETDEWEB)

    Yao, Jingyun; Wei, Xing [State Key Laboratory of Bioreactor Engineering, East China University of Science and Technology, 130 Meilong Road, Shanghai (China); Shanghai Collaborative Innovation Center for Biomanufacturing Technology, 130 Meilong Road, Shanghai (China); Lu, Yanhua, E-mail: luyanhua@ecust.edu.cn [State Key Laboratory of Bioreactor Engineering, East China University of Science and Technology, 130 Meilong Road, Shanghai (China); Shanghai Collaborative Innovation Center for Biomanufacturing Technology, 130 Meilong Road, Shanghai (China)

    2016-05-13

    Drug resistance limits leukemia treatment and chaetominine, a cytotoxic alkaloid that promotes apoptosis in a K562 human leukemia cell line via the mitochondrial pathway was studied with respect to chemoresistance in a K562/Adr human resistant leukemia cell line. Cytotoxicity assays indicated that K562/Adr resistance to adriamycin (ADR) did not occur in the presence of chaetominine and that chaetominine increased chemosensitivity of K562/Adr to ADR. Data show that chaetominine enhanced ADR-induced apoptosis and intracellular ADR accumulation in K562/Adr cells. Accordingly, chaetominine induced apoptosis by upregulating ROS, pro-apoptotic Bax and downregulating anti-apoptotic Bcl-2. RT-PCR and western-blot confirmed that chaetominine suppressed highly expressed MRP1 at mRNA and protein levels. But little obvious alternation of another drug transporter MDR1 mRNA was observed. Furthermore, inhibition of MRP1 by chaetominine relied on inhibiting Akt phosphorylation and nuclear Nrf2. In summary, chaetominine strongly reverses drug resistance by interfering with the PI3K/Akt/Nrf2 signaling, resulting in reduction of MRP1-mediated drug efflux and induction of Bax/Bcl-2-dependent apoptosis in an ADR-resistant K562/Adr leukemia cell line. - Highlights: • Chaetominine enhanced chemosensitivity of ADR against K562/Adr cells. • Chaetominine increased intracellular ADR levels via inhibiting MRP1. • Chaetominine induced apoptosis of K562/Adr cells through upregulation of ROS and modulation of Bax/Bcl-2. • Inhibition of MRP1 and Nrf2 by chaetominine treatment was correlative with blockade of PI3K/Akt signaling.

  18. Omega-3 polyunsaturated fatty acid has an anti-oxidant effect via the Nrf-2/HO-1 pathway in 3T3-L1 adipocytes

    Energy Technology Data Exchange (ETDEWEB)

    Kusunoki, Chisato, E-mail: yosizaki@belle.shiga-med.ac.jp [Department of Medicine, Shiga University of Medical Science, Seta Tsukinowa-Cho, Otsu, Shiga 520-2192 (Japan); Yang, Liu; Yoshizaki, Takeshi; Nakagawa, Fumiyuki; Ishikado, Atsushi; Kondo, Motoyuki; Morino, Katsutaro; Sekine, Osamu; Ugi, Satoshi [Department of Medicine, Shiga University of Medical Science, Seta Tsukinowa-Cho, Otsu, Shiga 520-2192 (Japan); Nishio, Yoshihiko [Division of Diabetes, Metabolism and Endocrinology, Department of Graduate School of Medical and Dental Sciences, Kagoshima University, 8-35-1 Sakuragaoka, Kagoshima 890-8544 (Japan); Kashiwagi, Atsunori; Maegawa, Hiroshi [Department of Medicine, Shiga University of Medical Science, Seta Tsukinowa-Cho, Otsu, Shiga 520-2192 (Japan)

    2013-01-04

    Highlights: Black-Right-Pointing-Pointer Omega-3 PUFA has a direct anti-oxidant effect in adipocytes. Black-Right-Pointing-Pointer EPA and DHA induce HO-1 expression in 3T3-L1 adipocytes. Black-Right-Pointing-Pointer Omega-3 PUFA and its end-product, 4-HHE, activates the Nrf-2/HO-1 pathway. Black-Right-Pointing-Pointer Omega-3 PUFA protects against oxidative stress-induced cytotoxicity. -- Abstract: Oxidative stress is produced in adipose tissue of obese subjects and has been associated with obesity-related disorders. Recent studies have shown that omega-3 polyunsaturated fatty acid ({omega}3-PUFA) has beneficial effects in preventing atherosclerotic diseases and insulin resistance in adipose tissue. However, the role of {omega}3-PUFA on adipocytes has not been elucidated. In this study, 3T3-L1 adipocytes were treated with {omega}3-PUFA and its metabolites, eicosapentaenoic acid (EPA), docosahexaenoic acid (DHA), or 4-hydroxy hexenal (4-HHE). {omega}3-PUFA and its metabolites dose-dependently increased mRNA and protein levels of the anti-oxidative enzyme, heme oxygenase-1 (HO-1); whereas no changes in the well-known anti-oxidant molecules, superoxide dismutase, catalase, and glutathione peroxidase, were observed. Knockdown of nuclear factor erythroid 2-related factor 2 (Nrf-2) significantly reduced EPA, DHA or 4-HHE-induced HO-1 mRNA and protein expression. Also, pretreatment with {omega}3-PUFA prevented H{sub 2}O{sub 2}-induced cytotoxicity in a HO-1 dependent manner. In conclusion, treatment with EPA and DHA induced HO-1 through the activation of Nrf-2 and prevented oxidative stress in 3T3-L1 adipocytes. This anti-oxidant defense may be of high therapeutic value for clinical conditions associated with systemic oxidative stress.

  19. MAT, a Novel Polyherbal Aphrodisiac Formulation, Enhances Sexual Function and Nrf2/HO-1 Pathway While Reducing Oxidative Damage in Male Rats

    Directory of Open Access Journals (Sweden)

    Kazim Sahin

    2018-01-01

    Full Text Available Mucuna pruriens, Ashwagandha, and Tribulus terrestris are known as the enhancers for sexual health, functional activities, vitality, and longevity. These herbs had been widely used in the Ayurveda medicine as aphrodisiacs through the ages, and their efficacy was also verified separately in our previous publication. Therefore, the aim of this study was to determine the effects of Mucuna, Ashwagandha, and Tribulus complexes on sexual function in rats. Twenty-eight male rats allocated to four groups as follows: (i negative control (C; (ii positive control or sildenafil citrate treated group (5 mg/kg (S; (iii MAT1 (combination of 10 mg Mucuna (M + 10 mg Ashwagandha (A + 10 mg Tribulus (T/kg BW; (iv MAT 2 (20 mg Mucuna + 20 mg Ashwagandha + 20 mg Tribulus/kg BW. There was no significant difference found between the MAT1 and MAT2 groups while they showed significantly increased testosterone, follicle-stimulating hormone (FSH, and luteinizing hormone (LH levels when compared to the negative control. Significant increases in Nrf2/HO1 levels and decreases in NF-κB were detected in MAT groups similar to the decrease in serum and testis malondialdehyde (MDA levels as compared to both controls. The sperm motility, count, and rate also significantly improved in both MAT groups, while ALT, AST, creatinine, ALP, and urea levels did not change in any of the groups. Oral consumption of MATs combination in male rats resulted in inhibition of NF-κB and MDA and also increased sex hormones with Nrf2-mediated HO-1 induction. MAT combinations may improve sexual functions by increasing levels of sexual hormones and regulation of NF-κB and Nrf2/HO-1 signaling pathways.

  20. Edaravone protects the retina against ischemia/reperfusion‑induced oxidative injury through the PI3K/Akt/Nrf2 pathway.

    Science.gov (United States)

    Xu, Yi-Pin; Han, Fang; Tan, Jian

    2017-12-01

    Retinal ischemia/reperfusion (I/R) injury can occur as a result of a number of ocular diseases or ischemic events in the brain, leading to possible vision loss if not treated properly. The overproduction of reactive oxygen species is important in the process of I/R injury. Edaravone, a free radical scavenger, has been demonstrated to have a neuroprotective effect in cerebral ischemia; however, its effect against retinal I/R injury remains to be fully elucidated. Therefore, the present study investigated the effects of edaravone on the oxidative parameters, retinal inflammation and apoptosis induced by I/R injury, and treated photoreceptor‑derived 661W cells with hydrogen peroxide (H2O2) and edaravone to examine the underlying mechanism. For the in vivo study, oxidative parameters (malondialdehyde, DNA fragmentation, total antioxidant status, superoxide dismutase and glutathione) in the retina, retinal thickness, and apoptotic index in the ganglionic cell layer and inner nuclear layer were measured. For the in vitro study, the effects of edaravone or nuclear factor erythroid‑2‑related factor 2 (Nrf2) small interfering RNA or phosphatidylinositol 3‑kinase (PI3K)/Akt inhibitors on cell viability, membrane integrity, levels of phosphorylated‑Akt, Akt and nuclear Nrf2 of H2O2‑treated 661W cells were examined. The results demonstrated that edaravone inhibited the oxidative injury in the retina induced by the retinal I/R procedure and increased retinal inflammation, and apoptosis. The results of the in vitro experiments demonstrated that edaravone effectively protected the viability and the membrane integrity of the H2O2‑treated 661W cells via the phosphatidylinositol 3‑kinase (PI3K)/Akt/Nrf2pathway. These results indicated the potential protective effect of edaravone against retinal I/R injury and provided a novel explanation for the protective effects of edaravone.

  1. MAT, a Novel Polyherbal Aphrodisiac Formulation, Enhances Sexual Function and Nrf2/HO-1 Pathway While Reducing Oxidative Damage in Male Rats

    Science.gov (United States)

    Tuzcu, Mehmet; Orhan, Cemal; Sahin, Nurhan; Akdemir, Fatih; Yilmaz, Ismet

    2018-01-01

    Mucuna pruriens, Ashwagandha, and Tribulus terrestris are known as the enhancers for sexual health, functional activities, vitality, and longevity. These herbs had been widely used in the Ayurveda medicine as aphrodisiacs through the ages, and their efficacy was also verified separately in our previous publication. Therefore, the aim of this study was to determine the effects of Mucuna, Ashwagandha, and Tribulus complexes on sexual function in rats. Twenty-eight male rats allocated to four groups as follows: (i) negative control (C); (ii) positive control or sildenafil citrate treated group (5 mg/kg) (S); (iii) MAT1 (combination of 10 mg Mucuna (M) + 10 mg Ashwagandha (A) + 10 mg Tribulus (T)/kg BW); (iv) MAT 2 (20 mg Mucuna + 20 mg Ashwagandha + 20 mg Tribulus/kg BW). There was no significant difference found between the MAT1 and MAT2 groups while they showed significantly increased testosterone, follicle-stimulating hormone (FSH), and luteinizing hormone (LH) levels when compared to the negative control. Significant increases in Nrf2/HO1 levels and decreases in NF-κB were detected in MAT groups similar to the decrease in serum and testis malondialdehyde (MDA) levels as compared to both controls. The sperm motility, count, and rate also significantly improved in both MAT groups, while ALT, AST, creatinine, ALP, and urea levels did not change in any of the groups. Oral consumption of MATs combination in male rats resulted in inhibition of NF-κB and MDA and also increased sex hormones with Nrf2-mediated HO-1 induction. MAT combinations may improve sexual functions by increasing levels of sexual hormones and regulation of NF-κB and Nrf2/HO-1 signaling pathways. PMID:29853975

  2. Omega-3 polyunsaturated fatty acid has an anti-oxidant effect via the Nrf-2/HO-1 pathway in 3T3-L1 adipocytes

    International Nuclear Information System (INIS)

    Kusunoki, Chisato; Yang, Liu; Yoshizaki, Takeshi; Nakagawa, Fumiyuki; Ishikado, Atsushi; Kondo, Motoyuki; Morino, Katsutaro; Sekine, Osamu; Ugi, Satoshi; Nishio, Yoshihiko; Kashiwagi, Atsunori; Maegawa, Hiroshi

    2013-01-01

    Highlights: ► Omega-3 PUFA has a direct anti-oxidant effect in adipocytes. ► EPA and DHA induce HO-1 expression in 3T3-L1 adipocytes. ► Omega-3 PUFA and its end-product, 4-HHE, activates the Nrf-2/HO-1 pathway. ► Omega-3 PUFA protects against oxidative stress-induced cytotoxicity. -- Abstract: Oxidative stress is produced in adipose tissue of obese subjects and has been associated with obesity-related disorders. Recent studies have shown that omega-3 polyunsaturated fatty acid (ω3-PUFA) has beneficial effects in preventing atherosclerotic diseases and insulin resistance in adipose tissue. However, the role of ω3-PUFA on adipocytes has not been elucidated. In this study, 3T3-L1 adipocytes were treated with ω3-PUFA and its metabolites, eicosapentaenoic acid (EPA), docosahexaenoic acid (DHA), or 4-hydroxy hexenal (4-HHE). ω3-PUFA and its metabolites dose-dependently increased mRNA and protein levels of the anti-oxidative enzyme, heme oxygenase-1 (HO-1); whereas no changes in the well-known anti-oxidant molecules, superoxide dismutase, catalase, and glutathione peroxidase, were observed. Knockdown of nuclear factor erythroid 2-related factor 2 (Nrf-2) significantly reduced EPA, DHA or 4-HHE-induced HO-1 mRNA and protein expression. Also, pretreatment with ω3-PUFA prevented H 2 O 2 -induced cytotoxicity in a HO-1 dependent manner. In conclusion, treatment with EPA and DHA induced HO-1 through the activation of Nrf-2 and prevented oxidative stress in 3T3-L1 adipocytes. This anti-oxidant defense may be of high therapeutic value for clinical conditions associated with systemic oxidative stress.

  3. Acrylamide-induced oxidative stress and inflammatory response are alleviated by N-acetylcysteine in PC12 cells: Involvement of the crosstalk between Nrf2 and NF-κB pathways regulated by MAPKs.

    Science.gov (United States)

    Pan, Xiaoqi; Wu, Xu; Yan, Dandan; Peng, Cheng; Rao, Chaolong; Yan, Hong

    2018-05-15

    Acrylamide (ACR) is a classic neurotoxin in animals and humans. However, the mechanism underlying ACR neurotoxicity remains controversial, and effective prevention and treatment measures against this condition are scarce. This study focused on clarifying the crosstalk between the involved signaling pathways in ACR-induced oxidative stress and inflammatory response and investigating the protective effect of antioxidant N-acetylcysteine (NAC) against ACR in PC12 cells. Results revealed that ACR exposure led to oxidative stress characterized by significant increase in reactive oxygen species (ROS) and malondialdehyde (MDA) levels and glutathione (GSH) consumption. Inflammatory response was observed based on the dose-dependently increased levels of pro-inflammatory cytokines tumor necrosis factor-α (TNF-α) and interleukin 6 (IL-6). NAC attenuated ACR-induced enhancement of MDA and ROS levels and TNF-α generation. In addition, ACR activated nuclear transcription factor E2-related factor 2 (Nrf2) and nuclear factor-κB (NF-κB) signaling pathways. Knockdown of Nrf2 by siRNA significantly blocked the increased NF-κB p65 protein expression in ACR-treated PC12 cells. Down-regulation of NF-κB by specific inhibitor BAY11-7082 similarly reduced ACR-induced increase in Nrf2 protein expression. NAC treatment increased Nrf2 expression and suppressed NF-κB p65 expression to ameliorate oxidative stress and inflammatory response caused by ACR. Further results showed that mitogen-activated protein kinases (MAPKs) pathway was activated prior to the activation of Nrf2 and NF-κB pathways. Inhibition of MAPKs blocked Nrf2 and NF-κB pathways. Collectively, ACR activated Nrf2 and NF-κB pathways which were regulated by MAPKs. A crosstalk between Nrf2 and NF-κB pathways existed in ACR-induced cell damage. NAC protected against oxidative damage and inflammatory response induced by ACR by activating Nrf2 and inhibiting NF-κB pathways in PC12 cells. Copyright © 2018 Elsevier B

  4. Effects of various feeding patterns of Bacillus coagulans on growth performance, antioxidant response and Nrf2-Keap1 signaling pathway in juvenile gibel carp (Carassius auratus gibelio).

    Science.gov (United States)

    Yu, Yebing; Wang, Changhai; Wang, Aimin; Yang, Wenping; Lv, Fu; Liu, Fei; Liu, Bo; Sun, Cunxin

    2018-02-01

    The present study was conducted to evaluate the effects of various Bacillus coagulans feeding patterns on growth, antioxidant parameter and Nrf2 pathway in juvenile gibel carp. The similar size of gibel carp (initial weight: 14.33 ± 0.15 g) were subjected to three levels of B. coagulans supplementation (0, 500, and 1000 mg/kg) and two feeding modes (supplementing B. coagulans continuously or for two days of B. coagulans after 5 days of a basal diet) according to a 3 × 2 factorial design. The fish that were continuously fed 500 mg/kg B. coagulans (P2) and those fed the first basal diet for 5 days followed by 500 mg/kg or 1000 mg/kg B.coagulans for 2 days (P4 or P5) showed higher weight gain rate and specific growth rate than the other groups. Blood respiratory burst (RB), myeloperoxidase (MPO), and anti-superoxide anion free radical (AFASER) activities in the P4 group were higher than those of the control. White blood cell count (WBC), RB activity, MPO activity, and glutathione (GSH) content in the P5 group were also higher than those of the control. A similar higher trend was observed in the gene expressions of NADPH oxidase 2 (NOX2), NFE2-related factor (Nrf2), Kelch-like-ECH-associated protein(Keap1) in the P4 and NOX2, NRF2, CNC homolog 1 (Bach1), peroxiredoxin 2 (Prx2) in the P5 group compared with the control. Additionally, we observed a significantly lower level of plasma aspartate aminotransferase (AST), lower activity of alanine aminotransferase (ALT), a higher level of MPO, higher GPX activity, and increased NRF2 and Prx2 expression were all observed in the P2 treatment group compared with the control. Furthermore, the malondialdehyde (MDA) content in the P2, P3, and P4 groups was lower than that of the control. These results indicate that a diet supplemented with appropriate levels of B.coagulans could improve the growth, immune response, and antioxidant capability of gibel carp. We concluded that the pattern of two days of 500 or 1000 mg/kg B

  5. Impaired transcriptional activity of Nrf2 in age-related myocardial oxidative stress is reversible by moderate exercise training.

    Directory of Open Access Journals (Sweden)

    Sellamuthu S Gounder

    Full Text Available Aging promotes accumulation of reactive oxygen/nitrogen species (ROS/RNS in cardiomyocytes, which leads to contractile dysfunction and cardiac abnormalities. These changes may contribute to increased cardiovascular disease in the elderly. Inducible antioxidant pathways are regulated by nuclear erythroid 2 p45-related factor 2 (Nrf2 through antioxidant response cis-elements (AREs and are impaired in the aging heart. Whereas acute exercise stress (AES activates Nrf2 signaling and promotes myocardial antioxidant function in young mice (~2 months, aging mouse (>23 months hearts exhibit significant oxidative stress as compared to those of the young. The purpose of this study was to investigate age-dependent regulation of Nrf2-antioxidant mechanisms and redox homeostasis in mouse hearts and the impact of exercise. Old mice were highly susceptible to oxidative stress following high endurance exercise stress (EES, but demonstrated increased adaptive redox homeostasis after moderate exercise training (MET; 10m/min, for 45 min/day for ~6 weeks. Following EES, transcription and protein levels for most of the ARE-antioxidants were increased in young mice but their induction was blunted in aging mice. In contrast, 6-weeks of chronic MET promoted nuclear levels of Nrf2 along with its target antioxidants in the aging heart to near normal levels as seen in young mice. These observations suggest that enhancing Nrf2 function and endogenous cytoprotective mechanisms by MET, may combat age-induced ROS/RNS and protect the myocardium from oxidative stress diseases.

  6. Attenuation of Aβ25–35-induced parallel autophagic and apoptotic cell death by gypenoside XVII through the estrogen receptor-dependent activation of Nrf2/ARE pathways

    International Nuclear Information System (INIS)

    Meng, Xiangbao; Wang, Min; Sun, Guibo; Ye, Jingxue; Zhou, Yanhui; Dong, Xi; Wang, Tingting; Lu, Shan; Sun, Xiaobo

    2014-01-01

    Amyloid-beta (Aβ) has a pivotal function in the pathogenesis of Alzheimer's disease. To investigate Aβ neurotoxicity, we used an in vitro model that involves Aβ 25–35 -induced cell death in the nerve growth factor-induced differentiation of PC12 cells. Aβ 25–35 (20 μM) treatment for 24 h caused apoptotic cell death, as evidenced by significant cell viability reduction, LDH release, phosphatidylserine externalization, mitochondrial membrane potential disruption, cytochrome c release, caspase-3 activation, PARP cleavage, and DNA fragmentation in PC12 cells. Aβ 25–35 treatment led to autophagic cell death, as evidenced by augmented GFP-LC3 puncta, conversion of LC3-I to LC3-II, and increased LC3-II/LC3-I ratio. Aβ 25–35 treatment induced oxidative stress, as evidenced by intracellular ROS accumulation and increased production of mitochondrial superoxide, malondialdehyde, protein carbonyl, and 8-OHdG. Phytoestrogens have been proved to be protective against Aβ-induced neurotoxicity and regarded as relatively safe targets for AD drug development. Gypenoside XVII (GP-17) is a novel phytoestrogen isolated from Gynostemma pentaphyllum or Panax notoginseng. Pretreatment with GP-17 (10 μM) for 12 h increased estrogen response element reporter activity, activated PI3K/Akt pathways, inhibited GSK-3β, induced Nrf2 nuclear translocation, augmented antioxidant responsive element enhancer activity, upregulated heme oxygenase 1 (HO-1) expression and activity, and provided protective effects against Aβ 25–35 -induced neurotoxicity, including oxidative stress, apoptosis, and autophagic cell death. In conclusion, GP-17 conferred protection against Aβ 25–35 -induced neurotoxicity through estrogen receptor-dependent activation of PI3K/Akt pathways, inactivation of GSK-3β and activation of Nrf2/ARE/HO-1 pathways. This finding might provide novel insights into understanding the mechanism for neuroprotective effects of phytoestrogens or gypenosides

  7. Sulforaphane Suppresses Hepatitis C Virus Replication by Up-Regulating Heme Oxygenase-1 Expression through PI3K/Nrf2 Pathway.

    Directory of Open Access Journals (Sweden)

    Jung-Sheng Yu

    Full Text Available Hepatitis C virus (HCV infection-induced oxidative stress is a major risk factor for the development of HCV-associated liver disease. Sulforaphane (SFN is an antioxidant phytocompound that acts against cellular oxidative stress and tumorigenesis. However, there is little known about its anti-viral activity. In this study, we demonstrated that SFN significantly suppressed HCV protein and RNA levels in HCV replicon cells and infectious system, with an IC50 value of 5.7 ± 0.2 μM. Moreover, combination of SFN with anti-viral drugs displayed synergistic effects in the suppression of HCV replication. In addition, we found nuclear factor erythroid 2-related factor 2 (Nrf2/HO-1 induction in response to SFN and determined the signaling pathways involved in this process, including inhibition of NS3 protease activity and induction of IFN response. In contrast, the anti-viral activities were attenuated by knockdown of HO-1 with specific inhibitor (SnPP and shRNA, suggesting that anti-HCV activity of SFN is dependent on HO-1 expression. Otherwise, SFN stimulated the phosphorylation of phosphoinositide 3-kinase (PI3K leading Nrf2-mediated HO-1 expression against HCV replication. Overall, our results indicated that HO-1 is essential in SFN-mediated anti-HCV activity and provide new insights in the molecular mechanism of SFN in HCV replication.

  8. Saponins from Aralia taibaiensis Attenuate D-Galactose-Induced Aging in Rats by Activating FOXO3a and Nrf2 Pathways

    Science.gov (United States)

    Li, Ying-Na; Guo, Yu; Xi, Miao-Miao; Yang, Pei; Zhou, Xue-Ying; Yin, Shuang; Hai, Chun-Xu; Li, Jin-Gang; Qin, Xu-Jun

    2014-01-01

    Reactive oxygen species (ROS) are closely related to the aging process. In our previous studies, we found that the saponins from Aralia taibaiensis have potent antioxidant activity, suggesting the potential protective activity on the aging. However, the protective effect of the saponins and the possible underlying molecular mechanism remain unknown. In the present study, we employed a D-galactose-induced aging rat model to investigate the protective effect of the saponins. We found that D-galactose treatment induced obvious aging-related changes such as the decreased thymus and spleen coefficients, the increased advanced glycation end products (AGEs) level, senescence-associated β-galactosidase (SAβ-gal) activity, and malondialdehyde (MDA) level. Further results showed that Forkhead box O3a (FOXO3a), nuclear factor-erythroid 2-related factor 2 (Nrf2), and their targeted antioxidants such as superoxide dismutase 2 (SOD2), catalase (CAT), glutathione reductase (GR), glutathione (GSH), glutamate-cysteine ligase (GCL), and heme oxygenase 1 (HO-1) were all inhibited in the aging rats induced by D-galactose treatment. Saponins supplementation showed effective protection on these changes. These results demonstrate that saponins from Aralia taibaiensis attenuate the D-galactose-induced rat aging. By activating FOXO3a and Nrf2 pathways, saponins increase their downstream multiple antioxidants expression and function, at least in part contributing to the protection on the D-galactose-induced aging in rats. PMID:24669284

  9. Curcumin Attenuates on Carbon Tetrachloride-Induced Acute Liver Injury in Mice via Modulation of the Nrf2/HO-1 and TGF-β1/Smad3 Pathway

    Directory of Open Access Journals (Sweden)

    Xinyan Peng

    2018-01-01

    Full Text Available This study aimed to investigate the protective effect of curcumin against carbon tetrachloride (CCl4-induced acute liver injury in a mouse model, and to explain the underlying mechanism. Curcumin at doses of 50, 100 and 200 mg/kg/day were administered orally once daily for seven days prior to CCl4 exposure. At 24 h, curcumin-attenuated CCl4 induced elevated serum transaminase activities and histopathological damage in the mouse’s liver. Curcumin pre-treatment at 50, 100 and 200 mg/kg significantly ameliorated CCl4-induced oxidative stress, characterized by decreased malondialdehyde (MDA formations, and increased superoxide dismutase (SOD, catalase (CAT activities and glutathione (GSH content, followed by a decrease in caspase-9 and -3 activities. Curcumin pre-treatment significantly decreased CCl4-induced inflammation. Furthermore, curcumin pre-treatment significantly down-regulated the expression of TGF-β1 and Smad3 mRNAs (both p < 0.01, and up-regulated the expression of nuclear-factor erythroid 2-related factor 2 (Nrf2 and HO-1 mRNA (both p < 0.01 in the liver. Inhibition of HO-1 attenuated the protective effect of curcumin on CCl4-induced acute liver injury. Given these outcomes, curcumin could protect against CCl4-induced acute liver injury by inhibiting oxidative stress and inflammation, which may partly involve the activation of Nrf2/HO-1 and inhibition of TGF-β1/Smad3 pathways.

  10. The Critical Role of Redox Homeostasis in Shikonin-Induced HL-60 Cell Differentiation via Unique Modulation of the Nrf2/ARE Pathway

    Directory of Open Access Journals (Sweden)

    Bo Zhang

    2012-01-01

    Full Text Available Among various cancer cell lines, the leukemia cell line HL-60 was most sensitive to Shikonin, with evidence showing both the prooxidative activities and proapoptotic effects of micromolar concentrations of Shikonin. However, the mechanism involved in the cytotoxicity of Shikonin in the submicromolar range has not been fully characterized. Using biochemical and free radical biological experiments in vitro, we identified the prodifferentiated profiles of Shikonin and evaluated the redox homeostasis during HL-60 differentiation. The data showed a strong dose-response relationship between Shikonin exposure and the characteristics of HL-60 differentiation in terms of morphology changes, nitroblue tetrazolium (NBT reductive activity, and the expression level of surface antigens CD11b/CD14. During drug exposure, intercellular redox homeostasis changes towards oxidation are necessary to support Shikonin-induced differentiation, which was proven by additional enzymatic and non-enzymatic redox modulators. A statistically significant and dose-dependent increase (P<0.05 was recorded with regard to the unique expression levels of the Nrf2/ARE downstream target genes in HL-60 cells undergoing late differentiation, which were restored with further antioxidants employed with the Shikonin treatment. Our research demonstrated that Shikonin is a differentiation-inducing agent, and its mechanisms involve the Nrf2/ARE pathway to modulate the intercellular redox homeostasis, thus facilitating differentiation.

  11. L-cysteine protects intestinal integrity, attenuates intestinal inflammation and oxidant stress, and modulates NF-κB and Nrf2 pathways in weaned piglets after LPS challenge.

    Science.gov (United States)

    Song, Ze he; Tong, Guo; Xiao, Kan; Jiao, Le fei; Ke, Ya lu; Hu, Cai hong

    2016-04-01

    In this study we investigated whetherL-cysteine (L-cys) could alleviate LPS-induced intestinal disruption and its underlying mechanism. Piglets fed with anL-cys-supplemented diet had higher average daily gain.L-cys alleviated LPS-induced structural and functional disruption of intestine in weanling piglets, as demonstrated by higher villus height, villus height (VH) to crypt depth (CD) ratio, and transepithelial electrical resistance (TER) and lower FITC-dextran 4 (FD4) kDa flux in jejunum and ileum. Supplementation withL-cys up-regulated occludin and claudin-1 expression, reduced caspase-3 activity and enhanced proliferating cell nuclear antigen expression of jejunum and ileum relative to LPS group. Additionally,L-cys suppressed the LPS-induced intestinal inflammation and oxidative stress, as demonstrated by down-regulated TNF-α, IL-6 and IL-8 mRNA levels, increased catalase, superoxide dismutase, glutathione peroxidase activity, glutathione (GSH) contents and the ratio of GSH and oxidized glutathione in jejunum and ileum. Finally, a diet supplemented withL-cys inhibited NF-κB(p65) nuclear translocation and elevated NF erythroid 2-related factor 2 (Nrf2) translocation compared with the LPS group. Collectively, our results indicated the protective function ofL-cys on intestinal mucosa barrier may closely associated with its anti-inflammation, antioxidant and regulating effect on the NF-κB and Nrf2 signaling pathways. © The Author(s) 2016.

  12. Tartary buckwheat flavonoids ameliorate high fructose-induced insulin resistance and oxidative stress associated with the insulin signaling and Nrf2/HO-1 pathways in mice.

    Science.gov (United States)

    Hu, Yuanyuan; Hou, Zuoxu; Yi, Ruokun; Wang, Zhongming; Sun, Peng; Li, Guijie; Zhao, Xin; Wang, Qiang

    2017-08-01

    The present study was conducted to explore the effects of a purified tartary buckwheat flavonoid fraction (TBF) on insulin resistance and hepatic oxidative stress in mice fed high fructose in drinking water (20%) for 8 weeks. The results indicated that continuous administration of TBF dose-dependently improved the insulin sensitivity and glucose intolerance in high fructose-fed mice. TBF treatment also reversed the reduced level of insulin action on the phosphorylation of insulin receptor substrate-1 (IRS-1), protein kinase B (Akt) and phosphatidylinositol 3-kinase (PI3K), as well as the translocation of glucose transporter type 4 (GLUT4) in the insulin-resistant liver. Furthermore, TBF was found to exert high antioxidant capacity as it acts as a shield against oxidative stress induced by high fructose by restoring the antioxidant status, and modulating nuclear factor E2 related factor 2 (Nrf2) translocation to the nucleus with subsequently up-regulated antioxidative enzyme protein expression. Histopathological examinations revealed that impaired pancreatic/hepatic tissues were effectively restored in high fructose-fed mice following TBF treatment. Our results show that TBF intake is effective in preventing the conversion of high fructose-induced insulin resistance and hepatic oxidative stress in mice by improving the insulin signaling molecules and the Nrf2 signal pathway in the liver.

  13. Antioxidant and Antifibrotic Effect of a Herbal Formulation In Vitro and in the Experimental Andropause via Nrf2/HO-1 Signaling Pathway

    Directory of Open Access Journals (Sweden)

    Woong Jin Bae

    2017-01-01

    Full Text Available The Korean herbal formulation Ojayeonjonghwan is used for improving late-onset hypogonadism (LOH symptoms such as erectile dysfunction (ED. A previous research suggested that a modified Ojayeonjonghwan (KH-204 could be used as an alternative to the treatment for ED. The pharmacological effects were examined in different conditions, including in vitro and in vivo. We measured the survival rate of TM3 Leydig cells under the oxidative stress condition. The s.c. injection of leuprorelin was used to induce androgen deprivation. We measured serum testosterone levels, oxidative stress, and apoptosis. The results of the treatment by KH-204 (1 preserved TM3 cells from oxidative stress by improving the expression of nuclear factor erythroid 2-related factor 2 (Nrf2/heme oxygenase-1 (HO-1; (2 lowered the expression of transforming growth factor-beta (TGF-β 1/SMAD; (3 increased the average of serum testosterone in androgen-deprived male rats; (4 kept the activation of spermatogenesis; (5 upgraded the contents of 8-hydroxy-20-deoxyguanosine (8-OHdG and degraded the contents of superoxide dismutase (SOD; and (6 reduced apoptosis. We studied that KH-204 improved testicular dysfunction in LOH. It is likely, at least in part, to degrade oxidative stress through the Nrf2/HO-1 pathway. These findings may offer credible evidences for the use of new alternative therapies to treat LOH.

  14. Honokiol protects pancreatic β cell against high glucose and intermittent hypoxia-induced injury by activating Nrf2/ARE pathway in vitro and in vivo.

    Science.gov (United States)

    Li, Chen-Guang; Ni, Chang-Lin; Yang, Min; Tang, Yun-Zhao; Li, Zhu; Zhu, Yan-Juan; Jiang, Zhen-Huan; Sun, Bei; Li, Chun-Jun

    2018-01-01

    Obstructive sleep apnea hypopnea syndrome (OSAHS) is associated with glucose intolerance, insulin resistance and type 2 diabetes mellitus (T2DM). Although several studies have revealed that intermittent hypoxia (IH) in OSAHS may further aggravate pancreatic β cell damage and promote the evolution of type 2 diabetes (T2DM) by increasing oxidative stress, the underlying mechanisms are unclear. Honokiol, a potent radical scavenger, has been demonstrated to ameliorate oxidative stress in many cases. The present study aimed to explore the potential mechanism of IH and diabetes synergistically damage and destruct the pancreatic β cell, examine the effects of honokiol on ameliorating pancreatic β cell injury in this context and explore the mechanism of such effects. High glucose (HG) cultured INS-1 cells were exposed to 50 μM of honokiol for 24, 48 and 72 h with or without IH intervention. T2DM rats were treated with honokiol and exposed to 80 s of IH followed by 160 s of normoxia for 8 weeks. The cell proliferation, apoptosis and oxidative stress were measured. Blood glucose, insulin, glucagon and HOMA-IR (Homeostasis model assessment -insulin resistence) were also detected, and the expression of nuclear factor erythroid 2-related factor 2 (Nrf2) and heme oxygenase-1 (HO-1) were detected by immunofluorescence staining and western blotting. Honokiol can reduce oxidative stress, cytotoxicity and apoptosis in the INS-1 cells of rats receiving HG treatment or both HG and IH treatment. IH can further aggravate pancreas dysfunction, cause a marked elevation in fasting blood glucose, glucagon, HOMA-IR and oxidative stress levels in DM rats. In addition, honokiol can effectively activate the Nrf2/ARE pathway and reverse this pancreatic dysfunction in vivo and in vitro. These findings indicate that honokiol acts as a potent ROS scavenger via Nrf2/ARE pathway and effectively attenuates oxidative stress and improves pancreatic β cell function of DM rats under IH

  15. Thyroid Hormone-Induced Cytosol-to-Nuclear Translocation of Rat Liver Nrf2 Is Dependent on Kupffer Cell Functioning

    Directory of Open Access Journals (Sweden)

    Luis A. Videla

    2012-01-01

    Full Text Available L-3,3′,5-triiodothyronine (T3 administration upregulates nuclear factor-E2-related factor 2 (Nrf2 in rat liver, which is redox-sensitive transcription factor mediating cytoprotection. In this work, we studied the role of Kupffer cell respiratory burst activity, a process related to reactive oxygen species generation and liver homeostasis, in Nrf2 activation using the macrophage inactivator gadolinium chloride (GdCl3; 10 mg/kg i.v. 72 h before T3 [0.1 mg/kg i.p.] or NADPH oxidase inhibitor apocynin (1.5 mmol/L added to the drinking water for 7 days before T3, and determinations were performed 2 h after T3. T3 increased nuclear/cytosolic Nrf2 content ratio and levels of heme oxygenase 1 (HO-1, catalytic subunit of glutamate cysteine ligase, and thioredoxin (Western blot over control values, proteins whose gene transcription is induced by Nrf2. These changes were suppressed by GdCl3 treatment prior to T3, an agent-eliciting Kupffer-cell depletion, inhibition of colloidal carbon phagocytosis, and the associated respiratory burst activity, with enhancement in nuclear inhibitor of Nrf2 kelch-like ECH-associated protein 1 (Keap1/Nrf2 content ratios suggesting Nrf2 degradation. Under these conditions, T3-induced tumor necrosis factor-α (TNF-α response was eliminated by previous GdCl3 administration. Similar to GdCl3, apocynin given before T3 significantly reduced liver Nrf2 activation and HO-1 expression, a NADPH oxidase inhibitor eliciting abolishment of colloidal carbon-induced respiratory burst activity without altering carbon phagocytosis. It is concluded that Kupffer cell functioning is essential for upregulation of liver Nrf2-signaling pathway by T3. This contention is supported by suppression of the respiratory burst activity of Kupffer cells and the associated reactive oxygen species production by GdCl3 or apocynin given prior to T3, thus hindering Nrf2 activation.

  16. Xanthohumol attenuates cisplatin-induced nephrotoxicity through inhibiting NF-κB and activating Nrf2 signaling pathways.

    Science.gov (United States)

    Li, Fan; Yao, Yunyi; Huang, Hui; Hao, Hua; Ying, Mingzhong

    2018-06-12

    Cisplatin is a chemotherapeutic agent that widely used in the treatment of cancer. However, cisplatin has been reported to induce nephrotoxicity by directly inducing inflammatory response and oxidative stress. In this study, we aimed to investigate the protective effects and mechanism of xanthohumol on cisplatin-induced nephrotoxicity. The model of nephrotoxicity was induced by intraperitoneal injection of cisplatin and xanthohumol was given intraperitoneally for three consecutive days. The results showed that xanthohumol significantly attenuated kidney histological changes and serum creatinine and BUN production. The levels of TNF-α, IL-1ß and IL-6 in kidney tissues were suppressed by xanthohumol. The levels of malondialdehyde (MDA) and ROS were suppressed by treatment of xanthohumol. The activities of glutathione (GSH) and superoxide dismutase (SOD) decreased by cisplatin were reversed by xanthohumol. Furthermore, the expression of TLR4 and the activation of NF-κB induced by cisplatin were significantly inhibited by xanthohumol. The expression of Nrf2 and HO-1 were dose-dependently up-regulated by the treatment of xanthohumol. In conclusion, xanthohumol protects against cisplatin-induced nephrotoxicity by ameliorating inflammatory and oxidative responses. Copyright © 2018 Elsevier B.V. All rights reserved.

  17. Antioxidant and glucose metabolizing potential of edible insect, Brachytrupes orientalis via modulating Nrf2/AMPK/GLUT4 signaling pathway.

    Science.gov (United States)

    Dutta, Prachurjya; Dey, Tapan; Dihingia, Anjum; Manna, Prasenjit; Kalita, Jatin

    2017-11-01

    Brachytrupes orientalis (Gryllidae) is a common edible insect species eaten by the different tribes of North East India. This study investigated the potentiality of Brachytrupes orientalis extracts in different solvent hydro-alcoholic (AEBO), hexane (HEBO) and ethyl acetate (EEBO) on glucose utilization and cell viability in high glucose (HG) treated myotubes. It has been observed that AEBO supplementation significantly increased the glucose utilization against HG exposure; however, treatment HEBO and EEBO have no significant effect. AEBO also increased the intercellular glucose-6-phosphate level and the protein expression of both phospho-AMPK and GLUT4 in HG treated myotubes in a dose dependent manner. Furthermore, supplementation with AEBO decreased the intercellular ROS production, lipid peroxidation, and up-regulated the protein expression of Nrf2 and GST. Chromatography and Spectroscopic analyses of AEBO also suggest that Ursolic acid may be one of the bioactive principles with rich potassium, sodium, calcium and magnesium content. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  18. Andrographolide exerts anti-hepatitis C virus activity by up-regulating haeme oxygenase-1 via the p38 MAPK/Nrf2 pathway in human hepatoma cells.

    Science.gov (United States)

    Lee, Jin-Ching; Tseng, Chin-Kai; Young, Kung-Chia; Sun, Hung-Yu; Wang, Shainn-Wei; Chen, Wei-Chun; Lin, Chun-Kuang; Wu, Yu-Hsuan

    2014-01-01

    This study aimed to evaluate the anti-hepatitis C virus (HCV) activity of andrographolide, a diterpenoid lactone extracted from Andrographis paniculata, and to identify the signalling pathway involved in its antiviral action. Using HCV replicon and HCVcc infectious systems, we identified anti-HCV activity of andrographolide by measuring protein and RNA levels. A reporter activity assay was used to determine transcriptional regulation of anti-HCV agents. A specific inhibitor and short hairpin RNAs were used to investigate the mechanism responsible for the effect of andrographolide on HCV replication. In HCV replicon and HCVcc infectious systems, andrographolide time- and dose-dependently suppressed HCV replication. When combined with IFN-α, an inhibitor targeting HCV NS3/4A protease (telaprevir), or NS5B polymerase (PSI-7977), andrographolide exhibited a significant synergistic effect. Andrographolide up-regulated the expression of haeme oxygenase-1 (HO-1), leading to increased amounts of its metabolite biliverdin, which was found to suppress HCV replication by promoting the antiviral IFN responses and inhibiting NS3/4A protease activity. Significantly, these antiviral effects were attenuated by an HO-1-specific inhibitor or HO-1 gene knockdown, indicating that HO-1 contributed to the anti-HCV activity of andrographolide. Andrographolide activated p38 MAPK phosphorylation, which stimulated nuclear factor erythroid 2-related factor 2 (Nrf2)-mediated HO-1 expression, and this was found to be associated with its anti-HCV activity. Our results demonstrate that andrographolide has the potential to control HCV replication and suggest that targeting the Nrf2-HO-1 signalling pathway might be a promising strategy for drug development. © 2013 The British Pharmacological Society.

  19. Sulforaphane prevents angiotensin II-induced cardiomyopathy by activation of Nrf2 via stimulating the Akt/GSK-3ß/Fyn pathway

    Directory of Open Access Journals (Sweden)

    Ying Xin

    2018-05-01

    Conclusion: These results suggest that Nrf2 plays a central role in the prevention of Ang II-induced cardiomyopathy, and SFN prevents Ang II-induced cardiomyopathy partially via the Akt/GSK-3β/Fyn-mediated Nrf2 activation.

  20. Rutin reverses radiation-induced oxidative DNA damage and inflammation through the modulation of p38/Nf-Kb and Keap1/Nrf2 pathway

    International Nuclear Information System (INIS)

    Manna, Krishnendu; Khan, Amitava; Biswas, Sushobhan; Das, Ujjal; Sengupta, Aaveri; Dey, Sanjit; Chakraborty, Anindita

    2016-01-01

    Rutin (RU), widely known plant polyphenol, possesses wide range of biological activities. In this study, we evaluated the effect of RU on radiation (IR)-induced oxidative stress and inflammation in murine liver and explored the potential mechanisms underlying this effect. Swiss albino mice were subjected to oral pretreatment of RU (75 mg/kg body weight) for three consecutive days before irradiation (6 Gy). Plethora of biochemical indices were carried out to determine the hepato protective effect of RU. Molecular mechanism of action was also assessed through employing the immunoblot, flow cytometry and immunofluorescence techniques. Hepatoprotective effects of RU were associated with the upregulation of antioxidant enzyme activities (SOD, catalase and GSH) and down regulation of serum toxicity markers (ALT, AST and LDH). Results also demonstrated that RU significantly down regulated the levels of hepatic inflammatory markers like TNF-α, IL-6 and expressions of p38-MAPK, NF-κB, iNOS and COX-2. Histopathological changes further confirmed the biochemical and immunohistochemical results showing that IR caused significant structural damage to liver which were reversed by pretreatment of RU. RU also significantly suppressed the IR-induced activation of Keap1 and modulated the phosphorylation of PI3K/AKT. Further, pretreatment with RU augmented the expression of Nrf2 thereby enhancing the activity of downstream phase-2 detoxifying hepatic enzymes (HO-1, NQO-1, GST and Mn-SOD) which altered the IR-induced oxidative imbalance. The present results is evidence based mechanism that RU remained a promising radioprotector in attenuating IR-induced oxidative stress, inflammation and hepatotoxicity through the modulation of Nrf2/HO-1 and p38 /NF-κB signaling pathway. (author)

  1. Antihepatocarcinoma Effect of Portulaca oleracea L. in Mice by PI3K/Akt/mTOR and Nrf2/HO-1/NF-κB Pathway

    Science.gov (United States)

    Guoyin, Zheng; Hao, Peng; Min, Li; Wei, Gu; Zhe, Chen

    2017-01-01

    The purpose of the present study was to evaluate the pharmacological effects of Portulaca oleracea L. (Purslane) (PL) on N-nitrosodiethylamine- (NDEA-) induced hepatocellular carcinomas (HCC) and explore its potential mechanism. Mice were randomly assigned to four groups: control group, NDEA group, NDEA + Purslane (100 mg/kg) group, and NDEA + Purslane (200 mg/kg) group. The animal of each group was given NDEA (100 ppm) in drinking water. 1 h later, Purslane dissolved in PBS was intragastrically administered for continuous seven days. The results showed that Purslane reduced the activities of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in liver and serum. Purslane also reduced the contents of interleukin-6 (IL-6), IL-1β, tumor necrosis factor-α (TNF-α), and methane dicarboxylic aldehyde (MDA) and restored the activity of superoxygen dehydrogenises (SOD) in serum. Purslane could obviously attenuate the hepatic pathological alteration. Furthermore, treatment with Purslane effectively inhibited the phosphorylations of phosphatidylinositol 3 kinase (PI3K), protein kinase B (Akt), mammalian target of rapamycin (mTOR), nuclear factor-kappa B (NF-κB), and inhibitor of NF-κBα (IκBα) and upregulated the expressions of NF-E2-related factor 2 (Nrf2) and heme oxygenase- (HO-) 1. In conclusion, our research suggested that Purslane exhibited protective effects on NDEA-induced hepatocellular carcinomas by anti-inflammatory and antioxidative properties via the PI3K/Akt/mTOR and Nrf2/HO-1/NF-κB pathway. PMID:28659990

  2. Dimethyl Fumarate Protects Neural Stem/Progenitor Cells and Neurons from Oxidative Damage through Nrf2-ERK1/2 MAPK Pathway

    Directory of Open Access Journals (Sweden)

    Qin Wang

    2015-06-01

    Full Text Available Multiple sclerosis (MS is the most common multifocal inflammatory demyelinating disease of the central nervous system (CNS. Due to the progressive neurodegenerative nature of MS, developing treatments that exhibit direct neuroprotective effects are needed. Tecfidera™ (BG-12 is an oral formulation of the fumaric acid esters (FAE, containing the active metabolite dimethyl fumarate (DMF. Although BG-12 showed remarkable efficacy in lowering relapse rates in clinical trials, its mechanism of action in MS is not yet well understood. In this study, we reported the potential neuroprotective effects of dimethyl fumarate (DMF on mouse and rat neural stem/progenitor cells (NPCs and neurons. We found that DMF increased the frequency of the multipotent neurospheres and the survival of NPCs following oxidative stress with hydrogen peroxide (H2O2 treatment. In addition, utilizing the reactive oxygen species (ROS assay, we showed that DMF reduced ROS production induced by H2O2. DMF also decreased oxidative stress-induced apoptosis. Using motor neuron survival assay, DMF significantly promoted survival of motor neurons under oxidative stress. We further analyzed the expression of oxidative stress-induced genes in the NPC cultures and showed that DMF increased the expression of transcription factor nuclear factor-erythroid 2-related factor 2 (Nrf2 at both levels of RNA and protein. Furthermore, we demonstrated the involvement of Nrf2-ERK1/2 MAPK pathway in DMF-mediated neuroprotection. Finally, we utilized SuperArray gene screen technology to identify additional anti-oxidative stress genes (Gstp1, Sod2, Nqo1, Srxn1, Fth1. Our data suggests that analysis of anti-oxidative stress mechanisms may yield further insights into new targets for treatment of multiple sclerosis (MS.

  3. Lycopene ameliorates atrazine-induced oxidative damage in adrenal cortex of male rats by activation of the Nrf2/HO-1 pathway.

    Science.gov (United States)

    Abass, Marwa Ahmed; Elkhateeb, Shereen Ahmed; Abd El-Baset, Samia Adel; Kattaia, Asmaa Alhosiny; Mohamed, Eman Mosallam; Atteia, Hebatallah Husseini

    2016-08-01

    Atrazine (ATZ) is one of the most commonly used herbicides contaminating plants, soil and water resources. Several strategies have been used to counteract ATZ toxicity. Here, we tested the hypothesis that lycopene could ameliorate ATZ-induced toxicity in the adrenal cortex. For this purpose, 35 adult male albino rats were randomized into five equal groups: untreated control, vehicle control (received 0.5 mL corn oil/day), lycopene (treated with lycopene dissolved in 0.5 mL corn oil, 10 mg/kg b.w./day), ATZ (received ATZ dissolved in 0.5 mL corn oil 300 mg/kg b.w./day), and ATZ + lycopene (treated with ATZ and lycopene at the same previously mentioned doses). All treatments were given by oral gavage for 4 weeks. We found that ATZ exposure significantly increased relative adrenal weight, plasma ACTH levels, and adrenal oxidative stress as manifested by elevated malondialdehyde levels, decreased reduced glutathione content and depressed antioxidant enzyme activities in adrenal cortex tissues with respect to control groups. Furthermore, the transcription of adrenal cortex nuclear factor erythroid 2-related factor 2 (Nrf2), heme oxygenase-1 (HO-1), nuclear factor kappa B, and caspase-3 genes was increased significantly compared with the control groups. This was accompanied with DNA fragmentation and structural and ultrastructural changes in zona glomerulosa and zona fasiculata of the adrenal cortex. Notably, all these changes were partially ameliorated in rats treated concomitantly with ATZ and lycopene. Our results showed that lycopene exerts protective effects against ATZ-induced toxicity in rat adrenal cortex. These effects may be attributed to the antioxidative property of lycopene and its ability to activate the Nrf2/HO-1 pathway.

  4. Exercise Training Mitigates Water Pipe Smoke Exposure-Induced Pulmonary Impairment via Inhibiting NF-κB and Activating Nrf2 Signalling Pathways

    Directory of Open Access Journals (Sweden)

    Abderrahim Nemmar

    2018-01-01

    activating Nrf2 signalling pathways.

  5. Tanshinol ameliorates CCl4-induced liver fibrosis in rats through the regulation of Nrf2/HO-1 and NF-κB/IκBα signaling pathway

    Directory of Open Access Journals (Sweden)

    Wang R

    2018-05-01

    Full Text Available Rong Wang,* Jing Wang,* Fuxing Song, Shengnan Li, Yongfang Yuan Department of Pharmacy, Shanghai 9th People’s Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China *These authors contributed equally to this work Abstract: Tanshinol, a water-soluble component isolated from Salvia miltiorrhiza Bunge, has a variety of biological activities involving anti-fibrotic effect. However, the exact role and the underlying mechanisms remain largely unclear. This study mainly focused on the anti-hepatic fibrotic activities and mechanisms of tanshinol on carbon tetrachloride (CCl4-induced liver fibrosis in rats via anti-oxidative and anti-inflammation pathways. The rats were divided into 4 groups as follows: control, model, tanshinol 20 mg/kg, and tanshinol 40 mg/kg. Except for the control group, CCl4 was used to induce liver fibrosis processing for 8 weeks, meanwhile rats in tanshinol groups were intraperitoneally injected with additional tanshinol. Control group simultaneously received the same volumes of olive oil and saline. The potentially protective effect and mechanisms of tanshinol on liver fibrosis in rats were evaluated. The serum levels of alanine aminotransferase, aspartate aminotransferase, and total bilirubin were obviously lower in the tanshinol treatment groups related to model group. Compared with the model group, the levels of hyaluronic acid, type IV collagen, Laminin (LN, and procollagen III peptide (PIIIP in serum were significantly decreased after tanshinol treatment. Furthermore, tanshinol could regulate Nrf2/HO-1 signaling pathway and increase the level of superoxide dismutase (SOD and glutathione peroxidase (GSH-Px, and also decrease the level of malondialdehyde (MDA to against damage induced by oxidative stress. Simultaneously tanshinol could regulate nuclear factor kappa B signaling pathway to inhibit expression of inflammation factors, including transforming growth factor-β, tumor necrosis factor-α, Cox-2

  6. Minocycline attenuates sevoflurane-induced cell injury via activation of Nrf2.

    Science.gov (United States)

    Tian, Yue; Wu, Xiuying; Guo, Shanbin; Ma, Ling; Huang, Wei; Zhao, Xiaochun

    2017-04-01

    Minocycline has been demonstrated to exert neuroprotective effects in various experimental models. In the present study, we investigated the mechanisms underlying the protective effects of minocycline on cell injury induced by the inhalation of the anesthetic, sevoflurane. In our in vivo experiments using rats, minocycline attenuated sevoflurane-induced neuronal degeneration and apoptosis in the rat hippocampus, and this effect was associated with the minocycline-mediated suppression of oxidative stress in the hippocampus. In in vitro experiments, minocycline inhibited sevoflurane-induced apoptosis and the production of reactive oxygen species (ROS) in H4 human neuroglioma cells. In addition, minocycline suppressed the sevoflurane-induced upregulation of interleukin (IL)-6 and the activation of the nuclear factor-κB (NF-κB) signaling pathway in H4 cells. Furthermore, we found that nuclear factor E2-related factor 2 (Nrf2), an activator of the stress response, was upregulated and activated upon sevoflurane treatment both in the rat hippocampus and in H4 cells. In addition, minocycline further augmented the upregulation and activation of Nrf2 when used in conjunction with sevoflurane. Moreover, the knockdown of Nrf2 in H4 cells by small interfering RNA (siRNA) diminished the cytoprotective effect of minocycline, and attenuated the inhibitory effect of minocycline on ROS production, IL-6 upregulation and the activation of the NF-κB signaling pathway. On the whole, our findings indicate that minocycline may exert protective effects against sevoflurane-induced cell injury via the Nrf2-modulated antioxidant response and the inhibition of the activation of the NF-κB signaling pathway.

  7. Minocycline attenuates sevoflurane-induced cell injury via activation of Nrf2

    Science.gov (United States)

    Tian, Yue; Wu, Xiuying; Guo, Shanbin; Ma, Ling; Huang, Wei; Zhao, Xiaochun

    2017-01-01

    Minocycline has been demonstrated to exert neuroprotective effects in various experimental models. In the present study, we investigated the mechanisms underlying the protective effects of minocycline on cell injury induced by the inhalation of the anesthetic, sevoflurane. In our in vivo experiments using rats, minocycline attenuated sevoflurane-induced neuronal degeneration and apoptosis in the rat hippocampus, and this effect was associated with the minocycline-mediated suppression of oxidative stress in the hippocampus. In in vitro experiments, minocycline inhibited sevoflurane-induced apoptosis and the production of reactive oxygen species (ROS) in H4 human neuroglioma cells. In addition, minocycline suppressed the sevoflurane-induced upregulation of interleukin (IL)-6 and the activation of the nuclear factor-κB (NF-κB) signaling pathway in H4 cells. Furthermore, we found that nuclear factor E2-related factor 2 (Nrf2), an activator of the stress response, was upregulated and activated upon sevoflurane treatment both in the rat hippocampus and in H4 cells. In addition, minocycline further augmented the upregulation and activation of Nrf2 when used in conjunction with sevoflurane. Moreover, the knockdown of Nrf2 in H4 cells by small interfering RNA (siRNA) diminished the cytoprotective effect of minocycline, and attenuated the inhibitory effect of minocycline on ROS production, IL-6 upregulation and the activation of the NF-κB signaling pathway. On the whole, our findings indicate that minocycline may exert protective effects against sevoflurane-induced cell injury via the Nrf2-modulated antioxidant response and the inhibition of the activation of the NF-κB signaling pathway. PMID:28260081

  8. Noncanonical SQSTM1/p62-Nrf2 pathway activation mediates proteasome inhibitor resistance in multiple myeloma cells via redox, metabolic and translational reprogramming

    OpenAIRE

    Riz, Irene; Hawley, Teresa S.; Marsal, Jeffrey W.; Hawley, Robert G.

    2016-01-01

    Multiple Myeloma (MM) is a B-cell malignancy characterized by the accumulation of clonal plasma cells in the bone marrow, with drug resistance being a major cause of therapeutic failure. We established a carfilzomib-resistant derivative of the LP-1 MM cell line (LP-1/Cfz) and found that the transcription factor NF-E2 p45-related factor 2 (Nrf2; gene symbol NFE2L2) contributes to carfilzomib resistance. The mechanism of Nrf2 activation involved enhanced translation of Nrf2 as well as its posit...

  9. HMOX1 and NQO1 genes are upregulated in response to contact sensitizers in dendritic cells and THP-1 cell line: role of the Keap1/Nrf2 pathway.

    Science.gov (United States)

    Ade, Nadège; Leon, Fanny; Pallardy, Marc; Peiffer, Jean-Luc; Kerdine-Romer, Saadia; Tissier, Marie-Hélène; Bonnet, Pierre-Antoine; Fabre, Isabelle; Ourlin, Jean-Claude

    2009-02-01

    Electrophilicity is one of the most common features of skin contact sensitizers and is necessary for protein haptenation. The Keap1 (Kelch-like ECH-associated protein 1)/Nrf2 -signaling pathway is dedicated to the detection of electrophilic stress in cells leading to the upregulation of genes involved in protection or neutralization of chemical reactive species. Signals provided by chemical stress could play an important role in dendritic cell activation and the aim of this work was to test whether contact sensitizers were specific activators of the Keap1/Nrf2 pathway. CD34-derived dendritic cells (CD34-DC) and the THP-1 myeloid cell line were treated by a panel of sensitizers (Ni, 1-chloro 2,4-dinitrobenzene, cinnamaldehyde, 7-hydroxycitronellal, 1,4-dihydroquinone, alpha-methyl-trans-cinnamaldehyde, 2-4-tert-(butylbenzyl)propionaldehyde or Lilial, and 1,4-phenylenediamine), irritants (sodium dodecyl sulfate, benzalkonium chloride), and a nonsensitizer molecule (chlorobenzene). Three well-known Nrf2 activators (tert-butylhydroquinone, lipoic acid, sulforaphane) were also tested. Expression of hmox1 and nqo1 was measured using real-time PCR and cellular accumulation of Nrf2 was assessed by Western blot. Our results showed an increased expression at early time points of hmox1 and nqo1 mRNAs in response to sensitizers but not to irritants. Accumulation of the Nrf2 protein was also observed only with chemical sensitizers. A significant inhibition of the expression of hmox1 and nqo1 mRNAs and CD86 expression was found in 1-chloro 2,4-dinitrobenzene-treated THP-1 cells preincubated with N-acetyl cysteine, a glutathione precursor. Altogether, these data suggested that the Keap1/Nrf2-signaling pathway was activated by electrophilic molecules including sensitizers in dendritic cells and in the THP-1 cell line. Monitoring of this pathway may provide new biomarkers (e.g., Nrf2, hmox1) for the detection of the sensitization potential of chemicals.

  10. Inhibition of early T cell cytokine production by arsenic trioxide occurs independently of Nrf2.

    Directory of Open Access Journals (Sweden)

    Kelly R VanDenBerg

    Full Text Available Nuclear factor erythroid 2-related factor 2 (Nrf2 is a stress-activated transcription factor that induces a variety of cytoprotective genes. Nrf2 also mediates immunosuppressive effects in multiple inflammatory models. Upon activation, Nrf2 dissociates from its repressor protein, Keap1, and translocates to the nucleus where it induces Nrf2 target genes. The Nrf2-Keap1 interaction is disrupted by the environmental toxicant and chemotherapeutic agent arsenic trioxide (ATO. The purpose of the present study was to determine the effects of ATO on early events of T cell activation and the role of Nrf2 in those effects. The Nrf2 target genes Hmox-1, Nqo-1, and Gclc were all upregulated by ATO (1-2 μM in splenocytes derived from wild-type, but not Nrf2-null, mice, suggesting that Nrf2 is activated by ATO in splenocytes. ATO also inhibited IFNγ, IL-2, and GM-CSF mRNA and protein production in wild-type splenocytes activated with the T cell activator, anti-CD3/anti-CD28. However, ATO also decreased production of these cytokines in activated splenocytes from Nrf2-null mice, suggesting the inhibition is independent of Nrf2. Interestingly, ATO inhibited TNFα protein secretion, but not mRNA expression, in activated splenocytes suggesting the inhibition is due to post-transcriptional modification. In addition, c-Fos DNA binding was significantly diminished by ATO in wild-type and Nrf2-null splenocytes activated with anti-CD3/anti-CD28, consistent with the observed inhibition of cytokine production by ATO. Collectively, this study suggests that although ATO activates Nrf2 in splenocytes, inhibition of early T cell cytokine production by ATO occurs independently of Nrf2 and may instead be due to impaired AP-1 DNA binding.

  11. Taurine Protects Mouse Spermatocytes from Ionizing Radiation-Induced Damage Through Activation of Nrf2/HO-1 Signaling.

    Science.gov (United States)

    Yang, Wenjun; Huang, Jinfeng; Xiao, Bang; Liu, Yan; Zhu, Yiqing; Wang, Fang; Sun, Shuhan

    2017-01-01

    The increasing prevalence of ionizing radiation exposure has inevitably raised public concern over the potential detrimental effects of ionizing radiation on male reproductive system function. The detection of drug candidates to prevent reproductive system from damage caused by ionizing radiation is urgent. We aimed to investigate the protective role of taurine on the injury of mouse spermatocyte-derived cells (GC-2) subjected to ionizing radiation. mouse spermatocytes (GC-2 cells) were exposed to ionizing radiation with or without treatment of Taurine. The effect of ionizing radiation and Taurine treatment on GC-2 cells were evaluated by cell viability assay (CCK8), cell cycle and apoptosis. The relative protein abundance change was determined by Western blotting. The siRNA was used to explore whether Nrf2 signaling was involved in the cytoprotection of Taurine. Taurine significantly inhibited the decrease of cell viability, percentage of apoptotic cells and cell cycle arrest induced by ionizing radiation. Western blot analysis showed that taurine significantly limited the ionizing radiation-induced down-regulation of CyclinB1 and CDK1, and suppressed activation of Fas/FasL system pathway. In addition, taurine treatment significantly increased the expression of Nrf2 and HO-1 in GC-2 cells exposed to ionizing radiation, two components in antioxidant pathway. The above cytoprotection of Taurine was blocked by siNrf2. Our results demonstrate that taurine has the potential to effectively protect GC-2 cells from ionizing radiation- triggered damage via upregulation of Nrf2/HO-1 signaling. © 2017 The Author(s). Published by S. Karger AG, Basel.

  12. Neuroprotective effects of vildagliptin in rat rotenone Parkinson's disease model: role of RAGE-NFκB and Nrf2-antioxidant signaling pathways.

    Science.gov (United States)

    Abdelsalam, Rania M; Safar, Marwa M

    2015-06-01

    Gliptins have been recently shown to conquer neuronal degeneration in cell cultures via modulating glucagon-like peptide (GLP)-1. This peptide produced in the gut not only crosses the blood-brain barrier but is also synthesized in the brain and acts on GLP-1R exerting central anti-inflammatory and antiapoptotic effects, thus impeding neuronal damage. This study investigated the antiparkinsonian effect of vildagliptin, a dipeptidyl peptidase (DPP)-4 inhibitor in a rat rotenone model targeting mainly the RAGE-NFκB/Nrf2-signaling pathways, to judge the potential anti-inflammatory/antioxidant effects of the drug. Vildagliptin markedly improved the motor performance in the open field and rotarod tests, effects that were emphasized by the accompanied reduction in striatal dopamine content. It modified the striatal energy level (ADP/ATP) associated with partial antagonism of body weight reduction. This incretin enhancer suppressed nuclear factor (NF)κB and, consequently, the downstream inflammatory mediator tumor necrosis factor-α. Normalization of receptor for advanced glycated end product (RAGE) is a main finding which justifies the anti-inflammatory effects of vildagliptin, together with hampering striatal inducible nitric oxide synthase, intracellular adhesion molecule-1 as well as myeloperoxidase. The antioxidant potential of vildagliptin was depicted as entailing reduction in thiobarbituric acid-reactive substances and the transcriptional factor Nrf-2 level. Vildagliptin guarded against neuronal demise through an antiapoptotic effect as reflected by the reduction in the mitochondrial matrix component cytochrome c and the key downstream executioner caspase-3. In conclusion, vildagliptin is endowed with various neuroprotective effects and thus can be a promising candidate for the management of Parkinson's disease. In the rat rotenone model of Parkinson's disease (PD), striatal RAGE/NFκB signaling was up-regulated associated with elevated levels of inflammatory

  13. 17β-Estradiol up-regulates Nrf2 via PI3K/AKT and estrogen receptor signaling pathways to suppress light-induced degeneration in rat retina.

    Science.gov (United States)

    Zhu, C; Wang, S; Wang, B; Du, F; Hu, C; Li, H; Feng, Y; Zhu, R; Mo, M; Cao, Y; Li, A; Yu, X

    2015-09-24

    Human age-related retinal diseases, such as age-related macular degeneration (AMD), are intimately associated with decreased tissue oxygenation and hypoxia. Different antioxidants have been investigated to reverse AMD. In the present study, we describe the antioxidant 17β-estradiol (βE2) and investigate its protective effects on retinal neurons. Fourteen days after ovariectomy, adult Sprague-Dawley rats were exposed to 8000-lux light for 12h to induce retinal degeneration. Reactive oxygen species (ROS) levels were assessed by confocal fluorescence microscopy using 2,7-dichlorofluorescein diacetate. Nuclear factor erythroid 2-related factor 2 (Nrf2) and antioxidant enzyme mRNA expression were detected by real-time PCR. Western blotting was used to evaluate NRF2 activation. NRF2 translocation was determined by immunohistochemistry, with morphological changes monitored by hematoxylin and eosin staining. Following light exposure, βE2 significantly reduced ROS production. βE2 also up-regulated NRF2 mRNA and protein levels, with maximal expression at 4 and 12h post-exposure, respectively. Interestingly, following βE2 administration, NRF2 was translocated from the cytoplasm to the nucleus, primarily in the outer nuclear layer. βE2 also up-regulated NRF2, which triggered phase-2 antioxidant enzyme expression (superoxide dismutases 1 and 2, catalase, glutaredoxins 1 and 2, and thioredoxins 1 and 2), reduced ROS production, and ameliorated retinal damage. However, the beneficial effects of βE2 were markedly suppressed by pretreatment with LY294002 or ICI182780, specific inhibitors of the phosphatidylinositol 3-kinase-Akt (PI3K/AKT), and estrogen receptor (ER) signaling pathways, respectively. Taken together, these observations suggest that βE2 exerts antioxidative effects following light-induced retinal degeneration potentially via NRF2 activation. This protective mechanism may depend on two pathways: a rapid, non-genomic-type PI3K/AKT response, and a genomic-type ER

  14. Nrf2 regulates cellular behaviors and Notch signaling in oral squamous cell carcinoma cells.

    Science.gov (United States)

    Fan, Hong; Paiboonrungruan, Chorlada; Zhang, Xinyan; Prigge, Justin R; Schmidt, Edward E; Sun, Zheng; Chen, Xiaoxin

    2017-11-04

    Oxidative stress is known to play a pivotal role in the development of oral squamous cell carcinoma (OSCC). We have demonstrated that activation of the nuclear factor erythroid 2-related factor 2 (Nrf2) signaling pathway has chemopreventive effects against oxidative stress-associated OSCC. However, Nrf2 have dual roles in cancer development; while it prevents carcinogenesis of normal cells, hyperactive Nrf2 also promotes the survival of cancer cells. This study is aimed to understand the function of Nrf2 in regulating cellular behaviors of OSCC cells, and the potential mechanisms through which Nrf2 facilitates OSCC. We established the Nrf2-overexpressing and Nrf2-knockdown OSCC cell lines, and examined the function of Nrf2 in regulating cell proliferation, migration, invasion, cell cycle and colony formation. Our data showed that Nrf2 overexpression promoted cancer phenotypes in OSCC cells, whereas Nrf2 silencing inhibited these phenotypes. In addition, Nrf2 positively regulated Notch signaling pathway in OSCC cells in vitro. Consistent with this observation, Nrf2 activation in Keap1 -/- mice resulted in not only hyperproliferation of squamous epithelial cells in mouse tongue as evidenced by increased expression of PCNA, but also activation of Notch signaling in these cells as evidenced by increased expression of NICD1 and Hes1. In conclusion, Nrf2 regulates cancer behaviors and Notch signaling in OSCC cells. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. L-3-n-Butylphthalide Protects HSPB8 K141N Mutation-Induced Oxidative Stress by Modulating the Mitochondrial Apoptotic and Nrf2 Pathways

    Directory of Open Access Journals (Sweden)

    Xiao-Dong Yang

    2017-07-01

    Full Text Available Charcot–Marie–Tooth disease (CMT, also known as hereditary motor and sensory neuropathy, is the most common inherited peripheral nerve disorder. Missense mutations, such as K141N, in the small heat shock protein HSPB8 are known to cause distal hereditary motor neuropathy 2A (dHMN2A or Charcot-Marie-Tooth neuropathy type 2L (CMT2L. However, of critical clinical significance, very few specific therapies for this disease exist. In the present study, we investigated the impact of mutant K141N HSPB8 on mitochondrial distribution and function in a cellular model of CMT2L. Our results indicate that K141N HSPB8 induced mitochondrial aggregation and caused increased oxidative stress injury. As an extraction from Chinese celery Apium graveolens Linn seeds, L-3-n-Butylphthalide (NBP, has been reported to exert many neuroprotective effects, we interrogated whether NBP could elicit a protective effect on the cell injury typically caused by HSPB8 K141N mutations. We found NBP could reverse the pathological processes induced by HSPB8 K141N mutation via an antioxidant effect, modulation of the Bax/Bcl-2 mitochondrial apoptotic and Nrf2 pathways. We propose a novel function of HSPB8, highlighting the consequence of the K141N pathogenic mutation. Furthermore, we suggest NBP may have promising therapeutic potential in the treatment of CMT2L.

  16. Sulforaphane induces apoptosis in T24 human urinary bladder cancer cells through a reactive oxygen species-mediated mitochondrial pathway: the involvement of endoplasmic reticulum stress and the Nrf2 signaling pathway.

    Science.gov (United States)

    Jo, Guk Heui; Kim, Gi-Young; Kim, Wun-Jae; Park, Kun Young; Choi, Yung Hyun

    2014-10-01

    Sulforaphane, a naturally occurring isothiocyanate found in cruciferous vegetables, has received a great deal of attention because of its ability to inhibit cell proliferation and induce apoptosis in cancer cells. In this study, we investigated the anticancer activity of sulforaphane in the T24 human bladder cancer line, and explored its molecular mechanism of action. Our results showed that treatment with sulforaphane inhibited cell viability and induced apoptosis in T24 cells in a concentration-dependent manner. Sulforaphane-induced apoptosis was associated with mitochondria dysfunction, cytochrome c release and Bcl-2/Bax dysregulation. Furthermore, the increased activity of caspase-9 and -3, but not caspase-8, was accompanied by the cleavage of poly ADP-ribose polymerase, indicating the involvement of the mitochondria-mediated intrinsic apoptotic pathway. Concomitant with these changes, sulforaphane triggered reactive oxygen species (ROS) generation, which, along with the blockage of sulforaphane-induced loss of mitochondrial membrane potential and apoptosis, was strongly attenuated by the ROS scavenger N-acetyl-L-cysteine. Furthermore, sulforaphane was observed to activate endoplasmic reticulum (ER) stress and the nuclear factor-E2-related factor-2 (Nrf2) signaling pathway, as demonstrated by the upregulation of ER stress‑related proteins, including glucose-regulated protein 78 and C/EBP-homologous protein, and the accumulation of phosphorylated Nrf2 proteins in the nucleus and induction of heme oxygenase-1 expression, respectively. Taken together, these results demonstrate that sulforaphane has antitumor effects against bladder cancer cells through an ROS-mediated intrinsic apoptotic pathway, and suggest that ER stress and Nrf2 may represent strategic targets for sulforaphane-induced apoptosis.

  17. Tomatidine enhances lifespan and healthspan in C. elegans through mitophagy induction via the SKN-1/Nrf2 pathway

    DEFF Research Database (Denmark)

    Fang, Evandro Fei; Waltz, Tyler B; Kassahun, Henok

    2017-01-01

    in human aging. Tomatidine, a natural compound abundant in unripe tomatoes, inhibits age-related skeletal muscle atrophy in mice. Here we show that tomatidine extends lifespan and healthspan in C. elegans, an animal model of aging which shares many major longevity pathways with mammals. Tomatidine improves...... many C. elegans behaviors related to healthspan and muscle health, including increased pharyngeal pumping, swimming movement, and reduced percentage of severely damaged muscle cells. Microarray, imaging, and behavioral analyses reveal that tomatidine maintains mitochondrial homeostasis by modulating...... occurs in C. elegans, primary rat neurons, and human cells. Our data suggest that tomatidine may delay some physiological aspects of aging, and points to new approaches for pharmacological interventions for diseases of aging....

  18. Systemic administration of the apocarotenoid bixin protects skin against solar UV-induced damage through activation of NRF2.

    Science.gov (United States)

    Tao, Shasha; Park, Sophia L; Rojo de la Vega, Montserrat; Zhang, Donna D; Wondrak, Georg T

    2015-12-01

    Exposure to solar ultraviolet (UV) radiation is a causative factor in skin photodamage and carcinogenesis, and an urgent need exists for improved molecular photoprotective strategies different from (or synergistic with) photon absorption. Recent studies suggest a photoprotective role of cutaneous gene expression orchestrated by the transcription factor NRF2 (nuclear factor-E2-related factor 2). Here we have explored the molecular mechanism underlying carotenoid-based systemic skin photoprotection in SKH-1 mice and provide genetic evidence that photoprotection achieved by the FDA-approved apocarotenoid and food additive bixin depends on NRF2 activation. Bixin activates NRF2 through the critical Cys-151 sensor residue in KEAP1, orchestrating a broad cytoprotective response in cultured human keratinocytes as revealed by antioxidant gene expression array analysis. Following dose optimization studies for cutaneous NRF2 activation by systemic administration of bixin, feasibility of bixin-based suppression of acute cutaneous photodamage from solar UV exposure was investigated in Nrf2(+/+) versus Nrf2(-/-) SKH-1 mice. Systemic administration of bixin suppressed skin photodamage, attenuating epidermal oxidative DNA damage and inflammatory responses in Nrf2(+/+) but not in Nrf2(-/-) mice, confirming the NRF2-dependence of bixin-based cytoprotection. Taken together, these data demonstrate feasibility of achieving NRF2-dependent cutaneous photoprotection by systemic administration of the apocarotenoid bixin, a natural food additive consumed worldwide. Copyright © 2015 Elsevier Inc. All rights reserved.

  19. Metformin inhibits heme oxygenase-1 expression in cancer cells through inactivation of Raf-ERK-Nrf2 signaling and AMPK-independent pathways

    International Nuclear Information System (INIS)

    Do, Minh Truong; Kim, Hyung Gyun; Khanal, Tilak; Choi, Jae Ho; Kim, Dong Hee; Jeong, Tae Cheon; Jeong, Hye Gwang

    2013-01-01

    Resistance to therapy is the major obstacle to more effective cancer treatment. Heme oxygenase-1 (HO-1) is often highly up-regulated in tumor tissues, and its expression is further increased in response to therapies. It has been suggested that inhibition of HO-1 expression is a potential therapeutic approach to sensitize tumors to chemotherapy and radiotherapy. In this study, we tested the hypothesis that the anti-tumor effects of metformin are mediated by suppression of HO-1 expression in cancer cells. Our results indicate that metformin strongly suppresses HO-1 mRNA and protein expression in human hepatic carcinoma HepG2, cervical cancer HeLa, and non-small-cell lung cancer A549 cells. Metformin also markedly reduced Nrf2 mRNA and protein levels in whole cell lysates and suppressed tert-butylhydroquinone (tBHQ)-induced Nrf2 protein stability and antioxidant response element (ARE)-luciferase activity in HepG2 cells. We also found that metformin regulation of Nrf2 expression is mediated by a Keap1-independent mechanism and that metformin significantly attenuated Raf-ERK signaling to suppress Nrf2 expression in cancer cells. Inhibition of Raf-ERK signaling by PD98059 decreased Nrf2 mRNA expression in HepG2 cells, confirming that the inhibition of Nrf2 expression is mediated by an attenuation of Raf-ERK signaling in cancer cells. The inactivation of AMPK by siRNA, DN-AMPK or the pharmacological AMPK inhibitor compound C, revealed that metformin reduced HO-1 expression in an AMPK-independent manner. These results highlight the Raf-ERK-Nrf2 axis as a new molecular target in anticancer therapy in response to metformin treatment. - Highlights: • Metformin inhibits HO-1 expression in cancer cells. • Metformin attenuates Raf-ERK-Nrf2 signaling. • Suppression of HO-1 by metformin is independent of AMPK. • HO-1 inhibition contributes to anti-proliferative effects of metformin

  20. When defense becomes dangerous – transcription factor Nrf2 and cancer

    Directory of Open Access Journals (Sweden)

    Adam Krysztofiak

    2015-01-01

    Full Text Available The transcription factor Nrf2 controls the expression of genes encoding cytoprotective enzymes and proteins. Its activation is related to conformational changes in the inhibitory protein Keap1 and/or Nrf2 phosphorylation by upstream kinases. Activation of Nrf2 can lead to the induction of phase II enzymes responsible for the inactivation of potential carcinogens. This may constitute an important strategy of chemoprevention. Moreover, these enzymatic systems participating in the biotransformation of drugs can reduce their therapeutic effects, contributing to drug resistance. For this reason, a clear understanding of the role of Nrf2 is essential to assess the beneficial and adverse effects of its up-regulation, particularly in relation to the prevention and treatment of cancer. This article summarizes the current state of knowledge on the significance of Nrf2 in tumorigenesis.

  1. 3H-1,2-Dithiole-3-thione as a novel therapeutic agent for the treatment of ischemic stroke through Nrf2 defense pathway.

    Science.gov (United States)

    Kuo, Ping-Chang; Yu, I-Chen; Scofield, Barbara A; Brown, Dennis A; Curfman, Eric T; Paraiso, Hallel C; Chang, Fen-Lei; Yen, Jui-Hung

    2017-05-01

    Cerebral ischemic stroke accounts for more than 80% of all stroke cases. During cerebral ischemia, reactive oxygen species produced in brain tissue induce oxidative stress and inflammatory responses. D3T, the simplest compound of the cyclic, sulfur-containing dithiolethiones, is found in cruciferous vegetables and has been reported to induce antioxidant genes and glutathione biosynthesis through activation of Nrf2. In addition to antioxidant activity, D3T was also reported to possess anti-inflammatory effects. In this study, we evaluated the therapeutic potential of D3T for the treatment of ischemic stroke and investigated the mechanisms underlying the protective effects of D3T in ischemic stroke. Mice subjected to transient middle cerebral artery occlusion/reperfusion (tMCAO/R) were administered with vehicle or D3T to evaluate the effect of D3T in cerebral brain injury. We observed D3T reduced infarct size, decreased brain edema, lessened blood-brain barrier disruption, and ameliorated neurological deficits. Further investigation revealed D3T suppressed microglia (MG) activation and inhibited peripheral inflammatory immune cell infiltration of CNS in the ischemic brain. The protective effect of D3T in ischemic stroke is mediated through Nrf2 induction as D3T-attenuated brain injury was abolished in Nrf2 deficient mice subjected to tMCAO/R. In addition, in vitro results indicate the induction of Nrf2 by D3T is required for its suppressive effect on MG activation and cytokine production. In summary, we demonstrate for the first time that D3T confers protection against ischemic stroke, which is mediated through suppression of MG activation and inhibition of CNS peripheral cell infiltration, and that the protective effect of D3T in ischemic stroke is dependent on the activation of Nrf2. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Induction of Mrp3 and Mrp4 transporters during acetaminophen hepatotoxicity is dependent on Nrf2

    International Nuclear Information System (INIS)

    Aleksunes, Lauren M.; Slitt, Angela L.; Maher, Jonathan M.; Augustine, Lisa M.; Goedken, Michael J.; Chan, Jefferson Y.; Cherrington, Nathan J.; Klaassen, Curtis D.; Manautou, Jose E.

    2008-01-01

    The transcription factor NFE2-related factor 2 (Nrf2) mediates detoxification and antioxidant gene transcription following electrophile exposure and oxidative stress. Mice deficient in Nrf2 (Nrf2-null) are highly susceptible to acetaminophen (APAP) hepatotoxicity and exhibit lower basal and inducible expression of cytoprotective genes, including NADPH quinone oxidoreductase 1 (Nqo1) and glutamate cysteine ligase (catalytic subunit, or Gclc). Administration of toxic APAP doses to C57BL/6J mice generates electrophilic stress and subsequently increases levels of hepatic Nqo1, Gclc and the efflux multidrug resistance-associated protein transporters 1-4 (Mrp1-4). It was hypothesized that induction of hepatic Mrp1-4 expression following APAP is Nrf2 dependent. Plasma and livers from wild-type (WT) and Nrf2-null mice were collected 4, 24 and 48 h after APAP. As expected, hepatotoxicity was greater in Nrf2-null compared to WT mice. Gene and protein expression of Mrp1-4 and the Nrf2 targets, Nqo1 and Gclc, was measured. Induction of Nqo1 and Gclc mRNA and protein after APAP was dependent on Nrf2 expression. Similarly, APAP treatment increased hepatic Mrp3 and Mrp4 mRNA and protein in WT, but not Nrf2-null mice. Mrp1 was induced in both genotypes after APAP, suggesting that elevated expression of this transporter was independent of Nrf2. Mrp2 was not induced in either genotype at the mRNA or protein levels. These results show that Nrf2 mediates induction of Mrp3 and Mrp4 after APAP but does not affect Mrp1 or Mrp2. Thus coordinated regulation of detoxification enzymes and transporters by Nrf2 during APAP hepatotoxicity is a mechanism by which hepatocytes may limit intracellular accumulation of potentially toxic chemicals

  3. Novel function of transcription factor Nrf2 as an inhibitor of RON tyrosine kinase receptor-mediated cancer cell invasion.

    Science.gov (United States)

    Thangasamy, Amalraj; Rogge, Jessica; Krishnegowda, Naveen K; Freeman, James W; Ammanamanchi, Sudhakar

    2011-09-16

    Recepteur d' origine nantais (RON), a tyrosine kinase receptor, is aberrantly expressed in human tumors and promotes cancer cell invasion. RON receptor activation is also associated with resistance to tamoxifen treatment in breast cancer cells. Nrf2 is a positive regulator of cytoprotective genes. Using chromatin immunoprecipitation (ChIP) and site-directed mutagenesis studies of the RON promoter, we identified Nrf2 as a negative regulator of RON gene expression. High Nrf2 and low RON expression was observed in normal mammary tissue whereas high RON and low or undetectable expression of Nrf2 was observed in breast tumors. The Nrf2 inducer sulforaphane (SFN) as well as ectopic Nrf2 expression or knock-down of the Nrf2 negative regulator keap1, which stabilizes Nrf2, inhibited RON expression and invasion of carcinoma cells. Consequently, our studies identified a novel functional role for Nrf2 as a "repressor" and RON kinase as a molecular target of SFN, which mediates the anti-tumor effects of SFN. These results are not limited to breast cancer cells since the Nrf2 inducer SFN stabilized Nrf2 and inhibited RON expression in carcinoma cells from various tumor types.

  4. Benzo[a]pyrene affects Jurkat T cells in the activated state via the antioxidant response element dependent Nrf2 pathway leading to decreased IL-2 secretion and redirecting glutamine metabolism

    Energy Technology Data Exchange (ETDEWEB)

    Murugaiyan, Jayaseelan; Rockstroh, Maxie; Wagner, Juliane [Department of Proteomics, Helmholtz-Centre for Environmental Research — UFZ, Permoserstr. 15, 04318 Leipzig (Germany); Baumann, Sven [Department of Metabolomics, Helmholtz-Centre for Environmental Research — UFZ, Permoserstr. 15, 04318 Leipzig (Germany); Schorsch, Katrin [Department of Proteomics, Helmholtz-Centre for Environmental Research — UFZ, Permoserstr. 15, 04318 Leipzig (Germany); Trump, Saskia; Lehmann, Irina [Department of Environmental Immunology, Helmholtz-Centre for Environmental Research — UFZ, Permoserstr. 15, 04318 Leipzig (Germany); Bergen, Martin von [Department of Proteomics, Helmholtz-Centre for Environmental Research — UFZ, Permoserstr. 15, 04318 Leipzig (Germany); Department of Environmental Immunology, Helmholtz-Centre for Environmental Research — UFZ, Permoserstr. 15, 04318 Leipzig (Germany); Department of Biotechnology, Chemistry and Environmental Engineering, Aalborg University, Aalborg (Denmark); Tomm, Janina M., E-mail: Janina.tomm@ufz.de [Department of Proteomics, Helmholtz-Centre for Environmental Research — UFZ, Permoserstr. 15, 04318 Leipzig (Germany)

    2013-06-15

    There is a clear evidence that environmental pollutants, such as benzo[a]pyrene (B[a]P), can have detrimental effects on the immune system, whereas the underlying mechanisms still remain elusive. Jurkat T cells share many properties with native T lymphocytes and therefore are an appropriate model to analyze the effects of environmental pollutants on T cells and their activation. Since environmental compounds frequently occur at low, not acute toxic concentrations, we analyzed the effects of two subtoxic concentrations, 50 nM and 5 μM, on non- and activated cells. B[a]P interferes directly with the stimulation process as proven by an altered IL-2 secretion. Furthermore, B[a]P exposure results in significant proteomic changes as shown by DIGE analysis. Pathway analysis revealed an involvement of the AhR independent Nrf2 pathway in the altered processes observed in unstimulated and stimulated cells. A participation of the Nrf2 pathway in the change of IL-2 secretion was confirmed by exposing cells to the Nrf2 activator tBHQ. tBHQ and 5 μM B[a]P caused similar alterations of IL-2 secretion and glutamine/glutamate metabolism. Moreover, the proteome changes in unstimulated cells point towards a modified regulation of the cytoskeleton and cellular stress response, which was proven by western blotting. Additionally, there is a strong evidence for alterations in metabolic pathways caused by B[a]P exposure in stimulated cells. Especially the glutamine/glutamate metabolism was indicated by proteome pathway analysis and validated by metabolite measurements. The detrimental effects were slightly enhanced in stimulated cells, suggesting that stimulated cells are more vulnerable to the environmental pollutant model compound B[a]P. - Highlights: • B[a]P affects the proteome of Jurkat T cells also at low concentrations. • Exposure to B[a]P (50 nM, 5 μM) did not change Jurkat T cell viability. • Both B[a]P concentrations altered the IL-2 secretion of stimulated cells.

  5. Ectodermal-neural cortex 1 down-regulates Nrf2 at the translational level.

    Directory of Open Access Journals (Sweden)

    Xiao-Jun Wang

    Full Text Available The transcription factor Nrf2 is the master regulator of a cellular defense mechanism against environmental insults. The Nrf2-mediated antioxidant response is accomplished by the transcription of a battery of genes that encode phase II detoxifying enzymes, xenobiotic transporters, and antioxidants. Coordinated expression of these genes is critical in protecting cells from toxic and carcinogenic insults and in maintaining cellular redox homeostasis. Activation of the Nrf2 pathway is primarily controlled by Kelch-like ECH-associated protein 1 (Keap1, which is a molecular switch that turns on or off the Nrf2 signaling pathway according to intracellular redox conditions. Here we report our finding of a novel Nrf2 suppressor ectodermal-neural cortex 1 (ENC1, which is a BTB-Kelch protein and belongs to the same family as Keap1. Transient expression of ENC1 reduced steady-state levels of Nrf2 and its downstream gene expression. Although ENC1 interacted with Keap1 indirectly, the ENC1-mediated down-regulation of Nrf2 was independent of Keap1. The negative effect of ENC1 on Nrf2 was not due to a change in the stability of Nrf2 because neither proteasomal nor lysosomal inhibitors had any effects. Overexpression of ENC1 did not result in a change in the level of Nrf2 mRNA, rather, it caused a decrease in the rate of Nrf2 protein synthesis. These results demonstrate that ENC1 functions as a negative regulator of Nrf2 through suppressing Nrf2 protein translation, which adds another level of complexity in controlling the Nrf2 signaling pathway.

  6. Dextran loading protects macrophages from lipid peroxidation and induces a Keap1/Nrf2/ARE-dependent antioxidant response.

    Science.gov (United States)

    Chechushkov, Anton; Zaitseva, Natalia; Vorontsova, Elena; Kozhin, Petr; Menshchikova, Elena; Shkurupiy, Vyacheslav

    2016-12-01

    Linear dextrans are often proposed as drug delivery systems with milder adverse effects and lower effective drug concentrations. Linear dextrans are polysaccharides that can potentially be used to load macrophages with drugs to transport them to a site of inflammation. Recently, it was reported that dextrans may exert a protective effect vis-à-vis drug cytotoxicity and during wound healing. The aim of the current work was to evaluate molecular mechanisms of action of dextrans that may be relevant to the cytoprotective effects. We determined the effect of treatment with 40- or 70-kDa dextran on production of reactive oxygen species, lipid peroxidation, and lysosomal pH in the J774 macrophage cell line. In addition, induction of Keap1/Nrf2/ARE and autophagic activity were evaluated. Dextrans of both molecular weights protected the cells from oxidative stress induced by cumene hydroperoxide and from lysosomal stress induced by ammonium chloride. The effect was associated with induction of the Keap1/Nrf2/ARE signaling pathway. Furthermore, dextran stimulated autophagy in a dose-dependent manner but inhibited the autophagosome-lysosome fusion in a time-dependent manner. This study shows possible cytoprotective effects of dextran under oxidative stress, and these findings may be used for the development of novel (dextran-based) drug delivery approaches. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. Interplay between VEGF and Nrf2 regulates angiogenesis due to intracranial venous hypertension.

    Science.gov (United States)

    Li, Liwen; Pan, Hao; Wang, Handong; Li, Xiang; Bu, Xiaomin; Wang, Qiang; Gao, Yongyue; Wen, Guodao; Zhou, Yali; Cong, Zixiang; Yang, Youqing; Tang, Chao; Liu, Zhengwei

    2016-11-21

    Venous hypertension(VH) plays an important role in the pathogenesis of cerebral arteriovenous malformations (AVMs) and is closely associated with the HIF-1α/VEGF signaling pathway. Nuclear factor erythroid 2-related factor 2(Nrf2) significantly influences angiogenesis; however, the interplay between Nrf2 and VEGF under VH in brain AVMs remains unclear. Therefore, our study aimed to investigate the interplay between Nrf2 and VEGF due to VH in brain AVMs. Immunohistochemistry indicated that Nrf2 and VEGF were highly expressed in human brain AVM tissues. In vivo, we established a VH model in both wild-type (WT) and siRNA-mediated Nrf2 knockdown rats. VH significantly increased the expression of Nrf2 and VEGF. Loss of Nrf2 markedly inhibited the upregulation of VEGF, as determined by Western blot analysis and qRT-PCR. In vitro, primary brain microvascular endothelial cells (BMECs) were isolated from WT and Nrf2 -/- mice, and a VEGF-Nrf2 positive feed-back loop was observed in BMECs. By trans well assay and angiogenesis assay, Nrf2 knockout significantly inhibited the migration and vascular tube formation of BMECs. These findings suggest that the interplay between Nrf2 and VEGF can contribute to VH-induced angiogenesis in brain AVMs pathogenesis.

  8. Disruption of Nrf2, a key inducer of antioxidant defenses, attenuates ApoE-mediated atherosclerosis in mice.

    Directory of Open Access Journals (Sweden)

    Thomas E Sussan

    Full Text Available BACKGROUND: Oxidative stress and inflammation are two critical factors that drive the formation of plaques in atherosclerosis. Nrf2 is a redox-sensitive transcription factor that upregulates a battery of antioxidative genes and cytoprotective enzymes that constitute the cellular response to oxidative stress. Our previous studies have shown that disruption of Nrf2 in mice (Nrf2(-/- causes increased susceptibility to pulmonary emphysema, asthma and sepsis due to increased oxidative stress and inflammation. Here we have tested the hypothesis that disruption of Nrf2 in mice causes increased atherosclerosis. PRINCIPAL FINDINGS: To investigate the role of Nrf2 in the development of atherosclerosis, we crossed Nrf2(-/- mice with apoliporotein E-deficient (ApoE(-/- mice. ApoE(-/- and ApoE(-/-Nrf2(-/- mice were fed an atherogenic diet for 20 weeks, and plaque area was assessed in the aortas. Surprisingly, ApoE(-/-Nrf2(-/- mice exhibited significantly smaller plaque area than ApoE(-/- controls (11.5% vs 29.5%. This decrease in plaque area observed in ApoE(-/-Nrf2(-/- mice was associated with a significant decrease in uptake of modified low density lipoproteins (AcLDL by isolated macrophages from ApoE(-/-Nrf2(-/- mice. Furthermore, atherosclerotic plaques and isolated macrophages from ApoE(-/-Nrf2(-/- mice exhibited decreased expression of the scavenger receptor CD36. CONCLUSIONS: Nrf2 is pro-atherogenic in mice, despite its antioxidative function. The net pro-atherogenic effect of Nrf2 may be mediated via positive regulation of CD36. Our data demonstrates that the potential effects of Nrf2-targeted therapies on cardiovascular disease need to be investigated.

  9. Qing brick tea (QBT) aqueous extract protects monosodium glutamate-induced obese mice against metabolic syndrome and involves up-regulation Transcription Factor Nuclear Factor-Erythroid 2-Related Factor 2 (Nrf2) antioxidant pathway.

    Science.gov (United States)

    Gao, Wenqi; Xiao, Changyi; Hu, Jun; Chen, Biaoxin; Wang, Chunyan; Cui, Bangping; Deng, Pengyi; Yang, Jian; Deng, Zhifang

    2018-04-18

    Qing brick tea (QBT), traditional and popular beverage for Chinese people, is an important post-fermentation dark tea. Our present study was performed to investigate the ameliorative effects of QBT aqueous extract on metabolic syndrome (Mets) in monosodium glutamate-induced obese mice and the potential mechanisms. Monosodium glutamate-induced obese mice were used to evaluate the anti-Mets effects of QBT. Content levels of malonaldehyde (MDA), reactive oxygen species (ROS) and protein carbonylation, antioxidant enzyme activities of superoxide dismutase (SOD), glutathione peroxidase (GPx), catalase (CAT), glutathione reductase (GR) in the skeletal muscle were assessed by commercial kits, respectively. Western blot and Q-PCR were used to detect the expressions of Transcription Factor Nuclear Factor-Erythroid 2-Related Factor 2 (Nrf2) signaling pathway and downstream antioxidant factors. In addition, activity of AKT signaling and expression of glucose transporter type 4 (GLUT4) in the skeletal muscle were investigated by western blot. QBT treatment limited gain of body weight, waistline and LEE index, improved insulin resistance and glucose intolerance, reduced lipid level in MSG mice. Content levels of MDA, ROS and protein carbonylation in skeletal muscle of QBT group were significantly improved compared to those of MSG mice. The antioxidant enzyme activities of SOD, GPx, CAT, and GR were increased in skeletal muscle of MSG mice intervened with QBT. After 20-week QBT treatment, Nrf2 signaling pathway and downstream antioxidant factors were both increased in the skeletal muscle. In addition, QBT treatment improved insulin signaling by preferentially augmenting AKT signaling, as well as increased the protein expression of GLUT4 in the skeletal muscle. Our results showed that QBT intake was effective in protecting monosodium glutamate-induced obese mice against metabolic syndrome and involved in the Nrf2 signaling pathway in the skeletal muscle. Copyright © 2018

  10. Carbon monoxide mediates heme oxygenase 1 induction via Nrf2 activation in hepatoma cells

    International Nuclear Information System (INIS)

    Lee, Bok-Soo; Heo, JungHee; Kim, Yong-Man; Shim, Sang Moo; Pae, Hyun-Ock; Kim, Young-Myeong; Chung, Hun-Taeg

    2006-01-01

    Carbon monoxide (CO) and nitric oxide (NO) are two gas molecules which have cytoprotective functions against oxidative stress and inflammatory responses in many cell types. Currently, it is known that NO produced by nitric oxide synthase (NOS) induces heme oxygenase 1 (HO1) expression and CO produced by the HO1 inhibits inducible NOS expression. Here, we first show CO-mediated HO1 induction and its possible mechanism in human hepatocytes. Exposure of HepG2 cells or primary hepatocytes to CO resulted in dramatic induction of HO1 in dose- and time-dependent manner. The CO-mediated HO1 induction was abolished by MAP kinase inhibitors (MAPKs) but not affected by inhibitors of PI3 kinase or NF-κB. In addition, CO induced the nuclear translocation and accumulation of Nrf2, which suppressed by MAPKs inhibitors. Taken together, we suggest that CO induces Nrf2 activation via MAPKs signaling pathways, thereby resulting in HO1 expression in HepG2 cells

  11. Gemfibrozil pretreatment affecting antioxidant defense system and inflammatory, but not Nrf-2 signaling pathways resulted in female neuroprotection and male neurotoxicity in the rat models of global cerebral ischemia-reperfusion.

    Science.gov (United States)

    Mohagheghi, Fatemeh; Khalaj, Leila; Ahmadiani, Abolhassan; Rahmani, Behrouz

    2013-04-01

    Two important pathophysiological mechanisms involved during cerebral ischemia are oxidative stress and inflammation. In pathological conditions such as brain ischemia the ability of free radicals production is greater than that of elimination by endogenous antioxidative systems, so brain is highly injured due to oxidation and neuroinflammation. Fibrates as peroxisome proliferator-activated receptor (PPAR)-α ligands, are reported to have antioxidant and anti-inflammatory actions. In this study, gemfibrozil, a fibrate is investigated for its therapeutic potential against global cerebral ischemia-reperfusion (I/R) injury of male and female rats. This study particularly has focused on inflammatory and antioxidant signaling pathways, such as nuclear factor erythroid-related factor (Nrf)-2, as well as the activity of some endogenous antioxidant agents. It was found that pretreatment of animals with gemfibrozil prior to I/R resulted in a sexually dimorphic outcome. Within females it proved to be protective, modulating inflammatory factors and inducing antioxidant defense system including superoxide dismutase (SOD), catalase, as well as glutathione level. However, Nrf-2 signaling pathway was not affected. It also decreased malondialdehyde level as an index of lipid peroxidation. In contrast, gemfibrozil pretreatment was toxic to males, enhancing the expression of inflammatory factors such as tumor necrosis factor-α, nuclear factor-κB, and cyclooxygenase-2, and decreasing Nrf-2 expression and SOD activity, leading to hippocampal neurodegeneration. Considering that gemfibrozil is a commonly used anti-hyperlipidemic agent in clinic, undoubtedly more investigations are crucial to exactly unravel its sex-dependent neuroprotective/neurodegenerative potential.

  12. Gold-quercetin nanoparticles prevent metabolic endotoxemia-induced kidney injury by regulating TLR4/NF-κB signaling and Nrf2 pathway in high fat diet fed mice.

    Science.gov (United States)

    Xu, Min-Xuan; Wang, Ming; Yang, Wei-Wei

    2017-01-01

    High-fat diet-induced metabolic syndrome followed by chronic kidney disease caused by intestinal endotoxemia have received extensive attention. Toll-like receptor 4 (TLR4)/nuclear factor-kappa B (NF-κB) and oxidative stress-related Nrf2/Keap1 were regarded as the key target points involved in metabolic inflammation and kidney injury. However, the molecular mechanism of interaction between TLR4/NF-κB and Nrf2 activation in high-fat diet-induced renal injury is not absolutely understood. Quercetin, a natural product, has been reported to possess antitumor and anti-inflammatory effects. In this regard, this study attempted to prepare poly(d,l-lactide- co -glycolide)-loaded gold nanoparticles precipitated with quercetin (GQ) to investigate the anti-inflammatory and anti-oxidative stress effects in high-fat diet-induced kidney failure. For this study, C57BL/6 mice fed fat-rich fodder were used as the metabolic syndrome model to evaluate the protective effects of GQ on kidney injury and to determine whether TLR4/NF-κB and Nrf2 pathways were associated with the process. Moreover, histological examinations, enzyme-linked immunosorbent assay, Western blot, and basic blood tests and systemic inflammation-related indicators were used to investigate the inhibitory effects of GQ and underlying molecular mechanism by which it may reduce renal injury. Of note, podocyte injury was found to participate in endotoxin-stimulated inflammatory response. TLR4/NF-κB and Nrf2 pathways were upregulated with high-fat diet intake in mice, resulting in reduction of superoxide dismutase activity and increase in superoxide radical, H 2 O 2 , malondialdehyde, XO, XDH, and XO/XDH ratio. In addition, upregulation of TLR4/NF-κB and oxidative stress by endotoxin were observed in vitro, which were suppressed by GQ administration, ultimately alleviating podocyte injury. These findings indicated that GQ could restore the metabolic disorders caused by high-fat diet, which suppresses insulin

  13. Evaluation of potential antioxidant and anti-inflammatory effects of Antrodia cinnamomea powder and the underlying molecular mechanisms via Nrf2- and NF-κB-dominated pathways in broiler chickens.

    Science.gov (United States)

    Lee, M T; Lin, W C; Wang, S Y; Lin, L J; Yu, B; Lee, T T

    2018-04-17

    improvement of immunomodulatory-related capacity by ACP. Furthermore, ACP could induce the Nrf2-dependent pathway and decrease the NF-κB-dominated inflammatory signaling pathway. Antioxidant and immune capacity in terms of antioxidant enzymes and cell tolerance also was elevated by ACP. Concomitantly, body weight increasing with ACP supplementation as compared to the corresponding control group further implied the promising effects exerted by ACP.

  14. Reduction of oxidative damages induced by titanium dioxide nanoparticles correlates with induction of the Nrf2 pathway by GSPE supplementation in mice.

    Science.gov (United States)

    Niu, Linpeng; Shao, Mengjiao; Liu, Yuan; Hu, Jinfeng; Li, Ruofan; Xie, Heran; Zhou, Lixiao; Shi, Lei; Zhang, Rong; Niu, Yujie

    2017-09-25

    Titanium dioxide nanoparticles (TiO 2 NPs) are widely used to additives in cosmetics, pharmaceuticals, paints and foods. Recent studies have demonstrated that TiO 2 NPs increased the risk of cancer and the mechanism might relate with oxidative stress. Grape seed procyanidin extract (GSPE) is a natural compound which has been demonstrated to possess a wide array of pharmacological and biochemical actions, including anti-inflammatory, anti-carcinogenic, and antioxidant properties. Our data show that GSPE prevents the changes of histopathology and biomarkers in heart, liver and kidney that occur in mice exposed to TiO 2 NPs. After pretreatment with GSPE, the DNA damage, reactive oxygen species (ROS) generation and malondialdehyde (MDA) content in mice exposed to TiO 2 NPs had statistically significant decreases in dose dependent manners. GSPE increased the expression of nuclear factor erythroid 2 (NF-E2)-related factor 2 (Nrf2), NAD(P)H dehydrogenase[quinine] 1(NQO1), heme oxygenase 1 (HO-1) and glutamate-cysteine ligase catalytic subunit (GCLC). We conclude that grape seed procyanidin extract prevents the majority of tissue and molecular damage resulting from nanoparticle treatment. The protective effect of GSPE may be due to its strong antioxidative activities which related with the activated Nrf2 and its down-regulated genes including NQO1, HO-1 and GCLC. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Preventive Effects of Velvet Antler (Cervus elaphus against Lipopolysaccharide-Induced Acute Lung Injury in Mice by Inhibiting MAPK/NF-κB Activation and Inducing AMPK/Nrf2 Pathways

    Directory of Open Access Journals (Sweden)

    Jui-Shu Chang

    2018-01-01

    Full Text Available Velvet antler (Cervus elaphus is a typical traditional animal medicine. It is considered to have various pharmacological effects including stimulation of the immune system, increase in the physical strength, and enhancement of sexual function. This paper aims to investigate the aqueous extract of velvet antler (AVA in the mouse models of LPS-induced ALI. Inhibition of NO, TNF-α, IL-1β, IL-6, and IL-10 productions contributes to the attenuation of LPS-induced lung inflammation by AVA. A 5-day pretreatment of AVA prevented histological alterations and enhanced antioxidant enzyme activity in lung tissues. AVA significantly reduced the material (total number of cells and proteins in the BALF. Western blot analysis revealed that the expression of iNOS and COX-2 and phosphorylation of IκB-α and MAPKs proteins are blocked in LPS-stimulated macrophages as well as LPS-induced lung injury in mice. Consistent with this concept, the phosphorylation of CaMKKβ, LKB1, AMPK, Nrf2, and HO-1 was activated after AVA treatment. The results from this study indicate AVA has anti-inflammatory effects in vivo and AVA is a potential model for the development of health food. In addition, its pathways may be at least partially associated with inhibiting MAPK/NF-κB activation and upregulating AMPK/Nrf2 pathways and the regulation of antioxidant enzyme activity.

  16. Procyanidins from wild grape (Vitis amurensis) seeds regulate ARE-mediated enzyme expression via Nrf2 coupled with p38 and PI3K/Akt pathway in HepG2 cells.

    Science.gov (United States)

    Bak, Min-Ji; Jun, Mira; Jeong, Woo-Sik

    2012-01-01

    Procyanidins, polymers of flavan-3-ol units, have been reported to exhibit many beneficial health effects such as antioxidant and anti-carcinogenic effects. In this study, we investigated the cancer chemopreventive properties of procyanidins from wild grape (Vitis amurensis) seeds in particular their roles in inducing phase II detoxifying/antioxidant enzymes as well as in modulating the upstream kinases. Ethanolic extract of V. amurensis seeds was fractionated with a series of organic solvents and finally separated into six fractions, F1-F6. Chemical properties of the procyanidins were analyzed by vanillin assay, BuOH-HCl test, and depolymerization with phloroglucinol followed by LC/MS analysis. The F5 had the highest procyanidin content among all the fractions and strongly induced the reporter activity of antioxidant response element as well as the protein expression of nuclear factor E2-related factor (Nrf2) in HepG2 human hepatocarcinoma cells. The procyanidin-rich F5 also strongly induced the expression of the phase II detoxifying and antioxidant enzymes such as NAD(P)H:quinone oxidoreductase1 and hemeoxygenase1. Phosphorylations of the upstream kinases such as MAPKs and PI3K/Akt were significantly increased by treatment with procyanidin fraction. In addition, the procyanidin-mediated Nrf2 expression was partly attenuated by PI3K inhibitor LY294002, and almost completely by p38 inhibitor SB202190, but neither by JNK inhibitor SP600125 nor by MEK1/2 inhibitor U0126. Taken together, the procyanidins from wild grape seeds could be used as a potential natural chemopreventive agent through Nrf2/ARE-mediated phase II detoxifying/antioxidant enzymes induction via p38 and PI3K/Akt pathway.

  17. Procyanidins from Wild Grape (Vitis amurensis Seeds Regulate ARE-Mediated Enzyme Expression via Nrf2 Coupled with p38 and PI3K/Akt Pathway in HepG2 Cells

    Directory of Open Access Journals (Sweden)

    Woo-Sik Jeong

    2012-01-01

    Full Text Available Procyanidins, polymers of flavan-3-ol units, have been reported to exhibit many beneficial health effects such as antioxidant and anti-carcinogenic effects. In this study, we investigated the cancer chemopreventive properties of procyanidins from wild grape (Vitis amurensis seeds in particular their roles in inducing phase II detoxifying/antioxidant enzymes as well as in modulating the upstream kinases. Ethanolic extract of V. amurensis seeds was fractionated with a series of organic solvents and finally separated into six fractions, F1–F6. Chemical properties of the procyanidins were analyzed by vanillin assay, BuOH-HCl test, and depolymerization with phloroglucinol followed by LC/MS analysis. The F5 had the highest procyanidin content among all the fractions and strongly induced the reporter activity of antioxidant response element as well as the protein expression of nuclear factor E2-related factor (Nrf2 in HepG2 human hepatocarcinoma cells. The procyanidin-rich F5 also strongly induced the expression of the phase II detoxifying and antioxidant enzymes such as NAD(PH:quinone oxidoreductase1 and hemeoxygenase1. Phosphorylations of the upstream kinases such as MAPKs and PI3K/Akt were significantly increased by treatment with procyanidin fraction. In addition, the procyanidin-mediated Nrf2 expression was partly attenuated by PI3K inhibitor LY294002, and almost completely by p38 inhibitor SB202190, but neither by JNK inhibitor SP600125 nor by MEK1/2 inhibitor U0126. Taken together, the procyanidins from wild grape seeds could be used as a potential natural chemopreventive agent through Nrf2/ARE-mediated phase II detoxifying/antioxidant enzymes induction via p38 and PI3K/Akt pathway.

  18. Enhanced sensitivity of A549 cells to the cytotoxic action of anticancer drugs via suppression of Nrf2 by procyanidins from Cinnamomi Cortex extract

    Energy Technology Data Exchange (ETDEWEB)

    Ohnuma, Tomokazu; Matsumoto, Takashi; Itoi, Ayano; Kawana, Ayako; Nishiyama, Takahito; Ogura, Kenichiro [Department of Drug Metabolism and Molecular Toxicology, School of Pharmacy, Tokyo University of Pharmacy and Life Sciences, 1432-1 Horinouchi, Hachioji-shi, Tokyo 192-0392 (Japan); Hiratsuka, Akira, E-mail: hiratuka@toyaku.ac.jp [Department of Drug Metabolism and Molecular Toxicology, School of Pharmacy, Tokyo University of Pharmacy and Life Sciences, 1432-1 Horinouchi, Hachioji-shi, Tokyo 192-0392 (Japan)

    2011-10-07

    Highlights: {yields} We found a novel inhibitor of Nrf2 known as a chemoresistance factor. {yields} Overexpressed Nrf2 in lung cancer cells was suppressed by Cinnamomi Cortex extract. {yields} Cytotoxic action of anticancer drugs in cells treated with the extract was enhanced. {yields} Procyanidin tetramers and pentamers were active components in suppressing Nrf2. -- Abstract: Nuclear factor-E2-related factor 2 (Nrf2) is an important cytoprotective transcription factor because Nrf2-regulated enzymes play a key role in antioxidant and detoxification processes. Recent studies have reported that lung cancer cells overexpressing Nrf2 exhibit increased resistance to chemotherapy. Suppression of overexpressed Nrf2 is needed for a new therapeutic approach against lung cancers. In the present study, we found that Cinnamomi Cortex extract (CCE) has an ability to suppress Nrf2-regulated enzyme activity and Nrf2 expression in human lung cancer A549 cells with high Nrf2 activity. Moreover, we demonstrated that CCE significantly enhances sensitivity of A549 cells to the cytotoxic action of doxorubicin and etoposide as well as increasing the intracellular accumulation of both drugs. These results suggest that CCE might be an effective concomitant agent to reduce anticancer drug resistance derived from Nrf2 overexpression. Bioactivity-guided fractionation revealed that procyanidin tetramers and pentamers contained in CCE were active components in suppressing Nrf2.

  19. Nrf2 the rescue: Effects of the antioxidative/electrophilic response on the liver

    International Nuclear Information System (INIS)

    Klaassen, Curtis D.; Reisman, Scott A.

    2010-01-01

    Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcription factor that positively regulates the basal and inducible expression of a large battery of cytoprotective genes. These gene products include proteins that catalyze reduction reactions (NAD(P)H:quinone oxidoreductase 1, Nqo1), conjugation reactions (glutathione-S-transferases, Gsts and UDP-glucuronosyltransferases, Ugts), as well as the efflux of potentially toxic xenobiotics and xenobiotic conjugates (multidrug resistance-associated proteins, Mrps). The significance of Nrf2 in the liver has been established, as livers of Nrf2-null mice are more susceptible to various oxidative/electrophilic stress-induced pathologies than wild-type mice. In contrast, both pharmacological and genetic models of hepatic Nrf2 activation are protective against oxidative/electrophilic stress. Furthermore, because certain Nrf2-target genes in the liver could affect the distribution, metabolism, and excretion of xenobiotics, the effects of Nrf2 on the kinetics of drugs and other xenobiotics should also be considered, with a special emphasis on metabolism and excretion. Therefore, this review highlights the research that has contributed to the understanding of the importance of Nrf2 in toxicodynamics and toxicokinetics, especially that which pertains to the liver.

  20. Yeast as a Tool to Study Signaling Pathways in Mitochondrial Stress Response and Cytoprotection

    Directory of Open Access Journals (Sweden)

    Maša Ždralević

    2012-01-01

    Full Text Available Cell homeostasis results from the balance between cell capability to adapt or succumb to environmental stress. Mitochondria, in addition to supplying cellular energy, are involved in a range of processes deciding about cellular life or death. The crucial role of mitochondria in cell death is well recognized. Mitochondrial dysfunction has been associated with the death process and the onset of numerous diseases. Yet, mitochondrial involvement in cellular adaptation to stress is still largely unexplored. Strong interest exists in pharmacological manipulation of mitochondrial metabolism and signaling. The yeast Saccharomyces cerevisiae has proven a valuable model organism in which several intracellular processes have been characterized in great detail, including the retrograde response to mitochondrial dysfunction and, more recently, programmed cell death. In this paper we review experimental evidences of mitochondrial involvement in cytoprotection and propose yeast as a model system to investigate the role of mitochondria in the cross-talk between prosurvival and prodeath pathways.

  1. Nrf2 deficiency improves glucose tolerance in mice fed a high-fat diet

    International Nuclear Information System (INIS)

    Zhang, Yu-Kun Jennifer; Wu, Kai Connie; Liu, Jie; Klaassen, Curtis D.

    2012-01-01

    Nrf2, a master regulator of intracellular redox homeostasis, is indicated to participate in fatty acid metabolism in liver. However, its role in diet-induced obesity remains controversial. In the current study, genetically engineered Nrf2-null, wild-type (WT), and Nrf2-activated, Keap1-knockdown (K1-KD) mice were fed either a control or a high-fat Western diet (HFD) for 12 weeks. The results indicate that the absence or enhancement of Nrf2 activity did not prevent diet-induced obesity, had limited effects on lipid metabolism, but affected blood glucose homeostasis. Whereas the Nrf2-null mice were resistant to HFD-induced glucose intolerance, the Nrf2-activated K1-KD mice exhibited prolonged elevation of circulating glucose during a glucose tolerance test even on the control diet. Feeding a HFD did not activate the Nrf2 signaling pathway in mouse livers. Fibroblast growth factor 21 (Fgf21) is a liver-derived anti-diabetic hormone that exerts glucose- and lipid-lowering effects. Fgf21 mRNA and protein were both elevated in livers of Nrf2-null mice, and Fgf21 protein was lower in K1-KD mice than WT mice. The inverse correlation between Nrf2 activity and hepatic expression of Fgf21 might explain the improved glucose tolerance in Nrf2-null mice. Furthermore, a more oxidative cellular environment in Nrf2-null mice could affect insulin signaling in liver. For example, mRNA of insulin-like growth factor binding protein 1, a gene repressed by insulin in hepatocytes, was markedly elevated in livers of Nrf2-null mice. In conclusion, genetic alteration of Nrf2 does not prevent diet-induced obesity in mice, but deficiency of Nrf2 improves glucose homeostasis, possibly through its effects on Fgf21 and/or insulin signaling. -- Highlights: ► Nrf2 deficiency improves glucose tolerance in mice fed a high-fat diet. ► The anti-diabetic hormone, Fgf21, is highly expressed in livers of Nrf2-null mice. ► The absence of Nrf2 increases the insulin-regulated Igfbp-1 mRNA in liver.

  2. Nrf2 deficiency improves glucose tolerance in mice fed a high-fat diet

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Yu-Kun Jennifer; Wu, Kai Connie; Liu, Jie; Klaassen, Curtis D., E-mail: cklaasse@kumc.edu

    2012-11-01

    Nrf2, a master regulator of intracellular redox homeostasis, is indicated to participate in fatty acid metabolism in liver. However, its role in diet-induced obesity remains controversial. In the current study, genetically engineered Nrf2-null, wild-type (WT), and Nrf2-activated, Keap1-knockdown (K1-KD) mice were fed either a control or a high-fat Western diet (HFD) for 12 weeks. The results indicate that the absence or enhancement of Nrf2 activity did not prevent diet-induced obesity, had limited effects on lipid metabolism, but affected blood glucose homeostasis. Whereas the Nrf2-null mice were resistant to HFD-induced glucose intolerance, the Nrf2-activated K1-KD mice exhibited prolonged elevation of circulating glucose during a glucose tolerance test even on the control diet. Feeding a HFD did not activate the Nrf2 signaling pathway in mouse livers. Fibroblast growth factor 21 (Fgf21) is a liver-derived anti-diabetic hormone that exerts glucose- and lipid-lowering effects. Fgf21 mRNA and protein were both elevated in livers of Nrf2-null mice, and Fgf21 protein was lower in K1-KD mice than WT mice. The inverse correlation between Nrf2 activity and hepatic expression of Fgf21 might explain the improved glucose tolerance in Nrf2-null mice. Furthermore, a more oxidative cellular environment in Nrf2-null mice could affect insulin signaling in liver. For example, mRNA of insulin-like growth factor binding protein 1, a gene repressed by insulin in hepatocytes, was markedly elevated in livers of Nrf2-null mice. In conclusion, genetic alteration of Nrf2 does not prevent diet-induced obesity in mice, but deficiency of Nrf2 improves glucose homeostasis, possibly through its effects on Fgf21 and/or insulin signaling. -- Highlights: ► Nrf2 deficiency improves glucose tolerance in mice fed a high-fat diet. ► The anti-diabetic hormone, Fgf21, is highly expressed in livers of Nrf2-null mice. ► The absence of Nrf2 increases the insulin-regulated Igfbp-1 mRNA in liver.

  3. 10-Oxo-trans-11-octadecenoic acid generated from linoleic acid by a gut lactic acid bacterium Lactobacillus plantarum is cytoprotective against oxidative stress

    Energy Technology Data Exchange (ETDEWEB)

    Furumoto, Hidehiro; Nanthirudjanar, Tharnath [Division of Applied Biosciences, Graduate School of Agriculture, Kyoto University, Kitashirakawa Oiwake-cho, Sakyo-ku, Kyoto 606-8502 (Japan); Kume, Toshiaki; Izumi, Yasuhiko [Department of Pharmacology, Graduate School of Pharmaceutical Sciences, Kyoto University, 46-29, Simoadachi-cho, Sakyo-ku, Kyoto 606-8501 (Japan); Park, Si-Bum [Laboratory of Industrial Microbiology, Graduate School of Agriculture, Kyoto University, Kitashirakawa Oiwake-cho, Sakyo-ku, Kyoto 606-8502 (Japan); Kitamura, Nahoko; Kishino, Shigenobu; Ogawa, Jun [Division of Applied Life Sciences, Graduate School of Agriculture, Kyoto University, Kitashirakawa Oiwake-cho, Sakyo-ku, Kyoto 606-8502 (Japan); Hirata, Takashi [Division of Applied Biosciences, Graduate School of Agriculture, Kyoto University, Kitashirakawa Oiwake-cho, Sakyo-ku, Kyoto 606-8502 (Japan); Faculty of Rehabilitation, Shijonawategakuen University, 5-11-10, Hojo, Daitou-shi, Osaka 574-0011 (Japan); Sugawara, Tatsuya, E-mail: sugawara@kais.kyoto-u.ac.jp [Division of Applied Biosciences, Graduate School of Agriculture, Kyoto University, Kitashirakawa Oiwake-cho, Sakyo-ku, Kyoto 606-8502 (Japan)

    2016-04-01

    Oxidative stress is a well-known cause of multiple diseases. The nuclear factor erythroid 2-related factor 2 (Nrf2)-antioxidant response element (ARE) pathway plays a central role in cellular antioxidative responses. In this study, we investigated the effects of novel fatty acid metabolite derivatives of linoleic acid generated by the gut lactic acid bacteria Lactobacillus plantarum on the Nrf2-ARE pathway. 10-Oxo-trans-11-octadecenoic acid (KetoC) protected HepG2 cells from cytotoxicity induced by hydrogen peroxide. KetoC also significantly increased cellular Nrf2 protein levels, ARE-dependent transcription, and the gene expression of antioxidative enzymes such as heme oxygenase-1 (HO-1), glutamate-cysteine ligase modifier subunit (GCLM), and NAD(P)H:quinone oxidoreductase 1 (NQO1) in HepG2 cells. Additionally, a single oral dose administration of KetoC also increased antioxidative gene expression and protein levels of Nrf2 and HO-1 in mouse organs. Since other fatty acid metabolites and linoleic acid did not affect cellular antioxidative responses, the cytoprotective effect of KetoC may be because of its α,β-unsaturated carbonyl moiety. Collectively, our data suggested that KetoC activated the Nrf2-ARE pathway to enhance cellular antioxidative responses in vitro and in vivo, which further suggests that KetoC may prevent multiple diseases induced by oxidative stress. - Highlights: • We evaluated the effect of modified fatty acids generated by Lactobacillus plantarum. • 10-Oxo-trans-11-ocatadecenoic acid (KetoC) protected cells from oxidative stress. • KetoC activated the Nrf2-ARE pathway to promote antioxidative gene expression. • KetoC promoted the expression of antioxidative enzymes in mice organs. • The cytoprotective effect of KetoC was because of α,β-unsaturated carbonyl moiety.

  4. 10-Oxo-trans-11-octadecenoic acid generated from linoleic acid by a gut lactic acid bacterium Lactobacillus plantarum is cytoprotective against oxidative stress

    International Nuclear Information System (INIS)

    Furumoto, Hidehiro; Nanthirudjanar, Tharnath; Kume, Toshiaki; Izumi, Yasuhiko; Park, Si-Bum; Kitamura, Nahoko; Kishino, Shigenobu; Ogawa, Jun; Hirata, Takashi; Sugawara, Tatsuya

    2016-01-01

    Oxidative stress is a well-known cause of multiple diseases. The nuclear factor erythroid 2-related factor 2 (Nrf2)-antioxidant response element (ARE) pathway plays a central role in cellular antioxidative responses. In this study, we investigated the effects of novel fatty acid metabolite derivatives of linoleic acid generated by the gut lactic acid bacteria Lactobacillus plantarum on the Nrf2-ARE pathway. 10-Oxo-trans-11-octadecenoic acid (KetoC) protected HepG2 cells from cytotoxicity induced by hydrogen peroxide. KetoC also significantly increased cellular Nrf2 protein levels, ARE-dependent transcription, and the gene expression of antioxidative enzymes such as heme oxygenase-1 (HO-1), glutamate-cysteine ligase modifier subunit (GCLM), and NAD(P)H:quinone oxidoreductase 1 (NQO1) in HepG2 cells. Additionally, a single oral dose administration of KetoC also increased antioxidative gene expression and protein levels of Nrf2 and HO-1 in mouse organs. Since other fatty acid metabolites and linoleic acid did not affect cellular antioxidative responses, the cytoprotective effect of KetoC may be because of its α,β-unsaturated carbonyl moiety. Collectively, our data suggested that KetoC activated the Nrf2-ARE pathway to enhance cellular antioxidative responses in vitro and in vivo, which further suggests that KetoC may prevent multiple diseases induced by oxidative stress. - Highlights: • We evaluated the effect of modified fatty acids generated by Lactobacillus plantarum. • 10-Oxo-trans-11-ocatadecenoic acid (KetoC) protected cells from oxidative stress. • KetoC activated the Nrf2-ARE pathway to promote antioxidative gene expression. • KetoC promoted the expression of antioxidative enzymes in mice organs. • The cytoprotective effect of KetoC was because of α,β-unsaturated carbonyl moiety.

  5. Attenuation of Aβ{sub 25–35}-induced parallel autophagic and apoptotic cell death by gypenoside XVII through the estrogen receptor-dependent activation of Nrf2/ARE pathways

    Energy Technology Data Exchange (ETDEWEB)

    Meng, Xiangbao; Wang, Min [Key Laboratory of Bioactive Substances and Resources Utilization of Chinese Herbal Medicine, Ministry of Education, Institute of Medicinal Plant Development, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing 100193 (China); Sun, Guibo, E-mail: sunguibo@126.com [Key Laboratory of Bioactive Substances and Resources Utilization of Chinese Herbal Medicine, Ministry of Education, Institute of Medicinal Plant Development, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing 100193 (China); Ye, Jingxue [Jilin Agricultural University, Changchun, Jilin 130021 (China); Zhou, Yanhui [Center of Cardiology, People' s Hospital of Jilin Province, Changchun, 130021, Jilin (China); Dong, Xi [Wenzhou Medical University, Wenzhou, Zhejiang 325035 (China); Wang, Tingting; Lu, Shan [Key Laboratory of Bioactive Substances and Resources Utilization of Chinese Herbal Medicine, Ministry of Education, Institute of Medicinal Plant Development, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing 100193 (China); Sun, Xiaobo, E-mail: sun_xiaobo163@163.com [Key Laboratory of Bioactive Substances and Resources Utilization of Chinese Herbal Medicine, Ministry of Education, Institute of Medicinal Plant Development, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing 100193 (China)

    2014-08-15

    Amyloid-beta (Aβ) has a pivotal function in the pathogenesis of Alzheimer's disease. To investigate Aβ neurotoxicity, we used an in vitro model that involves Aβ{sub 25–35}-induced cell death in the nerve growth factor-induced differentiation of PC12 cells. Aβ{sub 25–35} (20 μM) treatment for 24 h caused apoptotic cell death, as evidenced by significant cell viability reduction, LDH release, phosphatidylserine externalization, mitochondrial membrane potential disruption, cytochrome c release, caspase-3 activation, PARP cleavage, and DNA fragmentation in PC12 cells. Aβ{sub 25–35} treatment led to autophagic cell death, as evidenced by augmented GFP-LC3 puncta, conversion of LC3-I to LC3-II, and increased LC3-II/LC3-I ratio. Aβ{sub 25–35} treatment induced oxidative stress, as evidenced by intracellular ROS accumulation and increased production of mitochondrial superoxide, malondialdehyde, protein carbonyl, and 8-OHdG. Phytoestrogens have been proved to be protective against Aβ-induced neurotoxicity and regarded as relatively safe targets for AD drug development. Gypenoside XVII (GP-17) is a novel phytoestrogen isolated from Gynostemma pentaphyllum or Panax notoginseng. Pretreatment with GP-17 (10 μM) for 12 h increased estrogen response element reporter activity, activated PI3K/Akt pathways, inhibited GSK-3β, induced Nrf2 nuclear translocation, augmented antioxidant responsive element enhancer activity, upregulated heme oxygenase 1 (HO-1) expression and activity, and provided protective effects against Aβ{sub 25–35}-induced neurotoxicity, including oxidative stress, apoptosis, and autophagic cell death. In conclusion, GP-17 conferred protection against Aβ{sub 25–35}-induced neurotoxicity through estrogen receptor-dependent activation of PI3K/Akt pathways, inactivation of GSK-3β and activation of Nrf2/ARE/HO-1 pathways. This finding might provide novel insights into understanding the mechanism for neuroprotective effects of phytoestrogens

  6. Resveratrol-Induced Downregulation of NAF-1 Enhances the Sensitivity of Pancreatic Cancer Cells to Gemcitabine via the ROS/Nrf2 Signaling Pathways

    Directory of Open Access Journals (Sweden)

    Liang Cheng

    2018-01-01

    Full Text Available NAF-1 (nutrient-deprivation autophagy factor-1, which is an outer mitochondrial membrane protein, is known to play important roles in calcium metabolism, antiapoptosis, and antiautophagy. Resveratrol, a natural polyphenolic compound, is considered as a potent anticancer agent. Nevertheless, the molecular mechanisms underlying the effects of resveratrol and NAF-1 and their mediation of drug resistance in pancreatic cancer remain unclear. Here, we demonstrate that resveratrol suppresses the expression of NAF-1 in pancreatic cancer cells by inducing cellular reactive oxygen species (ROS accumulation and activating Nrf2 signaling. In addition, the knockdown of NAF-1 activates apoptosis and impedes the proliferation of pancreatic cancer cells. More importantly, the targeting of NAF-1 by resveratrol can improve the sensitivity of pancreatic cancer cells to gemcitabine. These results highlight the significance of strategies that target NAF-1, which may enhance the efficacy of gemcitabine in pancreatic cancer therapy.

  7. Dwindling of cardio damaging effect of isoproterenol by Punica granatum L. peel extract involve activation of nitric oxide-mediated Nrf2/ARE signaling pathway and apoptosis inhibition.

    Science.gov (United States)

    Gupta, Mahesh; Sharma, Pallavi; Mazumder, Arindam Ghosh; Patial, Vikram; Singh, Damanpreet

    2015-09-09

    Punica granatum L. (Punicaceae) peel is often considered as a food waste in-spite of its high bioactive metabolite composition. Primarily it is rich in therapeutically active phenolics that act on multiple cellular sites, through diverse mechanisms. Hence, the present study was envisaged to investigate the effect of standardised peel extract of P. granatum against isoproterenol (ISO)-induced myocardial infarction (MI). ISO administration at a dose of 150 mg/kg; s.c., twice at 24 h interval resulted in electrocardiographic abnormalities with increased heart weight and myocardial tissue damage signifying MI. Pretreatment with the extract at 50, 100 and 200 mg/kg; p.o., for 21 days prior to ISO intoxication (30 min prior to intoxication on day 22 and 23) attenuated the observed changes, along with increased myocardial tissue superoxide dismutase activity, reduced glutathione and nitrite levels, and decreased lipid peroxidation. The extract treated groups also showed reduced serum marker enzymes of MI, showing maximum effect at highest tested dose. Immunohistochemical studies revealed increased myocardial expression of nuclear factor erythroid 2-related factor 2 (Nrf2), endothelial nitric oxide synthase (eNOS) and Bcl-2 proteins in the extract treated groups with decreased Bax expression. From the results it can be concluded that the extract pretreatment prevents ISO-induced MI through increased myocardial expression of eNOS, leading to nitric oxide-mediated Nrf2 activation, thus upregulating antioxidant mechanisms, along with inhibition of apoptosis. Copyright © 2015 Elsevier Inc. All rights reserved.

  8. Involvement of activation of the Nrf2/ARE pathway in protection against 6-OHDA-induced SH-SY5Y cell death by α-iso-cubebenol.

    Science.gov (United States)

    Park, Sun Young; Kim, Do Yeon; Kang, Jong-Koo; Park, Geuntae; Choi, Young-Whan

    2014-09-01

    Free radical-mediated neurodegeneration is one of the many causes of Parkinson's disease (PD). As part of our ongoing studies on the identification of biologically active Schisandra chinensis components, we have isolated and structurally elucidated α-iso-cubebenol. This study was carried out in an attempt to clarify the neuroprotective effect of α-iso-cubebenol on toxin-insulted dopaminergic neuronal death using 6-hydroxy-dopamine (6-OHDA)-induced dopaminergic SH-SY5Y cells. α-iso-cubebenol significantly attenuated the loss of mitochondrial function (MTT assay) and membrane integrity (lactate dehydrogenase assay) associated with 6-OHDA-induced neurotoxicity. Pretreatment of the cells with α-iso-cubebenol diminished the intracellular accumulation of reactive oxygen species (ROS) and calcium in response to 6-OHDA. Moreover, α-iso-cubebenol protected against 6-OHDA-induced neurotoxicity through inhibition of SH-SY5Y cell apoptosis. In addition, JC-1 staining, which is a well-established measure of mitochondrial damage, was decreased after treatment with α-iso-cubebenol. Notably, α-iso-cubebenol inhibited the release of mitochondrial flavoprotein apoptosis inducing factor (AIF) from the mitochondria to the cytosol and nucleus following 6-OHDA treatment. In addition, α-iso-cubebenol reduced the 6-OHDA-induced phosphorylation of ERK and induced the phosphorylation of PKA, PKB, and CREB in a dose-dependent manner. Moreover, α-iso-cubebenol stimulated the activation of Nrf2, a downstream target of CREB. Furthermore, α-iso-cubebenol stimulated the expression of multiple antioxidant response genes (NQO-1 and HO-1). Finally, CREB and Nrf2 siRNA transfection diminished α-iso-cubebenol-mediated neuroprotection. Copyright © 2014 Elsevier Inc. All rights reserved.

  9. NRF2 deficiency replicates transcriptomic changes in Alzheimer's patients and worsens APP and TAU pathology

    Directory of Open Access Journals (Sweden)

    Ana I. Rojo

    2017-10-01

    Full Text Available Failure to translate successful neuroprotective preclinical data to a clinical setting in Alzheimer's disease (AD indicates that amyloidopathy and tauopathy alone provide an incomplete view of disease. We have tested here the relevance of additional homeostatic deviations that result from loss of activity of transcription factor NRF2, a crucial regulator of multiple stress responses whose activity declines with ageing. A transcriptomic analysis demonstrated that NRF2-KO mouse brains reproduce 7 and 10 of the most dysregulated pathways of human ageing and AD brains, respectively. Then, we generated a mouse that combines amyloidopathy and tauopathy with either wild type (AT-NRF2-WT or NRF2-deficiency (AT-NRF2-KO. AT-NRF2-KO brains presented increased markers of oxidative stress and neuroinflammation as well as higher levels of insoluble phosphorylated-TAU and Aβ*56 compared to AT-NRF2-WT mice. Young adult AT-NRF2-KO mice exhibited deficits in spatial learning and memory and reduced long term potentiation in the perforant pathway. This study demonstrates the relevance of normal homeostatic responses that decline with ageing, such as NRF2 activity, in the protection against proteotoxic, inflammatory and oxidative stress and provide a new strategy to fight AD.

  10. Dihydro-CDDO-trifluoroethyl amide (dh404, a novel Nrf2 activator, suppresses oxidative stress in cardiomyocytes.

    Directory of Open Access Journals (Sweden)

    Tomonaga Ichikawa

    Full Text Available Targeting Nrf2 signaling appears to be an attractive approach for the treatment of maladaptive cardiac remodeling and dysfunction; however, pharmacological modulation of the Nrf2 pathway in the cardiovascular system remains to be established. Herein, we report that a novel synthetic triterpenoid derivative, dihydro-CDDO-trifluoroethyl amide (dh404, activates Nrf2 and suppresses oxidative stress in cardiomyocytes. Dh404 interrupted the Keap1-Cul3-Rbx1 E3 ligase complex-mediated Nrf2 ubiquitination and subsequent degradation saturating the binding capacity of Keap1 to Nrf2, thereby rendering more Nrf2 to be translocated into the nuclei to activate Nrf2-driven gene transcription. A mutant Keap1 protein containing a single cysteine-to-serine substitution at residue 151 within the BTB domain of Keap1 was resistant to dh404-induced stabilization of Nrf2 protein. In addition, dh404 did not dissociate the interaction of Nrf2 with the Keap1-Cul3-Rbx1 E3 ligase complex. Thus, it is likely that dh404 inhibits the ability of Keap1-Cul3-Rbx1 E3 ligase complex to target Nrf2 for ubiquitination and degradation via modifying Cys-151 of Keap1 to change the conformation of the complex. Moreover, dh404 was able to stabilize Nrf2 protein, to enhance Nrf2 nuclear translocation, to activate Nrf2-driven transcription, and to suppress angiotensin II (Ang II-induced oxidative stress in cardiomyocytes. Knockdown of Nrf2 almost blocked the anti-oxidative effect of dh404. Dh404 activated Nrf2 signaling in the heart. Taken together, dh404 appears to be a novel Nrf2 activator with a therapeutic potential for cardiac diseases via suppressing oxidative stress.

  11. Gold-quercetin nanoparticles prevent metabolic endotoxemia-induced kidney injury by regulating TLR4/NF-kB signaling and Nrf2 pathway in high fat diet fed mice

    Directory of Open Access Journals (Sweden)

    Xu MX

    2017-01-01

    Full Text Available Min-Xuan Xu,1,2,* Ming Wang,3,* Wei-Wei Yang4 1Chongqing Key Laboratory of Medicinal Resources in the Three Gorges Reservoir Region, School of Biological and Chemical Engineering, Chongqing University of Education, Chongqing, 2College of Engineering and Applied Sciences, Nanjing University, Nanjing, 3Department of Urology, The Second Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou, Zhejiang, 4Department of Nephrology, Huai’an First People’s Hospital, Nanjing Medical University, Jiangsu, People’s Republic of China *These authors contributed equally to this work Abstract: High-fat diet-induced metabolic syndrome followed by chronic kidney disease caused by intestinal endotoxemia have received extensive attention. Toll-like receptor 4 (TLR4/nuclear factor-kappa B (NF-κB and oxidative stress-related Nrf2/Keap1 were regarded as the key target points involved in metabolic inflammation and kidney injury. However, the molecular mechanism of interaction between TLR4/NF-κB and Nrf2 activation in high-fat diet-induced renal injury is not absolutely understood. Quercetin, a natural product, has been reported to possess antitumor and anti-inflammatory effects. In this regard, this study attempted to prepare poly(d,l-lactide-co-glycolide-loaded gold nanoparticles precipitated with quercetin (GQ to investigate the anti-inflammatory and anti-oxidative stress effects in high-fat diet-induced kidney failure. For this study, C57BL/6 mice fed fat-rich fodder were used as the metabolic syndrome model to evaluate the protective effects of GQ on kidney injury and to determine whether TLR4/NF-κB and Nrf2 pathways were associated with the process. Moreover, histological examinations, enzyme-linked immunosorbent assay, Western blot, and basic blood tests and systemic inflammation-related indicators were used to investigate the inhibitory effects of GQ and underlying molecular mechanism by which it may reduce renal injury. Of note, podocyte

  12. A protective role of nuclear factor-erythroid 2-related factor-2 (Nrf2) in inflammatory disorders

    International Nuclear Information System (INIS)

    Kim, Jiyoung; Cha, Young-Nam; Surh, Young-Joon

    2010-01-01

    Nuclear factor-erythroid 2-related factor-2 (Nrf2) is a key transcription factor that plays a central role in cellular defense against oxidative and electrophilic insults by timely induction of antioxidative and phase-2 detoxifying enzymes and related stress-response proteins. The 5'-flanking regions of genes encoding these cytoprotective proteins contain a specific consensus sequence termed antioxidant response element (ARE) to which Nrf2 binds. Recent studies have demonstrated that Nrf2-ARE signaling is also involved in attenuating inflammation-associated pathogenesis, such as autoimmune diseases, rheumatoid arthritis, asthma, emphysema, gastritis, colitis and atherosclerosis. Thus, disruption or loss of Nrf2 signaling causes enhanced susceptibility not only to oxidative and electrophilic stresses but also to inflammatory tissue injuries. During the early-phase of inflammation-mediated tissue damage, activation of Nrf2-ARE might inhibit the production or expression of pro-inflammatory mediators including cytokines, chemokines, cell adhesion molecules, matrix metalloproteinases, cyclooxygenase-2 and inducible nitric oxide synthase. It is likely that the cytoprotective function of genes targeted by Nrf2 may cooperatively regulate the innate immune response and also repress the induction of pro-inflammatory genes. This review highlights the protective role of Nrf2 in inflammation-mediated disorders with special focus on the inflammatory signaling modulated by this redox-regulated transcription factor.

  13. A protective role of nuclear factor-erythroid 2-related factor-2 (Nrf2) in inflammatory disorders

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jiyoung [National Research Laboratory, College of Pharmacy, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Cha, Young-Nam [Inha University College of Medicine, Incheon 382-751 (Korea, Republic of); Surh, Young-Joon, E-mail: surh@plaza.snu.ac.kr [National Research Laboratory, College of Pharmacy, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Department of Molecular Medicine and Biopharmaceutical Sciences, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Cancer Research Institute, Seoul National University, Seoul 110-799 (Korea, Republic of)

    2010-08-07

    Nuclear factor-erythroid 2-related factor-2 (Nrf2) is a key transcription factor that plays a central role in cellular defense against oxidative and electrophilic insults by timely induction of antioxidative and phase-2 detoxifying enzymes and related stress-response proteins. The 5'-flanking regions of genes encoding these cytoprotective proteins contain a specific consensus sequence termed antioxidant response element (ARE) to which Nrf2 binds. Recent studies have demonstrated that Nrf2-ARE signaling is also involved in attenuating inflammation-associated pathogenesis, such as autoimmune diseases, rheumatoid arthritis, asthma, emphysema, gastritis, colitis and atherosclerosis. Thus, disruption or loss of Nrf2 signaling causes enhanced susceptibility not only to oxidative and electrophilic stresses but also to inflammatory tissue injuries. During the early-phase of inflammation-mediated tissue damage, activation of Nrf2-ARE might inhibit the production or expression of pro-inflammatory mediators including cytokines, chemokines, cell adhesion molecules, matrix metalloproteinases, cyclooxygenase-2 and inducible nitric oxide synthase. It is likely that the cytoprotective function of genes targeted by Nrf2 may cooperatively regulate the innate immune response and also repress the induction of pro-inflammatory genes. This review highlights the protective role of Nrf2 in inflammation-mediated disorders with special focus on the inflammatory signaling modulated by this redox-regulated transcription factor.

  14. Nrf2 Activation Protects against Solar-Simulated Ultraviolet Radiation in Mice and Humans.

    Science.gov (United States)

    Knatko, Elena V; Ibbotson, Sally H; Zhang, Ying; Higgins, Maureen; Fahey, Jed W; Talalay, Paul; Dawe, Robert S; Ferguson, James; Huang, Jeffrey T-J; Clarke, Rosemary; Zheng, Suqing; Saito, Akira; Kalra, Sukirti; Benedict, Andrea L; Honda, Tadashi; Proby, Charlotte M; Dinkova-Kostova, Albena T

    2015-06-01

    The transcription factor Nrf2 determines the ability to adapt and survive under conditions of electrophilic, oxidative, and inflammatory stress by regulating the expression of elaborate networks comprising nearly 500 genes encoding proteins with versatile cytoprotective functions. In mice, disruption of Nrf2 increases susceptibility to carcinogens and accelerates disease pathogenesis. Paradoxically, Nrf2 is upregulated in established human tumors, but whether this upregulation drives carcinogenesis is not known. Here we show that the incidence, multiplicity, and burden of solar-simulated UV radiation-mediated cutaneous tumors that form in SKH-1 hairless mice in which Nrf2 is genetically constitutively activated are lower than those that arise in their wild-type counterparts. Pharmacologic Nrf2 activation by topical biweekly applications of small (40 nmol) quantities of the potent bis(cyano enone) inducer TBE-31 has a similar protective effect against solar-simulated UV radiation in animals receiving long-term treatment with the immunosuppressive agent azathioprine. Genetic or pharmacologic Nrf2 activation lowers the expression of the pro-inflammatory factors IL6 and IL1β, and COX2 after acute exposure of mice to UV radiation. In healthy human subjects, topical applications of extracts delivering the Nrf2 activator sulforaphane reduced the degree of solar-simulated UV radiation-induced skin erythema, a quantifiable surrogate endpoint for cutaneous damage and skin cancer risk. Collectively, these data show that Nrf2 is not a driver for tumorigenesis even upon exposure to a very potent and complete carcinogen and strongly suggest that the frequent activation of Nrf2 in established human tumors is a marker of metabolic adaptation. ©2015 American Association for Cancer Research.

  15. Sulforaphane and Other Nutrigenomic Nrf2 Activators: Can the Clinician's Expectation Be Matched by the Reality?

    Science.gov (United States)

    Houghton, Christine A.; Fassett, Robert G.; Coombes, Jeff S.

    2016-01-01

    The recognition that food-derived nonnutrient molecules can modulate gene expression to influence intracellular molecular mechanisms has seen the emergence of the fields of nutrigenomics and nutrigenetics. The aim of this review is to describe the properties of nutrigenomic activators of transcription factor Nrf2 (nuclear factor erythroid 2-related factor 2), comparing the potential for sulforaphane and other phytochemicals to demonstrate clinical efficacy as complementary medicines. Broccoli-derived sulforaphane emerges as a phytochemical with this capability, with oral doses capable of favourably modifying genes associated with chemoprevention. Compared with widely used phytochemical-based supplements like curcumin, silymarin, and resveratrol, sulforaphane more potently activates Nrf2 to induce the expression of a battery of cytoprotective genes. By virtue of its lipophilic nature and low molecular weight, sulforaphane displays significantly higher bioavailability than the polyphenol-based dietary supplements that also activate Nrf2. Nrf2 activation induces cytoprotective genes such as those playing key roles in cellular defense mechanisms including redox status and detoxification. Both its high bioavailability and significant Nrf2 inducer capacity contribute to the therapeutic potential of sulforaphane-yielding supplements. PMID:26881038

  16. Escin activates AKT-Nrf2 signaling to protect retinal pigment epithelium cells from oxidative stress

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Kaijun [Eye Center, The 2nd Affiliated Hospital, Medical College of Zhejiang University, Hangzhou (China); Zhejiang Provincial Key Lab of Ophthalmology, Hangzhou (China); Jiang, Yiqian [The First People Hospital of Xiaoshan, Hangzhou (China); Wang, Wei; Ma, Jian [Eye Center, The 2nd Affiliated Hospital, Medical College of Zhejiang University, Hangzhou (China); Zhejiang Provincial Key Lab of Ophthalmology, Hangzhou (China); Chen, Min, E-mail: eyedrchenminzj@163.com [Eye Center, The 2nd Affiliated Hospital, Medical College of Zhejiang University, Hangzhou (China); Zhejiang Provincial Key Lab of Ophthalmology, Hangzhou (China)

    2015-12-25

    Here we explored the anti-oxidative and cytoprotective potentials of escin, a natural triterpene-saponin, against hydrogen peroxide (H{sub 2}O{sub 2}) in retinal pigment epithelium (RPE) cells. We showed that escin remarkably attenuated H{sub 2}O{sub 2}-induced death and apoptosis of established (ARPE-19) and primary murine RPE cells. Meanwhile, ROS production and lipid peroxidation by H{sub 2}O{sub 2} were remarkably inhibited by escin. Escin treatment in RPE cells resulted in NF-E2-related factor 2 (Nrf2) signaling activation, evidenced by transcription of anti-oxidant-responsive element (ARE)-regulated genes, including HO-1, NQO-1 and SRXN-1. Knockdown of Nrf2 through targeted shRNAs/siRNAs alleviated escin-mediated ARE gene transcription, and almost abolished escin-mediated anti-oxidant activity and RPE cytoprotection against H{sub 2}O{sub 2}. Reversely, escin was more potent against H{sub 2}O{sub 2} damages in Nrf2-over-expressed ARPE-19 cells. Further studies showed that escin-induced Nrf2 activation in RPE cells required AKT signaling. AKT inhibitors (LY294002 and perifosine) blocked escin-induced AKT activation, and dramatically inhibited Nrf2 phosphorylation, its cytosol accumulation and nuclear translocation in RPE cells. Escin-induced RPE cytoprotection against H{sub 2}O{sub 2} was also alleviated by the AKT inhibitors. Together, these results demonstrate that escin protects RPE cells from oxidative stress possibly through activating AKT-Nrf2 signaling.

  17. Peracetylated hydroxytyrosol, a new hydroxytyrosol derivate, attenuates LPS-induced inflammatory response in murine peritoneal macrophages via regulation of non-canonical inflammasome, Nrf2/HO1 and JAK/STAT signaling pathways.

    Science.gov (United States)

    Montoya, Tatiana; Aparicio-Soto, Marina; Castejón, María Luisa; Rosillo, María Ángeles; Sánchez-Hidalgo, Marina; Begines, Paloma; Fernández-Bolaños, José G; Alarcón-de-la-Lastra, Catalina

    2018-03-18

    The present study was designed to investigate the anti-inflammatory effects of a new derivative of hydroxytyrosol (HTy), peracetylated hydroxytyrosol (Per-HTy), compared with its parent, HTy, on lipopolysaccharide (LPS)-stimulated murine macrophages as well as potential signaling pathways involved. In particular, we attempted to characterize the role of the inflammasome underlying Per-HTy possible anti-inflammatory effects. Isolated murine peritoneal macrophages were treated with HTy or its derivative in the presence or absence of LPS (5 μg/ml) for 18 h. Cell viability was determined using sulforhodamine B (SRB) assay. Nitric oxide (NO) production was analyzed by Griess method. Production of pro-inflammatory cytokines was evaluated by enzyme-linked immunosorbent assay (ELISA) and inducible nitric oxide synthase (iNOS) and cyclooxygenase (COX)-2, janus kinase/signal transducer and activator of transcription (JAK/STAT) pathway (STAT3), haem oxigenase 1 (HO1), nuclear factor (erythroid-derived 2)-like 2 (Nrf2) expression and mitogen-activated protein kinases (MAPKs) activation was determined by Western blot. Per-HTy significantly reduced the levels of NO and pro-inflammatory cytokines as well as both COX-2 and iNOS expressions. Furthermore, Per-HTy treatment inhibited STAT3 and increased Nrf2 and HO1 protein levels in murine macrophages exposed to LPS. In addition, Per-HTy anti-inflammatory activity was related with an inhibition of non-canonical nucleotide binding domain (NOD)-like receptor (NLRP3) inflammasome pathways by decreasing pro-inflammatory interleukin (IL)-1β and IL-18 cytokine levels as consequence of regulation of cleaved caspase-11 enzyme. These results support that this new HTy derivative may offer a new promising nutraceutical therapeutic strategy in the management of inflammatory-related pathologies. Copyright © 2018. Published by Elsevier Inc.

  18. Ganglioside GM1 protects against high altitude cerebral edema in rats by suppressing the oxidative stress and inflammatory response via the PI3K/AKT-Nrf2 pathway.

    Science.gov (United States)

    Gong, Gu; Yin, Liang; Yuan, Libang; Sui, Daming; Sun, Yangyang; Fu, Haiyu; Chen, Liang; Wang, Xiaowu

    2018-03-01

    High altitude cerebral edema (HACE) is a severe type of acute mountain sickness (AMS) that occurs in response to a high altitude hypobaric hypoxic (HH) environment. GM1 monosialoganglioside can alleviate brain injury under adverse conditions including amyloid-β-peptide, ischemia and trauma. However, its role in HACE-induced brain damage remains poorly elucidated. In this study, GM1 supplementation dose-dependently attenuated increase in rat brain water content (BWC) induced by hypobaric chamber (7600 m) exposurefor 24 h. Compared with the HH-treated group, rats injected with GM1 exhibited less brain vascular leakage, lower aquaporin-4 and higher occludin expression, but they also showed increase in Na+/K+-ATPase pump activities. Importantly, HH-incurred consciousness impairment and coordination loss also were ameliorated following GM1 administration. Furthermore, the increased oxidative stress and decrease in anti-oxidant stress system under the HH condition were also reversely abrogated by GM1 treatment via suppressing accumulation of ROS, MDA and elevating the levels of SOD and GSH. Simultaneously, GM1 administration also counteracted the enhanced inflammation in HH-exposed rats by muting pro-inflammatory cytokines IL-1β, TNF-α, and IL-6 levels in serum and brain tissues. Subsequently, GM1 potentiated the activation of the PI3K/AKT-Nrf2 pathway. Cessation of this pathway by LY294002 reversed GM1-mediated inhibitory effects on oxidative stress and inflammation, and ultimately abrogated the protective role of GM1 in abating brain edema, cognitive and motor dysfunction. Overall, GM1 may afford a protective intervention in HACE by suppressing oxidative stress and inflammatory response via activating the PI3K/AKT-Nrf2 pathway, implying a promising agent for the treatment of HACE. Copyright © 2018 Elsevier Ltd. All rights reserved.

  19. Overview of Nrf2 as Therapeutic Target in Epilepsy

    Directory of Open Access Journals (Sweden)

    Liliana Carmona-Aparicio

    2015-08-01

    Full Text Available Oxidative stress is a biochemical state of imbalance in the production of reactive oxygen and nitrogen species and antioxidant defenses. It is involved in the physiopathology of degenerative and chronic neuronal disorders, such as epilepsy. Experimental evidence in humans and animals support the involvement of oxidative stress before and after seizures. In the past few years, research has increasingly focused on the molecular pathways of this process, such as that involving transcription factor nuclear factor E2-related factor 2 (Nrf2, which plays a central role in the regulation of antioxidant response elements (ARE and modulates cellular redox status. The aim of this review is to present experimental evidence on the role of Nrf2 in this neurological disorder and to further determine the therapeutic impact of Nrf2 in epilepsy.

  20. 10-Oxo-trans-11-octadecenoic acid generated from linoleic acid by a gut lactic acid bacterium Lactobacillus plantarum is cytoprotective against oxidative stress.

    Science.gov (United States)

    Furumoto, Hidehiro; Nanthirudjanar, Tharnath; Kume, Toshiaki; Izumi, Yasuhiko; Park, Si-Bum; Kitamura, Nahoko; Kishino, Shigenobu; Ogawa, Jun; Hirata, Takashi; Sugawara, Tatsuya

    2016-04-01

    Oxidative stress is a well-known cause of multiple diseases. The nuclear factor erythroid 2-related factor 2 (Nrf2)-antioxidant response element (ARE) pathway plays a central role in cellular antioxidative responses. In this study, we investigated the effects of novel fatty acid metabolite derivatives of linoleic acid generated by the gut lactic acid bacteria Lactobacillus plantarum on the Nrf2-ARE pathway. 10-Oxo-trans-11-octadecenoic acid (KetoC) protected HepG2 cells from cytotoxicity induced by hydrogen peroxide. KetoC also significantly increased cellular Nrf2 protein levels, ARE-dependent transcription, and the gene expression of antioxidative enzymes such as heme oxygenase-1 (HO-1), glutamate-cysteine ligase modifier subunit (GCLM), and quinone oxidoreductase 1 (NQO1) in HepG2 cells. Additionally, a single oral dose administration of KetoC also increased antioxidative gene expression and protein levels of Nrf2 and HO-1 in mouse organs. Since other fatty acid metabolites and linoleic acid did not affect cellular antioxidative responses, the cytoprotective effect of KetoC may be because of its α,β-unsaturated carbonyl moiety. Collectively, our data suggested that KetoC activated the Nrf2-ARE pathway to enhance cellular antioxidative responses in vitro and in vivo, which further suggests that KetoC may prevent multiple diseases induced by oxidative stress. Copyright © 2016. Published by Elsevier Inc.

  1. A Novel EphA2 Inhibitor Exerts Beneficial Effects in PI-IBS in Vivo and in Vitro Models via Nrf2 and NF-κB Signaling Pathways

    Directory of Open Access Journals (Sweden)

    Li Zeng

    2018-03-01

    Full Text Available Though the detailed pathological mechanism of post-infectious irritable bowel syndrome (PI-IBS remains unclear, accumulating evidence indicates that oxidative stress and inflammation are implicated in the process of PI-IBS. Oxidative stress and inflammation are regulated by Nrf2 and NF-κB signaling pathways, respectively. EphA2, a member of Eph receptor family, promotes oxidative stress and inflammatory responses via regulation of Nrf2 and NF-κB signaling pathways in various types of human diseases. Understanding the mechanisms by which EphA2 regulate oxidative stress and inflammation in PI-IBS is important for the development of new strategies to treat PI-IBS. However, the effects of ALW-II-41-27, a novel EphA2 inhibitor on PI-IBS and the underlying molecular mechanisms have never been studied. In the present study, we showed that ALW-II-41-27 decreased gastrointestinal motility and abdominal withdrawal reflex (AWR scores, markedly reduced the levels of oxidative stress markers [4-hydroxy-2-nonenal (4-HNE, protein carbonyl, and 8-hydroxy-2-de-axyguanine (8-OHdG] and proinflammatory cytokines (TNF-α, IL-6, IL-17, and ICAM-1, and remarkably increased the level of anti-inflammatory cytokine (IL-10 in serum and colon of Trichinella spiralis-infected mice. Moreover, ALW-II-41-27 was effective in suppressing oxidative stress and inflammation in LPS-treated NCM460 colonic cells. Treatment of ALW-II-41-27 reversed the activation of NF-κB and inactivation of Nrf2 in LPS-treated NCM460 cells. Importantly, these protective effects of ALW-II-41-27 were partially inhibited by EphA2 KO and abolished by EphA2 overexpression. In conclusion, EphA2 may represent a promising therapeutic target for patients with PI-IBS and ALW-II-41-27 might function as a novel therapeutic agent for PI-IBS.

  2. Direct Keap1-Nrf2 disruption as a potential therapeutic target for Alzheimer's disease.

    Directory of Open Access Journals (Sweden)

    Fiona Kerr

    2017-03-01

    Full Text Available Nrf2, a transcriptional activator of cell protection genes, is an attractive therapeutic target for the prevention of neurodegenerative diseases, including Alzheimer's disease (AD. Current Nrf2 activators, however, may exert toxicity and pathway over-activation can induce detrimental effects. An understanding of the mechanisms mediating Nrf2 inhibition in neurodegenerative conditions may therefore direct the design of drugs targeted for the prevention of these diseases with minimal side-effects. Our study provides the first in vivo evidence that specific inhibition of Keap1, a negative regulator of Nrf2, can prevent neuronal toxicity in response to the AD-initiating Aβ42 peptide, in correlation with Nrf2 activation. Comparatively, lithium, an inhibitor of the Nrf2 suppressor GSK-3, prevented Aβ42 toxicity by mechanisms independent of Nrf2. A new direct inhibitor of the Keap1-Nrf2 binding domain also prevented synaptotoxicity mediated by naturally-derived Aβ oligomers in mouse cortical neurons. Overall, our findings highlight Keap1 specifically as an efficient target for the re-activation of Nrf2 in AD, and support the further investigation of direct Keap1 inhibitors for the prevention of neurodegeneration in vivo.

  3. DNA demethylation upregulated Nrf2 expression in Alzheimer's disease cellular model

    Directory of Open Access Journals (Sweden)

    Huimin eCao

    2016-01-01

    Full Text Available Nuclear factor erythroid 2-related factor 2 (Nrf2 is an important transcription factor in the defense against oxidative stress. Cumulative evidence has shown that oxidative stress plays a key role in the pathogenesis of Alzheimer's disease (AD. Previous animal and clinical studies had observed decreased expression of Nrf2 in AD. However, the underlying regulation mechanisms of Nrf2 in AD remain unclear. Here, we used the DNA methyltransferases (Dnmts inhibitor 5-aza-2′-deoxycytidine (5-Aza to test whether Nrf2 expression was regulated by methylation in N2a cells characterizing by expressing human Swedish mutant amyloid precursor protein (N2a/APPswe. We found 5-Aza treatment increased Nrf2 at both mRNA and protein levels via down-regulating the expression of Dnmts and DNA demethylation. In addition, 5-Aza mediated upregulation of Nrf2 expression was concomitant with increased nuclear translocation of Nrf2 and higher expression of Nrf2 downstream target gene NAD(PH:quinone oxidoreductas (NQO1. Our study showed that DNA demethylation promoted the Nrf2 cell signaling pathway, which may enhance the antioxidant system against AD development.

  4. Supplementation of Superfine Powder Prepared from Chaenomeles speciosa Fruit Increases Endurance Capacity in Rats via Antioxidant and Nrf2/ARE Signaling Pathway

    Directory of Open Access Journals (Sweden)

    Ka Chen

    2014-01-01

    Full Text Available Chaenomeles speciosa fruit is a traditional herb medicine widely used in China. In this study, superfine powder of C. speciosa fruit (SCE, ground by supersonic nitrogen airflow at −140°C, was investigated to assess its in vitro antioxidant activity and in vivo antiphysical fatigue activity. SCE was homogenous (d<10 μm and rich in antioxidants like polyphenols, saponins, oleanolic acid, ursolic acid, ascorbic acid, and SOD. According to the in vitro experiments, SCE displayed promising antioxidant activity with powerful FARP, SC-DPPH, and SC-SAR activities. According to the in vivo experiments, rats supplemented with SCE had prolonged exhaustive swimming time (57% compared to the nonsupplemented rats. Meanwhile, compared to the nonsupplemented rats, the SCE-supplemented rats had higher levels of blood glucose and liver and muscular glycogen and lower levels of LA and BUN. Lower MDA, higher antioxidant enzymes (SOD, CAT, and GSH-Px activities, and upregulated Nrf2/ARE mediated antioxidant enzymes (HO-1, Trx, GCLM, and GCLC expression were also detected in the supplemented group. This study indicates that SCE is a potent antioxidant and antifatigue agent, and SCE could be a promising raw material for the food and pharmaceutical industries.

  5. Identification of a Novel and Potent Nrf2 inhibitor as a Radiosensitizer with High Throughput Screening

    Energy Technology Data Exchange (ETDEWEB)

    Ahn, Ji Yeon; Park, Sa Rah; Yun, Yeon Sook; Song, Jie Young [Korea Institute of Radiological and Medical Sciences, Seoul (Korea, Republic of)

    2009-05-15

    Lung cancer is the leading cause of cancer death in both men and women in the United States. Non-small cell lung cancer (NSCLC) accounts for more than 75% of all lung cancers and radiotherapy (RT) is the general treatment modality for these lung cancer patients. Nuclear factor erythroid-2. related factor 2 (Nrf2) is a redox-sensitive transcription factor that regulates the expression of genes encoding electrophiles and xenobiotic detoxification enzymes and efflux proteins, which confer cytoprotection against oxidative stress and xenobiotics in normal cells. Kelch-like ECH-associated protein (Keap1) sequesters Nrf2 and leads to proteasomal degradation of Nrf2 in non-stressed condition. Keap1 is often found with biallelic mutation in NSCLC cell lines and NSCLC patients, results in constitutive activation of Nrf2 function, and contributes to resistance of chemotherapy (CT) or RT (3, 4). We thus postulated that inhibition of Nrf2 in cancer cells could increase sensitivity to RT. Our primary results show that IM3829, a putative Nrf2 inhibitor, enhances the efficacy of RT and CT in H1299 lung cancer cell.

  6. Hepatocyte-protective effect of nectandrin B, a nutmeg lignan, against oxidative stress: Role of Nrf2 activation through ERK phosphorylation and AMPK-dependent inhibition of GSK-3β

    Energy Technology Data Exchange (ETDEWEB)

    Song, Jae-Sook; Kim, Eun-Kyung; Choi, Yong-Won [Department of Pharmacy, College of Pharmacy and Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan, Gyeonggi-do 15588 (Korea, Republic of); Oh, Won Keun [College of Pharmacy and Research Institute of Pharmaceutical Sciences, Seoul National University (Korea, Republic of); Kim, Young-Mi, E-mail: ymikim12@hanyang.ac.kr [Department of Pharmacy, College of Pharmacy and Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan, Gyeonggi-do 15588 (Korea, Republic of)

    2016-09-15

    Oxidative stress can contribute to the development and progression of liver diseases, such as drug-induced or alcoholic liver injury, nonalcoholic fatty liver disease, and nonalcoholic steatohepatitis. Nectandrin B is a bioactive lignan isolated from nutmeg extract. To date, little information is available about its pharmacological activities in the liver. This study investigated the hepatocyte-protective effect of nectandrin B against tert-butylhydroperoxide-induced oxidative injury and the underlying molecular mechanism. The cell viability assay revealed that nectandrin B prevents apoptosis stimulated by tert-butylhydroperoxide in both HepG2 cells and primary mouse hepatocytes. Nectandrin B also attenuated ROS production and restored the depleted glutathione level. Real-time PCR and immunoblot analyses showed that the expression of glutamate-cysteine ligase, an enzyme responsible for the glutathione biosynthesis, was induced by nectandrin B, indicating its indirect antioxidative effect. The NF-E2-related factor-2 (Nrf2) regulates gene expression of an array of antioxidant enzymes in hepatocytes. Nectandrin B stimulated Nrf2 activation as evidenced by its enhanced nuclear accumulation and increased antioxidant response element (ARE)-luciferase activity. Intriguingly, the hepatocyte-protective effect of nectandrin B against oxidative damage was completely abrogated by Nrf2 knockdown using Nrf2 specific siRNA. Nectandrin B promoted ERK activation, but inactivated GSK-3β through the AMPK-mediated inhibitory phosphorylation. The enforced overexpression of dominant-negative mutant of MEK1 or AMPKα, or wild-type GSK-3β inhibited the increase in the NQO1-ARE-luciferase activity stimulated by nectandrin B, suggesting that both ERK and AMPK-GSK-3β signalings are involved in the activation of Nrf2/ARE pathway by nectandrin B. Consistent with this, cytoprotection and restoration of glutathione level by nectandrin B was also blocked by the overexpression of dominant

  7. Expression of Nrf2 in neurodegenerative diseases.

    Science.gov (United States)

    Ramsey, Chenere P; Glass, Charles A; Montgomery, Marshall B; Lindl, Kathryn A; Ritson, Gillian P; Chia, Luis A; Hamilton, Ronald L; Chu, Charleen T; Jordan-Sciutto, Kelly L

    2007-01-01

    In response to oxidative stress, the nuclear factor E2-related factor 2 (Nrf2) transcription factor translocates from the cytoplasm into the nucleus and transactivates expression of genes with antioxidant activity. Despite this cellular mechanism, oxidative damage is abundant in Alzheimer and Parkinson disease (AD and PD). To investigate mechanisms by which Nrf2 activity may be aberrant or insufficient in neurodegenerative conditions, we assessed Nrf2 localization in affected brain regions of AD, Lewy body variant of AD (LBVAD), and PD. By immunohistochemistry, Nrf2 is expressed in both the nucleus and the cytoplasm of neurons in normal hippocampi with predominant expression in the nucleus. In AD and LBVAD, Nrf2 was predominantly cytoplasmic in hippocampal neurons and was not a major component of beta amyloid plaques or neurofibrillary tangles. By immunoblotting, we observed a significant decrease in nuclear Nrf2 levels in AD cases. In contrast, Nrf2 was strongly nuclear in PD nigral neurons but cytoplasmic in substantia nigra of normal, AD, and LBVAD cases. These findings suggest that Nrf2-mediated transcription is not induced in neurons in AD despite the presence of oxidative stress. In PD, nuclear localization of Nrf2 is strongly induced, but this response may be insufficient to protect neurons from degeneration.

  8. Nrf2 protects human bladder urothelial cells from arsenite and monomethylarsonous acid toxicity

    International Nuclear Information System (INIS)

    Wang Xiaojun; Sun Zheng; Chen Weimin; Eblin, Kylee E.; Gandolfi, Jay A.; Zhang, Donna D.

    2007-01-01

    Arsenic is widely spread in our living environment and imposes a big challenge on human health worldwide. Arsenic damages biological systems through multiple mechanisms including the generation of reactive oxygen species. The transcription factor Nrf2 regulates the cellular antioxidant response that protects cells from various insults. In this study, the protective role of Nrf2 in arsenic toxicity was investigated in a human bladder urothelial cell line, UROtsa. Using a UROtsa cell line stably infected with Nrf2-siRNA, we clearly demonstrate that compromised Nrf2 expression sensitized the cells to As(III)- and MMA(III)-induced toxicity. On the other hand, the activation of the Nrf2 pathway by tert-butylhydroquinone (tBHQ) and sulforaphane (SF), the known Nrf2-inducers, rendered UROtsa cells more resistant to As(III) and MMA(III). Furthermore, the wild-type mouse embryo fibroblast (WT-MEF) cells were protected from As(III)- and MMA(III)-induced toxicity following Nrf2 activation by tBHQ or SF, whereas neither tBHQ nor SF conferred protection in the Nrf2 -/- MEF cells, demonstrating that tBHQ- or SF-mediated protection against As(III)- and MMA(III)-induced toxicity depends on Nrf2 activation. These results, obtained by both loss of function and gain of function analyses, clearly demonstrate the protective role of Nrf2 in arsenic-induced toxicity. The current work lays the groundwork for using Nrf2 activators for therapeutic and dietary interventions against adverse effects of arsenic

  9. Effects of rehabilitation training on apoptosis of nerve cells and the recovery of neural and motor functions in rats with ischemic stroke through the PI3K/Akt and Nrf2/ARE signaling pathways.

    Science.gov (United States)

    Jin, Xiao-Fei; Wang, Shan; Shen, Min; Wen, Xin; Han, Xin-Rui; Wu, Jun-Chang; Tang, Gao-Zhuo; Wu, Dong-Mei; Lu, Jun; Zheng, Yuan-Lin

    2017-09-01

    This study was designed in order to investigate the effects between rehabilitation training on the apoptosis of nerve cells and the recovery of neural and motor functions of rats with ischemic stroke by way of the phosphatidylinositol 3-kinase/protein kinase B (PI3K/Akt) and nuclear factor E2-related factor 2/antioxidant responsive element (Nrf2/ARE) signaling pathways. In total, 110 healthy adult male Sprague-Dawley (SD) rats were selected in order to take part in this study. Ninety SD rats were used in order to establish the middle cerebral artery occlusion (MCAO), among which 80 rats were randomly assigned as part of the natural recovery, natural recovery+Rp-PI3K (the rats injected with PI3K/Akt inhibitor LY294002), rehabilitation training, and rehabilitation training+Rp-PI3K groups. Meanwhile, 20 rats were selected as part of the sham operation group. The neural and motor functions of these rats were evaluated using a balance beam test and the Bederson score. The mRNA expressions of PI3K, Akt, Nrf2 and HO-1 were measured using an RT-qPCR. The protein expressions of PI3K, p-PI3K, Akt, p-Akt, Nrf2 and HO-1 were also detected by using western blotting and the immunohistochemistry process. The cell cycle and cell apoptosis were detected by using a flow cytometry and TUNEL assay. The sham operation group exhibited lower neural and motor function scores than other groups. At the 7, 14, and 21 d marks of this study, the neural and motor function scores were increased in the natural recovery, natural recovery+Rp-PI3K, and rehabilitation training+Rp-PI3K groups in comparison with the rehabilitation training group but found to be decreased in the natural recovery group in comparison with the natural recovery+Rp-PI3K group. In comparison with the sham operation group, expressions of PI3K, Nrf2 and HO-1, and proportions of p-PI3K/PI3K and p-Akt/Akt were all higher in the natural recovery, rehabilitation training, and rehabilitation training+Rp-PI3K groups. Same trends were

  10. Dihydro-CDDO-trifluoroethyl amide suppresses inflammatory responses in macrophages via activation of Nrf2

    International Nuclear Information System (INIS)

    Li, Bin; Abdalrahman, Akram; Lai, Yimu; Janicki, Joseph S.; Ward, Keith W.; Meyer, Colin J.; Wang, Xing Li; Tang, Dongqi; Cui, Taixing

    2014-01-01

    Highlights: • Dh404 suppresses the expression of a selected set of pro-inflammatory cytokines in inflamed macrophages via activating Nrf2. • Dh404 activates Nrf2 while keeping Keap1 function intact in macrophages. • Dh404 minimally regulates NF-κB pathway in macrophages. - Abstract: Nuclear factor erythroid 2-related factor (Nrf2) is the major regulator of cellular defenses against various pathological stresses in a variety of organ systems, thus Nrf2 has evolved to be an attractive drug target for the treatment and/or prevention of human disease. Several synthetic oleanolic triterpenoids including dihydro-CDDO-trifluoroethyl amide (dh404) appear to be potent activators of Nrf2 and exhibit chemopreventive promises in multiple disease models. While the pharmacological efficacy of Nrf2 activators may be dependent on the nature of Nrf2 activation in specific cell types of target organs, the precise role of Nrf2 in mediating biological effects of Nrf2 activating compounds in various cell types remains to be further explored. Herein we report a unique and Nrf2-dependent anti-inflammatory profile of dh404 in inflamed macrophages. In lipopolysaccharide (LPS)-inflamed RAW264.7 macrophages, dh404 dramatically suppressed the expression of pro-inflammatory cytokines including inducible nitric oxide synthase (iNOS), monocyte chemotactic protein-1 (MCP-1), and macrophage inflammatory protein-1 beta (MIP-1β), while minimally regulating the expression of interleulin-6 (IL-6), IL-1β, and tumor necrosis factor alpha (TNFα). Dh404 potently activated Nrf2 signaling; however, it did not affect LPS-induced NF-κB activity. Dh404 did not interrupt the interaction of Nrf2 with its endogenous inhibitor Kelch-like ECH associating protein 1 (Keap1) in macrophages. Moreover, knockout of Nrf2 blocked the dh404-induced anti-inflammatory responses in LPS-inflamed macrophages. These results demonstrated that dh404 suppresses pro-inflammatory responses in macrophages via an activation

  11. Dihydro-CDDO-trifluoroethyl amide suppresses inflammatory responses in macrophages via activation of Nrf2

    Energy Technology Data Exchange (ETDEWEB)

    Li, Bin [Shandong University Qilu Hospital Research Center for Cell Therapy, Key Laboratory of Cardiovascular Remodeling and Function Research, Qilu Hospital of Shandong University, Jinan 250012 (China); Department of Cell Biology and Anatomy, University of South Carolina School of Medicine, Columbia, SC 29208 (United States); Abdalrahman, Akram; Lai, Yimu; Janicki, Joseph S. [Department of Cell Biology and Anatomy, University of South Carolina School of Medicine, Columbia, SC 29208 (United States); Ward, Keith W.; Meyer, Colin J. [Department of Pharmacology, Reata Pharmaceuticals, Inc., Irving, TX 75063 (United States); Wang, Xing Li [Shandong University Qilu Hospital Research Center for Cell Therapy, Key Laboratory of Cardiovascular Remodeling and Function Research, Qilu Hospital of Shandong University, Jinan 250012 (China); Tang, Dongqi, E-mail: Dongqi.Tang@uscmed.sc.edu [Shandong University Qilu Hospital Research Center for Cell Therapy, Key Laboratory of Cardiovascular Remodeling and Function Research, Qilu Hospital of Shandong University, Jinan 250012 (China); Department of Cell Biology and Anatomy, University of South Carolina School of Medicine, Columbia, SC 29208 (United States); Cui, Taixing, E-mail: taixing.cui@uscmed.sc.edu [Shandong University Qilu Hospital Research Center for Cell Therapy, Key Laboratory of Cardiovascular Remodeling and Function Research, Qilu Hospital of Shandong University, Jinan 250012 (China); Department of Cell Biology and Anatomy, University of South Carolina School of Medicine, Columbia, SC 29208 (United States)

    2014-02-21

    Highlights: • Dh404 suppresses the expression of a selected set of pro-inflammatory cytokines in inflamed macrophages via activating Nrf2. • Dh404 activates Nrf2 while keeping Keap1 function intact in macrophages. • Dh404 minimally regulates NF-κB pathway in macrophages. - Abstract: Nuclear factor erythroid 2-related factor (Nrf2) is the major regulator of cellular defenses against various pathological stresses in a variety of organ systems, thus Nrf2 has evolved to be an attractive drug target for the treatment and/or prevention of human disease. Several synthetic oleanolic triterpenoids including dihydro-CDDO-trifluoroethyl amide (dh404) appear to be potent activators of Nrf2 and exhibit chemopreventive promises in multiple disease models. While the pharmacological efficacy of Nrf2 activators may be dependent on the nature of Nrf2 activation in specific cell types of target organs, the precise role of Nrf2 in mediating biological effects of Nrf2 activating compounds in various cell types remains to be further explored. Herein we report a unique and Nrf2-dependent anti-inflammatory profile of dh404 in inflamed macrophages. In lipopolysaccharide (LPS)-inflamed RAW264.7 macrophages, dh404 dramatically suppressed the expression of pro-inflammatory cytokines including inducible nitric oxide synthase (iNOS), monocyte chemotactic protein-1 (MCP-1), and macrophage inflammatory protein-1 beta (MIP-1β), while minimally regulating the expression of interleulin-6 (IL-6), IL-1β, and tumor necrosis factor alpha (TNFα). Dh404 potently activated Nrf2 signaling; however, it did not affect LPS-induced NF-κB activity. Dh404 did not interrupt the interaction of Nrf2 with its endogenous inhibitor Kelch-like ECH associating protein 1 (Keap1) in macrophages. Moreover, knockout of Nrf2 blocked the dh404-induced anti-inflammatory responses in LPS-inflamed macrophages. These results demonstrated that dh404 suppresses pro-inflammatory responses in macrophages via an activation

  12. Curcumin plays neuroprotective roles against traumatic brain injury partly via Nrf2 signaling.

    Science.gov (United States)

    Dong, Wenwen; Yang, Bei; Wang, Linlin; Li, Bingxuan; Guo, Xiangshen; Zhang, Miao; Jiang, Zhenfei; Fu, Jingqi; Pi, Jingbo; Guan, Dawei; Zhao, Rui

    2018-05-01

    Traumatic brain injury (TBI), which leads to high mortality and morbidity, is a prominent public health problem worldwide with no effective treatment. Curcumin has been shown to be beneficial for neuroprotection in vivo and in vitro, but the underlying mechanism remains unclear. This study determined whether the neuroprotective role of curcumin in mouse TBI is dependent on the NF-E2-related factor (Nrf2) pathway. The Feeney weight-drop contusion model was used to mimic TBI. Curcumin was administered intraperitoneally 15 min after TBI induction, and brains were collected at 24 h after TBI. The levels of Nrf2 and its downstream genes (Hmox-1, Nqo1, Gclm, and Gclc) were detected by Western blot and qRT-PCR at 24 h after TBI. In addition, edema, oxidative damage, cell apoptosis and inflammatory reactions were evaluated in wild type (WT) and Nrf2-knockout (Nrf2-KO) mice to explore the role of Nrf2 signaling after curcumin treatment. In wild type mice, curcumin treatment resulted in reduced ipsilateral cortex injury, neutrophil infiltration, and microglia activation, improving neuron survival against TBI-induced apoptosis and degeneration. These effects were accompanied by increased expression and nuclear translocation of Nrf2, and enhanced expression of antioxidant enzymes. However, Nrf2 deletion attenuated the neuroprotective effects of curcumin in Nrf2-KO mice after TBI. These findings demonstrated that curcumin effects on TBI are associated with the activation the Nrf2 pathway, providing novel insights into the neuroprotective role of Nrf2 and the potential therapeutic use of curcumin for TBI. Copyright © 2018. Published by Elsevier Inc.

  13. Gene expression profiling following NRF2 and KEAP1 siRNA knockdown in human lung fibroblasts identifies CCL11/Eotaxin-1 as a novel NRF2 regulated gene

    Science.gov (United States)

    2012-01-01

    Background Oxidative Stress contributes to the pathogenesis of many diseases. The NRF2/KEAP1 axis is a key transcriptional regulator of the anti-oxidant response in cells. Nrf2 knockout mice have implicated this pathway in regulating inflammatory airway diseases such as asthma and COPD. To better understand the role the NRF2 pathway has on respiratory disease we have taken a novel approach to define NRF2 dependent gene expression in a relevant lung system. Methods Normal human lung fibroblasts were transfected with siRNA specific for NRF2 or KEAP1. Gene expression changes were measured at 30 and 48 hours using a custom Affymetrix Gene array. Changes in Eotaxin-1 gene expression and protein secretion were further measured under various inflammatory conditions with siRNAs and pharmacological tools. Results An anti-correlated gene set (inversely regulated by NRF2 and KEAP1 RNAi) that reflects specific NRF2 regulated genes was identified. Gene annotations show that NRF2-mediated oxidative stress response is the most significantly regulated pathway, followed by heme metabolism, metabolism of xenobiotics by Cytochrome P450 and O-glycan biosynthesis. Unexpectedly the key eosinophil chemokine Eotaxin-1/CCL11 was found to be up-regulated when NRF2 was inhibited and down-regulated when KEAP1 was inhibited. This transcriptional regulation leads to modulation of Eotaxin-1 secretion from human lung fibroblasts under basal and inflammatory conditions, and is specific to Eotaxin-1 as NRF2 or KEAP1 knockdown had no effect on the secretion of a set of other chemokines and cytokines. Furthermore, the known NRF2 small molecule activators CDDO and Sulphoraphane can also dose dependently inhibit Eotaxin-1 release from human lung fibroblasts. Conclusions These data uncover a previously unknown role for NRF2 in regulating Eotaxin-1 expression and further the mechanistic understanding of this pathway in modulating inflammatory lung disease. PMID:23061798

  14. Targeting of the Glutathione, Thioredoxin, and Nrf2 Antioxidant Systems in Head and Neck Cancer.

    Science.gov (United States)

    Roh, Jong-Lyel; Jang, Hyejin; Kim, Eun Hye; Shin, Daiha

    2017-07-10

    The glutathione (GSH), thioredoxin (Trx), and Nrf2 systems represent a major defense against reactive oxygen species (ROS), the cellular imbalance of which in cancer promotes growth and therapeutic resistance. This study investigated whether targeting the GSH, Trx, and Nrf2 antioxidant systems effectively eliminated head and neck cancer (HNC). At high concentrations, auranofin, but not buthionine sulfoximine (BSO) alone, decreased the viability of HNC, whereas even at low concentrations, auranofin plus BSO synergized to kill HNC cells. Dual silencing of the genes for GCLM and TrxR1 induced GSH depletion, Trx activity inhibition, and ROS accumulation, synergistically killing HNC cells. Inhibition of the GSH and Trx systems resulted in activation of the Nrf2-antioxidant response element (ARE) pathway, which may result in suboptimal GSH and Trx inhibition where HNC is resistant. Genetic inhibition of Nrf2 and/or HO-1 or trigonelline enhanced growth suppression, ROS accumulation, and cell death from GSH and Trx inhibition. The in vivo effects of GSH, Trx, and Nrf2 system inhibition were confirmed in a mouse HNC xenograft model by achieving growth inhibition >60% compared with those of control. Innovations: This study is the first to show that triple inhibition of GSH, Trx, and Nrf2 pathways could be an effective method to overcome the resistance of HNC. Inhibition of the Nrf2-ARE pathway in addition to dual inhibition of the GSH and Trx antioxidant systems can effectively eliminate resistant HNC. Antioxid. Redox Signal. 27, 106-114.

  15. 6-OHDA-induced apoptosis and mitochondrial dysfunction are mediated by early modulation of intracellular signals and interaction of Nrf2 and NF-κB factors

    International Nuclear Information System (INIS)

    Tobón-Velasco, Julio C.; Limón-Pacheco, Jorge H.; Orozco-Ibarra, Marisol; Macías-Silva, Marina; Vázquez-Victorio, Genaro; Cuevas, Elvis; Ali, Syed F.

    2013-01-01

    6-Hydroxydopamine (6-OHDA) is a neurotoxin that generates an experimental model of Parkinson's disease in rodents and is commonly employed to induce a lesion in dopaminergic pathways. The characterization of those molecular mechanisms linked to 6-OHDA-induced early toxicity is needed to better understand the cellular events further leading to neurodegeneration. The present work explored how 6-OHDA triggers early downstream signaling pathways that activate neurotoxicity in the rat striatum. Mitochondrial function, caspases-dependent apoptosis, kinases signaling (Akt, ERK 1/2, SAP/JNK and p38) and crosstalk between nuclear factor kappa B (NF-κB) and nuclear factor-erythroid-2-related factor 2 (Nrf2) were evaluated at early times post-lesion. We found that 6-OHDA initiates cell damage via mitochondrial complex I inhibition, cytochrome c and apoptosis-inducing factor (AIF) release, as well as activation of caspases 9 and 3 to induce apoptosis, kinase signaling modulation and NF-κB-mediated inflammatory responses, accompanied by inhibition of antioxidant systems regulated by the Nrf2 pathway. Our results suggest that kinases SAP/JNK and p38 up-regulation may play a role in the early stages of 6-OHDA toxicity to trigger intrinsic pathways for apoptosis and enhanced NF-κB activation. In turn, these cellular events inhibit the activation of cytoprotective mechanisms, thereby leading to a condition of general damage

  16. Sulforaphane Protects against Cardiovascular Disease via Nrf2 Activation

    Directory of Open Access Journals (Sweden)

    Yang Bai

    2015-01-01

    Full Text Available Cardiovascular disease (CVD causes an unparalleled proportion of the global burden of disease and will remain the main cause of mortality for the near future. Oxidative stress plays a major role in the pathophysiology of cardiac disorders. Several studies have highlighted the cardinal role played by the overproduction of reactive oxygen or nitrogen species in the pathogenesis of ischemic myocardial damage and consequent cardiac dysfunction. Isothiocyanates (ITC are sulfur-containing compounds that are broadly distributed among cruciferous vegetables. Sulforaphane (SFN is an ITC shown to possess anticancer activities by both in vivo and epidemiological studies. Recent data have indicated that the beneficial effects of SFN in CVD are due to its antioxidant and anti-inflammatory properties. SFN activates NF-E2-related factor 2 (Nrf2, a basic leucine zipper transcription factor that serves as a defense mechanism against oxidative stress and electrophilic toxicants by inducing more than a hundred cytoprotective proteins, including antioxidants and phase II detoxifying enzymes. This review will summarize the evidence from clinical studies and animal experiments relating to the potential mechanisms by which SFN modulates Nrf2 activation and protects against CVD.

  17. Epigenetics Reactivation of Nrf2 in Prostate TRAMP C1 Cells by Curcumin Analogue FN1.

    Science.gov (United States)

    Li, Wenji; Pung, Doug; Su, Zheng-Yuan; Guo, Yue; Zhang, Chengyue; Yang, Anne Yuqing; Zheng, Xi; Du, Zhi-Yun; Zhang, Kun; Kong, Ah-Ng

    2016-04-18

    It has previously been shown that curcumin can effectively inhibit prostate cancer proliferation and progression in TRAMP mice, potentially acting through the hypomethylation of the Nrf2 gene promoter and hence activation of the Nrf2 pathway to enhance cell antioxidative defense. FN1 is a synthetic curcumin analogue that shows stronger anticancer activity than curcumin in other reports. We aimed to explore the epigenetic modification of FN1 that restores Nrf2 expression in TRAMP-C1 cells. Stably transfected HepG2-C8 cells were used to investigate the effect of FN1 on the Nrf2- antioxidant response element (ARE) pathway. Real-time quantitative PCR and Western blotting were applied to study the influence of FN1 on endogenous Nrf2 and its downstream genes. Bisulfite genomic sequencing (BGS) and methylated DNA immunoprecipitation (MeDIP) were then performed to examine the methylation profile of the Nrf2 promoter. An anchorage-independent colony-formation analysis was conducted to examine the tumor inhibition activity of FN1. Epigenetic modification enzymes, including DNMTs and HDACs, were investigated by Western blotting. The luciferase reporter assay indicated that FN1 was more potent than curcumin in activating the Nrf2-ARE pathway. FN1 increased the expression of Nrf2 and its downstream detoxifying enzymes. FN1 significantly inhibited the colony formation of TRAMP-C1 cells. BGS and MeDIP assays revealed that FN1 treatment (250 nM for 3 days) reduced the percentage of CpG methylation of the Nrf2 promoter. FN1 also downregulated epigenetic modification enzymes. In conclusion, our results suggest that FN1 is a novel anticancer agent for prostate cancer. In the TRAMP-C1 cell line, FN1 can increase the level of Nrf2 and downstream genes via activating the Nrf2-ARE pathway and inhibit the colony formation potentially through the decreased expression of keap1 coupled with CpG demethylation of the Nrf2 promoter. This CpG demethylation effect may come from decreased

  18. The age- and sex-specific decline of the 20s proteasome and the Nrf2/CncC signal transduction pathway in adaption and resistance to oxidative stress in Drosophila melanogaster.

    Science.gov (United States)

    Pomatto, Laura C D; Wong, Sarah; Carney, Caroline; Shen, Brenda; Tower, John; Davies, Kelvin J A

    2017-04-01

    Hallmarks of aging include loss of protein homeostasis and dysregulation of stress-adaptive pathways. Loss of adaptive homeostasis, increases accumulation of DNA, protein, and lipid damage. During acute stress, the Cnc-C ( Drosophila Nrf2 orthologue) transcriptionally-regulated 20S proteasome degrades damaged proteins in an ATP-independent manner. Exposure to very low, non-toxic, signaling concentrations of the redox-signaling agent hydrogen peroxide (H 2 O 2 ) cause adaptive increases in the de novo expression and proteolytic activity/capacity of the 20S proteasome in female D. melanogaster (fruit-flies). Female 20S proteasome induction was accompanied by increased tolerance to a subsequent normally toxic but sub-lethal amount of H 2 O 2 , and blocking adaptive increases in proteasome expression also prevented full adaptation. We find, however, that this adaptive response is both sex- and age-dependent. Both increased proteasome expression and activity, and increased oxidative-stress resistance, in female flies, were lost with age. In contrast, male flies exhibited no H 2 O 2 adaptation, irrespective of age. Furthermore, aging caused a generalized increase in basal 20S proteasome expression, but proteolytic activity and adaptation were both compromised. Finally, continual knockdown of Keep1 (the cytosolic inhibitor of Cnc-C) in adults resulted in older flies with greater stress resistance than their age-matched controls, but who still exhibited an age-associated loss of adaptive homeostasis.

  19. The nuclear factor (erythroid-derived 2)-like 2 (NRF2) antioxidant response promotes melanocyte viability and reduces toxicity of the vitiligo-inducing phenol monobenzone.

    Science.gov (United States)

    Arowojolu, Omotayo A; Orlow, Seth J; Elbuluk, Nada; Manga, Prashiela

    2017-07-01

    Vitiligo, characterised by progressive melanocyte death, can be initiated by exposure to vitiligo-inducing phenols (VIPs). VIPs generate oxidative stress in melanocytes and activate the master antioxidant regulator NRF2. While NRF2-regulated antioxidants are reported to protect melanocytes from oxidative stress, the role of NRF2 in the melanocyte response to monobenzone, a clinically relevant VIP, has not been characterised. We hypothesised that activation of NRF2 may protect melanocytes from monobenzone-induced toxicity. We observed that knockdown of NRF2 or NRF2-regulated antioxidants NQO1 and PRDX6 reduced melanocyte viability, but not viability of keratinocytes and fibroblasts, suggesting that melanocytes were preferentially dependent upon NRF2 activity for growth compared to other cutaneous cells. Furthermore, melanocytes activated the NRF2 response following monobenzone exposure and constitutive NRF2 activation reduced monobenzone toxicity, supporting NRF2's role in the melanocyte stress response. In contrast, melanocytes from individuals with vitiligo (vitiligo melanocytes) did not activate the NRF2 response as efficiently. Dimethyl fumarate-mediated NRF2 activation protected normal and vitiligo melanocytes against monobenzone-induced toxicity. Given the contribution of oxidant-antioxidant imbalance in vitiligo, modulation of this pathway may be of therapeutic interest. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  20. Adverse effects of microplastics and oxidative stress-induced MAPK/Nrf2 pathway-mediated defense mechanisms in the marine copepod Paracyclopina nana

    Science.gov (United States)

    Jeong, Chang-Bum; Kang, Hye-Min; Lee, Min-Chul; Kim, Duck-Hyun; Han, Jeonghoon; Hwang, Dae-Sik; Souissi, Sami; Lee, Su-Jae; Shin, Kyung-Hoon; Park, Heum Gi; Lee, Jae-Seong

    2017-01-01

    Microplastic pollution causes a major concern in the marine environment due to their worldwide distribution, persistence, and adverse effects of these pollutants in the marine ecosystem. Despite its global presence, there is still a lack of information on the effect of microplastics on marine organisms at the molecular level. Herein we demonstrated ingestion and egestion of nano- (0.05 μm) and micro-sized (0.5 and 6 μm) polystyrene microbeads in the marine copepod Paracyclopina nana, and examined molecular responses to exposure to microbeads with in vivo endpoints such as growth rate and fecundity. Also, we proposed an adverse outcome pathway for microplastic exposure that covers molecular and individual levels. This study provides the first insight into the mode of action in terms of microplastic-induced oxidative stress and related signaling pathways in P. nana.

  1. Sulforaphane and Other Nutrigenomic Nrf2 Activators: Can the Clinician’s Expectation Be Matched by the Reality?

    Directory of Open Access Journals (Sweden)

    Christine A. Houghton

    2016-01-01

    Full Text Available The recognition that food-derived nonnutrient molecules can modulate gene expression to influence intracellular molecular mechanisms has seen the emergence of the fields of nutrigenomics and nutrigenetics. The aim of this review is to describe the properties of nutrigenomic activators of transcription factor Nrf2 (nuclear factor erythroid 2-related factor 2, comparing the potential for sulforaphane and other phytochemicals to demonstrate clinical efficacy as complementary medicines. Broccoli-derived sulforaphane emerges as a phytochemical with this capability, with oral doses capable of favourably modifying genes associated with chemoprevention. Compared with widely used phytochemical-based supplements like curcumin, silymarin, and resveratrol, sulforaphane more potently activates Nrf2 to induce the expression of a battery of cytoprotective genes. By virtue of its lipophilic nature and low molecular weight, sulforaphane displays significantly higher bioavailability than the polyphenol-based dietary supplements that also activate Nrf2. Nrf2 activation induces cytoprotective genes such as those playing key roles in cellular defense mechanisms including redox status and detoxification. Both its high bioavailability and significant Nrf2 inducer capacity contribute to the therapeutic potential of sulforaphane-yielding supplements.

  2. Resveratrol, an Nrf2 activator, ameliorates aging-related progressive renal injury.

    Science.gov (United States)

    Kim, Eun Nim; Lim, Ji Hee; Kim, Min Young; Ban, Tae Hyun; Jang, In-Ae; Yoon, Hye Eun; Park, Cheol Whee; Chang, Yoon Sik; Choi, Bum Soon

    2018-01-11

    Two important issues in the aging kidney are mitochondrial dysfunction and oxidative stress. An Nrf2 activator, resveratrol, is known to have various effects. Resveratrol may prevent inflammation and oxidative stress by activating Nrf2 and SIRT1 signaling. We examined whether resveratrol could potentially ameliorate the cellular condition, such as renal injury due to cellular oxidative stress and mitochondrial dysfunction caused by aging. Male 18-month-old C57BL/6 mice were used. Resveratrol (40 mg/kg) was administered to aged mice for 6 months. We compared histological changes, oxidative stress, and aging-related protein expression in the kidney between the resveratrol-treated group (RSV) and the control group (cont). We performed experiments using small-interfering RNAs (siRNAs) for Nrf2 and SIRT1 in cultured HK2 cells. Resveratrol improved renal function, proteinuria, histological changes and inflammation in aging mice. Also, expression of Nrf2-HO-1-NOQ-1 signaling and SIRT1-AMPK-PGC-1α signaling was increased in the RSV group. Transfection with Nrf2 and SIRT1 siRNA prevented resveratrol-induced anti-oxidative effect in HK2 cells in media treated with H 2 O 2 . Activation of the Nrf2 and SIRT1 signaling pathways ameliorated oxidative stress and mitochondrial dysfunction. Pharmacological targeting of Nrf2 signaling molecules may reduce the pathologic changes of aging in the kidney.

  3. Activation of anti-oxidant Nrf2 signaling by enone analogues of curcumin.

    Science.gov (United States)

    Deck, Lorraine M; Hunsaker, Lucy A; Vander Jagt, Thomas A; Whalen, Lisa J; Royer, Robert E; Vander Jagt, David L

    2018-01-01

    Inflammation and oxidative stress are common in many chronic diseases. Targeting signaling pathways that contribute to these conditions may have therapeutic potential. The transcription factor Nrf2 is a major regulator of phase II detoxification and anti-oxidant genes as well as anti-inflammatory and neuroprotective genes. Nrf2 is widespread in the CNS and is recognized as an important regulator of brain inflammation. The natural product curcumin exhibits numerous biological activities including ability to induce the expression of Nrf2-dependent phase II and anti-oxidant enzymes. Curcumin has been examined in a number of clinical studies with limited success, mainly owing to limited bioavailability and rapid metabolism. Enone analogues of curcumin were examined with an Nrf2 reporter assay to identify Nrf2 activators. Analogues were separated into groups with a 7-carbon dienone spacer, as found in curcumin; a 5-carbon enone spacer with and without a ring; and a 3-carbon enone spacer. Activators of Nrf2 were found in all three groups, many of which were more active than curcumin. Dose-response studies demonstrated that a range of substituents on the aromatic rings of these enones influenced not only the sensitivity to activation, reflected in EC 50 values, but also the extent of activation, which suggests that multiple mechanisms are involved in the activation of Nrf2 by these analogues. Copyright © 2017. Published by Elsevier Masson SAS.

  4. Chronic Endurance Exercise Impairs Cardiac Structure and Function in Middle-Aged Mice with Impaired Nrf2 Signaling

    Directory of Open Access Journals (Sweden)

    Gobinath Shanmugam

    2017-05-01

    Full Text Available Nuclear factor erythroid 2 related factor 2 (Nrf2 signaling maintains the redox homeostasis and its activation is shown to suppress cardiac maladaptation. Earlier we reported that acute endurance exercise (2 days evoked antioxidant cytoprotection in young WT animals but not in aged WT animals. However, the effect of repeated endurance exercise during biologic aging (WT characterized by an inherent deterioration in Nrf2 signaling and pathological aging (pronounced oxidative susceptibility—Nrf2 absence in the myocardium remains elusive. Thus, the purpose of our study was to determine the effect of chronic endurance exercise-induced cardiac adaptation in aged mice with and without Nrf2. Age-matched WT and Nrf2-null mice (Nrf2−/− (>22 months were subjected to 6 weeks chronic endurance exercise (25 meter/min, 12% grade. The myocardial redox status was assessed by expression of antioxidant defense genes and proteins along with immunochemical detection of DMPO-radical adduct, GSH-NEM, and total ubiquitination. Cardiac functions were assessed by echocardiography and electrocardiogram. At sedentary state, loss of Nrf2 resulted in significant downregulation of antioxidant gene expression (Nqo1, Ho1, Gclm, Cat, and Gst-α with decreased GSH-NEM immuno-fluorescence signals. While Nrf2−/− mice subjected to CEE showed an either similar or more pronounced reduction in the transcript levels of Gclc, Nqo1, Gsr, and Gst-α in relation to WT littermates. In addition, the hearts of Nrf2−/− on CEE showed a substantial reduction in specific antioxidant proteins, G6PD and CAT along with decreased GSH, a pronounced increase in DMPO-adduct and the total ubiquitination levels. Further, CEE resulted in a significant upregulation of hypertrophy genes (Anf, Bnf, and β-Mhc (p < 0.05 in the Nrf2−/− hearts in relation to WT mice. Moreover, the aged Nrf2−/− mice exhibited a higher degree of cardiac remodeling in association with a significant decrease in

  5. Nrf2 protects against 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD)-induced oxidative injury and steatohepatitis

    International Nuclear Information System (INIS)

    Lu Hong; Cui Wei; Klaassen, Curtis D.

    2011-01-01

    Previous studies demonstrate that Nrf2, a master regulator of antioxidative responses, is essential in mediating induction of many antioxidative enzymes by acute activation of the AhR. However, the role of Nrf2 in protecting against oxidative stress and DNA damage induced by sustained activation of the AhR remains unknown and was investigated herein. Tissue and blood samples were collected from wild-type (WT) and Nrf2-null mice 21 days after administration of a low-toxic dose (10 μg/kg ip) of TCDD. Only Nrf2-null mice lost body weight after TCDD treatment; however, blood levels of ALT were not markedly changed in either genotype, indicating a lack of extensive necrosis. Compared to livers of TCDD-treated WT mice, livers of TCDD-treated Nrf2-null mice had: 1) degenerated hepatocytes, lobular inflammation, marked fat accumulation, and higher mRNA expression of inflammatory and fibrotic genes; 2) depletion of glutathione, elevation in lipid peroxidation and marker of DNA damage; 3) attenuated induction of phase-II enzymes Nqo1, Gsta1/2, and Ugt2b35 mRNAs, but higher induction of cytoprotective Ho-1, Prdx1, Trxr1, Gclc, and Epxh1 mRNAs; 4) higher mRNA expression of Fgf21 and triglyceride-synthesis genes, but down-regulation of bile-acid-synthesis genes and cholesterol-efflux transporters; and 5) trend of induction/activation of c-jun and NF-kB. Additionally, TCDD-treated Nrf2-null mice had impaired adipogenesis in white adipose tissue. In conclusion, Nrf2 protects livers of mice against oxidative stress, DNA damage, and steatohepatitis induced by TCDD-mediated sustained activation of the AhR. The aggravated hepatosteatosis in TCDD-treated Nrf2-null mice is due to increased lipogenesis in liver and impaired lipogenesis in white adipose tissue. - Highlights: → TCDD causes hepatosteatosis and induction of Nrf2-target genes in wild-type mice. → TCDD causes weight loss, oxidative injury, and steatohepatitis in Nrf2-null mice. → Livers of TCDD-treated Nrf2-null mice

  6. Nitroxide delivery system for Nrf2 activation and skin protection.

    Science.gov (United States)

    Ben Yehuda Greenwald, Maya; Frušić-Zlotkin, Marina; Soroka, Yoram; Sasson, Shmuel Ben; Bianco-Peled, Havazelet; Bitton, Ronit; Kohen, Ron

    2015-08-01

    Cyclic nitroxides are a large group of compounds composed of diverse stable radicals also known as synthetic antioxidants. Although nitroxides are valuable for use in several skin conditions, in in vivo conditions they have several drawbacks, such as nonspecific dispersion in normal tissue, preferential renal clearance and rapid reduction of the nitroxide to the corresponding hydroxylamine. However, these drawbacks can be easily addressed by encapsulating the nitroxides within microemulsions. This approach would allow nitroxide activity and therefore their valuable effects (e.g. activation of the Keap1-Nrf2-EpRE pathway) to continue. In this work, nitroxides were encapsulated in a microemulsion composed of biocompatible ingredients. The nanometric size and shape of the vehicle microemulsion and nitroxide microemulsion displayed high similarity, indicating that the stability of the microemulsions was preserved. Our studies demonstrated that nitroxide microemulsions were more potent inducers of the Keap1-Nrf2-EpRE pathway than the free nitroxides, causing the activation of phase II enzymes. Moreover, microemulsions containing nitroxides significantly reduced UVB-induced cytotoxicity in the skin. Understanding the mechanism of this improved activity may expand the usage of many other Nrf2 modulating molecules in encapsulated form, as a skin protection strategy against oxidative stress-related conditions. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. Brain-Derived Neurotrophic Factor Increases Synaptic Protein Levels via the MAPK/Erk Signaling Pathway and Nrf2/Trx Axis Following the Transplantation of Neural Stem Cells in a Rat Model of Traumatic Brain Injury.

    Science.gov (United States)

    Chen, Tao; Wu, Yu; Wang, Yuzi; Zhu, Jigao; Chu, Haiying; Kong, Li; Yin, Liangwei; Ma, Haiying

    2017-11-01

    Brain-derived neurotrophic factor (BDNF) plays an important role in promoting the growth, differentiation, survival and synaptic stability of neurons. Presently, the transplantation of neural stem cells (NSCs) is known to induce neural repair to some extent after injury or disease. In this study, to investigate whether NSCs genetically modified to encode the BDNF gene (BDNF/NSCs) would further enhance synaptogenesis, BDNF/NSCs or naive NSCs were directly engrafted into lesions in a rat model of traumatic brain injury (TBI). Immunohistochemistry, western blotting and RT-PCR were performed to detect synaptic proteins, BDNF-TrkB and its downstream signaling pathways, at 1, 2, 3 or 4 weeks after transplantation. Our results showed that BDNF significantly increased the expression levels of the TrkB receptor gene and the phosphorylation of the TrkB protein in the lesions. The expression levels of Ras, phosphorylated Erk1/2 and postsynaptic density protein-95 were elevated in the BDNF/NSCs-transplanted groups compared with those in the NSCs-transplanted groups throughout the experimental period. Moreover, the nuclear factor (erythroid-derived 2)-like 2/Thioredoxin (Nrf2/Trx) axis, which is a specific therapeutic target for the treatment of injury or cell death, was upregulated by BDNF overexpression. Therefore, we determined that the increased synaptic proteins level implicated in synaptogenesis might be associated with the activation of the MAPK/Erk1/2 signaling pathway and the upregulation of the antioxidant agent Trx modified by BDNF-TrkB following the BDNF/NSCs transplantation after TBI.

  8. Constitutive activation of Nrf2 induces a stable reductive state in the mouse myocardium

    Directory of Open Access Journals (Sweden)

    Gobinath Shanmugam

    2017-08-01

    Full Text Available Redox homeostasis regulates key cellular signaling pathways in both physiology and pathology. The cell's antioxidant response provides a defense against oxidative stress and establishes a redox tone permissive for cell signaling. The molecular regulation of the well-known Keap1/Nrf2 system acts as sensor responding to changes in redox homeostasis and is poorly studied in the heart. Importantly, it is not yet known whether Nrf2 alone can serve as a master regulator of cellular redox homeostasis without compensation of the transcriptional regulation of antioxidant response element (ARE genes through alternate mechanisms. Here, we addressed this question using cardiac-specific transgenic expression at two different levels of constitutively active nuclear erythroid related factor 2 (caNrf2 functioning independently of Keap1. The caNrf2 mice showed augmentation of glutathione (GSH, the key regulator of the cellular thiol redox state. The Trans-AM assay for Nrf2-binding to the antioxidant response element (ARE showed a dose-dependent increase associated with upregulation of several major antioxidant genes and proteins. This was accompanied by a significant decrease in dihydroethidium staining and malondialdehyde (MDA in the caNrf2-TG mice myocardium. Interestingly, caNrf2 gene-dosage dependent redox changes were noted resulting in generation of a multi-stage model of pro-reductive and reductive conditions in the myocardium of TG-low and TG-high mice, respectively. These data clearly show that Nrf2 levels alone are capable of serving as the master regulator of the ARE. These models provide an important platform to investigate the impact of the Nrf2 system independent of the need to regulate the activity of Keap1 and the consequent exposure to pro-oxidants or electrophiles, which have numerous off-target effects.

  9. The Role of Nrf2: Adipocyte Differentiation, Obesity, and Insulin Resistance

    Directory of Open Access Journals (Sweden)

    Hyun-Ae Seo

    2013-01-01

    Full Text Available Metabolic diseases, such as type 2 diabetes and obesity, are increasing globally, and much work has been performed to elucidate the regulatory mechanisms of these diseases. Nuclear factor E2-related factor 2 (Nrf2 is a basic leucine zipper transcription factor that serves as a primary cellular defense against the cytotoxic effects of oxidative stress. Recent studies have proposed a close relationship between oxidative stress and energy metabolism-associated disease. The Nrf2 pathway, as a master regulator of cellular defense against oxidative stress, has emerged as a critical target of energy metabolism; however, its effects are controversial. This review examines the current state of research on the role of Nrf2 on energy metabolism, specifically with respect to its participation in adipocyte differentiation, obesity, and insulin resistance, and discusses the possibility of using Nrf2 as a therapeutic target in the clinic.

  10. Protective function of pyridoxamine on retinal photoreceptor cells via activation of the p‑Erk1/2/Nrf2/Trx/ASK1 signalling pathway in diabetic mice.

    Science.gov (United States)

    Ren, Xiang; Sun, Hong; Zhang, Chenghong; Li, Chen; Wang, Jinlei; Shen, Jie; Yu, Dong; Kong, Li

    2016-07-01

    The present study aimed to investigate the mechanisms that mediate the protective effects of pyridoxamine (PM) on light‑damaged retinal photoreceptor cells in diabetic mice. A high‑fat diet and streptozotocin were used to induce a mouse model of type II diabetes. During the experiment, mice were divided the mice into three types of group, as follows: Control groups (negative control and light‑damaged groups); experimental groups (diabetic and diabetic light‑damaged groups); and treatment groups (25, 50 and 100 mg/kg PM‑treated groups). Using hematoxylin‑eosin staining, the number of nuclear layer cells were counted. Western blotting and immunohistochemistry were performed to measure the levels of thioredoxin (Trx), phospho‑extracellular signal‑regulated kinase 1/2 (p‑Erk1/2), nuclear factor erythroid 2‑related factor 2 (Nrf2) and apoptosis signal‑regulating kinase 1 (ASK1). The photoreceptor cell count in the outer nuclear layer of the light‑damaged, diabetic control and diabetic light‑damaged groups were significantly reduced compared with the negative control group (PTrx, p‑Erk1/2 and Nrf2 expression levels (PTrx, p‑Erk1/2 and Nrf2 expression levels were significantly increased (PTrx, p‑Erk1/2 and Nrf2 expression, and the downregulation of ASK1 expression.

  11. Proteomics analysis of dendritic cell activation by contact allergens reveals possible biomarkers regulated by Nrf2

    Energy Technology Data Exchange (ETDEWEB)

    Mussotter, Franz, E-mail: franz.mussotter@bfr.bund.de [German Federal Institute for Risk Assessment (BfR), Department of Chemical and Product Safety, Berlin (Germany); Tomm, Janina Melanie [Helmholtz Centre for Environmental Research (UFZ), Department of Molecular Systems Biology, Leipzig (Germany); El Ali, Zeina; Pallardy, Marc; Kerdine-Römer, Saadia [INSERM UMR 996, Univ Paris-Sud, Université Paris-Saclay, Chátenay-Malabry (France); Götz, Mario [German Federal Institute for Risk Assessment (BfR), Department of Chemical and Product Safety, Berlin (Germany); Bergen, Martin von [Helmholtz Centre for Environmental Research (UFZ), Department of Molecular Systems Biology, Leipzig (Germany); University of Leipzig, Institute of Biochemistry, Leipzig (Germany); Aalborg University, Department of Chemistry and Bioscience, Aalborg (Denmark); Haase, Andrea; Luch, Andreas [German Federal Institute for Risk Assessment (BfR), Department of Chemical and Product Safety, Berlin (Germany)

    2016-12-15

    Allergic contact dermatitis is a widespread disease with high clinical relevance affecting approximately 20% of the general population. Typically, contact allergens are low molecular weight electrophilic compounds which can activate the Keap1/Nrf2 pathway. We performed a proteomics study to reveal possible biomarkers for dendritic cell (DC) activation by contact allergens and to further elucidate the role of Keap1/Nrf2 signaling in this process. We used bone marrow derived dendritic cells (BMDCs) of wild-type (nrf2{sup +/+}) and Nrf2 knockout (nrf2{sup −/−}) mice and studied their response against the model contact sensitizers 2,4-dinitrochlorobenzene (DNCB), cinnamaldehyde (CA) and nickel(II) sulfate by 2-dimensional polyacrylamide gel electrophoresis (2D-PAGE) in combination with electrospray ionization tandem mass spectrometry (ESI-MS/MS). Sodium dodecyl sulfate (SDS, 100 μM) served as irritant control. While treatment with nickel(II) sulfate and SDS had only little effects, CA and DNCB led to significant changes in protein expression. We found 18 and 30 protein spots up-regulated in wild-type cells treated with 50 and 100 μM CA, respectively. For 5 and 10 μM DNCB, 32 and 37 spots were up-regulated, respectively. Almost all of these proteins were not differentially expressed in nrf2{sup −/−} BMDCs, indicating an Nrf2-dependent regulation. Among them proteins were detected which are involved in oxidative stress and heat shock responses, as well as in signal transduction or basic cellular pathways. The applied approach allowed us to differentiate between Nrf2-dependent and Nrf2-independent cellular biomarkers differentially regulated upon allergen-induced DC activation. The data presented might contribute to the further development of suitable in vitro testing methods for chemical-mediated sensitization. - Highlights: • Contact allergens induce proteins involved in DC maturation Nrf2-dependently. • Induction of these proteins points to a functional

  12. Curcumin Derivative Epigenetically Reactivates Nrf2 Antioxidative Stress Signaling in Mouse Prostate Cancer TRAMP C1 Cells.

    Science.gov (United States)

    Li, Wenji; Su, Zheng-Yuan; Guo, Yue; Zhang, Chengyue; Wu, Renyi; Gao, Linbo; Zheng, Xi; Du, Zhi-Yun; Zhang, Kun; Kong, Ah-Ng

    2018-02-19

    The carcinogenesis of prostate cancer (PCa) in TRAMP model is highly correlated with hypermethylation in the promoter region of Nrf2 and the accompanying reduced transcription of Nrf2 and its regulated detoxifying genes. We aimed to investigate the effects of (3E,5E)-3,5-bis-(3,4,5-trimethoxybenzylidene)-tetrahydro-thiopyran-4-one (F10) and (3E,5E)-3,5-bis-(3,4,5-trimethoxy-benzylidene)-tetrahydropyran-4-one (E10), two synthetic curcumin derivatives, on restoring Nrf2 activity in TRAMP C1 cells. HepG2-C8 cells transfected with an antioxidant-response element (ARE)-luciferase vector were treated with F10, E10, curcumin, and sulforaphane (SFN) to compare their effects on Nrf2-ARE pathways. We performed real-time quantitative PCR and Western blotting to investigate the effects of F10 and E10 on Nrf2, correlated phase II detoxification genes. We also measured expression and activity of DNMTand HDAC enzymes. Enrichment of H3K27me3 on the promoter region of Nrf2 was explored with a chromatin immunoprecipitation (ChIP) assay. Methylation of the CpG region in Nrf2 promoter was doubly examined by bisulfite genomic sequencing (BGS) and methylation DNA immunoprecipitation (MeDIP). Compared with curcumin and SFN, F10 is more potent in activating Nrf2-ARE pathways. Both F10 and E10 enhanced level of Nrf2 and the correlated phase II detoxifying genes. BGS and MeDIP assays indicated that F10 but not E10 hypomethylated the Nrf2 promoter. F10 also downregulated the protein level of DNMT1, DNMT3a, DNMT3b, HDAC1, HDAC4, and HDAC7 and the activity of DNMTs and HDACs. F10 but not E10 effectively reduced the accumulation of H3k27me3 on the promoter of Nrf2. F10 and E10 can activate the Nrf2-ARE pathway and increase the level of Nrf2 and correlated phase II detoxification genes. The reactivation effect on Nrf2 by F10 in TRAMP C1 may come from demethylation, decrease of HDACs, and inhibition of H3k27me3 accumulation.

  13. Photoprotection by dietary phenolics against melanogenesis induced by UVA through Nrf2-dependent antioxidant responses

    Science.gov (United States)

    Chaiprasongsuk, Anyamanee; Onkoksoong, Tasanee; Pluemsamran, Thanyawan; Limsaengurai, Saowalak; Panich, Uraiwan

    2015-01-01

    Dietary phenolics may play a protective role in UV-mediated skin pigmentation through their antioxidant and UV-absorbing actions. In this study, we investigated whether genetic silencing of Nrf2, regulating the transcription of antioxidant genes, affected melanogenesis in primary human epidermal melanocytes (HEMn) and B16F10 melanoma cells subjected to UVA (8 J/cm2) exposure. Then, we explored the antimelanogenic actions of phenolics; caffeic acid (CA) and ferulic acid (FA) providing partial UVA protection; quercetin (QU) and rutin (RU) providing strong UVA protection and; avobenzone (AV), an efficient UVA filter, in association with modulation of Nrf2-mediated antioxidant defenses in response to UVA insults in B16F10 cells. Upon oxidative insults, Nrf2 silencing promoted melanogenesis in both HEMn and B16F10 cells irradiated with UVA. Stimulation of melanogenesis by UVA correlated with increased ROS and oxidative DNA damage (8-OHdG), GSH depletion as well as a transient downregulation of Nrf2 nuclear translocation and of Nrf2-ARE signaling in B16F10 cells. All test compounds exerted antimelanogenic effects with respect to their abilities to reverse UVA-mediated oxidative damage as well as downregulation of Nrf2 activity and its target antioxidants (GCLC, GST and NQO1) in B16F10 cells. In conclusion, defective Nrf2 may promote melanogenesis under UVA irradiation through oxidative stress mechanisms. Compounds with antioxidant and/or UVA absorption properties could protect against UVA-induced melanogenesis through indirect regulatory effect on Nrf2-ARE pathway. PMID:26765101

  14. An overview of the molecular mechanisms and novel roles of Nrf2 in neurodegenerative disorders.

    Science.gov (United States)

    Yang, Yang; Jiang, Shuai; Yan, Juanjuan; Li, Yue; Xin, Zhenlong; Lin, Yan; Qu, Yan

    2015-02-01

    Recently, growing evidence has demonstrated that nuclear factor erythroid 2-related factor 2 (Nrf2) is a pivotal regulator of endogenous defense systems that function via the activation of a set of protective genes, and this is particularly clear in the central nervous system (CNS). Therefore, it is highly useful to summarize the current literature on the molecular mechanisms and role of Nrf2 in the CNS. In this review, we first briefly introduce the molecular features of Nrf2. We then discuss the regulation, cerebral actions, upstream modulators and downstream targets of Nrf2 pathway. Following this background, we expand our discussion to the role of Nrf2 in several major neurodegenerative disorders (NDDs) such as Alzheimer's disease, Parkinson's disease, Huntington's disease, multiple sclerosis and amyotrophic lateral sclerosis. Lastly, we discuss some potential future directions. The information reviewed here may be significant in the design of further experimental research and increase the potential of Nrf2 as a therapeutic target in the future. Copyright © 2014 Elsevier Ltd. All rights reserved.

  15. Concerted action of p62 and Nrf2 protects cells from palmitic acid-induced lipotoxicity

    Energy Technology Data Exchange (ETDEWEB)

    Park, Jeong Su [Severance Biomedical Science Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Kang, Dong Hoon [Department of Life Science and Ewha Research Center for Systems Biology (Korea, Republic of); The Research Center for Cell Homeostasis, Ewha Womans University, Seoul 127-750 (Korea, Republic of); Lee, Da Hyun [Severance Biomedical Science Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Bae, Soo Han, E-mail: soohanbae@yuhs.ac [Severance Biomedical Science Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of)

    2015-10-09

    Nonalcoholic fatty liver disease (NAFLD), frequently associated with obesity and diabetes mellitus, is caused by the accumulation of excess fatty acids within liver cells. Palmitic acid (PA), a common saturated fatty acid found in mammals, induces the generation of reactive oxygen species (ROS) and elicits apoptotic cell death, known as lipotoxicity. However, protective mechanisms against PA-induced lipotoxicity have not been elucidated. In this study, we aimed to clarify the role of p62, an adapter protein in the autophagic process, as well as the nuclear factor erythroid 2-related factor 2 (Nrf2)-Kelch-like ECH-associated protein 1 (Keap1) pathway, in protecting cells from PA-induced lipotoxicity. The Nrf2-Keap1 pathway is essential for the protection of cells from oxidative stress. p62 enhances its binding to Keap1 and leads to Nrf2 activation. Here, we show that PA potentiates Keap1 degradation and thereby activates the transcription of Nrf2 target genes partially through autophagy. Furthermore, this PA-mediated Keap1 degradation depends on p62. Correspondingly, a lack of p62 attenuates the PA-mediated Nrf2 activation and increases the susceptibility of cells to oxidative stress. These results indicate that p62 plays an important role in protecting cells against lipotoxicity through Keap1 degradation-mediated Nrf2 activation. - Highlights: • PA induces Keap1 downregulation and activates Nrf2 target gene transcription. • PA-induced Keap1 degradation is partly mediated by the autophagic pathway. • PA-induced Keap1 degradation depends on p62. • Ablation of p62 exacerbates PA-mediated apoptotic cell death.

  16. Concerted action of p62 and Nrf2 protects cells from palmitic acid-induced lipotoxicity

    International Nuclear Information System (INIS)

    Park, Jeong Su; Kang, Dong Hoon; Lee, Da Hyun; Bae, Soo Han

    2015-01-01

    Nonalcoholic fatty liver disease (NAFLD), frequently associated with obesity and diabetes mellitus, is caused by the accumulation of excess fatty acids within liver cells. Palmitic acid (PA), a common saturated fatty acid found in mammals, induces the generation of reactive oxygen species (ROS) and elicits apoptotic cell death, known as lipotoxicity. However, protective mechanisms against PA-induced lipotoxicity have not been elucidated. In this study, we aimed to clarify the role of p62, an adapter protein in the autophagic process, as well as the nuclear factor erythroid 2-related factor 2 (Nrf2)-Kelch-like ECH-associated protein 1 (Keap1) pathway, in protecting cells from PA-induced lipotoxicity. The Nrf2-Keap1 pathway is essential for the protection of cells from oxidative stress. p62 enhances its binding to Keap1 and leads to Nrf2 activation. Here, we show that PA potentiates Keap1 degradation and thereby activates the transcription of Nrf2 target genes partially through autophagy. Furthermore, this PA-mediated Keap1 degradation depends on p62. Correspondingly, a lack of p62 attenuates the PA-mediated Nrf2 activation and increases the susceptibility of cells to oxidative stress. These results indicate that p62 plays an important role in protecting cells against lipotoxicity through Keap1 degradation-mediated Nrf2 activation. - Highlights: • PA induces Keap1 downregulation and activates Nrf2 target gene transcription. • PA-induced Keap1 degradation is partly mediated by the autophagic pathway. • PA-induced Keap1 degradation depends on p62. • Ablation of p62 exacerbates PA-mediated apoptotic cell death.

  17. Transcription factor Nrf2 mediates an adaptive response to sulforaphane that protects fibroblasts in vitro against the cytotoxic effects of electrophiles, peroxides and redox-cycling agents

    International Nuclear Information System (INIS)

    Higgins, Larry G.; Kelleher, Michael O.; Eggleston, Ian M.; Itoh, Ken; Yamamoto, Masayuki; Hayes, John D.

    2009-01-01

    Sulforaphane can stimulate cellular adaptation to redox stressors through transcription factor Nrf2. Using mouse embryonic fibroblasts (MEFs) as a model, we show herein that the normal homeostatic level of glutathione in Nrf2 -/- MEFs was only 20% of that in their wild-type counterparts. Furthermore, the rate of glutathione synthesis following its acute depletion upon treatment with 3 μmol/l sulforaphane was very substantially lower in Nrf2 -/- MEFs than in wild-type cells, and the rebound leading to a ∼ 1.9-fold increase in glutathione that occurred 12-24 h after Nrf2 +/+ MEFs were treated with sulforaphane was not observed in Nrf2 -/- fibroblasts. Wild-type MEFs that had been pre-treated for 24 h with 3 μmol/l sulforaphane exhibited between 1.4- and 3.2-fold resistance against thiol-reactive electrophiles, including isothiocyanates, α,β-unsaturated carbonyl compounds (e.g. acrolein), aryl halides and alkene epoxides. Pre-treatment of Nrf2 +/+ MEFs with sulforaphane also protected against hydroperoxides (e.g. cumene hydroperoxide, CuOOH), free radical-generating compounds (e.g. menadione), and genotoxic electrophiles (e.g. chlorambucil). By contrast, Nrf2 -/- MEFs were typically ∼ 50% less tolerant of these agents than wild-type fibroblasts, and sulforaphane pre-treatment did not protect the mutant cells against xenobiotics. To test whether Nrf2-mediated up-regulation of glutathione represents the major cytoprotective mechanism stimulated by sulforaphane, 5 μmol/l buthionine sulfoximine (BSO) was used to inhibit glutathione synthesis. In Nrf2 +/+ MEFs pre-treated with sulforaphane, BSO diminished intrinsic resistance and abolished inducible resistance to acrolein, CuOOH and chlorambucil, but not menadione. Thus Nrf2-dependent up-regulation of GSH is the principal mechanism by which sulforaphane pre-treatment induced resistance to acrolein, CuOOH and chlorambucil, but not menadione.

  18. Targeting the Nrf2/Amyloid-Beta Liaison in Alzheimer's Disease: A Rational Approach.

    Science.gov (United States)

    Simoni, Elena; Serafini, Melania M; Caporaso, Roberta; Marchetti, Chiara; Racchi, Marco; Minarini, Anna; Bartolini, Manuela; Lanni, Cristina; Rosini, Michela

    2017-07-19

    Amyloid is a prominent feature of Alzheimer's disease (AD). Yet, a linear linkage between amyloid-β peptide (Aβ) and the disease onset and progression has recently been questioned. In this context, the crucial partnership between Aβ and Nrf2 pathways is acquiring paramount importance, offering prospects for deciphering the Aβ-centered disease network. Here, we report on a new class of antiaggregating agents rationally designed to simultaneously activate transcription-based antioxidant responses, whose lead 1 showed interesting properties in a preliminary investigation. Relying on the requirements of Aβ recognition, we identified the catechol derivative 12. In SH-SY5Y neuroblastoma cells, 12 combined remarkable free radical scavenger properties to the ability to trigger the Nrf2 pathway and induce the Nrf2-dependent defensive gene NQO1 by means of electrophilic activation of the transcriptional response. Moreover, 12 prevented the formation of cytotoxic stable oligomeric intermediates, being significantly more effective, and per se less toxic, than prototype 1. More importantly, as different chemical features were exploited to regulate Nrf2 and Aβ activities, the two pathways could be tuned independently. These findings point to compound 12 and its derivatives as promising tools for investigating the therapeutic potential of the Nrf2/Aβ cellular network, laying foundation for generating new drug leads to confront AD.

  19. Silencing of NRF2 Reduces the Expression of ALDH1A1 and ALDH3A1 and Sensitizes to 5-FU in Pancreatic Cancer Cells

    Directory of Open Access Journals (Sweden)

    Hong-Quan Duong

    2017-07-01

    Full Text Available Pancreatic cancer remains an intractable cancer with a poor five-year survival rate, which requires new therapeutic modalities based on the biology of pancreatic oncogenesis. Nuclear factor E2 related factor-2 (NRF2, a key cytoprotective nuclear transcription factor, regulates antioxidant production, reduction, detoxification and drug efflux proteins. It also plays an essential role in cell homeostasis, cell proliferation and resistance to chemotherapy. We aimed to evaluate the possibility that modulation of NRF2 expression could be effective in the treatment of pancreatic cancer cells. We investigated whether the depletion of NRF2 by using small interfering RNAs (siRNAs is effective in the expression of biomarkers of pancreatic cancer stemness such as aldehyde dehydrogenase 1 family, member A1 (ALDH1A1 and aldehyde dehydrogenase 3 family, member A1 (ALDH3A1. NRF2 knockdown markedly reduced the expression of NRF2 and glutamate-cysteine ligase catalytic subunit (GCLC in cell lines established from pancreatic cancers. NRF2 silencing also decreased the ALDH1A1 and ALDH3A1 expression. Furthermore, this NRF2 depletion enhanced the antiproliferative effects of the chemotherapeutic agent, 5-fluorouracil (5-FU in pancreatic cancer cells.

  20. Inorganic Arsenic Induces NRF2-Regulated Antioxidant Defenses in Both Cerebral Cortex and Hippocampus in Vivo.

    Science.gov (United States)

    Zhang, Yang; Duan, Xiaoxu; Li, Jinlong; Zhao, Shuo; Li, Wei; Zhao, Lu; Li, Wei; Nie, Huifang; Sun, Guifang; Li, Bing

    2016-08-01

    Inorganic arsenic is reported to induce the reactive oxygen species-mediated oxidative stress, which is supposed to be one of the main mechanisms of arsenic-related neurological diseases. Nuclear factor erythroid 2-related factor 2 (NRF2), a master regulator of antioxidant defense systems, up-regulates the expression of target genes to fight against oxidative damages caused by harmful substances, including metals. In the present study, mice were used as a model to investigate the oxidative stress levels and the expressions of NRF2-regulated antioxidant substances in both cerebral cortex and hippocampus with 5, 10 and 20 mg/kg NaAsO2 exposure intra-gastrically. Our results showed that acute NaAsO2 treatment resulted in decreased total anti-oxidative capacity (T-AOC) and increased maleic dialdehyde production in the nervous system. We also detected rapidly elevation of NRF2 protein levels by enhancement of Nrf2 transcription, especially at 20 mg/kg NaAsO2 exposure group. In the meantime, mRNA and protein levels of Nrf2 encoding antioxidant enzymes heme oxygenase-1 (HO-1), NAD(P)H: quinine oxidoreductase 1 (NQO1) and glutathione S-transferase (GST) were consistently elevated time- and dose-dependently both in the cerebral cortex and hippocampus. Taken together, the presence study demonstrated the activation of NRF2 pathway, an early antioxidant defensive response, in both cerebral cortex and hippocampus upon inorganic arsenic (iAs) exposure in vivo. A better knowledge on the roles of NRF2 pathway in maintaining cellular redox homeostasis would be helpful for the strategies on improvement of neurotoxicity related to this metalloid.

  1. An essential role of Nrf2 in American ginseng-mediated anti-oxidative actions in cardiomyocytes.

    Science.gov (United States)

    Li, Jinqing; Ichikawa, Tomonaga; Jin, Yu; Hofseth, Lorne J; Nagarkatti, Prakash; Nagarkatti, Mitzi; Windust, Anthony; Cui, Taixing

    2010-07-20

    administration of American ginseng markedly increased Nrf2 activity in murine hearts. These results demonstrate that American ginseng suppresses oxidative stress and oxidative stress-induced cell death in cardiomyocytes through activating the Nrf2 pathway, thereby providing cardioprotection against pathological cardiac remodeling. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.

  2. Targeting NRF2 for Improved Skin Barrier Function and Photoprotection: Focus on the Achiote-Derived Apocarotenoid Bixin.

    Science.gov (United States)

    Rojo de la Vega, Montserrat; Krajisnik, Andrea; Zhang, Donna D; Wondrak, Georg T

    2017-12-18

    The transcription factor NRF2 (nuclear factor-E2-related factor 2) orchestrates major cellular defense mechanisms including phase-II detoxification, inflammatory signaling, DNA repair, and antioxidant response. Recent studies strongly suggest a protective role of NRF2-mediated gene expression in the suppression of cutaneous photodamage induced by solar UV (ultraviolet) radiation. The apocarotenoid bixin, a Food and Drug Administration (FDA)-approved natural food colorant (referred to as 'annatto') originates from the seeds of the achiote tree native to tropical America, consumed by humans since ancient times. Use of achiote preparations for skin protection against environmental insult and for enhanced wound healing has long been documented. We have recently reported that (i) bixin is a potent canonical activator of the NRF2-dependent cytoprotective response in human skin keratinocytes; that (ii) systemic administration of bixin activates NRF2 with protective effects against solar UV-induced skin damage; and that (iii) bixin-induced suppression of photodamage is observable in Nrf2 +/+ but not in Nrf2 -/- SKH-1 mice confirming the NRF2-dependence of bixin-induced antioxidant and anti-inflammatory effects. In addition, bixin displays molecular activities as sacrificial antioxidant, excited state quencher, PPAR (peroxisome proliferator-activated receptor) α/γ agonist, and TLR (Toll-like receptor) 4/NFκB (nuclear factor kappa-light-chain-enhancer of activated B cells) antagonist, all of which might be relevant to the enhancement of skin barrier function and environmental stress protection. Potential skin photoprotection and photochemoprevention benefits provided by topical application or dietary consumption of this ethno-pharmacologically validated phytochemical originating from the Americas deserves further preclinical and clinical examination.

  3. Targeting NRF2 for Improved Skin Barrier Function and Photoprotection: Focus on the Achiote-Derived Apocarotenoid Bixin

    Directory of Open Access Journals (Sweden)

    Montserrat Rojo de la Vega

    2017-12-01

    Full Text Available The transcription factor NRF2 (nuclear factor-E2-related factor 2 orchestrates major cellular defense mechanisms including phase-II detoxification, inflammatory signaling, DNA repair, and antioxidant response. Recent studies strongly suggest a protective role of NRF2-mediated gene expression in the suppression of cutaneous photodamage induced by solar UV (ultraviolet radiation. The apocarotenoid bixin, a Food and Drug Administration (FDA-approved natural food colorant (referred to as ‘annatto’ originates from the seeds of the achiote tree native to tropical America, consumed by humans since ancient times. Use of achiote preparations for skin protection against environmental insult and for enhanced wound healing has long been documented. We have recently reported that (i bixin is a potent canonical activator of the NRF2-dependent cytoprotective response in human skin keratinocytes; that (ii systemic administration of bixin activates NRF2 with protective effects against solar UV-induced skin damage; and that (iii bixin-induced suppression of photodamage is observable in Nrf2+/+ but not in Nrf2−/− SKH-1 mice confirming the NRF2-dependence of bixin-induced antioxidant and anti-inflammatory effects. In addition, bixin displays molecular activities as sacrificial antioxidant, excited state quencher, PPAR (peroxisome proliferator-activated receptor α/γ agonist, and TLR (Toll-like receptor 4/NFκB (nuclear factor kappa-light-chain-enhancer of activated B cells antagonist, all of which might be relevant to the enhancement of skin barrier function and environmental stress protection. Potential skin photoprotection and photochemoprevention benefits provided by topical application or dietary consumption of this ethno-pharmacologically validated phytochemical originating from the Americas deserves further preclinical and clinical examination.

  4. Down-regulation of microRNA-142-5p attenuates oxygen-glucose deprivation and reoxygenation-induced neuron injury through up-regulating Nrf2/ARE signaling pathway.

    Science.gov (United States)

    Wang, Ning; Zhang, Lingmin; Lu, Yang; Zhang, Mingxin; Zhang, Zhenni; Wang, Kui; Lv, Jianrui

    2017-05-01

    MicroRNAs (miRNAs) play vital roles in regulating neuron survival during cerebral ischemia/reperfusion injury. miR-142-5p is reported to be an important regulator of cellular survival. However, little is known about the role of miR-142-5p in regulating neuron survival during cerebral ischemia/reperfusion injury. In this study, we aimed to investigate the precise function and mechanism of miR-142-5p in the regulation of neuron ischemia/reperfusion injury using a cellular model of oxygen-glucose deprivation and reoxygenation (OGD/R)-induced injury in hippocampal neurons in vitro. We found that miR-142-5p was induced in hippocampal neurons with OGD/R treatment. The inhibition of miR-142-5p attenuated OGD/R-induced cell injury and oxidative stress, whereas the overexpression of miR-142-5p aggravated them. Nuclear factor erythroid 2-related factor 2 (Nrf2) was identified as a target gene of miR-142-5p. Moreover, miR-142-5p regulated Nrf2 expression and downstream signaling. Knockdown of Nrf2 abolished the protective effects of miR-142-5p suppression. In addition, we showed an inverse correlation relationship between miR-142-5p and Nrf2 in an in vivo model of middle cerebral artery occlusion in rats. Taken together, these results suggest that miR-142-5p contributes to OGD/R-induced cell injury and the down-regulation of miR-142-5p attenuates OGD/R-induced neuron injury through promoting Nrf2 expression. Our study provides a novel insight into understanding the molecular pathogenesis of cerebral ischemia/reperfusion injury and indicates a potential therapeutic target for the treatment of cerebral ischemia/reperfusion injury. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  5. The Nrf2-inducers tanshinone I and dihydrotanshinone protect human skin cells and reconstructed human skin against solar simulated UV☆

    Science.gov (United States)

    Tao, Shasha; Justiniano, Rebecca; Zhang, Donna D.; Wondrak, Georg T.

    2013-01-01

    Exposure to solar ultraviolet (UV) radiation is a causative factor in skin photocarcinogenesis and photoaging, and an urgent need exists for improved strategies for skin photoprotection. The redox-sensitive transcription factor Nrf2 (nuclear factor-E2-related factor 2), a master regulator of the cellular antioxidant defense against environmental electrophilic insult, has recently emerged as an important determinant of cutaneous damage from solar UV, and the concept of pharmacological activation of Nrf2 has attracted considerable attention as a novel approach to skin photoprotection. In this study, we examined feasibility of using tanshinones, a novel class of phenanthrenequinone-based cytoprotective Nrf2 inducers derived from the medicinal plant Salvia miltiorrhiza, for protection of cultured human skin cells and reconstructed human skin against solar simulated UV. Using a dual luciferase reporter assay in human Hs27 dermal fibroblasts pronounced transcriptional activation of Nrf2 by four major tanshinones [tanshinone I (T-I), dihydrotanshinone (DHT), tanshinone IIA (T-II-A) and cryptotanshinone (CT)] was detected. In fibroblasts, the more potent tanshinones T-I and DHT caused a significant increase in Nrf2 protein half-life via blockage of ubiquitination, ultimately resulting in upregulated expression of cytoprotective Nrf2 target genes (GCLC, NQO1) with the elevation of cellular glutathione levels. Similar tanshinone-induced changes were also observed in HaCaT keratinocytes. T-I and DHT pretreatment caused significant suppression of skin cell death induced by solar simulated UV and riboflavin-sensitized UVA. Moreover, feasibility of tanshinone-based cutaneous photoprotection was tested employing a human skin reconstruct exposed to solar simulated UV (80 mJ/cm2 UVB; 1.53 J/cm2 UVA). The occurrence of markers of epidermal solar insult (cleaved procaspase 3, pycnotic nuclei, eosinophilic cytoplasm, acellular cavities) was significantly attenuated in DHT

  6. The Nrf2-inducers tanshinone I and dihydrotanshinone protect human skin cells and reconstructed human skin against solar simulated UV.

    Science.gov (United States)

    Tao, Shasha; Justiniano, Rebecca; Zhang, Donna D; Wondrak, Georg T

    2013-01-01

    Exposure to solar ultraviolet (UV) radiation is a causative factor in skin photocarcinogenesis and photoaging, and an urgent need exists for improved strategies for skin photoprotection. The redox-sensitive transcription factor Nrf2 (nuclear factor-E2-related factor 2), a master regulator of the cellular antioxidant defense against environmental electrophilic insult, has recently emerged as an important determinant of cutaneous damage from solar UV, and the concept of pharmacological activation of Nrf2 has attracted considerable attention as a novel approach to skin photoprotection. In this study, we examined feasibility of using tanshinones, a novel class of phenanthrenequinone-based cytoprotective Nrf2 inducers derived from the medicinal plant Salvia miltiorrhiza, for protection of cultured human skin cells and reconstructed human skin against solar simulated UV. Using a dual luciferase reporter assay in human Hs27 dermal fibroblasts pronounced transcriptional activation of Nrf2 by four major tanshinones [tanshinone I (T-I), dihydrotanshinone (DHT), tanshinone IIA (T-II-A) and cryptotanshinone (CT)] was detected. In fibroblasts, the more potent tanshinones T-I and DHT caused a significant increase in Nrf2 protein half-life via blockage of ubiquitination, ultimately resulting in upregulated expression of cytoprotective Nrf2 target genes (GCLC, NQO1) with the elevation of cellular glutathione levels. Similar tanshinone-induced changes were also observed in HaCaT keratinocytes. T-I and DHT pretreatment caused significant suppression of skin cell death induced by solar simulated UV and riboflavin-sensitized UVA. Moreover, feasibility of tanshinone-based cutaneous photoprotection was tested employing a human skin reconstruct exposed to solar simulated UV (80 mJ/cm(2) UVB; 1.53 J/cm(2) UVA). The occurrence of markers of epidermal solar insult (cleaved procaspase 3, pycnotic nuclei, eosinophilic cytoplasm, acellular cavities) was significantly attenuated in DHT

  7. The Nrf2-inducers tanshinone I and dihydrotanshinone protect human skin cells and reconstructed human skin against solar simulated UV

    Directory of Open Access Journals (Sweden)

    Shasha Tao

    2013-01-01

    Full Text Available Exposure to solar ultraviolet (UV radiation is a causative factor in skin photocarcinogenesis and photoaging, and an urgent need exists for improved strategies for skin photoprotection. The redox-sensitive transcription factor Nrf2 (nuclear factor-E2-related factor 2, a master regulator of the cellular antioxidant defense against environmental electrophilic insult, has recently emerged as an important determinant of cutaneous damage from solar UV, and the concept of pharmacological activation of Nrf2 has attracted considerable attention as a novel approach to skin photoprotection. In this study, we examined feasibility of using tanshinones, a novel class of phenanthrenequinone-based cytoprotective Nrf2 inducers derived from the medicinal plant Salvia miltiorrhiza, for protection of cultured human skin cells and reconstructed human skin against solar simulated UV. Using a dual luciferase reporter assay in human Hs27 dermal fibroblasts pronounced transcriptional activation of Nrf2 by four major tanshinones [tanshinone I (T-I, dihydrotanshinone (DHT, tanshinone IIA (T-II-A and cryptotanshinone (CT] was detected. In fibroblasts, the more potent tanshinones T-I and DHT caused a significant increase in Nrf2 protein half-life via blockage of ubiquitination, ultimately resulting in upregulated expression of cytoprotective Nrf2 target genes (GCLC, NQO1 with the elevation of cellular glutathione levels. Similar tanshinone-induced changes were also observed in HaCaT keratinocytes. T-I and DHT pretreatment caused significant suppression of skin cell death induced by solar simulated UV and riboflavin-sensitized UVA. Moreover, feasibility of tanshinone-based cutaneous photoprotection was tested employing a human skin reconstruct exposed to solar simulated UV (80 mJ/cm2 UVB; 1.53 J/cm2 UVA. The occurrence of markers of epidermal solar insult (cleaved procaspase 3, pycnotic nuclei, eosinophilic cytoplasm, acellular cavities was significantly attenuated in DHT

  8. Cytoprotection of human endothelial cells against oxidative stress by 1-[2-cyano-3,12-dioxooleana-1,9(11)-dien-28-oyl]imidazole (CDDO-Im): application of systems biology to understand the mechanism of action.

    Science.gov (United States)

    Wang, Xinyu; Bynum, James A; Stavchansky, Solomon; Bowman, Phillip D

    2014-07-05

    Cellular damage from oxidative stress, in particular following ischemic injury, occurs during heart attack, stroke, or traumatic injury, and is potentially reducible with appropriate drug treatment. We previously reported that caffeic acid phenethyl ester (CAPE), a plant-derived polyphenolic compound, protected human umbilical vein endothelial cells (HUVEC) from menadione-induced oxidative stress and that this cytoprotective effect was correlated with the capacity to induce heme oxygenase-1 (HMOX1) and its protein product, a phase II cytoprotective enzyme. To further improve this cytoprotective effect, we studied a synthetic triterpenoid, 1-[2-cyano-3,12-dioxooleana-1,9(11)-dien-28-oyl]imidazole (CDDO-Im), which is known as a potent phase II enzyme inducer with antitumor and anti-inflammatory activities, and compared it to CAPE. CDDO-Im at 200nM provided more protection to HUVEC against oxidative stress than 20μM CAPE. We explored the mechanism of CDDO-Im cytoprotection with gene expression profiling and pathway analysis and compared to that of CAPE. In addition to potent up-regulation of HMOX1, heat shock proteins (HSP) were also found to be highly induced by CDDO-Im in HUVEC. Pathway analysis results showed that transcription factor Nrf2-mediated oxidative stress response was among the top canonical pathways commonly activated by both CDDO-Im and CAPE. Compared to CAPE, CDDO-Im up-regulated more HSP and some of them to a much higher extent. In addition, CDDO-Im treatment affected Nrf2 pathway more significantly. These findings may provide an explanation why CDDO-Im is a more potent cytoprotectant than CAPE against oxidative stress in HUVEC. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. Dose-dependent transitions in Nrf2-mediated adaptive response and related stress responses to hypochlorous acid in mouse macrophages

    International Nuclear Information System (INIS)

    Woods, Courtney G.; Fu Jingqi; Xue Peng; Hou Yongyong; Pluta, Linda J.; Yang Longlong; Zhang Qiang; Thomas, Russell S.; Andersen, Melvin E.; Pi Jingbo

    2009-01-01

    Hypochlorous acid (HOCl) is potentially an important source of cellular oxidative stress. Human HOCl exposure can occur from chlorine gas inhalation or from endogenous sources of HOCl, such as respiratory burst by phagocytes. Transcription factor Nrf2 is a key regulator of cellular redox status and serves as a primary source of defense against oxidative stress. We recently demonstrated that HOCl activates Nrf2-mediated antioxidant response in cultured mouse macrophages in a biphasic manner. In an effort to determine whether Nrf2 pathways overlap with other stress pathways, gene expression profiling was performed in RAW 264.7 macrophages exposed to HOCl using whole genome mouse microarrays. Benchmark dose (BMD) analysis on gene expression data revealed that Nrf2-mediated antioxidant response and protein ubiquitination were the most sensitive biological pathways that were activated in response to low concentrations of HOCl (< 0.35 mM). Genes involved in chromatin architecture maintenance and DNA-dependent transcription were also sensitive to very low doses. Moderate concentrations of HOCl (0.35 to 1.4 mM) caused maximal activation of the Nrf2 pathway and innate immune response genes, such as IL-1β, IL-6, IL-10 and chemokines. At even higher concentrations of HOCl (2.8 to 3.5 mM) there was a loss of Nrf2-target gene expression with increased expression of numerous heat shock and histone cluster genes, AP-1-family genes, cFos and Fra1 and DNA damage-inducible Gadd45 genes. These findings confirm an Nrf2-centric mechanism of action of HOCl in mouse macrophages and provide evidence of interactions between Nrf2, inflammatory, and other stress pathways.

  10. Nrf2 Expression Modifies Influenza A Entry and Replication inNasal Epithelial Cells

    Science.gov (United States)

    Influenza infection is a major cause of morbidity and mortality worldwide, especially during pandemics outbreaks. Emerging data indicate that phase II antioxidant enzyme pathways could playa role in virus-associated inflammation and immune clearance. While Nrf2-dependent gene exp...

  11. Effects of trigonelline inhibition of the Nrf2 transcription factor in vitro on Echinococcus granulosus.

    Science.gov (United States)

    Qin, Wenjuan; Guan, Dongfang; Ma, Rongji; Yang, Rentan; Xing, Guoqiang; Shi, Hongjuan; Tang, Guangyao; Li, Jiajie; Lv, Hailong; Jiang, Yufeng

    2017-08-01

    The aim of this study was to investigate the impact of trigonelline (TRG) on Echinococcus granulosus, and to explore the inhibition impact of nuclear factor erythroid-2-related factor 2 (Nrf2) signaling pathway on E. granulosus protoscoleces. Echinococcus granulosus protoscoleces were incubated with various concentrations of TRG, and then Nrf2 protein expression and its localization in protoscoleces were detected by western blot analysis and immunofluorescence assay, respectively. Reactive oxygen species (ROS) level in protoscoleces was measured using ROS detection kit. Caspase-3 activity was measured using a caspase-3 activity assay kit, and NAD(P)H quinone oxidoreductase (NQO)-1 and heme oxygenase (HO)-1 activities in protoscoleces were measured by ELISA. The effect of TRG on protoscoleces viability was investigated using 0.1% eosin staining, and ultrastructural alterations in protoscoleces were examined by scanning electron microscopy (SEM). Immunolocalization experiment clearly showed that Nrf2 protein was predominantly present in cells of protoscoleces. TRG treatment reduced NQO-1 and HO-1 activities in protoscoleces, but could increase ROS level at early time. Protoscoleces could not survive when treated with 250 μM TRG for 12 days. SEM results showed that TRG-treated protoscoleces presented damage in the protoscoleces region, including hook deformation, lesions, and digitiform protuberance. Nrf2 protein expression was significantly decreased and caspase-3 activity was clearly increased in protoscoleces treated with TRG for 24 and 48 h, respectively, when compared with that in controls (P granulosus protoscoleces. Nrf2 protein was mainly expressed in the cells and TRG could efficiently inhibit the Nrf2 signaling pathway in E. granulosus. © The Author 2017. Published by Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. All rights reserved. For

  12. Pharmacological targeting of GSK-3 and NRF2 provides neuroprotection in a preclinical model of tauopathy

    Directory of Open Access Journals (Sweden)

    Antonio Cuadrado

    2018-04-01

    Full Text Available Tauopathies are a group of neurodegenerative disorders where TAU protein is presented as aggregates or is abnormally phosphorylated, leading to alterations of axonal transport, neuronal death and neuroinflammation. Currently, there is no treatment to slow progression of these diseases. Here, we have investigated whether dimethyl fumarate (DMF, an inducer of the transcription factor NRF2, could mitigate tauopathy in a mouse model. The signaling pathways modulated by DMF were also studied in mouse embryonic fibroblast (MEFs from wild type or KEAP1-deficient mice. The effect of DMF on neurodegeneration, astrocyte and microglial activation was examined in Nrf2+/+ and Nrf2−/− mice stereotaxically injected in the right hippocampus with an adeno-associated vector expressing human TAUP301L and treated daily with DMF (100 mg/kg, i.g during three weeks. DMF induces the NRF2 transcriptional through a mechanism that involves KEAP1 but also PI3K/AKT/GSK-3-dependent pathways. DMF modulates GSK-3β activity in mouse hippocampi. Furthermore, DMF modulates TAU phosphorylation, neuronal impairment measured by calbindin-D28K and BDNF expression, and inflammatory processes involved in astrogliosis, microgliosis and pro-inflammatory cytokines production. This study reveals neuroprotective effects of DMF beyond disruption of the KEAP1/NRF2 axis by inhibiting GSK3 in a mouse model of tauopathy. Our results support repurposing of this drug for treatment of these diseases. Keywords: DMF, Inflammation, Neurodegeneration, NRF2, Oxidative stress, TAU/ GSK-3

  13. Cardiac Aging - Benefits of Exercise, Nrf2 Activation and Antioxidant Signaling.

    Science.gov (United States)

    Narasimhan, Madhusudhanan; Rajasekaran, Namakkal-Soorappan

    2017-01-01

    Cardiovascular dysfunction and heart failure associated with aging not only impairs the cardiac function but also the quality of life eventually decreasing the life expectancy of the elderly. Notably, cardiac tissue can prematurely age under certain conditions such as genetic mutation, persistent redox stress and overload, aberrant molecular signaling, DNA damage, telomere attrition, and other pathological insults. While cardiovascular-related morbidity and mortality is on the rise and remains a global health threat, there has been only little to moderate improvements in its medical management. This is due to the fact that the lifestyle changes to molecular mechanisms underlying age-related myocardial structure and functional remodeling are multifactorial and intricately operate at different levels. Along these lines, the intrinsic redox mechanisms and oxidative stress (OS) are widely studied in the myocardium. The accumulation of reactive oxygen species (ROS) with age and the resultant oxidative damage has been shown to increase the susceptibility of the myocardium to multiple complications such as atherosclerosis, hypertension, ischemic heart disease, cardiac myopathy, and heart failure. There has been growing interest in trying to enhance the mechanisms that neutralize the ROS and curtailing OS as a possible anti-aging intervention and as a treatment for age-related disorders. Natural defense system to fight against OS involves a master transcription factor named nuclear erythroid-2-p45-related factor-2 (Nrf2) that regulates several antioxidant genes. Compelling evidence exists on the Nrf2 gain of function through pharmacological interventions in counteracting the oxidative damage and affords cytoprotection in several organs including but not limited to lung, liver, kidney, brain, etc. Nevertheless, thus far, only a few studies have described the potential role of Nrf2 and its non-pharmacological induction in cardiac aging. This chapter explores the effects of

  14. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  15. A novel role for small molecule glycomimetics in the protection against lipid-induced endothelial dysfunction: Involvement of Akt/eNOS and Nrf2/ARE signaling.

    Science.gov (United States)

    Mahmoud, Ayman M; Wilkinson, Fiona L; Jones, Alan M; Wilkinson, James A; Romero, Miguel; Duarte, Juan; Alexander, M Yvonne

    2017-01-01

    Glycomimetics are a diverse array of saccharide-inspired compounds, designed to mimic the bioactive functions of glycosaminoglycans. Therefore, glycomimetics represent a unique source of novel therapies to target aberrant signaling and protein interactions in a wide range of diseases. We investigated the protective effects of four newly synthesized small molecule glycomimetics against lipid-induced endothelial dysfunction, with an emphasis on nitric oxide (NO) and oxidative stress. Four aromatic sugar mimetics were synthesized by the stepwise transformation of 2,5-dihydroxybenzoic acid to derivatives (C1-C4) incorporating sulfate groups to mimic the structure of heparan sulfate. Glycomimetic-treated human umbilical vein endothelial cells (HUVECs) were exposed to palmitic acid to model lipid-induced oxidative stress. Palmitate-induced impairment of NO production was restored by the glycomimetics, through activation of Akt/eNOS signaling. Furthermore, C1-C4 significantly inhibited palmitate-induced reactive oxygen species (ROS) production, lipid peroxidation, and activity and expression of NADPH oxidase. These effects were attributed to activation of the Nrf2/ARE pathway and downstream activation of cellular antioxidant and cytoprotective proteins. In ex vivo vascular reactivity studies, the glycomimetics (C1-C4) also demonstrated a significant improvement in endothelium-dependent relaxation and decreased ROS production and NADPH oxidase activity in isolated mouse thoracic aortic rings exposed to palmitate. The small molecule glycomimetics, C1-C4, protect against lipid-induced endothelial dysfunction through up-regulation of Akt/eNOS and Nrf2/ARE signaling pathways. Thus, carbohydrate-derived therapeutics are a new class of glycomimetic drugs targeting endothelial dysfunction, regarded as the first line of defense against vascular complications in cardiovascular disease. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Role of Nrf2 antioxidant defense in mitigating cadmium-induced oxidative stress in the olfactory system of zebrafish

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Lu; Gallagher, Evan P., E-mail: evang3@uw.edu

    2013-01-15

    Exposure to trace metals can disrupt olfactory function in fish leading to a loss of behaviors critical to survival. Cadmium (Cd) is an olfactory toxicant that elicits cellular oxidative stress as a mechanism of toxicity while also inducing protective cellular antioxidant genes via activation of the nuclear factor (erythroid-derived 2)-like 2 (Nrf2) pathway. However, the molecular mechanisms of Cd-induced olfactory injury have not been characterized. In the present study, we investigated the role of the Nrf2-mediated antioxidant defense pathway in protecting against Cd-induced olfactory injury in zebrafish. A dose-dependent induction of Nrf2-regulated antioxidant genes associated with cellular responses to oxidative stress was observed in the olfactory system of adult zebrafish following 24 h Cd exposure. Zebrafish larvae exposed to Cd for 3 h showed increased glutathione S-transferase pi (gst pi), glutamate–cysteine ligase catalytic subunit (gclc), heme oxygenase 1 (hmox1) and peroxiredoxin 1 (prdx1) mRNA levels indicative of Nrf2 activation, and which were blocked by morpholino-mediated Nrf2 knockdown. The inhibition of antioxidant gene induction in Cd-exposed Nrf2 morphants was associated with disruption of olfactory driven behaviors, increased cell death and loss of olfactory sensory neurons (OSNs). Nrf2 morphants also exhibited a downregulation of OSN-specific genes after Cd exposure. Pre-incubation of embryos with sulforaphane (SFN) partially protected against Cd-induced olfactory tissue damage. Collectively, our results indicate that oxidative stress is an important mechanism of Cd-mediated injury in the zebrafish olfactory system. Moreover, the Nrf2 pathway plays a protective role against cellular oxidative damage and is important in maintaining zebrafish olfactory function. -- Highlights: ► Oxidative stress is an important mechanism of Cd-mediated olfactory injury. ► Cd induces antioxidant gene expression in the zebrafish olfactory system. ► The

  17. Effects of Nrf2 deficiency on arsenic metabolism in mice.

    Science.gov (United States)

    Wang, Huihui; Zhu, Jiayu; Li, Lu; Li, Yongfang; Lv, Hang; Xu, Yuanyuan; Sun, Guifan; Pi, Jingbo

    2017-12-15

    Inorganic arsenic (iAs) is a known toxicant and carcinogen. Worldwide arsenic exposure has become a threat to human health. The severity of arsenic toxicity is strongly correlated with the speed of arsenic metabolism (methylation) and clearance. Furthermore, oxidative stress is recognized as a major mechanism for arsenic-induced toxicity. Nuclear factor-E2-related factor 2 (Nrf2), a key regulator in cellular adaptive antioxidant response, is clearly involved in alleviation of arsenic-induced oxidative damage. Multiple studies demonstrate that Nrf2 deficiency mice are more vulnerable to arsenic-induced intoxication. However, what effect Nrf2 deficiency might have on arsenic metabolism in mice is still unknown. In the present study, we measured the key enzymes involved in arsenic metabolism in Nrf2-WT and Nrf2-KO mice. Our results showed that basal transcript levels of glutathione S-transferase omega 2 (Gsto2) were significantly higher and GST mu 1 (Gstm1) lower in Nrf2-KO mice compared to Nrf2-WT control. Arsenic speciation and methylation rate in liver and urine was then studied in mice treated with 5mg/kg sodium arsenite for 12h. Although there were some alterations in arsenic metabolism enzymes between Nrf2-WT and Nrf2-KO mice, the Nrf2 deficiency had no significant effect on arsenic methylation. These results suggest that the Nrf2-KO mice are more sensitive to arsenic than Nrf2-WT mainly because of differences in adaptive antioxidant detoxification capacity rather than arsenic methylation capacity. Copyright © 2017. Published by Elsevier Inc.

  18. Berberine, a natural antidiabetes drug, attenuates glucose neurotoxicity and promotes Nrf2-related neurite outgrowth

    Energy Technology Data Exchange (ETDEWEB)

    Hsu, Ya-Yun [Department of Pharmacology, School of Medicine, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Graduate Institute of Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Tseng, Yu-Ting [Graduate Institute of Natural Products, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Lo, Yi-Ching, E-mail: yichlo@kmu.edu.tw [Department of Pharmacology, School of Medicine, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Graduate Institute of Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Graduate Institute of Natural Products, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China)

    2013-11-01

    Reactive oxygen intermediates production and apoptotic damage induced by high glucose are major causes of neuronal damage in diabetic neuropathy. Berberine (BBR), a natural antidiabetes drug with PI3K-activating activity, holds promise for diabetes because of its dual antioxidant and anti-apoptotic activities. We have previously reported that BBR attenuated H{sub 2}O{sub 2} neurotoxicity via activating the PI3K/Akt/Nrf2-dependent pathway. In this study, we further explored the novel protective mechanism of BBR on high glucose-induced apoptotic death and neurite damage of SH-SY5Y cells. Results indicated BBR (0.1–10 nM) significantly attenuated reactive oxygen species (ROS) production, nucleus condensation, and apoptotic death in high glucose-treated cells. However, AG1024, an inhibitor of insulin growth factor-1 (IGF-1) receptor, significantly abolished BBR protection against high glucose-induced neuronal death. BBR also increased Bcl-2 expression and decreased cytochrome c release. High glucose down-regulated IGF-1 receptor and phosphorylation of Akt and GSK-3β, the effects of which were attenuated by BBR treatment. BBR also activated nuclear erythroid 2-related factor 2 (Nrf2), the key antioxidative transcription factor, which is accompanied with up-regulation of hemeoxygenase-1 (HO-1). Furthermore, BBR markedly enhanced nerve growth factor (NGF) expression and promoted neurite outgrowth in high glucose-treated cells. To further determine the role of the Nrf2 in BBR neuroprotection, RNA interference directed against Nrf2 was used. Results indicated Nrf2 siRNA abolished BBR-induced HO-1, NGF, neurite outgrowth and ROS decrease. In conclusion, BBR attenuated high glucose-induced neurotoxicity, and we are the first to reveal this novel mechanism of BBR as an Nrf2 activator against glucose neurotoxicity, providing another potential therapeutic use of BBR on the treatment of diabetic complications. - Highlights: • BBR attenuates high glucose-induced ROS

  19. PCB 126 toxicity is modulated by cross-talk between caveolae and Nrf2 signaling

    Energy Technology Data Exchange (ETDEWEB)

    Petriello, Michael C. [Graduate Center for Toxicology, College of Medicine, University of Kentucky, Lexington, KY 40536 (United States); University of Kentucky Superfund Research Center, Lexington, KY 40536 (United States); Han, Sung Gu [University of Kentucky Superfund Research Center, Lexington, KY 40536 (United States); Department of Food Science and Biotechnology of Animal Resources, College of Animal Bioscience and Technology, Konkuk University, Seoul 143-701 (Korea, Republic of); Newsome, Bradley J. [University of Kentucky Superfund Research Center, Lexington, KY 40536 (United States); Department of Chemistry, College of Arts and Sciences, University of Kentucky, Lexington, KY 40506 (United States); Hennig, Bernhard [Graduate Center for Toxicology, College of Medicine, University of Kentucky, Lexington, KY 40536 (United States); University of Kentucky Superfund Research Center, Lexington, KY 40536 (United States); Department of Animal and Food Sciences, College of Agriculture, Food and Environment, University of Kentucky, KY 40506 (United States)

    2014-06-01

    Environmental toxicants such as polychlorinated biphenyls (PCBs) have been implicated in the promotion of multiple inflammatory disorders including cardiovascular disease, but information regarding mechanisms of toxicity and cross-talk between relevant cell signaling pathways is lacking. To examine the hypothesis that cross-talk between membrane domains called caveolae and nuclear factor (erythroid-derived 2)-like 2 (Nrf2) pathways alters PCB-induced inflammation, caveolin-1 was silenced in vascular endothelial cells, resulting in a decreased PCB-induced inflammatory response. Cav-1 silencing (siRNA treatment) also increased levels of Nrf2-ARE transcriptional binding, resulting in higher mRNA levels of the antioxidant genes glutathione s-transferase and NADPH dehydrogenase quinone-1 in both vehicle and PCB-treated systems. Along with this upregulated antioxidant response, Cav-1 siRNA treated cells exhibited decreased mRNA levels of the Nrf2 inhibitory protein Keap1 in both vehicle and PCB-treated samples. Silencing Cav-1 also decreased protein levels of Nrf2 inhibitory proteins Keap1 and Fyn kinase, especially in PCB-treated cells. Further, endothelial cells from wildtype and Cav-1 −/− mice were isolated and treated with PCB to better elucidate the role of functional caveolae in PCB-induced endothelial inflammation. Cav-1 −/− endothelial cells were protected from PCB-induced cellular dysfunction as evidenced by decreased vascular cell adhesion molecule (VCAM-1) protein induction. Compared to wildtype cells, Cav-1 −/− endothelial cells also allowed for a more effective antioxidant response, as observed by higher levels of the antioxidant genes. These data demonstrate novel cross-talk mechanisms between Cav-1 and Nrf2 and implicate the reduction of Cav-1 as a protective mechanism for PCB-induced cellular dysfunction and inflammation. - Highlights: • Reduction of caveolin-1 protein protects against polychlorinated biphenyl toxicity. • Decreasing

  20. Berberine, a natural antidiabetes drug, attenuates glucose neurotoxicity and promotes Nrf2-related neurite outgrowth

    International Nuclear Information System (INIS)

    Hsu, Ya-Yun; Tseng, Yu-Ting; Lo, Yi-Ching

    2013-01-01

    Reactive oxygen intermediates production and apoptotic damage induced by high glucose are major causes of neuronal damage in diabetic neuropathy. Berberine (BBR), a natural antidiabetes drug with PI3K-activating activity, holds promise for diabetes because of its dual antioxidant and anti-apoptotic activities. We have previously reported that BBR attenuated H 2 O 2 neurotoxicity via activating the PI3K/Akt/Nrf2-dependent pathway. In this study, we further explored the novel protective mechanism of BBR on high glucose-induced apoptotic death and neurite damage of SH-SY5Y cells. Results indicated BBR (0.1–10 nM) significantly attenuated reactive oxygen species (ROS) production, nucleus condensation, and apoptotic death in high glucose-treated cells. However, AG1024, an inhibitor of insulin growth factor-1 (IGF-1) receptor, significantly abolished BBR protection against high glucose-induced neuronal death. BBR also increased Bcl-2 expression and decreased cytochrome c release. High glucose down-regulated IGF-1 receptor and phosphorylation of Akt and GSK-3β, the effects of which were attenuated by BBR treatment. BBR also activated nuclear erythroid 2-related factor 2 (Nrf2), the key antioxidative transcription factor, which is accompanied with up-regulation of hemeoxygenase-1 (HO-1). Furthermore, BBR markedly enhanced nerve growth factor (NGF) expression and promoted neurite outgrowth in high glucose-treated cells. To further determine the role of the Nrf2 in BBR neuroprotection, RNA interference directed against Nrf2 was used. Results indicated Nrf2 siRNA abolished BBR-induced HO-1, NGF, neurite outgrowth and ROS decrease. In conclusion, BBR attenuated high glucose-induced neurotoxicity, and we are the first to reveal this novel mechanism of BBR as an Nrf2 activator against glucose neurotoxicity, providing another potential therapeutic use of BBR on the treatment of diabetic complications. - Highlights: • BBR attenuates high glucose-induced ROS production and

  1. Translational control of Nrf2 within the open reading frame

    International Nuclear Information System (INIS)

    Perez-Leal, Oscar; Barrero, Carlos A.; Merali, Salim

    2013-01-01

    Highlights: •Identification of a novel Nrf2 translational repression mechanism. •The repressor is within the 3′ portion of the Nrf2 ORF. •The translation of Nrf2 or eGFP is reduced by the regulatory element. •The translational repression can be reversed with synonymous codon substitutions. •The molecular mechanism requires the mRNA sequence, but not the encoded amino acids. -- Abstract: Nuclear Factor Erythroid 2-Related Factor 2 (Nrf2) is a transcription factor that is essential for the regulation of an effective antioxidant and detoxifying response. The regulation of its activity can occur at transcription, translation and post-translational levels. Evidence suggests that under environmental stress conditions, new synthesis of Nrf2 is required – a process that is regulated by translational control and is not fully understood. Here we described the identification of a novel molecular process that under basal conditions strongly represses the translation of Nrf2 within the open reading frame (ORF). This mechanism is dependent on the mRNA sequence within the 3′ portion of the ORF of Nrf2 but not in the encoded amino acid sequence. The Nrf2 translational repression can be reversed with the use of synonymous codon substitutions. This discovery suggests an additional layer of control to explain the reason for the low Nrf2 concentration under quiescent state

  2. NRF2 Protection against Liver Injury Produced by Various Hepatotoxicants

    Directory of Open Access Journals (Sweden)

    Jie Liu

    2013-01-01

    Full Text Available To investigate the role of Nrf2 as a master defense against the hepatotoxicity produced by various chemicals, Nrf2-null, wild-type, Keap1-knock down (Keap1-Kd and Keap1-hepatocyte knockout (Keap1-HKO mice were used as a “graded Nrf2 activation” model. Mice were treated with 14 hepatotoxicants at appropriate doses, and blood and liver samples were collected thereafter (6 h to 7 days depending on the hepatotoxicant. Graded activation of Nrf2 offered a Nrf2-dependent protection against the hepatotoxicity produced by carbon tetrachloride, acetaminophen, microcystin, phalloidin, furosemide, cadmium, and lithocholic acid, as evidenced by serum alanine aminotransferase (ALT activities and by histopathology. Nrf2 activation also offered moderate protection against liver injury produced by ethanol, arsenic, bromobenzene, and allyl alcohol but had no effects on the hepatotoxicity produced by D-galactosamine/endotoxin and the Fas ligand antibody Jo-2. Graded Nrf2 activation reduced the expression of inflammatory genes (MIP-2, mKC, IL-1β, IL-6, and TNFα, oxidative stress genes (Ho-1, Egr1, ER stress genes (Gadd45 and Gadd153, and genes encoding cell death (Noxa, Bax, Bad, and caspase3. Thus, this study demonstrates that Nrf2 prevents the liver from many, but not all, hepatotoxicants. The Nrf2-mediated protection is accompanied by induction of antioxidant genes, suppression of inflammatory responses, and attenuation of oxidative stress.

  3. Adenovirus-Mediated Over-Expression of Nrf2 Within Mesenchymal Stem Cells (MSCs Protected Rats Against Acute Kidney Injury

    Directory of Open Access Journals (Sweden)

    Mohammad Mohammadzadeh-Vardin

    2015-06-01

    Full Text Available Purpose: Recent developments in the field of cell therapy have led to a renewed interest in treatment of acute kidney injury (AKI. However, the early death of transplanted mesenchymal stem cells (MSCs in stressful microenvironment of a recipient tissue is a major problem with this kind of treatment. The objective of this study was to determine whether overexpression of a cytoprotective factor, nuclear factor erythroid-2 related factor 2 (Nrf2, in MSCs could protect rats against AKI. Methods: The Nrf2 was overexpressed in MSCs by recombinant adenoviruses, and the MSCs were implanted to rats suffering from cisplatin-induced AKI. Results: The obtained results showed that transplantation with the engineered MSCs ameliorates cisplatin-induced AKI. Morphologic features of the investigated kidneys showed that transplantation with the MSCs in which Nrf2 had been overexpressed significantly improved the complications of AKI. Conclusion: These findings suggested that the engineered MSCs might be a good candidate to be further evaluated in clinical trials. However, detailed studies must be performed to investigate the possible carcinogenic effect of Nrf2 overexpression.

  4. Alkylating Agent-Induced NRF2 Blocks Endoplasmic Reticulum Stress-Mediated Apoptosis via Control of Glutathione Pools and Protein Thiol Homeostasis.

    Science.gov (United States)

    Zanotto-Filho, Alfeu; Masamsetti, V Pragathi; Loranc, Eva; Tonapi, Sonal S; Gorthi, Aparna; Bernard, Xavier; Gonçalves, Rosângela Mayer; Moreira, José C F; Chen, Yidong; Bishop, Alexander J R

    2016-12-01

    Alkylating agents are a commonly used cytotoxic class of anticancer drugs. Understanding the mechanisms whereby cells respond to these drugs is key to identify means to improve therapy while reducing toxicity. By integrating genome-wide gene expression profiling, protein analysis, and functional cell validation, we herein demonstrated a direct relationship between NRF2 and Endoplasmic Reticulum (ER) stress pathways in response to alkylating agents, which is coordinated by the availability of glutathione (GSH) pools. GSH is essential for both drug detoxification and protein thiol homeostasis within the ER, thus inhibiting ER stress induction and promoting survival, an effect independent of its antioxidant role. NRF2 accumulation induced by alkylating agents resulted in increased GSH synthesis via GCLC/GCLM enzyme, and interfering with this NRF2 response by either NRF2 knockdown or GCLC/GCLM inhibition with buthionine sulfoximine caused accumulation of damaged proteins within the ER, leading to PERK-dependent apoptosis. Conversely, upregulation of NRF2, through KEAP1 depletion or NRF2-myc overexpression, or increasing GSH levels with N-acetylcysteine or glutathione-ethyl-ester, decreased ER stress and abrogated alkylating agents-induced cell death. Based on these results, we identified a subset of lung and head-and-neck carcinomas with mutations in either KEAP1 or NRF2/NFE2L2 genes that correlate with NRF2 target overexpression and poor survival. In KEAP1-mutant cancer cells, NRF2 knockdown and GSH depletion increased cell sensitivity via ER stress induction in a mechanism specific to alkylating drugs. Overall, we show that the NRF2-GSH influence on ER homeostasis implicates defects in NRF2-GSH or ER stress machineries as affecting alkylating therapy toxicity. Mol Cancer Ther; 15(12); 3000-14. ©2016 AACR. ©2016 American Association for Cancer Research.

  5. Alkylating agent induced NRF2 blocks endoplasmic reticulum stress-mediated apoptosis via control of glutathione pools and protein thiol homeostasis

    Science.gov (United States)

    Zanotto-Filho, Alfeu; Masamsetti, V. Pragathi; Loranc, Eva; Tonapi, Sonal S.; Gorthi, Aparna; Bernard, Xavier; Gonçalves, Rosângela Mayer; Moreira, José C. F.; Chen, Yidong; Bishop, Alexander J. R.

    2016-01-01

    Alkylating agents are a commonly used cytotoxic class of anticancer drugs. Understanding the mechanisms whereby cells respond to these drugs is key to identify means to improve therapy while reducing toxicity. By integrating genome-wide gene expression profiling, protein analysis and functional cell validation, we herein demonstrated a direct relationship between NRF2 and Endoplasmic Reticulum (ER) stress pathways in response to alkylating agents, which is coordinated by the availability of glutathione (GSH) pools. GSH is essential for both drug detoxification and protein thiol homeostasis within the ER, thus inhibiting ER stress induction and promoting survival; an effect independent of its antioxidant role. NRF2 accumulation induced by alkylating agents resulted in increased GSH synthesis via GCLC/GCLM enzyme, and interfering with this NRF2 response by either NRF2 knockdown or GCLC/GCLM inhibition with buthionine sulfoximine (BSO) caused accumulation of damaged proteins within the ER, leading to PERK-dependent apoptosis. Conversely, upregulation of NRF2, through KEAP1 depletion or NRF2-myc overexpression, or increasing GSH levels with N-acetylcysteine (NAC) or glutathione-ethyl-ester (GSH-E), decreased ER stress and abrogated alkylating agents-induced cell death. Based on these results, we identified a subset of lung and head-and-neck carcinomas with mutations in either KEAP1 or NRF2/NFE2L2 genes that correlate with NRF2 targets overexpression and poor survival. In KEAP1 mutant cancer cells, NRF2 knockdown and GSH depletion increased cell sensitivity via ER stress induction in a mechanism specific to alkylating drugs. Overall, we show that the NRF2-GSH influence on ER homeostasis implicates defects in NRF2-GSH or ER stress machineries as affecting alkylating therapy toxicity. PMID:27638861

  6. 4-methoxychalcone enhances cisplatin-induced oxidative stress and cytotoxicity by inhibiting the Nrf2/ARE-mediated defense mechanism in A549 lung cancer cells.

    Science.gov (United States)

    Lim, Juhee; Lee, Sung Ho; Cho, Sera; Lee, Ik-Soo; Kang, Bok Yun; Choi, Hyun Jin

    2013-10-01

    Nuclear factor erythroid 2-related factor 2 (Nrf2) is a key transcriptional regulator for the protection of cells against oxidative and xenobiotic stresses. Recent studies have demonstrated that high constitutive expression of Nrf2 is observed in many types of cancer cells showing resistance to anti-cancer drugs, suggesting that the suppression of overexpressed Nrf2 could be an attractive therapeutic strategy to overcome cancer drug resistance. In the present study, we aimed to find small molecule compounds that enhance the sensitivity of tumor cells to cisplatin induced cytotoxicity by suppressing Nrf2-mediated defense mechanism. A549 lung cancer cells were shown to be more resistant to the anti-cancer drug cisplatin than HEK293 cells, with higher Nrf2 signaling activity; constitutively high amounts of Nrf2-downstream target proteins were observed in A549 cells. Among the three chalcone derivatives 4-methoxy-chalcone (4-MC), hesperidin methylchalcone, and neohesperidin dihydrochalcone, 4-MC was found to suppress transcriptional activity of Nrf2 in A549 cells but to activate it in HEK293 cells. 4-MC was also shown to down-regulate expression of Nrf2 and the downstream phase II detoxifying enzyme NQO1 in A549 cells. The PI3K/Akt pathway was found to be involved in the 4-MC-induced inhibition of Nrf2/ARE activity in A549 cells. This inhibition of Nrf2 signaling results in the accelerated generation of reactive oxygen species and exacerbation of cytotoxicity in cisplatin-treated A549 cells. Taken together, these results suggest that the small molecule compound 4-MC could be used to enhance the sensitivity of tumor cells to the therapeutic effect of cisplatin through the regulation of Nrf2/ARE signaling.

  7. Fenofibrate activates Nrf2 through p62-dependent Keap1 degradation

    International Nuclear Information System (INIS)

    Park, Jeong Su; Kang, Dong Hoon; Lee, Da Hyun; Bae, Soo Han

    2015-01-01

    Peroxisome proliferator-activated receptor α (PPARα) activates the β-oxidation of fatty acids in the liver. Fenofibrate is a potent agonist of PPARα and is used in the treatment of hyperlipidemia. Fenofibrate treatment often induces the production of intracellular reactive oxygen species (ROS), leading to cell death. The nuclear factor erythroid 2-related factor 2 (Nrf2)-Kelch-like ECH-associated protein 1 (Keap1) pathway is an essential component of the defense mechanism against oxidative stress. However, the molecular mechanism underlying the regulation of the Nrf2-Keap1 pathway in fenofibrate-induced cell death is not known. In this study, we demonstrated that fenofibrate induces Keap1 degradation and Nrf2 activation. This fenofibrate-mediated Keap1 degradation is partly dependent on autophagy. Furthermore, fenofibrate-induced Keap1 degradation followed by Nrf2 activation is mainly mediated by p62, which functions as an adaptor protein in the autophagic pathway. Consistent with these findings, ablation of p62 increased fenofibrate-mediated apoptotic cell death associated with ROS accumulation. These results strongly suggest that p62 plays a crucial role in preventing fenofibrate-induced cell death. - Highlights: • Fenofibrate induces cell death by increasing ROS production. • The underlying defense mechanism against this effect is unknown. • Fenofibrate induces autophagy-dependent Keap1 degradation and Nrf2 activation. • This process is p62-dependent; lack of p62 enhanced fenofibrate-mediated apoptosis. • p62 plays a crucial role in preventing fenofibrate-induced cell death

  8. Fenofibrate activates Nrf2 through p62-dependent Keap1 degradation

    Energy Technology Data Exchange (ETDEWEB)

    Park, Jeong Su [Severance Biomedical Science Institute (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Kang, Dong Hoon [Department of Life Science and Ewha Research Center for Systems Biology (Korea, Republic of); The Research Center for Cell Homeostasis, Ewha Womans University, Seoul 127-750 (Korea, Republic of); Lee, Da Hyun [Severance Biomedical Science Institute (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Bae, Soo Han, E-mail: soohanbae@yuhs.ac [Severance Biomedical Science Institute (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of)

    2015-09-25

    Peroxisome proliferator-activated receptor α (PPARα) activates the β-oxidation of fatty acids in the liver. Fenofibrate is a potent agonist of PPARα and is used in the treatment of hyperlipidemia. Fenofibrate treatment often induces the production of intracellular reactive oxygen species (ROS), leading to cell death. The nuclear factor erythroid 2-related factor 2 (Nrf2)-Kelch-like ECH-associated protein 1 (Keap1) pathway is an essential component of the defense mechanism against oxidative stress. However, the molecular mechanism underlying the regulation of the Nrf2-Keap1 pathway in fenofibrate-induced cell death is not known. In this study, we demonstrated that fenofibrate induces Keap1 degradation and Nrf2 activation. This fenofibrate-mediated Keap1 degradation is partly dependent on autophagy. Furthermore, fenofibrate-induced Keap1 degradation followed by Nrf2 activation is mainly mediated by p62, which functions as an adaptor protein in the autophagic pathway. Consistent with these findings, ablation of p62 increased fenofibrate-mediated apoptotic cell death associated with ROS accumulation. These results strongly suggest that p62 plays a crucial role in preventing fenofibrate-induced cell death. - Highlights: • Fenofibrate induces cell death by increasing ROS production. • The underlying defense mechanism against this effect is unknown. • Fenofibrate induces autophagy-dependent Keap1 degradation and Nrf2 activation. • This process is p62-dependent; lack of p62 enhanced fenofibrate-mediated apoptosis. • p62 plays a crucial role in preventing fenofibrate-induced cell death.

  9. Involvement of ERK-Nrf-2 signaling in ionizing radiation induced cell death in normal and tumor cells.

    Directory of Open Access Journals (Sweden)

    Raghavendra S Patwardhan

    Full Text Available Prolonged oxidative stress favors tumorigenic environment and inflammation. Oxidative stress may trigger redox adaptation mechanism(s in tumor cells but not normal cells. This may increase levels of intracellular antioxidants and establish a new redox homeostasis. Nrf-2, a master regulator of battery of antioxidant genes is constitutively activated in many tumor cells. Here we show that, murine T cell lymphoma EL-4 cells show constitutive and inducible radioresistance via activation of Nrf-2/ERK pathway. EL-4 cells contained lower levels of ROS than their normal counterpart murine splenic lymphocytes. In response to radiation, the thiol redox circuits, GSH and thioredoxin were modified in EL-4 cells. Pharmacological inhibitors of ERK and Nrf-2 significantly enhanced radiosensitivity and reduced clonogenic potential of EL-4 cells. Unirradiated lymphoma cells showed nuclear accumulation of Nrf-2, upregulation of its dependent genes and protein levels. Interestingly, MEK inhibitor abrogated its nuclear translocation suggesting role of ERK in basal and radiation induced Nrf-2 activation in tumor cells. Double knockdown of ERK and Nrf-2 resulted in higher sensitivity to radiation induced cell death as compared to individual knockdown cells. Importantly, NF-kB which is reported to be constitutively active in many tumors was not present at basal levels in EL-4 cells and its inhibition did not influence radiosensitivity of EL-4 cells. Thus our results reveal that, tumor cells which are subjected to heightened oxidative stress employ master regulator cellular redox homeostasis Nrf-2 for prevention of radiation induced cell death. Our study reveals the molecular basis of tumor radioresistance and highlights role of Nrf-2 and ERK.

  10. Age-related retinopathy in NRF2-deficient mice.

    Directory of Open Access Journals (Sweden)

    Zhenyang Zhao

    2011-04-01

    Full Text Available Cumulative oxidative damage is implicated in the pathogenesis of age-related macular degeneration (AMD. Nuclear factor erythroid 2-related factor 2 (NRF2 is a transcription factor that plays key roles in retinal antioxidant and detoxification responses. The purposes of this study were to determine whether NRF2-deficient mice would develop AMD-like retinal pathology with aging and to explore the underlying mechanisms.Eyes of both wild type and Nrf2(-/- mice were examined in vivo by fundus photography and electroretinography (ERG. Structural changes of the outer retina in aged animals were examined by light and electron microscopy, and immunofluorescence labeling. Our results showed that Nrf2(-/- mice developed age-dependent degenerative pathology in the retinal pigment epithelium (RPE. Drusen-like deposits, accumulation of lipofuscin, spontaneous choroidal neovascularization (CNV and sub-RPE deposition of inflammatory proteins were present in Nrf2(-/- mice after 12 months. Accumulation of autophagy-related vacuoles and multivesicular bodies was identified by electron microscopy both within the RPE and in Bruch's membrane of aged Nrf2(-/- mice.Our data suggest that disruption of Nfe2l2 gene increased the vulnerability of outer retina to age-related degeneration. NRF2-deficient mice developed ocular pathology similar to cardinal features of human AMD and deregulated autophagy is likely a mechanistic link between oxidative injury and inflammation. The Nrf2(-/- mice can provide a novel model for mechanistic and translational research on AMD.

  11. Nrf2 transcription factor gene regulates basal transcription of ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-10-19

    Oct 19, 2009 ... induction in the Nrf2(-/-) mouse brain. In contrast, there ... mouse brain by any of the chemicals used . Key words: .... The blots were then probed with the human SOD2 .... Nrf2, null and wild mice as part of my PhD work. I wish.

  12. Polydatin Protects Rat Liver against Ethanol-Induced Injury: Involvement of CYP2E1/ROS/Nrf2 and TLR4/NF-κB p65 Pathway

    Directory of Open Access Journals (Sweden)

    Qiong-Hui Huang

    2017-01-01

    Full Text Available Excessive alcohol consumption leads to serious liver injury, associating with oxidative stress and inflammatory response. Previous study has demonstrated that polydatin (PD exerted antioxidant and anti-inflammatory effects and attenuated ethanol-induced liver damage, but the research remained insufficient. Hence, this experiment aimed to evaluate the hepatoprotective effect and potential mechanisms of PD on ethanol-induced hepatotoxicity. Our results showed that PD pretreatment dramatically decreased the levels of alanine aminotransferase (ALT, aspartate aminotransferase (AST, alkaline phosphatase (ALP, and lactate dehydrogenase (LDH in the serum, suppressed the malonaldehyde (MDA and triglyceride (TG content and the production of reactive oxygen species (ROS, and enhanced the activities of superoxide dismutase (SOD, glutathione peroxidase (GSH-Px, catalase (CAT, andalcohol dehydrogenase (ADH, and aldehyde dehydrogenase (ALDH, paralleled by an improvement of histopathology alterations. The protective effect of PD against oxidative stress was probably associated with downregulation of cytochrome P450 2E1 (CYP2E1 and upregulation of nuclear factor erythroid 2-related factor 2 (Nrf2 and its target gene haem oxygenase-1 (HO-1. Moreover, PD inhibited the release of proinflammatory cytokines (TNF-α, IL-1β, and IL-6 via downregulating toll-like receptor 4 (TLR4 and nuclear factor kappa B (NF-κB p65. To conclude, PD pretreatment protects against ethanol-induced liver injury via suppressing oxidative stress and inflammation.

  13. Modulation of proteostasis by transcription factor NRF2 and impact in neurodegenerative diseases

    Directory of Open Access Journals (Sweden)

    Marta Pajares

    2017-04-01

    Full Text Available Neurodegenerative diseases are linked to the accumulation of specific protein aggregates, suggesting an intimate connection between injured brain and loss of proteostasis. Proteostasis refers to all the processes by which cells control the abundance and folding of the proteome thanks to a wide network that integrates the regulation of signaling pathways, gene expression and protein degradation systems. This review attempts to summarize the most relevant findings about the transcriptional modulation of proteostasis exerted by the transcription factor NRF2 (nuclear factor (erythroid-derived 2-like 2. NRF2 has been classically considered as the master regulator of the antioxidant cell response, although it is currently emerging as a key component of the transduction machinery to maintain proteostasis. As we will discuss, NRF2 could be envisioned as a hub that compiles emergency signals derived from misfolded protein accumulation in order to build a coordinated and perdurable transcriptional response. This is achieved by functions of NRF2 related to the control of genes involved in the maintenance of the endoplasmic reticulum physiology, the proteasome and autophagy.

  14. Role of Nrf2 and protective effects of Metformin against tobacco smoke-induced cerebrovascular toxicity

    Directory of Open Access Journals (Sweden)

    Shikha Prasad

    2017-08-01

    Full Text Available Cigarette smoking (CS is associated with vascular endothelial dysfunction in a causative way primarily related to the TS content of reactive oxygen species (ROS, nicotine, and inflammation. TS promotes glucose intolerance and increases the risk of developing type-2 diabetes mellitus (2DM with which it shares other pathogenic traits including the high risk of cerebrovascular and neurological disorders like stroke via ROS generation, inflammation, and blood-brain barrier (BBB impairment. Herein we provide evidence of the role played by nuclear factor erythroid 2-related factor (Nrf2 in CS-induced cerebrobvascular/BBB impairments and how these cerebrovascular harmful effects can be circumvented by the use of metformin (MF; a widely prescribed, firstline anti-diabetic drug treatment. Our data in fact revealed that MF activates counteractive mechanisms primarily associated with the Nrf2 pathway which drastically reduce CS toxicity at the cerebrovascular level. These include the suppression of tight junction (TJ protein downregulation and loss of BBB integrity induced by CS, reduction of inflammation and oxidative stress, renormalization of the expression levels of the major BBB glucose transporter Glut-1 and that of the anticoagulant factor thrombomodulin. Further, we provide additional insights on the controversial interplay between Nrf2 and AMPK. Keywords: Oxidative stress, Cigarette smoke, Metformin, Blood hemostasis, Blood brain barrier, Tight junctions, Nrf2, Glucose transporter

  15. SPBP is a sulforaphane induced transcriptional coactivator of NRF2 regulating expression of the autophagy receptor p62/SQSTM1.

    Directory of Open Access Journals (Sweden)

    Sagar Ramesh Darvekar

    Full Text Available Organisms exposed to oxidative stress respond by orchestrating a stress response to prevent further damage. Intracellular levels of antioxidant agents increase, and damaged components are removed by autophagy induction. The KEAP1-NRF2 signaling pathway is the main pathway responsible for cell defense against oxidative stress and for maintaining the cellular redox balance at physiological levels. Sulforaphane, an isothiocyanate derived from cruciferous vegetables, is a potent inducer of KEAP1-NRF2 signaling and antioxidant response element driven gene expression. In this study, we show that sulforaphane enhances the expression of the transcriptional coregulator SPBP. The expression curve peaks 6-8 hours post stimulation, and parallels the sulforaphane-induced expression of NRF2 and the autophagy receptor protein p62/SQSTM1. Reporter gene assays show that SPBP stimulates the expression of p62/SQSTM1 via ARE elements in the promoter region, and siRNA mediated knock down of SPBP significantly decreases the expression of p62/SQSTM1 and the formation of p62/SQSTM1 bodies in HeLa cells. Furthermore, SPBP siRNA reduces the sulforaphane induced expression of NRF2, and the expression of the autophagy marker protein LC3B. Both these proteins contain ARE-like elements in their promoter regions. Over-expressed SPBP and NRF2 acts synergistically on the p62/SQSTM1 promoter and colocalize in nuclear speckles in HeLa cells. Collectively, these results suggest that SPBP is a coactivator of NRF2, and hence may be important for securing enhanced and sustained expression of NRF2 induced genes such as proteins involved in selective autophagy.

  16. Antcin C from Antrodia cinnamomea Protects Liver Cells Against Free Radical-Induced Oxidative Stress and Apoptosis In Vitro and In Vivo through Nrf2-Dependent Mechanism

    Directory of Open Access Journals (Sweden)

    M. Gokila Vani

    2013-01-01

    Full Text Available In this study, we investigated the cytoprotective effects of antcin C, a steroid-like compound isolated from Antrodia cinnamaomea against AAPH-induced oxidative stress and apoptosis in human hepatic HepG2 cells. Pretreatment with antcin C significantly protects hepatic cells from AAPH-induced cell death through the inhibition of ROS generation. Furthermore, AAPH-induced lipid peroxidation, ALT/AST secretion and GSH depletion was significantly inhibited by antcin C. The antioxidant potential of antcin C was correlated with induction of antioxidant genes including, HO-1, NQO-1, γ-GCLC, and SOD via transcriptional activation of Nrf2. The Nrf2 activation by antcin C is mediated by JNK1/2 and PI3K activation, whereas pharmacologic inhibition of JNK1/2 and PI3K abolished antcin C-induced Nrf2 activity. In addition, AAPH-induced apoptosis was significantly inhibited by antcin C through the down-regulation of pro-apoptotic factors including, Bax, cytochrome c, capase 9, -4, -12, -3, and PARP. In vivo studies also show that antcin C significantly protected mice liver from AAPH-induced hepatic injury as evidenced by reduction in hepatic enzymes in circulation. Further, immunocytochemistry analyses showed that antcin C significantly increased HO-1 and Nrf2 expression in mice liver tissues. These results strongly suggest that antcin C could protect liver cells from oxidative stress and cell death via Nrf2/ARE activation.

  17. Activation of Nrf2 protects against triptolide-induced hepatotoxicity.

    Directory of Open Access Journals (Sweden)

    Jia Li

    Full Text Available Triptolide, the major active component of Tripterygium wilfordii Hook f. (TWHF, has a wide range of pharmacological activities. However, the toxicities of triptolide, particularly the hepatotoxicity, limit its clinical application. The hepatotoxicity of triptolide has not been well characterized yet. The aim of this study was to investigate the role of NF-E2-related factor 2 (Nrf2 in triptolide-induced toxicity and whether activation of Nrf2 could protect against triptolide-induced hepatotoxicity. The results showed that triptolide caused oxidative stress and cell damage in HepG2 cells, and these toxic effects could be aggravated by Nrf2 knockdown or be counteracted by overexpression of Nrf2. Treatment with a typical Nrf2 agonist, sulforaphane (SFN, attenuated triptolide-induced liver dysfunction, structural damage, glutathione depletion and decrease in antioxidant enzymes in BALB/C mice. Moreover, the hepatoprotective effect of SFN on triptolide-induced liver injury was associated with the activation of Nrf2 and its downstream targets. Collectively, these results indicate that Nrf2 activation protects against triptolide-induced hepatotoxicity.

  18. Cul3-mediated Nrf2 ubiquitination and antioxidant response element (ARE) activation are dependent on the partial molar volume at position 151 of Keap1.

    Science.gov (United States)

    Eggler, Aimee L; Small, Evan; Hannink, Mark; Mesecar, Andrew D

    2009-07-29

    Nrf2 (nuclear factor erythroid 2-related factor 2) is a transcription factor that activates transcription of a battery of cytoprotective genes by binding to the ARE (antioxidant response element). Nrf2 is repressed by the cysteine-rich Keap1 (kelch-like ECH-associated protein 1) protein, which targets Nrf2 for ubiquitination and subsequent degradation by a Cul3 (cullin 3)-mediated ubiquitination complex. We find that modification of Cys(151) of human Keap1, by mutation to a tryptophan, relieves the repression by Keap1 and allows activation of the ARE by Nrf2. The Keap1 C151W substitution has a decreased affinity for Cul3, and can no longer serve to target Nrf2 for ubiquitination, though it retains its affinity for Nrf2. A series of 12 mutant Keap1 proteins, each containing a different residue at position 151, was constructed to explore the chemistry required for this effect. The series reveals that the extent to which Keap1 loses the ability to target Nrf2 for degradation, and hence the ability to repress ARE activation, correlates well with the partial molar volume of the residue. Other physico-chemical properties do not appear to contribute significantly to the effect. Based on this finding, a structural model is proposed whereby large residues at position 151 cause steric clashes that lead to alteration of the Keap1-Cul3 interaction. This model has significant implications for how electrophiles which modify Cys(151), disrupt the repressive function of Keap1.

  19. Nrf2-inducing anti-oxidation stress response in the rat liver--new beneficial effect of lansoprazole.

    Science.gov (United States)

    Yamashita, Yasunobu; Ueyama, Takashi; Nishi, Toshio; Yamamoto, Yuta; Kawakoshi, Akatsuki; Sunami, Shogo; Iguchi, Mikitaka; Tamai, Hideyuki; Ueda, Kazuki; Ito, Takao; Tsuruo, Yoshihiro; Ichinose, Masao

    2014-01-01

    Lansoprazole is a potent anti-gastric ulcer drug that inhibits gastric proton pump activity. We identified a novel function for lansoprazole, as an inducer of anti-oxidative stress responses in the liver. Gastric administration of lansoprazole (10-100 mg/kg) to male Wistar rats produced a dose-dependent increase in hepatic mRNA levels of nuclear factor, erythroid-derived 2, -like 2 (Nrf2), a redox-sensitive transcription factor, at 3 h and Nrf2 immunoreactivity (IR) in whole hepatic lysates at 6 h. Conversely, the levels of Kelch-like ECH-associated protein (Keap1), which sequesters Nrf2 in the cytoplasm under un-stimulated conditions, were unchanged. Translocation of Nrf2 into the nuclei of hepatocytes was observed using western blotting and immunohistochemistry. Expression of mRNAs for Nrf2-dependent antioxidant and phase II enzymes, such as heme oxygenase 1 (HO-1), NAD (P) H dehydrogenase, quinone 1 (Nqo1), glutathione S-transferase A2 (Gsta2), UDP glucuronosyltransferase 1 family polypeptide A6 (Ugt1a6), were dose-dependently up-regulated at 3 h. Furthermore, the levels of HO-1 IR were dose-dependently increased in hepatocytes at 6 h. Subcutaneous administration of lansoprazole (30 mg/kg/day) for 7 successive days resulted in up-regulation and nuclear translocation of Nrf2 IR in hepatocytes and up-regulation of HO-1 IR in the liver. Pretreatment with lansoprazole attenuated thioacetamide (500 mg/kg)-induced acute hepatic damage via both HO-1-dependent and -independent pathways. Up-stream networks related to Nrf2 expression were investigated using microarray analysis, followed by data mining with Ingenuity Pathway Analysis. Up-regulation of the aryl hydrocarbon receptor (AhR)-cytochrome P450, family 1, subfamily a, polypeptide 1 (Cyp1a1) pathway was associated with up-regulation of Nrf2 mRNA. In conclusion, lansoprazole might have an alternative indication in the prevention and treatment of oxidative hepatic damage through the induction of both phase I and phase

  20. Nrf2-Inducing Anti-Oxidation Stress Response in the Rat Liver - New Beneficial Effect of Lansoprazole

    Science.gov (United States)

    Yamashita, Yasunobu; Ueyama, Takashi; Nishi, Toshio; Yamamoto, Yuta; Kawakoshi, Akatsuki; Sunami, Shogo; Iguchi, Mikitaka; Tamai, Hideyuki; Ueda, Kazuki; Ito, Takao; Tsuruo, Yoshihiro; Ichinose, Masao

    2014-01-01

    Lansoprazole is a potent anti-gastric ulcer drug that inhibits gastric proton pump activity. We identified a novel function for lansoprazole, as an inducer of anti-oxidative stress responses in the liver. Gastric administration of lansoprazole (10–100 mg/kg) to male Wistar rats produced a dose-dependent increase in hepatic mRNA levels of nuclear factor, erythroid-derived 2, -like 2 (Nrf2), a redox-sensitive transcription factor, at 3 h and Nrf2 immunoreactivity (IR) in whole hepatic lysates at 6 h. Conversely, the levels of Kelch-like ECH-associated protein (Keap1), which sequesters Nrf2 in the cytoplasm under un-stimulated conditions, were unchanged. Translocation of Nrf2 into the nuclei of hepatocytes was observed using western blotting and immunohistochemistry. Expression of mRNAs for Nrf2-dependent antioxidant and phase II enzymes, such as heme oxygenase 1 (HO-1), NAD (P) H dehydrogenase, quinone 1 (Nqo1), glutathione S-transferase A2 (Gsta2), UDP glucuronosyltransferase 1 family polypeptide A6 (Ugt1a6), were dose-dependently up-regulated at 3 h. Furthermore, the levels of HO-1 IR were dose-dependently increased in hepatocytes at 6 h. Subcutaneous administration of lansoprazole (30 mg/kg/day) for 7 successive days resulted in up-regulation and nuclear translocation of Nrf2 IR in hepatocytes and up-regulation of HO-1 IR in the liver. Pretreatment with lansoprazole attenuated thioacetamide (500 mg/kg)-induced acute hepatic damage via both HO-1-dependent and -independent pathways. Up-stream networks related to Nrf2 expression were investigated using microarray analysis, followed by data mining with Ingenuity Pathway Analysis. Up-regulation of the aryl hydrocarbon receptor (AhR)-cytochrome P450, family 1, subfamily a, polypeptide 1 (Cyp1a1) pathway was associated with up-regulation of Nrf2 mRNA. In conclusion, lansoprazole might have an alternative indication in the prevention and treatment of oxidative hepatic damage through the induction of both phase I and

  1. Anti-neuroinflammatory Activity of Elephantopus scaber L. via Activation of Nrf2/HO-1 Signaling and Inhibition of p38 MAPK Pathway in LPS-Induced Microglia BV-2 Cells

    Directory of Open Access Journals (Sweden)

    Chim-Kei Chan

    2017-06-01

    Full Text Available Elephantopus scaber L. (family: Asteraceae has been traditionally utilized as a folkloric medicine and scientifically shown to exhibit anti-inflammatory activities in various in vivo inflammatory models. Given the lack of study on the effect of E. scaber in neuroinflammation, this study aimed to investigate the anti-neuroinflammatory effect and the underlying mechanisms of ethyl acetate fraction from the leaves of E. scaber (ESEAF on the release of pro-inflammatory mediators in lipopolysaccharide (LPS-induced microglia cells (BV-2. Present findings showed that ESEAF markedly attenuated the translocation of NF-κB to nucleus concomitantly with the significant mitigation on the LPS-induced production of NO, iNOS, COX-2, PGE2, IL-1β, and TNF-α. These inflammatory responses were reduced via the inhibition of p38. Besides, ESEAF was shown to possess antioxidant activities evident by the DPPH and SOD scavenging activities. The intracellular catalase enzyme activity was enhanced by ESEAF in the LPS-stimulated BV-2 cells. Furthermore, the formation of ROS induced by LPS in BV-2 cells was reduced upon the exposure to ESEAF. Intriguingly, the reduction of ROS was found in concerted with the activation of Nrf2 and HO-1. It is conceivable that the activation promotes the scavenging power of antioxidant enzymes as well as to ameliorate the inflammatory response in LPS-stimulated BV-2 cells. Finally, the safety profile analysis through oral administration of ESEAF at 2000 mg/kg did not result in any mortalities, adverse effects nor histopathologic abnormalities of organs in mice. Taken altogether, the cumulative findings suggested that ESEAF holds the potential to develop as nutraceutical for the intervention of neuroinflammatory disorders.

  2. Sinomenine attenuates renal fibrosis through Nrf2-mediated inhibition of oxidative stress and TGFβ signaling

    Energy Technology Data Exchange (ETDEWEB)

    Qin, Tian [School of Life Science & Technology, China Pharmaceutical University, Nanjing 210009 (China); Yin, Shasha; Yang, Jun; Zhang, Qin; Liu, Yangyang [Jiangsu Key Laboratory of Molecular Medicine, Nanjing University School of Medicine, Nanjing 210093 (China); Huang, Fengjie, E-mail: hfj@cpu.edu.cn [School of Life Science & Technology, China Pharmaceutical University, Nanjing 210009 (China); Cao, Wangsen, E-mail: wangsencao@nju.edu.cn [Jiangsu Key Laboratory of Molecular Medicine, Nanjing University School of Medicine, Nanjing 210093 (China)

    2016-08-01

    signaling of TGBβ/Smad and Wnt/β-catenin. • Sinomenine exerts anti-renal fibrotic functions mainly via activating Nrf2 pathways.

  3. The PTEN/NRF2 Axis Promotes Human Carcinogenesis

    DEFF Research Database (Denmark)

    Rojo, Ana I; Rada, Patricia; Mendiola, Marta

    2014-01-01

    and tumorigenic advantage. Tissue microarrays from endometrioid carcinomas showed that 80% of PTEN-negative tumors expressed high levels of NRF2 or its target heme oxygenase-1 (HO-1). INNOVATION: These results uncover a new mechanism of oncogenic activation of NRF2 by loss of its negative regulation by PTEN/GSK-3....../β-TrCP that may be relevant to a large number of tumors, including endometrioid carcinomas. CONCLUSION: Increased activity of NRF2 due to loss of PTEN is instrumental in human carcinogenesis and represents a novel therapeutic target. Antioxid. Redox Signal. 21, 2498-2514....

  4. Fisetin Protects PC12 Cells from Tunicamycin-Mediated Cell Death via Reactive Oxygen Species Scavenging and Modulation of Nrf2-Driven Gene Expression, SIRT1 and MAPK Signaling in PC12 Cells.

    Science.gov (United States)

    Yen, Jui-Hung; Wu, Pei-Shan; Chen, Shu-Fen; Wu, Ming-Jiuan

    2017-04-17

    Fisetin (3,7,3',4'-tetrahydroxyflavone) is a dietary flavonol and exhibits antioxidant, anti-inflammatory, and neuroprotective activities. However, high concentration of fisetin is reported to produce reactive oxygen species (ROS), induce endoplasmic reticulum (ER) stress and cause cytotoxicity in cancer cells. The aim of this study is to investigate the cytoprotective effects of low concentration of fisetin against tunicamycin (Tm)-mediated cytotoxicity in neuronal-like catecholaminergic PC12 cells. Cell viability was assayed by MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) and apoptotic and autophagic markers were analyzed by Western blot. Gene expression of unfolded protein response (UPR) and Phase II enzymes was further investigated using RT-Q-PCR or Western blotting. Intracellular ROS level was measured using 2',7'-dichlorodihydrofluorescein diacetate (H₂DCFDA) by a fluorometer. The effects of fisetin on mitogen activated protein kinases (MAPKs) and SIRT1 (Sirtuin 1) signaling pathways were examined using Western blotting and specific inhibitors. Fisetin (<20 µM) restored cell viability and repressed apoptosis, autophagy and ROS production in Tm-treated cells. Fisetin attenuated Tm-mediated expression of ER stress genes, such as glucose-regulated proteins 78 (GRP78), C/EBP homologous protein (CHOP also known as GADD153) and Tribbles homolog 3 (TRB3), but induced the expression of nuclear E2 related factor (Nrf)2-targeted heme oxygenase (HO)-1, glutamate cysteine ligase (GCL) and cystine/glutamate transporter (xCT/SLC7A11), in both the presence and absence of Tm. Moreover, fisetin enhanced phosphorylation of ERK (extracellular signal-regulated kinase), JNK (c-JUN NH₂-terminal protein kinase), and p38 MAPK. Addition of JNK and p38 MAPK inhibitor significantly antagonized its cytoprotective activity and modulatory effects on UPR. Fisetin also restored Tm-inhibited SIRT1 expression and addition of sirtinol (SIRT1 activation inhibitor

  5. Nrf2 and Redox Status in Prediabetic and Diabetic Patients

    Directory of Open Access Journals (Sweden)

    Angélica S. Jiménez-Osorio

    2014-11-01

    Full Text Available The redox status associated with nuclear factor erythroid 2-related factor-2 (Nrf2 was evaluated in prediabetic and diabetic subjects. Total antioxidant status (TAS in plasma and erythrocytes, glutathione (GSH and malondialdehyde (MDA content and activity of antioxidant enzymes were measured as redox status markers in 259 controls, 111 prediabetics and 186 diabetic type 2 subjects. Nrf2 was measured in nuclear extract fractions from peripheral blood mononuclear cells (PBMC. Nrf2 levels were lower in prediabetic and diabetic patients. TAS, GSH and activity of glutamate cysteine ligase were lower in diabetic subjects. An increase of MDA and superoxide dismutase activity was found in diabetic subjects. These results suggest that low levels of Nrf2 are involved in the development of oxidative stress and redox status disbalance in diabetic patients.

  6. Cytoprotective effect of kaempferol against palmitic acid-induced pancreatic β-cell death through modulation of autophagy via AMPK/mTOR signaling pathway.

    Science.gov (United States)

    Varshney, Ritu; Gupta, Sumeet; Roy, Partha

    2017-06-15

    Lipotoxicity of pancreatic β-cells is the pathological manifestation of obesity-linked type II diabetes. We intended to determine the cytoprotective effect of kaempferol on pancreatic β-cells undergoing apoptosis in palmitic acid (PA)-stressed condition. The data showed that kaempferol treatment increased cell viability and anti-apoptotic activity in PA-stressed RIN-5F cells and murine pancreatic islets. Furthermore, kaempferol's ability to instigate autophagy was illustrated by MDC-LysoTracker red staining and TEM analysis which corroborated well with the observed increase in LC3 puncta and LC3-II protein expressions along with the concomitant decline in p62 expression. Apart from this, the data showed that kaempferol up/down-regulates AMPK/mTOR phosphorylation respectively. Subsequently, upon inhibition of AMPK phosphorylation by AMPK inhibitors, kaempferol-mediated autophagy was abolished which further led to the decline in β-cell survival. Such observations collectively lead to the conclusion that, kaempferol exerts its cytoprotective role against lipotoxicity by activation of autophagy via AMPK/mTOR pathway. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Skin Redox Balance Maintenance: The Need for an Nrf2-Activator Delivery System

    Directory of Open Access Journals (Sweden)

    Maya Ben-Yehuda Greenwald

    2016-01-01

    Full Text Available The skin, being the largest organ of the body, functions as a barrier between our body and the environment. It is consistently exposed to various exogenous and endogenous stressors (e.g., air pollutants, ionizing and non-ionizing irradiation, toxins, mitochondrial metabolism, enzyme activity, inflammatory process, etc. producing reactive oxygen species (ROS and physical damage (e.g., wounds, sunburns also resulting in reactive oxygen species production. Although skin is equipped with an array of defense mechanisms to counteract reactive oxygen species, augmented exposure and continued reactive oxygen species might result in excessive oxidative stress leading to many skin disorders including inflammatory diseases, pigmenting disorders and some types of cutaneous malignancy. The nuclear factor erythroid 2-related factor 2 (Nrf2 is an emerging regulator of cellular resistance and of defensive enzymes such as the phase II enzymes. Induction of the Keap1–Nrf2 pathway may have a beneficial effect in the treatment of a large number of skin disorders by stimulating an endogenous defense mechanism. However, prolonged and enhanced activation of this pathway is detrimental and, thus, limits the therapeutic potential of Keap1–Nrf2 modulators. Here, we review the consequences of oxidative stress to the skin, and the defense mechanisms that skin is equipped with. We describe the challenges of maintaining skin redox balance and its impact on skin status and function. Finally, we suggest a novel strategy for maintenance of skin redox homeostasis by modulating the Keap1–Nrf2 pathway using nanotechnology-based delivery systems.

  8. Sulforaphane Inhibits Lipopolysaccharide-Induced Inflammation, Cytotoxicity, Oxidative Stress, and miR-155 Expression and Switches to Mox Phenotype through Activating Extracellular Signal-Regulated Kinase 1/2-Nuclear Factor Erythroid 2-Related Factor 2/Antioxidant Response Element Pathway in Murine Microglial Cells.

    Science.gov (United States)

    Eren, Erden; Tufekci, Kemal Ugur; Isci, Kamer Burak; Tastan, Bora; Genc, Kursad; Genc, Sermin

    2018-01-01

    Sulforaphane (SFN) is a natural product with cytoprotective, anti-inflammatory, and antioxidant effects. In this study, we evaluated the mechanisms of its effects on lipopolysaccharide (LPS)-induced cell death, inflammation, oxidative stress, and polarization in murine microglia. We found that SFN protects N9 microglial cells upon LPS-induced cell death and suppresses LPS-induced levels of secreted pro-inflammatory cytokines, tumor necrosis factor-alpha, interleukin-1 beta, and interleukin-6. SFN is also a potent inducer of redox sensitive transcription factor, nuclear factor erythroid 2-related factor 2 (Nrf2), which is responsible for the transcription of antioxidant, cytoprotective, and anti-inflammatory genes. SFN induced translocation of Nrf2 to the nucleus via extracellular signal-regulated kinase 1/2 (ERK1/2) pathway activation. siRNA-mediated knockdown study showed that the effects of SFN on LPS-induced reactive oxygen species, reactive nitrogen species, and pro-inflammatory cytokine production and cell death are partly Nrf2 dependent. Mox phenotype is a novel microglial phenotype that has roles in oxidative stress responses. Our results suggested that SFN induced the Mox phenotype in murine microglia through Nrf2 pathway. SFN also alleviated LPS-induced expression of inflammatory microRNA, miR-155. Finally, SFN inhibits microglia-mediated neurotoxicity as demonstrated by conditioned medium and co-culture experiments. In conclusion, SFN exerts protective effects on microglia and modulates the microglial activation state.

  9. A Polymorphic Antioxidant Response Element Links NRF2/sMAF Binding to Enhanced MAPT Expression and Reduced Risk of Parkinsonian Disorders

    Directory of Open Access Journals (Sweden)

    Xuting Wang

    2016-04-01

    Full Text Available The NRF2/sMAF protein complex regulates the oxidative stress response by occupying cis-acting enhancers containing an antioxidant response element (ARE. Integrating genome-wide maps of NRF2/sMAF occupancy with disease-susceptibility loci, we discovered eight polymorphic AREs linked to 14 highly ranked disease-risk SNPs in individuals of European ancestry. Among these SNPs was rs242561, located within a regulatory region of the MAPT gene (encoding microtubule-associated protein Tau. It was consistently occupied by NRF2/sMAF in multiple experiments and its strong-binding allele associated with higher mRNA levels in cell lines and human brain tissue. Induction of MAPT transcription by NRF2 was confirmed using a human neuroblastoma cell line and a Nrf2-deficient mouse model. Most importantly, rs242561 displayed complete linkage disequilibrium with a highly protective allele identified in multiple GWASs of progressive supranuclear palsy, Parkinson’s disease, and corticobasal degeneration. These observations suggest a potential role for NRF2/sMAF in tauopathies and a possible role for NRF2 pathway activators in disease prevention.

  10. Rosemary Extracts Upregulate Nrf2, Sestrin2, and MRP2 Protein Level in Human Hepatoma HepG2 Cells

    Directory of Open Access Journals (Sweden)

    Xiao-pei Tong

    2017-01-01

    Full Text Available In the past few decades, the incidence of liver cancer has been rapidly rising across the world. Rosemary is known to possess antioxidant activity and is used as natural antioxidant food preservative. It is proposed to have anticancer activity in treating different tumor models. In this study, we try to explore the impact of rosemary extracts on upregulating the level of Nrf2 and Nrf2-regulatory proteins, Sestrin2 and MRP2 in HepG2 cells, and to speculate its potential mechanism. The anticancer activity of rosemary extract, including its polyphenolic diterpenes carnosic acid and carnosol, was evaluated to understand the potential effect on HepG2 cells. Rosemary extract, carnosic acid, and carnosol induced the expression of Sestrin2 and MRP2 associate with enhancement of Nrf2 protein level in HepG2 cells, in which carnosic acid showed most obvious effect. Although the activation pathway of Nrf2/ARE was not exactly assessed, it can be assumed that the enhancement of expression of Sestrin2 and MRP2 may result from upregulation of Nrf2.

  11. Docosahexaenoic Acid (DHA) Provides Neuroprotection in Traumatic Brain Injury Models via Activating Nrf2-ARE Signaling.

    Science.gov (United States)

    Zhu, Wei; Ding, Yuexia; Kong, Wei; Li, Tuo; Chen, Hongguang

    2018-04-16

    In this study, we explored the neuroprotective effects of docosahexaenoic acid (DHA) in traumatic brain injury (TBI) models. In this study, we first confirmed that DHA was neuroprotective against TBI via the NSS test and Morris water maze experiment. Western blot was conducted to identify the expression of Bax, caspase-3, and Bcl-2. And the cell apoptosis of the TBI models was validated by TUNEL staining. Relationships between nuclear factor erythroid 2-related factor 2-antioxidant response element (Nrf2-ARE) pathway-related genes and DHA were explored by RT-PCR and Western blot. Rats of the DHA group performed remarkably better than those of the TBI group in both NSS test and water maze experiment. DHA conspicuously promoted the expression of Bcl-2 and diminished that of cleaved caspase-3 and Bax, indicating the anti-apoptotic role of DHA. Superoxide dismutase (SOD) activity and cortical malondialdehyde content, glutathione peroxidase (GPx) activity were renovated in rats receiving DHA treatment, implying that the neuroprotective influence of DHA was derived from lightening the oxidative stress caused by TBI. Moreover, immunofluorescence and Western blot experiments revealed that DHA facilitated the translocation of Nrf2 to the nucleus. DHA administration also notably increased the expression of the downstream factors NAD(P)H:quinone oxidoreductase (NQO-1) and heme oxygenase 1(HO-1). DHA exerted neuroprotective influence on the TBI models, potentially through activating the Nrf2- ARE pathway.

  12. Increased Alzheimer's disease-like pathology in the APP/ PS1ΔE9 mouse model lacking Nrf2 through modulation of autophagy.

    Science.gov (United States)

    Joshi, Gururaj; Gan, Kok Ann; Johnson, Delinda A; Johnson, Jeffrey A

    2015-02-01

    The presence of senile plaques is one of the major pathologic hallmarks of the brain with Alzheimer's disease (AD). The plaques predominantly contain insoluble amyloid β-peptide, a cleavage product of the larger amyloid precursor protein (APP). Two enzymes, named β and γ secretase, generate the neurotoxic amyloid-β peptide from APP. Mature APP is also turned over endogenously by autophagy, more specifically by the endosomal-lysosomal pathway. A defective lysosomal system is known to be pathogenic in AD. Modulation of NF-E2 related factor 2 (Nrf2) has been shown in several neurodegenerative disorders, and Nrf2 has become a potential therapeutic target for various neurodegenerative disorders, including AD, Parkinson's disease, and amyotrophic lateral sclerosis. In the current study, we explored the effect of genetic ablation of Nrf2 on APP/Aβ processing and/or aggregation as well as changes in autophagic dysfunction in APP/PS1 mice. There was a significant increase in inflammatory response in APP/PS1 mice lacking Nrf2. This was accompanied by increased intracellular levels of APP, Aβ (1-42), and Aβ (1-40), without a change total full-length APP. There was a shift of APP and Aβ into the insoluble fraction, as well as increased poly-ubiquitin conjugated proteins in mice lacking Nrf2. APP/PS1-mediated autophagic dysfunction is also enhanced in Nrf2-deficient mice. Finally, neurons in the APP/PS1/Nrf2-/- mice had increased accumulation of multivesicular bodies, endosomes, and lysosomes. These outcomes provide a better understanding of the role of Nrf2 in modulating autophagy in an AD mouse model and may help design better Nrf2 targeted therapeutics that could be efficacious in the treatment of AD. Published by Elsevier Inc.

  13. Ebselen attenuates cisplatin-induced ROS generation through Nrf2 activation in auditory cells.

    Science.gov (United States)

    Kim, Se-Jin; Park, Channy; Han, A Lum; Youn, Myung-Ja; Lee, Jeong-Han; Kim, Yunha; Kim, Eun-Sook; Kim, Hyung-Jin; Kim, Jin-Kyung; Lee, Ho-Kyun; Chung, Sang-Young; So, Hongseob; Park, Raekil

    2009-05-01

    Ebselen, an organoselenium compound that acts as a glutathione peroxidase mimetic, has been demonstrated to possess antioxidant and anti-inflammatory activities. However, the molecular mechanism underlying this effect is not fully understood in auditory cells. The purpose of the present study is to investigate the protective effect of ebselen against cisplatin-induced toxicity in HEI-OC1 auditory cells, organotypic cultures of cochlear explants from two-day postnatal rats (P(2)) and adult Balb/C mice. Pretreatment with ebselen ameliorated apoptotic death induced by cisplatin in HEI-OC1 cells and organotypic cultures of Corti's organ. Ebselen pretreatment also significantly suppressed cisplatin-induced increases in intracellular reactive oxygen species (ROS), intracellular reactive nitrogen species (RNS) and lipid peroxidation levels. Ebselen dose-dependently increased the expression level of an antioxidant response element (ARE)-luciferase reporter in HEI-OC1 cells through the translocation of Nrf2 into the nucleus. Furthermore, we found that pretreatment with ebselen significantly restored Nrf2 function, whereas it ameliorated the cytotoxicity of cisplatin in cells transfectants with either a pcDNA3.1 (control) or a DN-Nrf2 (dominant-negative) plasmid. We also observed that Nrf2 activation by ebselen increased the expression of phase II antioxidant genes, including heme oxygenase (HO-1), NAD(P)H:quinine oxidoreductase, and gamma-glutamylcysteine synthetase (gamma-GCS). Treatment with ebselen resulted in an increased expression of HO-1 and intranuclear Nrf2 in hair cells of organotypic cultured cochlea. After intraperitoneal injection with cisplatin, auditory brainstem responses (ABRs) threshold was measured on 8th day in Balb/C mice. ABR threshold shift was marked occurred in mice injected with cisplatin (16 mg/kg, n=5; Click and 8-kHz stimuli, pebselen was not significantly changed. These results suggest that ebselen activates the Nrf2-ARE signaling pathway

  14. Regulation of hemeoxygenase-1 gene expression by Nrf2 and c-Jun in tertiary butylhydroquinone-stimulated rat primary astrocytes

    International Nuclear Information System (INIS)

    Park, Jin-Sun; Kim, Hee-Sun

    2014-01-01

    Highlights: • tBHQ increased HO-1 mRNA and protein levels in rat primary astrocytes. • tBHQ enhanced HO-1 gene transcription in an ARE-dependent manner. • tBHQ increased the nuclear translocation and DNA binding of Nrf2 and c-Jun to ARE. • Nrf2 and c-Jun are involved in the differential modulation of HO-1 expression. • Nrf2 and c-Jun regulate HO-1 expression via their coordinated interaction. - Abstract: Hemeoxygenase-1 (HO-1) is a phase II antioxidant enzyme that is primarily involved in detoxification and cytoprotection in a variety of tissues. However, the mechanism underlying HO-1 gene expression remains unclear. In the present study, we investigated the regulation of HO-1 expression in primary cultured astrocytes by using the natural antioxidant compound tertiary butylhydroquinone (tBHQ). We found that tBHQ increased HO-1 mRNA and protein levels. Promoter analysis revealed that tBHQ enhanced HO-1 gene transcription in an antioxidant response element (ARE)-dependent manner. In addition, tBHQ increased the nuclear translocation and DNA binding of Nrf2 and c-Jun to ARE. Small interfering RNA (siRNA) experiments demonstrated that Nrf2 and c-Jun are involved in the differential modulation of HO-1 expression. Thus, Nrf2 knockdown reduced the basal level of HO-1 expression but did not affect the fold induction by tBHQ. On the other hand, knockdown of c-Jun diminished tBHQ-mediated induction of HO-1 without affecting basal expression. The data suggest that Nrf2 generally modulates the basal expression of HO-1, while c-Jun mediates HO-1 induction in response to tBHQ. The results of co-immunoprecipitation assays demonstrated a physical interaction between Nrf2 and c-Jun in tBHQ-treated astrocytes. The results suggest that Nrf2 and c-Jun regulate HO-1 expression via their coordinated interaction in tBHQ-treated rat primary astrocytes

  15. Mangiferin Upregulates Glyoxalase 1 Through Activation of Nrf2/ARE Signaling in Central Neurons Cultured with High Glucose.

    Science.gov (United States)

    Liu, Yao-Wu; Cheng, Ya-Qin; Liu, Xiao-Li; Hao, Yun-Chao; Li, Yu; Zhu, Xia; Zhang, Fan; Yin, Xiao-Xing

    2017-08-01

    Mangiferin, a natural C-glucoside xanthone, has anti-inflammatory, anti-oxidative, neuroprotective actions. Our previous study showed that mangiferin could attenuate diabetes-associated cognitive impairment of rats by enhancing the function of glyoxalase 1 (Glo-1) in brain. The aim of this study was to investigate whether Glo-1 upregulation by mangiferin in central neurons exposed to chronic high glucose may be related to activation of Nrf2/ARE pathway. Compared with normal glucose (25 mmol/L) culture, Glo-1 protein, mRNA, and activity levels were markedly decreased in primary hippocampal and cerebral cortical neurons cultured with high glucose (50 mmol/L) for 72 h, accompanied by the declined Nrf2 nuclear translocation and protein expression of Nrf2 in cell nucleus, as well as protein expression and mRNA level of γ-glutamylcysteine synthetase (γ-GCS) and superoxide dismutase activity, target genes of Nrf2/ARE signaling. Nonetheless, high glucose cotreating with mangiferin or sulforaphane, a typical inducer of Nrf2 activation, attenuated the above changes in both central neurons. In addition, mangiferin and sulforaphane significantly prevented the formation of advanced glycation end-products (AGEs) reflecting Glo-1 activity, while elevated the level of glutathione, a cofactor of Glo-1 activity and production of γ-GCS, in high glucose cultured central neurons. These findings demonstrated that Glo-1 was greatly downregulated in central neurons exposed to chronic high glucose, which is expected to lead the formation of AGEs and oxidative stress damages. We also proved that mangiferin enhanced the function of Glo-1 under high glucose condition by inducing activation of Nrf2/ARE signaling pathway.

  16. Neutrophils in oral paracoccidioidomycosis and the involvement of Nrf2.

    Directory of Open Access Journals (Sweden)

    Vera Cavalcanti Araújo

    Full Text Available Neutrophils have been implicated in granuloma formation in several infectious diseases, in addition to their main phagocytic and pathogen destruction role. It has been demonstrated that Nrf2 regulates antioxidant protection in neutrophils, attenuating inflammation without compromising the hosts bacterial defense. In this study, we analyzed the presence of neutrophils in Paracoccidioides brasiliensis mycosis (PCM, as well as the immunoexpression of Nrf2. Thirty-nine cases of oral PCM were classified according to quantity of fungi and to the presence of loose or well-organized granulomas and microabscesses. An Nrf2 antibody was used for immunohistochemical analysis. The results showed that neutrophils are present in microabscesses and loose granulomas, but were absent in structured granulomas. A greater quantity of fungi was shown in cases with only loose granulomas when compared to loose and well organized granulomas. Nrf2 was observed in the nuclei of neutrophils of loose granulomas and abscesses, with its expression in loose granulomas maintained despite the additional presence of well organized granulomas in the same specimen. This study suggests that neutrophils participate in P. brasiliensis granuloma formation and that Nrf2 has a possible role in neutrophil survival, via modulation of the inflammatory response.

  17. Flavonoids as Putative Inducers of the Transcription Factors Nrf2, FoxO, and PPARγ.

    Science.gov (United States)

    Pallauf, Kathrin; Duckstein, Nils; Hasler, Mario; Klotz, Lars-Oliver; Rimbach, Gerald

    2017-01-01

    Dietary flavonoids have been shown to extend the lifespan of some model organisms and may delay the onset of chronic ageing-related diseases. Mechanistically, the effects could be explained by the compounds scavenging free radicals or modulating signalling pathways. Transcription factors Nrf2, FoxO, and PPAR γ possibly affect ageing by regulating stress response, adipogenesis, and insulin sensitivity. Using Hek-293 cells transfected with luciferase reporter constructs, we tested the potency of flavonoids from different subclasses (flavonols, flavones, flavanols, and isoflavones) to activate these transcription factors. Under cell-free conditions (ABTS and FRAP assays), we tested their free radical scavenging activities and used α -tocopherol and ascorbic acid as positive controls. Most of the tested flavonoids, but not the antioxidant vitamins, stimulated Nrf2-, FoxO-, and PPAR γ -dependent promoter activities. Flavonoids activating Nrf2 also tended to induce a FoxO and PPAR γ response. Interestingly, activation patterns of cellular stress response by flavonoids were not mirrored by their activities in ABTS and FRAP assays, which depended mostly on hydroxylation in the flavonoid B ring and, in some cases, extended that of the vitamins. In conclusion, the free radical scavenging properties of flavonoids do not predict whether these molecules can stimulate a cellular response linked to activation of longevity-associated transcription factors.

  18. NRF2 Orchestrates the Metabolic Shift during Induced Pluripotent Stem Cell Reprogramming

    Directory of Open Access Journals (Sweden)

    Kate E. Hawkins

    2016-03-01

    Full Text Available The potential of induced pluripotent stem cells (iPSCs in disease modeling and regenerative medicine is vast, but current methodologies remain inefficient. Understanding the cellular mechanisms underlying iPSC reprogramming, such as the metabolic shift from oxidative to glycolytic energy production, is key to improving its efficiency. We have developed a lentiviral reporter system to assay longitudinal changes in cell signaling and transcription factor activity in living cells throughout iPSC reprogramming of human dermal fibroblasts. We reveal early NF-κB, AP-1, and NRF2 transcription factor activation prior to a temporal peak in hypoxia inducible factor α (HIFα activity. Mechanistically, we show that an early burst in oxidative phosphorylation and elevated reactive oxygen species generation mediates increased NRF2 activity, which in turn initiates the HIFα-mediated glycolytic shift and may modulate glucose redistribution to the pentose phosphate pathway. Critically, inhibition of NRF2 by KEAP1 overexpression compromises metabolic reprogramming and results in reduced efficiency of iPSC colony formation.

  19. Flavonoids as Putative Inducers of the Transcription Factors Nrf2, FoxO, and PPARγ

    Directory of Open Access Journals (Sweden)

    Kathrin Pallauf

    2017-01-01

    Full Text Available Dietary flavonoids have been shown to extend the lifespan of some model organisms and may delay the onset of chronic ageing-related diseases. Mechanistically, the effects could be explained by the compounds scavenging free radicals or modulating signalling pathways. Transcription factors Nrf2, FoxO, and PPARγ possibly affect ageing by regulating stress response, adipogenesis, and insulin sensitivity. Using Hek-293 cells transfected with luciferase reporter constructs, we tested the potency of flavonoids from different subclasses (flavonols, flavones, flavanols, and isoflavones to activate these transcription factors. Under cell-free conditions (ABTS and FRAP assays, we tested their free radical scavenging activities and used α-tocopherol and ascorbic acid as positive controls. Most of the tested flavonoids, but not the antioxidant vitamins, stimulated Nrf2-, FoxO-, and PPARγ-dependent promoter activities. Flavonoids activating Nrf2 also tended to induce a FoxO and PPARγ response. Interestingly, activation patterns of cellular stress response by flavonoids were not mirrored by their activities in ABTS and FRAP assays, which depended mostly on hydroxylation in the flavonoid B ring and, in some cases, extended that of the vitamins. In conclusion, the free radical scavenging properties of flavonoids do not predict whether these molecules can stimulate a cellular response linked to activation of longevity-associated transcription factors.

  20. The effect of Mastin® on expression of Nrf2 in the rat heart with subtotally nephrectomy chronic Kidney disease model

    Science.gov (United States)

    Nathania, J.; Soetikno, V.

    2017-08-01

    Chronic kidney disease (CKD) is increasingly prevalent in Indonesia and worldwide. One of the major causes of morbidity and mortality in CKD is the complication of cardiovascular disease. Mastin® is a supplement that is locally produced in Indonesia and is made from extract of mangosteen pericarp, which is reported to have antioxidative, anti-inflammatory, and antitumor properties. The present study aimed to investigate whether Mastin® could improve antioxidant responses in the rat heart during CKD by measuring the expression of nuclear factor erythroid-2-related factor (Nrf)2, a master regulator of antioxidant response elements. RNA was extracted from the heart tissue of three groups of rats: a normal group, a nephrectomy group, and a nephrectomy with Mastin® group. Two-step real-time RT-PCR was then conducted to calculate the relative expression of the Nrf2 gene. Nrf2 expression was markedly decreased in the nephrectomy group vs the normal group, but slightly increas ed in the nephrectomy with Mastin® group vs the nephrectomy group. CKD resulted in impaired activation of the Nrf2 pathway in the rat heart. Although the administration of Mastin® slightly increased Nrf2 expression, it was not enough to confer cardioprotective effects through the Nrf2 pathway.

  1. PF-4708671, a specific inhibitor of p70 ribosomal S6 kinase 1, activates Nrf2 by promoting p62-dependent autophagic degradation of Keap1

    Energy Technology Data Exchange (ETDEWEB)

    Park, Jeong Su [Severance Biomedical Science Institute (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Kang, Dong Hoon [Department of Life Science and Ewha Research Center for Systems Biology (Korea, Republic of); The Research Center for Cell Homeostasis, Ewha Womans University, Seoul 127-750 (Korea, Republic of); Lee, Da Hyun [Severance Biomedical Science Institute (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Bae, Soo Han, E-mail: soohanbae@yuhs.ac [Severance Biomedical Science Institute (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of)

    2015-10-23

    p70 ribosomal S6 kinase 1 (S6K1) is an important serine/threonine kinase and downstream target of the mechanistic target of rapamycin complex 1 (mTORC1) signaling pathway. PF-4708671 is a specific inhibitor of S6K1, and prevents S6K1-mediated phosphorylation of the S6 protein. PF-4708671 treatment often leads to apoptotic cell death. However, the protective mechanism against PF-4708671-induced cell death has not been elucidated. The nuclear factor erythroid 2-related factor 2 (Nrf2)-Kelch-like ECH-associated protein 1 (Keap1) pathway is essential for protecting cells against oxidative stress. p62, an adaptor protein in the autophagic process, enhances Nrf2 activation through the impairment of Keap1 activity. In this study, we showed that PF-4708671 induces autophagic Keap1 degradation-mediated Nrf2 activation in p62-dependent manner. Furthermore, p62-dependent Nrf2 activation plays a crucial role in protecting cells from PF-4708671-mediated apoptosis. - Highlights: • PF-4708671, a S6K1-specific inhibitor, prevents S6K1-mediated S6 phosphorylation. • However, PF-4708671 treatment often leads to apoptotic cell death. • Protective mechanism against PF-4708671-induced cell death remains to be elucidated. • PF-4708671 induced p62-dependent, autophagic Keap1 degradation-mediated Nrf2 activation. • p62-dependent Nrf2 activation protects cells from PF-4708671-mediated apoptosis.

  2. Selenium antagonizes cadmium-induced apoptosis in chicken spleen but not involving Nrf2-regulated antioxidant response.

    Science.gov (United States)

    Chen, Menghao; Li, Xiaojing; Fan, Ruifeng; Cao, Changyu; Yao, Haidong; Xu, Shiwen

    2017-11-01

    The nuclear transcription factor NF-E2-related factor 2 (Nrf2) binds to antioxidant response elements (AREs) and is involved in the regulation of genes participated in defending cells against oxidative damage, which have been confirmed in animal models. Selenium (Se), known as an important element in the regulation of antioxidant activity, can antagonize Cadmium (Cd) toxicity in birds. However, the role of Nrf2 in selenium-cadmium interaction has not been reported in birds. To further explore the mechanism of selenium attenuating spleen toxicity induced by cadmium in chickens, cadmium chloride (CdCl 2 , 150mg/kg) and sodium selenite (Na 2 SeO 3 , 2mg/kg) were co-administrated or individually administered in the diet of chickens for 90 days. The results showed that Cd exposure increased the level of hydrogen peroxide (H 2 O 2 ) and malondialdehyde (MDA) and decreased the antioxidant enzyme activities, including superoxide dismutase (SOD), glutathione peroxidase (Gpx), total antioxidative capacity (T-AOC), catalase (CAT). Cd exposure increased obviously nuclear accumulation of Nrf2, and the expression of Nrf2 downstream heme oxygenase-1 (HO-1) and NAD(P)H: quinine oxidoreductase 1 (NQO1), reduced the expression of Kelch-like ECH-associated protein (keap1), Gpx-1 and thioredoxin reductase-1 (TrxR1). In addition, Cd induced the increase of bak, caspase9, p53, Cyt c mRNA levels, increased bax/bcl-2 ratio, increased caspase3 mRNA and protein levels. Selenium treatment reduced the accumulation of Cd in the spleen, attenuates Cd-induced Nrf2 nuclear accumulation, enhanced antioxidant enzyme activities, ameliorated Cd-induced oxidative stress and apoptosis in the spleen. In summary, our results demonstrate that Se ameliorated spleen toxicity induced by cadmium by modulating the antioxidant system, independently of Nrf2-regulated antioxidant response pathway. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. UVA Irradiation Enhances Brusatol-Mediated Inhibition of Melanoma Growth by Downregulation of the Nrf2-Mediated Antioxidant Response

    Science.gov (United States)

    Wang, Mei; Shi, Guangwei; Bian, Chunxiang; Nisar, Muhammad Farrukh; Guo, Yingying; Wu, Yan; Li, Wei; Huang, Xiao; Jiang, Xuemei; Bartsch, Jörg W.

    2018-01-01

    Brusatol (BR) is a potent inhibitor of Nrf2, a transcription factor that is highly expressed in cancer tissues and confers chemoresistance. UVA-generated reactive oxygen species (ROS) can damage both normal and cancer cells and may be of potential use in phototherapy. In order to provide an alternative method to treat the aggressive melanoma, we sought to investigate whether low-dose UVA with BR is more effective in eliminating melanoma cells than the respective single treatments. We found that BR combined with UVA led to inhibition of A375 melanoma cell proliferation by cell cycle arrest in the G1 phase and triggers cell apoptosis. Furthermore, inhibition of Nrf2 expression attenuated colony formation and tumor development from A375 cells in heterotopic mouse models. In addition, cotreatment of UVA and BR partially suppressed Nrf2 and its downstream target genes such as HO-1 along with the PI3K/AKT pathway. We propose that cotreatment increased ROS-induced cell cycle arrest and cellular apoptosis and inhibits melanoma growth by regulating the AKT-Nrf2 pathway in A375 cells which offers a possible therapeutic intervention strategy for the treatment of human melanoma. PMID:29670684

  4. Targeted deletion of Nrf2 reduces urethane-induced lung tumor development in mice.

    Directory of Open Access Journals (Sweden)

    Alison K Bauer

    Full Text Available Nrf2 is a key transcription factor that regulates cellular redox and defense responses. However, permanent Nrf2 activation in human lung carcinomas promotes pulmonary malignancy and chemoresistance. We tested the hypothesis that Nrf2 has cell survival properties and lack of Nrf2 suppresses chemically-induced pulmonary neoplasia by treating Nrf2(+/+ and Nrf2(-/- mice with urethane. Airway inflammation and injury were assessed by bronchoalveolar lavage analyses and histopathology, and lung tumors were analyzed by gross and histologic analysis. We used transcriptomics to assess Nrf2-dependent changes in pulmonary gene transcripts at multiple stages of neoplasia. Lung hyperpermeability, cell death and apoptosis, and inflammatory cell infiltration were significantly higher in Nrf2(-/- mice compared to Nrf2(+/+ mice 9 and 11 wk after urethane. Significantly fewer lung adenomas were found in Nrf2(-/- mice than in Nrf2(+/+ mice at 12 and 22 wk. Nrf2 modulated expression of genes involved cell-cell signaling, glutathione metabolism and oxidative stress response, and immune responses during early stage neoplasia. In lung tumors, Nrf2-altered genes had roles in transcriptional regulation of cell cycle and proliferation, carcinogenesis, organismal injury and abnormalities, xenobiotic metabolism, and cell-cell signaling genes. Collectively, Nrf2 deficiency decreased susceptibility to urethane-induced lung tumorigenesis in mice. Cell survival properties of Nrf2 were supported, at least in part, by reduced early death of initiated cells and heightened advantage for tumor cell expansion in Nrf2(+/+ mice relative to Nrf2(-/- mice. Our results were consistent with the concept that Nrf2 over-activation is an adaptive response of cancer conferring resistance to anti-cancer drugs and promoting malignancy.

  5. The adjuvant component α-tocopherol triggers via modulation of Nrf2 the expression and turnover of hypocretin in vitro and its implication to the development of narcolepsy.

    Science.gov (United States)

    Masoudi, Sanita; Ploen, Daniela; Kunz, Katharina; Hildt, Eberhard

    2014-05-23

    After the H1N1 swine flu vaccination campaign an increased number of narcolepsy cases in children and adolescents was observed in Scandinavian and later in further European countries that correlated with the vaccination by an AS03-adjuvanted influenza vaccine (Pandemrix). Narcolepsy is a chronic sleep disorder characterized by the loss of hypocretin in the cerebrospinal fluid due to selective destruction of hypocretin-producing neurons in the perifornical hypothalamus. In >99% of the cases narcolepsy is associated with the HLA-subtype DQB1*602 giving the link to an autoimmune process. In contrast to other squalene-based adjuvants, for which no association with narcolepsy was reported so far, ASO3 contains in addition α-tocopherol. It could be observed recently that α-tocopherol activates the transcription factor Nrf2. Nrf2 triggers the expression of cytoprotective genes, i.e. the catalytic active subunits of the constitutive proteasome, by binding to the antioxidant response element (ARE). It was hypothesized that α-tocopherol via activation of Nrf2 affects expression and turnover of hypocretin, leading to an increased amount of hypocretinα-specific fragments that bind to DQB1*602. α-Tocopherol activates Nrf2 in neuronal cells in vitro. Promoter analysis revealed an ARE sequence in the hypocretin promoter. Indeed, α-tocopherol increases by activation of Nrf2 the expression of hypocretin. In parallel, α-tocopherol -dependent induction of Nrf2 augments expression of catalytic subunits of the proteasome leading to increased degradation of hypocretin. Moreover, elevated activation of Nrf2 is associated with a decreased activity of NF-κB that results in an increased sensitivity to apoptotic stimuli. In case of a genetic predisposition (DQB1*602) α-tocopherol could confer to development of narcolepsy by activation of Nrf2 that finally leads to an elevated formation of longer hypocretin-derived fragments that can be presented by HLA-subtype DQB1*602. These cells

  6. Serum Oxidative Stress-Induced Repression of Nrf2 and GSH Depletion: A Mechanism Potentially Involved in Endothelial Dysfunction of Young Smokers

    Science.gov (United States)

    Fratta Pasini, Anna; Albiero, Anna; Stranieri, Chiara; Cominacini, Mattia; Pasini, Andrea; Mozzini, Chiara; Vallerio, Paola; Cominacini, Luciano; Garbin, Ulisse

    2012-01-01

    Background Although oxidative stress plays a major role in endothelial dysfunction (ED), the role of glutathione (GSH), of nuclear erythroid-related factor 2 (Nrf2) and of related antioxidant genes (ARE) are yet unknown. In this study we combined an in vivo with an in vitro model to assess whether cigarette smoking affects flow-mediated vasodilation (FMD), GSH concentrations and the Nrf2/ARE pathway in human umbilical vein endothelial cells (HUVECs). Methods and Results 52 healthy subjects (26 non-smokers and 26 heavy smokers) were enrolled in this study. In smokers we demonstrated increased oxidative stress, i.e., reduced concentrations of GSH and increased concentrations of oxidation products of the phospholipid 1-palmitoyl-2-arachidonyl-sn-glycero-3-phosphorylcholine (oxPAPC) in serum and in peripheral blood mononuclear cells (PBMC), used as in vivo surrogates of endothelial cells. Moreover we showed impairment of FMD in smokers and a positive correlation with the concentration of GSH in PBMC of all subjects. In HUVECs exposed to smokers' serum but not to non-smokers' serum we found that oxidative stress increased, whereas nitric oxide and GSH concentrations decreased; interestingly the expression of Nrf2, of heme oxygenase-1 (HO-1) and of glutamate-cysteine ligase catalytic (GCLC) subunit, the rate-limiting step of synthesis of GSH, was decreased. To test the hypothesis that the increased oxidative stress in smokers may have a causal role in the repression of Nrf2/ARE pathway, we exposed HUVECs to increasing concentrations of oxPAPC and found that at the highest concentration (similar to that found in smokers' serum) the expression of Nrf2/ARE pathway was reduced. The knockdown of Nrf2 was associated to a significant reduction of HO-1 and GCLC expression induced by oxPAPC in ECs. Conclusions In young smokers with ED a novel further consequence of increased oxidative stress is a repression of Nrf2/ARE pathway leading to GSH depletion. PMID:22272327

  7. Serum oxidative stress-induced repression of Nrf2 and GSH depletion: a mechanism potentially involved in endothelial dysfunction of young smokers.

    Directory of Open Access Journals (Sweden)

    Anna Fratta Pasini

    Full Text Available Although oxidative stress plays a major role in endothelial dysfunction (ED, the role of glutathione (GSH, of nuclear erythroid-related factor 2 (Nrf2 and of related antioxidant genes (ARE are yet unknown. In this study we combined an in vivo with an in vitro model to assess whether cigarette smoking affects flow-mediated vasodilation (FMD, GSH concentrations and the Nrf2/ARE pathway in human umbilical vein endothelial cells (HUVECs.52 healthy subjects (26 non-smokers and 26 heavy smokers were enrolled in this study. In smokers we demonstrated increased oxidative stress, i.e., reduced concentrations of GSH and increased concentrations of oxidation products of the phospholipid 1-palmitoyl-2-arachidonyl-sn-glycero-3-phosphorylcholine (oxPAPC in serum and in peripheral blood mononuclear cells (PBMC, used as in vivo surrogates of endothelial cells. Moreover we showed impairment of FMD in smokers and a positive correlation with the concentration of GSH in PBMC of all subjects. In HUVECs exposed to smokers' serum but not to non-smokers' serum we found that oxidative stress increased, whereas nitric oxide and GSH concentrations decreased; interestingly the expression of Nrf2, of heme oxygenase-1 (HO-1 and of glutamate-cysteine ligase catalytic (GCLC subunit, the rate-limiting step of synthesis of GSH, was decreased. To test the hypothesis that the increased oxidative stress in smokers may have a causal role in the repression of Nrf2/ARE pathway, we exposed HUVECs to increasing concentrations of oxPAPC and found that at the highest concentration (similar to that found in smokers' serum the expression of Nrf2/ARE pathway was reduced. The knockdown of Nrf2 was associated to a significant reduction of HO-1 and GCLC expression induced by oxPAPC in ECs.In young smokers with ED a novel further consequence of increased oxidative stress is a repression of Nrf2/ARE pathway leading to GSH depletion.

  8. Pirarubicin induces an autophagic cytoprotective response through suppression of the mammalian target of rapamycin signaling pathway in human bladder cancer cells

    International Nuclear Information System (INIS)

    Li, Kuiqing; Chen, Xu; Liu, Cheng; Gu, Peng; Li, Zhuohang; Wu, Shaoxu; Xu, Kewei; Lin, Tianxin; Huang, Jian

    2015-01-01

    Pirarubicin is widely used in intravesical chemotherapy for bladder cancer, but its efficacy is limited due to drug resistance; the mechanism has not been well studied. Emerging evidence shows that autophagy can be a novel target for cancer therapy. This study aimed to investigate the role of autophagy in pirarubicin-treated bladder cancer cells. Bladder cancer cells EJ and J82 were treated with pirarubicin, siRNA, 3-methyladenine or hydroxychloroquine. Cell proliferation and apoptosis were tested by cell survival assay and flow cytometric analysis, respectively. Autophagy was evaluated by immunoblotting before and after the treatments. The phosphorylated mammalian target of rapamycin, serine/threonine kinase p70 S6 kinase, and eukaryotic translation initiation factor 4E binding protein 1 were also investigated by immunoblotting. We found that pirarubicin could induce autophagy in bladder cancer cells. Inhibition of autophagy by 3-methyladenine, hydroxychloroquine or knockdown of autophagy related gene 3 significantly increased apoptosis in pirarubicin-treated bladder cancer cells. Pirarubicin-induced autophagy was mediated via the mTOR/p70S6K/4E-BP1 signaling pathway. In conclusion, autophagy induced by pirarubicin plays a cytoprotective role in bladder cancer cells, suggesting that inhibition of autophagy may improve efficacy over traditional pirarubicin chemotherapy in bladder cancer patients. - Highlights: • Pirarubicin induced autophagy in bladder cancer cells. • Inhibition of autophagy enhanced pirarubicin-induced apoptosis. • Pirarubicin induced autophagy through inhibition of mTOR signaling pathway

  9. Pirarubicin induces an autophagic cytoprotective response through suppression of the mammalian target of rapamycin signaling pathway in human bladder cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Li, Kuiqing; Chen, Xu [Department of Urology, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou 510120 (China); Guangdong Provincial Key Laboratory of Malignant Tumor Epigenetics and Gene Regulation, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou 510120 (China); Liu, Cheng [Department of Urology, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou 510120 (China); Gu, Peng; Li, Zhuohang; Wu, Shaoxu [Department of Urology, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou 510120 (China); Guangdong Provincial Key Laboratory of Malignant Tumor Epigenetics and Gene Regulation, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou 510120 (China); Xu, Kewei [Department of Urology, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou 510120 (China); Lin, Tianxin, E-mail: tianxinl@sina.com [Department of Urology, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou 510120 (China); Guangdong Provincial Key Laboratory of Malignant Tumor Epigenetics and Gene Regulation, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou 510120 (China); Huang, Jian, E-mail: urolhj@sina.com [Department of Urology, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou 510120 (China)

    2015-05-01

    Pirarubicin is widely used in intravesical chemotherapy for bladder cancer, but its efficacy is limited due to drug resistance; the mechanism has not been well studied. Emerging evidence shows that autophagy can be a novel target for cancer therapy. This study aimed to investigate the role of autophagy in pirarubicin-treated bladder cancer cells. Bladder cancer cells EJ and J82 were treated with pirarubicin, siRNA, 3-methyladenine or hydroxychloroquine. Cell proliferation and apoptosis were tested by cell survival assay and flow cytometric analysis, respectively. Autophagy was evaluated by immunoblotting before and after the treatments. The phosphorylated mammalian target of rapamycin, serine/threonine kinase p70 S6 kinase, and eukaryotic translation initiation factor 4E binding protein 1 were also investigated by immunoblotting. We found that pirarubicin could induce autophagy in bladder cancer cells. Inhibition of autophagy by 3-methyladenine, hydroxychloroquine or knockdown of autophagy related gene 3 significantly increased apoptosis in pirarubicin-treated bladder cancer cells. Pirarubicin-induced autophagy was mediated via the mTOR/p70S6K/4E-BP1 signaling pathway. In conclusion, autophagy induced by pirarubicin plays a cytoprotective role in bladder cancer cells, suggesting that inhibition of autophagy may improve efficacy over traditional pirarubicin chemotherapy in bladder cancer patients. - Highlights: • Pirarubicin induced autophagy in bladder cancer cells. • Inhibition of autophagy enhanced pirarubicin-induced apoptosis. • Pirarubicin induced autophagy through inhibition of mTOR signaling pathway.

  10. EX4 stabilizes and activates Nrf2 via PKCδ, contributing to the prevention of oxidative stress-induced pancreatic beta cell damage

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Mi-Hwi; Kim, Eung-Hwi [College of Pharmacy, Gachon Institute of Pharmaceutical Science, Gachon University, Yeonsu-ku, Incheon (Korea, Republic of); Lee Gil Ya Cancer and Diabetes Institute, Gachon University, Yeonsu-ku, Incheon (Korea, Republic of); Jung, Hye Seung [Department of Internal Medicine, Seoul National University College of Medicine, Seoul (Korea, Republic of); Yang, Dongki [Department of Physiology, Gachon University College of Medicine, Incheon (Korea, Republic of); Park, Eun-Young, E-mail: parkey@mokpo.ac.kr [College of Pharmacy, Natural Medicine Research Institute, Mokpo National University, Muan-gun, Jeonnam (Korea, Republic of); Jun, Hee-Sook, E-mail: hsjun@gachon.ac.kr [College of Pharmacy, Gachon Institute of Pharmaceutical Science, Gachon University, Yeonsu-ku, Incheon (Korea, Republic of); Lee Gil Ya Cancer and Diabetes Institute, Gachon University, Yeonsu-ku, Incheon (Korea, Republic of); Gachon Medical Research Institute, Gil Hospital, Incheon (Korea, Republic of)

    2017-01-15

    Oxidative stress in pancreatic beta cells can inhibit insulin secretion and promote apoptotic cell death. Exendin-4 (EX4), a glucagon-like peptide-1 receptor agonist, can suppress beta cell apoptosis, improve beta cell function and protect against oxidative damage. In this study, we investigated the molecular mechanisms for antioxidative effects of EX4 in pancreatic beta cells. INS-1 cells, a rat insulinoma cell line, were pretreated with EX4 and exposed to palmitate or H{sub 2}O{sub 2}. Reactive oxygen species (ROS) production, and glutathione and insulin secretion were measured. The mRNA and protein expression levels of antioxidant genes were examined. The level of nuclear factor erythroid 2-related factor 2 (Nrf2), its binding to antioxidant response element (ARE), and its ubiquination in the presence of EX4 were determined. The Nrf2 signaling pathway was determined using rottlerin (protein kinase [PK]Cδ inhibitor), H89 (PKA inhibitor) and LY294002 (phosphatidylinositide 3-kinase [PI3K] inhibitor). EX4 treatment decreased ROS production, recovered cellular glutathione levels and insulin secretion in the presence of oxidative stress in INS-1 cells. The expression levels of glutamate-cysteine ligase catalytic subunit and heme oxygenase-1 were increased by EX4 treatment. EX4 promoted Nrf2 translocation, ARE binding activity and enhanced stabilization of Nrf2 by inhibition of ubiquitination. Knockdown of Nrf2 abolished the effect of EX4 on increased insulin secretion. Inhibition of PKCδ attenuated Nrf2 translocation and antioxidative gene expression by EX4 treatment. We suggest that EX4 activates and stabilizes Nrf2 through PKCδ activation, contributing to the increase of antioxidant gene expression and consequently improving beta cell function in the presence of oxidative stress. - Highlights: • EX4 protects against oxidative stress-induced pancreatic beta cell dysfunction. • EX4 increases antioxidant gene expression. • Antioxidative effect of EX4 is

  11. EX4 stabilizes and activates Nrf2 via PKCδ, contributing to the prevention of oxidative stress-induced pancreatic beta cell damage

    International Nuclear Information System (INIS)

    Kim, Mi-Hwi; Kim, Eung-Hwi; Jung, Hye Seung; Yang, Dongki; Park, Eun-Young; Jun, Hee-Sook

    2017-01-01

    Oxidative stress in pancreatic beta cells can inhibit insulin secretion and promote apoptotic cell death. Exendin-4 (EX4), a glucagon-like peptide-1 receptor agonist, can suppress beta cell apoptosis, improve beta cell function and protect against oxidative damage. In this study, we investigated the molecular mechanisms for antioxidative effects of EX4 in pancreatic beta cells. INS-1 cells, a rat insulinoma cell line, were pretreated with EX4 and exposed to palmitate or H 2 O 2 . Reactive oxygen species (ROS) production, and glutathione and insulin secretion were measured. The mRNA and protein expression levels of antioxidant genes were examined. The level of nuclear factor erythroid 2-related factor 2 (Nrf2), its binding to antioxidant response element (ARE), and its ubiquination in the presence of EX4 were determined. The Nrf2 signaling pathway was determined using rottlerin (protein kinase [PK]Cδ inhibitor), H89 (PKA inhibitor) and LY294002 (phosphatidylinositide 3-kinase [PI3K] inhibitor). EX4 treatment decreased ROS production, recovered cellular glutathione levels and insulin secretion in the presence of oxidative stress in INS-1 cells. The expression levels of glutamate-cysteine ligase catalytic subunit and heme oxygenase-1 were increased by EX4 treatment. EX4 promoted Nrf2 translocation, ARE binding activity and enhanced stabilization of Nrf2 by inhibition of ubiquitination. Knockdown of Nrf2 abolished the effect of EX4 on increased insulin secretion. Inhibition of PKCδ attenuated Nrf2 translocation and antioxidative gene expression by EX4 treatment. We suggest that EX4 activates and stabilizes Nrf2 through PKCδ activation, contributing to the increase of antioxidant gene expression and consequently improving beta cell function in the presence of oxidative stress. - Highlights: • EX4 protects against oxidative stress-induced pancreatic beta cell dysfunction. • EX4 increases antioxidant gene expression. • Antioxidative effect of EX4 is mediated by

  12. Andrographolide inhibits TNFα-induced ICAM-1 expression via suppression of NADPH oxidase activation and induction of HO-1 and GCLM expression through the PI3K/Akt/Nrf2 and PI3K/Akt/AP-1 pathways in human endothelial cells.

    Science.gov (United States)

    Lu, Chia-Yang; Yang, Ya-Chen; Li, Chien-Chun; Liu, Kai-Li; Lii, Chong-Kuei; Chen, Haw-Wen

    2014-09-01

    Andrographolide, the major bioactive component of Andrographis paniculata, has been demonstrated to have various biological properties including anti-inflammation, antioxidation, and anti-hepatotoxicity. Oxidative stress is considered a major risk factor in aging, inflammation, cancer, atherosclerosis, and diabetes mellitus. NADPH oxidase is a major source of endogenous reactive oxygen species (ROS). In this study, we used EA.hy926 endothelial-like cells to explore the anti-inflammatory activity of andrographolide. Andrographolide attenuated TNFα-induced ROS generation, Src phosphorylation, membrane translocation of the NADPH oxidase subunits p47(phox) and p67(phox), and ICAM-1 gene expression. In the small hairpin RNA interference assay, shp47(phox) abolished TNFα-induced p65 nuclear translocation, ICAM-1 gene expression, and adhesion of HL-60 cells. Andrographolide induced the gene expression of heme oxygenase 1 (HO-1) and glutamate cysteine ligase modifier subunit (GCLM) in a time-dependent manner. Cellular glutathione (GSH) content was increased by andrographolide. shGCLM attenuated the andrographolide-induced increase in GSH content and reversed the andrographolide inhibition of HL-60 adhesion. shHO-1 showed a similar effect on andrographolide inhibition of HL-60 adhesion to shGCLM. The mechanism underlying the up-regulation of HO-1 and GCLM by andrographolide was dependent on the PI3K/Akt pathway, and both the Nrf2 and AP-1 transcriptional factors were involved. Our results suggest that andrographolide attenuates TNFα-induced ICAM-1 expression at least partially through suppression of NADPH oxidase activation and induction of HO-1 and GCLM expression, which is PI3K/Akt pathway-dependent. Copyright © 2014. Published by Elsevier Inc.

  13. Hyperactivation of Nrf2 in early tubular development induces nephrogenic diabetes insipidus

    Science.gov (United States)

    Suzuki, Takafumi; Seki, Shiori; Hiramoto, Keiichiro; Naganuma, Eriko; Kobayashi, Eri H.; Yamaoka, Ayaka; Baird, Liam; Takahashi, Nobuyuki; Sato, Hiroshi; Yamamoto, Masayuki

    2017-01-01

    NF-E2-related factor-2 (Nrf2) regulates cellular responses to oxidative and electrophilic stress. Loss of Keap1 increases Nrf2 protein levels, and Keap1-null mice die of oesophageal hyperkeratosis because of Nrf2 hyperactivation. Here we show that deletion of oesophageal Nrf2 in Keap1-null mice allows survival until adulthood, but the animals develop polyuria with low osmolality and bilateral hydronephrosis. This phenotype is caused by defects in water reabsorption that are the result of reduced aquaporin 2 levels in the kidney. Renal tubular deletion of Keap1 promotes nephrogenic diabetes insipidus features, confirming that Nrf2 activation in developing tubular cells causes a water reabsorption defect. These findings suggest that Nrf2 activity should be tightly controlled during development in order to maintain renal homeostasis. In addition, tissue-specific ablation of Nrf2 in Keap1-null mice might create useful animal models to uncover novel physiological functions of Nrf2. PMID:28233855

  14. Protection from cyanide-induced brain injury by the Nrf2 transcriptional activator carnosic acid.

    Science.gov (United States)

    Zhang, Dongxian; Lee, Brian; Nutter, Anthony; Song, Paul; Dolatabadi, Nima; Parker, James; Sanz-Blasco, Sara; Newmeyer, Traci; Ambasudhan, Rajesh; McKercher, Scott R; Masliah, Eliezer; Lipton, Stuart A

    2015-06-01

    Cyanide is a life-threatening, bioterrorist agent, preventing cellular respiration by inhibiting cytochrome c oxidase, resulting in cardiopulmonary failure, hypoxic brain injury, and death within minutes. However, even after treatment with various antidotes to protect cytochrome oxidase, cyanide intoxication in humans can induce a delayed-onset neurological syndrome that includes symptoms of Parkinsonism. Additional mechanisms are thought to underlie cyanide-induced neuronal damage, including generation of reactive oxygen species. This may account for the fact that antioxidants prevent some aspects of cyanide-induced neuronal damage. Here, as a potential preemptive countermeasure against a bioterrorist attack with cyanide, we tested the CNS protective effect of carnosic acid (CA), a pro-electrophilic compound found in the herb rosemary. CA crosses the blood-brain barrier to up-regulate endogenous antioxidant enzymes via activation of the Nrf2 transcriptional pathway. We demonstrate that CA exerts neuroprotective effects on cyanide-induced brain damage in cultured rodent and human-induced pluripotent stem cell-derived neurons in vitro, and in vivo in various brain areas of a non-Swiss albino mouse model of cyanide poisoning that simulates damage observed in the human brain. Cyanide, a potential bioterrorist agent, can produce a chronic delayed-onset neurological syndrome that includes symptoms of Parkinsonism. Here, cyanide poisoning treated with the proelectrophillic compound carnosic acid, results in reduced neuronal cell death in both in vitro and in vivo models through activation of the Nrf2/ARE transcriptional pathway. Carnosic acid is therefore a potential treatment for the toxic central nervous system (CNS) effects of cyanide poisoning. ARE, antioxidant responsive element; Nrf2 (NFE2L2, Nuclear factor (erythroid-derived 2)-like 2). © 2015 International Society for Neurochemistry.

  15. Topical Bixin Confers NRF2-Dependent Protection Against Photodamage and Hair Graying in Mouse Skin

    Science.gov (United States)

    Rojo de la Vega, Montserrat; Zhang, Donna D.; Wondrak, Georg T.

    2018-01-01

    Environmental exposure to solar ultraviolet (UV) radiation causes acute photodamage, premature aging, and skin cancer, attributable to UV-induced genotoxic, oxidative, and inflammatory stress. The transcription factor NRF2 [nuclear factor erythroid 2 (E2)-related factor 2] is the master regulator of the cellular antioxidant response protecting skin against various environmental stressors including UV radiation and electrophilic pollutants. NRF2 in epidermal keratinocytes can be activated using natural chemopreventive compounds such as the apocarotenoid bixin, an FDA-approved food additive and cosmetic ingredient from the seeds of the achiote tree (Bixa orellana). Here, we tested the feasibility of topical use of bixin for NRF2-dependent skin photoprotection in two genetically modified mouse models [SKH1 and C57BL/6J (Nrf2+/+ versus Nrf2-/-)]. First, we observed that a bixin formulation optimized for topical NRF2 activation suppresses acute UV-induced photodamage in Nrf2+/+ but not Nrf2-/- SKH1 mice, a photoprotective effect indicated by reduced epidermal hyperproliferation and oxidative DNA damage. Secondly, it was demonstrated that topical bixin suppresses PUVA (psoralen + UVA)-induced hair graying in Nrf2+/+ but not Nrf2-/- C57BL/6J mice. Collectively, this research provides the first in vivo evidence that topical application of bixin can protect against UV-induced photodamage and PUVA-induced loss of hair pigmentation through NRF2 activation. Topical NRF2 activation using bixin may represent a novel strategy for human skin photoprotection, potentially complementing conventional sunscreen-based approaches. PMID:29636694

  16. EGCG evokes Nrf2 nuclear translocation and dampens PTP1B expression to ameliorate metabolic misalignment under insulin resistance condition.

    Science.gov (United States)

    Mi, Yashi; Zhang, Wentong; Tian, Haoyu; Li, Runnan; Huang, Shuxian; Li, Xingyu; Qi, Guoyuan; Liu, Xuebo

    2018-03-01

    As a major nutraceutical component of green tea (-)-epigallocatechin-3-gallate (EGCG) has attracted interest from scientists due to its well-documented antioxidant and antiobesity bioactivities. In the current study, we aimed to investigate the protective effect of EGCG on metabolic misalignment and in balancing the redox status in mice liver and HepG2 cells under insulin resistance condition. Our results indicated that EGCG accelerates the glucose uptake and evokes IRS-1/Akt/GLUT2 signaling pathway via dampening the expression of protein tyrosine phosphatase 1B (PTP1B). Consistently, ectopic expression of PTP1B by Ad-PTP1B substantially impaired EGCG-elicited IRS-1/Akt/GLUT2 signaling pathway. Moreover, EGCG co-treatment stimulated nuclear translocation of Nrf2 by provoking P13K/AKT signaling pathway and thus modulated the downstream expressions of antioxidant enzymes such as HO-1 and NQO-1 in HepG2 cells. Furthermore, knockdown Nrf2 by small interfering RNA (siRNA) notably enhanced the expression of PTP1B and blunt EGCG-stimulated glucose uptake. Consistent with these results, in vivo study revealed that EGCG supplement significantly ameliorated high-fat and high-fructose diet (HFFD)-triggered insulin resistance and oxidative stress by up-regulating the IRS-1/AKT and Keap1/Nrf2 transcriptional pathways. Administration of an appropriate chemopreventive agent, such as EGCG, could potentially serve as an additional therapeutic intervention in the arsenal against obesity.

  17. NRF2 Signaling Negatively Regulates Phorbol-12-Myristate-13-Acetate (PMA-Induced Differentiation of Human Monocytic U937 Cells into Pro-Inflammatory Macrophages.

    Directory of Open Access Journals (Sweden)

    Min-Gu Song

    Full Text Available Blood monocytes are recruited to injured tissue sites and differentiate into macrophages, which protect against pathogens and repair damaged tissues. Reactive oxygen species (ROS are known to be an important contributor to monocytes' differentiation and macrophages' function. NF-E2-related factor 2 (NRF2, a transcription factor regulating cellular redox homeostasis, is known to be a critical modulator of inflammatory responses. We herein investigated the role of NRF2 in macrophage differentiation using the human monocytic U937 cell line and phorbol-12-myristate-13-acetate (PMA. In U937 cells with NRF2 silencing, PMA-stimulated cell adherence was significantly facilitated when compared to control U937 cells. Both transcript and protein levels for pro-inflammatory cytokines, including interleukine-1β (IL-1β, IL-6, and tumor necrosis factor-α (TNFα were highly elevated in PMA-stimulated NRF2-silenced U937 compared to the control. In addition, PMA-inducible secretion of monocyte chemotactic protein 1 (MCP-1 was significantly high in NRF2-silenced U937. As an underlying mechanism, we showed that NRF2-knockdown U937 retained high levels of cellular ROS and endoplasmic reticulum (ER stress markers expression; and subsequently, PMA-stimulated levels of Ca2+ and PKCα were greater in NRF2-knockdown U937 cells, which caused enhanced nuclear accumulation of nuclear factor-ҡB (NFҡB p50 and extracellular signal-regulated kinase (ERK-1/2 phosphorylation. Whereas the treatment of NRF2-silenced U937 cells with pharmacological inhibitors of NFҡB or ERK1/2 largely blocked PMA-induced IL-1β and IL-6 expression, indicating that these pathways are associated with cell differentiation. Taken together, our results suggest that the NRF2 system functions to suppress PMA-stimulated U937 cell differentiation into pro-inflammatory macrophages and provide evidence that the ROS-PKCα-ERK-NFҡB axis is involved in PMA-facilitated differentiation of NRF2-silenced U937

  18. Decreased histone deacetylase 2 impairs Nrf2 activation by oxidative stress

    International Nuclear Information System (INIS)

    Mercado, Nicolas; Thimmulappa, Rajesh; Thomas, Catherine M.R.; Fenwick, Peter S.; Chana, Kirandeep K.; Donnelly, Louise E.; Biswal, Shyam; Ito, Kazuhiro; Barnes, Peter J.

    2011-01-01

    Research highlights: → Nrf2 anti-oxidant function is impaired when HDAC activity is inhibited. → HDAC inhibition decreases Nrf2 protein stability. → HDAC2 is involved in reduced Nrf2 stability and both correlate in COPD samples. → HDAC inhibition increases Nrf2 acetylation. -- Abstract: Nuclear factor erythroid 2-related factor 2 (Nrf2) plays a crucial role in cellular defence against oxidative stress by inducing the expression of multiple anti-oxidant genes. However, where high levels of oxidative stress are observed, such as chronic obstructive pulmonary disease (COPD), Nrf2 activity is reduced, although the molecular mechanism for this defect is uncertain. Here, we show that down-regulation of histone deacetylase (HDAC) 2 causes Nrf2 instability, resulting in reduced anti-oxidant gene expression and increase sensitivity to oxidative stress. Although Nrf2 protein was clearly stabilized after hydrogen peroxide (H 2 O 2 ) stimulation in a bronchial epithelial cell line (BEAS2B), Nrf2 stability was decreased and Nrf2 acetylation increased in the presence of an HDAC inhibitor, trichostatin A (TSA). TSA also reduced Nrf2-regulated heme-oxygenase-1 (HO-1) expression in these cells, and this was confirmed in acute cigarette-smoke exposed mice in vivo. HDAC2 knock-down by RNA interference resulted in reduced H 2 O 2 -induced Nrf2 protein stability and activity in BEAS2B cells, whereas HDAC1 knockdown had no effect. Furthermore, monocyte-derived macrophages obtained from healthy volunteers (non-smokers and smokers) and COPD patients showed a significant correlation between HDAC2 expression and Nrf2 expression (r = 0.92, p < 0.0001). Thus, reduced HDAC2 activity in COPD may account for increased Nrf2 acetylation, reduced Nrf2 stability and impaired anti oxidant defences.

  19. Decreased histone deacetylase 2 impairs Nrf2 activation by oxidative stress

    Energy Technology Data Exchange (ETDEWEB)

    Mercado, Nicolas [Airway Disease Section, National Heart and Lung Institute, Imperial College, London SW3 6LY (United Kingdom); Thimmulappa, Rajesh [Department of Environmental Health Sciences, Johns Hopkins Bloomberg School of Public Health, Baltimore, MD (United States); Thomas, Catherine M.R.; Fenwick, Peter S.; Chana, Kirandeep K.; Donnelly, Louise E. [Airway Disease Section, National Heart and Lung Institute, Imperial College, London SW3 6LY (United Kingdom); Biswal, Shyam [Department of Environmental Health Sciences, Johns Hopkins Bloomberg School of Public Health, Baltimore, MD (United States); Ito, Kazuhiro [Airway Disease Section, National Heart and Lung Institute, Imperial College, London SW3 6LY (United Kingdom); Barnes, Peter J., E-mail: p.j.barnes@imperial.ac.uk [Airway Disease Section, National Heart and Lung Institute, Imperial College, London SW3 6LY (United Kingdom)

    2011-03-11

    Research highlights: {yields} Nrf2 anti-oxidant function is impaired when HDAC activity is inhibited. {yields} HDAC inhibition decreases Nrf2 protein stability. {yields} HDAC2 is involved in reduced Nrf2 stability and both correlate in COPD samples. {yields} HDAC inhibition increases Nrf2 acetylation. -- Abstract: Nuclear factor erythroid 2-related factor 2 (Nrf2) plays a crucial role in cellular defence against oxidative stress by inducing the expression of multiple anti-oxidant genes. However, where high levels of oxidative stress are observed, such as chronic obstructive pulmonary disease (COPD), Nrf2 activity is reduced, although the molecular mechanism for this defect is uncertain. Here, we show that down-regulation of histone deacetylase (HDAC) 2 causes Nrf2 instability, resulting in reduced anti-oxidant gene expression and increase sensitivity to oxidative stress. Although Nrf2 protein was clearly stabilized after hydrogen peroxide (H{sub 2}O{sub 2}) stimulation in a bronchial epithelial cell line (BEAS2B), Nrf2 stability was decreased and Nrf2 acetylation increased in the presence of an HDAC inhibitor, trichostatin A (TSA). TSA also reduced Nrf2-regulated heme-oxygenase-1 (HO-1) expression in these cells, and this was confirmed in acute cigarette-smoke exposed mice in vivo. HDAC2 knock-down by RNA interference resulted in reduced H{sub 2}O{sub 2}-induced Nrf2 protein stability and activity in BEAS2B cells, whereas HDAC1 knockdown had no effect. Furthermore, monocyte-derived macrophages obtained from healthy volunteers (non-smokers and smokers) and COPD patients showed a significant correlation between HDAC2 expression and Nrf2 expression (r = 0.92, p < 0.0001). Thus, reduced HDAC2 activity in COPD may account for increased Nrf2 acetylation, reduced Nrf2 stability and impaired anti oxidant defences.

  20. An exceptionally potent inducer of cytoprotective enzymes: elucidation of the structural features that determine inducer potency and reactivity with Keap1.

    Science.gov (United States)

    Dinkova-Kostova, Albena T; Talalay, Paul; Sharkey, John; Zhang, Ying; Holtzclaw, W David; Wang, Xiu Jun; David, Emilie; Schiavoni, Katherine H; Finlayson, Stewart; Mierke, Dale F; Honda, Tadashi

    2010-10-29

    The Keap1/Nrf2/ARE pathway controls a network of cytoprotective genes that defend against the damaging effects of oxidative and electrophilic stress, and inflammation. Induction of this pathway is a highly effective strategy in combating the risk of cancer and chronic degenerative diseases, including atherosclerosis and neurodegeneration. An acetylenic tricyclic bis(cyano enone) bearing two highly electrophilic Michael acceptors is an extremely potent inducer in cells and in vivo. We demonstrate spectroscopically that both cyano enone functions of the tricyclic molecule react with cysteine residues of Keap1 and activate transcription of cytoprotective genes. Novel monocyclic cyano enones, representing fragments of rings A and C of the tricyclic compound, reveal that the contribution to inducer potency of the ring C Michael acceptor is much greater than that of ring A, and that potency is further enhanced by spatial proximity of an acetylenic function. Critically, the simultaneous presence of two cyano enone functions in rings A and C within a rigid three-ring system results in exceptionally high inducer potency. Detailed understanding of the structural elements that contribute to the reactivity with the protein sensor Keap1 and to high potency of induction is essential for the development of specific and selective lead compounds as clinically relevant chemoprotective agents.

  1. Cytochrome P450 2A5 and bilirubin: Mechanisms of gene regulation and cytoprotection

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Sangsoo Daniel; Antenos, Monica [Department of Biomedical Sciences, University of Guelph, Guelph, Ontario, N1G 2W1 (Canada); Squires, E. James [Department of Animal and Poultry Sciences, University of Guelph, Guelph, Ontario, N1G 2W1 (Canada); Kirby, Gordon M., E-mail: gkirby@uoguelph.ca [Department of Biomedical Sciences, University of Guelph, Guelph, Ontario, N1G 2W1 (Canada)

    2013-07-15

    Bilirubin (BR) has recently been identified as the first endogenous substrate for cytochrome P450 2A5 (CYP2A5) and it has been suggested that CYP2A5 plays a major role in BR clearance as an alternative mechanism to BR conjugation by uridine-diphosphate glucuronyltransferase 1A1. This study investigated the mechanisms of Cyp2a5 gene regulation by BR and the cytoprotective role of CYP2A5 in BR hepatotoxicity. BR induced CYP2A5 expression at the mRNA and protein levels in a dose-dependent manner in primary mouse hepatocytes. BR treatment also caused nuclear translocation of Nuclear factor-E2 p45-related factor 2 (Nrf2) in hepatocytes. In reporter assays, BR treatment of primary hepatocytes transfected with a Cyp2a5 promoter-luciferase reporter construct resulted in a 2-fold induction of Cyp2a5 reporter activity. Furthermore, cotransfection of the hepatocytes with a Nrf2 expression vector without BR treatment resulted in an increase in Cyp2a5 reporter activity of approximately 2-fold and BR treatment of Nrf2 cotransfectants further increased reporter activity by 4-fold. In addition, site-directed mutation of the ARE in the reporter construct completely abolished both the BR- and Nrf2-mediated increases in reporter activity. The cytoprotective role of CYP2A5 against BR-mediated apoptosis was also examined in Hepa 1–6 cells that lack endogenous CYP2A5. Transient overexpression of CYP2A5 partially blocked BR-induced caspase-3 cleavage in Hepa 1–6 cells. Furthermore, in vitro degradation of BR was increased by microsomes from Hepa 1–6 cells overexpressing CYP2A5 compared to control cells transfected with an empty vector. Collectively, these results suggest that Nrf2-mediated CYP2A5 transactivation in response to BR may provide an additional mechanism for adaptive cytoprotection against BR hepatotoxicity. - Highlights: • The mechanism of Cyp2a5 gene regulation by BR was investigated. • The cytoprotective role of CYP2A5 in BR hepatotoxicity was determined. • BR

  2. Gene-expression signature regulated by the KEAP1-NRF2-CUL3 axis is associated with a poor prognosis in head and neck squamous cell cancer.

    Science.gov (United States)

    Namani, Akhileshwar; Matiur Rahaman, Md; Chen, Ming; Tang, Xiuwen

    2018-01-06

    NRF2 is the key regulator of oxidative stress in normal cells and aberrant expression of the NRF2 pathway due to genetic alterations in the KEAP1 (Kelch-like ECH-associated protein 1)-NRF2 (nuclear factor erythroid 2 like 2)-CUL3 (cullin 3) axis leads to tumorigenesis and drug resistance in many cancers including head and neck squamous cell cancer (HNSCC). The main goal of this study was to identify specific genes regulated by the KEAP1-NRF2-CUL3 axis in HNSCC patients, to assess the prognostic value of this gene signature in different cohorts, and to reveal potential biomarkers. RNA-Seq V2 level 3 data from 279 tumor samples along with 37 adjacent normal samples from patients enrolled in the The Cancer Genome Atlas (TCGA)-HNSCC study were used to identify upregulated genes using two methods (altered KEAP1-NRF2-CUL3 versus normal, and altered KEAP1-NRF2-CUL3 versus wild-type). We then used a new approach to identify the combined gene signature by integrating both datasets and subsequently tested this signature in 4 independent HNSCC datasets to assess its prognostic value. In addition, functional annotation using the DAVID v6.8 database and protein-protein interaction (PPI) analysis using the STRING v10 database were performed on the signature. A signature composed of a subset of 17 genes regulated by the KEAP1-NRF2-CUL3 axis was identified by overlapping both the upregulated genes of altered versus normal (251 genes) and altered versus wild-type (25 genes) datasets. We showed that increased expression was significantly associated with poor survival in 4 independent HNSCC datasets, including the TCGA-HNSCC dataset. Furthermore, Gene Ontology, Kyoto Encyclopedia of Genes and Genomes, and PPI analysis revealed that most of the genes in this signature are associated with drug metabolism and glutathione metabolic pathways. Altogether, our study emphasizes the discovery of a gene signature regulated by the KEAP1-NRF2-CUL3 axis which is strongly associated with

  3. Activation of Nrf2 is required for up-regulation of the π class of glutathione S-transferase in rat primary hepatocytes with L-methionine starvation.

    Science.gov (United States)

    Lin, Ai-Hsuan; Chen, Haw-Wen; Liu, Cheng-Tze; Tsai, Chia-Wen; Lii, Chong-Kuei

    2012-07-04

    Numerous genes expression is regulated in response to amino acid shortage, which helps organisms adapt to amino acid limitation. The expression of the π class of glutathione (GSH) S-transferase (GSTP), a highly inducible phase II detoxification enzyme, is regulated mainly by activates activating protein 1 (AP-1) binding to the enhancer I of GSTP (GPEI). Here we show the critical role of nuclear factor erythroid-2-related factor 2 (Nrf2) in up-regulating GSTP gene transcription. Primary rat hepatocytes were cultured in a methionine-restricted medium, and immunoblotting and RT-PCR analyses showed that methionine restriction time-dependently increased GSTP protein and mRNA expression over a 48 h period. Nrf2 translocation to the nucleus, nuclear proteins binding to GPEI, and antioxidant response element (ARE) luciferase reporter activity were increased by methionine restriction as well as by l-buthionine sulfoximine (BSO), a GSH synthesis inhibitor. Transfection with Nrf2 siRNA knocked down Nrf2 expression and reversed the methionine-induced GSTP expression and GPEI binding activity. Chromatin immunoprecipitation assay confirmed the binding of Nrf2 to the GPEI. Phosphorylation of extracellular signal-regulated kinase 2 (ERK2) was increased in methionine-restricted and BSO-treated cells. ERK2 siRNA abolished methionine restriction-induced Nrf2 nuclear translocation, GPEI binding activity, ARE-luciferase reporter activity, and GSTP expression. Our results suggest that the up-regulation of GSTP gene transcription in response to methionine restriction likely occurs via the ERK-Nrf2-GPEI signaling pathway.

  4. Pharmacokinetics of dietary cancer chemopreventive compound dibenzoylmethane in rats and the impact of nanoemulsion and genetic knockout of Nrf2 on its disposition.

    Science.gov (United States)

    Lin, Wen; Hong, Jin-Liern; Shen, Guoxiang; Wu, Rachel T; Wang, Yuwen; Huang, Mou-Tuan; Newmark, Harold L; Huang, Qingrong; Khor, Tin Oo; Heimbach, Tycho; Kong, Ah-Ng

    2011-03-01

    The pharmacokinetic disposition of a dietary cancer chemopreventive compound dibenzoylmethane (DBM) was studied in male Sprague-Dawley rats after intravenous (i.v.) and oral (p.o.) administrations. Following a single i.v. bolus dose, the mean plasma clearance (CL) of DBM was low compared with the hepatic blood flow. DBM displayed a high volume of distribution (Vss). The elimination terminal t1/2 was long. The mean CL, Vss and AUC0-∞/dose were similar between the i.v. 10 and 10 mg/kg doses. After single oral doses (10, 50 and 250 mg/kg), the absolute oral bioavailability (F*) of DBM was 7.4%-13.6%. The increase in AUC was not proportional to the oral doses, suggesting non-linearity. In silico prediction of oral absorption also demonstrated low DBM absorption in vivo. An oil-in-water nanoemulsion containing DBM was formulated to potentially overcome the low F* due to poor water solubility of DBM, with enhanced oral absorption. Finally, to examine the role of Nrf2 on the pharmacokinetics of DBM, since DBM activates the Nrf2-dependent detoxification pathways, Nrf2 wild-type (+/+) mice and Nrf2 knockout (-/-) mice were utilized. There was an increased systemic plasma exposure of DBM in Nrf2 (-/-) mice, suggesting that the Nrf2 genotype could also play a role in the pharmacokinetic disposition of DBM. Taken together, the results show that DBM has low oral bioavailability which could be due in part to poor water solubility and this could be overcome by a nanotechnology-based drug delivery system and furthermore the Nrf2 genotype could also play a role in the pharmacokinetics of DBM. Copyright © 2010 John Wiley & Sons, Ltd.

  5. Fisetin inhibits TNF-α-induced inflammatory action and hydrogen peroxide-induced oxidative damage in human keratinocyte HaCaT cells through PI3K/AKT/Nrf-2-mediated heme oxygenase-1 expression.

    Science.gov (United States)

    Seo, Seung-Hee; Jeong, Gil-Saeng

    2015-12-01

    Oxidative skin damage and skin inflammation play key roles in the pathogenesis of skin-related diseases. Fisetin is a naturally occurring flavonoid abundantly found in several vegetables and fruits. Fisetin has been shown to exert various positive biological effects, such as anti-cancer, anti-proliferative, neuroprotective and anti-oxidative effects. In this study, we investigate the skin protective effects and anti-inflammatory properties of fisetin in hydrogen peroxide- and TNF-α-challenged human keratinocyte HaCaT cells. When HaCaT cells were treated with non-cytotoxic concentrations of fisetin (1-20μM), heme oxygenase (HO)-1 mRNA and protein expression increased in a dose-dependent manner. Furthermore, fisetin dose-dependently increased cell viability and reduced ROS production in hydrogen peroxide-treated HaCaT cells. Fisetin also inhibited the production of NO, PGE2 IL-1β, IL-6, expression of iNOS and COX-2, and activation of NF-κB in HaCaT cells treated with TNF-α. Fisetin induced Nrf2 translocation to the nuclei. HO-1 siRNA transient transfection reversed the effects of fisetin on cytoprotection, ROS reduction, NO, PGE2, IL-1β, IL-6, and TNF-α production, and NF-κB DNA-binding activity. Moreover, fisetin increased Akt phosphorylation and a PI3K pathway inhibitor (LY294002) abolished fisetin-induced cytoprotection and NO inhibition. Taken together, these results provide evidence for a beneficial role of fisetin in skin therapy. Copyright © 2015. Published by Elsevier B.V.

  6. Xanthohumol ameliorates lipopolysaccharide (LPS-induced acute lung injury via induction of AMPK/GSK3β-Nrf2 signal axis

    Directory of Open Access Journals (Sweden)

    Hongming Lv

    2017-08-01

    Full Text Available Abundant natural flavonoids can induce nuclear factor-erythroid 2 related factor 2 (Nrf2 and/or AMP-activated protein kinase (AMPK activation, which play crucial roles in the amelioration of various inflammation- and oxidative stress-induced diseases, including acute lung injury (ALI. Xanthohumol (Xn, a principal prenylflavonoid, possesses anti-inflammation and anti-oxidant activities. However, whether Xn could protect from LPS-induced ALI through inducing AMPK/Nrf2 activation and its downstream signals, are still poorly elucidated. Accordingly, we focused on exploring the protective effect of Xn in the context of ALI and the involvement of underlying molecular mechanisms. Our findings indicated that Xn effectively alleviated lung injury by reduction of lung W/D ratio and protein levels, neutrophil infiltration, MDA and MPO formation, and SOD and GSH depletion. Meanwhile, Xn significantly lessened histopathological changes, reactive oxygen species (ROS generation, several cytokines secretion, and iNOS and HMGB1 expression, and inhibited Txnip/NLRP3 inflammasome and NF-κB signaling pathway activation. Additionally, Xn evidently decreased t-BHP-stimulated cell apoptosis, ROS generation and GSH depletion but increased various anti-oxidative enzymes expression regulated by Keap1-Nrf2/ARE activation, which may be associated with AMPK and GSK3β phosphorylation. However, Xn-mediated inflammatory cytokines and ROS production, histopathological changes, Txnip/NLRP3 inflammasome and NF-κB signaling pathway in WT mice were remarkably abrogated in Nrf2-/- mice. Our experimental results firstly provided a support that Xn effectively protected LPS-induced ALI against oxidative stress and inflammation damage which are largely dependent upon upregulation of the Nrf2 pathway via activation of AMPK/GSK3β, thereby suppressing LPS-activated Txnip/NLRP3 inflammasome and NF-κB signaling pathway. Keywords: Xanthohumol, Acute lung injury, Oxidative stress

  7. A novel strategy to activate cytoprotective genes in the injured brain

    International Nuclear Information System (INIS)

    Zhao, Jing; Redell, John B.; Moore, Anthony N.; Dash, Pramod K.

    2011-01-01

    Highlights: → A strategy to increase cytoprotective gene expression in injured tissue is outlined. → A peptide containing a DEETGE motif can increase